pred_label stringclasses 2
values | pred_label_prob float64 0.5 1 | wiki_prob float64 0.25 1 | text stringlengths 145 1.01M | source stringlengths 39 45 |
|---|---|---|---|---|
__label__wiki | 0.610684 | 0.610684 | France: King Hussein Of Jordan Re-States His Position On Middle East Peace During Official Visit. 1978
VLVA37PYBII91NHDSVA5B0AQZLUZZ-FRANCE-KING-HUSSEIN-OF-JORDAN-RE-STATES-HIS-POSITION-ON-MIDDLE
King Hussein of Jordan, on a three-day official visit to Paris, has had talks at the French Foreign Ministry and the Elysee Palace.
LV INTERIOR King Hussein of Jordan and officials arriving at Quai D'Orsay, Paris.
SV King Hussein seated at table with officials (4 shots)
SV King Hussein speaking to newsmen in English and SV King Hussein speaking in Arabic.
TRANSCRIPT: REPORTER: "Majesty, about the Palestinian problem Where will it be solved? Inside or outside the Camp David negotiations?"
SEQ. 3: HUSSEIN: "Our position is very clear in this regard. We have always been after the establishment of a just and durable peace based on the implementation of Security Council resolution 242 and 338. And it has to be durable peace. For it to be lasting, it has to be a just peace the generations that follow could accept and live with."
REPORTER: "Could that peace be not far off?"
HUSSEIN: "That does not unfortunately depend on me only."
United Nations Resolution 242 was unanimously adopted by the Security Council on 22 November, 1967. It calls for the withdrawal of Israeli forces from all territories occupied during the Six-Day-War as a major requirement for a lasting peace in the Middle East. Resolution 338, passed in October, 1973, called fro an end to the fighting at that time and urged implementation of Resolution 242.
Initials HS/
Background: King Hussein of Jordan, on a three-day official visit to Paris, has had talks at the French Foreign Ministry and the Elysee Palace. On Tuesday (12 December) he told newsmen that there could only be lasting peace in the Middle East if Israel withdrew from all territories occupied in the 1967 war.
SYNOPSIS: The King's first meeting was at the Quai D'Orsay offices of the newly-appointed French Foreign Minister, Monsieur Jean Francois-Poncet. The Minister is President Valery Giscard d'Estaing's closest political associate and the talks centred on the Jordanian approach to the Palestinian problem. Later, King Hussein visited president Giscard for talks which were expected to involve Arab and Jordanian thinking, following last month's 'hard-line' summit in Baghdad. After the meeting he spoke to newsmen.
King Hussein's visit is the first leg of a European tour to Italy, the Vatican and Britain. It follows a four-day visit to West Germany in November.
HUSSEIN
RE-STATES
VLVA37PYBII91NHDSVA5B0AQZLUZZ
Raf Dive Bombers Attack Japanese Positions
Aeroplanes from the Royal Air Force attack Japanese targets in the jungle
Bombarding The German Positions
Large guns are fired on Germans in French countryside
South Vietnam: Government Troops Attack Vietcong Positions.
IN SOUTH VIETNAM THE FIGHTING CONTINUES. HERE ARE SCENES TAKEN SHORTLY AFTER BITTER FIGHTING IN?
Exposed Position For Belgian Army
Belgian army rapidly descends an exposed hillside
Raf Bombers Attack Japanese Positions In Minbya
Bombing raids in Union of Myanmar (also known as Burma)
Cyprus: Greek Cypriot Hotel Position Dismantled
PRESIDENT MAKARIOS YESTERDAY (SATURDAY) ORDERED THE REMOVAL OF A NEW SANDBAGGED POST OUTSIDE NICOSIA'S LEDRA PALACE HOTEL.
Holland: Restaurant Towed Into Position Off Pier.
BUILDING A RESTAURANT IN THE NORTH SEA IS NO EASY TASK. BUT BUILDING A RESTAURANT?
Vietnam: Hue, Last Position Of Struggle Force
Saigon May 24.- At 5,00PM of May 23, 1966 nearly 30,000 buddhists grouped at the Dieu De pagoda in Hue to pray for those who were killed in Danang fighting.- Powerful buddhist leader, venerable Thich Tri Quang condemned the US support to government troops to kill vietnamese in Danang and destroy the democracy request of the people, Tri Quang also ordered Buddhists to be calm and await for the final order of the fight if it will be in need of. | cc/2020-05/en_middle_0078.json.gz/line913 |
__label__wiki | 0.824169 | 0.824169 | Tag Archives: David Montgomery
Reuters: Newspaper chief Montgomery “forced out” of publishing group
Former News of the World editor David Montgomery has announced he will retire from Mecom, the European publishing group he founded in 2000, after coming under pressure from shareholders to quit.
According to a report by Reuters, current CEO Montgomery will leave the company – which owns more than 300 printed titles and 200 websites – in January in response to the concerns of shareholders who are “fed up with ongoing high debt levels and falling sales”.
Montgomery slashed costs and jobs as he sought to drive his local-newspaper businesses in the Netherlands, Denmark, Norway and Poland into the digital age in the face of the industry’s worst-ever recession.
In a statement on Mecom’s website confirming Montgomery’s move, the chief executive was said to have the “complete confidence of the board”. It added that a search process will be conducted by the board to find his successor.
This entry was posted in Business, Editors' pick, Newspapers, Online Journalism and tagged David Montgomery, Mecom, Newspapers, print, publishing group, retirement, reuters on September 10, 2010 by Rachel Bartlett.
Kristine Lowe: Time to support David Montgomery?
At the weekend, the Sunday Times reported that Mecom CEO David Montgomery faced an investor rebellion.
Kristine Lowe, who has followed the activities of Mecom (which owns 300 newspapers) since its early days, shares her thoughts on her blog, linking into content elsewhere.
“My hunch is that it’s [the rebellion] nothing to cheer for,” she says.
“[I]f we look at the objections against his leadership brought forth after last year’s revolt, and Mecom’s continuing poor stock market performance this year, it seems to me that the man who gained a reputation as such a brutal cost-cutter during his Mirror-days is simply not a brutal enough cost-cutter for the investors in question.
She also notes that örsen, the Danish financial daily, is reporting that Mecom shareholders are disappointed that share prices have not improved more.
Full post at this link…
This entry was posted in Editors' pick, Newspapers and tagged David Montgomery, Mecom, Norway on January 27, 2010 by Judith Townend.
MediaGuardian: Mecom pushes ahead with niche paid content
David Montgomery’s Mecom newspaper group will put niche, specific content at the heart of its plans to charge for news online.
Montgomery, who said he is confident that a carefully planned digital strategy could make up for the a predicted shortfall in print ad spend, said its new online paid content strategy would not focus on charging for general or international news.
Full story at this link…
This entry was posted in Editors' pick, Newspapers and tagged David Montgomery, Mecom on January 15, 2010 by Laura Oliver.
Journalism Daily: Academics boycott Observer, theblogpaper’s launch and AOP conference
A daily round-up of all the content published on the Journalism.co.uk site. You can also sign up to our e-newsletter and subscribe to the feed for the Journalism Daily here.
News and features:
Academics threaten Observer boycott over ousted columnist, as newspaper faces uncertain future with GNM
theblogpaper prepares for September launch
Chris Cramer and David Montgomery to appear at AOP’s 2009 conference
Stuff reshapes editorial team
Ed’s picks:
‘Our vanishing heritage’: @johnemcintyre’s list of disappearing ‘newspaper lingo’
Adam Westbrook: 6×6 storytelling for freelance journalists
Online Journalism Blog: ‘How can the UK government save journalism?’
VentureBeat: Twitter launching commercial accounts
New Media Knowledge: The UK blogosphere and making money from blogging
paidContent:UK: FT.com to profile IP numbers to find new subscribers
Tip of the day:
Visualising with Muckety.com
#FollowJourn:
@abigailrieley/freelance journalist
On the Editors’ Blog:
Academics threaten Observer boycott – the letters in full
Event: Guardian.co.uk live Q&A on online journalism
thelondonpaper’s closure – tell the rivals or readers first?
Fifth International Photography Award open for entries
Business Insider lets readers ’embed’ posts
This entry was posted in Journalism Daily and tagged Adam Westbrook, Chris Cramer, David Montgomery, e-newsletter, freelance journalists Online, Guardian.co.uk, Journalism Daily, Journalism.co.uk, ousted columnist, the Journalism Daily, Twitter, UK government, United Kingdom, venturebeat on August 21, 2009 by Laura Oliver.
The Independent, Mecom – and what David Montgomery thought of it all
More twists and turns in the Independent and Mecom sagas today.
Independent News and Media (at time of writing) has failed to reach an agreement with bondholders – the company was meant to reach a deal on the £179 million bond by May 18, but is now seeking a ‘standstill’ period.
Meanwhile newspaper publisher Mecom has secured yet another convenant extension, raising about £140 million in new equity from shareholders, but also announced 500 job cuts.
The news has triggered a memory for blogger Kristine Lowe of a journalism conference in 1997 2007, where Mecom boss David Montgomery responded to an assertion by the Telegraph that there was no reason for the Independent or Guardian to exist:
“I didn’t say that. The Telegraph did. But in general I think companies should make money. I think it’s demeaning for people to work for companies that don’t,” he told Lowe at the time.
How very apt.
This entry was posted in Newspapers and tagged David Montgomery, GBP, guardian, Independent, Kristine Lowe, Mecom, newspaper publisher, the Telegraph on April 30, 2009 by Laura Oliver.
MediaGuardian: Mecom to sell Norwegian titles
Mecom, former Mirror Group man David Montgomery’s European newspaper group, is to shed some of its Norwegian papers to raise £50 million in funds.
This entry was posted in Editors' pick, Newspapers and tagged David Montgomery, GBP, Mecom, newspaper, Norway, Online Journalism Scandinavia on February 18, 2009 by Laura Oliver.
MediaGuardian: Montgomery empire has two months to solve financial woes
Former Mirror Group boss David Montgomery secured a two-month stay of execution for his ‘media empire’, as it ‘tries to renegotiate its debts amid rising concern about its future,’ reports the Guardian.
“Mecom, which has debts of almost £600m, compared with a stockmarket value of £13.5m, said it was in talks with its banks about amending its overdraft ‘so as to provide financial stability in the medium term.'”
This entry was posted in Editors' pick, Journalism and tagged David Montgomery, GBP, Mecom, media empire, The Guardian on December 23, 2008 by Judith Townend.
Online Journalism Scandinavia: Mecom’s Danish arm will cut costs with open-source CMS
Mecom-owned Berlingske Media, Denmark’s biggest daily newspaper publisher, has decided to ditch its costly online publishing system for open-source software Drupal.
As Journalism.co.uk reported earlier this year, Berlingske Media already runs some of its sites on Drupal – a free content management system (CMS).
After a long period of deliberation, the Danish division of Mecom, the ailing pan-European media group headed by former Mirror-boss David Montgomery, has decided to make Drupal its online publishing system of choice.
“It is no secret that economy means a lot to us, but if the system had been unstable and not user-friendly, the price would not have been decisive,” Berlingske’s CEO Lisbeth Knudesen told eJour (in Danish).
She particularly praised Drupal for being so much more flexible than traditional publishing platforms.
This entry was posted in Online Journalism and tagged Berlingske Media, CEO, cms, content management system, costly online publishing system, daily newspaper publisher, David Montgomery, Denmark, Drupal, Journalism.co.uk, Lisbeth Knudesen, Mecom, media, Online Journalism Scandinavia, online publishing system, open-source software on December 23, 2008 by Kristine Lowe.
Sunday Times: David Montgomery steps down as Mecom executive chairman
David Montgomery has relinquished his role as executive chairman of Mecom in a bid to halt falling share prices, which have dropped by 97 per cent in the last year.
Montgomery becomes chief executive of the publishing group in the move.
This entry was posted in Editors' pick, Jobs, Newspapers and tagged chief executive of the publishing group, David Montgomery, executive chairman, Mecom, Sunday Times on November 17, 2008 by Laura Oliver.
Online Journalism Scandinavia: Behind the spin of Mecom’s half-year results
Even former Mirror boss David Montgomery, who has a reputation as a ferocious cost-cutter, admits his new pan-European newspaper group Mecom cannot cost-cut its way out of a recession.
Shares in the company tumbled on the London Stock Exchange last week after the newspaper group failed to impress the market with its interim half-year results.
Perhaps jittery from all the recent talk of recession, investors did not appreciate the highly geared company’s reports of ‘worsening economic conditions’.
Despite Montgomery’s assurances that his business model is very different from that of UK newspapers – with subscription rates as high as 96 per cent in some of the countries Mecom operates in – alert observers noted that advertising still makes up 52 per cent of revenue.
No more title-specific news desks?
As widely reported, this does of course mean employees at the company, already disgruntled about redundancies on the table, will have to prepare for an even tighter ship in times ahead.
But there is more to this story: in a phone conference with employee representatives last week, Montgomery is reported to have admitted the company cannot cost-cut its way out of a recession; and emphasised that new ways of working and new streams of revenue were necessary for newspapers to have a profitable future.
He specifically highlighted two areas as key to the company’s future strategy: digital expansion, where its Norwegian division, Edda Media, is leading the pack with 9 per cent of its revenues from digital operations; and the media house strategy pioneered by Lisbeth Knudsen, the CEO of its Danish operation.
As Journalism.co.uk previously reported, Knudsen has reorganised her company’s titles into ‘verticals’ that deliver copy not only across platforms, but also titles – be they broadsheet, tabloid or regional newspapers. This, apparently, is to become the standard for all future media house strategy in Mecom.
“Mecom’s German division for instance – comprised of Berliner Zeitung, a national; Netzeitung, an online-only newspaper, and various magazine titles – should pay heed to these words. This model might be seen as a good fit for Germany,” an employee representative told me.
Mecom has also established an agreement that allows all Mecom countries to exchange software solutions developed in one country to another Mecom country without charge. The Reader’s Newspaper, a citizen journalism portal previously described by Journalism.co.uk, for instance, is to be exported from Norway to Denmark and Poland.
Another Norwegian export is a new range of hyper-local websites and freesheets Mecom is launching in Poland: Moje Miastro – a concept that has been operating for some time in Norway. The newspaper group, often portrayed as cash-starved and too much in debt, has also entered into an agreement to buy Edtytor Sp. z o.o., a regional newspaper business in Olsztyn. It has told employee representatives that the Polish expansion in new products was to blame for the dip in profits from its Polish arm.
Beware the ghost of recession
In other words, keeping an eye on innovations in the various parts of Mecom’s far-flung empire, can give useful pointers to what we can expect on group level.
Unfortunately for Mecom, a less fortunate trend spreading through the many European countries the company operates in is the ghost of recession.
In this age of globalisation, operating in more than one European country is no safe hedge against a market downturn, despite Montgomery indicating otherwise.
As Peter Kirwan recently wrote in his Press Gazette blog: “[W]hen it comes to the ad recession, we’re at the end of beginning, not the beginning of the end.”
In the summer months we have seen the footprints of recession appear in new territories such as Norway and Holland, causing the job and property classifieds markets to shrink – a sure sign that worse is yet to come.
For Mecom, the question is which is strongest, which will have the final say: the ability to come up with new innovative ways of doing business with less resources, or the clammy hand of a jittery market in the throes of recession?
This entry was posted in Online Journalism and tagged Berliner Zeitung, business model, CEO, CEO of its Danish operation, David Montgomery, Denmark, Edtytor Sp. z o.o., Europe, Germany, Journalism.co.uk, Lisbeth Knudsen, London Stock Exchange, Mecom, newspaper, newspaper group, Norway, Online Journalism Scandinavia, peter kirwan, Poland, Reader's Newspaper, Reorganization, representative, software solutions, The Netherlands, United Kingdom on August 27, 2008 by Kristine Lowe. | cc/2020-05/en_middle_0078.json.gz/line915 |
__label__wiki | 0.519836 | 0.519836 | HOME • 2020 CALENDAR • OLDER CALENDARS • BLUES CD's • BLUES POSTERS • BLUES T-SHIRTS • MUSEUM RECORDS!
HOME • BLUES CALENDAR BUY OUR CALENDAR! BLUES CD's • BLUES POSTERS • BLUES T-SHIRTS • MUSEUM RECORDS! • PAST YEARS' CALENDARS • JOHN'S AUCTIONS
Sample Blues Images' Classic Blues Songs From the 1920's
About Blues Images
History of Blues Images Calendars
article on
John Tefteller
Finds The
Long-Lost
J.D. Short Paramount 78!!
John Tefteller buys the world's most expensive 78 rpm record!
John buys the World's Rarest 45 rpm record!!
Blues T-Shirts
Blues CD's
NEW! Volume 16 CD
Older Calendars
Blues Images' Yazoo Specials!:
Yazoo's CD Set "The Stuff That Dreams Are Made Of!" Only $22.95!
Yazoo's CD Set "The Return Of The Stuff That Dreams Are Made Of!"
Only $22.95!
Yazoo's Rare Country Films
"You Are There" Only $15.95!
Postage & Prices
Mail Order Forms-
Print and mail to us
Museum Items
Wholesale Dealers
History of the Blues Calendar part 2 (cont. from part 2)
As the Great Depression took its toll, Paramount stopped advertising in the Defender (though they continued to produce artwork and promotional materials they sent directly to record stores) and eventually folded in 1933. The Boerner company continued to limp along until the 1940’s when it finally succumbed.
The photos and promotional artwork remained in the files of the newspaper until that day when the newspaper was sold and the artwork was placed on the loading dock.
In the 1960’s, Dutch Blues researcher and Paramount label collector Max Vreede first discovered some of the advertisements while doing research for his Paramount Records Discography. He found, on microfilm, some ancient issues of the Chicago Defender, which contained some of the artwork. His book (long out of print) reproduced a few of the images for the first time but, coming from old microfilm, they were grainy and blurry. The only way to see them as the original artists intended would be to locate the original artwork, yet no one had any idea how or where to find it — until the two Wisconsin reporters unknowingly did just that.
These newly discovered images are of supreme quality. They have been touched up a bit and even slightly altered for this calendar to make them even more striking. The overall beauty and charm of the original artwork has not been compromised, only strengthened.
The cover photograph of Charley Patton on our 2004 Classic Blues Artwork Calendar was shown here for the very first time anywhere. Everything in the history of Blues music revolves around, or was inspired in part by, Patton. Robert Johnson may be more well-known due to the legends surrounding him, but even Johnson had to be inspired by someone and that someone was Patton.
In the 1960’s, a small, grainy photo of only Patton’s head was found in Georgia by Blues collector Max Tarpley. It was, until now, the only existing photograph of Patton. That photograph has been reproduced worldwide on CD’s, magazine covers and artsy Blues books for the past 40 years. Record collectors and Blues enthusiasts have had reoccurring dreams that somewhere out there a complete, crisp and clear photo existed.
Continued on page 3 | cc/2020-05/en_middle_0078.json.gz/line917 |
__label__wiki | 0.906974 | 0.906974 | An alarming rise of non-albicans Candida species and uncommon yeasts in the clinical samples; a combination of various molecular techniques for identification of etiologic agents
Monireh Taei1,
Mostafa Chadeganipour1 &
Rasoul Mohammadi ORCID: orcid.org/0000-0002-8220-45111,2
Yeasts are unicellular microorganisms may cause systemic infection in immunocompromised patients. The aim of this study was to identify yeast strains isolated from clinical specimens using molecular techniques.
A total of 202 yeast strains isolated from 341 clinical samples between February 2017 and May 2019. All clinical isolates were identified using phenotypic and molecular tests including PCR–RFLP, duplex-PCR, multiplex-PCR, and PCR-sequencing. The most yeast fungal isolates were obtained from urine (66.8%), nail (9.4%), skin lesion (7.9%), bronchoalveolar lavage (5.9%), and blood (3.9%). One hundred and twenty-one Candida species were identified as non-albicans versus 76 Candida albicans. Trichosporon asahii, and Pichia terricola were uncommon non-Candida yeasts isolated from urine samples. For the first time, we isolated P. terricola as etiological agent of urinary tract infection in a pregnant female. Since Candida species show different levels of resistance to antifungal agents, precise identification of clinical isolates is critical for better treatment of infection.
Candida species are the most common cause of fungal infections worldwide. They are the third most dominant cause of healthcare-related infections [1]. Candida albicans is the most common species in humans; however, the increasing of non-albicans Candida (NAC) species have been recognized significantly during the last two decades [2,3,4]. The most NAC infections are caused by C. glabrata, C. tropicalis, C. parapsilosis, C. dubliniensis, C. guilliermondii, C. krusei, and C. kefyr [5,6,7]. The growing number of NAC species might be connected to former exposure to polyenes and azoles, use of indwelling catheters, malignancies, age, the improved biochemical and molecular diagnostic methods in laboratories, and geographical regions [8, 9]. As compared with C. albicans, this epidemiological pattern towards NAC species with high MICs of azoles and triazoles, appears among high-risk patients due to the common and prolonged use of antifungal agents [10]. High mortality rate (30-50%), along with raising resistance to antifungal agents among NAC species, imposes serious medical and economic problems to the society [7, 11]. The raising frequency of NAC species has been repeatedly reported from different areas worldwide, for example, C. tropicalis is frequently isolated in Asia and South America and C. glabrata has a high frequency in North and Central Europe and United States of America specially, among the elderly people [12]. Due to the increase reports of uncommon yeast infection and their antifungal resistance by physicians in our region, the present study was undertaken to investigate the frequency of various Candida species and rare yeasts collected from fungal infections in Kashani university hospital and Shefa Lab (referral medical mycology laboratory), in Isfahan, Iran, by combination of miscellaneous molecular techniques.
Patients and sampling
A total of 341 suspected cases (75 male and 266 female) referred to the Kashani university hospital and a referral medical mycology laboratory (Shefa Lab.), in Isfahan, Iran, from February 2017 to May 2019. Demographic data were documented for each subject. Excluding criteria were considered for the patients who had taken antifungal agents during the last week.
Primary screening
All specimens were examined by direct microscopy with 10% Potassium Hydroxide (KOH 10%), sub-culture on sabouraud dextrose agar (Biolife, Italy), and CHROMagar Candida (France).
Molecular methods as secondary screening for identification of Candida species
Polymerase chain reaction-restriction fragment length polymorphism (PCR–RFLP) for identification of six prevalent species of Candida
This screening was done in an iterative manner (Additional file 1: Figures S1–S6).
Genomic DNA of isolates was extracted and ITS1-5.8SrDNA-ITS2 region was amplified. Briefly, the ITS1-5.8SrDNA-ITS2 region was amplified by a PCR mixture including 5 μL of 10× reaction buffer, 0.4 mM dNTPs, 1.5 mM MgCl2, 2.5 U of Taq polymerase, 30 pmol of both ITS1 (5′-TCC GTA GGT GAA CCT GCG G-3′) and ITS4 (5′-TCC TCC GCT TAT TGA TAT GC-3′) primers and 2 μL DNA in a final volume of 50 μL. The PCR cycling conditions were: an initial denaturation phase at 94 °C for 5 min, followed by 32 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 45 s, and extension at 72 °C for 1 min, with a final extension phase at 72 °C for 7 min. PCR products were digested with the restriction enzyme MspI (Fermentas, Vilnius, Lithuania). Five microliter of each PCR amplicons and 10 μL of RFLP products were separated by gel electrophoresis on 1.5% and 2% agarose gel (containing 0.5 μg/mL ethidium bromide), respectively. In this stage, all clinical isolates first grouped into 6 prevalent species as Candida albicans, C. tropicalis, C. parapsilosis complex, C. glabrata, C. krusei, and C. guilliermondii [13].
Duplex-PCR assay for distinction of C. albicans and C. dubliniensis
Species-specificity primers were used to identify C. albicans and C. dubliniensis. The sequences of these primers are as follows:
CALF (5′-TGGTAAGGCGGGATCGCTT-3′) and CALR (5′-GGTCAAAGTTTGAAGATATAC) for C. albicans, and CDUF (5′-AAACTTGTCACGAGATTATTTTT) and CDUR (5′-AAAGTTTGAAGAATAAAATGGC-3′) for C. dubliniensis. The size of PCR products for C. albicans and C. dubliniensis are 100 bp, and 325 bp, respectively [14].
Multiplex-PCR for differentiation of Candida glabrata and its phylogenetically related species Candida bracarensis and Candida nivariensis
Targeting the ITS1 region, reverse primer UNI-5.8S (5′ ACCAGAGGGCGCAATGTG 3′) and forward primers GLA-f (5′ CGGTTGGTGGGTGTTCTGC 3′), NIV-f (5′ AGGGAGGAGTTTGTATCTTTCAAC 3′), and BRA-f (5′ GGGACGGTAAGTCTCCCG 3′), were applied for identification of C. glabrata, C. nivariensis, and C. bracarensis, respectively. Expected amplicon size for C. glabrata, C. nivariensis, and C. bracarensis are 379 bp, 293 bp, and 223 bp, respectively [15].
Multiplex-PCR for differentiation of Candida parapsilosis complex
Three pairs of primers including CPAF (5′ TTTGCTTTGGTAGGCCTTCTA 3′) and CPAR (5′ GAGGTCGAATTTGGAAGAAGT 3′), CORF (5′ TTTGGTGGCCCACGGCCT 3′) and CORR (5′ TGAGGTCGAATTTGGAAGAATT 3′), and CMEF (5′ TTTGGTGGGCCCACGGCT 3′) and CMER (5′ GAGGTCGAATTTGGAAGAATGT 3′), were used for identification of Candida parapsilosis, C. orthopsilosis, and C. methapsilosis, respectively. The size of amplicons for Candida parapsilosis, C. orthopsilosis, and C. methapsilosis are 379 bp, 367 bp, and 374 bp, respectively [16].
