text
stringlengths 19
172k
| meta
dict |
|---|---|
Don't let pain take control of your life.
Pain is different for every person. That’s why our team at Gibson General Pain Management Center takes the time to learn what is causing your pain and the best way to treat it. By working together, we can find solutions that work for you and break the pain cycle. If you suffer from acute or chronic pain, our expert team is ready to provide you with the most advanced and effective pain management treatments available.
|
{
"timestamp": "2019-04-21T15:14:50",
"url": "http://www.gibsongeneral.com/Services/Pain-Management",
"language": "en",
"source": "c4"
}
|
Jamie Durie says that he switched loyalties from one TV channel to another as a "challenge".
Jamie Durie has revealed the reasons behind his television defection.
The Australian TV gardener, who is best known for his shows Backyard Blitz and The Outdoor Room, originally worked for the Nine Network but moved to Channel Seven because he wanted a "challenge". However, he has since decided to return to his original employer to host new series Top Design.
Durie told The Daily Telegraph: "It wasn't a financial decision, it was a new challenge. In the end it was the right decision. It wasn't the easiest decision but it was the right one at the time. I also got the opportunity to work on Sunday Night, prove my skills as a journalist, which I found really interesting. I learned a lot and I can bring all that back to Nine.
"I've built some amazing relationships with people here [at Nine] and we always had a mutual respect for each other. Sure there's always a couple of comments thrown around when you leave a network, but at the end of the day it's just fish and chips wrap. You just move on and nothing really gets in the way of long-standing friendships and business relationships."
Durie added: "Everybody knows how hard I work. Everybody knows my work ethic and everybody knows I bring something fresh and new to whatever I do. I hope that's happened here with Top Design."
Durie recently visited cyclone-damaged Hayman Island to help give the resort a makeover. He also revealed at the beginning of the year that he wants to have more children with girlfriend Sophie Scarf and that he would love to retire to Bali.
|
{
"timestamp": "2019-04-25T04:08:12",
"url": "https://www.digitalspy.com/australian-tv/a329618/jamie-durie-reveals-reasons-behind-tv-defection/",
"language": "en",
"source": "c4"
}
|
You will be working for a manufacturing organisation who supply precision engineered products to the aerospace and defence sector. Your new company are going through a large period of expansion, due to recently winning large contracts with international organisations.
Your new position involves implementing operational improvement programmes across the production facility, creating a culture of lean manufacturing and continuous improvement, for the operational benefit of the organisation.
In order to be successful in your new CI Lead job, you will have vast amount of experience in a Continuous Improvement role. You will also have an excellent understanding of lean manufacturing techniques, having implemented them in a manufacturing environment. You will need to be qualified to Six Sigma Black Belt level, as a minimum.
In return for this position, you will receive a salary of up to £80,000 with great company benefits including 25 days holidays pension, Life Assurance and private healthcare.
|
{
"timestamp": "2019-04-26T13:42:50",
"url": "http://zenoot.com/job/continuous-improvement-lead-2/",
"language": "en",
"source": "c4"
}
|
The Perfect Ofsted ICT Lesson – my book!
As you may or may not be aware I’ve been writing a book. I have to say it has been and continues to be one of the most reflective things I have ever done in relation to my practice. I can highly recommend it. If you’ve enjoyed blogging, try putting together a book. You will examine the way in which you work in so much more detail than you ever thought you would. I have and am LOVING it.
The publication date for the book is set for August of this year and it can be pre-ordered by visiting http://bit.ly/PerfectICT on Amazon.
If you’d like to find out more, you’ll have to get the book. If you like what I write about on my blog and are looking for ideas that are backed with pedagogy, linked to the Ofsted framework, including tried and tested ideas from practitioners from across the country that you can take to embed in areas across your curriculum, across primary or secondary, then take a look.
Well done! Should be a lot of customers given the changes in the NC.
Like you I’m passionate about how you can use technology effectively in the classroom to bring about the best outcomes for learners. Hopefully this book will be of use to many teachers across all sectors.
|
{
"timestamp": "2019-04-21T05:15:32",
"url": "https://ictevangelist.com/the-perfect-ict-lesson-my-book/",
"language": "en",
"source": "c4"
}
|
3.7 Is there any prohibition on completing the transaction before clearance is received or any compulsory waiting period has ended? What are the risks?
A merger, which comes within the jurisdictional tests described above, must not be implemented before clearance has been obtained or the compulsory waiting period has ended. Section 19(1) provides that a notifiable merger shall not be put into effect until the Competition Authority has determined it may be put into effect or the relevant time periods (described in question 3.6 above), have elapsed without the Competition Authority making a determination. Section 19(2) of the Competition Act provides that a notifiable merger which is put into effect prior to a clearance determination is void. Completing prior to clearance (i.e. where clearance is ultimately given) is not a criminal offence. However, contravention of a Competition Authority decision blocking a concentration or allowing it subject to conditions does amount to a criminal offence punishable by fines and imprisonment.
The Competition Act does not state whether a transaction which is completed prior to clearance is rendered void for all time, or merely until such time as the Competition Authority makes a clearance determination. In May 2003, the Competition Authority issued a Press Release on alleged "gun jumping", stating that "parties must be very careful to ensure they maintain separate and independent operations until the Competition Authority has made its determination". In that case, the Competition Authority conducted an investigation and ultimately found that implementation had not in fact taken place so no breach of the pre-merger waiting period had occurred.
The point was considered in detail by the Competition Authority in March 2004. In Radio 2000/Newstalk 106, Radio 2000 acquired operational control of the target radio station before the transaction had been approved by the Competition Authority. The Competition Authority concluded that the Section 19(2) of the Competition Act is designed to protect the Competition Authority's right of review and is not intended to render a merger or acquisition void indefinitely. The effect is that a transaction which has been implemented prior to clearance remains void until such time as the Competition Authority issues a decision approving the transaction. While this practical approach provides much needed clarity to merging parties on the issue of "voidness", it is somewhat at odds with a previous statement by the Competition Authority that it views "gun jumping" as a very serious matter and will give high priority to investigating allegations that merging parties have put a transaction into effect before expiry of the mandatory waiting period. A further mechanism employed by merging companies completing a transaction prior to clearance is to provide the Competition Authority with "hold separate" undertakings. In Noonan Services Group Limited/Federal Security Group and Stena/DFDS, the merging companies informed the Competition Authority that they would "hold separate" until clearance was issued by the Competition Authority. While the Authority will nonetheless take the view that a breach of the Competition Act has occurred, to date it has not taken any action against the parties in such circumstances.
The Competition Authority introduced a revised standard form for notifications (Form M), effective from 1 September 2005, which consolidates and replaces the previous Forms M1 and M2 (available at www.tca.ie ). All parts of the Notification Form must generally be completed unless expressly waived by the Competition Authority in pre-notification discussions. In particular, the requirement to complete question 4 of the Notification Form (which relates to overlapping products and/or services) may be waived by the Competition Authority, and the parties may be exempted from completing some or all of question 4, where there is no overlap or the overlap is de minimis.
In general, it is not necessary to have pre-notification meetings with the Competition Authority, unless the merger has particular competition concerns, or the overlap is de minimis and the parties are seeking an exemption from responding to some or all of question 4. It is possible to engage in "pre-notification discussions" with the Competition Authority prior to the conclusion of a binding agreement, where the parties can show a bona fide intention of proceeding with the transaction. This may be evidenced by, for example, a letter of intent signed by the parties. Pre-notification discussions offer the possibility to discuss jurisdictional and other legal issues as well as those outlined above in relation to completion of the Notification Form. However, the Competition Authority states that it is not bound by any comments made in the course of such discussions. Pre-notification discussions are also subject to conditions of strict confidentiality.
3.9 Is there a short form or accelerated procedure for any types of mergers?
No. The procedure is the same for all mergers. However, parties can petition the Competition Authority to speed up the process by reducing or eliminating the period for third party notice under Section 20 of the Competition Act. The Competition Authority has demonstrated a willingness to accommodate the specific circumstances of individual mergers by expediting the review process, for example, the HMV Ireland/Zavvi merger was cleared in nine days due to insolvency concerns. However, the Competition Authority is unlikely to use such accelerated procedures save in the most exceptional of circumstances.
The obligation to notify is on all of the "undertakings involved" in a transaction (this does not include the vendor), although in practice most notifications are submitted jointly. The filing fee is currently €8,000 and is payable on filing.
4.1 What is the substantive test against which a merger will be assessed? Are non-competition issues taken into account?
|
{
"timestamp": "2019-04-23T12:31:05",
"url": "https://ie.vlex.com/vid/comparative-guide-merger-control-2012-341957602",
"language": "en",
"source": "c4"
}
|
Primary and Clustering Keys should be one of the very first things you learn about when modeling Cassandra data. With this post I will cover what the different types of Primary Keys are, how they can be used, what their purpose is, and how they affect your queries.
A single column Primary Key is also called a Partition Key. When Cassandra is deciding where in the cluster to store this particular piece of data, it will hash the partition key. The value of that hash dictates where the data will reside and which replicas will be responsible for it.
The Partition Key is responsible for the distribution of data among the nodes. suppose there are 4 nodes A , B ,C ,D and let’s assume hash values are between 0-100 and also assume that 0-25 , 25-50 , 50-75 and 75-100 are the hash values for the nodes A,B,C,D . When we insert the first row into the company_Information table, the value of comp_id will be hashed. Let’s also assume that the first record will have a hash of 34. That will fall into the values that Node 2’s partition is assigned.
A multi-column primary key is called a Compound Key.
Primary keys can also be more than one column.
This example has four columns in the Primary Key clause. An interesting characteristic of Compound Keys is that only the first column is considered the Partition Key. There rest of the columns in the Primary Key clause are Clustering Keys.
You can change the default shorting order from ascending to descending by “order By” . There is an additional WITH clause that you need to add to the CREATE TABLE to make this possible.
Now we’ve changed the ordering of the Clustering Keys to sort city in descending order . Did you notice that I did not specify what the sort is for country_code? Since it’s the partition key, there is nothing to sort as hashed values won’t be close to each other in the cluster.
Each additional column that is added to the Primary Key clause is called a Clustering Key. A clustering key is responsible for sorting data within the partition. In our example company_Information table, country_code is the partition key with city, name & comp_id acting as the clustering keys. By default, the clustering key columns are sorted in ascending order.
|
{
"timestamp": "2019-04-22T08:19:24",
"url": "https://blog.knoldus.com/data-modeling-in-cassandra/",
"language": "en",
"source": "c4"
}
|
Tea With Lily is a company dedicated to hiring out vintage crockery and accessories for all occasions. Christenings, birthday parties, baby showers, weddings or indeed any parties are made special by using our beautiful bone china tea sets and crockery. We even wash up afterwards, leaving you to enjoy your party. We hire throughout Surrey, Hampshire, West Sussex and South West London. All current money saving offers and a full price list are available on our website.
Quality Products International Ltd is an Australian owned, company with an operational base in China, and offices in UK and USA. The focus of QPI Ltd is on Quality Control and Product development. The company was formed as and extension of a family company trading in Australia and Asia for over 40 years. The extensive contacts we have forged in that time has placed us in a unique position to facilitate quality at source supply of a range of products. Our operational base in Shenzhen is at the heart of the Pearl River Delta, China�s largest and most diverse manufacturing centre. We have direct connections for a wide range of OEM products, including Clothing, Consumer Products, Swimming and Sports Products, Hardware Products, and Electronics products including TV''s, Mobile Phones, Netbooks, MID''s etc. Our product sourcing team aims to provide better value for money than many companies can attain even dealing directly with factories. While a competitive price is important, there are key elements that QPI includes as a standard part of our service. - Basic factory vetting/auditing to confirm they appear to meet production capabilities, quality and ethical standards claimed - Independent Production Sampling - Product Design/Development - During Production / Pre-Shipment Random AQL Inspections, where QPI staff visit the factory at key stages during the production cycle - Production Monitoring Clear, timely communications, IP security and quality factors are just some of the key services managed by QPI. Our years of experience has shown us the "good, bad, ugly" of doing business in China. Our sourcing staff has direct access to reputable and reliable vendors who are serious about quality and timely delivery. This is only achievable by our "on the ground" staff who understand the local customs and have the ability to develop "guanxi" (local relationship). We also offer services such as Formal Factory Auditing, Factory Credit Checks, IQC, lab testing, product certification, etc at competitive rates.
Based in Walton-le-Dale (Preston) UK, Source in Asia Today Ltd provides Outsourcing expertise and services to clients throughout the UK. The company has many years experience in the Outsourcing Consultants sector. Whether your products are high quality machined parts, moulded parts, tooling or consumables and fancy goods, quotations can be provided at a competitive cost for products.
We are Juancheng County Xingda Hair Products Co. Ltd. which is a 100% human hair products manufactory in China. All our product arts and crafts is the best. 70% of our products are sold to Europe. Now we have built our own international trade department and trade freely with international client. We are seeking for sale-businessman all over the world. If you have any interest. please contact us. Welcome to visit our factory.
Trade China specialise in sourcing trips to Shenzhen Dongguan and Guangzhou including the Canton China Fair with over 22,000 Chinese manufacturers and exhibitors. Trade China Ltd suppliers of 12 Years Provide Chinese OEM manufacturing. Injection mould tools. Plastic mouldings. Medical. Security. Automotive. PCB. Metal pressings. Lighting. Toy manufacturing. Feel free to contact our suppliers direct. Unlike most companies with contacts in China we don�t try to hide who we deal with preferring an open book approach. However Trade China recommends an all inclusive 8 Days 7 Nights in China sourcing trip to maximise your time reducing your costs. Good Chinese suppliers are very loyal and Trade China will help negotiate the best of deals based on loyalty and trust.
Anlysun Electronic will design electronics solutions based on your requirements. we have both software and hardware engineers, to cover the majority of design projects. Our service center can be branch of your company and your assistants help you to do the business in china. we do not take any commission just service fee adviance, just on behalf of you do the business in china.
Butterfly Garden Tea Parties china hire will make your tea party an ideal way to spend time with friends and family whilst enjoying a touch of elegance which will transport you and your guests to days gone by.Tea tastes better being enjoyed with china tea cups and cake tastes more luxurious and delicious when eaten from pretty floral plates. Our collection of mismatched china from 1900's to the 1960's boasts a huge variety of pretty designs and our wide selection of accessories to dress your event looks exquisite set out for afternoon tea, a ladies luncheon or charity party. We can also set up a large head table for added impact where your guests can help themselves to a cup, saucer and plate set of their choice. If there is anything that you require that we don't have, we will do our best to source it for you. Engagement Parties, Hen Do's, Weddings, Baby Showers, Christenings, Birthdays, Graduations, Anniversaries, Wakes, Corporate or Charity Events, Photo Shoots and Product Launches - every important occasion in your life, we can enhance that experience.
Outsourcing of parts and manufacturing with China and UK-based engineering design and programme management. Complete start-up and product transfer.
|
{
"timestamp": "2019-04-26T09:55:06",
"url": "https://www.uksmallbusinessdirectory.co.uk/listing/185264/",
"language": "en",
"source": "c4"
}
|
Piedmont College was established in 1897 in the wilderness of Georgia as the JS Green Collegiate Institute. In 1903 the school changed to its current name. More recently, the school opened a second campus in 1996 and has many new on-campus buildings in order to expand the college. Piedmont College is religiously affiliated with the National Association of Congretional Christian Churches and United Church of Christ. The school's mission is "to educate students to become successful and responsible citizens through rigorous academic instruction in the liberal arts and professional disciplines."
Piedmont College offers select courses that can be completed entirely online in most of its degree programs. The school also offers hybrid courses, which are completed partially online and partially in class.
|
{
"timestamp": "2019-04-24T12:21:01",
"url": "https://www.geteducated.com/online-schools/piedmont-college",
"language": "en",
"source": "c4"
}
|
This list includes our picks for the top 100 drone companies making an impact on the industry right now.
These companies have a lot on their shoulders, especially as new regulations are always coming out and the future of the industry can seem uncertain at times. So we should all applaud them for their contributions to the drone industry.
This article is a useful resource to find interesting companies in the drone industry and support services — including drone manufacturers, drone delivery services, education, training, software, flight operations management, funding sources for drone company startups, and drone services for hire.
The companies are broken up by industry and ordered alphabetically.
Is your company featured in this list?
3D Robotics released the Solo drone in 2015, which was the world’s first “smart” drone that made it easier to take photographs using a drone.
Action Drone USA manufactures drones for industrial uses and commercial applications that work with software made by third-party developers.
Aerialtronics DV b.v. is an end-to-end aerial solution developer that utilizes drones, artificial intelligence and IoT to provide businesses with augmented and actionable insights that create a perfect synergy between aerial applications and everyday business operations. Strong areas of operation are law enforcement and industrial enterprise solutions.
Aeryon Labs, Inc. makes rugged drones for commercial aerial camera work that can carry heavy payloads.
AguaDrone manufactures a waterproof drone that is used for fishing and has a sonar finder to locate fish as well as a remote-controlled system to release bait that it can carry.
Air Hogs made by Spin Master are hobby drones made with foam to look like vehicles driven by superheroes like the Batplane and spaceships in movies like Star Trek or Star Wars.
Airspace offers a drone security system to identify, track, and take down unauthorized drones in restricted airspace or those that are flying without permission over private property.
Altair Aerial is a new company from Nebraska that released the Blackhawk drone, which is for hobby flying.
Ambarella makes the electronic chips for drone cameras that allow them to take photos and video in low-light conditions.
Aptonomy creates drones used for security purposes that use artificial software to improve surveillance.
Atlas Dynamics makes automated drone systems that include a charging station for a drone to use. The drone automatically launches, flies a pre-programmed flight, and then returns to the charging station.
Aurora Integrated Systems is based in India. They make long-range tactical drone systems, rapidly-deployable Aerostat-guided systems, and technologies that use inertial navigation controls.
Autel Robotics creates excellent drones made for aerial photography.
BFD Systems started in 2017 making customized drone solutions for heavy payload integration.
Blade makes easy-to-fly quadcopters and mini-drones for beginners.
Cheerson makes popular inexpensive drones for beginners. Their CX-13 is one of my all-time favorite quadcopters.
CyPhy designs and makes custom drones for use to solve commercial problems with robotic tools.
Dedrone makes systems that are used to track drones by monitoring movement patterns, sound, and other parameters to block invasions of privacy and unauthorized drone flights.
DJI is a very popular drone company know for the Mavic models of drones that are suitable for professional drone pilots and commercial photographers.
Draganfly Innovations makes custom drone systems for photography, industrial uses and research purposes.
Drone Aviation Corp. makes commercial drone security systems.
Echodyne provides ground-based airspace management radar and airborne detect-and-avoid radar for commercial UAS.
EHANG designs and makes drones that are controlled by a smartphone. The drone flies easily by using smart algorithms to help reduce pilot errors such as object detection, collision avoidance, and automatic return home in the case of a loss of the communication signal.
Embention makes high-quality custom drones that are suitable for flying anywhere and are good for international uses.
Fat Shark makes cameras, goggles, and accessories used for first-person-view (FPV) drone flying.
FLIR makes imaging solutions that use drones to take thermal images for heat detection, measurement, and research.
Flyability invented the Elios drone, which is sturdy enough to survive a collision and then remains in stable flight after being hit. It is safe to fly this drone near people. It can fly in difficult places that are normally out of reach. It won the UAE Drones for Good Award in 2015, which had the prize of one million dollars.
Force1 manufacturers inexpensive toy drones for hobby photographers.
Freefly invented the Movi Gimbal Stabilizer, which is used to rotate and then hold cameras in position for photography. The make the professional ALTA drone.
GoPro makes very popular camera for extreme sports that can also be attached to drones.
Gryphon Sensors specializes in systems for drone detection, for traffic management for drone flying corridors, and beyond line-of-sight drone-flying.
HighGreat is an innovative company that conducts research and development, manufactures and sales of recreational unmanned aircraft systems like the Mark drone.
Hubsan manufactures popular consumer drones like the X4 series. These are starter quadcopters, which are suitable for beginners.
Infinium Robotics makes drone systems that are autonomous and are used for indoor flying to manage inventory and can create swarm flying effects for promotions.
Insitu manufactures commercial drone and creates software that uses the intelligence gathering by drones such as reconnaissance photos for surveying and mapping. The make the ScanEagle drone designed for agricultural uses. It can also be used for the protection and inspection of oil or gas pipelines.
Intel makes drones and the software controls for aerial light shows that look as good as fireworks. These drones fly in the multiple hundreds at one time. Intel keeps breaking world records for the number of drones that can fly simultaneously.
JJRC is a Chinese manufacturer that makes toy drones and hobby drones.
Kespry makes drones made specifically for aerial photography used in construction, mining, and surveying.
Parrot manufactures high-end hobby drones for consumers and the ANAFI camera drone that can be used for professional photography.
PowerVision Group is a Chinese manufacturer that makes smart drones that fly using virtual reality headsets for first-person-view (FPV) flying.
Propeller Aero is an Australian company that makes integrated drones systems to help manage large construction sites.
Saildrone makes drones for use on water for scientific research, such as weather prediction, ocean current flows, and fish monitoring.
senseFly is a subsidiary of Parrot. This company specializes in drones used for mapping and surveying. They are used for agriculture, industrial applications, mining, and humanitarian aid projects.
SicDrone creates drones designed for maximum flight efficiency for agricultural applications and governmental security projects.
Skydio has the best autonomy in the world, including the ability to operate in GPS-denied environments because of their computer vision-based navigation.
Skylark Drones makes commercial drones for use in agriculture, construction projects, energy sector uses, and mining.
Sky Viper makes hobby drones for aerial videography, and racing. Sky Viper also has a flight simulation application for smartphones to use for self-training.
SkySpecs makes the Guardian drone that has an obstacle avoidance system. It can fly autonomously and is used to inspect infrastructure.
SparrowHawk is made by Search Systems. This is an anti-drone system designed to be attached to a drone. It deploys a net to capture drones in mid-air. This system is used to prevent authorized drone flying in restricted airspace.
Sunlight Photonics makes drones that look like birds that fly using solar power. They can be used as fleets to create temporary communication systems or for security and surveillance.
Syma Toys is a China-based company that manufacturers consumer drones, quadcopters, and helicopters.
TE Connectivity makes the sensors used by drones for collision avoidance and that allow drones to be used in harsh environments and to fly in bad weather.
Teal Drones makes high performance racing drones.
TuffWing is a U. S.-based company that creates drones that are used for aerial mapping. and can carry many types of sensors.
UDI creates inexpensive consumer drones that are priced less than $100.
Uvify makes the Draco racing drone and the new OOri mini drone.
Walkera Technology Co., Ltd. makes small consumer models and commercial drones for agriculture, fire prevention, land surveying, and inspection of energy resources.
Workswell makes infrared imaging equipment and other sensors for drones.
Yuneec makes remote-controlled airplanes. The company makes consumer drones like the Mantis Q, which respond to voice commands. It makes drones designed for commercial applications such as the Typhoon H520.
ZeroTech is a Chinese company that makes smart drones and micro-drones, such as the Dobby pocket drone.
Amazon has its PrimeAir service under development with the goal to be able to deliver packages to customers in 30 minutes or less. FAA approval in the United States has not yet been granted for this service (as of January 2019); however, real-world tests are ongoing in the UK.
Flirtey is the first company in America to get FAA approval for drone package delivery. Flirtey wants to be the last-mile solution for the urgent delivery of time-sensitive items such as medical supplies. The FAA approved their delivery methods for remote areas with sparse populations.
Flytrex is a company in Israel that invented a cloud-based drone management system for delivery companies that want to offer their customer point-to-point delivery or point-to-area delivery services.
Matternet makes the Matternet One drone and software controls that are designed specifically for transportation and delivery services.
Project Wing is a Alphabet (Google) project that began in 2017 to deliver food to remote parts of Australia.
Zipline makes drones for use in Rwanda, Africa, to deliver blood and vital medical supplies to remote inaccessible areas.
DroneBlocks created a complete system for educators to use to teach students about drones in a project-style teaching environment.
Drone Launch Academy provides online training for budding professional pilots to help them pass the Part 107 exam.
Droneport Texas focuses on opportunities for drone flying in the state of Texas by producing public events and offering training activities for first responders.
OnPoynt supplies drones technology to teachers for hands-on training programs so that students can learn to build and fly drones.
PCS Edventures offers drone technology to educators as part of its focus on support for science, technology, engineering, and mathematics (STEM) programs.
The Zephyr simulator is made by Little Arms Studios. It is a good simulator to use to learn drone flying.
1 Martian Way is a company from India that specializes in developing artificial intelligence software for use with drone technology.
3DR build drones systems for construction projects and for use by engineers. This system is used to create high-resolution maps and 3D models.
Agribotix focuses on creating drone technology systems for use in agriculture. It produces data processing software that is used to analyze photos of agriculture.
Airware makes the Aerial Information Platform. This software helps operate a commercial drone fleet that follows government regulations and meets insurance requirements.
Ascending Technologies produces drone flight systems to control drones for many industrial, research, and commercial purposes.
Avision Robotics develops software used to create models and for simulations. The company created a software control system for the communication and navigation needs of drone fleets that are used in agriculture, construction, and mining.
Bentley created ContextCapture. It is a cloud-based and on-premises solution that helps produce complex 3D models of real-world projects up to the scale of a large city. It is used to help make decisions about the design, construction, and management of infrastructure projects.
Betterview helps architects and construction firms make better building decisions through the use of aerial drone photography and surveys.
Botlink makes automated drone flying software.
Citadel Defense makes a software security system to stop unauthorized drone flights in real-time.
Datumate is a data analytics company. They create safety-monitoring solutions for construction applications. The company creates automated, precise, cost-effective solutions that help keep crews on a construction project safe.
DroneDeploy created cloud-based drone software, which works with any drone that is controlled by a smartphone. With this software, it is possible to create 3D models and maps for analysis. This data can be shared from a smartphone connected to a drone.
Esri built ArcGIS mapping software. ArcGIS allows people to connect, get maps, send data, and use apps with data from geographic information systems (GIS).
Fortem makes collision avoidance software for drones and perimeter drone security systems for controlled airspace and critical infrastructure.
Gamaya uses hyper-spectral image capture and technology to help farmers with more accurate agricultural inspection data.
GeoCue Group creates software tools for use with kinematic LIDAR data.
Identified Technologies makes drone-tracking software for commercial drones that improves productivity.
Iris Automation specializes in making software and solutions to help drones with collision avoidance.
Maps Made Easy created software that allows drone pilots to make their own maps by using accurate, high-resolution imagery.
Neurala has artificial intelligence software that can be used to control a drone or a fleet of drones.
Pix Processing invented a software application to use for 3D reconstruction of structures based on aerial and handheld images. This software is used for archeology, architecture, agriculture, insurance, lumber, and mining.
PrecisionHawk provides software tools to use data collected by drones and process it to create 3D terrain mapping.
Raptor Maps offers software to create maps made from drone data that uses artificial intelligence with thermal analysis to create insights.
