title
list | over_18
list | post_content
stringlengths 0
9.37k
⌀ | C1
list | C2
list | C3
list |
|---|---|---|---|---|---|
[
"Why is the word \"No\" phonetically similar in so many languages while \"Yes\" seems to have way more diversity?"
] |
[
false
] | null |
[
"We're really looking at Indo-European languages here, which includes everything from Hindi to English to Ancient Greek. These languages all share a common origin - the proto-indo-european language, or PIE. PIE has been partially reconstructed from examining the huge number of current and historic languages in the family.",
"It looks like there was a word for something like \"not\" or \"no\" in PIE that has a \"ne\" sound in it, and the child languages have mostly inherited that. That's why \"no\" is so similar across so many languages. However, there is no \"yes\" in PIE, which means that descendent languages have invented their own form, in many different ways."
] |
[
"I don't know of a modern language, but there is no word for \"yes\" in Classical Latin. When responding in the affirmative to a question a Roman might respond with \"hoc\" (this), \"vero\" (truly), \"sic\" (thus), or by simply repeating the verb used in the question."
] |
[
"It’s hard to imagine a language that doesn’t have a word for “yes”. It seems like a such a basic need for any language. Surely any society would have a need at some time to answer in the affirmative. How did they do this if there was no word? I suppose one could imagine that it was a gesture but there are often occasions where a question is asked and the two are not in sight of each other. Is there any precedent of a known, modern language that doesn’t have a word for “yes”?"
] |
[
"Why do LED lights \"jiggle\" ?"
] |
[
false
] |
I've noticed this with all LEDs, but particularly on clock faces (which I guess aren't really LEDs). You know the old digital clocks on cable boxes? If you look at them, away, and back, the lights seem to dance around. What's going on with my eyes? EDIT: Thanks for all the answers! Upvotes for everyone!
|
[
"The LEDs will be Multiplexed. Its primarily used as a way of saving I/O pins on your control circuitry. The most basic method would connect 16 LEDs as a 4x4 grid, which only needs 4+4=8 pins to control it. But doing this means that only a subset of the LEDs can be on at any one time (one row/column in this example) so each group is briefly lit in turn. when this is done fast enough your brain just sees a constant illumination, but the edges of our sight are optimised for noticing fast movement so your more likely to see the flicker when you look away.",
"tl:dr: they are flashing to save money, you normally cant see it, but your peripheral vision sometimes can."
] |
[
"Another reason this can happen is if the LED is being dimmed by a lower duty cycle PWM.",
"This is a decent article that describes what is happening: ",
"http://www.arduino.cc/en/Tutorial/PWM"
] |
[
"LEDs are often driven with circuitry that protects them by turning them on and off very rapidly. They are flashing fast enough that you don't normally notice it unless they are moving across your field of view."
] |
[
"How do we know that stellar black hole are not neutron star ?"
] |
[
false
] |
How do we know that stellar black holes are not neutron star becoming too massive to let photon go away ? In other word, why a neutron star smaller than 3 solar masses "eating" an other star and reaching 3 solar masses collapse into a black hole ? Why this star doesn't stay a neutron star being invisible by physics ?
|
[
"How do we know that stellar black holes are not neutron star becoming too massive to let photon go away ?",
"If something is too massive to let light escape, then it's black - so by definition it's a black hole!",
"But a black hole can't be a neutron star. This is because the speed of light is the universal speed limit - nothing can travel faster than it. So if an object's gravitational pull is so strong that light can't escape, it means that ",
" can escape. This means no force can ",
" overcome that gravity. So the gravitational collapse continues unimpeded until you reach a singularity (or some quantum gravity state).",
"Neutron stars are what happens when the gravitational pull inward of a ball of neutrons is balanced by the outward ",
" of the neutrons. This means that the Pauli exclusion principle forbids the neutrons from being packed any tighter together than they already are. That counteracts gravity. But if the gravity is so strong that light can't escape, this means neutron degeneracy pressure certainly won't do any better, and so the gravitational collapse wins out. What you're left with at the end - a singularity or some other exotic state - can no longer be described as a ball of neutrons."
] |
[
"No, it's not, as I tried to make clear in my post. As I said, if you have an event horizon - meaning light can't escape - then it's impossible to end up with anything ",
" than a singularity. (When I say \"singularity\" here it should be understood that, depending on the details of quantum gravity, you could also end up with some exotic object smaller than a Planck length. But it certainly wouldn't be a neutron star or anything else constructed from the known laws of physics!)",
"What you're asking is whether you can have an event horizon outside the neutron star, while all the neutrons in the star stay put where they are. But if light within the horizon gets sucked back in, then those neutrons would have to be able to move faster than light in order to stay put. But nothing can move faster than light, so those neutrons would get sucked in just like light does."
] |
[
"From the perspective of an outside observer, yes, although from the perspective of the matter falling in, it takes a finite time to reach the center."
] |
[
"I don't understand how such an ancient star can be in our Galaxy. Can someone explain in more detail how this is possible please?"
] |
[
false
] |
[deleted]
|
[
"Our corner of the universe is just as old as every other part of the universe. Space and time, all of it, was present from the big bang onwards. As you said, it has just expanded, that expansion doesnt create new parts of the universe, it's just that the fabric of space-time is getting larger everywhere, equally. All of the energy and matter that exists today has always existed from the very beginning. Our solar and most others are the remnants of supernovae and other processes that facilitate the fusion of lighter elements like hydrogen into heavier ones like helium and carbon and silicon and so on.",
"It's true that what we see at the furthest reaches of the observable universe are typically older, but that is because what we are seeing is the light from that time having taken that long to reach us. so it's impossible for us to see anything newer than the oldest things in the universe. There's no reasons that stable elements from the early universe cannot still be in existence and in our part of the universe."
] |
[
"Am I simply wrong in my understanding that space expands uniformly in all directions at all points and that this particular star happened to be in a spot where the universe was still fresh and new?",
"The universe expands uniformly, yes (on very large scales), but I don't understand the second half of the question. This star formed a long time ago and has just hung around ever since. Presumably most other galaxies would also have stars that are as old as this one."
] |
[
"Spacetime only expands on large scales, millions of light-years. Small scale objects (essentially anything that's gravitationally bound) don't experience expansion. So to this star, distant galaxies are getting more distant, but the surface of the star isn't getting any farther from the core of the star."
] |
[
"Is it just a coincidence that Newton's Law of Gravitation and Coulomb's Law are so similar?"
] |
[
false
] |
I couldn't help but notice that Coulombs law and Newton's Law of Universal Gravitation are remarkably similar. Coulombs Law is F=K (q1*q2)/r Newton's is F=G (m1*m2)/r This can't just be coincidence right? Is there a relationship between these two?
|
[
"The short answer is that we see the force is proportional to the two \"charges\" that go into it, and is proportional the surface area of the sphere between the two. The latter part comes out of conservation laws and specifically has r",
" dependence because we live in a 3 space dimension universe."
] |
[
"The ",
"² relationship ultimately comes from the relationship between surface density of a two-sphere of constant whatever at different radii. If the density at ",
" = 1 is one whatchamacallit per unit of area, the density at ",
" = 2 will be one-fourth of a whatchamacallit per unit of area, because the total whatever remained constant while the surface area went up by a factor of ",
"².",
"If we lived in a different universe where there were ",
"-spheres, then the surface area of an ",
"-sphere would change by some other factor of ",
" then we wouldn't have inverse-square laws. We'd have some other kind of laws.",
"Gravity, the Coulomb force, the radiant flux of light, the way sound intensity diminishes with distance … we've got two-spheres all over the place, so we've got inverse-square laws all over the place."
] |
[
"It makes sense intuitively. In terms of gravitation, ",
"F ∝ m",
"F ∝ 1/r",
"Since it's a force of attraction between two bodies another term must be added, namely the mass of the other object: 'M', a scaling factor is also included 'G'",
"Thus,",
"F = GMm/r",
"This argument is also true in terms of charges. The force is directly proportional to the strength of the charges and experiences a cutoff as the distance between them increases including the scaling factor. The obvious difference being that electrical/magnetic forces can repel. As far as we're concerned there is no fundamental relationship at the classical level. It just so happens that the forces require two arguments, strength of the particle's mass/charge and the distance between them. It also happens that the force is inverse \"squarely\" proportional."
] |
[
"Black holes - what happens as their mass decreases due to Hawking radiation?"
] |
[
false
] |
[deleted]
|
[
"No. Once a black hole is formed, it remains a black hole. (according to my knowledge of the best current theory) While black holes ",
" by gravitational force exceeding any possible forces or pressures holding matter apart, once they're formed they stop behaving like \"normal\" matter, and are just their own thing. As they evaporate they become smaller and hotter black holes until they evaporate completely away in a burst of particle production from Hawking radiation."
] |
[
"I don't know, it depends on what your specific \"why\" is. But I'm going to guess that the answer there is that black holes just are their own things. They're not an infinitely dense \"point\" of compressed matter, like so much garbage compacted together. They're unique objects that keep all of the information to describe what went into making them stored on their surface. That information eventually feeds into the types of things produced via Hawking radiation and escapes into the universe as it evaporates. ",
"Try ",
"this great response by RRC",
" as to what a black hole is."
] |
[
"The limit on the amount of mass required to form a black hole isn't a ",
" limit. You can mathematically describe a black hole of any mass just fine; it's just that the only processes we know of that are capable of forming black holes from non-black holes are restricted to fairly large stars. A black hole just requires a certain ",
", which existing black holes obviously have already."
] |
[
"Does perception of size and scale limit our ability to understand extremely large and small objects?"
] |
[
false
] |
For example, if scientists had access to functioning models of an atom and a galaxy and both were scaled to the size of a football stadium, how much (if any) additional information could be gained by using the instruments and technology currently available?
|
[
"The nature of these objects makes it impossible for this to occur, thus we couldn't have them, they would not possibly have the same properties. If an atom was big enough to see, it would not be an atom, same with the galaxy.",
"If my aunt had a penis, would she still be my aunt?"
] |
[
"Not really. The issues with observation are generally related to things like the wavelength and interactions of photons, so you could be a lot smaller, but you couldn't \"see\" anything more than we do at our scale. ",
"The large end, you're still limited by that pesky speed of light! If we had bigger mirrors we could perhaps resolve things from further away, but there's a limit to the value of that. At some point you'd get big enough the you would not live long enough to move your arm, so something silly like that."
] |
[
"There's two parts to your question. The first is whether it limit our ability to understand them; the second is the hypothetical.",
"On the first, yes, we are limited. Like dogs being better at scent than echo-location, we likewise are biologically biased towards certain things - mostly in the concrete. We have very little physical intuition of the very large and very small (\"one death is a tragedy, a million is a statistic\"), and this doesn't change for scientists.",
"What we (somehow!) have the ability to do is to create abstractions (math, numerical representation, visualizations) that reflect certain (hopefully important) parts of this reality, something we call a \"model\" in the business. This removes some of the limitations, and I think that with the aid of these models, we can adequately deal with extremely large and small objects (for example, by projecting them through use of logarithms onto a linear scale). In that regard, what we ",
" handle well is the existence of arbitrarily large dimensions.",
"This relates to your second question about whether it's possible to get more information by building physical models of the exceedingly large and the exceeding small. It's a loaded question, because the characteristics of the exceedingly small is different; they simply obey a different set of physical rules than what we're accustomed to. If you blow up an electron the size of a stadium, would it remain probabilistic? Or would it now obey macroscopic mechanics? If it's the former, it'll probably (<-pun intended) remains as enigmatic; if it's the latter, it just isn't an electron in the way we know it anymore."
] |
[
"Fluorinated vs. Fluoridated?"
] |
[
false
] |
One of the cases I was reading for law school was disucssing an issue over water being fluoriDated. This confused me because in my lab experience when fluorine is added to something it the term was fluoriNated. Does the change in terminology have to do with the oxidation state of the fluorine, or something else entirely? Thanks in advance for your help!
|
[
"Fluorination is the addition of a neutral fluorine atom to a molecule. ",
"Fluoridation is the addition of a negatively charged fluoride ion. "
] |
[
"Whether or not the starting F is charged is dependent on the exact scheme used, but if the final product involves F substitution, it's a fluorination. Fluoridation yields F- in solution. ",
"In the standard state fluorine is a diatomic gas. But using something like XeF2 to convert a carboxyllic acid to an alkyl fluoride is a fluorination using just a single F atom. "
] |
[
"There are a few examples of fluorination with aqueous F-, but they're rare enough to still be publishable. Almost always you need F2 as a starting material. "
] |
[
"Are there any planets larger than stars? And if there are, could a star smaller than it revolve around it?"
] |
[
false
] |
I just really want to know. Edit: Ok, so it is now my understanding that it is not about size. It is about mass. What if a planets mass is greater than the star it is near?
|
[
"We are sitting on a planet larger than some stars! ",
"White dwarfs",
", the endpoint of stellar evolution for most of the stars in the universe, are stars that are roughly Earth-sized. While all white dwarfs have radii smaller than Jupiter, for example, Jupiter would still orbit around a white dwarf (and not the other way around) because white dwarfs are very very dense. "
] |
[
"Mass is the key here, not size/density. The short short version is that the object with less mass would orbit the object with greater mass. ",
"The longer version is that any two objects orbit the center of mass of the system. For instance, the earth and the moon orbit a point that is inside of the earth, but is not the center of the earth. Imagine holding something fairly heavy in your arms, then spinning around rapidly. You would have to lean back to maintain balance/equilibrium, right? Same thing."
] |
[
"So would a star orbit a planet with a larger density, no matter the size?"
] |
[
"Why does an antenna not look like a lightbulb?"
] |
[
false
] |
From my basic understanding, both antennas and light bulbs emmit electro magnetic radiation but from what they look like, they are completely different. What about microwaves? I know x rays machines look like cameras, but they absorb radiation and not emit radiation, so it makes a bit more sense. Where is the x ray camera flash and how does it work in comparison?
|
[
"There are many ways to release electromagnetic radiation, and the object's share will depend on the method used, as well as the wavelength you wish to create. ",
"Standard light bulbs work via incandescence. This is (approximately) ",
"black body radiation",
". Black body radiation is similar to fire- you make something hot enough and it gives off visible light (in fact, things at every temperature give off electromagnetic radiation, but cold things give off radiation which has too long of wavelength for the human eye to see, so they don't appear to glow. This is how thermal cameras work- they simply see a higher wavelength light than human eyes). ",
"An antenna, on the other hand, wishes to make a very controlled signal, so it can encode data in it. Thus, you wouldn't want to use black body radiation, because that just produces random radiation. Instead, it produces electromagnetic radiation by accelerating charges from one end of the antenna to the other. An accelerating charge makes a propagating EM wave, and the frequency that you move that charge at determines the wavelength of the EM wave you make. In general, you want the length of your antenna to be about as long as the wavelength you're trying to make. That's why car antennas are about 3 feet long- radio waves are \"around\" a meter long (they really vary based on which part of the radio spectrum you're looking at). ",
"LEDs on the other hand work via ",
"Electroluminescence",
" which is a more complicated method of making light. "
] |
[
"Energy has to run through the filament or gas of a lightbulb to make it produce light. That means it needs to be connected to a wire at either end. You could make a long skinny bulb like an antenna, but then you need a wire running down the side of it to complete the circuit. It is easier to bend the filament or tube around so that both ends are near the bottom, and thus a rounded shape.",
"The energy in an antenna does not have a return to the transmitter / receiver. It either goes out the antenna of the transmitter, or it comes in the antenna of the receiver. The length of an antenna is usually dependent upon the wavelength it is transmitting / receiving."
] |
[
"/u/Weed_O_Whirler",
" gave you a good answer, but I thought I'd add a few things. You can think of the lightbulb as being composed of many antennas - they're just very, very small, and they're powered by heat rather than being driven by an electrical signal.",
"Like the other post I mentioned said, EM radiation comes from accelerating charges. Radio antennas do this by accelerating charges back and forth along their length. Microwaves do this by having electrons move in a kind of circular vortex inside of a vacuum tube, and circular motion is a form of constant acceleration. They move in a circle because the vacuum tube is surrounded by strong magnets, and magnetic fields for electrons to move in a curve. This kind of device is called a ",
"magnetron",
".",
"Xray machines accelerate electrons differently. They usually work by shooting a beam of electrons at a metal plate; when the electrons hit the metal plate they knock off electrons that are in the metal, and this rapid acceleration of electrons in the metal causes the emission of xrays. Xrays are short wavelength/high frequency, so you need very rapid acceleration to produce them. This is why old TV tubes were made with leaded glass; they had a tendency to produce xrays because they worked by accelerating an electron beam towards a metal grid.",
"You might also be interested in something called a ",
"free electron laser",
". You might be thinking, \"if accelerating electrons make EM radiation, can I make any kind of radiation I want by just building a machine that jiggles electrons back and forth at a bunch of different frequencies?\" The answer is yes, and that's how a free electron laser works."
] |
[
"What is the maximum \"resolution\" of a tattoo on human skin?"
] |
[
false
] |
When a person receives a tattoo, what are the factors that limit how fine the lines can be? With the right equipment, could only a single cell be dyed, or would the ink "bleed out" and lower the maximum resolution possible?
|
[
"How, pray tell, do you dye an atom..."
] |
[
"How, pray tell, do you dye an atom..."
] |
[
"Right now the limiting factor is the size of the needle and deposition volume (how much ink is placed in the deeper layers of the skin per puncture). ",
"At the cellular level, ink injection can be a little \"blurry\". The ink is deposited, damaging the epidermis and surrounding layers of skin. The immune system attempts to get rid of the pigment particles, and does so to the surface pigment by flaking it off. But the deeper pigment gets encapsulated by fibroblasts in the collagen matrix (\"scar\" tissue). I imagine this process leads to some movement/\"bleeding\" of the different pigments, but I would say not more than a few cell widths' worth."
] |
[
"Anti-Particles"
] |
[
false
] |
Physics Why don't anti-particles flow backwards in time? Keep in mind that I am dumb, I honestly feel like I should know why but I don't.
|
[
"Anti-particles do not flow backward in time. What would it even mean for something to flow backwards in time? ",
"However, it's a useful calculational tool when computing scattering cross-sections to replace the absorption of an anti-particle moving forward in time with the emission of a particle moving backwards in time, because it's simpler and you get the same answer either way. "
] |
[
"Real answer: antiparticles are just siblings to regular particles, there is no black magic about them by themselves. If you had a bowl, or a planet, or a galaxy of antimatter (large clumps of antiparticles), it wouldn't behave differently than regular matter by itself does. Given this, why ",
" an antielectron flow backwards in time? There is no reason. It wouldn't. I hope I made this clear and this explanation helps you.",
"Stick-up-the-ass-physicist-on-the-internet-answer",
" we describe nature with rules of mathematics, and we can use those rules to interpret a negative sign in some equations of motions as \"time flowing backwards.\" It is the same negative sign that differentiates particles from their antiparticles. Thus, it ",
" that antiparticles, with some other stipulations, can be described as flowing backwards in time."
] |
[
"Actually, while the QFT may predict the same measurable quantities for a backwards-in-time antiparticle and a forwards-in-time particle, it doesn't mean the two are the same. A particle moving backwards in time would violate causality. It would mean you could send messages to the past using anti-particles, which simply isn't the case. "
] |
[
"Can/what happens if a nuclear powered submarine’s reacor melts down?"
] |
[
false
] | null |
[
"There's not going to be any hole melting in the submarine. If you've ever seen someone boil water in a paper cup, that's why. There's a lot of ocean and there's no way the reactor has enough mass to heat steel hot enough or fast enough to either go through the containment vessel or the hull. ",
"TL;DR the interior of the reactor melts and stays inside the pressure vessel. ",
"A reactor has fuel plates, which are shaped like flat bar stock, like 1\" wide and 3/16\" thick (or thicker..but not too thick. Heat is generated from the inside out so too thick would make the center of the fuel meat melt, which is no bueno) and vary in length depending on the size of the reactor. They are stacked with spacers, and mounted in big cells. Water flows down the length of the cells. There is a lot of heat generated, which would rapidly cause steam bubbles to form around the fuel, so the entire system is pressurized to a very high pressure. Higher pressure and the water can get very hot without turning to steam. USN reactors are all classified as \"pressurized water reactors\". Steam doesn't transfer heat efficiently, so there are a lot of things with the system to prevent steam forming in the core. If you get steam in the core, you get a meltdown (Three Mile Island, Fukishima). ",
"If the pressure of the system gets low, due to a leak or something else, or if the coolant stops flowing, the fuel plates are still generating heat. Depending on what power the reactor had been running at before flow stopped or pressure was lost, there is either going to be a lot of heat, leading to the fuel plates melting, or a little heat that might make the fuel plates crack (not a good thing). In either case, ambient losses through the hull will prevent it from doing that much. ",
"In fact, the thickness of the reactor containment vessel is based on preventing melted fuel from getting out, based on a worse case power level with instant loss of pressure and/or flow. ",
"Radioactivity in the ship would be bad, likely lethal, as the majority of the reactivity is supposed to stay in the reactor vessel. The pressure vessel has some serious shielding. If radioactive particles get out of the core and are pumped around unshielded piping or vented inside the reactor compartment (the room with the reactor in it, with no ventilation ports and able to withstand a massive amount of atmospheric pressure) the radioactivity near the bulkheads would be lethal in relatively quick order, but only to people inside the sub. Realistically, it would be mostly contained and would give the crew time to get out and shut the hatches. After that, it would be cooled by the surrounding ocean. ",
"There are a ton of redundant systems on naval reactors and they have designs that are rugged as hell. Civilian power plants don't change angles and aren't designed to continue operating after nearby explosions. The reactors on warships are. "
] |
[
"Everyone on the sub would likely be exposed to highly lethal levels of radiation",
"Which I imagine, given the brand new hole in their hull, is probably the least of their worries, heh."