PCR-sequencing
All PCR products with no cutting site for the restriction enzyme MspI considered as non-Candida yeasts, and were applied for sequence analysis. The non-Candida yeasts amplicons were purified using the ethanol purification method, and cycle sequencing reactions in forward direction were performed (Bioneer, South Korea). The sequencing products were analyzed with Chromas 2.3 (http://chromas.software.informer.com/2.4/), and were evaluated by using of NCBI BLAST searches against fungal sequences existing in DNA databases (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
The results of phenotypic and genotypic tests were analyzed by Chi square and Fisher’s exact test in the SPSS version 23.
Two hundred and two patients out of 341 suspected cases had yeast fungal infections (59.2%). Male to female sex ratio was 74/128. Age range of patients was 1–87 years with the median age range of 42.3. Diabetes (18.8%), pregnancy (18.3%), kidney stones (2.9%), burn (2.9%), and neoplasm (2.4%) were the most leading predisposing factors among patients. The most yeast fungal isolates were obtained from urine (66.8%), nail (9.4%), skin lesion (7.9%), bronchoalveolar lavage (5.9%), and blood (3.9%) (Fig. 1). The majority of patients hospitalized in ICU (9.9%), surgical ward (9.9%), neurological intensive care unit (NICU) (8.9%), infectious diseases ward (8.9%), and gynaecology ward (7.4%). Ninety-six cases (46.5%) were outpatients. Interestingly, 121 Candida species were identified as non-albicans versus 76 Candida albicans by molecular techniques (Fig. 2). Among NAC species, 92 Candida glabrata (76%), 8 Pichia kudriavzevii (teleomorph of the Candida krusei) (6.6%), 7 C. kefyr (5.7%), 6 C. parapsilosis (4.9%), 3 C. tropicalis (2.4%), 1 C. dubliniensis (0.8%), 1 C. guilliermondii (0.8%), 1 C. famata (Debaryomyces hansenii) (0.8%), 1 Kluyveromyces marxianus (teleomorph of the Candida parapsilosis) (0.8%), and 1 C. orthopsilosis (0.8%) were isolated from clinical samples. Fourteen isolates had no cutting site for the restriction enzyme MspI and their amplicon sizes were under 500 bp. These clinical isolates were applied for cycle sequencing reactions in forward direction. Table 1 shows the frequency of Candida species in the present study among various clinical specimens in different wards of the hospital.
Various clinical samples infected to yeast species in the present study
a Agarose gel electrophoresis of PCR–RFLP products of Candida isolates: lane 1 is C. glabrata, lanes 2–4, and 6–9 are C. albicans, and lane 5 is C. tropicalis; b Agarose gel electrophoresis of duplex-PCR for distinction of C. albicans and C. dubliniensis; lanes 1–4 are C. albicans; c multiplex-PCR for differentiation of C. parapsilosis complex; lanes 1, 2 are C. parapsilosis; d multiplex-PCR for differentiation of C. glabrata complex; lanes 1, 2 are C. glabrata; N is negative control; and M is 100 bp DNA size marker
Table 1 The numbers of yeast isolates among various clinical samples
Fisher’s exact test revealed that the associations between the kind of clinical samples and yeasts were not statistically significant (p = 0.85).
Although C. albicans is the principal causative agent of candidiasis, the raising of NAC species resistant to antifungal drugs such as echinocandins and fluconazole in patients with nosocomial infections is concerning. Resistance to azoles is infrequent in C. albicans (< 5%), however, it is more current in C. parapsilosis (4–10%), C. tropicalis (4–9%), and C. glabrata (4–16%) [17]. Increasing of NAC species is due to the improved laboratory diagnosis, previous exposure to polyene and azole agents, use of indwelling medical devices, malignancies, growing number of immunocompromised patients, and long-term immunosuppressive and cytotoxic therapy in organ transplant recipients and cancer patients [9, 18]. It is usually believed that increasing use of azole treatments in clinics may be associated with the rise of NAC species [19]. The most patients infected to NAC, received empirical antifungals, whereas more C. albicans infections were treated when the diagnosis was confirmed. These findings may suggest that NAC infections are in worse clinical conditions [20]. In the last two decades, C. albicans was responsible for over 80% of etiological agents of all types of candidiasis [21], however, in the present study C. albicans isolated from almost 38.5% of Candida infections. Candida glabrata is obtained from 15 to 20% of Candida infections [22, 23], but we isolated 92 C. glabrata strains (46.7%) in the present investigation. In consistent with Singh et al. [24] we revealed a high prevalence of NAC species (61.4%), but C. albicans was the most repeatedly isolate (38.5%). The predominance of C. glabrata among NAC in the present investigation, is contrary to the prospective report by Chakrabarti et al. [25] where C. tropicalis was the most prevalent NAC species (42.1%). Furthermore, Bhattacharjee reported C. tropicalis as the most common NAC in a tertiary care hospital in Kolkata, India [26]. Kaur et al. and Al-Attas and Amro, reported a lower rate of C. glabrata, as well. They showed frequencies of (10%) and (11.1%) for C. glabrata, respectively [27, 28]. Interestingly, Pakshir et al. [29] showed C. parapsilosis as the most prevalent Candida species collected from fingernail infections (45.3%), even higher than C. albicans (23.7%). Non-albicans Candida infections may have more incidence among patients with allogeneic hepatocyte transplantation, neutropenia, hematologic malignancies, and severe immune suppression [30, 31] however, in our study, there was no difference between neutropenia and malignancies with C. albicans or NAC infections. Montagna et al. [32] found that C. albicans was more prevalent than NAC species in surgical wards, nevertheless, it was mainly isolated from gynaecology (n = 10), ICU (n = 9), and infectious diseases (n = 8) wards in the present study. According to PCR–RFLP using the restriction enzyme MspI, the differentiation between C. albicans and C. dubliniensis in C. albicans complex, C. parapsilosis, C. orthopsilosis, and C. methapsilosis in C. parapsilosis complex, and C. glabrata, C. bracarensis and C. nivariensis in C. glabrata complex is not possible, so we used effective molecular tests (duplex and multiplex-PCR) for distinguishing them. All strains in C. glabrata complex were C. glabrata, however, one C. dubliniensis and one C. orthopsilosis were isolated from C. albicans complex and C. parapsilosis complex, respectively. Candida orthopsilosis is a rare Candida species that reported by Tavanti et al. [33] for the first time. We also identified this species for the first time in Iran in our previous study [34]. In agreement with our previous report, here it was isolated from a patient with fingernail infection. Trichosporon asahii (Trichosporon beigelii) was another uncommon yeast isolated in the present study and identified by PCR-sequencing. This species is connected with a wide spectrum of clinical signs, ranging from superficial lesions in immunocompetent individuals to severe systemic and fatal infections in immunocompromised patients [35]. It is the most prevalent non-Candida cause of fungemia [36], however, all T. asahii in the present study were isolated from urine samples. We also isolated Pichia terricola from clinical sample for the first time. Pichia genus is found in plants, fruit juices, and soil. It has also been described as a normal flora of throat, skin, and alimentary tract. Some species such as P. anomala can cause serious infections among immunosuppressed patients mainly in infants [37], however, we isolated P. terricola from the urine sample of a pregnant female with severe urinary tract infection.
In conclusion, the contribution of C. albicans and NAC species in Candida infections is changing from the past in different areas, and epidemiological data show the increasing of NAC infections worldwide. Due to the increasing of antifungal resistance of Candida species and the elevating number of immuno suppressed patients, it is essential to provide new effective strategies for treatment of this fungal infection. As NAC species have various virulence factors and antifungal susceptibility profile, precise molecular identification can help us to reach to these advantageous strategies.
Due to the sanctions, the most antifungal agents were not found in the country, and if they were, they would be 4–5 times of the price. We recommend the antifungal susceptibility testing of clinical isolates in further studies.
All data generated or analyzed during this study are included in this article.
NAC:
non-albicans Candida
MIC:
minimum inhibitory concentration
RFLP:
restriction fragment length polymorphism
Cortegiani A, Misseri G, Chowdhary A. What’s new on emerging resistant Candida species. Intensive Care Med. 2019;45(4):512–5.
Manfredi M, McCullough M, Al-Karaawi Z, Hurel S, Porter S. The isolation, identification and molecular analysis of Candida spp. isolated from the oral cavities of patients with diabetes mellitus. Oral Microbiol Immunol. 2002;17(3):181–5.
Badiee P, Alborzi A, Shakiba E, Ziyaeyan M, Rasuli M. Molecular identification and in vitro susceptibility of Candida albicans and C. dubliniensis isolated from immunocompromised patients. Iran Red Crescent Med J. 2009;11(4):391–7.
Ahmad S, Khan Z, Mokaddas E, Khan ZU. Isolation and molecular identification of Candida dubliniensis from non-human immunodeficiency virus-infected patients in Kuwait. J Med Microbiol. 2004;53(Pt 7):633–7.
Pfaller MA, Castanheira M, Messer SA, Jones RN. In vitro antifungal susceptibilities of isolates of Candida spp. and Aspergillus spp. from China to nine systemically active antifungal agents: data from the SENTRY antifungal surveillance program, 2010 through 2012. Mycoses. 2015;58(4):209–14.
Pfaller M, Rhomberg P, Messer S, Jones R, Castanheira M. Isavuconazole, micafungin, and 8 comparator antifungal agents’ susceptibility profiles for common and uncommon opportunistic fungi collected in 2013: temporal analysis of antifungal drug resistance using CLSI species-specific clinical breakpoints and proposed epidemiological cutoff values. Diagn Microbiol Infect Dis. 2015;82(4):303–13.
Kołaczkowska A, Kołaczkowski M. Drug resistance mechanisms and their regulation in non-albicans Candida species. J Antimicrob Chemother. 2016;71(6):1438–50.
Pfaller MA, Castanheira M, Messer SA, Moet GJ, Jones RN. Variation in Candida spp. distribution and antifungal resistance rates among bloodstream infection isolates by patient age: report from the SENTRY Antimicrobial Surveillance Program (2008–2009). Diagn Microbiol Infect Dis. 2010;68(3):278–83.
Miceli MH, Díaz JA, Lee SA. Emerging opportunistic yeast infections. Lancet Infect Dis. 2011;11(2):142–51.
Falagas ME, Roussos N, Vardakas KZ. Relative frequency of albicans and the various non-albicans Candida spp. among candidemia isolates from inpatients in various parts of the world: a systematic review. Int J Infect Dis. 2010;14(11):e954–66.
Pereira CA, Toledo BC, Santos CT, Costa ACBP, Back-Brito GN, Kaminagakura E, et al. Opportunistic microorganisms in individuals with lesions of denture stomatitis. Diagn Microbiol Infect Dis. 2013;76(4):419–24.
Blot S, Vandewoude K, Hoste E, Poelaert J, Colardyn F. Outcome in critically ill patients with candidal fungaemia: Candida albicans vs. Candida glabrata. J Hosp Infect. 2001;47(4):308–13.
Mirhendi H, Makimura K, Khoramizadeh M, Yamaguchi H. A one-enzyme PCR-RFLP assay for identification of six medically important Candida species. Nippon Ishinkin Gakkai Zasshi. 2006;47(3):225–9.
Ahmad S, Khan Z, Asadzadeh M, Theyyathel A, Chandy R. Performance comparison of phenotypic and molecular methods for detection and differentiation of Candida albicans and Candida dubliniensis. BMC Infect Dis. 2012;25(12):230.
Romeo O, Scordino F, Pernice I, Passo CL, Criseo G. A multiplex PCR protocol for rapid identification of Candida glabrata and its phylogenetically related species Candida nivariensis and Candida bracarensis. J Microbiol Methods. 2009;79(1):117–20.
Rodríguez L, Jewtuchowicz V. Molecular characterization of Candida parapsilosis species complex in niches of the oral cavity in a cohort of patients from Argentina with different oral and dental clinical manifestations. J Dent Sci Ther. 2016;1(1):18–25.
Maubon D, Garnaud C, Calandra T, Sanglard D, Cornet M. Resistance of Candida spp. to antifungal drugs in the ICU: where are we now? Intensive Care Med. 2014;40(9):1241–55.
Paul S, Kannan I. Molecular identification and antifungal susceptibility pattern of Candida species isolated from HIV infected patients with candisiasis. Curr Med Mycol. 2019;5(1):21–6.
Blot S, Vandijck D, Vandewoude K. Risk factors for Candida non-albicans candidemia. Diagn Microbiol Infect Dis. 2008;61(3):362–3.
Gong X, Luan T, Wu X, Li G, Qiu H, Kang Y, et al. Invasive candidiasis in intensive care units in China: risk factors and prognoses of Candida albicans and non-albicans Candida infections. Am J Infect Control. 2016;44(5):e59–63.
Muadcheingka T, Tantivitayakul P. Distribution of Candida albicans and non-albicans Candida species in oral candidiasis patients: correlation between cell surface hydrophobicity and biofilm forming activities. Arch Oral Biol. 2015;60(6):894–901.
Méan M, Marchetti O, Calandra T. Bench-to-bedside review: Candida infections in the intensive care unit. Crit Care. 2008;12(1):204.
Pfaller M, Diekema D. Epidemiology of invasive candidiasis: a persistent public health problem. Clin Microbiol Rev. 2007;20(1):133–63.
Singh T, Kashyap AK, Ahluwalia G, Chinna D, Sidhu SS. Epidemiology of fungal infections in critical care setting of a tertiary care teaching hospital in North India: a prospective surveillance study. Mortality. 2014. https://doi.org/10.15380/2277-5706.jcsr.13.050.
Chakrabarti A, Chatterjee SS, Rao K, Zameer M, Shivaprakash M, Singhi S, et al. Recent experience with fungaemia: change in species distribution and azole resistance. Scand J Infect Dis. 2009;41(4):275–84.
Bhattacharjee P. Epidemiology and antifungal susceptibility of Candida species in a tertiary care hospital, Kolkata, India. Curr Med Mycol. 2016;2(2):20–7.
Kaur R, Dhakad MS, Goyal R, Kumar R. Emergence of non-albicans Candida species and antifungal resistance in intensive care unit patients. Asian Pac J Trop Biomed. 2016;6(5):455–60.
Al-Attas SA, Amro SO. Candidal colonization, strain diversity, and antifungal susceptibility among adult diabetic patients. Ann Saudi Med. 2010;30(2):101–8.
Pakshir K, Zomorodian K, Zakaei A, Motamedi M, Ghiasi MR, Karamitalab M. Molecular identification and in vitro antifungal susceptibility testing of Candida species isolated from patients with onychomycosis. Curr Med Mycol. 2015;1(4):26–32.
Apisarnthanarak A, Naknarongkij N, Kiratisin P, Mundy LM. Risk factors and outcomes of Candida albicans and non-albicans Candida species at a Thai tertiary care center. Am J Infect Control. 2009;37(9):781–2.
Serefhanoglu K, Timurkaynak F, Can F, Cagir U, Arslan H, Ozdemir FN. Risk factors for candidemia with non-albicans Candida spp. in intensive care unit patients with end-stage renal disease on chronic hemodialysis. J Formos Med Assoc. 2012;111(6):325–32.
Montagna M, Lovero G, Borghi E, Amato G, Andreoni S, Campion L, et al. Candidemia in intensive care unit: a nationwide prospective observational survey (GISIA-3 study) and review of the European literature from 2000 through 2013. Eur Rev Med Pharmacol Sci. 2014;18(5):661–74.
Tavanti A, Davidson AD, Gow NA, Maiden MC, Odds FC. Candida orthopsilosis and Candida metapsilosis spp. nov. to replace Candida parapsilosis groups II and III. J Clin Microbiol. 2005;43(1):284–92.
Mohammadi R, Mirhendi H, Rezaei-Matehkolaei A, Ghahri M, Shidfar MR, Jalalizand N, et al. Molecular identification and distribution profile of Candida species isolated from Iranian patients. Med Mycol. 2013;51(6):657–63.
Wolf DG, Falk R, Hacham M, Theelen B, Boekhout T, Scorzetti G, et al. Multidrug-resistant Trichosporon asahii infection of nongranulocytopenic patients in three intensive care units. J Clin Microbiol. 2001;39(12):4420–5.
Krcmery V Jr, Mateička F, Kunová A, Špánik S, Gyarfáš J, Syčová Z, et al. Hematogenous trichosporonosis in cancer patients: report of 12 cases including 5 during prophylaxis with itraconazol. Support Care Cancer. 1999;7(1):39–43.
Pfaller MA, Diekema DJ, Merz WG. Infections caused by non-Candida, non-Cryptococcus yeasts. 2nd ed. London: Churchill Livingstone; 2009.
All authors appreciate Kashani university hospital and Shefa laboratory personnel for their cooperation.
This study was supported by Isfahan University of Medical Sciences, Isfahan, Iran, under the Thesis Number 397112. The role of the funding body was in the design of the investigation.
Department of Medical Parasitology and Mycology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran
Monireh Taei
, Mostafa Chadeganipour
& Rasoul Mohammadi
Infectious Diseases and Tropical Medicine Research Center, Isfahan University of Medical Sciences, Isfahan, Iran
Rasoul Mohammadi
Search for Monireh Taei in:
Search for Mostafa Chadeganipour in:
Search for Rasoul Mohammadi in:
RM design of study; MT, RM, and MC sample collection; RM and MT perform practical tests; RM, and MC data evaluation; and RM preparation of the manuscript. All authors read and approved the final manuscript.
Correspondence to Rasoul Mohammadi.
This investigation was approved by the Ethics Committee of Isfahan University of Medical Sciences. The code number is IR.MUI.MED.REC.1397.066.
Consent to publish
Additional file 1. Agarose gel electrophoresis photos of PCR–RFLP taken from primary screening and repeat experiments. Fig S1. Agarose gel electrophoresis for PCR–RFLP; from left to right: C. albicans, C. glabrata, C. albicans, C. glabrata, C. glabrata, C. albicans, C. glabrata, C. albicans, C. glabrata, and 100 bp DNA size Marker. Fig S2. Agarose gel electrophoresis for PCR–RFLP; from left to right: C. glabrata, C. parapsilosis, C. tropicalis, C. albicans, C. albicans, No band, C. albicans, C. albicans (dim band), and 100 bp DNA size Marker. Fig S3. Agarose gel electrophoresis for PCR–RFLP; from left to right: C. albicans, C. tropicalis, C. albicans, C. albicans, C. albicans, Mixed bands (C. albicans, and C. kefyr), C. albicans, C. albicans, C. albicans, C. albicans, C. albicans, C. glabrata, C. glabrata, C. tropicalis, C. albicans, and 100 bp DNA size Marker. Fig S4. Agarose gel electrophoresis for PCR–RFLP; from left to right: C. parapsilosis, C. parapsilosis, C. parapsilosis, C. parapsilosis, C. parapsilosis, No band, and 100 bp DNA size Marker. Fig S5. Agarose gel electrophoresis for PCR–RFLP; from left to right: C. albicans, C. albicans, C. albicans, C. albicans, C. albicans, C. albicans, C. albicans, C. albicans, C. albicans, and 100 bp DNA size Marker. Fig S6. Agarose gel electrophoresis for PCR–RFLP; from left to right: C. tropicalis, C. parapsilosis, C. albicans, albicans, albicans, and 100 bp DNA size Marker.
Taei, M., Chadeganipour, M. & Mohammadi, R. An alarming rise of non-albicans Candida species and uncommon yeasts in the clinical samples; a combination of various molecular techniques for identification of etiologic agents. BMC Res Notes 12, 779 (2019) doi:10.1186/s13104-019-4811-1
Non-albicans Candida species
Uncommon yeasts
Trichosporon asahii
Pichia terricola
Molecular techniques | cc/2020-05/en_middle_0078.json.gz/line921 |
__label__cc | 0.606957 | 0.393043 | Home California Government Ballots and Bills Calif. Legislature Approves McCarty Measure to Ban For-Profit Charter Schools – AB 406
Calif. Legislature Approves McCarty Measure to Ban For-Profit Charter Schools – AB 406
Christopher Simmons
Aug 23, 2018 12:36 PM PDT
SACRAMENTO, Calif. /California Newswire/ — The California State Legislature today approved AB 406 by Calif. Assemblymember Kevin McCarty (D-Sacramento), which would prohibit for-profit corporations from managing and operating charter schools in the Golden State. This bipartisan measure was approved by the State Senate on a 28 to 7 vote and by the State Assembly on a 49 to 15 vote.
Throughout the United States, a number of corporations are seeking to privatize public education as an untapped market for increasing corporate profits. A disturbing trend in this effort to privatize our public schools has been in the charter school arena. These corporations take public taxpayer dollars and use a percentage of those dollars for corporate profits and excessive salaries for their executives with little or no transparency and accountability – taking taxpayer money away from students. In California, 34 charter schools run by for-profit corporations serve over 25,000 students and divert millions of dollars annually away from public schools and into the pockets of corporate investors.
“The privatization of public education must end,” said Assemblymember Kevin McCarty. “Passage of AB 406 puts student success ahead of corporate profits and affirms California’s belief that public tax dollars should be spent to increase student success in the classroom, not to increase corporate wealth the boardroom. This is an historic day in California and I respectfully encourage Governor Brown to sign AB 406 into law.”
The Legislature’s passage of AB 406 created a unique coalition, rarely seen in education policy where the California Federation of Teachers (CFT), representing thousands of public school teachers and the California Charter School Association (CCSA), representing charter schools both supported AB 406.
“Assembly Bill 406 will prohibit for-profit corporations from creating and managing charter schools in California, thus stopping the practice of diverting public dollars away from students for corporate profits with little to no accountability or transparency,” said Joshua Pechthalt, President of the CFT. “The State of California has clearly shown that these for-profit education management organizations are ripping off taxpayers, misleading parents and shortchanging our students.”
A broad alliance across the state also supported AB 406 including the California Teachers Association, the American Federation of State, County and Municipal Employees, the Association of California School Administrators, the California Labor Federation, the California School Boards Association, the California School Employees Association and the California State PTA.
“AB 406 is in keeping with the overwhelming public sentiment in California that public dollars should not be used to advance a profit motive when it comes to the education of our children,” said Carlos Marquez, Senior Vice President, Government Affairs for CCSA. “California has long embraced a vibrant and thriving charter school sector that’s public, free, and open to all. If there was any doubt that the overwhelming majority of charter schools in California are run by nonprofits and play by the rules, let AB 406 settle that question once and for all.”
AB 406 now heads to Governor Jerry Brown for final consideration.
Kevin McCarty represents California’s 7th Assembly District, which include the cities of Sacramento, West Sacramento and unincorporated Sacramento County. McCarty serves as Chair of the Assembly Budget Subcommittee on Education Finance.
More to Read:
Calif. Assemblymember McCarty Releases Statement on Governor Brown's 2018-19 Proposed State Budget
Calif. Assemblymembers McCarty and Ting Demand 'Tax Justice' for Middle Class Californians
Calif. Assembly Approves McCarty Legislation Promoting STEM Education Through After School Coding Courses for Kids
http://christophersimmons.com
Christopher Simmons has been a working journalist since his first magazine sale in 1984. He has since written for wide variety of print and online publications covering lifestyle, tech and entertainment. He is an award-winning author, designer, photographer, and musician. He is a member of ASCAP and PRSA. He is the founder and CEO of Neotrope®, based in Torrance, CA, USA.
California Government
CA Education
California NEWS INDEX
Assemblymember Kevin McCarty | cc/2020-05/en_middle_0078.json.gz/line928 |
__label__wiki | 0.627306 | 0.627306 | Generations of Women Turn out for Chelsea Clinton in Falmouth
by Laura M. Reckford
Written by Laura M. Reckford
FALMOUTH – It was an occasion that attracted generations. Mothers brought their mothers and their children to the Chelsea Clinton book-signing this morning at Eight Cousins Books in Falmouth.
Hundreds of people stood in line to get their copies of books signed by Chelsea Clinton. CAPE COD WAVE PHOTO
Hundreds of people turned out to the event in which the daughter of former President Bill Clinton and presidential candidate Hillary Clinton, was signing copies of her new children’s book, “She Persisted: 13 American Women Who Changed the World.” The crowd—661 people, according to bookstore staff—filled the back parking lot of the bookstore and snaked out to the Falmouth Town Hall parking lot.
Over all, more than 1,000 copies were sold of “She Persisted” and an earlier Chelsea Clinton book, “It’s Your World: Get Informed, Get Inspired & Get Going.” People began arriving for the signing before 8:30am, two hours before the 10:30 event, according to one attendee who was one of the first in line.
Among the early arrivals were Kristin Bennett of East Falmouth with her three daughters, Grace, 5, Ellie, 7, and Anna, 11, and their grandmother, Marjorie Roache, also of East Falmouth.
Kristin Bennett of East Falmouth with her daughters, Grace, Anna, and Ellie and their grandmother, Marjorie Roache, were early arrivals for the Chelsea Clinton book-signing. CAPE COD WAVE PHOTO
When asked what brought them to the event, Roache considered the question for a moment before saying, “Because of the current political climate, and we’re worried about the future of our country. And it’s important for our girls to feel empowered.”
Anna had already read the book and pronounced it, “awesome.”
Her mom, Kristin Bennett said that she brought all of her daughters to the event because, “I think that it’s important for my girls to see women who are strong and involved as role models.”
Sara Hines, one of the co-owners of Eight Cousins Books, said it was one of the biggest days ever for the store. While the book’s sales today did not break one-day sales records at the store, which are held by Judy Blume when she came for a book-signing some years ago, Hines said the sales overall of the Clinton book since it was released in May could have broken records. “We had a lot more people pre-purchase than I expected. It is definitely in Harry Potter league. I don’t know of any book that has come close,” she said.
Leslie Garrett, at right, with her daughter, Savannah, far left, her mother, Ann Dynan, and her daughter’s friend, Isabella, were among the multi-generational groups who turned out for the Chelsea Clinton book-signing. CAPE COD WAVE PHOTO
Janet Daniels, a retired educator from Winchester who summers in the Maravista section of Falmouth, said, “I’m getting this book for my granddaughter.” Of Chelsea Clinton, she added, “She could be president some day, you never know.”
