CombinedText
stringlengths
4
3.42M
class Mvnvm < Formula desc "Maven version manager" homepage "https://mvnvm.org/" url "https://bitbucket.org/mjensen/mvnvm/get/mvnvm-1.0.14.tar.gz" sha256 "09c61a1a7aa0b7e94db122d0b705267f22dce429d3bbcf2345b08ee7a92564c7" license "Apache-2.0" head "https://bitbucket.org/mjensen/mvnvm.git" bottle :unneeded depends_on "openjdk" conflicts_with "maven", because: "also installs a 'mvn' executable" def install bin.install "mvn" bin.install "mvnDebug" bin.env_script_all_files libexec/"bin", Language::Java.overridable_java_home_env end test do (testpath/"settings.xml").write <<~EOS <settings><localRepository>#{testpath}/repository</localRepository></settings> EOS (testpath/"mvnvm.properties").write <<~EOS mvn_version=3.5.2 EOS (testpath/"pom.xml").write <<~EOS <?xml version="1.0" encoding="UTF-8"?> <project xmlns="https://maven.apache.org/POM/4.0.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="https://maven.apache.org/POM/4.0.0 http://maven.apache.org/maven-v4_0_0.xsd"> <modelVersion>4.0.0</modelVersion> <groupId>org.homebrew</groupId> <artifactId>maven-test</artifactId> <version>1.0.0-SNAPSHOT</version> <properties> <maven.compiler.source>1.7</maven.compiler.source> <maven.compiler.target>1.7</maven.compiler.target> </properties> </project> EOS (testpath/"src/main/java/org/homebrew/MavenTest.java").write <<~EOS package org.homebrew; public class MavenTest { public static void main(String[] args) { System.out.println("Testing Maven with Homebrew!"); } } EOS system "#{bin}/mvn", "-gs", "#{testpath}/settings.xml", "compile" end end mvnvm 1.0.15 (#77159) class Mvnvm < Formula desc "Maven version manager" homepage "https://mvnvm.org/" url "https://bitbucket.org/mjensen/mvnvm/get/mvnvm-1.0.15.tar.gz" sha256 "2d2163b89d918e07146131407751eb7aff9c5fb5ae8c954b912e60860fb1c8ea" license "Apache-2.0" head "https://bitbucket.org/mjensen/mvnvm.git" bottle :unneeded depends_on "openjdk" conflicts_with "maven", because: "also installs a 'mvn' executable" def install bin.install "mvn" bin.install "mvnDebug" bin.env_script_all_files libexec/"bin", Language::Java.overridable_java_home_env end test do (testpath/"settings.xml").write <<~EOS <settings><localRepository>#{testpath}/repository</localRepository></settings> EOS (testpath/"mvnvm.properties").write <<~EOS mvn_version=3.5.2 EOS (testpath/"pom.xml").write <<~EOS <?xml version="1.0" encoding="UTF-8"?> <project xmlns="https://maven.apache.org/POM/4.0.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="https://maven.apache.org/POM/4.0.0 http://maven.apache.org/maven-v4_0_0.xsd"> <modelVersion>4.0.0</modelVersion> <groupId>org.homebrew</groupId> <artifactId>maven-test</artifactId> <version>1.0.0-SNAPSHOT</version> <properties> <maven.compiler.source>1.7</maven.compiler.source> <maven.compiler.target>1.7</maven.compiler.target> </properties> </project> EOS (testpath/"src/main/java/org/homebrew/MavenTest.java").write <<~EOS package org.homebrew; public class MavenTest { public static void main(String[] args) { System.out.println("Testing Maven with Homebrew!"); } } EOS system "#{bin}/mvn", "-gs", "#{testpath}/settings.xml", "compile" end end
class Mycli < Formula include Language::Python::Virtualenv desc "CLI for MySQL with auto-completion and syntax highlighting" homepage "http://mycli.net/" url "https://files.pythonhosted.org/packages/d3/ba/13b9ca22e77fbe6770c39c6fae912ec2fe95bbbbcc7b1ed287851f04c438/mycli-1.10.0.tar.gz" sha256 "e3ff390c66dcd9ea15235ea36ee7ad26630197c21d95e78926df54f41ad1fcc7" bottle do cellar :any_skip_relocation sha256 "536fd1d384ca20ac324faf71afd36ec6f843a1bff6d861115c019782eaf7decb" => :sierra sha256 "56a3c12c4ed9992e7a56e05ed79528dc19793a18c830b454f60e867a342bd203" => :el_capitan sha256 "b325516f12c51b385a5bf5f25a9f0503eac6dbd1369fd9cc6166041c95cfe80e" => :yosemite end depends_on :python depends_on "openssl" resource "click" do url "https://files.pythonhosted.org/packages/95/d9/c3336b6b5711c3ab9d1d3a80f1a3e2afeb9d8c02a7166462f6cc96570897/click-6.7.tar.gz" sha256 "f15516df478d5a56180fbf80e68f206010e6d160fc39fa508b65e035fd75130b" end resource "configobj" do url "https://files.pythonhosted.org/packages/64/61/079eb60459c44929e684fa7d9e2fdca403f67d64dd9dbac27296be2e0fab/configobj-5.0.6.tar.gz" sha256 "a2f5650770e1c87fb335af19a9b7eb73fc05ccf22144eb68db7d00cd2bcb0902" end resource "prompt_toolkit" do url "https://files.pythonhosted.org/packages/55/56/8c39509b614bda53e638b7500f12577d663ac1b868aef53426fc6a26c3f5/prompt_toolkit-1.0.14.tar.gz" sha256 "cc66413b1b4b17021675d9f2d15d57e640b06ddfd99bb724c73484126d22622f" end resource "pycryptodome" do url "https://files.pythonhosted.org/packages/45/ca/f0c2ca6c65084d60f68553cf072de7db0d918c7bb07ece88781f6af24625/pycryptodome-3.4.5.tar.gz" sha256 "be84544eadc2bb71d4ace39e4984ed2990111f053f24267a07afb4b4e1e5428f" end resource "Pygments" do url "https://files.pythonhosted.org/packages/71/2a/2e4e77803a8bd6408a2903340ac498cb0a2181811af7c9ec92cb70b0308a/Pygments-2.2.0.tar.gz" sha256 "dbae1046def0efb574852fab9e90209b23f556367b5a320c0bcb871c77c3e8cc" end resource "PyMySQL" do url "https://files.pythonhosted.org/packages/29/f8/919a28976bf0557b7819fd6935bfd839118aff913407ca58346e14fa6c86/PyMySQL-0.7.11.tar.gz" sha256 "56e3f5bcef6501012233620b54f6a7b8a34edc5751e85e4e3da9a0d808df5f68" end resource "six" do url "https://files.pythonhosted.org/packages/b3/b2/238e2590826bfdd113244a40d9d3eb26918bd798fc187e2360a8367068db/six-1.10.0.tar.gz" sha256 "105f8d68616f8248e24bf0e9372ef04d3cc10104f1980f54d57b2ce73a5ad56a" end resource "sqlparse" do url "https://files.pythonhosted.org/packages/45/67/14bdaeff492e6d03a055fe80502bae10b679891c25a0dc59be2fe51002f8/sqlparse-0.2.3.tar.gz" sha256 "becd7cc7cebbdf311de8ceedfcf2bd2403297024418801947f8c953025beeff8" end resource "wcwidth" do url "https://files.pythonhosted.org/packages/55/11/e4a2bb08bb450fdbd42cc709dd40de4ed2c472cf0ccb9e64af22279c5495/wcwidth-0.1.7.tar.gz" sha256 "3df37372226d6e63e1b1e1eda15c594bca98a22d33a23832a90998faa96bc65e" end def install virtualenv_install_with_resources end test do system bin/"mycli", "--help" end end mycli 1.11.0 Closes #15523. Signed-off-by: ilovezfs <fbd54dbbcf9e596abad4ccdc4dfc17f80ebeaee2@icloud.com> class Mycli < Formula include Language::Python::Virtualenv desc "CLI for MySQL with auto-completion and syntax highlighting" homepage "http://mycli.net/" url "https://files.pythonhosted.org/packages/7a/b6/332fa148e50c976f49a94deced0c572c243766bf817ceb5b6053276bb370/mycli-1.11.0.tar.gz" sha256 "0e27ad54e59c5e13ac30ed4bf53556ef57813c38edb56ad099ffad7bc18918de" bottle do cellar :any_skip_relocation sha256 "536fd1d384ca20ac324faf71afd36ec6f843a1bff6d861115c019782eaf7decb" => :sierra sha256 "56a3c12c4ed9992e7a56e05ed79528dc19793a18c830b454f60e867a342bd203" => :el_capitan sha256 "b325516f12c51b385a5bf5f25a9f0503eac6dbd1369fd9cc6166041c95cfe80e" => :yosemite end depends_on :python depends_on "openssl" resource "asn1crypto" do url "https://files.pythonhosted.org/packages/67/14/5d66588868c4304f804ebaff9397255f6ec5559e46724c2496e0f26e68d6/asn1crypto-0.22.0.tar.gz" sha256 "cbbadd640d3165ab24b06ef25d1dca09a3441611ac15f6a6b452474fdf0aed1a" end resource "backports.csv" do url "https://files.pythonhosted.org/packages/6a/0b/2071ad285e87dd26f5c02147ba13abf7ec777ff20416a60eb15ea204ca76/backports.csv-1.0.5.tar.gz" sha256 "8c421385cbc6042ba90c68c871c5afc13672acaf91e1508546d6cda6725ebfc6" end resource "cffi" do url "https://files.pythonhosted.org/packages/5b/b9/790f8eafcdab455bcd3bd908161f802c9ce5adbf702a83aa7712fcc345b7/cffi-1.10.0.tar.gz" sha256 "b3b02911eb1f6ada203b0763ba924234629b51586f72a21faacc638269f4ced5" end resource "cli_helpers" do url "https://files.pythonhosted.org/packages/2b/7e/307131c2c3f3abef2d1e68b7088882c078da6ce5bb57cbe79bac12718c72/cli_helpers-0.2.1.tar.gz" sha256 "a868e69e780c1fd5091c83e784e8b18e2005cab921f1dfda4ffd376271ee85ac" end resource "click" do url "https://files.pythonhosted.org/packages/95/d9/c3336b6b5711c3ab9d1d3a80f1a3e2afeb9d8c02a7166462f6cc96570897/click-6.7.tar.gz" sha256 "f15516df478d5a56180fbf80e68f206010e6d160fc39fa508b65e035fd75130b" end resource "configobj" do url "https://files.pythonhosted.org/packages/64/61/079eb60459c44929e684fa7d9e2fdca403f67d64dd9dbac27296be2e0fab/configobj-5.0.6.tar.gz" sha256 "a2f5650770e1c87fb335af19a9b7eb73fc05ccf22144eb68db7d00cd2bcb0902" end resource "cryptography" do url "https://files.pythonhosted.org/packages/2a/0c/31bd69469e90035381f0197b48bf71032991d9f07a7e444c311b4a23a3df/cryptography-1.9.tar.gz" sha256 "5518337022718029e367d982642f3e3523541e098ad671672a90b82474c84882" end resource "enum34" do url "https://files.pythonhosted.org/packages/bf/3e/31d502c25302814a7c2f1d3959d2a3b3f78e509002ba91aea64993936876/enum34-1.1.6.tar.gz" sha256 "8ad8c4783bf61ded74527bffb48ed9b54166685e4230386a9ed9b1279e2df5b1" end resource "idna" do url "https://files.pythonhosted.org/packages/d8/82/28a51052215014efc07feac7330ed758702fc0581347098a81699b5281cb/idna-2.5.tar.gz" sha256 "3cb5ce08046c4e3a560fc02f138d0ac63e00f8ce5901a56b32ec8b7994082aab" end resource "ipaddress" do url "https://files.pythonhosted.org/packages/4e/13/774faf38b445d0b3a844b65747175b2e0500164b7c28d78e34987a5bfe06/ipaddress-1.0.18.tar.gz" sha256 "5d8534c8e185f2d8a1fda1ef73f2c8f4b23264e8e30063feeb9511d492a413e1" end resource "prompt_toolkit" do url "https://files.pythonhosted.org/packages/55/56/8c39509b614bda53e638b7500f12577d663ac1b868aef53426fc6a26c3f5/prompt_toolkit-1.0.14.tar.gz" sha256 "cc66413b1b4b17021675d9f2d15d57e640b06ddfd99bb724c73484126d22622f" end resource "pycparser" do url "https://files.pythonhosted.org/packages/be/64/1bb257ffb17d01f4a38d7ce686809a736837ad4371bcc5c42ba7a715c3ac/pycparser-2.17.tar.gz" sha256 "0aac31e917c24cb3357f5a4d5566f2cc91a19ca41862f6c3c22dc60a629673b6" end resource "Pygments" do url "https://files.pythonhosted.org/packages/71/2a/2e4e77803a8bd6408a2903340ac498cb0a2181811af7c9ec92cb70b0308a/Pygments-2.2.0.tar.gz" sha256 "dbae1046def0efb574852fab9e90209b23f556367b5a320c0bcb871c77c3e8cc" end resource "PyMySQL" do url "https://files.pythonhosted.org/packages/29/f8/919a28976bf0557b7819fd6935bfd839118aff913407ca58346e14fa6c86/PyMySQL-0.7.11.tar.gz" sha256 "56e3f5bcef6501012233620b54f6a7b8a34edc5751e85e4e3da9a0d808df5f68" end resource "six" do url "https://files.pythonhosted.org/packages/b3/b2/238e2590826bfdd113244a40d9d3eb26918bd798fc187e2360a8367068db/six-1.10.0.tar.gz" sha256 "105f8d68616f8248e24bf0e9372ef04d3cc10104f1980f54d57b2ce73a5ad56a" end resource "sqlparse" do url "https://files.pythonhosted.org/packages/45/67/14bdaeff492e6d03a055fe80502bae10b679891c25a0dc59be2fe51002f8/sqlparse-0.2.3.tar.gz" sha256 "becd7cc7cebbdf311de8ceedfcf2bd2403297024418801947f8c953025beeff8" end resource "terminaltables" do url "https://files.pythonhosted.org/packages/9b/c4/4a21174f32f8a7e1104798c445dacdc1d4df86f2f26722767034e4de4bff/terminaltables-3.1.0.tar.gz" sha256 "f3eb0eb92e3833972ac36796293ca0906e998dc3be91fbe1f8615b331b853b81" end resource "wcwidth" do url "https://files.pythonhosted.org/packages/55/11/e4a2bb08bb450fdbd42cc709dd40de4ed2c472cf0ccb9e64af22279c5495/wcwidth-0.1.7.tar.gz" sha256 "3df37372226d6e63e1b1e1eda15c594bca98a22d33a23832a90998faa96bc65e" end def install virtualenv_install_with_resources end test do system bin/"mycli", "--help" end end
class Myman < Formula desc "Text-mode videogame inspired by Namco's Pac-Man" homepage "https://myman.sourceforge.io/" url "https://downloads.sourceforge.net/project/myman/myman-cvs/myman-cvs-2009-10-30/myman-wip-2009-10-30.tar.gz" sha256 "bf69607eabe4c373862c81bf56756f2a96eecb8eaa8c911bb2abda78b40c6d73" head ":pserver:anonymous:@myman.cvs.sourceforge.net:/cvsroot/myman", using: :cvs bottle do rebuild 2 sha256 arm64_monterey: "7572bde41926ba4a33b300b0e43b890648fb8d19e47e4a50b43608e99c9b8e9a" sha256 arm64_big_sur: "a38be300e040956aa8f9d997a715c91152868d5aeaadc6406330729523036828" sha256 monterey: "0b4412e46e30f8970f331f4948e3210b956abceceebbb0b480ace2af2fa3973a" sha256 big_sur: "651100d0ad19af5ef07a55c1bd0d728211d8810e9da024d9344f3ed5c024e46b" sha256 catalina: "90c5dee20ff2517495521e588b09678789462a8a63dc6a600da13a76cb5e86b0" sha256 mojave: "1ff1470d676dabb177f06c2683b67da5e70e39bbab28f7457762d4adda5cffb0" sha256 high_sierra: "b5f0af51ce1098ea35e48bc50f4097cbb9e647989decd6d7791476b062ef7582" sha256 sierra: "376c71ad2f5abcc0233b3873d70cc963e54ac0ca00a552eceb025ac09b931ff6" sha256 el_capitan: "d3b66de7eae03edecb2573524d94239bd013ffd57eeb1980411da12f6d2b2b98" sha256 yosemite: "b318e0b227a3ad281afe95edc5a0cc7ab0b1d5e46b1699e6221eb201de869b48" sha256 x86_64_linux: "28f96eb2fba35b8c50f166eecd9b48dc8336229e97425f290209d15e9526eeeb" end depends_on "groff" => :build uses_from_macos "ncurses" on_macos do depends_on "coreutils" => :build depends_on "gnu-sed" => :build end on_linux do depends_on "util-linux" => :build # for `col` end def install if OS.mac? ENV["RMDIR"] = "grmdir" ENV["SED"] = "gsed" ENV["INSTALL"] = "ginstall" end system "./configure", "--disable-debug", "--disable-dependency-tracking", "--disable-silent-rules", "--prefix=#{prefix}" system "make", "install" end test do system bin/"myman", "-k" end end myman: remove Yosemite bottle Yosemite support was removed in Homebrew 3.5.0. class Myman < Formula desc "Text-mode videogame inspired by Namco's Pac-Man" homepage "https://myman.sourceforge.io/" url "https://downloads.sourceforge.net/project/myman/myman-cvs/myman-cvs-2009-10-30/myman-wip-2009-10-30.tar.gz" sha256 "bf69607eabe4c373862c81bf56756f2a96eecb8eaa8c911bb2abda78b40c6d73" head ":pserver:anonymous:@myman.cvs.sourceforge.net:/cvsroot/myman", using: :cvs bottle do rebuild 2 sha256 arm64_monterey: "7572bde41926ba4a33b300b0e43b890648fb8d19e47e4a50b43608e99c9b8e9a" sha256 arm64_big_sur: "a38be300e040956aa8f9d997a715c91152868d5aeaadc6406330729523036828" sha256 monterey: "0b4412e46e30f8970f331f4948e3210b956abceceebbb0b480ace2af2fa3973a" sha256 big_sur: "651100d0ad19af5ef07a55c1bd0d728211d8810e9da024d9344f3ed5c024e46b" sha256 catalina: "90c5dee20ff2517495521e588b09678789462a8a63dc6a600da13a76cb5e86b0" sha256 mojave: "1ff1470d676dabb177f06c2683b67da5e70e39bbab28f7457762d4adda5cffb0" sha256 high_sierra: "b5f0af51ce1098ea35e48bc50f4097cbb9e647989decd6d7791476b062ef7582" sha256 sierra: "376c71ad2f5abcc0233b3873d70cc963e54ac0ca00a552eceb025ac09b931ff6" sha256 el_capitan: "d3b66de7eae03edecb2573524d94239bd013ffd57eeb1980411da12f6d2b2b98" sha256 x86_64_linux: "28f96eb2fba35b8c50f166eecd9b48dc8336229e97425f290209d15e9526eeeb" end depends_on "groff" => :build uses_from_macos "ncurses" on_macos do depends_on "coreutils" => :build depends_on "gnu-sed" => :build end on_linux do depends_on "util-linux" => :build # for `col` end def install if OS.mac? ENV["RMDIR"] = "grmdir" ENV["SED"] = "gsed" ENV["INSTALL"] = "ginstall" end system "./configure", "--disable-debug", "--disable-dependency-tracking", "--disable-silent-rules", "--prefix=#{prefix}" system "make", "install" end test do system bin/"myman", "-k" end end
class Mysql < Formula desc "Open source relational database management system" homepage "https://dev.mysql.com/doc/refman/5.7/en/" url "https://cdn.mysql.com/Downloads/MySQL-5.7/mysql-boost-5.7.15.tar.gz" sha256 "7342a3a3e40878378dfaee252d42a3a5b06c58237f49c2544424d27316738945" bottle do sha256 "84f562c4eda4ce7ecf89f38f480f8a27f23a7500fd0a1b13daadcb16308bc00e" => :sierra sha256 "378bf7d07c791ee5144a958f1395fdb8838f29b2358ee927f9bc0e3f0673f66d" => :el_capitan sha256 "03df7e5ebba4674d75c6ec8c5ae68f0ea6df339595c3a5434740ce545296ccbe" => :yosemite sha256 "cf205231fd0bd4177bf3a94761d4dcc6985d1eb7597592f8e4947e826acf7fd2" => :mavericks end option "with-test", "Build with unit tests" option "with-embedded", "Build the embedded server" option "with-archive-storage-engine", "Compile with the ARCHIVE storage engine enabled" option "with-blackhole-storage-engine", "Compile with the BLACKHOLE storage engine enabled" option "with-local-infile", "Build with local infile loading support" option "with-debug", "Build with debug support" deprecated_option "enable-local-infile" => "with-local-infile" deprecated_option "enable-debug" => "with-debug" deprecated_option "with-tests" => "with-test" depends_on "cmake" => :build depends_on "pidof" unless MacOS.version >= :mountain_lion depends_on "openssl" # https://github.com/Homebrew/homebrew-core/issues/1475 # Needs at least Clang 3.3, which shipped alongside Lion. # Note: MySQL themselves don't support anything below Mavericks. depends_on :macos => :lion conflicts_with "mysql-cluster", "mariadb", "percona-server", :because => "mysql, mariadb, and percona install the same binaries." conflicts_with "mysql-connector-c", :because => "both install MySQL client libraries" conflicts_with "mariadb-connector-c", :because => "both install plugins" fails_with :llvm do build 2326 cause "https://github.com/Homebrew/homebrew/issues/issue/144" end def datadir var/"mysql" end def install # Don't hard-code the libtool path. See: # https://github.com/Homebrew/homebrew/issues/20185 inreplace "cmake/libutils.cmake", "COMMAND /usr/bin/libtool -static -o ${TARGET_LOCATION}", "COMMAND libtool -static -o ${TARGET_LOCATION}" # Build without compiler or CPU specific optimization flags to facilitate # compilation of gems and other software that queries `mysql-config`. ENV.minimal_optimization # -DINSTALL_* are relative to `CMAKE_INSTALL_PREFIX` (`prefix`) args = %W[ -DMYSQL_DATADIR=#{datadir} -DINSTALL_INCLUDEDIR=include/mysql -DINSTALL_MANDIR=share/man -DINSTALL_DOCDIR=share/doc/#{name} -DINSTALL_INFODIR=share/info -DINSTALL_MYSQLSHAREDIR=share/mysql -DWITH_SSL=yes -DWITH_SSL=system -DDEFAULT_CHARSET=utf8 -DDEFAULT_COLLATION=utf8_general_ci -DSYSCONFDIR=#{etc} -DCOMPILATION_COMMENT=Homebrew -DWITH_EDITLINE=system -DWITH_BOOST=boost ] # To enable unit testing at build, we need to download the unit testing suite if build.with? "test" args << "-DENABLE_DOWNLOADS=ON" else args << "-DWITH_UNIT_TESTS=OFF" end # Build the embedded server args << "-DWITH_EMBEDDED_SERVER=ON" if build.with? "embedded" # Compile with ARCHIVE engine enabled if chosen args << "-DWITH_ARCHIVE_STORAGE_ENGINE=1" if build.with? "archive-storage-engine" # Compile with BLACKHOLE engine enabled if chosen args << "-DWITH_BLACKHOLE_STORAGE_ENGINE=1" if build.with? "blackhole-storage-engine" # Make universal for binding to universal applications if build.universal? ENV.universal_binary args << "-DCMAKE_OSX_ARCHITECTURES=#{Hardware::CPU.universal_archs.as_cmake_arch_flags}" end # Build with local infile loading support args << "-DENABLED_LOCAL_INFILE=1" if build.with? "local-infile" # Build with debug support args << "-DWITH_DEBUG=1" if build.with? "debug" system "cmake", ".", *std_cmake_args, *args system "make" system "make", "install" # Don't create databases inside of the prefix! # See: https://github.com/Homebrew/homebrew/issues/4975 rm_rf prefix/"data" # Perl script was removed in 5.7.9 so install C++ binary instead. # Binary is deprecated & will be removed in future upstream # update but is still required for mysql-test-run to pass in test. (prefix/"scripts").install "client/mysql_install_db" bin.install_symlink prefix/"scripts/mysql_install_db" # Fix up the control script and link into bin inreplace "#{prefix}/support-files/mysql.server" do |s| s.gsub!(/^(PATH=".*)(")/, "\\1:#{HOMEBREW_PREFIX}/bin\\2") # pidof can be replaced with pgrep from proctools on Mountain Lion s.gsub!(/pidof/, "pgrep") if MacOS.version >= :mountain_lion end bin.install_symlink prefix/"support-files/mysql.server" end def post_install # Make sure the datadir exists datadir.mkpath unless (datadir/"mysql/user.frm").exist? ENV["TMPDIR"] = nil system bin/"mysqld", "--initialize-insecure", "--user=#{ENV["USER"]}", "--basedir=#{prefix}", "--datadir=#{datadir}", "--tmpdir=/tmp" end end def caveats s = <<-EOS.undent We've installed your MySQL database without a root password. To secure it run: mysql_secure_installation To connect run: mysql -uroot EOS if File.exist? "/etc/my.cnf" s += <<-EOS.undent A "/etc/my.cnf" from another install may interfere with a Homebrew-built server starting up correctly. EOS end s end plist_options :manual => "mysql.server start" def plist; <<-EOS.undent <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>KeepAlive</key> <true/> <key>Label</key> <string>#{plist_name}</string> <key>ProgramArguments</key> <array> <string>#{opt_bin}/mysqld_safe</string> <string>--bind-address=127.0.0.1</string> <string>--datadir=#{datadir}</string> </array> <key>RunAtLoad</key> <true/> <key>WorkingDirectory</key> <string>#{datadir}</string> </dict> </plist> EOS end test do system "/bin/sh", "-n", "#{bin}/mysqld_safe" (prefix/"mysql-test").cd do system "./mysql-test-run.pl", "status", "--vardir=#{testpath}" end end end mysql 5.7.16 Closes #5945. Signed-off-by: Mike McQuaid <a17fed27eaa842282862ff7c1b9c8395a26ac320@mikemcquaid.com> class Mysql < Formula desc "Open source relational database management system" homepage "https://dev.mysql.com/doc/refman/5.7/en/" url "https://cdn.mysql.com/Downloads/MySQL-5.7/mysql-boost-5.7.16.tar.gz" sha256 "43fc282f807353ff77ead21efb5f85f7f214c2a5362762a8cc370ae1c075095a" bottle do sha256 "84f562c4eda4ce7ecf89f38f480f8a27f23a7500fd0a1b13daadcb16308bc00e" => :sierra sha256 "378bf7d07c791ee5144a958f1395fdb8838f29b2358ee927f9bc0e3f0673f66d" => :el_capitan sha256 "03df7e5ebba4674d75c6ec8c5ae68f0ea6df339595c3a5434740ce545296ccbe" => :yosemite sha256 "cf205231fd0bd4177bf3a94761d4dcc6985d1eb7597592f8e4947e826acf7fd2" => :mavericks end option "with-test", "Build with unit tests" option "with-embedded", "Build the embedded server" option "with-archive-storage-engine", "Compile with the ARCHIVE storage engine enabled" option "with-blackhole-storage-engine", "Compile with the BLACKHOLE storage engine enabled" option "with-local-infile", "Build with local infile loading support" option "with-debug", "Build with debug support" deprecated_option "enable-local-infile" => "with-local-infile" deprecated_option "enable-debug" => "with-debug" deprecated_option "with-tests" => "with-test" depends_on "cmake" => :build depends_on "pidof" unless MacOS.version >= :mountain_lion depends_on "openssl" # https://github.com/Homebrew/homebrew-core/issues/1475 # Needs at least Clang 3.3, which shipped alongside Lion. # Note: MySQL themselves don't support anything below Mavericks. depends_on :macos => :lion conflicts_with "mysql-cluster", "mariadb", "percona-server", :because => "mysql, mariadb, and percona install the same binaries." conflicts_with "mysql-connector-c", :because => "both install MySQL client libraries" conflicts_with "mariadb-connector-c", :because => "both install plugins" fails_with :llvm do build 2326 cause "https://github.com/Homebrew/homebrew/issues/issue/144" end def datadir var/"mysql" end def install # Don't hard-code the libtool path. See: # https://github.com/Homebrew/homebrew/issues/20185 inreplace "cmake/libutils.cmake", "COMMAND /usr/bin/libtool -static -o ${TARGET_LOCATION}", "COMMAND libtool -static -o ${TARGET_LOCATION}" # Build without compiler or CPU specific optimization flags to facilitate # compilation of gems and other software that queries `mysql-config`. ENV.minimal_optimization # -DINSTALL_* are relative to `CMAKE_INSTALL_PREFIX` (`prefix`) args = %W[ -DMYSQL_DATADIR=#{datadir} -DINSTALL_INCLUDEDIR=include/mysql -DINSTALL_MANDIR=share/man -DINSTALL_DOCDIR=share/doc/#{name} -DINSTALL_INFODIR=share/info -DINSTALL_MYSQLSHAREDIR=share/mysql -DWITH_SSL=yes -DWITH_SSL=system -DDEFAULT_CHARSET=utf8 -DDEFAULT_COLLATION=utf8_general_ci -DSYSCONFDIR=#{etc} -DCOMPILATION_COMMENT=Homebrew -DWITH_EDITLINE=system -DWITH_BOOST=boost ] # To enable unit testing at build, we need to download the unit testing suite if build.with? "test" args << "-DENABLE_DOWNLOADS=ON" else args << "-DWITH_UNIT_TESTS=OFF" end # Build the embedded server args << "-DWITH_EMBEDDED_SERVER=ON" if build.with? "embedded" # Compile with ARCHIVE engine enabled if chosen args << "-DWITH_ARCHIVE_STORAGE_ENGINE=1" if build.with? "archive-storage-engine" # Compile with BLACKHOLE engine enabled if chosen args << "-DWITH_BLACKHOLE_STORAGE_ENGINE=1" if build.with? "blackhole-storage-engine" # Make universal for binding to universal applications if build.universal? ENV.universal_binary args << "-DCMAKE_OSX_ARCHITECTURES=#{Hardware::CPU.universal_archs.as_cmake_arch_flags}" end # Build with local infile loading support args << "-DENABLED_LOCAL_INFILE=1" if build.with? "local-infile" # Build with debug support args << "-DWITH_DEBUG=1" if build.with? "debug" system "cmake", ".", *std_cmake_args, *args system "make" system "make", "install" # Don't create databases inside of the prefix! # See: https://github.com/Homebrew/homebrew/issues/4975 rm_rf prefix/"data" # Perl script was removed in 5.7.9 so install C++ binary instead. # Binary is deprecated & will be removed in future upstream # update but is still required for mysql-test-run to pass in test. (prefix/"scripts").install "client/mysql_install_db" bin.install_symlink prefix/"scripts/mysql_install_db" # Fix up the control script and link into bin inreplace "#{prefix}/support-files/mysql.server" do |s| s.gsub!(/^(PATH=".*)(")/, "\\1:#{HOMEBREW_PREFIX}/bin\\2") # pidof can be replaced with pgrep from proctools on Mountain Lion s.gsub!(/pidof/, "pgrep") if MacOS.version >= :mountain_lion end bin.install_symlink prefix/"support-files/mysql.server" end def post_install # Make sure the datadir exists datadir.mkpath unless (datadir/"mysql/user.frm").exist? ENV["TMPDIR"] = nil system bin/"mysqld", "--initialize-insecure", "--user=#{ENV["USER"]}", "--basedir=#{prefix}", "--datadir=#{datadir}", "--tmpdir=/tmp" end end def caveats s = <<-EOS.undent We've installed your MySQL database without a root password. To secure it run: mysql_secure_installation To connect run: mysql -uroot EOS if File.exist? "/etc/my.cnf" s += <<-EOS.undent A "/etc/my.cnf" from another install may interfere with a Homebrew-built server starting up correctly. EOS end s end plist_options :manual => "mysql.server start" def plist; <<-EOS.undent <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>KeepAlive</key> <true/> <key>Label</key> <string>#{plist_name}</string> <key>ProgramArguments</key> <array> <string>#{opt_bin}/mysqld_safe</string> <string>--bind-address=127.0.0.1</string> <string>--datadir=#{datadir}</string> </array> <key>RunAtLoad</key> <true/> <key>WorkingDirectory</key> <string>#{datadir}</string> </dict> </plist> EOS end test do system "/bin/sh", "-n", "#{bin}/mysqld_safe" (prefix/"mysql-test").cd do system "./mysql-test-run.pl", "status", "--vardir=#{testpath}" end end end
class Mysql < Formula desc "Open source relational database management system" homepage "https://dev.mysql.com/doc/refman/8.0/en/" url "https://cdn.mysql.com/Downloads/MySQL-8.0/mysql-boost-8.0.30.tar.gz" sha256 "c331ac7a68099a2116097acbb14fd331423d486fe47ce0e346925111b44df69c" license "GPL-2.0-only" => { with: "Universal-FOSS-exception-1.0" } revision 1 livecheck do url "https://dev.mysql.com/downloads/mysql/?tpl=files&os=src" regex(/href=.*?mysql[._-](?:boost[._-])?v?(\d+(?:\.\d+)+)\.t/i) end bottle do sha256 arm64_monterey: "087a0ccf2725c577cfe4de6c44d6517145e5a8bfa2bf926ab32b378e0acf4dd6" sha256 arm64_big_sur: "6078d657be355c5080a14f2a9a600816c9fdc130530ee0d044d3ffafd0d279a9" sha256 monterey: "084a01b67a7bb5d5fd171a4c318de5f9a621487b19bff7737252e549cbf9c5fe" sha256 big_sur: "aae3214fe212112289a5e7557d69533409976a60cfb331080f0ca460d3bb0d0f" sha256 catalina: "f9309cdf8443ac1b763925d275180cc369d59b37fdf268044f2ed5b1ed749833" sha256 x86_64_linux: "51d635cbaaee4370c605fbb58186983ad5e4e5790a990a682f6e28758d97ca19" end depends_on "cmake" => :build depends_on "pkg-config" => :build depends_on "icu4c" depends_on "libevent" depends_on "libfido2" depends_on "lz4" depends_on "openssl@1.1" depends_on "protobuf" depends_on "zlib" # Zlib 1.2.12+ depends_on "zstd" uses_from_macos "curl" uses_from_macos "cyrus-sasl" uses_from_macos "libedit" on_linux do depends_on "patchelf" => :build depends_on "gcc" # for C++17 end conflicts_with "mariadb", "percona-server", because: "mysql, mariadb, and percona install the same binaries" fails_with gcc: "5" # Patch out check for Homebrew `boost`. # This should not be necessary when building inside `brew`. # https://github.com/Homebrew/homebrew-test-bot/pull/820 patch do url "https://raw.githubusercontent.com/Homebrew/formula-patches/030f7433e89376ffcff836bb68b3903ab90f9cdc/mysql/boost-check.patch" sha256 "af27e4b82c84f958f91404a9661e999ccd1742f57853978d8baec2f993b51153" end def datadir var/"mysql" end def install if OS.linux? # Fix libmysqlgcs.a(gcs_logging.cc.o): relocation R_X86_64_32 # against `_ZN17Gcs_debug_options12m_debug_noneB5cxx11E' can not be used when making # a shared object; recompile with -fPIC ENV.append_to_cflags "-fPIC" # Disable ABI checking inreplace "cmake/abi_check.cmake", "RUN_ABI_CHECK 1", "RUN_ABI_CHECK 0" end # -DINSTALL_* are relative to `CMAKE_INSTALL_PREFIX` (`prefix`) args = %W[ -DFORCE_INSOURCE_BUILD=1 -DCOMPILATION_COMMENT=Homebrew -DINSTALL_DOCDIR=share/doc/#{name} -DINSTALL_INCLUDEDIR=include/mysql -DINSTALL_INFODIR=share/info -DINSTALL_MANDIR=share/man -DINSTALL_MYSQLSHAREDIR=share/mysql -DINSTALL_PLUGINDIR=lib/plugin -DMYSQL_DATADIR=#{datadir} -DSYSCONFDIR=#{etc} -DWITH_SYSTEM_LIBS=ON -DWITH_BOOST=boost -DWITH_EDITLINE=system -DWITH_FIDO=system -DWITH_ICU=system -DWITH_LIBEVENT=system -DWITH_LZ4=system -DWITH_PROTOBUF=system -DWITH_SSL=system -DWITH_ZLIB=system -DWITH_ZSTD=system -DWITH_UNIT_TESTS=OFF -DENABLED_LOCAL_INFILE=1 -DWITH_INNODB_MEMCACHED=ON ] system "cmake", ".", *std_cmake_args, *args system "make" system "make", "install" (prefix/"mysql-test").cd do system "./mysql-test-run.pl", "status", "--vardir=#{Dir.mktmpdir}" end # Remove the tests directory rm_rf prefix/"mysql-test" # Don't create databases inside of the prefix! # See: https://github.com/Homebrew/homebrew/issues/4975 rm_rf prefix/"data" # Fix up the control script and link into bin. inreplace "#{prefix}/support-files/mysql.server", /^(PATH=".*)(")/, "\\1:#{HOMEBREW_PREFIX}/bin\\2" bin.install_symlink prefix/"support-files/mysql.server" # Install my.cnf that binds to 127.0.0.1 by default (buildpath/"my.cnf").write <<~EOS # Default Homebrew MySQL server config [mysqld] # Only allow connections from localhost bind-address = 127.0.0.1 mysqlx-bind-address = 127.0.0.1 EOS etc.install "my.cnf" end def post_install # Make sure the var/mysql directory exists (var/"mysql").mkpath # Don't initialize database, it clashes when testing other MySQL-like implementations. return if ENV["HOMEBREW_GITHUB_ACTIONS"] unless (datadir/"mysql/general_log.CSM").exist? ENV["TMPDIR"] = nil system bin/"mysqld", "--initialize-insecure", "--user=#{ENV["USER"]}", "--basedir=#{prefix}", "--datadir=#{datadir}", "--tmpdir=/tmp" end end def caveats s = <<~EOS We've installed your MySQL database without a root password. To secure it run: mysql_secure_installation MySQL is configured to only allow connections from localhost by default To connect run: mysql -uroot EOS if (my_cnf = ["/etc/my.cnf", "/etc/mysql/my.cnf"].find { |x| File.exist? x }) s += <<~EOS A "#{my_cnf}" from another install may interfere with a Homebrew-built server starting up correctly. EOS end s end service do run [opt_bin/"mysqld_safe", "--datadir=#{var}/mysql"] keep_alive true working_dir var/"mysql" end test do (testpath/"mysql").mkpath (testpath/"tmp").mkpath system bin/"mysqld", "--no-defaults", "--initialize-insecure", "--user=#{ENV["USER"]}", "--basedir=#{prefix}", "--datadir=#{testpath}/mysql", "--tmpdir=#{testpath}/tmp" port = free_port fork do system "#{bin}/mysqld", "--no-defaults", "--user=#{ENV["USER"]}", "--datadir=#{testpath}/mysql", "--port=#{port}", "--tmpdir=#{testpath}/tmp" end sleep 5 assert_match "information_schema", shell_output("#{bin}/mysql --port=#{port} --user=root --password= --execute='show databases;'") system "#{bin}/mysqladmin", "--port=#{port}", "--user=root", "--password=", "shutdown" end end Fixed a typo class Mysql < Formula desc "Open source relational database management system" homepage "https://dev.mysql.com/doc/refman/8.0/en/" url "https://cdn.mysql.com/Downloads/MySQL-8.0/mysql-boost-8.0.30.tar.gz" sha256 "c331ac7a68099a2116097acbb14fd331423d486fe47ce0e346925111b44df69c" license "GPL-2.0-only" => { with: "Universal-FOSS-exception-1.0" } revision 1 livecheck do url "https://dev.mysql.com/downloads/mysql/?tpl=files&os=src" regex(/href=.*?mysql[._-](?:boost[._-])?v?(\d+(?:\.\d+)+)\.t/i) end bottle do sha256 arm64_monterey: "087a0ccf2725c577cfe4de6c44d6517145e5a8bfa2bf926ab32b378e0acf4dd6" sha256 arm64_big_sur: "6078d657be355c5080a14f2a9a600816c9fdc130530ee0d044d3ffafd0d279a9" sha256 monterey: "084a01b67a7bb5d5fd171a4c318de5f9a621487b19bff7737252e549cbf9c5fe" sha256 big_sur: "aae3214fe212112289a5e7557d69533409976a60cfb331080f0ca460d3bb0d0f" sha256 catalina: "f9309cdf8443ac1b763925d275180cc369d59b37fdf268044f2ed5b1ed749833" sha256 x86_64_linux: "51d635cbaaee4370c605fbb58186983ad5e4e5790a990a682f6e28758d97ca19" end depends_on "cmake" => :build depends_on "pkg-config" => :build depends_on "icu4c" depends_on "libevent" depends_on "libfido2" depends_on "lz4" depends_on "openssl@1.1" depends_on "protobuf" depends_on "zlib" # Zlib 1.2.12+ depends_on "zstd" uses_from_macos "curl" uses_from_macos "cyrus-sasl" uses_from_macos "libedit" on_linux do depends_on "patchelf" => :build depends_on "gcc" # for C++17 end conflicts_with "mariadb", "percona-server", because: "mysql, mariadb, and percona install the same binaries" fails_with gcc: "5" # Patch out check for Homebrew `boost`. # This should not be necessary when building inside `brew`. # https://github.com/Homebrew/homebrew-test-bot/pull/820 patch do url "https://raw.githubusercontent.com/Homebrew/formula-patches/030f7433e89376ffcff836bb68b3903ab90f9cdc/mysql/boost-check.patch" sha256 "af27e4b82c84f958f91404a9661e999ccd1742f57853978d8baec2f993b51153" end def datadir var/"mysql" end def install if OS.linux? # Fix libmysqlgcs.a(gcs_logging.cc.o): relocation R_X86_64_32 # against `_ZN17Gcs_debug_options12m_debug_noneB5cxx11E' can not be used when making # a shared object; recompile with -fPIC ENV.append_to_cflags "-fPIC" # Disable ABI checking inreplace "cmake/abi_check.cmake", "RUN_ABI_CHECK 1", "RUN_ABI_CHECK 0" end # -DINSTALL_* are relative to `CMAKE_INSTALL_PREFIX` (`prefix`) args = %W[ -DFORCE_INSOURCE_BUILD=1 -DCOMPILATION_COMMENT=Homebrew -DINSTALL_DOCDIR=share/doc/#{name} -DINSTALL_INCLUDEDIR=include/mysql -DINSTALL_INFODIR=share/info -DINSTALL_MANDIR=share/man -DINSTALL_MYSQLSHAREDIR=share/mysql -DINSTALL_PLUGINDIR=lib/plugin -DMYSQL_DATADIR=#{datadir} -DSYSCONFDIR=#{etc} -DWITH_SYSTEM_LIBS=ON -DWITH_BOOST=boost -DWITH_EDITLINE=system -DWITH_FIDO=system -DWITH_ICU=system -DWITH_LIBEVENT=system -DWITH_LZ4=system -DWITH_PROTOBUF=system -DWITH_SSL=system -DWITH_ZLIB=system -DWITH_ZSTD=system -DWITH_UNIT_TESTS=OFF -DENABLED_LOCAL_INFILE=1 -DWITH_INNODB_MEMCACHED=ON ] system "cmake", ".", *std_cmake_args, *args system "make" system "make", "install" (prefix/"mysql-test").cd do system "./mysql-test-run.pl", "status", "--vardir=#{Dir.mktmpdir}" end # Remove the tests directory rm_rf prefix/"mysql-test" # Don't create databases inside of the prefix! # See: https://github.com/Homebrew/homebrew/issues/4975 rm_rf prefix/"data" # Fix up the control script and link into bin. inreplace "#{prefix}/support-files/mysql.server", /^(PATH=".*)(")/, "\\1:#{HOMEBREW_PREFIX}/bin\\2" bin.install_symlink prefix/"support-files/mysql.server" # Install my.cnf that binds to 127.0.0.1 by default (buildpath/"my.cnf").write <<~EOS # Default Homebrew MySQL server config [mysqld] # Only allow connections from localhost bind-address = 127.0.0.1 mysqlx-bind-address = 127.0.0.1 EOS etc.install "my.cnf" end def post_install # Make sure the var/mysql directory exists (var/"mysql").mkpath # Don't initialize database, it clashes when testing other MySQL-like implementations. return if ENV["HOMEBREW_GITHUB_ACTIONS"] unless (datadir/"mysql/general_log.CSM").exist? ENV["TMPDIR"] = nil system bin/"mysqld", "--initialize-insecure", "--user=#{ENV["USER"]}", "--basedir=#{prefix}", "--datadir=#{datadir}", "--tmpdir=/tmp" end end def caveats s = <<~EOS We've installed your MySQL database without a root password. To secure it run: mysql_secure_installation MySQL is configured to only allow connections from localhost by default To connect run: mysql -u root EOS if (my_cnf = ["/etc/my.cnf", "/etc/mysql/my.cnf"].find { |x| File.exist? x }) s += <<~EOS A "#{my_cnf}" from another install may interfere with a Homebrew-built server starting up correctly. EOS end s end service do run [opt_bin/"mysqld_safe", "--datadir=#{var}/mysql"] keep_alive true working_dir var/"mysql" end test do (testpath/"mysql").mkpath (testpath/"tmp").mkpath system bin/"mysqld", "--no-defaults", "--initialize-insecure", "--user=#{ENV["USER"]}", "--basedir=#{prefix}", "--datadir=#{testpath}/mysql", "--tmpdir=#{testpath}/tmp" port = free_port fork do system "#{bin}/mysqld", "--no-defaults", "--user=#{ENV["USER"]}", "--datadir=#{testpath}/mysql", "--port=#{port}", "--tmpdir=#{testpath}/tmp" end sleep 5 assert_match "information_schema", shell_output("#{bin}/mysql --port=#{port} --user=root --password= --execute='show databases;'") system "#{bin}/mysqladmin", "--port=#{port}", "--user=root", "--password=", "shutdown" end end
class Nauty < Formula desc "Automorphism groups of graphs and digraphs" homepage "https://pallini.di.uniroma1.it/" url "https://pallini.di.uniroma1.it/nauty27r1.tar.gz" version "27r1" sha256 "76ca5d196e402c83a987f90c28ff706bcc5a333bb4a8fbb979a62d3b99c34e77" livecheck do url :homepage regex(/href=.*?nauty[._-]?v?(\d+(?:\.\d+)*(?:r\d+)?)\.t/i) end bottle do sha256 cellar: :any_skip_relocation, arm64_big_sur: "6d7980d67e772addbc5220e4536a1193580253ae2a52fbc7182d12eb73573c6b" sha256 cellar: :any_skip_relocation, big_sur: "8714e05e1d050933e8571cca1c388a088d11170757fa5b1ae3fe5be7f490f6b5" sha256 cellar: :any_skip_relocation, catalina: "5d118260b6fdabceb476c1421e4b4dd41d3027943b623ff7a4dc81baf6e284b9" sha256 cellar: :any_skip_relocation, mojave: "2fa3783663f6e67d9a6e42c492c68412fdeeff7201d81e557b75927ff50b78f1" sha256 cellar: :any_skip_relocation, high_sierra: "a5333c52eecb023c23be9638ebd916606db43f8f7ef1d7ada4877ca00355d65a" sha256 cellar: :any_skip_relocation, x86_64_linux: "ec5559817e20258d6940c16e36c2b38b2c62430f4d786a2215de9eaae302de5a" end def install system "./configure", "--prefix=#{prefix}" system "make", "all" bin.install %w[ NRswitchg addedgeg amtog assembleg biplabg catg complg converseg copyg countg cubhamg deledgeg delptg directg dreadnaut dretodot dretog edgetransg genbg genbgL geng gengL genquarticg genrang genspecialg gentourng gentreeg hamheuristic labelg linegraphg listg multig newedgeg pickg planarg ranlabg shortg showg subdivideg twohamg underlyingg vcolg watercluster2 ] (include/"nauty").install Dir["*.h"] lib.install "nauty.a" => "libnauty.a" doc.install "nug27.pdf", "README", Dir["*.txt"] # Ancillary source files listed in README pkgshare.install %w[sumlines.c sorttemplates.c bliss2dre.c blisstog.c poptest.c dretodot.c] end test do # from ./runalltests out1 = shell_output("#{bin}/geng -ud1D7t 11 2>&1") out2 = shell_output("#{bin}/genrang -r3 114 100 | #{bin}/countg --nedDr -q") assert_match "92779 graphs generated", out1 assert_match "100 graphs : n=114; e=171; mindeg=3; maxdeg=3; regular", out2 # test that the library is installed and linkable-against (testpath/"test.c").write <<~EOS #define MAXN 1000 #include <nauty.h> int main() { int n = 12345; int m = SETWORDSNEEDED(n); nauty_check(WORDSIZE, m, n, NAUTYVERSIONID); return 0; } EOS system ENV.cc, "test.c", "-I#{include}/nauty", "-L#{lib}", "-lnauty", "-o", "test" system "./test" end end nauty 2.7r2 * nauty 2.7r2 * nauty: improve livecheck Closes #84618. Co-authored-by: Sam Ford <0ca8a4bfe5c5e61f6c29b211ba5263c8e9cfe2e1@users.noreply.github.com> Signed-off-by: Sam Ford <0ca8a4bfe5c5e61f6c29b211ba5263c8e9cfe2e1@users.noreply.github.com> Signed-off-by: BrewTestBot <8a898ee6867e4f2028e63d2a6319b2224641c06c@users.noreply.github.com> class Nauty < Formula desc "Automorphism groups of graphs and digraphs" homepage "https://pallini.di.uniroma1.it/" url "https://pallini.di.uniroma1.it/nauty27r2.tar.gz" version "2.7r2" sha256 "69c16c17da1cca90c25f6fb3bb242798af95f096fc3e2ff3e3398f390fcea768" version_scheme 1 livecheck do url :homepage regex(/Current\s+?version:\s*?v?(\d+(?:\.\d+)+(?:r\d+)?)/i) end bottle do sha256 cellar: :any_skip_relocation, arm64_big_sur: "6d7980d67e772addbc5220e4536a1193580253ae2a52fbc7182d12eb73573c6b" sha256 cellar: :any_skip_relocation, big_sur: "8714e05e1d050933e8571cca1c388a088d11170757fa5b1ae3fe5be7f490f6b5" sha256 cellar: :any_skip_relocation, catalina: "5d118260b6fdabceb476c1421e4b4dd41d3027943b623ff7a4dc81baf6e284b9" sha256 cellar: :any_skip_relocation, mojave: "2fa3783663f6e67d9a6e42c492c68412fdeeff7201d81e557b75927ff50b78f1" sha256 cellar: :any_skip_relocation, high_sierra: "a5333c52eecb023c23be9638ebd916606db43f8f7ef1d7ada4877ca00355d65a" sha256 cellar: :any_skip_relocation, x86_64_linux: "ec5559817e20258d6940c16e36c2b38b2c62430f4d786a2215de9eaae302de5a" end def install system "./configure", "--prefix=#{prefix}" system "make", "all" bin.install %w[ NRswitchg addedgeg amtog assembleg biplabg catg complg converseg copyg countg cubhamg deledgeg delptg directg dreadnaut dretodot dretog edgetransg genbg genbgL geng gengL genquarticg genrang genspecialg gentourng gentreeg hamheuristic labelg linegraphg listg multig newedgeg pickg planarg ranlabg shortg showg subdivideg twohamg underlyingg vcolg watercluster2 ] (include/"nauty").install Dir["*.h"] lib.install "nauty.a" => "libnauty.a" doc.install "nug27.pdf", "README", Dir["*.txt"] # Ancillary source files listed in README pkgshare.install %w[sumlines.c sorttemplates.c bliss2dre.c blisstog.c poptest.c dretodot.c] end test do # from ./runalltests out1 = shell_output("#{bin}/geng -ud1D7t 11 2>&1") out2 = shell_output("#{bin}/genrang -r3 114 100 | #{bin}/countg --nedDr -q") assert_match "92779 graphs generated", out1 assert_match "100 graphs : n=114; e=171; mindeg=3; maxdeg=3; regular", out2 # test that the library is installed and linkable-against (testpath/"test.c").write <<~EOS #define MAXN 1000 #include <nauty.h> int main() { int n = 12345; int m = SETWORDSNEEDED(n); nauty_check(WORDSIZE, m, n, NAUTYVERSIONID); return 0; } EOS system ENV.cc, "test.c", "-I#{include}/nauty", "-L#{lib}", "-lnauty", "-o", "test" system "./test" end end
require 'formula' class Ncmpc < Formula url 'http://downloads.sourceforge.net/project/musicpd/ncmpc/0.16.1/ncmpc-0.16.1.tar.bz2' homepage 'http://mpd.wikia.com/wiki/Client:Ncmpc' md5 'f3e53a379bd0bc82d315aa111bfdd17a' depends_on 'pkg-config' => :build depends_on 'gettext' depends_on 'glib' depends_on 'libmpdclient' def install system "./configure", "--prefix=#{prefix}", "--disable-debug", "--disable-dependency-tracking" system "make install" end end ncmpc 0.19 Signed-off-by: Adam Vandenberg <34c2b6407fd5a10249a15d699d40f9ed1782e98c@gmail.com> require 'formula' class Ncmpc < Formula url 'http://downloads.sourceforge.net/musicpd/ncmpc-0.19.tar.bz2' homepage 'http://mpd.wikia.com/wiki/Client:Ncmpc' md5 'd298ad1313ef3a522ef03367f8a1ffc0' depends_on 'pkg-config' => :build depends_on 'gettext' depends_on 'glib' depends_on 'libmpdclient' def install system "./configure", "--prefix=#{prefix}", "--disable-debug", "--disable-dependency-tracking" system "make install" end end
class Neo4j < Formula desc "Robust (fully ACID) transactional property graph database" homepage "http://neo4j.com" url "http://dist.neo4j.org/neo4j-community-2.3.2-unix.tar.gz" version "2.3.2" sha256 "37e24d95c914c54d5cbbe99473d4beef89da78adb2db04eb87258a489225932a" devel do url "http://dist.neo4j.org/neo4j-community-3.0.0-M02-unix.tar.gz" sha256 "2a20f420e94fe4189363ce8ab327c0e5e054df3fc74a0249e9e2c7fe0455a0d6" version "3.0.0-M02" end bottle :unneeded def install # Remove windows files rm_f Dir["bin/*.bat"] # Install jars in libexec to avoid conflicts libexec.install Dir["*"] # Symlink binaries bin.install_symlink Dir["#{libexec}/bin/neo4j{,-shell,-import}"] # Adjust UDC props # Suppress the empty, focus-stealing java gui. (libexec/"conf/neo4j-wrapper.conf").append_lines <<-EOS.undent wrapper.java.additional=-Djava.awt.headless=true wrapper.java.additional.4=-Dneo4j.ext.udc.source=homebrew EOS end end neo4j 2.3.3, 3.0.0-M05 (devel) neo4j 2.3.3 Closes #202. Signed-off-by: Andrew Janke <02e0a999c50b1f88df7a8f5a04e1b76b35ea6a88@apjanke.net> class Neo4j < Formula desc "Robust (fully ACID) transactional property graph database" homepage "http://neo4j.com" url "http://dist.neo4j.org/neo4j-community-2.3.3-unix.tar.gz" version "2.3.3" sha256 "01559c55055516a42ee2dd100137b6b55d63f02959a3c6c6db7a152e045828d9" devel do url "http://dist.neo4j.org/neo4j-community-3.0.0-M05-unix.tar.gz" sha256 "2b7878f424859de6951e86f9abb71701d8d45ab22e1157410504fe6a6bb17a95" version "3.0.0-M05" end bottle :unneeded depends_on :java => "1.7+" def install # Remove windows files rm_f Dir["bin/*.bat"] # Fix Java detection to work with 1.8 # https://github.com/neo4j/neo4j/issues/6895 inreplace "bin/utils", "java_home -v 1.7", "java_home -v 1.7+" if build.stable? # Install jars in libexec to avoid conflicts libexec.install Dir["*"] # Symlink binaries bin.install_symlink Dir["#{libexec}/bin/neo4j{,-shell,-import}"] # Adjust UDC props # Suppress the empty, focus-stealing java gui. (libexec/"conf/neo4j-wrapper.conf").append_lines <<-EOS.undent wrapper.java.additional=-Djava.awt.headless=true wrapper.java.additional.4=-Dneo4j.ext.udc.source=homebrew EOS end test do ENV.java_cache ENV["NEO4J_LOG"] = testpath/"libexec/data/log/neo4j.log" ENV["NEO4J_PIDFILE"] = testpath/"libexec/data/neo4j-service.pid" mkpath testpath/"libexec/data/log" assert_match /Neo4j .*is not running/i, shell_output("#{bin}/neo4j status", 3) end end
require 'formula' class Nexus < Formula homepage 'http://www.sonatype.org/' url 'http://download.sonatype.com/nexus/oss/nexus-2.9.0-04-bundle.tar.gz' version '2.9.0-04' sha1 'a46f60f015fdf3f699771962fbb468cdb5d39dcf' def install rm_f Dir['bin/*.bat'] # Put the sonatype-work directory in the var directory, to persist across version updates inreplace "nexus-#{version}/conf/nexus.properties", 'nexus-work=${bundleBasedir}/../sonatype-work/nexus', "nexus-work=#{var}/nexus" libexec.install Dir["nexus-#{version}/*"] bin.install_symlink libexec/'bin/nexus' end plist_options :manual => "#{HOMEBREW_PREFIX}/opt/nexus/libexec/bin/nexus start" def plist; <<-EOS.undent <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>Label</key> <string>com.sonatype.nexus</string> <key>ProgramArguments</key> <array> <string>#{opt_bin}/nexus</string> <string>start</string> </array> <key>RunAtLoad</key> <true/> </dict> </plist> EOS end end nexus 2.9.1-02 Closes Homebrew/homebrew#32618. Signed-off-by: Mike McQuaid <a17fed27eaa842282862ff7c1b9c8395a26ac320@mikemcquaid.com> require 'formula' class Nexus < Formula homepage 'http://www.sonatype.org/' url 'http://download.sonatype.com/nexus/oss/nexus-2.9.1-02-bundle.tar.gz' version '2.9.1-02' sha1 '1635c58922134cfd3a0361fcb7e2d1346162445e' def install rm_f Dir['bin/*.bat'] # Put the sonatype-work directory in the var directory, to persist across version updates inreplace "nexus-#{version}/conf/nexus.properties", 'nexus-work=${bundleBasedir}/../sonatype-work/nexus', "nexus-work=#{var}/nexus" libexec.install Dir["nexus-#{version}/*"] bin.install_symlink libexec/'bin/nexus' end plist_options :manual => "#{HOMEBREW_PREFIX}/opt/nexus/libexec/bin/nexus start" def plist; <<-EOS.undent <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>Label</key> <string>com.sonatype.nexus</string> <key>ProgramArguments</key> <array> <string>#{opt_bin}/nexus</string> <string>start</string> </array> <key>RunAtLoad</key> <true/> </dict> </plist> EOS end end
