text
stringlengths
3
1.05M
exports.seed = async function (knex) { // Deletes ALL existing entries await knex("items").del(); await knex("items").insert([ { item_id: 1, item_name: "Shroom Variant One", item_blurb: "This is a blurb describing the scroom variant, a little bit of info to get the custy clicking.", ...
mycallback( {"CONTRIBUTOR OCCUPATION": "", "CONTRIBUTION AMOUNT (F3L Bundled)": "2500.00", "ELECTION CODE": "G2010", "MEMO CODE": "", "CONTRIBUTOR EMPLOYER": "", "DONOR CANDIDATE STATE": "", "CONTRIBUTOR STREET 1": "Post Office Box 1254", "CONTRIBUTOR MIDDLE NAME": "", "DONOR CANDIDATE FEC ID": "", "DONOR CANDIDATE MID...
from cx_Freeze import setup, Executable # Dependencies are automatically detected, but it might need # fine tuning. buildOptions = dict(packages = [], excludes = []) import sys base = 'Win32GUI' if sys.platform=='win32' else None executables = [ Executable('WordGuesserHelper.py', base=base) ] setup(name='Word G...
#The MIT License (MIT) #Copyright (c) 2015 bpyamasinn. #Permission is hereby granted, free of charge, to any person obtaining a copy #of this software and associated documentation files (the "Software"), to deal #in the Software without restriction, including without limitation the rights #to use, copy, modify, merge...
import pytest from pytest import approx import subprocess import igrf time = "2010-07-12" def test_bad_date(): with pytest.raises(RuntimeError): igrf.igrf("2500-01-01", 65, 80, 0) def test_igrf13(): mag = igrf.igrf(time, 65, 85, 0) assert mag.north.item() == approx(9295.415460) assert mag...
#!/usr/bin/env python3 # Copyright 2019 IBM Corp. # # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless requir...
#!/usr/bin/env python3 # Copyright (c) 2015-2018 The Bitcoin Core developers # Distributed under the MIT software license, see the accompanying # file COPYING or http://www.opensource.org/licenses/mit-license.php. ''' This checks if all command line args are documented. Return value is 0 to indicate no error. Author:...
"""A task_utils package. """ # Always prefer setuptools over distutils from setuptools import setup, find_packages # To use a consistent encoding from codecs import open from os import path here = path.abspath(path.dirname(__file__)) # Get the long description from the README file with open(path.join(here, 'README.r...
module.exports = { port: 8888, env: 'dev' }
# -*- coding: utf-8 -*- # Generated by Django 1.9.6 on 2016-07-04 04:33 from __future__ import unicode_literals import django.core.validators from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('users', '0001_initial'), ] operations = [ migr...
/* * Copyright 2010-2017 Amazon.com, Inc. or its affiliates. All Rights Reserved. * * Licensed under the Apache License, Version 2.0 (the "License"). * You may not use this file except in compliance with the License. * A copy of the License is located at * * http://aws.amazon.com/apache2.0 * * or in the "license" fil...
/* Copyright 2007-2015 QReal Research Group * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or...
/** * Auto-generated action file for "Microsoft Graph API" API. * * Generated at: 2019-08-07T14:53:12.910Z * Mass generator version: 1.1.0 * * flowground :- Telekom iPaaS / microsoft-graph-api-connector * Copyright © 2019, Deutsche Telekom AG * contact: flowground@telekom.de * * All files of this connector ar...
var group__l3gd20h__link__driver = [ [ "DRIVER_L3GD20H_LINK_DEBUG_PRINT", "group__l3gd20h__link__driver.html#gad894c8654ccab82dfa3cce2188793c44", null ], [ "DRIVER_L3GD20H_LINK_DELAY_MS", "group__l3gd20h__link__driver.html#ga2456ba670a8c970abc730b7d7272f529", null ], [ "DRIVER_L3GD20H_LINK_IIC_DEINIT", "gro...