Standing next to her in line, Janet Simons-Folger of Falmouth was holding places in line for eight others, including her 91-year-old mother, who she picked up from a nearby nursing home to bring her to the event, as well as her daughter, Lian, 25, who was bringing her boss’s four daughters to the event all the way from Boston. “It’s all good—spreading the news on strong women,” she said.
Also standing nearby in line was Leslie Garrett of Florida, who has summered in Mashpee most of her life, with her mother, Ann Dynan, a retired teacher, and her daughter, Savannah Garrett, and her daughter’s friend, Isabella Paolini, both 14 years old. “The big thing for us is showing our daughters strong women are in history. My daughter wants to go into government and make a difference.”
Lauri Gilbert of Bourne, right, with her daughter, Maggie Gilbert, and her mother, Carole Valeri. All three attended Bourne High School, classes of 1981, 2011, and 1952, respectively. CAPE COD WAVE PHOTO
Nearby was another trio of generations. Lauri Gilbert, Bourne High School Class of 1981, was there with her mother, Carole Valeri, Bourne High School Class of 1952, and her daughter, Maggie Gilbert, 24, Bourne High School Class of 2011. Lauri Gilbert, a teacher, said she plans to use the book in her classroom.
One of the few men in line, Sam Shapiro, 26, of East Falmouth, said he attended the event to get a copy of the book for his three-year-old cousin, “a cute little girl with a lot of health issues.”
“I wanted to come and meet Chelsea and get a book signed for Karli,” he said.
He was with his mother, Debra Cormier, a teacher in Plymouth, who also said she plans to teach the book as part of her social studies curriculum “to read with my second graders.”
Culture Falmouth
A Vision for Falmouth’s Dome
Heavy Rain Causes Falmouth Flooding – Slideshow
Our Top 10 Cape Cod Wave Moments of 2019
Top 10 Most Popular Cape Cod Wave Stories of 2019
2019 – A Year Of Scenic Photos
Happy New Year From Cape Cod Wave!
Steven Xiarhos Retires – A Police Story. Is Politics Next?
Nimrod Property For Sale… Again
Can This Cape Cod Beach Be Saved? Falmouth Fights Coastal Erosion
Falmouth’s ‘Inconvenient Legend’: Melvin Reine Dies
Talking To Anti-Trump Demonstrators At The Weekly Falmouth Rally
A Tale Of Two Cape Cod Rallies About Trump, An Essay
Talking To Supporters At A Trump Rally In Hyannis
A Cleveland Browns Fan In New England
New Water Main In Falmouth – VIDEO
Falmouth Town Turbines Shut Down Forever; Two Neighbors React
Big Storm Photos – Trees, Wires & More… You Can’t Get There From Here
The Sea Was Angry That Day – Falmouth Storm VIDEO
Civil War? It’s Time For County Commissioner Ronald Beaty To Resign – An Editorial
Ron Beaty’s Political “Penance” – A Profile
Open Cape’s Fiber Optic Cable Coming Soon To Falmouth Main Street
New Herring Cove Beach Parking Lot – Slideshow
Brian Switzer, The Teacher Who Made It Cool To Be Smart And Motivated
Cape Cod Sharks + Surfers; A Changing Equation
A Cape Cod Shark Story; 10-year Anniversary of the Woods Hole Shark – CCW Classic
A New Outer Cape Newspaper + Charles Sennott On The Crisis In Journalism
Straight to Provincetown: Changing Demographics at the Cape’s Tip
Falmouth Road Race – On Their Mark, The Porta Potties Are Set, Go!
A Kennedy Tragedy & The Media Circus That Comes To Town – An Essay
Hey Boston Globe, Go Back To The City You Came From! – Editorial
Reading the Mueller Report in Provincetown — VIDEO
Laura M. Reckford
Laura M. Reckford is co-founder of Cape Cod Wave. She has been a reporter and editor on Cape Cod for more than 20 years in magazines, newspapers and radio. She has also authored numerous Frommer's Travel Guide editions on Cape Cod, Martha's Vineyard and Nantucket. | cc/2020-05/en_middle_0078.json.gz/line932 |
__label__cc | 0.59245 | 0.40755 | IN RE: DAILA W.
Supreme Court, Appellate Division, Fourth Department.
IN RE: DAILA W., DANIEL W. AND
CAF 14–01279
Decided: November 20, 2015
PRESENT: SCUDDER, P.J., SMITH, CENTRA, WHALEN, AND DEJOSEPH, JJ. CARA A. WALDMAN, FAIRPORT, FOR RESPONDENT–APPELLANT. KIMBERLY A. KOLCH, UTICA, FOR PETITIONER–RESPONDENT.
MEMORANDUM AND ORDER
JESSICA REYNOLDS–AMUSO, ATTORNEY FOR THE CHILDREN, CLINTON.
JOHN G. KOSLOSKY, ATTORNEY FOR THE CHILD, UTICA.
It is hereby ORDERED that the order so appealed from is unanimously affirmed without costs.
Memorandum: These consolidated appeals arise from a neglect proceeding pursuant to Family Court Act article 10 and a custody proceeding pursuant to Family Court Act article 6. Both proceedings concern Daniel W. and Daiana W., the children of Danielle W. (mother), respondent in both proceedings, and Daniel P. (father), respondent in the neglect proceeding and petitioner in the custody proceeding. During the pendency of the neglect proceeding, the children were placed temporarily with the paternal grandmother. In appeal No. 1, the mother appeals from the order of disposition in the neglect proceeding that, inter alia, returned the children to the care and custody of the father. In appeal No. 2, the mother appeals from the order in the custody proceeding that, inter alia, awarded sole custody of the children to the father.
As a preliminary matter, we reject the father's contention that these appeals were rendered moot by subsequent orders that modified the visitation provisions of the order in appeal No. 2. The subsequent proceedings did not address the custody of the children, and the orders in those proceedings therefore did not “render [these] appeal[s] on the issue of custody meaningless” (Matter of Karen PP. v. Clyde QQ., 197 A.D.2d 753, 754).
We reject the mother's contention that Family Court erred in modifying the existing custody arrangement by awarding custody of the children to the father. As the mother correctly concedes, “the parties' acrimonious relationship and inability to communicate with each other render[ed] the existing joint custody arrangement inappropriate” (Matter of Ingersoll v. Platt, 72 AD3d 1560, 1561). The mother also correctly concedes that the father established “the requisite change in circumstances to warrant an inquiry into whether the best interests of the child[ren] would be served by modifying the existing custody arrangement” (Matter of Mercado v. Frye, 104 AD3d 1340, 1341, lv denied 21 NY3d 859). Contrary to the mother's contention, we conclude that the court's determination regarding the best interests of the children is supported by a sound and substantial basis in the record and that the court properly considered the appropriate factors in awarding sole custody to the father (see Eschbach v. Eschbach, 56 N.Y.2d 167, 171–172; Matter of Olufsen v. Plummer, 105 AD3d 1418, 1418). “Giving due deference to the court's ‘superior ability to evaluate the character and credibility of the witnesses ․, we perceive no basis to disturb its award of custody to the father’ “ (Matter of Tarrant v. Ostrowski, 96 AD3d 1580, 1582, lv denied 20 NY3d 855).
Frances E. Cafarell | cc/2020-05/en_middle_0078.json.gz/line938 |
__label__cc | 0.674301 | 0.325699 | Steve McIntyre's big blooper - mistaking water mass movement for water temperature!
Update: see below for the latest bit of continuing obstinate idiocy from Steve McIntyre, plus another diagram, plus another reference.
There are undoubtedly a few knowledgeable people chuckling or groaning over an article Steve McIntyre wrote on his blog last week. In case you are, like me, loathe to visit a blog where the author has a tendency to both conspiracy ideation and alleging the work of scientists is a "scam" and their results "fake", these here are the nuts and bolts (as I understand it).
Steve McIntyre mistook water mass movement for temperature (archived here). Or more correctly, he mistook a measure which was used to indicate water mass movement as being used to indicate water temperature.
If you're wondering how anyone, even a climate science denier, could possibly make such a silly mistake, read on.
Rahmstorf15 and the Atlantic Meridional Overturning Circulation
You may recall the hullabaloo that followed a new paper by Stefan Rahmstorf and colleagues. I've already written about the three protest articles (in almost as many hours) on Anthony Watts denier blog (click here). Now Steve McIntyre is protesting loud and long - and making a huge fool of himself in the process. (He'd already written at least two protest articles that I haven't bothered to read. If they are as bad as this, his third(?), then they'll be very bad indeed.)
Rahmstorf15 was about the Atlantic Meridional Overturning Circulation (AMOC), and how it may have slowed in the late twentieth century (particularly between 1970 and 1990). The authors attributed this slowing to the influx of fresh cold water, primarily from melting of the Greenland ice sheet. The implication is that, because Greenland is going to continue to melt, the AMOC may continue to slow down and cause marked changes in climate up north, and probably in more places, too. The massive ocean currents have a turnover time of around 1,000 years - which is long term as far as humans are concerned. However the impact of any major changes would be felt in the short and medium term (decades to centuries).
To learn more, go read the article by the lead author, Stefan Rahmstorf, at realclimate.org, if you don't subscribe to Nature Climate Change (or don't want to buy the paper itself). I've previously put together a list of other articles on the paper, which are worth reading.)
How Steve McIntyre gets it wrong (again)
I heard about Steve's big blooper from a tip from Bill H in the comments here. So I popped over to Steve's blog (which I don't usually bother with). Steve was thinking that Stefan Rahmstorf and all his colleagues got something upside down. He was comparing a chart in Rahmstorf15, the AMOC paper, with one that he called "Sherwood11". Something about "d15N" data from corals off the coast of Canada.
Steve was in such a rush to show that "scientists don't know nuffin'" that he didn't say what "Sherwood11" was. No link. Nothing. (My first thought was U-NSW's Steve Sherwood, though I hadn't seen him write about corals before.) After a bit of detective work, I discovered Steve's "Sherwood11" was this paper by Owen Sherwood and co. (it's open access).
The Sherwood paper was about a nutrient regime shift in the western North Atlantic (as you can tell from the title: "Nutrient regime shift in the western North Atlantic indicated by compound-specific δ15N of deep-sea gorgonian corals"). The abstract suggests why this research was used by Stefan Rahmstorf in his study. Here's the relevant part from the abstract (my emphasis):
...In the Northwest Atlantic off Nova Scotia, coral δ15N is correlated with increasing presence of subtropical versus subpolar slope waters over the twentieth century. By using the new δ15N-AA approach to control for variable trophic processing, we are able to interpret coral bulk δ15N values as a proxy for nitrate source and, hence, slope water source partitioning. We conclude that the persistence of the warm, nutrient-rich regime since the early 1970s is largely unique in the context of the last approximately 1,800 yr. This evidence suggests that nutrient variability in this region is coordinated with recent changes in global climate and underscores the broad potential of δ15N-AA for paleoceanographic studies of the marine N cycle.
The Sherwood paper was describing changes in nutrient levels over the past 1,800 years or so, as measured by δ15N in a species of coral south of Nova Scotia. From that, the scientists were able to deduce changes in sources of water over time - with more or less water coming from the sub-Arctic compared to the sub-tropics.
BTW, "slope" refers to the continental slope, as shown in this diagram from the US Office of Naval Research:
Source: Office of Naval Research
When water from the cold sub-Arctic water dominates the region, it is much lower in nutrients than when warm water from the subtropics dominates. (This is described in Sherwood11 - and there's another description at NOAA, in the context of the North Atlantic Oscillation.)
Below is Figure 1 from Sherwood11, on which I've highlighted the area that the specimens came from. The map also shows the different sources of water, which dominate at different times:
Figure 1: Map of the study area with location of Northeast Channel. Blue arrows mark the approximate position of the Labrador Current, which transports Labrador slope water (LSW) southward, along-slope. Red arrows show the location of the Gulf Stream. Warm slope water (WSW) occupies the region between the Gulf Stream and continental shelf edge. Temperature and nitrate data were extracted from the 2 × 2 degree grid centered over the Northeast Channel, from 150 to 250 m water depth, where interannual variability is most pronounced (18). Temperature data are from the Bedford Institute of Oceanography hydrographic database. Nutrient data are from the Biochem database of Fisheries and Oceans Canada (44). Source: Sherwood11
How Steve McIntyre got his correlations wrong
Steve McIntyre mistakenly thought that Rahmstorf was using the δ15N data as a proxy for temperature of the water off Nova Scotia. They weren't. They were using the data (and findings) of Sherwood11 as an indication of the ocean currents. Steve mockingly wrote:
The idea that coldwater corals offshore Nova Scotia can be thermometers for ocean temperature in the subpolar gyre has little more plausibility than the belief that stripbark bristlecones in the distant Sierra Nevadas or contaminated Finnish sediments can be thermometers for the subpolar gyre.
If you're familiar with Rahmstorf15 then you'll be saying to yourself - but the paper was primarily focused on the region of the subpolar gyre, whereas Sherwood11 was about a location just south of Nova Scotia. And you'd be correct. You'll also be wondering why Steve assumed that the δ15N data used by Rahmstorf15 was as a temperature proxy - when both Rahmstorf15 and Sherwood11 were primarily about changes in ocean currents. Sure, Rahmstorf's AMOC index was based on temperature, but it was based on temperature of the sub-polar gyre - not on the temperature of the waters south of Nova Scotia. And Sherwood11 did discuss the temperature of the waters that were more (subtropical) or less (subarctic) rich in nutrients. But temperature wasn't the reason that Rahmstorf15 used the Sherwood11 data.
Steve had his correlations all wrong. If you still haven't caught on why, keep reading.
Movement of water mass, not a temperature proxy
Rahmstorf15 is all about the strength of the AMOC - how it slowed down a lot in recent years, particularly between 1970 and 1990. And it still hasn't got as fast as it was in the first half of the twentieth century. At one stage in the analysis, they used the corals as an illustration of the movement of ocean water mass (not temperature).
But first the diagram - Figure 5, which Steve picked out from Rahmstorf15, which shows the AMOC index (derived by the authors, based on temperature) as well as the annual mean bulk δ15N from Sherwood11 (as an indicator of water mass changes, not temperature changes) - as always, click to enlarge it:
In the text of Rahmstorf15, the authors state (my emphasis):
...The green curve denotes oceanic nitrogen 15 proxy data from corals of the US north-east coast from ref. 25. These annually resolved δ15N data represent a tracer for water mass changes in the region, where high values are characteristic of the presence of Labrador Slope Water. The time evolution of the δ15N tracer agrees well with that of our AMOC index (Fig. 5). Ref. 25 reports four more data points from ancient corals preceding the twentieth century, the oldest one from AD ∼500. These lie all above 10.5‰ [per mille], providing (albeit limited) evidence that the downward excursion to values below 10‰ between 1975 and 1995 and the corresponding water mass change may be unprecedented in several centuries.
That's right. Rahmstorf15 quite explicitly states that δ15N data represent a tracer for water mass changes.
It looks as if Steve McIntyre was so intent on proving that "scientists don't know nuffin'" that he didn't bother reading the paper. He copied and pasted the Figure 5 caption but didn't take the time to read the section in Rahmstorf15 that described the chart in more detail.
You'll also have noticed that Figure 5 has δ15N data plotted on the right hand axis, not the left hand one (which is a temperature scale for other different data). Maybe Steve missed that, too.
Now I'll show you the chart from Sherwood11, which Steve put up. It's a segment of Figure 3, which is of annual mean bulk δ15N from six colonies of the deep-sea gorgonian P. resedaeformis.
The two are very similar, aren't they. That's because Rahmstorf15 was using the data from Sherwood11. And notice the y axis label. It's not temperature is it. It says Bulk δ15N ‰. It's an indicator of the nutrient status of the ocean in that region over time. The (inverse) correlation with temperature (in that part of the ocean) is through the source of the nutrients - warm subtropical vs cold sub-Arctic.
As I said earlier, what got Steve so excited was that he (mis-)figured that Rahmstorf15 drew the wrong inference and were saying the mean bulk δ15N data represented temperature. Steve crowingly wrote further down:
It’s not even well established that coral d15N is a proxy for local ocean temperature. Coral d15N is not a well-studied proxy, to say the least. Only a few examples are reported with results from only one article being archived at NOAA. In one of the original articles on the proxy, co-authored by the lead author of Rahmstorf’s citation, d15N values were thought to depend on distance from sewage source.
Ha ha. Poor Steve. He doesn't even remember the title of Sherwood13. Yes, naturally enough (pun intended) there are many sources of nutrients that can increase the amount of mean bulk δ15N, including sewage. [To clarify/correct, sewage - and subarctic water increase the amount of δ15N. "During denitrification, light nitrate (14NO3-) is preferentially removed leaving the remaining nitrate pool enriched in heavy nitrate (15NO3-)" - see here Sou - a bit later.] Fact is, off the Labrador coast, the warmer water from the subtropics is more nutrient rich than the water from the subarctic. As stated in Sherwood11 (my emphasis):
During negative modes of the NAO, cold (6 °C), fresh (34.9 psu), and nutrient-poor (∼15 μM Graphic) Labrador Slope Water (LSW) is advected along slope, from the Grand Banks of Newfoundland to southwestward of Georges Bank (Fig. 1). During positive modes of the NAO, LSW retreats northeastward and is replaced by relatively warm (10 °C), saline (35.2 psu) and nutrient-rich (∼23 μM Graphic) Warm Slope Water (WSW) associated with the Gulf Stream.
Different regions, different surface temperatures
In case you are wondering, the temperature off the coast of Nova Scotia (Sherwood11) can be quite different to the temperature in the sub-polar gyre region that Rahmstorf15 was about. Here's a segment from a map from NOAA, showing the 2014 temperature as an anomaly from the 1880 to 1920 average. I've marked the different regions (click to enlarge):
It took five whole days before anyone noticed!
A whole five days passed before anyone commented on Steve's big blunder. Most of the commenters were dull and gullible and foolishly took Steve at his word (or what they could understand of his words.) Bill H was the first to point it out, writing much more succinctly than I did (archived here):
Steve, Having read the rahmstorf paper it is clear to me that nitrogen 15 content in coral is a proxy for water mass changes NOT temperature. Your entire post would consequently seem to be based on a false premise.
Steve McIntyre still didn't get it, replying:
Bill H, I do not understand what exactly you are objecting to. I do not claim to be infallible and try to correct errors when they are pointed out to me. Can you provide a direct quotation from statements that you believe to be erroneous. Simply saying that the entire post is “based on a wrong premise” is arm-waving. It is my understanding that Rahmstorf’s Figure 5 purports to show a positive correlation between Nova Scotia coral d15N and gyre temperature and I have seen nothing in your statements to change this understanding.
No. It's not "arm-waving". Bill rightly pointed out that the entire article is wrong. That it was based on a false premise, not that there was just one little itty bitty mistake. The whole damn thing was wrong. Did Steve really want Bill to quote the entire article?
Steve is stuck on his false notion that Rahmstorf15 included the δ15N data as a proxy for temperature, even though the paper specifically states it's an indicator of water mass changes, writing:
...These annually resolved δ15N data represent a tracer for water mass changes in the region, where high values are characteristic of the presence of Labrador Slope Water.
What follows from Bill H's comments is a lot of silliness, ranging from bristlecones to the disgraced Wegman. Really, I know a lot of deniers are hopeless at science, but surely they know the difference between "water mass changes" and "temperature". (I didn't see a sign of anyone except Bill H recognising Steve McIntyre's big blooper. If there was someone, Bill H might point it out in the comments.)
Update: Bill has pointed out that a commenter called Carrick saw what Bill H saw. I found it. (BTW I first archived this at Archive Today, but it chops off some bits, so the full version is also archived at WebCite, which didn't chop anything - but doesn't provide direct links to different bits of the article. WebCite includes a new comment by Steve - right at the bottom - where he's finally, six days later, showing signs of backtracking but not without some thimble switching.) [Sou - 12:54 am 8 April 2015 AEDT]
Update 2: How Steve's brain is stuck and won't budge
Steve McIntyre still hasn't got it. He's blundering about trying to link the Sherwood11 data to temperature, whereas the scientists linked it to water mass movement. In his latest comment he is still claiming a negative correlation - but it's not. That's because he can't get temperature out of his brain. (Is global warming causing a mind melt?). Well after lots of people attempted to point out his big blunder, Steve's last (latest) comment is:
In my opinion, there is considerable evidence for spatial autocorrelation of temperatures up to 1200 km or so. Indeed, this motivated the discussion of Chladni patterns in connection with our commentary on Steig et al 2009, as principal components applied to spatially autocorrelated data in a finite geometric region yields Chladni patterns.
The average distance from the Nova Scotia corals to the subpolar gyre gridcells used in R15 is 2500 km, double the Hansen radius. In addition, Rahmstorf is not arguing for a positive correlation, but for a NEGATIVE correlation. While NH wave patterns do exist, it’s a large jump to claiming that these are stable enough to yield a permanent negative correlation of temperatures at a distance of 2500 km or so.
And further down he wrote: "nor did Rabbitt support large negative correlations. A complete red herring."
He's wrong. Rahmstorf15 AMOC index showed a positive correlation with mean bulk δ15N as measured by Sherwood11. The AMOC index declined when the mean bulk δ15N declined, and rose when the mean bulk δ15N rose.
Steve's still got his correlations wrong. The positive correlation is with mean bulk δ15N, which is a "tracer for water mass movement". In other words, less Labrador sea water was pouring south into the region where the Sherwood11 coral measurements were taken, over the time that the AMOC was shown to slow. That is, over much of last century and most particularly from around 1970 to 1990. (See the charts above.) That meant that the corals had better access to nutrients. The Labrador slope water is nutrient poor, the water coming up from the subtropics is richer in nutrients. (Lower mean bulk δ15N signifies a more nutrient-rich environment.)
Steve's comment was after more than one person tried to correct his misconception. Even Eli Rabett chimed in with a detailed explanation, and pointed out that teleconnections aren't necessarily about atmospheric connections (they can be about ocean currents, too). Note that the second half of Eli's comment is not Eli, but Steve.
The last paragraph in Rahmstorf15 reads:
Although major uncertainties remain about the past evolution of the AMOC for lack of direct measurements, indirect evidence from multiple sources provides a consistent picture, linking together the time evolution of surface temperature, ocean circulation and, possibly, Greenland ice mass balance. If the interconnections between these three components continue as we have conjectured, the ongoing melting of the GIS, which reached an extreme in 2012 (ref. 44), may lead to further freshening of the subpolar Atlantic in the next few decades. Bamber et al.45 estimate that if current trends continue, the Greenland freshwater input from 1995 to AD 2025 may exceed 10,000 km3. This might lead to further weakening of the AMOC within a decade or two, and possibly even more permanent shutdown of Labrador Sea convection as a result of global warming, as has been predicted by some climate models.
Steve needs to read up on AMOC and Labrador sea convection. Or even look at some pictures, like this one from The Encyclopedia of Earth:
Topographic map of the Nordic Seas and subpolar basins with schematic circulation of surface currents (solid curves) and deep currents (dashed curves) that form a portion of the Atlantic meridional overturning circulation. Colors of curves indicate approximate temperatures.
Source: R. Curry, Woods Hole Oceanographic Institution/Science/USGCRP. Linked source: EoE
Or for more detail, this one from the Bedford Institute of Oceanography, which also has a short explanation of why the Labrador Sea is so important:
Source: Bedford Institute of Oceanography
Note also that Stefan Rahmstorf has been studying Atlantic circulation probably since before Steve McIntyre had ever heard of AMOC. He had a much cited paper in Nature twenty years ago, back in 1995:
Rahmstorf, Stefan. "Bifurcations of the Atlantic thermohaline circulation in response to changes in the hydrological cycle." (1995): 145-149. doi:10.1038/378145a0 (pdf here)
Who do you "believe" - an expert who has specialised in the subject for decades, or a conked out denier blogger with no scientific training or expertise, who can't tell the difference between temperature and mass movement? That's a rhetorical question :D
Added by Sou 8 April 3:40 pm AEDT
Rahmstorf, S., J.E. Box, G. Feulner, M.E. Mann, A. Robinson, S. Rutherford and E.J. Schaffernicht, "Exceptional twentieth-century slowdown in Atlantic Ocean overturning circulation", Nature Climate Change, 23 MARCH 2015 | DOI: 10.1038/NCLIMATE2554
Sherwood, Owen A., Moritz F. Lehmann, Carsten J. Schubert, David B. Scott, and Matthew D. McCarthy. "Nutrient regime shift in the western North Atlantic indicated by compound-specific δ15N of deep-sea gorgonian corals." Proceedings of the National Academy of Sciences 108, no. 3 (2011): 1011-1015. doi: 10.1073/pnas.1004904108 (open access)
Labels: Atlantic Meridional Overturning Circulation, Bill H, denier weirdness, nitrogen isotope, nutrients, Owen Sherwood, Stefan Rahmstorf, Steve McIntyre, water mass
Captain Flashheart April 7, 2015 at 9:58 PM
Gorgonian corals... What a cool name!
It's worth remembering Steve is an incompetent poseur, and everything he does is wrong. He also seems, in that thread, to have implicitly accepted one of the major flaws of the wegman report, though of course he denies it is his fault (even though wegman used Steve's code). That's progress of a sort, I guess...
Sou April 7, 2015 at 10:03 PM
Yes - great name isn't it. I should have worked it into the title of the article - missed opportunity :(
Bernard J. April 9, 2015 at 1:23 PM
Speaking of titles, I'm leaning to a temporary change from 'HotWhopper' to 'Climate Audit Audit'.
In the article "Week in Review" on Climate Etc April 3rd 2005, Dr Curry said this:
"As a follow up to recent post Whats up with the Atlantic? Steve McIntyre has 3 posts that DEVASTATES Rahstorf and Mann’s argument:"
In a previous article Dr Curry made glib, unsubstantiated and unprofessional remarks about Rahmstorf et al's use of proxies.
These days Judith is no more than an echo chamber for denier blogs. She doesn't bother applying any of her scientific knowledge to check their silly claims. She knows her audience well.
http://blog.hotwhopper.com/2015/02/confessions-of-deniers-at-judith-currys.html
Ha,, Harry, you beat me to it: see below.
