seed stringlengths 1 14k | source stringclasses 2
values |
|---|---|
import math
def euclidean_distance_native(u, v):
"""Computes the Euclidean distance between two vectors, represented as Python
lists.
Args:
u (List[float]): A vector, represented as a list of floats.
v (List[float]): A vector, represented as a list of floats.
Returns:
float: ... | bigcode/self-oss-instruct-sc2-concepts |
def del_pos(s):
"""
Deletes part-of-speech encoding from an entity string, if present.
:param s: Entity string.
:return: Entity string with part-of-speech encoding removed.
"""
if s.endswith("/n") or s.endswith("/a") or s.endswith("/v") or s.endswith("/r"):
s = s[:-2]
return s | bigcode/self-oss-instruct-sc2-concepts |
def _sortValue_familyName(font):
"""
Returns font.info.familyName.
"""
value = font.info.familyName
if value is None:
value = ""
return value | bigcode/self-oss-instruct-sc2-concepts |
import builtins
def builtin_target(obj):
"""Returns mock target string of a builtin"""
return f"{builtins.__name__}.{obj.__name__}" | bigcode/self-oss-instruct-sc2-concepts |
from functools import reduce
def bits_to_int(list_):
"""
Converts a big-endian bit string to its integer representation.
>>> bits_to_int([1, 0, 1])
5
"""
return reduce(
lambda a, x: a | (1 << x[1]) if x[0] == 1 else a,
zip(list_, range(len(list_) - 1, -1, -1)),
0,
... | bigcode/self-oss-instruct-sc2-concepts |
def tier_from_site_name(s):
"""
Splits site name by _ (underscore), and takes only the first part that represents tier.
"""
split = s.split('_')
tier = str(split[0])
return tier | bigcode/self-oss-instruct-sc2-concepts |
def _get_line_index(line_or_func, lines):
"""Return the appropriate line index, depending on ``line_or_func`` which
can be either a function, a positive or negative int, or None.
"""
if hasattr(line_or_func, '__call__'):
return line_or_func(lines)
elif line_or_func:
if line_or_func ... | bigcode/self-oss-instruct-sc2-concepts |
def ToString(bval):
"""Convert a bytes type into a str type
Args:
bval: bytes value to convert
Returns:
Python 3: A bytes type
Python 2: A string type
"""
return bval.decode('utf-8') | bigcode/self-oss-instruct-sc2-concepts |
def parse_image_size(image_size):
"""Parse "100x100" like string into a tuple."""
return tuple(map(int, image_size.split("x"))) | bigcode/self-oss-instruct-sc2-concepts |
def unwrap_model(model_wrapper):
"""Remove model's wrapper."""
model = model_wrapper.module
return model | bigcode/self-oss-instruct-sc2-concepts |
import torch
def torch_multinomial(input, num_samples, replacement=False):
"""
Like `torch.multinomial()` but works with cuda tensors.
Does not support keyword argument `out`.
"""
if input.is_cuda:
return torch_multinomial(input.cpu(), num_samples, replacement).cuda()
else:
ret... | bigcode/self-oss-instruct-sc2-concepts |
def dna_2_rna(dna_str):
"""
Transcribes DNA into RNA
RNA differs from DNA in that it contains a base called uracil in place of thymine.
An RNA string is formed by replacing all occurrences of 'T' in the DNA string with 'U'.
Params:
-------
dna_str: (str)
DNA string. For example: "GATGGAACTTGACTACGTAAATT"... | bigcode/self-oss-instruct-sc2-concepts |
def _translation_vectors(mtps, vector_table):
"""For a set of maximally translatable patterns, returns the set of
translation vectors for the MTPs.
Finds the common translation vectors for each note of a MTP, enabling
finding all occurrences of the MTP.
Args:
mtps: All MTPs of a point set
vector_table: Vecto... | bigcode/self-oss-instruct-sc2-concepts |
import re
def __get_auth_api_url(module, url):
"""
Return the parsed URL of the specific authentication API.
:param AnsibleModule module: the ansible module
:param str url: the initial URL of API
:rtype: str
"""
# format the input for zmd_port
if module.params['zmf_port'] is None:
... | bigcode/self-oss-instruct-sc2-concepts |
def calc_temp_overlap(start_1, end_1, start_2, end_2):
"""
Calculate the portion of the first time span that overlaps with the second
Parameters
----------
start_1: datetime
start of first time span
end_1: datetime
end of first time span
start_2: datetime
start of se... | bigcode/self-oss-instruct-sc2-concepts |
import socket
def is_port_in_use(port: int) -> bool:
"""
Check if a porty is in use.