#!/usr/bin/python # # Copyright 2018-2022 Polyaxon, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable ...
from django.apps import AppConfig class PostConfig(AppConfig): name = 'post'
"""Utilities for emulation_system tests.""" import os import pytest from emulation_system.opentrons_emulation_configuration import ( OpentronsEmulationConfiguration, SourceDownloadLocations, ) def get_test_configuration_file_path() -> str: """Returns path to test file.""" return os.path.join( ...
# Copyright 2011 OpenStack LLC. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required b...
/* * For a detailed explanation regarding each configuration property, visit: * https://jestjs.io/docs/configuration */ module.exports = { // All imported modules in your tests should be mocked automatically // automock: false, // Stop running tests after `n` failures // bail: 0, // The directory where ...
from typing import Container, Sequence import string #============================================================================== """ Implementation of the phone number mnemonics. - [EPI: 6.7]. """ def phone_mnemonic(phn_num: str) -> Container[Sequence]: def _phone_mnemonics(phn_num: str, ...
from __future__ import absolute_import from ..utils import walk from ..scan import Dispatcher from ..spec.v2_0.objects import ( Schema, Parameter, Response, PathItem, ) from ..spec.v2_0.parser import ( SchemaContext, ParameterContext, ResponseContext, PathItemContext, ...
const Storage = require('minio') require("dotenv").config({ path: '../.env' }) const config = require('./config') // console.log( config.storage ) config.storage.endPoint = 'localhost' var storage = new Storage.Client( config.storage ) // File that needs to be uploaded. // var file = './config.js' // var file = '/U...
from entityfx.linpack import Linpack from entityfx.benchmark_base import BenchmarkBase from entityfx.writer import Writer class ParallelLinpackBenchmark(BenchmarkBase): def __init__(self, writer: Writer, print_to_console : bool=True, is_enabled : bool=True) -> None: super().__init__(writer, print_to_conso...
/** \file * \brief iup_pplot Binding for Lua. * * See Copyright Notice in iup.h */ #ifndef __IUPLUA_PPLOT_H #define __IUPLUA_PPLOT_H #ifdef __cplusplus extern "C" { #endif #ifdef LUA_NOOBJECT /* Lua 3 */ int iup_pplotlua_open(void); #endif #ifdef LUA_TNONE /* Lua 5 */ int iup_pplotlua_open(lua_State* L); #e...
from typing import Any, Dict, Union import os import sys import time import torch import logging from omegaconf import DictConfig from .checkpointer import Checkpointer from ..events import Events from ..callback import Callback, handle_event from ....distributed import get_rank logger = logging.getLogger("checkpoint...
const fse = require('fs-extra'); const { Observable } = require('rx'); const { commonREs, titleify, info, readDir, pagesDir } = require('../utils'); const { httpsRE, isAStubRE, markdownLinkRE } = commonREs; function appendStub(path) { const pathArr = path.split('/'); const filePath = pathArr .slice(pathArr.i...
#!/usr/bin/python # -*- coding: utf-8 -*- from .interface import *
# -*- coding: utf-8 -*- ''' This is a PyTorch implementation of CURL: Neural Curve Layers for Global Image Enhancement https://arxiv.org/pdf/1911.13175.pdf Please cite paper if you use this code. Tested with Pytorch 1.7.1, Python 3.7.9 Authors: Sean Moran (sean.j.moran@gmail.com), 2020 ''' import matplotlib matplot...
import express from 'express'; import bodyParser from 'body-parser'; import morgan from 'morgan'; import http from 'http'; import dbmodels from 'bt-mongodb'; import cors from 'cors'; import router from './router'; import websocket from './websocket'; import mobileN from './mobile-notifier'; const conf = require('./con...
/* * Copyright (c) 2001 by David Brownell * * This program is free software; you can redistribute it and/or modify it * under the terms of the GNU General Public License as published by the * Free Software Foundation; either version 2 of the License, or (at your * option) any later version. * * This program is...