Thanks for the info about the earlier Curry article. I'll have a look at it but imagine it will lean very heavily on McIntyre's posts. Gavin Schmidt's remark in the famous set to with Judith: "In future I shall assume you are just being a conduit for someone else's opinions" is proving to be a sound strategy.
I've followed up the Curry reference and compared with McI . How about this for plagiarism:
McIntyre, March 25th:
"Rahmstorf and Mann’s results are not based on proxies for Atlantic current velocity, but on a network consisting of contaminated Tiljander sediments (upside-down or not), Graybill’s stripbark bristlecone chronologies, Briffa MXD series truncated to hide-the-decline and hundreds of nondescript tree ring series statistically indistinguishable from white noise. In other words, they used the same much-criticized proxy network as Mann et al 2008-9. It’s hard to understand why anyone would seriously believe (let alone publish in peer reviewed literature) that Atlantic ocean currents could be reconstructed by such dreck, but Rahmstorf et al 2015 stands as evidence to the contrary."
Curry: March 25th:
"Well, if there is anything I distrust more than climate model simulations of decadal to millennial scale ocean circulations and internal variability, it is Mannian proxy analysis of same. It seems like strip bark bristlecones and Tiljander sediments can tell us about Gulf Stream flow rates, as well as global temperatures. Remarkable."
A "conduit for someone else's opinions" indeed
The Very Reverend Jebediah Hypotenuse April 7, 2015 at 11:54 PM
Anyone who hasn't read the 'real climate' eschange between Curry and Schmidt really should. Now THAT was DEVASTATING.
Here's the full Gavin quote that bill is paraphrasing:
[Response: Thanks for passing by. In future I will simply assume you are a conduit for untrue statements rather than their originator. And if we are offering advice, might I suggest that you actually engage your critical faculties before demanding that others waste their time rebutting nonsense. I, for one, have much better things to do. – gavin]
KR April 8, 2015 at 1:09 PM
I read that, Reverend. And what saddened me the most was the intellectual _laziness_ that Curry exhibited - taking Montfords arguments at face value despite their ridiculous lack of sense, without ever applying a critical thought.
It's telling that Curry is insufficiently critical of the analysis that she completely misses what would be a mortifyingly embarrassing mistake for a first year undergraduate in biology.
But then, she herself admits that she has no ecology experience whatsoever, so it's no surprise that her capacity to understand and comment on the subject of isotope analyses in biological systems is severely limited by her reluctance to put her ideology aside in favour of due diligence in objective learning and understanding.
That said, she appears to be confident in her comments on the issue so perhaps she stands by them even now. Ten points for persistence in the face of opposition. I hope that people who might consider her next job application are able to take into consideration matters such as this.
It's worth noting for the record that oxygen (amongst other elements) isotope records in coral depositions can be used as a temperature proxy, and indeed are so used.
And guess what they show?
bill h April 8, 2015 at 7:19 PM
Thinking about Curry's parroting of McIntyre should she be reported for plagiarism? If an academic writes something that consists so much of quotes from what someone else said in another article is it not incumbent upon him/her to reference the original article rather than pass what s/he has written as his/her own creation?
Nah, the tedium of referencing is usually reserved for academic publications. It's good form to acknowledge your source, but on a blog, I don't think anyone would really care. Curry's not even really an academic anymore, and McIntyre is hardly going to complain.
Rational Troll
Lionel A April 10, 2015 at 9:19 PM
Seeing the TVRJH post above I had to revisit this at Real Climate by the full thread, the descent from scientist to nonsensist that Curry has demonstrated would make an aerobatic pilot's heart stop. Nothing brings this out more than the preceding comment #168 here:
http://www.realclimate.org/index.php/archives/2010/07/the-montford-delusion/comment-page-4/#comments
a head to head between Gavin and Curry would be a popcorn show but I doubt Curry would even dare.
Bill H April 7, 2015 at 10:53 PM
Sou, I may be succinct, but you greatly surpass me in your knowledge of the subject. This is an excellent post. I confess to being duped by Steve, since I had thought that the graph for the Sherwood data was of temperature vs time. Steve's howler is consequently even bigger than I thought. Like you I find there's something particularly unpleasant about Climate Audit, arising I'm sure from Steve's incessant hints and allusions concerning fraud and tricks - never just honest error. Watts and co. are much more like circus clowns, and consequently that bit more bearable. I was prompted to go there on impulse after seeing a "highlights" post from Prof Curry that included a reference to three "very technical" articles by McIntyre that were "devastating" for Rahmstorf et al. No indication as to what made them devestating, and I think "very technical" can be decoded as "I really didn't feel like making the effort to get to grips with them, but I know from Andrew Montford's brilliant book that Steve is one of the towering intellects of the modern age so I'm sure he can demolish anything by Mann and The Team".
I was fortunate that the first person to respond to my post was Carrick, whom I managed to persuade very speedily that Steve was wrong. He was the only person with whom I could have a civilised discussion. The reception from most of the crowd was every bit as low brow as I receive at WUWT. I was described as "hysterical", as "having issues", as being "Bill H. Rahmsdork, baby daddy of Ramsdorf (sic)", etc.... Steve started out as modertely polite, but has gradually moved away from his original claim that Rahmstorf et al. “used nitrogen -15 concentrations as a thermometer”, to something along the lines that they have produced a “squiggle on a graph with no statistical significance” – that’s what “Trick 3” has currently morphed into. I don’t know how much longer I want to play cat and mouse with Steve, but I might return for another round or two, especially with your briefing!
You have summed up the situation well. I was surprised that it is possible to find someone on WUWT who can think - you just have to ignore the constant jabs and trolling from dbstealey, the moderator.
I made a bit of a blooper myself - sewage decreases N in corals. It can kill them. I've fixed the article. The rest of the article should be fine.
Captain Flashheart April 7, 2015 at 11:42 PM
I noticed that Steve opened his reply to you with "I never claim to be infallible..." Who ever does that in writing or speech? Only a person who really does believe they are infallible...
I think you're pissing in the wind there, Bill H, but points for trying!
Sou April 8, 2015 at 12:18 AM
And again - my N isotopes were getting all topsy turvy and falling all over each other. The bit in the article about sewage was right the first time - almost.
Jammy Dodger April 8, 2015 at 12:26 AM
Yes, Bill H. Points for trying. I read through the comments (before Sou posted this article) and I did not really understand what was going on. The one point I did pick up was that you were saying the proxy was for water mass and not temperature. I had no idea if you were correct or not.
However I did notice how many people attacked you as hysterical (and you without a womb!) but none of these critics addressed the point you were making. I thought you did well to ignore the distractions - though to them that was more evidence of your hysteria. I got the distinct impression it was them getting hysterical.
Perhaps I will try again to understand this mass vs temperature thing as Sou has written an explanation. Keep up the good work.
I'm guessing Steve also hasn't corrected his guest post about Marotzke & Forster where Nic Lewis took advice from an economist and a mathemtician to suggest that Marotzke & Forster had made some kind of silly circular mistake that should be used in undergraduate classes as an example of a stupid mistake.
What I've discovered is that when someone says "I'm happy to correct my mistakes", what they really mean is "I'm happy to correct my mistakes, as long as you can prove - to me - beyond any measure of doubt, that I made one". That latter making it virtually impossible to convince them of a mistake.
Nick Stokes April 7, 2015 at 11:22 PM
SM did something similar in an earlier post on the Labrador Current, as described here. He cited some data of Sicre et al to claim that no 20Cen spike was evident, contrasting with Marcotte. But he hadn't read the paper, Sicre et al weren't testing just any locations. They chose locations that would respond to the movements of the Labrador current. They showed how in past periods of warmth, these alkenone sites showed cooler temperatures. They believed that the current AGW would drive stronger NW winds, enhance the LC, and produce cooling. They chose the sites specifically to test this. And yes, there was cooling, or at least, no warming.
Steve McIntyre is the living embodiment of why one should be slightly circumspect in your criticism of someone else's work if you want them to actually interact with you when you do so. Of course, if your goal is simply to generate talking points so that people can say "that work was debunked by...." then he's actually quite effective.
I was actually being challeneged on BH as to why I didn't go and comment on CA. I have, actually, but dealing with people who may be statistical experts but understand little physics is just tedious, especially when they think that a discussion should proceed via "No, you're wrong, I'm right".
ATTP, Steve might claim statistical expertise, but he has made huge statistical bloopers. Quite famous ones - talk about red noise :D. See also Deep Climate's excellent series. And he never was able to come to grips with exploratory factor analysis, used in the moon-landing paper.
I think it's a case of a childhood win of a math prize giving him delusions of omnipotence. His main problem being that about the only way he can try out his ideas is by posting them on his blog - for all the world to see his blundering and flailing about. He burnt any bridges he could have forged with the real experts long ago. All he's got is an economist and his denier fans. And they won't usually explain to him his mistakes. They are just for 'rah 'rah effect - like a chorus of idiots.
Yes, I'm aware of his past mistakes. Interestingly, he made a comment on my blog recently on a post where I was discussing an interview with Michel Foucalt. For some reason, his comment essentially pointed out that Foucalt may have belonged - at the same time - to the same organisation in Paris as Pol Pot. A somewhat odd thing to highlight, although Steve does seem to apply guilt by association more than might be regarded as reasonable.
Captain Flashheart April 8, 2015 at 12:56 AM
ATTP, it's unlikely that a man of Steve's intellectual calibre and educational background could understand Foucault, but it's highly likely that a man of Steve's political background would object to Foucault's ideas on principle. So he was just doing what he does to the climate scientists whose work he doesn't understand: smearing by implication and association.
He's nasty and he doesn't understand his own weaknesses.
Sou April 8, 2015 at 1:08 AM
Just checked what he wrote. Good grief! The French Communist Party has nothing in common with the Pol Pot regime in Cambodia. It's a respectable mainstream (if now minor) political party.
Steve was showing (once again) his nasty side, which seems to be the main side he shows to the world.
BTW - Even Steve saying "they might have been acquainted" solely on the grounds that they both belonged to the PCF for a very brief period, is a big stretch. I don't know the membership in the early 1950s, but according to Wiki, the PCF had 520,000 members in 1978!
http://en.wikipedia.org/wiki/French_Communist_Party
It was a rather odd comment. Steve might not understand Foucault, but I've just realised that I can't spell it :-)
McIntyre reminds me of a person who knows how to dismantle the engine of his car, and therefore thinks that he is able to race on a complicated track at full speed without ever having studied the route.
It just doesn't work like that.
Actually, I'll make a slightly more serious comment. There is something you learn after years of listening to other paper give scientific presentations, or read other people's scientific papers. Invariably when you think you've found some kind of obvious and silly mistake, you haven't; you've typically illustrated that you haven't properly understood what they were doing. That's why you then go and ask them questions before pointing out this obvious and silly mistake.
Rattus Norvegicus April 8, 2015 at 1:41 AM
Steve has never figured that out. It would also seem that he hasn't figured out that it helps to read papers before you critique them.
Steve used to have a reputation for "asking questions", or more properly, for endlessly harassing scientists and then either telling fibs about their work, or trying to pull apart some inconsequential "flaw" he thought he'd found, when mostly he was wrong - like in this case. I doubt too many scientists would fall for his "question asking" these days.
There is a lot he has never figured out.
Magma April 8, 2015 at 6:19 AM
...*almost* invariably. Very occasionally a "What did they mean? They couldn't possibly have meant...?" turns out to be justified.
caerbannog April 8, 2015 at 6:57 AM
This was inspired by a "debate" completely unrelated to climate science, but it sure as heck reminds me of McIntyre: http://i1.kym-cdn.com/photos/images/newsfeed/000/873/260/a5b.png
Dan Andrews April 8, 2015 at 8:10 AM
That's my default position too, and I'd drill that into my students' heads--i.e. if you think you've found a mistake, it most likely is a misunderstanding on your part especially if you're not an expert in the subject matter.
Well I now know where my friend gets his "debating" skills from. This guy absolutely fawns over McIntyre.
"Back in 2004, 2005, and 2006 (and beyond), Dr. McIntyre and Dr. McKitrick eviscerated the MBH98/99 hockey schtick graph with a series of peer-reviewed papers that ended up making their way into the references for the 2007 IPCC document...and landed both scientists positions as "expert reviewers" for the paleoclimate sections for AR4."
He's also admitted to me that he's been encouraged by McIntyre to spam these unmoderated forums to drown out anyone who disagrees with him. What's it called when you purposefully obfuscate and misrepresent what a scientist wrote? Gish-galloping of the highest order?
You could swap water mass movement and water temperature with the contribution of dynamics versus thermodynamics to sea ice thickness and I wouldn't be able to tell Rick Cina and McIntyre apart!
That statement is pretty bizarre, given what actually occurred. I especially like the claim about being an "expert reviewer". My dead pet cat could be an expert reviewer of 4AR.
A misrepresentation can take the form of a straw man. The idea is you make a "man of straw" out of what your opponent is saying and attack that instead of the argument. It is a dishonest debating technique.
I consider anyone using dishonest discussion techniques to be a troll. A troll isn't really interested in getting to the truth, they are only interested in "beating" their opponent. This fits my definition of a troll.
@whut April 8, 2015 at 4:12 AM
And then there was Null of HackIntyre.
Full of fury signifying nuffin.
Douglas Bush April 8, 2015 at 5:06 AM
All this says to me is that perhaps the deniers could benefit from peer review. Or at least some pal review which I hear they prefer. Just sayin...
Millicent April 8, 2015 at 5:35 AM
We are all of us waiting with scarcely concealed excitement for the revived Pattern Recognition in Physics and also (if one was not enough) the OAS's prestigious publication: journals which we all feel will rapidly establish themselves as leaders in the field.
Lotharsson April 9, 2015 at 3:51 AM
To be fair, some of them tried their version of that "peer review" thing in 2001-2004 and it went spectacularly poorly for them.
That incident reminds me somewhat of this one in its failure to utilise the correct data for the argument being made, although the McKitrick and Michaels debacle was arguably worse.
rumleyfips April 8, 2015 at 7:59 AM
I tried to read McI's blog once but couldn't: he can neither think nor write clearly. I always gave the shifty eye to his statistical and mathematical expertise.
Now I find that the problem is that he won't ( or can't ) read.
Cugel April 8, 2015 at 8:53 AM
I've always thought of McIntyre as Slimy Steve. His natural style is innuendo and then, when called on some insinuation, bringing on the fake outrage because "I never said that! Show me where I said that!"
One of Nature's born gits.
It's a common tactic. I've quite commonly encountered people (Andrew Montford is another) who will claim not to have said, or implied, something while clearly saying, or implying, exactly what they're claiming not to be saying (or implying) - okay, that's a bit convoluted which may actually be quite apt.
Montford is a great one for constructions like "one could be forgiven for thinking that...." when he's making his accusations. He can then claim when they're shown to be false that he never "thought" them anyway.
I've tried to be balanced when it comes to criticising people like Montford. However, after hearing him say on the BBC "the IPCC says that the net effect of the next few degrees of warming will be zero" (paraphrasing) I can't help but conclude that he's either dishonest, or stupid. I think he's also got a habit of simply not correcting genuinely factual errors, as illustrated in the past by William Connolley. I should acknowledge, that I may still be slightly ticked off that he doesn't have the word "twat" in his moderation list (I'm probably about to find out if Sou does :-) ).
Sou April 8, 2015 at 8:17 PM
ATTP, it wasn't even in my vocabulary, I had to look it up. (I live a sheltered life :D)
Google blogger doesn't have as many features as WordPress - moderation is solely by human intervention (except for Google's excellent spam filtering).
Hmmm, I'm somewhat disappointed that I've managed to expand your vocabulary in that way. Apologies :-)
At least now I'll know it's not a compliment if I'm called one.
(I'd rather learn such things from a physicist engaged in civil discourse than anyone else :D)
BBD April 9, 2015 at 5:12 AM
You should have seen what the recent charm contest winner at ATTP called ATTP the other day. Funnily enough, you banned him here a while back when he was posting as Rum Runner.
Watts and McIntyre are some of the biggest fools arounds. Hardly anybody will try and debate that. The only person I know of that is worse is Senator Inhofe. At least Watts and McIntyre TRY to read and understand the science (but failing miserably). Inhofe however, totally rejects ALL science, embracing some kind of warped creation-fabricated illusion instead.
Climate deniers are getting REALLY desperate as the climate continues to prove them wrong, wrong, wrong. This was inevitable - you cannot “deny” physics no matter how often you wish it would all just go away and leave you alone.
Nobody is escaping this topic, but the head-in-the-sand denialism is sure entertaining to watch.
Aggie April 8, 2015 at 3:29 PM
I didn't realise McIntyre was still blogging. I used to read his output around the hacked email time and fouind an endless stream of paranoia and personal villipend directed towards Michael Mann.
Tedious, obsessive and inconsequential.
I've added an update to the article. Steve's brain is stuck in temperature and no-one can get it to budge.
Brandon R. Gates April 8, 2015 at 6:54 PM
It's been said many times: professional fault-finders simply can't afford to ever be wrong. Thanks for the clear write-up and a much needed dose of sanity.
cRR Kampen April 8, 2015 at 8:24 PM
"A whole five days passed before anyone commented on Steve's big blunder."
It was no blunder, it was purpose. Do not presume innocence with climate revisionists.
In this case McIntyres tactic was just one more resounding succes. Five days!! Easy to guess what we'll find in non-knowledgeable MSM forums where people write who actually have permission to vote. You will find McIntyre all over. You will not find the debunk, or where it is presented you will find abuse.
You may be right, cRR. On the other hand, it could just be a sign that no-one of any substance visits Steve's blog much these days, or if they do they don't bother commenting. Bill H may have been a rare exception. That would mean that all Steve is doing these days is preaching to the 8% Dismissives. Like Anthony Watts and Judith Curry.
Even though Inhofe etc are in that group and have some influence politically, I don't think they will be able to stop the huge shift to renewables that seems to be starting.
I still maintain that the big shift will come from business and industry, and governments will mostly be playing catch up, after the event. Provided governments don't actively prevent the shift to renewables, that is. It'll be rather like the rapid change in information and communications. Blink, and we'll find ourselves in a different world.
It will still take intervention and international cooperation to get us as far as we need to go - but there are signs (eg with coal) that the shift is already happening and I doubt it can be stopped. Not saying there won't be a lot of damage from climate change - just that it's not *only* government policy that will drive the shift to renewables.
numerobis April 8, 2015 at 11:15 PM
It seems like industry managed to keep anglophone countries stuck on fossil fuels, but they seem to have largely overlooked the rest of the world. It's East Asia and Northern Europe that are laying the groundwork for post-fossil capitalism.
cRR Kampen April 9, 2015 at 12:16 AM
Yes, numerobis. And forget Holland, where Shell has kept the country in a #3 most backward position re renewables in all of Europe. But then Holland always had a transatlantic that is anglophilic hang too.
HAS April 8, 2015 at 8:31 PM
The curious thing of course is that Rahmstorf 2015 has the AMOC index +vely correlated with temp, and +vely correlated with the δ15N tracer.
Sherwood 2011 on the other hand has the δ15N tracer lagged as -vely correlated with temp.
Now the fact that so much can be written here without mentioning (or even trying to explain) this apparent contradiction suggests some embarrassment at the most generous.
It has been explained, HAS. Read the article again. There is no contradiction, apparent or otherwise.
The Sherwood11 region is quite different to the subpolar gyre region. The temperature in the Nova Scotia region isn't the issue as far as Rahmstorf15 goes.
The temperature around Nova Scotia is warmer when d15N is lower because the nutrient rich water comes from the subtropics. It's cooler when d15N is higher because the water is coming from the Labrador Sea, which is nutrient poor. It's the *nutrient status* that is how the researchers can tell where the water is coming from rather than the temperature - which is the whole point.
The nutrient status is the indicator of origin of the water - I'd say a much better indicator than temperature going back in time (1800 years for Sherwood11). The nutrient status would probably also give a rough guide to past temperatures - but that's only by correlation - not as a direct measure. d15N *was* directly measured. (There haven't been thermometers continuously at that site for the past 1800 years.)
When the AMOC slows down, less water is driven down to Nova Scotia from the subArctic, so it's getting more nutrient rich water from the subtropics.
As I say, there is no contradiction. Temperature of the water around Nova Scotia isn't the issue. It's where the water is coming from that's the issue - north or south. The correlation in Rahmstorf15 is of the AMOC index with dN15 (nutrient status) not with temperature off Nova Scotia. Mean bulk dN15 indicates where the water is coming from.
This is clearly explained in Rahmstorf15 (and elsewhere).
You are mixing up correlations. I'll say it again. The correlation in Rahmstorf15 is with mean bulk d15N as an indicator of water mass movement. It's not a correlation with temperature (Temperature *would* be an inverse correlation, but that's not what was being measured - it's dN15.)
What I don't get is why CA readers can't get that. It's not rocket science.
Sorry for the repeats. I figured I'd try different ways of explaining it to see if one of them scored some understanding :)
You are mixing up correlations. I'll say it again. The correlation in Rahmstorf15 is with mean bulk d15N as an indicator of water mass movement. It's not a correlation with temperature ... off Nova Scotia .
Since the AMOC index is itself based on temperature, obviously it goes up with the temperature of the subpolar gyre goes up and down when the temperature of the subpolar gyre goes down.
The subpolar gyre is a distance from Nova Scotia - so the temperatures of the two regions are not expected to be the same. Particularly because of ^^.
The first rule of Climate Auditing is:
The Auditor is never wrong. Ever. Got that?
The only way McI's blog can survive is if all his sycophants believe that. And they do.
Steve led his readers astray from the outset, when he wrote:
Rahmstorf’s Figure 5 shows a positive correlation between temperature and coral d15N (both decline together), while Sherwood et al reported a negative correlation (r=-0.27) between temperature and coral d15N. How’d they do that?
The answer is obvious to everyone but Steve himself (and maybe Steve's sycophants, who can't or won't think for themselves).
The temperature in Rahmstorf15 is the temperature of the subpolar gyre south of Greenland. The temperature in Sherwood11 is of a completely different region - off Nova Scotia.
When the temperature of the subpolar gyre drops enough from, say, the melting of Greenland's ice sheet - the AMOC slows down, the currents toward Labrador slow down, and in the region Sherwood11 was studying, more water comes from the subtropics rather than from the subArctic, so the water in that region is warmer.
Like I say - it's not rocket science.
When he started banging on about d15N around Hawaii, it showed he'd really lost the plot. (Not really, it was clear he'd lost the plot well before then.)
HAS,
Your question is perfectly reasonable and perhaps Sou is being overly harsh. It's not easy when Steve Mc repeatedly states in his post that Rahmstorf et al. were making measurements off the coast of Nova Scotia - the same area as Sherwood et al. Naturally, you have every right to be suspicious if the two groups obtain opposite correlations.
He was seriously wrong, as Sou points out. It gets even more confusing because all of a sudden he DOES start saying (7th April) that the two sets of measurements were 2500 km apart - correctly. Maybe he'd nipped over to Hot Whopper to see what all the fuss was about. He doesn't make any announcement of his previous error, or amend his original post to reflect the error. As a result it is even more difficult to work out what Trick no. 3 might actually have morphed into. Do you have any ideas?
Dan Andrews April 8, 2015 at 11:39 PM
I don't mind the repeats...I found them helpful in my understanding, probably because a few pieces from the paper and from your article hadn't clicked into place yet. Your multiple explanation was much appreciated.
HAS, I remember you were present during the Lewandowsky debacle, when McIntyre also showed himself to be completely out of his depth. What is it going to take for you to realize that Steve is incompetent and ignorant?
KR April 9, 2015 at 12:50 AM
It's always been my impression that McIntyre is clever (as in digging into details, playing with various statistical methods) without being smart (as in understanding the background behind the data or the proper interpretation of results or significance).
That was the case in the McIntyre/McKitrick papers disputing Mann et al 1998, where they applied PCA but failed to apply _any_ selection rules for component significance (the MM method derived 5 significant components, the MBH method had 2), resulting in MM incorrectly asserting that there was no hockey stick in the data. And in McIntyre's mis-application of PCA to Lewandowsky et al 2013, where he clearly didn't understand exploratory factor analysis (EFA), and again used the wrong number of principal factors. And over and over again with his various proxy nit-picking: an immense focus on the leaves while ignoring the forest.
Add to that the _constant_ insinuations of malfeasance and nefarious action, and McIntyre is both generally wrong and quite tiresome.
cRR Kampen April 9, 2015 at 1:26 AM
How typical he always errs to a certain side, or would that _actually_ be clever?
KR April 9, 2015 at 2:23 AM
I think it's simply motivated reasoning - having a conclusion and searching for arguments to support it, regardless of validity, applicability, significance, or an actual understanding of the statistical tools used.
Sure, KR. But I presume he does have an actual understanding of said tools. After 15 years of being taught and taught again.. Sorry, no innocence, to which stupidity may belong, to be found there.
numerobis April 9, 2015 at 2:41 AM
cRR, your constant insinuations of malfeasance are tiresome. If you have specific evidence against a particular individual, sure, lay it out.
Talk to Mann about malfeasance of McIntyre or the Serengeti strategy. Not to me. I'm just calling a thug a thug.
This guy holds a B.Sc math at Toronto Uni. This means you can simply assume the man is quite versed in e.g. factor analysis and really all other statistical tools used in climatology. It means he can actually and succesfully concoct and merchandise doubt which is what he has been doing since at least the publication of the so-called 'hockey stick'.
All those presuming 'stupidity' or any other kind of innocence with this man are fooled just as hard as the layman audience. Now: the thing I take issue with is that keeping up this presumption of innocence - like 'the man doesn't know better' and stuff like that simply helps him and his ilk merchandising the doubt. Because the general public cannot fathom the technicalties in e.g. a piece of Sou here; the only thing they see is heated discussion about climate change and the only conclusion they can make is 'the science is not settled'. You might have read a recent poll of US citizens of whom only a third know that scientists carry an even stronger consensus on CC than on 'cigarette smoking is dangerous' or evolution theory. That number is McIntyres succes and much of it is created on/by truly good blogs.