Skycatch systems use an analysis of drone-captured data to help engineers and construction managers better manage their operations with actionable information.
SLANTRANGE uses drone-captured images and multi-spectral sensors to produce accurate, calibrated, analytics for agricultural operations.
Uplift Data Partners uses the analysis of drone-captured aerial images to discover insights that improve construction project performance metrics.
AirMap invented drone system technology to manage airspace below 500 feet. This system provides accurate and reliable navigational support and communications for the drone industry.
Drone LogBook offers a flight-management system for drone pilots to help them maintain flight logs and manage batteries, equipment maintenance, accident incidents, location information, and pre-flight inspections.
Kittyhawk is a drone pilot’s software tool to log flying, record important data, and coordinate drone operations.
Measure offers software tools for drone-flying businesses that help to reduce operating risk and manage capital expenditures.
Skyward is a flight-operations management system used by drone operators and drone fleet managers.
Unifly makes software for fleet traffic management of drones to help them fly in authorized drone airspace corridors and prevent drone flights into restricted areas.
DR1 hosts drone races throughout the world. In 2017, DR1 was the first drone racing organization to host a drone race live on broadcast television. The race appeared on CBS News.
The Drone Racing League organizes drone racing events all over the world. DRL offers the DRL racing simulator in order for beginners to practice and learn how to become a drone-racing pilot.
MultiGP produces an annual American drone racing championship that accepts entries from the winners of the drone races sponsored by local racing chapters.
AUVSI produces an annual conference for the promotion of drones and robotics called the AUVSI XPONENTIAL.
Commercial UAV Expo is one of the leading tradeshows for the commercial drone market in North America. It invites the participation of manufacturers from all over the world.
InterDrone is a very popular drone conference for consumer and commercial drone enthusiasts that is held each year in Las Vegas during September.
New York City Drone Film Festival is a film festival dedicated to the best drone videos created in the world.
Unmanned Systems Canada produces events for Canada’s drone industry and supporters.
GENIUS NY has an annual competition that offers six, startup drone companies $500,000 each to cover a year of their initial operations.
SkyFund is a venture capital fund that invests in startup drone companies.
Aerial MOB provides professional high-quality aerial photography for cinematic projects such as films and television commercials. The won an Emmy for their work.
Arch Aerial provides drones services for aerial imaging, data collection, and mapping.
Drone America provides professional drone services for agricultural uses, research, anti-poaching surveillance, and other commercial needs.
DroneBase is a drone-pilot resource-locator service that allows you to hire a drone pilot for a project or become a freelance drone pilot listed on the system.
DroneCast is an advertising agency that specializes in using drones for advertisements, promotions, and marketing campaigns.
Dutch Drone Company offers a wide range of aerial services, including inspections, mapping, agriculture, and more.
Firmatek provides site data analytics and aerial mapping services using drones.
Congratulations to all of these companies for the incredible work they're doing in the drone industry.
They will all play a vital role as the industry continues to expand.
|
{
"timestamp": "2019-04-25T22:54:03",
"url": "https://mydroneauthority.com/industry/drone-companies/",
"language": "en",
"source": "c4"
}
|
Am planning a visit to Dublin in December-Jan. What is the weather like at that time of year?
Normally cold, Wrap up well, We'd usually have frost on the ground at that time of year.
We will go to Limerick the 15th December. Is it cold or rainy?
|
{
"timestamp": "2019-04-23T02:39:31",
"url": "http://www.irishtourist.com/board/9806.shtml",
"language": "en",
"source": "c4"
}
|
A few of the terraces look like ribbons, the other appear as if big chains. They curve from the beneath to the upside from the hill. The lower ones look like snails and the upper ones like towers. The terraces are looked layers on layers, high and low, the scale is very large, and the outline is pretty smooth.
The Longji Terraced Field shows a picture of great momentum and imposing beauty. It is about 20 km from the county and about 100 km. apart from the Guilin city . Winding from the riverside up to the mountain top, the Longji Terraced Field are built along with the slope, the highest spot is about 880 meters, and the lowest is about 380 meters.
The coiling line that starts from the mountain foot to up to the divides the mountain into layers of water glittering in the sun in spring, layers of green rice shoots in summer, layers of golden rice in fall, and layers of silvery frost in winter. The terraced fields were mostly built during the Ming Dynasty about 500 years ago.
With it beautiful scenery and landscape. The Longji Terraced Fields attracts more and more tourists nowadays.
|
{
"timestamp": "2019-04-19T09:18:15",
"url": "https://www.tourtravelchina.com/gulin-attraction/longji-terraced-field.html",
"language": "en",
"source": "c4"
}
|
That was the question posed to me early this morning.
is going through my mind.
My life’s Purpose is to encourage with my words and inspire with my life.
this time; the inspiration will be the perseverance during the pressure.
successes, deviate from my failures and not fall into the same disappointments I have faced.
have been set to make our journey most efficient.
belief system and financial status.
are familiar with? This should be our question.
therefore, He is who we need to connect with.
My current position is to be receptive and learn from what is occurring in my surroundings.
most apparent or in spite of what may be obvious similarities.
what my natural eyes can see.
Next ArticleWhat Are We Focused On?
|
{
"timestamp": "2019-04-21T21:03:02",
"url": "http://tgifj.com/home/what-inspires-you/",
"language": "en",
"source": "c4"
}
|
D O K Automotive is a full-service auto repair and preventative maintenance facility offering domestic vehicle repairs. Our technicians have the knowledge and experience to service and repair the most challenging domestic vehicles.
Oldsmobile represented the leadership and innovation of General Motors for over 100 years, earning a place in automotive history. While GM no longer makes Oldsmobile vehicles, D O K Automotive can help you keep your classic car on the road.
For questions about your domestic vehicle, contact us at 705-726-0085 or send us an email. Our technicians will help determine what needs to be done.
|
{
"timestamp": "2019-04-19T08:15:17",
"url": "https://www.dokautomotive.com/Barrie-domestic-auto-repair.html",
"language": "en",
"source": "c4"
}
|
Calon-calon lepasan SPM, Sijil Politeknik, Kolej Komuniti, Institut Kemahiran Mara, Institut Pertanian, Institut Kemahiran Tinggi PERDA dan Kemahiran Malaysia (SKM) boleh memohon ke program Diploma Politeknik Sesi Disembeir 2017 mulai 11 Ogos 2017 jam 12.30 tengah hari sehingga 11 September 2017 jam 5.00 petang.
Permohonan boleh dibuat dengan membeli UNIK ID / NO PIN UPU Kategori A berharga RM15.64 di BSN seluruh Malaysia mulai 11 Ogos 2017 jam 3.00 petang sehingga 11 September 2017.
Activities at Kampung Bidayuh Miri, 25/11/2015.
Treat the students and teachers from SMK Tebedu Serian who are on a “Lawatan-Sambil-Belajar” to an overseas Bidayuh village in Miri.
Jointly organized by DBNA Miri branch & JKKK Kpg Bidayuh Miri.
George Sikien Sunow reporting for DBNA CEC.
For more information regarding Bidayuh Youth Symposium 2015, please Click Here.
click on the Register Now icon on the left for online registration. MYSTERY GIFTS awaits those who refer / introduce the most friends to join this symposium. Please fill in the referral / introducer inside the online form if you are registering for your friends or family.
After 10 years of organising WBGC, the committee received the new Dato Sri Michael Manyin’s Challenge trophy for this year’s event which is to be held at Sarawak Golf Club (KGS). The trophy will replace the previous trophy after it was won by previous champion. About 65 participants have confirmed to join this year’s competition. This year, another challenge trophy up for grabs is the DBNA President’s Challenge trophy. Dato Sri Michael Manyin’s Challenge trophy is for Gross Champion and the President’s is for the Nett Champion.
To receive the challenge trophy today on 30 June 2014 was DBNA President Datu Ik Pahon Joyik who led the committee to meet Dato Sri Michael Manyin at his office at Ministry of Infrastructure Development and Communication Sarawak at Wisma Masja, Petra Jaya.
The committee members that attended the handing over of the trophy were the Organising Chairman Mr Robert Elone, Mr Joseph Jindy, Mr Ricky Guing, Mr James Sinjeng, Mr Chali Ungang, and Mr Joseph Beron.
The competition will be held on 5 July 2014 Saturday with lot of prizes to be won by the participants. Sponsors for this year’s event also come from individuals, the Yang Berhormats and also from the corporate bodies for the novelties like the hole-in-one, nearest to the hole, and longest drive. MASwings is sponsoring 2 sectors flight seats free from Kuching-Miri and Kuching-Bintulu to and fro.
DBNA and WBGC committees thank all that have contributed to ensure the success of this year’s event. This year, 10 Gross prizes and 10 Nett prizes are also up for grabs.
Dato Sri Michael Manyin said, “The Bidayuh when they organise any event, there are apolitical especially under DBNA. Every Bidayuh are invited to join”.
|
{
"timestamp": "2019-04-24T00:29:29",
"url": "http://dbna.org.my/blog/category/uncategorized/",
"language": "en",
"source": "c4"
}
|
Remember history while drinking your favourite hot drink with this Hadrian’s Wall ceramic coaster. It pictures ‘Genii Cucullati’, three religious figures that can be found in a stone carving at the museum of Housesteads. The deities date back to 225-50 AD, making them an incredibly interesting artefact. This coaster makes a great souvenir of your trip to Housesteads Roman Fort or Hadrian’s Wall.
|
{
"timestamp": "2019-04-22T18:07:37",
"url": "https://www.english-heritageshop.org.uk/homeware-garden/hadrians-wall-ceramic-coaster-housesteads-roman-fort",
"language": "en",
"source": "c4"
}
|
Our coffee syrups . . .
The word “Chai” simply means “tea” in India (Hindi), which was derived from “cha,” which is the Chinese word for “tea.” More precisely “Milk Tea” is the usual way of drinking the cup with Chai Latte being the common description.
Whilst ingrained Western milk drinkers follow a rather traditional habit, there are those who have newly discovered the spicy milk teas from India. This ancient beverage is treasured by people around the world for its delicious flavor and today it can be modified in whatever way best suits the drinker. For example, it is not uncommon to see someone order a chai tea with soy milk, while the next person orders a non-fat version.
This perhaps reinforces the versatility and experimentation happening in the beverage world currently. Have fun creating.
|
{
"timestamp": "2019-04-25T12:04:48",
"url": "https://barkersprofessional.nz/coffee-with-a-shot/",
"language": "en",
"source": "c4"
}
|
Let us understand what does private inheritance mean… Consider a simple example to illustrate the single inheritance. The Program given below shows a base class B and a derived class D. The class B contains one private data member, one public data member and three public member functions. The class D contains one private data member and two public member functions.
Inheritance in which the derived class is derived from only one base class is called single inheritance. Let us consider a simple example to illustrate the single inheritance. Program given below shows a base class B and a derived class D. The class B contains one private data member, one public data member and three public member functions. The class D contains one private data member and two public member functions.
Now Learn C++ Online absolutely free. Yes, its a Free, Online C++ programming tutorial site which will help you learn C++ online and provide you with the detailed knowledge about C++ Object Oriented Concepts (OOPS concepts). It is a complete tutorial that covers C++ programming right from the basics up to the advanced object oriented programming concepts.
LearnCPPOnline.com © 2019. All Rights Reserved.
|
{
"timestamp": "2019-04-20T21:12:11",
"url": "https://www.learncpponline.com/category/inheritance-pointers-polymorphism-virtual-functions-c-plus-plus/inheritance-c-plus-plus/single-inheritance-in-c-plus-plus/",
"language": "en",
"source": "c4"
}
|
Michele Celentano is proof that hyper-active kids grow up and get jobs and have careers. We know of nobody with more non-stop energy than Michele. In fact, at least year's program she taught one evening as long as her class wanted her to keep teaching.
This video is a promotional piece that Michele did for her own workshops, but here's what she doesn't tell you. She's non-stop passion about family portraiture. Her new book released earlier this year is a best seller, loaded with outstanding content to help elevate family portraiture. When she teaches she gives her class everything she possible can to help them develop the skill set to create/capture stunning family images.
She's a constant believer in education and over the years attended program after program taught by the finest photographers in the professional community and now, she's become one herself!
|
{
"timestamp": "2019-04-19T04:23:31",
"url": "http://www.skipcohenuniversity.com/summer-session-profiles/michelle-celentano",
"language": "en",
"source": "c4"
}
|
Description: Grady Champion is a young, blues singer and harmonica player, that has been compared to Sonny Boy Williamson, and people can hear exactly why on his Shanachie debut Payin\' for My Sins. The album includes a version of \"Don\'t Start Me to Talkin\'\" that really shows Grady\'s high-energy singing and harmonica playing and an update of the traditional blues lament \"Goin\' Down Slow\" with an AIDS parable -- a hard-bitten vignette of modern life. His revved-up, soulful vocalizing and the charm and insight he brings to his songwriting in numbers like the campy \"My Rooster Is King\" and the classic-sounding tale of infidelity \"You Got Some Explaining to Do\" (co-written by his producer Dennis Walker, who helped Robert Cray reach national fame) mark Grady as an important new talent.
|
{
"timestamp": "2019-04-26T12:59:51",
"url": "http://www.thebluescan.com/performer.php?id=210",
"language": "en",
"source": "c4"
}
|
The STS tank series is an all-in-one group and taken system that offers easy chemical replenishment and convenience. The unit is pre-assembled at the factory to help reduce installation time. The pump is mounted vertically for spill containment and includes a rain roof to prevent liquid intrusion into the motor housing. The tank systems are shipped with the single head Classic series pump models.
Dimensions: 20-1/2" OD x 25-1/4"
What's the max GPD this can output?
Hi. The max output per day is 3 gallons.
|
{
"timestamp": "2019-04-23T09:04:58",
"url": "http://www.inyopools.com/Products/13100007058049.htm",
"language": "en",
"source": "c4"
}
|
Litigation is a tough game, but a steady stream of young litigators are making their mark on the legal scene, working in civil and criminal courts and steadily building their reputations.
We have some of the up-and-comers here.
Kerry Cook took the relatively rare route directly to the independent Bar, securing a pupillage at a Chambers and enjoying the wide variety of work available.
Focusing on criminal advocacy he is establishing a reputation for his work in criminal, appellate, serious fraud and human rights issues among other areas.
Gaining a reputation as a capable barrister with broad experience in civil litigation, Tiho Mijatov is developing his reputation providing public law advice and advocacy.
Before joining chambers he was a judge’s clerk at the Court of Appeal, where he gained wide experience across civil and criminal law.
Bell Gully partner Liz Coats has already established a top reputation as an employment lawyer advising on a range of employment law matters for both public and private employers.
Working as a pragmatic advisor, she works across both the the Employment Relations Authority and Court as well as the Court of Appeal and has multiple endorsements from the major ranking publications.
Beginning his career in 2001 as a solicitor for Rudd, Watts & Stone (now Minter Ellison) Ian Brookie then joined the office of the Crown Solicitor in Auckland. While a Crown prosecutor, he prosecuted a large number of cases on behalf of the Crown, the Police and the Commerce Commission in both the District and High Courts.
As a defence lawyer working from Sentinel Chambers, Auckland, he is developing a solid reputation as a sound and successful criminal lawyer.
Wynn Williams partner Jeremy Johnson, 32, has achieved a highly successful academic and professional career, but recently hit the news with the establishment of the Christ College “Tuis”, dedicated to help GBT former Christ College students. Johnson, 32, is the youngest-ever president of Christ’s College Old Boys Association and also its first openly gay president.
However, breaking traditions and professional barriers is something Jeremy Johnson is used to.
Already an experienced litigator handling commercial and trust work among others, he has increasingly developed a practice on complex dispute issues. The youngest person to be admitted as a Fellow of the Arbitrators’ and Mediators’ Institute of New Zealand and widely recognised by legal media with a variety of glowing references.
A recipient of the prestigious Clearly Prize in 2009 and the youngest lawyer to appear before the Supreme Court in 2008, he represents the Anglican Diocese of Christchurch, a member of the Legislation Advisory Committee and others.
She may be on parental leave from Anthony Harper until later in the year, but Jessica Hanning is no litigator to be underestimated as some patsy lawyer.
Already recognised as a ‘Next Generation’ lawyer in the 2018 Legal 500 Asia Pacific she has focused on construction disputes and commercial litigation.
Liam Collins said it was luck that landed him a job with defence lawyer the late Greg King.
He had approached King to work with him and worked on the Ewen Macdonald case for the murder of Feilding farmer Scott Guy.
After graduating from Victoria University after summer school in 2010, he made his first court appearance in the Supreme Court and worked the Macdonald trial as his first High Court case.
Although without a top degree, the fast-talking, Queenstown-based lawyer retains a drive to make his mark in his chosen profession.
Founder of burgeoning Auckland boutique Morris Legal, Sally Morris has moved from working as a Crown prosecutor to becoming a relationship property and trust and estate specialist.
Admitted as a lawyer in New Zealand, New South Wales and New York she has a master of laws degree from Columbia University she has acted for Samsung against Apple in the Federal Court of Australia and has used her experience to considerable effect to resolve client disputes.
Hamish McQueen is a litigator and arbitrator at boutique Gilbert Walker and is making his mark as a litigator to watch.
A winner of the Shortland Chambers public law prize in 2008, the former Westlake Boys student has gone on to complete his A+ BA/LLB by collecting scholarships and prizes like confetti. By 2010 he had picked up five scholarships and prizes, more than any other student that year.
The Forrest Hill resident and fifth-year law student was awarded the LexisNexis prize in land law, Brookfields Lawyers scholarship, A G Davis scholarship in law and the Sir Alexander Johnstone scholarship in law.
He also won an unofficial Simpson Grierson scholarship.
A former Judges Clerk in the Court of Appeal he joined Shortland Chambers before completing his LLM at Cambridghe University and joining Gilbert Walker to extend his work in commercial, public and property law.
A specialist in criminal appellate work, Andrew Bailey works as a barrister handling everything from homicides and major drug offending to other statutory offending that takes him to most appellate courts and statutory bodies.
His efforts have included having criminal convictions overturned by the Supreme Court, as well as regularly handling an eclectic range of criminal defence and appellate work.
|
{
"timestamp": "2019-04-22T22:17:02",
"url": "http://www.lawfuel.com/blog/power-list-up-and-coming-litigation-stars/",
"language": "en",
"source": "c4"
}
|
Spirituality and religious views are diverse and plentiful in American society. No matter what your particular view, most people have some sense that life does not end when the human body takes it’s final breath. Science does prove to us that you cannot kill or destroy energy, is only turns into some other form. Therein resides the source of speculation and debate.
For sake of this offering, I am sharing a perspective on kidney donation from the idea of karmic implications. Most of us have some idea that what we do impacts future events. We try to be thoughtful, careful and smart with our choices. We may even say “what comes around goes around.” Or “do unto others as you would have them do unto you.” The term karma has origins in eastern religious traditions and essentially means the sum total of your contributions or debits to date. Your karmic condition is where you are at this moment in time based upon the life you are living, or the lives you have lived.
From a karmic perspective the reason a person donates a kidney has karmic origins. Perhaps you owed a kindness of significant proportion or you left a debt unpaid at some point in your existence. Perhaps in this life or another life time you were rescued and your life was saved, and you are paying forward the generosity you received. You are sustaining life, and potentially impacting an entire tribe of people from the inevitable loss that would occur without the donation.
Karma says balance will always be restored. Until it is restored we continue to have experiences that will force equitability. If you have found yourself in a position of donating a kidney, you are supposed to do so. It is part of your karma. Whether or not a kindness was bestowed upon you, perhaps you have a different karma to be of service in a selfless manner. Perhaps you were not selfless in another lifetime or experience, and this is a manner in which you can equalize the karma of selfishness. Or, perhaps you are on the way to becoming an enlightened being, and you simply want to maximize your energetic potential and be an instrument of service. This would generate a karmic implication of significant positive impact.
Where ever you fall in the spectrum of the creation of karmic balance or influence, kidney donation is a selfless and generous act. It often is performed with anonymity. Anonymity is the highest and most powerful form of giving that exists. Kidney donation is a huge boost karmically to anyone who decides to give that gift. In the act you put your own life at peril. No matter how safe the procedure, no surgery is guaranteed to go off without a hitch. You give to someone you may not even know or ever meet, or ever receive a “thank you” from. For those of you have given a kidney, know that you have influenced karma in a very powerful way for yourself, as well as for your recipient.
To those who receive a kidney, this is their opportunity to honor the loving nature of a divine consciousness who seeks to heal and love. They have been given an opportunity to live in an enlightened state of being because they were gifted. It will forever be written on the slate of who they are that by the grace of God, a gift was bestowed upon them. That will impact their psyche, their life, and the life of their loved ones, forever.
The message here is that karma is a reality of living. Until all our karma is resolved we continue to live, grow and having experiences of all kinds. Kidney donors are stacking the deck in their favor by selfless acts of generosity. Kidney donors are executing God’s work. Some might even call you Angels. There is divine activity at play, living large in these scenarios no matter how you shape them.
The only thing left to say to a kidney donor is Thank you. The only thing left for the kidney donor to do is to acknowledge to themselves that they been an instrument of divine intervention. That is an honor bestowed on to a few. Many kidney donors do not want to pat themselves on the back. It’s appropriate to acknowledge that you have been an instrument of divine blessing in another person’s existence. That itself is an honor.
You are good people. You are angels on earth. That is a spiritual truth.
Lovingly known as The Common-Sense Psychic. Phyllis King has worked with tens of thousands of people in 25 different countries. She is known for her practical and down to earth approach. She has been featured on, ABC, CBS and NBC TV, radio programs across the country, and has been published in over 70 print and online publications. Phyllis holds a B.A. in Sociology.
← Did I Just Create a Pre-Existing Condition?
|
{
"timestamp": "2019-04-25T14:48:36",
"url": "https://sparebodyparts.com/2017/06/16/kidney-karma/",
"language": "en",
"source": "c4"
}
|
Renowned communications pioneer Andrew J. Viterbi has given $50 million to the University of California San Diego in honor of his father, ophthalmologist Achille Viterbi. The gift will result in the founding of the Viterbi Family Department of Ophthalmology and the Viterbi Family Vision Research Center as well as establish six new endowed faculty chairs.
“With this historic gift – the largest ever to the Department of Ophthalmology – UC San Diego has the potential to cure blindness to help millions of people worldwide,” said Chancellor Pradeep K. Khosia in a UC San Diego News Center article.
The Viterbi Family Department of Ophthalmology is the first named Health Sciences department at the university. Its focus is clinical care and vision research, which complements the research and clinical efforts of the Shiley Eye Institute.
The Viterbi Family Vision Research Center, which will be located on the La Jolla campus, will concentrate on research to find cures for a number of eye diseases. Studies will center on curing glaucoma blindness and restoring vision lost through retinal degeneration as well as to those who have reversible vision loss due to cataracts or infections.
Viterbi, a co-founder and retired vice chairman and chief technical officer of Qualcomm Inc., is known in the wireless communications industry for the “Viterbi Algorithm.” Currently, he is Professor Emeritus at UC San Diego.
The gift honors his father, who was born in Italy to Italian Jewish parents and fled to America in 1939 to escape the laws in Fascist Italy targeting Jews. The physician obtained his medical license in 1905 in Italy but was forced to start over in America.
The campus is undergoing a physical transformation. UC San Diego alumnus and Qualcomm co-founder Franklin Antonio donated $30 million in support of the campus’ Jacobs School of Engineering. The approximately 200,000 square foot building is scheduled to be open by Fall 2021.
The Koman Family Outpatient Pavilion, which opened in March, offers clinical care and translational medicine. Named in honor of Bill and Amy Koman and family, the pavilion is located on the La Jolla campus.
The Halicloglu Data Institute, named in honor of UC San Diego computer science alumnus Taner Halicioglu, opened in March. An early Facebook employee, Halicioglu gave $75 million to build on the university’s multidisciplinary collaboration and data science.
In Fall 2017, the Tata Institute for Genetics and Society became home to the Biological and Physical Sciences departments. The new building was made possible by a $70 million gift from the Tata Trusts.
Lab suppliers wishing to market their products to UCSD science professionals should plan on attending the 45th semiannual Biotechnology Vendor ShowcaseTM Event. The next showcase at UCSD will be held on Thursday, Feb. 14.
|
{
"timestamp": "2019-04-21T18:25:43",
"url": "http://info.biotech-calendar.com/uc-san-diego-receives-50m-gift-for-eye-disease-research",
"language": "en",
"source": "c4"
}
|
Order your Delaware corporation or limited liability company online or by phone. Friendly, fast, professional service. Free information on Delaware corporations.
DelawareInc.com - Harvard Business Services, Inc.
Delaware Inc.com can help businesses incorporating in Delaware. Services like, Delaware LLC , Registered Agent, & Delaware DE Incorporations.
Delaware LLC, Delaware S Corporation Formation, Delaware Registered Agent. Entrepreneurs trust us when incorporating in Delaware and forming Delaware LLCs for as little as $10 plus fees. Delaware Registered Agent services since 1974.
|
{
"timestamp": "2019-04-19T22:21:08",
"url": "http://www.delawareontheweb.com/businesses/incorporating-delaware.htm",
"language": "en",
"source": "c4"
}
|
Volusion is a shopping cart platform to expand your business. Because of it’s largest variety, Volusion has been recognized for the Great User Experience. Volusion provides personal eCommerce assistant for the sole user and freelance entrepreneurs to help them build their attractive eCommerce websites.
Volusion provides Volusion Creative Kit, which enables storefront designs with beautiful themes, placing content with easy CMS, easy SEO optimization, and last but not least targeting audience for your brands, products, or services. Volusion will also work on your buyer’s experience with its smart selling tools which offer returns and refunds, abandoned cart report, offers, cross-selling, and end-to-end marketing.
To grow your business and to reach up to your international audience or end users, Volusion is working on fast lead generations practice. Volusion is best known for self-generated in-house services or tool, rather depending on the third party tool or service.
Write an email [email protected] about your business inquiry, suggestions, or ready-made business ideas. Create a new online Volusion store set up to run your business over the internet. You can also Request for a Quote to know the best suitable solution for your business idea.
|
{
"timestamp": "2019-04-22T17:02:34",
"url": "https://www.weblogico.com/services/volusion-design-and-development-service-india",
"language": "en",
"source": "c4"
}
|
You may or may not know that currently I live in Kansas. Go ahead, make your Dorothy & Toto jokes. I'll wait.
Everyone finished now? ;-) Well anyways, I've decided to do some nail art, commemorating my home state.
So the reason I've done the Kansas nail art, is this. As of last Friday, I finished up my last day at work, and in a little less than three weeks I will be moving to New York City.
No joke people! We are headed to the big city, and there are some exciting things in the works! I'm currently unemployed, granted I'm in day 1, but it's a weird feeling, and the next few weeks are focused on selling my house (please keep your fingers crossed/pray/send good juju, etc), packing up and getting rid of stuff, and enjoying what little time I have left with family/friends before I leave. To help with the transition, I have eleven lovely ladies who will be guest posting. I'm so excited for you to see what they've come up with.