#pragma once #include <opencv2/opencv.hpp> #include "Poco/URIStreamOpener.h" #include "Poco/StreamCopier.h" #include "Poco/Path.h" #include "Poco/URI.h" #include "Poco/Exception.h" #include "Poco/SharedPtr.h" #include "Poco/Net/HTTPStreamFactory.h" #include "Poco/Net/HTTPSStreamFactory.h" #include "Poco/Net/FTPStreamF...
export default class FormComponent { constructor(component, dataContext) { this.component = component; this.dataContext = dataContext; } async accept(visitor) { visitor.visit(this); } }
import time import datetime import os import requests from project.server.main.feed import harvest_and_insert from project.server.main.logger import get_logger logger = get_logger(__name__) def create_task_harvest(arg): collection_name = arg.get('collection_name') if collection_name: harvest_and_inse...
from __future__ import annotations import time from slack_sdk.web.client import WebClient from slack_sdk.web.slack_response import SlackResponse from . import templates class Message: def __init__(self, token: str, channel: str = ""): """Post ``message`` template to slack. Note: - Y...
# coding=utf-8 # -------------------------------------------------------------------------- # Copyright (c) Microsoft Corporation. All rights reserved. # Licensed under the MIT License. See License.txt in the project root for license information. # Code generated by Microsoft (R) AutoRest Code Generator. # Changes may ...
deepmacDetailCallback("0050c2741000/36",[{"a":"Dongmun Vision Building, Sinjeong 6-dong, Yangcheon-gu, Seoul Yangcheon-gu, KR 158-740","o":"Dain","d":"2008-07-30","t":"add","s":"ieee","c":"KR"}]);
from dx.share import add_props_to_ns, validate_roman_numeral, roman2int from .symbol_formatting import RegexMatchable, SymbolGroup from .soup_postprocessing import listpager from traceback import print_tb class TocChapNum(RegexMatchable): def __init__(self, ch_num_substr): self.substr = ch_num_substr # Sto...
x = { ['method'](): void -> a b }
dojo.provide("dojo.nls.dojo-ext_pl");dojo.provide("dojo.nls.colors");dojo.nls.colors._built=true;dojo.provide("dojo.nls.colors.pl");dojo.nls.colors.pl={"lightsteelblue":"jasnostalowoniebieski","orangered":"pomarańczowoczerwony","midnightblue":"granatowoczarny","cadetblue":"niebieskoszary","seashell":"matowoliliowy","sl...
import numpy as np from openmdao.core.group import Group from openmdao.core.component import Component from openmdao.solvers.newton import Newton # from scipy.optimize import brentq from pycycle.constants import AIR_MIX from pycycle.thermo_static import SetStaticMN from pycycle import species_data from pycycle.flows...
'use strict' const mongoose = require('mongoose'); const Schema = mongoose.Schema; const bcrypt = require('bcrypt-nodejs'); const CourseEmbeddedTutorSchema = new Schema({ courseId: { type: Schema.Types.ObjectId, required: true }, gpa: { type: Number }, score:{ type: Number }, in...
from thinplate.hybrid import * try: import torch import thinplate.pytorch as torch except ImportError: pass __version__ = '1.0.0'
# Use of this source code is governed by the MIT license. __license__ = "MIT" from collections import defaultdict import itertools import sys from bs4.element import ( CharsetMetaAttributeValue, ContentMetaAttributeValue, Stylesheet, Script, TemplateString, nonwhitespace_re ) __all__ = [ '...
/** * \file * * \brief Component description for TCC * * Copyright (c) 2014 Atmel Corporation. All rights reserved. * * \asf_license_start * * \page License * * Redistribution and use in source and binary forms, with or without * modification, are permitted provided that the following conditions are met: *...
export default { elem: 'svg', attrs: { xmlns: 'http://www.w3.org/2000/svg', viewBox: '0 0 32 32', width: 32, height: 32, }, content: [ { elem: 'path', attrs: { d: 'M4 21v2h3.586L2 28.586 3.414 30 9 24.414V28h2v-7H4z' }, }, { elem: 'path', attrs: { d: ...