There is no innocence in climate revisionism.
As usual, you just double down on the vague allegations. If you want to play the man, be specific and provide actual proof. Things he's said are not proof that he's vaguely not innocent in some unspecified way. All they're proof of is that he's a vindictive asshole and an unrepentant idiot.
HAS April 9, 2015 at 8:19 AM
So the argument then is that temp in the Northwest Channel is negatively correlated with temp index Rahmstorf construct from GISS extracting the NH temp from the temp in the subpolar gyre region.
All well and good but the δ15N tracer looks much more like inverse of the NH that is meant to be extracted in the Rahmstorf temp index.
Perhaps what the δ15N tracer residue association with the index is just telling us the that the index over-extracts the NH temp. I can't see how this is done from the paper or SI, but it looks as though rather than being the difference between two regional temps (NH-SPG vs SPG) it compares NH (that includes SPG) with SPG.
The reason you can't see how it is done is because it wasn't done, dimbulb. It marks the source region for the water. (I hope I've got this right) Lower d15N means that the water is coming from the more nutrient rich tropics (Gulf Stream) and higher d15N means that the water comes from the Labrador current. It is a proxy for the relative strength of the two currents and has nothing to do with temperature.
But then I figured out that Steve was a mendacious little twat close to a decade ago and have ignored him since. You would be well advised to to likewise.
HAS April 9, 2015 at 10:13 AM
Rattus it may surprise you that Rahmstorf do in fact construct a temp index for the AMOC. It is sort of what their paper is about. Go read it.
First of all my apologies if I misled you further back in this thread. I had misunderstood Steve McIntyre while "debating" at Climate Audit, so please ignore my earlier comments.
But then everybody at Climate Audit seems to have failed to understand the Rahmstorf et al paper, despite Steve having produced 3 posts on the subject. The crucial thing is that d15N is NOT a proxy for temperature. Its a proxy for nutrients - because they contain nitrogen. Since polar flows into the gyre have different nutrient content to flows from the tropics it allows us to estimate which flow dominates. Now with this in mind I suggest you go back to Sou's article at the top of this post and read it: I found it helped my limited understanding and hence my ability to hold my own at Climate Audit. My advice to you is that if you want to learn about Climate Science don't try to do it at Climate Audit: 3 posts from McIntyre on the subject, yet his audience don't understand the ideas in the paper. Why? Because, to be frank, that isn't McIntyre's purpose. His purpose is to see if he can spot errors, and explain these errors in detail. While such audting can have value it's not really useful if you just want to understand what the authors did and why they did that. Maybe you are suspicious of climate scientists and so are attracted to what McIntyre does: well that's your right. All I would say is that it's worth going elsewhere to get your understanding of the work climate scientists do. Apart from anything else you then are better equipped to spot the flaws in the work.
Rattus Norvegicus April 9, 2015 at 10:41 AM
I've read his explanation but have not had time to read the paper. The use a difference between the region in question (south of Greenland) and the northern hemisphere mean (I think there were a couple of options) to estimate the strength of the AMOC. I've been busy the last couple of weeks. Sorry (NOT). The Sherwood data seem to have been used to verify whether or not the surface temperature difference as a proxy for the strength of the AMOC was valid.
Once I get through helping to setup a statewide climate monitoring network and working on an insect pest monitoring network I might have a chance, but I'm going to be damn busy doing work for the next few months.
Re constructing a temperature index: no they define a FOMC index at the outset and compare it with historic current flows.
It may surprise you but Rattus, Sou and I are actually trying to help you understand. If you choose to pay us back with sarcastic comments like "go read the paper", then will you please clear off, though maybe an apology for deceiving us with you apparently genuine request for help would be in order.
bill, I guess I can do without help from someone that refers to me as a dimbulb, offers help without having read the paper and makes comments about Sherwood that suggest he has neither read nor understood that either.
I don't understand you comment "they [presumably Rahmstorf] define a FOMC index at the outset and compare it with historic current flows".
As I noted before they set up and index using temp anomalies for the NH surface and for the SPG (they also look at other possibilities in the SI).
What I'd like to know is what is the mathematical formula that relates the index to those quantities. The reason is that the relationship between the δ15N tracer and the AMOC index may well be simply an artifact of how this was done.
The thing is that one really needs to think about some of this stuff, particularly when one gets results that seem a bit unusual.
HAS, so many points you raise. well lets deal with the first of them, namely that: Rattus shouldn't be offering help because he hasn't read the paper.
By your argument anyone who hasn't read the Principia Mathematica isn't qualified to teach High School Physics.
Yes, it's that absurd. Rattus has read a very clear summary of the paper, just as (decent) High School Physics teachers will themselves have learnt a summary of the key points of the principia.
With such absurdities in your arsenal you would appear to be a true McIntyre Disciple.
Added to which you have shown not a trace of gratitude for the time people on this board have spent trying to help you. Rather you display contempt for Rattus because he/she fails to satisfy your absurd epistemological criteria. Once again, Summa cum Laude at the School of McIntyre.
HAS - From the paper, here's how to work out the AMOC index:
We define an AMOC index by subtracting the Northern Hemisphere
mean surface temperature from that of the subpolar gyre.
where the subpolar gyre is:
We take the results of a climate model intercomparison1 to identify
the geographic region that is most sensitive to a reduction in the
AMOC (Fig. 1), which for simplicity we henceforth refer to as
‘subpolar gyre’ , although we use the term here merely to describe
a geographic region and not an ocean circulation feature.
I don't know what you mean by "the mathematical formula that relates the index to those quantities". Which quantities? If you mean the flow of water from the Labrador Slope then Rahmstorf15 research is just showing that as AMOC slowed, so did the Labrador Slope Water.
And with regard to:
"the relationship between the δ15N tracer and the AMOC index may well be simply an artifact of how this was done"
The whole is consistent internally - as AMOC slows or speeds up, so does the water flowing east/south in and out of the Labrador Sea. It is consistent with the well-understood knowledge of ocean currents (see maps above). It is consistent with model experiments. It is also consistent with findings of many other studies as cited in the paper.
I missed the earlier comment from HAS. It seems all wrong (what I can understand of it).
For example: "All well and good but the δ15N tracer looks much more like inverse of the NH that is meant to be extracted in the Rahmstorf temp index."
I don't know what this means. I will say that if you are seeing a pattern, HAS, it's a pattern that indicates the source of water off Nova Scotia. Where the water comes from. While it also suggest temperature of sea water in that region, its temperature is not relevant for this exercise. What is relevant is the source of the water - whether its source is Labrador Slope Water or the subtropics.
Rattus N and Bill H have it right. The Sherwood nutrient status data is not about temperature, it's about the movement of water.
Now look here, Sou Bundawhatever,
You admit that you haven't even read this Ramydonk paper and yet here you are trying to educate HAS about it who has clearly read, marked and digested every sentence therein.
I am shocked - simply shocked.
(Warning: the foregoing may contain traces of irony)
bill if you've got to the limit of your knowledge then say so rather than flounce off, we might learn something about this together.
Sou the reason I want to know the calculation is because the words you quote suggest that in fig, 3 3b is just 3a SPG - NH. But even to my enfeebled eyes it doesn't quite look right and it is unclear what locational resolution the index is calculated for. Does it just take one value for the index per year, or are they working with different values for each grid-cell?
On your other comments I think the misunderstanding comes from the stage of analysis I'm at. I see report results from modeling and some observations. I'm interested in how they are behaving and the extent to which that behaviour is a result of the analytic framework at that level.
You are I think accepting all the hypotheses about the physical relationships actual and implied from the models and accepting inferences based on those. Unfortunately the science ain't that well developed.
For example the relationship between the δ15N tracer and the index in Fig 5 may as I suggested simply be the result of the way the index is defined. Unfortunately Rahmstorf et al don't do any of the tests to eliminate the most obvious sources of contamination of this kind. To get an idea of the kind of work that does give confidence go and read how Sherwood eliminates the possibility that the δ15N changes arise from "physical oceanographic-driven changes in phytoplankton and zooplankton community structure".
Now I've only just come back to this and decided I probably had to look more closely at the modelling to understand the index. The following section gives the background:
“We test the performance of the index in a global warming scenario experiment for 1850 2100 with a state-of-the-art global climate model, the MPI-ESM-MR. This model has a realistic representation of the AMOC (refs 10,11) based on criteria that include the magnitude and shape of the AMOC stream function and the realism of sites of deep-water formation. Without satisfying those criteria, we cannot expect realistic spatial patterns of SST response to AMOC variations and hence a good correlation of our temperature-based AMOC index with the actual AMOC. An analysis of ten global climate models found that a surface temperature response in the North Atlantic subpolar gyre is a robust feature of AMOC variability, although the details of this response depend on the quality of representation of the AMOC (ref. 10).”
I then look at ref 10 and 11 and find in the latter which describes MPI-ESM-MR’s performance in the North Atlantic as follows:
“The largest SST errors are found in the North Atlantic where both model versions produce a too zonally oriented North Atlantic Current (NAC). The resulting cold bias covering the region between the simulated and observed subtropical gyre margin appears to be a persistent feature in state-of-the-art climate models, where lack of resolution prevents a proper representation of the Gulf Stream separation [Dengg et al., 1996]. The problems in the NAC path may, however, also be related to the representation of the deep western boundary current [Gerdes and Ko¨berle, 1995; Bryan et al., 2007] and the properties and strengths of the overflows across the GSR [Danabasoglu et al., 2010]. Even though the higher resolution in MR allows for a better representation of key features such as the flow through Florida Strait, there is no improvement in the Gulf Stream/ NAC position: the cold bias reaches even further to the north where the ‘‘northwest corner’’ should appear, and the MR realization shows a more pronounced warm bias in the Labrador Sea. “
Rahmstorf’s index is all about the SST. This doesn’t feel like a good start to this journey of discovery does it?
HAS, I get that to your "enfeebled eyes it doesn't quite look right" but I haven't a clue as to what doesn't look quite right to you or why. Nor do I have time to read and respond to every lengthy protest or insinuation you dream up as you shift the goal posts (if you've shifted them - I can't tell).
At the very least you could explain clearly and concisely exactly what you think is in error and why and what the correct interpretation of the data is (in your mind at least). Not fill up HW with your vague and meaningless what ifs.
Are you disputing:
a) The cold patch below Greenland referred to as the subpolar gyre?
b) That the cold spot below Greenland didn't really get colder between 1975 and 1990 relative to NH temp?
c) That a slowing of the AMOC may result in a slowing of the Labrador Convection
d) That a slowing of the AMOC may result in stopping the Labrador Convection in the future
e) that the Greenland ice sheet is melting
f) that there is any ocean in the North Atlantic
Have a look at fig 3 and tell me if you think the series in fig 3b is just the difference between the two series in fig 3a (taking into account that NH has a +3K). If it isn't then the index isn't just simple subtraction so how does Rahmstorf calculate the index?
Not curious?
And if the apparent relationship between δ15N tracer and the index as shown in fig 5 came about because of the way the index was designed rather than any physical reason you wouldn't be curious?
And if Rahmstorf was telling you that the models did a good job of modelling the AMOC and used the models to validate the index, but it turned out that wasn't the case, you wouldn't be curious?
Now I don't know what's actually happening here because bits of the paper are unclear, but there is prima facie evidence for each of those things.
Until those things are cleared up its hard to judge one way or the other on Rahmstorf's conclusions.
As I'm used to, numerobis, you repeat your claim without even checking what I said in that post. We will have to agree that you have only just come looking at what climate revisionism is. I'd advise you to read some more. A great primer is Michael Mann's "The hockey stick and the climate wars" and, of course, Oreskes/Conway's "Merchants of doubt". See you later.
HAS you say: "Have a look at fig 3 and tell me if you think the series in fig 3b is just the difference between the two series in fig 3a."
I had a look and yes, that's fairly obvious even just eyeballing the curves.
You then say: "And if the apparent relationship between δ15N tracer and the index as shown in fig 5 came about because of the way the index was designed rather than any physical reason you wouldn't be curious?"
That's what is called a strawman. You've made up something out of thin air and posed it as an "if" statement. The index was designed to represent a known physical phenomenon. It is based on the temperature difference between the subpolar gyre region and the Northern Hemisphere as a whole. The relationship with d15N is consistent with the physical explanation. As the movement of water slowed, more nutrient rich water dominated the area near Nova Scotia. (I've already covered that multiple times.)
You then say: "And if Rahmstorf was telling you that the models did a good job of modelling the AMOC and used the models to validate the index, but it turned out that wasn't the case, you wouldn't be curious? "
Another of your hypothetical "if" statements. Rahmstorf15 described that they tested their own AMOC index against a model, the MPI-ESM-MR. Here is the full quote:
We test the performance of the index in a global warming scenario experiment for 1850–2100 with a state-of-the-art global climate model, the MPI-ESM-MR. This model has a realistic representation of the AMOC (refs 10,11) based on criteria that include the magnitude and shape of the AMOC stream function and the realism of sites of deep-water formation. Without satisfying those criteria, we cannot expect realistic spatial patterns of SST response to AMOC variations and hence a good correlation of our temperature-based AMOC index with the actual AMOC.
Here are quotes about the model they used, the MPI-ESM-MR from the Roberts et al (2010) evaluation of models relating to AMOC:
In the upper ocean, the strength and depth of the Atlantic overturning maximum is in close agreement with observations in CCSM4, MPI-ESM-LR, MPI-ESM-P, and MPI-ESM-MR.
Similarly, CCSM4, MPI-ESM-MR, MPI-ESM-LR, and MPI-ESM-P represent the vertical structure of temperature, salinity, and density in the subpolar gyre relatively well and also do a good job at simulating the depth and magnitude of the overturning maximum at 26.58N.
In MPI-ESM-MR, the SST dipole index behaves as would be predicted from analysis of the preindustrial control simulation.
You say: "Now I don't know what's actually happening here because bits of the paper are unclear, but there is prima facie evidence for each of those things. Until those things are cleared up its hard to judge one way or the other on Rahmstorf's conclusions."
I take it that it's now "cleared up" enough for you.
That looks a good reply Sou. I wonder what stawmen HAS will conjure up now.
When do you think "curious" become a euphemism for asking stupid questions?
Rattus Norvegicus April 9, 2015 at 11:31 PM
In this sort of argument "curious" means "I'm about to raise a completely unfounded question about this study for the purpose of raising doubt and throwing mud on the reputations of all involved".
"Have a look at fig 3 and tell me if you think the series in fig 3b is just the difference between the two series in fig 3a (taking into account that NH has a +3K). "
The main clues are on 3b the words "Subpolar gyre - NH". And on figure 3a the reminder "NH + 3K" and the label "Subpolar gyre". Complicated, eh?
I am normally wary of just eyeballing a graph. But a quick check it looks pretty consistent with that calculation.
Of course I do have the advantage I am not desperate to find something wrong with it.
HAS April 10, 2015 at 7:27 AM
And yet when I look at (say) 1400 I have SPG minus NH from 3b of about 0.6K and from 3a SPG of 0.6K and NH+3K of 2.6K = -0.4K. A straight linear combination of the results from 3b is 1.0K compared with 0.6K from 3b. The calculation seems to be more complex than that.
The reason why the calculation is important to understand is because all the major conclusions of the paper are based on it.
On the "strawman" (they are more properly referred to as "hypotheses") in play here. One that the "time evolution of δ15N tracer agrees well with that of our AMOC index" and from that this it tells us something about water flows (Rahmstorf), and the other that the δ15N tracer is an artifact of the fact that it is correlated with sea temperatures elsewhere as is the index, and the relationship between the it and the index is inevitable.
Right now I don't have enough information to test my hypothesis, but I'd say two things about the quality of Rahmstorf as a piece of research. First they have failed to do the simple testing to eliminate this possibility, and second they report no statistical testing of the relationship between the tracer and the index, instead simply asking us to rely upon eyeballing a graph.
The modelling issue is in the same vein. When I read what Rahmstorf said about the criteria they used for performance testing against models it struck me as strange that they didn't mention its performance in reproducing SST particularly since the index is based on this, and the reliance on GCMs for the millennium reconstructions.
Something about the dog that didn't bark in the night.
That should be:
On the "strawman" (they are more properly referred to as "hypotheses") there are two in play here.
You rudely criticised others for not reading the paper. Clearly you have not read the Supplemental Information of the paper.
77 StatisticalsignificanceoftherecentlowAMOCindex77
Toinvestigat ewhether thelowAMOC indexvaluesseeninthelate20
Centurycould occurby78
randomnaturalvariability,weperformedaseriesofMonteCarlosimulation s .Thetimeinterval900‐79
1850ADwaschosentocharacterizethenaturalvariabilityoftheAMOC indexasweconsider this80
pre‐industrialperiodtobe unaffectedbyanthropogenicclimatechange.81
NATURE CLIMATE CHANGE | www.nature.com/natureclimatechange 3
DOI: 10.1038/NCLIMATE2554
Thanks anonymous but that deals with a different issue. Having constructed the index they then test on the assumption that the index is ARMA(1,1) the chances that the drop in the index in the late 20th C might have occurred by chance.
We haven't got to the point of even constructing the index yet.
Rattus Norvegicus April 10, 2015 at 10:36 AM
HAS, there is such a thing as a corresponding author if you think they are lying.
HAS April 10, 2015 at 12:06 PM
Rattus, I just want to be clear. I haven't accused anyone of lying. Less than honest, perhaps - I am sure the authors have run formal statistical analysis of the relationship between the tracer and index, it's such a trivial thing to do and report (even within word limits) and it is an important plank in the development of their argument to get that relationship established.
Also, given Sherwood reports the relationship between the tracer and NAO and statistical relationships abound between NAO and both the AMOC index and its components, one has to ask why these weren't explored if only for completeness.
Rattus Norvegicus April 10, 2015 at 12:58 PM
That's why there is a corresponding author. Write him and ask your questions.
Sou April 10, 2015 at 1:25 PM
HAS - it's you who are being less than honest. You are not "just wanting to be clear" at all. You are wanting to insinuate wrong with no evidence by building strawmen. No they are not hypothesis, they are strawmen.
Almost from the outset your comments have been borderline. Your base position is that climate science is a hoax and by hook or by crook you'll prove it to the world.
You are doing what is known as concern trolling and are pushing your luck here.
HAS April 10, 2015 at 1:31 PM
Sou I evaluate science for commercial exploitation for a business.
I don't regard climate science as a hoax, just run a jaundiced eye over it. It is like most science and the curates egg, "good in parts".
In this case Sherwood strikes me as pretty good, but Rahmstorf as rather light weight, for the reasons I've outlined. I notice there has been no dispute relating to the methodological issues I've raised.
This blog should probably widen its brief and start having a go at any climate science that is second rate rather than deciding a priori that the science that produce a certain class of result is sacrosanct and those that don't is to be damned.
There you go again - classic concern trolling.
>>I notice there has been no dispute relating to the methodological issues I've raised.
We have. What I and every other HW reader would have noticed is that you didn't respond to my questions up thread. I also noticed you didn't acknowledge your gross errors when they were pointed out to you. I also noticed your constant shifting of the goal posts, and your nasty allegations of dishonesty and your really dumb insinuations that the scientists "don't know nuffin".
Coming from you your insinuations are a joke.
I find it hard to believe you "evaluate science" for a business. Which business? What science? Do you ever get paid? Do you always subcontract to bloggers like you are doing here?
I've already spent way too much time pointing out your dumb mistakes and showing you up for the troll you are.
Borrowed from pjclarke at 09:52 AM on 11 September, 2012
on Shaping Tomorrows World - about Steve McIntyre but applies to HAS's behaviour here too.
You're in real trouble now, Professor. You've come to the attention of The Auditor. He has asked you Questions. You now have two choices:-
(1) You could assume the questions are posed in good faith, The Auditor is genuinely interested in the knowing the answers, and will make constructive and reasonable use of the information. This would be a category error. It's like those email scams where if you respond the spammers know the address they've hit is real. Next thing you know there will be a second round of followup questions, and so on ad nauseum. Dr Gerald North writes:-
"This guy can just wear you out. He has started it with me but I just don’t bite. But there are some guys, Ben Santer comes to mind, who if they are questioned will take a lot of time to answer. He’s sincere and he just can’t leave these things along. If you get yourself in a back-and-forth with these guys it can be never ending, and basically they shut you down with requests. They want everything, all your computer programs. Then they send you back a comment saying, “I don’t understand this, can you explain it to me.” It’s never ending. And the first thing you know you’re spending all your time dealing with these guys.”
Do you really want that?
(2) You ignore the questions. This will lead to a post at the Audit weblog using words like 'stonewall', 'petulance', 'refusal'. You won't be directly accused of malpractice or fraud, naturally, however the comments will be a playground where those with a desire to speculate about 'What is Lewandowsky hiding?' will be given free rein. There will then be a short hiatus during which you may think your life is getting back to normal, but then the orchestrated FOI requests for any and all emails relating to the paper will start ...
There is no 3rd choice.
pjclarke was wrong in one respect - the auditor has accused scientists of "fake" "scam" etc - when he couldn't understand the science.
Sou, that was a couple of very lazy responses (although no doubt it made you feel better).
The problem we are dealing with (on-topic) is the chain of temp correlations between the tracer and the index and how that came about. That is after all what your initial post is essentially all about.
I think we've established that no one reading the thread understand how the index was created, we don't understand the statistical relationship between the index and the tracer, we don't understand how the time series was created given the problems GCMs have in modeling the SST in the region, nor do we understand the impact of the tracer being correlated with the NAO and its confounding effect back on the relationship.
In light of that you may be confident about drawing out the various physical relationship you have. Me I'd me more circumspect. I confess these issues makes me look sideways at the authors, but perhaps we should just agree to differ on that and move on.
I'm genuinely interested in what's going on here and hwo the system is behaving. I'm also interested in the uncertainty in it all. I think that's the interesting bit.
What I don't understand is why you aren't curious about this stuff.
If you are perhaps try and talk about the substantive issues rather than flounce off throwing abuse across your shoulder as Bill did.
This is the last time I'll do unpaid corrections for HAS, who wrote:
Get your "enfeebled eyes" checked, HAS. I did check, with precision, and once again your calculations are out. I've copied Figure 3, and drawn lines for the last data point, which clearly shows:
NH + 3K =3.7
NH = 3.7 - 3 = -0.7
Sub polar gyre = 0.5
Sub polar gyre-NH = 0.5-0.7 =-0.2
AMOC index=-0.2 = Sub polar gyre-NH
As Dan Andrews wrote recently:
...if you think you've found a mistake, it most likely is a misunderstanding on your part especially if you're not an expert in the subject matter.
And another version: if a concern troll claims to have found "something wrong" in a science paper, it is more likely an attempt at deception on their part, especially if they have already admitted to having a "jaundiced" and "enfeebled" eye.
HAS wrote:
What bullshit. All you are genuinely interested in is FUD. So far you've been wrong on every count.
And then HAS had the gall to write: "What I don't understand is why you aren't curious about this stuff."
That's after I've spent a heap of my valuable time painstakingly checking and correcting and reporting HAS's mistakes and deceptions - here and here and here and here and here and now here.
While for his part (he has to be a he, if he's a stereotypical denier) HAS has not given a straight answer to my questions. Instead all he does is shift the goal posts in true troll fashion.
And quit flaming other commenters. It was Bill H who discovered Steve's big blooper in the first place. He didn't "flounce off" from CA, despite all the pathetic flames he got there, and he didn't "flounce off" from here either.
Enough HAS. Time out for you.
I've already called "time out" for HAS.
Phil Clarke April 10, 2015 at 7:29 PM
When I wrote that (as pjclarke, I also used John Philip, which is a reversal of my first two names for a while when I deemed that using my real name at places like WUWT was unwise.) it was true, McIntyre was the master of passive aggression, building a case for fraud while being very careful not to use the actual word or directly accusing malpractice, [no he would just title his posts things like 'Get a stick, Get a stick' and refer to particular reconstructions as 'like crack cocaine' to dendrochronologists] , relying instead on selective quotation, cherry picking and elevating inconsequential methodological molehills into mountains. I'm not at CA much these days but I do see that for whatever reason, he seems less cautious now. I guess he's given up on being taken seriously outside his little coterie….
Ben Santer's description of his encounters with the auditor are instructive (scroll down)
http://www.realclimate.org/index.php/archives/2010/02/close-encounters-of-the-absurd-kind/?wpmp_tp=1
The punch-line of this story is that Mr. McIntyre’s Freedom of Information Act requests were completely unnecessary. In my opinion, they were frivolous. Mr. McIntyre already had access to all of the information necessary to check our calculations and our findings.
When I invited Mr. McIntyre to “audit” our entire study, including the intermediate calculations, and told him that all the data necessary to perform such an “audit” were freely available, he expressed moral outrage on his blog. I began to receive threatening emails. Complaints about my “stonewalling” behavior were sent to my superiors at Lawrence Livermore National Laboratory and at the U.S. Department of Energy.
A little over a month after receiving Mr. McIntyre’s Freedom of Information Act requests, I decided to release all of the intermediate calculations I had performed for our International Journal of Climatology paper. I made these datasets available to the entire scientific community. I did this because I wanted to continue with my scientific research. I did not want to spend all of my available time and energy responding to harassment incited by Mr. McIntyre’s blog.
PS If you want examples of someone saying something without actually saying it, check out McIntyre's attack poodle Andrew Montford's hilarious 'Bishop Hill' blog. He's a master of the 'some may think', 'it has been reported in some quarters' style of rhetoric. He never says 'is', always 'seems'. I think he may be channelling Francis Urquhart in the original (BBC) series House of Cards 'you may well think that, I could not possibly comment' -)
Typo. First hyperlink should go here
https://noconsensus.wordpress.com/2009/04/02/ten-replies-to-gavin-advocacy-vs-science/#comment-3875
First of many examples of me being snipped or banned.