"""
with socket.socket(socket.AF_INET, socket.SOCK_STREAM) as s:
return s.connect_ex(('localhost', port)) == 0 | bigcode/self-oss-instruct-sc2-concepts |
def process_fieldmap_solrf(data):
"""
Processes array of raw data from a rfdataX file into a dict.
From the documentation:
Here, the rfdataV5 file contains the Fourier coefficients for both E fields and B fields.
The first half contains E fields, and the second half contains B fields.
See m... | bigcode/self-oss-instruct-sc2-concepts |
def utf8(s):
"""Convert to UTF-8."""
return s.encode("UTF-8") | bigcode/self-oss-instruct-sc2-concepts |
def element_is_scrolled_to_left(element):
"""
Is the element scrolled to the left?
:param element:
:return: Boolean
"""
return int(element.get_property('scrollLeft')) == 0 | bigcode/self-oss-instruct-sc2-concepts |
import pathlib
def as_uri(path):
"""
Converts the supplied path to file URI
:param path: Path to be converted
:return: Path as a fille URI
"""
p = pathlib.Path(path)
return p.as_uri() | bigcode/self-oss-instruct-sc2-concepts |
import torch
def _tuple_splice_range(inputs, start, end):
"""
Splices each tensor element of given tuple (inputs) from range start
(inclusive) to end (non-inclusive) on its first dimension. If element
is not a Tensor, it is left unchanged. It is assumed that all tensor elements
have the same first... | bigcode/self-oss-instruct-sc2-concepts |
import uuid
def is_uuid(id):
"""Verify if a string is an UUID"""
try:
v = uuid.UUID(id)
except ValueError:
v = None
return isinstance(v, uuid.UUID) | bigcode/self-oss-instruct-sc2-concepts |
import secrets
def pick(s, n):
"""Return a string with n randomly picked characters from string s."""
return "".join(secrets.choice(s) for i in range(n)) | bigcode/self-oss-instruct-sc2-concepts |
import json
import re
def uri_twitch(bot, response, matches):
""" Extract Twitch.tv channel information. """
channel = json.loads(response.text)
title = channel['status'].replace('\n', ' ')
title = re.sub(r'\s+', ' ', title).strip()
game = channel['game'].replace('\n', ' ')
game = re.sub(r'\s... | bigcode/self-oss-instruct-sc2-concepts |
def delete(flavor_id, **kwargs):
"""Delete flavor."""
# NOTE: flavor_id can be any string, don't convert flavor name to uuid
url = '/flavors/{flavor_id}'.format(flavor_id=flavor_id)
return url, {} | bigcode/self-oss-instruct-sc2-concepts |
def compute_denominator(log_strike, variance, deriv_1, deriv_2):
"""
Compute denominator in local vol equation.
Args:
log_strike: The log-strike.
variance: The variance.
deriv_1: The first derivative of variance wrt log strike.
deriv_2: The second derivative of variance wrt... | bigcode/self-oss-instruct-sc2-concepts |
def _LookupTargets(names, mapping):
"""Returns a list of the mapping[name] for each value in |names| that is in
|mapping|."""
return [mapping[name] for name in names if name in mapping] | bigcode/self-oss-instruct-sc2-concepts |
import requests
def connect_to_endpoint(url, headers):
"""Fetches latest information of a Twitter handle
Args:
url: URL to make a GET call
headers: Headers need for authentication
Returns:
List of tweets in json format
"""
response = requests.request("GET", url, headers=he... | bigcode/self-oss-instruct-sc2-concepts |
def rotate(x, y, ctx, cty, ang) :
""" Rotate catalog x,y against center (ctx,cty), using specified rotate angle
args:
x: ndarray of x, or scalar
y: ndarray of y
ctx: center x, scalar
cty: center y
ang: rotate angle, 0-7
0 keep original
1 CW 90 deg
... | bigcode/self-oss-instruct-sc2-concepts |
def rank_order(df, rank_column, ascending=False):
"""
Given dataframe with a column of numerical values, order and rank those values.