'use strict'; Object.defineProperty(exports, "__esModule", { value: true }); var _react = require('react'); var _react2 = _interopRequireDefault(_react); var _CreateSvgIcon = require('./utils/CreateSvgIcon'); var _CreateSvgIcon2 = _interopRequireDefault(_CreateSvgIcon); function _interopRequireDefault(obj) { re...
// // Created by Federico Pagnozzi on 28/11/14. // Copyright (c) 2014 Federico Pagnozzi. All rights reserved. // This file is distributed under the BSD 2-Clause License. See LICENSE.TXT // for details. #ifndef GENERALPARSER_H #define GENERALPARSER_H #include "emilibase.h" /** * All the classes that are involved in...
var margin = {top: 53, right: 20, bottom: 30, left: 40}, width = 400 - margin.left - margin.right, height = 285 - margin.top - margin.bottom; var x = d3.scale.ordinal() .rangeRoundBands([0, width], .1, 1); var y = d3.scale.linear() .range([height, 0]); var xAxis = d3.svg.axis() .scale(x) .ori...
# -*- coding: utf-8 -*- # Copyright 2020 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law o...
module.exports = { testURL: 'http://localhost/', testEnvironment: 'jsdom', reporters: ['default', ['jest-junit', { output: './coverage/tests-report.xml' }]], preset: "ts-jest", testEnvironment: "jsdom", testPathIgnorePatterns: [ "dist/*" ], moduleDirectories: [ 'node_modules', './' ], mo...
"use strict"; var __awaiter = (this && this.__awaiter) || function (thisArg, _arguments, P, generator) { function adopt(value) { return value instanceof P ? value : new P(function (resolve) { resolve(value); }); } return new (P || (P = Promise))(function (resolve, reject) { function fulfilled(value) { t...
import logging import traceback from dexbot.ui import translate_error from .ui.error_dialog_ui import Ui_Dialog from dexbot.qt_queue.idle_queue import idle_add from PyQt5 import QtWidgets, QtCore class PyQtHandler(logging.Handler): """ Logging handler for Py Qt events. Based on Vinay Sajip's DBHandler c...
import ast import io import textwrap import token import tokenize import traceback from types import CodeType from typing import Any, Dict, Iterable, List, Sequence, Tuple from .util import debug, NoMoreRecords def _split_last_statement(tokens: Iterable[tokenize.TokenInfo], prog: str) -> Tuple[int, int]: def _li...
# SPDX-License-Identifier: Apache-2.0 # Copyright 2020, 2021 igo95862 # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # http://www.apache.org/licenses/LICENSE-2.0 # Unless required by appli...
from dataclasses import dataclass from typing import List, Set from kgdata.wikidata.models.wdentity import WDEntity from kgdata.wikidata.models.multilingual import ( MultiLingualString, MultiLingualStringList, ) @dataclass class WDClass: __slots__ = ( "id", "label", "description"...
// // Generated by class-dump 3.5 (64 bit). // // class-dump is Copyright (C) 1997-1998, 2000-2001, 2004-2013 by Steve Nygard. // #import "NSObject.h" #import "PLPhotoLibraryPathManager.h" @class NSString, NSURL, PLFileSystemCapabilities; @interface PLPhotoLibraryPathManagerCore : NSObject <PLPhotoLibraryPa...
# -*- coding: utf-8 -*- # Copyright 2020 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law o...
# -*- coding: utf-8 -*- from __future__ import unicode_literals from frappe import _ import frappe def get_data(): return [ { "label":_("Transaction"), "items":[ { "type":"doctype", "label":_("Lead"), "name":"Lead" ...