Have you ever undertaken a cross country move? Any advice?
NYC is going to be so awesome for you!
I'm really pumped about NYC, there is just so much to do before we get there.
Aaaah so pretty I love the Kansas nails,I am about to do the guest post and send it over tonight!
Thanks!! I can't wait to see the post!
You did awesome!!! These nails are just amazeballs. I'm sure you will have a grand old time in NYC.
Thanks!!! I think you should go ahead and start saving money to come visit. Just sayin!
|
{
"timestamp": "2019-04-21T00:50:16",
"url": "http://www.fancysidenails.com/2013/07/ive-got-announcementand-its-big-one.html",
"language": "en",
"source": "c4"
}
|
Spring skiing in the Alps: The Ortler round trip.
This is the classic thing to do after skiing powder in Canada all winter: head to the cradle of ski mountaineering in the Alps. Immerse yourself in the languages, cultures (did I mention food and wine?) of those storied ranges, and ski some pretty high quality terrain in the process. On the Ortler traverse, you ski back and forth between Italian speaking (and eating and drinking) Lombardy and German speaking (and Tyrolean eating and drinking) South Tyrol. An area so full of history, art, architecture (did I mention food and wine?) that it's almost sacrilegious to go up into the mountains. Not that those don't have their share of history.
But the mountains are well worth it. They are big and serious, but they are also very accessible. There are numerous huts, there is easy access to the trailheads, and in Sulden, there is a great telepherique system that gets us high into the mountains.
We ski past the great and storied north faces of Ortler and Koenigspitze, into the upper Valtellina, the terra magnifica with its wine and Roman baths, we climb Cevedale, at 3,770 m one of the premier ski mountains of the Eastern Alps, we traverse the old boundary between Austria and Italy with its barbed wire and fortifications, and we enjoy the hospitality of German and Italian speaking huts. The terrain is big and glaciated. Ski crampons are a must, and in places boot crampons may be necessary.
This is the classic thing to do after skiing powder in Canada all winter: head to the cradle of ski mountaineering in the Alps. Immerse yourself in the languages, cultures (did I mention food and wine?) of those storied ranges, and ski some pretty high quality terrain in the process. On the Graubuenden Skihouchroute, you travel through the mountains where the ancient Raetoromanic dialect Ladin is spoken, and the names sing in that language. This route parallels the river Inn on its northwest side above the sgraffito painted villages of Madulain, La Punt and Zuoz.We start at the sources of the Inn, head over to Julier Pass and the Rhine watershed, and continue northeast, with the best chance for powder runs, toward Davos. We ski past the great and storied north faces of Ortler and Koenigspitze, into the upper Valtellina, the terra magnifica with its wine and Roman baths, we climb Cevedale, at 3,770 m one of the premier ski mountains of the Eastern Alps, we traverse the old boundary between Austria and Italy with its barbed wire and fortifications, and we enjoy the hospitality of German and Italian speaking huts. The terrain is big and glaciated. Ski crampons are a must, and in places boot crampons may be necessary.
|
{
"timestamp": "2019-04-23T20:36:36",
"url": "http://bearmountaineering.ca/trips/spring-skiing-in-europe",
"language": "en",
"source": "c4"
}
|
We’re starving neuroblastoma of polyamines with drug DFMO. But there won’t be just one cure for such a diverse disease.
Last week, three of our young neuroblastoma researchers received funding from NSW Government to support their research into innovative, new treatment approaches. Just as cancer is not one single disease, with one single cure, there are also different sub-types of neuroblastoma. Different people and different types of cancer respond in unique ways, which is why research into new treatments is so important.
The most effective of these new approaches will be tested in the clinic and results will be compared to find the safest, most effective treatment for children with neuroblastoma. This means we’re getting our research from the lab bench to a child’s bedside as quickly as possible.
*The international clinical trial for children with relapsed neuroblastoma, being led by Sydney Children’s Hospital, Randwick, is the result of ground breaking research by Children’s Cancer Institute. The cost of the DFMO for this clinical trial is being supported by The Kids Cancer Project and Lions Childhood Cancer Research Foundation.
Dr Dan Carter’s project is based on his discovery from single cell profiling that a small group of genes controlling cell division are substantially increased in the cells that initiate tumours. He will investigate if increased levels of the genes are needed for neuroblastoma to begin and then test if drugs inhibiting the genes could be a new therapy for high risk subtypes of neuroblastoma.
Dr Pei Yan Liu will define the role in promoting neuroblastoma tumour growth of a new long, non-protein coding RNA she recently discovered. The RNA is found in large amounts in high-risk neuroblastoma. Dr Liu will test new combination therapies to target the RNA.
Dr Orazio Vittorio (shown above) will evaluate the potential of dextran-catechin as a future neuroblastoma treatment. This molecule is a chemically-modified natural compound that targets copper metabolism, an emerging target for anticancer drug design.
Listen to an interview with our Executive Director Professor Michelle Haber AM on radio station 2BS Bathurst about why neuroblastoma research is important.
Top image: Solving the polyamine puzzle through research will lead to better neuroblastoma treatments.
|
{
"timestamp": "2019-04-23T02:33:58",
"url": "https://ccia.org.au/blog/neuroblastoma-treatment-search-polyamine-puzzles-beyond/",
"language": "en",
"source": "c4"
}
|
Glucodin Energy Tablets 32 give an instant boost of energy for active people, in a handy pocket pack.
Chew 2-3 Tablets as often as desired.
Ideal for busy, active people who need additional energy reserves.
Excellent for use in low-fat diets.
|
{
"timestamp": "2019-04-20T11:02:07",
"url": "http://watsoniapharmacy.com.au/productdetail.aspx?name=Glucodin-Tab-50Gm-32",
"language": "en",
"source": "c4"
}
|
I recently published my third novel, the second in a series about a witch with a twist.
In The Promptuary I introduce a gone, but not forgotten, twentieth century icon.
I’m sure you have heard of Marilyn Monroe.
Early on in the writing process I established a sort of template for the series.
My witch, Anaïs Blue, is tasked with helping the dead with their unfinished business.
Of course, she could help anyone, but I decided it was much more interesting to use a public figure.
The challenge, which requires a great deal of research, is to determine what the public figure’s true desire or purpose was.
For many people, celebrity status is dumped on them.
Fame is never what it is cut out to be. The press and other media will eventually mould a public figure into something fictitious.
Whether they play along is immaterial. Under the facade, there is an ordinary human being.
Often, they have desires other than what is publicly presented. Many are frustrated by this and never truly achieve what they want out of life.
We too easily forget the public figure is just a shell. A real person exists beneath.
In The Promptuary I make no secret about who the celebrity is. She is Marilyn Monroe.
I did extensive research into this incredibly famous icon. I wanted to know what made her really tick.
I was most fortunate that there was an exhibition about her in Amsterdam whilst I was writing the novel.
The exhibition centred around her personal effects and various documents. Everything came from a private collector and even included a version of the The Seven Year Itch dress.
It was not the dress, but other things, which gave me a true insight into her life.
She was an avid reader. She absorbed information like a sponge. Her intelligence was such that she snagged one of the greatest writers of the modern age.
For a period she was married to Arthur Miller.
Unfortunately, I believe he never really got to know the real her. He married the icon.
The relationship failed because he revealed things about her which she wished to keep secret. He broke her trust. There was no respect.
One of the major discoveries I made was her talent for one-liners.
This helped me compose her character.
It gave me the fodder to centralise her personality. However, the one-liners were only Marilyn at face value.
I discovered that deep inside she had one overwhelming desire.
It saddened her that she was unable to fulfil this desire.
The desire was a very basic one, but something she could never have. It was central to her bouts of depression and possibly contributed to her untimely death.
I cannot reveal it here. If I did so, I would give away one of the most essential elements of the novel.
If you want to know more then you will have to read The Promptuary.
If you have already read the book, I would interested to know what you think.
On the 10th of August The Promptuary was revealed to world.
|
{
"timestamp": "2019-04-22T14:11:22",
"url": "http://pjwhittlesea.com/marilyn-monroe-unfinished-business/?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+PJWhittlesea+%28P.+J.+Whittlesea%29",
"language": "en",
"source": "c4"
}
|
Circadian clocks have evolved as mechanisms that allow organisms to adapt to the day/night cyclical changes, a direct consequence of the rotation of the Earth. In the last two decades, and due to its amazing repertoire of genetic tools, Drosophila has been at the leading front in the discovery of genes that account for how the clock operates at a single cell level, which are conserved throughout the animal kingdom. Although the biochemical components underlying these molecular clocks have been characterized in certain detail, the mechanisms used by clock neurons to convey information to downstream pathways controlling behavior remain elusive. In the fruit fly, a subset of circadian neurons called the small ventral lateral neurons (sLNvs) are capable of synchronizing other clock cells relying on a neuropeptide named pigment dispersing factor (PDF). In addition, a number of years ago we described another mechanism as a possible candidate for contributing to the transmission of information downstream of the sLNvs, involving adult-specific remodeling of the axonal terminals of these circadian neurons. In this manuscript we describe some of the molecular events that lead to this striking form of structural plasticity on a daily basis.
The rotation of the earth around its own axis imposes cyclic changes on environmental conditions, primarily through variations on luminosity and temperature. The existence of an endogenous, self-sustained and entrainable circadian clock in almost every living organism allows them to anticipate those daily changes and concomitantly adapt their physiology and behavior to a changing environment . Although the biological processes that present circadian modulation may differ depending on the ecological niche that each species occupies, the molecular basis of the circadian clock shows an intriguing similarity through evolution. Briefly, circadian clocks depend on the coordinated activity of transcriptional/translational feedback loops of clock genes running within specific pacemaker cells . In Drosophila melanogaster this molecular clock is allocated in a circadian network of approximately 150 neurons in the adult brain, and the coordinated activity of the whole circuit is necessary for plastic responses to different environmental stimuli (revised in ). However, under constant conditions, circadian locomotor activity strongly depends on the activity of 8 neurons located on the accessory medulla on each side of the adult brain , , which are known as the small and large lateral ventral neurons (sLNvs and lLNvs, respectively); all of them express the PIGMENT DISPERSING FACTOR neuropeptide and are therefore also known as PDF neurons. Several experiments have determined that the sLNvs are in fact in charge of determining the endogenous period of locomotion under constant conditions , while the lLNvs appear to be involved in sleep and arousal –. How the circadian network transmits time of day information is still under debate but the activity of the PDF neuropeptide , and, more specifically, daily changes on immunoreactivity of the PDF-containing dense core vesicles at the axonal terminals as well as circadian changes on electrical activity have been proposed as putative mechanisms. In addition, we have demonstrated that the sLNvs axonal terminals exhibit a higher degree of complexity during the day and a reduced complexity during the night accompanying the daily changes in PDF levels . Interestingly, this circadian structural plasticity may result in a change in synaptic partners at different times of the day and might offer another relevant mechanism to transmit time of day information .
Axonal structural plasticity related to circuit assembly during development has extensively been studied but only recently its occurrence during adulthood in the absence of physical lesions has been reported , . Axonal remodeling during adulthood is recruited to adjust biological processes such as axonal injury, adult neurogenesis, sensory experience, learning and memory and as a response to homeostatic regulation followed by sleep deprivation , . In addition to such homeostatic changes, endogenous mechanisms determine circadian axonal remodeling of peripheral circuits , and, also, of central neurons relevant to circadian rhythms , , . The molecular and cellular processes underlying such axonal plasticity during adulthood are not clear, but different mechanisms might be engaged in the remodeling of specific neurons . In the case of circadian structural plasticity, it is expected that at least part of the molecules responsible for orchestrating changes in axonal terminals show circadian modulation of gene expression, protein stability and/or activity. In this regard, we found matrix metalloproteinases (Mmps) to be attractive candidates to modulate circadian axonal remodeling of PDF neurons.
In Drosophila there are only two Mmps, Mmp1 and Mmp2, and their action is involved in several processes ranging from tissue remodeling , tumor invasiveness , axon guidance, axonal fasciculation and dendritic remodeling . Interestingly, cell-type specific gene-expression profiling revealed enrichment of Mmp1 and 2 expression in sLNv neurons at the beginning of the night . Moreover, Mmp1 appears to be a direct target of CLOCK, a central component of the molecular clock .
In this study we investigated the molecular mechanisms underlying circadian structural remodeling of PDF axonal terminals. We demonstrated that both Mmps are key players in the remodeling of PDF neurons, promoting a reduction of the complexity of the axonal arborizations. In concert with the action of Mmps, fine tuning of the dorsal arborizations also depends on the PDF neuropeptide. Furthermore, we found that cell-type autonomous modulation of Mmp1 levels, unlike Mmp2, regulates the levels of the PDF neuropeptide, highlighting the relevance of Mmp1 in the determination of the neuronal output of the central pacemaker cells.
To examine a possible contribution of Mmps to the circadian structural plasticity of the sLNvs axonal terminals we altered Mmp1 or Mmp2 expression specifically in PDF neurons and analyzed the degree of arborization at the dorsal protocerebrum at two time points during the subjective day, at Circadian Time 2 (CT2, 2 hours after the lights should have been on) and CT14 (2 hours after lights should have been off) (Figure 1A). We restricted our treatment to the adult stage by using the pdf-GS RU486-inducible GeneSwitch strain recently described to bypass any potential developmental effect. As previously described , control flies displayed a more complex arborization pattern during the early subjective day (CT2) and less arborized display during the early subjective night (CT14). On the contrary, adult-specific Mmp1 or Mmp2 overexpression in PDF neurons abolished any remodeling of dorsal projections, leading to a non-oscillating and less complex circuit that shows even fewer axonal crosses than the nighttime control neurons (Figure 1B). Overexpression with independent transgenic lines rendered similar results (Figure S1 A). A more detailed analysis of structural complexity indicated that Mmp1 does not affect its total axonal length while it does reduce the complexity of the arborizations all along the axonal projections. In contrast, Mmp2 has a significant effect on total axonal length indicating that the changes trigged by Mmp2 overexpression involve modification of the length of axonal terminals (Figure S1 B–D). Thus, although both Mmps impact the circadian remodeling of PDF neurons, the underlying mechanisms are not necessarily the same.
Fig. 1. Mmps are key players of the structural plasticity of PDF neurons.
A. Schematic diagram illustrating the standard protocol and method for the analysis of the complexity of the PDF axonal arbor on confocal images. In all figures “VEH” and “RU” stand for “vehicle”- and “RU486”-containing fly food. B. Adult-specific Mmp overexpression triggers structural phenotypes. Left panel. Representative confocal images of GFP immunoreactivity at the dorsal protocerebrum at the early subjective day (CT2) and early subjective night (CT14) during the 4th day of constant darkness (DD4). Right panel. Quantitation of total axonal crosses. Wild type flies display circadian structural remodeling of axonal terminals while animals overexpressing Mmp1 or Mmp2 show reduced and constant complexity. Throughout the manuscript all experimental groups include CD8GFP, so the control group “+” refers to a single copy of CD8GFP;pdf-GS. Throughout the manuscript the average ± standard error of the mean is shown. C. Adult-specific Mmp downregulation also affects dorsal axonal branches. Silencing either Mmp1 or Mmp2 abolished circadian structural plasticity leading to a more complex structure clamped at the daytime configuration. Data represents the average of 4 to 5 experiments and a minimum of 27 brains were analyzed per CT/Genotype. Different letters indicate statistically significant differences with a p<0.05 (Two-way ANOVA with a Duncan post-hoc test). For more details, see the Statistics section in Materials and Methods. “+” refers to a single copy of the pdf-GS/CD8GFP;Dcr2 transgenes. In both experiments all the experimental groups include RU to induce expression. Scale: 10 µm.
To corroborate Mmp1 presence in PDF neurons, immunohistochemistry on whole mount brains was carried out during both transitions, dark to light and light to dark. Despite its overall low levels (that precluded reliable detection in the sLNvs), Mmp1 was more frequently detected in the large LNvs somas at dusk rather than at dawn (Figure S1F), which is in agreement with the transcription profile reported for this gene (roughly undetectable at ZT0 and detectable at ZT12, ).
We extended our analysis on the role of Mmps in circadian plasticity through RNAi-mediated downregulation of Mmp1 or Mmp2 expression. Co-expression of Dicer2 ensured a drastic reduction of Mmp1 and Mmp2 levels since expression on the whole animal through the constitutive promoter actin-GAL4 caused larval or pupal lethality as it is the case for null mutants (). The acute activation of a component of the silencing machinery did not affect circadian remodeling per se, since control flies overexpressing Dicer2 showed changes in the degree of complexity reminiscent of wild type animals (Compare “+” in Figures 1B and 1C). Adult specific downregulation of Mmp1 or Mmp2 disrupts the daily changes in the complexity, although the structure is fixed on a daytime configuration comparable to the one of control animals (Figure 1C). Importantly, independent RNAi lines triggered similar effects (Figure S1G). Downregulation of Mmp2 but not Mmp1 significantly increased the length of the main axonal branches, underscoring that they affect the structure of PDF neurons through different mechanisms (Figure S1 E).
In conclusion both Mmps are key players in the circadian modulation of the fine structure of the sLNvs, where high Mmp levels promote a less complex arborization, as the one observed during the early night, while low Mmp levels lead to the opposite effect.
To examine if structural plasticity of PDF neurons is necessary for the control of behavioral rhythmicity we sought to determine if flies that do not present cyclic axonal remodeling show any disruption on circadian locomotor activity. Control flies and those overexpressing either Mmp1, Mmp2 or specific RNAi constructs directed to Mmp1 or Mmp2 were recorded for their locomotor activity during 4 days in the presence of external cues (cycles of 12 hours of lights and 12 hours of darkness, LD) and then released to constant darkness (DD) to evidence the circadian control of behavior. Wild type flies present a clear rhythm in their locomotor activity both in the presence of synchronizing cues (LD) and in constant conditions (DD). In DD, this rhythm has a period of approximately 24 h and flies consolidate their activity along the subjective day. In this experiment, genetic as well as the non-induced controls (flies including all transgenes kept in the absence of the chemical inducer) behave as wild type animals with largely rhythmic individuals with an endogenous period close to 24 h (Figure 2 and Table S1). Overexpression of Mmp1 or Mmp2 with a single copy of the transgenes did not cause any significant effect on locomotor rhythmicity (Figure 2A) although increasing Mmp1 levels through the addition of a second UAS-transgene produced a significant reduction of behavioral rhythmicity (Figure S2). Interestingly, downregulation of Mmp1 but not Mmp2 led to a severe deconsolidation of locomotor activity that resulted in a clear reduction in the rhythmicity of the population (Figure 2B). Those that remained rhythmic displayed an endogenous period indistinguishable from control flies (Table S1), highlighting a specific effect of Mmp1 on the consolidation of rhythmic locomotor activity as opposed to period determination.
Fig. 2. Mmp1 modulates behavioral rhythmicity.
A. Representative actograms (left panel) and quantitation of percentage of rhythmicity (right panel) from overexpression experiments. Locomotor activity of individual flies was recorded for 4 days under light-dark cycles and then transferred to constant darkness (gray area) for 9 additional days. Overexpression of Mmp1 or Mmp2 with one UAS copy does not affect circadian locomotor activity. “+” in the x axis refers to a single copy of CD8GFP; pdf-GS. NS, non significant. B. Adult-specific Mmp downregulation trigger opposite effects on locomotor rhythmicity. Silencing Mmp1 but not Mmp2 alters normal circadian locomotor activity. “+” in the x axis refers to a single copy of CD8GFP; pdf-GS. Data represents at least 3 independent experiments and a minimum of 32 flies per Genotype/Condition were analyzed. Different letters indicate statistically significant differences with a p<0.05 (Two-way ANOVA with a Duncan post-hoc test). For other controls and measurements of endogenous period see Table S1.
Given the complexity and extent of daily reorganization we reasoned that other molecules might be implicated in fine tuning the structure of PDF neurons along the day. The analysis of structural changes in the same brain over time indicates that axonal projections of sLNvs endure changes in pruning and neuritogenesis as well as changes in the degree of fasciculation . Consistent with such contribution, it has recently been shown that Fasciclin 2 (Fas2), the ortholog of mammalian NCAMs in Drosophila, plays a role in the structural remodeling of sLNv axonal projections . In addition, Mmps act in concert with Fas2 promoting the fasciculation of axonal bundles during the development of neuronal circuits but also interact with the Ecdysone pathway assisting dendritic pruning . Taking this information into account, we sought to examine whether these two programs were also recruited in PDF neurons to accomplish their circadian structural remodeling. To shed light on this possibility, we tested if modulating Fas2 or Ecdysone Receptor (EcR) levels could modulate the structural defects caused by high Mmp1 levels. RNAi-mediated downregulation of Fas2 levels in the context of Mmp1 overexpression partially restored the complexity of axonal arborizations (Figure S3 A). Noteworthy, this rescue was not a byproduct of the inclusion of additional UAS constructs since additional transgenes in the context of Mmp1 overexpression did not alter its phenotype (see below). On the other hand, expression of a RNAi line directed to EcR in PDF neurons rescued the structural plasticity to wild type levels, antagonizing the effects caused by Mmp1 overexpression. Along these lines, downregulation of EcR affected PDF neurons per se, clamping the structure in the more complex, highly arborized, configuration (Figure S3 B and ).
Together these results demonstrate that the daily axonal remodeling of PDF neurons is a complex and highly regulated process that depends on the concerted activity of Mmps, Fasciclin 2 and the Ecdysone Receptor.
PDF is crucial for the proper control of circadian locomotor activity since pdfo1 and pdf Receptor (pdfR/han) mutants largely become arrhythmic under DD conditions , ,. Therefore, we wondered if the behavioral phenotypes described for flies with Mmp1 missexpression were reflecting an alteration of PDF signaling. To address this possibility we measured the levels of the neuropeptide at the dorsal protocerebrum by immunohistochemistry during the early subjective day (CT2) and night (CT14). In control animals, PDF immunoreactivity changes at the dorsal terminals, with high levels at CT2 and low levels at CT14 (Figure 3 A–B, upper panels). Overexpression of Mmp1 or Mmp2 affected PDF immunoreactivity and disrupted its circadian oscillation. Mmp1 effect was far more severe, resulting in reduced PDF levels at both timepoints to an extent that reached statistical significance; on the contrary, Mmp2 affected PDF levels rather subtly and led to intermediate levels that did not significantly differ from any timepoint in control flies (Figure 3A). Overexpression with independent transgenic lines retrieved similar results (Figure S4 A). RNAi analysis showed that reduced Mmp1 but not Mmp2 levels abolished the circadian oscillation in PDF immunoreactivity, resulting in levels reminiscent of the daytime configuration (Figure 3B). Interestingly, the fact that downregulation of Mmp1 but not Mmp2 affects PDF immunoreactivity correlates with the specific effect of silencing Mmp1 on locomotor activity, suggesting that clamping PDF at high levels might be the cause of the behavioral phenotypes observed.
Fig. 3. Cell autonomous Mmp1 expression regulates PDF levels.
A. Overexpression experiments Left panel. Representative confocal images of PDF immunoreactivity at the dorsal protocerebrum taken during CT2 and CT14 on DD4. Right panel. PDF levels at the dorsal protocerebrum. Control flies exhibit circadian oscillation of PDF levels, while Mmp1 overexpression reduces PDF to levels lower than those observed at nighttime in controls. In contrast, Mmp2 overexpression leads to intermediate levels. “+” in the x axis refers to a single copy of CD8GFP; pdf-GS. B. Downregulation experiments. Reducing Mmp1 but not Mmp2 levels abolishes circadian oscillations in PDF immunoreactivity to constant daytime levels. “+” in the x axis refers to a single copy of CD8GFP, Dcr2; pdf-GS. Data represents the average (± standard error of the mean) of at least 3 independent experiments and a minimum of 23 flies per Genotype/CT were analyzed. Different letters indicate statistically significant differences with a p<0.05 (Two-way ANOVA with a Duncan post-hoc test). In overexpression experiments logarithmic transformation was applied to fulfill ANOVA requirements. In both experiments all the experimental groups include RU to induce expression. Scale: 10 µm.
Recently, we have demonstrated that the PDF neuropeptide operates during development to determine the fine structure of the dorsal axonal projections of sLNv neurons . As we demonstrated here, Mmp1 affects the circadian remodeling of PDF projections in the adult, concomitantly altering the levels of the neuropeptide. We reasoned that if PDF was responsible for the daily axonal remodeling of sLNvs, rescuing PDF levels in the context of Mmp1 overexpression should reestablish circadian structural plasticity. Indeed, PDF overexpression in the context of Mmp1 overexpression restored circadian structural plasticity of PDF neurons to wild type levels (Figure 4A). To directly test a role of the neuropeptide on the plasticity of sLNv neurons, we expressed a specific RNAi to downregulate PDF levels in an adult-specific fashion and analyzed its effect on circadian axonal remodeling. PDF knockdown caused a severe abrogation of the daily remodeling of axonal terminals that rendered the structure in a configuration reminiscent of the one observed in animals overexpressing Mmp1 (Figure 4B).
Fig. 4. PDF defines the axonal remodeling of its own neurons.
A. Quantitation of total axonal crosses from UAS-PDF rescue experiments. Overexpression of PDF rescues the structural plasticity defects caused by Mmp1 overexpression. “+” in the x axis refers to a single copy of CD8GFP; pdf-GS. Data represents the average (± standard error of the mean) between 3–5 independent experiments and a minimum of 21 flies were analyzed per Genotype/CT. B. PDF downregulation prevents circadian axonal remodeling of sLNv terminals and reduces daytime complexity to nighttime levels. “+” in the x axis refers to a single copy of CD8GFP, Dcr2; pdf-GS. Data represents the average (± standard error of the mean) between 3 independent experiments and a minimum of 25 flies were analyzed per Genotype/CT. In both experiments different letters indicate statistical differences with a p<0.05 (Two-way ANOVA with a Duncan post-hoc test) and all the experimental groups include RU to induce expression.
In conclusion, these experiments clearly demonstrate the relevance of the PDF neuropeptide in the daily remodeling of PDF terminals. Moreover, these results led us to propose that daily changes in PDF levels at the dorsal terminals could be responsible for the circadian structural remodeling of the axonal arbor.
One particularly intriguing observation made on the course of this work was that Mmp1 deregulation led to altered PDF immunoreactivity. In principle, Mmp1 could be altering PDF levels at the axonal terminals by affecting any step from transcription to neuropeptide processing, release or even degradation either directly or indirectly. To analyze if Mmp1 reduces pdf transcription or mRNA stability we measured the steady state levels of pdf mRNA by quantitative Real Time PCR (qRT-PCR) in head extracts of control and flies overexpressing Mmp1 or a RNAi against Mmp1 during the early morning (ZT2). No significant differences were observed between control and mutant flies (Figure S4B), suggesting that neither pdf transcriptional levels nor mRNA stability were grossly affected upon Mmp1 deregulation.