] |
[
"Ok I like this explanation better. Thanks"
] |
[
"A rise or fall in elevation causes a persons ears to hurt. What other effects are caused to the human body from a fall or rise in elevation?"
] |
[
false
] | null |
[
"A rise or fall in elevation causes a persons ear to hurt due to changes in pressure. ",
"Other side effects would be gasses that are usually dispersed in water ( like the co2 in your coke ) to become gas again. Imagine if you had a pipeline full of coke and all of a sudden the pressure drops, all the co2 in the coke releases and the pipeline basicly bursts. This can happen to your blood aswell. The co2 in your blood becomes gas again and you can get embolisms. ( This happens more than commenly with divers)"
] |
[
"So a person could get the bends from a change of elevation? Would there be any noticeable effects on any internal organs if the change of elevation was slow? For example, would I be able to notice any discomfort while driving uphill?"
] |
[
"What are \" the bends\" ?",
"If the change of elevation is slow you would not notice any discomfort because. It's mostly sudden shifts in pressure that causes discomfort/illness"
] |
[
"If I tied a incredibly long string around a rock and lowered into the Marianas Trench from a boat, would the rock become heavier? What would happen to my string?"
] |
[
false
] | null |
[
"The rock would become lighter because the water would become more dense (by about 3%), and there would be a greater force of buoyancy acting on the rock."
] |
[
"But what about the huge amount of pressure going that deep? Could you explain a bit more about the water density changing?"
] |
[
"The water is compressed by the immense pressure."
] |
[
"Black holes are alway illustrated with their accretion disks around their equators. Is this necessarily the case?"
] |
[
false
] |
I know there have been a lot of black hole questions lately but now the megathreads are gone, I have another one! Here is a typical black hole render: Like most renderings we see the accretion disk in a neatish ring and the energetic jets shooting out perpendicular to it. For a rotating black hole, is the accretion disk always around the equator, and the jets always emanating from the poles? I know that in Newtonian celestial mechanics, rings are a lower energy and more stable configuration than a spherical shell, which is why you end up with planetary rings rather than spherical shells, but in planet formation scenarios I had thought the only reason these rings (and Moons) tend to be at or near the equator of the planet is because of angular momentum preserved from the original dust cloud that formed the system (correct me if I'm wrong on this!). Presuming that matter can approach a black hole from nearly any angle, if accretion disks are indeed generally around a rotating black hole's equator, what forces are causing this? Is there some Newtonian answer I'm missing, or is it something related to frame dragging or some other effect in general relativity?
|
[
"It's both.",
"So yeah, you get discs everywhere in astronomy, because that's what happens if you have (a) dissipation, and (b) angular momentum. The gas particles can bump into each other and convert kinetic energy into internal wibbles, and that wibbly energy can be spat out as light - so you can cool down, and get rid of random motions, until you settle into the lowest energy configuration. However, you can't get rid of angular momentum so easily, so you end up with the lowest energy thing that's still spinning, i.e. a disc.",
"I think you've got one small misconception with that though. The angular momentum doesn't have to come from a single spinning object. If you have multiple inflows, they're still going to add up to having some sort of spin - it would be an incredible coincidence for all the rotation to exactly cancel out. This is why galaxies can be flat too. Galaxies are the result of lots of converging flows, and lots of mergers of other galaxies. But the gas always settles down into a disc, because it can still lose energy, and still have angular momentum. (Note that the ",
" don't settle into a disc, because stars don't lose their kinetic energy so well - same with dark matter. The reason the stars are in a disc in the Milky Way is that they formed from gas that was in a disc).",
"So, classically, a compact object that's got inflows from all over the place should still end up with a nice accretion disc.",
"However, with black holes we do have also have a \"frame-dragging\" effect, where a rotating black hole can drag around the nearby gas. Inflows can produce a disc that ",
" have the same rotation axis as the black hole, and this means that the black hole and the disc are applying a torque (a rotational force) on each other - the accretion disc can change the spin of the black hole, as well as the black hole changing the spin of the disc. This can end up with the spins getting aligned, but you can also end up with a kind of resonance making them ",
" - i.e. they have the same axis of rotation, but the disc is spinning in the opposite direction to the black hole. It comes out more complex than you'd expect."
] |
[
"Thanks, that's a really good and detailed answer and you're right, I did forget about how angular momentum can add up and still end up forming a disc!"
] |
[
"I'd imagine frame dragging is a big part of it, but I don't actually know for sure. I do know, however, that it isn't universal, as the black hole at the center of PG211+143 does not have an accretion disk that is well aligned (except for the innermost portion)."
] |
[
"Novice Question: I often hear references to events, planets or phenomena occurring \"millions of light-years\" away. This confuses me - how is such a distance even measurable, and with that, wouldn't these events have been occurring millions of years ago and not currently?"
] |
[
false
] | null |
[
"You might read up on this:",
"http://en.wikipedia.org/wiki/Cosmic_distance_ladder",
"For nearby objects (stars in our part of the galaxy) we can measure distances directly using trigonometry. Think back to geometry class. Two angles and a length will allow you to calculate all the other measurements of a triangle. We know the size of the Earth's orbit. This is our length. At two different times of the year, measure the angle between the Earth and the distant star. You need very precise equipment to do it, but you can actually measure the difference in angles. This allows you to calculate the distance to all the nearby stars.",
"Beyond that, there's a whole host of techniques which you can read up on. Basically you look for \"standard candles.\" A standard candle is something that produces the same or nearly the same amount of light, regardless of where in the universe it occurs.",
"An example of this is a type Ia supernova. If a white dwarf is gathering mass from another source, say by feeding off a large red giant, it will get larger. However, the way white dwarves are supported, they are only stable up to 1.38 solar masses, the Chandrasekhar limit. After this, they experience runaway fusion and literally blow themselves apart in a massive explosion visible across the universe.",
"Ia supernova aren't the only or even the most violent events in the universe, but they're useful because of how identical they are. Each one explodes at right about the same mass. They are nearly identical. So, if you know how much energy something releases, what kind of light it will give off, you can determine it's absolute magnitude. We can measure how bright a 1a supernova is from Earth and determine it's distance through elementary calculation. ",
"There are many ways to measure cosmic distance. The 1a supernova is probably the easiest to understand."
] |
[
"No-one has touched the second part of your question, and it's a bit of a mind bender.",
"Only where you are at is 'now'. Anything you see that isn't immediately where you are appears as it was however long ago the light left it to travel to your eye. Your friend over there is at his own 'now' and you, as he sees you, are as you were a very short time ago.",
"Over short, walkable distances, the speed of light is effectively infinite so it makes very little difference. A few millionths of a second ago is usually pretty much the same as 'now'. (I'm deliberately ignoring the fact that nerve impulses travel more slowly than light, so everything we see and touch is as it was a significant fraction of a second in the past by the time we experience it.)",
"When it comes to even short astronomical distances, the differences add up. We see the Moon and feel the moon's gravity as it was and where it was just over a second ago. The sun is roughly 8 and a quarter minutes away by the same scale.",
"You've then got to decide \"Which now is now?\", after all, what we see and what we experience is 'now' even if those potential experiences have had to propagate to us through spacetime over seconds, minutes, millions of years, so even though light left distant galaxies millions of years ago, we can say that from our viewpoint, these things are happening 'now' because they're having an effect on us now. ",
"For example, if the Andromeda galaxy was to disappear at the moment I'm typing this, ignoring the lightspeed delay, nothing sentient or having mass in our galaxy would be any the wiser for a couple of million years, so even though it has ceased to exist, it still exists from the 'here and now' point of view because it appears to be there and everything behaves as if it does.",
"TL;DR The past is now."
] |
[
"The distances are measured through a ",
"variety of methods",
" such as ",
"parallax",
", or using certain objects as ",
"standard candles",
" and comparing luminosity.",
"And you're correct, when someone looks at something a million light years away and sees it happening ",
", the actual even took place a million years ago.",
"However, since that's an annoying correction to bring up every time you want to discuss cosmic events that you're currently looking at, and since most people that are going to be having said discussion understand this, it's usually find to refer to such things in the present tense."
] |
[
"Did epicanthic folds evolve separately in different parts of the planet or were they spread from a certain focal point?"
] |
[
false
] | null |
[
"I asked this question here because of the ridiculously low amount of information on the subject available on Wikipedia. Hopefully someone will provide a better elaborated response."
] |
[
"It pains me that I can't remember the source (a book tracing human migration through separate studies of nuclear and mitochondrial DNA), but I do remember reading that originally all homo sapiens had epicanthic folds, and a mutation in the population that eventually migrated to western Europe resulted in that group losing them. "
] |
[
"http://en.wikipedia.org/wiki/Epicanthic_fold#Evolutionary_origin"
] |
[
"If 1/4 of the world was blown away by nuclear explosion, could the other 3/4 of the world survive?"
] |
[
false
] | null |
[
"An explosion strong enough to eject 1/4th of the planet earth into space would kill everything on earth and turn the earth into molten rubble.",
"Remember that cataclysmic events like the asteroid that wiped out the dinosaurs were merely big enough to make a (by comparison to the earth small) dent into the earth."
] |
[
"Then let's take it down a notch. How large of an explosion do we need to move the earth out of rotation? If nuclear war broke out would that be a factor? Blowing the earth out of orbit? "
] |
[
"Not even close. The earth is incredibly heavy and while atomic bombs are powerful they are puny in comparison to the kinetic energy of the earth..."
] |
[
"If I was standing in one of Jupiter's moons, would I feel lighter when facing Jupiter?"
] |
[
false
] | null |
[
"Copying and pasting my answer from the last time this was asked:",
"There would be a difference in weight depending on where you are standing, but it's not quite like you think.",
"Jupiter's moons are in orbit around Jupiter, ",
"which means they are continuously in freefall in Jupiter's gravity, but because of their forward momentum they are constantly missing the planet and maintaining their distance.",
" ",
"If you are on a moon you are in a similar freefall motion around Jupiter as the moon, so you don't perceive most of Juptiter's gravity when you step on a scale. However because you are stuck to the surface of the moon away from its center, it may be pushing you a bit off of the orbit around Jupiter you would otherwise be taking, or Jupiter may be pulling you a different amount than the center of the moon. These effects will cause differences in the weight you feel standing on the moon depending on where you are on the moon relative to Jupiter.",
"This effect is called the ",
"\"tidal force\"",
", because it is exactly the same thing that causes the tides of Earth's oceans. The Earth and Moon are orbiting each other, but the oceans are held off at a distance from that ideal orbit so get sloshed around a bit as the Earth rotates relative to the Moon.",
"Now perhaps counterintuitively, you'll feel lighter not only when Jupiter is over your head, but also when you are on the opposite side of the moon! You'll feel heavier when you are near the poles above or below the moon's orbital plane. ",
"The perceived forces look like this.",
"Why is this? Free orbits are faster the closer they are to the body they're orbiting. If you are on the side of the moon facing Jupiter, you are in the ",
" of a smaller faster orbit than the moon's center of gravity, but you are stuck at the moon's slower ",
" of its higher orbit. Thus you aren't going fast enough to maintain your orbit around Jupiter and so \"should\" be falling closer to the planet, and feel like you're getting pulled off the moon's surface a little bit.",
"Similarly if you are on the far side, you are in the position of a larger orbit, but are moving too fast and feel like you are being flung off the moon.",
"If you are on the north pole you're going the right speed, but have an ",
"orbital inclination.",
" That is, because you're in a different orbital plane than the center of the moon, you should be weaving up and down relative to the moon once each orbit. The moon has to hold you up to prevent that from happening, so you feel heavier."
] |
[
"This is incorrect because the moon is in freefall around Jupiter. You have to take into account the tidal acceleration due to Jupiter, which is about 0.003 m/s",
" across Europa."
] |
[
"This is incorrect because the moon is in freefall around Jupiter. You have to take into account the tidal acceleration due to Jupiter, which is about 0.003 m/s",
" across Europa."
] |
[
"Question about antimatter..."
] |
[
false
] |
Say (hypothetically) that we could create stable anti-matter particles in mass quantities. Would it be possible to combine different anti-particles (anti-oxygen and anti-hydrogen for example) to create the anti-version of substances we commonly have on earth (like a kind of anti-water)? Also, if this is in anyway possible, how would the anti-substance behave differently when interacting with normal everyday matter? (Other than obliterating any of its positively charged counterparts it encounters, of course.) I saw this basic question posted as a comment in another thread and thought it deserved its own post since it's an interesting thought experiment... At least i think it is. It IS 3:45am and I'm 15 beers deep though so i may just be drunk and missing the obvious point. if so down vote me and disregard... tldr; Would the anti-version of common substances act any differently than their positive counterparts in a normal earth environment? is it even possible to combine anti-particles into structured arrangements and make anti-elements? Would it be possible in the foreseeable future?
|
[
"We could make a whole anti-you, just don't shake hands.",
"Though interestingly, this brings up the larger point of symmetry in the universe. Can you in fact make a mirror version of something (with everything being reversed) and still have it operate identically? Well ideally yes, but because of certain problems with observation, it seems that the universe does at a certain level favor one dichotomy over another.",
"One example is the absence what should have been a half antimatter universe, but instead we see a singularly matter dominated one which suggests that in some way antimatter does behave differently then normal matter in a way which is less stable. So the symmetry is only partial. ",
"I suggest you read Richard Feynman's The Character of Physical Law, one chapter really delves into what your asking."
] |
[
"Also, is there a physical definition of 'contact'? I mean, an electron can be a probability wave. I assume that is also true for the positron."
] |
[
"He would be killed by ",
" our air. Anti-air, on the other hand, no problem."
] |
[
"Why is the wheel damage on the Curiosity rover so bad compared to Opportunity?"
] |
[
false
] |
Recently in the news has been a subject of worry. I have yet to see a concise explanation as to why exactly the wheel damage is so bad compared to the 13 year old curiosity rover. Why is that, whats different between the two rovers or the two terrains?
|
[
"Oppurtunity weighs 174kg, while curiosity weighs 900kg. Also Oppurtunity top speed is 0.1miles/h while curiosity does 3.35miles/h. ",
"I have a feeling you are underestimating curiosity's size, check out these pictures ",
"https://marsmobile.jpl.nasa.gov/images/Evans_Mars_Yard.jpg"
] |
[
"I had no idea of their sizes. Fascinating. Thanks for the post."
] |
[
"Yeah, there's a Smarter Every Day video where Destin meets some of the Curiosity engineers and the full scale model they keep on Earth for reference. ",
"That was the first time I realised how bleeding huge it is and what an achievement it was to put something the size of a VW on another planet.",
"Edited, because I am obvious not a clever guy. Cheers ",
"/u/mogulermade"
] |
[
"My bottle of isopropyl alcohol has an expiration date. What is happening chemically that makes it \"expire\"?"
] |
[
false
] | null |
[
"It's possible they're worried about peroxide formation. Oxygen radical oxidation at the methyne position would lead to a peroxide hydrate, which would be in equilibrium with acetone and hydrogen peroxide. Any organic solvent + peroxide is considered a risk so they advocate periodic disposal. How serious this risk actually is, I have no idea, but autoxidation if alcohols isn't usually that fast. This might be a better safe than sorry scenario."
] |
[
"A pharmacist once told me it has more to do with legal requirements than actual scientific reasons "
] |
[
"Entirely possible. I'm a chemist by trade and our safety organization requires us to dispose of certain chemicals annually. I cannot for the life of me understand why half of them are on the list. Someone pulling a CYA makes sense."
] |
[
"Weird permanent thing in the sky?"
] |
[
false
] |
A few months ago, my dad and I were camping in the middle of nowhere in Queensland, Australia. There was no major light pollution for at least 60 kilometres, so we could see a lot of the stars and astronomical stuff. Around 9 pm, we were sitting there looking at it all, and I noticed a cloud; nothing strange, so I took no notice of it. It was a moderately windy night, so when I looked back at it 20 minutes later and it hasn't moved, I was naturally curious. I asked him if it was one of those huge masses of gas in space, and he said it probably wasn't, and he wasn't exactly sure what it was. He did a lot of science and mathematics in university, so I trusted him. I am also relatively knowledgeable in physics (brag), but I couldn't think of what it could be. I forgot about it, and then we went to bed (tent?) at 11 pm-ish. At 3 am, I got up to go pee, and it was in the exact same spot as when I saw it hours ago, even though the rest of the starts and gas masses had shifted around. At that point I realised that it had to be in our atmosphere, or spinning with the earth at least, because it hadn't moved. It also definitely couldn't have been a cloud or anything physically light because at that time it was insanely windy at sea level, so I couldn't imagine what it would be like that far up. Still now, months later, I have no idea what it could have been. Does anyone in the entire community have an idea? It's been killing me ever since I saw it.
|
[
"Probably the Large Magellanic Cloud. There are two dwarf galaxies visible from the Southern Hemisphere - the Large and Small Magellanic Clouds. You can see the Large Magellanic Cloud quite well from any reasonably dark area - I can see it from my parent's house on the outskirts of Tauranga - but the Small Magellanic Cloud is a bit trickier to see.",
"They do stay in ",
" the same spot in the sky. The sky rotates around the \"southern celestial pole\", which is the extension of the southern pole into the sky. The Magellanic Clouds are close to the southern celestial pole, so if you're far enough south, they just go in circles in the sky, and never cross the horizon. They'll always be roughly south.",
"Were you in southern Queensland, i.e. near Brisbane? The further south you are, the easier they are to see. Australia does extend far enough north that the northern regions will see the Magellanic Clouds cross the horizon. The further south you are, the higher they'll be."
] |
[
"whatever it was that OP saw, it didn't move with the background of stars",
"Both the Large and Small Magellanic Clouds are located at -70° declination, meaning they're very close to the Southern Celestial Pole, which doesn't move at all over the course of the night. ",
"Even after 6 hours, the Large Magellanic Cloud would still be hanging out low in the Southern Sky. It would have moved barely at all compared to stars across the rest of the sky.",
"I can also verify that I was fooled for a minute into thinking the Magellanic Clouds were just clouds the first time I went camping in New Zealand, and I know the night sky extremely well."
] |
[
"You can see them near the horizon in the lower latitudes of the northern hemisphere.",
"The Earth's axis of rotation doesn't really change over a year (it does slowly change over a ",
"longer period",
" though), so if you're on the northern side of the planet, then the Earth is always between you and some portion of the southern sky."
] |
[
"Modeling the Zombie Apocalypse: AKA Help me with Differential Equations"
] |
[
false
] |
Hello everybody, For a project I am presenting a simple model of a zombie infectious disease. I am modeling it somewhat like a chemical equation, so that the rate of infection is proportional to the population of zombies and the population of humans. Note that L, Z, and D represent the living, zombie, and dead population. Hopefully everything else is explained by my notes, but don't hesitate to ask me any questions. I am having difficulty figuring out how to solve these equations explicitly for Z and L in terms of time. Do I need to simplify my model, or is there a way to solve this that I am not aware of. Thanks a lot :D
|
[
"Assuming a, b, c, d and j are all constants (that is they aren't functions of time), and L, Z, and D = L(t), Z(t), and D(t) respectively, you have a system of coupled first order ordinary differential equations. You have three equations, and three unknowns. Solve them the same way you would solve any algebraic system: substitute equations, add/subtract them, and isolate your variables. Matrices might help you out. I would just do it numerically, using Python or Matlab.",
"Here is some more info on ODE systems.",
"\n",
"http://tutorial.math.lamar.edu/Classes/DE/SystemsDE.aspx",
" ",
"Also, maybe this is just the physicist in me, but time derivatives are typically represented by dots, while spacial derivatives are represented by primes.",
"EDIT: This is a non-linear system, since you have cross terms (z*L). You will most likely have to solve this numerically.",
"EDIT 2: I'm going to work this out via computer. I'll let you know what your model looks like.",
"EDIT 3: I tried your model and I could not get results. Either I don't understand it correctly or there are some flaws. Maybe you can better explain the parameters to me? However, I did find another model online (Munz 2009) and worked it out in Python. Basically, you assume there is an outbreak and that some small percentage of people that die naturally resurrect as zombies. You also have as parameters the chance of transmission (alive people become zombies), chance of zombies/people being killed, and the birth rate. Also, no matter how one dies, they still have a chance to resurrect as a zombie. Once you get one zombie, the situation rapidly deteriorates, and the zombies soon take over (in a matter of days).",
"For a small town, with a population of 500 people, here are my results:\n",
"http://imgur.com/a/IcrQ0",
"Even a huge 10 daily births can't fend off the Zombies!"