#!/usr/bin/env python3 # -*- coding: utf-8 -*- # Author: Bertrand256 # Created on: 2018-03 import sys import re from typing import Optional import simplejson import logging from PyQt5.QtCore import pyqtSlot from PyQt5.QtWidgets import QDialog, QMessageBox from decimal import Decimal from bitcoinrpc.authproxy import ...
/* @flow */ import config from '../config' import { noop } from 'shared/util' export let warn = noop export let tip = noop export let generateComponentTrace = (noop: any) // work around flow check 生成组件堆栈 export let formatComponentName = (noop: any) //格式化组件名 if (process.env.NODE_ENV !== 'production') { const hasCo...
from django.urls import path from . import views app_name = "tasks" urlpatterns = [ path("", views.index, name="index"), path("add/", views.add, name="add") ]
/** * * @Description 邮件发送 * 调用方法:sendMail('994718917@qq.com','这是测试邮件', 'Hi miqilin,这是一封测试邮件'); * @Author miqilin * @Created 2020/04/05 15:10 * 技术只是解决问题的选择,而不是解决问题的根本... * */ const nodemailer = require('nodemailer') const smtpTransport = require('nodemailer-smtp-transport') const config = { email: { servi...
# coding:utf-8 """ @author : linkin @email : yooleak@outlook.com @date : 2018-10-04 """ import logging import time from inspect import isfunction from components.crawlers import builtin_crawlers from config.config import COLLECT_TIME_GAP from custom.custom import my_crawlers from tools.threads impor...
from episod_lib import get_all_episod, printe # -------------------------------------------------------- def epirule_equals(source, new): if len(source) is not len(new): return False for index in range(len(source)): src_sym = source[index] new_sym = new[index] if src_sym is not...
/* Licensed to the Apache Software Foundation (ASF) under one or more contributor license agreements. See the NOTICE file distributed with this work for additional information regarding copyright ownership. The ASF licenses this file to you under the Apache License, Version 2.0 (the "License"); you may not use ...
# -*- coding: utf-8 -*- import numpy as np from .signal_formatpeaks import _signal_formatpeaks_sanitize from .signal_interpolate import signal_interpolate def signal_period(peaks, sampling_rate=1000, desired_length=None, interpolation_order="cubic"): """Calculate signal period from a series of peaks. Parame...
""" Tests for DataFrame.mask; tests DataFrame.where as a side-effect. """ import numpy as np from pandas import DataFrame, isna import pandas._testing as tm class TestDataFrameMask: def test_mask(self): df = DataFrame(np.random.randn(5, 3)) cond = df > 0 rs = df.where(cond, np.nan) ...
# -*- coding: utf-8 -*- #!/usr/bin/env python # # Copyright 2015,2016,2017,2018 Daniel Fernandez (daniel@dfmd.mx), Saul Pilatowsky (saul@dfmd.mx) # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the Licens...
# encoding: utf-8 import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding field 'OpinsysAuthProvider.school' db.add_column('opinsys_opinsysauthprovider', 'school', self.gf...
export default{ label:'margin-vertical', isResponsive:true, prefix:'my', isStepAsLabel:true, steps:['0','1','2','3','4','5'] }
module.exports=[' ','\xA0','\u1680','\u180E','\u2000','\u2001','\u2002','\u2003','\u2004','\u2005','\u2006','\u2007','\u2008','\u2009','\u200A','\u2028','\u2029','\u202F','\u205F','\u3000']
"use strict"; var __decorate = (this && this.__decorate) || function (decorators, target, key, desc) { var c = arguments.length, r = c < 3 ? target : desc === null ? desc = Object.getOwnPropertyDescriptor(target, key) : desc, d; if (typeof Reflect === "object" && typeof Reflect.decorate === "function") r = Refl...
import subprocess import argparse def get_args(): params = argparse.ArgumentParser() params.add_argument('--rom', help="specified modified BIOS rom", required=True) params.add_argument('--extractor', help='specified Modified version UEFIExtract path') return params.parse_args() def get_digests(cmd):...
var structsys__fstatat__args = [ [ "buf", "d9/d5d/structsys__fstatat__args.html#a6783f510ae899c37a1c99d55edc6461d", null ], [ "buf_l_", "d9/d5d/structsys__fstatat__args.html#a2a2e0cc51edb4a3c726e64af9635e18b", null ], [ "buf_r_", "d9/d5d/structsys__fstatat__args.html#a23029210abe9ad0de139937db7d40161", null...