An alternative explanation to the observation that Mmp1 dramatically alters PDF levels at the dorsal protocerebrum is that it could affect neuropeptide release from the dorsal terminals. We tested this hypothesis expressing a GFP fusion to the atrial natriuretic peptide (ANF-GFP) in PDF neurons. When expressed in secretory cells, ANF-GFP was reported to be processed, localized and released in response to physiological signals as an endogenous neuropeptide , . Overexpression of Mmp1 reduced ANF-GFP levels, which could be taken as an indication of increased peptide release at all timepoints, suggesting that Mmp1 could promote PDF release from sLNv axonal terminals (Figure S4C).
To further investigate the ability of Mmp1 to process or degrade PDF, the Mmp1 catalytic domain was expressed in E. coli as a His fusion protein. After fast protein liquid chromatography (FPLC) purification and refolding, Mmp1 activity on a previously characterized substrate was confirmed (Figure S5 A and ). Next, we incubated purified recombinant Mmp1 with PDF for 5 to 60 minutes at 37°C. The reaction products were purified by reverse-phase HPLC . In contrast to recombinant Mmp1 (Figure 5A) and PDF alone (Figure 5B), co-incubation of PDF with Mmp1 gave rise to four novel peaks consistent with PDF fragments (Figure 5C and Figures S6 A–B). Moreover, preincubation of Mmp1 with Batimastat, a well-characterized inhibitor of mammalian metalloproteinases , prevented PDF cleavage, underscoring that Mmp1 (as opposed to any contaminant potentially present in the original purified fraction) specifically hydrolyzes the neuropeptide (Figure 5D). To identify Mmp1 cleavage sites, the four degradation peaks were analyzed by MALDI-TOF-TOF. In the fast eluting fraction, peptides containing the C-terminal sequence of PDF (corresponding to the fragment LSLPKNMNDA of the reported sequence ) and to the fragment LLSLPKNMNDA were identified (Table 1). Additional fractions included peptides containing the N-terminal PDF sequence (corresponding to amino-acids YNSELINSL), thereby identifying the P1' L-L and P1' L-S as primary sites of Mmp1 cleavage (Figure 5E). We also tested whether Mmp2 could degrade PDF in vitro. Surprisingly, no novel peaks were detected upon incubation under the same conditions that resulted in Mmp1-directed degradation, even though Mmp2 was able to degrade a previously reported fluorogenic substrate for Mmp2 , thus confirming that recombinant Mmp2 displays proteolytic activity (Figure S5 B–C).
Fig. 5. Mmp1 processes the PDF neuropeptide in vitro.
A–D. Reverse-phase HPLC profiles of Mmp1 alone (A), PDF alone (B), PDF+Mmp1 (C) or PDF+Mmp1+Batimastat (D) incubated for 1 h at 37°C. C. Peaks 1 through 4 contained PDF fragments and the peak 5 was full-length PDF as determined by MS/MS shown in Table 1. D. Note the absence of PDF degradation products when Mmp1 was preincubated with the MMP inhibitor Batimastat. Fractions 6 and 7 included PDF 1–19 as identified by MS/MS shown in Table 1. E. Schematic representation of Mmp1 preferred cleavage sites within PDF. Arrows indicate the peptide bonds hydrolyzed by Mmp1 as determined by MS/MS analysis. In bold and italics, P1' residues.
Tab. 1. MS and MSMS analysis of PDF products detected after incubation with Mmp1.
Taken together these results suggest that Mmp1 could modulate PDF levels at the dorsal terminals, thus contributing to the cyclical changes in PDF immunoreactivity relevant in the control of rhythmic locomotor behavior.
Adult neuronal plasticity is a common mechanism by which neurons adapt their physiology to a changing environment. In particular axonal structural plasticity allows axons to explore new putative postsynaptic targets and, therefore, modify local connectivity as a response to specific stimuli. However, despite its relevance in several neuronal circuits, the molecular mechanisms underlying adult structural plasticity are still poorly understood . In this paper, we studied the molecular mechanisms responsible for the axonal remodeling of sLNvs terminals, a unique type of structural plasticity that comprises spatial long scale changes on a daily basis. We demonstrated a key role of the matrix metalloproteinases and the PDF neuropeptide in the control of circadian structural plasticity of the sLNv axonal terminals. Moreover, we established Mmp1 as a cell-type autonomous regulator of PDF levels, which are key in the transmission of temporal information in the Drosophila brain , –.
Throughout this work we extensively showed that deregulation of specific molecules within PDF neurons abrogates circadian structural remodeling of sLNv dorsal terminals, underscoring that PDF neurons can modulate the complexity of the arborization of their own axonal projections. In addition, cell-type specific downregulation and overexpression of Mmp1 or Mmp2 led to increased and reduced axonal complexity reminiscent of the wild type daytime or nighttime configuration, respectively. Interestingly, mRNA steady state levels of both Mmps are enriched in the sLNvs during the beginning of the night , which was further confirmed for Mmp1 by immunohistochemistry in the somas of the lLNvs (Figure S1F), suggesting that circadian expression of matrix metalloproteinases within PDF neurons contributes to the daily axonal remodeling.
The fact that pacemaker neurons regulate their own structural plasticity allows this cellular phenomenon to be under tight temporal control. In fact, PDF neurons respond to the neuropeptide PDF , and this signal is necessary to coordinate molecular oscillations within sLNvs , , demonstrating that PDF neurons control diverse aspects of their physiology, in part, cell-autonomously. Extrinsic signals derived from other neurons or even from the glia might add modulation to this autonomous control of structural plasticity.
Herein we demonstrate that both Mmps are key players in the control of circadian structural plasticity and their action promotes a reduction in the complexity of axonal arborizations. Matrix metalloproteinases have extensively been implicated in neuronal remodeling during development , , , but, to our knowledge, this is the first evidence of a direct role in adult structural plasticity. Interestingly, minocycline treatment alleviates structural defects in the sLNv axonal terminals of dfmr1 flies (a fly model of Fragile X syndrome) and this effect appears to be mediated by inhibition of Mmp activity . Although both Mmps are involved in the active remodeling of PDF dorsal arborization, only Mmp2 significantly reduces the total length of axonal terminals. On the other hand, Mmp1 but not Mmp2 significantly reduces PDF levels at the dorsal terminals and in doing so it affects the consolidation of rhythmic locomotor activity. That said we cannot rule out a PDF-independent effect of Mmp1 on locomotor activity. Sequence analysis revealed that Drosophila Mmp1 and Mmp2 are more related to different human Mmps than they are to each other ; also, Mmp1 seems to be secreted while Mmp2 is retained in the cell membrane , therefore different substrates are anticipated for both Mmps. In sum, Mmps modulate relevant aspects of circadian physiology acting at different levels through non-redundant activities.
Mmp1 effect on PDF levels and on the structural remodeling of the dorsal terminals correlates with behavioral arrhythmicity. This observation gives rise to interesting interpretations. On one hand, altering PDF levels or even PDF cycling at the axonal terminals through Mmp1 deregulation leads to arrhythmicity in the locomotor activity paradigm, highlighting once again the relevance of this neuropeptide in the control of circadian behavior . On the other hand, altering Mmp2 expression abolished structural plasticity but did not affect locomotor rhythmicity suggesting that daily axonal remodeling of PDF terminals is not essential for consolidation of rest-activity cycles, in turn opening the attractive possibility that other outputs could depend on such cyclical structural changes . Thus, we propose that pacemaker neurons employ PDF and other classical neurotransmitters to convey time-of-day information to other clock neurons relevant in the control of locomotor activity patterns, and in addition, they communicate via synaptic outputs that are modulated by the daily remodeling of PDF arborizations to regulate other aspects of circadian physiology. In agreement with this possibility, the mammalian suprachiasmatic nucleus uses diffusible signals, like neuropeptides, to daily adjust locomotor activity while depends on synaptic connections to control circadian release of hormones –.
Mmp1 overexpression leads to a strong reduction of PDF levels in the sLNv axonal terminals while silencing Mmp1 expression clamps PDF levels high, comparable to the daytime configuration. In vitro analysis demonstrated that Mmp1 can cleave PDF at specific peptide bonds between the first serine-leucine and between two consecutive leucines; the latter a preferred position for several mammalian MMPs ), strongly suggesting that Mmp1 could terminate PDF biological activity. In favor of this possibility, it was reported that similar fragments (PDF1-7 and PDF8-18, targeting the peptide bond between S-L) generated by a different (human neprilysin) peptidase do not activate the PDF receptor .
Noteworthy, Mmp1 has been shown to be a direct target of the CLOCK transcription factor , enriched in PDF neurons particularly at the beginning of the night (, , and Figure S1F), which correlates with low PDF immunoreactivity. This time-of-day dependent expression profile, together with the in vitro and in vivo demonstration of a link between both molecules included here, strongly supports the possibility that endogenous Mmp1 could actively control PDF levels at the dorsal terminals. Interestingly, it has been reported that while most mammalian MMPs are secreted in an inactive form, a few of them contain a RXK/RR motif recognized by furin, which would enable them to be activated by intracellular serin proteinases before they are exported (reviewed in ). Furthermore, Mmp1 contains a similar furin consensus sequence (RXKR) that could mediate its intracellular activation . Thus, in principle, MMP1 could be activated within PDF terminals and thus modulate PDF levels at the protocerebrum. Alternatively, MMP1 could degrade PDF in the extracellular space. Lower PDF levels available would give rise to a reduced PDF signaling onto the sLNvs (mediated by PDFR), and in doing so they could alter excitability (Seluzicki et al. 2014) and in turn affect PDF release (Figure S4C and ).
Genetic interaction experiments suggest that Mmp1 is involved in the active (and daily) pruning of PDF axonal arborizations through modulation of the activity of EcR and axonal fasciculation; these observations are in line with a recent report showing that MEF2 mediates the activity-dependent remodeling taking place at the PDF dorsal terminals through the regulation of Fasciclin2 . In addition, activation of B1-EcR triggers dendrite remodeling through the action of Mmps during metamorphosis . Interestingly, several proteins induced by EcR (for example, the ABC transporter E23) are enriched at the beginning of the night in PDF neurons . Strikingly, PDF overexpression rescued the decreased axonal complexity triggered by Mmp1 overexpression. Moreover, adult-specific PDF downregulation reduced axonal complexity and rendered the structure in the nighttime configuration, similar to the effect of Mmp1 overexpression. Thus, as it has been reported during development , PDF neurons modulate the structure of their own axonal projections via the action of the PDF neuropeptide. Taking these results into account we propose that PDF changes, acting directly via receptors in the sLNvs or indirectly through retrograde signals released by other PDFR immunoreactive neurons , could provide relevant feedback information to pacemaker neurons and thereby adjust their connectivity.
In addition to the role of the molecules identified throughout this work and elsewhere , we previously demonstrated that adult-specific electrical silencing of PDF neurons reduces axonal complexity without abolishing circadian oscillations in their complexity, while it clamps PDF levels to the nighttime configuration , underscoring that although electrical activity is relevant for structural plasticity, other activity-independent mechanisms underlie axonal remodeling of the sLNv arborizations. During the early morning lLNvs show higher action potential (AP) firing rate compared to the early night , and the limited data available on the electrophysiological properties of the sLNv neurons points in the same direction ; these changes in electrical properties are accompanied by high and low PDF immunoreactivity in the terminals during day and night respectively . Since activity of a subset of mammalian MMPs can be modulated by electrical stimuli , , circadian changes in the electrical activity of sLNv neurons could modulate the activity of endogenous Mmps. This modulation would act in concert with the proposed clock- controlled transcriptional regulation of Mmp1 expression . In this context, we propose that during the day, higher sLNv electrical activity along with low Mmp1 levels determine high PDF immunoreactivity in the axonal terminals; peptide signaling in turn promotes a more complex axonal arborization. In contrast, at night, reduced electrical activity and high Mmp1 levels result in decreased PDF immunoreactivity at the axonal terminals and this, along with the action of Mmp2, Fas2 and EcR, reduces the complexity of axonal projections (Figure 6).
Fig. 6. A model for the regulation of circadian axonal remodeling of sLNv neurons.
The bidirectional arrow between electrical activity and Mmp1 suggests a possible coordination of both processes. Mmp1 effects on structural plasticity are dependent on the modulation of PDF levels at the sLNv terminals, via direct proteolysis, while Mmp2 appears to act downstream of the neuropeptide. Electrical activity regulates the overall level of complexity but it is not required to determine the circadian aspect of this remodeling. Given our current understanding Fas2 and EcR could act either upstream or downstream of PDF; however, the well-known Fas2 function points to a more direct modulation of circuit structure. Changes in the size of “PDF” and “Mmp1” molecules illustrate oscillations in abundance along the day.
In sum, the results presented here demonstrate that pacemaker neurons adjust their axonal arbors in a cell-type autonomous manner by recruiting complex mechanisms involving matrix metalloproteinases, modulation of the Ecdysone Receptor, changes in fasciculation and signaling through the PDF neuropeptide.
Flies were grown and maintained at 25°C in vials containing standard cornmeal/agar medium supplemented with yeast under 12∶12 h light∶dark cycles. GeneSwitch expression was induced by transferring 1–4 day old adult males to food containing RU486 (mifepristone, Sigma, USA) in 80% ethanol to a final concentration of 200 µg/ml (or 500 µg/ml in the case of UAS-pdf rescue experiments) or with the same amount of ethanol (vehicle) in control treatments. All stocks used in this study were described previously: pdf-GeneSwitch (pdf-GS) was generated in our laboratory , UAS-Mmp1 (chromosomes II and III) and UAS-Mmp2 (chromosomes II and III) were gently provided by A. Page-McCaw , UAS-Mmp1RNAiB and UAS-Mmp2RNAiB by D. Bohmann and UAS-pdf by P. Taghert . w1118 (#40015), UAS-CD8GFP (#5137), UAS-CD8RFP (#27398), UAS-ANFGFP (#7001) and UAS-myrRFP (#7119) were obtained from the Bloomington Stock Center. UAS-Mmp1RNAi (#101505), UAS-Mmp2RNAi (#107888), UAS-Dicer2 (#60008 and 60009), UAS-pdfRNAi (#4380), UAS-EcRRNAi (#37059) and UAS-Fas2RNAi (#36351) were obtained from the Vienna RNAi Stock Center. Experiments shown in Figure S1 G were carried out with the RNAi lines generated by the Bohmann laboratory .
Male adult flies (2–4 days old) were placed in glass tubes containing standard food (supplemented with 200 µg/ml RU 486 or vehicle, as indicated in each experiment) and monitored for activity with infrared detectors and a computerized data collection system (TriKinetics, Waltham, MA). Activity was monitored in LD conditions for 4 days, followed by constant darkness for 9–10 more days (DD). Period and rhythmicity in DD were estimated using ClockLab software (Actimetrics, Evanston, IL) as previously described .
Adult heads were fixed with 4% formaldehyde in 100 mM phosphate buffer pH 7.5 for 30 min at room temperature (RT). Brains were dissected and rinsed three times in PBS with 0.1% Triton X-100 (PT) for 15 min, with the exception of immunohistochemistry against Mmp1 were PBS with 0.6% Triton X-100 was used in all the incubations. Samples were blocked in 7% normal goat serum for 1 h in PT, and incubated with primary antibody at 4°C overnight. The primary antibodies employed were rabbit anti-GFP 1∶500 (Invitrogen, USA), chicken anti-GFP 1∶500 (Upstate, USA), rabbit anti-RFP 1∶500 (Rockland, USA), a cocktail of mouse anti-Mmp1 antibodies 1∶10 (3A6B4, 3B8D12 and 5H7B11 from DSHB) and homemade rat anti-Drosophila-PDF 1∶500 . Samples were washed 4×15 min in PT, and incubated with secondary antibody at 1∶250 for 2 h at RT; secondary antibodies were washed 4×15 min in PT and mounted in 80% glycerol in PT. The secondary antibodies used were Cy2-conjugated donkey anti-rabbit, Cy2-conjugated donkey anti-chicken, Cy3-conjugated donkey anti-rat, Cy3-conjugated-donkey anti-rabbit, Cy3-conjugated donkey anti-mouse, Cy5-conjugated donkey anti-mouse IgG1 (Jackson InmunoResearch, USA). Images were taken either on a Zeiss Pascal LSM or a Zeiss LSM 510 Meta Confocal microscope.
Images were taken with a 40× objective and an optical zoom of 2×. For the analysis of PDF immunoreactivity all pictures were taken employing the same confocal settings and quantification was performed using Image J software (downloaded from http://rsbweb.nih.gov/ij/). Briefly, mCD8GFP signal was adjusted to threshold levels generating a selection that delimit the area of sLNv axonal terminals. This selection was then applied to the PDF channel and mean intensity was measured. A rectangle of the same or a higher area was located outside of PDF neurons and used to subtract background signal. The same protocol was applied to measure GFP levels in ANF-GFP experiments with the exception that mCD8RFP was used to delimit the circuitry. Structural plasticity was analyzed as reported . Total axonal length was measured with the LSM Image Browser Software by following the principal axonal branch of the dorsal projections (illustrated in Figure S1C). In all cases the analysis was performed blind.
Total RNA isolation from fly head extracts was performed using Trizol (Invitrogen, Carlsbad, CA), and FastStart Universal SYBR Green Master (Roche) was used for reverse transcription following the manufacturer's instructions. The real-time assays were conducted in the Stratagene Mx3000P QPCR System (La Jolla, CA) using SYBR green as the detection system and ROX as reference dye. The primers were designed using Primer3 (available online at http://frodo.wi.mit.edu/primer3/). mRNA levels were assessed from four independent RNA extractions and two technical replicates were performed on each sample. Only primer pairs with efficiency between 90% and 110% were used. For pdf the following primers were used: Forward ‘GCCACTCTCTGTCGCTATCC’ and Reverse ‘CAGTGGTGGGTCGTCCTAAT’. RpL49 was used for normalization and the following primers were used: Forward ‘GAACAAGAAGGCCCATCGTA’ and Reverse ‘AGTAACAGGCTTGGCTTGC’.
The catalytic domains of Drosophila Mmp1 (735 bp) and Mmp2 (483 bp) were expressed in E. Coli as a His fusion protein. Catalytic domains were cloned after PCR amplification using the following plasmids as templates (Drosophila Genome Resource Center, RE19818 and SD03462 for Mmp1 and Mmp2, respectively) and then transformed into E. coli BL21 AI (Invitrogen). The following primers were used: Forward ‘CAATCGGCACCCGTTTCCACC’ and Reverse ’CTAATACAGTGACTGGATGGCCGC’ for Mmp1 and Forward ‘CAGGGACCCAAGTGGTCCAGAA’ and Reverse ‘AACCTAGTACAACTGCTGAATGCC’ for Mmp2. Expression was induced by addition of 0.2% L-arabinose (Calbiochem), followed by incubation for 2 hours at 37°C. Recombinant Mmp1 was solubilized using 50 mM Tris-HCl (pH 8.5) containing 500 mM NaCl, 2 M urea, 1 mM β-mercaptoethanol, 1 mM PMSF, and 1% Triton x-100. Recombinant Mmp2 was solubilized using 20 mM Tris-HCl, pH 7.6, containing 6 M GdnHCl and 5 mM DTT. Both recombinant proteins were purified by FPLC with a His Trap Ni2+-chelating column (GE Healthcare) with a 0–250 mM Imidazol gradient at 0.5 ml/min flow during 50 minutes. After sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) analysis, fractions with the recombinant protein were pooled. Refolding of Mmp1 was achieved by dialysis against a 50 mM Tris buffer (pH 7.6) containing 5 mM CaCl2, 200 mM NaCL, 50 µM ZnSO4, 0.05% Brij 35, 20% glycerol and 2 mM DTT, O.N at 4°C. Refolding of Mmp2 was obtained by a 2-step dialysis, first against a 50 mM Tris buffer (pH 7.6) containing 5 mM CaCl2, 200 mM NaCL, 50 µM ZnSO4, 0.05% Brij 35, 20% glycerol and 2 M GndHCl, for 16 h at 4°C and then against the same buffer containing 2 mM DTT without GndHCl, for 16 h at 4°C. After concentration with a 10 kDa cut-off Amicon Ultra-15 Centrifugal Filter (Millipore), the enzyme preparations were stored with 40% glycerol at −20°C for activity assays.
The enzymatic activity of purified recombinant Mmps was confirmed using well characterized substrates , . Four µg of synthetic fibronectin (Sigma) were incubated alone or together with 250 ng of purified Mmp1, with or without pre-incubation with 1 mM Batimastat inhibitor (Sigma) for 30 min at room temperature. The reaction buffer was 0.1 M Hepes, 0.1 M NaCl (pH 7.4). After incubation for 18 h at 37°C, samples were analyzed by 7.5% SDS–PAGE in Tris–Tricine gels and stained with Coomassie Brillant Blue. The enzymatic activity of purified recombinant Mmp2 was analyzed by using the synthetic OmniMMP™ fluorogenic substrate Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2.AcOH (Enzo Life Sciences).
The substrate at 1 µM and Mmp2 at 200 mM were incubated in assay buffer 50 mM HEPES, 10 mM CaCl2, 0.05% Brij 35 and 10 µM ZnCl2 pH 7.0 for 1 h at 37°C. For its inhibition, Mmp2 was previously incubated with 1 mM Batimastat for 30 min at room temperature. The emission at 393 nm for 1 h and the emission spectra between 350 and 450 nm were measured in a JASCO FP-6500 espectrofluorometer at 37°C (Ex.: 328 nm).
The PDF peptide was synthesized at NeOmps (France); the primary sequence is YNSELINSLLSLPKNMNDA; since it was originally synthesized for coupling to a carrier during antibody production an additional tyrosine (Y) at position 1 was included. Synthetic PDF was purified by reverse-phase high performance liquid chromatography (HPLC), and evaluated by matrix assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry (MS) (Cequibiem, Universidad de Buenos Aires, Argentina). The lyophilized peptide was dissolved in 0.1 M Hepes, 0.1 M NaCl (pH 7.4) and aliquoted and stored at −20°C for further use.
One hundred and fifty µg of PDF were incubated with 1 µg of purified Mmp1 or Mmp2, with or without pre-incubation (30 minutes at room temperature) with 1 mM Batimastat inhibitor (Sigma) for 5, 15 and 60 minutes at 37°C in 0.1 M Hepes, 0.1 M NaCl (pH 7.4) in a final volume of 100 µl. Reactions were stopped by the addition of 50 µl of 1% (v/v) trifluoroacetic acid (TFA) and the final volume was made up to 500 µl with milli-Q water. The intact/parent peptide and peptide fragments generated by peptidase activity were resolved and quantified by reverse-phase HPLC using a C18 Beckman 5 µm (4.6 mm×25 cm) column and detection at 214 nm . Peptides were eluted with a linear gradient from 0% to 60% acetonitrile in 0.1% TFA at 1 ml/min flow during 1 hour. The differential peaks were analysed by mass spectrometry.
Molecular masses of intact peptides and the products of Mmp1 degradation were determined (CEQUIBIEM, University of Buenos Aires). Samples were desalted through reversed-phase ZipTip (Millipore, MA) following manufacturer's instructions and analyzed on an Ultraflex II MALDI TOF TOF (Bruker Daltonics) in Reflectron Positive mode and Lift mode using standard instrument settings, and HCCA matrix.
Statistical analyses were performed with the InfoStat package version 2009 (Grupo InfoStat, FCA, Universidad Nacional de Córdoba, Argentina). Normality was tested using Shapiro-Wilks test and the homogeneity of variance was assessed with Levene's test. In all the graphs, experimental groups with different letters indicate statistically significant differences. To illustrate with an example, groups with letters AB are not statistically different from groups coded either with an A or a B but they are statistically different from groups with a letter C. p<0.05 was considered statistically significant. For structural plasticity analysis and circadian PDF and ANF-GFP immunoreactivity a two way ANOVA with Circadian Time (CT) and Genotype as factors was performed. In the case of structural plasticity analysis, each independent set of crosses (including one vial per condition) was considered as a blocking factor to reduce the variability between experiments. Locomotor activity was analyzed by a two way ANOVA with Genotype and Treatment (RU or Vehicle) as factors. During two way ANOVA analysis, the significance of the interaction between the two factors (Genotype×CT or Genotype×Treatment) was first analyzed. If the interaction was statistically significantly different (i.e., p<0.05) a Duncan multiple comparison test over the Interaction was performed. In the cases where the interaction was not significantly different, we performed the statistical analysis for each factor separately (analysis of principal effects). As a consequence, in those cases, it was not possible to perform all the combinatorial comparisons between experimental groups but only the ones indicated in the corresponding figures. For qRT-PCR analysis differences between genotypes were studied by a one way ANOVA. For the statistical analysis of axonal crosses per ring (shown in Figure S1) a repeated measured design was applied where Genotype and CT were considered external factors and Ring an internal factor repeated in space. To simplify the analysis only the axonal crosses with rings, 1, 3 and 6 were taken into account. To analyze ANOVA assumptions, Box's test for homogeneity of variance and covariance matrices, and Mauchly's sphericity test were performed. In all the cases replicates indicate the number of independent experiments. The number of flies used per experiment is indicated in the legend of each particular figure and was adjusted to minimize the internal variance between individuals and considering the specific requirements of the technique.
1. HutRA, BeersmaDG (2011) Evolution of time-keeping mechanisms: early emergence and adaptation to photoperiod. Philos Trans R Soc Lond B Biol Sci 366: 2141–2154.
2. OzkayaO, RosatoE (2012) The circadian clock of the fly: a neurogenetics journey through time. Adv Genet 77: 79–123.
3. FrenkelL, CerianiMF (2011) Circadian plasticity: from structure to behavior. Int Rev Neurobiol 99: 107–138.
4. Helfrich-ForsterC, ShaferOT, WulbeckC, GrieshaberE, RiegerD, et al. (2007) Development and morphology of the clock-gene-expressing lateral neurons of Drosophila melanogaster. J Comp Neurol 500: 47–70.
5. RennSC, ParkJH, RosbashM, HallJC, TaghertPH (1999) A pdf neuropeptide gene mutation and ablation of PDF neurons each cause severe abnormalities of behavioral circadian rhythms in Drosophila. Cell 99: 791–802.
6. GrimaB, ChelotE, XiaR, RouyerF (2004) Morning and evening peaks of activity rely on different clock neurons of the Drosophila brain. Nature 431: 869–873.
7. StoleruD, PengY, AgostoJ, RosbashM (2004) Coupled oscillators control morning and evening locomotor behaviour of Drosophila. Nature 431: 862–868.
8. SheebaV, FogleKJ, KanekoM, RashidS, ChouYT, et al. (2008) Large ventral lateral neurons modulate arousal and sleep in Drosophila. Curr Biol 18: 1537–1545.
9. PariskyKM, AgostoJ, PulverSR, ShangY, KuklinE, et al. (2008) PDF cells are a GABA-responsive wake-promoting component of the Drosophila sleep circuit. Neuron 60: 672–682.
10. ShangY, GriffithLC, RosbashM (2008) Light-arousal and circadian photoreception circuits intersect at the large PDF cells of the Drosophila brain. Proc Natl Acad Sci U S A 105: 19587–19594.