class Nginx < Formula desc "HTTP(S) server and reverse proxy, and IMAP/POP3 proxy server" homepage "http://nginx.org/" url "http://nginx.org/download/nginx-1.10.1.tar.gz" sha256 "1fd35846566485e03c0e318989561c135c598323ff349c503a6c14826487a801" head "http://hg.nginx.org/nginx/", :using => :hg bottle do sha256 "2b67c86454cc67bdeb2a637d9872ae471a810d8a2dae40b6a0c1dad7b253d30d" => :el_capitan sha256 "6ac0a3e07cad5efb31185998f6cd6754de6d799396ffd872814593ba3430fdb3" => :yosemite sha256 "c2f67c6b720a2f2c790338e0d30103acf36c757c068bbed8cc4c79734fd3779e" => :mavericks end devel do url "http://nginx.org/download/nginx-1.11.1.tar.gz" sha256 "5d8dd0197e3ffeb427729c045382182fb28db8e045c635221b2e0e6722821ad0" end # Before submitting more options to this formula please check they aren't # already in Homebrew/homebrew-nginx/nginx-full: # https://github.com/Homebrew/homebrew-nginx/blob/master/Formula/nginx-full.rb option "with-passenger", "Compile with support for Phusion Passenger module" option "with-webdav", "Compile with support for WebDAV module" option "with-debug", "Compile with support for debug log" option "with-http2", "Compile with support for the HTTP/2 module" option "with-gunzip", "Compile with support for gunzip module" deprecated_option "with-spdy" => "with-http2" depends_on "pcre" depends_on "passenger" => :optional depends_on "openssl" => :recommended depends_on "libressl" => :optional def install # Changes default port to 8080 inreplace "conf/nginx.conf" do |s| s.gsub! "listen 80;", "listen 8080;" s.gsub! " #}\n\n}", " #}\n include servers/*;\n}" end pcre = Formula["pcre"] openssl = Formula["openssl"] libressl = Formula["libressl"] if build.with? "libressl" cc_opt = "-I#{pcre.include} -I#{libressl.include}" ld_opt = "-L#{pcre.lib} -L#{libressl.lib}" else cc_opt = "-I#{pcre.include} -I#{openssl.include}" ld_opt = "-L#{pcre.lib} -L#{openssl.lib}" end args = %W[ --prefix=#{prefix} --with-http_ssl_module --with-pcre --with-ipv6 --sbin-path=#{bin}/nginx --with-cc-opt=#{cc_opt} --with-ld-opt=#{ld_opt} --conf-path=#{etc}/nginx/nginx.conf --pid-path=#{var}/run/nginx.pid --lock-path=#{var}/run/nginx.lock --http-client-body-temp-path=#{var}/run/nginx/client_body_temp --http-proxy-temp-path=#{var}/run/nginx/proxy_temp --http-fastcgi-temp-path=#{var}/run/nginx/fastcgi_temp --http-uwsgi-temp-path=#{var}/run/nginx/uwsgi_temp --http-scgi-temp-path=#{var}/run/nginx/scgi_temp --http-log-path=#{var}/log/nginx/access.log --error-log-path=#{var}/log/nginx/error.log --with-http_gzip_static_module ] if build.with? "passenger" nginx_ext = `#{Formula["passenger"].opt_bin}/passenger-config --nginx-addon-dir`.chomp args << "--add-module=#{nginx_ext}" end args << "--with-http_dav_module" if build.with? "webdav" args << "--with-debug" if build.with? "debug" args << "--with-http_gunzip_module" if build.with? "gunzip" args << "--with-http_v2_module" if build.with? "http2" if build.head? system "./auto/configure", *args else system "./configure", *args end system "make", "install" if build.head? man8.install "docs/man/nginx.8" else man8.install "man/nginx.8" end (etc/"nginx/servers").mkpath (var/"run/nginx").mkpath end def post_install # nginx's docroot is #{prefix}/html, this isn't useful, so we symlink it # to #{HOMEBREW_PREFIX}/var/www. The reason we symlink instead of patching # is so the user can redirect it easily to something else if they choose. html = prefix/"html" dst = var/"www" if dst.exist? html.rmtree dst.mkpath else dst.dirname.mkpath html.rename(dst) end prefix.install_symlink dst => "html" # for most of this formula's life the binary has been placed in sbin # and Homebrew used to suggest the user copy the plist for nginx to their # ~/Library/LaunchAgents directory. So we need to have a symlink there # for such cases if rack.subdirs.any? { |d| d.join("sbin").directory? } sbin.install_symlink bin/"nginx" end end def passenger_caveats; <<-EOS.undent To activate Phusion Passenger, add this to #{etc}/nginx/nginx.conf, inside the 'http' context: passenger_root #{Formula["passenger"].opt_libexec}/src/ruby_supportlib/phusion_passenger/locations.ini; passenger_ruby /usr/bin/ruby; EOS end def caveats s = <<-EOS.undent Docroot is: #{var}/www The default port has been set in #{etc}/nginx/nginx.conf to 8080 so that nginx can run without sudo. nginx will load all files in #{etc}/nginx/servers/. EOS s << "\n" << passenger_caveats if build.with? "passenger" s end plist_options :manual => "nginx" def plist; <<-EOS.undent <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>Label</key> <string>#{plist_name}</string> <key>RunAtLoad</key> <true/> <key>KeepAlive</key> <false/> <key>ProgramArguments</key> <array> <string>#{opt_bin}/nginx</string> <string>-g</string> <string>daemon off;</string> </array> <key>WorkingDirectory</key> <string>#{HOMEBREW_PREFIX}</string> </dict> </plist> EOS end test do (testpath/"nginx.conf").write <<-EOS worker_processes 4; error_log #{testpath}/error.log; pid #{testpath}/nginx.pid; events { worker_connections 1024; } http { client_body_temp_path #{testpath}/client_body_temp; fastcgi_temp_path #{testpath}/fastcgi_temp; proxy_temp_path #{testpath}/proxy_temp; scgi_temp_path #{testpath}/scgi_temp; uwsgi_temp_path #{testpath}/uwsgi_temp; server { listen 8080; root #{testpath}; access_log #{testpath}/access.log; error_log #{testpath}/error.log; } } EOS system "#{bin}/nginx", "-t", "-c", testpath/"nginx.conf" end end nginx: use secure urls class Nginx < Formula desc "HTTP(S) server and reverse proxy, and IMAP/POP3 proxy server" homepage "https://nginx.org/" url "https://nginx.org/download/nginx-1.10.1.tar.gz" sha256 "1fd35846566485e03c0e318989561c135c598323ff349c503a6c14826487a801" head "http://hg.nginx.org/nginx/", :using => :hg bottle do sha256 "2b67c86454cc67bdeb2a637d9872ae471a810d8a2dae40b6a0c1dad7b253d30d" => :el_capitan sha256 "6ac0a3e07cad5efb31185998f6cd6754de6d799396ffd872814593ba3430fdb3" => :yosemite sha256 "c2f67c6b720a2f2c790338e0d30103acf36c757c068bbed8cc4c79734fd3779e" => :mavericks end devel do url "https://nginx.org/download/nginx-1.11.1.tar.gz" sha256 "5d8dd0197e3ffeb427729c045382182fb28db8e045c635221b2e0e6722821ad0" end # Before submitting more options to this formula please check they aren't # already in Homebrew/homebrew-nginx/nginx-full: # https://github.com/Homebrew/homebrew-nginx/blob/master/Formula/nginx-full.rb option "with-passenger", "Compile with support for Phusion Passenger module" option "with-webdav", "Compile with support for WebDAV module" option "with-debug", "Compile with support for debug log" option "with-http2", "Compile with support for the HTTP/2 module" option "with-gunzip", "Compile with support for gunzip module" deprecated_option "with-spdy" => "with-http2" depends_on "pcre" depends_on "passenger" => :optional depends_on "openssl" => :recommended depends_on "libressl" => :optional def install # Changes default port to 8080 inreplace "conf/nginx.conf" do |s| s.gsub! "listen 80;", "listen 8080;" s.gsub! " #}\n\n}", " #}\n include servers/*;\n}" end pcre = Formula["pcre"] openssl = Formula["openssl"] libressl = Formula["libressl"] if build.with? "libressl" cc_opt = "-I#{pcre.include} -I#{libressl.include}" ld_opt = "-L#{pcre.lib} -L#{libressl.lib}" else cc_opt = "-I#{pcre.include} -I#{openssl.include}" ld_opt = "-L#{pcre.lib} -L#{openssl.lib}" end args = %W[ --prefix=#{prefix} --with-http_ssl_module --with-pcre --with-ipv6 --sbin-path=#{bin}/nginx --with-cc-opt=#{cc_opt} --with-ld-opt=#{ld_opt} --conf-path=#{etc}/nginx/nginx.conf --pid-path=#{var}/run/nginx.pid --lock-path=#{var}/run/nginx.lock --http-client-body-temp-path=#{var}/run/nginx/client_body_temp --http-proxy-temp-path=#{var}/run/nginx/proxy_temp --http-fastcgi-temp-path=#{var}/run/nginx/fastcgi_temp --http-uwsgi-temp-path=#{var}/run/nginx/uwsgi_temp --http-scgi-temp-path=#{var}/run/nginx/scgi_temp --http-log-path=#{var}/log/nginx/access.log --error-log-path=#{var}/log/nginx/error.log --with-http_gzip_static_module ] if build.with? "passenger" nginx_ext = `#{Formula["passenger"].opt_bin}/passenger-config --nginx-addon-dir`.chomp args << "--add-module=#{nginx_ext}" end args << "--with-http_dav_module" if build.with? "webdav" args << "--with-debug" if build.with? "debug" args << "--with-http_gunzip_module" if build.with? "gunzip" args << "--with-http_v2_module" if build.with? "http2" if build.head? system "./auto/configure", *args else system "./configure", *args end system "make", "install" if build.head? man8.install "docs/man/nginx.8" else man8.install "man/nginx.8" end (etc/"nginx/servers").mkpath (var/"run/nginx").mkpath end def post_install # nginx's docroot is #{prefix}/html, this isn't useful, so we symlink it # to #{HOMEBREW_PREFIX}/var/www. The reason we symlink instead of patching # is so the user can redirect it easily to something else if they choose. html = prefix/"html" dst = var/"www" if dst.exist? html.rmtree dst.mkpath else dst.dirname.mkpath html.rename(dst) end prefix.install_symlink dst => "html" # for most of this formula's life the binary has been placed in sbin # and Homebrew used to suggest the user copy the plist for nginx to their # ~/Library/LaunchAgents directory. So we need to have a symlink there # for such cases if rack.subdirs.any? { |d| d.join("sbin").directory? } sbin.install_symlink bin/"nginx" end end def passenger_caveats; <<-EOS.undent To activate Phusion Passenger, add this to #{etc}/nginx/nginx.conf, inside the 'http' context: passenger_root #{Formula["passenger"].opt_libexec}/src/ruby_supportlib/phusion_passenger/locations.ini; passenger_ruby /usr/bin/ruby; EOS end def caveats s = <<-EOS.undent Docroot is: #{var}/www The default port has been set in #{etc}/nginx/nginx.conf to 8080 so that nginx can run without sudo. nginx will load all files in #{etc}/nginx/servers/. EOS s << "\n" << passenger_caveats if build.with? "passenger" s end plist_options :manual => "nginx" def plist; <<-EOS.undent <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>Label</key> <string>#{plist_name}</string> <key>RunAtLoad</key> <true/> <key>KeepAlive</key> <false/> <key>ProgramArguments</key> <array> <string>#{opt_bin}/nginx</string> <string>-g</string> <string>daemon off;</string> </array> <key>WorkingDirectory</key> <string>#{HOMEBREW_PREFIX}</string> </dict> </plist> EOS end test do (testpath/"nginx.conf").write <<-EOS worker_processes 4; error_log #{testpath}/error.log; pid #{testpath}/nginx.pid; events { worker_connections 1024; } http { client_body_temp_path #{testpath}/client_body_temp; fastcgi_temp_path #{testpath}/fastcgi_temp; proxy_temp_path #{testpath}/proxy_temp; scgi_temp_path #{testpath}/scgi_temp; uwsgi_temp_path #{testpath}/uwsgi_temp; server { listen 8080; root #{testpath}; access_log #{testpath}/access.log; error_log #{testpath}/error.log; } } EOS system "#{bin}/nginx", "-t", "-c", testpath/"nginx.conf" end end
require 'formula' class Nginx < Formula homepage 'http://nginx.org/' url 'http://nginx.org/download/nginx-1.0.5.tar.gz' head 'http://nginx.org/download/nginx-1.1.0.tar.gz' unless ARGV.build_head? md5 '373c7761a7c682b92b164c8ee3d6d243' else md5 '3381f34eafc755f935a2d94148500505' end depends_on 'pcre' skip_clean 'logs' # Changes default port to 8080 # Tell configure to look for pcre in HOMEBREW_PREFIX def patches DATA end def options [ ['--with-passenger', "Compile with support for Phusion Passenger module"], ['--with-webdav', "Compile with support for WebDAV module"] ] end def passenger_config_args passenger_root = `passenger-config --root`.chomp if File.directory?(passenger_root) return "--add-module=#{passenger_root}/ext/nginx" end puts "Unable to install nginx with passenger support. The passenger" puts "gem must be installed and passenger-config must be in your path" puts "in order to continue." exit end def install args = ["--prefix=#{prefix}", "--with-http_ssl_module", "--with-pcre", "--conf-path=#{etc}/nginx/nginx.conf", "--pid-path=#{var}/run/nginx.pid", "--lock-path=#{var}/nginx/nginx.lock"] args << passenger_config_args if ARGV.include? '--with-passenger' args << "--with-http_dav_module" if ARGV.include? '--with-webdav' system "./configure", *args system "make install" (prefix+'org.nginx.nginx.plist').write startup_plist end def caveats; <<-EOS.undent In the interest of allowing you to run `nginx` without `sudo`, the default port is set to localhost:8080. If you want to host pages on your local machine to the public, you should change that to localhost:80, and run `sudo nginx`. You'll need to turn off any other web servers running port 80, of course. You can start nginx automatically on login running as your user with: mkdir -p ~/Library/LaunchAgents cp #{prefix}/org.nginx.nginx.plist ~/Library/LaunchAgents/ launchctl load -w ~/Library/LaunchAgents/org.nginx.nginx.plist Though note that if running as your user, the launch agent will fail if you try to use a port below 1024 (such as http's default of 80.) EOS end def startup_plist return <<-EOPLIST <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>Label</key> <string>org.nginx.nginx</string> <key>RunAtLoad</key> <true/> <key>KeepAlive</key> <true/> <key>UserName</key> <string>#{`whoami`.chomp}</string> <key>ProgramArguments</key> <array> <string>#{sbin}/nginx</string> <string>-g</string> <string>daemon off;</string> </array> <key>WorkingDirectory</key> <string>#{HOMEBREW_PREFIX}</string> </dict> </plist> EOPLIST end end __END__ --- a/auto/lib/pcre/conf +++ b/auto/lib/pcre/conf @@ -155,6 +155,22 @@ else . auto/feature fi + if [ $ngx_found = no ]; then + + # Homebrew + HOMEBREW_PREFIX=${NGX_PREFIX%Cellar*} + ngx_feature="PCRE library in ${HOMEBREW_PREFIX}" + ngx_feature_path="${HOMEBREW_PREFIX}/include" + + if [ $NGX_RPATH = YES ]; then + ngx_feature_libs="-R${HOMEBREW_PREFIX}/lib -L${HOMEBREW_PREFIX}/lib -lpcre" + else + ngx_feature_libs="-L${HOMEBREW_PREFIX}/lib -lpcre" + fi + + . auto/feature + fi + if [ $ngx_found = yes ]; then CORE_DEPS="$CORE_DEPS $REGEX_DEPS" CORE_SRCS="$CORE_SRCS $REGEX_SRCS" --- a/conf/nginx.conf +++ b/conf/nginx.conf @@ -33,7 +33,7 @@ #gzip on; server { - listen 80; + listen 8080; server_name localhost; #charset koi8-r; Nginx 1.0.6/1.1.1 Signed-off-by: Adam Vandenberg <34c2b6407fd5a10249a15d699d40f9ed1782e98c@gmail.com> require 'formula' class Nginx < Formula homepage 'http://nginx.org/' url 'http://nginx.org/download/nginx-1.0.6.tar.gz' head 'http://nginx.org/download/nginx-1.1.1.tar.gz' if ARGV.build_head? md5 '5afe88508dfca83db2cb991dceceb3a3' else md5 'bc98bac3f0b85da1045bc02e6d8fc80d' end depends_on 'pcre' skip_clean 'logs' # Changes default port to 8080 # Tell configure to look for pcre in HOMEBREW_PREFIX def patches DATA end def options [ ['--with-passenger', "Compile with support for Phusion Passenger module"], ['--with-webdav', "Compile with support for WebDAV module"] ] end def passenger_config_args passenger_root = `passenger-config --root`.chomp if File.directory?(passenger_root) return "--add-module=#{passenger_root}/ext/nginx" end puts "Unable to install nginx with passenger support. The passenger" puts "gem must be installed and passenger-config must be in your path" puts "in order to continue." exit end def install args = ["--prefix=#{prefix}", "--with-http_ssl_module", "--with-pcre", "--conf-path=#{etc}/nginx/nginx.conf", "--pid-path=#{var}/run/nginx.pid", "--lock-path=#{var}/nginx/nginx.lock"] args << passenger_config_args if ARGV.include? '--with-passenger' args << "--with-http_dav_module" if ARGV.include? '--with-webdav' system "./configure", *args system "make install" (prefix+'org.nginx.nginx.plist').write startup_plist end def caveats; <<-EOS.undent In the interest of allowing you to run `nginx` without `sudo`, the default port is set to localhost:8080. If you want to host pages on your local machine to the public, you should change that to localhost:80, and run `sudo nginx`. You'll need to turn off any other web servers running port 80, of course. You can start nginx automatically on login running as your user with: mkdir -p ~/Library/LaunchAgents cp #{prefix}/org.nginx.nginx.plist ~/Library/LaunchAgents/ launchctl load -w ~/Library/LaunchAgents/org.nginx.nginx.plist Though note that if running as your user, the launch agent will fail if you try to use a port below 1024 (such as http's default of 80.) EOS end def startup_plist return <<-EOPLIST <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>Label</key> <string>org.nginx.nginx</string> <key>RunAtLoad</key> <true/> <key>KeepAlive</key> <true/> <key>UserName</key> <string>#{`whoami`.chomp}</string> <key>ProgramArguments</key> <array> <string>#{sbin}/nginx</string> <string>-g</string> <string>daemon off;</string> </array> <key>WorkingDirectory</key> <string>#{HOMEBREW_PREFIX}</string> </dict> </plist> EOPLIST end end __END__ --- a/auto/lib/pcre/conf +++ b/auto/lib/pcre/conf @@ -155,6 +155,22 @@ else . auto/feature fi + if [ $ngx_found = no ]; then + + # Homebrew + HOMEBREW_PREFIX=${NGX_PREFIX%Cellar*} + ngx_feature="PCRE library in ${HOMEBREW_PREFIX}" + ngx_feature_path="${HOMEBREW_PREFIX}/include" + + if [ $NGX_RPATH = YES ]; then + ngx_feature_libs="-R${HOMEBREW_PREFIX}/lib -L${HOMEBREW_PREFIX}/lib -lpcre" + else + ngx_feature_libs="-L${HOMEBREW_PREFIX}/lib -lpcre" + fi + + . auto/feature + fi + if [ $ngx_found = yes ]; then CORE_DEPS="$CORE_DEPS $REGEX_DEPS" CORE_SRCS="$CORE_SRCS $REGEX_SRCS" --- a/conf/nginx.conf +++ b/conf/nginx.conf @@ -33,7 +33,7 @@ #gzip on; server { - listen 80; + listen 8080; server_name localhost; #charset koi8-r;
class Nomad < Formula desc "Distributed, Highly Available, Datacenter-Aware Scheduler" homepage "https://www.nomadproject.io" url "https://github.com/hashicorp/nomad/archive/v0.8.2.tar.gz" sha256 "18a42b02ae548a344a79b10cd34b710f5ab964ce57a58bd516af4b0c3826fdf1" head "https://github.com/hashicorp/nomad.git" bottle do cellar :any_skip_relocation sha256 "878e086ab495a10d3adf52a41a56551e22e0807ae17d2cb3d93d35716658232c" => :high_sierra sha256 "03cae4d45075a262e58ef8f32fa00540e4e37b36e8b4436b5ede9b1afad73c51" => :sierra sha256 "ba5ab3208d3be2f4046e9ad7cbfb2b715132ac217b30dfe85c24d35c7abea177" => :el_capitan end option "with-dynamic", "Build dynamic binary with CGO_ENABLED=1" depends_on "go" => :build def install ENV["GOPATH"] = buildpath (buildpath/"src/github.com/hashicorp/nomad").install buildpath.children cd "src/github.com/hashicorp/nomad" do ENV["CGO_ENABLED"] = "1" if build.with? "dynamic" system "go", "build", "-tags", "ui", "-o", bin/"nomad" prefix.install_metafiles end end test do begin pid = fork do exec "#{bin}/nomad", "agent", "-dev" end sleep 10 ENV.append "NOMAD_ADDR", "http://127.0.0.1:4646" system "#{bin}/nomad", "node-status" ensure Process.kill("TERM", pid) end end end nomad 0.8.3 Closes #27192. Signed-off-by: commitay <10d69e516de6fc57655a0b77a4a950d85cd2179f@users.noreply.github.com> class Nomad < Formula desc "Distributed, Highly Available, Datacenter-Aware Scheduler" homepage "https://www.nomadproject.io" url "https://github.com/hashicorp/nomad/archive/v0.8.3.tar.gz" sha256 "af1aee7bd182a656c846a710b262318b7a10bb31671843697f302606a758fe04" head "https://github.com/hashicorp/nomad.git" bottle do cellar :any_skip_relocation sha256 "878e086ab495a10d3adf52a41a56551e22e0807ae17d2cb3d93d35716658232c" => :high_sierra sha256 "03cae4d45075a262e58ef8f32fa00540e4e37b36e8b4436b5ede9b1afad73c51" => :sierra sha256 "ba5ab3208d3be2f4046e9ad7cbfb2b715132ac217b30dfe85c24d35c7abea177" => :el_capitan end option "with-dynamic", "Build dynamic binary with CGO_ENABLED=1" depends_on "go" => :build def install ENV["GOPATH"] = buildpath (buildpath/"src/github.com/hashicorp/nomad").install buildpath.children cd "src/github.com/hashicorp/nomad" do ENV["CGO_ENABLED"] = "1" if build.with? "dynamic" system "go", "build", "-tags", "ui", "-o", bin/"nomad" prefix.install_metafiles end end test do begin pid = fork do exec "#{bin}/nomad", "agent", "-dev" end sleep 10 ENV.append "NOMAD_ADDR", "http://127.0.0.1:4646" system "#{bin}/nomad", "node-status" ensure Process.kill("TERM", pid) end end end
# OCaml does not preserve binary compatibility across compiler releases, # so when updating it you should ensure that all dependent packages are # also updated by incrementing their revisions. # # Specific packages to pay attention to include: # - camlp4 # - opam # # Applications that really shouldn't break on a compiler update are: # - mldonkey # - coq # - coccinelle # - unison class Ocaml < Formula desc "General purpose programming language in the ML family" homepage "https://ocaml.org/" head "http://caml.inria.fr/svn/ocaml/trunk", :using => :svn stable do url "http://caml.inria.fr/pub/distrib/ocaml-4.03/ocaml-4.03.0.tar.gz" sha256 "7fdf280cc6c0a2de4fc9891d0bf4633ea417046ece619f011fd44540fcfc8da2" end pour_bottle? do # The ocaml compilers embed prefix information in weird ways that the default # brew detection doesn't find, and so needs to be explicitly blacklisted. reason "The bottle needs to be installed into /usr/local." satisfy { HOMEBREW_PREFIX.to_s == "/usr/local" } end bottle do cellar :any_skip_relocation sha256 "5a9ad99085350c0ac9a81bb9eb82543580c57069c2e1f6ca85efaf17ad2ab9f6" => :el_capitan sha256 "495a9536a4b6a3b5bb8d4988f5c2c50d2e961a8cd1bc3b133b5d4f90425bc828" => :yosemite sha256 "0d7ffe037bb862f141368110578f4c3aed01692ad5473bc222ea18d0cfcbac4a" => :mavericks end option "with-x11", "Install with the Graphics module" option "with-flambda", "Install with flambda support" depends_on :x11 => :optional def install ENV.deparallelize # Builds are not parallel-safe, esp. with many cores # the ./configure in this package is NOT a GNU autoconf script! args = ["-prefix", HOMEBREW_PREFIX.to_s, "-with-debug-runtime", "-mandir", man] args << "-no-graph" if build.without? "x11" args << "-flambda" if build.with? "flambda" system "./configure", *args system "make", "world.opt" system "make", "install", "PREFIX=#{prefix}" end test do assert_match "val x : int = 1", shell_output("echo 'let x = 1 ;;' | ocaml 2>&1") assert_match HOMEBREW_PREFIX.to_s, shell_output("ocamlc -where") end end ocaml: style nits # OCaml does not preserve binary compatibility across compiler releases, # so when updating it you should ensure that all dependent packages are # also updated by incrementing their revisions. # # Specific packages to pay attention to include: # - camlp4 # - opam # # Applications that really shouldn't break on a compiler update are: # - mldonkey # - coq # - coccinelle # - unison class Ocaml < Formula desc "General purpose programming language in the ML family" homepage "https://ocaml.org/" url "http://caml.inria.fr/pub/distrib/ocaml-4.03/ocaml-4.03.0.tar.gz" sha256 "7fdf280cc6c0a2de4fc9891d0bf4633ea417046ece619f011fd44540fcfc8da2" head "http://caml.inria.fr/svn/ocaml/trunk", :using => :svn pour_bottle? do # The ocaml compilers embed prefix information in weird ways that the default # brew detection doesn't find, and so needs to be explicitly blacklisted. reason "The bottle needs to be installed into /usr/local." satisfy { HOMEBREW_PREFIX.to_s == "/usr/local" } end bottle do cellar :any_skip_relocation sha256 "5a9ad99085350c0ac9a81bb9eb82543580c57069c2e1f6ca85efaf17ad2ab9f6" => :el_capitan sha256 "495a9536a4b6a3b5bb8d4988f5c2c50d2e961a8cd1bc3b133b5d4f90425bc828" => :yosemite sha256 "0d7ffe037bb862f141368110578f4c3aed01692ad5473bc222ea18d0cfcbac4a" => :mavericks end option "with-x11", "Install with the Graphics module" option "with-flambda", "Install with flambda support" depends_on :x11 => :optional def install ENV.deparallelize # Builds are not parallel-safe, esp. with many cores # the ./configure in this package is NOT a GNU autoconf script! args = ["-prefix", HOMEBREW_PREFIX.to_s, "-with-debug-runtime", "-mandir", man] args << "-no-graph" if build.without? "x11" args << "-flambda" if build.with? "flambda" system "./configure", *args system "make", "world.opt" system "make", "install", "PREFIX=#{prefix}" end test do output = shell_output("echo 'let x = 1 ;;' | #{bin}/ocaml 2>&1") assert_match "val x : int = 1", output assert_match HOMEBREW_PREFIX.to_s, shell_output("#{bin}/ocamlc -where") end end
class Paket < Formula desc "Dependency manager for .NET with support for NuGet and Git repositories" homepage "https://fsprojects.github.io/Paket/" url "https://github.com/fsprojects/Paket/releases/download/5.242.2/paket.exe" sha256 "e7e27c3f648300d66c7f45ab66c4a9071741a81bb0473d45bd189b354c2ce694" bottle :unneeded depends_on "mono" def install libexec.install "paket.exe" (bin/"paket").write <<~EOS #!/bin/bash mono #{libexec}/paket.exe "$@" EOS end test do test_package_id = "Paket.Test" test_package_version = "1.2.3" touch testpath/"paket.dependencies" touch testpath/"testfile.txt" system bin/"paket", "install" assert_predicate testpath/"paket.lock", :exist? (testpath/"paket.template").write <<~EOS type file id #{test_package_id} version #{test_package_version} authors Test package author description Description of this test package files testfile.txt ==> lib EOS system bin/"paket", "pack", "output", testpath assert_predicate testpath/"#{test_package_id}.#{test_package_version}.nupkg", :exist? end end paket 5.243.0 (#52244) class Paket < Formula desc "Dependency manager for .NET with support for NuGet and Git repositories" homepage "https://fsprojects.github.io/Paket/" url "https://github.com/fsprojects/Paket/releases/download/5.243.0/paket.exe" sha256 "7f3b61fb13ec166996eef275e15f62abcab0656bafc06420a8edf02d596b7bbb" bottle :unneeded depends_on "mono" def install libexec.install "paket.exe" (bin/"paket").write <<~EOS #!/bin/bash mono #{libexec}/paket.exe "$@" EOS end test do test_package_id = "Paket.Test" test_package_version = "1.2.3" touch testpath/"paket.dependencies" touch testpath/"testfile.txt" system bin/"paket", "install" assert_predicate testpath/"paket.lock", :exist? (testpath/"paket.template").write <<~EOS type file id #{test_package_id} version #{test_package_version} authors Test package author description Description of this test package files testfile.txt ==> lib EOS system bin/"paket", "pack", "output", testpath assert_predicate testpath/"#{test_package_id}.#{test_package_version}.nupkg", :exist? end end
class Paket < Formula desc "Dependency manager for .NET with support for NuGet and Git repositories" homepage "https://fsprojects.github.io/Paket/" url "https://github.com/fsprojects/Paket/releases/download/5.252.0/paket.exe" sha256 "ef8ebcc2ed03d38e45cf62f6c092db3eb61a0bb178c37fecfed87181d4d4c60a" license "MIT" bottle :unneeded depends_on "mono" def install libexec.install "paket.exe" (bin/"paket").write <<~EOS #!/bin/bash mono #{libexec}/paket.exe "$@" EOS end test do test_package_id = "Paket.Test" test_package_version = "1.2.3" touch testpath/"paket.dependencies" touch testpath/"testfile.txt" system bin/"paket", "install" assert_predicate testpath/"paket.lock", :exist? (testpath/"paket.template").write <<~EOS type file id #{test_package_id} version #{test_package_version} authors Test package author description Description of this test package files testfile.txt ==> lib EOS system bin/"paket", "pack", "output", testpath assert_predicate testpath/"#{test_package_id}.#{test_package_version}.nupkg", :exist? end end paket 5.257.0 (#65150) class Paket < Formula desc "Dependency manager for .NET with support for NuGet and Git repositories" homepage "https://fsprojects.github.io/Paket/" url "https://github.com/fsprojects/Paket/releases/download/5.257.0/paket.exe" sha256 "58185853a390c979aedec9fe2b7b2f81c1131ebfae51c5be4121b670b329deef" license "MIT" bottle :unneeded depends_on "mono" def install libexec.install "paket.exe" (bin/"paket").write <<~EOS #!/bin/bash mono #{libexec}/paket.exe "$@" EOS end test do test_package_id = "Paket.Test" test_package_version = "1.2.3" touch testpath/"paket.dependencies" touch testpath/"testfile.txt" system bin/"paket", "install" assert_predicate testpath/"paket.lock", :exist? (testpath/"paket.template").write <<~EOS type file id #{test_package_id} version #{test_package_version} authors Test package author description Description of this test package files testfile.txt ==> lib EOS system bin/"paket", "pack", "output", testpath assert_predicate testpath/"#{test_package_id}.#{test_package_version}.nupkg", :exist? end end
class Pango < Formula desc "Framework for layout and rendering of i18n text" homepage "https://www.pango.org/" url "https://download.gnome.org/sources/pango/1.42/pango-1.42.3.tar.xz" sha256 "fb3d875305d5143f02cde5c72fec3903e60dc35844759dc14b2df4955b5dde3a" bottle do sha256 "49c20497b7779559877d1d9ba6e60bb479d305c09a6301b832f7eba404dcee6e" => :high_sierra sha256 "3906e3e45e7784e9ec4c2be43b39005770d68534001a0cb2f8625bfe38a325cc" => :sierra sha256 "6affe3058a7a77093ce2054dca9f2dfbd538222d12f6dff88e829ce588e25200" => :el_capitan end head do url "https://gitlab.gnome.org/GNOME/pango.git" depends_on "automake" => :build depends_on "autoconf" => :build depends_on "libtool" => :build depends_on "gtk-doc" => :build end depends_on "gobject-introspection" => :build depends_on "pkg-config" => :build depends_on "cairo" depends_on "fribidi" depends_on "fontconfig" depends_on "glib" depends_on "harfbuzz" # This fixes a font-size problem in gtk # For discussion, see https://bugzilla.gnome.org/show_bug.cgi?id=787867 patch do url "https://gitlab.gnome.org/tschoonj/pango/commit/60df2b006e5d4553abc7bb5fe9a99539c91b0022.patch" sha256 "d5ece753cf393ef507dd2b0415721b4381159da5e2f40793c6d85741b1b163bc" end def install system "./autogen.sh" if build.head? system "./configure", "--disable-dependency-tracking", "--disable-silent-rules", "--prefix=#{prefix}", "--with-html-dir=#{share}/doc", "--enable-introspection=yes", "--enable-static", "--without-xft" system "make" system "make", "install" end test do system "#{bin}/pango-view", "--version" (testpath/"test.c").write <<~EOS #include <pango/pangocairo.h> int main(int argc, char *argv[]) { PangoFontMap *fontmap; int n_families; PangoFontFamily **families; fontmap = pango_cairo_font_map_get_default(); pango_font_map_list_families (fontmap, &families, &n_families); g_free(families); return 0; } EOS cairo = Formula["cairo"] fontconfig = Formula["fontconfig"] freetype = Formula["freetype"] gettext = Formula["gettext"] glib = Formula["glib"] libpng = Formula["libpng"] pixman = Formula["pixman"] flags = %W[ -I#{cairo.opt_include}/cairo -I#{fontconfig.opt_include} -I#{freetype.opt_include}/freetype2 -I#{gettext.opt_include} -I#{glib.opt_include}/glib-2.0 -I#{glib.opt_lib}/glib-2.0/include -I#{include}/pango-1.0 -I#{libpng.opt_include}/libpng16 -I#{pixman.opt_include}/pixman-1 -D_REENTRANT -L#{cairo.opt_lib} -L#{gettext.opt_lib} -L#{glib.opt_lib} -L#{lib} -lcairo -lglib-2.0 -lgobject-2.0 -lpango-1.0 -lpangocairo-1.0 ] flags << "-lintl" if OS.mac? system ENV.cc, "test.c", "-o", "test", *flags system "./test" end end pango: update 1.42.3 bottle for Linuxbrew. Closes Linuxbrew/homebrew-core#8686. Signed-off-by: Michka Popoff <7b0496f66f66ee22a38826c310c38b415671b832@gmail.com> class Pango < Formula desc "Framework for layout and rendering of i18n text" homepage "https://www.pango.org/" url "https://download.gnome.org/sources/pango/1.42/pango-1.42.3.tar.xz" sha256 "fb3d875305d5143f02cde5c72fec3903e60dc35844759dc14b2df4955b5dde3a" bottle do sha256 "49c20497b7779559877d1d9ba6e60bb479d305c09a6301b832f7eba404dcee6e" => :high_sierra sha256 "3906e3e45e7784e9ec4c2be43b39005770d68534001a0cb2f8625bfe38a325cc" => :sierra sha256 "6affe3058a7a77093ce2054dca9f2dfbd538222d12f6dff88e829ce588e25200" => :el_capitan sha256 "d373d4ea65432327bad7bfb2d091ec7727aab03ade8a12d6e23a71e10f38d2b9" => :x86_64_linux end head do url "https://gitlab.gnome.org/GNOME/pango.git" depends_on "automake" => :build depends_on "autoconf" => :build depends_on "libtool" => :build depends_on "gtk-doc" => :build end depends_on "gobject-introspection" => :build depends_on "pkg-config" => :build depends_on "cairo" depends_on "fribidi" depends_on "fontconfig" depends_on "glib" depends_on "harfbuzz" # This fixes a font-size problem in gtk # For discussion, see https://bugzilla.gnome.org/show_bug.cgi?id=787867 patch do url "https://gitlab.gnome.org/tschoonj/pango/commit/60df2b006e5d4553abc7bb5fe9a99539c91b0022.patch" sha256 "d5ece753cf393ef507dd2b0415721b4381159da5e2f40793c6d85741b1b163bc" end def install system "./autogen.sh" if build.head? system "./configure", "--disable-dependency-tracking", "--disable-silent-rules", "--prefix=#{prefix}", "--with-html-dir=#{share}/doc", "--enable-introspection=yes", "--enable-static", "--without-xft" system "make" system "make", "install" end test do system "#{bin}/pango-view", "--version" (testpath/"test.c").write <<~EOS #include <pango/pangocairo.h> int main(int argc, char *argv[]) { PangoFontMap *fontmap; int n_families; PangoFontFamily **families; fontmap = pango_cairo_font_map_get_default(); pango_font_map_list_families (fontmap, &families, &n_families); g_free(families); return 0; } EOS cairo = Formula["cairo"] fontconfig = Formula["fontconfig"] freetype = Formula["freetype"] gettext = Formula["gettext"] glib = Formula["glib"] libpng = Formula["libpng"] pixman = Formula["pixman"] flags = %W[ -I#{cairo.opt_include}/cairo -I#{fontconfig.opt_include} -I#{freetype.opt_include}/freetype2 -I#{gettext.opt_include} -I#{glib.opt_include}/glib-2.0 -I#{glib.opt_lib}/glib-2.0/include -I#{include}/pango-1.0 -I#{libpng.opt_include}/libpng16 -I#{pixman.opt_include}/pixman-1 -D_REENTRANT -L#{cairo.opt_lib} -L#{gettext.opt_lib} -L#{glib.opt_lib} -L#{lib} -lcairo -lglib-2.0 -lgobject-2.0 -lpango-1.0 -lpangocairo-1.0 ] flags << "-lintl" if OS.mac? system ENV.cc, "test.c", "-o", "test", *flags system "./test" end end
require 'formula' class Pango < Formula homepage 'http://www.pango.org/' url 'http://ftp.gnome.org/pub/GNOME/sources/pango/1.28/pango-1.28.4.tar.bz2' sha256 '7eb035bcc10dd01569a214d5e2bc3437de95d9ac1cfa9f50035a687c45f05a9f' depends_on 'pkg-config' => :build depends_on 'glib' fails_with_llvm "Undefined symbols when linking", :build => "2326" if MacOS.leopard? depends_on 'fontconfig' # Leopard's fontconfig is too old. depends_on 'cairo' # Leopard doesn't come with Cairo. elsif MacOS.lion? depends_on 'cairo' # links against system Cairo without this end def install system "./configure", "--prefix=#{prefix}", "--with-x" system "make install" end end pango 1.29.4 This updates pango to 1.29.3 and fixes the html doc install path. It also enables the creation of two man pages. Added at the end is a def test that uses pango, cairo, glib, libz, and freetype. The formula creates shared native libraies as it was previously crafted, and it compiles using llvm 2335, gcc-4.2.1, and clang-2.0 from XCode 4.0.2 on 64bit OSX 10.6.8. Signed-off-by: Adam Vandenberg <34c2b6407fd5a10249a15d699d40f9ed1782e98c@gmail.com> require 'formula' class Pango < Formula homepage 'http://www.pango.org/' url 'http://ftp.gnome.org/pub/gnome/sources/pango/1.29/pango-1.29.4.tar.bz2' sha256 'f15deecaecf1e9dcb7db0e4947d12b5bcff112586434f8d30a5afd750747ff2b' depends_on 'pkg-config' => :build depends_on 'glib' fails_with_llvm "Undefined symbols when linking", :build => "2326" if MacOS.leopard? depends_on 'fontconfig' # Leopard's fontconfig is too old. depends_on 'cairo' # Leopard doesn't come with Cairo. elsif MacOS.lion? depends_on 'cairo' # links against system Cairo without this end def install system "./configure", "--disable-dependency-tracking", "--disable-debug", "--prefix=#{prefix}", "--enable-man", "--with-x", "--with-html-dir=#{share}/doc" system "make" system "make install" end def test mktemp do system "#{bin}/pango-view -t 'test-image' --waterfall --rotate=10 --annotate=1 --header -q -o output.png" system "/usr/bin/qlmanage -p output.png" end end end
class Pegtl < Formula desc "Parsing Expression Grammar Template Library" homepage "https://github.com/taocpp/PEGTL" url "https://github.com/taocpp/PEGTL/archive/3.0.0.tar.gz" sha256 "b47af025450f5c12251cd831f90deab666e18a8029f3dbffb32672b0450af902" license "MIT" bottle do cellar :any_skip_relocation sha256 "abf71571ff392323eb08f1cadb23d744900467cbcb26a9a8f2e689e8af93b6be" => :big_sur sha256 "10ad60dbc5a6c4054579b2e7529dfb053395cfd2c9bc5ddb5c2bf6b939b8f9cd" => :catalina sha256 "10ad60dbc5a6c4054579b2e7529dfb053395cfd2c9bc5ddb5c2bf6b939b8f9cd" => :mojave sha256 "10ad60dbc5a6c4054579b2e7529dfb053395cfd2c9bc5ddb5c2bf6b939b8f9cd" => :high_sierra end depends_on "cmake" => :build if MacOS.version <= :mojave depends_on "gcc" fails_with :clang do cause "'path' is unavailable in c++ < 17: introduced in macOS 10.15" end end def install mkdir "build" do system "cmake", "..", *std_cmake_args, "-DPEGTL_BUILD_TESTS=OFF", "-DPEGTL_BUILD_EXAMPLES=OFF", "-DCMAKE_CXX_STANDARD=17" system "make", "install" end rm "src/example/pegtl/CMakeLists.txt" (pkgshare/"examples").install (buildpath/"src/example/pegtl").children end test do system ENV.cxx, pkgshare/"examples/hello_world.cpp", "-std=c++17", "-o", "helloworld" assert_equal "Good bye, homebrew!\n", shell_output("./helloworld 'Hello, homebrew!'") end end pegtl: update 3.0.0 bottle. class Pegtl < Formula desc "Parsing Expression Grammar Template Library" homepage "https://github.com/taocpp/PEGTL" url "https://github.com/taocpp/PEGTL/archive/3.0.0.tar.gz" sha256 "b47af025450f5c12251cd831f90deab666e18a8029f3dbffb32672b0450af902" license "MIT" bottle do cellar :any_skip_relocation sha256 "3044879b7c3b323251009528b53b5bea68cb314f51cfec06f59ceb15f74b492b" => :big_sur sha256 "5fa80672bf58a5eaa91bf684ea3ef37c96b37a9b1f8246517e279a8613a0231e" => :catalina sha256 "854e19bfaf2383f758acb6f978ea5f8ad04e23790543facef037019832a7ce6c" => :mojave end depends_on "cmake" => :build if MacOS.version <= :mojave depends_on "gcc" fails_with :clang do cause "'path' is unavailable in c++ < 17: introduced in macOS 10.15" end end def install mkdir "build" do system "cmake", "..", *std_cmake_args, "-DPEGTL_BUILD_TESTS=OFF", "-DPEGTL_BUILD_EXAMPLES=OFF", "-DCMAKE_CXX_STANDARD=17" system "make", "install" end rm "src/example/pegtl/CMakeLists.txt" (pkgshare/"examples").install (buildpath/"src/example/pegtl").children end test do system ENV.cxx, pkgshare/"examples/hello_world.cpp", "-std=c++17", "-o", "helloworld" assert_equal "Good bye, homebrew!\n", shell_output("./helloworld 'Hello, homebrew!'") end end
class Pgcli < Formula homepage "http://pgcli.com/" url "https://pypi.python.org/packages/source/p/pgcli/pgcli-0.17.0.tar.gz" sha256 "b7a47405da61bc05dbceb28443e13965f322f58d942e119499976be19e2e2d44" bottle do cellar :any sha256 "0119d16d4bddd2c18a8780d6423d4f730cb2b0782c753565c3626aa58aa3a78a" => :yosemite sha256 "408ac44b598737ad2d240b7a858c9668ab62ed61267ece56577986d09077834b" => :mavericks sha256 "0ee3f0a9fe8214615586ba630234511d1c71623fd77bf7d102c258a4adb9efe5" => :mountain_lion end depends_on :python if MacOS.version <= :snow_leopard depends_on "openssl" depends_on :postgresql resource "sqlparse" do url "https://pypi.python.org/packages/source/s/sqlparse/sqlparse-0.1.14.tar.gz" sha256 "e561e31853ab9f3634a1a2bd53035f9e47dfb203d56b33cc6569047ba087daf0" end resource "psycopg2" do url "https://pypi.python.org/packages/source/p/psycopg2/psycopg2-2.6.tar.gz" sha256 "c00afecb302a99a4f83dec9b055c4d1cc196926d62c8db015d68432df8118ca8" end resource "six" do url "https://pypi.python.org/packages/source/s/six/six-1.9.0.tar.gz" sha256 "e24052411fc4fbd1f672635537c3fc2330d9481b18c0317695b46259512c91d5" end resource "wcwidth" do url "https://pypi.python.org/packages/source/w/wcwidth/wcwidth-0.1.4.tar.gz" sha256 "906d3123045d77027b49fe912458e1a1e1d6ca1a51558a4bd9168d143b129d2b" end resource "Pygments" do url "https://pypi.python.org/packages/source/P/Pygments/Pygments-2.0.2.tar.gz" sha256 "7320919084e6dac8f4540638a46447a3bd730fca172afc17d2c03eed22cf4f51" end resource "click" do url "https://pypi.python.org/packages/source/c/click/click-4.0.tar.gz" sha256 "f49e03611f5f2557788ceeb80710b1c67110f97c5e6740b97edf70245eea2409" end resource "prompt_toolkit" do url "https://pypi.python.org/packages/source/p/prompt_toolkit/prompt_toolkit-0.37.tar.gz" sha256 "680f0abab097619e013c75f4fc234f7734ee888a483d9492e326ecd7883c6859" end def install ENV.prepend_create_path "PYTHONPATH", libexec/"vendor/lib/python2.7/site-packages" %w[click prompt_toolkit psycopg2 sqlparse Pygments wcwidth six].each do |r| resource(r).stage do system "python", *Language::Python.setup_install_args(libexec/"vendor") end end ENV.prepend_create_path "PYTHONPATH", libexec/"lib/python2.7/site-packages" system "python", *Language::Python.setup_install_args(libexec) bin.install Dir["#{libexec}/bin/*"] bin.env_script_all_files(libexec/"bin", :PYTHONPATH => ENV["PYTHONPATH"]) end test do system bin/"pgcli", "--help" end end pgcli: update 0.17.0 bottle. class Pgcli < Formula homepage "http://pgcli.com/" url "https://pypi.python.org/packages/source/p/pgcli/pgcli-0.17.0.tar.gz" sha256 "b7a47405da61bc05dbceb28443e13965f322f58d942e119499976be19e2e2d44" bottle do cellar :any sha256 "e777938c9c25c9a3c0077a414d5d2ecf48e2fe91e769ce193d403308a36dc24a" => :yosemite sha256 "07a2a41835ae74229d7866d3cfb95bf4b3027c6eb0c55e73dfb3a747f635db54" => :mavericks sha256 "d6c8bf046088a100a2a9989c9406a5b590c733d0a29ea32a7eddc73f114a04b8" => :mountain_lion end depends_on :python if MacOS.version <= :snow_leopard depends_on "openssl" depends_on :postgresql resource "sqlparse" do url "https://pypi.python.org/packages/source/s/sqlparse/sqlparse-0.1.14.tar.gz" sha256 "e561e31853ab9f3634a1a2bd53035f9e47dfb203d56b33cc6569047ba087daf0" end resource "psycopg2" do url "https://pypi.python.org/packages/source/p/psycopg2/psycopg2-2.6.tar.gz" sha256 "c00afecb302a99a4f83dec9b055c4d1cc196926d62c8db015d68432df8118ca8" end resource "six" do url "https://pypi.python.org/packages/source/s/six/six-1.9.0.tar.gz" sha256 "e24052411fc4fbd1f672635537c3fc2330d9481b18c0317695b46259512c91d5" end resource "wcwidth" do url "https://pypi.python.org/packages/source/w/wcwidth/wcwidth-0.1.4.tar.gz" sha256 "906d3123045d77027b49fe912458e1a1e1d6ca1a51558a4bd9168d143b129d2b" end resource "Pygments" do url "https://pypi.python.org/packages/source/P/Pygments/Pygments-2.0.2.tar.gz" sha256 "7320919084e6dac8f4540638a46447a3bd730fca172afc17d2c03eed22cf4f51" end resource "click" do url "https://pypi.python.org/packages/source/c/click/click-4.0.tar.gz" sha256 "f49e03611f5f2557788ceeb80710b1c67110f97c5e6740b97edf70245eea2409" end resource "prompt_toolkit" do url "https://pypi.python.org/packages/source/p/prompt_toolkit/prompt_toolkit-0.37.tar.gz" sha256 "680f0abab097619e013c75f4fc234f7734ee888a483d9492e326ecd7883c6859" end def install ENV.prepend_create_path "PYTHONPATH", libexec/"vendor/lib/python2.7/site-packages" %w[click prompt_toolkit psycopg2 sqlparse Pygments wcwidth six].each do |r| resource(r).stage do system "python", *Language::Python.setup_install_args(libexec/"vendor") end end ENV.prepend_create_path "PYTHONPATH", libexec/"lib/python2.7/site-packages" system "python", *Language::Python.setup_install_args(libexec) bin.install Dir["#{libexec}/bin/*"] bin.env_script_all_files(libexec/"bin", :PYTHONPATH => ENV["PYTHONPATH"]) end test do system bin/"pgcli", "--help" end end
phash 0.9.4 Signed-off-by: Adam Vandenberg <34c2b6407fd5a10249a15d699d40f9ed1782e98c@gmail.com> require 'formula' class Phash < Formula url 'http://www.phash.org/releases/pHash-0.9.4.tar.gz' homepage 'http://www.phash.org/' sha1 '9710b8a1d4d24e7fc3ac43c33eac8e89d9e727d7' depends_on 'cimg' unless ARGV.include? "--disable-image-hash" and ARGV.include? "--disable-video-hash" depends_on 'ffmpeg' unless ARGV.include? "--disable-video-hash" unless ARGV.include? "--disable-audio-hash" depends_on 'libsndfile' depends_on 'libsamplerate' depends_on 'mpg123' end def options [ ["--disable-image-hash", "Disable image hash"], ["--disable-video-hash", "Disable video hash"], ["--disable-audio-hash", "Disable audio hash"] ] end def install args = ["--disable-debug", "--disable-dependency-tracking", "--prefix=#{prefix}", "--enable-shared"] # disable specific hashes if specified as an option args << "--disable-image-hash" if ARGV.include? "--disable-image-hash" args << "--disable-video-hash" if ARGV.include? "--disable-video-hash" args << "--disable-audio-hash" if ARGV.include? "--disable-audio-hash" system "./configure", *args system "make install" end end
# coding: utf-8 lib = File.expand_path('../lib', __FILE__) $LOAD_PATH.unshift(lib) unless $LOAD_PATH.include?(lib) require 'rundock/version' Gem::Specification.new do |spec| spec.name = "rundock" spec.version = Rundock::VERSION spec.authors = ["hiracy"] spec.email = ["leizhen@mbr.nifty.com"] spec.summary = %q{Simple Execution framework for various servers} spec.homepage = "https://github.com/hiracy/rundock" spec.license = "MIT" spec.files = `git ls-files -z`.split("\x0").reject { |f| f.match(%r{^(test|spec|features)/}) } spec.bindir = "exe" spec.executables = spec.files.grep(%r{^exe/}) { |f| File.basename(f) } spec.require_paths = ["lib"] spec.add_development_dependency "bundler", "~> 1.9" spec.add_development_dependency "rake", "~> 10.0" spec.add_runtime_dependency "specinfra", [">= 2.31.0", "< 3.0.0"] spec.add_runtime_dependency "ansi" spec.add_runtime_dependency "schash" spec.add_runtime_dependency "thor" spec.add_runtime_dependency 'net-ssh' end Remove schash to gemspec # coding: utf-8 lib = File.expand_path('../lib', __FILE__) $LOAD_PATH.unshift(lib) unless $LOAD_PATH.include?(lib) require 'rundock/version' Gem::Specification.new do |spec| spec.name = "rundock" spec.version = Rundock::VERSION spec.authors = ["hiracy"] spec.email = ["leizhen@mbr.nifty.com"] spec.summary = %q{Simple Execution framework for various servers} spec.homepage = "https://github.com/hiracy/rundock" spec.license = "MIT" spec.files = `git ls-files -z`.split("\x0").reject { |f| f.match(%r{^(test|spec|features)/}) } spec.bindir = "exe" spec.executables = spec.files.grep(%r{^exe/}) { |f| File.basename(f) } spec.require_paths = ["lib"] spec.add_development_dependency "bundler", "~> 1.9" spec.add_development_dependency "rake", "~> 10.0" spec.add_runtime_dependency "specinfra", [">= 2.31.0", "< 3.0.0"] spec.add_runtime_dependency "ansi" spec.add_runtime_dependency "thor" spec.add_runtime_dependency 'net-ssh' end
require File.expand_path("../../Abstract/abstract-php", __FILE__) class Php71 < AbstractPhp init desc "PHP Version 7.1" revision 18 bottle do sha256 "5cb5d5383ea653e6000f83e035f4abbe1ecab27045f833e20a54813585141f7f" => :sierra sha256 "3e8453247379539c98b57fcd43043c3840177d8188141b76865b0533363a9b97" => :el_capitan sha256 "e314207c0d752ffe4b5b3b27eb7d34156092a4e1660c946507b196193408815f" => :yosemite end include AbstractPhpVersion::Php71Defs url PHP_SRC_TARBALL sha256 PHP_CHECKSUM[:sha256] version PHP_VERSION head PHP_GITHUB_URL, :branch => PHP_BRANCH def php_version "7.1" end def php_version_path "71" end end php71: update 7.1.6_18 bottle. require File.expand_path("../../Abstract/abstract-php", __FILE__) class Php71 < AbstractPhp init desc "PHP Version 7.1" revision 18 bottle do sha256 "b1c4a67544833a4729766a26b9043d23e219b49aa48347135d638bc8e1064358" => :sierra sha256 "80c71b4c72854cdfdc3ecc0f32577fd77cb84c8b8a94b2970e2eecc1a3706082" => :el_capitan sha256 "5ba5cbb4c2510bbb53caac4dcbc7859eeb69c4d55b986e521743f71f07d620b7" => :yosemite end include AbstractPhpVersion::Php71Defs url PHP_SRC_TARBALL sha256 PHP_CHECKSUM[:sha256] version PHP_VERSION head PHP_GITHUB_URL, :branch => PHP_BRANCH def php_version "7.1" end def php_version_path "71" end end
require 'formula' class Phyml < Formula homepage 'http://www.atgc-montpellier.fr/phyml/' url 'http://phyml.googlecode.com/files/phyml-20110919.tar.gz' sha1 '6f6281af465d6daab0d7f774c1d0f62856b1af80' def install # separate steps required system "./configure", "--prefix=#{prefix}" system "make" system "./configure", "--prefix=#{prefix}", "--enable-phytime" system "make" bin.install %w(src/phyml src/phytime) doc.install Dir['doc/phyml-manual.pdf'] rm_rf Dir['examples/.svn'] chmod 0644, Dir['examples/*'] share.install Dir['examples/*'] end def caveats; <<-EOS.undent Examples have been installed here: #{share} See options for phyml by running: phmyl --help PhyML must be run with the "-i" option to specify an input or it will segfault. Example: phyml -i #{share}/nucleic EOS end end phyml 20120412 - Upgrade to version 20120412 Closes Homebrew/homebrew#15475. Signed-off-by: Adam Vandenberg <34c2b6407fd5a10249a15d699d40f9ed1782e98c@gmail.com> require 'formula' class Phyml < Formula homepage 'http://www.atgc-montpellier.fr/phyml/' url 'https://phyml.googlecode.com/files/phyml-20120412.tar.gz' sha1 '8a4699ad2bba7e2f76c8eefa277d29290f92071c' def install # separate steps required system "./configure", "--prefix=#{prefix}" system "make" system "./configure", "--prefix=#{prefix}", "--enable-phytime" system "make" bin.install %w(src/phyml src/phytime) doc.install Dir['doc/phyml-manual.pdf'] rm_rf Dir['examples/.svn'] chmod 0644, Dir['examples/*'] share.install Dir['examples/*'] end def caveats; <<-EOS.undent Examples have been installed here: #{share} See options for phyml by running: phmyl --help PhyML must be run with the "-i" option to specify an input or it will segfault. Example: phyml -i #{share}/nucleic EOS end end
class Ponyc < Formula desc "Object-oriented, actor-model, capabilities-secure programming language" homepage "http://www.ponylang.org" url "http://www.ponylang.org/releases/source/ponyc-0.1.6.tar.bz2" sha256 "28592dd60320e1a587d256e08e7053e42975f8dc3dd5fb5eb0fd57baae5dc01e" bottle do sha256 "c5d4837fdcdcb8abff9faef03002b64ea589e53cb10cfcd703eee505483f5fed" => :yosemite sha256 "9b96cf934f39d9f61170704ba1165b718b868bd56bc089a343970a9ef0ca8d3d" => :mavericks sha256 "49e11ccb179955ad14703e5ce2c965b28519d2937b82b4b93379c8356aac4925" => :mountain_lion end depends_on "llvm" => "with-rtti" needs :cxx11 def install ENV.cxx11 system "make", "install", "config=release", "destdir=#{prefix}" end test do system "#{bin}/ponyc", "-rexpr", "#{prefix}/packages/builtin" end end ponyc 0.1.7 Closes Homebrew/homebrew#40857. Signed-off-by: Xu Cheng <9a05244150b861e40c78843b801eed71bca54eac@me.com> class Ponyc < Formula desc "Object-oriented, actor-model, capabilities-secure programming language" homepage "http://www.ponylang.org" url "http://www.ponylang.org/releases/source/ponyc-0.1.7.tar.bz2" sha256 "fc6f783f65cd6708a80bdea71f414cada801528143ea22d9bb13957cb7061eb6" bottle do sha256 "c5d4837fdcdcb8abff9faef03002b64ea589e53cb10cfcd703eee505483f5fed" => :yosemite sha256 "9b96cf934f39d9f61170704ba1165b718b868bd56bc089a343970a9ef0ca8d3d" => :mavericks sha256 "49e11ccb179955ad14703e5ce2c965b28519d2937b82b4b93379c8356aac4925" => :mountain_lion end depends_on "llvm" => "with-rtti" needs :cxx11 def install ENV.cxx11 system "make", "install", "config=release", "destdir=#{prefix}" end test do system "#{bin}/ponyc", "-rexpr", "#{prefix}/packages/builtin" end end