""" .. See the NOTICE file distributed with this work for additional information regarding copyright ownership. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache....
(self.webpackChunkdocusaurus_template=self.webpackChunkdocusaurus_template||[]).push([[28775],{3905:function(e,t,r){"use strict";r.d(t,{Zo:function(){return u},kt:function(){return m}});var n=r(67294);function o(e,t,r){return t in e?Object.defineProperty(e,t,{value:r,enumerable:!0,configurable:!0,writable:!0}):e[t]=r,e...
#!/usr/bin/env python3 # Print out all the codons for the sequence below in reading frame 1 # Use a 'for' loop dna = 'ATAGCGAATATCTCTCATGAGAGGGAA' """ print(dna[0:3]) print(dna[3:6]) print(dna[6:9]) print(dna[9:12]) """ # For loop prints out all codons in increments of 3 #for i in range(0, 27, 3): # 27 total charac...
"use strict"; var __assign = (this && this.__assign) || function () { __assign = Object.assign || function(t) { for (var s, i = 1, n = arguments.length; i < n; i++) { s = arguments[i]; for (var p in s) if (Object.prototype.hasOwnProperty.call(s, p)) t[p] = s[p]; ...
import { useSelector } from "react-redux"; import { ProgressBar as Bar } from "react-step-progress-bar"; import styled from "styled-components"; import { selectCurrentStepPercentage } from "../../app/module/selectors"; import { Constants } from "../../data/constants"; const ProgressBar = (props) => { const percent =...
import versioneer from setuptools import setup, find_packages from codecs import open from os import path here = path.abspath(path.dirname(__file__)) with open(path.join(here, "README.rst"), encoding="utf-8") as f: long_description = f.read() requires = [ "matplotlib>=2.0.0", "pandas>=0.24", "Cython",...
const types = { FIREBASE_INITIALIZED: "FIREBASE_INITIALIZED", ATTACHED_ON_AUTH_STATE_CHANGE: "ATTACHED_ON_AUTH_STATE_CHANGE", ON_AUTH_STATE_CHANGE: "ON_AUTH_STATE_CHANGE", SIGN_IN: "SIGN_IN", SIGN_UP: "SIGN_UP", SIGN_OUT: "SIGN_OUT" } export default types;
/* Version 2.0, May 2020 */ /*jslint browser: true */ (function ($) { "use strict"; function highlight(selector) { $(selector).effect("highlight", {}, 2000); } function initToggleAnswers() { var answerTitles = $(".admonition-answer .admonition-title"); $(".admonition-title ~ ...
import logging import operator import warnings from haystack.backends import SQ from haystack.constants import REPR_OUTPUT_SIZE, ITERATOR_LOAD_PER_QUERY, DEFAULT_OPERATOR from haystack.exceptions import NotRegistered class SearchQuerySet(object): """ Provides a way to specify search parameters and lazily load...
# Copyright (C) 2013 eNovance SAS <licensing@enovance.com> # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicabl...
import React, { Component } from 'react'; import { StyleSheet, View, TextInput, Dimensions } from 'react-native'; import { Button, Container, Text, Header, Content, Left, Right } from 'native-base'; import GlobalHeader from './GlobalHeader'; import ip from '../server/keys/ipstore'; import Icon from 'react-native-vector...
/* This file is part of web3.js. web3.js is free software: you can redistribute it and/or modify it under the terms of the GNU Lesser General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version. web3.js is distribu...