11. LinY, StormoGD, TaghertPH (2004) The neuropeptide pigment-dispersing factor coordinates pacemaker interactions in the Drosophila circadian system. J Neurosci 24: 7951–7957.
12. ParkJH, Helfrich-ForsterC, LeeG, LiuL, RosbashM, et al. (2000) Differential regulation of circadian pacemaker output by separate clock genes in Drosophila. ProcNatlAcadSciUSA 97: 3608–3613.
13. CaoG, NitabachMN (2008) Circadian control of membrane excitability in Drosophila melanogaster lateral ventral clock neurons. J Neurosci 28: 6493–6501.
14. FernandezMP, BerniJ, CerianiMF (2008) Circadian remodeling of neuronal circuits involved in rhythmic behavior. PLoS Biol 6: e69.
15. GorostizaEA, Depetris-ChauvinA, FrenkelL, PírezN, CerianiMF (2014) Circadian pacemaker neurons change synaptic contacts across the day. Curr Biol 24: 1–7.
16. De PaolaV, HoltmaatA, KnottG, SongS, WilbrechtL, et al. (2006) Cell type-specific structural plasticity of axonal branches and boutons in the adult neocortex. Neuron 49: 861–875.
17. MajewskaAK, NewtonJR, SurM (2006) Remodeling of synaptic structure in sensory cortical areas in vivo. J Neurosci 26: 3021–3029.
18. GogollaN, GalimbertiI, CaroniP (2007) Structural plasticity of axon terminals in the adult. Curr Opin Neurobiol 17: 516–524.
19. AppelbaumL, WangG, YokogawaT, SkariahGM, SmithSJ, et al. (2010) Circadian and homeostatic regulation of structural synaptic plasticity in hypocretin neurons. Neuron 68: 87–98.
20. BusheyD, TononiG, CirelliC (2011) Sleep and synaptic homeostasis: structural evidence in Drosophila. Science 332: 1576–1581.
21. MehnertKI, BeramendiA, ElghazaliF, NegroP, KyriacouCP, et al. (2007) Circadian changes in Drosophila motor terminals. Dev Neurobiol 67: 415–421.
22. BarthM, SchultzeM, SchusterCM, StraussR (2010) Circadian plasticity in photoreceptor cells controls visual coding efficiency in Drosophila melanogaster. PLoS One 5: e9217.
23. BecquetD, GirardetC, GuillaumondF, Francois-BellanAM, BoslerO (2008) Ultrastructural plasticity in the rat suprachiasmatic nucleus. Possible involvement in clock entrainment. Glia 56: 294–305.
24. Page-McCawA, SeranoJ, SanteJM, RubinGM (2003) Drosophila matrix metalloproteinases are required for tissue remodeling, but not embryonic development. Dev Cell 4: 95–106.
25. BeaucherM, HerspergerE, Page-McCawA, ShearnA (2007) Metastatic ability of Drosophila tumors depends on MMP activity. Dev Biol 303: 625–634.
26. MillerCM, Page-McCawA, BroihierHT (2008) Matrix metalloproteinases promote motor axon fasciculation in the Drosophila embryo. Development 135: 95–109.
27. KuoCT, JanLY, JanYN (2005) Dendrite-specific remodeling of Drosophila sensory neurons requires matrix metalloproteases, ubiquitin-proteasome, and ecdysone signaling. Proc Natl Acad Sci U S A 102: 15230–15235.
28. NagoshiE, SuginoK, KulaE, OkazakiE, TachibanaT, et al. (2010) Dissecting differential gene expression within the circadian neuronal circuit of Drosophila. Nat Neurosci 13: 60–68.
29. KadenerS, StoleruD, McDonaldM, NawatheanP, RosbashM (2007) Clockwork Orange is a transcriptional repressor and a new Drosophila circadian pacemaker component. Genes Dev 21: 1675–1686.
30. Depetris-ChauvinA, BerniJ, AranovichEJ, MuraroNI, BeckwithEJ, et al. (2011) Adult-specific electrical silencing of pacemaker neurons uncouples molecular clock from circadian outputs. Curr Biol 21: 1783–1793.
31. Kula-EversoleE, NagoshiE, ShangY, RodriguezJ, AlladaR, et al. (2010) Surprising gene expression patterns within and between PDF-containing circadian neurons in Drosophila. Proc Natl Acad Sci U S A 107: 13497–13502.
32. SivachenkoA, LiY, AbruzziKC, RosbashM (2013) The transcription factor mef2 links the Drosophila core clock to fas2, neuronal morphology, and circadian behavior. Neuron 79: 281–292.
33. GorostizaEA, CerianiMF (2013) Retrograde bone morphogenetic protein signaling shapes a key circadian pacemaker circuit. J Neurosci 33: 687–696.
34. LearBC, MerrillCE, LinJM, SchroederA, ZhangL, et al. (2005) A G protein-coupled receptor, groom-of-PDF, is required for PDF neuron action in circadian behavior. Neuron 48: 221–227.
35. HyunS, LeeY, HongST, BangS, PaikD, et al. (2005) Drosophila GPCR Han is a receptor for the circadian clock neuropeptide PDF. Neuron 48: 267–278.
36. HusainQM, EwerJ (2004) Use of targetable gfp-tagged neuropeptide for visualizing neuropeptide release following execution of a behavior. J Neurobiol 59: 181–191.
37. RaoS, LangC, LevitanES, DeitcherDL (2001) Visualization of neuropeptide expression, transport, and exocytosis in Drosophila melanogaster. J Neurobiol 49: 159–172.
38. LlanoE, PendasAM, Aza-BlancP, KornbergTB, Lopez-OtinC (2000) Dm1-MMP, a matrix metalloproteinase from Drosophila with a potential role in extracellular matrix remodeling during neural development. J Biol Chem 275: 35978–35985.
39. IsaacRE, JohnsonEC, AudsleyN, ShirrasAD (2007) Metabolic inactivation of the circadian transmitter, pigment dispersing factor (PDF), by neprilysin-like peptidases in Drosophila. J Exp Biol 210: 4465–4470.
40. SledgeGWJr, QulaliM, GouletR, BoneEA, FifeR (1995) Effect of matrix metalloproteinase inhibitor batimastat on breast cancer regrowth and metastasis in athymic mice. J Natl Cancer Inst 87: 1546–1550.
41. ParkJH, HallJC (1998) Isolation and chronobiological analysis of a neuropeptide pigment- dispersing factor gene in Drosophila melanogaster. JBiolRhythms 13: 219–228.
42. LlanoE, AdamG, PendasAM, QuesadaV, SanchezLM, et al. (2002) Structural and enzymatic characterization of Drosophila Dm2-MMP, a membrane-bound matrix metalloproteinase with tissue-specific expression. J Biol Chem 277: 23321–23329.
43. Helfrich-ForsterC, TauberM, ParkJH, Muhlig-VersenM, SchneuwlyS, et al. (2000) Ectopic expression of the neuropeptide pigment-dispersing factor alters behavioral rhythms in Drosophila melanogaster. JNeurosci 20: 3339–3353.
44. WulbeckC, GrieshaberE, Helfrich-ForsterC (2008) Pigment-dispersing factor (PDF) has different effects on Drosophila's circadian clocks in the accessory medulla and in the dorsal brain. J Biol Rhythms 23: 409–424.
45. SheebaV, SharmaVK, GuH, ChouYT, O'DowdDK, et al. (2008) Pigment dispersing factor-dependent and -independent circadian locomotor behavioral rhythms. JNeurosci 28: 217–227.
46. YoshiiT, WulbeckC, SehadovaH, VeleriS, BichlerD, et al. (2009) The neuropeptide pigment-dispersing factor adjusts period and phase of Drosophila's clock. J Neurosci 29: 2597–2610.
47. ShaferOT, KimDJ, Dunbar-YaffeR, NikolaevVO, LohseMJ, et al. (2008) Widespread receptivity to neuropeptide PDF throughout the neuronal circadian clock network of Drosophila revealed by real-time cyclic AMP imaging. Neuron 58: 223–237.
48. DuvallLB, TaghertPH (2012) The circadian neuropeptide PDF signals preferentially through a specific adenylate cyclase isoform AC3 in M pacemakers of Drosophila. PLoS Biol 10: e1001337.
49. PengY, StoleruD, LevineJD, HallJC, RosbashM (2003) Drosophila free-running rhythms require intercellular communication. PLoS Biol 1: E13.
50. MillerCM, LiuN, Page-McCawA, BroihierHT (2011) Drosophila MMP2 regulates the matrix molecule faulty attraction (Frac) to promote motor axon targeting in Drosophila. J Neurosci 31: 5335–5347.
51. YasunagaK, KanamoriT, MorikawaR, SuzukiE, EmotoK (2010) Dendrite reshaping of adult Drosophila sensory neurons requires matrix metalloproteinase-mediated modification of the basement membranes. Dev Cell 18: 621–632.
52. SillerSS, BroadieK (2011) Neural circuit architecture defects in a Drosophila model of Fragile X syndrome are alleviated by minocycline treatment and genetic removal of matrix metalloproteinase. Dis Model Mech 4: 673–685.
53. Meyer-BernsteinEL, JettonAE, MatsumotoSI, MarkunsJF, LehmanMN, et al. (1999) Effects of suprachiasmatic transplants on circadian rhythms of neuroendocrine function in golden hamsters. Endocrinology 140: 207–218.
54. SilverR, LeSauterJ, TrescoPA, LehmanMN (1996) A diffusible coupling signal from the transplanted suprachiasmatic nucleus controlling circadian locomotor rhythms. Nature 382: 810–813.
55. de la IglesiaHO, SchwartzWJ (2006) Minireview: timely ovulation: circadian regulation of the female hypothalamo-pituitary-gonadal axis. Endocrinology 147: 1148–1153.
56. Birkedal-HansenH, MooreWG, BoddenMK, WindsorLJ, Birkedal-HansenB, et al. (1993) Matrix metalloproteinases: a review. Crit Rev Oral Biol Med 4: 197–250.
57. KadenerS, MenetJS, SuginoK, HorwichMD, WeissbeinU, et al. (2009) A role for microRNAs in the Drosophila circadian clock. Genes Dev 23: 2179–2191.
58. RodriguezJ, TangCH, KhodorYL, VodalaS, MenetJS, et al. (2013) Nascent-Seq analysis of Drosophila cycling gene expression. Proc Natl Acad Sci U S A 110: E275–284.
59. SternlichtMD, WerbZ (2001) How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol 17: 463–516.
60. ChoiC, CaoG, TanenhausAK, McCarthyEV, JungM, et al. (2012) Autoreceptor control of peptide/neurotransmitter corelease from PDF neurons determines allocation of circadian activity in drosophila. Cell Rep 2: 332–344.
61. BeckwithEJ, GorostizaEA, BerniJ, RezavalC, Perez-SantangeloA, et al. (2013) Circadian Period Integrates Network Information Through Activation of the BMP Signaling Pathway. PLoS Biol 11: e1001733.
62. SheebaV, GuH, SharmaVK, O'DowdDK, HolmesTC (2008) Circadian- and light-dependent regulation of resting membrane potential and spontaneous action potential firing of Drosophila circadian pacemaker neurons. JNeurophysiol 99: 976–988.
63. RestituitoS, KhatriL, NinanI, MathewsPM, LiuX, et al. (2011) Synaptic autoregulation by metalloproteases and gamma-secretase. J Neurosci 31: 12083–12093.
64. DziembowskaM, WlodarczykJ (2012) MMP9: a novel function in synaptic plasticity. Int J Biochem Cell Biol 44: 709–713.
65. UhlirovaM, BohmannD (2006) JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila. EMBO J 25: 5294–5304.
66. CerianiMF, HogeneschJB, YanovskyM, PandaS, StraumeM, et al. (2002) Genome-wide expression analysis in Drosophila reveals genes controlling circadian behavior. J Neurosci 22: 9305–9319.
67. IsaacRE, NasselDR (2003) Identification and localization of a neprilysin-like activity that degrades tachykinin-related peptides in the brain of the cockroach, Leucophaea maderae, and locust, Locusta migratoria. J Comp Neurol 457: 57–66.
|
{
"timestamp": "2019-04-20T18:24:42",
"url": "https://www.prolekare.cz/casopisy/plos-genetics/2014-10/mmp1-processing-of-the-pdf-neuropeptide-regulates-circadian-structural-plasticity-of-pacemaker-neurons-55256",
"language": "en",
"source": "c4"
}
|
Pat Cronley has played for Presidents, Governors, Movie Stars and TONS of Weddings!
Merry Christmas to you too Dean. Your entertainers were terrific. Pat Cronley is my favorite as you know. The magician was good, but I think next year we should try a different guy…different tricks. But the Barry Manilow singer was the greatest….my boss thought he was the best we ever had. Our Christmas party was absolutely a success.
|
{
"timestamp": "2019-04-20T00:51:21",
"url": "http://www.ruschentertainment.com/pat-cronley/",
"language": "en",
"source": "c4"
}
|
RxEAL is an ambitious startup with headquarters in Riga, Latvia building the future products using the blockchain technology today.
RxEAL was founded in the year of 2017 that was marked by the raise in cryptocurrency popularity. During the end of the 2017 and beginning of 2018 RxEAL idea was marketed to the public and found support from the people sharing our vision who contributed to the project during our native RXL token sale event. The shown support allowed us to deliver the platform that will change the rental security deposit experience.
Our mission is to create a better and more fair environment for rental security deposits. As we pursue that mission, we’re guided by a set of principles - passion about blockchain technology, building strong team and partner network, transparency to our clients and long-term sustainability.
RxEAL team, advisor and partner network consists of passionate professionals with strong vision and belief in future of the blockchain techonology.
|
{
"timestamp": "2019-04-18T22:16:08",
"url": "https://rxeal.com/about-us",
"language": "en",
"source": "c4"
}
|
Pulao and Biryani are the two types of Indian rice recipes that form an integral part of any formal or even informal lunch or dinner. Peas pulao has just the right mix of green peas with flavourful rice. The ghee and whole spices simply blend magically with the rice and peas to prepare a flavourful delight, peas pulao. Simple pulaos like this matar pulao are served with a curry dish and raita.
Pulao masala : 1 tbsp.
Heat ghee in a pan, add cashew nuts and toss till it turns light golden brown.
In the same oil add cumin seeds, coarsely ground cardamom, cinnamon,cloves and bay leave together. Add them once the cumins splutter.
Now add the peas, cover and cook for 2-3 mins.
Then add cooked basmati rice, sugar, salt and pulao masala, mix well.
Stir gently once in a while so that the rice does not burn at the bottom of the pan. Remove from the flame.
If it is just right then you might want to add some more salt as the rice.Turn off the heat and cover again for 5 minutes..
That's it. Serve the hot peas pulao with a vegetable or meat curry or eat it just like that. A raita always goes well with a pulao.
Sending this to Radhika's "Let's Cook #11 ~ Rice " event, Reva's "Royal Feast Biriyani"
|
{
"timestamp": "2019-04-24T21:47:40",
"url": "http://cuisinedelights.blogspot.com/2012/01/green-peas-pulao-matar-pulao.html",
"language": "en",
"source": "c4"
}
|
SARANAC LAKE — When the U.S. Olympic speedskaters hit the ice in Pyeongchang, John Dimon will be watching their feet.
Dimon owned the Dimon Sports Speedskating shop in Lake Placid from 1997 to 2008 and is now the owner of the Human Power Planet Earth bike shop on Main Street in Saranac Lake. He was a speedskater — briefly — himself. He still makes and sells skates.
The shop is partly dedicated to bicycles and partly to Nordic skates, which have long blades somewhat similar to those of speedskates. Hockey and figure skates are different specialties, with different blades.
“I did a lot of Category 1 skaters, some national age group champions. It’s kind of neat when you tune a blade and they set a record on it,” Dimon said.
“One of the fastest speedskaters is Mitch Whitmore in the 500 meter,” Dimon said. “I remember him when he was a little kid, racing out in the Midwest.” Dimon’s other pick for the podium is Joey Mantia, a several-time world champion. Although he’s never met Mantia, he’s got a good idea whose skates Mantia is wearing.
The uniforms and the blades have become critical components in what’s been called the world’s fastest all-human-powered sport. In a sport where success is measured by tenths of a second, the U.S. team’s chances this year may be, literally, on a knife’s edge.
“There was this transition when a sport went from being all human-factor to being — at the highest levels — really technical,” Dimon said. In the 1960s artificial ice — using de-ionized water — cut down the friction and made skate times faster.
Another big change was curving the blades. When you compare a speedskate blade to a hockey or figure skate blade, it’s straighter and thinner: 1 mm or 1.4 mm compared to 4 mm. The wider blades are slightly concave, or “hollow grind,” which works better to create a straight glide forward.
In speedskating, the narrower, longer blades “give them more bite to the push,” said Dimon. speedskates are also harder than figure or hockey skates, measuring 64 on the Rockwell scale as opposed to the wider blades’ 60.
Since Eric Heiden’s five gold medals in 1980 brought the sport to the attention of many Americans, the blades have literally had a curve thrown in: “In short track speedskating, they were bending the blades. When they moved indoors, speedskating in a hockey ring has many more turns. Bending the rocker helps with cornering on the turns,” Dimon said.
Dimon remembers skating under coach Pat Maxwell, who introduced him to Mike Miller. Miller took his skates from him, remarked, “Oh, these aren’t even bent,” and proceeded to shut the penalty box door on them a few times to bend them.
Bending the blades shaved off as much as 10 mph around the corners and dropped the record times around the world. Short track speedskates also have the blade not in the center of balance, but offset, to prevent the boot from touching the ice when it’s angled inward.
While many skaters won’t allow anyone else to sharpen their skates, all boots are custom made to fit the skater’s foot. Some skaters order individual changes to their skates.
“Cathy Turner had a 17-and-a-half inch blade,” Dimon said. “She was really amazing. I used to work for the company that built her skates. She had one blade moved forward on the boot.” That way, when her feet crossed over, the blades wouldn’t touch.
Another innovation that shaved time from speedskating totals was the “shark suit.” Aerodynamic fabric, first used in swimming, became a necessity for speedskaters after Heiden’s famous yellow suit.
The clap skate caught on and world records fell rapidly in the 1998 Olympics in Nagano, Japan.
This year factors that affect racers’ speeds may be as large as Pyeongchang’s elevation (700 feet above sea level) or as small as the micrometer of a skate blade.
“That’s cool, isn’t it?” Dimon said.
|
{
"timestamp": "2019-04-18T20:37:36",
"url": "http://www.adirondackdailyenterprise.com/news/local-news/2018/02/john-dimon-a-competitive-edge/",
"language": "en",
"source": "c4"
}
|
If you observe the enterprise news, you’ve got most likely observed the word neuroscience being used more ceaselessly over the past year or so. One who enters into one thing that he or she has passion at an early age in life will certainly achieve success than who spend more often than not in increased research and nonetheless really feel not prepared for any critical enterprise. According to elkington the enterprise doesn’t have one single purpose of attaining revenue however to extend the aim set by adding environmental and social values. The franchise receives an unique space and the suitable to distribute the publication of coffee news.
When I was a tweenager, I began reacting to newspapers – print & the paper itself – allergist figured it was because of the high sulfur content material esp in the recycled paper. If your enterprise is new in social media marketing akin to which has few followers on all platforms, the list may be shorter.
Just check out what occurred to the economic system the recent years, the enterprise group went down and it dragged a lot of people affected much of the residing conditions. The information was principally fed to you, you weren’t capable of exit and find completely different opinions. Please be happy to post your small business ideas that you’ll never use within the feedback part under.
Try to identify areas of business you think your organization ought to evaluate – alternatives to achieve market share from opponents, and/or develop your market to include new customers. However as soon as a website is established and is producing an income it is among the finest enterprise alternatives on the earth.
We, Investment Point provides inventory market trading consultancy to our paid customers on daily & positional technique to Buy, Sell or Hold of Nifty, Bank Nifty and Stock particular pattern by way of SMS / What’s app picture solely through +ninety one ninety nine 793 80808 so contact on the identical.
|
{
"timestamp": "2019-04-21T08:35:52",
"url": "http://www.jackboy365.com/cost-containment-strategies-for-businesses.html",
"language": "en",
"source": "c4"
}
|
Denver, CO - Colorado U.S. Senator Michael Bennet today released the following statement on President's Trump federal budget blueprint, which would increase defense spending by $54 billion by cutting funding from more than a dozen agencies.
"This budget is not a serious proposal to help our country compete in the 21st century economy." Bennet said. "Even members of the President's own party have called this dead on arrival. Cutting investments in infrastructure, environmental protection, research, and affordable housing isn't putting ‘America First.' Instead, this blueprint offers ideologically-driven cuts masquerading as deficit reduction. The President should abandon this plan and start working with Republicans and Democrats on responsible, bipartisan solutions to reduce our deficit while maintaining important investments in our country."
|
{
"timestamp": "2019-04-23T09:58:24",
"url": "https://www.bennet.senate.gov/public/index.cfm/press-releases?id=2A27E88D-072A-7036-F9FA-306F0D15B265",
"language": "en",
"source": "c4"
}
|
You’re reading novel The Demonic King Chases His Wife: The Rebellious Good-for-Nothing Miss Chapter 1065 online at LightNovelFree.com. Please use the follow button to get notification about the latest chapter next time when you visit LightNovelFree.com. Use F11 button to read novel in full-screen(PC only). Drop by anytime you want to read free – fast – latest novel. It’s great if you could leave a comment, share your opinion about the new chapters, new novel with others on the internet. We’ll do our best to bring you the finest, latest novel everyday. Enjoy!
"Girl, you don't need to worry. The road is still very long." Nangong Liuyun slowly said to console her while stroking her soft hair.
"With you here, I don't need to worry." Su Luo smilingly looked at him.
Nangong Liuyun left the imprint of a kiss on her forehead.
The warm atmosphere between the two people was full of tender feelings.
Li Yaoyao scoffed heavily, "I'll just see how many points you guys will get!"
Su Luo continued talking with Nangong Liuyun.
Nangong Liuyun laughed as he listened, as if what she said was very amusing.
Li Yaoyao stood there for quite a while, but no one paid any attention to her.
Those two people were simply ignoring her, treating her as though she didn't exist!
Thinking up to here, Li Yaoyao almost exploded.
Situ Ming saw that the atmosphere wasn't quite right and hurriedly pulled Li Yaoyao away.
Nangong Liuyun showed clearly that he didn't like Yaoyao. He also clearly showed that Su Luo was a precious treasure to him. If Yaoyao really got into a quarrel with Su Luo, it was clear to see who would eat the loss.
Situ Ming was also puzzled ah….
Those two words, Situ Ming still didn't have the courage to say them.
Just at this moment, violent battle sounds could be heard coming from the white jade bridge.
However, the battle sounds quickly settled down.
Su Luo immediately sat upright, gazing unblinkingly at the body of the bridge.
Sure enough, a turntable slowly appeared.
"Beichen Ying and Zi Yan made it across!" A smile appeared on Su Luo's face.
However, regardless of the grades, at least the two of them were safe. This was the best news.
"I already said you were worrying groundlessly. Now, you should feel rea.s.sured." Nangong Liuyun's eyes contained a smile.
"Eh! Let's take a look at how much they scored."
While the two people talked, that turntable's speed was slowing down.
"Thirty! thirty! thirty!" Li Yaoyao shouted loudly as she waved her fist around.
Su Luo frowned in annoyance: "How can it be thirty points? Is this person insane?"
Nangong Liuyun made a show of being very serious as he touched his chin: "I reckon she is insane. You should stay away from her. Be careful not to get infected."
When Su Luo heard this, with a 'pfft', she laughed out loud.
"That person was originally your most beloved little junior sister. Now, you're actually saying this about her?"
Nangong Liyun was unconcerned. The tips of his eyebrows raised slightly: "Isn't it said that when one marries a wife, he forgets his mother? What does a little junior sister count for?"
"Oh, you really are…" Even Su Luo was speechless.
How could there be such a shameless person? Saying when one married a wife, he would forget his mother in such a pompous manner?
If his mother was really still alive, Su Luo felt she would have no face to see this elder again.
"I really am what?" Nangong Liuyun's pair of enchanting and devilishly charming eyes winked, almost suffocating the person he was enticing.
Su Luo, with great difficulty, turned her gaze away: "I still haven't married you yet. Talk less nonsense."
"What? I'm already your man. You still don't want to take responsibility?" The G.o.d-like His Highness Prince Jin, he opened his eyes wide in disbelief. That expression was extremely exaggerated.
"You—" Su Luo pushed him aside hatefully, "I simply never touched you before. Don't say such nonsense!"
"What do you mean you haven't? We've already shared a bed for so many days. The heavens had seen this, with mother earth as witness. You can't renege on it!" Nangong Liuyun pointed to the heavens in a deadly earnest manner and then stepped on the earth.
His voice wasn't low, it could be heard clearly within a range of several hundred meters.
Su Luo became extremely impatient and pushed Nangong Liuyun: "Move aside, move aside. Don't block me. I still need to see the score."
Who knew that Nangong Liuyun would, with one move, imprison her in his embrace: "No, if you don't admit it, then I won't let you see."
Such a childish man! Su Luo groaned inwardly as she held her forehead up gracefully.
She really lost to him.
You're reading novel The Demonic King Chases His Wife: The Rebellious Good-for-Nothing Miss Chapter 1065 online at LightNovelFree.com. You can use the follow function to bookmark your favorite novel ( Only for registered users ). If you find any errors ( broken links, can't load photos, etc.. ), Please let us know so we can fix it as soon as possible. And when you start a conversation or debate about a certain topic with other people, please do not offend them just because you don't like their opinions.
You're reading The Demonic King Chases His Wife: The Rebellious Good-for-Nothing Miss Chapter 1065. This novel has been translated by Updating. Author: Su Xiao Nuan,苏小暖 already has 10841 views.
Current Time is Apr-21-2019 02:46:45 AM.
|
{
"timestamp": "2019-04-21T02:46:45",
"url": "https://novelzec.com/novel-seri-88891981/chapter_896",
"language": "en",
"source": "c4"
}
|
The story of the career and loves of Howard Roark, a genius architect, in the face of a society hostile to greatness.
"The astounding story of a man that said that he would stop the motor of the world—and did."
The master work of a master writer.
"The book thoroughly exposes the Branden's and their motives, finally laying to rest all of the urban myths surrounding these private affairs, assisted by portions of the unpublished journals of Ayn Rand herself. I care little for the private lives of philosophers, but these matters have become an impediment to the serious discussion of Ayn Rand's ideas. Valliant's deft dispatch of the Branden's should clear the path for more rational consideration." -- Michael Limber, Amazon review.
|
{
"timestamp": "2019-04-21T17:14:41",
"url": "http://www.solopassion.com/store-ayn-rand",
"language": "en",
"source": "c4"
}
|
❤️Subscribe to our channel for more cracks,keys and many more.
Enjoy Bitdefender Total Security 2018 Crack Plus License Key Download.