Allows for ties if a value is the same as the previous value.
"""
df = df.sort_values(rank_column, ascending=ascending).reset_index().drop('index', axis=1)
ranki... | bigcode/self-oss-instruct-sc2-concepts |
import copy
def get_descendants(node, include_self=True):
"""
Return a flat list including `node` and all its descendants. Nodes returned
are modified to remove the tree structure between them (set `children=[]`).
"""
results = []
if include_self:
node_copy = copy.deepcopy(node)
... | bigcode/self-oss-instruct-sc2-concepts |
def get_max_value(array):
"""
Finds (the first occurence of) maximum value in a 1D array.
:param array: 1D array (there is no safety check on that)
:return: (index, value)
index Index of the maximum element.
value Value of the maximum element.
"""
max_val = max(array)
... | bigcode/self-oss-instruct-sc2-concepts |
def add_lowercase_context_to_sequences(seq, uc_s, uc_e,
convert_to_rna=False):
"""
Given a sequence and uppercase middle region start (uc_s) and end (uc_e),
make context region upstream + downstream lowercase.
Two coordinates should be one-based.
Return lowerca... | bigcode/self-oss-instruct-sc2-concepts |
from pathlib import Path
import re
def guess_file(path: Path) -> str:
"""Guess the type of a file and return the corresponding file extension."""
lines = path.read_text().splitlines()
MAX_LINES = 500 # noqa: N806
f77ish = True
f90ish = False
for i, line in enumerate(lines):
if i >=... | bigcode/self-oss-instruct-sc2-concepts |
def check_model_termination(ClockStruct,InitCond):
"""
Function to check and declare model termination
*Arguments:*\n
`ClockStruct` : `ClockStructClass` : model time paramaters
`InitCond` : `InitCondClass` : containing current model paramaters
*Returns:*
`ClockStruct` : `ClockStructC... | bigcode/self-oss-instruct-sc2-concepts |
def gtk_false(*args):
"""
GTK False default handler
"""
return False | bigcode/self-oss-instruct-sc2-concepts |
def int_or_none(value):
"""
Returns int or none if int could not be converted
"""
try:
return int(value)
except ValueError:
return None | bigcode/self-oss-instruct-sc2-concepts |
def avg_item_count_character(cursor):
"""Returns the average number of items per character from sqlite cursor.
Args:
cursor (sqlite3.Cursor): cursor to sqlite database
Returns:
(float) Average number of items per character
"""
return cursor.execute("""SELECT AVG(item_ct)
FROM(
... | bigcode/self-oss-instruct-sc2-concepts |
def parse_uri(uri):
"""Extracts the host, port and db from an uri"""
host, port, db = uri, 6379, 0
if len(host.split('/')) == 2:
host, db = host.split('/')
if len(host.split(':')) == 2:
host, port = host.split(':')
return host, int(port), int(db) | bigcode/self-oss-instruct-sc2-concepts |
def distribution_to_particle(predictions, n_particles=50):
""" Convert a distribution prediction to a particle prediction
Args:
predictions (Distribution): a batch of distribution predictions.
n_particles (int): the number of particles to sample.
"""
return predictions.sample... | bigcode/self-oss-instruct-sc2-concepts |
def nulls(data):
"""Returns keys of values that are null (but not bool)"""
return [k for k in data.keys()
if not isinstance(data[k], bool) and not data[k]] | bigcode/self-oss-instruct-sc2-concepts |
def _process_ratios(value):
"""Helper function to convert the GPS ratios in float format"""
return float(value[0])/float(value[1]) | bigcode/self-oss-instruct-sc2-concepts |
def normalize_path(path):
"""
Returns a normalized path from a `path` string.
"""
return "/" + path.strip("/") | bigcode/self-oss-instruct-sc2-concepts |
def get_vgci_warnings(tc):
"""
extract warnings from the parsed test case stderr
"""
warnings = []
if tc['stderr']:
for line in tc['stderr'].split('\n'):
# For each line
if "WARNING" in line and "vgci" in line:
# If it is a CI warning, keep it
... | bigcode/self-oss-instruct-sc2-concepts |
from pathlib import Path
def get_reps_path(params, split):
"""Return path to directory where dialogue representations are stored."""