/* * ATTENTION: The "eval" devtool has been used (maybe by default in mode: "development"). * This devtool is neither made for production nor for readable output files. * It uses "eval()" calls to create a separate source file in the browser devtools. * If you are trying to read the output file, select a different ...
var expect = require('chai').expect, path = require('path'), EventEmitter = require('events').EventEmitter, ScriptManager = require('../lib/ScriptManager').ScriptManager; describe('ScriptManager', function() { var manager; var realMainAppScript = 'folder' + path.sep + 'App.js'; var mainAppScript = 'f...
# Copyright 2016-2018 Dirk Thomas # Licensed under the Apache License, Version 2.0 from collections import OrderedDict from concurrent.futures import CancelledError import locale import os from pathlib import Path import re import traceback from colcon_core.environment_variable import EnvironmentVariable from colcon_...
#!/usr/bin/env python # Wenchang Yang (wenchang@princeton.edu) # Fri Aug 23 11:53:11 EDT 2019 #import os, os.path, sys #import xarray as xr, numpy as np, pandas as pd #import matplotlib.pyplot as plt import xarray as xr from numpy import exp, log # physical parameters Lv = 2.555e6 # J/kg g = 9.81 #m/s**-2 c_p = 1005.7...
# graphicsDisplay.py # ------------------ # Licensing Information: You are free to use or extend these projects for # educational purposes provided that (1) you do not distribute or publish # solutions, (2) you retain this notice, and (3) you provide clear # attribution to UC Berkeley, including a link to http://ai.be...
import React from 'react'; import './MoodSelect.css'; import Typing from 'react-typing-animation'; import EMA from './../../img/EMAhappy.png'; function SadGrief (){ return ( <div className="std=msg"> <img className="EMAs_Image" src= {EMA} alt="empathy-protocol" /> ...
import Skeleton from './Skeleton'; export { Skeleton, };
from enum import IntEnum, unique from django.contrib.auth import get_user_model from django.db import models from django.db.models.signals import post_delete, post_save from django.dispatch import receiver from django.utils import timezone from comment.models import Comment from comment.managers import ReactionManage...
""" Morphological Post-Processing for Turkish (c) 2018 by Mehmet Dolgun, m.dolgun@yahoo.com All functionality is provided by main class: TurkishPostProcessor special characters Vowel Harmony: ^ : make previous vowel back, i.e. aIuo->eiUO e.g kol-A -> kola, rol^-A -> role H : high vowels, using harmon...
var class_ext_1_1_net_1_1_j_s_o_n_date_time_json_converter = [ [ "CanConvert", "db/dbb/class_ext_1_1_net_1_1_j_s_o_n_date_time_json_converter.html#a39c32e35b626711bcec0d22d444c53c3", null ], [ "ReadJson", "db/dbb/class_ext_1_1_net_1_1_j_s_o_n_date_time_json_converter.html#ad832406a54dd397ce04ff1285470c96d", nul...
/* * Licensed to the Apache Software Foundation (ASF) under one * or more contributor license agreements. See the NOTICE file * distributed with this work for additional information * regarding copyright ownership. The ASF licenses this file * to you under the Apache License, Version 2.0 (the * "License"); you ...
""" from https://github.com/keithito/tacotron """ import re valid_symbols = [ "AA", "AA0", "AA1", "AA2", "AE", "AE0", "AE1", "AE2", "AH", "AH0", "AH1", "AH2", "AO", "AO0", "AO1", "AO2", "AW", "AW0", "AW1", "AW2",...
/* IITH Compilers authors: S Venkata Keerthy, D Tharun email: {cs17mtech11018, cs15mtech11002}@iith.ac.in Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-...
#!/usr/bin/env python3 # -*- coding: utf-8 -*- #Created on Thu Nov 9 21:38:24 2017 #@author: ryanday #MIT License #Copyright (c) 2018 Ryan Patrick Day #Permission is hereby granted, free of charge, to any person obtaining a copy #of this software and associated documentation files (the "Software"), to deal #in t...