Bitdefender Total Security 2018 Crack Plus License Key Download are up to date.
We are not responsible for any illegal actions you do with theses files. Download and use Bitdefender Total Security 2018 Crack Plus License Key Download on your own responsibility.
|
{
"timestamp": "2019-04-24T18:32:53",
"url": "http://infovine.us/19000/hacks-and-cheats/bitdefender-total-security-2018-crack-plus-license-key-download/",
"language": "en",
"source": "c4"
}
|
Bagnalls were one of five painting contractors to be acknowledged at the 2014 Johnstone’s Painter of the Year awards, for their charitable contribution to the communities in which they work. Bagnalls were highly commended for the community achievements delivered during their partnership contract at Regenda Housing. Bagnalls have a well established commitment to working in the community by giving donations of paints and sundries, holding painting and decorating workshops for residents and offering trained painters to manage community painting projects through its Community Paintbrush scheme. Paddy McGuinness, awarded the certificates at the award ceremony held at Celtic Manor in South Wales on Saturday evening.
|
{
"timestamp": "2019-04-21T20:28:21",
"url": "https://www.bagnalls.co.uk/2015/05/18/bagnalls-acknowledged-for-community-spirit/",
"language": "en",
"source": "c4"
}
|
We all know Brad Pitt and Jennifer Aniston was once a popular couple of Hollywood. The duo gave major relationship goals; however, they called it quits after enjoying a few years of marital bliss. Well, it seems both Jennifer and Brad have let the bygones be bygones and have become friends now. Jennifer turned 50 today and she hosted a grand birthday bash on this special occasion. The actress invited a number of popular faces from Hollywood.
However, one person on her guest list who made the appearance simply took everyone by surprise. Well, it was none other than her ex-husband Brad Pitt. Yes, you heard it right! The actress invited Brad for her birthday party and he made to it appearance. The actress looked smoking hot in a backless black jumpsuit. She was captured by the paparazzi as she made her way to the Sunset Tower in Los Angeles.
While Brad’s appearance made several tongues wagging, it seems Jennifer and Pitt are now in talking terms.
For all those who are not aware, Jennifer and Brad met in 1998 and got married in the year 2000. The couple’s marriage did not last long and soon got separated. Post his separation from Jen, Brad soon started dating Angelina Jolie and also married her. However, Brad and Jolie’s marriage too didn’t last and they headed for separation.
Also Read: Brad Pitt is finding love again as his nightmare divorce from Angelina Jolie is almost over?
Are Brad Pitt and Jennifer Aniston reconnecting via text messages?
In the wake of the Brangelina divorce, these funny memes of Jennifer Aniston have taken Twitterati by storm!
|
{
"timestamp": "2019-04-26T15:57:04",
"url": "https://www.pinkvilla.com/entertainment/news/brad-pitt-drops-former-wife-jennifer-aniston-s-50th-birthday-bash-setting-internet-fire-440021",
"language": "en",
"source": "c4"
}
|
The number of women entrepreneurs has grown tremendously over the last decade. According to the 2016 State of Women-Owned Businesses report commissioned by American Express OPEN, the number of women-owned firms increased by 45% between 2007 and 2016, compared to just a 9% increase among all businesses in the U.S. Today 11.3 million women own 38% of businesses in the country. Back in 2007, women owned 29% of American businesses.
|
{
"timestamp": "2019-04-19T02:20:39",
"url": "https://pwnglobal.net/component/content/article.html?id=3437",
"language": "en",
"source": "c4"
}
|
ANJALI MOBILE SERVICE WAS ESTABLISHED IN 2012.WE ARE SUCCESSFULLY COMPLETED 6YEARS IN OUR SERVICE.OUR PASSION FOR THE CUSTOMER SERVICE AND PEOPLE FLEXIBLE SERVICE LEAD US TO SERVICE FOR BRANDED PRODUCTS. WE HAVE WIDE NETWORK OF SKILLED PROFESSIONAL AND WELL TRAINED ENGINEERS CAN DO THE MOBILE SERVICE TO COMPLETE FOR GIVEN THE TIME LINE. CUSTOMER SATISFACTION IS OUR UTMOST PRIORITY.YOU CAN ANYTIME AVAIL OUR 24/7 FREE TECHNICAL SUPPORT, CARRY YOUR DEVICE TO OUR WORKSTATION ANYTIME FOR ANY SERVICE QUERY, NEED HELP AT DOOR STEP, WE HAVE OUR ONCALL SUPPORT TOO.
|
{
"timestamp": "2019-04-19T04:39:21",
"url": "http://www.buysellcart.in/anjali-mobile-service-center-in-balapur/",
"language": "en",
"source": "c4"
}
|
Accupril by Parke-davis Div Of Pfizer Inc is a brow oval tablet film coated about 10 mm in size, imprinted with pd;527;5. The product is a human prescription drug with active ingredient(s) quinapril hydrochloride.
Imprint: PD;527;5 What is the Imprint?
|
{
"timestamp": "2019-04-23T07:53:02",
"url": "https://ndclist.com/pill-identifier/accupril-0071-0527",
"language": "en",
"source": "c4"
}
|
The Philharmonic Orchestra and the Kulturforum are a few steps away from the Beisheim Center, while the Deutsche Theater, the Staatsoper, the famous Gendarmenmarkt and Museum Island are located on the other side of the Brandenburg Gate.
The very popular covered Potsdamer Platz Arcades are ideal for a leisurely shopping trip in all weathers, and international fashion is on offer in the exclusive shops on Kurfürstendamm and in Friedrichstrasse. It's a difficult choice, given that both of these shopping strips are within easy reach of the Beisheim Center.
Later on, visitors can immerse themselves in Berlin's night life on Potsdamer Platz with its excellent restaurants, cafés and trendy bars.
|
{
"timestamp": "2019-04-20T07:10:54",
"url": "http://beisheim-center.com/en/location/culture_shopping.php",
"language": "en",
"source": "c4"
}
|
A friend of mine recently felt trapped. For many years he’s been nursing a dream of a new career that would take him and his wife overseas where they would have impact on people around the world. Recently, that longing has grown so intense that it’s keeping him up at night. Not with excitement, but with regret.
A number of years ago, when real-estate was still appreciating in value, he invested in some major improvements in his home, betting he would gain more than his investment in return when he sold his house. At the time, it seemed like an easy decision. A safe bet. That bet morphed into deep regret, however, as housing valuations plummeted leaving him a prisoner to his own home—held captive by an upside-down mortgage.
As we talked, it became clear that my friend suffered from more than regret. He felt shame; those incessant reminders that he not only failed, he failed irreparably and would continue to do so. Regret can do that. Left unchecked, it nags at us becoming full-blown shame until we believe that all is lost because of our poor decisions. It can be utterly debilitating, because once we’re in a state of shame we have no shortage of mistakes with which we can accuse ourselves.
The problem, of course, is that the words of shame spawned by regret aren’t true. In fact, regret, itself, can be an ally for action if you respond to it correctly. Regret is an emotional response to a decision gone awry. Some decisions are foolish and avoidable, like engaging in an affair, for instance. Some, like my friend’s investment in his home, are not. They were made in good faith with the best information and counsel available at the time. The consequences merely did not turn out as he had hoped.
Embrace your limitations. God never expects you to be omniscient. That’s His department. Berating yourself because you should have known better only leads to shame and leaves you feeling trapped, like my friend. It robs you of the confidence you need to move forward toward your dream. Continued self-criticism denies the sovereignty of God and is simply another form of pride. Get over yourself. Embrace your weaknesses and bad decisions, and move on.
Transform obstacles into incubators. There’s an old saying I’m fond of: “There are no problems, only opportunities, some of which are insurmountable.” It’s funny, but true. Some of our best opportunities are insurmountable. “Could it be,” I asked my friend, “that God affirmed that decision in you in order to have you stay put in your present job and incubate your dream even more?” He looked startled by the thought, smiled and said, “You may be right.” It wasn’t his decision that imprisoned him. It was how he thought of it that did. If you feel you have to stay put, you can still go somewhere; go deep.
Lean into your regret. One of the deep places we can go is in our area of regret. This may appear counter-intuitive, because our natural response to failure of any kind is avoidance. When the check engine light goes on in our car, it’s wise to follow its advice. Check the engine. Get a proper diagnosis and get it fixed. Likewise, when regret appears, we should check our internal engine as well. It may be that we’ve made something or someone more important than God in our life. Perhaps we’ve grown dependent on that person or thing to make our dream come true, forgetting that God is “able to do immeasurably more than all we ask or imagine” (Ephesians 3:2). By unearthing these dependencies and asking God to free us from them we affirm our trust in God to lead us, regardless of where we now find ourselves.
Share your thoughts with other readers: What are some of the ways you’ve transformed regret into action?
This entry was posted in Reflecting and tagged dreams, failure, limitations, regret, shame. Bookmark the permalink.
Focusing on our regrets keeps us looking backward instead of moving forward. Joseph is a great biblical example of a leader who determined not to live in the past but to remain faithful in the present, even when the future looked bleak. (Genesis 37-50). It was in the cauldron of the present that God forged him into a leader that was ready for the task. Not a moment of waiting was wasted.
Being Your hands and feet in the spaces ordained for us today.
Hi Jack! Loved the prayer and the quote you dug up from CS Lewis. Great stuff!
|
{
"timestamp": "2019-04-19T00:42:46",
"url": "https://www.learygates.com/2012/07/18/making-regret-your-ally-for-action/",
"language": "en",
"source": "c4"
}
|
Ordering the World in the Eighteenth Century. von Donald,Diana & Frank O'Gorman., Ed.: - Antiquariaat A. Kok & Zn. B.V.
Home Donald,Diana & Frank O'Gorman., Ed. Ordering the World in the Eighteenth Century.
Ordering the World in the Eighteenth Century.
Donald,Diana & Frank O'Gorman., Ed.
|
{
"timestamp": "2019-04-19T01:25:54",
"url": "https://www.zvab.com/Ordering-World-Eighteenth-Century-Donald-Diana/11732451606/bd",
"language": "en",
"source": "c4"
}
|
Travel over the Stone Arch, Hennepin Avenue and Merriam Street Bridges as we cross over and follow Mississippi River on this magical horse drawn carriage ride.
Clip-clop along the cobblestones of Main Street and see the beautiful views of the Minneapolis skyline.
With all of the charm, elegance and nostalgia that only a horse drawn carriage provides, you will see: Cobblestones of Main Street, James J Hill’s Stone Arch Bridge, Mississippi River, St. Anthony Falls, Mill City Museum, Guthrie Theater, Downtown Minneapolis skyline, Warehouse District, Federal Reserve Bank, Hennepin Avenue Bridge, Historic Nicollet Island.
M S: Our trip was wonderful. I highly recommend this to anyone looking for a great date night!
Lauryn M: Our driver was extremely friendly, as was our beautiful horse, King. The skyline/tour itself was perfect!
|
{
"timestamp": "2019-04-21T14:46:02",
"url": "https://thehitchingcompany.com/tour/mississippi-river-grand-carriage-tour/",
"language": "en",
"source": "c4"
}
|
How do I report a scam?
What do I do if a seller seems suspicious?
Always try and get in contact with the seller on the phone and plan an inspection.
If you cannot and the listing is too good to be true, it probably is. Never send any money to anyone before inspecting the item.
We have a dedicated Trust & Safety team who will be able to investigate and give you advice on how to stay protected. For more information, read our safety tips for buyers or visit our online safety section.
|
{
"timestamp": "2019-04-22T16:05:40",
"url": "https://help.carsales.com.au/hc/en-gb/articles/204883865-What-do-I-do-if-a-seller-seems-suspicious-",
"language": "en",
"source": "c4"
}
|
Could use 1 healer! Just did a check and 18 of our players have been here over 1 year and 10 players have been here over 3 years!
SONS AND DAUGHTERS OF THE HORDE, come trial with Swarm. Thanks.
Lookin for 1-2 dps to go into BFA with!
Would love an Rsham or Rdruid.
|
{
"timestamp": "2019-04-25T20:23:31",
"url": "https://us.battle.net/forums/en/wow/search?a=Traxin%40Thrall",
"language": "en",
"source": "c4"
}
|
If you've struggled with pain and discomfort, or want a solution for your ear concerns, come in to see our team today. You'll get one-on-one, personal service for your individual needs. That's what makes us so unique.
Trust us to provide you with comprehensive service.
Our ear therapy services can do much more than just provide you with relief from discomfort and pain. For many people, they help to clear out ear wax, but also to help eliminate the toxins that could be affecting your health.
Talk to us today about your needs. Get information about how your ears are affecting your overall health.
With more than 35 years as a registered nurse, our professional can help you with many of your ailments and concerns. Come in and talk to our reliable, professional staff today. We're always available to meet your needs.
Let us help with colon hydro therapy needs as well as nutrition services. You could see a significant improvement in your quality of life.
Come in to see us today. Let's talk about your needs and find the right type of ear therapy to resolve the complications and problems you've been having.
|
{
"timestamp": "2019-04-20T05:01:46",
"url": "http://assuredhealthservice.com/ear-therapy/1730584",
"language": "en",
"source": "c4"
}
|
In vSphere both the physical function (PF) and virtual functions (VFs) of an SR-IOV capable physical adapter can be configured to handle virtual machine traffic.
The PF of an SR-IOV physical adapter controls the VFs that virtual machines use, and can carry the traffic flowing through the standard or distributed switch that handles the networking of these SR-IOV enabled virtual machines.
The SR-IOV physical adapter works in different modes depending on whether it backs the traffic of the switch.
The physical adapter provides virtual functions to virtual machines attached to the switch and directly handles traffic from non SR-IOV virtual machines on the switch.
You can check whether an SR-IOV physical adapter is in mixed mode in the topology diagram of the switch. An SR-IOV physical adapter in mixed mode appears with the icon in the list of physical adapters for a standard switch or in the list of uplink group adapters for a distributed switch.
The physical adapter provides virtual functions to virtual machines connected to a virtual switch, but does not back traffic from non SR-IOV virtual machines on the switch.
To verify whether the physical adapter is in SR-IOV only mode, examine the topology diagram of the switch. In this mode, the physical adapter is in a separate list called External SR-IOV Adapters and appears with the icon.
The physical adapter is not used for traffic related to VF aware virtual machines. It handles traffic from non SR-IOV virtual machines only.
|
{
"timestamp": "2019-04-18T20:39:48",
"url": "https://docs.vmware.com/en/VMware-vSphere/6.7/com.vmware.vsphere.networking.doc/GUID-6B2EBF69-E1CA-4D31-A035-2C7BF6B96397.html",
"language": "en",
"source": "c4"
}
|
Learn about America’s fastest growing sport.
Watch basketball at the library and make your picks for our bracket challenge.
Discover hunting and fishing resources at the library.
A list of hockey teams in Topeka since 1998.
Local high school sports give you inexpensive entertainment.
Visit the Shawnee County Sports Hall of Fame plaques and memorabilia at the library.
Older sports fans will remember a groundbreaking show that introduced American television audiences to numerous sports.
Gear up for the 2018 World Cup with recommendations on who to watch and what to read.
Review all the spring sports tournaments coming up in May.
Learn the history of baseball’s favorite song.
|
{
"timestamp": "2019-04-24T18:07:33",
"url": "https://tscpl.org/topic/sports",
"language": "en",
"source": "c4"
}
|
As a business owner or CEO do you find it hard to figure out what to do about professional and personal development for your team?
Who should be doing what training?
What sort of professional development would be best?
Should you even worry about personal development opportunities?
But make no mistake… there is a definite impact on your business from either providing, or not providing, professional and personal development for staff.
Research into the Millennial (Gen Y) cohort clearly shows that staff who don’t feel as though they are improving their skills won’t stay around in your business. At least the good ones won’t!
And it’s not only Gen Y who feel like that. Many people want to improve themselves and feel more productive.
From experience working with many businesses here are a few thoughts that are probably relevant for you, your team and your business.
Role-based development includes essential and advanced skills and knowledge required to improve performance in the role the team member now holds.
Career-based development addresses a selected number of development options drawn from a suite of capabilities deemed important for the career path of the individual.
Studying an online course (e.g. a tutorial on Lynda or free MOOC from a university).
Signing up for ecourses delivered via email.
Individual activities focusing on specific skills.
Receiving mentoring from a suitable colleague.
Attending specific industry events to learn from industry leaders and influencers.
Reading relevant books or ‘thought leader’ resources (and sharing their insights with others).
Receiving regular coaching from their team leader.
Learning more about the business and your clients by shadowing colleagues in various parts of the business or spending time onsite with clients.
Within the development journey it’s important to create and maintain the balance of expectations for team members. It could be easy for them to develop a sense of entitlement; that they should be able to access every development opportunity that is available.
However, some opportunities, especially career-based options, should be available to those who earn it. That is, to team members who are reaching predefined performance standards.
In combination with the Dual Track Development Journey it could also be a good idea to establish a variety of leadership-related development opportunities.
If you would like to discuss these ideas further or get some professional insight into how you can introduce these ideas into your organisation please get in touch to request a complimentary, 45-minute consultation. We’d love to speak with you. Contact us to find out more.
|
{
"timestamp": "2019-04-20T03:13:06",
"url": "https://pathfinderadvisors.com.au/what-happens-no-professional-development/",
"language": "en",
"source": "c4"
}
|
Twyla joined our staff in the spring of 2016 and has made a tremendous impact since her arrival. She was trained at Canine Companions for Independence in Santa Rosa, CA and was selected specifically for our program. Twyla is 4 years old and can provide comfort to our clients in the waiting room, interview room, counseling and as victims testify against their abusers in the court room.
Studies show the trust, acceptance, and tactile comfort of a friendly dog change the physiology of a nervous child.
Visit cci.org to learn more about Canine Companions for Independence.
|
{
"timestamp": "2019-04-25T00:53:13",
"url": "https://www.emmashousecac.org/about-twyla",
"language": "en",
"source": "c4"
}
|
You abbreviate me. I stray from an obedience as semaphore precedes lane change. Your eyes shift pattern to portrayal. I between my way to pertinence. The lavish praise of record kindles centered destination, as I chalk my way into a white home with a yard, an intended distance from my history. Elapsed and episodic split particulates of moment. What it means to have rescinded what first fended off the paucity, tamed via tissue hinged to an intended whole.
|
{
"timestamp": "2019-04-25T16:47:25",
"url": "http://ojalart.com/feature-writers/featured-writer-sheila-murphys-flash-fiction-salt-earth/",
"language": "en",
"source": "c4"
}
|
Mirrored Gallery Frames Interior | Chetekantiques.com mirror gallery frames. mirrored gallery wall frames. mirrored gallery frames.
Mirrored Gallery Frames Fantasy Pin By Ye Sha On Interior Pinterest Wall Decor Shelves And With Regard To 7. Mirrored Gallery Frames Inviting Photos Of Nice Design Mirror Bed For 17. Mirrored Gallery Frames Lovely Large Picture Easiest Way To Hang A Wall Intended For 4. Mirrored Gallery Frames Stylish Mirror Loft West Elm As Well 3. Mirrored Gallery Frames Household 33 Bright Idea Picture Wasikhan Co Wall Regarding 13. Mirrored Gallery Frames Comfy 33 Enjoyable Inspiration Ideas Design Silver 6. Mirrored Gallery Frames Invigorate Mirror West Elm Intended For 0. Mirrored Gallery Frames Inviting Stella Frame Sp16 Living5 Living Room Inspiration Z Gallerie 8. Mirrored Gallery Frames Encourage 8 X10 Frame Threshold Target As Well 10. Mirrored Gallery Frames Wish Stella Frame Photo Decor Z Gallerie Along With 5. Mirrored Gallery Frames Incredible West Elm Mirror Designs With Regard To 12. Mirrored Gallery Frames Motivate Living Rooms Mirror In Addition To 1. Mirrored Gallery Frames Beautiful Fancy Ideas Around Round Mirror Design Wall In Addition To 9. Mirrored Gallery Frames House Parrillayvinos As Well 16. Mirrored Gallery Frames Incredible Mirror West Elm With Regard To 2. Mirrored Gallery Frames Dream Collage Picture Frame For 18. Mirrored Gallery Frames Property 33 Marvellous Design West Elm Mirror Designs For 19. Mirrored Gallery Frames Attractive Where Can I Find Picture Wasikhan Co For 11.
|
{
"timestamp": "2019-04-26T11:39:12",
"url": "http://chetekantiques.com/29401/mirrored-gallery-frames/",
"language": "en",
"source": "c4"
}
|
The highest temperature will reach 4 degrees Celsius, while the the lowest temperature will drop to 1 degrees Celsius. The wind will be a light breeze, and the mean air pressure will be 1023 mb. Relative humidity will be high.
The highest temperature will reach 9 degrees Celsius, while the the lowest temperature will drop to 4 degrees Celsius. The wind will be a gentle breeze, and the mean air pressure will be 1012 mb. Relative humidity will be high.
There is a 89% probability of moderate rainfall, moderate sleet and snowfall, light snowfall and showers.
The highest temperature will reach 5 degrees Celsius, while the the lowest temperature will drop to -2 degrees Celsius. The wind will be a light breeze, and the mean air pressure will be 1010 mb. Relative humidity will be high.
There is a 79% probability of moderate rainfall, moderate sleet and snowfall, light snowfall and showers.
The highest temperature will reach 2 degrees Celsius, while the the lowest temperature will drop to -1 degrees Celsius. The wind will be a gentle breeze, fog will form, and the mean air pressure will be 1006 mb. Relative humidity will be very high.
There is a 63% probability of light snowfall and showers.
The highest temperature will reach 0 degrees Celsius, while the the lowest temperature will drop to -3 degrees Celsius. The wind will be a light breeze, fog will form, and the mean air pressure will be 8079 mb. Relative humidity will be .
The highest temperature will reach -2 degrees Celsius, while the the lowest temperature will drop to -3 degrees Celsius. The wind will be a light breeze, fog will form, and the mean air pressure will be 1014 mb. Relative humidity will be very high.
|
{
"timestamp": "2019-04-25T02:38:15",
"url": "http://www.viewweather.com/w7665599-weather-forecast-for-varful_gruiu_muntii_calimani_-judetul_mures.html",
"language": "en",
"source": "c4"
}
|
Our PDF Printer has a hardware margin of 0 (zero). This enables the installed printer to write to the edge of the paper. Normally this is a great feature but sometimes it may be a problem because the created PDF files are sent directly to a physical printer without scaling it to fit the margins of the physical printer.
In case you want to use a hardware margin together with the PDF Printer, you have to create a new form (paper size) on your system. New forms are easily created from the Control Panel list of printers. Just open the File menu and select Server Properties.
From the list of available forms you should select the one that you want to add margins to. In this example we will choose the A4 form.
Click the Create new form checkbox to design a new form. Enter a name and changes the margins. Select Save Form when you are done.
When the new form is saved, you should go to printer properties of the PDF Printer. Here you click Printing Preferences. In the next dialog you click Advanced. Now you can select your new form as the default paper size of the PDF Printer.
|
{
"timestamp": "2019-04-23T23:09:21",
"url": "https://www.7-pdf.com/products/pdf-printer/documentation/change-margins",
"language": "en",
"source": "c4"
}
|
Welcome to episode 65 of Sweetman Podcast with support from our sponsors – T Leaf T, Yeastie Boys and Le Petite Chocolat.
This conversation is me chatting with the Artistic Director of the NZ Festival and Wellington Jazz Festival, Shelagh Magadza.
I hadn’t met Shelagh until she came around for a chat following my invitation. I wanted to help promote and plug the upcoming Jazz Festival but also to get a bit of her story too, to help people to understand what’s required in that sort of role – the passion, but also the workload. We talked a lot about next week’s Festival line-up, which is pretty stellar. And the previous festivals, Shelagh and her team have essentially rebuilt a once-broken Wellington Jazz Festival. They’ve taken it under their wing, they also run the International Arts Festival (every two years in Wellington, Feb/March). In recent years the Jazz Festival has been host to some living legends of jazz: Wayne Shorter, Cassandra Wilson, Dee Bridgewater…and this year add Bill Frisell, Dianne Reeves and Dave Weckl, among many others, to that list.
I also wanted to talk to Shelagh because I’ve enjoyed watching her introduce shows at the recent festivals, it’s clear there’s passion and interest and energy there. She believes in the arts, believes in the acts she’s endorsing.
So I hope you enjoy finding out a bit more about the festival, and the idea of running a festival – and the woman behind it, in my conversation with Shelagh Magadza.
You’ll also get to hear snippets of music from many of these year’s Festival guests, hopefully it helps to get you in the mood, to make choices around what you want to see and to give a further shape and sound to our conversation.
Please enjoy episode 65 of Sweetman Podcast, my conversation with Shelagh Magadza.
Posted in Blog, Podcasts and tagged with Artistic Director, Arts Festival, Bill Frisell, Cassandra Wilson, Chat, Comet Is Coming, Conversation, Dave Weckl, Dianne Reeves, Discussion, ep65, Festival, Festival of the Arts, International Festival, Interview, iTunes, Jazz, Jazz Festival, Le Petite Chocolat, Michael Houstoun, NZ Festival, Plug, Podcast, PR, Promo, Rodger Fox, Shelagh Magadza, Simon Sweetman, Soundcloud, Sweetman Podcast, Sweetman Podcast: Episode 65 – Shelagh Magadza, T Leaf T, Wayne Shorter, Wellington, Wgtn, Wynton Marsalis, Yeastie Boys. RSS 2.0 feed.
|
{
"timestamp": "2019-04-22T00:06:57",
"url": "https://offthetracks.co.nz/sweetman-podcast-episode-65-shelagh-magadza/",
"language": "en",
"source": "c4"
}
|
Micro-Top® XT by Bomanite is a two-part, polymer-modified cementitious coating consisting of a unique rubber-like polymer liquid and a cement-aggregate blend. It can be applied over almost any clean, sound surface including concrete, cement block, tile, metal and wood in a wide range of colors and graphics. Micro-Top XT has extraordinary adhesion and ability to withstand prolonged pedestrian and vehicular traffic. In these respects, the material is far superior to conventional cementitious coatings.
Micro-Top XT provides a tough, water-retardant coating that substantially reduces water penetration, freeze-thaw scaling and concrete carbonation. It is a “breathable” coating that releases normal entrapped vapor without loosening or blistering. Typical uses include concrete exterior restoration, parking structure protection, sidewalk resurfacing, wall refinishing and installation coating, stadium renovation, swimming pool walkways and balcony deck surfacing.
|
{
"timestamp": "2019-04-23T20:24:29",
"url": "https://bomanite.com/system_sub/micro-top-xt/",
"language": "en",
"source": "c4"
}
|
1) Understand the non-consumptive effects of a predator on pathogens of soybean loopers.
2) Make the results accessible to farmers, agricultural centers, and the public.
3) Use the results to help improve Integrated Pest Management (IPM) programs and expand environmentally-friendly agriculture practices.