class Ponyc < Formula desc "Object-oriented, actor-model, capabilities-secure programming language" homepage "https://www.ponylang.org/" url "https://github.com/ponylang/ponyc/archive/0.31.0.tar.gz" sha256 "74bb8ccbfc4201e14a2f66502033397d63179f073be04ee366a66d329dd56778" head "https://github.com/ponylang/ponyc.git" bottle do cellar :any sha256 "1e31b7a35c59af6641c7efe49f9b2d1cb171410c3d5afbe75fe0a559c5f5987d" => :mojave sha256 "eb7677788987281f1f2032b59ef4cd5e5fa01896e79b346638bdb6fe8a8480e7" => :high_sierra sha256 "3edc0fc29683d3e6d1143c73ac0508d8beba49a499268d876b2cc8671d1959d7" => :sierra end # https://github.com/ponylang/ponyc/issues/1274 # https://github.com/Homebrew/homebrew-core/issues/5346 pour_bottle? do reason <<~EOS The bottle requires Xcode/CLT 8.0 or later to work properly. EOS satisfy { DevelopmentTools.clang_build_version >= 800 } end depends_on "llvm@7" depends_on :macos => :yosemite def install ENV.cxx11 ENV["LLVM_CONFIG"] = "#{Formula["llvm@7"].opt_bin}/llvm-config" system "make", "install", "verbose=1", "config=release", "ponydir=#{prefix}", "prefix=" end test do system "#{bin}/ponyc", "-rexpr", "#{prefix}/packages/stdlib" (testpath/"test/main.pony").write <<~EOS actor Main new create(env: Env) => env.out.print("Hello World!") EOS system "#{bin}/ponyc", "test" assert_equal "Hello World!", shell_output("./test1").strip end end ponyc: update 0.31.0 bottle. class Ponyc < Formula desc "Object-oriented, actor-model, capabilities-secure programming language" homepage "https://www.ponylang.org/" url "https://github.com/ponylang/ponyc/archive/0.31.0.tar.gz" sha256 "74bb8ccbfc4201e14a2f66502033397d63179f073be04ee366a66d329dd56778" head "https://github.com/ponylang/ponyc.git" bottle do cellar :any sha256 "655afafb64d7b0b4cdeb03dd4c4d630ce9a2492c3939562eec9024c75182ced1" => :mojave sha256 "94ba5d35ffe02c3034c213b12ed5f6db2c1782f06e5d4ff812e0b83b50f8f558" => :high_sierra sha256 "847c0653e378ed949248256d459896c875a8d652279769dd88dc1ebb996850c8" => :sierra end # https://github.com/ponylang/ponyc/issues/1274 # https://github.com/Homebrew/homebrew-core/issues/5346 pour_bottle? do reason <<~EOS The bottle requires Xcode/CLT 8.0 or later to work properly. EOS satisfy { DevelopmentTools.clang_build_version >= 800 } end depends_on "llvm@7" depends_on :macos => :yosemite def install ENV.cxx11 ENV["LLVM_CONFIG"] = "#{Formula["llvm@7"].opt_bin}/llvm-config" system "make", "install", "verbose=1", "config=release", "ponydir=#{prefix}", "prefix=" end test do system "#{bin}/ponyc", "-rexpr", "#{prefix}/packages/stdlib" (testpath/"test/main.pony").write <<~EOS actor Main new create(env: Env) => env.out.print("Hello World!") EOS system "#{bin}/ponyc", "test" assert_equal "Hello World!", shell_output("./test1").strip end end
class Procs < Formula desc "Modern replacement for ps written by Rust" homepage "https://github.com/dalance/procs" url "https://github.com/dalance/procs/archive/v0.8.16.tar.gz" sha256 "8f0f014079f2769f3a9f4d01aeb79ed169398c8382a346699304cff32ba987da" bottle do cellar :any_skip_relocation sha256 "7407ff757136c071c07ed1d604242f98a82ed9b2e2466e7b176b1b1226fc1339" => :catalina sha256 "170081d604733bb6fa86ccf599dbd7feddedcfce7c767eb438c89f49c2c6010b" => :mojave sha256 "a42ad2cf8b274cc0ed0b1b978b6896afadf4b2956836beacf994abb9455aa54c" => :high_sierra end depends_on "rust" => :build def install system "cargo", "install", "--locked", "--root", prefix, "--path", "." end test do output = shell_output("#{bin}/procs") count = output.lines.count assert count > 2 assert output.start_with?(" PID:") end end procs: update 0.8.16 bottle. Closes #18743. Signed-off-by: Dawid Dziurla <c4a7db180859322ef5630a1dfc2805b5bc97fc25@gmail.com> class Procs < Formula desc "Modern replacement for ps written by Rust" homepage "https://github.com/dalance/procs" url "https://github.com/dalance/procs/archive/v0.8.16.tar.gz" sha256 "8f0f014079f2769f3a9f4d01aeb79ed169398c8382a346699304cff32ba987da" bottle do cellar :any_skip_relocation sha256 "7407ff757136c071c07ed1d604242f98a82ed9b2e2466e7b176b1b1226fc1339" => :catalina sha256 "170081d604733bb6fa86ccf599dbd7feddedcfce7c767eb438c89f49c2c6010b" => :mojave sha256 "a42ad2cf8b274cc0ed0b1b978b6896afadf4b2956836beacf994abb9455aa54c" => :high_sierra sha256 "976ed222895f4c33034498622b97c1dbfa0a10c0c048bc2003eae79549ebc5e7" => :x86_64_linux end depends_on "rust" => :build def install system "cargo", "install", "--locked", "--root", prefix, "--path", "." end test do output = shell_output("#{bin}/procs") count = output.lines.count assert count > 2 assert output.start_with?(" PID:") end end
class Procs < Formula desc "Modern replacement for ps written by Rust" homepage "https://github.com/dalance/procs" url "https://github.com/dalance/procs/archive/v0.11.3.tar.gz" sha256 "bf56fde52d0f6544a2ca3db6d4552867e5cf9daf1c5a31f8b3ad6e3258986b0f" license "MIT" bottle do sha256 cellar: :any_skip_relocation, big_sur: "94ee0bcfdb8ff6a0aa12591593a8b70a0f77cc5a2b7159bd34d34b34bff92a61" sha256 cellar: :any_skip_relocation, arm64_big_sur: "3008bb790329683036c24cf85abe1088f6058db3a3eb54e033a42f24878df0aa" sha256 cellar: :any_skip_relocation, catalina: "74096d5074fa5171235dbeef0d8ba9c227f6da4128b9094e393651795bd20a8f" sha256 cellar: :any_skip_relocation, mojave: "38eb93c5e9ecb2b684fee7bbc9c7e479f72df7e4799b202891a7158ae53ea02b" end depends_on "rust" => :build def install system "cargo", "install", *std_cargo_args end test do output = shell_output("#{bin}/procs") count = output.lines.count assert count > 2 assert output.start_with?(" PID:") end end procs: update 0.11.3 bottle. class Procs < Formula desc "Modern replacement for ps written by Rust" homepage "https://github.com/dalance/procs" url "https://github.com/dalance/procs/archive/v0.11.3.tar.gz" sha256 "bf56fde52d0f6544a2ca3db6d4552867e5cf9daf1c5a31f8b3ad6e3258986b0f" license "MIT" bottle do sha256 cellar: :any_skip_relocation, big_sur: "94ee0bcfdb8ff6a0aa12591593a8b70a0f77cc5a2b7159bd34d34b34bff92a61" sha256 cellar: :any_skip_relocation, arm64_big_sur: "3008bb790329683036c24cf85abe1088f6058db3a3eb54e033a42f24878df0aa" sha256 cellar: :any_skip_relocation, catalina: "74096d5074fa5171235dbeef0d8ba9c227f6da4128b9094e393651795bd20a8f" sha256 cellar: :any_skip_relocation, mojave: "38eb93c5e9ecb2b684fee7bbc9c7e479f72df7e4799b202891a7158ae53ea02b" sha256 cellar: :any_skip_relocation, x86_64_linux: "3d43ec2f118295190dbdd88069298332c106e43e73068edf084f8abdfbfd6b87" end depends_on "rust" => :build def install system "cargo", "install", *std_cargo_args end test do output = shell_output("#{bin}/procs") count = output.lines.count assert count > 2 assert output.start_with?(" PID:") end end
class Pyenv < Formula desc "Python version management" homepage "https://github.com/pyenv/pyenv" url "https://github.com/pyenv/pyenv/archive/v1.2.8.tar.gz" sha256 "79c0ba0fa6fce3aa71e71d666d8082badbb52bc88dc3ed05b3c4b1ceeba54991" version_scheme 1 head "https://github.com/pyenv/pyenv.git" bottle do cellar :any sha256 "91995c220edec23af2798e302e3a197bee2c9a153dffb7f51e3a7308120b0a54" => :mojave sha256 "44c787de32fd6e1d17a79e6e927a20cfd175056948f0ad1bb621a6c2f06b8534" => :high_sierra sha256 "20c3dd22f4baa8b4557229483258d0c65bfefe8e4546c0a15a948e17ad51f315" => :sierra sha256 "86182bb87c253e24eb02a5c621e9a393c36dc9411678afb61dd934f6847237d5" => :el_capitan end depends_on "autoconf" depends_on "openssl" depends_on "pkg-config" depends_on "readline" def install inreplace "libexec/pyenv", "/usr/local", HOMEBREW_PREFIX system "src/configure" system "make", "-C", "src" prefix.install Dir["*"] %w[pyenv-install pyenv-uninstall python-build].each do |cmd| bin.install_symlink "#{prefix}/plugins/python-build/bin/#{cmd}" end end test do shell_output("eval \"$(#{bin}/pyenv init -)\" && pyenv versions") end end pyenv: update 1.2.8 bottle. class Pyenv < Formula desc "Python version management" homepage "https://github.com/pyenv/pyenv" url "https://github.com/pyenv/pyenv/archive/v1.2.8.tar.gz" sha256 "79c0ba0fa6fce3aa71e71d666d8082badbb52bc88dc3ed05b3c4b1ceeba54991" version_scheme 1 head "https://github.com/pyenv/pyenv.git" bottle do cellar :any sha256 "dea10b5b953c6772d5bc7358e0afba94ed458aeab405211ba47a7dc7e3887989" => :mojave sha256 "9f206fc149947ee70a2b047e8997b6bf0e523bdef0ef5114a3fc757da4352b61" => :high_sierra sha256 "a950cc23612877468d69dc8c896eec55fd52bd8e8bbfa9c5c03d26bd5322b106" => :sierra end depends_on "autoconf" depends_on "openssl" depends_on "pkg-config" depends_on "readline" def install inreplace "libexec/pyenv", "/usr/local", HOMEBREW_PREFIX system "src/configure" system "make", "-C", "src" prefix.install Dir["*"] %w[pyenv-install pyenv-uninstall python-build].each do |cmd| bin.install_symlink "#{prefix}/plugins/python-build/bin/#{cmd}" end end test do shell_output("eval \"$(#{bin}/pyenv init -)\" && pyenv versions") end end
class Pyenv < Formula desc "Python version management" homepage "https://github.com/pyenv/pyenv" url "https://github.com/pyenv/pyenv/archive/1.2.25.tar.gz" sha256 "ecb34d3eeb4042cdeb2db8fb14db387af486e49ec41bbdcec7b9c95d65a44151" license "MIT" version_scheme 1 head "https://github.com/pyenv/pyenv.git" livecheck do url :stable strategy :github_latest end bottle do sha256 cellar: :any, arm64_big_sur: "38eb9ebf6ba630e5291a1c4c50943278858553bb70bc7302c163f35d289789bf" sha256 cellar: :any, big_sur: "e97e845395083a8dd1261cbcae543f9707d3948180763e5dd96bd4f2b48f6f82" sha256 cellar: :any, catalina: "03d0687354f87759cda216809cb7d3888936279a09002e47eaa6237d6245408a" sha256 cellar: :any, mojave: "6347e3e5e40c312ba0ee7a0e1f6bc250f5386db981edcc354b8d102844344794" end depends_on "autoconf" depends_on "openssl@1.1" depends_on "pkg-config" depends_on "readline" uses_from_macos "bzip2" uses_from_macos "libffi" uses_from_macos "ncurses" uses_from_macos "xz" uses_from_macos "zlib" def install inreplace "libexec/pyenv", "/usr/local", HOMEBREW_PREFIX system "src/configure" system "make", "-C", "src" prefix.install Dir["*"] %w[pyenv-install pyenv-uninstall python-build].each do |cmd| bin.install_symlink "#{prefix}/plugins/python-build/bin/#{cmd}" end # Do not manually install shell completions. See: # - https://github.com/pyenv/pyenv/issues/1056#issuecomment-356818337 # - https://github.com/Homebrew/homebrew-core/pull/22727 end test do shell_output("eval \"$(#{bin}/pyenv init -)\" && pyenv versions") end end pyenv 1.2.26 Closes #74562. Signed-off-by: Thierry Moisan <8bf87a6c4caed0437859f8c8fafc6782533e4540@gmail.com> Signed-off-by: BrewTestBot <8a898ee6867e4f2028e63d2a6319b2224641c06c@users.noreply.github.com> class Pyenv < Formula desc "Python version management" homepage "https://github.com/pyenv/pyenv" url "https://github.com/pyenv/pyenv/archive/1.2.26.tar.gz" sha256 "004a47be4919ca717bee546d3062543d166c24678a21a9a5aa75f3bd0653c5d2" license "MIT" version_scheme 1 head "https://github.com/pyenv/pyenv.git" livecheck do url :stable strategy :github_latest end bottle do sha256 cellar: :any, arm64_big_sur: "38eb9ebf6ba630e5291a1c4c50943278858553bb70bc7302c163f35d289789bf" sha256 cellar: :any, big_sur: "e97e845395083a8dd1261cbcae543f9707d3948180763e5dd96bd4f2b48f6f82" sha256 cellar: :any, catalina: "03d0687354f87759cda216809cb7d3888936279a09002e47eaa6237d6245408a" sha256 cellar: :any, mojave: "6347e3e5e40c312ba0ee7a0e1f6bc250f5386db981edcc354b8d102844344794" end depends_on "autoconf" depends_on "openssl@1.1" depends_on "pkg-config" depends_on "readline" uses_from_macos "bzip2" uses_from_macos "libffi" uses_from_macos "ncurses" uses_from_macos "xz" uses_from_macos "zlib" def install inreplace "libexec/pyenv", "/usr/local", HOMEBREW_PREFIX system "src/configure" system "make", "-C", "src" prefix.install Dir["*"] %w[pyenv-install pyenv-uninstall python-build].each do |cmd| bin.install_symlink "#{prefix}/plugins/python-build/bin/#{cmd}" end # Do not manually install shell completions. See: # - https://github.com/pyenv/pyenv/issues/1056#issuecomment-356818337 # - https://github.com/Homebrew/homebrew-core/pull/22727 end test do shell_output("eval \"$(#{bin}/pyenv init -)\" && pyenv versions") end end
require 'formula' class Pyqt5 < Formula homepage 'http://www.riverbankcomputing.co.uk/software/pyqt/download5' url 'http://downloads.sf.net/project/pyqt/PyQt5/PyQt-5.2/PyQt-gpl-5.2.tar.gz' sha1 'a1c232d34ab268587c127ad3097c725ee1a70cf0' option 'enable-debug', "Build with debug symbols" depends_on :python3 => :recommended depends_on :python => :optional if !Formula.factory("python").installed? && build.with?("python") && build.with?("python3") odie <<-EOS.undent pyqt5: You cannot use system Python 2 and Homebrew's Python 3 simultaneously. Either `brew install python` or use `--without-python3`. EOS elsif build.without?("python3") && build.without?("python") odie "pyqt5: --with-python3 must be specified when using --without-python" end depends_on 'qt5' if build.with? 'python3' depends_on 'sip' => 'with-python3' else depends_on 'sip' end def pythons pythons = [] ["python", "python3"].each do |python| next if build.without? python version = /\d\.\d/.match `#{python} --version 2>&1` pythons << [python, version] end pythons end def install pythons.each do |python, version| args = [ "--confirm-license", "--bindir=#{bin}", "--destdir=#{lib}/python#{version}/site-packages", # To avoid conflicts with PyQt (for Qt4): "--sipdir=#{share}/sip/Qt5/", # sip.h could not be found automatically "--sip-incdir=#{Formula.factory('sip').opt_prefix}/include", # Force deployment target to avoid libc++ issues "QMAKE_MACOSX_DEPLOYMENT_TARGET=#{MacOS.version}" ] args << '--debug' if build.include? 'enable-debug' system python, "configure.py", *args system "make" system "make", "install" system "make", "clean" if pythons.length > 1 end end test do system "pyuic5", "--version" system "pylupdate5", "-version" pythons.each do |python, version| system python, "-c", "import PyQt5" end end end pyqt5: use Formula[] require 'formula' class Pyqt5 < Formula homepage 'http://www.riverbankcomputing.co.uk/software/pyqt/download5' url 'http://downloads.sf.net/project/pyqt/PyQt5/PyQt-5.2/PyQt-gpl-5.2.tar.gz' sha1 'a1c232d34ab268587c127ad3097c725ee1a70cf0' option 'enable-debug', "Build with debug symbols" depends_on :python3 => :recommended depends_on :python => :optional if !Formula["python"].installed? && build.with?("python") && build.with?("python3") odie <<-EOS.undent pyqt5: You cannot use system Python 2 and Homebrew's Python 3 simultaneously. Either `brew install python` or use `--without-python3`. EOS elsif build.without?("python3") && build.without?("python") odie "pyqt5: --with-python3 must be specified when using --without-python" end depends_on 'qt5' if build.with? 'python3' depends_on 'sip' => 'with-python3' else depends_on 'sip' end def pythons pythons = [] ["python", "python3"].each do |python| next if build.without? python version = /\d\.\d/.match `#{python} --version 2>&1` pythons << [python, version] end pythons end def install pythons.each do |python, version| args = [ "--confirm-license", "--bindir=#{bin}", "--destdir=#{lib}/python#{version}/site-packages", # To avoid conflicts with PyQt (for Qt4): "--sipdir=#{share}/sip/Qt5/", # sip.h could not be found automatically "--sip-incdir=#{Formula["sip"].opt_prefix}/include", # Force deployment target to avoid libc++ issues "QMAKE_MACOSX_DEPLOYMENT_TARGET=#{MacOS.version}" ] args << '--debug' if build.include? 'enable-debug' system python, "configure.py", *args system "make" system "make", "install" system "make", "clean" if pythons.length > 1 end end test do system "pyuic5", "--version" system "pylupdate5", "-version" pythons.each do |python, version| system python, "-c", "import PyQt5" end end end
class Qjson < Formula desc "Map JSON to QVariant objects" homepage "http://qjson.sourceforge.net" url "https://downloads.sourceforge.net/project/qjson/qjson/0.8.1/qjson-0.8.1.tar.bz2" mirror "https://mirrors.kernel.org/debian/pool/main/q/qjson/qjson_0.8.1.orig.tar.bz2" sha256 "cd4db5b956247c4991a9c3e95512da257cd2a6bd011357e363d02300afc814d9" head "https://github.com/flavio/qjson.git" bottle do cellar :any revision 2 sha256 "4d47edace9872cd7cb267ca6e77c7f7d55400918cbdc57d45e4ee5d12087f4da" => :el_capitan sha256 "a505ef97e0a0a3e05013ef1aa641af1104dedb363ff75c7d23b2c3dee5299649" => :yosemite sha256 "2563c0f4d42e92136279434e9e73201b3117993d2eaa949359dab9c148d71710" => :mavericks end depends_on "cmake" => :build depends_on "qt" def install system "cmake", ".", *std_cmake_args system "make", "install" end test do (testpath/"test.cpp").write <<-EOS.undent #include <qjson/parser.h> int main() { QJson::Parser parser; return 0; } EOS system ENV.cxx, "-I#{include}", "-L#{lib}", "-lqjson", testpath/"test.cpp", "-o", testpath/"test" system "./test" end end qjson 0.9.0 Closes #7410. Signed-off-by: ilovezfs <fbd54dbbcf9e596abad4ccdc4dfc17f80ebeaee2@icloud.com> class Qjson < Formula desc "Map JSON to QVariant objects" homepage "http://qjson.sourceforge.net" url "https://github.com/flavio/qjson/archive/0.9.0.tar.gz" sha256 "e812617477f3c2bb990561767a4cd8b1d3803a52018d4878da302529552610d4" bottle do cellar :any revision 2 sha256 "4d47edace9872cd7cb267ca6e77c7f7d55400918cbdc57d45e4ee5d12087f4da" => :el_capitan sha256 "a505ef97e0a0a3e05013ef1aa641af1104dedb363ff75c7d23b2c3dee5299649" => :yosemite sha256 "2563c0f4d42e92136279434e9e73201b3117993d2eaa949359dab9c148d71710" => :mavericks end depends_on "cmake" => :build depends_on "qt5" def install system "cmake", ".", *std_cmake_args system "make", "install" end test do (testpath/"test.cpp").write <<-EOS.undent #include <qjson-qt5/parser.h> int main() { QJson::Parser parser; return 0; } EOS system ENV.cxx, "test.cpp", "-o", "test", "-std=c++11", "-I#{include}", "-L#{lib}", "-lqjson-qt5", "-I#{Formula["qt5"].opt_include}", "-F#{Formula["qt5"].opt_lib}", "-framework", "QtCore" system "./test" end end
class Quill < Formula desc "C++17 Asynchronous Low Latency Logging Library" homepage "https://github.com/odygrd/quill" url "https://github.com/odygrd/quill/archive/v2.0.1.tar.gz" sha256 "39527aca74edd02d9df0bba62211df9f6d53984d4f6cca470734e19c4d8b69fb" license "MIT" head "https://github.com/odygrd/quill.git", branch: "master" bottle do sha256 cellar: :any_skip_relocation, arm64_monterey: "b3dd00263847be710f058bc6cd6395c41d254c7c27177c427e0eb8d8ab2c8fc9" sha256 cellar: :any_skip_relocation, arm64_big_sur: "1eea3220d9dca9856367b5a9954ad6411c1493963bceb7631968ae0ec58b3876" sha256 cellar: :any_skip_relocation, monterey: "b590cb7f606c77dcc54c97a000052705ae2fd12692f7e018f11b02e1a248a445" sha256 cellar: :any_skip_relocation, big_sur: "dc256f5c6fa1a2b648c0488aad6f59930f147fc911e9b7f640f1672046aa81ba" sha256 cellar: :any_skip_relocation, catalina: "fcd86fd1ec214cc8ad5b6554d48f80e200464ce76811061d9976f56b3e8fb685" sha256 cellar: :any_skip_relocation, x86_64_linux: "ab2de46843bae5e9820b62cc6728bb24c7d40fe359711db394c17708ebcaba5c" end depends_on "cmake" => :build on_linux do depends_on "gcc" end fails_with gcc: "5" def install mkdir "quill-build" do args = std_cmake_args args << ".." system "cmake", *args system "make", "install" end end test do (testpath/"test.cpp").write <<~EOS #include "quill/Quill.h" int main() { quill::start(); quill::Handler* file_handler = quill::file_handler("#{testpath}/basic-log.txt", "w"); quill::Logger* logger = quill::create_logger("logger_bar", file_handler); LOG_INFO(logger, "Test"); } EOS system ENV.cxx, "-std=c++17", "test.cpp", "-I#{include}", "-L#{lib}", "-lquill", "-o", "test", "-pthread" system "./test" assert_predicate testpath/"basic-log.txt", :exist? assert_match "Test", (testpath/"basic-log.txt").read end end quill 2.0.2 Closes #102735. Signed-off-by: Sean Molenaar <2b250e3fea88cfef248b497ad5fc17f7dc435154@users.noreply.github.com> Signed-off-by: Rui Chen <907c7afd57be493757f13ccd1dd45dddf02db069@chenrui.dev> Signed-off-by: BrewTestBot <8a898ee6867e4f2028e63d2a6319b2224641c06c@users.noreply.github.com> class Quill < Formula desc "C++17 Asynchronous Low Latency Logging Library" homepage "https://github.com/odygrd/quill" url "https://github.com/odygrd/quill/archive/v2.0.2.tar.gz" sha256 "d2dc9004886b787f8357e97d2f2d0c74a460259f7f95d65ab49d060fe34a9b5c" license "MIT" head "https://github.com/odygrd/quill.git", branch: "master" bottle do sha256 cellar: :any_skip_relocation, arm64_monterey: "b3dd00263847be710f058bc6cd6395c41d254c7c27177c427e0eb8d8ab2c8fc9" sha256 cellar: :any_skip_relocation, arm64_big_sur: "1eea3220d9dca9856367b5a9954ad6411c1493963bceb7631968ae0ec58b3876" sha256 cellar: :any_skip_relocation, monterey: "b590cb7f606c77dcc54c97a000052705ae2fd12692f7e018f11b02e1a248a445" sha256 cellar: :any_skip_relocation, big_sur: "dc256f5c6fa1a2b648c0488aad6f59930f147fc911e9b7f640f1672046aa81ba" sha256 cellar: :any_skip_relocation, catalina: "fcd86fd1ec214cc8ad5b6554d48f80e200464ce76811061d9976f56b3e8fb685" sha256 cellar: :any_skip_relocation, x86_64_linux: "ab2de46843bae5e9820b62cc6728bb24c7d40fe359711db394c17708ebcaba5c" end depends_on "cmake" => :build on_linux do depends_on "gcc" end fails_with gcc: "5" def install mkdir "quill-build" do args = std_cmake_args args << ".." system "cmake", *args system "make", "install" end end test do (testpath/"test.cpp").write <<~EOS #include "quill/Quill.h" int main() { quill::start(); quill::Handler* file_handler = quill::file_handler("#{testpath}/basic-log.txt", "w"); quill::Logger* logger = quill::create_logger("logger_bar", file_handler); LOG_INFO(logger, "Test"); } EOS system ENV.cxx, "-std=c++17", "test.cpp", "-I#{include}", "-L#{lib}", "-lquill", "-o", "test", "-pthread" system "./test" assert_predicate testpath/"basic-log.txt", :exist? assert_match "Test", (testpath/"basic-log.txt").read end end
# coding: utf-8 require 'mechanize/test_case' class TestMechanizeHttpAgent < Mechanize::TestCase def setup super @agent = @mech.agent @uri = URI.parse 'http://example/' @req = Net::HTTP::Get.new '/' @res = Net::HTTPOK.allocate @res.instance_variable_set :@code, 200 @res.instance_variable_set :@header, {} @headers = if RUBY_VERSION > '1.9' then %w[accept user-agent] else %w[accept] end end def auth_realm uri, scheme, type base_uri = uri + '/' realm = Mechanize::HTTP::AuthRealm.new scheme, base_uri, 'r' @agent.authenticate_methods[base_uri][type] << realm realm end def test_auto_io Tempfile.open 'input' do |input_io| input_io.binmode input_io.write '12345' input_io.rewind out_io = @agent.auto_io __name__, 1024, input_io assert_equal '12345', out_io.string assert_equal Encoding::BINARY, out_io.string.encoding if Object.const_defined? :Encoding end end def test_auto_io_chunk Tempfile.open 'input' do |input_io| chunks = [] input_io.binmode input_io.write '12345' input_io.rewind @agent.auto_io __name__, 1, input_io do |chunk| chunks << chunk end assert_equal %w[1 2 3 4 5], chunks end end def test_auto_io_tempfile @agent.max_file_buffer = 3 Tempfile.open 'input' do |input_io| input_io.binmode input_io.write '12345' input_io.rewind out_io = @agent.auto_io __name__, 1, input_io result = out_io.read assert_equal '12345', result assert_equal Encoding::BINARY, result.encoding if Object.const_defined? :Encoding end end def test_auto_io_yield Tempfile.open 'input' do |input_io| input_io.binmode input_io.write '12345' input_io.rewind out_io = @agent.auto_io __name__, 1024, input_io do |chunk| "x#{chunk}" end assert_equal 'x12345', out_io.string end end def test_certificate_equals cert_path = File.expand_path '../data/server.crt', __FILE__ cert = OpenSSL::X509::Certificate.new File.read cert_path @agent.certificate = cert assert_equal cert.to_pem, @agent.certificate.to_pem end def test_certificate_equals_file cert_path = File.expand_path '../data/server.crt', __FILE__ cert = OpenSSL::X509::Certificate.new File.read cert_path @agent.certificate = cert_path assert_equal cert.to_pem, @agent.certificate.to_pem end def test_connection_for_file uri = URI.parse 'file:///nonexistent' conn = @agent.connection_for uri assert_equal Mechanize::FileConnection.new, conn end def test_connection_for_http conn = @agent.connection_for @uri assert_equal @agent.http, conn end def test_disable_keep_alive @agent.disable_keep_alive @req refute @req['connection'] end def test_disable_keep_alive_no @agent.keep_alive = false @agent.disable_keep_alive @req assert_equal 'close', @req['connection'] end def test_enable_gzip @agent.enable_gzip @req assert_equal 'gzip,deflate,identity', @req['accept-encoding'] end def test_enable_gzip_no @agent.gzip_enabled = false @agent.enable_gzip @req assert_equal 'identity', @req['accept-encoding'] end def test_fetch_file_nonexistent in_tmpdir do nonexistent = File.join Dir.pwd, 'nonexistent' uri = URI.parse "file://#{nonexistent}" e = assert_raises Mechanize::ResponseCodeError do @agent.fetch uri end assert_equal '404 => Net::HTTPNotFound', e.message end end def test_fetch_file_plus Tempfile.open '++plus++' do |io| content = 'plusses +++' io.write content io.rewind uri = URI.parse "file://#{Mechanize::Util.uri_escape io.path}" page = @agent.fetch uri assert_equal content, page.body assert_kind_of Mechanize::File, page end end def test_fetch_file_space foo = File.expand_path("../htdocs/dir with spaces/foo.html", __FILE__) uri = URI.parse "file://#{Mechanize::Util.uri_escape foo}" page = @agent.fetch uri assert_equal File.read(foo), page.body assert_kind_of Mechanize::Page, page end def test_fetch_head_gzip uri = @uri + '/gzip?file=index.html' page = @agent.fetch uri, :head assert_kind_of Mechanize::Page, page end def test_fetch_hooks @agent.pre_connect_hooks << proc do |agent, request| assert_equal '/index.html', request.path assert_equal @agent, agent end @agent.post_connect_hooks << proc do |agent, uri, response, body| assert_equal @agent, agent assert_equal URI('http://example/index.html'), uri assert_equal '200', response.code assert_kind_of String, body end @agent.fetch URI 'http://example/index.html' end def test_fetch_post_connect_hook response = nil @agent.post_connect_hooks << lambda { |_, _, res, _| response = res } @agent.fetch 'http://localhost/' assert response end def test_fetch_server_error e = assert_raises Mechanize::ResponseCodeError do @mech.get 'http://localhost/response_code?code=500' end assert_equal '500', e.response_code end def test_get_meta_refresh_header_follow_self @agent.follow_meta_refresh = true @agent.follow_meta_refresh_self = true page = Mechanize::Page.new(@uri, nil, '', 200, @mech) @res.instance_variable_set :@header, 'refresh' => ['0'] refresh = @agent.get_meta_refresh @res, @uri, page assert_equal [0.0, URI('http://example/')], refresh end def test_get_meta_refresh_header_no_follow page = Mechanize::Page.new(@uri, nil, '', 200, @mech) @res.instance_variable_set :@header, 'refresh' => ['0'] refresh = @agent.get_meta_refresh @res, @uri, page assert_nil refresh end def test_get_meta_refresh_header_no_follow_self @agent.follow_meta_refresh = true page = Mechanize::Page.new(@uri, nil, '', 200, @mech) @res.instance_variable_set :@header, 'refresh' => ['0'] refresh = @agent.get_meta_refresh @res, @uri, page assert_nil refresh end def test_get_meta_refresh_meta_follow_self @agent.follow_meta_refresh = true @agent.follow_meta_refresh_self = true body = <<-BODY <title></title> <meta http-equiv="refresh" content="0"> BODY page = Mechanize::Page.new(@uri, nil, body, 200, @mech) refresh = @agent.get_meta_refresh @res, @uri, page assert_equal [0, nil], refresh end def test_get_meta_refresh_meta_no_follow body = <<-BODY <title></title> <meta http-equiv="refresh" content="0"> BODY page = Mechanize::Page.new(@uri, nil, body, 200, @mech) refresh = @agent.get_meta_refresh @res, @uri, page assert_nil refresh end def test_get_meta_refresh_meta_no_follow_self @agent.follow_meta_refresh = true body = <<-BODY <title></title> <meta http-equiv="refresh" content="0"> BODY page = Mechanize::Page.new(@uri, nil, body, 200, @mech) refresh = @agent.get_meta_refresh @res, @uri, page assert_nil refresh end def test_get_robots robotstxt = @agent.get_robots 'http://localhost/robots.txt' refute_equal '', robotstxt robotstxt = @agent.get_robots 'http://localhost/response_code?code=404' assert_equal '', robotstxt end def test_hook_content_encoding_response @mech.content_encoding_hooks << lambda{|agent, uri, response, response_body_io| response['content-encoding'] = 'gzip' if response['content-encoding'] == 'agzip'} @res.instance_variable_set :@header, 'content-encoding' => %w[agzip] body_io = StringIO.new 'part' @agent.hook_content_encoding @res, @uri, body_io assert_equal 'gzip', @res['content-encoding'] end def test_http_request_file uri = URI.parse 'file:///nonexistent' request = @agent.http_request uri, :get assert_kind_of Mechanize::FileRequest, request assert_equal '/nonexistent', request.path end def test_http_request_get request = @agent.http_request @uri, :get assert_kind_of Net::HTTP::Get, request assert_equal '/', request.path end def test_http_request_post request = @agent.http_request @uri, :post assert_kind_of Net::HTTP::Post, request assert_equal '/', request.path end def test_idle_timeout_equals @agent.idle_timeout = 1 assert_equal 1, @agent.http.idle_timeout end def test_inflate body_io = StringIO.new "x\x9C+H,*\x01\x00\x04?\x01\xB8" result = @agent.inflate body_io assert_equal 'part', result.read end def test_post_connect @agent.post_connect_hooks << proc { |agent, uri, response, body| assert_equal @agent, agent assert_equal @res, response assert_equal 'body', body throw :called } io = StringIO.new 'body' assert_throws :called do @agent.post_connect @uri, @res, io end assert_equal 0, io.pos end def test_pre_connect @agent.pre_connect_hooks << proc { |agent, request| assert_equal @agent, agent assert_equal @req, request throw :called } assert_throws :called do @agent.pre_connect @req end end def test_request_add_headers @agent.request_add_headers @req, 'Content-Length' => 300 assert_equal '300', @req['content-length'] end def test_request_add_headers_etag @agent.request_add_headers @req, :etag => '300' assert_equal '300', @req['etag'] end def test_request_add_headers_if_modified_since @agent.request_add_headers @req, :if_modified_since => 'some_date' assert_equal 'some_date', @req['if-modified-since'] end def test_request_add_headers_none @agent.request_add_headers @req assert_equal @headers, @req.to_hash.keys.sort end def test_request_add_headers_request_headers @agent.request_headers['X-Foo'] = 'bar' @agent.request_add_headers @req assert_equal @headers + %w[x-foo], @req.to_hash.keys.sort end def test_request_add_headers_symbol e = assert_raises ArgumentError do @agent.request_add_headers @req, :content_length => 300 end assert_equal 'unknown header symbol content_length', e.message end def test_request_auth_basic @agent.user = 'user' @agent.password = 'password' auth_realm @uri, 'Basic', :basic @agent.request_auth @req, @uri assert_match %r%^Basic %, @req['Authorization'] end def test_request_auth_digest @agent.user = 'user' @agent.password = 'password' realm = auth_realm @uri, 'Digest', :digest @agent.digest_challenges[realm] = 'Digest realm=r, qop="auth"' @agent.request_auth @req, @uri assert_match %r%^Digest %, @req['Authorization'] assert_match %r%qop=auth%, @req['Authorization'] end def test_request_auth_iis_digest @agent.user = 'user' @agent.password = 'password' realm = auth_realm @uri, 'Digest', :digest @agent.digest_challenges[realm] = 'Digest realm=r, qop="auth"' @agent.request_auth @req, @uri assert_match %r%^Digest %, @req['Authorization'] assert_match %r%qop=auth%, @req['Authorization'] end def test_request_auth_none @agent.request_auth @req, @uri assert_nil @req['Authorization'] end def test_request_cookies uri = URI.parse 'http://host.example.com' Mechanize::Cookie.parse uri, 'hello=world domain=.example.com' do |cookie| @agent.cookie_jar.add uri, cookie end @agent.request_cookies @req, uri assert_equal 'hello=world domain=.example.com', @req['Cookie'] end def test_request_cookies_many uri = URI.parse 'http://host.example.com' cookie_str = 'a=b domain=.example.com, c=d domain=.example.com' Mechanize::Cookie.parse uri, cookie_str do |cookie| @agent.cookie_jar.add uri, cookie end @agent.request_cookies @req, uri expected = cookie_str.sub ', ', '; ' assert_equal expected, @req['Cookie'] end def test_request_cookies_none @agent.request_cookies @req, @uri assert_nil @req['Cookie'] end def test_request_cookies_wrong_domain uri = URI.parse 'http://host.example.com' Mechanize::Cookie.parse uri, 'hello=world domain=.example.com' do |cookie| @agent.cookie_jar.add uri, cookie end @agent.request_cookies @req, @uri assert_nil @req['Cookie'] end def test_request_host @agent.request_host @req, @uri assert_equal 'example', @req['host'] end def test_request_host_nonstandard @uri.port = 81 @agent.request_host @req, @uri assert_equal 'example:81', @req['host'] end def test_request_language_charset @agent.request_language_charset @req assert_equal 'en-us,en;q=0.5', @req['accept-language'] assert_equal 'ISO-8859-1,utf-8;q=0.7,*;q=0.7', @req['accept-charset'] end def test_request_referer referer = URI.parse 'http://old.example' @agent.request_referer @req, @uri, referer assert_equal 'http://old.example', @req['referer'] end def test_request_referer_https uri = URI.parse 'https://example' referer = URI.parse 'https://old.example' @agent.request_referer @req, uri, referer assert_equal 'https://old.example', @req['referer'] end def test_request_referer_https_downgrade referer = URI.parse 'https://old.example' @agent.request_referer @req, @uri, referer assert_nil @req['referer'] end def test_request_referer_https_downgrade_case uri = URI.parse 'http://example' referer = URI.parse 'httpS://old.example' @agent.request_referer @req, uri, referer assert_nil @req['referer'] end def test_request_referer_https_upgrade uri = URI.parse 'https://example' referer = URI.parse 'http://old.example' @agent.request_referer @req, uri, referer assert_equal 'http://old.example', @req['referer'] end def test_request_referer_none @agent.request_referer @req, @uri, nil assert_nil @req['referer'] end def test_request_referer_strip uri = URI.parse 'http://example.com/index.html' host_path = "old.example/page.html?q=x" referer = "http://#{host_path}" [ "", "@", "user1@", ":@", "user1:@", ":password1@", "user1:password1@", ].each { |userinfo| ['', '#frag'].each { |frag| url = URI.parse "http://#{userinfo}#{host_path}#{frag}" @agent.request_referer @req, uri, url assert_equal referer, @req['referer'], url } } end def test_request_user_agent @agent.request_user_agent @req assert_match %r%^Mechanize/#{Mechanize::VERSION}%, @req['user-agent'] ruby_version = if RUBY_PATCHLEVEL >= 0 then "#{RUBY_VERSION}p#{RUBY_PATCHLEVEL}" else "#{RUBY_VERSION}dev#{RUBY_REVISION}" end assert_match %r%Ruby/#{ruby_version}%, @req['user-agent'] end def test_resolve_bad_uri e = assert_raises ArgumentError do @agent.resolve 'google' end assert_equal 'absolute URL needed (not google)', e.message end def test_resolve_utf8 uri = 'http://example?q=ü' resolved = @agent.resolve uri assert_equal '/?q=%C3%BC', resolved.request_uri end def test_resolve_parameters_body input_params = { :q => 'hello' } uri, params = @agent.resolve_parameters @uri, :post, input_params assert_equal 'http://example/', uri.to_s assert_equal input_params, params end def test_resolve_parameters_query uri, params = @agent.resolve_parameters @uri, :get, :q => 'hello' assert_equal 'http://example/?q=hello', uri.to_s assert_nil params end def test_resolve_parameters_query_append input_params = { :q => 'hello' } @uri.query = 'a=b' uri, params = @agent.resolve_parameters @uri, :get, input_params assert_equal 'http://example/?a=b&q=hello', uri.to_s assert_nil params end def test_response_authenticate @res.instance_variable_set :@header, 'www-authenticate' => ['Basic realm=r'] @agent.user = 'user' @agent.password = 'password' @agent.response_authenticate @res, nil, @uri, @req, {}, nil, nil base_uri = @uri + '/' realm = Mechanize::HTTP::AuthRealm.new 'Basic', base_uri, 'r' assert_equal [realm], @agent.authenticate_methods[base_uri][:basic] end def test_response_authenticate_digest @res.instance_variable_set(:@header, 'www-authenticate' => ['Digest realm=r']) @agent.user = 'user' @agent.password = 'password' @agent.response_authenticate @res, nil, @uri, @req, {}, nil, nil base_uri = @uri + '/' realm = Mechanize::HTTP::AuthRealm.new 'Digest', base_uri, 'r' assert_equal [realm], @agent.authenticate_methods[base_uri][:digest] challenge = Mechanize::HTTP::AuthChallenge.new 'Digest', 'realm' => 'r' assert_equal challenge, @agent.digest_challenges[realm] end def test_response_authenticate_digest_iis @res.instance_variable_set(:@header, 'www-authenticate' => ['Digest realm=r'], 'server' => ['Microsoft-IIS']) @agent.user = 'user' @agent.password = 'password' @agent.response_authenticate @res, nil, @uri, @req, {}, nil, nil base_uri = @uri + '/' realm = Mechanize::HTTP::AuthRealm.new 'Digest', base_uri, 'r' assert_equal [realm], @agent.authenticate_methods[base_uri][:iis_digest] end def test_response_authenticate_multiple @res.instance_variable_set(:@header, 'www-authenticate' => ['Basic realm=r, Digest realm=r']) @agent.user = 'user' @agent.password = 'password' @agent.response_authenticate @res, nil, @uri, @req, {}, nil, nil base_uri = @uri + '/' realm = Mechanize::HTTP::AuthRealm.new 'Digest', base_uri, 'r' assert_equal [realm], @agent.authenticate_methods[base_uri][:digest] assert_empty @agent.authenticate_methods[base_uri][:basic] end def test_response_authenticate_no_www_authenticate denied = page URI('http://example/denied'), 'text/html', '', 403 @agent.user = 'user' @agent.password = 'password' e = assert_raises Mechanize::UnauthorizedError do @agent.response_authenticate @res, denied, @uri, @req, {}, nil, nil end assert_equal '403 => Net::HTTPForbidden', e.message end def test_response_authenticate_ntlm @uri += '/ntlm' @res.instance_variable_set(:@header, 'www-authenticate' => ['Negotiate, NTLM']) @agent.user = 'user' @agent.password = 'password' @agent.domain = 'domain' page = @agent.response_authenticate @res, nil, @uri, @req, {}, nil, nil assert_equal 'ok', page.body # lame test end def test_response_authenticate_unknown @agent.user = 'user' @agent.password = 'password' page = Mechanize::File.new nil, nil, nil, 401 @res.instance_variable_set(:@header, 'www-authenticate' => ['Unknown realm=r']) assert_raises Mechanize::UnauthorizedError do @agent.response_authenticate @res, page, @uri, @req, nil, nil, nil end end def test_response_content_encoding_7_bit @res.instance_variable_set :@header, 'content-encoding' => %w[7bit] body = @agent.response_content_encoding @res, StringIO.new('part') assert_equal 'part', body.read end def test_response_content_encoding_deflate @res.instance_variable_set :@header, 'content-encoding' => %w[deflate] body_io = StringIO.new "x\x9C+H,*\x01\x00\x04?\x01\xB8" body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read assert body_io.closed? end def test_response_content_encoding_deflate_chunked @res.instance_variable_set :@header, 'content-encoding' => %w[deflate] body_io = StringIO.new "x\x9C+H,*\x01\x00\x04?\x01\xB8" body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read end def test_response_content_encoding_deflate_corrupt @res.instance_variable_set :@header, 'content-encoding' => %w[deflate] body_io = StringIO.new "x\x9C+H,*\x01\x00\x04?\x01" # missing 1 byte e = assert_raises Mechanize::Error do @agent.response_content_encoding @res, body_io end assert_match %r%error handling content-encoding deflate:%, e.message assert_match %r%Zlib%, e.message assert body_io.closed? end def test_response_content_encoding_deflate_empty @res.instance_variable_set :@header, 'content-encoding' => %w[deflate] body = @agent.response_content_encoding @res, StringIO.new assert_equal '', body.read end # IIS/6.0 ASP.NET/2.0.50727 does not wrap deflate with zlib, WTF? def test_response_content_encoding_deflate_no_zlib @res.instance_variable_set :@header, 'content-encoding' => %w[deflate] body = @agent.response_content_encoding @res, StringIO.new("+H,*\001\000") assert_equal 'part', body.read end def test_response_content_encoding_gzip @res.instance_variable_set :@header, 'content-encoding' => %w[gzip] body_io = StringIO.new \ "\037\213\b\0002\002\225M\000\003+H,*\001\000\306p\017I\004\000\000\000" body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read assert body_io.closed? end def test_response_content_encoding_gzip_chunked def @res.content_length() nil end @res.instance_variable_set :@header, 'content-encoding' => %w[gzip] body_io = StringIO.new \ "\037\213\b\0002\002\225M\000\003+H,*\001\000\306p\017I\004\000\000\000" body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read end def test_response_content_encoding_gzip_corrupt log = StringIO.new logger = Logger.new log @agent.context.log = logger @res.instance_variable_set :@header, 'content-encoding' => %w[gzip] body_io = StringIO.new \ "\037\213\b\0002\002\225M\000\003+H,*\001" e = assert_raises Mechanize::Error do @agent.response_content_encoding @res, body_io end assert_match %r%error handling content-encoding gzip:%, e.message assert_match %r%Zlib%, e.message assert_match %r%unable to gunzip response, trying raw inflate%, log.string assert_match %r%unable to gunzip response:%, log.string assert body_io.closed? end def test_response_content_encoding_gzip_corrupt_checksum log = StringIO.new logger = Logger.new log @agent.context.log = logger @res.instance_variable_set :@header, 'content-encoding' => %w[gzip] body_io = StringIO.new \ "\037\213\b\0002\002\225M\000\003+H,*\001\000\306p\017I\004\000\000" e = assert_raises Mechanize::Error do @agent.response_content_encoding @res, body_io end assert_match %r%error handling content-encoding gzip:%, e.message assert_match %r%Zlib%, e.message assert_match %r%unable to gunzip response, trying raw inflate%, log.string end def test_response_content_encoding_gzip_empty @res.instance_variable_set :@header, 'content-encoding' => %w[gzip] body = @agent.response_content_encoding @res, StringIO.new assert_equal '', body.read end def test_response_content_encoding_gzip_encoding_bad @res.instance_variable_set(:@header, 'content-encoding' => %w[gzip], 'content-type' => 'text/html; charset=UTF-8') # "test\xB2" body_io = StringIO.new \ "\037\213\b\000*+\314N\000\003+I-.\331\004\000x\016\003\376\005\000\000\000" body = @agent.response_content_encoding @res, body_io expected = "test\xB2" expected.force_encoding Encoding::BINARY if have_encoding? content = body.read assert_equal expected, content assert_equal Encoding::BINARY, content.encoding if have_encoding? end def test_response_content_encoding_none @res.instance_variable_set :@header, 'content-encoding' => %w[none] body = @agent.response_content_encoding @res, StringIO.new('part') assert_equal 'part', body.read end def test_response_content_encoding_tempfile_7_bit body_io = tempfile 'part' @res.instance_variable_set :@header, 'content-encoding' => %w[7bit] body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read refute body_io.closed? ensure begin body_io.close! unless body_io.closed? rescue IOError # HACK for ruby 1.8 end end def test_response_content_encoding_tempfile_gzip body_io = tempfile "x\x9C+H,*\x01\x00\x04?