] |
[
"I haven't tried solving anything but:",
"1) What function does carrying around the D have? It doesn't further constrain the first two equations, you have no constraints on it, etc. I think you're better off just dropping that variable. ",
"2) This whole things simplifies to:",
"L' = aL + bLZ",
"Z' = cZ + dLZ",
"It's not linear (annoyingly) but I think there's an actual algebraic solution. I'll try looking it up over the weekend if some other expert doesn't do it first.",
"3) The character of these curves is going to depend a LOT on the variables, do you have some starting values to help with numerical modeling?"
] |
[
"jepzilla is correct that it models as a Lotka-Volterra equation.",
"Bear in mind that there are a few trivial equilibrium solutions to your series of equations (letters refer to your variables):",
"If b > a (that is human death rate is higher than human birth rate) then you'll end up with effective total extinction (humans die first, zombies decay after). (alpha is < 0 in the classic model)",
"If c < d (that is zombies are killed by survivors faster than they can make new zombies) then the survivors will win. (delta is < 0 in the classic model.)",
"If j ~ 0 (zombies decay too slowly) you end up with the problem where the zombies will effectively wipe out all the humans before their population starts to decrease. While in theory the human population will rebound once all the zombies are almost gone, humans aren't infinitely differentiable. (If j = 0, you'll be back at the extinction fixed point)."
] |
[
"Does a material's ability to transmit electricity correlate to it's ability to conduct heat?"
] |
[
false
] |
I guess I was thinking of metal as an example, it seems to do both well. I bet there are examples where one material can only do one or the other but is it more likely that if a material can conduct one it can also conduct the other?
|
[
"They are different properties. However, you are correct that in metals, the thermal and electric conductivities tend to track well together. That is because in metals both heat and electricity are carried through valence electrons. (see Wiedemann-Franz Law)",
"This does not hold in other materials. For example, diamond is a famous example an electric insulator but has very good thermal conduction properties. Materials with good electric conductivity but poor thermal conductivity are much harder to find. You could argue that some superconductors fit this, since the electrical conductivity is infinite, but the thermal conductivity is not."
] |
[
"Thanks for clearing that up! "
] |
[
"Not always."
] |
[
"How much of the brain can be damaged / Which damaged parts reduce what functionality? Based on the awesome scenario of a brain-eating worm!"
] |
[
false
] | null |
[
"This question is too broad. There are many kinds of disorders that can arise as a result of brain damage. I recommend doing some background reading and coming back with a more specific question."
] |
[
"I mean, I'm happy to have some credible guidance to papers or similar on what can happen if specific parts of the brain get damaged...? Do I have to ask for a specific part of the brain so it isn't too broad?"
] |
[
"Here are some examples of disorders: visual agnosia, prosopagnosia, optic ataxia, spatial neglect, simultagnosia/ Balint's syndrome, achromatopsia, cortical blindness (and blindsight), amnesia, inability to form new memories, motor deficits, deficits in emotional processing, flat affect, effects on personality, language disorders such as various forms of aphasia, coma and vegetative state, compulsive lying as a result of alcoholism (Korsakoff's syndrome), etc. etc. All of these are results of damage to different brain areas."
] |
[
"Do electric cars use electrical energy from the battery more efficiently than gasoline/diesel cars use heat energy from their fuel?"
] |
[
false
] |
Simple question: In terms of total Joules of energy transmitted to the crankshaft (...or whatever electric cars connect to the drivetrain), which is the most efficient, strictly speaking?
|
[
"Yes. By a very large margin.",
"A heat engine like a gas engine converts between 20-30% of its thermal energy into kinetic motion at the crankshaft.",
"An electrical motor can convert over 90% of the energy within a battery into kinetic motion given the right motor sizing.",
"So if we have 1000KJ within a battery vs 1000KJ within a gas tank the Electric motor will allow the car use much more of that energy, and waste much less heat than a gas engine."
] |
[
"The problem here is that heat engines can be made much more efficient than 20 to 30% but only if they are specifically designed to operate at a very constant and specific velocity. So if you use one of those to generate electricity, you can get heat engines to be more efficient. A friend of mine did a quick back of the envelope calculation once that showed that heat engines efficiency plus the efficiency of electric motors can still be greater than a car. "
] |
[
"The problem here is that heat engines can be made much more efficient than 20 to 30% but only if they are specifically designed to operate at a very constant and specific velocity. So if you use one of those to generate electricity, you can get heat engines to be more efficient. A friend of mine did a quick back of the envelope calculation once that showed that heat engines efficiency plus the efficiency of electric motors can still be greater than a car. "
] |
[
"Why is the benchmark for fevers 37.5 degree celsius?"
] |
[
false
] |
Typically, a fever of above 37.5 degrees is considered a red flag. Is this experimentally derived, or merely arbitrary? Is there anything that prevents another number from being the standard?
|
[
"We consider medically significant fevers to be >38 degrees Celsius. This, like normal values for any vital sign or blood test, was arrived at by taking (presumptively) healthy people and seeing what range 95% of them have as values.",
"When we set abnormal values, we try to find the right balance between not missing people with truly abnormal values and picking up too many people with normal variants.",
"In other words, if we set the fever number to be 37.6, we would probably catch most people who truly have an infection, but we would suspect infection in a lot of people who were healthy. ",
"If we set thefever threshold to 38.6, we would probably only catch people who were infected, but we would miss a lot of people who had an infection with a lower temperature.",
"38 degrees seems to strike the right balance between not suspecting infection in everybody and not missing little who were infected."
] |
[
"As far as I know, the temperature of fever is not absolute, but is empirically determined to be around 37.5 - 38.3 degrees (also depending on where you measure the temperature). There are evidence that a higher temperature increases the speed of the immune system response.",
"Regarding denaturation, I am under the impression that the steepest increase in denaturation happens around 50 - 60 degrees depending on the protein \"melting point\": ",
"http://www1.lsbu.ac.uk/water/images/ecoli.gif"
] |
[
"Body temperature, 96.6F or 37C, was originally determined by Dr. Carl Wunderlich in the mid 1800’s. Unfortunately, his study, which involved 25,000 patients at the time, utilized a poorly designed thermometer and therefore this whole idea that 37 is normal is rather flawed. ",
"I would highly recommend listening to the Freakonomics show that covered this as part of their “bad medicine” series. Very interesting.",
"http://freakonomics.com/podcast/bad-medicine-part-1-story-98-6/"
] |
[
"Can we make small, lab-sized, analyzable nuclear explosions?"
] |
[
false
] | null |
[
"Depends on the size of the lab?",
"But for a \"classical\" nuclear explosion to occour you need a \"critical mass\".",
"This the minimum mass of nuclear material that can go critical (explode). Assuming you're not using any special technology to encourage criticality other than high explosives like in a classical nuclear bomb; then no you can not create a \"lab\" sized nuclear explosion unless you count something like the Nevada testing Fields as a lab.",
"However most nuclear physics and experiments even those related to nuclear bombs do not require a full explosion for testing. You can test aspects in reactors, Lazer ignition facilities, and simulators with out the boom"
] |
[
"Very small note. Nuclear explosions need to be super critical to go off. If the pile is critical it will run away and melt down. Both are real bad for anyone in the near vicinity, but the super critical requirement is why fission bombs need all that high explosive to compress the mass fast enough to pass through critical into super critical.",
"I'm sourcing this info from 'The Making of the Atomic Bomb' by Richard Rhodes."
] |
[
"Technically, they have to be in a state called \"prompt-supercritical\" to go off, which is why the explosive is necessary.\nSupercritical reactions are the ones that run away and melt down.\nCritical reactions mean they are \"stable\" (the amount of energy they are producing doesn't change with respect to time). Otherwise you are correct. ",
"Making of the atomic bomb is a great book btw!"
] |
[
"Are there a lot of gasses floating around in outerspace? Which ones, and in what quantities?"
] |
[
false
] |
Basically I am curious as to what actually makes up "space". I have a hard time fathoming the idea of there being a such thing as "nothing". Also what happens when oxygen is sucked out of a spaceship, like can you make concentrated "community" of gas in space? This was originally posted here:
|
[
"Careful, the concentrations of other gases and elements are not only measurable, but routinely measured through absorption lines of starlight or other sources of light that pass through these clouds of gas, getting preferentially absorbed at certain frequencies that correspond to atomic transitions of these elements and molecules."
] |
[
"Mostly it is interstellar dust. See ",
"here",
" for a great introduction to this topic."
] |
[
"A side question:",
"When you speak about near-lightspeed velocities, one of the dangers of space travel is that if you run into something like a micro asteroid or something, you would be obliterated. Is this a hazard when speaking about single hydrogen atoms in this context? Their mass is not exactly great but if you're traveling near c..."
] |
[
"If isotopes like uranium undergo alpha-decay (which can be easily shielded), why are nuclear disasters like the one in Chernobyl so insanely hazardous?"
] |
[
false
] |
Is it because of the air maybe? Or is there beta radiation involved as well?
|
[
"Uranium, on its own, isn't that dangerous. It's a fairly weak alpha emitter, and its daughter products give off some (but not much) gamma/beta radiation. You could stand next to a fresh uranium fuel bundle, and not be in any danger. But as the fuel spends time in the reactor, other things are formed.",
"When uranium splits, it forms two new atoms - fission products. And due to the nature of nuclear stability, these fission products tend to be highly radioactive (with short half-lives). So inside a reactor, you have the buildup of things like cesium-137, iodine-131, or strontium-90, which all decay by beta/gamma emission and can pose a danger to people in high enough quantities."
] |
[
"One of the biggest problems is gamma radiation. Many nuclear reactions are going to release some kind of gamma ray energy in addition to alpha or beta emission. And Gamma rays are this side of impossible to shield, essentially just requiring a lot of mass between you and the source. (like lead or thick concrete or lots of water)"
] |
[
"Alpha radiation is only dangerous if a source is inside the body where there is no layer of dead cells (skin) for protection.",
"In fact, it is much more highly-ionising than beta or gamma radiation, which makes it the most dangerous of the three if ingested or inhaled"
] |
[
"Why don't normal wires do a good job of conducting high frequency signals?"
] |
[
false
] |
As signal frequency increases, normal wires no longer do the trick. You need coax cables, and eventually a waveguide or an optical fiber. I'm assuming this is because normal conductors would begin to act as antennas and radiate EM waves rather than conducting electricity? What is the intuitive explanation for why this happens?
|
[
"You have to think of it as a transmission line, a distributed inductance/capacitance network. For a plain wire in air, where is the capacitance? It's zero. So the transmission line degrades to an inductor. Inductors become higher impedance at higher frequencies. ",
"Investigating what the best impedance for max power transfer and lowest loss is useful - it's been a long time since I did that math."
] |
[
"RF engineer checking in here.",
"A really intuitive answer is a little difficult to come by, unfortunately. We can say though, that you need to replace (simpler) circuit theory with (more complete) EM wave theory once the dimensions of your structure approach the wavelength of your signal. Circuit theory really is just a simplification of Maxwell's equations, but in high-frequency regimes, the assumptions used to generate circuit theory aren't valid anymore. A common rule of thumb is that when your transmission structure is 1/10 of your signal's wavelength or more, you should use a transmission line or waveguide analysis.",
"A simple pair of wires might still be acceptable for higher frequency (check out ",
"twin-lead",
" transmission lines), but that's going to depend on your signal and the circuitry it's connecting. I'll explain:",
"At high frequencies, your transmission line (wires, coax, waveguide) will have a \"characteristic impedance\", and its ability to accept power from a source and transfer it to a load will depend on the relationship between the transmission line's impedance and that of the source/load. Ideally, everything has the same impedance, and then you'll get 100% power transfer (assuming no conductive or dielectric losses).",
"This is kind of a complicated subject, so I tried to start with a basic answer. I'm happy to answer more specific questions if you have them!"
] |
[
"A plain wire in air actually will have a nonzero capacitance, just like the isolated sphere in the example ",
"here",
". It can hold a charge, and if you integrate the electric field all the way from infinity (where you assume it is zero), you can compute the voltage. That gives you C = Q/V.",
"Not that it would be a good transmission line- it would probably resemble an antenna more than anything."
] |
[
"How unique are individual animals of the same species?"
] |
[
false
] |
There are 7 billion homo sapiens, and each one is fairly unique in genotype and phenotype (excluding twins). There is also a great variety amongst humans that is not typically found in other species. But why aren't other animals as individually unique? And what advantage did it give humans to be so?
|
[
"There is also a great variety amongst humans that is not typically found in other species.",
"That's just because you don't notice the difference in other species as much as you do in humans. It's \"all Asians look the same\" syndrome."
] |
[
"I'd imagine if you were the member of another species of animal you'd see much greater range in phenotype. Many, many species of animal are extremely choosy about who they mate with. Think of peahens and birds of paradise. They notice any minute flaw in a male and will refuse to mate with him. ",
"Also, think about dogs. I know we've domesticated them and they've been subject to artificial selection, but dog species vary widely in appearance and demeanor and many of them are still closely enough related that they can produce viable offspring. "
] |
[
"Other animals probably are just as individually unique, it's just we notice differences in humans because that's the way our brain has evolved. We we specialized circuits that analyze human features in faces and the such.",
"Humans I believe are actually much less genetically variable that most other animals since we are all derived from a small population of early humans after a bottleneck event. We have a single nucleotide polymorphism only once every 1000 base pairs (which is why you see figures like 99.9% identity between humans), and I've been led to believe that the majority of other animals have a great degree of variation, although I can't name a source or remember numbers right now."
] |
[
"Does our Universe have infinite mass?"
] |
[
false
] |
I have seen comments and questions on AskScience about the Universe being infinite. When I think of the Universe as infinite, I think of infinite stars, solar systems, planets, etc. Is this what scientists think? That our Universe has an infinite amount of stars, solar systems, galaxies, and planets?
|
[
"If our current cosmological models are correct and the universe is infinite, then the quantity of massive objects in the universe will be infinite. Whether or not this is actually the case remains an open question."
] |
[
"Does this mean it's impossible (under our current cosmological models) for a spatially-infinite universe to exist that only contains a finite amount of mass? If so, what prevents this possibility?"
] |
[
"Our current models are predicated on the assumptions of homogeneity (the universe is roughly the same everywhere) and isotropy (the universe is roughly the same in all directions). Homogeneity requires that the mass-density of the universe be roughly constant. Since the mass density of the observable universe is positive, homogeneity therefore requires that the mass density ",
" be positive, with, perhaps, some isolated small regions where it's zero. Thus, if the universe is infinite and homogeneous, then it must contain infinite mass. If it contained only a finite mass, then you could go out far enough from us and find a point beyond which there was no more mass, which would contradict homogeneity.",
"Now, granted, we can't be sure the universe actually ",
" homogeneous. But the ",
" universe is largely homogeneous, and everything we've been able to determine about our universe is that we're no-where special. So we ",
", until contrary evidence is provided, that the universe is homogeneous overall."
] |
[
"If i had a rope on an intergalactic scale, would the rope break due to the metric expansion of the universe?"
] |
[
false
] |
So, we know the universe is expanding due to the metric expansion of the universe. On small scales, the expansion is so small that we don't notice it: all the forces we are used to (gravitation, the electrical force of chemical bonds, ect) "compensate" for the minute changes. Lets say I have a rope or pole that is impossibly long, my intergalactic rope. The rope at any point would not see its neighboring sections moving away, so it would seem that the instantaneous strain on the rope should be pretty small. But over all, the rope cannot maintain the same length without the ends moving towards the center. So here are my questions:
|
[
"It depends on where the ends of the rope are. If it's out in free space in a flat gravitational potential, it won't experience any expansion force, because it will just be held together.",
"However, if the ends of the rope are, say, in the gravity wells of two receding galaxies, the ends of the rope will be pulled apart and it will eventually either snap or get pulled out of the gravity wells. More likely snap."
] |
[
"The metric expansion of space should make it so the two astronauts are moving away from each other and from the center of the rope.",
"Is this rope in a gravity well? Are the astronauts holding onto it?",
"If the rope is held together, then the astronaut should see the rope fly away from them, while experiencing a velocity of 0.",
"Yep, assuming their using their own inertial reference frame to record these observations.",
"If the length of the rope to the center is above 4.5 parsecs, than the end of the rope would appear to move at the speed of light, which is impossible...",
"If by 4.5 parsecs you mean 14 gigalightyears, then yes, the other end of the rope would be receding at the speed of light, which means that the ",
"."
] |
[
"Sorry, i meant 4.5 GParsecs :-P. Maybe I'm thinking about this wrong, but if the astronaut is 1 m from the end of the rope, but the center of the rope is at 4.5 GParsecs, then the center should appear (or as you aptly pointed out, not appear) to be moving that fast without breaking the \"cosmic speed limit\" because space is growing that fast, but the piece of the rope near the astronaut (1 m at t=0) should not.",
"(Thank you so much for your responses, btw...I know us people that only think about this stuff for fun must be very frustrating sometimes). Did you see my question about the ends of the rope forming their own gravity wells because they are being pulled at high speeds towards the center of the rope? My current guess is that the rope would tear itself apart before it got longer than 9 GParsecs, preventing the impossible state from ever happening."
] |
[
"Hot days feel hotter if they are humid, but a damp cold feels colder than a dry cold. At what temperature in the middle do wet and dry days feel exactly the same?"
] |
[
false
] | null |
[
"This isn’t really an equilibrium thing it has more to do with conductivity. Wet air is essentially a mixture of dry air and water, and water has more thermal capacity and is a better conductor than dry air. So the wetter the air the better it will conduct the air temperature to your body. There is also the interaction of humidity and your sweat evaporating that makes wet heat feel hotter. It’s more like how hot metal will feel hotter than air at the same temperature and cold metal will also feel colder than air at the same temperature."
] |
[
"Why do damp colds feel colder? Is it because the air is damper or more likely its because your clothing is damper after sweating/precipitation ?",
"depending on your clothing, (e.g. wool) damp clothing could feel about the same as dry clothing, unlike cotton, that feels much colder when wet.",
"In the spirit of the question, at what temperature would a relative humidity (RH) of 100% feel the same as an RH of 0% to bare skin ? When the difference in temperature is imperciptible, which is at about a change of 1C over a long period. Based off a psychometric chart, the relative humidity at 100% vs 0% with a difference of 1C occurs around -20C ."
] |
[
"This isn’t really an equilibrium thing it has more to do with conductivity.",
"This will confuse others. The predominant method of heat transfer depends entirely on the specifics of RH and the difference in temperature. With an air temp near body temp there'd be minimal conductive heat transfer and basically only evaporative cooling. ",
"Also water vapour in air only starts to outweigh the thermal conductivity of the air itself when it reaches above 50 grams / kg (since water is about 20x more conductive than air). Well above any point you'd encounter in normal climates and really only present in a sauna or steam room."
] |
[
"In the liver, if blood from the sinusoids can enter the central vein, why doesn't the blood just constantly bleed out of it too?"
] |
[
false
] | null |
[
"There are different types of liver failure but I assume you are talking about chronic liver damage leading to cirrhosis. ",
"When a healthy liver undergoes prolonged damage (alcohol, hepatitis C, autoimmune disorders, iron) the cells are eventually replaced by scarring as they die off. This causes difficulty for the blood to filter through the liver thus increasing back-pressure in the portal venous system (the venous system going from the GI to the liver) which is separate from the systemic system. The portal hypertension engorges veins in the stomach and esophagus which greatly increases their risk of bursting and bleeding.",
"On top of the mechanical pressure, the liver is also responsible for synthesizing many proteins including clotting factors and thrombopoetin (stimulates platelets). Loss of these proteins from cellular damage also greatly increases general bleeding risk. ",
"People who have cirrhosis from alcohol consumption also generally have damage to their GI system from alcohol itself increasing bleeding risk. "
] |
[
"Different answers. Blood in veins ",
" go both directions, they are not driven by cardiac pressure from your heart beat. The movement is passive, driven by muscle contraction. But the veins have one way valves that prevent extensive back flow. Once they pass these valves, they cannot go back. So the net flow is forward towards your heart. ",
"In the intestines, nutrients are actively taken up by molecular pumps that only work in one direction. "
] |
[
"Thanks for the answer. When a person's liver fails and they have bleeding into the gut, is that because the \"valve\" process stops working?"
] |
[
"Why does the Fluorine anion in toothpaste strengthen tooth enamel (Hydroxyl apatite) but the Fluorine anion in hydrofluoric acid hate the human skeleton (also hydroxyl apatite)?"
] |
[
false
] |
Is it just a concentration issue? Is this a question wrongly asked? related: apatite mineral (in rocks) Ca5(PO4)3(F,Cl,OH) hydroxyl apatite: Ca5(PO4)3(OH) carbonated hydroxyl apatite (bone and teeth)
|
[
"hydrofluoric acid is an acid (pKa = 3.14) with high tissue penetrance. Acidity (availability of hydrogen / hydronium ions) leads to decomposition of the hydroxyl apatite crystals, which is a concept physiologically employed during bone resorption (osteoclasts secrete hydronium ions to attack the mineral structure, which leads to a release in calcium and phosphate ions). Additionally, all other side effects of local acidity in tissue occur.",
"Tooth paste contains fluoride salts which are practically non-acidic, so they are not inherently destructive towards hydroxyl apatite. The fluoride ions from the fluoride salts get integrated into the apatite mineral structure to form fluoride apatite. However, ingestion and/or resorption of higher amounts of fluoride ions (way too low amounts in tooth paste or drinking water, but sufficient amounts in case of hydrofluoric acid toxification) leads to disturbances in calcium and magnesium metabolism because of inhibition of crucial enzymes as well as disturbances in the central nervous system.",
"EDIT: What I forgot to mention is that fluoride ions in sufficient concentrations will form insoluble salts with calcium ions, which is even more apparent in case of hydrofluoric acid because of the relatively low pKa and the fact that calcium ions get released from bone tissue in higher acidity. This is also the reason why hydrofluoric acid is so corrosive towards biological tissue - virtually all cells in your body depend on calcium ion signaling and the forming salt crystals are mechanically destructive towards cells as well. I also suspect that the acidity influences the insolubleness of these salts."
