title list | over_18 list | post_content stringlengths 0 9.37k ⌀ | C1 list | C2 list | C3 list |
|---|---|---|---|---|---|
[
"Why is the word \"No\" phonetically similar in so many languages while \"Yes\" seems to have way more diversity?"
] | [
false
] | null | [
"We're really looking at Indo-European languages here, which includes everything from Hindi to English to Ancient Greek. These languages all share a common origin - the proto-indo-european language, or PIE. PIE has been partially reconstructed from examining the huge number of current and historic languages in the ... | [
"I don't know of a modern language, but there is no word for \"yes\" in Classical Latin. When responding in the affirmative to a question a Roman might respond with \"hoc\" (this), \"vero\" (truly), \"sic\" (thus), or by simply repeating the verb used in the question."
] | [
"It’s hard to imagine a language that doesn’t have a word for “yes”. It seems like a such a basic need for any language. Surely any society would have a need at some time to answer in the affirmative. How did they do this if there was no word? I suppose one could imagine that it was a gesture but there are often oc... |
[
"Why do LED lights \"jiggle\" ?"
] | [
false
] | I've noticed this with all LEDs, but particularly on clock faces (which I guess aren't really LEDs). You know the old digital clocks on cable boxes? If you look at them, away, and back, the lights seem to dance around. What's going on with my eyes? EDIT: Thanks for all the answers! Upvotes for everyone! | [
"The LEDs will be Multiplexed. Its primarily used as a way of saving I/O pins on your control circuitry. The most basic method would connect 16 LEDs as a 4x4 grid, which only needs 4+4=8 pins to control it. But doing this means that only a subset of the LEDs can be on at any one time (one row/column in this example... | [
"Another reason this can happen is if the LED is being dimmed by a lower duty cycle PWM.",
"This is a decent article that describes what is happening: ",
"http://www.arduino.cc/en/Tutorial/PWM"
] | [
"LEDs are often driven with circuitry that protects them by turning them on and off very rapidly. They are flashing fast enough that you don't normally notice it unless they are moving across your field of view."
] |
[
"How do we know that stellar black hole are not neutron star ?"
] | [
false
] | How do we know that stellar black holes are not neutron star becoming too massive to let photon go away ? In other word, why a neutron star smaller than 3 solar masses "eating" an other star and reaching 3 solar masses collapse into a black hole ? Why this star doesn't stay a neutron star being invisible by physics ? | [
"How do we know that stellar black holes are not neutron star becoming too massive to let photon go away ?",
"If something is too massive to let light escape, then it's black - so by definition it's a black hole!",
"But a black hole can't be a neutron star. This is because the speed of light is the universal sp... | [
"No, it's not, as I tried to make clear in my post. As I said, if you have an event horizon - meaning light can't escape - then it's impossible to end up with anything ",
" than a singularity. (When I say \"singularity\" here it should be understood that, depending on the details of quantum gravity, you could als... | [
"From the perspective of an outside observer, yes, although from the perspective of the matter falling in, it takes a finite time to reach the center."
] |
[
"I don't understand how such an ancient star can be in our Galaxy. Can someone explain in more detail how this is possible please?"
] | [
false
] | [deleted] | [
"Our corner of the universe is just as old as every other part of the universe. Space and time, all of it, was present from the big bang onwards. As you said, it has just expanded, that expansion doesnt create new parts of the universe, it's just that the fabric of space-time is getting larger everywhere, equally. ... | [
"Am I simply wrong in my understanding that space expands uniformly in all directions at all points and that this particular star happened to be in a spot where the universe was still fresh and new?",
"The universe expands uniformly, yes (on very large scales), but I don't understand the second half of the questi... | [
"Spacetime only expands on large scales, millions of light-years. Small scale objects (essentially anything that's gravitationally bound) don't experience expansion. So to this star, distant galaxies are getting more distant, but the surface of the star isn't getting any farther from the core of the star."
] |
[
"Is it just a coincidence that Newton's Law of Gravitation and Coulomb's Law are so similar?"
] | [
false
] | I couldn't help but notice that Coulombs law and Newton's Law of Universal Gravitation are remarkably similar. Coulombs Law is F=K (q1*q2)/r Newton's is F=G (m1*m2)/r This can't just be coincidence right? Is there a relationship between these two? | [
"The short answer is that we see the force is proportional to the two \"charges\" that go into it, and is proportional the surface area of the sphere between the two. The latter part comes out of conservation laws and specifically has r",
" dependence because we live in a 3 space dimension universe."
] | [
"The ",
"² relationship ultimately comes from the relationship between surface density of a two-sphere of constant whatever at different radii. If the density at ",
" = 1 is one whatchamacallit per unit of area, the density at ",
" = 2 will be one-fourth of a whatchamacallit per unit of area, because the tota... | [
"It makes sense intuitively. In terms of gravitation, ",
"F ∝ m",
"F ∝ 1/r",
"Since it's a force of attraction between two bodies another term must be added, namely the mass of the other object: 'M', a scaling factor is also included 'G'",
"Thus,",
"F = GMm/r",
"This argument is also true in terms of ch... |
[
"Black holes - what happens as their mass decreases due to Hawking radiation?"
] | [
false
] | [deleted] | [
"No. Once a black hole is formed, it remains a black hole. (according to my knowledge of the best current theory) While black holes ",
" by gravitational force exceeding any possible forces or pressures holding matter apart, once they're formed they stop behaving like \"normal\" matter, and are just their own thi... | [
"I don't know, it depends on what your specific \"why\" is. But I'm going to guess that the answer there is that black holes just are their own things. They're not an infinitely dense \"point\" of compressed matter, like so much garbage compacted together. They're unique objects that keep all of the information to ... | [
"The limit on the amount of mass required to form a black hole isn't a ",
" limit. You can mathematically describe a black hole of any mass just fine; it's just that the only processes we know of that are capable of forming black holes from non-black holes are restricted to fairly large stars. A black hole just r... |
[
"Does perception of size and scale limit our ability to understand extremely large and small objects?"
] | [
false
] | For example, if scientists had access to functioning models of an atom and a galaxy and both were scaled to the size of a football stadium, how much (if any) additional information could be gained by using the instruments and technology currently available? | [
"The nature of these objects makes it impossible for this to occur, thus we couldn't have them, they would not possibly have the same properties. If an atom was big enough to see, it would not be an atom, same with the galaxy.",
"If my aunt had a penis, would she still be my aunt?"
] | [
"Not really. The issues with observation are generally related to things like the wavelength and interactions of photons, so you could be a lot smaller, but you couldn't \"see\" anything more than we do at our scale. ",
"The large end, you're still limited by that pesky speed of light! If we had bigger mirrors ... | [
"There's two parts to your question. The first is whether it limit our ability to understand them; the second is the hypothetical.",
"On the first, yes, we are limited. Like dogs being better at scent than echo-location, we likewise are biologically biased towards certain things - mostly in the concrete. We ha... |
[
"Fluorinated vs. Fluoridated?"
] | [
false
] | One of the cases I was reading for law school was disucssing an issue over water being fluoriDated. This confused me because in my lab experience when fluorine is added to something it the term was fluoriNated. Does the change in terminology have to do with the oxidation state of the fluorine, or something else entirely? Thanks in advance for your help! | [
"Fluorination is the addition of a neutral fluorine atom to a molecule. ",
"Fluoridation is the addition of a negatively charged fluoride ion. "
] | [
"Whether or not the starting F is charged is dependent on the exact scheme used, but if the final product involves F substitution, it's a fluorination. Fluoridation yields F- in solution. ",
"In the standard state fluorine is a diatomic gas. But using something like XeF2 to convert a carboxyllic acid to an alk... | [
"There are a few examples of fluorination with aqueous F-, but they're rare enough to still be publishable. Almost always you need F2 as a starting material. "
] |
[
"Are there any planets larger than stars? And if there are, could a star smaller than it revolve around it?"
] | [
false
] | I just really want to know. Edit: Ok, so it is now my understanding that it is not about size. It is about mass. What if a planets mass is greater than the star it is near? | [
"We are sitting on a planet larger than some stars! ",
"White dwarfs",
", the endpoint of stellar evolution for most of the stars in the universe, are stars that are roughly Earth-sized. While all white dwarfs have radii smaller than Jupiter, for example, Jupiter would still orbit around a white dwarf (and not ... | [
"Mass is the key here, not size/density. The short short version is that the object with less mass would orbit the object with greater mass. ",
"The longer version is that any two objects orbit the center of mass of the system. For instance, the earth and the moon orbit a point that is inside of the earth, but is... | [
"So would a star orbit a planet with a larger density, no matter the size?"
] |
[
"Why does an antenna not look like a lightbulb?"
] | [
false
] | From my basic understanding, both antennas and light bulbs emmit electro magnetic radiation but from what they look like, they are completely different. What about microwaves? I know x rays machines look like cameras, but they absorb radiation and not emit radiation, so it makes a bit more sense. Where is the x ray camera flash and how does it work in comparison? | [
"There are many ways to release electromagnetic radiation, and the object's share will depend on the method used, as well as the wavelength you wish to create. ",
"Standard light bulbs work via incandescence. This is (approximately) ",
"black body radiation",
". Black body radiation is similar to fire- you ma... | [
"Energy has to run through the filament or gas of a lightbulb to make it produce light. That means it needs to be connected to a wire at either end. You could make a long skinny bulb like an antenna, but then you need a wire running down the side of it to complete the circuit. It is easier to bend the filament o... | [
"/u/Weed_O_Whirler",
" gave you a good answer, but I thought I'd add a few things. You can think of the lightbulb as being composed of many antennas - they're just very, very small, and they're powered by heat rather than being driven by an electrical signal.",
"Like the other post I mentioned said, EM radiatio... |
[
"What is the maximum \"resolution\" of a tattoo on human skin?"
] | [
false
] | When a person receives a tattoo, what are the factors that limit how fine the lines can be? With the right equipment, could only a single cell be dyed, or would the ink "bleed out" and lower the maximum resolution possible? | [
"How, pray tell, do you dye an atom..."
] | [
"How, pray tell, do you dye an atom..."
] | [
"Right now the limiting factor is the size of the needle and deposition volume (how much ink is placed in the deeper layers of the skin per puncture). ",
"At the cellular level, ink injection can be a little \"blurry\". The ink is deposited, damaging the epidermis and surrounding layers of skin. The immune system... |
[
"Anti-Particles"
] | [
false
] | Physics Why don't anti-particles flow backwards in time? Keep in mind that I am dumb, I honestly feel like I should know why but I don't. | [
"Anti-particles do not flow backward in time. What would it even mean for something to flow backwards in time? ",
"However, it's a useful calculational tool when computing scattering cross-sections to replace the absorption of an anti-particle moving forward in time with the emission of a particle moving backward... | [
"Real answer: antiparticles are just siblings to regular particles, there is no black magic about them by themselves. If you had a bowl, or a planet, or a galaxy of antimatter (large clumps of antiparticles), it wouldn't behave differently than regular matter by itself does. Given this, why ",
" an antielectron... | [
"Actually, while the QFT may predict the same measurable quantities for a backwards-in-time antiparticle and a forwards-in-time particle, it doesn't mean the two are the same. A particle moving backwards in time would violate causality. It would mean you could send messages to the past using anti-particles, which s... |
[
"Can/what happens if a nuclear powered submarine’s reacor melts down?"