With increasing use of soy products there is a need to find environmentally sustainable ways to maintain crop yield. It is becoming apparent that chemical pesticides need to be reduced for a more environmentally safe alternative. To this end we are working to elucidate the effects of predators on the disease transmission of crop pests. By learning more about the interactions of crop pests with their natural enemies and pathogens, IPM programs can be improved and more successfully implemented. Previous attempts at applying biological control agents have had unforeseen consequences, so careful preparation and understanding of these agents and their interactions in the environment is of critical importance. We are ready to expand the body of research available to farmers, agricultural centers, and the general public to help decrease pest damage. By using the right predators in combination with the right pathogens we can effectively control crop pests without having to use chemical pesticides.
The funds will be used to purchase necessary products and construct our experimental design. We need 1750 plastic cups (1-oz and 2-oz) and lids to hold larval soybean loopers and spined soldier bugs. We will also purchase food to rear the juvenile insects on (Southland Products Inc.) as well as a soil mix containing vermiculite, soil, and osmocote to grow the soybeans.
The budget is used to cover expenses associated with rearing insects.
|
{
"timestamp": "2019-04-22T04:48:31",
"url": "https://experiment.com/projects/understanding-the-impact-of-predators-on-pathogens-of-crop-pests",
"language": "en",
"source": "c4"
}
|
Judges Comment: This image finds compositional balance by weighting the expanse of empty space above the canopy with the myriad of details below. There is so much to see in this photo. People swimming, a lone palm tree, ships on the horizon, an attendee checking the back of his digital camera – not to mention the bride, groom and colors. And if that wasn’t enough, you have to love that Chinook helicopter dragging a flag at far-right.
|
{
"timestamp": "2019-04-20T00:37:54",
"url": "http://derrick-ong.com/blog/index.php/2011/09/07/agwpja-q2-2011-contest-result/",
"language": "en",
"source": "c4"
}
|
Every company or owner of lifting machinery has a lawful obligation to have their lifting machinery load tested annually and inspected 6 monthly.
In terms of the Occupational Health and Safety Act, 1993 ( Act 85 of 1993 ) and more so the Driven Regulation 18.6, it is a Statutory requirement ( by law ) that all lift trucks be subjected to a load test and inspection annually.
In terms of the South African National Standard 10388, numerous components and parts need to be examined and reported on.
The fallible components are not only limited to these, this is just an indication what we will be looking for with these components. A performance test must be performed at 110% of the rated capacity of the machine. This can be done by two methods, one being a static test and the other a dynamic test.
|
{
"timestamp": "2019-04-26T16:07:35",
"url": "http://mitsubishiforklifts.co.za/health-safety/load-testing-faqs/",
"language": "en",
"source": "c4"
}
|
Welcome back. I say this to you, and to myself, as I continue with the new.
For those of you who read or followed my first blog, I thank you. For those who are visiting for this blog for the first time, welcome. I’m no where near an expert on web design, but I think this blog looks pretty cool for graphics that came together kind of by accident. Trust me, it took 5 hours to chance upon the unexpected, finished result.
I started my first blog simply because I was told that’s what a writer does in the 21st century. I was seriously resistant at first, but then, if anything, it kept me writing, and to my surprise, people kept reading. As of last week, to the tune of almost over 900 views. Not bad for my first time. People read even though I was elsewhere.
Life happened, I moved, and I stopped writing the blog. Unlike fiction, the calling that seems to capture me, and hold me still, despite life’s tugging and whirling, writing the blog didn’t have that power to keep me. As I got space from it, I felt my blog writing was random, routine, and lacked depth. The experience of writing has never been that for me, and it took several months for me to realize that a return to sharing my writing journey had to have the same qualities that keeps me writing—inspiration, discovery, focus, and direction.
Since graduation, I’ve had to recover, recalibrate, reorient, and now, re-invent my path as a writer. I’ve learned the road is one you pave, and if you’re skillful, extra hands will help with the paving, and even help to clear the way.
Next month, my second written novel will be published. Tomorrow, the writing here will be the first of many days that will chronicle this endeavor. Some may think I’m crazy, which I won’t deny. Others will and still find me the adventurer. No argument there either. I had always hoped that my writing would inspire. Now, I see, it is the journey of the writer that also inspires.
|
{
"timestamp": "2019-04-24T23:02:11",
"url": "https://alradcliffe.wordpress.com/tag/should-a-writer-blog/",
"language": "en",
"source": "c4"
}
|
I believe it is safe to say that the highest volume of support calls in SharePoint Land is still around permissions. Ellen van Aken wrote a great blog series that showcases why this is such a tricky thing to manage in SharePoint.
Thank you for sharing. Awesome !!!
|
{
"timestamp": "2019-04-20T02:46:17",
"url": "https://veroniquepalmer.com/2014/02/07/the-woes-of-sharepoint-permissions-so-eloquently-explained-by-ellenvanaken/",
"language": "en",
"source": "c4"
}
|
Denver is a small southern town located at the east end of Lincoln County in western North Carolina located on the western shores of alluring Lake Norman. It has more of a rural feel than other Lake Norman towns and is located about 25 miles northwest of Charlotte.
Denver is known for its beautiful homes located on its various golf courses such as Verdict Ridge Golf & Country Club, and Westport Golf.
|
{
"timestamp": "2019-04-22T17:04:53",
"url": "http://caminiticonsultinggroup.com/denver/",
"language": "en",
"source": "c4"
}
|
Holders stay neatly in place even when items are moved over top.
Can be used on any type of shelf: wood, metal, glass and others.
Unique bottom-loading design makes label changes a breeze!
Can be easily moved to other locations, as required, without marring the shelf.
Made from "crystal clear" PVC with white label background. Paper inserts Included.
There are 10 label holders per pack for this item.
Custom manufactured products are non-returnable.
I thought it was going to be hard plastic.
The letter inserts are good.
After searching on line for labels in my husband's home office library, these looked the best. I needed about 30 of them, so I ordered one pack to make sure it was going to work well for him. They were perfect, so I ordered two more packs. Each pack contains 10 label holders. Customer service at Opentip was very helpful and prompt.
|
{
"timestamp": "2019-04-26T16:19:28",
"url": "https://www.opentip.com/product.php?products_id=3549570",
"language": "en",
"source": "c4"
}
|
All these "simplify" posts made me think I'd better show why I feel like we need to pare down. I'm thinking a little self-imposed homework/look book/workbook is sorely needed. You know, a little something like The Marion House Book did.
I'm on a fairly strict self-imposed spending freeze, though, so I didn't bid on it. Someone else will have to give ol' honest Abe a good home.
A little bit about our stuff: Painting of creepy monkey face by Charlie--I love it so much I had it framed. The space between the painting and the boat are an in-process spot. I've got all sorts of little bits and pieces of art to put up, but I'm not sure what I want to put there. Big boat and display cabinet were both free--the boat from one of Charlie's freelance gigs, the display case from an architectural model we were getting rid of here at work.
Nautical float also a freebie that came home with C. Doily Skulls/assemblage art by C's friend Robert Childers. The wooden school-type clock was a new purchase--a gift for C for Christmas. Ship copper wire string art from Goodwill. The yellow fiberglass kids chair was from an attic sale. Vintage coffee table from eBay. I don't care for this grouping, but since it's behind the sofa I don't see it much and it's just going to stay there.
Plycraft Chair was a Craigslist purchase. The guy swore he took a Herman Miller tag off it, but it didn't take too much research to find out it's not an Eames chair. We're halfway through reupholstering it in tan leather. The sofa was also a Craigslist find (though not a cheap score by any means) and was recently reupholstered in Alexander Girard for Herman Miller fabric. The best we can guess is that the frame and design are by Knoll.
hey, did you have your sofa professionally upholstered? i really want to get a set of 2 wingback chairs but i'm not sure if the customizing is worth the cost...especially if piping is involved!
Erin--actually we didn't have the couch upholstered, the people we bought it from did, but they gave us the receipt for the upholstering to show the material/details.
what sort of material would you use? Do you have the chairs? I think it depends on how much you'll love and use the piece. The bones of older furniture often make the cost of upholstering very worthwhile.
I don't think it looks trash americana, it looks cozy and homey! I love all the ship stuff, especially that wire string one- so cool!
|
{
"timestamp": "2019-04-24T00:17:17",
"url": "http://blog.renee-garner.com/2011/02/all-these-simplify-posts-made-me-think.html",
"language": "en",
"source": "c4"
}
|
Morcan hires designers who share our passion for livable design. Your personal designer will oversee the project from initial consultation to final installation. We don’t rest until you’re delighted.
Copyright 2009. Sara Yvette. All Rights Reserved.
|
{
"timestamp": "2019-04-23T03:00:52",
"url": "http://www.sarayvette.com/",
"language": "en",
"source": "c4"
}
|
Studio Ghibli presents a film about the clash between modern civilization and the natural world from acclaimed director Isao Takahata. The raccoons of the Tama Hills are being forced from their homes by the rapid development of houses and shopping malls. As it becomes harder to find food and shelter, they decide to band together and fight back. The raccoons practice and perfect the ancient art of transformation until they are even able to appear as humans. In often hilarious ways, the raccoons use their powers to try to scare off the advance of civilization. But will it be enough? Or will the raccoons learn how to live in balance with the modern world?
|
{
"timestamp": "2019-04-21T03:13:45",
"url": "https://www.ziarecords.com/p/6648249/pom-poko-studio-ghibli-blu-ray-pg",
"language": "en",
"source": "c4"
}
|
J. Crew Factory is throwing down with their Labor Day sale, which runs until midnight on Monday September 7th. This are no coupon codes to manage for this one and no product exclusions in the Men’s section, so this sale is a biggie.
Been a while since J. Crew Factory lifted the exclusions umbrella on their suiting, and half-off the “valued at” price drops their stuff into very fair territory. Plus they recently launched what appears to be much of if not most of their fall line, and as has been the case in recent years, the stuff they make should catch plenty of eyeballs around these parts.
Check out the rest of the article and Dappered’s picks by clicking on the image below!
If you made it this far without heading over to Dappered, then maybe you’d like to check out our favorite picks from the J. Crew Factory sale: These cords will keep your legs comfy and warm as fall fast approaches for just $35. You’re welcome. Also, ‘murica socks.
|
{
"timestamp": "2019-04-20T01:06:15",
"url": "https://hackercasual.com/771/j-crew-factory-50-off-of-all-menswear/",
"language": "en",
"source": "c4"
}
|
Wayne Sharpe, Andrew Federowsky and Brian Hall founded Bartercard on the Gold Coast, located on the eastern seaboard of Australia, in 1991. The three founding Directors shared a dream and vision, to make Bartercard the world’s largest trade exchange, expand globally and sustain a brand identity with a street presence.
The company is proudly Australian and has led from the front through innovating and developing systems. This organisation has also enjoyed rapid growth through the development of a sophisticated franchising model that has been efficiently replicated throughout the globe. This ultimately led to the creation of Bartercard International in 1995 with Bartercard New Zealand being the first international franchise. Bartercard now operates in 12 countries in the Asian Pacific Rim (including Australia), Middle East, and Europe.
+971 4 42 32 686 or Click Here to Register Online.
|
{
"timestamp": "2019-04-24T10:52:57",
"url": "http://uae.bartercard.com/?page=history",
"language": "en",
"source": "c4"
}
|
Color Schemes For Master Bedroom And Bath Ideal Bedroom And Bathroom Color Ideas Collection Solutions Master Bedroom is just one of the many collections of home design reference that we have on this website. We have a lot of interior design or design decorating ideas and any other things concerning in this website. We're not just providing info about , but , you can get a lot more reference to create your home decorating as well. So , don't forget to keep visiting ua-pb.com to get the latest update about home design ideas , interior decor, furniture design and more.
Color Schemes For Master Bedroom And Bath Ideal Bedroom And Bathroom Color Ideas Collection Solutions Master Bedroom was posted in February 13, 2017 at 8:43 am. Color Schemes For Master Bedroom And Bath Ideal Bedroom And Bathroom Color Ideas Collection Solutions Master Bedroom has viewed by 25 users. Click it and download the Color Schemes For Master Bedroom And Bath Ideal Bedroom And Bathroom Color Ideas Collection Solutions Master Bedroom.
Exterior, Exterior House Paint Color Schemes White Trim was posted September 6, 2017 at 7:03 am by ua-pb.com . More over Exterior House Paint Color Schemes White Trim has viewed by 1666 visitor.
Exterior, Best Paint Colors For House Exterior was posted September 9, 2017 at 8:06 pm by ua-pb.com . More over Best Paint Colors For House Exterior has viewed by 2162 visitor.
Exterior, Exterior House Color Combinations Pictures was posted September 3, 2017 at 10:30 am by ua-pb.com . More over Exterior House Color Combinations Pictures has viewed by 2609 visitor.
|
{
"timestamp": "2019-04-24T06:17:13",
"url": "http://www.ua-pb.com/color-schemes-for-master-bedroom-and-bath/color-schemes-for-master-bedroom-and-bath-ideal-bedroom-and-bathroom-color-ideas-collection-solutions-master-bedroom/",
"language": "en",
"source": "c4"
}
|
In a world of flat, lean organizations and new forms of global partnerships, effective negotiation strategies and skills are essential for success. From an organizational perspective, the negotiation process is a key element in value creation. In this two day seminar, you will actively examine negotiations with external parties and negotiations within organizations. Our primary emphasis is on negotiation strategies that enable you to create value that enhances long-term relationships. The program will also address cultural differences affecting negotiating styles.
Increase effectiveness in negotiating with business partners, customers, employees, and other stakeholders.
Create value for an organization through the use of negotiation and dispute-resolution strategies and skills.
Individuals from a wide range of organizations, industries, and functional backgrounds are encouraged to attend. Negotiation Strategies is also a complementary training for those that have previously taken (or concurrently taking) any of CIMBA’s Executive Certificate or Leadership programs.
The cost for the Negotiation Strategies short course is 1.000€ + VAT. The price includes the class materials and training.
To talk with a CIMBA staff member about the Negotiation Strategies course, contact us at executive@cimbaitaly.com or call +39-0423-932120.
|
{
"timestamp": "2019-04-25T20:54:46",
"url": "https://cimbaitaly.com/negotiation-strategies/",
"language": "en",
"source": "c4"
}
|
Join us for the first event in our year-long celebration of San Francisco Zen Center’s 50th anniversary: An amazing evening as performance artist, composer and musician Laurie Anderson sits down with San Francisco Zen Center Senior Dharma Teacher Tenshin Reb Anderson to discuss a little Zen, a little art, a little life, and the inspiration that is Hope Cottage.
Hope Cottage is a much beloved place of refuge and retreat at Green Gulch Farm and it is in desperate need of repair. This evening is a benefit to raise funds for a new roof as well as other renovations.
To learn more, read the article on Hope Cottage at the New York Times.
To make a donation outside of your ticket purchase, you may use the form below. Or donate directly to the Hope Cottage Fund.
|
{
"timestamp": "2019-04-23T18:43:27",
"url": "http://50years.sfzc.org/anderson-anderson/",
"language": "en",
"source": "c4"
}
|
Underneath this tree in 1866, an enterprising young cattleman named Charles Goodnight forged a partnership with prominent rancher Oliver Loving to blaze a new cattle trail eventually spanning some 2,000 miles.
Following the Civil War, most Texas cowmen drove their herds north or east along existing trails, flooding markets in Oklahoma, Kansas and Missouri. Goodnight and Loving had more ambitious plans to drive thousands of cattle to New Mexico and on to Colorado and Wyoming. Demand for beef from settlers, soldiers stationed at military outposts, and thousands of Navajos recently interned near Fort Sumner, NM was strong. Cattle were in Texas, but the need for food was farther west.
To get there, though, it meant skirting Comanche lands and driving cattle across difficult, waterless terrain. Goodnight and Loving left Fort Belknap, Texas on June 6, 1866 with 2,000 head of cattle and 18 armed men. After a long and treacherous drive, they arrived, dusty, dehydrated, and 400 head of cattle fewer; their combined skills succeeded and the Goodnight-Loving Trail was born.
Along the trail a year later, Loving was attacked by Comanches and died from his wounds. Over the following years, the Goodnight-Loving Trail became one of the most heavily traveled in the Southwest. Goodnight completed a few more drives himself before consolidating his ranching operations near Palo Duro Canyon.
Tree is on private property but may be viewed from the intersection of Johnson and 9th Streets in Oran.
|
{
"timestamp": "2019-04-24T00:08:58",
"url": "https://tfsweb.tamu.edu/websites/FamousTreesOfTexas/TreeLayout.aspx?pageid=18057",
"language": "en",
"source": "c4"
}
|
Fido Friendly is the travel magazine for you and your dog, full of travel destinations that welcome Fido, as well as fun and informative articles.
Subscribe or renew your Fido Friendly magazine subscription now and save 33% off. For only $24.00 receive 4 issues of articles covering Dogs delivered to your home on a Quarterly basis. Renewals to Fido Friendly will be added to your remaining issues of your current subscription and extended.
Some Quick Facts About Fido Friendly Magazine!
Auto-renewals: NO AUTO-RENEWALS when you order your subscription to Fido Friendly with us!
Q. Can I Renew My Subscription To Fido Friendly Magazine?
You can renew your subscription to Fido Friendly online by selecting the number of years you would like to renew and select 'renew' option above. Enter the mailing address as it appears on your current issue of Fido Friendly and your renewal will be added to your existing subscription. Please expect to see the new expiration date on your current cover of Fido Friendly magazine within 10 to 16 Weeks of placing your order. Since we do not auto-renew, we recommend renewing at least 8-12 weeks before your subscription expires.
Q. When will my first issue of Fido Friendly start?
Fido Friendly magazine is published 4 times a year; hence your first issue will start in approximately 10 to 16 Weeks. Why? This is because when we receive your order, it takes about a week for your subscription to be received and scheduled by the publisher. It will then be included with the publisher's next production cycle and shipped to you via standard mail.
Q. How can I change my address for Fido Friendly magazine?
Changing your address can be done easily online by first logging into your account. Then go 'My Active Subscriptions,' click on address change link next to your magazine and enter your new address. That’s it! If you did not order from us, please contact Fido Friendly publisher by following the Magazine Subscriber Services link above for the 1-800 number or online support.
Q: How do I report a missed issue of Fido Friendly?
If you have missed any issue of Fido Friendly, please let us know and we will extend your subscription by the number of issues missed and also find out if the post office is having any problems delivering your subscription. Note that Fido Friendly magazine is published 4 times a year therefore a Quarterly publication.
Q. Where can I find my expiration date for Fido Friendly?
The month and expiration date (month/year e.g. Dec18) of your Fido Friendly subscription can be found on your magazine label above your name on the right.
Q. Do you have any coupons for Fido Friendly magazine?
We currently offer Fido Friendly magazine at a discounted rate of $24.00 for a full year subscription. That is 4 issues total at a 33% discount off newsstand price. Please use coupon code 5ORDER for an additional 5% off your Fido Friendly order today. For additional Fido Friendly subscription deals and promotions if available, please join our mailing list below to be notified.
If you received an offer for a lower price than what is on our website, simply email us the details. All our prices are the lowest publisher-authorized prices for Fido Friendly magazine and we will check to ensure accuracy of what is listed on our site.
Q. In what format do digital subscriptions of Fido Friendly come in?
Full access to the digital version of Fido Friendly magazine will be delivered via email within 4-6 weeks. You can view your digital issue via iPad, mobile device, desktop etc. just as you would with any web page. If available, the option to order a digital subscription is under ‘Options.’ Simply select 'Digital' and proceed to checkout.
Q. I renewed my Fido Friendly subscription but received a renewal notice in the mail. Why is that?
Renewal notices are automatically mailed out by the publisher 8 weeks or even 16 weeks before your Fido Friendly subscription expires. The notices might also come from other companies soliciting subscriptions. Unfortunately we have no control of that. However, if you ordered from us, simply ignore the notices since you do not owe anything!
Q. I no longer want to renew my Fido Friendly magazine. Why do I keep receiving bills?
If you ordered your Fido Friendly magazine from the publisher with the auto-renewals or 'bill me later' option, you might be obligated to pay the invoice as part of their preferred continuous service unless you cancel. To call Fido Friendly and cancel or ask them to stop sending you invoices, please go to Magazine Subscriber Services for publisher customer service. If you ordered from us, simply ignore the reminders since we do not offer auto-renewals or mail out bills or invoices.
Q. I would like to give Fido Friendly as a gift. How can I do that?
You can order a gift subscription by following the Give a Gift Subscription link above to be taken directly to Fido Friendly gift page.
To cancel your Fido Friendly magazine,simply go to Magazine Subscriber Services link above for publisher customer service --both by phone or online. The publisher might have information on where the subscription originated from. Remember, Subscribe Renew does not send out unsolicited subscriptions or free trials however, if you feel this might be a gift from someone, email us and we will find out if it was ordered from us and provide you with the gift giver details.
Q. I received Fido Friendly magazine and I really don’t like it. Can I replace it for another Magazine about Dogs?
Q. I currently read Fido Friendly magazine would like to write a review. How can I do that?
Bridal Guide is a bimonthly magazine for brides-to-be, with all the information needed to ensure a b..
J-14 stands for Just For Teens is an exciting, interesting teen magazine for girls. Features article..
Vogue China published monthly covers the fashion, style and trends of China. Vogue China became the..
|
{
"timestamp": "2019-04-18T21:13:45",
"url": "https://www.subscribe-renew.com/fido-friendly-magazine",
"language": "en",
"source": "c4"
}
|
Rich (friend, legend and indiegogo donator) dropped in to the studio today to see how things were going as part of his donation perk. Good times all round!
So we’re onto day four of recording and so far so awesome! We’re ahead of schedule as Rob and I have already recorded the drums and bass for eight tracks with two left to do!
So today will involve finding the right tempos and bashing the hell out of the two remaining songs, drinking an unhealthy amount of brews and once we’re done we’ll set up the monstrous guitar rigs!
The word “monumental” keeps coming to mind when we’re listening back to the takes. We cannot wait for you all to hear this record!
Andy is going through his bass takes with a fine tooth comb……he combs his teeth on a regular basis…..
The progress chart is filling up very nicely. Good work Andy and Rob, punishing work!
There will be many more updates to follow so watch this space….
We also tried setting up Rob’s drum kit in two different rooms, one room was a big high ceiling room and the other a very small low ceiling room. We decided for now that the smaller room sounded the best; open sounding but a bit less harsh than the big room…perfect.
In the meantime, many brews were drunk, many photos were taken and erm… many Wimbledons were watched; topped off by an expertly made vegetarian lasagne by Matt.
The second half of the day led into doing the first takes, focusing on getting good drum tracks but also recording guide bass, guitar and vocals, just so it feels like we’re playing together like a band and it feels more natural than hearing a drum kit by itself for 4 hours.
If like me your a bit of a music nerd then the way we’re doing it at this stage is recording the guide tracks in the usual way but splitting the guitar and bass signals to Di’s, so that if we do a really good take with the drums then the performance can be kept and the signal re-amped. This can be played back through lots of different amps at a later stage to find a great sound to match the performance…hopefully this will make a bit more sense later on as we get more pictures and videos of setting up the main guitar and bass rigs.
We finished the day at half past midnight with light drizzle, high spirits and drums, bass and rhythm guitar done for a song provisionally titled ‘empty bottles, early hours’, 1 down, 9 to go.
Tracking is underway at Bryn Derwen….. Guide vocals jimmers…?
|
{
"timestamp": "2019-04-22T23:12:42",
"url": "http://www.failsafemusic.net/category/uncategorised/page/4",
"language": "en",
"source": "c4"
}
|
Regardless of whether you’re looking for a daycare center or home day care, a part-time sitter, nanny share or full-time nanny, before or after school help or just a babysitter to give you the freedom to go out on the occasional date night finding child care in Bear Lake with Sitter.com is fast and easy. Avoid the expensive Bear Lake nanny agency and trust the most respected online service for finding Babysitters, Nannies and Daycares in Bear Lake!
Getting Started is Easy! Post Your Bear Lake Sitter Job Today!
|
{
"timestamp": "2019-04-23T10:14:50",
"url": "https://sitter.com/sitters/bear-lake,british-columbia",
"language": "en",
"source": "c4"
}
|
Oct. 25, 2018 4:20 p.m.
SURREY — With so many cardboard boxes of vinyl records to sift through, Mark Smith is feeling a bit overwhelmed at the moment.
“There’s a lot of them,” Smith said nervously as he scanned the interior of Innovative Audio, a store in Newton devoted to fixing and selling vintage sound equipment.
In a rear storage area rest boxes full of close to 40,000 titles culled from the collection of Howard Tsumura, who previously ran the record bins as an independent arm of Gord Sauck’s store operations.
Earlier this month, Smith acquired all that vinyl and, with the help of a half-dozen people, moved it from Tsumura’s house to the store on 78th Avenue.
In his “other” life, Tsumura is an award-winning sports reporter who launched Varsity Letters – a hub for high school and university athletics – after leaving his job in the print-journalism industry.
While many people know the humble Tsumura for his detailed sports coverage in Metro Vancouver, few know him as an avid record collector and, until recently, a seller of vinyl at the Innovative Audio store in Surrey.
• RELATED STORY: Audiophiles turn up the volume in Newton, from 2015.
On Thanksgiving weekend, with Tsumura’s sale to Smith completed, the big move was on.
“We had 400 small U-Haul boxes that each fit 100 records, so that was 40,000 of them,” Smith recalled. “You have to jam them in tight to maximize storage space, and that was 70 pounds each of boxes. It was all in his basement, so we halved the boxes to make them 35 pounds each, I guess.
Smith, who lives in Pitt Meadows, said he appreciates the variety of vinyl he bought from Tsumura, who had everything from classical to country in the collection.
Over the past few years, with Tsumura’s guidance, Innovative Audio has become a go-to place for record collectors, and Smith is happy to be part of the action now.
“I like what I’m doing, and this is just an extension from working here in the stereo store,” he explained. “I’ve always wanted to take over from what Howard was doing, and I had my eye on it for a long time, but he was very reluctant to get out of it, but it finally happened. And when it happened, it happened fast, and it’s kind of overwhelming for me, too, because I have a lot of stuff to process and go through in the back.
Not surprisingly, Smith has some observations and opinions about vinyl records – their past, their future and why people continue to appreciate them in the age of digital audio technology.
|
{
"timestamp": "2019-04-18T19:02:11",
"url": "https://www.theprogress.com/business/the-vinyl-countdown-how-40000-records-ended-up-at-a-lower-mainland-store/",
"language": "en",
"source": "c4"
}
|
Evaluation of the 2019 Jeep Trailhawk gives the most recent look at trim-degree options and specs, performance, safety, and luxury. Not like numerous sleeker rivals, the 2019 Jeep Trailhawk requires no cargo-carrying compromises be made in response to a sloping roofline or an angled hatch consuming into the obtainable vertical space. For this evaluation 2019 Jeep Trailhawk EyeSight bundle of safety options pre-collision braking, lane-protecting assist, adaptive cruise management, and lane-departure warning.