directory = Path(params.path_to_representations)
path_r = f'{params.bot}Bot_{params.bot_version}_representations_{split}.h5'
return directory / path_r | bigcode/self-oss-instruct-sc2-concepts |
import re
def _include(path, includes, excludes):
"""
:params path: The file path to check whether to include
:params includes: List of include regexs to apply
:params excludes: List of exclude regexs to apply
:returns True if the file path should be included, False
"""
if includes is No... | bigcode/self-oss-instruct-sc2-concepts |
def inverted_y(coordinate_y, height):
"""反转y坐标。
Args:
coordinate_y: y坐标。
height: 高度。
Returns:
新的y坐标
"""
return abs(coordinate_y - height) | bigcode/self-oss-instruct-sc2-concepts |
import collections
def graph_inputs(name, **kwargs):
"""Creates a namedtuple of the given keys and values.
Args:
name (string): Name of the tuple.
kwargs (tf.Tensor): One or more tensor(s) to add to the
namedtuple's values. The parameter names are used as keys
in the n... | bigcode/self-oss-instruct-sc2-concepts |
def _port_in_range(value):
"""Return True if port is in expected range."""
return 49512 <= value <= 65535 | bigcode/self-oss-instruct-sc2-concepts |
def results_summary(results_data):
"""
Return a summary of the results stored in a dataframe.
Returns a dict containing unique entities in each column
Ignores the exp_data, f_min, min_params and time columns
"""
unique_vals_dict = {}
col_list = list(results_data.columns.values)
... | bigcode/self-oss-instruct-sc2-concepts |
import re
import keyword
def is_valid_identifier(var, allow_unicode=False):
"""Return true if var contains a valid Python identifier
Parameters
----------
val : string
identifier to check
allow_unicode : bool (default: False)
if True, then allow Python 3 style unicode identifiers.... | bigcode/self-oss-instruct-sc2-concepts |
import re
def is_rgb_code(s: str) -> bool:
""" Returns True if `s` appears to be a single rgb escape code. """
pattern = '^\033\\[((38)|(48));2;\\d{1,3};\\d{1,3};\\d{1,3}m'
return re.match(pattern, s) is not None | bigcode/self-oss-instruct-sc2-concepts |
def props_of_this_event(event, ts_tuple, run):
"""
Find the set of propositions that correspond to an event.
Parameters
-----------
event: A tuple
An event is a tuple of the form (agent_no, run_pos). This argument
can either be a tuple of events (simultaneous events) or a tuple of
integers (single event).
... | bigcode/self-oss-instruct-sc2-concepts |
import site
from pathlib import Path
def find_pkg(name):
"""Find package in site-packages"""
for p in site.getsitepackages():
pkg_path = Path(p) / name
if pkg_path.exists():
return pkg_path
return None | bigcode/self-oss-instruct-sc2-concepts |
import json
def readfile(filepath):
"""
reads a pipeline json file and returns the resulting dictionary
"""
with open(filepath, "r") as json_file:
json_data = json.load(json_file)
return json_data | bigcode/self-oss-instruct-sc2-concepts |
def points_to_region(region_pts):
"""
Reverse Voronoi region polygon IDs to point ID assignments by returning a dict that maps each point ID to its
Voronoi region polygon ID. All IDs should be integers.
:param region_pts: dict mapping Voronoi region polygon IDs to list of point IDs
:return: dict ma... | bigcode/self-oss-instruct-sc2-concepts |
def clean_file_name(filename):
"""Clean the filename for the client.
If it has directory structure, purge it and give only the file name.
:param filename: file name to be cleaned
:return: cleaned filename
"""
if '/' in filename:
filename = filename.split('/')[-1]
return filename | bigcode/self-oss-instruct-sc2-concepts |
def mean_normalize(x, mean_x, max_x, min_x):
"""
Mean normalization of input x, given dataset mean, max, and min.
>>> mean_normalize(10, 10, 15, 5)
0.0
>>> mean_normalize(15, 20, 30, 10)
-0.25
Formula from:
https://en.wikipedia.org/wiki/Feature_scaling
"""
# If min=max, all va... | bigcode/self-oss-instruct-sc2-concepts |
def calculate_centroid(gps_bounds):
"""Given a set of GPS boundaries, return lat/lon of centroid.
gps_bounds -- (lat(y) min, lat(y) max, long(x) min, long(x) max)
Returns:
Tuple of (lat, lon) representing centroid
"""
return (
gps_bounds[0] + float(gps_bounds[1] - gps_bounds[0])/2... | bigcode/self-oss-instruct-sc2-concepts |
import re
def hasNewRating(filename):
"""
Checks if parameter file name already has a rating.