] |
[
"HF is lipid (fat) soluble. This means it freely diffuses into the body, and into cells (i.e. though cell membranes). Fluorine then goes to work doing what it does (insert nasty picture here). Paradoxically HF being a weak acid actually makes it much more destructive than it would be if it were a strong acid. When HF is mixed with water it dissociates into F- and H+. If it were a strong acid this would happen to every molecule of HF. The produced ions, F- and H+, can't easily pass though lipid membranes, such as the one found in your skin or surrounding your cells, so damage would be a localized burn (this is what happens when you spill sulfuric acid on yourself). Unfortunately HF is a weak acid and only a small amount of HF actually breaks down, the rest remains as HF (technically they are at equilibrium). HF, being lipid soluble, easily passes though your skin and cell membranes, wherein it can dissociate to make F-, which starts impairing any process involving calcium. important process it impairs is nerve action, so many people don't actually realize (no working nerves = no pain) they've been exposed until it's too late to apply effective treatment. I've heard stories of people working with HF where the first symptoms arise 4-8 hours later. One was of a guy waking up in the middle of the night with \"melted\" fingers. ",
"Comparatively fluorine salts, NaF for instance, are not lipid soluble. This means it will not freely enter the body/cells and will not cause the same damage that HF does. Why isn't NaF lipid soluble you ask? In reality NaF won't exist in a water based solution (i.e. in your toothpaste or your mouth). When mixed with water NaF breaks apart into Na+ and F-, ions that cannot move easily though a cell membrane. Too much F- from NaF is still bad (see: rickets), but nowhere near as destructive as HF.",
"I may have gone a bit off topic. Too sum things up in regards to your question. NaF doesn't penetrate that far into the enamel, and the Ca2+ is in a solid, stable, form. The F- just binds to the solid surface and doesn't do much else. HF will penetrate to the bone, where, by its acidic nature, it will actively degrade the bone, sequestering the produced Ca2+. It will also penetrate into the bone, killing the osteroblast/osteocytes/ect responsible for bone health. Essentially you both loose bone mass, and kill the bone repair and patience system."
] |
[
"It IS possible to overdose on toothpaste, and become poisoned by the fluoride. Typically this occurs in children. "
] |
[
"If a blind person were to consume a hallucinogenic drug, would they get visual hallucinations?"
] |
[
false
] |
I also ask this for any lack of a sense. Would the Synesthesia hear sounds/see colors still apply for one who is deaf? or blind? If one became blind in life, having been able to see before, would they get visuals? (I am asking with LSD in mind, but any other hallucinogen is still in question)
|
[
"Depends on how long they were blind",
". People blind from birth didn't see anything, people who had lost their vision later in life did. "
] |
[
"If you've ever taken LSD you wouldnt ask that question. Psychedelics arent all about the visuals, they help you \"see\" things from a different perspective. Audio gets affected also depending on the dosage. Truth be told there is no real way of knowing what someone else will feel, my hypothetical question is do people all see colour the same way? Is my red your green?"
] |
[
"so if there were no visual illusions, how would the LSD affect them?"
] |
[
"What was the most intelligent Dinosaur and how intelligent was it?"
] |
[
false
] | null |
[
"How would it even be possible to come to a valid conclusion on this? "
] |
[
"I'd say that the ",
"New Caledonian Crow",
" is probably the smartest dinosaur."
] |
[
"I'm not sure that would be the correct way to look at it, the Crow is pretty damn smart."
] |
[
"When I hear that computers will exceed the computing power of the human mind, what exactly does that mean?"
] |
[
false
] |
I'm only confused by this because computers quite obviously aren't and won't soon be capable of human level sentience.
|
[
"When people refer to computing power, they are referring to the ",
"number of operations or calculations per second",
". When they say that computers will exceed the computing power of the brain, they mean to say that a computer will be able to more in a single second than we can.",
"This point has already been reached in many situations, such as basic math. A calculator will be able to do any function you give it (generally) faster than a person could. "
] |
[
"It's quite wishy-washy. The important thing to keep in mind is we don't understand how the human brain works yet, so people assume that the brain computes in a way that is roughly analogous to a parallel computer. But this is completely unknown, there is no known way to use a brain as a computer. For all we know a single neuron take an entire computer to match (I've read theories along this line, but they seem extreme).",
"Here's a ",
"relevant wikipedia link",
"An estimate of the brain's processing power, based on a simple switch model for neuron activity, is around 1014 (100 trillion) neuron updates per second.[34] Kurzweil looks at various estimates for the hardware required to equal the human brain and adopts a figure of 1016 computations per second (cps).[35] He uses this figure to predict the necessary hardware will be available sometime between 2015 and 2025, if the current exponential growth in computer power continues."
] |
[
"According to Moore's law, computing power doubles every 18 months. This \"curve\" is said to be changing as some people speculate that computers would never be \"smarter\" than humans. In regards to your question, people think computers will be so powerful they will be able to learn and adapt faster than humans sparking the \"robots taking over the world\" theories and conspiracies. "
] |
[
"Why do computers get slower over time?"
] |
[
false
] |
I've always wondered this, and wanted a good answer. So, why is it that a brand new computer will outperform an older one with the same specs? Does it have to do with memory?
|
[
"So, why is it that a brand new computer will outperform an older one with the same specs? Does it have to do with memory?",
"If they truly have the same specs and the same software installed in the same way, then there will be no difference. I do find it a bit odd that you would replace an older computer with an equivalent one, since the price per performance for computers is steadily dropping. There are some seemingly trivial hardware changes, such as a solid state hard drive instead of a standard magnetic disk, that can have dramatic performance differences.",
"I'm not quite sure to what you are referring with 'memory'. Hard drive data fragmentation could be an issue that slows a computer down. If a computer has been in use for a while, the copying and deletion of data can eventually force the computer to store data less sequentially, but I somewhat doubt that this effect would entirely account for the slowdown you are referring. Unless your hard drive is or was rather full, this shouldn't be a major factor and is easily fixable by using a defragmentation tool.",
"Another possible factor is background programs and spyware. As you install software onto your computer, there is sometimes a component that is constantly running in the background even if the program isn't open. Individually, this program is insignificant, but after a few years of software, they can build up and together will noticeably slow the computer down. A fresh computer lacks these, and thus will run faster. I believe that this is most likely what you are seeing."
] |
[
"Furthermore, as a corollary to his first point: software is updated as if your computer is getting faster. As you continue to upgrade your software on a constant computer, your computer appears to be getting slower."
] |
[
"Filesystems tend to get somewhat sloppy over time; reading/writing/overwriting/moving/performing any other operation on a filesystem tends to increase fragmentation as well as filesystem inconsistencies and errors. Operating systems also tend to get bogged down with each new application you install as many software packages nowadays like installing background services, setting them up by default to start on boot as opposed to when needed by their respective software. Whenever you uninstall software often you will be left with some leftover configuration files or linked libraries (for example DLLs for windows, .so for Linux, etc). Linked libraries are always in the OS PATH and as such always end up getting loaded which increases boot time and once running means you have stuff loaded into memory than you just don't need. These are mostly software issues. Hardware can also fail. Bad sectors on the hard drive can increase the drive's seek time leading to slower performance. Leaking/bulging/deteriorating capacitors on your motherboard and/or addon cards can cause a myriad of issues including mysterious slowness but not complete failure. Dust buildup in CPU heatsinks/fans can increase operating temperature enough for the CPU to throttle it's speed down to avoid overheating. This also applies to modern video cards with massive heatsinks.",
"Source: I've been working college IT for over 5 years now."
] |
[
"When does interbreeding fail? Can a human's sperm enter and fertilize a goat's egg? Will something start to grow, and die soon after, or will it not even get that far?"
] |
[
false
] | null |
[
"Interbreeding fails when organisms are sufficiently different, the more closely related they are, the better chance they have. Typically the organisms have to be within 2 chromosomes of each other in terms of total chromosome count. Humans have 46 chromosomes, goats have 60. Also, if the animals are of different genera it is quite unlikely that they will interbreed successfully. Goats are most closely related to sheep, and sheep only have ",
"54 chromosomes, and are a different genus. Hybrids of these are stillborn usually.",
"The degree to which a potential offspring can grow in utero is quite different depending on how related the animals are. Some will be stillborn, others won't be able to conceive at all (such as humans and goats). There is no real way to broadly generalize the level of potential development.",
"Edit: lost a word."
] |
[
"http://en.wikipedia.org/wiki/Humanzee",
"There's speculation that there's no definite barrier to the idea, and I only know of one example of any human beings making an attempt. Ilya Ivanovich Ivanov supposedly employed at least one woman in an attempt to inseminate her artificially with ape sperm.",
"Unfortunately, or fortunately, as it were, there's very little information on the subject. It may have been propaganda to discredit the doctor, or it may have been buried in order to save face for numerous involved parties.",
"At best, I think we could consider this to be an irregular myth perhaps with some tidbits of truth mixed in.",
"Still, the possibility, however unethical, certainly is fascinating.",
"One thing to note, however, is that human beings have ",
" than other extant apes, owing to a mutation that fused the 2nd and 4th ape chromosomes into one large human chromosome. Usually, though, hybridization tends to be possible with animals of a similar genetic structure, and within 1-2 chromosomes of one another, as patchgrabber mentioned.",
"Again, it's not impossible, but the best way to answer that question is simply: we don't know. All we do know, is that currently, the human genepool is a product of at least three speculated hybridizations with other species of hominid, so at the very least, we are already a hybrid species."
] |
[
"Do we know what would happen with a human/chimp interbreed ? "
] |
[
"Apple seeds contain Amygdalin, a substance that can lead to cyanide poisoning."
] |
[
false
] |
Does anyone know how poisonous it is and how many seeds you would have to eat before it became dangerous? Does this substance build up in the body or is it easily flushed out? Got curious after seeing a few posts over in and couldn't find any good information via google.
|
[
"I asked this question a month ago. ",
"Here ya go",
" Apparently ~0.6 mg per gram of seeds which is a decent amount.",
"Amygdalin is the most prominent sugar present in the seed itself. ",
"Though it's must easier to get cyanide poisoning from improperly cooked cassava roots, though apparently eating (and chewing) a cup of apple seeds would be harmful and there is a death on record because of it."
] |
[
"The LD50 (the statistically derived mean does that causes death in 50% of test subjects) ",
"has been found to be 880mg of orally ingested amygdalin per kg of subjects weight in rats",
".",
"Now, apple seeds contain about 2-3% amygdalin by weight (couldn't find a link: Weiss, M., Hydrocyanic Acid in Apple Embryos, Flora, 149(3): 386-395, 1960.), and if we say an apple seed weighs about 0.75 grams, we can estimate that a pool of 68kg person (~150lb) would need to eat around 2,660 apple seeds to approach the same LD50 limit.",
"Obviously, you don't want 50% of the people to die, and the LD50 from rat to human isn't identical, and LD's don't scale linearly, so it's kind of difficult to give you an idea of what a totally save, 99.99999% survival rate would be, but that should give you an idea that you'll be fine if you eat a few pips.",
"Also, you can buy ",
"500mg tablets over at Amazon.com",
", so I'd wager it's not super-lethal to eat a good number of seeds.",
"Edit: fixed links"
] |
[
"An interesting calculation, but as I indicated in my comments most of the amygdalin present in the seeds is not processed by metabolism because it is encapsulated."
] |
[
"Could somebody explain me how TALEN-missions work on an example task?"
] |
[
false
] |
I just don't understand that, but I hope I will, if you have explained it .) I'm new to Biochemistry so could you explain it like I'm.. 10, maybe 18? I found this task in the world of the internet and got interested in it, but I don't go through it: First of all it's about TALEN (you already know it, but to make it clear: Transcription Activator-Like Effector Nukleasen). Let's start: There are 2 TALENs that want to cut throught a sequence that goes like that. 5’-CAGCCAGACTGCCTTCCGGGTCACTGCCATGGA GGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCT GAGTCAGGAAACATTTTCAGACCTAT-3’ (Question on the side, what does the 5' and -3' mean? Wikipedia told me nothing, or I'm just too blind for it) and for the amino acid on place 12 and 13 NI = A; NG = T; NN = G; HD = C The TALEN-Pair should start at the start codon -That I have to find first, the DNA binding are 15 base, the cut is 5 basepairs away from the bindingpoint. Then -that's the end of the first number: Identify the start codon and say where the both binding-positions are (the 15-Base thing).. Then I should translate the 15 + 15 base (the binding pairs) into the RVD -That's i think the: NI = A; NG = T; NN = G; HD = C Then I should define the binding and cutting-point of the restriction enzyme Bsal and EcoRI (-The english wiki has more information about that than the german one) And the last thing is to decide which enzyme (Bsal or EcoRI) is better to get sticky ends in the sequence up there after the PCR and "restriction cut". That should happen throught ligation for 5 different DNA sequences. I'm sorry for this text-wall, but happy for every answer, if you understand what I want from you, because.. myself doesn't understand it.
|
[
"The ' (prime) number refers to the points on the sugar ring on the individual base. When strung together in DNA, the 3' (3 prime) carbon of one base is attached to the phosphate chain on the next base. The phosphate chain on the next base is attached to the 5' carbon on its sugar ring. When you chop out a length of DNA, you release this 5'C - P - 3'C bond at either end. (This diagram might help: ",
"http://bioap.wikispaces.com/file/view/08P-210-DNA-5-3.jpg/207075400/345x384/08P-210-DNA-5-3.jpg",
")",
"This means you can refer to either end of a DNA molecule, one has a bare unattached 5' carbon and the other has a bare unattached 3' carbon. This is important as, by convention, you always write the DNA sequence in the 5' to 3' direction. That is, in the sequence you've given, you would always write it:",
"5’-CAGCCAGACTGCCTTCCGGGTCACTGCCATGGA\nGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCT\nGAGTCAGGAAACATTTTCAGACCTAT-3’",
"and not:",
"3'-ATAGGTCTGAAAATGTTTCCTGACTCAGAGGGGGCTCGACGCTAGGATCTGACTGCGGCTCCTCCATGGCAGTGACCCGGAAGGCAGTCTGGCTG-5'",
"Which is also technically correct (though on the opposite strand). This just makes sure, when you're dealing with DNA sequences, that everyone reading the same thing from a pretty abstract sequence of letters."
] |
[
"Sorry if I've misunderstood your question next, but your start codon will be ATG, then you can find the sequence 15 bases 3' (further on) than that.",
"I think I can see the question you've been set with the restriction enzymes. Bsa1 will give you a 'blunt end' cut. That is both DNA strands will be cut at the same point, giving a stable 'blunt' end (check the arrows on the sequence in the NEB catalogue: ",
"https://www.neb.com/products/r0535-bsai",
")",
"EcoR1 cuts the strands in a staggered manner, this means, at either side of the cut site, two complimentary sections of strand will be left single standed (check the arrows here: ",
"https://www.neb.com/products/r0101-ecori",
").",
"Single stranded bits of DNA are always looking to bind to their complimentary sequences, whereas double stranded sections are stable. So this gives you the clues you need to find which enzyme is best if you want to reattach DNA at restriction enzyme sites."
] |
[
"Thank you, now I understand that with the 3' and 5' .) ...seems easy "
] |
[
"Why doesn't water rise and compress the air in an upside-down cup lowered into water?"
] |
[
false
] |
I just put a cup upside down in a pool of water but every bit inside of it was dry afterwards. I thought the air would get heavily compressed by the water, but why doesn't it?
|
[
"It does. You just didn't push the cup down far enough. As a bonus, as you compress the air it gets denser so the bouancy of the air decreases. If you push it down far enough the air won't be bouyant enough to keep the cup floating. "
] |
[
"It should.",
"Ordinary atmospheric pressure corresponds to a column of water of about 10 meters, so if you put down the glass to a depth of 1m, the pressure will increase by 10% and the volume of the air will be reduced by 9%. So if the cup is 15cm tall, you should create a wet edge of 1.35 cm. "
] |
[
"As a physics student of 5 years I know this to be true, but I had never considered it in this way, and assuming your container is made of something more dense than water (presumably glass) you're absolutely right. I love that you posted this comment! Thank you for making me consider a new and interesting phenomenon."
] |
[
"Could \"dark matter\" be hiding in black holes?"
] |
[
false
] |
I watched an episode of Nova: Science Now where they were searching for dark matter. The way they explained it, the biggest evidence for dark matter is that galaxies are spinning so fast that there must be more gravity holding them together than that which can be accounted for by the stars/novas/planets etc that can be seen. Then they jump to a scientist saying that dark matter is not like regular matter (i.e. non-baryonic matter). I don't understand how they make that leap. Why couldn't the "missing" matter be normal matter either in the form of A) cold gasses spread throughout galaxies/between galaxies, B) in lots of black holes all over, or C) in massive black holes which I've heard are thought to possibly exist in the center of galaxies? I just read about , and it seems that they don't see the lensing which would be indicative of option B, so I guess they can rule out objects between 0.00000001 solar masses to 100 solar masses, but what about option "A" (particles/objects below that range) or "C" (black holes above that range)? EDIT: Why the downvotes? I'm seriously looking for an answer, does no one know why scientists have made the leap to assuming there must be non-baryonic dark matter out there?
|
[
"Ah, well we think that dark matter is this. We have examples of similar particles in fact, neutrinos. Neutrinos pass through you and the earth and so on, huge numbers of them every second (I can't remember the exact count). But think about it, if they only interact gravitationally (and by the weak force) what's to stop them at the earth's center. All the energy they've gained from falling to the center of the earth is then lost on the path back out of the earth on the other side. We expect dark matter to behave like neutrinos, only interacting gravitationally and weakly. Except that it has to be much heavier than neutrinos are. Neutrinos are so light they're almost always flitting about at very nearly the speed of light. And again, nothing to slow them down. But dark matter doesn't seem to behave like particles moving at the speed of light, it seems to be \"cold\", relatively slow. We strongly suspect that the particles are ",
"neutralinos",
", the lightest supersymmetric partners of the gauge bosons. the LHC may find evidence of their existence."
] |
[
"And a follow up question: if dark matter is some form of non-baryonic particles, which for the most part, only interact with \"regular\" matter through gravity, then would these particles be \"falling\" to earth and falling through the earth until they reach the center, and just add to the earth's mass by squeezing into the center of the earth?"
] |
[
"Gravity is not enough to make something fall. For example, the Earth is not falling into the Sun. To fall, you also have to dissipate your energy, to slow down. For example, a gas cloud can form a star because it radiates a lot of energy and can thus cool down and collapse. But dark matter cannot radiate, so it cannot lose its energy."
] |
[
"Viewed from the ISS or space, is the sun green?"
] |
[
true
] |
[deleted]
|
[
"No, because the Sun is not monochromatic-- i.e., it emits a broad spectrum of light, not just at its peak wavelength. It would appear white from space. There are really no stars that appear green to us. Those which have peak wavelengths near the ~500 nm range simply appear white to us, because their spectra result in all of our color receptors being stimulated, and the brightness-detecting rods being stimulated most of all.",
"One of the sources of this kind of confusion is the way that the EM spectrum is commonly depicted, as a rainbow. It's accurate to how we perceive monochromatic light, such as that from a laser, but it doesn't mean much of anything about how we'll perceive a wide spectrum.",
"Here's a graph that roughly shows the ",
"solar spectrum and the color sensitivity bands of the human eye.",
". And this next graph shows the sensitivity of the ",
"three types of cone receptors as well as the rods",
"-- rods tell us how bright or dark an object appears. The rod cell's sensitivity is ",
" similar to the shape of the solar spectrum, meaning that sunlight is always going to appear very bright to us. If you try to put a neutral-density filter over your eyes (basically achromatic sunglasses) to reduce the brightness, then you run into the problem that your cones are drastically less sensitive than your rods. This is why you can't see color well in poor lighting conditions. "
] |
[
"Yes. It appears yellowish to us because a significant fraction of the blue spectrum is redirected in the atmosphere through ",
"Rayleigh scattering",
"."
] |
[
"Yes. It appears yellowish to us because a significant fraction of the blue spectrum is redirected in the atmosphere through ",
"Rayleigh scattering",
"."
] |
[
"Why do rainbows form in such specific halfcircular shapes?"
] |
[
false
] | null |
[
"They don't. Rainbows are circular but a little less than half is normally covered by the horizon. ",
"They form that way due to them being light bouncing through rain drops at a particular angle relative to your eyes."
] |
[
"Yes. If you have flown through or near a rain storm you might spot a full circle rainbow. Really cool looking."