When I wrote my little piece referencing The Auditor above, I was actually paying homage to Phil Clarke, because I will always remember that famous comment of his on Lewandowsky's site. So glad he came along here and resurrected it for our reading pleasure.
I have nicked over to CA from time to time, and bumped into HAS there. His style is quite similar to McIntyre's. HAS couldn't possibly be another one of McI's 'Nigel Persaud'-type sockpuppets, could he? He's got that same dogged persistence, and way of casting thinly veiled accusations of malfeasance at climate scientists. But, nah... that's rather implausible.
Millicent April 11, 2015 at 12:21 AM
"His style is quite similar to McIntyre's. HAS couldn't possibly be another one of McI's 'Nigel Persaud'-type sockpuppets, could he?"
I believe the correct response is "some might think that".
Captain Flashheart April 11, 2015 at 12:27 AM
I think he's not ... over at Climate Audit (shudder) his writing style is very different to McI's. Also this is McI's technique: he never comments on "lesser" blogs but his footsoldiers go and do his work for him. HAS covered himself in ignominy during the Lewandowsky debacle, when McI was completely incapable of doing anything mathematically useful but HAS was all over Lewandowsky's website casting aspersions, as were Carrick, foxgoose and the rest of McI's useful idiots. Also when McI needs to intimidate someone it's his useful idiots who post up identifying details - McI eggs them on but they do the dirty work, leaving McI with the moral high ground of "cleaning up the ad homs" (as someone foolishly observed above - this is not McI being nice, it's McI maintaining his reputation through the shitty actions of his useful idiots).
It's a sad fact about humanity that there are people stupid enough and malicious enough to be useful idiots for a no good waste of talent like McI. When the history of this era is written - a history drowned in shit - people like McI are going to be given a very negative review. His blog followers like HAS won't even rate a mention, but they certainly deserve a footnote: "He was surrounded by stupid, shallow dickheads who never amounted to anything."
Phil Clarke April 11, 2015 at 12:42 AM
Remember when McI (or was it Mosher?) posted up a pro-forma FOI request to CRU for station data on Climate Audit and encouraged the winged monkeys to take 5 stations each and submit a request? ISTR CRU got an average of one every half hour for about a fortnight, each of which must be responded to.
What did they then do with the data?
That was Mosher. And to imagine, they got all pissed off when these idiotic requests were labeled as "vexatious". They didn't mean to harass the CRU, nooooo....
Sou April 11, 2015 at 1:06 AM
Not just Mosher - Steve McIntyre himself instigated FOI attacks (AKA denial of research attacks) and urged his readers to bomb CRU with vexatious FOIs. I am not aware of any blog articles or research papers as a result. I'd say it was solely done for vindictive harassment:
Steve McIntyre Posted Jul 24, 2009 at 10:59 AM
I suggest that interested readers can participate by choosing 5 countries and sending the following FOI request to [email address redacted by Sou]:
A CA reader notified me offline that he requested agreements involving Russia, China, India. I already requested Canada, United States, Australia, U.K., and Brazil.
Please keep adding to the inventory of FOI requests to CRU.
BTW - I wasn't sure you were the author of that famous passage, Phil. I use it all the time. It sums up the Auditor perfectly - though since you wrote that he did start alleging fakery and scams. I don't know if he's backed off a bit on that following Andrew Weaver's successful court case and Michael Mann's lawsuits. If I get the urge I'll check - one of these days.
Captain Flashheart - it's not quite true that Steve *never* comments on lesser blogs. He does very occasionally post a comment at WUWT, which I'm sure he would regard as a "lesser" blog. The deniers there just love it when he appears, albeit so briefly. They feel especially honoured.
I've got to say, though, that when he does comment there, you'd think he was just another pleb from Anthony's denier rabble. You'd not think he was the god he otherwise pretends to be.
http://blog.hotwhopper.com/2014/06/denier-weirdness-is-steve-mcintyre.html
A dumb comment - as bad as his mixing up temperature with water mass movement.
Rattus Norvegicus April 11, 2015 at 6:39 AM
Bill H April 11, 2015 at 9:04 AM
Well, Sou, you’ve hit the big time when a heavy from Climate Audit shows up. I’ve just had a look over there at the “Rahmstorf trick 3” thread, and HAS recently left a message proclaiming his being banned. It’s easy to find, being right at the end of what’s probably a more or less dead thread.
I left a comment describing his behaviour, citing examples, just to put some balance. I also noted the “coincidence” of another “HAS” on Lewandowsky’s blog in the recent past. (Hit tip Capt. Flashheart).
It’s hard to tell if McI has actually sent him over. I don’t want to judge on this one, partly because someone else at C.A. was suggesting I had been sent on a mission to undermine McI.
Anyway, how you persisted in the face of such rudeness and ingratitude I can’t imagine. Your doggedness reminded me of a hero of mine, Nick Stokes, another Aussie, who helped keep me sane during that grisly Lisbon “conference”/Judith Curry’s “coming out” party back in 2011. Is it all down to the famous Aussie grit and determination?
Incidentally on the subjects of Curry and of McIntyre's useful idiots did you spot the shameful bit of plagiarism of McIntyre from her that I posted up near the beginning of this thread?
A professor at one of the World's top 100 universities acting as the Auditor's parrot.
Dhogaza April 11, 2015 at 12:58 PM
"I think we've established that no one reading the thread understand how the index was created, WE don't understand the statistical relationship between the index and the tracer, WE don't understand how the time series was created given the problems GCMs have in modeling the SST in the region, nor do WE understand the impact of the tracer being correlated with the NAO and its confounding effect back on the relationship."
WE is inclusive, therefore HAS stated that he doesn't understand, either.
Yet, that didn't stop him from accusing the authors: "Rattus, I just want to be clear. I haven't accused anyone of lying. Less than honest, perhaps"
Bill H. Is English not HAS's first language? He writes it rather well in that case.
Or maybe, as with many trolls here, he was aching for me to ban him (ignoring my requests) so that he could trot back and play the martyr. When I didn't ban him, he decided that taking "time out" was as good and played the martyr in any case.
He's behaved in classic troll fashion from his very first comment to his last martyrdom complaint, when he went back to his home.
If he hadn't had a home to go to, then he probably would have followed up his "time out" by sending me a rash of comments here at HW, claiming things like "nobody reads HW anyway", and becoming increasingly abusive until I did ban him completely.
"He's behaved in classic troll fashion from his very first comment to his last martyrdom complaint, when he went back to his home" should read:
"HAS behaved in classic troll fashion from his very first comment to his last martyrdom complaint, when he flounced off back to his home".
Also - many thanks, Bill :)
I've just had a peep, and HAS is doing a Steve and making up stuff. It demonstrates that we were wasting our time talking to the proverbial brick wall (HAS). Though I'm pleased to see our comments did help other readers.
And I see that Steve is doing a Steve and denying he couldn't understand EFA and gave eventually up in a huff. (Steve is still trying to claim it was Lewandowsky13 that was "highly flawed" - when it was Steve who couldn't understand it. And it was his work that was not just "highly flawed" it was arguably defamatory - watch this space.)
To save readers the trouble here's a link - starting with Donna Summer's nice link:
https://archive.today/CAt3A#selection-5227.0-5251.86
(Very few people have bothered to check HAS's tall tale by coming here, he'll be very glad to know. And I don't blame them.)
@Doghaza - not to mention that everyone *except* HAS understands it's a simple subtraction:
AMOC index = Sub-polar Gyre temperature minus Northern Hemisphere mean surface temperature
HAS was testing to see if his "time out" was up. It's not. He asked if I'd checked 1400 - by which I think he meant did I try to work out from Figure 3 itself, by attempting to line up the lines.
I did better. I wrote to the authors, and can confirm that it's a simple subtraction.
Millicent April 11, 2015 at 8:38 PM
Well if HAS is still about perhaps he'd deign to explain to us all why he and all the other self-appointed 'auditors' out there have failed year after year to identify any of the serial blunders committed by 'contrarian' scientists. It seems so very like the entire 'auditing' community are a bunch of fakes.
But Sou, HAS confirmed by his expert eyeball that the subtraction was wrong. How can you trust the authors over his eyes?
Some have suggested that Steve McIntyre is more often wrong than right. I don't presume that he's deliberately misleading people, but has certainly been suggested by others.
If a Google search of "Steve McIntyre is more often wrong than right" returned 261,000 results, you wouldn't be curious?
And if the first result claimed to show that he is on an obsessive quest to disprove Michael Mann's hockey stick you wouldn't be curious?
I hate to ascribe motives. People are just as likely to be stupid as malevolent. It is possible he is actually right in this case, but plenty of evidence has been presented to the contrary.
Until this is all cleared up its hard to judge one way or the other.
Gee, it's fun to play the innuendo game. Glenn Beck would be proud.
Captain Flashheart April 12, 2015 at 1:47 AM
I don't need to be curious or ask leading questions. I know McI is more often wrong than right.
And malevolent.
Layzej April 12, 2015 at 7:01 AM
Sou: "I did better. I wrote to the authors, and can confirm that it's a simple subtraction."
Ack! Your missing the point Sou. The point is to raise questions, not provide answers. Answers are typically mundane. Not so questions. Questions make us curious, and if phrased just the right way they can also make us suspicious.
Anybody can provide answers. Especially if it's as easy as asking the author. It's hard to build a narrative around answers. Who's the villain? Where's the intrigue? We need to focus on questions.
We should never forget that it is the faux auditor's prerogative to ask the questions, and it is for the rest of us - mere mortals - to provide the answers. And answers must be given even though they represent nothing more than the material from which the next set of questions are formulated, because the faux auditors are only performing the fossil fuel industry's mission to spread disinformation.
The faux auditors see themselves as this, only without the 'wit':
https://www.youtube.com/watch?v=9xwmyFAHxso
The rest of humanity sees them like this: but only the ridiculous bit, not the wit:
https://www.youtube.com/watch?v=sAn7baRbhx4
'Debating' with them bears a remarkable similarity to their using FoI to demand data that they have no intention of analysing. The data is nothing to them, the harassment, and the innuendo about fraudulent science is all.
Maybe you haven't been hanging around too long in the climate change blogosphere, but if you have you should know that these pissing contests rarely if ever get 'cleared up'. Because people like McIntyre will never, ever admit to being wrong, even on the smallest point.
numerobis April 13, 2015 at 3:10 AM
metzomagic: Anon was serving up a nicely roasted McI kabob on a skewer. I'm sure they're acutely aware of all climate change blogosphere traditions, including the inability of any major denier to admit error.
I'm not sure if I allowed back here, but I do need to admit I was wrong.
The relationship between d15N and the AMOC didn't arise from relationships between d15N and either of the temperature series that went into AMOC. The failure was much more basic than that.
The problem with finding interrelationships between time series like d15N and AMOC is that you need to make sure that there aren't quite unrelated factors driving them the apparent relationship. This is indicated if the series aren't stationary which is the case with these two series.
One way to confirm or otherwise the existence of a relationship is to take first differences and compare the series (this is comparing the slope at each point rather than the actual value - obviously if these aren't related one would find it hard to say the time series were related).
I digitalised the AMOC index and the d15N series and checked them out.
Despite strong relationships between the series (that you see in the graphs) there is no relationship at all between the first differences of the d15N series and the AMOC index.
Moving to the physical interpretation there is no case for arguing the AMOC tells us anything about the movement of the flows.
This probably explains why the authors didn't do the required analysis, and left it to our failing eyeballs to draw the conclusions from the graphs.
It's your failure, HAS - not the experts.
HAS's comment is coming from someone who five days ago didn't understand the paper enough to realise that dN15 was about mass water movement, not temperature. This was despite him apparently reading the paper, and despite the above article, and despite the numerous responses he got. He decided the authors and reviewers and editors from Nature Climate Change had messed up! An inflated sense of self-importance and a denier bent, has HAS.
Then he couldn't understand the simple subtraction used to develop the AMOC index, again insinuating the authors were wrong and he was "right". Ha! He "didn't believe" the clear statement explaining it in the paper, and couldn't even see what was staring him in the face in a chart.
He's still pitting himself against one of the world's leading experts on AMOC - and still losing badly.
Take no notice of HAS, ever, on anything related to climate or earth sciences.
A slowing AMOC will, by definition, slow ocean currents. (BIg hint: the "C" in AMOC stands for circulation!)
http://www.eoearth.org/view/article/150290/
The fact that the slopes of whatever at two places, very far apart, aren't identical every single minute in time means squat. There is a lot of water mass movement between the sub-polar gyre and the area near Nova Scotia and an awful lot of ocean for it to move around in.
The fact is that less water came from the Labrador when the AMOC index dropped suggested a slowing of the AMOC. That's quite clear.
(Think "water mass movement" in a vast ocean - not the flow of water out of a short 2cm diam hose.)
HAS's comment has been moved to the the HotWhoppery.
KR April 15, 2015 at 12:28 AM
HAS is taking first differences and considering the AMOC and d15N series to be nonstationary? Sounds like somebody has been reading the Beenstock et al nonsense and thinking both d15N and the AMOC are random walks, an approach best described as worthless by Tamino here and here.
A recurring, albeit pointless, exercise from deniers. Both mass flow changes from d15N and the AMOC are bounded phenomena driven by physics, not random walks. As a pointer to readers, whenever you hear someone invoke "not stationary", "first differences", or "random walk" with respect to climate, you're about to hear nonsense.
A random walk is ARIMA(0,1,0) a special case of integrated time series. Like random walks the series we have here are integrated to the first order but are they not random walks.
The difference is they also contain significant autoregression and trend, but is possible that if the autoregression is modeled at higher orders the trend ceases to be significant (i.e. they are likely ARIMA (3,1,0) or ARIMA (1,1,1)) .
[The parameter used in the ARIMA model show the order of AutoRegression, Intergration, and Moving Averages (aka trend) respectively]
KR April 15, 2015 at 8:02 AM
But you asserted that the d15N proxy and SST AMOC index are non-stationary. As opposed to physically constrained (trend!) stationary phenomena that will vary around the driven/forced state?
As trend-stationary phenomena the appropriate check on their relationship (if you are interested in those statistics) would be correlation of values over time, not differencing and comparing _rates_ of change (derivatives), an inherently noisy comparison. Which in the case of two different physical phenomena is particularly uninformative.
And (as has been pointed out to you repeatedly on this thread) both are effects (and indicators) of the underlying circulation changes investigated in the paper. Their relationships are properly speaking to that circulation, as separate indicators, and the Rahmstorf et al paper isn't trying to make conclusions about the statistical relationship of the two indexes. They are using the physics of circulation, and the understood relationships between water mass source/d15N and between circulation patterns/AMOC SST index to investigate the AMOC circulation.
Screwing around with the statistics of index derivatives, in the absence of the underlying physics, is nonsensical. And doesn't address Rahmstorf et al in any manner whatsoever - it's simply irrelevant.
Shorter answer: "...you need to make sure that there aren't quite unrelated factors driving them the apparent relationship..." There are known factors driving both indexes - the ocean circulation. And while proxies need to be checked for physical confounding factors, both proxies have strong relationships to the underlying AMOC.
You aren't making a physical argument, such as investigating possible confounding factors - you're just messing around with (inapplicable) statistics trying to generate some kind of objection. Physics discussions require physics, and you aren't supplying any.
How did you compare the series HAS? How does your argument change if both series are correlated with or driven by an I observed factor?
Why didn't you digitize the series before you started making accusations of deception about the construction of the index? Your eyes were good enough then, until you were shown up as a fool. Now you have moved on to a new criticism, without acknowledging how mean your last one was... You say the "graph was ambiguous " but what you should say is you "didn't understand the graph when everyone else did".
You really are as Ill mannered and mendacious as your hero.
KR April 15, 2015 at 1:21 PM
Captain Flashheart - "Why didn't you digitize the series before you started making accusations of deception about the construction of the index? [...]. Now you have moved on to a new criticism, without acknowledging how mean your last one was..."
Because HAS is thrashing around with different claims trying to come up with a sciency sounding objection to the paper. And failing.
Bill H April 9, 2015 at 3:41 AM
Well, Steve Mc has amended his post, in the interests of “clarifying misunderstandings”. Interestingly he has only added text: there are no “strikethrough” passages. This makes for some rather clumsy syntax. The substantial changes are:
But all that the coral d15N series show is (at most) that there has been increased [Apr 7 – mixing proportion of lower d15N Gulf Stream waters, which could account for] increased temperatures offshore Nova Scotia) – but the significance of this relationship is very tenuous.
It’s not even well established that coral d15N is a proxy for local ocean temperature [Apr 7 – or mixing of water masses].
There’s currently nothing at the top of the post to indicate that amendments have been made, so anyone reading it would be puzzled by the various “[Apr 7th]” insertions.
The second amendment is highly disingenuous: of course it hasn’t been “well established” that it’s a temperature proxy, since there are plenty of good temperature proxies available already, so such “establishment” is unnecessary. Unfortunately, his “no deletions” rule meant he had to fall back on this form of words.
As for Steve’s claim more general claim elsewhere of d15N being “little used” as a proxy I actually challenged him on this, having the temerity to suggest that maybe he needed to research it sufficiently. He replied that he didn’t need to research because he was an expert on proxies already. A quick search by me on Google Scholar revealed 1100 citations on d15N as a proxy. Not exactly “little used”.
No acknowledgement was made to me for pointing out that Rahmstorf et al were not using d15N as a temperature proxy, which rather undermines his claims of mistreatment by scientists for their not acknowledging his “assistance” to them.
His article has turned into a real mess. As you say, he still hasn't let go of his temperature idea. Plus he inserted a strawman:
"[Apr 7 – mixing proportion of lower d15N Gulf Stream waters, which could account for] increased temperatures offshore Nova Scotia) – but the significance of this relationship is very tenuous. On its face, the d15N series does not show that subpolar gyre temperatures have decreased [the definition of Rahmstorf’s AMOC index]."
No it doesn't show that. And Rahmstorf15 makes no such claim. That would be silly - it's way too far away and in any case, the currents are flowing *away* from the subpolar gyre, not toward it.
The significance of d15N was that it supported the evidence for slowing of the AMOC - the movement of water. That's it. It wasn't used in reference to temperature of the subpolar gyre at all.
The main part of the study was looking at the anomalous temperatures in the subpolar gyre, plus data on Greenland ice melt.
Steve McIntyre is a clod.
As for mistreatment by scientists - phooey! He's the one who has maligned scientists and endlessly harassed them. He doesn't deserve any treatment at all. Not even deigned with mistreatment.
I'm not surprised he's done nothing but give you grief. He doesn't take corrections kindly - especially not from someone who accepts climate science.
You are being credited in places that matter :)
Actually, to give Steve his due he did take down some of the ad homs.
Looking through Steve McIntyre's amended post I note that the passage:
remains completely unchanged, so he's still claiming that Rahmstorf et al. are using d15N as a "thermometer". Either he overlooked like that or, despite his great cunning, he couldn't work out a way of adding text to make it look less wrong.
Unchanged and unhinged. :-)
I still find it hard to believe that he doesn't understand what is going on, but he hates Mann so much...
and you hate McI so much
"and you hate McI so much"
What sort of person would admire the vile innuendo that accompanies his posts?
Brandon R. Gates April 12, 2015 at 4:34 AM
Bill H,
I note McI is now claiming that you've run away from the discussion of stripbark bristlecones, leaving the impression that they actually apply to Rahmstorf (2015). I would think they don't, but then I think. Apologies if this has been covered explicitly somewhere else in this thread ... has gotten a bit lengthy and tedious in places. Keep fighting the good fight.
Anoy, hate is too intense an emotion to describe what I feel about McI. Contempt describes it better.
Pope Francis' endorsement of science has upset den...
Deniers will be delighted with UAH v. 6 beta
Bombshell! Dumb Denialism from Anthony Watts about...
Denier Weirdness: A mock delegation from the Heart...
Falsifying projections from WUWT
Elevated Denial: Mountains can't get warmer, every...
Do you believe wheat viruses can disappear by magi...
More global warming denial from Anthony Watts at W...
Danley Wolfe continues the long, drawn out hiatus ...
Not so fast, with that so-called hiatus...
A near-perfect example of a CO2 denierism at WUWT
Lifting the floor at WUWT, to adapt to sea level r...
Wildfires add to atmospheric CO2: A lesson for Aus...
There are rabbits and rabbits and lagomorphs unkno...
Blog enhancements and changes
Is climate science denial going out of fashion? Re...
Will Steffen and all of climate science vs Bjorn L...
How to add the author, time and comments link to t...
A DuKE of deniosaurs at WUWT say: Bring on the Cre...
El Niño on Alert: at least 70% chance in 2015
How to go about going against mainstream science -...
A small facelift
CO2 and the Permian-Triassic Mass Extinction Event...
Why 97% is important - Yale US survey on public pe...
No permafrost bomb - probably
Roy Spencer is comparing himself to Nobel Prize wi...
Steve McIntyre's big blooper - mistaking water mas...
WUWT Quote of the Day: Smokey On Cherry-Picking
They really are a bunch of paranoid twits at WUWT!...
More conspiracy theories: WUWT's Tim Ball plus Jud... | cc/2020-05/en_middle_0078.json.gz/line941 |
__label__cc | 0.748332 | 0.251668 | ACTIVITIES & DEBATES
BRUSSELS STUDIES INSTITUTE
About the BSI
The BSI plays an integrating role in the scientific knowledge of Brussels. It is the driving force behind an ever-expanding network. Its members and partners constitute an ritical mass in a relatively small territory.
The Brussels Studies Institute (BSI) was born in 2012 from the desire of academic circles to work together to better understand and make known the complexity of the Brussels reality to researchers but also to field actors and the general public.
The BSI is a unique partnership around the theme of urban knowledge.
It supports scientific research in Brussels and encourages an integrated, multilingual and multidisciplinary approach to it.
The research platform on Brussels since 2012
3 founding universities
29 research centres
More than 300 researchers
An interdisciplinary approach
DISCOVER THE BSI BOARD & TEAM
The BSI is involved in all components of the knowledge chain in and for Brussels: from bringing stakeholders together to develop integrated knowledge, to disseminating and promoting it.
To carry out its activities, the BSI invariably mobilizes teams of researchers with diverse profiles (in terms of universities, disciplines, languages) to analyse an urban/metropolitan societal challenge or problem from different angles, with a common reference framework. Not only does this multi-perspective approach enrich the content produced, but it also makes it possible to extend the dissemination of results by mobilizing different networks:
The BSI conducts researches on Brussels
It brings together multi-institutional and multidisciplinary research groups to answer the many questions raised by the societal challenges of the city-region.
DISSEMINATION & DOCUMENTATION
The BSI centralises and develops reference resources in Brussels
Its mission is to enable as many people as possible to obtain easy and reliable information on the assumptions and real facts prevailing in the Brussels-Capital Region.
The BSI organizes public events
It organises a series of events focusing on issues that are relevant in the academic sphere, the political agenda and the societal debate.
The BSI leads a research ecosystem on Brussels
The BSI works hand in hand with its two sister organizations: the electronic journal Brussels Studies and the Brussels Academy, an urban and civic university.
The BSI is the privileged partner of the Brussels urban studies networks: Ebxl (ULB), BCUS (VUB) and IRIB (USL-B).
The BSI brings together 29 research centres linked to eight higher education institutions, representing more than 300 researchers from a wide range of disciplines.
DISCOVER THE RESEARCH CENTRES
BATir - Building, Architecture & Town Planning (ULB)
BCUS - Brussels Centre for Urban Studies (VUB)
Bedrijfskunde - Praktijkgericht Onderzoek (Odisee)
BIAL - Brussels Institute for Applied Linguistics (VUB)
BRIO – Brussels Informatie-, Documentatie- en Onderzoekscentrum (VUB)
BUSI - Department of Business (VUB)
CEDRE – Centre d’Etude du Droit de l’Environnement (Université Saint-Louis – Bruxelles)
Centre de droit public - (ULB)
CES – Centre d’Etudes Sociologiques (Université Saint-Louis – Bruxelles)
CEVIPOL - Centre d'étude de la vie politique (ULB)
CIRC - Centre Interdisciplinaire de Recherches en Droit Constitutionnel et Administratif (Université Saint-Louis – Bruxelles)
CLARA - Centre des Laboratoires Associés pour la Recherche en Architecture (ULB)
CLIC - Centre for Literary and Intermedial Crossings (VUB)
COSMOPOLIS - City, Culture & Society (VUB)
CRHIDI - Centre de Recherches en Histoire du Droit et des Institutions (Université Saint-Louis – Bruxelles)
CRISS : Approches sociales de la Santé - Ecole de Santé Publique (ULB)
Dominique Verté (VUB) from Belgian Ageing Studies
GERME - Groupe de recherche sur les Relations Ethniques, les Migrations et l’Egalité (ULB)
GIRSEF - Groupe interdisciplinaire de Recherche sur la Socialisation, l'Education et la Formation (UCL)
iCite - International Centre for Innovation, Technology and Education Studies (Solvay Brussels School of Economics and Management - ULB)
IGEAT - Institut de Gestion de l'Environnement et d'Aménagement du Territoire (ULB)
Interface Demography (VUB)
IRIB - Institut de Recherches Interdisciplinaires sur Bruxelles (Université Saint-Louis – Bruxelles)
LIEU - Laboratoire interdisciplinaire en études urbaines (ULB)
METICES - Migrations, Espaces, Travail, Institutions, Citoyenneté, Epistémologie, Santé (ULB)
MOBI - Mobility, Logistics and Automotive Technology Research Centre (VUB)
Onderzoekscel Data en Beleid (OCDB) / Research Unit Data & Policy (RUDP) (VUB)
POLISSI - Politiques et systèmes de Santé - Santé internationale - Ecole de Santé Publique (ULB)
RHEA Expertisecentrum (VUB)
SOFT - Software Languages Lab (VUB)
SMIT - Studies on Media, Information and Telecommunication (VUB)
TOR (Tempus Omnia Revelat) - Onderzoeksgroep voor de studie van tijd, cultuur en samenleving (VUB)
Key Steps
In the creation of the BSI
BSI projects
BSI has in its portfolio some 45 projects (completed or in progress), financed by more than 30 public, parapublic and private donors.