] | [
false
] | null | [
"There's not going to be any hole melting in the submarine. If you've ever seen someone boil water in a paper cup, that's why. There's a lot of ocean and there's no way the reactor has enough mass to heat steel hot enough or fast enough to either go through the containment vessel or the hull. ",
"TL;DR the interi... | [
"Everyone on the sub would likely be exposed to highly lethal levels of radiation",
"Which I imagine, given the brand new hole in their hull, is probably the least of their worries, heh."
] | [
"Ok I like this explanation better. Thanks"
] |
[
"A rise or fall in elevation causes a persons ears to hurt. What other effects are caused to the human body from a fall or rise in elevation?"
] | [
false
] | null | [
"A rise or fall in elevation causes a persons ear to hurt due to changes in pressure. ",
"Other side effects would be gasses that are usually dispersed in water ( like the co2 in your coke ) to become gas again. Imagine if you had a pipeline full of coke and all of a sudden the pressure drops, all the co2 in the ... | [
"So a person could get the bends from a change of elevation? Would there be any noticeable effects on any internal organs if the change of elevation was slow? For example, would I be able to notice any discomfort while driving uphill?"
] | [
"What are \" the bends\" ?",
"If the change of elevation is slow you would not notice any discomfort because. It's mostly sudden shifts in pressure that causes discomfort/illness"
] |
[
"If I tied a incredibly long string around a rock and lowered into the Marianas Trench from a boat, would the rock become heavier? What would happen to my string?"
] | [
false
] | null | [
"The rock would become lighter because the water would become more dense (by about 3%), and there would be a greater force of buoyancy acting on the rock."
] | [
"But what about the huge amount of pressure going that deep? Could you explain a bit more about the water density changing?"
] | [
"The water is compressed by the immense pressure."
] |
[
"Black holes are alway illustrated with their accretion disks around their equators. Is this necessarily the case?"
] | [
false
] | I know there have been a lot of black hole questions lately but now the megathreads are gone, I have another one! Here is a typical black hole render: Like most renderings we see the accretion disk in a neatish ring and the energetic jets shooting out perpendicular to it. For a rotating black hole, is the accretion disk always around the equator, and the jets always emanating from the poles? I know that in Newtonian celestial mechanics, rings are a lower energy and more stable configuration than a spherical shell, which is why you end up with planetary rings rather than spherical shells, but in planet formation scenarios I had thought the only reason these rings (and Moons) tend to be at or near the equator of the planet is because of angular momentum preserved from the original dust cloud that formed the system (correct me if I'm wrong on this!). Presuming that matter can approach a black hole from nearly any angle, if accretion disks are indeed generally around a rotating black hole's equator, what forces are causing this? Is there some Newtonian answer I'm missing, or is it something related to frame dragging or some other effect in general relativity? | [
"It's both.",
"So yeah, you get discs everywhere in astronomy, because that's what happens if you have (a) dissipation, and (b) angular momentum. The gas particles can bump into each other and convert kinetic energy into internal wibbles, and that wibbly energy can be spat out as light - so you can cool down, and... | [
"Thanks, that's a really good and detailed answer and you're right, I did forget about how angular momentum can add up and still end up forming a disc!"
] | [
"I'd imagine frame dragging is a big part of it, but I don't actually know for sure. I do know, however, that it isn't universal, as the black hole at the center of PG211+143 does not have an accretion disk that is well aligned (except for the innermost portion)."
] |
[
"Novice Question: I often hear references to events, planets or phenomena occurring \"millions of light-years\" away. This confuses me - how is such a distance even measurable, and with that, wouldn't these events have been occurring millions of years ago and not currently?"
] | [
false
] | null | [
"You might read up on this:",
"http://en.wikipedia.org/wiki/Cosmic_distance_ladder",
"For nearby objects (stars in our part of the galaxy) we can measure distances directly using trigonometry. Think back to geometry class. Two angles and a length will allow you to calculate all the other measurements of a trian... | [
"No-one has touched the second part of your question, and it's a bit of a mind bender.",
"Only where you are at is 'now'. Anything you see that isn't immediately where you are appears as it was however long ago the light left it to travel to your eye. Your friend over there is at his own 'now' and you, as he sees... | [
"The distances are measured through a ",
"variety of methods",
" such as ",
"parallax",
", or using certain objects as ",
"standard candles",
" and comparing luminosity.",
"And you're correct, when someone looks at something a million light years away and sees it happening ",
", the actual even took... |
[
"Did epicanthic folds evolve separately in different parts of the planet or were they spread from a certain focal point?"
] | [
false
] | null | [
"I asked this question here because of the ridiculously low amount of information on the subject available on Wikipedia. Hopefully someone will provide a better elaborated response."
] | [
"It pains me that I can't remember the source (a book tracing human migration through separate studies of nuclear and mitochondrial DNA), but I do remember reading that originally all homo sapiens had epicanthic folds, and a mutation in the population that eventually migrated to western Europe resulted in that grou... | [
"http://en.wikipedia.org/wiki/Epicanthic_fold#Evolutionary_origin"
] |
[
"If 1/4 of the world was blown away by nuclear explosion, could the other 3/4 of the world survive?"
] | [
false
] | null | [
"An explosion strong enough to eject 1/4th of the planet earth into space would kill everything on earth and turn the earth into molten rubble.",
"Remember that cataclysmic events like the asteroid that wiped out the dinosaurs were merely big enough to make a (by comparison to the earth small) dent into the earth... | [
"Then let's take it down a notch. How large of an explosion do we need to move the earth out of rotation? If nuclear war broke out would that be a factor? Blowing the earth out of orbit? "
] | [
"Not even close. The earth is incredibly heavy and while atomic bombs are powerful they are puny in comparison to the kinetic energy of the earth..."
] |
[
"If I was standing in one of Jupiter's moons, would I feel lighter when facing Jupiter?"
] | [
false
] | null | [
"Copying and pasting my answer from the last time this was asked:",
"There would be a difference in weight depending on where you are standing, but it's not quite like you think.",
"Jupiter's moons are in orbit around Jupiter, ",
"which means they are continuously in freefall in Jupiter's gravity, but because... | [
"This is incorrect because the moon is in freefall around Jupiter. You have to take into account the tidal acceleration due to Jupiter, which is about 0.003 m/s",
" across Europa."
] | [
"This is incorrect because the moon is in freefall around Jupiter. You have to take into account the tidal acceleration due to Jupiter, which is about 0.003 m/s",
" across Europa."
] |
[
"Question about antimatter..."
] | [
false
] | Say (hypothetically) that we could create stable anti-matter particles in mass quantities. Would it be possible to combine different anti-particles (anti-oxygen and anti-hydrogen for example) to create the anti-version of substances we commonly have on earth (like a kind of anti-water)? Also, if this is in anyway possible, how would the anti-substance behave differently when interacting with normal everyday matter? (Other than obliterating any of its positively charged counterparts it encounters, of course.) I saw this basic question posted as a comment in another thread and thought it deserved its own post since it's an interesting thought experiment... At least i think it is. It IS 3:45am and I'm 15 beers deep though so i may just be drunk and missing the obvious point. if so down vote me and disregard... tldr; Would the anti-version of common substances act any differently than their positive counterparts in a normal earth environment? is it even possible to combine anti-particles into structured arrangements and make anti-elements? Would it be possible in the foreseeable future? | [
"We could make a whole anti-you, just don't shake hands.",
"Though interestingly, this brings up the larger point of symmetry in the universe. Can you in fact make a mirror version of something (with everything being reversed) and still have it operate identically? Well ideally yes, but because of certain problem... | [
"Also, is there a physical definition of 'contact'? I mean, an electron can be a probability wave. I assume that is also true for the positron."
] | [
"He would be killed by ",
" our air. Anti-air, on the other hand, no problem."
] |
[
"Why is the wheel damage on the Curiosity rover so bad compared to Opportunity?"
] | [
false
] | Recently in the news has been a subject of worry. I have yet to see a concise explanation as to why exactly the wheel damage is so bad compared to the 13 year old curiosity rover. Why is that, whats different between the two rovers or the two terrains? | [
"Oppurtunity weighs 174kg, while curiosity weighs 900kg. Also Oppurtunity top speed is 0.1miles/h while curiosity does 3.35miles/h. ",
"I have a feeling you are underestimating curiosity's size, check out these pictures ",
"https://marsmobile.jpl.nasa.gov/images/Evans_Mars_Yard.jpg"
] | [
"I had no idea of their sizes. Fascinating. Thanks for the post."
] | [
"Yeah, there's a Smarter Every Day video where Destin meets some of the Curiosity engineers and the full scale model they keep on Earth for reference. ",
"That was the first time I realised how bleeding huge it is and what an achievement it was to put something the size of a VW on another planet.",
"Edited, be... |
[
"My bottle of isopropyl alcohol has an expiration date. What is happening chemically that makes it \"expire\"?"
] | [
false
] | null | [
"It's possible they're worried about peroxide formation. Oxygen radical oxidation at the methyne position would lead to a peroxide hydrate, which would be in equilibrium with acetone and hydrogen peroxide. Any organic solvent + peroxide is considered a risk so they advocate periodic disposal. How serious this risk... | [
"A pharmacist once told me it has more to do with legal requirements than actual scientific reasons "
] | [
"Entirely possible. I'm a chemist by trade and our safety organization requires us to dispose of certain chemicals annually. I cannot for the life of me understand why half of them are on the list. Someone pulling a CYA makes sense."
] |
[
"Weird permanent thing in the sky?"