] |
[
"To expand on Sinderlings point. imagine a line in space. At the back end, the sun, at the front end, the centre of the rainbow (full circle), in order to see it your eyes have to be on a specific point on that line because that point is rather like the focal point on a satellite dish where the signal collector is located.",
"So if you're standing on the ground with the sun low on the horizon, the rainbow centre is also on the ground, like a half buried dish.",
"What makes Rainbows magical is that only you can see it. Anyone else looking who is not exactly where your eyes are is seeing a slighly different rainbow. If they are a yard forward they are looking at a rainbow a yard behind yours"
] |
[
"How does evolutionary science explain how fresh water fish ended up in inland lakes?"
] |
[
false
] |
EDIT: Thanks for all the responses. I'm not arguing against evolution (I believe in it), I'm wondering because I live in a glacial lakes area (with many lakes) and it kind of makes me wonder, where did all these sunfish, walleye, northern pike, etc come from? Are they all descendants (that have evolved) from ocean species, or did they end up in fresh water lakes some other way?
|
[
"There are a large variety of fish that can live in both freshwater and saltwater. Some of these fish include salmon, bull sharks, and striped bass. All three species mostly come into freshwater to spawn. (There are other fish that leave freshwater to spawn in the ocean)",
"There are incidences where man-made dams prevented fish from returning to the ocean. They are now 100% freshwater fish. As Pangea became the continents, it trapped some species and that could explain how some fish went from saltwater fish to freshwater fish.",
"Another explanations would be flooding. An area becoming flooded and previously barren lakes trapping fish when the flood waters dissipate."
] |
[
"Fish can be transported on water fowl. ",
"Source",
", ",
"source",
", ",
"source"
] |
[
"Good question, there could be several reasons to explain an observed lack of divergence.",
"It may be that lakes which are now isolated were once connected, but not enough time has passed for speciation to occur. In North America, the ",
"last glacial maximum",
" was only 19000-26500 years ago, so many lakes have been colonized since that period.",
"Repeated colonization (i.e. through flooding or temporary waterways) may result in significant gene flow between water bodies.",
"Many lakes no longer exhibit completely natural circumstances as they've been stocked, or there has been accidental release of fish. In the case of largemouth bass, stocking has been conducted since the late 1800's.",
"In some cases there has been significant divergence, as the largemouth bass is comprised of ",
"two subspecies",
" that can be differentiated genetically."
] |
[
"Which Came First, the Virus or the Cell?"
] |
[
false
] |
Was the virus around before the first cell and the cell evolved either from or independently of the virus? Or did the cell evolve first and the virus evolved either from or independently of the cell?
|
[
"No one can tell you for sure. However, since a virus cannot reproduce without a cell to infect, it stands to reason cells would have come first."
] |
[
"I wrote a response (viruses came from or after cells), then checked wikipedia, which is smarter and more informative than I am. Here's a direct copy paste:\n",
"http://en.wikipedia.org/wiki/Virus#Origins",
"Viruses are found wherever there is life and have probably existed since living cells first evolved.[34] The origin of viruses is unclear because they do not form fossils, so molecular techniques have been used to compare the DNA or RNA of viruses and are a useful means of investigating how they arose.[35] There are three main hypotheses that try to explain the origins of viruses:[36][37]",
" ",
" ",
" "
] |
[
"Well, it's not just a protein. It's DNA (or RNA) wrapped in a protein coat. The protein isn't nearly as important as the DNA. ",
"I'm gonna agree with the above comment. Since they're obligate parasites, it makes more sense to think that viruses didn't evolve until cells did, though we don't know for sure."
] |
[
"Intuitive explanation of digital signal reconstruction?"
] |
[
false
] |
We know we can reconstruct a discretely sampled signal (let’s say we are working with audio range) as long as the sampling rate is at least twice that of the highest frequency in the signal. To physically reconstruct this signal, we output the samples as a train of impulses in time to the sampling frequency. I understand that, because of the Shannon / Nyquist theories, (since we sampled twice our highest frequency) we can reconstruct the signal without loss of information. I saw a great visual not too long ago about how the reconstructed signal is just a collection of sinc waveforms in time, where the sinc ripples (in the frequency domain) sum together to recreate the information between samples. What I do not understand is how this physically, intuitively, transpires- what about an impulse voltage output correctly creates the frequency information between samples? What constitutes an impulse output? Is it strictly the amount of time the output remains on? Furthermore, I know there is filtering that can be done to remove higher frequencies / artifacts that may occur, but I am not sure if the filter is necessary component? Please forgive any misconceptions, and let me know if I’ve made any mistakes or grand assumptions. Thank you!
|
[
"I am a little bit confused about the second last section of your question. Specifically the part \"what about an impulse voltage output correctly creates the frequency information between the samples? What do you mean by an 'impulse output'? Do you mean the dirac delta function? ",
"https://en.wikipedia.org/wiki/Dirac_delta_function",
"Lets reexamine the situation to see if this clears it up.",
"If you have a band limited signal below lets say 20kHz. Then by sampling at 40ksps, you can perfectly reconstruct the information 'within the band' of the original signal in the 'continues time'.",
"If you simply put impulses on the time marks where you sampled the original signal, you will not have an actual reconstruction of the signal. The original signal, even though it was band limited, had information in between the sample points. As you mentioned these intermediate points can only be correctly reconstructed by convolving the impulses (dirac delta pulse in continuous time) with the sinc-function. This is because the sinc function's frequency domain representation is a perfect low-pass filter. ",
"On an intuitive level you can think of it as following. Assume you have a continuous time domain signal bandlimited to fmax. This implies that all the information in between discrete sample points at 2",
"fmax is redundant. ",
"The math works out as following.",
"Start with signal x(t) band limited to fmax. x(t) can be sampled at 2",
"omega) = 1/(2",
"pi*fmax) ",
"The original signal is then a convolution between the sinc function and x'(t) which is: ",
"x'(t) = sum n=1 to N of x[n]",
"1/(2*fmax))",
"I might have made some math mistakes here and there. "
] |
[
"we output the samples as a train of impulses in time to the sampling frequency.",
"This is how a DAC which has no reconstruction filter operates. It outputs what looks like a ",
"series of step functions",
". The spacing between each step is the sample time; lets say 52kHz (for typical audio). ",
"When you play this back through your headphones; each voltage jump causes the speaker cone to move. So, the speaker cone is moved 52000 times per second. But, it physically isnt able to move that fast; they are designed to only be able to move at ~20kHz. So, as long as the dac is outputting signals <20kHz at the sample rate of 52kHz, the cone itself will act as a low pass filter and the digital \"step function\" signal will end up moving the cone in a smooth(ish) pattern with energy below 20kHz. ",
"With precision measurement tools, you could be able to see the effect of this \"step function\" output (more precision than a pair of headphones). So what is done for applications which require more precision? These are primarily high end audio and niche industries like dynamic signal analyzers.",
"Such tools use a reconstruction filter to create a smooth output signal. Some of the highest quality DACs are sigma delta. For 20kHz signal; we again choose a 52kHz sample frequency. But before being output, the signal gets digitally upsampled by a large factor, say 64x; so in the 52kHz sample frequency signal we get a digital signal with a sample frequency of ~3.4MHz. Its also digitally filtered here to eliminate out of band energy >20kHz. The DAC outputs the signal at that high frequency of ~3MHz. An analog low pass \"reconstruction\" filter eliminates any high frequency energy that could come from the ~3MHz \"step function\" being output. The result is an extremely smooth voltage output without any energy outside of 20kHz. Note these numbers are examples, they change chip to chip, etc."
] |
[
"I believe most audio is sampled at 44.1kHz isn't it? "
] |
[
"Is it possible to trap static electricity in a mason jar?"
] |
[
false
] |
Is it possible to trap static electricity in a mason jar? If so how long can it stay "trapped" in there? I am helping my daughter with a science experiment.
|
[
"If you coat the inside and the outside with different pieces of metal (e.g. aluminum foil). This is called a Leyden Jar, and was one of the first methods of controlling electricity.",
"https://en.wikipedia.org/wiki/Leyden_jar"
] |
[
"If you do this be careful, the resulting capacitor can store a lot more energy than what you would think and you can get a nasty discharge. From the inventor himself :",
"I would like to tell you about a new but terrible experiment, which I advise you never to try yourself, nor would I, who have experienced it, and survived by the grace of God, do it again for all the kingdom of France.",
"and ",
"Generally the blow does not break the glass, no matter how thing it is, nor does it knock the hand away [from the phial]; but the arm and the entire body are affected so terribly I can't describe it.\nI thought I was done for.",
"So don't charge it too much and test it on yourself before you let children touch it."
] |
[
"Having made one, it can usually deal with low storage in farads, but very high voltages, ones that you will seldom find with normal capacitors. That's why you can use them to store static electricity."
] |
[
"Why is owning a large carnivorous animal (lion, tiger) from infancy more dangerous than owning a dog?"
] |
[
false
] | null |
[
"Dogs have been selectively bred over the course of many generations. One of the criteria that breeders have used to select which dogs to use for breeding is aggression. Some breeds, like Rottweilers, pitbull terriers, etc., were bred to have high aggression toward perceived threats, but almost all dogs were bred so that they are not aggressive toward their master(s). "
] |
[
"After tens of thousands of years of domestication, dogs have undergone genetic and behavioral changes when compared to their wild ancestors.",
"Dogs retain juvenile traits, both in appearance and behavior, into adulthood that wolves naturally outgrow as they mature. They are more submissive and playful, and less aggressive. In many ways, a domesticated dog is more comparable to a wolf pup than an adult wolf.",
"Lions, on the other hand, do not have a long history of domestication in their generic stock and retain all of the aggression and danger normally associated with apex predators."
] |
[
"This is why owning a wolf, which is nearly identical to may breeds of dog, is a bad idea. Even half wolves are known to be more likely to attack their owners."
] |
[
"Geothermal energy: Are there any dangers/concerns in accelerating the rate of heat loss from the crust?"
] |
[
false
] |
I am not sure what they would be. I can imagine over a very long and not-scary amount of time we would dampen the depth of brittle rheology, which may increase seismic hazards. That's all I can speculate on though, are there any identified risks of geothermal energy as the main source of energy for a large population over a foreseeable amount of time?
|
[
"There are some concerns with geothermal energy, but they don't really have to do with accelerated heat loss from the earth.",
"With respect to accelerating heat-loss from the crust, there is not much to be concerned about. It's easy to forget how large the entire earth is as a system, especially when we only think about the crust. There is ~6000 kilometers of extremely hot material between us and the core, which collectively holds massive amounts of energy as heat. ",
"Some concerns with geothermal energy on a commercial scale, where we use heat from the earth to generate steam, are:",
"1) The use of hot water from the ground (hydrothermal fluids) in large quantities can change the dynamics of the groundwater system and water table of the region. Just like when an aquifer is over-pumped for drinking water, overuse of hydrothermal fluids can lead to land subsidence, and also sometimes an increase in geothermal activity due to pressure relief. (I can go into further detail if necessary, but you should look at ",
"Wairakei Power Station",
" for an example.",
"2) Hydrothermal fluids aren't 'regular water' in that they have higher concentrations of metals which could (and generally are) be above the safe limit for human and animal consumption or contact. Hydrothermal fluids can be rich in dissolved arsenic, cadmium, thallium, etc. nasty stuff! The issue is what to do with the water once it's been used, and what will the effects of using a lot of this water be on the existing hydrogeological systems, particularly the ones in use for potable water. ",
"There are other types of geothermal systems which are 'single user' or can be installed in your backyard. On the most basic level, you dig a huge pit, make a huge network of PVC pipe that will loop water underground for as long as you can manage (based on the size of the pit) before bringing it into your home to be heated by a boiler. The premise is that the ground acts as a great insulator from cold in the winter, and at a certain depth (location dependant) the subsurface will be warmer. Additionally, taking advantage of the geothermal gradient (an increase of 25ºC/km depth) is a small component. ",
"The idea is that boiling water that is say, 20º or 25ºC uses less energy than having to heat water from 5ºC - which is an average temperature of tap water in the winter. ",
"Incidentally these systems are more about using the ground as a heat sink for a large heat pump, but I guess you could still call it geothermal energy. ",
"Wikipedia",
" has a very nice description of what's going on. "
] |
[
"No worries!",
"RE: 1) Water is generally pumped back into the ground, I say generally because there are different types of geothermal power plants. Some pump water down into a borehole that will put it in contact with hot rock which will heat it and then bring it back up as steam, while others use aquifer water which is naturally boiling. To be honest, my field of knowledge is geology, and while I understand the basic mechanics of the plants- I can't go into details about the two. ",
"Having said that, since subsidence is the issue we are talking about here, and we can agree that in many cases geothermal plants will pump water back into the ground, I can speak to the problems that poses. ",
"Pumping water back into the ground may return the water to it's place of origin but it's being returned in a different form (temperature, phase, maybe even mineral content) and being transported by different methods. ",
"Ground stability is really like balancing, each element of the system (the soil, the bedrock, the unsaturated (vadose) zone, the saturated zone, faults and fractures, etc.) are all dynamic systems that are currently in a state of equilibrium which is why they are still. When we harness the power of the geothermal energy, we are disturbing the equilibrium of that system causing change which is sometimes manifested as movement. Obviously, there are things we do to minimize the effect of our actions on that equilibrium\nlike using the resource within the tolerance of the equilibrium so as not to disturb it, or to try and put in place additional systems to counterbalance the changes that are resulting from our actions. I know that's very high level, but these are the kind of things that geological engineers thing about for most structures they are responsible for. ",
"In this case specifically, a subsidence issue would be directly related to the geology of the area. I did a quick search for some info about the Wairakei region, and it would seem the area is prone to subsidence for a couple of reasons. Firstly it is a wet plant, meaning it is using hydrothermal fluid from the ground, as opposed to a dry plant which pumps water down. Similar to any well system, pumping water means that you change the shape of the water table and also the hydrologic gradient. Parts of the ground may rely on hydrostatic pressure to maintain their equilibrium. ",
"Returning water to the ground doesn't necessarily guarantee it will behave in the same way before you took it out. ",
"RE: 2) The dissolved metals are ions that are stable in solution mostly because of the temperature and pH of the water- not because of the pressure. Any metal that would have precipitated out of solution due to decreased pressure would have done so much deeper in the ground AFAIK. Plus we know that dissolved metal ions can exist in relatively large quantities (relative to their toxicity) in river and lake water without them being hot. Pressure controlled precipitation does actually play a very important role in the formation of rocks, but more so in the mantle than here. (I can elaborate, but it doesn't have anything to do with this)",
"In terms of cleaning the water, it's actually a reducing environment which will cause the precipitation of the metal ions from the hydrothermal fluids. Remember they are dissolved as Tl(I)+ or Fe(2)+ etc. so they need an electron. It's actually extremely common for mining (and I suppose geothermal since this is a form of mining) to employ something called liming stations where they mix lime (sodium hydroxide) into the contaminated water to force precipitation. Mines have these massive artificial lakes that are connected by artificial streams with control points where lime can be added to catalyze the exsolution. ",
"It's quite amazing actually...though it really has nothing to do with this I've attached a ",
"picture",
" of the discharge to environment point of a mine I've been to. On the left, you can see the green water where metals are being precipitated out, and on the right is a clean blue lake. Despite the bad raps the mining companies get, that lake is cleaner than most of the natural ones in the region, and has never failed an environmental spot check. You can also see the lime tank in the centre! ",
"Sorry for the novel - but hope this answers your question!"
] |
[
"thank you for your thoughtful response! i have learned a lot."
] |
[
"Why is it justified to use just even one \"free\" parameter in theories in the physical sciences?"
] |
[
false
] |
Why is it okay to tune a free parameter (or maybe a few free parameters) in order to get the results you are aiming for?
|
[
"Because it is necessary. As long as the number of different observations you can describe with the theory is much larger than the number of free parameters this is still a successful theory. As an example, Newtonian gravity has the gravitational constant as free parameter. We can measure it with devices in the lab, but the same constant also applies for Earth and the Moon, for planets orbiting the Sun and so on."
] |
[
"In some cases the constants are just an artifact of our units. As an example: You can measure the speed of light in meters per second. But you can also use light-seconds as length unit and call it \"second\", then the speed of light is 1.",
"Similarly you can define the kilogram to be a mass (and change the other units in similar ways) such that the gravitational constant becomes 1. In this case you only shift the problem, however, because now you have to explain the mass values of the elementary particles.",
"The Standard Model and General Relativity are the best descriptions of the universe we have so far (although we don't know how to combine them to a single theory yet), with some caveats not relevant here. You get about 25 free parameters where we have no explanation for them, many of them are particle masses, the others describe interaction strengths of the particles. There might be some deeper reason why they have these values but we don't know it yet."
] |
[
"Okay that makes sense. Are there sometimes explanations for the value of the parameter? For example, is there any other reason why the gravitational constant has the value it has other than to provide the right scaling? "
] |
[
"How is it that there is a height difference between Pacific and Atlantic ocean?"
] |
[
false
] |
I just can’t figure out why, if they are interconnected by the strait of magellan at Kap Hoorn, why do they have to change height in the panama channel? Edit:
|
[
"There are two things to consider, (1) ocean surface topography (which plays a pretty minor role in the case of the Panama canal, but is important in a more general interpretation of the question in your title) and (2) tidal range (which is the much larger factor for the Panama canal specifically).",
"For the first, at a global scale there are a variety of causes for ",
"sea surface topography",
", i.e., there is on the order of ",
"~100 cm difference between \"mean sea level\" in different places",
". This changes on a short term basis as well, e.g. ",
"this video",
". Ocean currents are a large control on these height differences, e.g. ",
"this graphic",
", where generally areas of high surface ocean topography are areas where currents are flowing toward and low surface ocean topography are areas where currents are flowing from. Changes in these currents on a daily to seasonal basis in turn will turn change the ocean surface topography. Similarly, smaller variations from changes in from atmospheric pressure can cause short term changes. On longer time-scales, variation in Earth's gravitational field also influence the ocean surface topography (i.e., the ",
"geoid",
"). Ultimately, for the Panama canal, these differences are going to be pretty minor (on the order of a few cm to a few tens of cm at maximum). Of larger issue is tidal range.",
"For ",
"tidal range",
", i.e., the difference between low and high tides in a location, the primary influence between different places is the bathymetry/geography (there are also seasonal and other controls as well). Bays are especially notorious for amplifying tidal ranges (e.g., the ",
"Bay of Fundy",
"). With specific reference to the Panama canal, looking at map of ",
"tidal range",
" we can begin to see that this is a particular concern as the tidal range on the Pacific side is large, in excess of 5 m, where as the tidal range on the Caribbean side is virtually zero. This is incorporated into the ",
"design of the locks system",
"."
] |
[
"The Panama Canal rises in elevation (to about 85 feet) because the land rises in elevation. It goes up, then comes down.",
"An earlier plan for the canal, when the French had looked at the project, was to cut a sea-level canal. But that was kind of insane. When the project was taken up again it was decided that locks would be used to raise and lower the ships.",
"So if you look at the elevation of the sea at both ends of the canal they'll be roughly the same height*, even if the middle of the canal is a higher elevation. ",
"There's a very simple animation at the bottom of ",
"this page",
" that may help visualize this. ",
"u/CrustalTrudger"
] |
[
"A large inland river and lake supply the water for the locks. It is replenished by rainfall."
] |
[
"I recently heard that the player who chooses White in chess has a 5% increase of winning if then they choose black. Why is this? Don't both players have same chance?"
] |
[
false
] |
If you look at the averages of maths, white almost always leads by 5% p, give or take a few .somethings-somethings. Why is this? Both players have the same pieces, same rules, same board, etc. Why does white get a more statical advantage? Why not black?
|
[
"The game is not completely symmetric. White moves first, which is generally an advantage. While I cannot answer the specifics for chess, I can provide examples in other games.",
"In League of Legends, one of the most popular online games right now, the ",
"blue team has a great advantage",
" if you check the win rates. While the game is designed to be as symmetric as possible, there are minute differences. Players attribute the win rate difference to the UI placement and the placements of the baron and the dragon on the map, but we can't know for sure.",
"A better comparison might be ",
"Go",
", in which the legendary player ",
"Honinbo Shusaku",
" boldly claims that he never loses when he plays black, which goes first. This makes sense, as in his era people didn't realize what a great advantage it was to go first. In modern rules, white gets komi, free 6.5 points, to compensate for going second. Komi didn't exist in Shusaku's era. I suspect that, without the komi, black will have an abnormally high win rate in modern tournaments. ",
"Why does black get an advantage? In Go, there's the concept of ",
"sente",
" and ",
"gote",
". Sente means taking the initiative: you go where you want to go. Gote means you have to respond to your opponent; basically, you're playing on the terms of the player who has sente, because if you don't respond, you can lose the game. The player with sente \"forces\" the opponent to make certain moves. Going first puts you with many more opportunities to make sente moves.",
"Now, I don't know much about chess, but I suspect the same thing happens in chess. The player who goes first decides on the first move of the game, and that restricts the moves of the player who goes second. The white player has more opportunities for sente than the black player.",
"I am not sure if this post is considered anecdotal or not, but I did try my best providing sources and explanations."