The Government of the Brussels-Capital Region and Innoviris award a new three-year management contract.
The BSI today
The BSI is today a network of 29 affiliated research centres, from 8 higher education institutions (ULB, VUB, USL-B, UCL, KUL, Odisee, ICHEC, UQAM).
The Government of the Brussels-Capital Region and Innoviris award a three-year management contract.
BSI-citydev.brussels Chair
Launch of the very first inter-university chair BSI-citydev.brussels with Prof. Patrick Le Galès (Sciences Po) as holder.
BSI synopses
The scientific journal Brussels Studies and the BSI are launching the very first issue of the “BSI Synopses” series. These notes are written by a group of authors gathered around a Brussels issue. In the first issue, the theme was education in Brussels.
Creation of the Brussels Academy
In 2013, the Brussels Academy is created as a spin-off of the BSI to promote non-academic training in Brussels. The Brussels Academy offers a series of free off-campus courses and conferences, including at the Molenbeek Cultural Centre (one of the 19 municipalities of the BCR). In addition, a number of (fee-based) on-demand training offers are also available. Together with Brussels Studies, it is one of the sister organisations of the BSI.
Night of Knowledge on Brussels 2012
In collaboration with the Kaaitheater (much appreciated for its support), the BSI is organising the very first edition of the Night of Knowledge on Brussels, a carousel of presentations with short speeches of 14 minutes on Brussels. Debates and music bring variety.
Let’s do it !
The BSI really starts with a very small team, thanks to a start-up grant from the Brussels-Capital Region and Innoviris.
Creation of the BSI : ULB, VUB et USL-B
With the signing of a framework agreement by the rectors of the Université libre de Bruxelles, the Vrije Universiteit Brussel and the Facultés universitaires St. Louis (currently the Université Saint-Louis – Bruxelles), the Brussels Studies Institute is officially created.
Creation of the journal Brussels Studies
In 2006, the Brussels Studies, the open access scientific journal for research on Brussels, was launched. Brussels Studies offers researchers a specific dissemination channel for the presentation of results and offers its readers articles accessible to a non-specialist audience on important topics studied and discussed in the world of research. Together with the Brussels Academy, it will become one of the BSI’s sister organisations.
Université Saint-Louis
Région de Bruxelles Capitale
Innoviris
Avenue Depage 1, B-1000 Brussels
OUR MAIL ADDRESS
ULB CP 129/04
Av. F.D. Roosevelt 50, B-1050 Brussels
Please check the required field.
info@bsi.brussels
BSI publications
DEBATES & ACTIVITIES
Chaires BSI
Evénements BSI
DESIGNED BY COBEA.COOP | cc/2020-05/en_middle_0078.json.gz/line958 |
__label__wiki | 0.791487 | 0.791487 | The State of Diversity in the Workplace in 2020
Written by Bailey Reiners
Diversity and inclusion are hot topics among HR professionals and scholars. The topics are so complex, in fact, that universities have established degrees from Associate to PhD in Diversity and Inclusion. While we don't expect HR professionals to obtain a degree in the topic, it's important to remember that D&I requires continuous education — even if you do have that PhD.
In this article, we’re going to cover how 13 real companies boost diversity and inclusion at their company with different initiatives and activities. Hopefully these examples will help your team either kickstart or expand upon your current diversity and inclusion initiatives.
FREE E-BOOK: A RECRUITER’S GUIDE TO DIVERSITY & INCLUSION IN THE WORKPLACE. DOWNLOAD HERE.
13 Diversity and Inclusion Activities in the workplace
If you’re reading this article, you’re likely not among the 41% of managers who are “too busy” to focus on diversity initiatives, which means you’re ready to roll up your sleeves and tackle the challenge head on.
To help get you started, we’ve gathered 13 examples of how forward-thinking companies are working toward diversity in the workplace and broken them down into actionable tips.
1. Start with a plan
Image via Panorama Education
When it comes to diversity in the workplace, good intentions aren’t enough. When Panorama Education decided to get serious about its diversity and inclusion efforts, the company put pen to paper and outlined exactly what it wanted to accomplish. “In 2019, [we] will implement a Diversity, Equity and Inclusion Strategic Plan, which comprehensively outlines the goals, key milestones and activities that will support the organization in achieving its goals,” says Presceia Cooper, Account Manager at Panorama Education.
Understanding what it is you want to accomplish before you begin is the most reliable way to ensure you end up where you want to be. In Panorama’s case, this meant establishing some key definitions. “An important step in drafting this plan was defining what diversity, equity and inclusion mean to our company, recognizing that each pillar deserves its own definition and focus,” says Cooper.
Bonus Example: On their careers page, Panorama Education shares some statistics about the diversity on their team and why diversity, equality and inclusion matter to their team
Read more about Panorama Education’s diversity and inclusion initiatives.
2. Don’t skip the basics
Image via Medallia
Kicking off a formal diversity and inclusion plan is a good start, but it can be easy to lose sight of the forest for the trees. Don’t forget to ensure you’ve accounted for everything that’s within your control before casting a wider net. For Medallia, that meant starting with its internal policies and training.
“We have the basics for ensuring all employees are safe and respected, like a clear code of conduct, an anti-harassment and bullying policy, an anti-discrimination policy and mandatory trainings on these policies,” says Lauren Jackman, Inclusion Practice Lead at Medallia.
The company also ensures its employees are paid what they’re worth, regardless of their background. “We’ve also made an equal pay commitment and conducted our first-ever pay equity analysis to ensure that compensation for U.S. Medallians is equal across gender and race,” says Jackman.
Images via Medallia
Bonus Example: Medallia goes out of its way to celebrate diversity and individual characteristics, welcoming candidates on their website with the phrases you see above followed by this statement: "At Medallia we value people for all of the aspects that make them whole. We believe that people should not be defined only by a job title — nobody is “just an engineer” or “just a salesperson”. We are each partners, parents, children, siblings, friends, and former classmates."
Read more about Medallia’s diversity and inclusion initiatives.
Image via Rapid7
A diversity and inclusion initiative cannot simply be an edict from senior leadership. To succeed, it must be a company-wide effort supported by all members of the team. When Rapid7 kicked off its formal diversity and inclusion plan, the company learned that employee buy-in has to be a top priority. “We are just getting started, but the biggest lesson learned so far is that to really achieve this goal, we need to inspire every person in the company to understand the role they can play in making it happen,” says Christina Luconi, Chief People Officer at Rapid7.
The company works with its teams to ensure they understand the impact they can make, helping to set the company up for continued success. “This means not only broadening their mindsets in terms of what makes for an amazing team member, but ensuring every person who joins their team is made to feel embraced and included,” says Luconi.
Read more about Rapid7’s diversity and inclusion initiatives.
4. Be purposeful about it
Image via WP Engine
Diversity and inclusion happens where the rubber meets the road. A clearly-defined plan and employee buy in are a good starting point, but it’s critical that companies make purposeful and tangible efforts to promote diversity in the workplace.
“Quite simply — companies must be intentional about diversity,” says Eric Jones, VP of Brand and Communication at WP Engine. “Balance doesn’t just happen; you have to create an environment where differences are valued and encouraged.”
Specific (and measurable) initiatives are necessary to ensure progress is made. “Where there is focus there is progress,” continues Jones. “In order to empower future generations of workers, regardless of race, religion, sex or orientation, companies must do the work necessary to open their doors wider.”
Bonus Example: WP Engine also includes some high level stats about diversity representation in their company on their careers page. One unique stat they include is the number of employees that do not have a college degree. College degree requirements on job descriptions are overused and can unnecessarily disqualify top candidates who didn't take a traditional path.
Read more about WP Engine’s diversity and inclusion initiatives.
5. Level up on training
Image via Enova
Creating a diverse and equitable environment isn’t an easy task. Getting it right is difficult for even the most senior executives, let alone your newest hires. It’s unrealistic to expect your team to know every step to take to foster a diverse workplace, so training is almost always needed.
“To foster an inclusive environment, we offer unconscious bias training, which is mandatory for people managers,” says Stacey Kraft, Chief People Officer at Enova.
The company is also piloting additional steps, like interviewing for cultural add vs. cultural fit and removing resumes from the engineering interview process.
But Enova doesn’t treat its diversity and inclusion training as a “one and done” approach. “Our employee-driven diversity council focuses on providing opportunities for learning, community building and celebration during nationally recognized months of diversity,” says Kraft. By investing in continuing education, Enova has taken the steps necessary to ensure its team is always up to the challenge.
Read more about Enova’s diversity and inclusion initiatives.
6. Work with like minded partners
Image via HubSpot
When it comes to diversity in the workplace, it’s important to know that you don’t have to go it alone. Just about every company out there recognizes the benefits of corporate diversity, and thousands of them are working toward improving the status quo.
For companies like HubSpot, this offers the opportunity to partner with like-minded partners and enhance their efforts. “We partner with Wayfair and TripAdvisor on the [email protected] initiative and I was lucky enough to speak at a MITX Influence(her) event at LogMeIn just last week,” says Katie Burke, Chief People Officer at HubSpot, in reference to several other Boston-based companies.
Partnering with local companies has exposed HubSpot to a plethora of new ideas and perspectives and allowed Burke to gauge their own efforts against those of other businesses. “There are lots of smart folks who care deeply about this issue, but more work to be done to get us all to the next level.”
Bonus Example: HubSpot dedicates an entire page of their website to their Diversity and Inclusion efforts. They also make an effort to remain transparent about how diverse social categories are actually represented at their company, providing statistics on employee representation by gender, ethnicity and age across teams. They delve even deeper into their diversity statistics with the HubSpot 2019 diversity report.
Read more about HubSpot’s diversity and inclusion initiatives.
7. Use the right tools
Image via Glowforge
As with training, having the right tools in place is critical to the success of your diversity and inclusion efforts. You couldn’t expect your engineering or sales teams to be successful without the right tools, and the same is true for your diversity and inclusion efforts. Appropriate tooling can also help save hundreds of hours of repetitive work, which is an added bonus.
“We run all of our job descriptions and internal policies through a software platform called Textio, which provides guidance on how to word our job posts in a way that will appeal to applicants of all genders,” says Cynthia Mason, Senior Vice President of Glowforge.
“We are also working with a local company called Diverse City, which specializes in diversity and equity assessments, training, coaching and accountability systems,” says Mason. “They help us build sustainable diversity and inclusion strategies.”
Bonus Example: Most companies have an employee referral program, but Glowforge brings more meaning to their program, offering employees $5,000 for referring under-represented minorities that lead to a hire.
Read more about Glowforge’s diversity and inclusion initiatives.
8. Get granular
Image via Relatable
Improving diversity at the top line level is a worthwhile goal, but remember that businesses don’t operate as one single entity. They operate as a collection of individual teams, and the true benefits of diversity in the workplace will only be felt if each team is also a reflection of the company’s overarching efforts.
“As we continue to grow, we’re addressing diversity not only at a company level but, most importantly, at the team level,” says April Himel from Relatable’s People Operations Team. “If Relatable is 60 percent women, yet all of those women are on one single team, they’re still clearly underrepresented.”
Breaking down your diversity and inclusion efforts to the team level may add more work, but as Himel notes, “You won’t feel the true impact of diversity unless all groups are distributed and able to influence the decisions across the whole company.”
Read more about Relatable’s diversity and inclusion initiatives.
9. Track your metrics
Image via 4C
The old saying “That which gets measured gets done” is as true with diversity as any other objective. Simply put, if you aren’t measuring your progress, how do you know you’re making any?
The KPIs you track will vary by the state of your diversity and inclusion efforts and the objectives you’re trying to accomplish, but your recruiting pipeline is always a good place to start.
“We have mandated that there must be a diverse slate of candidates for every open role, and to measure our success, we track how diverse the slate was along with the hiring outcome,” says Kim Norwesh, Chief Human Resources Officer at 4C.
Performance tracking may seem like an intimidating task, but don’t overthink it. Something as basic as a shared spreadsheet is a great way to get started.
Read more about 4C’s diversity and inclusion initiatives.
10. Don’t forget about senior leadership
Image via RetailMeNot
We’ve already touched on diversity and inclusion at the team level, but it’s time to address the elephant in the room: senior leadership.
Executives have more influence over the direction of a company than any other group, so it’s critical that they accurately reflect the company and industry as a whole. Unfortunately, this is rarely the case. According to a recent study, 70% of Fortune 500 executives are white men.
We can do better, and companies like RetailMeNot already are.
“Our diversity and inclusion program started with a realization that our leadership needed to reflect our internal demographics and our customer base,” says Christine McCarey, Head of Diversity and Inclusion at RetailMeNot. “This work began as a women’s initiative, but it quickly pivoted to be more inclusive.”
This is one of the most difficult areas of diversity and inclusion to get right, but it’s arguably the most important, so don’t overlook it.
Bonus Example: The company has also dedicated a section of their careers page to explain what diversity and inclusion means to their team and how they are committed to incorporating it in their mission and implementing change through recruiting.
Read more about RetailMeNot’s diversity and inclusion initiatives.
11. have the tough conversations
Image via ThoughtWorks
The path to ruin is paved with good intentions, and ruin certainly shouldn’t be the fate of your diversity and inclusion program. In order to be successful, conviction and strength in the face of adversity are must have attributes.
“Hope and good intentions do not yield results,” says Tasha McCormic, Head of Diversity and Inclusion at ThoughtWorks in North America. “When it comes to diversity and inclusion, you have to be intentional and have a plan otherwise you will not see the change or progress you desire.”
Aside from sticking to your plan, being intentional also entails having some difficult conversations. This is never pleasant, but it’s an important part of the job.
“Do not shy away from tough conversations,” continues McCormic.
“Conversations about gender, race, sexism, ageism, etc. can be challenging, but you should not avoid them. In order for your diversity and inclusion efforts to be meaningful, you have to navigate through some uncomfortable areas, but your organization will be better off as a result of it.
Bonus Example: As an international organization with a wide range of diverse employees representing their workforce, ThoughtWorks takes diversity and inclusion very seriously. Their teams have over 60 active diversity programs and initiatives that focus on improving their workplaces and the greater tech industry.
Read more about ThoughtWorks’ diversity and inclusion initiatives.
12. Be patient
Rome wasn’t built in a day, and neither will be your diversity and inclusion efforts. When tackling an issue this complex, it’s important that you take a long view and give yourself ample time to accomplish your goals.
“Change may not happen overnight, especially when it comes to demographics,” says Tasha McCormic, Head of Diversity and Inclusion at ThoughtWorks in North America. “Do not get discouraged. If you continue to put time and effort into creating a more diverse and inclusive workplace, you will see results.”
13. If you’re serious, make the investment
Image via Duo
We may have saved the awkward money conversation for the end, but it’s too important to skip. If diversity and inclusion is something your organization is truly serious about, you’re going to have to make the necessary investments. There’s just no getting around it.
And the more ambitious your objectives, the larger that investment will likely be.
“Our program is designed to focus on three key areas: internal connectedness, community outreach and inclusive infrastructure led by a D&I team that develops programs and initiatives to support our vision,” says Trey Boynton, Manager of Diversity and Inclusion at Duo. “In just our first year, we’ve heavily invested people, time, resources, tools, partnerships and old-fashioned hard work. This is only the beginning, and we are excited about what lies ahead.”
Bonus Example: Duo focuses their careers and culture pages on diversity and individual characteristics with a variety of videos, employee testimonials and content from their social campaign #WeAreDuo that further highlights their diverse culture.
Read more about Duo’s diversity and inclusion initiatives.
Stay up-to-date on the latest tech news and emerging trends. | cc/2020-05/en_middle_0078.json.gz/line961 |
__label__cc | 0.573251 | 0.426749 | Turnover And Retention Rates for QSR Businesses
In our previous article, we discussed employee retention rate by industry and looked at which industries have the best and worst employee retention rates. In this article, we take a closer look at the restaurant industry, which has a notoriously high turnover rate and low retention rate.
Fast food restaurants, along with fast-casual restaurants, make up a segment of the restaurant industry known as quick service restaurants (QSR). Though the QSR industry is fast-growing, staffing issues abound.
What does turnover and recruiting look like in the QSR industry?
The Turnover and Growth Rate in the QSR Industry
Between 2016 and 2026, the Bureau of Labor Statistics (BLS) estimates that the Food and Beverage service industry will grow 14%, which is faster than average across all sectors. The growth, however, directly reflects the turnover rate in the industry. The BLS states, “Job prospects in most dining establishments will be excellent because many workers leave the occupation each year, resulting in numerous job openings.”
In 2016, the overall turnover rate in the restaurant sector was about 73%.
According to a recent study by Nation’s Restaurant News (NRN), 46% of the surveyed restaurant operators said turnover increased either “significantly” or “somewhat” over the past year. Additionally, 67% of restaurants polled in the NRN survey stated staffing challenges cited as a top concern.
The NRN study details which employees are most difficult to recruit and retain:
Back of the house: 59%
Front of the house: 28%
Corporate or regional employees: 4%
Within the back of the house category, restaurants have the most difficulty finding:
Line cook candidates: 72%
Prep cooks: 36%
Dishwashers: 33%
(Source: Nation's Restaurant News)
The Cost of Turnover in the QSR Industry
The Center for Hospitality Research at Cornell University estimates that turnover costs approximately $5,864 per person.
The granular breakdown looks something like this:
Pre-departure disengagement: $176
Recruiting to fill position: $1,173
Selection for new hire: $645
Orientation and training: $821
Productivity loss for all staff: $3,049
The same study shows that the average full-service restaurant operator pays about $146,600 in turnover, annually.
And the figure continues to rise.
Restaurant operators have experienced year-over-year increases associated with recruiting. More than two-thirds, or about 67%, of operators say increased competition for workers is the primary driver in rising costs.
These costs, especially when put into context, can be detrimental for a thin-margined restaurant business.
Why is Staffing an Issue for QSRs?
The staffing issues are two-fold. To start, it's a tight labor market out there. There are more job openings than available workers, and there is more competition than ever. Finding qualified staff is a difficult task for any QSR.
The second issue comes down to dollars and cents. The vast majority of respondents in the NRN study, (70%) said wages provide the most influential factor in motivating employees. This makes sense as many QSR employees are minimum wage employees.
The current federal minimum wage is $7.25 per hour, and according to the BLS, the median pay in the Food and Beverage serving category is about $20,410 per year or $9.81 per hour.
As restaurants already operate on a tight margin, finding a balance between wages and recruiting and retention costs is essential for survival.
Finding Leverage in a Tight Labor Market
On-demand payment benefits are a way to differentiate yourself in a tight labor market by giving your employees more control over when and how they receive their pay. With a daily pay benefit, employees can access their earned by unpaid wages with the click of a button.
We’ve seen companies who offer on-demand pay:
Fill open positions 52% faster than organizations who don’t offer an instant payroll benefit
Experience an average of 41% reduction in attrition
Daily pay is a financial perk that can be offered at no cost to a business.
Want to learn more about curbing the turnover costs at your QSR? Download our helpful workbook.
Written by Megan Wells
Megan Wells is a data journalist and content strategist based in San Francisco, California. Wells' work has appeared on Fox, Nasdaq, MSN, Motley Fool, and more. Wells also spoke at the 2015 Exceptional Women In Publishing conference.
Employee Retention, Employee Turnover
An Instant Pay Technology Myth - Payroll Will Never Sign Off On This NEXT
DailyPay Offers Early Access To Earnings At No Charge To Those Impacted By Hurricane Florence | cc/2020-05/en_middle_0078.json.gz/line963 |
__label__cc | 0.697473 | 0.302527 | Beta Channel Update
A partial list of changes is available in the log. Interested in switching release channels? Find out how. If you find a new issue, please let us know by filing a bug. The community help forum is also a great place to reach out for help or learn about common issues.
Di Mu
The beta channel has been updated to 52.0.2743.60 for Windows, Mac, and Linux.
Labels: Beta updates
Dev Channel Update
53.0.2783.5 for Mac and 53.0.2783.2 for Linux.
Krishna Govind
The dev channel has been updated to 53.0.2783.2/53.0.2783.4 for Windows, 53.0.2783.5 for Mac and 53.0.2783.2 for Linux.
Labels: Dev updates
A list of changes is available in the log. Interested in switching release channels? Find out how. If you find a new issue, please let us know by filing a bug. The community help forum is also a great place to reach out for help or learn about common issues.
The stable channel has been updated to 51.0.2704.106 for Windows, Mac, and Linux.
Beta Channel Update for Chrome OS
) has been released for all Chrome OS devices. This build contains a number of bug fixes, security updates and feature enhancements. A list of changes can be found here.
If you find new issues, please let us know by visiting our forum or filing a bug. Interested in switching channels? Find out how. You can submit feedback using ‘Report an issue...’ in the Chrome menu (3 vertical dots in the upper right corner of the browser).
Grace Kihumba
The Beta channel 52.0.2743.49 (Platform version: 8350.38.0) has been released for all Chrome OS devices. This build contains a number of bug fixes, security updates and feature enhancements. A list of changes can be found here.
for Windows, Mac and Linux.
The dev channel has been updated to 53.0.2774.3 for Windows, Mac and Linux.
Labels: dev update
Stable Channel Update for Chrome OS
The Stable channel has been updated to 51.0.2704.103 (Platform version: 8172.56.0/8172.57.0) for all Chrome OS devices except AOpen Chromebox Commercial. This build contains a number of bug fixes, security updates, and feature enhancements. Systems will be receiving updates over the next several days.
If you find new issues, please let us know by visiting our forum or filing a bug. Interested in switching channels? Find out how. You can submit feedback using ‘Report an issue...’ in the Chrome menu (3 horizontal bars in the upper right corner of the browser).
Bernie Thompson
Note: Access to bug details and links may be kept restricted until a majority of users are updated with a fix. We will also retain restrictions if the bug exists in a third party library that other projects similarly depend on, but haven’t yet fixed.
This update includes 3 security fixes. As usual, our ongoing internal security work was responsible for a wide range of fixes:
[620742] CVE-2016-1704: Various fixes from internal audits, fuzzing and other initiatives.
Many of our security bugs are detected using AddressSanitizer, MemorySanitizer, Control Flow Integrity or LibFuzzer.
Richard Bustamante
53.0.2767.5 for Windows, 53.0.2767.4 Mac and Linux.
The dev channel has been updated to 53.0.2767.4 /53.0.2767.5 for Windows, 53.0.2767.4 Mac and Linux.
The Beta channel 52.0.2743.32 (Platform version: 8350.21.1) has been released. This build contains a number of bug fixes, security updates and feature enhancements. A list of changes can be found here.
Dev Channel Update for Chrome OS
The Dev channel has been updated to
52.0.2743.32 (Platform version: 8350.21.1) for all Chrome OS devices except for monroe. This build contains a number of bug fixes, security updates and feature enhancements. A list of changes can be found here.
The dev channel has been updated to 53.0.2763.0 for Windows, Mac, and Linux.
Chrome for Android Update
. This release includes two barges full of performance and stability fixes, and also brings tabs back into the Chrome application. A partial list of the other changes in this build is available in the Git log. If you find a new issue, please let us know by filing a bug. More information about Chrome for Android is available on the Chrome site.
Alex Mineer
Good news, everyone! Chrome 51 for Android has been released and is now available in Google Play. This release includes two barges full of performance and stability fixes, and also brings tabs back into the Chrome application. A partial list of the other changes in this build is available in the Git log. If you find a new issue, please let us know by filing a bug. More information about Chrome for Android is available on the Chrome site.
Labels: Chrome for Android , Stable updates
Josafat Garcia
The Dev channel has been updated to 52.0.2743.32 (Platform version: 8350.21.0) for all Chrome OS devices. This build contains a number of bug fixes, security updates and feature enhancements. A list of changes can be found here.
Labels: Chrome OS , Dev updates
Admin Console Update
for Chrome devices for meetings based on a specific time in the local time zone.
Known issues are available here. Chrome for Work and Education customers can view detailed release notes in Google for Work Connect. Admins can report an issue by contacting support.
Lawrence Lui
The Admin console has been updated. Admins can now schedule a timed reboot for Chrome devices for meetings based on a specific time in the local time zone.
Labels: Admin Console
Chrome OS now automatically calibrates certain external monitors using specialized ICC profiles and settings
The Stable channel has been updated to 51.0.2704.79 (Platform version: 8172.47.0/1/2) for all Chrome OS devices. This build contains a number of bug fixes, security updates, and feature enhancements. Systems will be receiving updates over the next several days.
Some highlights of these changes are:
Chrome OS now has support for 3+ displays
Labels: Chrome OS , Stable updates
The stable channel has been updated to 51.0.2704.84 for Windows, Mac, and Linux.
This build contains a number of bug fixes, security updates and feature enhancements.
The Beta channel has been updated to 51.0.2704.79 (Platform version: 8172.47.0) for all Chrome OS devices except Dell Chromebook 11 and the Lenovo N22 Chromebook. This build contains a number of bug fixes, security updates and feature enhancements.
Anantha Keesara
Chromium blog to learn more about what's happening with Chrome!
A full list of changes in this build is available in the log. Interested in switching release channels? Find out how here. If you find a new issue, please let us know by filing a bug. The community help forum is also a great place to reach out for help or learn about common issues.
The Chrome team is excited to announce the promotion of Chrome 52 to the beta channel for Windows, Mac and Linux. Chrome 52.0.2743.24 contains our usual under-the-hood performance and stability tweaks, as well as cool new features to explore - head to the Chromium blog to learn more about what's happening with Chrome!
52.0.2743.19, 52.0.2743.21 (Platform version: 8350.14.0) for all Chrome OS devices except for celes and x86-alex-he . This build contains a number of bug fixes, security updates and feature enhancements. A list of changes can be found here.
The Dev channel has been updated to 52.0.2743.19, 52.0.2743.21 (Platform version: 8350.14.0) for all Chrome OS devices except for celes and x86-alex-he . This build contains a number of bug fixes, security updates and feature enhancements. A list of changes can be found here.