] | [
false
] | A few months ago, my dad and I were camping in the middle of nowhere in Queensland, Australia. There was no major light pollution for at least 60 kilometres, so we could see a lot of the stars and astronomical stuff. Around 9 pm, we were sitting there looking at it all, and I noticed a cloud; nothing strange, so I took no notice of it. It was a moderately windy night, so when I looked back at it 20 minutes later and it hasn't moved, I was naturally curious. I asked him if it was one of those huge masses of gas in space, and he said it probably wasn't, and he wasn't exactly sure what it was. He did a lot of science and mathematics in university, so I trusted him. I am also relatively knowledgeable in physics (brag), but I couldn't think of what it could be. I forgot about it, and then we went to bed (tent?) at 11 pm-ish. At 3 am, I got up to go pee, and it was in the exact same spot as when I saw it hours ago, even though the rest of the starts and gas masses had shifted around. At that point I realised that it had to be in our atmosphere, or spinning with the earth at least, because it hadn't moved. It also definitely couldn't have been a cloud or anything physically light because at that time it was insanely windy at sea level, so I couldn't imagine what it would be like that far up. Still now, months later, I have no idea what it could have been. Does anyone in the entire community have an idea? It's been killing me ever since I saw it. | [
"Probably the Large Magellanic Cloud. There are two dwarf galaxies visible from the Southern Hemisphere - the Large and Small Magellanic Clouds. You can see the Large Magellanic Cloud quite well from any reasonably dark area - I can see it from my parent's house on the outskirts of Tauranga - but the Small Magellan... | [
"whatever it was that OP saw, it didn't move with the background of stars",
"Both the Large and Small Magellanic Clouds are located at -70° declination, meaning they're very close to the Southern Celestial Pole, which doesn't move at all over the course of the night. ",
"Even after 6 hours, the Large Magellanic... | [
"You can see them near the horizon in the lower latitudes of the northern hemisphere.",
"The Earth's axis of rotation doesn't really change over a year (it does slowly change over a ",
"longer period",
" though), so if you're on the northern side of the planet, then the Earth is always between you and some po... |
[
"Modeling the Zombie Apocalypse: AKA Help me with Differential Equations"
] | [
false
] | Hello everybody, For a project I am presenting a simple model of a zombie infectious disease. I am modeling it somewhat like a chemical equation, so that the rate of infection is proportional to the population of zombies and the population of humans. Note that L, Z, and D represent the living, zombie, and dead population. Hopefully everything else is explained by my notes, but don't hesitate to ask me any questions. I am having difficulty figuring out how to solve these equations explicitly for Z and L in terms of time. Do I need to simplify my model, or is there a way to solve this that I am not aware of. Thanks a lot :D | [
"Assuming a, b, c, d and j are all constants (that is they aren't functions of time), and L, Z, and D = L(t), Z(t), and D(t) respectively, you have a system of coupled first order ordinary differential equations. You have three equations, and three unknowns. Solve them the same way you would solve any algebraic s... | [
"I haven't tried solving anything but:",
"1) What function does carrying around the D have? It doesn't further constrain the first two equations, you have no constraints on it, etc. I think you're better off just dropping that variable. ",
"2) This whole things simplifies to:",
"L' = aL + bLZ",
"Z' = cZ +... | [
"jepzilla is correct that it models as a Lotka-Volterra equation.",
"Bear in mind that there are a few trivial equilibrium solutions to your series of equations (letters refer to your variables):",
"If b > a (that is human death rate is higher than human birth rate) then you'll end up with effective total extin... |
[
"Does a material's ability to transmit electricity correlate to it's ability to conduct heat?"
] | [
false
] | I guess I was thinking of metal as an example, it seems to do both well. I bet there are examples where one material can only do one or the other but is it more likely that if a material can conduct one it can also conduct the other? | [
"They are different properties. However, you are correct that in metals, the thermal and electric conductivities tend to track well together. That is because in metals both heat and electricity are carried through valence electrons. (see Wiedemann-Franz Law)",
"This does not hold in other materials. For exampl... | [
"Thanks for clearing that up! "
] | [
"Not always."
] |
[
"How much of the brain can be damaged / Which damaged parts reduce what functionality? Based on the awesome scenario of a brain-eating worm!"
] | [
false
] | null | [
"This question is too broad. There are many kinds of disorders that can arise as a result of brain damage. I recommend doing some background reading and coming back with a more specific question."
] | [
"I mean, I'm happy to have some credible guidance to papers or similar on what can happen if specific parts of the brain get damaged...? Do I have to ask for a specific part of the brain so it isn't too broad?"
] | [
"Here are some examples of disorders: visual agnosia, prosopagnosia, optic ataxia, spatial neglect, simultagnosia/ Balint's syndrome, achromatopsia, cortical blindness (and blindsight), amnesia, inability to form new memories, motor deficits, deficits in emotional processing, flat affect, effects on personality, la... |
[
"Do electric cars use electrical energy from the battery more efficiently than gasoline/diesel cars use heat energy from their fuel?"
] | [
false
] | Simple question: In terms of total Joules of energy transmitted to the crankshaft (...or whatever electric cars connect to the drivetrain), which is the most efficient, strictly speaking? | [
"Yes. By a very large margin.",
"A heat engine like a gas engine converts between 20-30% of its thermal energy into kinetic motion at the crankshaft.",
"An electrical motor can convert over 90% of the energy within a battery into kinetic motion given the right motor sizing.",
"So if we have 1000KJ within a b... | [
"The problem here is that heat engines can be made much more efficient than 20 to 30% but only if they are specifically designed to operate at a very constant and specific velocity. So if you use one of those to generate electricity, you can get heat engines to be more efficient. A friend of mine did a quick back o... | [
"The problem here is that heat engines can be made much more efficient than 20 to 30% but only if they are specifically designed to operate at a very constant and specific velocity. So if you use one of those to generate electricity, you can get heat engines to be more efficient. A friend of mine did a quick back o... |
[
"Why is the benchmark for fevers 37.5 degree celsius?"
] | [
false
] | Typically, a fever of above 37.5 degrees is considered a red flag. Is this experimentally derived, or merely arbitrary? Is there anything that prevents another number from being the standard? | [
"We consider medically significant fevers to be >38 degrees Celsius. This, like normal values for any vital sign or blood test, was arrived at by taking (presumptively) healthy people and seeing what range 95% of them have as values.",
"When we set abnormal values, we try to find the right balance between not mis... | [
"As far as I know, the temperature of fever is not absolute, but is empirically determined to be around 37.5 - 38.3 degrees (also depending on where you measure the temperature). There are evidence that a higher temperature increases the speed of the immune system response.",
"Regarding denaturation, I am under t... | [
"Body temperature, 96.6F or 37C, was originally determined by Dr. Carl Wunderlich in the mid 1800’s. Unfortunately, his study, which involved 25,000 patients at the time, utilized a poorly designed thermometer and therefore this whole idea that 37 is normal is rather flawed. ",
"I would highly recommend listening... |
[
"Can we make small, lab-sized, analyzable nuclear explosions?"
] | [
false
] | null | [
"Depends on the size of the lab?",
"But for a \"classical\" nuclear explosion to occour you need a \"critical mass\".",
"This the minimum mass of nuclear material that can go critical (explode). Assuming you're not using any special technology to encourage criticality other than high explosives like in a classi... | [
"Very small note. Nuclear explosions need to be super critical to go off. If the pile is critical it will run away and melt down. Both are real bad for anyone in the near vicinity, but the super critical requirement is why fission bombs need all that high explosive to compress the mass fast enough to pass through c... | [
"Technically, they have to be in a state called \"prompt-supercritical\" to go off, which is why the explosive is necessary.\nSupercritical reactions are the ones that run away and melt down.\nCritical reactions mean they are \"stable\" (the amount of energy they are producing doesn't change with respect to time). ... |
[
"Are there a lot of gasses floating around in outerspace? Which ones, and in what quantities?"
] | [
false
] | Basically I am curious as to what actually makes up "space". I have a hard time fathoming the idea of there being a such thing as "nothing". Also what happens when oxygen is sucked out of a spaceship, like can you make concentrated "community" of gas in space? This was originally posted here: | [
"Careful, the concentrations of other gases and elements are not only measurable, but routinely measured through absorption lines of starlight or other sources of light that pass through these clouds of gas, getting preferentially absorbed at certain frequencies that correspond to atomic transitions of these elemen... | [
"Mostly it is interstellar dust. See ",
"here",
" for a great introduction to this topic."
] | [
"A side question:",
"When you speak about near-lightspeed velocities, one of the dangers of space travel is that if you run into something like a micro asteroid or something, you would be obliterated. Is this a hazard when speaking about single hydrogen atoms in this context? Their mass is not exactly great but i... |
[
"If isotopes like uranium undergo alpha-decay (which can be easily shielded), why are nuclear disasters like the one in Chernobyl so insanely hazardous?"
] | [
false
] | Is it because of the air maybe? Or is there beta radiation involved as well? | [
"Uranium, on its own, isn't that dangerous. It's a fairly weak alpha emitter, and its daughter products give off some (but not much) gamma/beta radiation. You could stand next to a fresh uranium fuel bundle, and not be in any danger. But as the fuel spends time in the reactor, other things are formed.",
"When ... | [
"One of the biggest problems is gamma radiation. Many nuclear reactions are going to release some kind of gamma ray energy in addition to alpha or beta emission. And Gamma rays are this side of impossible to shield, essentially just requiring a lot of mass between you and the source. (like lead or thick concrete or... | [
"Alpha radiation is only dangerous if a source is inside the body where there is no layer of dead cells (skin) for protection.",
"In fact, it is much more highly-ionising than beta or gamma radiation, which makes it the most dangerous of the three if ingested or inhaled"
] |
[
"Why don't normal wires do a good job of conducting high frequency signals?"
] | [
false
] | As signal frequency increases, normal wires no longer do the trick. You need coax cables, and eventually a waveguide or an optical fiber. I'm assuming this is because normal conductors would begin to act as antennas and radiate EM waves rather than conducting electricity? What is the intuitive explanation for why this happens? | [
"You have to think of it as a transmission line, a distributed inductance/capacitance network. For a plain wire in air, where is the capacitance? It's zero. So the transmission line degrades to an inductor. Inductors become higher impedance at higher frequencies. ",
"Investigating what the best impedance for max ... | [
"RF engineer checking in here.",
"A really intuitive answer is a little difficult to come by, unfortunately. We can say though, that you need to replace (simpler) circuit theory with (more complete) EM wave theory once the dimensions of your structure approach the wavelength of your signal. Circuit theory really ... | [
"A plain wire in air actually will have a nonzero capacitance, just like the isolated sphere in the example ",
"here",
". It can hold a charge, and if you integrate the electric field all the way from infinity (where you assume it is zero), you can compute the voltage. That gives you C = Q/V.",
"Not that it w... |
[
"How unique are individual animals of the same species?"
] | [
false
] | There are 7 billion homo sapiens, and each one is fairly unique in genotype and phenotype (excluding twins). There is also a great variety amongst humans that is not typically found in other species. But why aren't other animals as individually unique? And what advantage did it give humans to be so? | [
"There is also a great variety amongst humans that is not typically found in other species.",
"That's just because you don't notice the difference in other species as much as you do in humans. It's \"all Asians look the same\" syndrome."
] | [
"I'd imagine if you were the member of another species of animal you'd see much greater range in phenotype. Many, many species of animal are extremely choosy about who they mate with. Think of peahens and birds of paradise. They notice any minute flaw in a male and will refuse to mate with him. ",
"Also, think ab... | [
"Other animals probably are just as individually unique, it's just we notice differences in humans because that's the way our brain has evolved. We we specialized circuits that analyze human features in faces and the such.",
"Humans I believe are actually much less genetically variable that most other animals sin... |
[
"Does our Universe have infinite mass?"
] | [
false
] | I have seen comments and questions on AskScience about the Universe being infinite. When I think of the Universe as infinite, I think of infinite stars, solar systems, planets, etc. Is this what scientists think? That our Universe has an infinite amount of stars, solar systems, galaxies, and planets? | [
"If our current cosmological models are correct and the universe is infinite, then the quantity of massive objects in the universe will be infinite. Whether or not this is actually the case remains an open question."
] | [
"Does this mean it's impossible (under our current cosmological models) for a spatially-infinite universe to exist that only contains a finite amount of mass? If so, what prevents this possibility?"
] | [
"Our current models are predicated on the assumptions of homogeneity (the universe is roughly the same everywhere) and isotropy (the universe is roughly the same in all directions). Homogeneity requires that the mass-density of the universe be roughly constant. Since the mass density of the observable universe is p... |
[
"If i had a rope on an intergalactic scale, would the rope break due to the metric expansion of the universe?"