] |
[
"The starting player has what we call a ",
" (meaning, it is trivially clear that there is one), which is created by the rule that when a winning position (checkmate) is reached, play stops immediately. This has the result that every time a white player wins, he or she has been allowed to play one turn more than the other player. When a black player wins, however, he or she has never played more turns than the other player.",
"The same applies to 5-in-a-row. If X begins and O follows up, then if on turn 10 both X and O are able to complete a five-in-a-row, meaning they have both played equally well and are otherwise in an equally good position to win, then X wins because he gets to go first and O doesn't get a turn once a victory occurs."
] |
[
"There is actually ",
"a Wikipedia page",
" on the topic. Part of the problem is that a lot of early opening theory in chess was devoted indeed to Black saying \"okay, White did this, how am I going to respond to that to prevent him from dominating the center.\" That puts black on a responsive foot and makes it hard to dominate anything.",
"The basic theory was therefore \"white starts with the initiative; as long as white keeps it, white controls the game.\" This new approach is something more like black saying, \"initiative is abstract and I don't necessarily have to stop white from dominating the center as long as I can powerfully play into the center and sides.\" Approaches are often very dynamic, with fianchettos becoming more popular, and more aggressive.",
"It is generally conceded that white has enough advantage to grind a game into a draw if they're not interested in winning, so it's thought that chess has a perfect-play solution which is probably a draw, but might be a win for white. "
] |
[
"Would it be possible to get the optic nerve to send messages to a machine so we can see exactly what the person sees?"
] |
[
false
] |
I know nothing about optical science just wondering
|
[
"Broadly speaking, yes. Not with current technology, but I imagine we'll get there. We already record from the brain using a variety of invasive (e.g. implanted electrodes, or 2-photon microscopy with calcium imaging) and noninvasive (e.g. EEG, fMRI) methods.",
"From a practical stand point, the optic nerve is hard to access - before the signal reaches the cortex (the outermost layers of the brain, where \"high level\" processing happens), it goes straight to the middle of the brain. In that light, it's easier to record from the visual cortex, which is at the back of your head. You're still reading visual information there, but it has gone through more processing by then, which means it's more representative of what you actually perceive than the (less processed) information carried by the optic nerve.",
"The next step is to take the signals you've recorded, and find out what the eye was seeing. This is also an area of active research, especially if you include all efforts to extract information from any area of the brain - many people are looking at the sensory areas (auditory, visual, tactile, etc), but also memory, navigation, motor areas, and so on, figuring out how information is represented in those areas. We have a ways to go before we can reconstruct a full scene, but we're getting there. It's cool stuff. ",
"I think this question really breaks down into two somewhat different questions:",
"1) Can we record information from the optic nerve, and extract information about the scene from the signal? (discussed above)",
"2) How does that information relate to what the person perceives?",
"\"Perception\" and \"sensory input\" are not quite the same thing - perception would be how your brain interprets sensory input. The input is a rather more mechanical, deterministic quantity. That is, some kind of sensor - mechanoreceptors in the skin, hair cells in your cochlea, etc - is acted on by a stimulus - brushing against something, sound waves traveling through the air - and sends a pulse of spikes to the brain. At that point, it's only a physical stimulus. If we talk about perception, we're usually talking about a person's subjective experience of the stimulus. Knowing what signals your sensors (like your eyes) are outputting is not necessarily the same as knowing what you are perceiving.",
" We'll get there. We can currently record directly from the brain or nerves, and extract a certain amount of information from those signals, but not at this scale.",
"An easier solution to the same problem would be to track a person's eye movements (which we can do well), stick a camera next to their head, and have the camera point at the same thing that the person is looking at ;-)"
] |
[
"In theory I wouldn't know why not. The optic nerves send signals and if you can interpret those signals correctly, voilà.",
"In practice however this will be very difficult. Technology wise you would need to mimic the receiving end of a synapse which is hard enough by itself, but only begins there. Vision itself arises in the brain which is a very intricate system of collaborating specialized structures. Perhaps someone who knows more about how the brain converts nervous signals into a visual experience could chime in here."
] |
[
"this is what retinal neuroscience is all about - measuring the activity of the retina, e.g. by recording the action potentials of the ganglion cells whose axons make up the optic nerve, so that we can then get some idea of what information is actually being transmitted along the nerve to the brain, and what form that information takes. but we don't do this in humans - we use mice, cats, monkeys, etc.",
"based on the knowledge we gain in these sorts of experiments, though, we can build computational models of the retina (including the optic nerve). then, if you want to see what another person sees, based on the information carried by their optic nerves, the best way to do it would be to scan their retinae and build a model of its functional structure. then, use an eye tracker to record where the person points their eyes when they're looking at things, and feed those same images into your model, which (if it's a good model) will process the images as the person's retinae process them, and then you can view the output through whatever method you choose.",
"anyways, building a model and simulating a person's retina would be a much less invasive and computationally equivalent method compared with somehow measuring the optic nerve's entire throughput while it was in use. that would be extremely difficult, unless you invent some very high resolution scanner that can detect neural action potentials. when you invent that, you'll revolutionize neuroscience!"
] |
[
"Do you think that communication by quantum entanglement will ever be feasible?"
] |
[
false
] |
Even if it is in the distant future when we know so much more. Is there any possibility of this ever happening?
|
[
"You can't communicate with what we know as quantum entanglement. It's not just unfeasible, it's not possible even in principle. ",
"Nobody can say that in the future, what we know won't be proven wrong or very different from what we now know. But if it is, then they'll use a different term for it, since it's fundamentally different. ",
"So I'd say there's no possibility of it ever happening, since you'd have to be talking about a different theory that explained what we currently know as entanglement, not entanglement itself."
] |
[
"But the separate channel doesn't contain any useful information independently",
"A property shared with a classical ",
"one-time pad",
", which is usually referred to as encryption method rather than just communication.",
"I still think ",
"QKD",
" is nifty, but I wouldn't call the entanglement part communication any more than I'd call the random letters on a one-time pad 'communication'. They're both two things which happen to be correlated between the sender and receiver, but devoid of any information in-themselves."
] |
[
"Imagine you've got two particles, and you prepare them such that one is in the \"up\" state and the other is in the \"down\" state (i.e. you prepare the overall system to be \"neutral\" in some sense, that is to say you know there must be equal amounts of up and down). You don't make any measurements, and you separate them by, say, a light year. Alice has one particle, Bob has the other. ",
"Let's imagine Alice measures her particle and finds \"up\". She now immediately knows that when Bob makes his measurement, he will find \"down\". Even if Bob measures his before Alice could have sent him a message (i.e. less than one year after Alice), he will still get down - this ",
" like faster than light communication. But, from Bob's point of view, all he's done is measured down. He didn't know whether it would be up or down before measuring it, because Alice hasn't had time to send him a message saying that hers was up. This message would have to be sent via standard methods (i.e. at a maximum of light speed), rendering the whole thing no better than just sending the message through standard methods in the first place. "
] |
[
"Does sleep ever go to waste? f.e.If I sleep 14hrs instead of just 8."
] |
[
false
] | null |
[
"As someone who has been studying biology and physiology for many years I can say that though there are many theories about the function of sleep, they are simply guesses. To answer your question properly we would first need to know the purpose of sleep and why we must do it which we do not currently definitely know."
] |
[
"It's a bit of a difficult question to answer - especially since we don't understand why we sleep. I know it's not the most reliable source, but have a quick glance over no. 8 in ",
"this list",
"."
] |
[
"This doesn't really answer your question, but too much sleep correlates with lower life expectancy. But the causation may be due to a confounding factor (e.g. sickness causes both). ",
"http://www.ncbi.nlm.nih.gov/pubmed/17969458"
] |
[
"Is a pine tree that has cut and placed as a Christmas tree still alive?"
] |
[
false
] |
I placed this year's Christmas tree in the traditional base holder and have been placing water in the base daily; I am replacing about 0.5 liters of water daily, which suggests there is an active process of assimilating the water into the tree.
|
[
"First, as a minor point:",
"The most popular trees are various species of fir and spruce, but some species of pine are used as Christmas trees. (It's mostly regional.)",
"And yes, you are correct. If your tree is green and using water, it's still alive. Photosynthesis is still happening in the leaves. Some eco-friendly trees are even sold with root balls so they can be returned to nature after the holidays."
] |
[
"If you kept it watered and exposed to sunlight after cutting, how long would it be able to remain living? And why would it die? Is it just less efficient at absorbing water/nutrients through the trunk rather than roots? Too little surface area? "
] |
[
"This",
" link may be of help in explaining the possible scenarios here, but I don't think anyone has gotten a tree to root using rooting hormone, and the amount of time that the tree stays alive is dependent on many factors, including: the species of tree, how warm/dry your house is, how close it is to a source of moving, dry air (like a fireplace or heat vent), how much water it gets, what nutrients (if any) are in the water, etc.",
"Someone with more experience torturing evergreens may be able to refine my answer."
] |
[
"How does a computer communicate with another one behind NAT?"
] |
[
false
] |
I was learning about NAT and I think I understand how it works. You have a private IP. When you send a request to a computer on another network, the router changes the packet's source address so that the router receives the response, and then it forwards the response back to you ("you" being another computer). But this only happens when you initially send a request. How does a computer on a different network send you a packet if you didn't send it a request first? Assuming you are not the only device connected to your network, and it can't just send a packet to your private IP address, how can this communication occur?
|
[
"NAT traversal and STUN is what you're looking for. The ",
" is both peers tell a third party who and where they are (some identifier and the public IP:port as seen from the outside. The third party transmits that info to the peers. The peers then talk directly to each other. ",
"Here is a detailed description of the problem and a solution for hosts behind many NATs and when both peers are behind their own NAT. ",
"https://tailscale.com/blog/how-nat-traversal-works/"
] |
[
"Your understanding is a little incomplete, and correct under certain caveats. For NAT to make sense, the motivation is important. NAT is born out of the requirement to establish IP communication between two address realms which are not distinct (disjoint). For example, end-to-end IP communication is impossible between two hosts between a router (each) which are assigned the same IP address. Why is that use-case important? In some cases, re-using an address range for a subnet means that the limited IPv4 address range can be assigned to more than 2",
" hosts. In others, unwillingness to set up a network collaboratively.",
"What is NAT? it is a mapping of two IP address spaces, or IP address and port spaces. [1] [2] The ~host~ gateway performing address translation typically combines one of four implementation classes (these are historical terms, but useful to understand their different needs). Note that all of them involve a port, which is not an IP entity:",
"one-to-one NAT; an \"internal\" address and port is mapped to an \"external\" address and port. An external host can thus contact the internal address only at the internal port, by sending packets to the external address and port (*)",
"\"address-restricted-cone-NAT\"; same as one-to-one NAT, except the internal host must have initiated the communication to the external address, at any port",
"\"port-restricted-cone-NAT\"; same as one-to-one NAT, except the internal host must have initiated the communication to the external address and (specific) port",
"\"symmetric\" NAT; the most wrongly named variation is when an external address and port is used for a singular (internal address, internal port, destination address, destination port) (aka \"flow\") [3]. Communication must be initiated from the internal address and port",
"This terminology is no longer used because, as you have probably understood, the possible observed behaviours are largely common between them. Therefore terminology now uses behaviour. [4] [5]",
"In all these cases, the NAT gateway rewrites packet addresses and ports according to its mapping. All packets (pertaining to a connection) must be rewritten in order to maintain communication.",
"The mapping can be discovered (by hosts initiating communication) or configured statically.",
"As soon as a single NAT gateway exists between two hosts, the traversal problem occurs. Note that more than one NAT gateway may exist, so the problem is complex. Because NAT violates the end-to-end principle, and its operation is opaque to the end hosts, cooperation is necessary.",
"One solution is port forwarding [6]. Port forwarding (or destination network address translation) solves the problem of exposing a single internal host to external hosts, at a single external port. Packets to the external address & port are always forwarded to a single host and at the same port #. Sometimes this technique is used on an entire host, which becomes exposed, and is referred to as \"DMZ\" (from \"demilitarised zone\"). Port forwarding is popular with home setups and it is often a solution/workaround offered for peer-to-peer multiplayer games. Port forwarding is almost always a manual affair. Manual mappings can also be made by employing IGDP [7]",
"Another solution is hole punching. [8] Hole punching relies on implicit cooperation between hosts that they will use the same port number(s) on both sides of the NAT. While this is a crucial assumption for connection-oriented protocols, it makes little difference for connectionless ones. Hole punching methods include guessing or inferring mapping assignments by the gateway, when not relying on the aforementioned assumption. This technique is popular with peer-to-peer protocols.",
"Another proposed solution is dynamic discovery for the information necessary to perform traversal, by something like STUN [9]. STUN is intended as a way to discover NAT mappings. Once discovered, the host(s) can use other techniques to establish connectivity. It's a fragile and incomplete proposal.",
"At this point you may want to hear about some interesting details about NAT.",
"[1] ",
"https://datatracker.ietf.org/doc/html/rfc2663",
"[2] ",
"https://datatracker.ietf.org/doc/html/rfc1918",
"[3] It actually includes the protocol. Remember TCP and UDP port numbers overlap but their use differs",
"[4] ",
"https://datatracker.ietf.org/doc/html/rfc3489",
"[5] ",
"https://datatracker.ietf.org/doc/html/rfc4787",
"[6] ",
"https://en.wikipedia.org/wiki/Port_forwarding",
"[7] ",
"https://www.iso.org/news/2008/12/Ref1185.html",
"[8] ",
"https://en.wikipedia.org/wiki/TCP_hole_punching",
"[9] ",
"https://datatracker.ietf.org/doc/html/rfc5389"
] |
[
"Technically, I would say that there is also Source-NAT and Destination-NAT.",
"Source-NAT is used when you leave a network which share a common for most home connections. You get 1 public IP from your ISP and when you send traffic out to the internet, your router/firewall/CPE substitutes its own public IP for your private local IP as the source and sends it out to the internet.",
"Destination-NAT is used on the other side when your packet gets to a firewall that sits in front of a webserver or other public service. The firewall will substitute the destination IP for the actual IP of the server and send it out across the LAN to the server. Sometimes this also changes the destination Port of the packet."
] |
[
"Why is the apparent magnitude scale used to measure the brightness of stars backwards?"
] |
[
false
] | null |
[
"While ",
"/u/varialectio",
" is right that the system is logarithmic, there's no reason it couldn't be logarithmic in the other direction, with the brightest stars having the biggest numbers.",
"Historically, for the ancient Greeks, magnitude was a semi-arbitrary scale where \"first magnitude\" was like \"first class\" or \"first place\", the brightest stars. \"Second magnitude\" stars were less bright and important, and so on, down to sixth magnitude which was the limit of human vision. With the invention of photography we were able to measure brightness accurately, and we chose a logarithmic scale to fit the ancient system, because as it turns out the human eye measures brightness logarithmically.",
"https://en.wikipedia.org/wiki/Apparent_magnitude#History"
] |
[
"Right idea, but each division of magnitude isn't 10 times as bright: it's about 2.5 times as bright.\n",
"https://en.wikipedia.org/wiki/Apparent_magnitude#Calculations"
] |
[
"Logarithms. Log(1) is zero for your starting object. One tenth as bright is -1, one hundredth is -2, etc. So you define a scale as the negative of the logarithm to get rid of the awkward minus sign for most cases.",
"The pH acidity scale works the same way."
] |
[
"Should I take Feynman's view of quantum electrodynamics at face value?"
] |
[
false
] | null |
[
"Hi! This is a good question for our sister subreddit, ",
"/r/AskScienceDiscussion",
". All our panelists have flair over there as well."
] |
[
"Thanks! I'll post over there."
] |
[
"Cool, you're all set!"
] |
[
"Doesn't inflation make it impossible to measure the size of the universe?"
] |
[
false
] |
[deleted]
|
[
"It does, which is why measurements of the universe are referred to as the \"observable universe\", rather than just the universe."
] |
[
"Without a doubt. This is actually a consequence of our Universe having a particularly weird structure where it started off decelerating, and later became accelerating. Generally, in a decelerating universe you start off unable to see anything else, and then more and more comes into view; in an accelerating universe, you start off seeing ",
" and then more and more leaves your view. Our Universe, alas, has the worst of both worlds! So there are some maximally distant objects, past which we never could and never will be able to see."
] |
[
"So isn't it possible that there are galaxies that were always beyond our cosmological event horizon and therefore their light will never reach us? "
] |
[
"Can you leave solar system going up or down instead of horizontal?"
] |
[
false
] |
[deleted]
|
[
"You could, but you wouldn't be able to take advantage of all the ",
"gravity assists",
" that spacecraft headed out of the solar system (like the Voyager and Pioneer crafts) usually take advantage of. It's much slower, since you don't have any velocity in that direction to start with."
] |
[
"And what's more, you have to do a pretty drastic ",
"inclination change maneuver",
" - those are very expensive in terms of delta-v."
] |
[
"This is something you can do with gravity assists. It's already been done once,",
"https://en.wikipedia.org/wiki/Ulysses_%28spacecraft%29"
] |
[
"What is neuroplasticity?"
] |
[
false
] |
I know what the basic idea is but I am still a bit unsure. So if possible could I have a simplified and maybe a more in depth version of what neuroplasticity is.
|
[
"Rewiring of the brain. When I think plasticity, I think of how moldable the brain is.",
"For example, if you introduce a certain drug to the brain constantly, like nicotine, the chronic stimulation of nicotinic acetylcholine receptors may result in a down regulation of the receptors, or a decrease in the amount of receptors in response to this constant stimuli. Therefore, the brain is less responsive to nicotine.",
"So it is essentially rewiring of the brain due to some kind of stimuli. It is some kind of response as a result of something occurring to the brain "
] |
[
"Movies try to portray this as the character goes through a transition and comes out the other end with different ideas. If you take George Costanza and put him into a WWI trench, he will either die or come out a different person because his brain rewired itself to adapt to its new reality. "
] |
[
"Here's an excerpt from an essay I wrote. ",
"\"The next study has much more striking results and demonstrates to a larger degree how much of an effect extrinsic signalling can have and also shows the plasticity of a developing cortex. Experiments conducted on ferrets have shown that in the early stages of neural development, if the different inputs are surgically rewired to feed into different parts of the brain, then overtime, the brain tissue gets reassigned to be able to respond to that kind of stimulus. In the case of the ferrets, the visual nerves from the eye where connected to the primary auditory cortex and the nerves from the ear were severed. The brains of the ferrets were able to remodel and reassign the primary auditory cortex to such a degree that it responded to the input in a similar way that the primary visual cortex would have.\"",
"And the reference.",
"Stiles, J. 2010. The fundamentals of brain development: integrating nature and nurture, in McClelland, J. and Lambon-Ralph, M. (eds), Cognitive Neuroscience: Emergence of mind from brain, The Biomedical & Life Sciences Collection, Henry Stewart Talks Ltd, London"
] |
[
"How much would you weigh if Earth stopped rotating on its axis?"
] |
[
false
] | null |
[
"No, centripetal acceleration. It's due to gravity of course, but 0.034 ms",
" of it is needed to keep you on the earth's surface, the rest you feel as your weight."
] |
[
"Centripetal acceleration on the equator is ~0.034 ms",
" Gravitational acceleration is 9.81 ms",
" There would be about 0.35% difference in your weight (less if you're not at the equator)."
] |
[
"Did you mean centrifugal acceleration; with centripetal acceleration being acceleration due to gravity?"
] |
[
"Was the cosmic microwave background once visible light?"
] |
[
false
] |
From what I understand of the CMB it was initially very high energy and high frequency and as the universe cooled and expanded the light was shifted down to microwave radiation. Does that mean that at some point in the history of the universe the night sky was lit up in a specific color of light that we would be able to see? And going further was that point in time a time when there were solid planets and the universe pretty much as we know it now?
|
[
"Shortly after the Recombination era - the era from which cosmic background radiation originates - the cmb was bright orange. ",
"To understand what exactly happened, let's backtrack a bit.\nUntil 380 000 years after the big bang, the universe was too hot to form neutral atoms. Electrons and protons whizzed through space which such high speeds, that electromagnetic attraction wasn't strong enough to bind them together. Thus, space was filled with a hot plasma, that gave off thermal radiation. During this time, the universe was opaque to photons. Photons would bump into electrons frequently. This scattering of photons results in a mostly in-transparent universe with a visibility of a few thousand lightyears at most. (Which sounds a lot but is very small at cosmic scales)",
"Due to the expansion of the universe, this plasma finally cooled down to around 3000K. Which is cool enough to form neutral atoms around 400 000 years after the big bang. Since neutral atoms don't interact with photons that willingly, the universe became transparent. Thus, the thermal radiation of the plasma in the recombination era was emitted into all directions and from all points in space. And since the plasma was around 3000K at that time, and the black body radiation at that temperature is orangy, the hole universe was filled with orange light for a few million years.",
"The universe during the first few million years after the big bang saw the first stars being formed, but during this time, the only radiation emitted was the hydrogen line.",
"Over time, as the universe continued to expand, the cmb got redshifted. Now, ~13 billion years later, the cmb is redshifted down to around 2.7K, which is in the microwave part of the spectrum. "
] |
[
"The universe is no longer emitting CBR-type radiation (presumably at the much-lower temperature of the current universe), precisely because it is no longer opaque. The emissivity of the universe is 0. The emissivity and absorptivity of matter ",
", so the CBR is, in a sense, an artifact of the instant before the universe became transparent (and was emitting all this light) and the instant after (and suddenly stopped re-absorbing all that light.)",
"And in case you're curious why emissivity = absorptivity, you can try this experiment:",
"Take 2 samples of the same material. Cut them to a flat square and then use them to assemble a 6-sided cube. The two samples on opposite ends of the box, and the other four sides are mirrors.",
"If the emissivity and absorptivity aren't equal, the two samples, in thermal contact with each other via blackbody radiation, would end up in an equilibrium of different temperatures. Why must they be equal? Because in this universe ",
"we obey the laws of thermodynamics",
"!"