\x01\xB8" @res.instance_variable_set :@header, 'content-encoding' => %w[deflate] body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read assert body_io.closed? ensure body_io.close! unless body_io.closed? end def test_response_content_encoding_unknown @res.instance_variable_set :@header, 'content-encoding' => %w[unknown] body = StringIO.new 'part' e = assert_raises Mechanize::Error do @agent.response_content_encoding @res, body end assert_equal 'unsupported content-encoding: unknown', e.message end def test_response_content_encoding_x_gzip @res.instance_variable_set :@header, 'content-encoding' => %w[x-gzip] body_io = StringIO.new \ "\037\213\b\0002\002\225M\000\003+H,*\001\000\306p\017I\004\000\000\000" body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read end def test_response_cookies uri = URI.parse 'http://host.example.com' cookie_str = 'a=b domain=.example.com' @res.instance_variable_set(:@header, 'set-cookie' => [cookie_str], 'content-type' => %w[text/html]) page = Mechanize::Page.new uri, @res, '', 200, @mech @agent.response_cookies @res, uri, page assert_equal ['a=b domain=.example.com'], @agent.cookie_jar.cookies(uri).map { |c| c.to_s } end def test_response_cookies_many uri = URI.parse 'http://host.example.com' cookie1 = 'a=b domain=.example.com' cookie2 = 'c=d domain=.example.com' @res.instance_variable_set(:@header, 'set-cookie' => [cookie1, cookie2], 'content-type' => %w[text/html]) page = Mechanize::Page.new uri, @res, '', 200, @mech @agent.response_cookies @res, uri, page assert_equal ['a=b domain=.example.com', 'c=d domain=.example.com'], @agent.cookie_jar.cookies(uri).map { |c| c.to_s } end def test_response_cookies_meta uri = URI.parse 'http://host.example.com' cookie_str = 'a=b domain=.example.com' body = <<-BODY <head> <meta http-equiv="Set-Cookie" content="#{cookie_str}"> </head>" BODY @res.instance_variable_set(:@header, 'content-type' => %w[text/html]) page = Mechanize::Page.new uri, @res, body, 200, @mech @agent.response_cookies @res, uri, page assert_equal ['a=b domain=.example.com'], @agent.cookie_jar.cookies(uri).map { |c| c.to_s } end def test_response_follow_meta_refresh uri = URI.parse 'http://example/#id+1' body = <<-BODY <title></title> <meta http-equiv="refresh" content="0"> BODY page = Mechanize::Page.new(uri, nil, body, 200, @mech) @agent.follow_meta_refresh = true @agent.follow_meta_refresh_self = true page = @agent.response_follow_meta_refresh @res, uri, page, 0 assert_equal uri, page.uri end def test_response_follow_meta_refresh_limit uri = URI.parse 'http://example/#id+1' body = <<-BODY <title></title> <meta http-equiv="refresh" content="0"> BODY page = Mechanize::Page.new(uri, nil, body, 200, @mech) @agent.follow_meta_refresh = true @agent.follow_meta_refresh_self = true assert_raises Mechanize::RedirectLimitReachedError do @agent.response_follow_meta_refresh(@res, uri, page, @agent.redirection_limit) end end def test_response_parse body = '<title>hi</title>' @res.instance_variable_set :@header, 'content-type' => %w[text/html] page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal @mech, page.mech end def test_response_parse_content_type_case body = '<title>hi</title>' @res.instance_variable_set(:@header, 'content-type' => %w[text/HTML]) page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal 'text/HTML', page.content_type end def test_response_parse_content_type_encoding body = '<title>hi</title>' @res.instance_variable_set(:@header, 'content-type' => %w[text/html;charset=ISO-8859-1]) page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal @mech, page.mech assert_equal 'ISO-8859-1', page.encoding assert_equal 'ISO-8859-1', page.parser.encoding end def test_response_parse_content_type_encoding_broken_iso_8859_1 body = '<title>hi</title>' @res.instance_variable_set(:@header, 'content-type' => %w[text/html; charset=ISO_8859-1]) page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal 'ISO_8859-1', page.encoding end def test_response_parse_content_type_encoding_broken_utf_8 body = '<title>hi</title>' @res.instance_variable_set(:@header, 'content-type' => %w[text/html; charset=UTF8]) page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal 'UTF8', page.encoding assert_equal 'UTF8', page.parser.encoding end def test_response_parse_content_type_encoding_garbage body = '<title>hi</title>' @res.instance_variable_set(:@header, 'content-type' => %w[text/html; charset=garbage_charset]) page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal @mech, page.mech end def test_response_parse_content_type_encoding_semicolon body = '<title>hi</title>' @res.instance_variable_set(:@header, 'content-type' => %w[text/html;charset=UTF-8;]) page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal 'UTF-8', page.encoding end def test_response_read def @res.read_body() yield 'part' end def @res.content_length() 4 end io = @agent.response_read @res, @req, @uri body = io.read assert_equal 'part', body assert_equal Encoding::BINARY, body.encoding if body.respond_to? :encoding end def test_response_read_content_length_head req = Net::HTTP::Head.new '/' def @res.content_length() end def @res.read_body() end io = @agent.response_read @res, req, @uri assert_equal '', io.read end def test_response_read_content_length_mismatch def @res.content_length() 5 end def @res.read_body() yield 'part' end e = assert_raises EOFError do @agent.response_read @res, @req, @uri end assert_equal 'Content-Length (5) does not match response body length (4)', e.message end def test_response_read_content_length_redirect res = Net::HTTPFound.allocate def res.content_length() 5 end def res.code() 302 end def res.read_body() yield 'part' end res.instance_variable_set :@header, {} io = @agent.response_read res, @req, @uri assert_equal 'part', io.read end def test_response_read_error def @res.read_body() yield 'part' raise Net::HTTP::Persistent::Error end e = assert_raises Mechanize::ResponseReadError do @agent.response_read @res, @req, @uri end assert_equal @res, e.response assert_equal 'part', e.body_io.read assert_kind_of Net::HTTP::Persistent::Error, e.error end def test_response_read_file Tempfile.open 'pi.txt' do |tempfile| tempfile.write "π\n" tempfile.flush tempfile.rewind uri = URI.parse "file://#{tempfile.path}" req = Mechanize::FileRequest.new uri res = Mechanize::FileResponse.new tempfile.path io = @agent.response_read res, req, uri expected = "π\n" expected.force_encoding Encoding::BINARY if expected.respond_to? :encoding body = io.read assert_equal expected, body assert_equal Encoding::BINARY, body.encoding if body.respond_to? :encoding end end def test_response_read_large @agent.max_file_buffer = 10240 def @res.read_body() yield 'a' * 10241 end def @res.content_length() 10241 end io = @agent.response_read @res, @req, @uri assert_kind_of Tempfile, io assert_equal 10241, io.stat.size end def test_response_read_large_chunked @agent.max_file_buffer = 10240 def @res.read_body 11.times do yield 'a' * 1024 end end def @res.content_length() end io = @agent.response_read @res, @req, @uri assert_kind_of Tempfile, io assert_equal 11264, io.stat.size end def test_response_read_no_body req = Net::HTTP::Options.new '/' def @res.content_length() end def @res.read_body() end io = @agent.response_read @res, req, @uri assert_equal '', io.read end def test_response_read_unknown_code res = Net::HTTPUnknownResponse.allocate res.instance_variable_set :@code, 9999 res.instance_variable_set :@header, {} def res.read_body() yield 'part' end e = assert_raises Mechanize::ResponseCodeError do @agent.response_read res, @req, @uri end assert_equal res, e.page end def test_response_redirect @agent.redirect_ok = true referer = page 'http://example/referer' page = fake_page page = @agent.response_redirect({ 'Location' => '/index.html' }, :get, page, 0, referer) assert_equal URI('http://fake.example/index.html'), page.uri assert_equal 'http://example/referer', requests.first['Referer'] end def test_response_redirect_malformed @agent.redirect_ok = true referer = page 'http://example/referer' page = fake_page page = @agent.response_redirect({ 'Location' => '/index.html?q=あ' }, :get, page, 0, referer) assert_equal URI('http://fake.example/index.html?q=%E3%81%82'), page.uri assert_equal 'http://example/referer', requests.first['Referer'] end def test_response_redirect_limit @agent.redirect_ok = true referer = page 'http://example/referer' assert_raises Mechanize::RedirectLimitReachedError do @agent.response_redirect({ 'Location' => '/index.html' }, :get, fake_page, @agent.redirection_limit, referer) end end def test_response_redirect_not_ok @agent.redirect_ok = false page = fake_page page = @agent.response_redirect({ 'Location' => '/other' }, :get, page, 0, page) assert_equal URI('http://fake.example'), page.uri end def test_response_redirect_permanent @agent.redirect_ok = :permanent response = Net::HTTPMovedPermanently.allocate response.instance_variable_set :@header, { 'location' => %w[/index.html] } page = fake_page page = @agent.response_redirect response, :get, page, 0, page assert_equal URI('http://fake.example/index.html'), page.uri end def test_response_redirect_permanent_temporary @agent.redirect_ok = :permanent response = Net::HTTPMovedTemporarily.allocate response.instance_variable_set :@header, { 'location' => %w[/index.html] } page = fake_page page = @agent.response_redirect response, :get, page, 0, page assert_equal URI('http://fake.example/'), page.uri end def test_retry_change_request_equals refute @agent.http.retry_change_requests @agent.retry_change_requests = true assert @agent.http.retry_change_requests end def test_robots_allowed_eh allowed = URI 'http://localhost/index.html' disallowed = URI 'http://localhost/norobots.html' assert @agent.robots_allowed? allowed refute @agent.robots_allowed? disallowed refute @agent.robots_disallowed? allowed assert @agent.robots_disallowed? disallowed end def test_robots_allowed_eh_noindex @agent.robots = true noindex = URI 'http://localhost/noindex.html' assert @agent.robots_allowed? noindex assert_raises Mechanize::RobotsDisallowedError do @agent.fetch noindex end end def test_set_proxy @agent.set_proxy 'www.example.com', 9001, 'joe', 'lol' assert_equal @agent.proxy_uri.host, 'www.example.com' assert_equal @agent.proxy_uri.port, 9001 assert_equal @agent.proxy_uri.user, 'joe' assert_equal @agent.proxy_uri.password, 'lol' end def test_set_proxy_port_string @agent.set_proxy 'www.example.com', '9001', 'joe', 'lol' assert_equal @agent.proxy_uri.host, 'www.example.com' assert_equal @agent.proxy_uri.port, 9001 assert_equal @agent.proxy_uri.user, 'joe' assert_equal @agent.proxy_uri.password, 'lol' end def test_set_proxy_service_name @agent.set_proxy 'www.example.com', 'http', 'joe', 'lol' assert_equal @agent.proxy_uri.host, 'www.example.com' assert_equal @agent.proxy_uri.port, 80 assert_equal @agent.proxy_uri.user, 'joe' assert_equal @agent.proxy_uri.password, 'lol' end def test_set_proxy_service_name_bad e = assert_raises ArgumentError do @agent.set_proxy 'www.example.com', 'nonexistent service', 'joe', 'lol' end assert_equal 'invalid value for port: "nonexistent service"', e.message end def test_ssl in_tmpdir do store = OpenSSL::X509::Store.new @agent.ca_file = '.' @agent.cert_store = store @agent.certificate = ssl_certificate @agent.private_key = ssl_private_key @agent.ssl_version = 'SSLv3' if RUBY_VERSION > '1.9' @agent.verify_callback = proc { |ok, context| } http = @agent.http assert_equal '.', http.ca_file assert_equal store, http.cert_store assert_equal ssl_certificate, http.certificate assert_equal ssl_private_key, http.private_key assert_equal 'SSLv3', http.ssl_version if RUBY_VERSION > '1.9' assert_equal OpenSSL::SSL::VERIFY_PEER, http.verify_mode assert http.verify_callback end end def test_use_tempfile_eh refute @agent.use_tempfile? nil @agent.max_file_buffer = 1 refute @agent.use_tempfile? 0 assert @agent.use_tempfile? 1 @agent.max_file_buffer = nil refute @agent.use_tempfile? 1 end def test_verify_none_equals @agent.verify_mode = OpenSSL::SSL::VERIFY_NONE http = @agent.http assert_equal OpenSSL::SSL::VERIFY_NONE, http.verify_mode end end Add tests for FileResponse#[] which currently has a bug. # coding: utf-8 require 'mechanize/test_case' class TestMechanizeHttpAgent < Mechanize::TestCase def setup super @agent = @mech.agent @uri = URI.parse 'http://example/' @req = Net::HTTP::Get.new '/' @res = Net::HTTPOK.allocate @res.instance_variable_set :@code, 200 @res.instance_variable_set :@header, {} @headers = if RUBY_VERSION > '1.9' then %w[accept user-agent] else %w[accept] end end def auth_realm uri, scheme, type base_uri = uri + '/' realm = Mechanize::HTTP::AuthRealm.new scheme, base_uri, 'r' @agent.authenticate_methods[base_uri][type] << realm realm end def test_auto_io Tempfile.open 'input' do |input_io| input_io.binmode input_io.write '12345' input_io.rewind out_io = @agent.auto_io __name__, 1024, input_io assert_equal '12345', out_io.string assert_equal Encoding::BINARY, out_io.string.encoding if Object.const_defined? :Encoding end end def test_auto_io_chunk Tempfile.open 'input' do |input_io| chunks = [] input_io.binmode input_io.write '12345' input_io.rewind @agent.auto_io __name__, 1, input_io do |chunk| chunks << chunk end assert_equal %w[1 2 3 4 5], chunks end end def test_auto_io_tempfile @agent.max_file_buffer = 3 Tempfile.open 'input' do |input_io| input_io.binmode input_io.write '12345' input_io.rewind out_io = @agent.auto_io __name__, 1, input_io result = out_io.read assert_equal '12345', result assert_equal Encoding::BINARY, result.encoding if Object.const_defined? :Encoding end end def test_auto_io_yield Tempfile.open 'input' do |input_io| input_io.binmode input_io.write '12345' input_io.rewind out_io = @agent.auto_io __name__, 1024, input_io do |chunk| "x#{chunk}" end assert_equal 'x12345', out_io.string end end def test_certificate_equals cert_path = File.expand_path '../data/server.crt', __FILE__ cert = OpenSSL::X509::Certificate.new File.read cert_path @agent.certificate = cert assert_equal cert.to_pem, @agent.certificate.to_pem end def test_certificate_equals_file cert_path = File.expand_path '../data/server.crt', __FILE__ cert = OpenSSL::X509::Certificate.new File.read cert_path @agent.certificate = cert_path assert_equal cert.to_pem, @agent.certificate.to_pem end def test_connection_for_file uri = URI.parse 'file:///nonexistent' conn = @agent.connection_for uri assert_equal Mechanize::FileConnection.new, conn end def test_connection_for_http conn = @agent.connection_for @uri assert_equal @agent.http, conn end def test_disable_keep_alive @agent.disable_keep_alive @req refute @req['connection'] end def test_disable_keep_alive_no @agent.keep_alive = false @agent.disable_keep_alive @req assert_equal 'close', @req['connection'] end def test_enable_gzip @agent.enable_gzip @req assert_equal 'gzip,deflate,identity', @req['accept-encoding'] end def test_enable_gzip_no @agent.gzip_enabled = false @agent.enable_gzip @req assert_equal 'identity', @req['accept-encoding'] end def test_fetch_file_nonexistent in_tmpdir do nonexistent = File.join Dir.pwd, 'nonexistent' uri = URI.parse "file://#{nonexistent}" e = assert_raises Mechanize::ResponseCodeError do @agent.fetch uri end assert_equal '404 => Net::HTTPNotFound', e.message end end def test_fetch_file_plus Tempfile.open '++plus++' do |io| content = 'plusses +++' io.write content io.rewind uri = URI.parse "file://#{Mechanize::Util.uri_escape io.path}" page = @agent.fetch uri assert_equal content, page.body assert_kind_of Mechanize::File, page end end def test_fetch_file_space foo = File.expand_path("../htdocs/dir with spaces/foo.html", __FILE__) uri = URI.parse "file://#{Mechanize::Util.uri_escape foo}" page = @agent.fetch uri assert_equal File.read(foo), page.body assert_kind_of Mechanize::Page, page end def test_fetch_head_gzip uri = @uri + '/gzip?file=index.html' page = @agent.fetch uri, :head assert_kind_of Mechanize::Page, page end def test_fetch_hooks @agent.pre_connect_hooks << proc do |agent, request| assert_equal '/index.html', request.path assert_equal @agent, agent end @agent.post_connect_hooks << proc do |agent, uri, response, body| assert_equal @agent, agent assert_equal URI('http://example/index.html'), uri assert_equal '200', response.code assert_kind_of String, body end @agent.fetch URI 'http://example/index.html' end def test_fetch_post_connect_hook response = nil @agent.post_connect_hooks << lambda { |_, _, res, _| response = res } @agent.fetch 'http://localhost/' assert response end def test_fetch_server_error e = assert_raises Mechanize::ResponseCodeError do @mech.get 'http://localhost/response_code?code=500' end assert_equal '500', e.response_code end def test_get_meta_refresh_header_follow_self @agent.follow_meta_refresh = true @agent.follow_meta_refresh_self = true page = Mechanize::Page.new(@uri, nil, '', 200, @mech) @res.instance_variable_set :@header, 'refresh' => ['0'] refresh = @agent.get_meta_refresh @res, @uri, page assert_equal [0.0, URI('http://example/')], refresh end def test_get_meta_refresh_header_no_follow page = Mechanize::Page.new(@uri, nil, '', 200, @mech) @res.instance_variable_set :@header, 'refresh' => ['0'] refresh = @agent.get_meta_refresh @res, @uri, page assert_nil refresh end def test_get_meta_refresh_header_no_follow_self @agent.follow_meta_refresh = true page = Mechanize::Page.new(@uri, nil, '', 200, @mech) @res.instance_variable_set :@header, 'refresh' => ['0'] refresh = @agent.get_meta_refresh @res, @uri, page assert_nil refresh end def test_get_meta_refresh_meta_follow_self @agent.follow_meta_refresh = true @agent.follow_meta_refresh_self = true body = <<-BODY <title></title> <meta http-equiv="refresh" content="0"> BODY page = Mechanize::Page.new(@uri, nil, body, 200, @mech) refresh = @agent.get_meta_refresh @res, @uri, page assert_equal [0, nil], refresh end def test_get_meta_refresh_meta_no_follow body = <<-BODY <title></title> <meta http-equiv="refresh" content="0"> BODY page = Mechanize::Page.new(@uri, nil, body, 200, @mech) refresh = @agent.get_meta_refresh @res, @uri, page assert_nil refresh end def test_get_meta_refresh_meta_no_follow_self @agent.follow_meta_refresh = true body = <<-BODY <title></title> <meta http-equiv="refresh" content="0"> BODY page = Mechanize::Page.new(@uri, nil, body, 200, @mech) refresh = @agent.get_meta_refresh @res, @uri, page assert_nil refresh end def test_get_robots robotstxt = @agent.get_robots 'http://localhost/robots.txt' refute_equal '', robotstxt robotstxt = @agent.get_robots 'http://localhost/response_code?code=404' assert_equal '', robotstxt end def test_hook_content_encoding_response @mech.content_encoding_hooks << lambda{|agent, uri, response, response_body_io| response['content-encoding'] = 'gzip' if response['content-encoding'] == 'agzip'} @res.instance_variable_set :@header, 'content-encoding' => %w[agzip] body_io = StringIO.new 'part' @agent.hook_content_encoding @res, @uri, body_io assert_equal 'gzip', @res['content-encoding'] end def test_http_request_file uri = URI.parse 'file:///nonexistent' request = @agent.http_request uri, :get assert_kind_of Mechanize::FileRequest, request assert_equal '/nonexistent', request.path end def test_http_request_get request = @agent.http_request @uri, :get assert_kind_of Net::HTTP::Get, request assert_equal '/', request.path end def test_http_request_post request = @agent.http_request @uri, :post assert_kind_of Net::HTTP::Post, request assert_equal '/', request.path end def test_idle_timeout_equals @agent.idle_timeout = 1 assert_equal 1, @agent.http.idle_timeout end def test_inflate body_io = StringIO.new "x\x9C+H,*\x01\x00\x04?\x01\xB8" result = @agent.inflate body_io assert_equal 'part', result.read end def test_post_connect @agent.post_connect_hooks << proc { |agent, uri, response, body| assert_equal @agent, agent assert_equal @res, response assert_equal 'body', body throw :called } io = StringIO.new 'body' assert_throws :called do @agent.post_connect @uri, @res, io end assert_equal 0, io.pos end def test_pre_connect @agent.pre_connect_hooks << proc { |agent, request| assert_equal @agent, agent assert_equal @req, request throw :called } assert_throws :called do @agent.pre_connect @req end end def test_request_add_headers @agent.request_add_headers @req, 'Content-Length' => 300 assert_equal '300', @req['content-length'] end def test_request_add_headers_etag @agent.request_add_headers @req, :etag => '300' assert_equal '300', @req['etag'] end def test_request_add_headers_if_modified_since @agent.request_add_headers @req, :if_modified_since => 'some_date' assert_equal 'some_date', @req['if-modified-since'] end def test_request_add_headers_none @agent.request_add_headers @req assert_equal @headers, @req.to_hash.keys.sort end def test_request_add_headers_request_headers @agent.request_headers['X-Foo'] = 'bar' @agent.request_add_headers @req assert_equal @headers + %w[x-foo], @req.to_hash.keys.sort end def test_request_add_headers_symbol e = assert_raises ArgumentError do @agent.request_add_headers @req, :content_length => 300 end assert_equal 'unknown header symbol content_length', e.message end def test_request_auth_basic @agent.user = 'user' @agent.password = 'password' auth_realm @uri, 'Basic', :basic @agent.request_auth @req, @uri assert_match %r%^Basic %, @req['Authorization'] end def test_request_auth_digest @agent.user = 'user' @agent.password = 'password' realm = auth_realm @uri, 'Digest', :digest @agent.digest_challenges[realm] = 'Digest realm=r, qop="auth"' @agent.request_auth @req, @uri assert_match %r%^Digest %, @req['Authorization'] assert_match %r%qop=auth%, @req['Authorization'] end def test_request_auth_iis_digest @agent.user = 'user' @agent.password = 'password' realm = auth_realm @uri, 'Digest', :digest @agent.digest_challenges[realm] = 'Digest realm=r, qop="auth"' @agent.request_auth @req, @uri assert_match %r%^Digest %, @req['Authorization'] assert_match %r%qop=auth%, @req['Authorization'] end def test_request_auth_none @agent.request_auth @req, @uri assert_nil @req['Authorization'] end def test_request_cookies uri = URI.parse 'http://host.example.com' Mechanize::Cookie.parse uri, 'hello=world domain=.example.com' do |cookie| @agent.cookie_jar.add uri, cookie end @agent.request_cookies @req, uri assert_equal 'hello=world domain=.example.com', @req['Cookie'] end def test_request_cookies_many uri = URI.parse 'http://host.example.com' cookie_str = 'a=b domain=.example.com, c=d domain=.example.com' Mechanize::Cookie.parse uri, cookie_str do |cookie| @agent.cookie_jar.add uri, cookie end @agent.request_cookies @req, uri expected = cookie_str.sub ', ', '; ' assert_equal expected, @req['Cookie'] end def test_request_cookies_none @agent.request_cookies @req, @uri assert_nil @req['Cookie'] end def test_request_cookies_wrong_domain uri = URI.parse 'http://host.example.com' Mechanize::Cookie.parse uri, 'hello=world domain=.example.com' do |cookie| @agent.cookie_jar.add uri, cookie end @agent.request_cookies @req, @uri assert_nil @req['Cookie'] end def test_request_host @agent.request_host @req, @uri assert_equal 'example', @req['host'] end def test_request_host_nonstandard @uri.port = 81 @agent.request_host @req, @uri assert_equal 'example:81', @req['host'] end def test_request_language_charset @agent.request_language_charset @req assert_equal 'en-us,en;q=0.5', @req['accept-language'] assert_equal 'ISO-8859-1,utf-8;q=0.7,*;q=0.7', @req['accept-charset'] end def test_request_referer referer = URI.parse 'http://old.example' @agent.request_referer @req, @uri, referer assert_equal 'http://old.example', @req['referer'] end def test_request_referer_https uri = URI.parse 'https://example' referer = URI.parse 'https://old.example' @agent.request_referer @req, uri, referer assert_equal 'https://old.example', @req['referer'] end def test_request_referer_https_downgrade referer = URI.parse 'https://old.example' @agent.request_referer @req, @uri, referer assert_nil @req['referer'] end def test_request_referer_https_downgrade_case uri = URI.parse 'http://example' referer = URI.parse 'httpS://old.example' @agent.request_referer @req, uri, referer assert_nil @req['referer'] end def test_request_referer_https_upgrade uri = URI.parse 'https://example' referer = URI.parse 'http://old.example' @agent.request_referer @req, uri, referer assert_equal 'http://old.example', @req['referer'] end def test_request_referer_none @agent.request_referer @req, @uri, nil assert_nil @req['referer'] end def test_request_referer_strip uri = URI.parse 'http://example.com/index.html' host_path = "old.example/page.html?q=x" referer = "http://#{host_path}" [ "", "@", "user1@", ":@", "user1:@", ":password1@", "user1:password1@", ].each { |userinfo| ['', '#frag'].each { |frag| url = URI.parse "http://#{userinfo}#{host_path}#{frag}" @agent.request_referer @req, uri, url assert_equal referer, @req['referer'], url } } end def test_request_user_agent @agent.request_user_agent @req assert_match %r%^Mechanize/#{Mechanize::VERSION}%, @req['user-agent'] ruby_version = if RUBY_PATCHLEVEL >= 0 then "#{RUBY_VERSION}p#{RUBY_PATCHLEVEL}" else "#{RUBY_VERSION}dev#{RUBY_REVISION}" end assert_match %r%Ruby/#{ruby_version}%, @req['user-agent'] end def test_resolve_bad_uri e = assert_raises ArgumentError do @agent.resolve 'google' end assert_equal 'absolute URL needed (not google)', e.message end def test_resolve_utf8 uri = 'http://example?q=ü' resolved = @agent.resolve uri assert_equal '/?q=%C3%BC', resolved.request_uri end def test_resolve_parameters_body input_params = { :q => 'hello' } uri, params = @agent.resolve_parameters @uri, :post, input_params assert_equal 'http://example/', uri.to_s assert_equal input_params, params end def test_resolve_parameters_query uri, params = @agent.resolve_parameters @uri, :get, :q => 'hello' assert_equal 'http://example/?q=hello', uri.to_s assert_nil params end def test_resolve_parameters_query_append input_params = { :q => 'hello' } @uri.query = 'a=b' uri, params = @agent.resolve_parameters @uri, :get, input_params assert_equal 'http://example/?a=b&q=hello', uri.to_s assert_nil params end def test_response_authenticate @res.instance_variable_set :@header, 'www-authenticate' => ['Basic realm=r'] @agent.user = 'user' @agent.password = 'password' @agent.response_authenticate @res, nil, @uri, @req, {}, nil, nil base_uri = @uri + '/' realm = Mechanize::HTTP::AuthRealm.new 'Basic', base_uri, 'r' assert_equal [realm], @agent.authenticate_methods[base_uri][:basic] end def test_response_authenticate_digest @res.instance_variable_set(:@header, 'www-authenticate' => ['Digest realm=r']) @agent.user = 'user' @agent.password = 'password' @agent.response_authenticate @res, nil, @uri, @req, {}, nil, nil base_uri = @uri + '/' realm = Mechanize::HTTP::AuthRealm.new 'Digest', base_uri, 'r' assert_equal [realm], @agent.authenticate_methods[base_uri][:digest] challenge = Mechanize::HTTP::AuthChallenge.new 'Digest', 'realm' => 'r' assert_equal challenge, @agent.digest_challenges[realm] end def test_response_authenticate_digest_iis @res.instance_variable_set(:@header, 'www-authenticate' => ['Digest realm=r'], 'server' => ['Microsoft-IIS']) @agent.user = 'user' @agent.password = 'password' @agent.response_authenticate @res, nil, @uri, @req, {}, nil, nil base_uri = @uri + '/' realm = Mechanize::HTTP::AuthRealm.new 'Digest', base_uri, 'r' assert_equal [realm], @agent.authenticate_methods[base_uri][:iis_digest] end def test_response_authenticate_multiple @res.instance_variable_set(:@header, 'www-authenticate' => ['Basic realm=r, Digest realm=r']) @agent.user = 'user' @agent.password = 'password' @agent.response_authenticate @res, nil, @uri, @req, {}, nil, nil base_uri = @uri + '/' realm = Mechanize::HTTP::AuthRealm.new 'Digest', base_uri, 'r' assert_equal [realm], @agent.authenticate_methods[base_uri][:digest] assert_empty @agent.authenticate_methods[base_uri][:basic] end def test_response_authenticate_no_www_authenticate denied = page URI('http://example/denied'), 'text/html', '', 403 @agent.user = 'user' @agent.password = 'password' e = assert_raises Mechanize::UnauthorizedError do @agent.response_authenticate @res, denied, @uri, @req, {}, nil, nil end assert_equal '403 => Net::HTTPForbidden', e.message end def test_response_authenticate_ntlm @uri += '/ntlm' @res.instance_variable_set(:@header, 'www-authenticate' => ['Negotiate, NTLM']) @agent.user = 'user' @agent.password = 'password' @agent.domain = 'domain' page = @agent.response_authenticate @res, nil, @uri, @req, {}, nil, nil assert_equal 'ok', page.body # lame test end def test_response_authenticate_unknown @agent.user = 'user' @agent.password = 'password' page = Mechanize::File.new nil, nil, nil, 401 @res.instance_variable_set(:@header, 'www-authenticate' => ['Unknown realm=r']) assert_raises Mechanize::UnauthorizedError do @agent.response_authenticate @res, page, @uri, @req, nil, nil, nil end end def test_response_content_encoding_7_bit @res.instance_variable_set :@header, 'content-encoding' => %w[7bit] body = @agent.response_content_encoding @res, StringIO.new('part') assert_equal 'part', body.read end def test_response_content_encoding_deflate @res.instance_variable_set :@header, 'content-encoding' => %w[deflate] body_io = StringIO.new "x\x9C+H,*\x01\x00\x04?\x01\xB8" body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read assert body_io.closed? end def test_response_content_encoding_deflate_chunked @res.instance_variable_set :@header, 'content-encoding' => %w[deflate] body_io = StringIO.new "x\x9C+H,*\x01\x00\x04?\x01\xB8" body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read end def test_response_content_encoding_deflate_corrupt @res.instance_variable_set :@header, 'content-encoding' => %w[deflate] body_io = StringIO.new "x\x9C+H,*\x01\x00\x04?\x01" # missing 1 byte e = assert_raises Mechanize::Error do @agent.response_content_encoding @res, body_io end assert_match %r%error handling content-encoding deflate:%, e.message assert_match %r%Zlib%, e.message assert body_io.closed? end def test_response_content_encoding_deflate_empty @res.instance_variable_set :@header, 'content-encoding' => %w[deflate] body = @agent.response_content_encoding @res, StringIO.new assert_equal '', body.read end # IIS/6.0 ASP.NET/2.0.50727 does not wrap deflate with zlib, WTF? def test_response_content_encoding_deflate_no_zlib @res.instance_variable_set :@header, 'content-encoding' => %w[deflate] body = @agent.response_content_encoding @res, StringIO.new("+H,*\001\000") assert_equal 'part', body.read end def test_response_content_encoding_gzip @res.instance_variable_set :@header, 'content-encoding' => %w[gzip] body_io = StringIO.new \ "\037\213\b\0002\002\225M\000\003+H,*\001\000\306p\017I\004\000\000\000" body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read assert body_io.closed? end def test_response_content_encoding_gzip_chunked def @res.content_length() nil end @res.instance_variable_set :@header, 'content-encoding' => %w[gzip] body_io = StringIO.new \ "\037\213\b\0002\002\225M\000\003+H,*\001\000\306p\017I\004\000\000\000" body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read end def test_response_content_encoding_gzip_corrupt log = StringIO.new logger = Logger.new log @agent.context.log = logger @res.instance_variable_set :@header, 'content-encoding' => %w[gzip] body_io = StringIO.new \ "\037\213\b\0002\002\225M\000\003+H,*\001" e = assert_raises Mechanize::Error do @agent.response_content_encoding @res, body_io end assert_match %r%error handling content-encoding gzip:%, e.message assert_match %r%Zlib%, e.message assert_match %r%unable to gunzip response, trying raw inflate%, log.string assert_match %r%unable to gunzip response:%, log.string assert body_io.closed? end def test_response_content_encoding_gzip_corrupt_checksum log = StringIO.new logger = Logger.new log @agent.context.log = logger @res.instance_variable_set :@header, 'content-encoding' => %w[gzip] body_io = StringIO.new \ "\037\213\b\0002\002\225M\000\003+H,*\001\000\306p\017I\004\000\000" e = assert_raises Mechanize::Error do @agent.response_content_encoding @res, body_io end assert_match %r%error handling content-encoding gzip:%, e.message assert_match %r%Zlib%, e.message assert_match %r%unable to gunzip response, trying raw inflate%, log.string end def test_response_content_encoding_gzip_empty @res.instance_variable_set :@header, 'content-encoding' => %w[gzip] body = @agent.response_content_encoding @res, StringIO.new assert_equal '', body.read end def test_response_content_encoding_gzip_encoding_bad @res.instance_variable_set(:@header, 'content-encoding' => %w[gzip], 'content-type' => 'text/html; charset=UTF-8') # "test\xB2" body_io = StringIO.new \ "\037\213\b\000*+\314N\000\003+I-.\331\004\000x\016\003\376\005\000\000\000" body = @agent.response_content_encoding @res, body_io expected = "test\xB2" expected.force_encoding Encoding::BINARY if have_encoding? content = body.read assert_equal expected, content assert_equal Encoding::BINARY, content.encoding if have_encoding? end def test_response_content_encoding_none @res.instance_variable_set :@header, 'content-encoding' => %w[none] body = @agent.response_content_encoding @res, StringIO.new('part') assert_equal 'part', body.read end def test_response_content_encoding_tempfile_7_bit body_io = tempfile 'part' @res.instance_variable_set :@header, 'content-encoding' => %w[7bit] body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read refute body_io.closed? ensure begin body_io.close! unless body_io.closed? rescue IOError # HACK for ruby 1.8 end end def test_response_content_encoding_tempfile_gzip body_io = tempfile "x\x9C+H,*\x01\x00\x04?\x01\xB8" @res.instance_variable_set :@header, 'content-encoding' => %w[deflate] body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read assert body_io.closed? ensure body_io.close! unless body_io.closed? end def test_response_content_encoding_unknown @res.instance_variable_set :@header, 'content-encoding' => %w[unknown] body = StringIO.new 'part' e = assert_raises Mechanize::Error do @agent.response_content_encoding @res, body end assert_equal 'unsupported content-encoding: unknown', e.message end def test_response_content_encoding_x_gzip @res.instance_variable_set :@header, 'content-encoding' => %w[x-gzip] body_io = StringIO.new \ "\037\213\b\0002\002\225M\000\003+H,*\001\000\306p\017I\004\000\000\000" body = @agent.response_content_encoding @res, body_io assert_equal 'part', body.read end def test_response_cookies uri = URI.parse 'http://host.example.com' cookie_str = 'a=b domain=.example.com' @res.instance_variable_set(:@header, 'set-cookie' => [cookie_str], 'content-type' => %w[text/html]) page = Mechanize::Page.new uri, @res, '', 200, @mech @agent.response_cookies @res, uri, page assert_equal ['a=b domain=.example.com'], @agent.cookie_jar.cookies(uri).map { |c| c.to_s } end def test_response_cookies_many uri = URI.parse 'http://host.example.com' cookie1 = 'a=b domain=.example.com' cookie2 = 'c=d domain=.example.com' @res.instance_variable_set(:@header, 'set-cookie' => [cookie1, cookie2], 'content-type' => %w[text/html]) page = Mechanize::Page.new uri, @res, '', 200, @mech @agent.response_cookies @res, uri, page assert_equal ['a=b domain=.example.com', 'c=d domain=.example.com'], @agent.cookie_jar.cookies(uri).map { |c| c.to_s } end def test_response_cookies_meta uri = URI.parse 'http://host.example.com' cookie_str = 'a=b domain=.example.com' body = <<-BODY <head> <meta http-equiv="Set-Cookie" content="#{cookie_str}"> </head>" BODY @res.instance_variable_set(:@header, 'content-type' => %w[text/html]) page = Mechanize::Page.new uri, @res, body, 200, @mech @agent.response_cookies @res, uri, page assert_equal ['a=b domain=.example.com'], @agent.cookie_jar.cookies(uri).map { |c| c.to_s } end def test_response_follow_meta_refresh uri = URI.parse 'http://example/#id+1' body = <<-BODY <title></title> <meta http-equiv="refresh" content="0"> BODY page = Mechanize::Page.new(uri, nil, body, 200, @mech) @agent.follow_meta_refresh = true @agent.follow_meta_refresh_self = true page = @agent.response_follow_meta_refresh @res, uri, page, 0 assert_equal uri, page.uri end def test_response_follow_meta_refresh_limit uri = URI.parse 'http://example/#id+1' body = <<-BODY <title></title> <meta http-equiv="refresh" content="0"> BODY page = Mechanize::Page.new(uri, nil, body, 200, @mech) @agent.follow_meta_refresh = true @agent.follow_meta_refresh_self = true assert_raises Mechanize::RedirectLimitReachedError do @agent.response_follow_meta_refresh(@res, uri, page, @agent.redirection_limit) end end def test_response_parse body = '<title>hi</title>' @res.instance_variable_set :@header, 'content-type' => %w[text/html] page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal @mech, page.mech end def test_response_parse_content_type_case body = '<title>hi</title>' @res.instance_variable_set(:@header, 'content-type' => %w[text/HTML]) page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal 'text/HTML', page.content_type end def test_response_parse_content_type_encoding body = '<title>hi</title>' @res.instance_variable_set(:@header, 'content-type' => %w[text/html;charset=ISO-8859-1]) page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal @mech, page.mech assert_equal 'ISO-8859-1', page.encoding assert_equal 'ISO-8859-1', page.parser.encoding end def test_response_parse_content_type_encoding_broken_iso_8859_1 body = '<title>hi</title>' @res.instance_variable_set(:@header, 'content-type' => %w[text/html; charset=ISO_8859-1]) page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal 'ISO_8859-1', page.encoding end def test_response_parse_content_type_encoding_broken_utf_8 body = '<title>hi</title>' @res.instance_variable_set(:@header, 'content-type' => %w[text/html; charset=UTF8]) page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal 'UTF8', page.encoding assert_equal 'UTF8', page.parser.encoding end def test_response_parse_content_type_encoding_garbage body = '<title>hi</title>' @res.instance_variable_set(:@header, 'content-type' => %w[text/html; charset=garbage_charset]) page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal @mech, page.mech end def test_response_parse_content_type_encoding_semicolon body = '<title>hi</title>' @res.instance_variable_set(:@header, 'content-type' => %w[text/html;charset=UTF-8;]) page = @agent.response_parse @res, body, @uri assert_instance_of Mechanize::Page, page assert_equal 'UTF-8', page.encoding end def test_response_read def @res.read_body() yield 'part' end def @res.content_length() 4 end io = @agent.response_read @res, @req, @uri body = io.read assert_equal 'part', body assert_equal Encoding::BINARY, body.encoding if body.respond_to? :encoding end def test_response_read_content_length_head req = Net::HTTP::Head.new '/' def @res.content_length() end def @res.read_body() end io = @agent.response_read @res, req, @uri assert_equal '', io.read end def test_response_read_content_length_mismatch def @res.content_length() 5 end def @res.read_body() yield 'part' end e = assert_raises EOFError do @agent.response_read @res, @req, @uri end assert_equal 'Content-Length (5) does not match response body length (4)', e.message end def test_response_read_content_length_redirect res = Net::HTTPFound.allocate def res.content_length() 5 end def res.code() 302 end def res.read_body() yield 'part' end res.instance_variable_set :@header, {} io = @agent.response_read res, @req, @uri assert_equal 'part', io.read end def test_response_read_error def @res.read_body() yield 'part' raise Net::HTTP::Persistent::Error end e = assert_raises Mechanize::ResponseReadError do @agent.response_read @res, @req, @uri end assert_equal @res, e.response assert_equal 'part', e.body_io.read assert_kind_of Net::HTTP::Persistent::Error, e.error end def test_response_read_file Tempfile.open 'pi.txt' do |tempfile| tempfile.write "π\n" tempfile.flush tempfile.rewind uri = URI.parse "file://#{tempfile.path}" req = Mechanize::FileRequest.new uri res = Mechanize::FileResponse.new tempfile.path io = @agent.response_read res, req, uri expected = "π\n" expected.force_encoding Encoding::BINARY if expected.respond_to? :encoding body = io.read assert_equal expected, body assert_equal Encoding::BINARY, body.encoding if body.respond_to? :encoding end end def test_file_response_content_type Tempfile.open ['pi','.nothtml'] do |tempfile| res = Mechanize::FileResponse.new tempfile.path assert_equal nil, res['content-type'] end Tempfile.open ['pi','.xhtml'] do |tempfile| res = Mechanize::FileResponse.new tempfile.path assert_equal 'text/html', res['content-type'] end Tempfile.open ['pi','.html'] do |tempfile| res = Mechanize::FileResponse.new tempfile.path assert_equal 'text/html', res['Content-Type'] end end def test_response_read_large @agent.max_file_buffer = 10240 def @res.read_body() yield 'a' * 10241 end def @res.content_length() 10241 end io = @agent.response_read @res, @req, @uri assert_kind_of Tempfile, io assert_equal 10241, io.stat.size end def test_response_read_large_chunked @agent.max_file_buffer = 10240 def @res.read_body 11.times do yield 'a' * 1024 end end def @res.content_length() end io = @agent.response_read @res, @req, @uri assert_kind_of Tempfile, io assert_equal 11264, io.stat.size end def test_response_read_no_body req = Net::HTTP::Options.new '/' def @res.content_length() end def @res.read_body() end io = @agent.response_read @res, req, @uri assert_equal '', io.read end def test_response_read_unknown_code res = Net::HTTPUnknownResponse.allocate res.instance_variable_set :@code, 9999 res.instance_variable_set :@header, {} def res.read_body() yield 'part' end e = assert_raises Mechanize::ResponseCodeError do @agent.response_read res, @req, @uri end assert_equal res, e.page end def test_response_redirect @agent.redirect_ok = true referer = page 'http://example/referer' page = fake_page page = @agent.response_redirect({ 'Location' => '/index.html' }, :get, page, 0, referer) assert_equal URI('http://fake.example/index.html'), page.uri assert_equal 'http://example/referer', requests.first['Referer'] end def test_response_redirect_malformed @agent.redirect_ok = true referer = page 'http://example/referer' page = fake_page page = @agent.response_redirect({ 'Location' => '/index.html?q=あ' }, :get, page, 0, referer) assert_equal URI('http://fake.example/index.html?q=%E3%81%82'), page.uri assert_equal 'http://example/referer', requests.first['Referer'] end def test_response_redirect_limit @agent.redirect_ok = true referer = page 'http://example/referer' assert_raises Mechanize::RedirectLimitReachedError do @agent.response_redirect({ 'Location' => '/index.html' }, :get, fake_page, @agent.redirection_limit, referer) end end def test_response_redirect_not_ok @agent.redirect_ok = false page = fake_page page = @agent.response_redirect({ 'Location' => '/other' }, :get, page, 0, page) assert_equal URI('http://fake.example'), page.uri end def test_response_redirect_permanent @agent.redirect_ok = :permanent response = Net::HTTPMovedPermanently.allocate response.instance_variable_set :@header, { 'location' => %w[/index.html] } page = fake_page page = @agent.response_redirect response, :get, page, 0, page assert_equal URI('http://fake.example/index.html'), page.uri end def test_response_redirect_permanent_temporary @agent.redirect_ok = :permanent response = Net::HTTPMovedTemporarily.allocate response.instance_variable_set :@header, { 'location' => %w[/index.html] } page = fake_page page = @agent.response_redirect response, :get, page, 0, page assert_equal URI('http://fake.example/'), page.uri end def test_retry_change_request_equals refute @agent.http.retry_change_requests @agent.retry_change_requests = true assert @agent.http.retry_change_requests end def test_robots_allowed_eh allowed = URI 'http://localhost/index.html' disallowed = URI 'http://localhost/norobots.html' assert @agent.robots_allowed? allowed refute @agent.robots_allowed? disallowed refute @agent.robots_disallowed? allowed assert @agent.robots_disallowed? disallowed end def test_robots_allowed_eh_noindex @agent.robots = true noindex = URI 'http://localhost/noindex.html' assert @agent.robots_allowed? noindex assert_raises Mechanize::RobotsDisallowedError do @agent.fetch noindex end end def test_set_proxy @agent.set_proxy 'www.example.com', 9001, 'joe', 'lol' assert_equal @agent.proxy_uri.host, 'www.example.com' assert_equal @agent.proxy_uri.port, 9001 assert_equal @agent.proxy_uri.user, 'joe' assert_equal @agent.proxy_uri.password, 'lol' end def test_set_proxy_port_string @agent.set_proxy 'www.example.com', '9001', 'joe', 'lol' assert_equal @agent.proxy_uri.host, 'www.example.com' assert_equal @agent.proxy_uri.port, 9001 assert_equal @agent.proxy_uri.user, 'joe' assert_equal @agent.proxy_uri.password, 'lol' end def test_set_proxy_service_name @agent.set_proxy 'www.example.com', 'http', 'joe', 'lol' assert_equal @agent.proxy_uri.host, 'www.example.com' assert_equal @agent.proxy_uri.port, 80 assert_equal @agent.proxy_uri.user, 'joe' assert_equal @agent.proxy_uri.password, 'lol' end def test_set_proxy_service_name_bad e = assert_raises ArgumentError do @agent.set_proxy 'www.example.com', 'nonexistent service', 'joe', 'lol' end assert_equal 'invalid value for port: "nonexistent service"', e.message end def test_ssl in_tmpdir do store = OpenSSL::X509::Store.new @agent.ca_file = '.' @agent.cert_store = store @agent.certificate = ssl_certificate @agent.private_key = ssl_private_key @agent.ssl_version = 'SSLv3' if RUBY_VERSION > '1.9' @agent.verify_callback = proc { |ok, context| } http = @agent.http assert_equal '.', http.ca_file assert_equal store, http.cert_store assert_equal ssl_certificate, http.certificate assert_equal ssl_private_key, http.private_key assert_equal 'SSLv3', http.ssl_version if RUBY_VERSION > '1.9' assert_equal OpenSSL::SSL::VERIFY_PEER, http.verify_mode assert http.verify_callback end end def test_use_tempfile_eh refute @agent.use_tempfile? nil @agent.max_file_buffer = 1 refute @agent.use_tempfile? 0 assert @agent.use_tempfile? 1 @agent.max_file_buffer = nil refute @agent.use_tempfile? 1 end def test_verify_none_equals @agent.verify_mode = OpenSSL::SSL::VERIFY_NONE http = @agent.http assert_equal OpenSSL::SSL::VERIFY_NONE, http.verify_mode end end
class Rbenv < Formula desc "Ruby version manager" homepage "https://github.com/rbenv/rbenv#readme" url "https://github.com/rbenv/rbenv/archive/v1.1.2.tar.gz" sha256 "80ad89ffe04c0b481503bd375f05c212bbc7d44ef5f5e649e0acdf25eba86736" license "MIT" head "https://github.com/rbenv/rbenv.git" bottle do cellar :any sha256 "60b045c8843745c45d01616ee3f71b91f6a16ee09c47e23a7817a3edabeaccfd" => :big_sur sha256 "19d0b9e3b11bcacdf692e78248c1b5764f7d3f4b58f2b83ad7b39562863ba82e" => :arm64_big_sur sha256 "503ed6d818502f00f031b9f49461934e252b9bfba2876e90a326fc27bb1052d6" => :catalina sha256 "d1019098dee8d037587069398e5ad04e6d736f834dc44ae73943bec46b10b260" => :mojave sha256 "b5984102794a9d39388ca1f6ec77965aeea29b971cc00cb5af8ede8ee6c926d6" => :high_sierra sha256 "873175a851e5aa4f5b3438072030b945c252f08a9a07760c64dc045e2cce4724" => :sierra end depends_on "ruby-build" uses_from_macos "ruby" => :test def install inreplace "libexec/rbenv" do |s| s.gsub! '"${BASH_SOURCE%/*}"/../libexec', libexec s.gsub! ":/usr/local/etc/rbenv.d", ":#{HOMEBREW_PREFIX}/etc/rbenv.d\\0" if HOMEBREW_PREFIX.to_s != "/usr/local" end # Compile optional bash extension. system "src/configure" system "make", "-C", "src" if build.head? # Record exact git revision for `rbenv --version` output git_revision = `git rev-parse --short HEAD`.chomp inreplace "libexec/rbenv---version", /^(version=)"([^"]+)"/, %Q(\\1"\\2-g#{git_revision}") end prefix.install ["bin", "completions", "libexec", "rbenv.d"] end test do shell_output("eval \"$(#{bin}/rbenv init -)\" && rbenv versions") end end rbenv: use `Utils#git_short_head` (#68810) class Rbenv < Formula desc "Ruby version manager" homepage "https://github.com/rbenv/rbenv#readme" url "https://github.com/rbenv/rbenv/archive/v1.1.2.tar.gz" sha256 "80ad89ffe04c0b481503bd375f05c212bbc7d44ef5f5e649e0acdf25eba86736" license "MIT" head "https://github.com/rbenv/rbenv.git" bottle do cellar :any sha256 "60b045c8843745c45d01616ee3f71b91f6a16ee09c47e23a7817a3edabeaccfd" => :big_sur sha256 "19d0b9e3b11bcacdf692e78248c1b5764f7d3f4b58f2b83ad7b39562863ba82e" => :arm64_big_sur sha256 "503ed6d818502f00f031b9f49461934e252b9bfba2876e90a326fc27bb1052d6" => :catalina sha256 "d1019098dee8d037587069398e5ad04e6d736f834dc44ae73943bec46b10b260" => :mojave sha256 "b5984102794a9d39388ca1f6ec77965aeea29b971cc00cb5af8ede8ee6c926d6" => :high_sierra sha256 "873175a851e5aa4f5b3438072030b945c252f08a9a07760c64dc045e2cce4724" => :sierra end depends_on "ruby-build" uses_from_macos "ruby" => :test def install inreplace "libexec/rbenv" do |s| s.gsub! '"${BASH_SOURCE%/*}"/../libexec', libexec s.gsub! ":/usr/local/etc/rbenv.d", ":#{HOMEBREW_PREFIX}/etc/rbenv.d\\0" if HOMEBREW_PREFIX.to_s != "/usr/local" end # Compile optional bash extension. system "src/configure" system "make", "-C", "src" if build.head? # Record exact git revision for `rbenv --version` output git_revision = Utils.git_short_head(buildpath) inreplace "libexec/rbenv---version", /^(version=)"([^"]+)"/, %Q(\\1"\\2-g#{git_revision}") end prefix.install ["bin", "completions", "libexec", "rbenv.d"] end test do shell_output("eval \"$(#{bin}/rbenv init -)\" && rbenv versions") end end
Spree::OptionType.create!([ { name: 'adult', presentation: 'Adult', position: 1 }, { name: 'child', presentation: 'Child', position: 2 }, { name: 'infant', presentation: 'Infant', position: 3 }, { name: 'pax', presentation: 'Pax', position: 4 }, { name: 'season', presentation: 'Season', position: 10 }, { name: 'meal-plan', presentation: 'Meal Plan', position: 20 }, { name: 'trip', presentation: 'Trip', position: 70 }, { name: 'transmission', presentation: 'Transmission', position: 80 }, { name: 'duration', presentation: 'Duration', position: 90 }, { name: 'taxi-confort', presentation: 'Confort', position: 1 }, { name: 'type-class', presentation: 'Class', position: 1 } ] chance in option_types.rb Spree::OptionType.create!([ { name: 'adult', presentation: 'Adult', position: 1 }, { name: 'child', presentation: 'Child', position: 2 }, { name: 'infant', presentation: 'Infant', position: 3 }, { name: 'pax', presentation: 'Pax', position: 4 }, { name: 'season', presentation: 'Season', position: 10 }, { name: 'meal-plan', presentation: 'Meal Plan', position: 20 }, { name: 'trip', presentation: 'Trip', position: 70 }, { name: 'transmission', presentation: 'Transmission', position: 80 }, { name: 'duration', presentation: 'Duration', position: 90 }, { name: 'taxi-confort', presentation: 'Confort', position: 1 }, { name: 'type-class', presentation: 'Class', position: 1 } ]
class Rdate < Formula desc "Set the system's date from a remote host" homepage "https://www.aelius.com/njh/rdate/" url "https://www.aelius.com/njh/rdate/rdate-1.5.tar.gz" sha256 "6e800053eaac2b21ff4486ec42f0aca7214941c7e5fceedd593fa0be99b9227d" bottle do cellar :any_skip_relocation rebuild 1 sha256 "68597f7989ddba1ff853f54c0cf3adf36b3567268b69ca43d7b0795d290304b4" => :catalina sha256 "2d4c93b21caa56d3228d8ff2ff790f4142421ad6316cd74d77c568e84602a996" => :mojave sha256 "02e41a79e9aca3bad86802e1bc32c7148e8a2ea2f410c57765f9e9d8b2686fd1" => :high_sierra sha256 "9f4a6300d6d3ebc9034abeb5388fd40face1f286a7b97610b6a40a1dcdf166b5" => :sierra sha256 "acb2ae5951a0f32cbdce39e02d86c63cdb85b41fd02aff74aac6ea4939d71d8d" => :el_capitan sha256 "553782017635be9c8d80bbf6fd033f294cddcb427a2d83fe82af8c069c60867f" => :yosemite sha256 "3a36b6feccd119c90db3373a3de1b67f4aa03fc72aacdf7b11165b538206ae14" => :mavericks end def install system "./configure", "--disable-debug", "--disable-dependency-tracking", "--prefix=#{prefix}", "--mandir=#{man}" system "make", "install" end test do # note that the server must support RFC 868 system "#{bin}/rdate", "-p", "-t", "10", "time-b-b.nist.gov" end end rdate: add license class Rdate < Formula desc "Set the system's date from a remote host" homepage "https://www.aelius.com/njh/rdate/" url "https://www.aelius.com/njh/rdate/rdate-1.5.tar.gz" sha256 "6e800053eaac2b21ff4486ec42f0aca7214941c7e5fceedd593fa0be99b9227d" license "GPL-2.0" bottle do cellar :any_skip_relocation rebuild 1 sha256 "68597f7989ddba1ff853f54c0cf3adf36b3567268b69ca43d7b0795d290304b4" => :catalina sha256 "2d4c93b21caa56d3228d8ff2ff790f4142421ad6316cd74d77c568e84602a996" => :mojave sha256 "02e41a79e9aca3bad86802e1bc32c7148e8a2ea2f410c57765f9e9d8b2686fd1" => :high_sierra sha256 "9f4a6300d6d3ebc9034abeb5388fd40face1f286a7b97610b6a40a1dcdf166b5" => :sierra sha256 "acb2ae5951a0f32cbdce39e02d86c63cdb85b41fd02aff74aac6ea4939d71d8d" => :el_capitan sha256 "553782017635be9c8d80bbf6fd033f294cddcb427a2d83fe82af8c069c60867f" => :yosemite sha256 "3a36b6feccd119c90db3373a3de1b67f4aa03fc72aacdf7b11165b538206ae14" => :mavericks end def install system "./configure", "--disable-debug", "--disable-dependency-tracking", "--prefix=#{prefix}", "--mandir=#{man}" system "make", "install" end test do # note that the server must support RFC 868 system "#{bin}/rdate", "-p", "-t", "10", "time-b-b.nist.gov" end end