Movie ratings are in the format (\d.\d)
"""
pattern = re.compile('\[IMDb [0-9].[0-9]\]')
return pattern.search(filename) is not None | bigcode/self-oss-instruct-sc2-concepts |
from typing import Iterable
from typing import List
def _resplit(parts: Iterable[str]) -> List[str]:
"""
Given a list of strings, returns a list of lines, by splitting each string
into multiple lines where it contains newlines.
>>> _resplit([])
[]
>>> _resplit(['a', 'b'])
['a', 'b']
>... | bigcode/self-oss-instruct-sc2-concepts |
def remove_empty_kps(coco_context):
"""Returns a list of valid keypoint annotations
Arguments:
coco_context: The initialized cocoapi class
Returns:
processed_idx (list): List of images with
valid keypoint annotations
"""
processed_idx = []
image_idx_list = coco_cont... | bigcode/self-oss-instruct-sc2-concepts |
from datetime import datetime
def to_embed_timestamp(timestamp: int) -> datetime:
"""
Convert UNIX timestamp to datetime object for embed timestamps.
:param timestamp: UNIX timestamp with seconds accuracy.
:return: Timezone native datetime
"""
return datetime.utcfromtimestamp(timestamp) | bigcode/self-oss-instruct-sc2-concepts |
def make_inverted(m, n):
"""
Given two integers m and n, write a function that returns a reversed list of integers between m and n.
If the difference between m and n is even, include m and n, otherwise don't include.
If m == n, return empty list
If m < n, swap between m and n and continue.
Example 1:
Input: ... | bigcode/self-oss-instruct-sc2-concepts |
def visparamsListToStr(params):
""" Transform a list to a string formated as needed by
ee.data.getMapId
:param params: params to convert
:type params: list
:return: a string formated as needed by ee.data.getMapId
:rtype: str
"""
n = len(params)
if n == 1:
newbands = '{}'... | bigcode/self-oss-instruct-sc2-concepts |
def get_asa_owners(indexer_client, asset_id, asa_min_balance=0):
"""Search for ASAs owners
Args:
indexer_client (IndexerClient): Indexer Client V2
asset_id (int): ASA Asset ID
asa_min_balance (int): Optional; ASA minimum balance expressed as
minimal int units
Returns:
... | bigcode/self-oss-instruct-sc2-concepts |
def coleman_liau_index(n_chars, n_words, n_sents):
"""https://en.wikipedia.org/wiki/Coleman%E2%80%93Liau_index"""
return 5.879851 * (n_chars / n_words) - 29.587280 * (n_sents / n_words) - 15.800804 | bigcode/self-oss-instruct-sc2-concepts |
def choose_box(group, plot_data):
"""Given a set of overlapping bounding boxes and predictions, just choose a closest to stem box by centroid if there are multiples"""
if group.shape[0] == 1:
return group
else:
#Find centroid
individual_id = group.individual.unique()[0]
stem... | bigcode/self-oss-instruct-sc2-concepts |
def organize_edges(edges, borders=None, default_border='land'):
"""
Organize edges in to various collections specified by borders.
Required Arguments
------------------
* edges : List of edges of the form
(node_number, node_number, ... , edge_type)
The sort... | bigcode/self-oss-instruct-sc2-concepts |
def isstrlessthan(string, length):
"""Checks if string is below length"""
return len(string) < length | bigcode/self-oss-instruct-sc2-concepts |
import re
def _clean(text):
""" Cleans the text: Lowercasing, trimming, removing non-alphanumeric"""
return " ".join(re.findall(r'\w+', text, flags=re.UNICODE)).lower() | bigcode/self-oss-instruct-sc2-concepts |
import json
def read_config_file(filename):
"""
Read the json configuration file and
return a map with the config entries
"""
with open(filename) as json_file:
json_input = json.load(json_file)
return json_input | bigcode/self-oss-instruct-sc2-concepts |
def dim_col(d: int) -> str:
"""
Name of an dimension columns.
Parameters
----------
d
Dimension number.
Returns
-------
name: str
Dimension name.