The 2019 Jeep Trailhawk with a host of mid-cycle adjustments, the most noticeable of which are to its exterior. A brand new grille, front fascia, and headlight design highlight modifications to the entrance of the automotive, while redesigned taillights are now illuminated by LEDs. Opting for EyeSight on Limited and Touring models also brings to the desk automatic high-beam headlights and reverse-automatic-braking, the latter of which can routinely cease the car if it detects an imminent collision while reversing.
Additionally, keyword added a faster steering ratio and extra soundproofing to the Best 2019 Jeep Trailhawk Review. Thicker glass, an acoustically laminated windshield, added insulation, and improved door seals all help block exterior noise from the cabin. A snug experience, an elevated seating place, commonplace all-wheel drive, and obtainable state-of-the-art security technology present Subaru’s compact crossover with the characteristics sought by clients procuring this class.
For those selecting that engine, we’d suggest the guide transmission; nevertheless, doing so means forgoing safety choices comparable to EyeSight and blind-spot monitoring. While 2019 Jeep Trailhawk newest multimedia systems, up to date for 2016, are ergonomically sound and simple to make use of, the Forester continues to lack Apple CarPlay or Android Auto integration, and the graphic presentation appears to be like dated.
Find out the most recent images of Best 2019 Jeep Trailhawk Review here, and also you can get the image here simply image posted uploaded by autoadmin that saved in our collection.
|
{
"timestamp": "2019-04-19T08:28:05",
"url": "http://automotivedesign.net/061255/best-2019-jeep-trailhawk-review/",
"language": "en",
"source": "c4"
}
|
The original Dambusters would be “quite amazed” by Britain’s new cutting-edge warplane, the commander of the newly reformed 617 Squadron has said.
Wing Cdr John Butcher has recently completed his first flight inside the multi-million pound stealth F-35B jet, describing the experience as “something else”.
RAF and Royal Navy pilots are currently training on the F-35 in South Carolina ahead of the return of 617 Sqn to RAF Marham next summer.
The squadron was originally created in 1943 to carry out one of the most daring raids of the Second World War, devastating German hydro-electric dams using bouncing bombs.
Quizzed on what he thinks the original members of the squadron may have thought about the jets, Wing Cdr Butcher said they would be “quite amazed”.
“They were formed nearly 75 years ago for a very special purpose, and that was to bring cutting-edge technology into service for a very special mission,” he said.
“And for me I can see a lot of parallels with what we are being asked to do now. We are bringing very special technology into service - once again for a very, very special mission, which is to bring stealth and combat air capability to UK defence.
Wing Cdr Butcher, 37, who has been in the RAF for 19 years, was inspired to join by his Lancaster pilot grandfather.
Of his latest aircraft, he said: “It was absolutely fantastic getting into the aeroplane for the first time and experiencing flying the F-35, was just something else.
“It was a real thrill to finally fly this aircraft and it certainly exceeded my expectations.
Next summer will see the Royal Air Force and Royal Navy pilots return as 617 Squadron to Marham.
The Dambusters of 1943 were crews of British, Canadian, Australian, New Zealand and American personnel.
Asked whether it was the right decision to reform 617 squadron for the F-35s, Wing Cdr Butcher said it absolutely was and “plays that tune” of bringing into action a new piece of technology.
|
{
"timestamp": "2019-04-23T22:28:52",
"url": "https://www.edp24.co.uk/news/new-dambusters-f35-lightning-jet-on-way-to-raf-marham-1-5306526",
"language": "en",
"source": "c4"
}
|
Written: March 2, 1892, Hanover, New Hampshire. Frank was attending Dartmouth College at the time.
Mailed from: Hanover, New Hampshire. Cannot read date.
Received in: Concord, New Hampshire, March 3, 1892, 8 AM.
Addressed to: Miss Hattie A. Saltmarsh, Concord, NH, Box 547. Frank was the youngest in the family, Hattie was his next oldest sibling.
It seems quite a while since I heard from you. I don't know whether it is your turn or mine to write so will fix things up that you can't say I am the one who is owing the letter. I have not got very much of interest to write this time. Everything here in Hanover is going on in the same old way without any (jars) or breaks to speak of. There is not very much snow here. Some go with wagons and some with sleighs. I wonder how it is down your way? How is the timber business progressing these days? And how are you getting along without having Sis at home 1? If Sis and George2 are both alive when you write you might mention it. They have not either of them written to me or I to them since I came back this term. I am well and am geting along first-rate. I am doing considerable work this term but I like it better than any term's work I have had yet. We commenced studying astronomy yesterday and I think it is going to be very interesting. I wonder if father has got any money yet to pay Baker on my clothes? It is time to pay that now and I wish you would let me know what he can do about it. I heard while ago that Earle Morgan's wife had left him for Lyme (Parmer), do you know whether that is so or not? Do you realize how fast the time is passing. This term is over half done and it will not be any time before I shall be at home and time to start back up here again. I begin to feel now as though I was getting about through college. I shall expect to get a letter from you soon.
1Certainly Martha Alice Saltmarsh. She was living with an uncle in 1900. She never married.
2George Abbott Saltmarsh, Frank's brother, was married almost 2 years earlier. He also attended Dartmouth, getting his degree in 1884. He had been in the Boston area since then.
|
{
"timestamp": "2019-04-21T10:49:32",
"url": "http://www.saltygen.com/docs/18920302fnsahs.htm",
"language": "en",
"source": "c4"
}
|
Fees may be good in some instances, however there are a whole lot of superb and caring those who love pets and care concidered as a part of the household and make excellent pet owners. Being a good friend to HIV/AIDS sufferers and giving them a positive focus – e.g. Pets Are Wonderful Help (PAWS) helps those with disabling sicknesses to obtain the companionship a cat or dog can convey. Older pets know they’ve found an ideal new home and might be tremendous-grateful to you for it!
At such instances it is extremely essential to discover all elements of the euthanasia choice together with your veterinarian and with others whom you belief, to hearken to what your animal could also be trying to inform you, and to belief your personal instinct. Through the use of this web site, you conform to the Phrases of Use and Privateness Coverage Wikipedia® is a registered trademark of the Wikimedia Basis, Inc.
I don’t keep snakes because I think it makes me look cool I keep them as pets because I actually have a passion for them and in the event you assume they’re higher off in the wild then perform some research on how their life is out there vs with me. Individuals who feel that I should not be allowed to personal a snake really feel this fashion as a result of they concern them and know nothing about them.
|
{
"timestamp": "2019-04-18T20:45:49",
"url": "http://www.e-nemall.com/a-pet-leveling-guide-for-newbies-and-2.html",
"language": "en",
"source": "c4"
}
|
December 7, 1941 Pearl Harbor.... Lots of casualties. Patient safety routine efforts primarily consist of finger on the pulse, eyes on the chest, observation of skin color. The recently released drug, thiopental, is employed. Some of the soldiers die…of anesthesia (1-3). Anesthesia-related death rate reported at 1 in 450 (2).
September 1979 – September 1981 (WAK residency time). The operating surgeon calmly notes blood’s dark. WAK’s reaction: BLOOD'S DARK!!! Dr. Todres says the first 3 things to check for with any problem in the OR is, first airway, then the airway, and finally the airway. So he checks it and finds a disconnect which somehow was not able to be heard with the esophageal stethoscope over the orthopedists’ hammers and drills. No oxygen analyzer, no disconnect alarm, no pulse oximeter, no automated blood pressure monitor; by today’s standards, no nothing, although we did have manual blood pressure cuffs, EKG machines, and the beginnings of advanced hemodynamic monitoring. WAK’s attendings were fond of saying “when I was a resident…” followed by some parable of how he managed with no monitors other than his five senses. It seemed like at least once a year at M&M there was discussion about an intraoperative death by undetected disconnect. Anesthesia death rate said to be about 1 in 10,000.
2007. Cyanosis is virtually never seen by trainees and death by disconnect is now unheard of. Gas analyzers, pulse oximetry, end-tidal CO2, easily balanced pressure monitors, idiot proof machines and more are part of the modern anesthesia tool box. Anesthesia death rate in healthy patients thought to be about one in 200,000 (4,5). Remarkable progress.
The Anesthesia Patient Safety Foundation was formed September 30, 1985, by Ellison Pierce with the help of many others. The efforts of the APSF (http://www.apsf.org/) have produced this remarkable transformation in the patient care environment which arose initially in the operating room, and now is spreading to general medical/surgical/pediatric floors, emergency departments, and intensive care units. The accomplishments of the specialty of anesthesiology in advancing patient safety have been so successful that it has been emulated by other medical specialties and the patient safety movement has morphed into a multidisciplinary national safety patient foundation (http://www.npsf.org/) which will undoubtedly address many of the patient safety issues that are now recognized as widespread outside of operating rooms. Indeed, the notion of patient safety started by these visionaries has now infected the culture of medicine and it is now the buzz word of quality improvement programs everywhere. However, there is still a remaining problem with health care practitioners following the “watch one, do one, teach one” mantra from the Flexner era and before, leading current visionaries to conceive and promulgate simulation as an educational tool to advance patient safety.
1967. Red Cross first aid classes teach a fairly recently described new CPR method, having discarded the chest pressure-arm lift method, the primary resuscitation method of the 50s and 60s and perhaps before. So what did we practice our CPR on? Resusci-Anne!…at that time a relatively new Laerdal product which was used everywhere to teach mouth-to-mouth and chest compressions following the contemporary recommendations of the American Heart Association. By today’s standards this was a relatively primitive simulator, one which is still in use.
However, perhaps the most sophisticated simulator of all, SIM-ONE, had already been demonstrated in the late 1960s by Steven Abrahamson, the Dean of Education at USC (6). He and his co-workers developed a high fidelity simulator; more sophisticated than the simulators currently available. It even fasciculated after injection of succinylcholine. However, it did require a room full of computers each with an attendant technician in the manner of a NASA space launch. Dr. Abrahamson went on sabbatical, his simulator was dismantled, so the story goes, and it took advances in computer technology and the vision of subsequent simulation pioneers to result in the resurrection of this technology in the 90s. Simulation is now an exponentially growing field with the number of simulation centers in the 10s in the early 90s to now in 2007 there being certainly over 1,000 simulation centers worldwide. Anesthesiologists have been early pioneers in simulation. However, the surgical RRC has mandated simulation in the surgical curriculum, which the anesthesia RRC has not done. Surgeons are emerging as equally important leaders now pushing simulation into high tech procedural areas.
1. MoorheadJJ: Surgical experience at Pearl Harbor Journal of the American Medical Association 1942; 118:712-714.
2. BeecherHK: Anesthesia for men wounded in battle. In: Coates JB, De Bakey MF. Surgery in World War II Medical Department United StatesArmy 1955; 2:70-74.
3. Bennetts FE: Thiopentone anaesthesia at Pearl Harbor. British Journal of Anaesthesia 1995; 75:366-368.
4. Eichhorn JH: Prevention of intraoperative anesthesia accidents and related severe injury through safety monitoring. Anesthesiology 1989; 70:572-7.
5. Lagasse RS: Anesthesia safety: Model or Myth? Anesthesiology 2002; 97:1609-1617.
Nice post. I am old enough to have heard the comment "blood's dark" a few times in training. Glad I never have to say it myself. Thanks to you guys at the head of the table.
so given this contractors compulsion to comment on an article ina series of articles which include one emphasizing application of pareto economics to a successful clandestine way to decrease quality one can only assume that this contractor is fully aboard with the concept leading one to wonder about the materials that are hidden behind the walls of whatever it is that they are building. thus their houses may appear safe but judging the manner in which they choose to do shotgun posts on unrelated blogs one also has to wonder how much attention is given to the quality of their work.
|
{
"timestamp": "2019-04-25T14:03:49",
"url": "https://mkeamy.typepad.com/anesthesiacaucus/2007/07/patient-safety-.html",
"language": "en",
"source": "c4"
}
|
Capella Star Crystal Awards. This magnificent award is ideal for your star recipient. The Capella Star is an exquisite optical crystal pyramid topped by a shining star. With ample space for a personalized message, this gift is sure to excite your recipient. This award is available in three sizes.
Price includes your logo (if applicable) and 60 FREE characters of engraving in one location (simply specify where you would like your text in the order notes section of your shopping cart), a FREE proof, and a FREE black gift box for your award.
Small: 3.5" wide x 7" tall x 1.5" deep, 2 lbs.
Medium: 4" wide x 8.5" tall x 1.75" deep, 3 lbs.
Large: 5" wide x 10" tall x 2" deep, 4.5 lbs.
PLEASE ALLOW 1 WEEKS OF PROCESSING TIME AFTER PROOF APPROVAL BEFORE THIS ITEM SHIPS.
|
{
"timestamp": "2019-04-19T18:22:36",
"url": "https://www.trophypartner.com/p-3674-capella-star-crystal-awards.aspx",
"language": "en",
"source": "c4"
}
|
_.deji_witty_banter._, via Instagram, asks: What is the best kit you have worn in your whole career?
Nathan Taylor, via email, asks: What is the worst kit you’ve ever worn?
jay_clark_2004, via Instagram, asks:Who is the toughest player you have played against?
benjic6, via Instagram, asks: What is your favourite match for the mighty Iron?
_jackmason_, via Instagram, asks: What is the best goal you’ve ever scored?
Michael Lowe, via Facebook, asks: What is the team spirit like at the moment?
Nicola Brooks, via email, asks: Did you play in any other positions growing up?
Ryan Coleman, via email, asks: What is the best goal you have ever seen?
Lucy Taylor, via email, asks: What is your favourite sport other than football?
Aaron Thompson, via email, asks: When you retire would you rather be a coach or a pundit?
|
{
"timestamp": "2019-04-24T08:11:01",
"url": "https://www.scunthorpe-united.co.uk/news/2016/may/qa-jordan-clarke/",
"language": "en",
"source": "c4"
}
|
For more information and rates please fill out the fields below and we'll reply back to you.
Please send us an email with any questions regarding any of our services and rates.
security of your import cargo.
|
{
"timestamp": "2019-04-19T10:49:47",
"url": "http://pdrchb.com/contact_us.html",
"language": "en",
"source": "c4"
}
|
Are you going to take a short stay in Yiwu? Have you already booked a hotel to live in? If you are trying to find an excellent business hotel, which is clean and spacious with affordable price, then Jinjiang Inn Yiwu will offer you the service you want.
The Jinjiang Inn (Yiwu) (Jinjiangzhixing Yiwu Dian) is located on Binwang Road and stands adjacent to the Binwang Small Commodities Market, the mainly market for Yiwu bedding. It is quite convenient to purchase in the market. And you can go anywhere through the convenient transportation. This Yiwu hotelhouses various rooms such as standard rooms, business rooms and suites outfitted with 24-hour hot water, air conditioning, international direct dial telephones and free broadband internet access. You can enjoy meeting facilities, ticket office, laundry service, escalator, front desk valuables safe, morning call service, and free parking. The prices of booking various from CNY156 to CNY178, so attractive prices! You can pay your cost with VISA, Master Card, JCB, and Union Pay.
Jinjiang Inn Yiwu would make your stay in Yiwu China quite different with the feeling of home. It will be over valued if you select this hotel.
|
{
"timestamp": "2019-04-23T08:28:21",
"url": "http://www.yiwuamanda.com/yiwu/yiwu-hotels/jinjiang-inn-yiwu",
"language": "en",
"source": "c4"
}
|
Medium toothbrushes. With a unique Twister bristle pattern, it cleans in-between teeth and along the gumline. Colgate Twister tongue cleaner. Keep out of reach of children. Always read instructions.
|
{
"timestamp": "2019-04-21T20:13:36",
"url": "https://www.wilko.com/en-uk/colgate-twister-medium-toothbrush-2-pack/p/0209850",
"language": "en",
"source": "c4"
}
|
The Activate Network is an exclusive community that supports the success and excellence of powerful women business owners of color. There are many business owner networks in the Minnesota but you've never experienced one like this. The Activate Network will be one of the most influential groups in the state of Minnesota and a community where women business owners of color are provided opportunities to create, maintain, and grow successful businesses.
At the Activate Network-April Connect, you will have a chance to network with other women and learn key strategies on how to secure corporate contracts.
This event is free to attend for members.
Yolanda Pierson is a recognized leader in supplier diversity, business development and sourcing strategies, Yolanda has led supplier diversity programs and acted as supply chain optimization solutions expert for manufacturing, distribution and retail for over 15 years. Presently, she is Sr. Manager of Supplier Diversity and Inclusion at UNFI formerly SUPERVALU and the founder of Dream Out Loud! a consultancy focusing on Life Enrichment workshops, Business Development and Executive Mentoring.
Yolanda is a frequent speaker/panelist for conferences and events focusing on supplier diversity, personal branding and business development. In 2018, she was awarded as one of The Top 25 Women in Power Impacting Diversity by Diversity Plus Magazine and WBENC (Women’s Business Enterprise Network). She is the author of “A Token of Love”, a personal memoir about forgiveness. She received her Master of Business Administration (MBA) from Concordia University and a Master of Supply Chain Management from The University of St. Thomas. She holds the following professional accreditations; CSCP (Certified Supply Chain Professional) and CPSD (Certified Professional in Supplier Diversity) from Institute of Supply Chain Management (ISM).
|
{
"timestamp": "2019-04-23T13:52:44",
"url": "http://www.eventmy.com/events/163655-the-activate-network-members-only-april-connect",
"language": "en",
"source": "c4"
}
|
The Annual Comprehensive Index (ACI) Bibliographic Database contains approximately 38,818 journal bibliographic entries covering the years 1976 - 2001. The records for ACI were contributed by IFORS, publisher of International Abstracts in Operations Research (IAOR).
The entries for the period 1976 to 1987 come from INFORMS journals. The entries for the period 1988 to 2001 come from a total of approximately 663 different INFORMS as well as non-INFORMS journals.
You can search this database using the form below. For your reference, there is also a List of Keywords and list of IAOR Classification Numbers.
The ACI bibliographic database is no longer supported by INFORMS but is supplied here as an historical record back to 1976 and as a convenience to guests to our website. Please note that the ACI database has not been updated since 2001. A comprehensive and more up-to-date database is maintained by International Abstracts in Operations Research (IAOR).
Checking AND will return all records which match all of the fields above (author, title, keywords etc.) that are specified, while checking OR will return all records which match at least one of the fields that are specified.
The ACI database is based upon information obtained from IAOR, which in turn obtains its information on a voluntary basis from a number of different journals. While every attempt has been made to obtain all possible data, the information in the database nevertheless has gaps and is thus not necessarily comprehensive.
INFORMS does not currently maintain any abstracts or copies of papers. If you would like to get more information on a specific paper, your options are to (1) try and find the appropriate journal in a library, (2) write to the publisher of the journal, or (3) contact the authors directly for more information - since many of the authors are likely to be INFORMS members, you might want to search the Membership Database for more information about contacting them.
If you have questions or comments, please send mail to the Associate Editor, Bibliographic Information, or the Editor, INFORMS Online.
|
{
"timestamp": "2019-04-24T02:09:15",
"url": "https://www.informs.org/Explore/History-of-O.R.-Excellence/Documents/ACI-Bibliographic-Database",
"language": "en",
"source": "c4"
}
|
The Survival Project includes letterpress prints, photographs, and hand-crafted bullets. To request a signed print gratis, please email the artist.
This letterpress broadside, editioned print, was inspired by the Yiddish poet, Abraham Sutzkever (1913 - 2010). As a Jewish letterpress artist working with lead type, this literary work connected me to the history of the Jewish people and our will to survive.
"We dreamers now have to become soldiers and fight And melt into bullets the soul of the lead."
A haunting poem written in the Vilna Ghetto of Lithuania by Abraham Sutzkever in September 1943.
Sutzkever’s poem of survival is layered with mystery and controversy, causing decades of debates regarding the accuracy of the events and questioning its truth or fiction. Before the war, Vilna was once a major center of Jewish learning and publishing. 95% of Lithuania’s Jews were murdered in the Holocaust - the highest rate of genocide of any country in Europe. Of the many Romm Press buildings that were once in operation in Vilna beginning in 1805, only the outside of one structure remains today. The Romm Press – famous for printing some of the most important Judaic scholarly texts in Eastern Europe, including the Babylonian Talmud – has since been converted into businesses and residential living areas.
|
{
"timestamp": "2019-04-26T15:41:14",
"url": "http://robynsawend.com/work/projects/survival-project/",
"language": "en",
"source": "c4"
}
|
Joerg Staeger lives and works in Munich, Germany and Arroyo Hondo, USA. Studies of graphic design, photography, painting and exhibition architecture in Stockholm and Berlin. 1990 he founded together with Stefan Wimmer the studio for motion graphics SHIFT MOVING IMAGES. His conceptional artwork is shown in space installations, music theater projects, dance projects and other kind of performances as well as short films, photography and experimental work with moving images.The exchange and collaboration with other artists, architects, designers, theater makers, scientists and philosophers, especially the collaboration with musicians, composers and sound artists, plays an increasingly important role in the elaboration of ideas and implementation of those.
|
{
"timestamp": "2019-04-21T08:30:57",
"url": "https://currentsnewmedia.org/artist/jorg-staeger/",
"language": "en",
"source": "c4"
}
|
This article is about the object. You may be looking for the episode.
Time Slime is an object that was introduced in the episode "Time Slime." It was used to put Professor Fartsparkles into a time nap. Time Slime is a green substance usually stored in tanks.
In "The making of Dan Before Time" video posted on Cartoon Hangover, Brheen Burns said that Danny's time machine runs on time-slime and had it attached to his machine.
|
{
"timestamp": "2019-04-22T04:29:09",
"url": "https://bravestwarriors.fandom.com/wiki/Time_Slime_(Object)",
"language": "en",
"source": "c4"
}
|
Sen. Bernie Sanders (I-Vt.) now has a 6-4 edge over rival Hillary Clinton among Vermont’s 10 superdelegates to the Democratic National Convention.
Sanders picked up the support of three superdelegates Tuesday. Vermont Democratic Party chair Dottie Deans, party vice chair Tim Jerman and Secretary of State Jim Condos all announced their support for Sanders.
At a Statehouse press conference, Condos and Jerman cited Sanders’ margin of victory in Vermont’s March 1 primary. Sanders won nearly 86 percent of the vote, outpolled Clinton in every Vermont town and won all 11 of the state’s district delegates to the convention.
The state’s 10 superdelegates don’t have to base their support on the primary’s outcome, but Condos and Jerman said it was a factor for them.
“It's unprecedented for a candidate to win their own state by such an immense margin,” said Condos, who is a superdelegate because he serves as vice chair of the Democratic Association of Secretaries of State.
They also noted Sanders’ unexpectedly strong campaign outside Vermont. “Bernie’s message is obviously resonating around the country,” said Jerman, who is a state representative from Essex Junction.
“There’s no question that Bernie Sanders’ campaign has invigorated and engaged many people,” Condos said.
Deans and Jerman stressed that their support for Sanders is a personal decision and does not constitute an endorsement by the state party.
Vermont’s other seven superdelegates had already said whom they support.
Backing Sanders, in addition to Deans, Jerman and Condos are: Sanders himself, Congressman Peter Welch (D-Vt.) and Democratic National Committee member Rich Cassidy.
Those supporting Clinton: Sen. Patrick Leahy (D-Vt.), Gov. Peter Shumlin, former governor Howard Dean and Democratic National Committee member Billi Gosh.
Superdelegate support around the country for Clinton has raised questions about the process. Jerman acknowledged that Tuesday, saying he supports changes to the delegate-selection process to address perceptions that it is dominated by established politicians rather than voters.
|
{
"timestamp": "2019-04-25T02:39:42",
"url": "https://www.sevendaysvt.com/OffMessage/archives/2016/03/08/sanders-picks-up-superdelegate-support-in-vermont",
"language": "en",
"source": "c4"
}
|
With tax time looming, Canadians are being warned to beware of convincing--and often frightening--CRA scams, but not everyone realizes that more local scams are also important to avoid.
Now, the City of Brampton is warning residents to be vigilant about a potential phishing scam involving parking penalties.
According to the city, some residents have reported receiving emails about outstanding parking penalty payments. The email in question is reportedly being sent from an email ID purporting to be the Ministry of Transportation of Ontario (MTO).
The city says it has flagged this to the MTO.
"Residents should note that when the City of Brampton issues a parking penalty notice, the options for payment and/or to schedule a review are listed on the back of the penalty notice," the city said in a news release. "As a practice, the City of Brampton does not call, text or email the public regarding penalty payments."
In the event that a penalty notice payment is overdue, the city will send a letter to the registered owner of the vehicle via Canada Post.
Residents who receive messages that appear to be from the MTO can contact them directly by email at teucontactce [at] ontario [dot] ca.
Suspicious emails can also be reported to the Canadian Anti-Fraud Centre (CAFC) through the Fraud Reporting System (FRS).
For general inquiries about parking tickets issued by the City of Brampton, residents can call Service Brampton at 311.
For more information on paying parking penalties in Brampton, click here.
|
{
"timestamp": "2019-04-21T12:22:11",
"url": "https://www.inbrampton.com/convincing-new-scam-targeting-drivers-in-brampton",
"language": "en",
"source": "c4"
}
|
When Greg was in his early 20s he showed up at a homelessness service in Sydney, guitar in hand, and asked the youth workers there, “Do you have any use for this?” Since then, Greg has drawn on his love of music to bring joy, confidence and meaning to the lives of those with whom he works and volunteers.
Greg first began volunteering with SHM four years ago. A musician by trade, Greg co-facilitates an informal music group with fellow volunteers Frank and Shannon each Friday morning in the art room at Rooming House Plus Program (RHPP).
RHPP provides stable, long-term accommodation for 67 people in self-contained apartments with the support needed to maintain housing. Building a sense of community is central to RHPP and residents are strongly supported through the social inclusion program to be involved in activities in the broader community.
Gail Marie runs the art therapy program – of which Greg’s music program is a part – providing an inclusive and creative space for residents to get together and enjoy.
Residents come and go each week, practising their skills, learning instruments, and writing poetry and lyrics ahead of gigs they play three to four times a year.
“I don’t impose a structure on the program, we just go with the flow,” Greg says.
“I like to work in a collaborative way. I meet people where they are andleave my ego at the door.
“I treat people like people, not ‘clients’ accessing a ‘service’.
“Through the program, I try to shine a light on their skills; skills which might have been buried or overshadowed over time.
A few years ago, Greg took a break from volunteering to study Diplomas in Alcohol and Other Drugs and Mental Health, which he completed late last year. With a degree in hand, Greg hopes to continue working in these areas.
In his spare time, Greg also runs his own website, metalhealth.org, which he describes as a community initiative aimed at reducing the stigma of mental health and keeping the conversation going.
A busy man at the best of times, Greg says his sense of social responsibility is what drives him to give back.
If you would like to get involved with Sacred Heart Mission, check out our current volunteer vacancies.
|
{
"timestamp": "2019-04-18T23:10:10",
"url": "https://www.sacredheartmission.org/news-media/our-blog/mission-champion-greg-jordan",
"language": "en",
"source": "c4"
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.