require 'formula' class Redis <Formula url 'http://redis.googlecode.com/files/redis-1.2.6.tar.gz' head 'git://github.com/antirez/redis.git' homepage 'http://code.google.com/p/redis/' sha1 'c71aef0b3f31acb66353d86ba57dd321b541043f' def install fails_with_llvm "Breaks with LLVM" # Head and stable have different code layouts src = File.exists?('src/Makefile') ? 'src' : '.' system "make -C #{src}" %w( redis-benchmark redis-cli redis-server redis-stat redis-check-dump ).each { |p| # Some of these commands are only in 1.2.x, some only in head bin.install "#{src}/#{p}" rescue nil } %w( run db/redis log ).each { |p| (var+p).mkpath } # Fix up default conf file to match our paths inreplace "redis.conf" do |s| s.gsub! "/var/run/redis.pid", "#{var}/run/redis.pid" s.gsub! "dir ./", "dir #{var}/db/redis/" end doc.install Dir["doc/*"] etc.install "redis.conf" (prefix+'io.redis.redis-server.plist').write startup_plist end def caveats <<-EOS.undent Automatically load on login with: launchctl load -w #{prefix}/io.redis.redis-server.plist To start redis manually: redis-server #{etc}/redis.conf To access the server: redis-cli EOS end def startup_plist return <<-EOPLIST <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>KeepAlive</key> <true/> <key>Label</key> <string>io.redis.redis-server</string> <key>ProgramArguments</key> <array> <string>#{bin}/redis-server</string> <string>#{etc}/redis.conf</string> </array> <key>RunAtLoad</key> <true/> <key>UserName</key> <string>#{`whoami`.chomp}</string> <key>WorkingDirectory</key> <string>#{var}</string> <key>StandardErrorPath</key> <string>#{var}/log/redis.log</string> <key>StandardOutPath</key> <string>#{var}/log/redis.log</string> </dict> </plist> EOPLIST end end Update redis to 2.0.0. Signed-off-by: David Höppner <0xffea@gmail.com> * sha1 require 'formula' class Redis <Formula url 'http://redis.googlecode.com/files/redis-2.0.0.tar.gz' head 'git://github.com/antirez/redis.git' homepage 'http://code.google.com/p/redis/' sha1 '078601a2ee6d900f938709c9b40526646a449453' def install fails_with_llvm "Breaks with LLVM" # Head and stable have different code layouts src = File.exists?('src/Makefile') ? 'src' : '.' system "make -C #{src}" %w( redis-benchmark redis-cli redis-server redis-check-dump ).each { |p| bin.install "#{src}/#{p}" } %w( run db/redis log ).each { |p| (var+p).mkpath } # Fix up default conf file to match our paths inreplace "redis.conf" do |s| s.gsub! "/var/run/redis.pid", "#{var}/run/redis.pid" s.gsub! "dir ./", "dir #{var}/db/redis/" end doc.install Dir["doc/*"] etc.install "redis.conf" (prefix+'io.redis.redis-server.plist').write startup_plist end def caveats <<-EOS.undent Automatically load on login with: launchctl load -w #{prefix}/io.redis.redis-server.plist To start redis manually: redis-server #{etc}/redis.conf To access the server: redis-cli EOS end def startup_plist return <<-EOPLIST <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>KeepAlive</key> <true/> <key>Label</key> <string>io.redis.redis-server</string> <key>ProgramArguments</key> <array> <string>#{bin}/redis-server</string> <string>#{etc}/redis.conf</string> </array> <key>RunAtLoad</key> <true/> <key>UserName</key> <string>#{`whoami`.chomp}</string> <key>WorkingDirectory</key> <string>#{var}</string> <key>StandardErrorPath</key> <string>#{var}/log/redis.log</string> <key>StandardOutPath</key> <string>#{var}/log/redis.log</string> </dict> </plist> EOPLIST end end
require 'formula' class Rhino < Formula homepage 'https://www.mozilla.org/rhino/' url 'https://github.com/mozilla/rhino/releases/download/Rhino1_7R5_RELEASE/rhino1_7R5.zip' sha1 '39ada4cca8c7f651a68eda3f307ff9b68808f0ce' version '1.7R5' def install libexec.install 'js.jar' bin.write_jar_script libexec/'js.jar', 'rhino' end test do system "#{bin}/rhino", '-e', 'print(42);' end end rhino 1.7.6 Rhino 1.7.6. Closes Homebrew/homebrew#38685. Signed-off-by: Mike McQuaid <a17fed27eaa842282862ff7c1b9c8395a26ac320@mikemcquaid.com> require 'formula' class Rhino < Formula homepage 'https://www.mozilla.org/rhino/' url 'https://github.com/mozilla/rhino/releases/download/Rhino1_7_6_RELEASE/rhino1.7.6.zip' sha1 '7d86ccb422bc82569b334bad68cee385c3a4540c' def install libexec.install 'js.jar' bin.write_jar_script libexec/'js.jar', 'rhino' end test do system "#{bin}/rhino", '-e', 'print(42);' end end
class Scons < Formula desc "Substitute for classic 'make' tool with autoconf/automake functionality" homepage "http://www.scons.org" url "https://downloads.sourceforge.net/project/scons/scons/3.0.1/scons-3.0.1.tar.gz" sha256 "24475e38d39c19683bc88054524df018fe6949d70fbd4c69e298d39a0269f173" revision 1 unless OS.mac? bottle do cellar :any_skip_relocation sha256 "c791b4905477a5fbc33345cef5e412807ffc90ba6ea35bfc9a263f542702aa1c" => :high_sierra sha256 "c791b4905477a5fbc33345cef5e412807ffc90ba6ea35bfc9a263f542702aa1c" => :sierra sha256 "c791b4905477a5fbc33345cef5e412807ffc90ba6ea35bfc9a263f542702aa1c" => :el_capitan end depends_on "python" unless OS.mac? def install inreplace "engine/SCons/Platform/posix.py", "env['ENV']['PATH'] = '/usr/local/bin:/opt/bin:/bin:/usr/bin'", "env['ENV']['PATH'] = '#{HOMEBREW_PREFIX}/bin:/usr/local/bin:/opt/bin:/bin:/usr/bin'" \ if OS.linux? man1.install gzip("scons-time.1", "scons.1", "sconsign.1") system (OS.mac? ? "/usr/bin/python" : "python"), "setup.py", "install", "--prefix=#{prefix}", "--standalone-lib", # SCons gets handsy with sys.path---`scons-local` is one place it # will look when all is said and done. "--install-lib=#{libexec}/scons-local", "--install-scripts=#{bin}", "--install-data=#{libexec}", "--no-version-script", "--no-install-man" # Re-root scripts to libexec so they can import SCons and symlink back into # bin. Similar tactics are used in the duplicity formula. bin.children.each do |p| mv p, "#{libexec}/#{p.basename}.py" bin.install_symlink "#{libexec}/#{p.basename}.py" => p.basename end end test do (testpath/"test.c").write <<~EOS #include <stdio.h> int main() { printf("Homebrew"); return 0; } EOS (testpath/"SConstruct").write "Program('test.c')" system bin/"scons" assert_equal "Homebrew", shell_output("#{testpath}/test") end end scons: update 3.0.1_1 bottle for Linuxbrew. class Scons < Formula desc "Substitute for classic 'make' tool with autoconf/automake functionality" homepage "http://www.scons.org" url "https://downloads.sourceforge.net/project/scons/scons/3.0.1/scons-3.0.1.tar.gz" sha256 "24475e38d39c19683bc88054524df018fe6949d70fbd4c69e298d39a0269f173" revision 1 unless OS.mac? bottle do cellar :any_skip_relocation sha256 "c791b4905477a5fbc33345cef5e412807ffc90ba6ea35bfc9a263f542702aa1c" => :high_sierra sha256 "c791b4905477a5fbc33345cef5e412807ffc90ba6ea35bfc9a263f542702aa1c" => :sierra sha256 "c791b4905477a5fbc33345cef5e412807ffc90ba6ea35bfc9a263f542702aa1c" => :el_capitan sha256 "311b21b2300ccead3058b52bb15c2d800767eb22709eed0cca349e215d2bc9e7" => :x86_64_linux end depends_on "python" unless OS.mac? def install inreplace "engine/SCons/Platform/posix.py", "env['ENV']['PATH'] = '/usr/local/bin:/opt/bin:/bin:/usr/bin'", "env['ENV']['PATH'] = '#{HOMEBREW_PREFIX}/bin:/usr/local/bin:/opt/bin:/bin:/usr/bin'" \ if OS.linux? man1.install gzip("scons-time.1", "scons.1", "sconsign.1") system (OS.mac? ? "/usr/bin/python" : "python"), "setup.py", "install", "--prefix=#{prefix}", "--standalone-lib", # SCons gets handsy with sys.path---`scons-local` is one place it # will look when all is said and done. "--install-lib=#{libexec}/scons-local", "--install-scripts=#{bin}", "--install-data=#{libexec}", "--no-version-script", "--no-install-man" # Re-root scripts to libexec so they can import SCons and symlink back into # bin. Similar tactics are used in the duplicity formula. bin.children.each do |p| mv p, "#{libexec}/#{p.basename}.py" bin.install_symlink "#{libexec}/#{p.basename}.py" => p.basename end end test do (testpath/"test.c").write <<~EOS #include <stdio.h> int main() { printf("Homebrew"); return 0; } EOS (testpath/"SConstruct").write "Program('test.c')" system bin/"scons" assert_equal "Homebrew", shell_output("#{testpath}/test") end end
class Seqtk < Formula desc "Toolkit for processing sequences in FASTA/Q formats" homepage "https://github.com/lh3/seqtk" url "https://github.com/lh3/seqtk/archive/v1.3.tar.gz" sha256 "5a1687d65690f2f7fa3f998d47c3c5037e792f17ce119dab52fff3cfdca1e563" license "MIT" bottle do cellar :any_skip_relocation sha256 "bdcc9b85644f98bbcdffbb84816e40714c254f8e9e8c8e5c042b4d25496e0010" => :big_sur sha256 "5abbf374f3dab69b198b98a3126f521b64baf01ac5ed69b99be91ffd97f891f8" => :catalina sha256 "b695a43103700d7d0d4a07d50d8effec280f7d7a781ff518a42dec2bef44801e" => :mojave sha256 "4f377caf93e5d334e739375a5dcf06782f1d85516988a26df3f8f53d172b1e6f" => :high_sierra sha256 "fd3ecced5ba8f5a9eab13f8f2184f6a69d08b58c1ef53ad6e74bb45cab9324f4" => :sierra sha256 "55541e7e9249ef15bd4423ad9a45903918c2b4b54f632bc0472fb24aee683701" => :el_capitan end uses_from_macos "zlib" def install system "make" bin.install "seqtk" end test do (testpath/"test.fasta").write <<~EOS >U00096.2:1-70 AGCTTTTCATTCTGACTGCAACGGGCAATATGTCT CTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC EOS assert_match "TCTCTG", shell_output("#{bin}/seqtk seq test.fasta") end end seqtk: update 1.3 bottle. class Seqtk < Formula desc "Toolkit for processing sequences in FASTA/Q formats" homepage "https://github.com/lh3/seqtk" url "https://github.com/lh3/seqtk/archive/v1.3.tar.gz" sha256 "5a1687d65690f2f7fa3f998d47c3c5037e792f17ce119dab52fff3cfdca1e563" license "MIT" bottle do cellar :any_skip_relocation sha256 "bdcc9b85644f98bbcdffbb84816e40714c254f8e9e8c8e5c042b4d25496e0010" => :big_sur sha256 "4e1d4c35dc64c5ea008ecb2e83bfc5d7a4047256e37923a981e5a6cd6038f368" => :arm64_big_sur sha256 "5abbf374f3dab69b198b98a3126f521b64baf01ac5ed69b99be91ffd97f891f8" => :catalina sha256 "b695a43103700d7d0d4a07d50d8effec280f7d7a781ff518a42dec2bef44801e" => :mojave sha256 "4f377caf93e5d334e739375a5dcf06782f1d85516988a26df3f8f53d172b1e6f" => :high_sierra sha256 "fd3ecced5ba8f5a9eab13f8f2184f6a69d08b58c1ef53ad6e74bb45cab9324f4" => :sierra sha256 "55541e7e9249ef15bd4423ad9a45903918c2b4b54f632bc0472fb24aee683701" => :el_capitan end uses_from_macos "zlib" def install system "make" bin.install "seqtk" end test do (testpath/"test.fasta").write <<~EOS >U00096.2:1-70 AGCTTTTCATTCTGACTGCAACGGGCAATATGTCT CTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC EOS assert_match "TCTCTG", shell_output("#{bin}/seqtk seq test.fasta") end end
class Siege < Formula desc "HTTP regression testing and benchmarking utility" homepage "https://www.joedog.org/siege-home/" url "http://download.joedog.org/siege/siege-4.0.7.tar.gz" sha256 "bfa75b3eaad372e7b89eee75d789cd6acbda34900a0c6e49030cf0f803b56df8" license "GPL-3.0" bottle do sha256 "b7de9172ade8285cc5107e598397b6519edee6c1ecf4bb095faa7a1da1346da0" => :catalina sha256 "5a0064c051bbd111b8d8723fce3107e41777b223bedffc4e0d0d9da1967e6703" => :mojave sha256 "7c4381adab349f46db1445936da393a0f6d007b0f47f3d7660686718b5f9db4e" => :high_sierra end depends_on "openssl@1.1" def install # To avoid unnecessary warning due to hardcoded path, create the folder first (prefix/"etc").mkdir system "./configure", "--disable-dependency-tracking", "--prefix=#{prefix}", "--mandir=#{man}", "--localstatedir=#{var}", "--with-ssl=#{Formula["openssl@1.1"].opt_prefix}", "--with-zlib=#{MacOS.sdk_path_if_needed}/usr" system "make", "install" end def caveats <<~EOS macOS has only 16K ports available that won't be released until socket TIME_WAIT is passed. The default timeout for TIME_WAIT is 15 seconds. Consider reducing in case of available port bottleneck. You can check whether this is a problem with netstat: # sysctl net.inet.tcp.msl net.inet.tcp.msl: 15000 # sudo sysctl -w net.inet.tcp.msl=1000 net.inet.tcp.msl: 15000 -> 1000 Run siege.config to create the ~/.siegerc config file. EOS end test do system "#{bin}/siege", "--concurrent=1", "--reps=1", "https://www.google.com/" end end siege: update 4.0.7 bottle. class Siege < Formula desc "HTTP regression testing and benchmarking utility" homepage "https://www.joedog.org/siege-home/" url "http://download.joedog.org/siege/siege-4.0.7.tar.gz" sha256 "bfa75b3eaad372e7b89eee75d789cd6acbda34900a0c6e49030cf0f803b56df8" license "GPL-3.0" bottle do sha256 "ccc545449c2a0bacb0054078faee630f23e4728d1bf137cba9c5d8aa82e02495" => :catalina sha256 "0704038a2995eec4ffacbb3554230b2825ebb21c3c9c612baae24999a620e183" => :mojave sha256 "d2793b5aee87ffe4c04fca2c807477c3bcc8c5979888d26db995e0e58bece246" => :high_sierra end depends_on "openssl@1.1" def install # To avoid unnecessary warning due to hardcoded path, create the folder first (prefix/"etc").mkdir system "./configure", "--disable-dependency-tracking", "--prefix=#{prefix}", "--mandir=#{man}", "--localstatedir=#{var}", "--with-ssl=#{Formula["openssl@1.1"].opt_prefix}", "--with-zlib=#{MacOS.sdk_path_if_needed}/usr" system "make", "install" end def caveats <<~EOS macOS has only 16K ports available that won't be released until socket TIME_WAIT is passed. The default timeout for TIME_WAIT is 15 seconds. Consider reducing in case of available port bottleneck. You can check whether this is a problem with netstat: # sysctl net.inet.tcp.msl net.inet.tcp.msl: 15000 # sudo sysctl -w net.inet.tcp.msl=1000 net.inet.tcp.msl: 15000 -> 1000 Run siege.config to create the ~/.siegerc config file. EOS end test do system "#{bin}/siege", "--concurrent=1", "--reps=1", "https://www.google.com/" end end
class Siege < Formula desc "HTTP regression testing and benchmarking utility" homepage "https://www.joedog.org/siege-home/" url "http://download.joedog.org/siege/siege-4.0.4.tar.gz" sha256 "8f7dcf18bd722bb9cc92bc3ea4b59836b4a2f8d8f01d4a94c8d181f56d91ea6f" bottle do sha256 "975fa6c60a27b9462d55ef7b4e9faeec0569de3b48bd10dab89c88a001350459" => :mojave sha256 "a5e4990ab448ec37e9e5e7b392a7bf6aee03313bad6d89c6fda45decd4ddecf4" => :high_sierra sha256 "84ad0232db938f558c2ad57b5c61382b136483c3d4f106f6fcea7e647d2b9982" => :sierra sha256 "4ffac4100438cc7d6784a64774770ffe219bf330e96890c77eb012bab0f02ba5" => :el_capitan end depends_on "openssl" def install # To avoid unnecessary warning due to hardcoded path, create the folder first (prefix/"etc").mkdir system "./configure", "--disable-dependency-tracking", "--prefix=#{prefix}", "--mandir=#{man}", "--localstatedir=#{var}", "--with-ssl=#{Formula["openssl"].opt_prefix}" system "make", "install" end def caveats; <<~EOS macOS has only 16K ports available that won't be released until socket TIME_WAIT is passed. The default timeout for TIME_WAIT is 15 seconds. Consider reducing in case of available port bottleneck. You can check whether this is a problem with netstat: # sysctl net.inet.tcp.msl net.inet.tcp.msl: 15000 # sudo sysctl -w net.inet.tcp.msl=1000 net.inet.tcp.msl: 15000 -> 1000 Run siege.config to create the ~/.siegerc config file. EOS end test do system "#{bin}/siege", "--concurrent=1", "--reps=1", "https://www.google.com/" end end siege: use system zlib refs #37326 Closes #37342. Signed-off-by: Misty De Meo <85d6b3741948526aebc363d97f74b6575b2cc027@github.com> class Siege < Formula desc "HTTP regression testing and benchmarking utility" homepage "https://www.joedog.org/siege-home/" url "http://download.joedog.org/siege/siege-4.0.4.tar.gz" sha256 "8f7dcf18bd722bb9cc92bc3ea4b59836b4a2f8d8f01d4a94c8d181f56d91ea6f" revision 1 bottle do sha256 "975fa6c60a27b9462d55ef7b4e9faeec0569de3b48bd10dab89c88a001350459" => :mojave sha256 "a5e4990ab448ec37e9e5e7b392a7bf6aee03313bad6d89c6fda45decd4ddecf4" => :high_sierra sha256 "84ad0232db938f558c2ad57b5c61382b136483c3d4f106f6fcea7e647d2b9982" => :sierra sha256 "4ffac4100438cc7d6784a64774770ffe219bf330e96890c77eb012bab0f02ba5" => :el_capitan end depends_on "openssl" def install # To avoid unnecessary warning due to hardcoded path, create the folder first (prefix/"etc").mkdir system "./configure", "--disable-dependency-tracking", "--prefix=#{prefix}", "--mandir=#{man}", "--localstatedir=#{var}", "--with-ssl=#{Formula["openssl"].opt_prefix}", "--with-zlib=#{MacOS.sdk_path_if_needed}/usr" system "make", "install" end def caveats; <<~EOS macOS has only 16K ports available that won't be released until socket TIME_WAIT is passed. The default timeout for TIME_WAIT is 15 seconds. Consider reducing in case of available port bottleneck. You can check whether this is a problem with netstat: # sysctl net.inet.tcp.msl net.inet.tcp.msl: 15000 # sudo sysctl -w net.inet.tcp.msl=1000 net.inet.tcp.msl: 15000 -> 1000 Run siege.config to create the ~/.siegerc config file. EOS end test do system "#{bin}/siege", "--concurrent=1", "--reps=1", "https://www.google.com/" end end
require 'formula' class Smake < Formula homepage 'http://s-make.sourceforge.net/' url 'https://downloads.sourceforge.net/project/s-make/smake-1.2.4.tar.bz2' sha1 '677af2a1b768d5dfd3bd71dc46f81992e798191b' bottle do sha1 "30e72ed47a18ce5c90107cc45ac8b603b508169f" => :yosemite sha1 "6883bca2c7c13db1139234f73ef387f6a311fbcd" => :mavericks sha1 "709ab7a8011da3b92d61db6aa9eef3c7fbc1b9e7" => :mountain_lion end # A sed operation silently fails on Lion or older, due # to some locale settings in smake's build files. The sed # wrapper on 10.8+ overrides them. env :std if MacOS.version <= :lion def install ENV.deparallelize # the bootstrap smake does not like -j system "make", "GMAKE_NOWARN=true", "INS_BASE=#{libexec}", "INS_RBASE=#{libexec}", "install" bin.install_symlink libexec/"bin/smake" man1.install_symlink Dir["#{libexec}/share/man/man1/*.1"] man5.install_symlink Dir["#{libexec}/share/man/man5/*.5"] end test do system "#{bin}/smake", "-version" end end smake 1.2.5 Closes Homebrew/homebrew#38906. Signed-off-by: Xu Cheng <9a05244150b861e40c78843b801eed71bca54eac@me.com> require 'formula' class Smake < Formula homepage "http://s-make.sourceforge.net/" url "https://downloads.sourceforge.net/project/s-make/smake-1.2.5.tar.bz2" sha256 "27566aa731a400c791cd95361cc755288b44ff659fa879933d4ea35d052259d4" bottle do sha1 "30e72ed47a18ce5c90107cc45ac8b603b508169f" => :yosemite sha1 "6883bca2c7c13db1139234f73ef387f6a311fbcd" => :mavericks sha1 "709ab7a8011da3b92d61db6aa9eef3c7fbc1b9e7" => :mountain_lion end # A sed operation silently fails on Lion or older, due # to some locale settings in smake's build files. The sed # wrapper on 10.8+ overrides them. env :std if MacOS.version <= :lion def install ENV.deparallelize # the bootstrap smake does not like -j system "make", "GMAKE_NOWARN=true", "INS_BASE=#{libexec}", "INS_RBASE=#{libexec}", "install" bin.install_symlink libexec/"bin/smake" man1.install_symlink Dir["#{libexec}/share/man/man1/*.1"] man5.install_symlink Dir["#{libexec}/share/man/man5/*.5"] end test do system "#{bin}/smake", "-version" end end
class Snzip < Formula desc "Compression/decompression tool based on snappy" homepage "https://github.com/kubo/snzip" url "https://bintray.com/artifact/download/kubo/generic/snzip-1.0.4.tar.gz" sha256 "a45081354715d48ed31899508ebed04a41d4b4a91dca37b79fc3b8ee0c02e25e" revision 1 bottle do cellar :any sha256 "823e1f1e956fa360c53a42d388bd8ae2743a9acaf7a5b5e0ef9917bedbd8fa0e" => :sierra sha256 "68b4d3fd3d9eaf7aca423e3ab5b4b70f132c1c93ecb0340ed9a955e4dc05e55a" => :el_capitan sha256 "48922501808047146276f2ba24babe2c1f31f4ba602bc31c9ad04bd28e95316d" => :yosemite end depends_on "snappy" def install system "./configure", "--prefix=#{prefix}" system "make", "install" end test do (testpath/"test.out").write "test" system "#{bin}/snzip", "test.out" system "#{bin}/snzip", "-d", "test.out.sz" end end snzip: revision for snappy class Snzip < Formula desc "Compression/decompression tool based on snappy" homepage "https://github.com/kubo/snzip" url "https://bintray.com/artifact/download/kubo/generic/snzip-1.0.4.tar.gz" sha256 "a45081354715d48ed31899508ebed04a41d4b4a91dca37b79fc3b8ee0c02e25e" revision 2 bottle do cellar :any sha256 "823e1f1e956fa360c53a42d388bd8ae2743a9acaf7a5b5e0ef9917bedbd8fa0e" => :sierra sha256 "68b4d3fd3d9eaf7aca423e3ab5b4b70f132c1c93ecb0340ed9a955e4dc05e55a" => :el_capitan sha256 "48922501808047146276f2ba24babe2c1f31f4ba602bc31c9ad04bd28e95316d" => :yosemite end depends_on "snappy" def install system "./configure", "--prefix=#{prefix}" system "make", "install" end test do (testpath/"test.out").write "test" system "#{bin}/snzip", "test.out" system "#{bin}/snzip", "-d", "test.out.sz" end end
class Sonic < Formula desc "Fast, lightweight & schema-less search backend" homepage "https://github.com/valeriansaliou/sonic" url "https://github.com/valeriansaliou/sonic/archive/v1.3.5.tar.gz" sha256 "ff6b72939e87d2172428ac302a3aa152ac8a37206b8b0d11e73ded14dcc8e858" license "MPL-2.0" bottle do sha256 cellar: :any_skip_relocation, arm64_monterey: "0516f6d0b48cdb1341503d7624a4331ba7a295fe1d6212a10da9fc126ed97274" sha256 cellar: :any_skip_relocation, arm64_big_sur: "185d38158dec8ed312e1918034c686e7b38f60e19e018211bad81195ada48890" sha256 cellar: :any_skip_relocation, monterey: "d748bdcdfc8006e53155bac2381e6f67a96b0058c9c6c37a69febe2b63caafe7" sha256 cellar: :any_skip_relocation, big_sur: "ff012f2dc4eb12de080031e39605d8a5a1432b42e1f25a8ba4500235e30b61cb" sha256 cellar: :any_skip_relocation, catalina: "dff9ddad869f6ddd7847906a29ff8e340deca793ddbd4bb20f2d75da97abde90" sha256 cellar: :any_skip_relocation, x86_64_linux: "21b10085bc3ead567627b4a7b2f312754df2c42370ca4b9f2b2f0c16e9e48188" end depends_on "rust" => :build uses_from_macos "llvm" => :build uses_from_macos "netcat" => :test def install system "cargo", "install", *std_cargo_args inreplace "config.cfg", "./", var/"sonic/" etc.install "config.cfg" => "sonic.cfg" end service do run [opt_bin/"sonic", "-c", etc/"sonic.cfg"] keep_alive true working_dir var log_path var/"log/sonic.log" error_log_path var/"log/sonic.log" end test do port = free_port cp etc/"sonic.cfg", testpath/"config.cfg" inreplace "config.cfg", "[::1]:1491", "0.0.0.0:#{port}" inreplace "config.cfg", "#{var}/sonic", "." fork { exec bin/"sonic" } sleep 2 system "nc", "-z", "localhost", port end end sonic: update 1.3.5 bottle. class Sonic < Formula desc "Fast, lightweight & schema-less search backend" homepage "https://github.com/valeriansaliou/sonic" url "https://github.com/valeriansaliou/sonic/archive/v1.3.5.tar.gz" sha256 "ff6b72939e87d2172428ac302a3aa152ac8a37206b8b0d11e73ded14dcc8e858" license "MPL-2.0" bottle do sha256 cellar: :any_skip_relocation, arm64_monterey: "12cd94403578b030f96f2208528abebb6269cef80e06efbeefbc8f5baa8ce782" sha256 cellar: :any_skip_relocation, arm64_big_sur: "c52af62adf108a51d03bb005b9b161c6dc956afd80760bb2283728e66591d5ba" sha256 cellar: :any_skip_relocation, monterey: "0c45791287c7b6908028c6048231a2c59a88f502bf47968df9013f9ded539e5b" sha256 cellar: :any_skip_relocation, big_sur: "806778d9239d3131ab09956665d21676dc999b03c5ab1bb10bb1b2a4120a988f" sha256 cellar: :any_skip_relocation, catalina: "7925072868e77b09a96c3bcc99cf4f3f986792269cc4702a6f22ee1e7d741f83" sha256 cellar: :any_skip_relocation, x86_64_linux: "e7332b36992b4248bcee2636e67591d58805447a97387703d53f03e88497ce4d" end depends_on "rust" => :build uses_from_macos "llvm" => :build uses_from_macos "netcat" => :test def install system "cargo", "install", *std_cargo_args inreplace "config.cfg", "./", var/"sonic/" etc.install "config.cfg" => "sonic.cfg" end service do run [opt_bin/"sonic", "-c", etc/"sonic.cfg"] keep_alive true working_dir var log_path var/"log/sonic.log" error_log_path var/"log/sonic.log" end test do port = free_port cp etc/"sonic.cfg", testpath/"config.cfg" inreplace "config.cfg", "[::1]:1491", "0.0.0.0:#{port}" inreplace "config.cfg", "#{var}/sonic", "." fork { exec bin/"sonic" } sleep 2 system "nc", "-z", "localhost", port end end
require 'formula' class NoBdb5 < Requirement # Not fatal in case Squid starts working with a newer version of BDB. fatal false satisfy(:build_env => false) { !Formula.factory("berkeley-db").installed? } def message; <<-EOS.undent This software can fail to compile when Berkeley-DB 5.x is installed. You may need to try: brew unlink berkeley-db brew install squid brew link berkeley-db EOS end end class Squid < Formula homepage 'http://www.squid-cache.org/' url 'http://www.squid-cache.org/Versions/v3/3.2/squid-3.2.5.tar.gz' sha1 '17c6f03ca90b0918b847e9e34669ba827da7edba' depends_on NoBdb5.new def install system "./configure", "--disable-debug", "--disable-dependency-tracking", "--prefix=#{prefix}", "--localstatedir=#{var}" system "make install" end def plist; <<-EOS.undent <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>KeepAlive</key> <true/> <key>Label</key> <string>#{plist_name}</string> <key>ProgramArguments</key> <array> <string>#{opt_prefix}/sbin/squid</string> <string>-N</string> <string>-d 1</string> <string>-D</string> </array> <key>RunAtLoad</key> <true/> <key>UserName</key> <string>#{`whoami`.chomp}</string> <key>WorkingDirectory</key> <string>#{var}</string> </dict> </plist> EOS end end squild: style nits require 'formula' class NoBdb5 < Requirement # Not fatal in case Squid starts working with a newer version of BDB. fatal false satisfy(:build_env => false) { !Formula.factory("berkeley-db").installed? } def message; <<-EOS.undent This software can fail to compile when Berkeley-DB 5.x is installed. You may need to try: brew unlink berkeley-db brew install squid brew link berkeley-db EOS end end class Squid < Formula homepage 'http://www.squid-cache.org/' url 'http://www.squid-cache.org/Versions/v3/3.2/squid-3.2.5.tar.gz' sha1 '17c6f03ca90b0918b847e9e34669ba827da7edba' depends_on NoBdb5 def install system "./configure", "--disable-debug", "--disable-dependency-tracking", "--prefix=#{prefix}", "--localstatedir=#{var}" system "make install" end def plist; <<-EOS.undent <?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE plist PUBLIC "-//Apple//DTD PLIST 1.0//EN" "http://www.apple.com/DTDs/PropertyList-1.0.dtd"> <plist version="1.0"> <dict> <key>KeepAlive</key> <true/> <key>Label</key> <string>#{plist_name}</string> <key>ProgramArguments</key> <array> <string>#{opt_prefix}/sbin/squid</string> <string>-N</string> <string>-d 1</string> <string>-D</string> </array> <key>RunAtLoad</key> <true/> <key>UserName</key> <string>#{`whoami`.chomp}</string> <key>WorkingDirectory</key> <string>#{var}</string> </dict> </plist> EOS end end
class Stern < Formula desc "Tail multiple Kubernetes pods & their containers." homepage "https://github.com/wercker/stern" url "https://github.com/wercker/stern/archive/1.5.0.tar.gz" sha256 "2e2e1baef022fa850d5fc9ceb4053a35cd033e9059621c4cdabff874cb39cbaf" head "https://github.com/wercker/stern.git", :shallow => false bottle do cellar :any_skip_relocation sha256 "4c2136c7e92177ce888ecf552570ab5722731c0ff09d09497682078f8fa1bf90" => :sierra sha256 "d25a88970f952b7f05de8aaa9698e0f00add5ff8eb5e065c5060ab5b51f607ac" => :el_capitan sha256 "e8b7b50252464d9d4ff135be76f7e08f58f17c9100d6cba757fdc5af213265a8" => :yosemite end depends_on "go" => :build depends_on "govendor" => :build def install contents = Dir["{*,.git,.gitignore}"] gopath = buildpath/"gopath" (gopath/"src/github.com/wercker/stern").install contents ENV["GOPATH"] = gopath ENV.prepend_create_path "PATH", gopath/"bin" cd gopath/"src/github.com/wercker/stern" do system "govendor", "sync" system "go", "build", "-o", "bin/stern" bin.install "bin/stern" end end test do system "#{bin}/stern", "--version" end end stern: update 1.5.0 bottle. class Stern < Formula desc "Tail multiple Kubernetes pods & their containers." homepage "https://github.com/wercker/stern" url "https://github.com/wercker/stern/archive/1.5.0.tar.gz" sha256 "2e2e1baef022fa850d5fc9ceb4053a35cd033e9059621c4cdabff874cb39cbaf" head "https://github.com/wercker/stern.git", :shallow => false bottle do cellar :any_skip_relocation sha256 "33146c5768cd6dcc101fe5557b61b937cd550e61d6be34b44088351e6de7cdd1" => :sierra sha256 "7ccf008b8e3db8f8afcc8047b144a036f8d985615231576641fb46e3cbce35dc" => :el_capitan sha256 "cefee06366dee336ce9cb3996b1c2d45c584e5fa3dab9a17e55638be19ac4e43" => :yosemite end depends_on "go" => :build depends_on "govendor" => :build def install contents = Dir["{*,.git,.gitignore}"] gopath = buildpath/"gopath" (gopath/"src/github.com/wercker/stern").install contents ENV["GOPATH"] = gopath ENV.prepend_create_path "PATH", gopath/"bin" cd gopath/"src/github.com/wercker/stern" do system "govendor", "sync" system "go", "build", "-o", "bin/stern" bin.install "bin/stern" end end test do system "#{bin}/stern", "--version" end end
class Stern < Formula desc "Tail multiple Kubernetes pods & their containers" homepage "https://github.com/stern/stern" url "https://github.com/stern/stern/archive/v1.17.0.tar.gz" sha256 "6a3e62774793ebf318cfc3a296c92c6211afcf39f2ea852f6eea5b7319ff5ca1" license "Apache-2.0" head "https://github.com/stern/stern.git" bottle do sha256 cellar: :any_skip_relocation, arm64_big_sur: "1fe84c0352071e5e298b51b731bf41131933c292c073d7ef0b1819dc0643a2d8" sha256 cellar: :any_skip_relocation, big_sur: "405567683bac9931fb2d88f6a1c32928d12327b972d9ac585c9d2ebea2eec661" sha256 cellar: :any_skip_relocation, catalina: "da35f1b0008de6db7de6761f576da73ddc458e66275bebab4bdc40d1179f54e4" sha256 cellar: :any_skip_relocation, mojave: "a986b92863c0a8ce4fb1f3264dc06ce403ef1e7db61efcde8b9f2837effed3d4" end depends_on "go" => :build def install system "go", "build", "-ldflags", "-s -w -X github.com/stern/stern/cmd.version=#{version}", *std_go_args # Install shell completion output = Utils.safe_popen_read("#{bin}/stern", "--completion=bash") (bash_completion/"stern").write output output = Utils.safe_popen_read("#{bin}/stern", "--completion=zsh") (zsh_completion/"_stern").write output end test do assert_match "version: #{version}", shell_output("#{bin}/stern --version") end end stern 1.18.0 Closes #77415. Signed-off-by: Carlo Cabrera <3ffc397d0e4bded29cb84b56167de54c01e3a55b@users.noreply.github.com> Signed-off-by: BrewTestBot <8a898ee6867e4f2028e63d2a6319b2224641c06c@users.noreply.github.com> class Stern < Formula desc "Tail multiple Kubernetes pods & their containers" homepage "https://github.com/stern/stern" url "https://github.com/stern/stern/archive/v1.18.0.tar.gz" sha256 "86cb6458c2136936e787363587cfe3dd81fb96251ea961e7801824c3db0b4441" license "Apache-2.0" head "https://github.com/stern/stern.git" bottle do sha256 cellar: :any_skip_relocation, arm64_big_sur: "1fe84c0352071e5e298b51b731bf41131933c292c073d7ef0b1819dc0643a2d8" sha256 cellar: :any_skip_relocation, big_sur: "405567683bac9931fb2d88f6a1c32928d12327b972d9ac585c9d2ebea2eec661" sha256 cellar: :any_skip_relocation, catalina: "da35f1b0008de6db7de6761f576da73ddc458e66275bebab4bdc40d1179f54e4" sha256 cellar: :any_skip_relocation, mojave: "a986b92863c0a8ce4fb1f3264dc06ce403ef1e7db61efcde8b9f2837effed3d4" end depends_on "go" => :build def install system "go", "build", "-ldflags", "-s -w -X github.com/stern/stern/cmd.version=#{version}", *std_go_args # Install shell completion output = Utils.safe_popen_read("#{bin}/stern", "--completion=bash") (bash_completion/"stern").write output output = Utils.safe_popen_read("#{bin}/stern", "--completion=zsh") (zsh_completion/"_stern").write output end test do assert_match "version: #{version}", shell_output("#{bin}/stern --version") end end
class Swift < Formula desc "High-performance system programming language" homepage "https://github.com/apple/swift" url "https://github.com/apple/swift/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "026d596dd4a24580a5e442409e8c58259197bd73ddbb77e5aade96da982ea39b" bottle do cellar :any sha256 "f283aa347aa58b57dd835a91f311837fcb4b8cdbea52aaf9dcffdf33b8915e0c" => :high_sierra sha256 "2d8f4b3bf2a3c1d5ffd811b42378cb43da9f49c0c16fec6e294d93338bfc57ad" => :sierra end keg_only :provided_by_osx, "Apple's CLT package contains Swift" depends_on "cmake" => :build depends_on "ninja" => :build # Depends on latest version of Xcode # https://github.com/apple/swift#system-requirements depends_on :xcode => ["9.0", :build] # This formula is expected to have broken/missing linkage to # both UIKit.framework and AssetsLibrary.framework. This is # simply due to the nature of Swift's SDK Overlays. resource "clang" do url "https://github.com/apple/swift-clang/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "c940bd48c88f71622fb00167d92a619dd1614093893e1a09982c08da42259404" end resource "cmark" do url "https://github.com/apple/swift-cmark/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "e95d0b54a0e897e768c9437dd67d56ec887909d0294cf6536ba240accd0d294f" end resource "compiler-rt" do url "https://github.com/apple/swift-compiler-rt/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "1c2da685e8f424cb4460ed1daaf0c308f8deff63e7a3716c8a881cef60fbc7d8" end resource "llbuild" do url "https://github.com/apple/swift-llbuild/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "92001e449b54a47516086a4e7d5f575bffa2847ae1f658540b2ec6f6dee6c6e7" end resource "llvm" do url "https://github.com/apple/swift-llvm/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "a611487a82636142bc1ea8ef5b21401a5c75e57fb0dbf041ef8f2e85a472db2e" end resource "swiftpm" do url "https://github.com/apple/swift-package-manager/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "4c26d333a01c239de8aa96b0536b7ff7218b7a322851a7d3b3b91b59fb4ce244" end # According to the official llvm readme, GCC 4.7+ is required fails_with :gcc_4_0 fails_with :gcc ("4.3".."4.6").each do |n| fails_with :gcc => n end def install workspace = buildpath.parent build = workspace/"build" toolchain_prefix = "/Swift-#{version}.xctoolchain" install_prefix = "#{toolchain_prefix}/usr" ln_sf buildpath, "#{workspace}/swift" resources.each { |r| r.stage("#{workspace}/#{r.name}") } mkdir build do system "#{buildpath}/utils/build-script", "--release", "--assertions", "--no-swift-stdlib-assertions", "--build-subdir=#{build}", "--llbuild", "--swiftpm", "--ios", "--tvos", "--watchos", "--", "--workspace=#{workspace}", "--build-args=-j#{ENV.make_jobs}", "--install-destdir=#{prefix}", "--toolchain-prefix=#{toolchain_prefix}", "--install-prefix=#{install_prefix}", "--host-target=macosx-x86_64", "--build-swift-static-stdlib", "--build-swift-dynamic-stdlib", "--build-swift-dynamic-sdk-overlay", "--build-swift-static-sdk-overlay", "--build-swift-stdlib-unittest-extra", "--install-swift", "--swift-install-components=compiler;clang-resource-dir-symlink;"\ "clang-builtin-headers-in-clang-resource-dir;stdlib;sdk-overlay;tools;"\ "editor-integration;testsuite-tools;toolchain-dev-tools;license;sourcekit-inproc;"\ "sourcekit-xpc-service;swift-remote-mirror;swift-remote-mirror-headers", "--llvm-install-components=clang;libclang;libclang-headers", "--install-llbuild", "--install-swiftpm" end end test do (testpath/"test.swift").write <<~EOS let base = 2 let exponent_inner = 3 let exponent_outer = 4 var answer = 1 for _ in 1...exponent_outer { for _ in 1...exponent_inner { answer *= base } } print("(\\(base)^\\(exponent_inner))^\\(exponent_outer) == \\(answer)") EOS output = shell_output("#{prefix}/Swift-#{version}.xctoolchain/usr/bin/swift test.swift") assert_match "(2^3)^4 == 4096\n", output end end swift: use *_by_macos. class Swift < Formula desc "High-performance system programming language" homepage "https://github.com/apple/swift" url "https://github.com/apple/swift/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "026d596dd4a24580a5e442409e8c58259197bd73ddbb77e5aade96da982ea39b" bottle do cellar :any sha256 "f283aa347aa58b57dd835a91f311837fcb4b8cdbea52aaf9dcffdf33b8915e0c" => :high_sierra sha256 "2d8f4b3bf2a3c1d5ffd811b42378cb43da9f49c0c16fec6e294d93338bfc57ad" => :sierra end keg_only :provided_by_macos, "Apple's CLT package contains Swift" depends_on "cmake" => :build depends_on "ninja" => :build # Depends on latest version of Xcode # https://github.com/apple/swift#system-requirements depends_on :xcode => ["9.0", :build] # This formula is expected to have broken/missing linkage to # both UIKit.framework and AssetsLibrary.framework. This is # simply due to the nature of Swift's SDK Overlays. resource "clang" do url "https://github.com/apple/swift-clang/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "c940bd48c88f71622fb00167d92a619dd1614093893e1a09982c08da42259404" end resource "cmark" do url "https://github.com/apple/swift-cmark/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "e95d0b54a0e897e768c9437dd67d56ec887909d0294cf6536ba240accd0d294f" end resource "compiler-rt" do url "https://github.com/apple/swift-compiler-rt/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "1c2da685e8f424cb4460ed1daaf0c308f8deff63e7a3716c8a881cef60fbc7d8" end resource "llbuild" do url "https://github.com/apple/swift-llbuild/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "92001e449b54a47516086a4e7d5f575bffa2847ae1f658540b2ec6f6dee6c6e7" end resource "llvm" do url "https://github.com/apple/swift-llvm/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "a611487a82636142bc1ea8ef5b21401a5c75e57fb0dbf041ef8f2e85a472db2e" end resource "swiftpm" do url "https://github.com/apple/swift-package-manager/archive/swift-4.0.3-RELEASE.tar.gz" sha256 "4c26d333a01c239de8aa96b0536b7ff7218b7a322851a7d3b3b91b59fb4ce244" end # According to the official llvm readme, GCC 4.7+ is required fails_with :gcc_4_0 fails_with :gcc ("4.3".."4.6").each do |n| fails_with :gcc => n end def install workspace = buildpath.parent build = workspace/"build" toolchain_prefix = "/Swift-#{version}.xctoolchain" install_prefix = "#{toolchain_prefix}/usr" ln_sf buildpath, "#{workspace}/swift" resources.each { |r| r.stage("#{workspace}/#{r.name}") } mkdir build do system "#{buildpath}/utils/build-script", "--release", "--assertions", "--no-swift-stdlib-assertions", "--build-subdir=#{build}", "--llbuild", "--swiftpm", "--ios", "--tvos", "--watchos", "--", "--workspace=#{workspace}", "--build-args=-j#{ENV.make_jobs}", "--install-destdir=#{prefix}", "--toolchain-prefix=#{toolchain_prefix}", "--install-prefix=#{install_prefix}", "--host-target=macosx-x86_64", "--build-swift-static-stdlib", "--build-swift-dynamic-stdlib", "--build-swift-dynamic-sdk-overlay", "--build-swift-static-sdk-overlay", "--build-swift-stdlib-unittest-extra", "--install-swift", "--swift-install-components=compiler;clang-resource-dir-symlink;"\ "clang-builtin-headers-in-clang-resource-dir;stdlib;sdk-overlay;tools;"\ "editor-integration;testsuite-tools;toolchain-dev-tools;license;sourcekit-inproc;"\ "sourcekit-xpc-service;swift-remote-mirror;swift-remote-mirror-headers", "--llvm-install-components=clang;libclang;libclang-headers", "--install-llbuild", "--install-swiftpm" end end test do (testpath/"test.swift").write <<~EOS let base = 2 let exponent_inner = 3 let exponent_outer = 4 var answer = 1 for _ in 1...exponent_outer { for _ in 1...exponent_inner { answer *= base } } print("(\\(base)^\\(exponent_inner))^\\(exponent_outer) == \\(answer)") EOS output = shell_output("#{prefix}/Swift-#{version}.xctoolchain/usr/bin/swift test.swift") assert_match "(2^3)^4 == 4096\n", output end end
class TRec < Formula desc "Blazingly fast terminal recorder that generates animated gif images for the web" homepage "https://github.com/sassman/t-rec-rs" url "https://github.com/sassman/t-rec-rs/archive/v0.3.0.tar.gz" sha256 "124248b6a31d2f79175c597712357c8fc3354afd7b992df5d14f4ad8e078cc63" license "GPL-3.0-only" bottle do cellar :any_skip_relocation sha256 "c895fe703a54317c8a9fbeabadf8bbf1910c18f7f7163a818796d5d70c7ace10" => :big_sur sha256 "6039e8741541b9e2a63e98f144f6ed400389d276c8bbba651b0a407fbff9fca4" => :catalina sha256 "83733e285f7bb41e547e117e6e8ee8a5d1a7b1dda87e322006826c0b55fc41e6" => :mojave end depends_on "rust" => :build depends_on "imagemagick" def install system "cargo", "install", *std_cargo_args end test do # let's fetch the window id o = shell_output("#{bin}/t-rec -l | tail -1").strip win_id = o.split(/\s|\n/)[-1] # verify that it's an appropriate id assert_equal win_id && Integer(win_id).positive?, true # verify also error behaviour, as suggested o = shell_output("WINDOWID=999999 #{bin}/t-rec 2>&1", 1).strip assert_equal "Error: Cannot grab screenshot from CGDisplay of window id 999999", o end end t-rec: update 0.3.0 bottle. class TRec < Formula desc "Blazingly fast terminal recorder that generates animated gif images for the web" homepage "https://github.com/sassman/t-rec-rs" url "https://github.com/sassman/t-rec-rs/archive/v0.3.0.tar.gz" sha256 "124248b6a31d2f79175c597712357c8fc3354afd7b992df5d14f4ad8e078cc63" license "GPL-3.0-only" bottle do cellar :any_skip_relocation sha256 "8fd5f00875c39f075ca19d6b6030c5e8f7cbd0085fa1fa627df40af102441c17" => :big_sur sha256 "a32f243bf866f9966e945ced67ebab185763707600422ee1aadd4f00b7a6fde2" => :catalina sha256 "752857bd8be9fcf9cd769411eadff503242e1148ec4916283a9ee8acc66389a5" => :mojave end depends_on "rust" => :build depends_on "imagemagick" def install system "cargo", "install", *std_cargo_args end test do # let's fetch the window id o = shell_output("#{bin}/t-rec -l | tail -1").strip win_id = o.split(/\s|\n/)[-1] # verify that it's an appropriate id assert_equal win_id && Integer(win_id).positive?, true # verify also error behaviour, as suggested o = shell_output("WINDOWID=999999 #{bin}/t-rec 2>&1", 1).strip assert_equal "Error: Cannot grab screenshot from CGDisplay of window id 999999", o end end
t-rec 0.2.2 Closes #64918. Signed-off-by: chenrui <5fd29470147430022ff146db88de16ee91dea376@gmail.com> class TRec < Formula desc "Blazingly fast terminal recorder that generates animated gif images for the web" homepage "https://github.com/sassman/t-rec-rs" url "https://github.com/sassman/t-rec-rs/archive/v0.2.2.tar.gz" sha256 "57c89a5befeaab63201ee45f47d08a1fe3861947478c729a6f4a9318613e01fa" license "GPL-3.0-only" depends_on "rust" => :build depends_on "imagemagick" def install system "cargo", "install", *std_cargo_args end test do # let's fetch the window id o = shell_output("#{bin}/t-rec -l | tail -1").strip win_id = o.split(/\s|\n/)[-1] # verify that it's an appropriate id assert_equal win_id && Integer(win_id).positive?, true # verify also error behaviour, as suggested o = shell_output("WINDOWID=999999 #{bin}/t-rec 2>&1", 1).strip assert_equal "Error: Cannot grab screenshot from CGDisplay of window id 999999", o end end
class Tanka < Formula desc "Flexible, reusable and concise configuration for Kubernetes using Jsonnet" homepage "https://tanka.dev" url "https://github.com/grafana/tanka.git", :tag => "v0.10.0", :revision => "7f5f485a411aa08752fd6ed4847c8013e95f92d1" head "https://github.com/grafana/tanka.git" bottle do cellar :any_skip_relocation sha256 "a54f8f418c6ecdfe47395565087a4cd178e6e1a88e211c9af09ac65088e24125" => :catalina sha256 "e6dea5997e1f3d171eb3ab3dfe3ece611ac47a89b94e46aa679e1ed407a3d475" => :mojave sha256 "c540615f2c51aa62fd70c6b0ca31686c2b24216c5873c0e93520ef349296f8db" => :high_sierra end depends_on "go" => :build depends_on "kubernetes-cli" def install system "make", "static" bin.install "tk" end test do system "git", "clone", "https://github.com/sh0rez/grafana.libsonnet" system "#{bin}/tk", "show", "--dangerous-allow-redirect", "grafana.libsonnet/environments/default" end end tanka: add license class Tanka < Formula desc "Flexible, reusable and concise configuration for Kubernetes using Jsonnet" homepage "https://tanka.dev" url "https://github.com/grafana/tanka.git", :tag => "v0.10.0", :revision => "7f5f485a411aa08752fd6ed4847c8013e95f92d1" license "Apache-2.0" head "https://github.com/grafana/tanka.git" bottle do cellar :any_skip_relocation sha256 "a54f8f418c6ecdfe47395565087a4cd178e6e1a88e211c9af09ac65088e24125" => :catalina sha256 "e6dea5997e1f3d171eb3ab3dfe3ece611ac47a89b94e46aa679e1ed407a3d475" => :mojave sha256 "c540615f2c51aa62fd70c6b0ca31686c2b24216c5873c0e93520ef349296f8db" => :high_sierra end depends_on "go" => :build depends_on "kubernetes-cli" def install system "make", "static" bin.install "tk" end test do system "git", "clone", "https://github.com/sh0rez/grafana.libsonnet" system "#{bin}/tk", "show", "--dangerous-allow-redirect", "grafana.libsonnet/environments/default" end end
class Tdlib < Formula desc "Cross-platform library for building Telegram clients" homepage "https://core.telegram.org/tdlib" url "https://github.com/tdlib/td/archive/v1.6.0.tar.gz" sha256 "9dce57a96f9d4bac8f99aab13ef5cbf6fed04b234a5d22dfa7ef7dce06ea43f8" license "BSL-1.0" bottle do cellar :any sha256 "c1a28a0f9a80fb62b6ac8a30fffcaf413336e9df49f79f9f952ae38c8840becf" => :catalina sha256 "08507a9bf3c9f93ff97666fe9478398768f135e7943145a82946e008acf543e7" => :mojave sha256 "12ce0917663736dc4790482c5545a6bee2b82dd7b304ab401c4232ba5d14a3f3" => :high_sierra end depends_on "cmake" => :build depends_on "gperf" depends_on "openssl@1.1" depends_on "readline" def install mkdir "build" do system "cmake", "..", *std_cmake_args system "cmake", ".", *std_cmake_args system "make", "install" end end test do (testpath/"tdjson_example.cpp").write <<~EOS #include "td/telegram/td_json_client.h" #include <iostream> int main() { void* client = td_json_client_create(); if (!client) return 1; std::cout << "Client created: " << client; return 0; } EOS system ENV.cxx, "tdjson_example.cpp", "-L#{lib}", "-ltdjson", "-o", "tdjson_example" assert_match "Client created", shell_output("./tdjson_example") end end tdlib: add head build (#61640) class Tdlib < Formula desc "Cross-platform library for building Telegram clients" homepage "https://core.telegram.org/tdlib" url "https://github.com/tdlib/td/archive/v1.6.0.tar.gz" sha256 "9dce57a96f9d4bac8f99aab13ef5cbf6fed04b234a5d22dfa7ef7dce06ea43f8" license "BSL-1.0" head "https://github.com/tdlib/td.git" bottle do cellar :any sha256 "c1a28a0f9a80fb62b6ac8a30fffcaf413336e9df49f79f9f952ae38c8840becf" => :catalina sha256 "08507a9bf3c9f93ff97666fe9478398768f135e7943145a82946e008acf543e7" => :mojave sha256 "12ce0917663736dc4790482c5545a6bee2b82dd7b304ab401c4232ba5d14a3f3" => :high_sierra end depends_on "cmake" => :build depends_on "gperf" depends_on "openssl@1.1" depends_on "readline" def install mkdir "build" do system "cmake", "..", *std_cmake_args system "cmake", ".", *std_cmake_args system "make", "install" end end test do (testpath/"tdjson_example.cpp").write <<~EOS #include "td/telegram/td_json_client.h" #include <iostream> int main() { void* client = td_json_client_create(); if (!client) return 1; std::cout << "Client created: " << client; return 0; } EOS system ENV.cxx, "tdjson_example.cpp", "-L#{lib}", "-ltdjson", "-o", "tdjson_example" assert_match "Client created", shell_output("./tdjson_example") end end
class Tfsec < Formula desc "Static analysis powered security scanner for your terraform code" homepage "https://github.com/tfsec/tfsec" url "https://github.com/tfsec/tfsec/archive/v0.39.26.tar.gz" sha256 "06caee8a4214d62ebbebf76142f3c755ef3438eef7ea31ed409a339ac5f7f08c" license "MIT" livecheck do url :stable strategy :github_latest end bottle do sha256 cellar: :any_skip_relocation, arm64_big_sur: "daaa3b490742bc0dcc52d4694d189fbf7fb15b180d2a122e4967d5377130c10d" sha256 cellar: :any_skip_relocation, big_sur: "5b3041bb66ad87896e523d46b6114b2eb1590a4b87bbbb0534a3e27c08a8a695" sha256 cellar: :any_skip_relocation, catalina: "303965e7ae202f72eea584dcf72b92c05a6ae7bb0d559efbb33c23b368f29f88" sha256 cellar: :any_skip_relocation, mojave: "9b2ff3d935a0cb62fa97424b1671cad93c1acf8861621dfb3f131c8b41ece4fc" end depends_on "go" => :build def install system "scripts/install.sh", "v#{version}" bin.install "tfsec" end test do (testpath/"good/brew-validate.tf").write <<~EOS resource "aws_alb_listener" "my-alb-listener" { port = "443" protocol = "HTTPS" } EOS (testpath/"bad/brew-validate.tf").write <<~EOS } EOS good_output = shell_output("#{bin}/tfsec #{testpath}/good") assert_match "No problems detected!", good_output refute_match("WARNING", good_output) bad_output = shell_output("#{bin}/tfsec #{testpath}/bad 2>&1") assert_match "WARNING", bad_output end end tfsec: update 0.39.26 bottle. class Tfsec < Formula desc "Static analysis powered security scanner for your terraform code" homepage "https://github.com/tfsec/tfsec" url "https://github.com/tfsec/tfsec/archive/v0.39.26.tar.gz" sha256 "06caee8a4214d62ebbebf76142f3c755ef3438eef7ea31ed409a339ac5f7f08c" license "MIT" livecheck do url :stable strategy :github_latest end bottle do sha256 cellar: :any_skip_relocation, arm64_big_sur: "daaa3b490742bc0dcc52d4694d189fbf7fb15b180d2a122e4967d5377130c10d" sha256 cellar: :any_skip_relocation, big_sur: "5b3041bb66ad87896e523d46b6114b2eb1590a4b87bbbb0534a3e27c08a8a695" sha256 cellar: :any_skip_relocation, catalina: "303965e7ae202f72eea584dcf72b92c05a6ae7bb0d559efbb33c23b368f29f88" sha256 cellar: :any_skip_relocation, mojave: "9b2ff3d935a0cb62fa97424b1671cad93c1acf8861621dfb3f131c8b41ece4fc" sha256 cellar: :any_skip_relocation, x86_64_linux: "fa574a8f9c00a3cb714c8658d3c6fc2d2b492129d2f0cbeb030a41c478c38aa2" end depends_on "go" => :build def install system "scripts/install.sh", "v#{version}" bin.install "tfsec" end test do (testpath/"good/brew-validate.tf").write <<~EOS resource "aws_alb_listener" "my-alb-listener" { port = "443" protocol = "HTTPS" } EOS (testpath/"bad/brew-validate.tf").write <<~EOS } EOS good_output = shell_output("#{bin}/tfsec #{testpath}/good") assert_match "No problems detected!", good_output refute_match("WARNING", good_output) bad_output = shell_output("#{bin}/tfsec #{testpath}/bad 2>&1") assert_match "WARNING", bad_output end end