Example
-------
>>> from rle_array.testing import dim_col
>>> dim_col(1)
'dim_1'
"""
return f"d... | bigcode/self-oss-instruct-sc2-concepts |
import math
def s1diff(a,b):
"""Angle from a to b in an anticlockwise direction."""
if b < a:
b += 2*math.pi
return b - a | bigcode/self-oss-instruct-sc2-concepts |
def convert_length_in_minutes_to_hr_min_str(length_minutes=0):
"""
Convert minutes into something like 02h03m if given 123.
Note that both hr and min are 0-padded
"""
hour = length_minutes // 60
minutes = length_minutes % 60
return "%02dh%02dm" % (hour, minutes) | bigcode/self-oss-instruct-sc2-concepts |
def solve_linear_system_LU(matrix, syms):
"""
Solves the augmented matrix system using LUsolve and returns a dictionary
in which solutions are keyed to the symbols of syms *as ordered*.
The matrix must be invertible.
Examples
========
>>> from sympy import Matrix
>>> from sympy.abc im... | bigcode/self-oss-instruct-sc2-concepts |
def PyDateTime_GET_DAY(space, w_obj):
"""Return the day, as an int from 1 through 31.
"""
return space.int_w(space.getattr(w_obj, space.newtext("day"))) | bigcode/self-oss-instruct-sc2-concepts |
def freeze_parameters(model):
"""
Freezes all parameters from a given model.
Args:
model (any of nff.nn.models)
"""
for param in model.parameters():
param.requires_grad = False
return model | bigcode/self-oss-instruct-sc2-concepts |
def get_stats(stat_int_list: list) -> list:
"""Return a list of stats in play.
Argument(s):
stat_int_list: list -- list of stat indices
"""
stat_list = []
for stat in stat_int_list:
if stat == 0:
stat_list.append("Hunger")
elif stat == 1:
stat_list.appen... | bigcode/self-oss-instruct-sc2-concepts |
def convert_numeral(string: str) -> str:
"""
Convert a assembly numeral into a hexadecimal numeral
:param string: A string representation of a simpSim numeral
:return: Hexadecimal representation of the numeral
"""
return_num: int = 0
is_pointer: bool = string.startswith("[") and string.endsw... | bigcode/self-oss-instruct-sc2-concepts |
import string
import random
def generateCharacters(charCount):
"""Generates ASCII lowercase random characters"""
# https://www.educative.io/edpresso/how-to-generate-a-random-string-in-python
letters = string.ascii_lowercase
result = "".join(random.choice(letters) for i in range(charCount))
return ... | bigcode/self-oss-instruct-sc2-concepts |
def _pair_members_to_new_node(dm, i, j, disallow_negative_branch_length):
"""Return the distance between a new node and decendants of that new node.
Parameters
----------
dm : skbio.DistanceMatrix
The input distance matrix.
i, j : str
Identifiers of entries in the distance matrix to... | bigcode/self-oss-instruct-sc2-concepts |
def _sym_solve(Dinv, M, A, r1, r2, solve, splu=False):
"""
An implementation of [1] equation 8.31 and 8.32
References
----------
.. [1] Andersen, Erling D., and Knud D. Andersen. "The MOSEK interior point
optimizer for linear programming: an implementation of the
homogeneous a... | bigcode/self-oss-instruct-sc2-concepts |
def root_app(expr):
"""Returns the pair (r, args)
such that expr = r(*args)
Arguments:
- `expr`: an expression
"""
root = expr
args = []
while root.is_app():
args.append(root.arg)
root = root.fun
#The arguments were collected in reverse order
args.reverse... | bigcode/self-oss-instruct-sc2-concepts |
def get_file_download_details(file_response):
"""
Return the download_link from the file_response.
Used for updating the message with a download button.
"""
download_link = file_response['file']['url_private_download']
return download_link | bigcode/self-oss-instruct-sc2-concepts |
def percentage(f):
"""
Return the percentage version of a float f
"""
return round(f * 100, 3) | bigcode/self-oss-instruct-sc2-concepts |
from pathlib import Path
def create_module_scratch(module_name):
"""Create a scratch that is easily found (by developers) and removed, and doesn't
clutter up the working directories.
"""
path = Path("~").expanduser()
for path_part in ".idaes", "_scratch", module_name:
path = path / path_pa... | bigcode/self-oss-instruct-sc2-concepts |
def recall(recs, truth, k=None):
"""
Compute recommendation recall.