] | [
false
] | So, we know the universe is expanding due to the metric expansion of the universe. On small scales, the expansion is so small that we don't notice it: all the forces we are used to (gravitation, the electrical force of chemical bonds, ect) "compensate" for the minute changes. Lets say I have a rope or pole that is impossibly long, my intergalactic rope. The rope at any point would not see its neighboring sections moving away, so it would seem that the instantaneous strain on the rope should be pretty small. But over all, the rope cannot maintain the same length without the ends moving towards the center. So here are my questions: | [
"It depends on where the ends of the rope are. If it's out in free space in a flat gravitational potential, it won't experience any expansion force, because it will just be held together.",
"However, if the ends of the rope are, say, in the gravity wells of two receding galaxies, the ends of the rope will be pull... | [
"The metric expansion of space should make it so the two astronauts are moving away from each other and from the center of the rope.",
"Is this rope in a gravity well? Are the astronauts holding onto it?",
"If the rope is held together, then the astronaut should see the rope fly away from them, while experienci... | [
"Sorry, i meant 4.5 GParsecs :-P. Maybe I'm thinking about this wrong, but if the astronaut is 1 m from the end of the rope, but the center of the rope is at 4.5 GParsecs, then the center should appear (or as you aptly pointed out, not appear) to be moving that fast without breaking the \"cosmic speed limit\" becau... |
[
"Hot days feel hotter if they are humid, but a damp cold feels colder than a dry cold. At what temperature in the middle do wet and dry days feel exactly the same?"
] | [
false
] | null | [
"This isn’t really an equilibrium thing it has more to do with conductivity. Wet air is essentially a mixture of dry air and water, and water has more thermal capacity and is a better conductor than dry air. So the wetter the air the better it will conduct the air temperature to your body. There is also the interac... | [
"Why do damp colds feel colder? Is it because the air is damper or more likely its because your clothing is damper after sweating/precipitation ?",
"depending on your clothing, (e.g. wool) damp clothing could feel about the same as dry clothing, unlike cotton, that feels much colder when wet.",
"In the spirit o... | [
"This isn’t really an equilibrium thing it has more to do with conductivity.",
"This will confuse others. The predominant method of heat transfer depends entirely on the specifics of RH and the difference in temperature. With an air temp near body temp there'd be minimal conductive heat transfer and basically onl... |
[
"In the liver, if blood from the sinusoids can enter the central vein, why doesn't the blood just constantly bleed out of it too?"
] | [
false
] | null | [
"There are different types of liver failure but I assume you are talking about chronic liver damage leading to cirrhosis. ",
"When a healthy liver undergoes prolonged damage (alcohol, hepatitis C, autoimmune disorders, iron) the cells are eventually replaced by scarring as they die off. This causes difficulty for... | [
"Different answers. Blood in veins ",
" go both directions, they are not driven by cardiac pressure from your heart beat. The movement is passive, driven by muscle contraction. But the veins have one way valves that prevent extensive back flow. Once they pass these valves, they cannot go back. So the net flow is ... | [
"Thanks for the answer. When a person's liver fails and they have bleeding into the gut, is that because the \"valve\" process stops working?"
] |
[
"Why does the Fluorine anion in toothpaste strengthen tooth enamel (Hydroxyl apatite) but the Fluorine anion in hydrofluoric acid hate the human skeleton (also hydroxyl apatite)?"
] | [
false
] | Is it just a concentration issue? Is this a question wrongly asked? related: apatite mineral (in rocks) Ca5(PO4)3(F,Cl,OH) hydroxyl apatite: Ca5(PO4)3(OH) carbonated hydroxyl apatite (bone and teeth) | [
"hydrofluoric acid is an acid (pKa = 3.14) with high tissue penetrance. Acidity (availability of hydrogen / hydronium ions) leads to decomposition of the hydroxyl apatite crystals, which is a concept physiologically employed during bone resorption (osteoclasts secrete hydronium ions to attack the mineral structure,... | [
"HF is lipid (fat) soluble. This means it freely diffuses into the body, and into cells (i.e. though cell membranes). Fluorine then goes to work doing what it does (insert nasty picture here). Paradoxically HF being a weak acid actually makes it much more destructive than it would be if it were a strong acid. Whe... | [
"It IS possible to overdose on toothpaste, and become poisoned by the fluoride. Typically this occurs in children. "
] |
[
"If a blind person were to consume a hallucinogenic drug, would they get visual hallucinations?"
] | [
false
] | I also ask this for any lack of a sense. Would the Synesthesia hear sounds/see colors still apply for one who is deaf? or blind? If one became blind in life, having been able to see before, would they get visuals? (I am asking with LSD in mind, but any other hallucinogen is still in question) | [
"Depends on how long they were blind",
". People blind from birth didn't see anything, people who had lost their vision later in life did. "
] | [
"If you've ever taken LSD you wouldnt ask that question. Psychedelics arent all about the visuals, they help you \"see\" things from a different perspective. Audio gets affected also depending on the dosage. Truth be told there is no real way of knowing what someone else will feel, my hypothetical question is do pe... | [
"so if there were no visual illusions, how would the LSD affect them?"
] |
[
"What was the most intelligent Dinosaur and how intelligent was it?"
] | [
false
] | null | [
"How would it even be possible to come to a valid conclusion on this? "
] | [
"I'd say that the ",
"New Caledonian Crow",
" is probably the smartest dinosaur."
] | [
"I'm not sure that would be the correct way to look at it, the Crow is pretty damn smart."
] |
[
"When I hear that computers will exceed the computing power of the human mind, what exactly does that mean?"
] | [
false
] | I'm only confused by this because computers quite obviously aren't and won't soon be capable of human level sentience. | [
"When people refer to computing power, they are referring to the ",
"number of operations or calculations per second",
". When they say that computers will exceed the computing power of the brain, they mean to say that a computer will be able to more in a single second than we can.",
"This point has already b... | [
"It's quite wishy-washy. The important thing to keep in mind is we don't understand how the human brain works yet, so people assume that the brain computes in a way that is roughly analogous to a parallel computer. But this is completely unknown, there is no known way to use a brain as a computer. For all we know a... | [
"According to Moore's law, computing power doubles every 18 months. This \"curve\" is said to be changing as some people speculate that computers would never be \"smarter\" than humans. In regards to your question, people think computers will be so powerful they will be able to learn and adapt faster than humans ... |
[
"Why do computers get slower over time?"
] | [
false
] | I've always wondered this, and wanted a good answer. So, why is it that a brand new computer will outperform an older one with the same specs? Does it have to do with memory? | [
"So, why is it that a brand new computer will outperform an older one with the same specs? Does it have to do with memory?",
"If they truly have the same specs and the same software installed in the same way, then there will be no difference. I do find it a bit odd that you would replace an older computer with a... | [
"Furthermore, as a corollary to his first point: software is updated as if your computer is getting faster. As you continue to upgrade your software on a constant computer, your computer appears to be getting slower."
] | [
"Filesystems tend to get somewhat sloppy over time; reading/writing/overwriting/moving/performing any other operation on a filesystem tends to increase fragmentation as well as filesystem inconsistencies and errors. Operating systems also tend to get bogged down with each new application you install as many softwar... |
[
"When does interbreeding fail? Can a human's sperm enter and fertilize a goat's egg? Will something start to grow, and die soon after, or will it not even get that far?"
] | [
false
] | null | [
"Interbreeding fails when organisms are sufficiently different, the more closely related they are, the better chance they have. Typically the organisms have to be within 2 chromosomes of each other in terms of total chromosome count. Humans have 46 chromosomes, goats have 60. Also, if the animals are of different g... | [
"http://en.wikipedia.org/wiki/Humanzee",
"There's speculation that there's no definite barrier to the idea, and I only know of one example of any human beings making an attempt. Ilya Ivanovich Ivanov supposedly employed at least one woman in an attempt to inseminate her artificially with ape sperm.",
"Unfortuna... | [
"Do we know what would happen with a human/chimp interbreed ? "
] |
[
"Apple seeds contain Amygdalin, a substance that can lead to cyanide poisoning."
] | [
false
] | Does anyone know how poisonous it is and how many seeds you would have to eat before it became dangerous? Does this substance build up in the body or is it easily flushed out? Got curious after seeing a few posts over in and couldn't find any good information via google. | [
"I asked this question a month ago. ",
"Here ya go",
" Apparently ~0.6 mg per gram of seeds which is a decent amount.",
"Amygdalin is the most prominent sugar present in the seed itself. ",
"Though it's must easier to get cyanide poisoning from improperly cooked cassava roots, though apparently eating (and ... | [
"The LD50 (the statistically derived mean does that causes death in 50% of test subjects) ",
"has been found to be 880mg of orally ingested amygdalin per kg of subjects weight in rats",
".",
"Now, apple seeds contain about 2-3% amygdalin by weight (couldn't find a link: Weiss, M., Hydrocyanic Acid in Apple Em... | [
"An interesting calculation, but as I indicated in my comments most of the amygdalin present in the seeds is not processed by metabolism because it is encapsulated."
] |
[
"Could somebody explain me how TALEN-missions work on an example task?"
] | [
false
] | I just don't understand that, but I hope I will, if you have explained it .) I'm new to Biochemistry so could you explain it like I'm.. 10, maybe 18? I found this task in the world of the internet and got interested in it, but I don't go through it: First of all it's about TALEN (you already know it, but to make it clear: Transcription Activator-Like Effector Nukleasen). Let's start: There are 2 TALENs that want to cut throught a sequence that goes like that. 5’-CAGCCAGACTGCCTTCCGGGTCACTGCCATGGA GGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCT GAGTCAGGAAACATTTTCAGACCTAT-3’ (Question on the side, what does the 5' and -3' mean? Wikipedia told me nothing, or I'm just too blind for it) and for the amino acid on place 12 and 13 NI = A; NG = T; NN = G; HD = C The TALEN-Pair should start at the start codon -That I have to find first, the DNA binding are 15 base, the cut is 5 basepairs away from the bindingpoint. Then -that's the end of the first number: Identify the start codon and say where the both binding-positions are (the 15-Base thing).. Then I should translate the 15 + 15 base (the binding pairs) into the RVD -That's i think the: NI = A; NG = T; NN = G; HD = C Then I should define the binding and cutting-point of the restriction enzyme Bsal and EcoRI (-The english wiki has more information about that than the german one) And the last thing is to decide which enzyme (Bsal or EcoRI) is better to get sticky ends in the sequence up there after the PCR and "restriction cut". That should happen throught ligation for 5 different DNA sequences. I'm sorry for this text-wall, but happy for every answer, if you understand what I want from you, because.. myself doesn't understand it. | [
"The ' (prime) number refers to the points on the sugar ring on the individual base. When strung together in DNA, the 3' (3 prime) carbon of one base is attached to the phosphate chain on the next base. The phosphate chain on the next base is attached to the 5' carbon on its sugar ring. When you chop out a length o... | [
"Sorry if I've misunderstood your question next, but your start codon will be ATG, then you can find the sequence 15 bases 3' (further on) than that.",
"I think I can see the question you've been set with the restriction enzymes. Bsa1 will give you a 'blunt end' cut. That is both DNA strands will be cut at the sa... | [
"Thank you, now I understand that with the 3' and 5' .) ...seems easy "
] |
[
"Why doesn't water rise and compress the air in an upside-down cup lowered into water?"