class Toast < Formula desc "Tool for running tasks in containers" homepage "https://github.com/stepchowfun/toast" url "https://github.com/stepchowfun/toast/archive/v0.29.0.tar.gz" sha256 "ca119d05c236900d8e99edc6ede52d77e8371b1ea5d85b597417a71cb567da3c" bottle do cellar :any_skip_relocation sha256 "61c148156aa592cb33d4465b18ce81d2ca528c8cc524499e6ead8bb051cbc64c" => :catalina sha256 "34d9e8efd3a91ee82c9ff509b2abeb1d017c4ac8aa798705c86c7eb394458e3a" => :mojave sha256 "5e43e3bbd518846007f88539d2826344b84c5ab10d156bceb56207efa6fa1a5f" => :high_sierra end depends_on "rust" => :build def install system "cargo", "install", "--root", prefix, "--path", "." end test do (testpath/"toast.yml").write <<~EOS image: alpine tasks: homebrew_test: command: echo hello EOS assert_match "homebrew_test", shell_output("#{bin}/toast --list") end end toast: update 0.29.0 bottle. Closes #16727. Signed-off-by: Michka Popoff <7b0496f66f66ee22a38826c310c38b415671b832@gmail.com> class Toast < Formula desc "Tool for running tasks in containers" homepage "https://github.com/stepchowfun/toast" url "https://github.com/stepchowfun/toast/archive/v0.29.0.tar.gz" sha256 "ca119d05c236900d8e99edc6ede52d77e8371b1ea5d85b597417a71cb567da3c" bottle do cellar :any_skip_relocation sha256 "61c148156aa592cb33d4465b18ce81d2ca528c8cc524499e6ead8bb051cbc64c" => :catalina sha256 "34d9e8efd3a91ee82c9ff509b2abeb1d017c4ac8aa798705c86c7eb394458e3a" => :mojave sha256 "5e43e3bbd518846007f88539d2826344b84c5ab10d156bceb56207efa6fa1a5f" => :high_sierra sha256 "fa469747cfc5db43c22baefdc1cb936dff0eba25ce2c41b829fdab5b80b22205" => :x86_64_linux end depends_on "rust" => :build def install system "cargo", "install", "--root", prefix, "--path", "." end test do (testpath/"toast.yml").write <<~EOS image: alpine tasks: homebrew_test: command: echo hello EOS assert_match "homebrew_test", shell_output("#{bin}/toast --list") end end
class Trzsz < Formula include Language::Python::Virtualenv desc "Simple file transfer tools, similar to lrzsz (rz/sz), and compatible with tmux" homepage "https://trzsz.github.io" url "https://files.pythonhosted.org/packages/1a/73/dfeb828f96ce7a395fe38ce72f29b0e7fe3c43348f946ca7d3806a79e1a0/trzsz-1.1.0.tar.gz" sha256 "4e0d1b8afb8912d351e0de997f8f1e557298b547a6daac03c6a60282962ada72" license "MIT" bottle do rebuild 1 sha256 cellar: :any_skip_relocation, arm64_monterey: "07154f877574bbf3fee21b8e6a13358473b3bd0d0d45130924042a004a1dbd53" sha256 cellar: :any_skip_relocation, arm64_big_sur: "8c64bd93a5b3d27d0906f0e72b0c24ab4b9376da99bd744102ee5e865523b490" sha256 cellar: :any_skip_relocation, monterey: "f398dfd1819a386aba368ae0b3d9d2f8faf05a2f5534a75463588b6226106432" sha256 cellar: :any_skip_relocation, big_sur: "544b91290504a9dd32eb95cd8088286fd47bbcb04cfd8ed87b2b78b73d265356" sha256 cellar: :any_skip_relocation, catalina: "afc42b34487bfced6811239e7e0ba531a61b3d6a7f3871148f2216c60853f3b8" sha256 cellar: :any_skip_relocation, x86_64_linux: "34ec912a61b25e0d9b45afa6c72af31ef3d987f9479ab134ab483314f5157549" end depends_on "protobuf" depends_on "python@3.11" resource "iterm2" do url "https://files.pythonhosted.org/packages/4f/eb/47bb125fd3b32969f3bc8e0b8997bbe308484ac4d04331ae1e6199ae2c0f/iterm2-2.7.tar.gz" sha256 "f6f0bec46c32cecaf7be7fd82296ec4697d4bf2101f0c4aab24cc123991fa230" end resource "trzsz-iterm2" do url "https://files.pythonhosted.org/packages/9a/26/6f8505a1908efde7b771ba365beaf7c627fcb96e27691d380d9dc0272b72/trzsz-iterm2-1.1.0.tar.gz" sha256 "89f37b641528893ce529adf02e754f6d083379d4c9016590669f329b754f0966" end resource "trzsz-libs" do url "https://files.pythonhosted.org/packages/3f/75/c52618d862018af7ca1923be2b63d2cf7845f69da38970088fd64bb071e5/trzsz-libs-1.1.0.tar.gz" sha256 "f116a18d6429be74ff6a321e9a6b0b59afecc5d62bf27c9f17bd63a39b31633c" end resource "trzsz-svr" do url "https://files.pythonhosted.org/packages/eb/82/39f3144bd3584f7ecc5f23fa5f929d5cba8135ec690bfcbceae02490448f/trzsz-svr-1.1.0.tar.gz" sha256 "057ba12437f72e92b95087d6699ba9849d6f1a41286d9e9c7539a603d22a22fc" end resource "websockets" do url "https://files.pythonhosted.org/packages/85/dc/549a807a53c13fd4a8dac286f117a7a71260defea9ec0c05d6027f2ae273/websockets-10.4.tar.gz" sha256 "eef610b23933c54d5d921c92578ae5f89813438fded840c2e9809d378dc765d3" end def install virtualenv_install_with_resources bin.install_symlink libexec/"bin/trz" bin.install_symlink libexec/"bin/tsz" bin.install_symlink libexec/"bin/trzsz-iterm2" end test do assert_match "trz (trzsz) py #{version}", shell_output("#{bin}/trz -v") assert_match "tsz (trzsz) py #{version}", shell_output("#{bin}/tsz -v") assert_match "trzsz-iterm2 (trzsz) py #{version}", shell_output("#{bin}/trzsz-iterm2 -v") touch "tmpfile" assert_match "Not a directory", shell_output("#{bin}/trz tmpfile 2>&1") rm "tmpfile" assert_match "No such file", shell_output("#{bin}/tsz tmpfile 2>&1") assert_match "arguments are required", shell_output("#{bin}/trzsz-iterm2 2>&1", 2) end end trzsz: update 1.1.0 bottle. class Trzsz < Formula include Language::Python::Virtualenv desc "Simple file transfer tools, similar to lrzsz (rz/sz), and compatible with tmux" homepage "https://trzsz.github.io" url "https://files.pythonhosted.org/packages/1a/73/dfeb828f96ce7a395fe38ce72f29b0e7fe3c43348f946ca7d3806a79e1a0/trzsz-1.1.0.tar.gz" sha256 "4e0d1b8afb8912d351e0de997f8f1e557298b547a6daac03c6a60282962ada72" license "MIT" bottle do rebuild 1 sha256 cellar: :any_skip_relocation, arm64_ventura: "3f2338f18c26ef9115ad67c2338b8cd07139113e89e2a40e0eaa7b696de2b8cf" sha256 cellar: :any_skip_relocation, arm64_monterey: "07154f877574bbf3fee21b8e6a13358473b3bd0d0d45130924042a004a1dbd53" sha256 cellar: :any_skip_relocation, arm64_big_sur: "8c64bd93a5b3d27d0906f0e72b0c24ab4b9376da99bd744102ee5e865523b490" sha256 cellar: :any_skip_relocation, monterey: "f398dfd1819a386aba368ae0b3d9d2f8faf05a2f5534a75463588b6226106432" sha256 cellar: :any_skip_relocation, big_sur: "544b91290504a9dd32eb95cd8088286fd47bbcb04cfd8ed87b2b78b73d265356" sha256 cellar: :any_skip_relocation, catalina: "afc42b34487bfced6811239e7e0ba531a61b3d6a7f3871148f2216c60853f3b8" sha256 cellar: :any_skip_relocation, x86_64_linux: "34ec912a61b25e0d9b45afa6c72af31ef3d987f9479ab134ab483314f5157549" end depends_on "protobuf" depends_on "python@3.11" resource "iterm2" do url "https://files.pythonhosted.org/packages/4f/eb/47bb125fd3b32969f3bc8e0b8997bbe308484ac4d04331ae1e6199ae2c0f/iterm2-2.7.tar.gz" sha256 "f6f0bec46c32cecaf7be7fd82296ec4697d4bf2101f0c4aab24cc123991fa230" end resource "trzsz-iterm2" do url "https://files.pythonhosted.org/packages/9a/26/6f8505a1908efde7b771ba365beaf7c627fcb96e27691d380d9dc0272b72/trzsz-iterm2-1.1.0.tar.gz" sha256 "89f37b641528893ce529adf02e754f6d083379d4c9016590669f329b754f0966" end resource "trzsz-libs" do url "https://files.pythonhosted.org/packages/3f/75/c52618d862018af7ca1923be2b63d2cf7845f69da38970088fd64bb071e5/trzsz-libs-1.1.0.tar.gz" sha256 "f116a18d6429be74ff6a321e9a6b0b59afecc5d62bf27c9f17bd63a39b31633c" end resource "trzsz-svr" do url "https://files.pythonhosted.org/packages/eb/82/39f3144bd3584f7ecc5f23fa5f929d5cba8135ec690bfcbceae02490448f/trzsz-svr-1.1.0.tar.gz" sha256 "057ba12437f72e92b95087d6699ba9849d6f1a41286d9e9c7539a603d22a22fc" end resource "websockets" do url "https://files.pythonhosted.org/packages/85/dc/549a807a53c13fd4a8dac286f117a7a71260defea9ec0c05d6027f2ae273/websockets-10.4.tar.gz" sha256 "eef610b23933c54d5d921c92578ae5f89813438fded840c2e9809d378dc765d3" end def install virtualenv_install_with_resources bin.install_symlink libexec/"bin/trz" bin.install_symlink libexec/"bin/tsz" bin.install_symlink libexec/"bin/trzsz-iterm2" end test do assert_match "trz (trzsz) py #{version}", shell_output("#{bin}/trz -v") assert_match "tsz (trzsz) py #{version}", shell_output("#{bin}/tsz -v") assert_match "trzsz-iterm2 (trzsz) py #{version}", shell_output("#{bin}/trzsz-iterm2 -v") touch "tmpfile" assert_match "Not a directory", shell_output("#{bin}/trz tmpfile 2>&1") rm "tmpfile" assert_match "No such file", shell_output("#{bin}/tsz tmpfile 2>&1") assert_match "arguments are required", shell_output("#{bin}/trzsz-iterm2 2>&1", 2) end end
class Tsuru < Formula desc "tsuru-client is a tsuru command line tool for application developers." homepage "https://docs.tsuru.io/stable/" url "https://github.com/tsuru/tsuru-client/releases/download/1.2.0/tsuru_1.2.0_macOS_amd64.tar.gz" version "1.2.0" sha256 "da6a6b99aa25d14c8c9eb022c260f4085b230ea90144f9d8ba5f232fb959f404" def install bin.install "tsuru" bash_completion.install "misc/bash-completion" => "tsuru" zsh_completion.install "misc/zsh-completion" => "tsuru" end devel do url "https://github.com/tsuru/tsuru-client/releases/download/1.3.0-rc2/tsuru_1.3.0-rc2_macOS_amd64.tar.gz" sha256 "d5ec0c88094f623c96b9a2ab998171b4b85c43f4c192b01ed1fddaba51b88a4f" ENV['TSURU_DEVEL'] = "true" end end manually sets devel version to 1.3.0-rc2 class Tsuru < Formula desc "tsuru-client is a tsuru command line tool for application developers." homepage "https://docs.tsuru.io/stable/" url "https://github.com/tsuru/tsuru-client/releases/download/1.2.0/tsuru_1.2.0_macOS_amd64.tar.gz" version "1.2.0" sha256 "da6a6b99aa25d14c8c9eb022c260f4085b230ea90144f9d8ba5f232fb959f404" def install bin.install "tsuru" bash_completion.install "misc/bash-completion" => "tsuru" zsh_completion.install "misc/zsh-completion" => "tsuru" end devel do url "https://github.com/tsuru/tsuru-client/releases/download/1.3.0-rc2/tsuru_1.3.0-rc2_macOS_amd64.tar.gz" version "1.3.0-rc2" sha256 "d5ec0c88094f623c96b9a2ab998171b4b85c43f4c192b01ed1fddaba51b88a4f" ENV['TSURU_DEVEL'] = "true" end end
# This file was generated by GoReleaser. DO NOT EDIT. class Tsuru < Formula desc "tsuru-client is a tsuru command line tool for application developers." homepage "https://docs.tsuru.io/stable/" version "1.9.4" bottle :unneeded if OS.mac? url "https://github.com/tsuru/tsuru-client/releases/download/1.9.4/tsuru_1.9.4_macOS_amd64.tar.gz" sha256 "3185d90ba605fbfdc29f050dd3ab3fd46a3a904419046b49582f663bf05b8d25" end if OS.linux? && Hardware::CPU.intel? url "https://github.com/tsuru/tsuru-client/releases/download/1.9.4/tsuru_1.9.4_linux_amd64.tar.gz" sha256 "447ea2909a3f432fa4f66f81d536dfdd1ea40bcd25596bee78958e34c89e76c6" end def install bin.install "tsuru" bash_completion.install "misc/bash-completion" => "tsuru" zsh_completion.install "misc/zsh-completion" => "tsuru" end end Brew formula update for tsuru version 1.9.4 # This file was generated by GoReleaser. DO NOT EDIT. class Tsuru < Formula desc "tsuru-client is a tsuru command line tool for application developers." homepage "https://docs.tsuru.io/stable/" version "1.9.4" bottle :unneeded if OS.mac? url "https://github.com/tsuru/tsuru-client/releases/download/1.9.4/tsuru_1.9.4_macOS_amd64.tar.gz" sha256 "bb5ef01ac664f851d9a44f71eb47e2794496ff3a5720f69c337828a8686eb25a" end if OS.linux? && Hardware::CPU.intel? url "https://github.com/tsuru/tsuru-client/releases/download/1.9.4/tsuru_1.9.4_linux_amd64.tar.gz" sha256 "7535e7f0c159d1435cfff41c1c14d5afa12382480bbfb6a467c09b6d730eaff6" end def install bin.install "tsuru" bash_completion.install "misc/bash-completion" => "tsuru" zsh_completion.install "misc/zsh-completion" => "tsuru" end end
require "formula" class Tutum < Formula homepage "https://www.tutum.co/" url "https://github.com/tutumcloud/tutum-cli/archive/0.10.1.tar.gz" sha1 "3fce5453dd1dcc2879f0881a8281d3dcf132c187" bottle do cellar :any sha1 "e08f3c6648f97530e17dabc6adaedb46850570ca" => :yosemite sha1 "6fd1d204d5d308c08df4440e452a18155a2b1bdb" => :mavericks sha1 "f5f71249db2fd3f5ca8cdd4f970039a85013d51c" => :mountain_lion end depends_on :python if MacOS.version <= :snow_leopard depends_on "libyaml" resource "pyyaml" do url "https://pypi.python.org/packages/source/P/PyYAML/PyYAML-3.10.tar.gz" sha1 "476dcfbcc6f4ebf3c06186229e8e2bd7d7b20e73" end resource "requests" do url "https://pypi.python.org/packages/source/r/requests/requests-2.4.3.tar.gz" sha1 "411f1bfa44556f7dd0f34cd822047c31baa7d741" end resource "ago" do url "https://pypi.python.org/packages/source/a/ago/ago-0.0.6.tar.gz" sha1 "b48b99151370de0c1642748a3f3b206649645d8d" end resource "docker-py" do url "https://pypi.python.org/packages/source/d/docker-py/docker-py-0.5.3.tar.gz" sha1 "11708a7021e3d0d522e145c057256d7d2acaec07" end resource "python-dateutil" do url "https://pypi.python.org/packages/source/p/python-dateutil/python-dateutil-2.2.tar.gz" sha1 "fbafcd19ea0082b3ecb17695b4cb46070181699f" end resource "python-tutum" do url "https://pypi.python.org/packages/source/p/python-tutum/python-tutum-0.10.0.tar.gz" sha1 "844d2e924a4ecb59a7a7c5887dc2c3448f003908" end resource "six" do url "https://pypi.python.org/packages/source/s/six/six-1.8.0.tar.gz" sha1 "aa3b0659cbc85c6c7a91efc51f2d1007040070cd" end resource "tabulate" do url "https://pypi.python.org/packages/source/t/tabulate/tabulate-0.7.2.tar.gz" sha1 "da057c6d4faab9847436c3221c98f34911e623df" end def install ENV["PYTHONPATH"] = lib+"python2.7/site-packages" ENV.prepend_create_path "PYTHONPATH", libexec+"lib/python2.7/site-packages" ENV.prepend_create_path "PYTHONPATH", prefix+"lib/python2.7/site-packages" resources.each do |r| r.stage { system "python", "setup.py", "install", "--prefix=#{libexec}" } end system "python", "setup.py", "install", "--prefix=#{prefix}" rm "#{lib}/python2.7/site-packages/site.py" rm "#{lib}/python2.7/site-packages/easy-install.pth" bin.env_script_all_files(libexec+"bin", :PYTHONPATH => ENV["PYTHONPATH"]) end test do system "#{bin}/tutum", "container" end end tutum 0.10.5 Closes Homebrew/homebrew#34370. Signed-off-by: Mike McQuaid <a17fed27eaa842282862ff7c1b9c8395a26ac320@mikemcquaid.com> require "formula" class Tutum < Formula homepage "https://www.tutum.co/" url "https://github.com/tutumcloud/tutum-cli/archive/v0.10.5.tar.gz" sha1 "82238e8eba3a69879a523dd348baf9d47d00eba5" bottle do cellar :any sha1 "e08f3c6648f97530e17dabc6adaedb46850570ca" => :yosemite sha1 "6fd1d204d5d308c08df4440e452a18155a2b1bdb" => :mavericks sha1 "f5f71249db2fd3f5ca8cdd4f970039a85013d51c" => :mountain_lion end depends_on :python if MacOS.version <= :snow_leopard depends_on "libyaml" resource "pyyaml" do url "https://pypi.python.org/packages/source/P/PyYAML/PyYAML-3.10.tar.gz" sha1 "476dcfbcc6f4ebf3c06186229e8e2bd7d7b20e73" end resource "requests" do url "https://pypi.python.org/packages/source/r/requests/requests-2.4.3.tar.gz" sha1 "411f1bfa44556f7dd0f34cd822047c31baa7d741" end resource "ago" do url "https://pypi.python.org/packages/source/a/ago/ago-0.0.6.tar.gz" sha1 "b48b99151370de0c1642748a3f3b206649645d8d" end resource "docker-py" do url "https://pypi.python.org/packages/source/d/docker-py/docker-py-0.5.3.tar.gz" sha1 "11708a7021e3d0d522e145c057256d7d2acaec07" end resource "python-dateutil" do url "https://pypi.python.org/packages/source/p/python-dateutil/python-dateutil-2.2.tar.gz" sha1 "fbafcd19ea0082b3ecb17695b4cb46070181699f" end resource "python-tutum" do url "https://pypi.python.org/packages/source/p/python-tutum/python-tutum-0.10.5.tar.gz" sha1 "4e14fd392f69e0efd91f05f7a9dfc257677eb04f" end resource "six" do url "https://pypi.python.org/packages/source/s/six/six-1.8.0.tar.gz" sha1 "aa3b0659cbc85c6c7a91efc51f2d1007040070cd" end resource "tabulate" do url "https://pypi.python.org/packages/source/t/tabulate/tabulate-0.7.2.tar.gz" sha1 "da057c6d4faab9847436c3221c98f34911e623df" end def install ENV["PYTHONPATH"] = lib+"python2.7/site-packages" ENV.prepend_create_path "PYTHONPATH", libexec+"lib/python2.7/site-packages" ENV.prepend_create_path "PYTHONPATH", prefix+"lib/python2.7/site-packages" resources.each do |r| r.stage { system "python", "setup.py", "install", "--prefix=#{libexec}" } end system "python", "setup.py", "install", "--prefix=#{prefix}" rm "#{lib}/python2.7/site-packages/site.py" rm "#{lib}/python2.7/site-packages/easy-install.pth" bin.env_script_all_files(libexec+"bin", :PYTHONPATH => ENV["PYTHONPATH"]) end test do system "#{bin}/tutum", "container" end end
class Twarc < Formula include Language::Python::Virtualenv desc "Command-line tool and Python library for archiving Twitter JSON" homepage "https://github.com/DocNow/twarc" url "https://files.pythonhosted.org/packages/65/33/78a142c960c38e986c1d4aeb4206fbd57ac09f83c25638cfcb4ba0751e91/twarc-2.0.3.tar.gz" sha256 "fe29e0740f207768ba99c5e794479d300ad25b90d4c3de48cbbba8e4759acf2e" license "MIT" bottle do sha256 cellar: :any_skip_relocation, arm64_big_sur: "20c9920d4eb9e7ff0a19c13cb01b055a8ef68ad20dec38207915fa9606b72785" sha256 cellar: :any_skip_relocation, big_sur: "46cc1302f38f11db9f0ace0ed15b6bb3092664f8e0584a76f2cecea136512f59" sha256 cellar: :any_skip_relocation, catalina: "6029b15cd6fe4c27ed0cbe21aea2168e4837e694eddce660137987397c491e7e" sha256 cellar: :any_skip_relocation, mojave: "8b41c8ebf75a7db33fb0ace941d9238c7b4061789a138abaaf12fdd7a5aefd0e" end depends_on "python@3.9" resource "certifi" do url "https://files.pythonhosted.org/packages/06/a9/cd1fd8ee13f73a4d4f491ee219deeeae20afefa914dfb4c130cfc9dc397a/certifi-2020.12.5.tar.gz" sha256 "1a4995114262bffbc2413b159f2a1a480c969de6e6eb13ee966d470af86af59c" end resource "chardet" do url "https://files.pythonhosted.org/packages/ee/2d/9cdc2b527e127b4c9db64b86647d567985940ac3698eeabc7ffaccb4ea61/chardet-4.0.0.tar.gz" sha256 "0d6f53a15db4120f2b08c94f11e7d93d2c911ee118b6b30a04ec3ee8310179fa" end resource "click" do url "https://files.pythonhosted.org/packages/27/6f/be940c8b1f1d69daceeb0032fee6c34d7bd70e3e649ccac0951500b4720e/click-7.1.2.tar.gz" sha256 "d2b5255c7c6349bc1bd1e59e08cd12acbbd63ce649f2588755783aa94dfb6b1a" end resource "click-config-file" do url "https://files.pythonhosted.org/packages/13/09/dfee76b0d2600ae8bd65e9cc375b6de62f6ad5600616a78ee6209a9f17f3/click_config_file-0.6.0.tar.gz" sha256 "ded6ec1a73c41280727ec9c06031e929cdd8a5946bf0f99c0c3db3a71793d515" end resource "click-plugins" do url "https://files.pythonhosted.org/packages/5f/1d/45434f64ed749540af821fd7e42b8e4d23ac04b1eda7c26613288d6cd8a8/click-plugins-1.1.1.tar.gz" sha256 "46ab999744a9d831159c3411bb0c79346d94a444df9a3a3742e9ed63645f264b" end resource "configobj" do url "https://files.pythonhosted.org/packages/64/61/079eb60459c44929e684fa7d9e2fdca403f67d64dd9dbac27296be2e0fab/configobj-5.0.6.tar.gz" sha256 "a2f5650770e1c87fb335af19a9b7eb73fc05ccf22144eb68db7d00cd2bcb0902" end resource "idna" do url "https://files.pythonhosted.org/packages/ea/b7/e0e3c1c467636186c39925827be42f16fee389dc404ac29e930e9136be70/idna-2.10.tar.gz" sha256 "b307872f855b18632ce0c21c5e45be78c0ea7ae4c15c828c20788b26921eb3f6" end resource "oauthlib" do url "https://files.pythonhosted.org/packages/fc/c7/829c73c64d3749da7811c06319458e47f3461944da9d98bb4df1cb1598c2/oauthlib-3.1.0.tar.gz" sha256 "bee41cc35fcca6e988463cacc3bcb8a96224f470ca547e697b604cc697b2f889" end resource "python-dateutil" do url "https://files.pythonhosted.org/packages/be/ed/5bbc91f03fa4c839c4c7360375da77f9659af5f7086b7a7bdda65771c8e0/python-dateutil-2.8.1.tar.gz" sha256 "73ebfe9dbf22e832286dafa60473e4cd239f8592f699aa5adaf10050e6e1823c" end resource "requests" do url "https://files.pythonhosted.org/packages/6b/47/c14abc08432ab22dc18b9892252efaf005ab44066de871e72a38d6af464b/requests-2.25.1.tar.gz" sha256 "27973dd4a904a4f13b263a19c866c13b92a39ed1c964655f025f3f8d3d75b804" end resource "requests-oauthlib" do url "https://files.pythonhosted.org/packages/23/eb/68fc8fa86e0f5789832f275c8289257d8dc44dbe93fce7ff819112b9df8f/requests-oauthlib-1.3.0.tar.gz" sha256 "b4261601a71fd721a8bd6d7aa1cc1d6a8a93b4a9f5e96626f8e4d91e8beeaa6a" end resource "six" do url "https://files.pythonhosted.org/packages/6b/34/415834bfdafca3c5f451532e8a8d9ba89a21c9743a0c59fbd0205c7f9426/six-1.15.0.tar.gz" sha256 "30639c035cdb23534cd4aa2dd52c3bf48f06e5f4a941509c8bafd8ce11080259" end resource "urllib3" do url "https://files.pythonhosted.org/packages/cb/cf/871177f1fc795c6c10787bc0e1f27bb6cf7b81dbde399fd35860472cecbc/urllib3-1.26.4.tar.gz" sha256 "e7b021f7241115872f92f43c6508082facffbd1c048e3c6e2bb9c2a157e28937" end def install virtualenv_install_with_resources end test do assert_equal "usage: twarc [-h] [--log LOG] [--consumer_key CONSUMER_KEY]", shell_output("#{bin}/twarc -h").chomp.split("\n").first end end twarc: update 2.0.3 bottle. class Twarc < Formula include Language::Python::Virtualenv desc "Command-line tool and Python library for archiving Twitter JSON" homepage "https://github.com/DocNow/twarc" url "https://files.pythonhosted.org/packages/65/33/78a142c960c38e986c1d4aeb4206fbd57ac09f83c25638cfcb4ba0751e91/twarc-2.0.3.tar.gz" sha256 "fe29e0740f207768ba99c5e794479d300ad25b90d4c3de48cbbba8e4759acf2e" license "MIT" bottle do sha256 cellar: :any_skip_relocation, arm64_big_sur: "20c9920d4eb9e7ff0a19c13cb01b055a8ef68ad20dec38207915fa9606b72785" sha256 cellar: :any_skip_relocation, big_sur: "46cc1302f38f11db9f0ace0ed15b6bb3092664f8e0584a76f2cecea136512f59" sha256 cellar: :any_skip_relocation, catalina: "6029b15cd6fe4c27ed0cbe21aea2168e4837e694eddce660137987397c491e7e" sha256 cellar: :any_skip_relocation, mojave: "8b41c8ebf75a7db33fb0ace941d9238c7b4061789a138abaaf12fdd7a5aefd0e" sha256 cellar: :any_skip_relocation, x86_64_linux: "1e860ce1bb55330bacf34bfb9576153776ce26c5c16a8daddbb3451769491074" end depends_on "python@3.9" resource "certifi" do url "https://files.pythonhosted.org/packages/06/a9/cd1fd8ee13f73a4d4f491ee219deeeae20afefa914dfb4c130cfc9dc397a/certifi-2020.12.5.tar.gz" sha256 "1a4995114262bffbc2413b159f2a1a480c969de6e6eb13ee966d470af86af59c" end resource "chardet" do url "https://files.pythonhosted.org/packages/ee/2d/9cdc2b527e127b4c9db64b86647d567985940ac3698eeabc7ffaccb4ea61/chardet-4.0.0.tar.gz" sha256 "0d6f53a15db4120f2b08c94f11e7d93d2c911ee118b6b30a04ec3ee8310179fa" end resource "click" do url "https://files.pythonhosted.org/packages/27/6f/be940c8b1f1d69daceeb0032fee6c34d7bd70e3e649ccac0951500b4720e/click-7.1.2.tar.gz" sha256 "d2b5255c7c6349bc1bd1e59e08cd12acbbd63ce649f2588755783aa94dfb6b1a" end resource "click-config-file" do url "https://files.pythonhosted.org/packages/13/09/dfee76b0d2600ae8bd65e9cc375b6de62f6ad5600616a78ee6209a9f17f3/click_config_file-0.6.0.tar.gz" sha256 "ded6ec1a73c41280727ec9c06031e929cdd8a5946bf0f99c0c3db3a71793d515" end resource "click-plugins" do url "https://files.pythonhosted.org/packages/5f/1d/45434f64ed749540af821fd7e42b8e4d23ac04b1eda7c26613288d6cd8a8/click-plugins-1.1.1.tar.gz" sha256 "46ab999744a9d831159c3411bb0c79346d94a444df9a3a3742e9ed63645f264b" end resource "configobj" do url "https://files.pythonhosted.org/packages/64/61/079eb60459c44929e684fa7d9e2fdca403f67d64dd9dbac27296be2e0fab/configobj-5.0.6.tar.gz" sha256 "a2f5650770e1c87fb335af19a9b7eb73fc05ccf22144eb68db7d00cd2bcb0902" end resource "idna" do url "https://files.pythonhosted.org/packages/ea/b7/e0e3c1c467636186c39925827be42f16fee389dc404ac29e930e9136be70/idna-2.10.tar.gz" sha256 "b307872f855b18632ce0c21c5e45be78c0ea7ae4c15c828c20788b26921eb3f6" end resource "oauthlib" do url "https://files.pythonhosted.org/packages/fc/c7/829c73c64d3749da7811c06319458e47f3461944da9d98bb4df1cb1598c2/oauthlib-3.1.0.tar.gz" sha256 "bee41cc35fcca6e988463cacc3bcb8a96224f470ca547e697b604cc697b2f889" end resource "python-dateutil" do url "https://files.pythonhosted.org/packages/be/ed/5bbc91f03fa4c839c4c7360375da77f9659af5f7086b7a7bdda65771c8e0/python-dateutil-2.8.1.tar.gz" sha256 "73ebfe9dbf22e832286dafa60473e4cd239f8592f699aa5adaf10050e6e1823c" end resource "requests" do url "https://files.pythonhosted.org/packages/6b/47/c14abc08432ab22dc18b9892252efaf005ab44066de871e72a38d6af464b/requests-2.25.1.tar.gz" sha256 "27973dd4a904a4f13b263a19c866c13b92a39ed1c964655f025f3f8d3d75b804" end resource "requests-oauthlib" do url "https://files.pythonhosted.org/packages/23/eb/68fc8fa86e0f5789832f275c8289257d8dc44dbe93fce7ff819112b9df8f/requests-oauthlib-1.3.0.tar.gz" sha256 "b4261601a71fd721a8bd6d7aa1cc1d6a8a93b4a9f5e96626f8e4d91e8beeaa6a" end resource "six" do url "https://files.pythonhosted.org/packages/6b/34/415834bfdafca3c5f451532e8a8d9ba89a21c9743a0c59fbd0205c7f9426/six-1.15.0.tar.gz" sha256 "30639c035cdb23534cd4aa2dd52c3bf48f06e5f4a941509c8bafd8ce11080259" end resource "urllib3" do url "https://files.pythonhosted.org/packages/cb/cf/871177f1fc795c6c10787bc0e1f27bb6cf7b81dbde399fd35860472cecbc/urllib3-1.26.4.tar.gz" sha256 "e7b021f7241115872f92f43c6508082facffbd1c048e3c6e2bb9c2a157e28937" end def install virtualenv_install_with_resources end test do assert_equal "usage: twarc [-h] [--log LOG] [--consumer_key CONSUMER_KEY]", shell_output("#{bin}/twarc -h").chomp.split("\n").first end end
class Twarc < Formula include Language::Python::Virtualenv desc "Command-line tool and Python library for archiving Twitter JSON" homepage "https://github.com/DocNow/twarc" url "https://files.pythonhosted.org/packages/48/0f/b0491173d98d7c0093d3ad912b281f6fefccfcd59b268b2e67581ca08434/twarc-1.10.1.tar.gz" sha256 "db8d6f5fc4d786d9af3f9ca622e4e83175a34e93bda756923e5d6c546bca6c3e" license "MIT" livecheck do url :stable end bottle do cellar :any_skip_relocation sha256 "74c4def26e79e513331d2a7aa2fd6c7edc115ca06124545707abd8f2d3031b98" => :catalina sha256 "f219ea9b791a7700a3bbfdb4f57830af517f13942c004a5b1a962ebc80aecb69" => :mojave sha256 "8a845fe5b8a179c99eca6df8ae3d14665ec7c705b3cd4b7dff8a9b8c61df54e8" => :high_sierra end depends_on "python@3.8" resource "attrs" do url "https://files.pythonhosted.org/packages/98/c3/2c227e66b5e896e15ccdae2e00bbc69aa46e9a8ce8869cc5fa96310bf612/attrs-19.3.0.tar.gz" sha256 "f7b7ce16570fe9965acd6d30101a28f62fb4a7f9e926b3bbc9b61f8b04247e72" end resource "certifi" do url "https://files.pythonhosted.org/packages/40/a7/ded59fa294b85ca206082306bba75469a38ea1c7d44ea7e1d64f5443d67a/certifi-2020.6.20.tar.gz" sha256 "5930595817496dd21bb8dc35dad090f1c2cd0adfaf21204bf6732ca5d8ee34d3" end resource "chardet" do url "https://files.pythonhosted.org/packages/fc/bb/a5768c230f9ddb03acc9ef3f0d4a3cf93462473795d18e9535498c8f929d/chardet-3.0.4.tar.gz" sha256 "84ab92ed1c4d4f16916e05906b6b75a6c0fb5db821cc65e70cbd64a3e2a5eaae" end resource "idna" do url "https://files.pythonhosted.org/packages/ea/b7/e0e3c1c467636186c39925827be42f16fee389dc404ac29e930e9136be70/idna-2.10.tar.gz" sha256 "b307872f855b18632ce0c21c5e45be78c0ea7ae4c15c828c20788b26921eb3f6" end resource "more-itertools" do url "https://files.pythonhosted.org/packages/67/4a/16cb3acf64709eb0164e49ba463a42dc45366995848c4f0cf770f57b8120/more-itertools-8.4.0.tar.gz" sha256 "68c70cc7167bdf5c7c9d8f6954a7837089c6a36bf565383919bb595efb8a17e5" end resource "oauthlib" do url "https://files.pythonhosted.org/packages/fc/c7/829c73c64d3749da7811c06319458e47f3461944da9d98bb4df1cb1598c2/oauthlib-3.1.0.tar.gz" sha256 "bee41cc35fcca6e988463cacc3bcb8a96224f470ca547e697b604cc697b2f889" end resource "packaging" do url "https://files.pythonhosted.org/packages/55/fd/fc1aca9cf51ed2f2c11748fa797370027babd82f87829c7a8e6dbe720145/packaging-20.4.tar.gz" sha256 "4357f74f47b9c12db93624a82154e9b120fa8293699949152b22065d556079f8" end resource "pluggy" do url "https://files.pythonhosted.org/packages/f8/04/7a8542bed4b16a65c2714bf76cf5a0b026157da7f75e87cc88774aa10b14/pluggy-0.13.1.tar.gz" sha256 "15b2acde666561e1298d71b523007ed7364de07029219b604cf808bfa1c765b0" end resource "py" do url "https://files.pythonhosted.org/packages/97/a6/ab9183fe08f69a53d06ac0ee8432bc0ffbb3989c575cc69b73a0229a9a99/py-1.9.0.tar.gz" sha256 "9ca6883ce56b4e8da7e79ac18787889fa5206c79dcc67fb065376cd2fe03f342" end resource "pyparsing" do url "https://files.pythonhosted.org/packages/c1/47/dfc9c342c9842bbe0036c7f763d2d6686bcf5eb1808ba3e170afdb282210/pyparsing-2.4.7.tar.gz" sha256 "c203ec8783bf771a155b207279b9bccb8dea02d8f0c9e5f8ead507bc3246ecc1" end resource "pytest" do url "https://files.pythonhosted.org/packages/8f/c4/e4a645f8a3d6c6993cb3934ee593e705947dfafad4ca5148b9a0fde7359c/pytest-5.4.3.tar.gz" sha256 "7979331bfcba207414f5e1263b5a0f8f521d0f457318836a7355531ed1a4c7d8" end resource "python-dateutil" do url "https://files.pythonhosted.org/packages/be/ed/5bbc91f03fa4c839c4c7360375da77f9659af5f7086b7a7bdda65771c8e0/python-dateutil-2.8.1.tar.gz" sha256 "73ebfe9dbf22e832286dafa60473e4cd239f8592f699aa5adaf10050e6e1823c" end resource "requests" do url "https://files.pythonhosted.org/packages/da/67/672b422d9daf07365259958912ba533a0ecab839d4084c487a5fe9a5405f/requests-2.24.0.tar.gz" sha256 "b3559a131db72c33ee969480840fff4bb6dd111de7dd27c8ee1f820f4f00231b" end resource "requests-oauthlib" do url "https://files.pythonhosted.org/packages/23/eb/68fc8fa86e0f5789832f275c8289257d8dc44dbe93fce7ff819112b9df8f/requests-oauthlib-1.3.0.tar.gz" sha256 "b4261601a71fd721a8bd6d7aa1cc1d6a8a93b4a9f5e96626f8e4d91e8beeaa6a" end resource "six" do url "https://files.pythonhosted.org/packages/6b/34/415834bfdafca3c5f451532e8a8d9ba89a21c9743a0c59fbd0205c7f9426/six-1.15.0.tar.gz" sha256 "30639c035cdb23534cd4aa2dd52c3bf48f06e5f4a941509c8bafd8ce11080259" end resource "urllib3" do url "https://files.pythonhosted.org/packages/05/8c/40cd6949373e23081b3ea20d5594ae523e681b6f472e600fbc95ed046a36/urllib3-1.25.9.tar.gz" sha256 "3018294ebefce6572a474f0604c2021e33b3fd8006ecd11d62107a5d2a963527" end resource "wcwidth" do url "https://files.pythonhosted.org/packages/89/38/459b727c381504f361832b9e5ace19966de1a235d73cdbdea91c771a1155/wcwidth-0.2.5.tar.gz" sha256 "c4d647b99872929fdb7bdcaa4fbe7f01413ed3d98077df798530e5b04f116c83" end def install virtualenv_install_with_resources end test do assert_equal "usage: twarc [-h] [--log LOG] [--consumer_key CONSUMER_KEY]", shell_output("#{bin}/twarc -h").chomp.split("\n").first end end twarc: migrate to python@3.9 Closes #62446. Signed-off-by: Dustin Rodrigues <bb8ef414f2e67efe7ad38cfa83d7e2ec855def2b@gmail.com> Signed-off-by: BrewTestBot <8a898ee6867e4f2028e63d2a6319b2224641c06c@users.noreply.github.com> class Twarc < Formula include Language::Python::Virtualenv desc "Command-line tool and Python library for archiving Twitter JSON" homepage "https://github.com/DocNow/twarc" url "https://files.pythonhosted.org/packages/48/0f/b0491173d98d7c0093d3ad912b281f6fefccfcd59b268b2e67581ca08434/twarc-1.10.1.tar.gz" sha256 "db8d6f5fc4d786d9af3f9ca622e4e83175a34e93bda756923e5d6c546bca6c3e" license "MIT" revision 1 livecheck do url :stable end bottle do cellar :any_skip_relocation sha256 "74c4def26e79e513331d2a7aa2fd6c7edc115ca06124545707abd8f2d3031b98" => :catalina sha256 "f219ea9b791a7700a3bbfdb4f57830af517f13942c004a5b1a962ebc80aecb69" => :mojave sha256 "8a845fe5b8a179c99eca6df8ae3d14665ec7c705b3cd4b7dff8a9b8c61df54e8" => :high_sierra end depends_on "python@3.9" resource "attrs" do url "https://files.pythonhosted.org/packages/98/c3/2c227e66b5e896e15ccdae2e00bbc69aa46e9a8ce8869cc5fa96310bf612/attrs-19.3.0.tar.gz" sha256 "f7b7ce16570fe9965acd6d30101a28f62fb4a7f9e926b3bbc9b61f8b04247e72" end resource "certifi" do url "https://files.pythonhosted.org/packages/40/a7/ded59fa294b85ca206082306bba75469a38ea1c7d44ea7e1d64f5443d67a/certifi-2020.6.20.tar.gz" sha256 "5930595817496dd21bb8dc35dad090f1c2cd0adfaf21204bf6732ca5d8ee34d3" end resource "chardet" do url "https://files.pythonhosted.org/packages/fc/bb/a5768c230f9ddb03acc9ef3f0d4a3cf93462473795d18e9535498c8f929d/chardet-3.0.4.tar.gz" sha256 "84ab92ed1c4d4f16916e05906b6b75a6c0fb5db821cc65e70cbd64a3e2a5eaae" end resource "idna" do url "https://files.pythonhosted.org/packages/ea/b7/e0e3c1c467636186c39925827be42f16fee389dc404ac29e930e9136be70/idna-2.10.tar.gz" sha256 "b307872f855b18632ce0c21c5e45be78c0ea7ae4c15c828c20788b26921eb3f6" end resource "more-itertools" do url "https://files.pythonhosted.org/packages/67/4a/16cb3acf64709eb0164e49ba463a42dc45366995848c4f0cf770f57b8120/more-itertools-8.4.0.tar.gz" sha256 "68c70cc7167bdf5c7c9d8f6954a7837089c6a36bf565383919bb595efb8a17e5" end resource "oauthlib" do url "https://files.pythonhosted.org/packages/fc/c7/829c73c64d3749da7811c06319458e47f3461944da9d98bb4df1cb1598c2/oauthlib-3.1.0.tar.gz" sha256 "bee41cc35fcca6e988463cacc3bcb8a96224f470ca547e697b604cc697b2f889" end resource "packaging" do url "https://files.pythonhosted.org/packages/55/fd/fc1aca9cf51ed2f2c11748fa797370027babd82f87829c7a8e6dbe720145/packaging-20.4.tar.gz" sha256 "4357f74f47b9c12db93624a82154e9b120fa8293699949152b22065d556079f8" end resource "pluggy" do url "https://files.pythonhosted.org/packages/f8/04/7a8542bed4b16a65c2714bf76cf5a0b026157da7f75e87cc88774aa10b14/pluggy-0.13.1.tar.gz" sha256 "15b2acde666561e1298d71b523007ed7364de07029219b604cf808bfa1c765b0" end resource "py" do url "https://files.pythonhosted.org/packages/97/a6/ab9183fe08f69a53d06ac0ee8432bc0ffbb3989c575cc69b73a0229a9a99/py-1.9.0.tar.gz" sha256 "9ca6883ce56b4e8da7e79ac18787889fa5206c79dcc67fb065376cd2fe03f342" end resource "pyparsing" do url "https://files.pythonhosted.org/packages/c1/47/dfc9c342c9842bbe0036c7f763d2d6686bcf5eb1808ba3e170afdb282210/pyparsing-2.4.7.tar.gz" sha256 "c203ec8783bf771a155b207279b9bccb8dea02d8f0c9e5f8ead507bc3246ecc1" end resource "pytest" do url "https://files.pythonhosted.org/packages/8f/c4/e4a645f8a3d6c6993cb3934ee593e705947dfafad4ca5148b9a0fde7359c/pytest-5.4.3.tar.gz" sha256 "7979331bfcba207414f5e1263b5a0f8f521d0f457318836a7355531ed1a4c7d8" end resource "python-dateutil" do url "https://files.pythonhosted.org/packages/be/ed/5bbc91f03fa4c839c4c7360375da77f9659af5f7086b7a7bdda65771c8e0/python-dateutil-2.8.1.tar.gz" sha256 "73ebfe9dbf22e832286dafa60473e4cd239f8592f699aa5adaf10050e6e1823c" end resource "requests" do url "https://files.pythonhosted.org/packages/da/67/672b422d9daf07365259958912ba533a0ecab839d4084c487a5fe9a5405f/requests-2.24.0.tar.gz" sha256 "b3559a131db72c33ee969480840fff4bb6dd111de7dd27c8ee1f820f4f00231b" end resource "requests-oauthlib" do url "https://files.pythonhosted.org/packages/23/eb/68fc8fa86e0f5789832f275c8289257d8dc44dbe93fce7ff819112b9df8f/requests-oauthlib-1.3.0.tar.gz" sha256 "b4261601a71fd721a8bd6d7aa1cc1d6a8a93b4a9f5e96626f8e4d91e8beeaa6a" end resource "six" do url "https://files.pythonhosted.org/packages/6b/34/415834bfdafca3c5f451532e8a8d9ba89a21c9743a0c59fbd0205c7f9426/six-1.15.0.tar.gz" sha256 "30639c035cdb23534cd4aa2dd52c3bf48f06e5f4a941509c8bafd8ce11080259" end resource "urllib3" do url "https://files.pythonhosted.org/packages/05/8c/40cd6949373e23081b3ea20d5594ae523e681b6f472e600fbc95ed046a36/urllib3-1.25.9.tar.gz" sha256 "3018294ebefce6572a474f0604c2021e33b3fd8006ecd11d62107a5d2a963527" end resource "wcwidth" do url "https://files.pythonhosted.org/packages/89/38/459b727c381504f361832b9e5ace19966de1a235d73cdbdea91c771a1155/wcwidth-0.2.5.tar.gz" sha256 "c4d647b99872929fdb7bdcaa4fbe7f01413ed3d98077df798530e5b04f116c83" end def install virtualenv_install_with_resources end test do assert_equal "usage: twarc [-h] [--log LOG] [--consumer_key CONSUMER_KEY]", shell_output("#{bin}/twarc -h").chomp.split("\n").first end end
# # Cookbook Name:: memcached # Definition:: memcached_instance # # Copyright 2009-2013, Chef Software, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # define :memcached_instance do include_recipe 'runit' include_recipe 'memcached::package' instance_name = params[:name] == 'memcached' ? 'memcached' : "memcached-#{params[:name]}" opts = params runit_service instance_name do run_template_name 'memcached' default_logger true cookbook 'memcached' options({ :memory => node['memcached']['memory'], :port => node['memcached']['port'], :udp_port => node['memcached']['udp_port'], :listen => node['memcached']['listen'], :maxconn => node['memcached']['maxconn'], :user => node['memcached']['user'], :threads => node['memcached']['threads'], :max_object_size => node['memcached']['max_object_size'], :experimental_options => Array(node['memcached']['experimental_options']), :ulimit => node['memcached']['ulimit'] }.merge(opts)) end end add conditional logic for unspecified runit_service instance name # # Cookbook Name:: memcached # Definition:: memcached_instance # # Copyright 2009-2013, Chef Software, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # define :memcached_instance do include_recipe 'runit' include_recipe 'memcached::package' instance_name = params[:name] == 'memcached' || params[:name] == nil ? 'memcached' : "memcached-#{params[:name]}" opts = params runit_service instance_name do run_template_name 'memcached' default_logger true cookbook 'memcached' options({ :memory => node['memcached']['memory'], :port => node['memcached']['port'], :udp_port => node['memcached']['udp_port'], :listen => node['memcached']['listen'], :maxconn => node['memcached']['maxconn'], :user => node['memcached']['user'], :threads => node['memcached']['threads'], :max_object_size => node['memcached']['max_object_size'], :experimental_options => Array(node['memcached']['experimental_options']), :ulimit => node['memcached']['ulimit'] }.merge(opts)) end end
require 'formula' class Ufraw < Formula url 'http://sourceforge.net/project/downloading.php?group_id=127649&filename=ufraw-0.18.tar.gz' homepage 'http://ufraw.sourceforge.net' sha1 '41c9ad7aa7f1cbb63a6b0b330b3599b18a7e8cd2' depends_on 'pkg-config' => :build depends_on 'glib' depends_on 'libtiff' depends_on ':libpng' depends_on 'jpeg' depends_on 'little-cms' depends_on 'dcraw' depends_on 'exiv2' => :optional fails_with :llvm do cause "Segfault while linking" end def install system "./configure", "--disable-dependency-tracking", "--prefix=#{prefix}", "--without-gtk", "--without-gimp" system "make install" (share+'pixmaps').rmtree end end ufraw: oops require 'formula' class Ufraw < Formula url 'http://sourceforge.net/project/downloading.php?group_id=127649&filename=ufraw-0.18.tar.gz' homepage 'http://ufraw.sourceforge.net' sha1 '41c9ad7aa7f1cbb63a6b0b330b3599b18a7e8cd2' depends_on 'pkg-config' => :build depends_on :libpng depends_on 'glib' depends_on 'libtiff' depends_on 'jpeg' depends_on 'little-cms' depends_on 'dcraw' depends_on 'exiv2' => :optional fails_with :llvm do cause "Segfault while linking" end def install system "./configure", "--disable-dependency-tracking", "--prefix=#{prefix}", "--without-gtk", "--without-gimp" system "make install" (share+'pixmaps').rmtree end end
class Ugrep < Formula desc "Ultra fast grep with query UI, fuzzy search, archive search, and more" homepage "https://github.com/Genivia/ugrep" url "https://github.com/Genivia/ugrep/archive/v3.3.10.tar.gz" sha256 "8cf74bdf254bac78c19385028bbf8678d83be35522d452b71d16105a1c4c57b8" license "BSD-3-Clause" bottle do sha256 arm64_monterey: "1a1a330e8ddbcad040ee6e27feec14c3a764f487c2ba05820690384eec77d4eb" sha256 arm64_big_sur: "fd513b88aaa6f285a97555491fea561598f07b6f4b59b5b7411dce853f20f134" sha256 monterey: "6b4f045a46ceb962f0121861d701734105f27546f3d3f2b795499fabcace5191" sha256 big_sur: "a85c9166990bd812d422ff845a72a988a08529f45f8648e41c6e9d01116fd65a" sha256 catalina: "177f51f0afdb20f2f46c41c00b8c850461847b7be99e748427c890da7eddfeba" sha256 x86_64_linux: "8f538e1a53fc84dbd8edc1dbc103226dc14b36355a55271313b40584703f3346" end depends_on "pcre2" depends_on "xz" def install system "./configure", "--enable-color", "--disable-debug", "--disable-dependency-tracking", "--disable-silent-rules", "--prefix=#{prefix}" system "make" system "make", "install" end test do (testpath/"Hello.txt").write("Hello World!") assert_match "Hello World!", shell_output("#{bin}/ug 'Hello' '#{testpath}'").strip assert_match "Hello World!", shell_output("#{bin}/ugrep 'World' '#{testpath}'").strip end end ugrep: update 3.3.10 bottle. class Ugrep < Formula desc "Ultra fast grep with query UI, fuzzy search, archive search, and more" homepage "https://github.com/Genivia/ugrep" url "https://github.com/Genivia/ugrep/archive/v3.3.10.tar.gz" sha256 "8cf74bdf254bac78c19385028bbf8678d83be35522d452b71d16105a1c4c57b8" license "BSD-3-Clause" bottle do sha256 arm64_monterey: "2eb2df68d4134b1ab9e7bdc0662844d854da621da256e53213402f419547883c" sha256 arm64_big_sur: "151167f433748abda7992e759dd07aefda5c2c9ab0e9921daaeb3a508bcf2267" sha256 monterey: "2b89a817d6a760436998ed2d578d4bf8090fbde88de8665af98a3c1025d806b5" sha256 big_sur: "96b6ca0c6d8d6e9d2811fa6a2229a40827f3ebf92c49b826fb671dfe8a6dedf0" sha256 catalina: "e0f8a1abca264599e956af69bca6b377f48658935b59019ccd51c42517744542" sha256 x86_64_linux: "ec4512276c6b9556c34baa373226ddbe4719588a6129d164101c4f1244503dcb" end depends_on "pcre2" depends_on "xz" def install system "./configure", "--enable-color", "--disable-debug", "--disable-dependency-tracking", "--disable-silent-rules", "--prefix=#{prefix}" system "make" system "make", "install" end test do (testpath/"Hello.txt").write("Hello World!") assert_match "Hello World!", shell_output("#{bin}/ug 'Hello' '#{testpath}'").strip assert_match "Hello World!", shell_output("#{bin}/ugrep 'World' '#{testpath}'").strip end end
class Ugrep < Formula desc "Ultra fast grep with query UI, fuzzy search, archive search, and more" homepage "https://github.com/Genivia/ugrep" url "https://github.com/Genivia/ugrep/archive/v3.2.1.tar.gz" sha256 "a377b399227296caeca3e1b8945fcfc12001e78ad735f9d3d63d8015082608ee" license "BSD-3-Clause" bottle do sha256 arm64_big_sur: "546c74a1c439123708de875c4da6ec666e3b9dbab6a7883cdfb9f531f4e12e10" sha256 big_sur: "d75fb14835454d870a8dc52b51028e42d9983f887f3df0a78ba0d5a09cf9b569" sha256 catalina: "fbeb23f7a09bacf3ae75faa4a0e5e77e25d5fd4b1a834128543e018cf4e26593" sha256 mojave: "17f241f53694094870131b21e8a848e5ffee7231e61c533ca117146d8d5f46bc" end depends_on "pcre2" depends_on "xz" def install system "./configure", "--enable-color", "--disable-debug", "--disable-dependency-tracking", "--disable-silent-rules", "--prefix=#{prefix}" system "make" system "make", "install" end test do (testpath/"Hello.txt").write("Hello World!") assert_match "Hello World!", shell_output("#{bin}/ug 'Hello' '#{testpath}'").strip assert_match "Hello World!", shell_output("#{bin}/ugrep 'World' '#{testpath}'").strip end end ugrep 3.2.2 Closes #77169. Signed-off-by: Nanda H Krishna <b1c1d8736f20db3fb6c1c66bb1455ed43909f0d8@nandahkrishna.com> Signed-off-by: BrewTestBot <8a898ee6867e4f2028e63d2a6319b2224641c06c@users.noreply.github.com> class Ugrep < Formula desc "Ultra fast grep with query UI, fuzzy search, archive search, and more" homepage "https://github.com/Genivia/ugrep" url "https://github.com/Genivia/ugrep/archive/v3.2.2.tar.gz" sha256 "daedcb76da090b46e98cd5dc2b8785b6dccfe28d80e1fd4b1076b4c251f7244d" license "BSD-3-Clause" bottle do sha256 arm64_big_sur: "546c74a1c439123708de875c4da6ec666e3b9dbab6a7883cdfb9f531f4e12e10" sha256 big_sur: "d75fb14835454d870a8dc52b51028e42d9983f887f3df0a78ba0d5a09cf9b569" sha256 catalina: "fbeb23f7a09bacf3ae75faa4a0e5e77e25d5fd4b1a834128543e018cf4e26593" sha256 mojave: "17f241f53694094870131b21e8a848e5ffee7231e61c533ca117146d8d5f46bc" end depends_on "pcre2" depends_on "xz" def install system "./configure", "--enable-color", "--disable-debug", "--disable-dependency-tracking", "--disable-silent-rules", "--prefix=#{prefix}" system "make" system "make", "install" end test do (testpath/"Hello.txt").write("Hello World!") assert_match "Hello World!", shell_output("#{bin}/ug 'Hello' '#{testpath}'").strip assert_match "Hello World!", shell_output("#{bin}/ugrep 'World' '#{testpath}'").strip end end
require "language/node" class Ungit < Formula desc "The easiest way to use git. On any platform. Anywhere" homepage "https://github.com/FredrikNoren/ungit" url "https://registry.npmjs.org/ungit/-/ungit-1.4.46.tgz" sha256 "cbb177f1f45276894daa1d2580535c29b8adeaedc5c0dfc2af9ec3e9cd2813f7" bottle do cellar :any_skip_relocation rebuild 1 sha256 "107c230eec3615678b6640184c5156236850de4ff3b82b19ca559f92f65a54d9" => :mojave sha256 "a7e0c6abeb515541ef76cdeea81e516f628be258cc1cc55876f25f07566c0aa1" => :high_sierra sha256 "773b35dec90a13ba957acad35b882321e2e747e4671006fc81f63c5a8c7af163" => :sierra end depends_on "node" def install system "npm", "install", *Language::Node.std_npm_install_args(libexec) bin.install_symlink Dir["#{libexec}/bin/*"] end test do begin require "nokogiri" pid = fork do exec bin/"ungit", "--no-launchBrowser", "--autoShutdownTimeout", "5000" # give it an idle timeout to make it exit end sleep 5 assert_match "ungit", Nokogiri::HTML(shell_output("curl -s 127.0.0.1:8448/")).at_css("title").text ensure Process.kill("TERM", pid) Process.wait(pid) end end end ungit 1.4.47 Closes #44322. Signed-off-by: FX Coudert <c329953660db96eae534be5bbf1a735c2baf69b5@gmail.com> require "language/node" class Ungit < Formula desc "The easiest way to use git. On any platform. Anywhere" homepage "https://github.com/FredrikNoren/ungit" url "https://registry.npmjs.org/ungit/-/ungit-1.4.47.tgz" sha256 "be09b1210dbd221e2df1545ba6f3f90607609dcd4f816acd10128f7b97142f24" bottle do cellar :any_skip_relocation rebuild 1 sha256 "107c230eec3615678b6640184c5156236850de4ff3b82b19ca559f92f65a54d9" => :mojave sha256 "a7e0c6abeb515541ef76cdeea81e516f628be258cc1cc55876f25f07566c0aa1" => :high_sierra sha256 "773b35dec90a13ba957acad35b882321e2e747e4671006fc81f63c5a8c7af163" => :sierra end depends_on "node" def install system "npm", "install", *Language::Node.std_npm_install_args(libexec) bin.install_symlink Dir["#{libexec}/bin/*"] end test do begin require "nokogiri" pid = fork do exec bin/"ungit", "--no-launchBrowser", "--autoShutdownTimeout", "5000" # give it an idle timeout to make it exit end sleep 5 assert_match "ungit", Nokogiri::HTML(shell_output("curl -s 127.0.0.1:8448/")).at_css("title").text ensure Process.kill("TERM", pid) Process.wait(pid) end end end
require "language/node" class Ungit < Formula desc "The easiest way to use git. On any platform. Anywhere" homepage "https://github.com/FredrikNoren/ungit" url "https://registry.npmjs.org/ungit/-/ungit-1.4.46.tgz" sha256 "cbb177f1f45276894daa1d2580535c29b8adeaedc5c0dfc2af9ec3e9cd2813f7" bottle do cellar :any_skip_relocation sha256 "309b81a817280d6219cdaa460c2919deb3163faed9f42c3500280f020397a613" => :mojave sha256 "07f0ba12becf748cdd02a64c5d2059f4e130f24452b45963c59234fc8ad257bc" => :high_sierra sha256 "ee792bbbc4ac5ed8508e0c75ccd1be5cc3c6647e3a6194f2bc0dd997139b2686" => :sierra end depends_on "node" def install system "npm", "install", *Language::Node.std_npm_install_args(libexec) bin.install_symlink Dir["#{libexec}/bin/*"] end test do begin require "nokogiri" pid = fork do exec bin/"ungit", "--no-launchBrowser", "--autoShutdownTimeout", "5000" # give it an idle timeout to make it exit end sleep 3 assert_match "ungit", Nokogiri::HTML(shell_output("curl -s 127.0.0.1:8448/")).at_css("title").text ensure Process.kill("TERM", pid) Process.wait(pid) end end end ungit: fix flaky test Closes #42352. Signed-off-by: Chongyu Zhu <042dc4512fa3d391c5170cf3aa61e6a638f84342@lembacon.com> require "language/node" class Ungit < Formula desc "The easiest way to use git. On any platform. Anywhere" homepage "https://github.com/FredrikNoren/ungit" url "https://registry.npmjs.org/ungit/-/ungit-1.4.46.tgz" sha256 "cbb177f1f45276894daa1d2580535c29b8adeaedc5c0dfc2af9ec3e9cd2813f7" bottle do cellar :any_skip_relocation sha256 "309b81a817280d6219cdaa460c2919deb3163faed9f42c3500280f020397a613" => :mojave sha256 "07f0ba12becf748cdd02a64c5d2059f4e130f24452b45963c59234fc8ad257bc" => :high_sierra sha256 "ee792bbbc4ac5ed8508e0c75ccd1be5cc3c6647e3a6194f2bc0dd997139b2686" => :sierra end depends_on "node" def install system "npm", "install", *Language::Node.std_npm_install_args(libexec) bin.install_symlink Dir["#{libexec}/bin/*"] end test do begin require "nokogiri" pid = fork do exec bin/"ungit", "--no-launchBrowser", "--autoShutdownTimeout", "5000" # give it an idle timeout to make it exit end sleep 5 assert_match "ungit", Nokogiri::HTML(shell_output("curl -s 127.0.0.1:8448/")).at_css("title").text ensure Process.kill("TERM", pid) Process.wait(pid) end end end