"""
nrel = len(truth)
if nrel == 0:
return None
if k is not None:
nrel = min(nrel, k)
recs = recs.iloc[:k]
ngood = recs['item'].isin(truth.index).sum()
return ngood / nrel | bigcode/self-oss-instruct-sc2-concepts |
import torch
def translation_error(pose_pred, pose_target):
"""
Angular error for rotation matrix
:param pose_pred: shape (b, 3, 4), estimated pose
:param pose_target: shape (b, 3, 4), target pose
:return: float
>>> import torch
>>> pose_pred = torch.tensor([[1.0, 0, 0, 1], [0, 1, 0, 1],... | bigcode/self-oss-instruct-sc2-concepts |
def _replace_match(text, match, replacement):
"""Expands a regexp match in the text with its replacement.
Args:
text: str. The text in which to perform the replacement.
match: re.MatchObject. A match object that applies to "text".
replacement: str. The string to replace the match wit... | bigcode/self-oss-instruct-sc2-concepts |
def parse(css):
"""Parse a CSS style into a dict."""
result = {}
for declaration in css.split(";"):
if declaration:
key, value = declaration.split(":")
result[key] = value.strip()
return result | bigcode/self-oss-instruct-sc2-concepts |
def strip_whitespace(string_value):
"""
Return the input string without space, tab,
or newline characters (for comparing strings)
"""
return ''.join(
[c for c in string_value if c != ' ' and c != '\n' and c != '\t']
) | bigcode/self-oss-instruct-sc2-concepts |
def amgxwrapper_poisson_read_runtimes(*filepaths):
"""Read the runtimes to solve the system for multiple runs.
Parameters
----------
filepaths : tuple of strings or pathlib.Path objects
Path of the files to read.
Returns
-------
runtimes : list of floats
The runtimes.
... | bigcode/self-oss-instruct-sc2-concepts |
def set_device_orientation_override(alpha: float, beta: float, gamma: float) -> dict:
"""Overrides the Device Orientation.
Parameters
----------
alpha: float
Mock alpha
beta: float
Mock beta
gamma: float
Mock gamma
**Experimental**
"""
return {
... | bigcode/self-oss-instruct-sc2-concepts |
def load_movies(path_movies='movies.csv'):
"""
Returns a dictionary mapping item_id to item_name and another dictionary
mapping item_id to a list of genres
"""
data = {}
genreMap = {}
with open(path_movies, encoding = "utf8") as f_data:
for line in f_data:
parts = line.st... | bigcode/self-oss-instruct-sc2-concepts |
def label_smoothing(x_onehot, epsilon=0.1):
"""
Label smoothing for one-hot type label.
Args:
x_onehot: Tensor with shape [..., depth]
epsilon: float, default 0.1
The smoothing factor in range [0.0, 1.0].
Returns:
Tensor with same shape as x_onehot, and its value ha... | bigcode/self-oss-instruct-sc2-concepts |
def yesno(value, icaps=True):
"""
Return 'yes' or 'no' according to the (assumed-bool) value.
"""
if (value):
str = 'Yes' if icaps else 'yes'
else:
str = 'No' if icaps else 'no'
return str | bigcode/self-oss-instruct-sc2-concepts |
def get_utt_id(segment):
"""
Gives utterance IDs in a form like: en_4156-a-36558-37113
"""
return "{}-{}-{}-{}".format(segment.filename, segment.channel, int(segment.begin * 100), int(segment.end * 100),) | bigcode/self-oss-instruct-sc2-concepts |
import re
def GetCipdPackagePath(pkg_yaml_file):
"""Find CIPD package path in .yaml file.
There should one line in .yaml file, e.g.:
"package: chrome_internal/third_party/android_sdk/internal/q/add-ons" or
"package: chromium/third_party/android_sdk/public/platforms"
Args:
pkg_yaml_file: The yaml file ... | bigcode/self-oss-instruct-sc2-concepts |
def specific_gravity_to_gravity_points(sg, vol_gal):
"""Convert specific gravity to gravity points
Parameters
----------
sg : float
Specific gravity.
vol_gal : float
Wort volume, in gallons.
Returns
-------
gravity_points : float
Gravity points.
"""
... | bigcode/self-oss-instruct-sc2-concepts |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.