] | [
false
] | I just put a cup upside down in a pool of water but every bit inside of it was dry afterwards. I thought the air would get heavily compressed by the water, but why doesn't it? | [
"It does. You just didn't push the cup down far enough. As a bonus, as you compress the air it gets denser so the bouancy of the air decreases. If you push it down far enough the air won't be bouyant enough to keep the cup floating. "
] | [
"It should.",
"Ordinary atmospheric pressure corresponds to a column of water of about 10 meters, so if you put down the glass to a depth of 1m, the pressure will increase by 10% and the volume of the air will be reduced by 9%. So if the cup is 15cm tall, you should create a wet edge of 1.35 cm. "
] | [
"As a physics student of 5 years I know this to be true, but I had never considered it in this way, and assuming your container is made of something more dense than water (presumably glass) you're absolutely right. I love that you posted this comment! Thank you for making me consider a new and interesting phenomeno... |
[
"Could \"dark matter\" be hiding in black holes?"
] | [
false
] | I watched an episode of Nova: Science Now where they were searching for dark matter. The way they explained it, the biggest evidence for dark matter is that galaxies are spinning so fast that there must be more gravity holding them together than that which can be accounted for by the stars/novas/planets etc that can be seen. Then they jump to a scientist saying that dark matter is not like regular matter (i.e. non-baryonic matter). I don't understand how they make that leap. Why couldn't the "missing" matter be normal matter either in the form of A) cold gasses spread throughout galaxies/between galaxies, B) in lots of black holes all over, or C) in massive black holes which I've heard are thought to possibly exist in the center of galaxies? I just read about , and it seems that they don't see the lensing which would be indicative of option B, so I guess they can rule out objects between 0.00000001 solar masses to 100 solar masses, but what about option "A" (particles/objects below that range) or "C" (black holes above that range)? EDIT: Why the downvotes? I'm seriously looking for an answer, does no one know why scientists have made the leap to assuming there must be non-baryonic dark matter out there? | [
"Ah, well we think that dark matter is this. We have examples of similar particles in fact, neutrinos. Neutrinos pass through you and the earth and so on, huge numbers of them every second (I can't remember the exact count). But think about it, if they only interact gravitationally (and by the weak force) what's to... | [
"And a follow up question: if dark matter is some form of non-baryonic particles, which for the most part, only interact with \"regular\" matter through gravity, then would these particles be \"falling\" to earth and falling through the earth until they reach the center, and just add to the earth's mass by squeezin... | [
"Gravity is not enough to make something fall. For example, the Earth is not falling into the Sun. To fall, you also have to dissipate your energy, to slow down. For example, a gas cloud can form a star because it radiates a lot of energy and can thus cool down and collapse. But dark matter cannot radiate, so it ca... |
[
"Viewed from the ISS or space, is the sun green?"
] | [
true
] | [deleted] | [
"No, because the Sun is not monochromatic-- i.e., it emits a broad spectrum of light, not just at its peak wavelength. It would appear white from space. There are really no stars that appear green to us. Those which have peak wavelengths near the ~500 nm range simply appear white to us, because their spectra result... | [
"Yes. It appears yellowish to us because a significant fraction of the blue spectrum is redirected in the atmosphere through ",
"Rayleigh scattering",
"."
] | [
"Yes. It appears yellowish to us because a significant fraction of the blue spectrum is redirected in the atmosphere through ",
"Rayleigh scattering",
"."
] |
[
"Why do rainbows form in such specific halfcircular shapes?"
] | [
false
] | null | [
"They don't. Rainbows are circular but a little less than half is normally covered by the horizon. ",
"They form that way due to them being light bouncing through rain drops at a particular angle relative to your eyes."
] | [
"Yes. If you have flown through or near a rain storm you might spot a full circle rainbow. Really cool looking."
] | [
"To expand on Sinderlings point. imagine a line in space. At the back end, the sun, at the front end, the centre of the rainbow (full circle), in order to see it your eyes have to be on a specific point on that line because that point is rather like the focal point on a satellite dish where the signal collector is ... |
[
"How does evolutionary science explain how fresh water fish ended up in inland lakes?"
] | [
false
] | EDIT: Thanks for all the responses. I'm not arguing against evolution (I believe in it), I'm wondering because I live in a glacial lakes area (with many lakes) and it kind of makes me wonder, where did all these sunfish, walleye, northern pike, etc come from? Are they all descendants (that have evolved) from ocean species, or did they end up in fresh water lakes some other way? | [
"There are a large variety of fish that can live in both freshwater and saltwater. Some of these fish include salmon, bull sharks, and striped bass. All three species mostly come into freshwater to spawn. (There are other fish that leave freshwater to spawn in the ocean)",
"There are incidences where man-made ... | [
"Fish can be transported on water fowl. ",
"Source",
", ",
"source",
", ",
"source"
] | [
"Good question, there could be several reasons to explain an observed lack of divergence.",
"It may be that lakes which are now isolated were once connected, but not enough time has passed for speciation to occur. In North America, the ",
"last glacial maximum",
" was only 19000-26500 years ago, so many lakes... |
[
"Which Came First, the Virus or the Cell?"
] | [
false
] | Was the virus around before the first cell and the cell evolved either from or independently of the virus? Or did the cell evolve first and the virus evolved either from or independently of the cell? | [
"No one can tell you for sure. However, since a virus cannot reproduce without a cell to infect, it stands to reason cells would have come first."
] | [
"I wrote a response (viruses came from or after cells), then checked wikipedia, which is smarter and more informative than I am. Here's a direct copy paste:\n",
"http://en.wikipedia.org/wiki/Virus#Origins",
"Viruses are found wherever there is life and have probably existed since living cells first evolved.[34]... | [
"Well, it's not just a protein. It's DNA (or RNA) wrapped in a protein coat. The protein isn't nearly as important as the DNA. ",
"I'm gonna agree with the above comment. Since they're obligate parasites, it makes more sense to think that viruses didn't evolve until cells did, though we don't know for sure."
] |
[
"Intuitive explanation of digital signal reconstruction?"
] | [
false
] | We know we can reconstruct a discretely sampled signal (let’s say we are working with audio range) as long as the sampling rate is at least twice that of the highest frequency in the signal. To physically reconstruct this signal, we output the samples as a train of impulses in time to the sampling frequency. I understand that, because of the Shannon / Nyquist theories, (since we sampled twice our highest frequency) we can reconstruct the signal without loss of information. I saw a great visual not too long ago about how the reconstructed signal is just a collection of sinc waveforms in time, where the sinc ripples (in the frequency domain) sum together to recreate the information between samples. What I do not understand is how this physically, intuitively, transpires- what about an impulse voltage output correctly creates the frequency information between samples? What constitutes an impulse output? Is it strictly the amount of time the output remains on? Furthermore, I know there is filtering that can be done to remove higher frequencies / artifacts that may occur, but I am not sure if the filter is necessary component? Please forgive any misconceptions, and let me know if I’ve made any mistakes or grand assumptions. Thank you! | [
"I am a little bit confused about the second last section of your question. Specifically the part \"what about an impulse voltage output correctly creates the frequency information between the samples? What do you mean by an 'impulse output'? Do you mean the dirac delta function? ",
"https://en.wikipedia.org/wiki... | [
"we output the samples as a train of impulses in time to the sampling frequency.",
"This is how a DAC which has no reconstruction filter operates. It outputs what looks like a ",
"series of step functions",
". The spacing between each step is the sample time; lets say 52kHz (for typical audio). ",
"When y... | [
"I believe most audio is sampled at 44.1kHz isn't it? "
] |
[
"Is it possible to trap static electricity in a mason jar?"
] | [
false
] | Is it possible to trap static electricity in a mason jar? If so how long can it stay "trapped" in there? I am helping my daughter with a science experiment. | [
"If you coat the inside and the outside with different pieces of metal (e.g. aluminum foil). This is called a Leyden Jar, and was one of the first methods of controlling electricity.",
"https://en.wikipedia.org/wiki/Leyden_jar"
] | [
"If you do this be careful, the resulting capacitor can store a lot more energy than what you would think and you can get a nasty discharge. From the inventor himself :",
"I would like to tell you about a new but terrible experiment, which I advise you never to try yourself, nor would I, who have experienced it, ... | [
"Having made one, it can usually deal with low storage in farads, but very high voltages, ones that you will seldom find with normal capacitors. That's why you can use them to store static electricity."
] |
[
"Why is owning a large carnivorous animal (lion, tiger) from infancy more dangerous than owning a dog?"
] | [
false
] | null | [
"Dogs have been selectively bred over the course of many generations. One of the criteria that breeders have used to select which dogs to use for breeding is aggression. Some breeds, like Rottweilers, pitbull terriers, etc., were bred to have high aggression toward perceived threats, but almost all dogs were bred s... | [
"After tens of thousands of years of domestication, dogs have undergone genetic and behavioral changes when compared to their wild ancestors.",
"Dogs retain juvenile traits, both in appearance and behavior, into adulthood that wolves naturally outgrow as they mature. They are more submissive and playful, and less... | [
"This is why owning a wolf, which is nearly identical to may breeds of dog, is a bad idea. Even half wolves are known to be more likely to attack their owners."
] |
[
"Geothermal energy: Are there any dangers/concerns in accelerating the rate of heat loss from the crust?"
] | [
false
] | I am not sure what they would be. I can imagine over a very long and not-scary amount of time we would dampen the depth of brittle rheology, which may increase seismic hazards. That's all I can speculate on though, are there any identified risks of geothermal energy as the main source of energy for a large population over a foreseeable amount of time? | [
"There are some concerns with geothermal energy, but they don't really have to do with accelerated heat loss from the earth.",
"With respect to accelerating heat-loss from the crust, there is not much to be concerned about. It's easy to forget how large the entire earth is as a system, especially when we only thi... | [
"No worries!",
"RE: 1) Water is generally pumped back into the ground, I say generally because there are different types of geothermal power plants. Some pump water down into a borehole that will put it in contact with hot rock which will heat it and then bring it back up as steam, while others use aquifer water ... | [
"thank you for your thoughtful response! i have learned a lot."
] |
[
"Why is it justified to use just even one \"free\" parameter in theories in the physical sciences?"
] | [
false
] | Why is it okay to tune a free parameter (or maybe a few free parameters) in order to get the results you are aiming for? | [
"Because it is necessary. As long as the number of different observations you can describe with the theory is much larger than the number of free parameters this is still a successful theory. As an example, Newtonian gravity has the gravitational constant as free parameter. We can measure it with devices in the lab... | [
"In some cases the constants are just an artifact of our units. As an example: You can measure the speed of light in meters per second. But you can also use light-seconds as length unit and call it \"second\", then the speed of light is 1.",
"Similarly you can define the kilogram to be a mass (and change the othe... | [
"Okay that makes sense. Are there sometimes explanations for the value of the parameter? For example, is there any other reason why the gravitational constant has the value it has other than to provide the right scaling? "
] |
[
"How is it that there is a height difference between Pacific and Atlantic ocean?"
] | [
false
] | I just can’t figure out why, if they are interconnected by the strait of magellan at Kap Hoorn, why do they have to change height in the panama channel? Edit: | [
"There are two things to consider, (1) ocean surface topography (which plays a pretty minor role in the case of the Panama canal, but is important in a more general interpretation of the question in your title) and (2) tidal range (which is the much larger factor for the Panama canal specifically).",
"For the fir... | [
"The Panama Canal rises in elevation (to about 85 feet) because the land rises in elevation. It goes up, then comes down.",
"An earlier plan for the canal, when the French had looked at the project, was to cut a sea-level canal. But that was kind of insane. When the project was taken up again it was decided that ... | [
"A large inland river and lake supply the water for the locks. It is replenished by rainfall."