# Please don't update this formula until the release is official via # mailing list or blog post. There's a history of GitHub tags moving around. # https://github.com/hashicorp/vault/issues/1051 class Vault < Formula desc "Secures, stores, and tightly controls access to secrets" homepage "https://vaultproject.io/" url "https://github.com/hashicorp/vault.git", tag: "v1.9.4", revision: "fcbe948b2542a13ee8036ad07dd8ebf8554f56cb" license "MPL-2.0" head "https://github.com/hashicorp/vault.git", branch: "main" livecheck do url "https://releases.hashicorp.com/vault/" regex(%r{href=.*?v?(\d+(?:\.\d+)+)/?["' >]}i) end bottle do sha256 cellar: :any_skip_relocation, arm64_monterey: "4af8849bfb883c6709303e2f477bbf8118f7a610cb5a0588c6cdbefc77fe78aa" sha256 cellar: :any_skip_relocation, arm64_big_sur: "5873ce31a62c522bd87473dc52b896c98437fb8dc0c013b9e50de52d6dacc0a2" sha256 cellar: :any_skip_relocation, monterey: "8e3641a34533f592e7766e76236113d47f96343a9eac94159d445560ba029904" sha256 cellar: :any_skip_relocation, big_sur: "e9bbdf0d41dc238b40bb97fcee7d4d7626225d6c0aeb8620654c43fc0a452c4f" sha256 cellar: :any_skip_relocation, catalina: "904390bafeb870c90cc66989e346b85b1ccae9871835fc3de8643e0c75076d7d" sha256 cellar: :any_skip_relocation, x86_64_linux: "9c6c56c8c8651fc682b696516da9c612531a3a5aca2752e75a31867c62ce0be8" end depends_on "go" => :build depends_on "gox" => :build # Cannot build with `node` while upstream depends on node-sass<6 depends_on "node@14" => :build depends_on "yarn" => :build def install ENV.prepend_path "PATH", "#{ENV["GOPATH"]}/bin" system "make", "bootstrap", "static-dist", "dev-ui" bin.install "bin/vault" end service do run [opt_bin/"vault", "server", "-dev"] keep_alive true working_dir var log_path var/"log/vault.log" error_log_path var/"log/vault.log" end test do port = free_port ENV["VAULT_DEV_LISTEN_ADDRESS"] = "127.0.0.1:#{port}" ENV["VAULT_ADDR"] = "http://127.0.0.1:#{port}" pid = fork { exec bin/"vault", "server", "-dev" } sleep 5 system bin/"vault", "status" Process.kill("TERM", pid) end end vault: update 1.9.4 bottle. # Please don't update this formula until the release is official via # mailing list or blog post. There's a history of GitHub tags moving around. # https://github.com/hashicorp/vault/issues/1051 class Vault < Formula desc "Secures, stores, and tightly controls access to secrets" homepage "https://vaultproject.io/" url "https://github.com/hashicorp/vault.git", tag: "v1.9.4", revision: "fcbe948b2542a13ee8036ad07dd8ebf8554f56cb" license "MPL-2.0" head "https://github.com/hashicorp/vault.git", branch: "main" livecheck do url "https://releases.hashicorp.com/vault/" regex(%r{href=.*?v?(\d+(?:\.\d+)+)/?["' >]}i) end bottle do sha256 cellar: :any_skip_relocation, arm64_monterey: "bd093e6cc7f7c4185282a92d0844c0aa8527b3fcbff8ad9dda0f1f1259e19a00" sha256 cellar: :any_skip_relocation, arm64_big_sur: "e9f940a6c66cf751145ac8f35918653c2c76e1dc100bdd94f12a7a52e1842787" sha256 cellar: :any_skip_relocation, monterey: "0e71de8e8d51257df8d55545d6c9b602f08cbc8b95e8f7c0b5eed176a0b7ea4b" sha256 cellar: :any_skip_relocation, big_sur: "ccaa1a533d4a805f2e53ad5fc392a36e9814cafe5691ae921e2c421fd853fdd2" sha256 cellar: :any_skip_relocation, catalina: "4200322afc0841b0a4e7c8b789f6913424a90e1c8e9952595671aac6445a8c72" sha256 cellar: :any_skip_relocation, x86_64_linux: "c6c1a950343a5130c50d557804f6340ff7eec1c1cd49831f716bc81ff45127bd" end depends_on "go" => :build depends_on "gox" => :build # Cannot build with `node` while upstream depends on node-sass<6 depends_on "node@14" => :build depends_on "yarn" => :build def install ENV.prepend_path "PATH", "#{ENV["GOPATH"]}/bin" system "make", "bootstrap", "static-dist", "dev-ui" bin.install "bin/vault" end service do run [opt_bin/"vault", "server", "-dev"] keep_alive true working_dir var log_path var/"log/vault.log" error_log_path var/"log/vault.log" end test do port = free_port ENV["VAULT_DEV_LISTEN_ADDRESS"] = "127.0.0.1:#{port}" ENV["VAULT_ADDR"] = "http://127.0.0.1:#{port}" pid = fork { exec bin/"vault", "server", "-dev" } sleep 5 system bin/"vault", "status" Process.kill("TERM", pid) end end
class Viddy < Formula desc "Modern watch command" homepage "https://github.com/sachaos/viddy" url "https://github.com/sachaos/viddy/archive/refs/tags/v0.3.2.tar.gz" sha256 "441e057fb3e9ad75f034123ef023ff92eece67fe01d52745825f0c3c2ba89088" license "MIT" head "https://github.com/sachaos/viddy.git", branch: "master" bottle do sha256 cellar: :any_skip_relocation, arm64_monterey: "94203d619dfa11db244cefeea6407b657809ad1758b2b9b9edec988c02ad775c" sha256 cellar: :any_skip_relocation, arm64_big_sur: "7ed75fb4678c69f4b17e60b3f7d5d79062f9842d407065c5b8eea2f45408cb46" sha256 cellar: :any_skip_relocation, monterey: "35004a320ef6ab389a7172546f4b99e56474868fd4cca70a89d39c4b008be374" sha256 cellar: :any_skip_relocation, big_sur: "42683c3e7bbb2f3b9d9d17e48375ce6672a8b365f3a94f8c833e5058337c33a4" sha256 cellar: :any_skip_relocation, catalina: "b904656d10800778f242c860c550d5da3508a51d735702c1f779dfc2f3b657ca" sha256 cellar: :any_skip_relocation, x86_64_linux: "41afacff33d7f52feda350cfbffe22634cd903e7c141ac8277933d47746417b7" end depends_on "go" => :build def install system "go", "build", *std_go_args(ldflags: "-s -w -X main.version=v#{version}") end test do on_linux do # Errno::EIO: Input/output error @ io_fread - /dev/pts/0 return if ENV["HOMEBREW_GITHUB_ACTIONS"] end ENV["TERM"] = "xterm" require "pty" r, _, pid = PTY.spawn "#{bin}/viddy echo hello" sleep 1 Process.kill "SIGINT", pid assert_includes r.read, "Every" assert_equal 0, $CHILD_STATUS.exitstatus end end viddy 0.3.3 Closes #89263. Signed-off-by: Sean Molenaar <2b250e3fea88cfef248b497ad5fc17f7dc435154@users.noreply.github.com> Signed-off-by: BrewTestBot <8a898ee6867e4f2028e63d2a6319b2224641c06c@users.noreply.github.com> class Viddy < Formula desc "Modern watch command" homepage "https://github.com/sachaos/viddy" url "https://github.com/sachaos/viddy/archive/refs/tags/v0.3.3.tar.gz" sha256 "459d3ea43436b523e654f1f60356ef3150606ed17ca88895f54b7ee5999292a1" license "MIT" head "https://github.com/sachaos/viddy.git", branch: "master" bottle do sha256 cellar: :any_skip_relocation, arm64_monterey: "94203d619dfa11db244cefeea6407b657809ad1758b2b9b9edec988c02ad775c" sha256 cellar: :any_skip_relocation, arm64_big_sur: "7ed75fb4678c69f4b17e60b3f7d5d79062f9842d407065c5b8eea2f45408cb46" sha256 cellar: :any_skip_relocation, monterey: "35004a320ef6ab389a7172546f4b99e56474868fd4cca70a89d39c4b008be374" sha256 cellar: :any_skip_relocation, big_sur: "42683c3e7bbb2f3b9d9d17e48375ce6672a8b365f3a94f8c833e5058337c33a4" sha256 cellar: :any_skip_relocation, catalina: "b904656d10800778f242c860c550d5da3508a51d735702c1f779dfc2f3b657ca" sha256 cellar: :any_skip_relocation, x86_64_linux: "41afacff33d7f52feda350cfbffe22634cd903e7c141ac8277933d47746417b7" end depends_on "go" => :build def install system "go", "build", *std_go_args(ldflags: "-s -w -X main.version=v#{version}") end test do on_linux do # Errno::EIO: Input/output error @ io_fread - /dev/pts/0 return if ENV["HOMEBREW_GITHUB_ACTIONS"] end ENV["TERM"] = "xterm" require "pty" r, _, pid = PTY.spawn "#{bin}/viddy echo hello" sleep 1 Process.kill "SIGINT", pid assert_includes r.read, "Every" assert_equal 0, $CHILD_STATUS.exitstatus end end
class Vultr < Formula desc "Command-line tool for Vultr" homepage "https://jamesclonk.github.io/vultr" url "https://github.com/JamesClonk/vultr/archive/v2.0.1.tar.gz" sha256 "928f6c3caf8149f836a609ec43a3d031f0206a8cba095e026535c33c390c1157" head "https://github.com/JamesClonk/vultr.git" bottle do cellar :any_skip_relocation sha256 "af7d3754f0136c4ed3f0067920c0351931df48f487457ba6f12741e745e636e4" => :mojave sha256 "9384a5df861603c74301e8500d70c170f806348fbfdf5117b1c6d91bed7d26d2" => :high_sierra sha256 "a49908fc98bd2c2e2322e1d9511352ece67dbedc02879c71811d82b7c9bdaa3e" => :sierra end depends_on "go" => :build def install ENV["GOPATH"] = buildpath (buildpath/"src/github.com/JamesClonk").mkpath ln_s buildpath, buildpath/"src/github.com/JamesClonk/vultr" system "go", "build", "-o", bin/"vultr" end test do system bin/"vultr", "version" end end vultr: update 2.0.1 bottle. class Vultr < Formula desc "Command-line tool for Vultr" homepage "https://jamesclonk.github.io/vultr" url "https://github.com/JamesClonk/vultr/archive/v2.0.1.tar.gz" sha256 "928f6c3caf8149f836a609ec43a3d031f0206a8cba095e026535c33c390c1157" head "https://github.com/JamesClonk/vultr.git" bottle do cellar :any_skip_relocation sha256 "11edd7b69bd41bf11ceab87cc0353305612887f53ed2429ffe7034c0179f4dd5" => :catalina sha256 "af7d3754f0136c4ed3f0067920c0351931df48f487457ba6f12741e745e636e4" => :mojave sha256 "9384a5df861603c74301e8500d70c170f806348fbfdf5117b1c6d91bed7d26d2" => :high_sierra sha256 "a49908fc98bd2c2e2322e1d9511352ece67dbedc02879c71811d82b7c9bdaa3e" => :sierra end depends_on "go" => :build def install ENV["GOPATH"] = buildpath (buildpath/"src/github.com/JamesClonk").mkpath ln_s buildpath, buildpath/"src/github.com/JamesClonk/vultr" system "go", "build", "-o", bin/"vultr" end test do system bin/"vultr", "version" end end
class Whois < Formula desc "Lookup tool for domain names and other internet resources" homepage "https://packages.debian.org/sid/whois" url "https://deb.debian.org/debian/pool/main/w/whois/whois_5.4.1.tar.xz" sha256 "3ee6591fb14c103791430a8e6eb3d4c38a9f52aad799ea58c94250bd6985ec50" revision 1 head "https://github.com/rfc1036/whois.git" bottle do cellar :any sha256 "ea946cc40b9785347572dda2b7f62c2e26e45e52e3321e3675344bd3cfd13397" => :mojave sha256 "0ce754d0d55a28926e7e52d3ed1b68ed6dc4c0cce93c17319471da33e933fcde" => :high_sierra sha256 "00f07c1b7d94fddfef15e14c58a8f74b1b2313e4ce8c3864dbe68d6151e4a2fa" => :sierra end depends_on "pkg-config" => :build depends_on "libidn2" def install ENV.append "LDFLAGS", "-L/usr/lib -liconv" system "make", "whois", "HAVE_ICONV=1" bin.install "whois" man1.install "whois.1" man5.install "whois.conf.5" end def caveats; <<~EOS Debian whois has been installed as `whois` and may shadow the system binary of the same name. EOS end test do system "#{bin}/whois", "brew.sh" end end whois: update 5.4.1_1 bottle. class Whois < Formula desc "Lookup tool for domain names and other internet resources" homepage "https://packages.debian.org/sid/whois" url "https://deb.debian.org/debian/pool/main/w/whois/whois_5.4.1.tar.xz" sha256 "3ee6591fb14c103791430a8e6eb3d4c38a9f52aad799ea58c94250bd6985ec50" revision 1 head "https://github.com/rfc1036/whois.git" bottle do cellar :any sha256 "3ddfaef6c60a75569e15abe0302ab6bc3c681b03a1092ea5c32bc8ab4af89d16" => :mojave sha256 "44076fd65dbad4824f29d3f4e4257ad1337868f81e009e583e24b351a17bc6ae" => :high_sierra sha256 "ce9876b716a7f0d3ea4edcfb40159dd2b664b8f0cda0f29b5de0c3ad3ade7bbc" => :sierra end depends_on "pkg-config" => :build depends_on "libidn2" def install ENV.append "LDFLAGS", "-L/usr/lib -liconv" system "make", "whois", "HAVE_ICONV=1" bin.install "whois" man1.install "whois.1" man5.install "whois.conf.5" end def caveats; <<~EOS Debian whois has been installed as `whois` and may shadow the system binary of the same name. EOS end test do system "#{bin}/whois", "brew.sh" end end
require 'formula' class FrameworkPython < Requirement fatal true satisfy do q = `python -c "import distutils.sysconfig as c; print(c.get_config_var('PYTHONFRAMEWORK'))"` not q.chomp.empty? end def message "Python needs to be built as a framework." end end class Wxmac < Formula homepage 'http://www.wxwidgets.org' url 'http://downloads.sourceforge.net/project/wxpython/wxPython/2.9.5.0/wxPython-src-2.9.5.0.tar.bz2' sha1 '9183b2ffc6631cb2551c51b655a9d08904aa7b52' option 'disable-monolithic', "Build a non-monolithic library (split into multiple files)" depends_on :python => :recommended depends_on FrameworkPython if build.with? "python" def install_wx_python args = [ # Reference our wx-config "WX_CONFIG=#{bin}/wx-config", # At this time Wxmac is installed Unicode only "UNICODE=1", # Some scripts (e.g. matplotlib) expect to `import wxversion`, which is # only available on a multiversion build. Besides that `import wx` still works. "INSTALL_MULTIVERSION=1", # OpenGL and stuff "BUILD_GLCANVAS=1", "BUILD_GIZMOS=1", "BUILD_STC=1" ] cd "wxPython" do ENV.append_to_cflags "-arch #{MacOS.preferred_arch}" python do system python, "setup.py", "build_ext", "WXPORT=osx_cocoa", *args system python, "setup.py", "install", "--prefix=#{prefix}", "WXPORT=osx_cocoa", *args end end end def install # need to set with-macosx-version-min to avoid configure defaulting to 10.5 # need to enable universal binary build in order to build all x86_64 headers # need to specify x86_64 and i386 or will try to build for ppc arch and fail on newer OSes # https://trac.macports.org/browser/trunk/dports/graphics/wxWidgets30/Portfile#L80 ENV.universal_binary args = [ "--disable-debug", "--prefix=#{prefix}", "--enable-shared", "--enable-unicode", "--enable-std_string", "--enable-display", "--with-opengl", "--with-osx_cocoa", "--with-libjpeg", "--with-libtiff", "--with-libpng", "--with-zlib", "--enable-dnd", "--enable-clipboard", "--enable-webkit", "--enable-svg", "--with-expat", "--with-macosx-version-min=#{MacOS.version}", "--with-macosx-sdk=#{MacOS.sdk_path}", "--enable-universal_binary=#{Hardware::CPU.universal_archs.join(',')}", "--disable-precomp-headers" ] args << "--enable-monolithic" unless build.include? 'disable-monolithic' system "./configure", *args system "make install" if build.with? "python" ENV['WXWIN'] = Dir.getwd # We have already downloaded wxPython in a bundle with wxWidgets install_wx_python end end def caveats s = '' fp = FrameworkPython.new unless build.without? 'python' or fp.satisfied? s += fp.message end return s end end wxmac: disable lzma in internal libtiff Fixes Homebrew/homebrew#22732. require 'formula' class FrameworkPython < Requirement fatal true satisfy do q = `python -c "import distutils.sysconfig as c; print(c.get_config_var('PYTHONFRAMEWORK'))"` not q.chomp.empty? end def message "Python needs to be built as a framework." end end class Wxmac < Formula homepage 'http://www.wxwidgets.org' url 'http://downloads.sourceforge.net/project/wxpython/wxPython/2.9.5.0/wxPython-src-2.9.5.0.tar.bz2' sha1 '9183b2ffc6631cb2551c51b655a9d08904aa7b52' option 'disable-monolithic', "Build a non-monolithic library (split into multiple files)" depends_on :python => :recommended depends_on FrameworkPython if build.with? "python" def install_wx_python args = [ # Reference our wx-config "WX_CONFIG=#{bin}/wx-config", # At this time Wxmac is installed Unicode only "UNICODE=1", # Some scripts (e.g. matplotlib) expect to `import wxversion`, which is # only available on a multiversion build. Besides that `import wx` still works. "INSTALL_MULTIVERSION=1", # OpenGL and stuff "BUILD_GLCANVAS=1", "BUILD_GIZMOS=1", "BUILD_STC=1" ] cd "wxPython" do ENV.append_to_cflags "-arch #{MacOS.preferred_arch}" python do system python, "setup.py", "build_ext", "WXPORT=osx_cocoa", *args system python, "setup.py", "install", "--prefix=#{prefix}", "WXPORT=osx_cocoa", *args end end end def install # need to set with-macosx-version-min to avoid configure defaulting to 10.5 # need to enable universal binary build in order to build all x86_64 headers # need to specify x86_64 and i386 or will try to build for ppc arch and fail on newer OSes # https://trac.macports.org/browser/trunk/dports/graphics/wxWidgets30/Portfile#L80 ENV.universal_binary args = [ "--disable-debug", "--prefix=#{prefix}", "--enable-shared", "--enable-unicode", "--enable-std_string", "--enable-display", "--with-opengl", "--with-osx_cocoa", "--with-libjpeg", "--with-libtiff", # Otherwise, even in superenv, the internal libtiff can pick # up on a nonuniversal xz and fail # https://github.com/mxcl/homebrew/issues/22732 "--without-lzma", "--with-libpng", "--with-zlib", "--enable-dnd", "--enable-clipboard", "--enable-webkit", "--enable-svg", "--with-expat", "--with-macosx-version-min=#{MacOS.version}", "--with-macosx-sdk=#{MacOS.sdk_path}", "--enable-universal_binary=#{Hardware::CPU.universal_archs.join(',')}", "--disable-precomp-headers" ] args << "--enable-monolithic" unless build.include? 'disable-monolithic' system "./configure", *args system "make install" if build.with? "python" ENV['WXWIN'] = Dir.getwd # We have already downloaded wxPython in a bundle with wxWidgets install_wx_python end end def caveats s = '' fp = FrameworkPython.new unless build.without? 'python' or fp.satisfied? s += fp.message end return s end end
require 'formula' class Wxmac <Formula url 'http://prdownloads.sourceforge.net/wxwindows/wxMac-2.8.10.tar.gz' homepage 'http://www.wxwidgets.org' md5 'd18668cbf7026b8633e2cfc69e2f3868' def install %w{ CFLAGS CXXFLAGS LDFLAGS OBJCFLAGS OBJCXXFLAGS }.each do |compiler_flag| ENV.remove compiler_flag, "-arch x86_64" ENV.append compiler_flag, "-arch i386" end system "./configure", "--prefix=#{prefix}", "--disable-debug", "--disable-dependency-tracking" system "make install" end end wxWidgets - use bz2 download. require 'formula' class Wxmac <Formula url 'http://downloads.sourceforge.net/project/wxwindows/wxMac/2.8.10/wxMac-2.8.10.tar.bz2' homepage 'http://www.wxwidgets.org' md5 '67e5eb6823907081fc979d41e00f93d7' def install # Force i386 %w{ CFLAGS CXXFLAGS LDFLAGS OBJCFLAGS OBJCXXFLAGS }.each do |compiler_flag| ENV.remove compiler_flag, "-arch x86_64" ENV.append compiler_flag, "-arch i386" end system "./configure", "--prefix=#{prefix}", "--disable-debug", "--disable-dependency-tracking" system "make install" end end
require "formula" class X3270 < Formula homepage "http://x3270.bgp.nu/" url "https://downloads.sourceforge.net/project/x3270/x3270/3.3.15ga5/suite3270-3.3.15ga5-src.tgz" sha1 "7f918e21c9134ce4bccb7e0f661763f9f18946ee" bottle do sha1 "c8d06fd2d78e89f65976c45c99b69e8b3f585102" => :yosemite sha1 "305257a2615698a57341793cbda367588244faf8" => :mavericks sha1 "c35fdab2f4223da207164eff643313b2ee291b37" => :mountain_lion end depends_on :x11 option "with-c3270", "Include c3270 (curses-based version)" option "with-s3270", "Include s3270 (displayless version)" option "with-tcl3270", "Include tcl3270 (integrated with Tcl)" option "with-pr3287", "Include pr3287 (printer emulation)" def make_directory(directory) cd directory do system "./configure", "--prefix=#{prefix}" system "make" system "make install" system "make install.man" end end def install make_directory "x3270-3.3" make_directory "c3270-3.3" if build.with? "c3270" make_directory "pr3287-3.3" if build.with? "pr3287" make_directory "s3270-3.3" if build.with? "s3270" make_directory "tcl3270-3.3" if build.with? "tcl3270" end end x3270 3.3.15ga5 Closes Homebrew/homebrew#34630. Signed-off-by: Jack Nagel <43386ce32af96f5c56f2a88e458cb94cebee3751@gmail.com> require "formula" class X3270 < Formula homepage "http://x3270.bgp.nu/" url "https://downloads.sourceforge.net/project/x3270/x3270/3.3.15ga6/suite3270-3.3.15ga6-src.tgz" sha1 "c2d492b11db25b53aca9e9643e6522982cc479b4" bottle do sha1 "c8d06fd2d78e89f65976c45c99b69e8b3f585102" => :yosemite sha1 "305257a2615698a57341793cbda367588244faf8" => :mavericks sha1 "c35fdab2f4223da207164eff643313b2ee291b37" => :mountain_lion end depends_on :x11 option "with-c3270", "Include c3270 (curses-based version)" option "with-s3270", "Include s3270 (displayless version)" option "with-tcl3270", "Include tcl3270 (integrated with Tcl)" option "with-pr3287", "Include pr3287 (printer emulation)" def make_directory(directory) cd directory do system "./configure", "--prefix=#{prefix}" system "make" system "make install" system "make install.man" end end def install make_directory "x3270-3.3" make_directory "c3270-3.3" if build.with? "c3270" make_directory "pr3287-3.3" if build.with? "pr3287" make_directory "s3270-3.3" if build.with? "s3270" make_directory "tcl3270-3.3" if build.with? "tcl3270" end end
class X3270 < Formula desc "IBM 3270 terminal emulator for the X Window System and Windows" homepage "http://x3270.bgp.nu/" url "http://x3270.bgp.nu/download/04.00/suite3270-4.0ga12-src.tgz" sha256 "d2e5030b67f01aed7c74dd906114d44dbc89a103d32ed0db564bf80033b8e4fb" license "BSD-3-Clause" livecheck do url "http://x3270.bgp.nu/download.html" regex(/href=.*?suite3270[._-]v?(\d+(?:\.\d+)+(?:ga\d+)?)(?:-src)?\.t/i) end bottle do sha256 "1207876192b9bd7bcf06c7811cb376426e47028027a47718dc32224972352e80" => :catalina sha256 "d2d31ed1a62515d6acd00b2d3fa72a821b1d94bb13b581830e30664fe72f2626" => :mojave sha256 "c68394dce8fc34be49786ebfd1c0beb914b1f894611fc97163ca5a3097967151" => :high_sierra end depends_on "readline" def install args = %W[ --prefix=#{prefix} --enable-c3270 --enable-pr3287 --enable-s3270 --enable-tcl3270 ] system "./configure", *args system "make", "install" system "make", "install.man" end test do system bin/"c3270", "--version" end end x3270: update 4.0ga12 bottle. class X3270 < Formula desc "IBM 3270 terminal emulator for the X Window System and Windows" homepage "http://x3270.bgp.nu/" url "http://x3270.bgp.nu/download/04.00/suite3270-4.0ga12-src.tgz" sha256 "d2e5030b67f01aed7c74dd906114d44dbc89a103d32ed0db564bf80033b8e4fb" license "BSD-3-Clause" livecheck do url "http://x3270.bgp.nu/download.html" regex(/href=.*?suite3270[._-]v?(\d+(?:\.\d+)+(?:ga\d+)?)(?:-src)?\.t/i) end bottle do sha256 "910cfb45bab78112705869fd8bb3fac970d0bd84194ab9555635ff484d355bcb" => :catalina sha256 "99fbe83bf0dfbfab1f11b536608d02cd93d530eca7f0ec72ebde4d4424293444" => :mojave sha256 "e30468e4081beeab927279e9317f30107db6391ac4e8f9f5334d2ecc0e8e57e2" => :high_sierra end depends_on "readline" def install args = %W[ --prefix=#{prefix} --enable-c3270 --enable-pr3287 --enable-s3270 --enable-tcl3270 ] system "./configure", *args system "make", "install" system "make", "install.man" end test do system bin/"c3270", "--version" end end
class Xaric < Formula desc "IRC client" homepage "https://xaric.org/" url "https://xaric.org/software/xaric/releases/xaric-0.13.9.tar.gz" sha256 "cb6c23fd20b9f54e663fff7cab22e8c11088319c95c90904175accf125d2fc11" license "GPL-2.0-or-later" livecheck do url "https://xaric.org/software/xaric/releases/" regex(/href=.*?xaric[._-]v?(\d+(?:\.\d+)+)\.t/i) end bottle do sha256 arm64_monterey: "0679cb45a723581f21bd4295225c92e01a303155e772e07ad598303d8d3acff0" sha256 arm64_big_sur: "9f89bb7adc21f31a7721a5b3cc0586820cc59e50e82f6316ef74f2dbce1c512f" sha256 monterey: "914abc6071ee13379b8238fac06093d1e35277d1b36365ad346bc75dc7ee688c" sha256 big_sur: "4c9e9e9d0ef2e7f5c8bb8996ef72220f2315e756e1a4c9c8e23869b8e0abc84e" sha256 catalina: "5438f46156ba60b6658275aefdda7617296691d949f7dd0f85dcdac1225d254e" sha256 mojave: "e8c40aad03fec80e9566a1bb9c7100cbb3a4e0fca3dbc9f79f65271d3e29631f" end depends_on "openssl@1.1" uses_from_macos "ncurses" def install system "./configure", *std_configure_args, "--with-openssl=#{Formula["openssl@1.1"].opt_prefix}" system "make", "install" end test do require "pty" output = "" PTY.spawn("#{bin}/xaric", "-v") do |r, _w, _pid| r.each_line { |line| output += line } rescue Errno::EIO # GNU/Linux raises EIO when read is done on closed pty end assert_match "Xaric #{version}", output end end xaric: update 0.13.9 bottle. class Xaric < Formula desc "IRC client" homepage "https://xaric.org/" url "https://xaric.org/software/xaric/releases/xaric-0.13.9.tar.gz" sha256 "cb6c23fd20b9f54e663fff7cab22e8c11088319c95c90904175accf125d2fc11" license "GPL-2.0-or-later" livecheck do url "https://xaric.org/software/xaric/releases/" regex(/href=.*?xaric[._-]v?(\d+(?:\.\d+)+)\.t/i) end bottle do sha256 arm64_monterey: "0679cb45a723581f21bd4295225c92e01a303155e772e07ad598303d8d3acff0" sha256 arm64_big_sur: "9f89bb7adc21f31a7721a5b3cc0586820cc59e50e82f6316ef74f2dbce1c512f" sha256 monterey: "914abc6071ee13379b8238fac06093d1e35277d1b36365ad346bc75dc7ee688c" sha256 big_sur: "4c9e9e9d0ef2e7f5c8bb8996ef72220f2315e756e1a4c9c8e23869b8e0abc84e" sha256 catalina: "5438f46156ba60b6658275aefdda7617296691d949f7dd0f85dcdac1225d254e" sha256 mojave: "e8c40aad03fec80e9566a1bb9c7100cbb3a4e0fca3dbc9f79f65271d3e29631f" sha256 x86_64_linux: "407b5776d290e11fa9dc958d03d7035c623ff5876bc2f2fa37de4462f9f6547d" end depends_on "openssl@1.1" uses_from_macos "ncurses" def install system "./configure", *std_configure_args, "--with-openssl=#{Formula["openssl@1.1"].opt_prefix}" system "make", "install" end test do require "pty" output = "" PTY.spawn("#{bin}/xaric", "-v") do |r, _w, _pid| r.each_line { |line| output += line } rescue Errno::EIO # GNU/Linux raises EIO when read is done on closed pty end assert_match "Xaric #{version}", output end end
class Xauth < Formula desc "X.Org Applications: xauth" homepage "https://www.x.org/" url "https://www.x.org/pub/individual/app/xauth-1.1.1.tar.bz2" sha256 "164ea0a29137b284a47b886ef2affcb0a74733bf3aad04f9b106b1a6c82ebd92" license "MIT-open-group" bottle do sha256 cellar: :any, arm64_monterey: "f03feb786d9b9d59d83f3019ae0422946bf2bb2c9a1c87aedb5cafb8d1f6c8b9" sha256 cellar: :any, arm64_big_sur: "6eec2379cd9b33ef0a6f43fb987ae5c33f6023c252cdae90ae0c653ad26028f4" sha256 cellar: :any, monterey: "53010640b1e9a7aca696d305b3524dd5a1b01a3c60e2963ec40cce547633890e" sha256 cellar: :any, big_sur: "dbd7921c13d14ed10d9d011eea5cdf16b44f4019799c072ff492b7aa11063b31" sha256 cellar: :any, catalina: "68b0119f7e2d4e4269d7f2ded4657700f2d66d83f3da3bb0a38c9aff94943bd6" sha256 cellar: :any_skip_relocation, x86_64_linux: "f7fef9c7735f8d5b3405f4ff95bbf749e173a992f4cdbc028372f3356bc2f873" end depends_on "pkg-config" => :build depends_on "util-macros" => :build depends_on "libx11" depends_on "libxau" depends_on "libxext" depends_on "libxmu" on_linux do depends_on "libxcb" depends_on "libxdmcp" end def install args = %W[ --prefix=#{prefix} --sysconfdir=#{etc} --localstatedir=#{var} --disable-dependency-tracking --disable-silent-rules --enable-unix-transport --enable-tcp-transport --enable-ipv6 --enable-local-transport ] system "./configure", *args system "make" system "make", "install" end test do assert_match "unable to open display", shell_output("xauth generate :0 2>&1", 1) end end xauth 1.1.2 Closes #101033. Signed-off-by: Yurii Kolesnykov <dc76e9f0c0006e8f919e0c515c66dbba3982f785@yurikoles.com> Signed-off-by: Rui Chen <907c7afd57be493757f13ccd1dd45dddf02db069@chenrui.dev> Signed-off-by: BrewTestBot <8a898ee6867e4f2028e63d2a6319b2224641c06c@users.noreply.github.com> class Xauth < Formula desc "X.Org Applications: xauth" homepage "https://www.x.org/" url "https://www.x.org/pub/individual/app/xauth-1.1.2.tar.xz" sha256 "78ba6afd19536ced1dddb3276cba6e9555a211b468a06f95f6a97c62ff8ee200" license "MIT-open-group" bottle do sha256 cellar: :any, arm64_monterey: "f03feb786d9b9d59d83f3019ae0422946bf2bb2c9a1c87aedb5cafb8d1f6c8b9" sha256 cellar: :any, arm64_big_sur: "6eec2379cd9b33ef0a6f43fb987ae5c33f6023c252cdae90ae0c653ad26028f4" sha256 cellar: :any, monterey: "53010640b1e9a7aca696d305b3524dd5a1b01a3c60e2963ec40cce547633890e" sha256 cellar: :any, big_sur: "dbd7921c13d14ed10d9d011eea5cdf16b44f4019799c072ff492b7aa11063b31" sha256 cellar: :any, catalina: "68b0119f7e2d4e4269d7f2ded4657700f2d66d83f3da3bb0a38c9aff94943bd6" sha256 cellar: :any_skip_relocation, x86_64_linux: "f7fef9c7735f8d5b3405f4ff95bbf749e173a992f4cdbc028372f3356bc2f873" end depends_on "pkg-config" => :build depends_on "util-macros" => :build depends_on "libx11" depends_on "libxau" depends_on "libxext" depends_on "libxmu" on_linux do depends_on "libxcb" depends_on "libxdmcp" end def install args = %W[ --prefix=#{prefix} --sysconfdir=#{etc} --localstatedir=#{var} --disable-dependency-tracking --disable-silent-rules --enable-unix-transport --enable-tcp-transport --enable-ipv6 --enable-local-transport ] system "./configure", *args system "make" system "make", "install" end test do assert_match "unable to open display", shell_output("xauth generate :0 2>&1", 1) end end
class Xmake < Formula desc "Cross-platform build utility based on Lua" homepage "https://xmake.io/" url "https://github.com/xmake-io/xmake/releases/download/v2.3.9/xmake-v2.3.9.m1.tar.gz" version "2.3.9.m1" sha256 "25a8fc39c6859854d26cec918eca94e16427d76870a9f29f4b302f7d300674a2" license "Apache-2.0" head "https://github.com/xmake-io/xmake.git" bottle do cellar :any_skip_relocation sha256 "9102ec2c17817f4aaf96710c73f568078ceba2201d35fd33cbeb09fc5a52c3e7" => :big_sur sha256 "97601c30b48b566feede80e8c546fa8a7f8f47340d5fa99775ae89fa21ebf798" => :catalina sha256 "1d38ca72d9c6b48a735ad97896956a795a74e85f99318eb84eb8ac856d363628" => :mojave end on_linux do depends_on "readline" end def install on_linux do ENV["XMAKE_ROOT"] = "y" if ENV["CI"] end system "make", "build" system "make", "install", "prefix=#{prefix}" end test do system bin/"xmake", "create", "test" cd "test" do system bin/"xmake" assert_equal "hello world!", shell_output("#{bin}/xmake run").chomp end end end xmake: update 2.3.9.m1 bottle. class Xmake < Formula desc "Cross-platform build utility based on Lua" homepage "https://xmake.io/" url "https://github.com/xmake-io/xmake/releases/download/v2.3.9/xmake-v2.3.9.m1.tar.gz" version "2.3.9.m1" sha256 "25a8fc39c6859854d26cec918eca94e16427d76870a9f29f4b302f7d300674a2" license "Apache-2.0" head "https://github.com/xmake-io/xmake.git" bottle do cellar :any_skip_relocation sha256 "304929df3becb98dbb71c977c378c7bee7a82b625e4829178d744ecba9733df8" => :big_sur sha256 "2934592e40f18bfa65bd290b7343a30178117e8f88a4a344745774760fc8cbba" => :arm64_big_sur sha256 "5b43f0aecef9254ea7d2f8bcff909165d6b3dce3f7c93afe8294a429173596bd" => :catalina sha256 "66edef034918bdaec425876134c341d6092f1fd83e346403d14b23ac483c906d" => :mojave end on_linux do depends_on "readline" end def install on_linux do ENV["XMAKE_ROOT"] = "y" if ENV["CI"] end system "make", "build" system "make", "install", "prefix=#{prefix}" end test do system bin/"xmake", "create", "test" cd "test" do system bin/"xmake" assert_equal "hello world!", shell_output("#{bin}/xmake run").chomp end end end
class Xonsh < Formula include Language::Python::Virtualenv desc "Python-powered, cross-platform, Unix-gazing shell language and command prompt" homepage "https://xon.sh/" url "https://files.pythonhosted.org/packages/7f/3d/a29fe1f9dc61502a0cdee70e4bd4f97164106975209b6feaa2e064d241fc/xonsh-0.9.25.tar.gz" sha256 "20af3480d6ac1b8a48f03288796b16a35f498f047e3472c300e4ef5a26f03d60" license "BSD-2-Clause-Views" head "https://github.com/xonsh/xonsh.git" bottle do sha256 cellar: :any_skip_relocation, big_sur: "f452f1a1bb8d5d47fcc882a8fc9819b39a38570e4b5a5aa259569f974e88619e" sha256 cellar: :any_skip_relocation, arm64_big_sur: "adf5638b08a02469fda9b604245892717519c3e2e6672f2a0d45fde285e235b6" sha256 cellar: :any_skip_relocation, catalina: "c32fcc12a0c3e00d98929d4d2a31f7d3c890ac5210a48a17087eb3e854af7982" sha256 cellar: :any_skip_relocation, mojave: "3ef62348b98b48176fb167fefc2097bb88fc5c0d4194c895234f72e86f79101c" end depends_on "python@3.9" # Resources based on `pip3 install xonsh[ptk,pygments,proctitle]` # See https://xon.sh/osx.html#dependencies resource "prompt-toolkit" do url "https://files.pythonhosted.org/packages/b1/46/4eb242362c43cf033b4ec4d7205612c46c9f904a8984cdfdb64d35476175/prompt_toolkit-3.0.14.tar.gz" sha256 "7e966747c18ececaec785699626b771c1ba8344c8d31759a1915d6b12fad6525" end resource "Pygments" do url "https://files.pythonhosted.org/packages/e1/86/8059180e8217299079d8719c6e23d674aadaba0b1939e25e0cc15dcf075b/Pygments-2.7.4.tar.gz" sha256 "df49d09b498e83c1a73128295860250b0b7edd4c723a32e9bc0d295c7c2ec337" end resource "pyperclip" do url "https://files.pythonhosted.org/packages/6f/4c/0b1d507ad7e8bc31d690d04b4f475e74c2002d060f7994ce8c09612df707/pyperclip-1.8.1.tar.gz" sha256 "9abef1e79ce635eb62309ecae02dfb5a3eb952fa7d6dce09c1aef063f81424d3" end resource "setproctitle" do url "https://files.pythonhosted.org/packages/a1/7f/a1d4f4c7b66f0fc02f35dc5c85f45a8b4e4a7988357a29e61c14e725ef86/setproctitle-1.2.2.tar.gz" sha256 "7dfb472c8852403d34007e01d6e3c68c57eb66433fb8a5c77b13b89a160d97df" end resource "wcwidth" do url "https://files.pythonhosted.org/packages/89/38/459b727c381504f361832b9e5ace19966de1a235d73cdbdea91c771a1155/wcwidth-0.2.5.tar.gz" sha256 "c4d647b99872929fdb7bdcaa4fbe7f01413ed3d98077df798530e5b04f116c83" end def install virtualenv_install_with_resources end test do assert_match "4", shell_output("#{bin}/xonsh -c 2+2") end end xonsh: update 0.9.25 bottle. class Xonsh < Formula include Language::Python::Virtualenv desc "Python-powered, cross-platform, Unix-gazing shell language and command prompt" homepage "https://xon.sh/" url "https://files.pythonhosted.org/packages/7f/3d/a29fe1f9dc61502a0cdee70e4bd4f97164106975209b6feaa2e064d241fc/xonsh-0.9.25.tar.gz" sha256 "20af3480d6ac1b8a48f03288796b16a35f498f047e3472c300e4ef5a26f03d60" license "BSD-2-Clause-Views" head "https://github.com/xonsh/xonsh.git" bottle do sha256 cellar: :any_skip_relocation, big_sur: "f452f1a1bb8d5d47fcc882a8fc9819b39a38570e4b5a5aa259569f974e88619e" sha256 cellar: :any_skip_relocation, arm64_big_sur: "adf5638b08a02469fda9b604245892717519c3e2e6672f2a0d45fde285e235b6" sha256 cellar: :any_skip_relocation, catalina: "c32fcc12a0c3e00d98929d4d2a31f7d3c890ac5210a48a17087eb3e854af7982" sha256 cellar: :any_skip_relocation, mojave: "3ef62348b98b48176fb167fefc2097bb88fc5c0d4194c895234f72e86f79101c" sha256 cellar: :any_skip_relocation, x86_64_linux: "2ca2fe502a6cb348331cbe0d7f1dd3f751c15af47361d961d80dbc0c41e47a09" end depends_on "python@3.9" # Resources based on `pip3 install xonsh[ptk,pygments,proctitle]` # See https://xon.sh/osx.html#dependencies resource "prompt-toolkit" do url "https://files.pythonhosted.org/packages/b1/46/4eb242362c43cf033b4ec4d7205612c46c9f904a8984cdfdb64d35476175/prompt_toolkit-3.0.14.tar.gz" sha256 "7e966747c18ececaec785699626b771c1ba8344c8d31759a1915d6b12fad6525" end resource "Pygments" do url "https://files.pythonhosted.org/packages/e1/86/8059180e8217299079d8719c6e23d674aadaba0b1939e25e0cc15dcf075b/Pygments-2.7.4.tar.gz" sha256 "df49d09b498e83c1a73128295860250b0b7edd4c723a32e9bc0d295c7c2ec337" end resource "pyperclip" do url "https://files.pythonhosted.org/packages/6f/4c/0b1d507ad7e8bc31d690d04b4f475e74c2002d060f7994ce8c09612df707/pyperclip-1.8.1.tar.gz" sha256 "9abef1e79ce635eb62309ecae02dfb5a3eb952fa7d6dce09c1aef063f81424d3" end resource "setproctitle" do url "https://files.pythonhosted.org/packages/a1/7f/a1d4f4c7b66f0fc02f35dc5c85f45a8b4e4a7988357a29e61c14e725ef86/setproctitle-1.2.2.tar.gz" sha256 "7dfb472c8852403d34007e01d6e3c68c57eb66433fb8a5c77b13b89a160d97df" end resource "wcwidth" do url "https://files.pythonhosted.org/packages/89/38/459b727c381504f361832b9e5ace19966de1a235d73cdbdea91c771a1155/wcwidth-0.2.5.tar.gz" sha256 "c4d647b99872929fdb7bdcaa4fbe7f01413ed3d98077df798530e5b04f116c83" end def install virtualenv_install_with_resources end test do assert_match "4", shell_output("#{bin}/xonsh -c 2+2") end end
class Xonsh < Formula include Language::Python::Virtualenv desc "Python-ish, BASHwards-compatible shell language and command prompt" homepage "http://xon.sh" url "https://github.com/xonsh/xonsh/archive/0.6.7.tar.gz" sha256 "1ff04ac5aa8a9cfc6d88303bcf9ee304721be27e77ce14978804d9b52f3a1d3c" head "https://github.com/xonsh/xonsh.git" bottle do cellar :any_skip_relocation sha256 "f5d0fa80ffcf417374a1dda1b1652c8da378f54d4bd8269e3f4638202406e31d" => :high_sierra sha256 "16d711d47e9c84483a86d499ab90e8d3d9c11a6fada10ce650d36e85a4f73e03" => :sierra sha256 "024b243f0619ab8658620246717e4179963a6e9c070388fe6ecfc5c0e7722003" => :el_capitan end depends_on "python" def install virtualenv_install_with_resources end test do assert_match "4", shell_output("#{bin}/xonsh -c 2+2") end end xonsh: update 0.6.7 bottle for Linuxbrew. Closes Linuxbrew/homebrew-core#8056. Signed-off-by: Michka Popoff <7b0496f66f66ee22a38826c310c38b415671b832@gmail.com> class Xonsh < Formula include Language::Python::Virtualenv desc "Python-ish, BASHwards-compatible shell language and command prompt" homepage "http://xon.sh" url "https://github.com/xonsh/xonsh/archive/0.6.7.tar.gz" sha256 "1ff04ac5aa8a9cfc6d88303bcf9ee304721be27e77ce14978804d9b52f3a1d3c" head "https://github.com/xonsh/xonsh.git" bottle do cellar :any_skip_relocation sha256 "f5d0fa80ffcf417374a1dda1b1652c8da378f54d4bd8269e3f4638202406e31d" => :high_sierra sha256 "16d711d47e9c84483a86d499ab90e8d3d9c11a6fada10ce650d36e85a4f73e03" => :sierra sha256 "024b243f0619ab8658620246717e4179963a6e9c070388fe6ecfc5c0e7722003" => :el_capitan sha256 "37f77b257735ff98169303a677e5aeca2e779876ba8ec122c4af8eb86d6d926f" => :x86_64_linux end depends_on "python" def install virtualenv_install_with_resources end test do assert_match "4", shell_output("#{bin}/xonsh -c 2+2") end end
class Xonsh < Formula include Language::Python::Virtualenv desc "Python-ish, BASHwards-compatible shell language and command prompt" homepage "http://xon.sh" url "https://github.com/xonsh/xonsh/archive/0.5.0.tar.gz" sha256 "171ce4824bc0109e2b1366cdc0bafa68d74285f4fa157d5f0c62a37d2a4d3972" revision 1 head "https://github.com/scopatz/xonsh.git" bottle do sha256 "da5d3e32d9b9b940c0e7d6c8e7e8406d06fb8a5dd13bcdbfdb0b8059c056855c" => :sierra sha256 "25f8db5eb66b1482862c3c411a1f761f40c54c273578953bf274eaeea3384bf6" => :el_capitan sha256 "6218b185c3ffa22c1867f552b5b804faaef1c350f36523f68d20e77e055f88f9" => :yosemite end depends_on :python3 resource "ply" do url "https://files.pythonhosted.org/packages/a8/4d/487e12d0478ee0cbb15d6fe9b8916e98fe4e2fce4cc65e4de309209c0b24/ply-3.9.tar.gz" sha256 "0d7e2940b9c57151392fceaa62b0865c45e06ce1e36687fd8d03f011a907f43e" end def install virtualenv_install_with_resources end test do assert_match "4", shell_output("#{bin}/xonsh -c 2+2") end end xonsh 0.5.2 Closes #8543. Signed-off-by: Tomasz Pajor <ea73344294b1c6e2cb529d7fc98a4971de7607ac@polishgeeks.com> class Xonsh < Formula include Language::Python::Virtualenv desc "Python-ish, BASHwards-compatible shell language and command prompt" homepage "http://xon.sh" url "https://github.com/xonsh/xonsh/archive/0.5.2.tar.gz" sha256 "58bd878acdfe46372b56b3f4b764e85c1038bd149334731f778daa12ab072294" head "https://github.com/scopatz/xonsh.git" bottle do sha256 "da5d3e32d9b9b940c0e7d6c8e7e8406d06fb8a5dd13bcdbfdb0b8059c056855c" => :sierra sha256 "25f8db5eb66b1482862c3c411a1f761f40c54c273578953bf274eaeea3384bf6" => :el_capitan sha256 "6218b185c3ffa22c1867f552b5b804faaef1c350f36523f68d20e77e055f88f9" => :yosemite end depends_on :python3 resource "ply" do url "https://files.pythonhosted.org/packages/a8/4d/487e12d0478ee0cbb15d6fe9b8916e98fe4e2fce4cc65e4de309209c0b24/ply-3.9.tar.gz" sha256 "0d7e2940b9c57151392fceaa62b0865c45e06ce1e36687fd8d03f011a907f43e" end def install virtualenv_install_with_resources end test do assert_match "4", shell_output("#{bin}/xonsh -c 2+2") end end
class Xonsh < Formula include Language::Python::Virtualenv desc "Python-ish, BASHwards-compatible shell language and command prompt" homepage "http://xon.sh" url "https://github.com/xonsh/xonsh/archive/0.6.7.tar.gz" sha256 "1ff04ac5aa8a9cfc6d88303bcf9ee304721be27e77ce14978804d9b52f3a1d3c" head "https://github.com/xonsh/xonsh.git" bottle do cellar :any_skip_relocation sha256 "f5d0fa80ffcf417374a1dda1b1652c8da378f54d4bd8269e3f4638202406e31d" => :high_sierra sha256 "16d711d47e9c84483a86d499ab90e8d3d9c11a6fada10ce650d36e85a4f73e03" => :sierra sha256 "024b243f0619ab8658620246717e4179963a6e9c070388fe6ecfc5c0e7722003" => :el_capitan end depends_on "python" def install virtualenv_install_with_resources end test do assert_match "4", shell_output("#{bin}/xonsh -c 2+2") end end xonsh 0.6.8 Closes #29562. Signed-off-by: ilovezfs <fbd54dbbcf9e596abad4ccdc4dfc17f80ebeaee2@icloud.com> class Xonsh < Formula include Language::Python::Virtualenv desc "Python-ish, BASHwards-compatible shell language and command prompt" homepage "http://xon.sh" url "https://github.com/xonsh/xonsh/archive/0.6.8.tar.gz" sha256 "77d8b64ddc600549fd073a3ead20c41e049e61e26e7f3337322449f7c9b11b71" head "https://github.com/xonsh/xonsh.git" bottle do cellar :any_skip_relocation sha256 "f5d0fa80ffcf417374a1dda1b1652c8da378f54d4bd8269e3f4638202406e31d" => :high_sierra sha256 "16d711d47e9c84483a86d499ab90e8d3d9c11a6fada10ce650d36e85a4f73e03" => :sierra sha256 "024b243f0619ab8658620246717e4179963a6e9c070388fe6ecfc5c0e7722003" => :el_capitan end depends_on "python" def install virtualenv_install_with_resources end test do assert_match "4", shell_output("#{bin}/xonsh -c 2+2") end end
class Xrick < Formula desc "Clone of Rick Dangerous" homepage "https://www.bigorno.net/xrick/" url "https://www.bigorno.net/xrick/xrick-021212.tgz" # There is a repo at https://github.com/zpqrtbnk/xrick but it is organized # differently than the tarball sha256 "aa8542120bec97a730258027a294bd16196eb8b3d66134483d085f698588fc2b" bottle do rebuild 1 sha256 big_sur: "301f75c04e2c98c81b58868d7357e817b7dec1bc8a29747b27f088a10c1863ec" sha256 catalina: "b391e62a9cf0a3537ec68c03d215370d875a70a90fb7a8cb48cac8cc7281e2c2" sha256 mojave: "cf85542617f6e39a8fec0239a57d1bc1707f50289e5c91bee89e84664603f43c" end depends_on "sdl" def install inreplace "src/xrick.c", "data.zip", "#{pkgshare}/data.zip" system "make" bin.install "xrick" man6.install "xrick.6.gz" pkgshare.install "data.zip" end test do assert_match "xrick [version ##{version}]", shell_output("#{bin}/xrick --help", 1) end end xrick: update 021212 bottle. class Xrick < Formula desc "Clone of Rick Dangerous" homepage "https://www.bigorno.net/xrick/" url "https://www.bigorno.net/xrick/xrick-021212.tgz" # There is a repo at https://github.com/zpqrtbnk/xrick but it is organized # differently than the tarball sha256 "aa8542120bec97a730258027a294bd16196eb8b3d66134483d085f698588fc2b" bottle do rebuild 2 sha256 arm64_big_sur: "06c5d5c23d3a83ae82c8efa8303c186cb8b07f2f274b911062c0a56df4207e96" sha256 big_sur: "07143daa9065782675e5288a66dc2ea8ce418754d4842175b016dbc097b982cd" sha256 catalina: "67d2a811a5ecd67de860f226fc88feec5ed479ae05fc22e917d6fbe0686be783" sha256 mojave: "1a2f4d0cc564fd627d83f2b54606c59845b50fb3db04e7a118ca281377b4805a" end depends_on "sdl" def install inreplace "src/xrick.c", "data.zip", "#{pkgshare}/data.zip" system "make" bin.install "xrick" man6.install "xrick.6.gz" pkgshare.install "data.zip" end test do assert_match "xrick [version ##{version}]", shell_output("#{bin}/xrick --help", 1) end end
class Xsimd < Formula desc "Modern, portable C++ wrappers for SIMD intrinsics" homepage "https://xsimd.readthedocs.io/en/latest/" url "https://github.com/QuantStack/xsimd/archive/7.5.0.tar.gz" sha256 "45337317c7f238fe0d64bb5d5418d264a427efc53400ddf8e6a964b6bcb31ce9" license "BSD-3-Clause" bottle do sha256 cellar: :any_skip_relocation, arm64_big_sur: "c8c0550dcc933117abe0a9ac6369dcfa3f5fc67192a5470213200d70e8b34a49" sha256 cellar: :any_skip_relocation, big_sur: "c8c0550dcc933117abe0a9ac6369dcfa3f5fc67192a5470213200d70e8b34a49" sha256 cellar: :any_skip_relocation, catalina: "c8c0550dcc933117abe0a9ac6369dcfa3f5fc67192a5470213200d70e8b34a49" sha256 cellar: :any_skip_relocation, mojave: "c8c0550dcc933117abe0a9ac6369dcfa3f5fc67192a5470213200d70e8b34a49" end depends_on "cmake" => :build def install args = std_cmake_args args << "-DBUILD_TESTS=OFF" system "cmake", ".", *args system "make", "install" end test do (testpath/"test.c").write <<~EOS #include <vector> #include <type_traits> #include "xsimd/memory/xsimd_alignment.hpp" using namespace xsimd; struct mock_container {}; int main(void) { using u_vector_type = std::vector<double>; using a_vector_type = std::vector<double, aligned_allocator<double, XSIMD_DEFAULT_ALIGNMENT>>; using u_vector_align = container_alignment_t<u_vector_type>; using a_vector_align = container_alignment_t<a_vector_type>; using mock_align = container_alignment_t<mock_container>; if(!std::is_same<u_vector_align, unaligned_mode>::value) abort(); if(!std::is_same<a_vector_align, aligned_mode>::value) abort(); if(!std::is_same<mock_align, unaligned_mode>::value) abort(); return 0; } EOS system ENV.cxx, "test.c", "-std=c++14", "-I#{include}", "-o", "test" system "./test" end end xsimd: update 7.5.0 bottle. class Xsimd < Formula desc "Modern, portable C++ wrappers for SIMD intrinsics" homepage "https://xsimd.readthedocs.io/en/latest/" url "https://github.com/QuantStack/xsimd/archive/7.5.0.tar.gz" sha256 "45337317c7f238fe0d64bb5d5418d264a427efc53400ddf8e6a964b6bcb31ce9" license "BSD-3-Clause" bottle do sha256 cellar: :any_skip_relocation, arm64_big_sur: "c8c0550dcc933117abe0a9ac6369dcfa3f5fc67192a5470213200d70e8b34a49" sha256 cellar: :any_skip_relocation, big_sur: "c8c0550dcc933117abe0a9ac6369dcfa3f5fc67192a5470213200d70e8b34a49" sha256 cellar: :any_skip_relocation, catalina: "c8c0550dcc933117abe0a9ac6369dcfa3f5fc67192a5470213200d70e8b34a49" sha256 cellar: :any_skip_relocation, mojave: "c8c0550dcc933117abe0a9ac6369dcfa3f5fc67192a5470213200d70e8b34a49" sha256 cellar: :any_skip_relocation, x86_64_linux: "65cdb6754f3b1b6c42569b851e81ff800b95f2de91d246bce8f4f881eca4035f" end depends_on "cmake" => :build def install args = std_cmake_args args << "-DBUILD_TESTS=OFF" system "cmake", ".", *args system "make", "install" end test do (testpath/"test.c").write <<~EOS #include <vector> #include <type_traits> #include "xsimd/memory/xsimd_alignment.hpp" using namespace xsimd; struct mock_container {}; int main(void) { using u_vector_type = std::vector<double>; using a_vector_type = std::vector<double, aligned_allocator<double, XSIMD_DEFAULT_ALIGNMENT>>; using u_vector_align = container_alignment_t<u_vector_type>; using a_vector_align = container_alignment_t<a_vector_type>; using mock_align = container_alignment_t<mock_container>; if(!std::is_same<u_vector_align, unaligned_mode>::value) abort(); if(!std::is_same<a_vector_align, aligned_mode>::value) abort(); if(!std::is_same<mock_align, unaligned_mode>::value) abort(); return 0; } EOS system ENV.cxx, "test.c", "-std=c++14", "-I#{include}", "-o", "test" system "./test" end end
class Zbctl < Formula desc "Zeebe CLI client" homepage "https://docs.camunda.io/docs/apis-clients/cli-client/index/" url "https://github.com/camunda/zeebe.git", tag: "8.1.3", revision: "1b72df6594134e7b7fc60f1801d418c51bbcc3d7" license "Apache-2.0" head "https://github.com/camunda/zeebe.git", branch: "develop" bottle do sha256 cellar: :any_skip_relocation, arm64_monterey: "7bd176589d8afa4ee8b9443cf2ac4c53bb5357ecaaa11e16f41a7ae9ff10f695" sha256 cellar: :any_skip_relocation, arm64_big_sur: "7bd176589d8afa4ee8b9443cf2ac4c53bb5357ecaaa11e16f41a7ae9ff10f695" sha256 cellar: :any_skip_relocation, monterey: "eceb000a78b1653efee4d544347f27529ad910c4da2b68823ecd16025415edd9" sha256 cellar: :any_skip_relocation, big_sur: "eceb000a78b1653efee4d544347f27529ad910c4da2b68823ecd16025415edd9" sha256 cellar: :any_skip_relocation, catalina: "eceb000a78b1653efee4d544347f27529ad910c4da2b68823ecd16025415edd9" sha256 cellar: :any_skip_relocation, x86_64_linux: "12799955bd8ae11e903b762284cfaf25090766b6de39fd39ba0cf12c201c267a" end depends_on "go" => :build def install commit = Utils.git_short_head chdir "clients/go/cmd/zbctl" do project = "github.com/camunda/zeebe/clients/go/v8/cmd/zbctl/internal/commands" ldflags = %W[ -w -X #{project}.Version=#{version} -X #{project}.Commit=#{commit} ] system "go", "build", "-tags", "netgo", *std_go_args(ldflags: ldflags) generate_completions_from_executable(bin/"zbctl", "completion") end end test do # Check status for a nonexistent cluster status_error_message = "Error: rpc error: code = " \ "Unavailable desc = connection error: " \ "desc = \"transport: Error while dialing dial tcp 127.0.0.1:26500: connect: connection refused\"" output = shell_output("#{bin}/zbctl status 2>&1", 1) assert_match status_error_message, output # Check version commit = stable.specs[:revision][0..7] expected_version = "zbctl #{version} (commit: #{commit})" assert_match expected_version, shell_output("#{bin}/zbctl version") end end zbctl: update 8.1.3 bottle. class Zbctl < Formula desc "Zeebe CLI client" homepage "https://docs.camunda.io/docs/apis-clients/cli-client/index/" url "https://github.com/camunda/zeebe.git", tag: "8.1.3", revision: "1b72df6594134e7b7fc60f1801d418c51bbcc3d7" license "Apache-2.0" head "https://github.com/camunda/zeebe.git", branch: "develop" bottle do sha256 cellar: :any_skip_relocation, arm64_ventura: "7bd176589d8afa4ee8b9443cf2ac4c53bb5357ecaaa11e16f41a7ae9ff10f695" sha256 cellar: :any_skip_relocation, arm64_monterey: "7bd176589d8afa4ee8b9443cf2ac4c53bb5357ecaaa11e16f41a7ae9ff10f695" sha256 cellar: :any_skip_relocation, arm64_big_sur: "7bd176589d8afa4ee8b9443cf2ac4c53bb5357ecaaa11e16f41a7ae9ff10f695" sha256 cellar: :any_skip_relocation, monterey: "eceb000a78b1653efee4d544347f27529ad910c4da2b68823ecd16025415edd9" sha256 cellar: :any_skip_relocation, big_sur: "eceb000a78b1653efee4d544347f27529ad910c4da2b68823ecd16025415edd9" sha256 cellar: :any_skip_relocation, catalina: "eceb000a78b1653efee4d544347f27529ad910c4da2b68823ecd16025415edd9" sha256 cellar: :any_skip_relocation, x86_64_linux: "12799955bd8ae11e903b762284cfaf25090766b6de39fd39ba0cf12c201c267a" end depends_on "go" => :build def install commit = Utils.git_short_head chdir "clients/go/cmd/zbctl" do project = "github.com/camunda/zeebe/clients/go/v8/cmd/zbctl/internal/commands" ldflags = %W[ -w -X #{project}.Version=#{version} -X #{project}.Commit=#{commit} ] system "go", "build", "-tags", "netgo", *std_go_args(ldflags: ldflags) generate_completions_from_executable(bin/"zbctl", "completion") end end test do # Check status for a nonexistent cluster status_error_message = "Error: rpc error: code = " \ "Unavailable desc = connection error: " \ "desc = \"transport: Error while dialing dial tcp 127.0.0.1:26500: connect: connection refused\"" output = shell_output("#{bin}/zbctl status 2>&1", 1) assert_match status_error_message, output # Check version commit = stable.specs[:revision][0..7] expected_version = "zbctl #{version} (commit: #{commit})" assert_match expected_version, shell_output("#{bin}/zbctl version") end end