] |
[
"Just because light is in the visible part of the spectrum doesn't mean that it's necessarily bright enough to see with human eyes. I'm not sure of the energy density when it was in the visible spectrum, but it may still have been too dim to see.",
"It should have been pretty much the black-body brightness, i.e. exactly as bright as if the entire sky was made from 3000K-hot molten iron for example. Because every reverse ray traced from your eye would eventually hit the opaque plasma in the past.",
"In fact, as far as I can understand from reading ",
"this",
" for example, the CMB remains close to a perfect black body -- i.e. its shape matches its brightness to within fractions of a percent."
] |
[
"Why is it that the east coast of the United States is lined with barrier island while they are sparsely seen on the west coast?"
] |
[
false
] | null |
[
"There are many processes that aid in the formation of barrier islands, but before getting into those, take a look at the ",
"bathymetry reliefs of the continental shelfs around each coast",
" You'll see that land slopes steeply into the ocean in the west coast and gets deep very quickly whereas in the east coast, the shallow continental shelf extends quite far out into the ocean before it slopes down to the typical ocean floor depth. This allows for the dynamics of prevailing winds, coastal currents, outflowing rivers, and nearby eroding land to create stable barrier islands... which aren't really possible in the much deeper coasts out west."
] |
[
"Differences in tectonics at work. The Atlantic floor is spreading from the center towards the continents on either side, pushing up the sea-floor. On the west side of the US the plate is diving under the continent taking any prospective islands with it. "
] |
[
"There is only subduction occurring in the Pacific Northwest (Cascadia region - Juan de Fuca plate) on the West Coast of the US and most of California is impacted by a transform plate boundary. "
] |
[
"Why does evolution result in distinct species?"
] |
[
false
] | null |
[
"The Wiki on ",
"speciation",
" has ",
" more depth, as well as more than just one mechanism of speciation (mutatron described allopatric speciation, but there are other types!)."
] |
[
"Evolution doesn't necessarily result in distinct species, our need to classify results in \"distinct\" species.",
"And don't worry, this isn't a fundie rant.",
"We classify the results of evolution into species, but evolution does not necessarily produce distinct species. For example: ",
"This",
" is a gerbil, and ",
"this",
" is a mouse; both different species. But ",
"this",
" and ",
"this",
" are the same species (of course, natural selection had little to do with the generation of that last pair).",
"The same thing happens at the genetic level; there are species that are highly similar genetically, and there are cases of longstanding, distinct species that have been reclassified as the same species after their DNA was looked at.",
"There are many ways to classify species; I know of three off the top of my head and a Google search would certainly yield more. Each has its pros & cons, but it all boils down to us trying to make classified, neat sense out of an inherently messy process. Evolution makes a continuum, not distinct categories. ",
"Sometimes you get some new form along that continuum that is so much better than the things near its niche that it kicks the hell out of them and it winds up alone, distinct-looking. We pick up on these because we seek out patterns. We tend to ignore or conflate the ones that are very close in appearance, behavior, location, etc. ",
"Evolution makes a continuum, and man classifies that continuum into species to make things easier. "
] |
[
"Pulling out the biology notebook...\nNatural selection can be stabilizing, directional, or disruptive. In stabilizing selection, traits in the middle of the spectrum are selected for (i.e. everyone becomes average height). In directional selection, traits on one end of the spectrum are selected for (average height increases). In disruptive selection, traits in the middle of the spectrum are selected against (there are a lot of tall people and a lot of short people, but few people of average height). Disruptive selection can be a cause of speciation.\nSpeciation events can be allopatric or sympatric. \nIn allopatric speciation, populations (groups of organisms in the same species) are seperated physically, preventing genetic mixing. This can be a result of population dispersal (a population moves), or vivariance (a geological event creates a barrier). The isolated populations respond to different selective forces (because they are in different enviorments) or evolve differently as a result of genetic drift (chance).\nIn sympatric speciation, the populations are in contact but there is a strong divergent selection. The divergent selection can be coupled with other factors which cause genetic isolation (for example, soapberry bugs have evolved to eat little or big seeds. The bugs also mate near their food, so the two types rarely mate).\nSecondary contact occurs when previously isolated populations resume contact. If the divergence has affected how the populations mate, prezyotic isolation can occur, and the populations will continue to diverge. If no prezyotic isolation occurs, hybrid forms can occur and integrate alleles from each population. If hybrids are less fit, there will be a selection against interbreeding and isolation will likely continue. If hybrids are more fit, then a hybrid zone (geographic area dominated by the hybrid) may establish. It is possible that the populations were merge completely. It is also possible that they will continue to diverse and the hybrid will eventually form its own species. \nPlease message me if you have more questions :-D"
] |
[
"Do orbits of planets in a solar system have to be on the same plane?"
] |
[
false
] |
Currently, I see models of our solar system where the planets are all located on 1 plane. Is it possible for a solar system to exist where planets orbit on multiple planes?
|
[
"In principle there is nothing to prevent planets from orbiting on multiple planes. That is, if some super advanced civilization was to come to our solar system and move some planets around to orbit on another plane, that would work.",
"The reason that our solar system, and by extension other solar systems, orbits more or less on the same plane is due to conservation of angular momentum. Our solar system started out as a large rotating cloud of gas. Under influence of gravity, this cloud contracted to a disk, but the angular momentum of the cloud remained the same throughout this process.",
"The denser parts of the disk then started to attract even more mass and this caused the formation of the sun and other celestial bodies.",
"From the start of the formation process, everything rotated pretty much around a single axis. For part of the matter to instead rotate around another axis, an external source would have had to jolt it in the right way. But lacking such as external source, everything stayed more or less on the same plane."
] |
[
"And then there is Uranus. It orbits the sun in this same plane yet its tilted 98°. But I wonder, do its moons and ring system orbit Uranus at its equator or do they have an orbit matching the parent body?"
] |
[
"Main moons and rings orbit roughly around the equator, small moons orbit at different planes. "
] |
[
"Why don't the Mars Rovers have wipers for their solar panels?"
] |
[
false
] |
I know they were intended for a much shorter mission than the one they have undertaken, and that wipers would add some mechanical complexities that take away from space away from other systems, but does that preclude the possibility of having solar panel wipers in future missions?
|
[
"The problem is that wipers would add significantly to cost, weight, and complexity for a small improvement in function. \"Significantly\" because the wipers would have to be a long as the panels are wide, and they would have to be powered by extra motors and gears.",
"Then, when all is said and done, what's to prevent the wipers from getting coated with dust themselves, thus reducing their ability to clean the panels? Or from failing because of accumulated dust in their gears, levers and unfolding mechanism?",
"When in use, the wipers would have to stretch across the panels. When not in use, the wipers would have to fold up and be out of the way, otherwise they might block the sunlight that is the entire point of the panels. The folding scheme wold be another failure mode, both for the wipers and the panels.",
"I say this because I spent years thinking about issues like this during ",
"my time as an engineer on the NASA Space Shuttle project",
"."
] |
[
"Its pretty cool that you can link to your own wikipedia page. \nI mean, damn. And Im very excited that you remain a part of the Reddit community. ",
"I do have a question though. How much more effectively could the shuttle have been built with modern tech?"
] |
[
"How much more effectively could the shuttle have been built with modern tech?",
"I guess we'll find out -- with ",
"SpaceX",
", Elon Musk is doing something much more useful and appropriate to the task at hand. I can't tell you how exciting it is to see a private entrepreneur succeed where Big Government failed -- even when speaking about a project I played a part in.",
"And Elon Musk isn't the only one -- there are many similar projects, maybe not as far along as SpaceX (which is under NASA contract to haul cargo to the ISS), but that will very likely revolutionize space missions and even tourist travel.",
"It's a very exciting time for space exploration, especially because it's to some extent moving out of the inefficient hands of government.",
"Here is a great ",
"60 Minutes piece",
" about Elon Musk and SpaceX. It's a terrific summary."
] |
[
"Would moving the ISS to GSO for future salvage be practical?"
] |
[
false
] |
Seems like it would make for really good parts salvage whenever manufacturing in space becomes an industry. Putting it at GSO and abonding it would mean basically no maintenance costs wouldn't it?
|
[
"First, low earth orbit, where the ISS is, is about 160 km above the Earth's surface",
"The ISS is usually between 300-400km above the surface.",
"On top of everything, even if we did manage to boost the ISS into GSO, we actually don't have any rockets that can send a crewed capsule to GSO anyways.",
"Yet. Falcon Heavy and SLS will have this capability in about 5 years.",
"it took 15 separate launches from Earth to assemble the ISS",
"It actually took about 50, depending on when you consider the ISS to be complete.",
"and it will take a greater amount of effort to push all that mass into GSO",
"Not at all. It takes about 10km/s delta-v to get from Earth to LEO. It would require a boost of about 4km/s to get from LEO to GEO. The initial boost from Earth to LEO requires using rockets with a high thrust and low ISP, so they are pretty inefficient. The trip from LEO to GEO could use the VASIMR engine that will be installed on the ISS soon. It can use the energy from the ISS solar array to boost the orbit using tiny amounts of xenon or argon gas. 20-30 tons of fuel should be enough to move the ISS to GEO."
] |
[
"I've actually been advocating for several years that it should be boosted and left up there. Doing that would be much easier and cheaper and safer than capturing a 400 ton metallic asteroid into Earth orbit. Capturing an asteroid is a long term plan for NASA and the new asteroid mining companies, and the ISS is almost 100% composed of useful alloys. I think it would be a fantastic testbed for space based industry, testing refining and manufacturing techniques on a large scale. 100 years from now, pretty much every spacecraft in the solar system could have a little piece of ISS in it. ",
"Unfortunately, all the biggest obstacles to saving it are political."
] |
[
"No I don't. I live in a country with no space industry. I've been following the development of various space agencies closely for nearly 40 years though."
] |
[
"Is every instance of your immune system's successful response to an infection passed down to your children?"
] |
[
false
] | null |
[
"Immunological memory cells travel throughout the body and are what help you mount an immune reaction to a pathogen you have been previously exposed to.",
"Sperm cells are a separate cell line formed in the testes. The only way I can think of a sperm cell DNA to deviate from it's original form is by some sort of viral infection directly effecting spermatozoa DNA, or any other cause of DNA damage.",
"To answer your question, yes, the body records how to fight off certain infections but, no, this information is not transferred to your spermatozoa."
] |
[
"The DNA used to create offspring (germ cell) is typically not affected by infection, and even if it was it wouldn't confer immunity. No immunity is passed down through DNA because it is an acquired trait, not a genetic one. Mothers can pass antibodies to infants from breast milk, but that immunity doesn't last forever."
] |
[
"There is evidence that stressful life events (like starvation) can manifest themselves in epigenetic changes that can be passed down but it's more complicated than you're describing."
] |
[
"Do centrifugal forces still apply in a zero-gravity environment like space?"
] |
[
false
] | null |
[
"Centrifugal forces are basically pseudo forces. Unless you construct your system in a rotating reference frame, there is no centrifugal force term.",
"What we percieve as centrifugal forces (or centripetal forces by symmetry) are changes in the magnitude of force components due to a torque.\nSo unless the torque is provided by gravity itself, then there is no reason why what we would call a centrifugal force should disappear.",
"So if I have a cup attached to a tether, and I shoot a bullet into the cup the cup will spin. If the bullet is always in equilibrium with the cup for simplicity, and if there is no gravity the forces involved are the force from the cup impinging on the tether, and the tension in the tether. \nThe cup always wants to move in a straight line, and the tether wants to keep its length the same.",
"The centrifugal force in this scenario is the cup pulling on the tether. The centripetal force is the tension of the tether pulling the cup.\nEven if there is no gravity, these will still exist.",
"In fact, this is the very reason why in 2001: 'A Space Odyssey' the ship is shaped like a ring, to create an artificial gravity environment."
] |
[
"Yes, the forces are still there (say you spin a rope with a weight on the end). Actually this is what keeps planets orbiting around the sun. The centrifugal force in play here is gravity between the two massive objects."
] |
[
"Thank you, I was curious as centrifuges must be used for research on the ISS but I wasn't sure if the same forces applied. "
] |
[
"How do you derive the formula for the modulus of a complex number?"
] |
[
false
] | null |
[
"It's a definition. A useful one. It is the same as you would get if you consider the complex plane a regular 2D plane. In other words: if you draw the complex plane on paper the complex modulus will be the same as the distance from the origin to which ever complex number you're talking about."
] |
[
"It's just a definition. You can't prove a definition."
] |
[
"It's just a definition. You can't prove a definition."
] |
[
"I live on 3rd floor, I leave some food for a few days.. suddenly there are ants. How the hell do ants locate the food and they know to come? Do they have scouts in every building?"
] |
[
false
] | null |
[
"Yes, the ants have scouts.",
"Foraging ants will go out from the colony to scout for sources of food. When an ant finds a food source, it will turn around and return to the colony, leaving a trail of pheromones. These pheromones allow other ants to pick up the trail and find the food source. ",
"With every ant that uses the trail to get to the food source and back again, the level of pheromones is increased, making the trail more and more noticable for other ants in the colony. If the path becomes blocked or the food runs out, the ants return without food and don't leave any pheromones, which causes the trail to slowly dissipate.",
"This collective pathfinding behaviour of ants is quite fascinating. It also has applications in fields such as computer science. The so-called \"Ant Colony Optimization\" algorithm is an algorithm that mimics the behaviour of an ant colony that is trying to find the best path to a food source in order to solve pathfindings problems (or problems that can be translated into a pathfinding problem)."
] |
[
"this is a great explanation. do you know if when ants are killed their pheromones are released causing other ants to come? "
] |
[
"thanks for your response. "
] |
[
"Is there any reason why I shouldn't use a volumetric flask as a fractionating column?"
] |
[
false
] |
I have a bunch of the former and a few of the latter and I'd rather save the cash from the science budget.
|
[
"Nice try Mr. Home-Methlab-Guy"
] |
[
"haha LYE AND SUDAFED SON. But no really."
] |
[
"Meh. The flasks I prefer are made to fit a coat pocket."
] |
[
"Where does nature break down and choice of movement begin in microscopic creatures?"
] |
[
false
] |
On the atomic level, everything is just chemical reactions. At what point do these start turning into choices. For instance, On the cellular level, do they choose how their flagella spin to move? Do Viruses choose which cells to invade? Do they actually control their movements at that small of a scale or what?
|
[
"I'm going to share some of what I picked up in two quarters of biochemistry. The TL;DR is that when you're talking about things like cells, viruses, even organ systems, it's about feedback and feedback loops. A happens, A causes B, B causes C through G.",
"On a cellular level, there is guidance to what happens, but not perfect control, and not conscious control. Proteins have sequences that fold in predictable manners governed by thermodynamics. These proteins can be changed by reactions with other proteins, processed and altered, but reactions in the cell are still chemical reactions that depend on energy sources and favored directions of reaction. A lot of these things are controlled by moving compounds around in the cell, but again this is accomplished with specific pathways. Keep in mind that all of these processes are not accomplished by conscious choice, but by proteins, membranes, and other molecules that function according to the laws of physics. Our genetic code orchestrates all of this, but you can be sure that a strand of DNA isn't thinking, it's simply being read and transcribed.",
"Our bodies do a magnificent job of keeping us from reaching equilibrium, but the cells make no choices about it. Viruses don't choose what cells to infect, they move around the body and then they come in contact with the right type of cell and they attack. Your stomach doesn't choose to digest certain proteins, it releases enzymes that degrade the proteins that they contact."
] |
[
"On the cellular level, do they choose how their flagella spin to move?",
"I think an example would probably be illuminating here. ",
"In ",
", the bacterial flagella are ",
" rotating. The question is what direction (counter-clockwise rotation - forward swimming; clockwise rotation - causes tumbling). This is the behavior that is the end result of the ",
"bacterial chemotaxis",
" signaling cascade. Of course, it's been found that other environmental conditions can factor in - see, for example, ",
"this recent work",
" where glucose uptake can modulate the aforementioned chemosensory signaling. It is still chemistry, it's just becoming far more complex and subtle in its manifestations. "
] |
[
"Chemotaxis is probably the closest thing to 'choice of movement'. For example, if you've ever seen that video of the phagocyte chasing the bacteria (if not, go find it on Youtube cos it's ace), the phagocyte knows to chase the bacteria and the bacteria knows to run, because they can 'smell' eachother. The bacteria has complement factors and foreign antigens stuck to it that the phagocyte knows to attack, whilst the phagocyte is producing something the bacteria knows to avoid. Each has receptors for the other, which they move away from/towards.",
"Where that process becomes 'conscious' is largely up to you. I would argue everything we do is just a very complex cascade of chemotaxis."
] |
[
"If I were standing on Mars, would I be able to see the Earth and the Moon as two separate celestial bodies?"
] |
[
false
] |
Assuming that Earth is about the closest to Mars it can get. And if it wouldn't be possible , how strong would my telescope have to be to see them separately? Edit: I mean with the naked eye
|
[
"There's a lot of non-answers on here, so let me step in.",
"The distance from the Earth to the Moon is 385,000 km. According to Wikipedia, the closest Earth and Mars get in a given orbit is between 54 and 103 million km. Let's take the close value, 54 million.",
"The angular distance between the Earth and Moon in the Martian sky is therefore artan(385000/54000000)=24.28' arcminutes. The full moon is between 29 and 34 arcminutes depending on some factors. ",
"So, the distance between the Earth and the Moon, as seen from Mars, is just a bit under the diameter of the full Moon as seen from Earth - certainly far enough apart to distinguish them in the night sky. ",
"And yes, they would absolutely both be visible, just as Mercury is visible from Earth, even though it's similar to the Moon."
] |
[
"That picture is taken with a 50 cm telescope."
] |
[
"That picture is taken with a 50 cm telescope."
] |
[
"Why would 1.5 billion year old zircon crystals contain more helium than expected in radiometric dating tests?"
] |
[
false
] |
This is a and I decided to hold off for a few days to save it for my cake day. Please avoid having this turn into a religion vs science debate so that the wonderful mods don't get mad at me. The research from the group Radioisotopes and the Age of The Earth (RATE) makes the claim that far more Helium is found in 1.5 billion year old zircon crystals in granite than expected when performing Uranium based radiometric dating. Suggesting ages more along the lines of 6,000 years. Is there too much Helium found in Uranium dating? If so, why?
|
[
"Yay I do research on zircons so allow me to take a stab at answering this question:",
"The reason Uranium-Lead dating works so particularly well in zircons is because when the zircon forms it will take (practically) zero lead into its structure because lead is so uncomfortable in the crystal lattice. It does however love to take on Uranium so there is enough to produce a date.",
"This leads us to a simple point independent of helium production and systematics. If you have a zircon with some lead in it there is really only one way for that lead to get there and that is via radioactive decay. ",
"Uranium-Lead dating is no longer used to refer to just one dating scheme but usually 3. When we do U-Pb dating in our lab we produce data that allows for 206Pb/238U ages, 207Pb/235U ages, and 207Pb/206Pb ages. In a zircon that has not been exposed to high temperatures (which means little to no lead loss) those three ages will agree. That means if the decay constants are wrong and Earth is 6000 years old those decay constants would have to be wrong by exact amounts in order for those ages to work out correctly. Also we do not measure He when doing U-Pb dating because there are better ways to error check our results without using He (also measuring He is tricky our instrument (a SIMS) can't even measure it).",
"Now you might say well what about lead that is contaminating your zircon or formed in it for some unlikely reason, do you have a way to say how much there is of that? Yes it's called a common lead correction and it uses the isotope of lead that is not produced by radioactive decay (204Pb). Just looking at some data I took last week most of my samples had 99%+ of their lead from radioactive decay so this correction is usually not a huge deal.",
"Now if you're wondering why I've spent so much time not talking about helium it's because helium is really complicated to talk about and U-Pb dating can be defended without even considering it.",
"Helium is indeed a small atom that likes to diffuse but that diffusion is dependent on temperature and the distance it has to go is a function of crystal size and location of the atom from which it decayed. Now the reason for higher retentivity could be A) lower temperatures or B) a larger zircon. Pb losses do not happen until really high temperatures (north of 700C) and He will be lost earlier so if it is not this suggests the sample sat at low temperatures it will retain more He.",
"The big gripe I have however is that calculating total U and Pb in order to calculate how many decays happen is difficult because measuring the volume of a zircon is usually not done. The volume is usually assumed based off the length and width and the best shape that fits it. This usually works out OK for regularly shaped samples (ie nicely grown zircons) but it introduces some fairly large error bars in the estimated total He generated which would cast doubt on a simple interpretation. It also does not work and presents problems if the grains get broken up or have a very irregular shape!",
"Finally, I sort of hinted at it above but there is actually a thermometer called (U-Th)/He thermochronology which gets you the temperature and length of a heating event (with some assumptions). I can post a link to a paper on this if anyone is interested.",
"Just as a side comment finding an issue in one sample of zircons is not an impressive feat. I would guess U-Pb dating zircons is one of the most popular things for geochronologists to do and every year over 100k get dated. The issue I've left out of course is if this specific sample had some problem because I would need to read more about it. ",
"I hope that helps."