] |
[
"I recently heard that the player who chooses White in chess has a 5% increase of winning if then they choose black. Why is this? Don't both players have same chance?"
] | [
false
] | If you look at the averages of maths, white almost always leads by 5% p, give or take a few .somethings-somethings. Why is this? Both players have the same pieces, same rules, same board, etc. Why does white get a more statical advantage? Why not black? | [
"The game is not completely symmetric. White moves first, which is generally an advantage. While I cannot answer the specifics for chess, I can provide examples in other games.",
"In League of Legends, one of the most popular online games right now, the ",
"blue team has a great advantage",
" if you check the... | [
"The starting player has what we call a ",
" (meaning, it is trivially clear that there is one), which is created by the rule that when a winning position (checkmate) is reached, play stops immediately. This has the result that every time a white player wins, he or she has been allowed to play one turn more than ... | [
"There is actually ",
"a Wikipedia page",
" on the topic. Part of the problem is that a lot of early opening theory in chess was devoted indeed to Black saying \"okay, White did this, how am I going to respond to that to prevent him from dominating the center.\" That puts black on a responsive foot and makes it... |
[
"Would it be possible to get the optic nerve to send messages to a machine so we can see exactly what the person sees?"
] | [
false
] | I know nothing about optical science just wondering | [
"Broadly speaking, yes. Not with current technology, but I imagine we'll get there. We already record from the brain using a variety of invasive (e.g. implanted electrodes, or 2-photon microscopy with calcium imaging) and noninvasive (e.g. EEG, fMRI) methods.",
"From a practical stand point, the optic nerve is ha... | [
"In theory I wouldn't know why not. The optic nerves send signals and if you can interpret those signals correctly, voilà.",
"In practice however this will be very difficult. Technology wise you would need to mimic the receiving end of a synapse which is hard enough by itself, but only begins there. Vision itself... | [
"this is what retinal neuroscience is all about - measuring the activity of the retina, e.g. by recording the action potentials of the ganglion cells whose axons make up the optic nerve, so that we can then get some idea of what information is actually being transmitted along the nerve to the brain, and what form t... |
[
"Do you think that communication by quantum entanglement will ever be feasible?"
] | [
false
] | Even if it is in the distant future when we know so much more. Is there any possibility of this ever happening? | [
"You can't communicate with what we know as quantum entanglement. It's not just unfeasible, it's not possible even in principle. ",
"Nobody can say that in the future, what we know won't be proven wrong or very different from what we now know. But if it is, then they'll use a different term for it, since it's fun... | [
"But the separate channel doesn't contain any useful information independently",
"A property shared with a classical ",
"one-time pad",
", which is usually referred to as encryption method rather than just communication.",
"I still think ",
"QKD",
" is nifty, but I wouldn't call the entanglement part co... | [
"Imagine you've got two particles, and you prepare them such that one is in the \"up\" state and the other is in the \"down\" state (i.e. you prepare the overall system to be \"neutral\" in some sense, that is to say you know there must be equal amounts of up and down). You don't make any measurements, and you sepa... |
[
"Does sleep ever go to waste? f.e.If I sleep 14hrs instead of just 8."
] | [
false
] | null | [
"As someone who has been studying biology and physiology for many years I can say that though there are many theories about the function of sleep, they are simply guesses. To answer your question properly we would first need to know the purpose of sleep and why we must do it which we do not currently definitely kn... | [
"It's a bit of a difficult question to answer - especially since we don't understand why we sleep. I know it's not the most reliable source, but have a quick glance over no. 8 in ",
"this list",
"."
] | [
"This doesn't really answer your question, but too much sleep correlates with lower life expectancy. But the causation may be due to a confounding factor (e.g. sickness causes both). ",
"http://www.ncbi.nlm.nih.gov/pubmed/17969458"
] |
[
"Is a pine tree that has cut and placed as a Christmas tree still alive?"
] | [
false
] | I placed this year's Christmas tree in the traditional base holder and have been placing water in the base daily; I am replacing about 0.5 liters of water daily, which suggests there is an active process of assimilating the water into the tree. | [
"First, as a minor point:",
"The most popular trees are various species of fir and spruce, but some species of pine are used as Christmas trees. (It's mostly regional.)",
"And yes, you are correct. If your tree is green and using water, it's still alive. Photosynthesis is still happening in the leaves. Some... | [
"If you kept it watered and exposed to sunlight after cutting, how long would it be able to remain living? And why would it die? Is it just less efficient at absorbing water/nutrients through the trunk rather than roots? Too little surface area? "
] | [
"This",
" link may be of help in explaining the possible scenarios here, but I don't think anyone has gotten a tree to root using rooting hormone, and the amount of time that the tree stays alive is dependent on many factors, including: the species of tree, how warm/dry your house is, how close it is to a source... |
[
"How does a computer communicate with another one behind NAT?"
] | [
false
] | I was learning about NAT and I think I understand how it works. You have a private IP. When you send a request to a computer on another network, the router changes the packet's source address so that the router receives the response, and then it forwards the response back to you ("you" being another computer). But this only happens when you initially send a request. How does a computer on a different network send you a packet if you didn't send it a request first? Assuming you are not the only device connected to your network, and it can't just send a packet to your private IP address, how can this communication occur? | [
"NAT traversal and STUN is what you're looking for. The ",
" is both peers tell a third party who and where they are (some identifier and the public IP:port as seen from the outside. The third party transmits that info to the peers. The peers then talk directly to each other. ",
"Here is a detailed description ... | [
"Your understanding is a little incomplete, and correct under certain caveats. For NAT to make sense, the motivation is important. NAT is born out of the requirement to establish IP communication between two address realms which are not distinct (disjoint). For example, end-to-end IP communication is impossible bet... | [
"Technically, I would say that there is also Source-NAT and Destination-NAT.",
"Source-NAT is used when you leave a network which share a common for most home connections. You get 1 public IP from your ISP and when you send traffic out to the internet, your router/firewall/CPE substitutes its own public IP for yo... |
[
"Why is the apparent magnitude scale used to measure the brightness of stars backwards?"
] | [
false
] | null | [
"While ",
"/u/varialectio",
" is right that the system is logarithmic, there's no reason it couldn't be logarithmic in the other direction, with the brightest stars having the biggest numbers.",
"Historically, for the ancient Greeks, magnitude was a semi-arbitrary scale where \"first magnitude\" was like \"fi... | [
"Right idea, but each division of magnitude isn't 10 times as bright: it's about 2.5 times as bright.\n",
"https://en.wikipedia.org/wiki/Apparent_magnitude#Calculations"
] | [
"Logarithms. Log(1) is zero for your starting object. One tenth as bright is -1, one hundredth is -2, etc. So you define a scale as the negative of the logarithm to get rid of the awkward minus sign for most cases.",
"The pH acidity scale works the same way."
] |
[
"Should I take Feynman's view of quantum electrodynamics at face value?"
] | [
false
] | null | [
"Hi! This is a good question for our sister subreddit, ",
"/r/AskScienceDiscussion",
". All our panelists have flair over there as well."
] | [
"Thanks! I'll post over there."
] | [
"Cool, you're all set!"
] |
[
"Doesn't inflation make it impossible to measure the size of the universe?"
] | [
false
] | [deleted] | [
"It does, which is why measurements of the universe are referred to as the \"observable universe\", rather than just the universe."
] | [
"Without a doubt. This is actually a consequence of our Universe having a particularly weird structure where it started off decelerating, and later became accelerating. Generally, in a decelerating universe you start off unable to see anything else, and then more and more comes into view; in an accelerating univers... | [
"So isn't it possible that there are galaxies that were always beyond our cosmological event horizon and therefore their light will never reach us? "
] |
[
"Can you leave solar system going up or down instead of horizontal?"
] | [
false
] | [deleted] | [
"You could, but you wouldn't be able to take advantage of all the ",
"gravity assists",
" that spacecraft headed out of the solar system (like the Voyager and Pioneer crafts) usually take advantage of. It's much slower, since you don't have any velocity in that direction to start with."
] | [
"And what's more, you have to do a pretty drastic ",
"inclination change maneuver",
" - those are very expensive in terms of delta-v."
] | [
"This is something you can do with gravity assists. It's already been done once,",
"https://en.wikipedia.org/wiki/Ulysses_%28spacecraft%29"
] |
[
"What is neuroplasticity?"
] | [
false
] | I know what the basic idea is but I am still a bit unsure. So if possible could I have a simplified and maybe a more in depth version of what neuroplasticity is. | [
"Rewiring of the brain. When I think plasticity, I think of how moldable the brain is.",
"For example, if you introduce a certain drug to the brain constantly, like nicotine, the chronic stimulation of nicotinic acetylcholine receptors may result in a down regulation of the receptors, or a decrease in the amount... | [
"Movies try to portray this as the character goes through a transition and comes out the other end with different ideas. If you take George Costanza and put him into a WWI trench, he will either die or come out a different person because his brain rewired itself to adapt to its new reality. "
] | [
"Here's an excerpt from an essay I wrote. ",
"\"The next study has much more striking results and demonstrates to a larger degree how much of an effect extrinsic signalling can have and also shows the plasticity of a developing cortex. Experiments conducted on ferrets have shown that in the early stages of neural... |
[
"How much would you weigh if Earth stopped rotating on its axis?"
] | [
false
] | null | [
"No, centripetal acceleration. It's due to gravity of course, but 0.034 ms",
" of it is needed to keep you on the earth's surface, the rest you feel as your weight."
] | [
"Centripetal acceleration on the equator is ~0.034 ms",
" Gravitational acceleration is 9.81 ms",
" There would be about 0.35% difference in your weight (less if you're not at the equator)."
] | [
"Did you mean centrifugal acceleration; with centripetal acceleration being acceleration due to gravity?"
] |
[
"Was the cosmic microwave background once visible light?"
] | [
false
] | From what I understand of the CMB it was initially very high energy and high frequency and as the universe cooled and expanded the light was shifted down to microwave radiation. Does that mean that at some point in the history of the universe the night sky was lit up in a specific color of light that we would be able to see? And going further was that point in time a time when there were solid planets and the universe pretty much as we know it now? | [
"Shortly after the Recombination era - the era from which cosmic background radiation originates - the cmb was bright orange. ",
"To understand what exactly happened, let's backtrack a bit.\nUntil 380 000 years after the big bang, the universe was too hot to form neutral atoms. Electrons and protons whizzed throu... | [
"The universe is no longer emitting CBR-type radiation (presumably at the much-lower temperature of the current universe), precisely because it is no longer opaque. The emissivity of the universe is 0. The emissivity and absorptivity of matter ",
", so the CBR is, in a sense, an artifact of the instant before t... | [
"Just because light is in the visible part of the spectrum doesn't mean that it's necessarily bright enough to see with human eyes. I'm not sure of the energy density when it was in the visible spectrum, but it may still have been too dim to see.",
"It should have been pretty much the black-body brightness, i.e. ... |
[
"Why is it that the east coast of the United States is lined with barrier island while they are sparsely seen on the west coast?"