# -*- encoding: utf-8 -*- Gem::Specification.new do |s| s.name = %q{sandbox} s.version = "0.0.0" s.required_rubygems_version = Gem::Requirement.new(">= 0") if s.respond_to? :required_rubygems_version= s.authors = ["Brandon Dimcheff"] s.date = %q{2009-02-13} s.description = %q{TODO} s.email = %q{bdimchef-git@wieldim.com} s.files = ["README.rdoc", "VERSION.yml", "lib/sandbox.rb", "spec/sandbox_spec.rb", "spec/spec_helper.rb"] s.has_rdoc = true s.homepage = %q{http://github.com/bdimcheff/sandbox} s.rdoc_options = ["--inline-source", "--charset=UTF-8"] s.require_paths = ["lib"] s.rubygems_version = %q{1.3.1} s.summary = %q{TODO} if s.respond_to? :specification_version then current_version = Gem::Specification::CURRENT_SPECIFICATION_VERSION s.specification_version = 2 if Gem::Version.new(Gem::RubyGemsVersion) >= Gem::Version.new('1.2.0') then else end else end end Regenerated gemspec for version 0.0.1 # -*- encoding: utf-8 -*- Gem::Specification.new do |s| s.name = %q{sandbox} s.version = "0.0.1" s.required_rubygems_version = Gem::Requirement.new(">= 0") if s.respond_to? :required_rubygems_version= s.authors = ["Brandon Dimcheff"] s.date = %q{2009-02-13} s.description = %q{TODO} s.email = %q{bdimchef-git@wieldim.com} s.files = ["README.rdoc", "VERSION.yml", "lib/sandbox.rb", "spec/sandbox_spec.rb", "spec/spec_helper.rb"] s.has_rdoc = true s.homepage = %q{http://github.com/bdimcheff/sandbox} s.rdoc_options = ["--inline-source", "--charset=UTF-8"] s.require_paths = ["lib"] s.rubygems_version = %q{1.3.1} s.summary = %q{TODO} if s.respond_to? :specification_version then current_version = Gem::Specification::CURRENT_SPECIFICATION_VERSION s.specification_version = 2 if Gem::Version.new(Gem::RubyGemsVersion) >= Gem::Version.new('1.2.0') then else end else end end
$LOAD_PATH.unshift(File.expand_path( File.join('..', '..', 'oauth2-core', 'lib'), File.dirname(__FILE__) )) require "rubygems" require "bundler" Bundler.setup require 'oauth2/server' require 'rspec' require 'rspec/autorun' Dir.glob(File.dirname(__FILE__) + "/support/**/*.rb").each do |file| require file end Rspec.configure do |config| # == Mock Framework # # If you prefer to use mocha, flexmock or RR, uncomment the appropriate line: # # config.mock_with :mocha # config.mock_with :flexmock # config.mock_with :rr # config.mock_with :rspec config.include OAuth2::Matchers end Update spec_helper to complain about missing gems $LOAD_PATH.unshift(File.expand_path( File.join('..', '..', 'oauth2-core', 'lib'), File.dirname(__FILE__) )) require "rubygems" begin require "bundler" Bundler.setup rescue LoadError => e puts 'Bundler not found. Please install bundler with the command gem install bundler' end begin require 'rspec' require 'rspec/autorun' rescue LoadError => e puts 'RSpec not found. Please install rspec with command bundle install' end require 'oauth2/server' Dir.glob(File.dirname(__FILE__) + "/support/**/*.rb").each do |file| require file end Rspec.configure do |config| # == Mock Framework # # If you prefer to use mocha, flexmock or RR, uncomment the appropriate line: # # config.mock_with :mocha # config.mock_with :flexmock # config.mock_with :rr # config.mock_with :rspec config.include OAuth2::Matchers end
begin require 'dotenv' Dotenv.load rescue LoadError end task :environment do ENV['RACK_ENV'] = 'development' unless ENV['RACK_ENV'] require 'celluloid' require 'sucker_punch' require 'roda' require 'mongoid' require 'json' require 'mutations' require 'logger' require 'msgpack' require 'tilt/jbuilder.rb' Dir[__dir__ + '/../../models/*.rb'].each {|file| require file } require_relative '../../app/initializers/mongoid' end remove sucker_punch begin require 'dotenv' Dotenv.load rescue LoadError end task :environment do ENV['RACK_ENV'] = 'development' unless ENV['RACK_ENV'] require 'celluloid' require 'roda' require 'mongoid' require 'json' require 'mutations' require 'logger' require 'msgpack' require 'tilt/jbuilder.rb' Dir[__dir__ + '/../../models/*.rb'].each {|file| require file } require_relative '../../app/initializers/mongoid' end
# Test.rb # # Description: Implements replacive fuzzing by testing a set of URL's with # attack vectors and determines if a vulnerabilty occured on # the target. # # Author: Peter Mikitsh pam3961 # Author: Akshay Karnawat require 'mechanize' require 'net/http' require 'timeout' class Test # url: string of absolute URL paths to test # vectors: string array of replacive vectors to append to urls # authAgent: optional 'Mechanize' agent (if authentication used def self.test(url, vectors, authAgent, random, timeout) puts "Testing Vectors..." # create a new agent with timeout attributes agent = authAgent ? authAgent : Mechanize.new vectors.each do |vector| Test.replaciveFuzz(url, vector, agent, timeout) end end def self.createAttackURL(url, vector) return url + "/" + vector; end def self.replaciveFuzz(url, vector, agent, timeout) begin attack_url = Test.createAttackURL(url, vector) puts "Testing URL #{attack_url}" Timeout.timeout(timeout) { response = agent.get(attack_url) } if response.body.include? vector puts "\t Possible vulnerability identified. The response body contains the attack vector." end rescue Mechanize::ResponseCodeError => e puts "\t Possible vulnerability identified. #{e.response_code} - Unexcepted response code." rescue Timeout::Error puts "\t Possible vulnerability identified. Timeout error." end end end fix runtime error # Test.rb # # Description: Implements replacive fuzzing by testing a set of URL's with # attack vectors and determines if a vulnerabilty occured on # the target. # # Author: Peter Mikitsh pam3961 # Author: Akshay Karnawat require 'mechanize' require 'net/http' require 'timeout' class Test # url: string of absolute URL paths to test # vectors: string array of replacive vectors to append to urls # authAgent: optional 'Mechanize' agent (if authentication used def self.test(url, vectors, authAgent, random, timeout) puts "Testing Vectors..." # create a new agent with timeout attributes agent = authAgent ? authAgent : Mechanize.new vectors.each do |vector| Test.replaciveFuzz(url, vector, agent, timeout) end end def self.createAttackURL(url, vector) return url + "/" + vector; end def self.replaciveFuzz(url, vector, agent, timeout) begin attack_url = Test.createAttackURL(url, vector) puts "Testing URL #{attack_url}" Timeout.timeout(timeout) { response = agent.get(attack_url) if response.body.include? vector puts "\t Possible vulnerability identified. The response body contains the attack vector." end } rescue Mechanize::ResponseCodeError => e puts "\t Possible vulnerability identified. #{e.response_code} - Unexcepted response code." rescue Timeout::Error puts "\t Possible vulnerability identified. Timeout error." end end end
# encoding: UTF-8 require 'rubygems' require 'test/unit' require 'highline/import' # Password prompt LDAPPWD = ask("Enter LDAP admin password: ") { |q| q.echo = false } require 'yunohost/functions' require 'pp' class TestYunoHostFunctions < Test::Unit::TestCase def test_ldap_search result = [{ "objectclass" => ["mailAccount", "organizationalRole", "posixAccount", "simpleSecurityObject"], "dn" => "cn=admin," + LDAPDOMAIN.chomp }, { "objectclass" => ["sudoRole", "top"], "dn" => "cn=admin,ou=sudo," + LDAPDOMAIN.chomp }, { "objectclass" => ["groupOfNames", "top"], "dn" => "cn=admin,ou=groups," + LDAPDOMAIN.chomp }] assert_equal(result, @@yunoldap.search(LDAPDOMAIN, "(cn=admin)", ["dn", "objectclass"], false)) end def test_user_add attrs_hash = { "username" => "toto", "mail" => "toto@tata.net", "lastname" => "Tata Titi", "firstname" => "Toto", "password" => "yayaya" } result = { :dn=>"cn=Toto Tata Titi,ou=users," + LDAPDOMAIN, :attrs => { :objectclass => ["mailAccount", "inetorgperson"], :uid => "toto", :givenName => "Toto", :sn => "Tata Titi", :mail => "toto@tata.net", :displayName => "Toto Tata Titi", :userPassword => "{MD5}odEjpjk2q77oeCPi8a/6mw==", :cn => "Toto Tata Titi" } } user_delete("toto") if @@yunoldap.search(LDAPDOMAIN, "(uid=toto)") assert_equal(result, user_add(attrs_hash)) end def test_user_delete assert_equal(true, user_delete("toto")) end end user_info Test # encoding: UTF-8 require 'rubygems' require 'test/unit' require 'highline/import' # Password prompt LDAPPWD = ask("Enter LDAP admin password: ") { |q| q.echo = false } require 'yunohost/functions' require 'pp' @@user_hash = { "username" => "toto", "mail" => "toto@tata.net", "lastname" => "Tata Titi", "firstname" => "Toto", "password" => "yayaya" } class TestYunoHostFunctions < Test::Unit::TestCase def test_ldap_search result = [{ "objectclass" => ["mailAccount", "organizationalRole", "posixAccount", "simpleSecurityObject"], "dn" => "cn=admin," + LDAPDOMAIN.chomp }, { "objectclass" => ["sudoRole", "top"], "dn" => "cn=admin,ou=sudo," + LDAPDOMAIN.chomp }, { "objectclass" => ["groupOfNames", "top"], "dn" => "cn=admin,ou=groups," + LDAPDOMAIN.chomp }] assert_equal(result, @@yunoldap.search(LDAPDOMAIN, "(cn=admin)", ["dn", "objectclass"], false)) end def test_user_add result = { :dn =>"cn=Toto Tata Titi,ou=users," + LDAPDOMAIN, :attrs => { :objectclass => ["mailAccount", "inetorgperson"], :uid => "toto", :givenName => "Toto", :sn => "Tata Titi", :mail => "toto@tata.net", :displayName => "Toto Tata Titi", :userPassword => "{MD5}odEjpjk2q77oeCPi8a/6mw==", :cn => "Toto Tata Titi" } } user_delete("toto") if @@yunoldap.search(LDAPDOMAIN, "(uid=toto)") assert_equal(result, user_add(@@user_hash)) end def test_user_info result = { "givenName" => "Toto", "mailalias" => "none", "uid" => "toto", "mail" => "toto@tata.net", "sn" => "Tata Titi" } user_add(@@user_hash) unless @@yunoldap.search(LDAPDOMAIN, "(uid=toto)") assert_equal(result, user_info("toto")) end def test_user_delete user_add(@@user_hash) unless @@yunoldap.search(LDAPDOMAIN, "(uid=toto)") assert_equal(true, user_delete("toto")) end end
#!/usr/local/bin/ruby -w # $LOAD_PATH.unshift("lib") require 'madeleine' require 'test/unit' class Append def initialize(value) @value = value end def execute(system) system << @value end end module TestUtils def delete_directory(directory_name) Dir.foreach(directory_name) do |file| next if file == "." next if file == ".." assert(File.delete(directory_name + File::SEPARATOR + file) == 1, "Unable to delete #{file}") end Dir.delete(directory_name) end end class SnapshotMadeleineTest < Test::Unit::TestCase include TestUtils def teardown delete_directory(persistence_base) end def persistence_base "closing-test" end def test_closing madeleine = SnapshotMadeleine.new(persistence_base) { "hello" } madeleine.close assert_raises(RuntimeError) do madeleine.execute_command(Append.new("world")) end end end class NumberedFileTest < Test::Unit::TestCase def test_main target = Madeleine::NumberedFile.new(File::SEPARATOR + "foo", "bar", 321) assert_equal(File::SEPARATOR + "foo" + File::SEPARATOR + "000000000000000000321.bar", target.name) end end class CommandLogTest < Test::Unit::TestCase def setup @target = Madeleine::CommandLog.new(".") end def teardown @target.close File.delete(expected_file_name) end def test_logging f = open(expected_file_name, 'r') assert(f.stat.file?) @target.store(Addition.new(7)) read_command = Marshal.load(f) assert_equal(Addition, read_command.class) assert_equal(7, read_command.value) assert_equal(f.stat.size, f.tell) @target.store(Addition.new(3)) read_command = Marshal.load(f) assert_equal(3, read_command.value) assert_equal(f.stat.size, f.tell) f.close end def expected_file_name "000000000000000000001.command_log" end end class LoggerTest < Test::Unit::TestCase def test_creation @log = Object.new def @log.store(command) unless defined? @commands @commands = [] end @commands << command end def @log.commands @commands end log_factory = self target = Madeleine::Logger.new("whoah", log_factory) target.store(:foo) assert(@log.commands.include?(:foo)) end # Self-shunt def create_log(directory_name) @log end end class CommandVerificationTest < Test::Unit::TestCase def teardown Dir.delete("foo") end def test_broken_command target = SnapshotMadeleine.new("foo") { :a_system } assert_raises(Madeleine::InvalidCommandException) do target.execute_command(:not_a_command) end end end class CustomMarshallerTest < Test::Unit::TestCase include TestUtils def teardown delete_directory(prevalence_base) end def prevalence_base "custom-marshaller-test" end def madeleine_class SnapshotMadeleine end def test_changing_marshaller @log = "" marshaller = self target = madeleine_class.new(prevalence_base, marshaller) { "hello world" } target.take_snapshot assert_equal("dump ", @log) target = nil madeleine_class.new(prevalence_base, marshaller) { flunk() } assert_equal("dump load ", @log) end def load(io) @log << "load " assert_equal("dump data", io.read()) end def dump(system, io) @log << "dump " assert_equal("hello world", system) io.write("dump data") end end class ErrorRaisingCommand def execute(system) raise "woo-hoo" end end class ErrorHandlingTest < Test::Unit::TestCase include TestUtils def teardown delete_directory(prevalence_base) end def prevalence_base "error-handling-base" end def test_exception_in_command madeleine = SnapshotMadeleine.new(prevalence_base) { "hello" } assert_raises(RuntimeError) do madeleine.execute_command(ErrorRaisingCommand.new) end madeleine.close madeleine = SnapshotMadeleine.new(prevalence_base) { "hello" } madeleine.close end end class QueryTest < Test::Unit::TestCase include TestUtils def teardown delete_directory(prevalence_base) end def prevalence_base "query-base" end def test_querying madeleine = SnapshotMadeleine.new(prevalence_base) { "hello" } query = Object.new def query.execute(system) system.size end # 'query' is an un-marshallable singleton, so we implicitly test # that querys aren't stored. assert_equal(5, madeleine.execute_query(query)) # TODO: assert that no logging was done # TODO: assert that lock was held end end class TimeOptimizingLoggerTest < Test::Unit::TestCase def setup @target = Madeleine::Logger.new("some_directory", self) @log = [] def @log.store(command) self << command end end def test_optimizing_ticks assert_equal(0, @log.size) @target.store(Madeleine::Clock::Tick.new(Time.at(3))) assert_equal(0, @log.size) @target.store(Madeleine::Clock::Tick.new(Time.at(22))) assert_equal(0, @log.size) @target.store(Addition.new(100)) assert_kind_of(Madeleine::Clock::Tick, @log[0]) assert_equal(22, value_of_tick(@log[0])) assert_equal(100, @log[1].value) assert_equal(2, @log.size) end def value_of_tick(tick) @clock = Object.new def @clock.forward_to(time) @value = time.to_i end def @clock.value @value end tick.execute(self) @clock.value end # Self-shunt def create_log(directory_name) assert_equal("some_directory", directory_name) @log end # Self-shunt def clock @clock end end suite = Test::Unit::TestSuite.new("Madeleine") suite << SnapshotMadeleineTest.suite suite << NumberedFileTest.suite suite << CommandLogTest.suite suite << LoggerTest.suite suite << CommandVerificationTest.suite suite << CustomMarshallerTest.suite suite << ErrorHandlingTest.suite suite << QueryTest.suite suite << TimeOptimizingLoggerTest.suite require 'test_clocked' add_clocked_tests(suite) require 'test_automatic' add_automatic_tests(suite) require 'test_persistence' add_persistence_tests(suite) require 'test/unit/ui/console/testrunner' Test::Unit::UI::Console::TestRunner.run(suite) Tests don't leave junk directories around now. #!/usr/local/bin/ruby -w # $LOAD_PATH.unshift("lib") require 'madeleine' require 'test/unit' class Append def initialize(value) @value = value end def execute(system) system << @value end end module TestUtils def delete_directory(directory_name) Dir.foreach(directory_name) do |file| next if file == "." next if file == ".." assert(File.delete(directory_name + File::SEPARATOR + file) == 1, "Unable to delete #{file}") end Dir.delete(directory_name) end end class SnapshotMadeleineTest < Test::Unit::TestCase include TestUtils def teardown delete_directory(persistence_base) end def persistence_base "closing-test" end def test_closing madeleine = SnapshotMadeleine.new(persistence_base) { "hello" } madeleine.close assert_raises(RuntimeError) do madeleine.execute_command(Append.new("world")) end end end class NumberedFileTest < Test::Unit::TestCase def test_main target = Madeleine::NumberedFile.new(File::SEPARATOR + "foo", "bar", 321) assert_equal(File::SEPARATOR + "foo" + File::SEPARATOR + "000000000000000000321.bar", target.name) end end class CommandLogTest < Test::Unit::TestCase def setup @target = Madeleine::CommandLog.new(".") end def teardown @target.close File.delete(expected_file_name) end def test_logging f = open(expected_file_name, 'r') assert(f.stat.file?) @target.store(Addition.new(7)) read_command = Marshal.load(f) assert_equal(Addition, read_command.class) assert_equal(7, read_command.value) assert_equal(f.stat.size, f.tell) @target.store(Addition.new(3)) read_command = Marshal.load(f) assert_equal(3, read_command.value) assert_equal(f.stat.size, f.tell) f.close end def expected_file_name "000000000000000000001.command_log" end end class LoggerTest < Test::Unit::TestCase include TestUtils def teardown delete_directory("whoah") end def test_creation @log = Object.new def @log.store(command) unless defined? @commands @commands = [] end @commands << command end def @log.commands @commands end log_factory = self target = Madeleine::Logger.new("whoah", log_factory) target.store(:foo) assert(@log.commands.include?(:foo)) end # Self-shunt def create_log(directory_name) @log end end class CommandVerificationTest < Test::Unit::TestCase def teardown Dir.delete("foo") end def test_broken_command target = SnapshotMadeleine.new("foo") { :a_system } assert_raises(Madeleine::InvalidCommandException) do target.execute_command(:not_a_command) end end end class CustomMarshallerTest < Test::Unit::TestCase include TestUtils def teardown delete_directory(prevalence_base) end def prevalence_base "custom-marshaller-test" end def madeleine_class SnapshotMadeleine end def test_changing_marshaller @log = "" marshaller = self target = madeleine_class.new(prevalence_base, marshaller) { "hello world" } target.take_snapshot assert_equal("dump ", @log) target = nil madeleine_class.new(prevalence_base, marshaller) { flunk() } assert_equal("dump load ", @log) end def load(io) @log << "load " assert_equal("dump data", io.read()) end def dump(system, io) @log << "dump " assert_equal("hello world", system) io.write("dump data") end end class ErrorRaisingCommand def execute(system) raise "woo-hoo" end end class ErrorHandlingTest < Test::Unit::TestCase include TestUtils def teardown delete_directory(prevalence_base) end def prevalence_base "error-handling-base" end def test_exception_in_command madeleine = SnapshotMadeleine.new(prevalence_base) { "hello" } assert_raises(RuntimeError) do madeleine.execute_command(ErrorRaisingCommand.new) end madeleine.close madeleine = SnapshotMadeleine.new(prevalence_base) { "hello" } madeleine.close end end class QueryTest < Test::Unit::TestCase include TestUtils def teardown delete_directory(prevalence_base) end def prevalence_base "query-base" end def test_querying madeleine = SnapshotMadeleine.new(prevalence_base) { "hello" } query = Object.new def query.execute(system) system.size end # 'query' is an un-marshallable singleton, so we implicitly test # that querys aren't stored. assert_equal(5, madeleine.execute_query(query)) # TODO: assert that no logging was done # TODO: assert that lock was held end end class TimeOptimizingLoggerTest < Test::Unit::TestCase include TestUtils def setup @target = Madeleine::Logger.new("some_directory", self) @log = [] def @log.store(command) self << command end end def teardown delete_directory("some_directory") end def test_optimizing_ticks assert_equal(0, @log.size) @target.store(Madeleine::Clock::Tick.new(Time.at(3))) assert_equal(0, @log.size) @target.store(Madeleine::Clock::Tick.new(Time.at(22))) assert_equal(0, @log.size) @target.store(Addition.new(100)) assert_kind_of(Madeleine::Clock::Tick, @log[0]) assert_equal(22, value_of_tick(@log[0])) assert_equal(100, @log[1].value) assert_equal(2, @log.size) end def value_of_tick(tick) @clock = Object.new def @clock.forward_to(time) @value = time.to_i end def @clock.value @value end tick.execute(self) @clock.value end # Self-shunt def create_log(directory_name) assert_equal("some_directory", directory_name) @log end # Self-shunt def clock @clock end end suite = Test::Unit::TestSuite.new("Madeleine") suite << SnapshotMadeleineTest.suite suite << NumberedFileTest.suite suite << CommandLogTest.suite suite << LoggerTest.suite suite << CommandVerificationTest.suite suite << CustomMarshallerTest.suite suite << ErrorHandlingTest.suite suite << QueryTest.suite suite << TimeOptimizingLoggerTest.suite require 'test_clocked' add_clocked_tests(suite) require 'test_automatic' add_automatic_tests(suite) require 'test_persistence' add_persistence_tests(suite) require 'test/unit/ui/console/testrunner' Test::Unit::UI::Console::TestRunner.run(suite)
$:.push File.expand_path("../lib", __FILE__) # Maintain your gem's version: require "built_in_data/version" # Describe your gem and declare its dependencies: Gem::Specification.new do |s| s.name = "built_in_data" s.version = BuiltInData::VERSION s.authors = ['Aaron Baldwin', 'Jonathan S. Garvin', 'WWIDEA, Inc'] s.email = ["developers@wwidea.org"] s.homepage = "https://github.com/wwidea/built_in_data" s.summary = "Data management for Rails models." s.description = "BuiltInData is a simple tool for loading and updating data in a Rails application." s.license = 'MIT' s.files = Dir["{app,config,db,lib}/**/*"] + ["MIT-LICENSE", "Rakefile", "README.rdoc"] s.test_files = Dir["test/**/*"] s.add_dependency "rails", "~> 3.2.13" s.add_development_dependency "sqlite3" end update rails dependency for rails 4 $:.push File.expand_path("../lib", __FILE__) # Maintain your gem's version: require "built_in_data/version" # Describe your gem and declare its dependencies: Gem::Specification.new do |s| s.name = "built_in_data" s.version = BuiltInData::VERSION s.authors = ['Aaron Baldwin', 'Jonathan S. Garvin', 'WWIDEA, Inc'] s.email = ["developers@wwidea.org"] s.homepage = "https://github.com/wwidea/built_in_data" s.summary = "Data management for Rails models." s.description = "BuiltInData is a simple tool for loading and updating data in a Rails application." s.license = 'MIT' s.files = Dir["{app,config,db,lib}/**/*"] + ["MIT-LICENSE", "Rakefile", "README.rdoc"] s.test_files = Dir["test/**/*"] s.add_dependency "rails", ">= 3.2.13" s.add_development_dependency "sqlite3" end
#!/usr/bin/env ruby # Socket::PF_INET # Socket::SOCK_STREAM # s = Socket.new Socket::INET, Socket::SOCK_STREAM # s.connect Socket.pack_sockaddr_in(80, 'example.com') # # Using TCPSocket # s = TCPSocket.new 'example.com', 80 require "socket" STATUS_EXP = %r{\AHTTP/(\d+\.\d+) (?<code>\d+)} def set_light!(light, &callback) # Hue Bridge generally gives us: # * Response status line # * 3x cache-related header # * Connection close indicator # * 5x access control header # * Content type # * Body separator (blank) # * Response body, as a one-liner # ... so we allocate 14 entries right off the bat to avoid reallocating any # under-the-hood blocks of memory, etc. timings = [] timings << Time.now.to_f response = Array.new(14) uri = "/api/1234567890/lights/#{light}/state" timings << Time.now.to_f s = TCPSocket.new("192.168.2.10", 80) timings << Time.now.to_f body = %({"hue":#{callback.call},"transitiontime":0}) len = body.length s.puts("PUT #{uri} HTTP/1.0\nContent-Length: #{len}\n\n#{body}\n\n") timings << Time.now.to_f idx = 0 loop do tmp = s.gets break unless tmp response[idx] = tmp idx += 1 end timings << Time.now.to_f s.close timings << Time.now.to_f status = nil body = [] state = :find_status response.each do |line| case state when :find_status matches = STATUS_EXP.match(line) status = matches[:code].to_i if matches && matches[:code] state = :find_body when :find_body state = :capture_body if line == "\r\n" when :capture_body body << line end end timings << Time.now.to_f [status, body, timings[1..-1].zip(timings).map { |(a, b)| ((a - b) * 1000).round }] end LIGHTS = [37, 36, 38, 39, 40, 35] LAST_TIME = Array.new(LIGHTS.length) def error?(status, body) return true if status != 200 !!body.find { |line| line =~ /error/ } end start_time = Time.now.to_f successes = 0 failures = 0 trap("EXIT") do requests = successes + failures end_time = Time.now.to_f elapsed = end_time - start_time puts puts "Results: #{requests} requests in #{elapsed.round(2)} sec" puts " #{successes} successes, #{failures} failures" puts "Performance: #{(requests / elapsed).round(2)} req/sec" puts "Stability: #{((successes / requests.to_f) * 100).round(1)}% succeeded" puts exit 0 end iterations = 0 GC.disable begin loop do break if iterations >= 30 iterations += 1 hue = Random.rand(65_535) extra_wait = 0 LIGHTS.each do |light| status, body, _timings = set_light!(light) { hue } failed = error?(status, body) if failed failures += 1 extra_wait += 50 else successes += 1 end printf failed ? "-" : "*" end sleep 0.06 + (extra_wait / 1000.0) printf " (#{extra_wait}ms)" if extra_wait > 0 puts end rescue Interrupt puts "Goodbye." end This seems a hair more stable/robust... #!/usr/bin/env ruby # Socket::PF_INET # Socket::SOCK_STREAM # s = Socket.new Socket::INET, Socket::SOCK_STREAM # s.connect Socket.pack_sockaddr_in(80, 'example.com') # # Using TCPSocket # s = TCPSocket.new 'example.com', 80 require "socket" STATUS_EXP = %r{\AHTTP/(\d+\.\d+) (?<code>\d+)} def set_light!(light, &callback) # Hue Bridge generally gives us: # * Response status line # * 3x cache-related header # * Connection close indicator # * 5x access control header # * Content type # * Body separator (blank) # * Response body, as a one-liner # ... so we allocate 14 entries right off the bat to avoid reallocating any # under-the-hood blocks of memory, etc. timings = [] timings << Time.now.to_f response = Array.new(14) uri = "/api/1234567890/lights/#{light}/state" timings << Time.now.to_f s = TCPSocket.new("192.168.2.10", 80) timings << Time.now.to_f body = %({"hue":#{callback.call},"transitiontime":0}) len = body.length s.puts("PUT #{uri} HTTP/1.0\nContent-Length: #{len}\n\n#{body}\n\n") timings << Time.now.to_f idx = 0 loop do tmp = s.gets break unless tmp response[idx] = tmp idx += 1 end timings << Time.now.to_f s.close timings << Time.now.to_f status = nil body = [] state = :find_status response.each do |line| case state when :find_status matches = STATUS_EXP.match(line) status = matches[:code].to_i if matches && matches[:code] state = :find_body when :find_body state = :capture_body if line == "\r\n" when :capture_body body << line end end timings << Time.now.to_f [status, body, timings[1..-1].zip(timings).map { |(a, b)| ((a - b) * 1000).round }] end LIGHTS = [37, 36, 38, 39, 40, 35] LAST_TIME = Array.new(LIGHTS.length) def error?(status, body) return true if status != 200 !!body.find { |line| line =~ /error/ } end start_time = Time.now.to_f successes = 0 failures = 0 trap("EXIT") do requests = successes + failures end_time = Time.now.to_f elapsed = end_time - start_time puts puts "Results: #{requests} requests in #{elapsed.round(2)} sec" puts " #{successes} successes, #{failures} failures" puts "Performance: #{(requests / elapsed).round(2)} req/sec" puts "Stability: #{((successes / requests.to_f) * 100).round(1)}% succeeded" puts exit 0 end iterations = 0 GC.disable begin loop do break if iterations >= 30 iterations += 1 hue = Random.rand(65_535) extra_wait = 0 LIGHTS.each do |light| status, body, _timings = set_light!(light) { hue } failed = error?(status, body) if failed failures += 1 extra_wait += 10 else successes += 1 end printf failed ? "-" : "*" sleep 0.015 + (extra_wait / 1000.0) end # sleep 0.08 + (extra_wait / 1000.0) printf " (#{extra_wait}ms)" if extra_wait > 0 puts end rescue Interrupt puts "Goodbye." end
simple run and compare harness for different algos #!/usr/bin/env ruby # arg1 = number of entries to take from test data USE_RUBY = false raise "usage: test.rb NUM_ENTRIES MIN_RESEMBLANCE=0.6" unless ARGV.size==1 or ARGV.size==2 N = ARGV[0].to_i MIN_RES = ARGV[1] ? ARGV[1].to_f : 0.6 puts "NUM_ENTRIES=#{N} MIN_RESEMBLANCE=#{MIN_RES}" raise "test.rb configured to assume min_resem >= 0.6" unless MIN_RES >= 0.6 and MIN_RES <= 1 alias _puts puts def puts msg _puts "#{Time.now} #{msg}" end def time_call start = Time.now yield puts "time #{Time.now-start}s" end def run_unless_file_exists file if File.exists? file puts "using cached version of #{file}" else puts "calculating #{file}" yield end end def head_command n # "head -n #{n} name_addr | perl -pnle'tr/A-Z/a-z/'" "head -n #{n} name_addr" end def run command puts "exec #{command}" `#{command}` end def combine_resemblance_results file puts "combining resemblance.out files" resems = Dir.glob("resemblance.*.out") resems_sorted = resems.collect {|r| "#{r}.sorted"} resems.zip(resems_sorted).each { |p| `sort -rn -k3 < #{p[0]} > #{p[1]}` } `sort -rnm -k3 #{resems_sorted.join(' ')} > #{file}` resems.each { |r| File.delete(r) } resems_sorted.each { |r| File.delete(r) } end puts "---running #{N} entries" # assuming never want to compare any resemblances UNDER 0.6 so # its hardcoded. strange things happen if a run is done with x and then y using # cached x when y < x puts "---running shingling (#{USE_RUBY ? "ruby" : "cpp"} version)" file = "shingle.result.#{N}" run_unless_file_exists(file) do if USE_RUBY time_call { run "#{head_command(N)} | ruby shingle.rb coeff 0.6 > #{file}" } `cat #{file} | sort -rn -k3 > tmp.#{$$}` `mv tmp.#{$$} #{file}` else time_call { run "#{head_command(N)} | ./cpp/bin/Release/resemblance 0.6" } combine_resemblance_results file end end puts "#lines= #{`wc -l shingle.result.#{N}`}" =begin NUM_BITS = 64 puts "---running simhash #{NUM_BITS} bit" file = "simhash.result.#{N}.#{NUM_BITS}" run_unless_file_exists(file) do time_call { run "head -n #{N} name_addr | ruby simhash.rb #{NUM_BITS} 0.6" } combine_resemblance_results file end puts "#lines= #{`wc -l #{file}`}" puts run "./compare.rb shingle.result.#{N} #{file} #{MIN_RES}" =end def compare_sketch num_bits, sketch_size, cutoff puts "---running sketch num_bits=#{num_bits} sketch_size=#{sketch_size} cutoff=#{cutoff}" file = "sketch.result.#{N}.#{num_bits}b.#{sketch_size}s.#{cutoff}c" run_unless_file_exists(file) do time_call { run "#{head_command(N)} | ruby sketch.rb #{num_bits} #{sketch_size} #{cutoff} > #{file}" } end puts "#lines= #{`wc -l #{file}`}" puts run "./compare.rb shingle.result.#{N} #{file} #{MIN_RES}" end compare_sketch 64, 10, 2
$: << 'lib' require 'travis' require 'resque/heartbeat' handler do |job| Resque.redis = Travis.config['redis']['url'] Resque.prune_dead_workers end every 5.seconds, 'travis.purge_dead_workers' try disconnecting from redis in clock.rb $: << 'lib' require 'travis' require 'resque/heartbeat' handler do |job| Resque.redis = Travis.config['redis']['url'] Resque.prune_dead_workers Resque.redis.instance_variable_get(:@redis).client.disconnect end every 5.seconds, 'travis.purge_dead_workers'
Gem::Specification.new do |gem| gem.name = "config-parser" gem.summary = %Q{Parsing an options.yml file into a Hash with convenience.} gem.description = "Parsing an options.yml file into a Hash with convenience methods like overwriting variables per Rails environment and overwriting variables with a local options_local.yml file." gem.homepage = "https://github.com/openSUSE/rubygem_config-parser" gem.authors = ['cschum@suse.de', 'tom@opensuse.org'] gem.files = `git ls-files`.split("\n") gem.test_files = `git ls-files -- {test,spec,features}/*`.split("\n") gem.require_paths = ['lib'] gem.version = '0.1' end Bump version Gem::Specification.new do |gem| gem.name = "config-parser" gem.summary = %Q{Parsing an options.yml file into a Hash with convenience.} gem.description = "Parsing an options.yml file into a Hash with convenience methods like overwriting variables per Rails environment and overwriting variables with a local options_local.yml file." gem.homepage = "https://github.com/openSUSE/rubygem_config-parser" gem.authors = ['cschum@suse.de', 'tom@opensuse.org'] gem.files = `git ls-files`.split("\n") gem.test_files = `git ls-files -- {test,spec,features}/*`.split("\n") gem.require_paths = ['lib'] gem.version = '0.2' end
# Generated by jeweler # DO NOT EDIT THIS FILE DIRECTLY # Instead, edit Jeweler::Tasks in Rakefile, and run 'rake gemspec' # -*- encoding: utf-8 -*- Gem::Specification.new do |s| s.name = %q{transmission-connect} s.version = "0.2.2" s.required_rubygems_version = Gem::Requirement.new(">= 0") if s.respond_to? :required_rubygems_version= s.authors = ["Dmitry Brazhkin"] s.date = %q{2011-04-12} s.description = %q{Simple connector to transmission bittorrent client by HTTP-RPC} s.email = %q{dbrazhkin@gmail.com} s.extra_rdoc_files = [ "LICENSE.txt", "README.rdoc" ] s.files = [ ".document", "Gemfile", "Gemfile.lock", "LICENSE.txt", "README.rdoc", "Rakefile", "VERSION", "lib/transmission-connect.rb", "lib/transmission-connect/client.rb", "test/helper.rb", "test/test_client.rb", "test/test_transmission-connect.rb", "transmission-connect.gemspec" ] s.homepage = %q{http://github.com/Daem0n/transmission-connect} s.licenses = ["MIT"] s.require_paths = ["lib"] s.rubygems_version = %q{1.7.2} s.summary = %q{Simple connector to transmission bittorrent client} s.test_files = [ "test/helper.rb", "test/test_client.rb", "test/test_transmission-connect.rb" ] if s.respond_to? :specification_version then s.specification_version = 3 if Gem::Version.new(Gem::VERSION) >= Gem::Version.new('1.2.0') then s.add_runtime_dependency(%q<json>, [">= 0"]) s.add_development_dependency(%q<shoulda>, [">= 0"]) s.add_development_dependency(%q<bundler>, ["~> 1.0.0"]) s.add_development_dependency(%q<jeweler>, ["~> 1.5.2"]) s.add_development_dependency(%q<rcov>, [">= 0"]) else s.add_dependency(%q<json>, [">= 0"]) s.add_dependency(%q<shoulda>, [">= 0"]) s.add_dependency(%q<bundler>, ["~> 1.0.0"]) s.add_dependency(%q<jeweler>, ["~> 1.5.2"]) s.add_dependency(%q<rcov>, [">= 0"]) end else s.add_dependency(%q<json>, [">= 0"]) s.add_dependency(%q<shoulda>, [">= 0"]) s.add_dependency(%q<bundler>, ["~> 1.0.0"]) s.add_dependency(%q<jeweler>, ["~> 1.5.2"]) s.add_dependency(%q<rcov>, [">= 0"]) end end Regenerate gemspec for version 0.3.0 # Generated by jeweler # DO NOT EDIT THIS FILE DIRECTLY # Instead, edit Jeweler::Tasks in Rakefile, and run 'rake gemspec' # -*- encoding: utf-8 -*- Gem::Specification.new do |s| s.name = %q{transmission-connect} s.version = "0.3.0" s.required_rubygems_version = Gem::Requirement.new(">= 0") if s.respond_to? :required_rubygems_version= s.authors = ["Dmitry Brazhkin"] s.date = %q{2011-04-19} s.description = %q{Simple connector to transmission bittorrent client by HTTP-RPC} s.email = %q{dbrazhkin@gmail.com} s.executables = ["transmission.rb"] s.extra_rdoc_files = [ "LICENSE.txt", "README.rdoc" ] s.files = [ ".document", "Gemfile", "Gemfile.lock", "LICENSE.txt", "README.rdoc", "Rakefile", "VERSION", "bin/transmission.rb", "config/transmission.yml", "lib/transmission-connect.rb", "lib/transmission-connect/client.rb", "lib/transmission-connect/configuration.rb", "test/helper.rb", "test/test_client.rb", "test/test_transmission-connect.rb", "transmission-connect.gemspec" ] s.homepage = %q{http://github.com/Daem0n/transmission-connect} s.licenses = ["MIT"] s.require_paths = ["lib"] s.rubygems_version = %q{1.7.2} s.summary = %q{Simple connector to transmission bittorrent client} s.test_files = [ "test/helper.rb", "test/test_client.rb", "test/test_transmission-connect.rb" ] if s.respond_to? :specification_version then s.specification_version = 3 if Gem::Version.new(Gem::VERSION) >= Gem::Version.new('1.2.0') then s.add_runtime_dependency(%q<json>, [">= 0"]) s.add_runtime_dependency(%q<transmission-client>, [">= 0.0.3"]) s.add_development_dependency(%q<shoulda>, [">= 0"]) s.add_development_dependency(%q<bundler>, ["~> 1.0.0"]) s.add_development_dependency(%q<jeweler>, ["~> 1.5.2"]) s.add_development_dependency(%q<rcov>, [">= 0"]) else s.add_dependency(%q<json>, [">= 0"]) s.add_dependency(%q<transmission-client>, [">= 0.0.3"]) s.add_dependency(%q<shoulda>, [">= 0"]) s.add_dependency(%q<bundler>, ["~> 1.0.0"]) s.add_dependency(%q<jeweler>, ["~> 1.5.2"]) s.add_dependency(%q<rcov>, [">= 0"]) end else s.add_dependency(%q<json>, [">= 0"]) s.add_dependency(%q<transmission-client>, [">= 0.0.3"]) s.add_dependency(%q<shoulda>, [">= 0"]) s.add_dependency(%q<bundler>, ["~> 1.0.0"]) s.add_dependency(%q<jeweler>, ["~> 1.5.2"]) s.add_dependency(%q<rcov>, [">= 0"]) end end
module PersonMatchStrategies class FirstLastDob def match(options = {}) return [nil, nil] if options[:dob].blank? name_first_regex = Regexp.compile(Regexp.escape(options[:name_first].to_s.strip.downcase), true) name_last_regex = Regexp.compile(Regexp.escape(options[:name_last].to_s.strip.downcase), true) search_dob = cast_dob(options[:dob], options) found_people = Person.where({"members.dob" => search_dob, "name_first" => name_first_regex, "name_last" => name_last_regex}) if found_people.any? if found_people.many? raise AmbiguousMatchError.new("Multiple people with same first, last, and dob: #{options[:name_first]}, #{options[:name_last]}, #{options[:dob]}") else select_authority_member(found_people.first, options) end else [nil, nil] end end def cast_dob(dob, options) if dob.kind_of?(Date) return dob elsif dob.kind_of?(DateTime) return dob end begin Date.parse(dob) rescue raise AmbiguousMatchError.new("Invalid DOB: #{options[:name_first]}, #{options[:name_last]}, #{options[:dob]}") end end def select_authority_member(person, options) if !person.authority_member.present? raise AmbiguousMatchError.new("No authority member for person with first, last, and dob: #{options[:name_first]}, #{options[:name_last]}, #{options[:dob]}") end [person, person.authority_member] end end end Don't run the dob match if they don't provide dob. module PersonMatchStrategies class FirstLastDob def match(options = {}) return([nil, nil]) if options[:dob].blank? name_first_regex = Regexp.compile(Regexp.escape(options[:name_first].to_s.strip.downcase), true) name_last_regex = Regexp.compile(Regexp.escape(options[:name_last].to_s.strip.downcase), true) search_dob = cast_dob(options[:dob], options) found_people = Person.where({"members.dob" => search_dob, "name_first" => name_first_regex, "name_last" => name_last_regex}) if found_people.any? if found_people.many? raise AmbiguousMatchError.new("Multiple people with same first, last, and dob: #{options[:name_first]}, #{options[:name_last]}, #{options[:dob]}") else select_authority_member(found_people.first, options) end else [nil, nil] end end def cast_dob(dob, options) if dob.kind_of?(Date) return dob elsif dob.kind_of?(DateTime) return dob end begin Date.parse(dob) rescue raise AmbiguousMatchError.new("Invalid DOB: #{options[:name_first]}, #{options[:name_last]}, #{options[:dob]}") end end def select_authority_member(person, options) if !person.authority_member.present? raise AmbiguousMatchError.new("No authority member for person with first, last, and dob: #{options[:name_first]}, #{options[:name_last]}, #{options[:dob]}") end [person, person.authority_member] end end end
Deface::Override.new( :name => 'remove_wrapper_grid_class', :virtual_path => 'spree/layouts/spree_application', :set_attributes => '#wrapper', :attributes => {:class => ''}) Deface::Override.new( :name => 'wrap_wrapper_content_in_row', :virtual_path => 'spree/layouts/spree_application', :surround_contents => '#wrapper', :text => '<div class="row"><%= render_original %></div>') Deface::Override.new( :name => 'change_content_grid_class', :virtual_path => 'spree/layouts/spree_application', :set_attributes => '#content', :attributes => { "data-erb-class" => '<%= !content_for?(:sidebar) ? "span12" : "span9" %>' }) Move breadcrumbs inside content Deface::Override.new( :name => 'remove_wrapper_grid_class', :virtual_path => 'spree/layouts/spree_application', :set_attributes => '#wrapper', :attributes => {:class => ''}) Deface::Override.new( :name => 'wrap_wrapper_content_in_row', :virtual_path => 'spree/layouts/spree_application', :surround_contents => '#wrapper', :text => '<div class="row"><%= render_original %></div>') Deface::Override.new( :name => 'change_content_grid_class', :virtual_path => 'spree/layouts/spree_application', :set_attributes => '#content', :attributes => { "data-erb-class" => '<%= !content_for?(:sidebar) ? "span12" : "span9" %>' }) Deface::Override.new( :name => 'remove_breadcrumbs', :virtual_path => 'spree/layouts/spree_application', :remove => 'code[erb-loud]:contains("breadcrumbs")') Deface::Override.new( :name => 'add_breadcrumbs_into_content_area', :virtual_path => 'spree/layouts/spree_application', :insert_top => '#content', :text => '<%= breadcrumbs(@taxon) %>')
require 'thor' require 'httmultiparty' require 'crossfader/rcfile' module Crossfader class CLI < Thor include HTTMultiParty base_uri 'http://api.djz.com/v3' def initialize(*) @rcfile = Crossfader::RCFile.instance @loop_ids = [] super end desc 'auth', 'Allow the user to get their api access token' def auth say "Welcome! Before you can use crossfader, you'll first need to log in" say 'to your account and get an access token. Follow the steps below:' email = ask 'Enter your crossdfader.fm email address: ' password = ask('Enter your crossfader.fm password: ', :echo => false) options = { :body => {email: email, password: password } } response = self.class.post('/users/login', options) if response.code == 200 @rcfile[email] = { email: email, api_access_token: response['api_access_token'], dj_name: response['dj_name'] } say "\nAuthorized successfully!\n" else say "\nSomething went wrong. Tell Adam.\n" end end desc 'convert', 'Batch convert .wav files to .mp3 files' def convert say "Let's convert wavs to MP3s!" dir = ask('Select a folder of loops to convert: ') dir = dir.gsub(/\\/, "").strip Dir.foreach(dir) { |file| convert_wav_to_mp3(file.to_s, dir.to_s) } say "The loops were converted successfully" end desc 'upload', 'Batch upload loops' def upload say "Time to upload some loops!" dir = ask('Select a folder of loops to upload: ') dir = dir.gsub(/\\/, "").strip Dir.foreach(dir) { |file| create_loop_from_file(file, dir) } say "The loops were uploaded successfully" end desc 'create_pack', 'Create a new pack' def create_pack say "Create a new pack? That's a great idea!" pack_name = ask "What should we call this pack?" pack_sub = ask "Enter the subtitle for this pack:" response = create_new_pack(pack_name, pack_sub) say response if response.code == 200 say "Successfully created a pack named #{pack_name}" else say "Something went wrong." end end desc 'help', "Show available commands." def help say "\nYou can perform the following actions:" say "---\n\n" say "\`crossfader auth\` Authorize this app to work with the Crossfader.fm API.\n" say "\`crossfader convert\` : Convert a folder of .wav files to .mp3.\n" say "\`crossfader upload\` : Upload a folder of .mp3s to the server to create new loops.\n" say "\`crossfader batch\` : Create a new pack, convert a folder of .wav files to .mp3 files and upload them to the server in one step.\n" say "\`crossfader create_pack\` : Create a new empty pack.\n\n" say "---\n" say "Have questions, comments, or feed back? Contact Adam at adam@djz.com\n\n" end desc 'batch', "Create a new pack, convert wavs to mp3s, upload mp3s/jpgs as loops, and add loops to pack." def batch say "Time to batch convert and upload!" pack_name = ask "What do you want to name your new pack?" pack_sub = ask "Enter the subtitle for this pack:" dir = ask('Select a folder of loops to process and upload:') clean_dir = dir.gsub(/\\/, '').strip say clean_dir Dir.foreach(clean_dir) { |file| convert_wav_to_mp3(file.to_s, clean_dir.to_s) } Dir.foreach(clean_dir) { |file| create_loop_from_file(file.to_s, clean_dir.to_s) } response = create_new_pack(pack_name, pack_sub) if response.code == 200 say "Success!" else say "Something went wrong." end end private def convert_wav_to_mp3(file, dir) file_path = File.join(dir, file) if File.file? file_path and File.extname(file_path) == ".wav" mp3_path = "#{file_path}.mp3".gsub!('.wav', '') mp3_path_low = "#{file_path}-low.mp3".gsub!('.wav', '') %x(lame -b 192 -h "#{file_path}" "#{mp3_path}") %x(lame -b 96 -m m -h "#{file_path}" "#{mp3_path_low}") end end def create_loop_from_file(file, dir) file_path = File.join(dir, file) if File.file? file_path and File.extname(file_path) == ".wav" loop_high = open(file_path.gsub('.wav', '.mp3'), 'r+b') loop_low = open(file_path.gsub('.wav', '-low.mp3'), 'r+b') artwork = open(file_path.gsub('.wav', '.jpg'), 'r+b') length, bpm, key, artist, title = file.to_s.gsub('.mp3', '').split(' - ') headers = { 'Authorization' => "Token: #{@rcfile.api_access_token}" } body = { title: title, type: 'loop', content: { artist_name: artist, bpm: bpm, key: key, bar_count: length, loop_type: "Instrumental Song" }, loop_high: loop_high, loop: loop_low, artwork: artwork, published: 'true' } options = { headers: headers , body: body } response = self.class.post('/feed_items', options) @loop_ids << response['id'] say "New loop for #{title} created with an id of #{response['id']}" end end def create_new_pack(pack_name, pack_sub) headers = { 'Authorization' => "Token: #{@rcfile.api_access_token}" } body = { title: pack_name, content: { subtitle: pack_sub }, type: 'pack', pack_items: @loop_ids } options = { headers: headers , body: body } response = self.class.post('/feed_items', options) return response end end end keep uploading high quality mp3 as primary audio track require 'thor' require 'httmultiparty' require 'crossfader/rcfile' module Crossfader class CLI < Thor include HTTMultiParty base_uri 'http://api.djz.com/v3' def initialize(*) @rcfile = Crossfader::RCFile.instance @loop_ids = [] super end desc 'auth', 'Allow the user to get their api access token' def auth say "Welcome! Before you can use crossfader, you'll first need to log in" say 'to your account and get an access token. Follow the steps below:' email = ask 'Enter your crossdfader.fm email address: ' password = ask('Enter your crossfader.fm password: ', :echo => false) options = { :body => {email: email, password: password } } response = self.class.post('/users/login', options) if response.code == 200 @rcfile[email] = { email: email, api_access_token: response['api_access_token'], dj_name: response['dj_name'] } say "\nAuthorized successfully!\n" else say "\nSomething went wrong. Tell Adam.\n" end end desc 'convert', 'Batch convert .wav files to .mp3 files' def convert say "Let's convert wavs to MP3s!" dir = ask('Select a folder of loops to convert: ') dir = dir.gsub(/\\/, "").strip Dir.foreach(dir) { |file| convert_wav_to_mp3(file.to_s, dir.to_s) } say "The loops were converted successfully" end desc 'upload', 'Batch upload loops' def upload say "Time to upload some loops!" dir = ask('Select a folder of loops to upload: ') dir = dir.gsub(/\\/, "").strip Dir.foreach(dir) { |file| create_loop_from_file(file, dir) } say "The loops were uploaded successfully" end desc 'create_pack', 'Create a new pack' def create_pack say "Create a new pack? That's a great idea!" pack_name = ask "What should we call this pack?" pack_sub = ask "Enter the subtitle for this pack:" response = create_new_pack(pack_name, pack_sub) say response if response.code == 200 say "Successfully created a pack named #{pack_name}" else say "Something went wrong." end end desc 'help', "Show available commands." def help say "\nYou can perform the following actions:" say "---\n\n" say "\`crossfader auth\` Authorize this app to work with the Crossfader.fm API.\n" say "\`crossfader convert\` : Convert a folder of .wav files to .mp3.\n" say "\`crossfader upload\` : Upload a folder of .mp3s to the server to create new loops.\n" say "\`crossfader batch\` : Create a new pack, convert a folder of .wav files to .mp3 files and upload them to the server in one step.\n" say "\`crossfader create_pack\` : Create a new empty pack.\n\n" say "---\n" say "Have questions, comments, or feed back? Contact Adam at adam@djz.com\n\n" end desc 'batch', "Create a new pack, convert wavs to mp3s, upload mp3s/jpgs as loops, and add loops to pack." def batch say "Time to batch convert and upload!" pack_name = ask "What do you want to name your new pack?" pack_sub = ask "Enter the subtitle for this pack:" dir = ask('Select a folder of loops to process and upload:') clean_dir = dir.gsub(/\\/, '').strip say clean_dir Dir.foreach(clean_dir) { |file| convert_wav_to_mp3(file.to_s, clean_dir.to_s) } Dir.foreach(clean_dir) { |file| create_loop_from_file(file.to_s, clean_dir.to_s) } response = create_new_pack(pack_name, pack_sub) if response.code == 200 say "Success!" else say "Something went wrong." end end private def convert_wav_to_mp3(file, dir) file_path = File.join(dir, file) if File.file? file_path and File.extname(file_path) == ".wav" mp3_path = "#{file_path}.mp3".gsub!('.wav', '') mp3_path_low = "#{file_path}-low.mp3".gsub!('.wav', '') %x(lame -b 192 -h "#{file_path}" "#{mp3_path}") %x(lame -b 96 -m m -h "#{file_path}" "#{mp3_path_low}") end end def create_loop_from_file(file, dir) file_path = File.join(dir, file) if File.file? file_path and File.extname(file_path) == ".wav" loop_high = open(file_path.gsub('.wav', '.mp3'), 'r+b') loop_low = open(file_path.gsub('.wav', '-low.mp3'), 'r+b') artwork = open(file_path.gsub('.wav', '.jpg'), 'r+b') length, bpm, key, artist, title = file.to_s.gsub('.mp3', '').split(' - ') headers = { 'Authorization' => "Token: #{@rcfile.api_access_token}" } body = { title: title, type: 'loop', content: { artist_name: artist, bpm: bpm, key: key, bar_count: length, loop_type: "Instrumental Song" }, loop: loop_high, loop_low: loop_low, artwork: artwork, published: 'true' } options = { headers: headers , body: body } response = self.class.post('/feed_items', options) @loop_ids << response['id'] say "New loop for #{title} created with an id of #{response['id']}" end end def create_new_pack(pack_name, pack_sub) headers = { 'Authorization' => "Token: #{@rcfile.api_access_token}" } body = { title: pack_name, content: { subtitle: pack_sub }, type: 'pack', pack_items: @loop_ids } options = { headers: headers , body: body } response = self.class.post('/feed_items', options) return response end end end