] |
[
"In order to answer your question I need to introduce saturation as a concept (perhaps not for you but for lots of other people).",
"Saturation concentration depends on temperature and the composition of the melt/liquid in which something is trying to be dissolved. For a simple and delicious experiment try to dissolve some sugar in a glass of iced tea and you will see that not much dissolves. If you then make a hot cup of tea you can dissolve a lot more sugar. The saturation concentration is the amount of stuff you can dissolve before it no longer dissolves (ie you still see sugar crystals in your iced tea). The composition dependence is a little harder to explain but basically sugar will dissolve in some liquids more than in other liquids.",
"For talking about zircon saturation in melts there are two parameters that matter A) Temperature and B) composition. Zirconium ions do not fit well into melts that are high in silicon (and aluminum but let's forget about that for now) but they will fit well into melts that already have a lot of other ions in them which destroy the structure of said melt. So if you have a very felsic melt (high in silica for example granite) the saturation concentration is very low so zircons will be made even if there is not a lot of zirconium. In a more mafic melt (lower in silica for the purposes of this answer) the saturation concentration is much much higher so zircons are relatively rare.",
"This means that as a practical matter a lot of the zircons that are made are made in granites simply because the composition of the melt does not like zirconium so it will form a lot of zircons."
] |
[
"In order to answer your question I need to introduce saturation as a concept (perhaps not for you but for lots of other people).",
"Saturation concentration depends on temperature and the composition of the melt/liquid in which something is trying to be dissolved. For a simple and delicious experiment try to dissolve some sugar in a glass of iced tea and you will see that not much dissolves. If you then make a hot cup of tea you can dissolve a lot more sugar. The saturation concentration is the amount of stuff you can dissolve before it no longer dissolves (ie you still see sugar crystals in your iced tea). The composition dependence is a little harder to explain but basically sugar will dissolve in some liquids more than in other liquids.",
"For talking about zircon saturation in melts there are two parameters that matter A) Temperature and B) composition. Zirconium ions do not fit well into melts that are high in silicon (and aluminum but let's forget about that for now) but they will fit well into melts that already have a lot of other ions in them which destroy the structure of said melt. So if you have a very felsic melt (high in silica for example granite) the saturation concentration is very low so zircons will be made even if there is not a lot of zirconium. In a more mafic melt (lower in silica for the purposes of this answer) the saturation concentration is much much higher so zircons are relatively rare.",
"This means that as a practical matter a lot of the zircons that are made are made in granites simply because the composition of the melt does not like zirconium so it will form a lot of zircons."
] |
[
"You have been transported to a planet somewhere else in the Milky Way. Is it possible to deduce where you are in relation to Earth? If so, how would you do it, and what equipment would you need?"
] |
[
false
] | null |
[
"Yep! By using pulsars as beacons. Each pulsar has a very particular spin period, no two are exactly the same and we know them to very precise values. We know accurate distances to relatively few of them, but enough that by identifying the positions of these pulsars on the sky, we could accurately determine our 3D position in the Milky Way by triangulation. This idea ",
"has been tested by NASA",
" already (but only locally). "
] |
[
"That's one way - the successful test I linked to was with an X-ray telescope called NICER.",
"You could also do something similar in a way that would be feasible from the ground on an alien world with optical telescopes but less useful for spacecraft navigation, by mapping the locations and distances of globular clusters, which are identifiable by their metallicity, radius, encounter rates, and age. "
] |
[
"Am I right in thinking that this doesn't work in general? As far as I know the Milky Way is poorly mapped beyond the galactic core because we have a hard time seeing through it. Do we know of many pulsars on the other side of the galaxy?"
] |
[
"When someone is diabetic, does that mean their bodies don't have the ability to produce insulin or is it their brains that don't give the signal to produce insulin?"
] |
[
false
] | null |
[
"Roughly speaking, type 1 generally means that their pancreas does not produce enough insulin and type 2 generally means that the body cells are resistant to insulin. Brain signals aren't part of the hormone regulation."
] |
[
"There are two types of diabetes:",
"Type 1 - (Usually in young people) your body produces antibodies which destroy the cells which produce insulin. So basically you have deficiency of insulin. ",
"Type 2 - (Usually in the elderly) your cells are resistant to insulin. This means they lack membrane proteins which allow insulin to transfer glucose inside the cells. So you have insulin (even more than normal) however it cannot perform its function."
] |
[
"It can become involved in late type 2. With the cells becoming resistant, the brain signals for more and more insulin production until it reaches a point where the regulation arc stops working. Thus, the type 2 becomes insulin-dependant in addition to insulin-resistance.\nTo be precise it is actually the whole regulation arc, not only the cerebral part, but... It's the nearest to what the post asks. "
] |
[
"How far is humanity from creating a Jupiter Brain or Matrioshka Brain?"
] |
[
false
] | null |
[
"Thousands of years."
] |
[
"I heard one scientist say that one of the solutions to the low temperature requirement of quantum computers was to build one at low temperature, then use it to figure out how to make one at room temperature.",
"(his name was Chetan Nayak if anyone is interested)"
] |
[
"My organic computer system struggles to calculate the gratuity on a takeaway curry. Aim higher."
] |
[
"How does your adrenal gland \"know\" that you are scared and that it should release epinephrine?"
] |
[
false
] |
Edit: Sure, the brain sends a signal to the adrenal gland. But how does the gland "know" that this signal means "oh, you should release more adrenaline now"?
|
[
"The section of the adrenal gland that secretes adrenaline is the adrenal medulla. The adrenaline-releasing cells there are the chromaffin cells. Nerve cells from the central nervous system (brain and spinal cord) extend to the medulla",
" and \"synapse\" with the chromaffin cells (\"synapse\" just means that the end of the nerve cell is ",
" next to the chromaffin cell). When an action potential (i.e. a \"signal\" or \"impulse\") travels along these nerve cells, it causes a chemical called ACh to be released at the synapses. This chemical then binds to receptors on the outside of the chromaffin cells, causing them to release adrenaline into the blood. Sorry if this explanation is a bit ELI5 - alternatively feel free to ask if it's not ELI5 enough!"
] |
[
"Now determining how that input fires at the appropriate time is a lot more complicated!"
] |
[
"The inner part of the adrenal gland is different from the other glands in your body that release hormones into the blood stream. It receives direct neural input from the brain to release \"adrenaline\" (norepinephrine and epinephrine as they're called in the US). It's a sort of gland/nerve hybrid."
] |
[
"Is electrical tape safe for daily skin contact?"
] |
[
false
] | null |
[
"But doesn't PVC stand for polyvinyl chloride?"
] |
[
"OH DEAR GOD DON'T TOUCH THAT SHIT I WAS WRONG SAVE YOURSELF"
] |
[
"PVC? Poly vinyl chlorate? No.",
"\nYou'd have to set it on fire and inhale the fumes at a high concentration.\nDaily skin contact will not give you cancer. You could swallow some and have no ill effects."
] |
[
"Why are there more incidences of cancer in developed nations."
] |
[
false
] |
Source:
|
[
"Better medical care means better documentation of cancer.",
"It's not that developing nations don't get cancer, it's that, with all the shit going on there, knowing who has cancer is the least of their worries."
] |
[
"People live longer. Cancer generally arises in older people, so when the expected longevity increases, so do cancer rates."
] |
[
"Also, in a developed nation, you're less likely to die of something else before getting cancer."
] |
[
"When someone donates a pint of blood, how long does the body take to replace it? Are there any health advantages to donating blood? Does it lower blood pressure directly afterwards?"
] |
[
false
] | null |
[
"Are there any health advantages to donating blood?",
"One of my uncles has to attend an outpatients clinic once a month to have a pint of blood taken from him. He suffers from a condition known as ",
"haemochromatosis",
" which means the iron levels in his blood are higher than in an average person. The treatment help to mitigate the negative effects. The blood is unsuitable for transfusions though as AFAIK it's destroyed."
] |
[
"The blood plasma is replaced in a few days. The red blood cell count is fully restored on average, in 36 days, but range varies give or take two weeks of that average. It's why you must wait 8 weeks between donations.",
"It does lower blood pressure, but I'm sure it's not for long since you replace blood plasma so quickly. The only well founded health advantage of donating blood is for those with iron overload, a genetic disease. ",
"I'd like to believe, by donating often, my body is better and quicker at replacing lost RBCs, and my body would handle heavy blood loss better, incase of some accident. I doubt there's merit to this, so don't hold my word for this wishful speculation. "
] |
[
"It does lower blood pressure, but I'm sure it's not for long ",
"Your body can also regulate blood pressure through constricting or expanding your blood vessels."
] |
[
"Is there any evidence that second hand smoke is health risk outdoors?"
] |
[
false
] |
My school just banned smoking on everywhere on campus, no designated smoking areas at all and a $150 fine. A lot of places are doing this but it doesn't make any sense that second hand smoke could be harmful to someone 20 feet away in a completely open outdoor environment, especially with everything else in the air. Is there any research that says I'm wrong?
|
[
"Can you show any actual evidence for that? Is it riskier than a barbecue? A car? A candle? A gas stove?"
] |
[
"I'm sorry, but this is all anecdotal. You aren't providing sources. I'd provide my own, but I'm currently at work and unable to.",
"If someone would be so kind, there are several studies (I believe most prominently by the EPA) on this that have shown that ZERO (rather, statistically insignificant) risk is found with second-hand smoke. From what I understand, these studies were ignored when the public went on their crusade against second-hand smoking (in the US).",
"From what I understand, Penn and Teller did an episode on their show Bullshit! which went over this very thing.",
"Don't take all that the wrong way, though. I am a smoker, but I keep away from the general public when I am smoking. That's just polite. All that being said, polycyclic aromatic hydrocarbons are NOT good for the health of your lungs.",
"EDIT: So I did a little snooping. I found that in 1992 the EPA says that secondhand smoke causes lung cancer. About 3000 non-smoking adult Americans die each year from it. That was pretty widely disputed, and in 1998 was legally vacated by a federal judge. ",
"Here's a good article",
"The reason I care so much about this: \"Millions of dollars have been spent promoting belief in SHS as a killer, and more millions of dollars have been spent by businesses in order to comply with thousands of highly restrictive bans, while personal choice and freedom have been denied to millions of smokers. Finally, and perhaps most tragically, all this has diverted resources away from discovering the true cause(s) of lung cancer in nonsmokers.\""
] |
[
"A quick Google revealed this: ",
"Exposure to Secondhand Smoke Outside of a Bar and a Restaurant and Tobacco Exposure Biomarkers in Nonsmokers"
] |
[
"Did whales and hippos inherit aquatic birth from a common ancestor, or did they each evolve it separately? And why do some marine mammals, like sea otters, have aquatic birth, but others, like seals and sea lions, don't?"
] |
[
false
] | null |
[
"Did whales and hippos inherit aquatic birth from a common ancestor, or did they each evolve it separately?",
"They come by it seperately",
"And why do some marine mammals, like sea otters, have aquatic birth, but others, like seals and sea lions, don't?",
"This is going to come down to some combination of physiology and ecology: is it safer to give birth on land or in the water? Are you ",
" of giving birth on land or in the water?",
"I'll note that sea otters are capable of giving birth on both land and in the kelp."
] |
[
"Do we really know that stem-whales weren't giving birth aquatically? That would push aquatic birth back to Whippomorpha."
] |
[
"Eh, that's actually a pretty good point I suppose. "
] |
[
"What happens when water condenses on a hydrophobically coated object?"
] |
[
false
] |
E.g. Spray a bottle of beer with neverwet, stick it in the fridge for a while then take it out in a high humidity climate. Does the water precipitate on the bottom and slide off quickly? Edit: It might behoove me to ask if the shape of the object matters e.g. a glass sphere vs something irregular like a small metal statue.
|
[
"Hydrophoby is related to wetting angle, it is not pushing water away like magnet pushing metal. If the object is very hydrophobic, water forms more round droplets rather than splashes, and so it would form droplets and very likely fall/roll off the surface. This is how some plants leaves, such as aloe, are cleaned.",
"\nYou can find more abt it here:\n",
"https://en.wikipedia.org/wiki/Superhydrophobe"
] |
[
"It also makes it harder for the water to condense, because the first few molecules don't have have a hydrophilic surface attach to. This makes it harder to form a microscopic drop (nucleate) which can then grow into a larger drop.",
"Edit: grammar"
] |
[
"If this is the case and not what MoltenSlag says, what happens to the water/energy?"
] |
[
"Does modern day cryogenics keep the body intact, or does it irreparably destroy the body?"
] |
[
false
] | null |
[
"modern day cryogenics is, sadly, something used to steal money from rich people such as Walt Disney.",
"Like throwawydow has said, cells are damaged by freezing.",
"In the laboratory we have products such as DMSO and glycerol which we use to stop cells from freezing conventionally when at very very low temperatures (such as -80°C) but when you are unfreezing mammalian cells, about 80%-90% of them die.",
"Also DMSO is not good for you so we can't really put that in people or they will get sick. Plus it smells like rotten cabbage. (I don't think it is 100% toxic, but it certainly does make dangerous chemicals which would otherwise be safe, much more permeable to our skin).",
"Tl;dr",
"yes it appears to irreparably destroy the body."
] |
[
"Cryonics relies on ",
" hopes.",
"1) The technology to cure whatever killed you will be developed.",
"2) Most important The tech to restore your body and revive you from the freezing process will be developed. ",
"They realise that #2 is the more difficult (well some do) and that if cancer were cured today then no one previously frozen would be thawed out, because we can't revive them (and may never be able to)",
"This said if you have lots of money, say millions then this is just the ultimate longshot bet, with rather good odds. If you win you live. If you loose your still dead and won't be missing the money anyway. So if you have it to waste why not? There is that 1% chance you win. "
] |
[
"It's an interesting rumor - Walt Disney was never cryogenically frozen. The technology came out at pretty much the same time he died, and the rumor mill started turning....",
"http://en.wikipedia.org/wiki/Walt_Disney_hibernation_urban_legend"
] |
[
"When physicians talk about 'information', what do they mean?"
] |
[
false
] |
I have heard it said that "information cannot be lost in a black hole" and a hypothesis that in the beginning there was only information. What is meant by information in this context?
|
[
"Physicists*"
] |
[
"I think an easy way to think of it is to realize that a black hole is not an electron. Nor a proton. Nor an atom. It's not matter in any conventional sense of the word. It has the energy of mass, often the energy of rotation, and perhaps the energy of being charged. So what happens regarding all the electrons and protons and everything that falls in? What happens to the distinguishing features of these particles? The black hole singularity can't have them.",
"The proposed answer is \"Black Hole Complimentarity.\" The idea that since, to outside observers, all the matter gets frozen on the event horizon, then those distinguishing features never fell in either. "
] |
[
"Quantum state information. Spin, for example. Spin is conserved. So when a fermion falls into a black hole, its intrinsic angular momentum can't just ",
"I'm not sure what \"in the beginning there was only information\" is supposed to mean. I think it's either tautological or gibberish."
] |
[
"If inflammation is the body's immune response to an injury--why is it recommended to reduce inflammation with ice/NSAIDS?"
] |
[
false
] |
Pretty much all in the title. When I injure a muscle or tendon the first recommendation I come across is to ice the area / take a non-steroidal anti-inflammatory drug (ibuprofen!). Are these simply to reduce the symptoms of pain? or do they actually promote healing?
|
[
"Tendons and ligaments tend to have very little blood supply naturally (which is part of why they take so long to heal). Inflammation can create pressure which hampers what blood supply there is and can lead to a further hypoxic injury of the tissue.",
"As for why we have evolved this way, I could only speculate, so I won't. I hope someone else might be able to explain what benefit the inflammation response to trauma gives us.",
"Reduction of blood loss? ",
" I promised I wouldn't..."
] |
[
"I think that inflammation reduces the risk of infection. That fits with increased temperature and decreased blood flow. Modern environments are clean enough that it's not a big worry, so it's more important to prevent permanent injury."
] |
[
"So the first comment (by hematose) says that inflammation restricts bloodflow, the second comment (by thenumber42) says that inflammation increases bloodflow. This is why I love Reddit."
] |
[
"What type of hardware is used to render amazing CGI projects like Avatar: Way of the Water? Are these beefed up computers, or are they made special just for this line of work?"
] |
[
false
] | null |
[
"I have previously worked in video effects post-production but I have had no involvement in the production of either 'Avatar' movie and have not seen 'Avatar 2':",
"Fundamentally you could use any sort of commodity computer to render these effects, but the more powerful it is the quicker it can work. Even for the most powerful computers with the best graphics ability available you may still be looking at it taking many hours to render a single frame. If your movie is 24 frames a second and it takes, say 20 hours to render a frame, you can see that it soon becomes impractical to make and tweak a good visual storyline in a reasonable amount of time.",
"Enter the render farm: here you have a render farm and a job manager that can split the work out and send different parts of it to different computers. You might even split each single frame into different pieces for rendering on different computers. This way you can parallelize your work, so if you split your frame into 10 pieces, rather than it taking 20 hours to render it will take 2. ",
"Your job manager also needs to take account of what software, with what plugins, and what licences is available on each available node (computer in your render farm) and collating the output into a finished file.",
"If you have a lot of video effects in your movie, you are going to need a lot of computer time to render them, and for something that's almost entirely computer generated, you're going to need a massive amount of resources. Typically you will want to do this on a Linux farm if you can because it's so much simpler to manage at scale.",
"If you want to find out more about some of the software commonly used, you could look up:",
"nuke studio",
"Maya",
"Houdini",
"Deadline",
"These are just examples, and there are alternatives to all of them but Maya and Houdini would commonly be run on both workstations and render nodes to do the same job"
] |
[
"They recently announced they used AWS to render the movie.",
"https://www.datacenterdynamics.com/en/news/avatar-the-way-of-water-was-rendered-in-amazon-web-services/"
] |
[
"Thank you for that. Completely new information for me.",
"And it makes complete sense, that is an area where AWS (or other cloud products) excels: elastic compute capacity. The fact that AWS seemingly had enough compute capacity “just laying around” in Australia to handle Weta’s needs is mind-boggling to me, so I have to believe Weta gave Amazon time to increase it before throwing the entire load at them. (It says a deal was struck in 2020 but clearly they started long before then…)"
] |
[
"If a person loses their dominant hand, will their other hand ever gain the dexterity of the lost limb?"
] |
[
false
] |
On a related note, if somebody is born without the hand that would otherwise be dominant due to a birth defect, will their remaining hand be clumsier than normal? Does that question even make any sense? Thanks, experts!
|
[
"this is an empirical question, not a theoretical one, because dexterity is defined empirically. and because of the limited number of people to which it applies, anecdotal evidence is appropriate.",
"a friend of mine had his right arm badly injured in a car accident when he was a kid. so he had to start doing almost everything left-handed. a decade later, he was very proficient, but you could still clearly tell that he wasn't as dexterous (even as, say, an 8 year old using their natural hand). writing, typing, eating, you name it. of course practice makes you much better. but to me this is explicit evidence that one does not fully gain the dexterity of their original dominant hand. no amount of other people who might have gotten slightly better can disprove this empirical observation.",
"edit: to the mods: unless you understand why it's inappropriate to use a fixed effect statistical analysis on data of this nature, you shouldn't be removing this comment for being anecdotal."
] |
[
"the problem is, unless you had very specific measures, from that person, on how skilled they were at specific tasks before they lost the use of their dominant hand, you can't conduct a proper experiment. how precise would their motor control be at age 50 with their right hand? there's no way to know. so you can't do the comparison. it has to be a between-subjects design, and you need a very large sample."
] |
[
"In principle it could be answered empirically, possibly. I don't know what the right measure would be. But maybe someone could do a longitudinal study of people forced to use their non-dominant hands, and then look at some objective measures of performance, like writing speed or other fine motor tasks. I don't have the answer to whether these studies have been undertaken.",
"In this particular case, I find a case-study can be helpful in enlightening aspects of the question.",
"if you're asking whether something is scientific if it is not a theoretical issue: there are many many scientific endeavors that are not strictly theoretical. observing primates or other animals to study their behavior can be scientific but not theoretical per se. collecting observations is very important for building up a body of reliable knowledge. the more repeatable the observations, the better. but that doesn't mean that single observations can't be enlightening and helpful."
] |
[
"How would the Bloch vector evolve for a transition to virtual energy level?"
] |
[
false
] | null |
[
"There are different ways that the phrase “virtual energy level” could be interpreted. Can you clarify what you mean?"
] |
[
"So you mean intermediate states in a time-dependent perturbation theory expansion?"
] |
[
"If you transition into one of these states (as in the state vector becomes that state in the limit where t goes to infinity), then it’s an asymptotic state rather than a virtual intermediate state.",
"I don’t see how you even could have anything like that in a two-level system. Unless you mean the perturbation series of the form",
"(lower -> uppper) + (lower -> upper -> lower -> upper) + ... ."
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.