] | [
false
] | null | [
"There are many processes that aid in the formation of barrier islands, but before getting into those, take a look at the ",
"bathymetry reliefs of the continental shelfs around each coast",
" You'll see that land slopes steeply into the ocean in the west coast and gets deep very quickly whereas in the east coa... | [
"Differences in tectonics at work. The Atlantic floor is spreading from the center towards the continents on either side, pushing up the sea-floor. On the west side of the US the plate is diving under the continent taking any prospective islands with it. "
] | [
"There is only subduction occurring in the Pacific Northwest (Cascadia region - Juan de Fuca plate) on the West Coast of the US and most of California is impacted by a transform plate boundary. "
] |
[
"Why does evolution result in distinct species?"
] | [
false
] | null | [
"The Wiki on ",
"speciation",
" has ",
" more depth, as well as more than just one mechanism of speciation (mutatron described allopatric speciation, but there are other types!)."
] | [
"Evolution doesn't necessarily result in distinct species, our need to classify results in \"distinct\" species.",
"And don't worry, this isn't a fundie rant.",
"We classify the results of evolution into species, but evolution does not necessarily produce distinct species. For example: ",
"This",
" is a ger... | [
"Pulling out the biology notebook...\nNatural selection can be stabilizing, directional, or disruptive. In stabilizing selection, traits in the middle of the spectrum are selected for (i.e. everyone becomes average height). In directional selection, traits on one end of the spectrum are selected for (average height... |
[
"Do orbits of planets in a solar system have to be on the same plane?"
] | [
false
] | Currently, I see models of our solar system where the planets are all located on 1 plane. Is it possible for a solar system to exist where planets orbit on multiple planes? | [
"In principle there is nothing to prevent planets from orbiting on multiple planes. That is, if some super advanced civilization was to come to our solar system and move some planets around to orbit on another plane, that would work.",
"The reason that our solar system, and by extension other solar systems, orbit... | [
"And then there is Uranus. It orbits the sun in this same plane yet its tilted 98°. But I wonder, do its moons and ring system orbit Uranus at its equator or do they have an orbit matching the parent body?"
] | [
"Main moons and rings orbit roughly around the equator, small moons orbit at different planes. "
] |
[
"Why don't the Mars Rovers have wipers for their solar panels?"
] | [
false
] | I know they were intended for a much shorter mission than the one they have undertaken, and that wipers would add some mechanical complexities that take away from space away from other systems, but does that preclude the possibility of having solar panel wipers in future missions? | [
"The problem is that wipers would add significantly to cost, weight, and complexity for a small improvement in function. \"Significantly\" because the wipers would have to be a long as the panels are wide, and they would have to be powered by extra motors and gears.",
"Then, when all is said and done, what's to p... | [
"Its pretty cool that you can link to your own wikipedia page. \nI mean, damn. And Im very excited that you remain a part of the Reddit community. ",
"I do have a question though. How much more effectively could the shuttle have been built with modern tech?"
] | [
"How much more effectively could the shuttle have been built with modern tech?",
"I guess we'll find out -- with ",
"SpaceX",
", Elon Musk is doing something much more useful and appropriate to the task at hand. I can't tell you how exciting it is to see a private entrepreneur succeed where Big Government fai... |
[
"Would moving the ISS to GSO for future salvage be practical?"
] | [
false
] | Seems like it would make for really good parts salvage whenever manufacturing in space becomes an industry. Putting it at GSO and abonding it would mean basically no maintenance costs wouldn't it? | [
"First, low earth orbit, where the ISS is, is about 160 km above the Earth's surface",
"The ISS is usually between 300-400km above the surface.",
"On top of everything, even if we did manage to boost the ISS into GSO, we actually don't have any rockets that can send a crewed capsule to GSO anyways.",
"Yet. Fa... | [
"I've actually been advocating for several years that it should be boosted and left up there. Doing that would be much easier and cheaper and safer than capturing a 400 ton metallic asteroid into Earth orbit. Capturing an asteroid is a long term plan for NASA and the new asteroid mining companies, and the ISS is al... | [
"No I don't. I live in a country with no space industry. I've been following the development of various space agencies closely for nearly 40 years though."
] |
[
"Is every instance of your immune system's successful response to an infection passed down to your children?"
] | [
false
] | null | [
"Immunological memory cells travel throughout the body and are what help you mount an immune reaction to a pathogen you have been previously exposed to.",
"Sperm cells are a separate cell line formed in the testes. The only way I can think of a sperm cell DNA to deviate from it's original form is by some sort of... | [
"The DNA used to create offspring (germ cell) is typically not affected by infection, and even if it was it wouldn't confer immunity. No immunity is passed down through DNA because it is an acquired trait, not a genetic one. Mothers can pass antibodies to infants from breast milk, but that immunity doesn't last for... | [
"There is evidence that stressful life events (like starvation) can manifest themselves in epigenetic changes that can be passed down but it's more complicated than you're describing."
] |
[
"Do centrifugal forces still apply in a zero-gravity environment like space?"
] | [
false
] | null | [
"Centrifugal forces are basically pseudo forces. Unless you construct your system in a rotating reference frame, there is no centrifugal force term.",
"What we percieve as centrifugal forces (or centripetal forces by symmetry) are changes in the magnitude of force components due to a torque.\nSo unless the torque... | [
"Yes, the forces are still there (say you spin a rope with a weight on the end). Actually this is what keeps planets orbiting around the sun. The centrifugal force in play here is gravity between the two massive objects."
] | [
"Thank you, I was curious as centrifuges must be used for research on the ISS but I wasn't sure if the same forces applied. "
] |
[
"How do you derive the formula for the modulus of a complex number?"
] | [
false
] | null | [
"It's a definition. A useful one. It is the same as you would get if you consider the complex plane a regular 2D plane. In other words: if you draw the complex plane on paper the complex modulus will be the same as the distance from the origin to which ever complex number you're talking about."
] | [
"It's just a definition. You can't prove a definition."
] | [
"It's just a definition. You can't prove a definition."
] |
[
"I live on 3rd floor, I leave some food for a few days.. suddenly there are ants. How the hell do ants locate the food and they know to come? Do they have scouts in every building?"
] | [
false
] | null | [
"Yes, the ants have scouts.",
"Foraging ants will go out from the colony to scout for sources of food. When an ant finds a food source, it will turn around and return to the colony, leaving a trail of pheromones. These pheromones allow other ants to pick up the trail and find the food source. ",
"With every ant... | [
"this is a great explanation. do you know if when ants are killed their pheromones are released causing other ants to come? "
] | [
"thanks for your response. "
] |
[
"Is there any reason why I shouldn't use a volumetric flask as a fractionating column?"
] | [
false
] | I have a bunch of the former and a few of the latter and I'd rather save the cash from the science budget. | [
"Nice try Mr. Home-Methlab-Guy"
] | [
"haha LYE AND SUDAFED SON. But no really."
] | [
"Meh. The flasks I prefer are made to fit a coat pocket."
] |
[
"Where does nature break down and choice of movement begin in microscopic creatures?"
] | [
false
] | On the atomic level, everything is just chemical reactions. At what point do these start turning into choices. For instance, On the cellular level, do they choose how their flagella spin to move? Do Viruses choose which cells to invade? Do they actually control their movements at that small of a scale or what? | [
"I'm going to share some of what I picked up in two quarters of biochemistry. The TL;DR is that when you're talking about things like cells, viruses, even organ systems, it's about feedback and feedback loops. A happens, A causes B, B causes C through G.",
"On a cellular level, there is guidance to what happens, ... | [
"On the cellular level, do they choose how their flagella spin to move?",
"I think an example would probably be illuminating here. ",
"In ",
", the bacterial flagella are ",
" rotating. The question is what direction (counter-clockwise rotation - forward swimming; clockwise rotation - causes tumbling). T... | [
"Chemotaxis is probably the closest thing to 'choice of movement'. For example, if you've ever seen that video of the phagocyte chasing the bacteria (if not, go find it on Youtube cos it's ace), the phagocyte knows to chase the bacteria and the bacteria knows to run, because they can 'smell' eachother. The bacteria... |
[
"If I were standing on Mars, would I be able to see the Earth and the Moon as two separate celestial bodies?"
] | [
false
] | Assuming that Earth is about the closest to Mars it can get. And if it wouldn't be possible , how strong would my telescope have to be to see them separately? Edit: I mean with the naked eye | [
"There's a lot of non-answers on here, so let me step in.",
"The distance from the Earth to the Moon is 385,000 km. According to Wikipedia, the closest Earth and Mars get in a given orbit is between 54 and 103 million km. Let's take the close value, 54 million.",
"The angular distance between the Earth and Mo... | [
"That picture is taken with a 50 cm telescope."
] | [
"That picture is taken with a 50 cm telescope."
] |
[
"Why would 1.5 billion year old zircon crystals contain more helium than expected in radiometric dating tests?"
] | [
false
] | This is a and I decided to hold off for a few days to save it for my cake day. Please avoid having this turn into a religion vs science debate so that the wonderful mods don't get mad at me. The research from the group Radioisotopes and the Age of The Earth (RATE) makes the claim that far more Helium is found in 1.5 billion year old zircon crystals in granite than expected when performing Uranium based radiometric dating. Suggesting ages more along the lines of 6,000 years. Is there too much Helium found in Uranium dating? If so, why? | [
"Yay I do research on zircons so allow me to take a stab at answering this question:",
"The reason Uranium-Lead dating works so particularly well in zircons is because when the zircon forms it will take (practically) zero lead into its structure because lead is so uncomfortable in the crystal lattice. It does how... | [
"In order to answer your question I need to introduce saturation as a concept (perhaps not for you but for lots of other people).",
"Saturation concentration depends on temperature and the composition of the melt/liquid in which something is trying to be dissolved. For a simple and delicious experiment try to dis... | [
"In order to answer your question I need to introduce saturation as a concept (perhaps not for you but for lots of other people).",
"Saturation concentration depends on temperature and the composition of the melt/liquid in which something is trying to be dissolved. For a simple and delicious experiment try to dis... |
[
"You have been transported to a planet somewhere else in the Milky Way. Is it possible to deduce where you are in relation to Earth? If so, how would you do it, and what equipment would you need?"
] | [
false
] | null | [
"Yep! By using pulsars as beacons. Each pulsar has a very particular spin period, no two are exactly the same and we know them to very precise values. We know accurate distances to relatively few of them, but enough that by identifying the positions of these pulsars on the sky, we could accurately determine our 3D ... | [
"That's one way - the successful test I linked to was with an X-ray telescope called NICER.",
"You could also do something similar in a way that would be feasible from the ground on an alien world with optical telescopes but less useful for spacecraft navigation, by mapping the locations and distances of globular... | [
"Am I right in thinking that this doesn't work in general? As far as I know the Milky Way is poorly mapped beyond the galactic core because we have a hard time seeing through it. Do we know of many pulsars on the other side of the galaxy?"
] |
[
"When someone is diabetic, does that mean their bodies don't have the ability to produce insulin or is it their brains that don't give the signal to produce insulin?"
] | [
false
] | null | [
"Roughly speaking, type 1 generally means that their pancreas does not produce enough insulin and type 2 generally means that the body cells are resistant to insulin. Brain signals aren't part of the hormone regulation."
] | [
"There are two types of diabetes:",
"Type 1 - (Usually in young people) your body produces antibodies which destroy the cells which produce insulin. So basically you have deficiency of insulin. ",
"Type 2 - (Usually in the elderly) your cells are resistant to insulin. This means they lack membrane proteins whic... | [
"It can become involved in late type 2. With the cells becoming resistant, the brain signals for more and more insulin production until it reaches a point where the regulation arc stops working. Thus, the type 2 becomes insulin-dependant in addition to insulin-resistance.\nTo be precise it is actually the whole reg... |
[
"How far is humanity from creating a Jupiter Brain or Matrioshka Brain?"
] | [
false
] | null | [
"Thousands of years."
] | [
"I heard one scientist say that one of the solutions to the low temperature requirement of quantum computers was to build one at low temperature, then use it to figure out how to make one at room temperature.",
"(his name was Chetan Nayak if anyone is interested)"
] | [
"My organic computer system struggles to calculate the gratuity on a takeaway curry. Aim higher."
] |
[
"How does your adrenal gland \"know\" that you are scared and that it should release epinephrine?"
] | [
false
] | Edit: Sure, the brain sends a signal to the adrenal gland. But how does the gland "know" that this signal means "oh, you should release more adrenaline now"? | [
"The section of the adrenal gland that secretes adrenaline is the adrenal medulla. The adrenaline-releasing cells there are the chromaffin cells. Nerve cells from the central nervous system (brain and spinal cord) extend to the medulla",
" and \"synapse\" with the chromaffin cells (\"synapse\" just means that the... | [
"Now determining how that input fires at the appropriate time is a lot more complicated!"
] | [
"The inner part of the adrenal gland is different from the other glands in your body that release hormones into the blood stream. It receives direct neural input from the brain to release \"adrenaline\" (norepinephrine and epinephrine as they're called in the US). It's a sort of gland/nerve hybrid."
] |
[
"Is electrical tape safe for daily skin contact?"
] | [
false
] | null | [
"But doesn't PVC stand for polyvinyl chloride?"
] | [
"OH DEAR GOD DON'T TOUCH THAT SHIT I WAS WRONG SAVE YOURSELF"
] | [
"PVC? Poly vinyl chlorate? No.",
"\nYou'd have to set it on fire and inhale the fumes at a high concentration.\nDaily skin contact will not give you cancer. You could swallow some and have no ill effects."
] |
[
"Why are there more incidences of cancer in developed nations."
] | [
false
] | Source: | [
"Better medical care means better documentation of cancer.",
"It's not that developing nations don't get cancer, it's that, with all the shit going on there, knowing who has cancer is the least of their worries."
] | [
"People live longer. Cancer generally arises in older people, so when the expected longevity increases, so do cancer rates."
] | [
"Also, in a developed nation, you're less likely to die of something else before getting cancer."
] |
[
"When someone donates a pint of blood, how long does the body take to replace it? Are there any health advantages to donating blood? Does it lower blood pressure directly afterwards?"
] | [
false
] | null | [
"Are there any health advantages to donating blood?",
"One of my uncles has to attend an outpatients clinic once a month to have a pint of blood taken from him. He suffers from a condition known as ",
"haemochromatosis",
" which means the iron levels in his blood are higher than in an average person. The trea... | [
"The blood plasma is replaced in a few days. The red blood cell count is fully restored on average, in 36 days, but range varies give or take two weeks of that average. It's why you must wait 8 weeks between donations.",
"It does lower blood pressure, but I'm sure it's not for long since you replace blood plasma ... | [
"It does lower blood pressure, but I'm sure it's not for long ",
"Your body can also regulate blood pressure through constricting or expanding your blood vessels."
] |
[
"Is there any evidence that second hand smoke is health risk outdoors?"
] | [
false
] | My school just banned smoking on everywhere on campus, no designated smoking areas at all and a $150 fine. A lot of places are doing this but it doesn't make any sense that second hand smoke could be harmful to someone 20 feet away in a completely open outdoor environment, especially with everything else in the air. Is there any research that says I'm wrong? | [
"Can you show any actual evidence for that? Is it riskier than a barbecue? A car? A candle? A gas stove?"
] | [
"I'm sorry, but this is all anecdotal. You aren't providing sources. I'd provide my own, but I'm currently at work and unable to.",
"If someone would be so kind, there are several studies (I believe most prominently by the EPA) on this that have shown that ZERO (rather, statistically insignificant) risk is found ... | [
"A quick Google revealed this: ",
"Exposure to Secondhand Smoke Outside of a Bar and a Restaurant and Tobacco Exposure Biomarkers in Nonsmokers"
] |
[
"Did whales and hippos inherit aquatic birth from a common ancestor, or did they each evolve it separately? And why do some marine mammals, like sea otters, have aquatic birth, but others, like seals and sea lions, don't?"
] | [
false
] | null | [
"Did whales and hippos inherit aquatic birth from a common ancestor, or did they each evolve it separately?",
"They come by it seperately",
"And why do some marine mammals, like sea otters, have aquatic birth, but others, like seals and sea lions, don't?",
"This is going to come down to some combination of ph... | [
"Do we really know that stem-whales weren't giving birth aquatically? That would push aquatic birth back to Whippomorpha."
] | [
"Eh, that's actually a pretty good point I suppose. "
] |
[
"What happens when water condenses on a hydrophobically coated object?"
] | [
false
] | E.g. Spray a bottle of beer with neverwet, stick it in the fridge for a while then take it out in a high humidity climate. Does the water precipitate on the bottom and slide off quickly? Edit: It might behoove me to ask if the shape of the object matters e.g. a glass sphere vs something irregular like a small metal statue. | [
"Hydrophoby is related to wetting angle, it is not pushing water away like magnet pushing metal. If the object is very hydrophobic, water forms more round droplets rather than splashes, and so it would form droplets and very likely fall/roll off the surface. This is how some plants leaves, such as aloe, are cleaned... | [
"It also makes it harder for the water to condense, because the first few molecules don't have have a hydrophilic surface attach to. This makes it harder to form a microscopic drop (nucleate) which can then grow into a larger drop.",
"Edit: grammar"
] | [
"If this is the case and not what MoltenSlag says, what happens to the water/energy?"
] |
[
"Does modern day cryogenics keep the body intact, or does it irreparably destroy the body?"
] | [
false
] | null | [
"modern day cryogenics is, sadly, something used to steal money from rich people such as Walt Disney.",
"Like throwawydow has said, cells are damaged by freezing.",
"In the laboratory we have products such as DMSO and glycerol which we use to stop cells from freezing conventionally when at very very low tempera... | [
"Cryonics relies on ",
" hopes.",
"1) The technology to cure whatever killed you will be developed.",
"2) Most important The tech to restore your body and revive you from the freezing process will be developed. ",
"They realise that #2 is the more difficult (well some do) and that if cancer were cured today... | [
"It's an interesting rumor - Walt Disney was never cryogenically frozen. The technology came out at pretty much the same time he died, and the rumor mill started turning....",
"http://en.wikipedia.org/wiki/Walt_Disney_hibernation_urban_legend"
] |
[
"When physicians talk about 'information', what do they mean?"
] | [
false
] | I have heard it said that "information cannot be lost in a black hole" and a hypothesis that in the beginning there was only information. What is meant by information in this context? | [
"Physicists*"
] | [
"I think an easy way to think of it is to realize that a black hole is not an electron. Nor a proton. Nor an atom. It's not matter in any conventional sense of the word. It has the energy of mass, often the energy of rotation, and perhaps the energy of being charged. So what happens regarding all the electrons and ... | [
"Quantum state information. Spin, for example. Spin is conserved. So when a fermion falls into a black hole, its intrinsic angular momentum can't just ",
"I'm not sure what \"in the beginning there was only information\" is supposed to mean. I think it's either tautological or gibberish."
] |
[
"If inflammation is the body's immune response to an injury--why is it recommended to reduce inflammation with ice/NSAIDS?"
] | [
false
] | Pretty much all in the title. When I injure a muscle or tendon the first recommendation I come across is to ice the area / take a non-steroidal anti-inflammatory drug (ibuprofen!). Are these simply to reduce the symptoms of pain? or do they actually promote healing? | [
"Tendons and ligaments tend to have very little blood supply naturally (which is part of why they take so long to heal). Inflammation can create pressure which hampers what blood supply there is and can lead to a further hypoxic injury of the tissue.",
"As for why we have evolved this way, I could only speculate,... | [
"I think that inflammation reduces the risk of infection. That fits with increased temperature and decreased blood flow. Modern environments are clean enough that it's not a big worry, so it's more important to prevent permanent injury."
] | [
"So the first comment (by hematose) says that inflammation restricts bloodflow, the second comment (by thenumber42) says that inflammation increases bloodflow. This is why I love Reddit."
] |
[
"What type of hardware is used to render amazing CGI projects like Avatar: Way of the Water? Are these beefed up computers, or are they made special just for this line of work?"
] | [
false
] | null | [
"I have previously worked in video effects post-production but I have had no involvement in the production of either 'Avatar' movie and have not seen 'Avatar 2':",
"Fundamentally you could use any sort of commodity computer to render these effects, but the more powerful it is the quicker it can work. Even for the... | [
"They recently announced they used AWS to render the movie.",
"https://www.datacenterdynamics.com/en/news/avatar-the-way-of-water-was-rendered-in-amazon-web-services/"
] | [
"Thank you for that. Completely new information for me.",
"And it makes complete sense, that is an area where AWS (or other cloud products) excels: elastic compute capacity. The fact that AWS seemingly had enough compute capacity “just laying around” in Australia to handle Weta’s needs is mind-boggling to me, so ... |
[
"If a person loses their dominant hand, will their other hand ever gain the dexterity of the lost limb?"
] | [
false
] | On a related note, if somebody is born without the hand that would otherwise be dominant due to a birth defect, will their remaining hand be clumsier than normal? Does that question even make any sense? Thanks, experts! | [
"this is an empirical question, not a theoretical one, because dexterity is defined empirically. and because of the limited number of people to which it applies, anecdotal evidence is appropriate.",
"a friend of mine had his right arm badly injured in a car accident when he was a kid. so he had to start doing a... | [
"the problem is, unless you had very specific measures, from that person, on how skilled they were at specific tasks before they lost the use of their dominant hand, you can't conduct a proper experiment. how precise would their motor control be at age 50 with their right hand? there's no way to know. so you can... | [
"In principle it could be answered empirically, possibly. I don't know what the right measure would be. But maybe someone could do a longitudinal study of people forced to use their non-dominant hands, and then look at some objective measures of performance, like writing speed or other fine motor tasks. I don't ... |
[
"How would the Bloch vector evolve for a transition to virtual energy level?"
] | [
false
] | null | [
"There are different ways that the phrase “virtual energy level” could be interpreted. Can you clarify what you mean?"
] | [
"So you mean intermediate states in a time-dependent perturbation theory expansion?"
] | [
"If you transition into one of these states (as in the state vector becomes that state in the limit where t goes to infinity), then it’s an asymptotic state rather than a virtual intermediate state.",
"I don’t see how you even could have anything like that in a two-level system. Unless you mean the perturbation s... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.