This update includes 15 security fixes. Below, we highlight fixes that were contributed by external researchers. Please see the Chromium security page for more information.
[$7500][601073] High CVE-2016-1696: Cross-origin bypass in Extension bindings. Credit to anonymous.
[$7500][613266] High CVE-2016-1697: Cross-origin bypass in Blink. Credit to Mariusz Mlynski.
[$4000][603725] Medium CVE-2016-1698: Information leak in Extension bindings. Credit to Rob Wu.
[$3500][607939] Medium CVE-2016-1699: Parameter sanitization failure in DevTools. Credit to Gregory Panakkal.
[$1500][608104] Medium CVE-2016-1700: Use-after-free in Extensions. Credit to Rob Wu.
[$1000][608101] Medium CVE-2016-1701: Use-after-free in Autofill. Credit to Rob Wu.
[$1000][609260] Medium CVE-2016-1702: Out-of-bounds read in Skia. Credit to cloudfuzzer.
We would also like to thank all security researchers that worked with us during the development cycle to prevent security bugs from ever reaching the stable channel.
As usual, our ongoing internal security work was responsible for a wide range of fixes: | cc/2020-05/en_middle_0078.json.gz/line970 |
__label__cc | 0.56916 | 0.43084 | Home Staff
Camila Fernandez
Early childhood education and development
Assessment of developmental outcomes in early childhood
Early-grade literacy assessments
Observational measurement
Instrument design for experimental and nonexperimental evaluations
About Camila
Camila Fernández has expertise evaluating international early childhood development and educational programs aimed to improve children’s development, school readiness, and educational achievement. She has designed instruments for large-scale randomized evaluations in Latin America and has experience with quantitative and qualitative evaluation methods.
Fernández currently serves as international senior researcher for three experimental evaluations of reading programs in Peru and Guatemala funded by the U.S. Agency for International Development. She led the adaptation of early-grade literacy assessments and designed teacher and household surveys and classroom observation instruments for the impact evaluations in Peru and Guatemala. She currently leads the qualitative component of the implementation studies and monitors multicounty survey data collection efforts in those countries.
Before joining Mathematica in 2011, Fernández was assistant professor of psychology at Universidad de los Andes in Colombia. During that time, she collaborated in the evaluation of the national subsidized child care program Hogares Comunitarios de Bienestar, led the qualitative component of the mixed-methods evaluation of the national initiative for rural education, and co-led studies on risk factors for dropping out of school early funded by the Ministry of Education of Colombia and other nongovernmental organizations. She was the assessment and curriculum implementation consultant for the Center for the Evaluation of Development Policies at the Institute of Fiscal Studies on a randomized controlled trial of an integrated early childhood program delivered to beneficiaries of the Colombian conditional cash transfer program Familias en Acción.
Fernández holds a Ph.D. in developmental psychology from New York University. Her work has appeared in peer-reviewed publications, including BMJ, Social Science and Medicine, and First Language.
Evaluation Interim Report for the Georgia II Improving General Education Quality Project's School Rehabilitation and Training Activities
Evaluation Interim Report for the Georgia II Industry-Led Skills and Workforce Development Project
Improving Education Infrastructure and Training in Georgia
Key Blog Posts
Building the Evidence Base to Improve Outcomes for Women in Developing Countries
Home-Delivered Food Boxes Reduced Food Insecurity Among Adults, but Not Children
Using Data to Keep School Improvement on Track: Focus on Comprehensive Support and Improvement
State-by-State Impact of Proposed Changes to "Broad-Based Categorical Eligibility" in SNAP
Putting Paper to Work: How Rethinking Forms Can Put People First and Improve Engagement in Human Services Programs | cc/2020-05/en_middle_0078.json.gz/line972 |
__label__cc | 0.641691 | 0.358309 | by Andrea Goldsmith, Anaïs Nin , 2005
"... Copyright c ○ 2005 by Cambridge University Press. This material is in copyright. Subject to statutory exception and to the provisions of relevant collective licensing agreements, no reproduction of any part may take place without the written permission of Cambridge University ..."
Copyright c ○ 2005 by Cambridge University Press. This material is in copyright. Subject to statutory exception and to the provisions of relevant collective licensing agreements, no reproduction of any part may take place without the written permission of Cambridge University
The swiss-prot protein knowledgebase and its supplement trembl in 2003
by Brigitte Boeckmann, Amos Bairoch, Rolf Apweiler, Marie-claude Blatter, Anne Estreicher, Elisabeth Gasteiger, Maria J. Martin, Karine Michoud, Isabelle Phan, Rine Pilbout, Michel Schneider - Nucleic Acids Res , 2003
"... The SWISS-PROT protein knowledgebase ..."
The SWISS-PROT protein knowledgebase
2003: Global analyses of sea surface temperature, sea ice, and night marine air temperature since the late Nineteenth Century
by N. A. Rayner, D. E. Parker, E. B. Horton, C. K. Foll, L. V. Alex, D. P. Rowell, A. Kaplan - J. Geophysical Research
"... data set, HadISST1, and the nighttime marine air temperature (NMAT) data set, HadMAT1. HadISST1 replaces the global sea ice and sea surface temperature (GISST) data sets and is a unique combination of monthly globally complete fields of SST and sea ice concentration on a 1 ° latitude-longitude grid ..."
data set, HadISST1, and the nighttime marine air temperature (NMAT) data set, HadMAT1. HadISST1 replaces the global sea ice and sea surface temperature (GISST) data sets and is a unique combination of monthly globally complete fields of SST and sea ice concentration on a 1 ° latitude-longitude grid from 1871. The companion HadMAT1 runs monthly from 1856 on a 5 ° latitude-longitude grid and incorporates new corrections for the effect on NMAT of increasing deck (and hence measurement) heights. HadISST1 and HadMAT1 temperatures are reconstructed using a two-stage reducedspace optimal interpolation procedure, followed by superposition of quality-improved gridded observations onto the reconstructions to restore local detail. The sea ice fields are made more homogeneous by compensating satellite microwave-based sea ice concentrations for the impact of surface melt effects on retrievals in the Arctic and for algorithm deficiencies in the Antarctic and by making the historical in situ concentrations consistent with the satellite data. SSTs near sea ice are estimated using statistical relationships between SST and sea ice concentration. HadISST1 compares well with other published analyses, capturing trends in global, hemispheric, and regional SST well,
Fuzzy extractors: How to generate strong keys from biometrics and other noisy data. Technical Report 2003/235, Cryptology ePrint archive, http://eprint.iacr.org, 2006. Previous version appeared at EUROCRYPT 2004
by Yevgeniy Dodis, Rafail Ostrovsky, Leonid Reyzin, Adam Smith - 34 [DRS07] [DS05] [EHMS00] [FJ01] Yevgeniy Dodis, Leonid Reyzin, and Adam , 2004
"... We provide formal definitions and efficient secure techniques for • turning noisy information into keys usable for any cryptographic application, and, in particular, • reliably and securely authenticating biometric data. Our techniques apply not just to biometric information, but to any keying mater ..."
material that, unlike traditional cryptographic keys, is (1) not reproducible precisely and (2) not distributed uniformly. We propose two primitives: a fuzzy extractor reliably extracts nearly uniform randomness R from its input; the extraction is error-tolerant in the sense that R will be the same even
Kodaira-Spencer theory of gravity and exact results for quantum string amplitudes
by M. Bershadsky, S. Cecotti, H. Ooguri, C. Vafa - Commun. Math. Phys , 1994
"... We develop techniques to compute higher loop string amplitudes for twisted N = 2 theories with ĉ = 3 (i.e. the critical case). An important ingredient is the discovery of an anomaly at every genus in decoupling of BRST trivial states, captured to all orders by a master anomaly equation. In a particu ..."
We develop techniques to compute higher loop string amplitudes for twisted N = 2 theories with ĉ = 3 (i.e. the critical case). An important ingredient is the discovery of an anomaly at every genus in decoupling of BRST trivial states, captured to all orders by a master anomaly equation. In a
Parameterized Complexity
by Rod G. Downey, Michael R. Fellows, Rolf Niedermeier, Peter Rossmanith, Rod G. Downey (wellington, New Zeal, Michael R. Fellows (newcastle, Rolf Niedermeier (tubingen, Peter Rossmanith (tu Munchen , 1998
"... the rapidly developing systematic connections between FPT and useful heuristic algorithms | a new and exciting bridge between the theory of computing and computing in practice. The organizers of the seminar strongly believe that knowledge of parameterized complexity techniques and results belongs ..."
on parameterized complexity, and it hopefully serves as a driving force in the development of the eld. 1 We had 49 participants from Australia, Canada, India, Israel, New Zealand, USA, and various European countries. During the workshop 25 lectures were given. Moreover, one night session was devoted to open
Digital Game-Based Learning
by Marc Prensky
"... [Green and Bavelier, 2003] has grabbed national attention for suggesting that playing “action ” video and computer games has the positive effect of enhancing students ’ visual selective attention. But that finding is just one small part of a more important message that all parents and educators need ..."
[Green and Bavelier, 2003] has grabbed national attention for suggesting that playing “action ” video and computer games has the positive effect of enhancing students ’ visual selective attention. But that finding is just one small part of a more important message that all parents and educators
Solving multiclass learning problems via error-correcting output codes
by Thomas G. Dietterich, Ghulum Bakiri - JOURNAL OF ARTIFICIAL INTELLIGENCE RESEARCH , 1995
"... Multiclass learning problems involve nding a de nition for an unknown function f(x) whose range is a discrete set containing k>2values (i.e., k \classes"). The de nition is acquired by studying collections of training examples of the form hx i;f(x i)i. Existing approaches to multiclass l ..."
Multiclass learning problems involve nding a de nition for an unknown function f(x) whose range is a discrete set containing k>2values (i.e., k \classes"). The de nition is acquired by studying collections of training examples of the form hx i;f(x i)i. Existing approaches to multiclass
Monitoring the future: National survey results on drug use
by Lloyd D. Johnston, Ph. D, Patrick M. O’malley, Ph. D, Jerald G. Bachman, Ph. D, John E. Schulenberg, Ph. D - I: Secondary school students (NIH Publication No. 05-5726). Bethesda, MD: National Institute on Drug Abuse , 2005
"... by ..."
Analytic Number Theory
by Henryk Iwaniec, Emmanuel Kowalski - A.M.S COLLOQUIUM PUBL , 2004 | cc/2020-05/en_middle_0078.json.gz/line973 |
__label__cc | 0.740417 | 0.259583 | Activity recognition from user-annotated acceleration data
by Ling Bao, Stephen S. Intille , 2004
"... In this work, algorithms are developed and evaluated to detect physical activities from data acquired using five small biaxial accelerometers worn simultaneously on different parts of the body. Acceleration data was collected from 20 subjects without researcher supervision or observation. Subjects ..."
In this work, algorithms are developed and evaluated to detect physical activities from data acquired using five small biaxial accelerometers worn simultaneously on different parts of the body. Acceleration data was collected from 20 subjects without researcher supervision or observation
Detecting Pedestrians Using Patterns of Motion and Appearance
by Paul Viola, Michael J. Jones, Daniel Snow - IN ICCV , 2003
"... This paper describes a pedestrian detection system that integrates image intensity information with motion information. We use a detection style algorithm that scans a detector over two consecutive frames of a video sequence. The detector is trained (using AdaBoost) to take advantage of both moti ..."
This paper describes a pedestrian detection system that integrates image intensity information with motion information. We use a detection style algorithm that scans a detector over two consecutive frames of a video sequence. The detector is trained (using AdaBoost) to take advantage of both
by Ellen C. Hildreth , 1985
"... For both biological systems and machines, vision begins with a large and unwieldy array of measurements of the amount of light reflected from surfaces in the environment. The goal of vision is to recover physical properties of objects in the scene, such as the location of object boundaries and the s ..."
Abstract - Cited by 1277 (1 self) - Add to MetaCart
about the physical properties of the scene are provided by the changes of intensity in the image. The importance of intensity changes and edges in early visual processg has led to extensive research on their detection, description and .use, both in computer and biological vision systems. This article
An intrusion-detection model
by Dorothy E. Denning - IEEE TRANSACTIONS ON SOFTWARE ENGINEERING , 1987
"... A model of a real-time intrusion-detection expert system capable of detecting break-ins, penetrations, and other forms of computer abuse is described. The model is based on the hypothesis that security violations can be detected by monitoring a system's audit records for abnormal patterns of sy ..."
A model of a real-time intrusion-detection expert system capable of detecting break-ins, penetrations, and other forms of computer abuse is described. The model is based on the hypothesis that security violations can be detected by monitoring a system's audit records for abnormal patterns
Singularity Detection And Processing With Wavelets
by Stephane Mallat, Wen Liang Hwang - IEEE Transactions on Information Theory , 1992
"... Most of a signal information is often found in irregular structures and transient phenomena. We review the mathematical characterization of singularities with Lipschitz exponents. The main theorems that estimate local Lipschitz exponents of functions, from the evolution across scales of their wavele ..."
of their wavelet transform are explained. We then prove that the local maxima of a wavelet transform detect the location of irregular structures and provide numerical procedures to compute their Lipschitz exponents. The wavelet transform of singularities with fast oscillations have a different behavior that we
Detection and Tracking of Point Features
by Carlo Tomasi, Takeo Kanade - International Journal of Computer Vision , 1991
"... The factorization method described in this series of reports requires an algorithm to track the motion of features in an image stream. Given the small inter-frame displacement made possible by the factorization approach, the best tracking method turns out to be the one proposed by Lucas and Kanade i ..."
The factorization method described in this series of reports requires an algorithm to track the motion of features in an image stream. Given the small inter-frame displacement made possible by the factorization approach, the best tracking method turns out to be the one proposed by Lucas and Kanade in 1981. The method defines the measure of match between fixed-size feature windows in the past and current frame as the sum of squared intensity differences over the windows. The displacement is then defined as the one that minimizes this sum. For small motions, a linearization of the image intensities leads to a Newton-Raphson style minimization. In this report, after rederiving the method in a physically intuitive way, we answer the crucial question of how to choose the feature windows that are best suited for tracking. Our selection criterion is based directly on the definition of the tracking algorithm, and expresses how well a feature can be tracked. As a result, the criterion is optima...
Community detection in graphs
by Santo Fortunato , 2009
"... The modern science of networks has brought significant advances to our understanding of complex systems. One of the most relevant features of graphs representing real systems is community structure, or clustering, i. e. the organization of vertices in clusters, with many edges joining vertices of th ..."
The modern science of networks has brought significant advances to our understanding of complex systems. One of the most relevant features of graphs representing real systems is community structure, or clustering, i. e. the organization of vertices in clusters, with many edges joining vertices
A computational approach to edge detection
by John Canny - IEEE Transactions on Pattern Analysis and Machine Intelligence , 1986
"... Abstract-This paper describes a computational approach to edge detection. The success of the approach depends on the definition of a comprehensive set of goals for the computation of edge points. These goals must be precise enough to delimit the desired behavior of the detector while making minimal ..."
is extended along the edge. This detection scheme uses several elongated operators at each point, and the directional operator outputs are integrated with the gradient maximum detector. Index Terms-Edge detection, feature extraction, image processing, machine vision, multiscale image analysis. I.
Detecting faces in images: A survey
by Ming-hsuan Yang, David J. Kriegman, Narendra Ahuja - IEEE TRANSACTIONS ON PATTERN ANALYSIS AND MACHINE INTELLIGENCE , 2002
"... Images containing faces are essential to intelligent vision-based human computer interaction, and research efforts in face processing include face recognition, face tracking, pose estimation, and expression recognition. However, many reported methods assume that the faces in an image or an image se ..."
sequence have been identified and localized. To build fully automated systems that analyze the information contained in face images, robust and efficient face detection algorithms are required. Given a single image, the goal of face detection is to identify all image regions which contain a face regardless
Histograms of Oriented Gradients for Human Detection
by Navneet Dalal, Bill Triggs - In CVPR , 2005
"... We study the question of feature sets for robust visual object recognition, adopting linear SVM based human detection as a test case. After reviewing existing edge and gradient based descriptors, we show experimentally that grids of Histograms of Oriented Gradient (HOG) descriptors significantly out ..."
We study the question of feature sets for robust visual object recognition, adopting linear SVM based human detection as a test case. After reviewing existing edge and gradient based descriptors, we show experimentally that grids of Histograms of Oriented Gradient (HOG) descriptors significantly | cc/2020-05/en_middle_0078.json.gz/line974 |
__label__wiki | 0.668836 | 0.668836 | HomeAboutGive
Discover Our Labs
Explore Our Research Expertise
“When I began my education in civil engineering, spaces for lab work were limited. Because of this experience, I understand the importance of having a place where you can test and build, and collaborate.”
— John Toups, a civil engineer and entrepreneur
We help our graduates develop the tools and vision they need to address the complex demands of our evolving infrastructure. You can make a difference by supporting our research, funding scholarships, and helping us build and equip advanced laboratories.
Charles Toups describes his father John Toups' passion for giving back to help future generations obtain first-rate educational experiences. The Instructional Laboratory for Civil, Environmental, and Infrastructure Engineering at the Volgenau School of Engineering, is named in memory of John Toups.
Help us build a better world by:
Partnering with students on their senior design projects. Industry sponsors can support a team of seniors to help them conceptualize, design, analyze, build, test, and report on an engineering problem that benefits the sponsors.
Offering students internships and learning opportunities outside the classroom.
Mentoring a student.
Donating to build and equip labs.
Sponsoring a lecture series or other event during Engineers Week.
Supporting faculty research.
Funding a distinguished fellowship.
Financing scholarships.
Supporting student travel to conferences and national design competitions.
If you want to make a bigger impact or honor someone special, consider a naming opportunity.
Contact Michele Brumsey at 703-993-6069 to explore all our giving opportunities and plan gifts in ways that achieve our shared goals.
You can also support the alumni campaign. Please specify that you are donating to Sid and Reva Dewberry Department of Civil, Environmental, and Infrastructure Engineering.
Timeline of Transformational Gifts
1999: Dewberry Fundraising Campaign Leads to Endowed Chair
Michael Bronzini, (pictured), was appointed the first endowed chair of what was then referred to as the Urban Systems Engineering. The endowed chair was created in honor of Sidney O. Dewberry, founder of Dewberry, a leading professional services company in Fairfax, Virginia. Dewberry advocated for the Civil, Environmental, and Infrastructure Engineering Department. Read more.
2012: Sid and Reva Dewberry Make $1M Gift
Sidney O. and Reva Dewberry contributed $1 million to the Civil Engineering Department. To honor them, the department was renamed the Sid and Reva Dewberry Civil, Environmental, and Infrastructure Engineering Department.
2014: $3 Million Fundraising Effort Endows Hazel Chair
Sidney O. Dewberry spearheaded efforts to raise more than $3 million to establish the Eleanor and Bill Hazel (pictured) Endowed Chair in Civil, Environmental, and Infrastructure Engineering to recruit distinguished faculty whose teaching and research addresses the most forward-thinking approaches in the field. The Hazel family led the giving with a $1 million gift. Read more.
John Toups Endowment of $1.5 Million Benefits Civil Engineering
John Toups' gift of $1.5 million to the Sid and Reva Dewberry Department of Civil, Environmental, and Infrastructure Engineering provides for facility improvement and faculty support. The largest portion of the gift will support the teaching laboratory where civil engineering students test, build, experiment, innovate, and work in teams. A second portion of the gift will support faculty fellowships, and a third portion of the gift will enrich the school's graduate student experience by supplementing travel to conferences, summer study, and other programs.
"George Mason University has quickly become one of the many universities across the country that is providing the necessary education and training for future civil engineers. It was a pleasure for my wife and me to provide this gift to build a first-class civil and environmental engineering department."
— Sid Dewberry, founder of Dewberry and donor to the Sid and Reva Dewberry Department of Civil, Environmental, and Infrastructure Engineering | cc/2020-05/en_middle_0078.json.gz/line977 |
__label__cc | 0.644399 | 0.355601 | $200.0/min 4.9 51 $3.33/min
I have built technology ventures, both in the US and Canada with successful exits through acquisitions and a nine figure IPO. My background is weighted towards sales and marketing, particularly in the B2B space. I now help other companies move from startup to sustainability when I'm not behind the wheel of my tractor. More about me at http://www.linkedin.com/in/paulsullivanky
Pietari Grohn
$150.0/min 5.0 24 $2.5/min
Silicon Valley startup and venture capital attorney. Formerly founder of Vivio and Rviewr. Practical and business-minded counsel.
Founder, Co-Founder, Partner, President of 9 companies. Sold 7 of them. Bootstrapped and VC backed. Started in retail/franchising and commercial RE, transitioned to software/Internet. Decent dude, love to help/connect others.
Edgar Tirado
$150.0/min 5.0 2 $2.5/min
100+ Mergers and Acquisition transactions (exceeding over $10 billion in aggregate deal value), which include over 6 years with Fenwick & West, LLP in Silicon Valley, over 2 years with DLA Piper LLP (US) in San Diego and currently with a firm that I have formed with a few of my former Fenwick colleagues. Merger. Company Sale.
Rich Gorman
$350.0/min N/A 0 $5.83/min
As a pioneer in online direct response marketing, Rich Gorman has built hundreds of direct response campaigns that have achieved scale and has invested in dozens of startups. I'm an expert in direct response, internet start-ups, publishing, and performance marketing.
Sean Sheppard
ÜT: 33.235697,-111.843906
$200.0/min N/A 33 $3.33/min
I specialize in accelerating growth in companies across a wide range of industries and markets.
Christian Hunter
$60.0/min N/A 0 $1/min
Started, ran, and sold a few successful startups. Pretty narrowly focused on direct to consumer service companies. If you have a customer-facing offering you think can be significantly scaled, let's talk. BACKGROUND: My first startup sale (Bargain.com) went for $64.5 million in cash deal to a NASDAQ traded company My second startup sale (inq.com / TouchCommerce) went to another NASDAQ traded company in a cash and stock deal worth $215 million.
Gary Gilchrist
Gary works exclusively with CEOs, private equity firms and key executives to define the capabilities and strategies required for organizational readiness to grow sales revenues by 2-3x and identify key targets for growth. He is an expert at enhancing the sales infrastructure and strategies needed to institutionalize sales processes that form the DNA needed to bring start-up companies over the finish line. As a hands-on executive he has a unique combination of strategic sales management and tactical execution, ideally suited for an organization with aggressive growth goals and sales turnaround. Over the course of his career, he’s successfully helped multiple startups transform their sales organizations by putting the operational best practices in place leading them to a merger or acquisition by Fortune 1000 companies. Gary has managed Sales Teams and Business Development for various organizations across his career including software and data companies such as Experian, Dunn & Bradstreet, West Corporation, and On24. He brings proven methodologies for sales leadership, demand generation, organic and business development, new product launches, account growth, compensation and incentive planning and a host of other best practices. His work is defined by the goals of his clients with the aim of taking them from Good 2 Great. (G2G!) Gary is a sought-after coach and mentor with experience across the variety of sales disciplines and strategies needed to achieve success in the services, software and technology industries. | cc/2020-05/en_middle_0078.json.gz/line978 |
__label__wiki | 0.766814 | 0.766814 | Nominations are now open for the Champions of Pride Awards
Champion of Pride Young Catalyst Award recipient Andraya Williams, right, rides in the Bank of America Charlotte Pride Parade in 2014. Photo by Jennifer Hogan.
Nominations now open for the Champions of Pride Awards to honor LGBTQ & ally community members
Awards recognize outstanding LGBTQ leadership, community allies, young catalysts
Click here to nominate an award recipient today.
Charlotte Pride, a local non-profit organization which produces educational and social programming to celebrate and empower the Queen City’s LGBTQ community, has opened nominations for its annual Champions of Pride Awards. Any individual may be nominated for the awards starting now through May 31, 2015, at charlottepride.org/champions/.
The Champions of Pride Awards seek to recognize those whose work and dedication exemplify the spirit of Pride. Our Champions endeavor to empower and unite LGBTQ and allied people through their leadership, service and support. Champions understand the importance of celebrating our past, present and future while advancing LGBTQ rights and visibility. A wide range of nominations are encouraged in order to honor the full diversity of the community. Any individual or couple may be nominated for a Charlotte Pride 2013 Champion of Pride Award in the following four categories:
Harvey Milk Award – Given annually to an individual or couple to honor exceptional leadership or service to the community by those who champion LGBTQ causes in the greater Charlotte community.
Outstanding Ally Award – Given annually to an individual or couple to honor those who do not identify as LGBTQ, but who have stalwartly supported community with a demonstrated, ongoing passion and commitment to better LGBTQ lives.
Young Catalyst Award – Given annually to an individual or a couple to recognize a young adult leader under the age of 30 who is an “up-and-coming” leader within the community and/or whose contributions to the community have carried significant impact over the last year.
Legacy Award – Given to an individual or couple to honor a lifelong commitment of outstanding leadership and service to the Charlotte LGBTQ community for an extended period of years; this special award may be presented from time-to-time by the committee.
Each award will be presented at the 2015 Charlotte Pride Festival and Parade, August 15-16, 2015, in Uptown Charlotte. Nomination details and nomination forms can be found online at charlottepride.org/champions/. The deadline for nominations is May 31, 2015. Award recipients will be chosen and notified by June 22, 2015, by the Charlotte Pride Executive Committee and will be asked to participate in this year’s festival and parade.
Inaugural awards in 2013 were presented to transgender activist Janice Covington, straight allies and PFLAG parents Beverly and Bill McIntyre and Latino LGBTQ and undocumented activist Juan Carlos Ramos,. In 2014, awards were presented to Time Out Youth founder Tonda Taylor, Holy Trinity Lutheran Church’s the Rev. Dr. Nancy Kraft and transgender student Andraya Williams. Click here to learn more about 2013 recipients and here for 2014 recipients.
ABOUT CHARLOTTE PRIDE: Charlotte Pride works to celebrate and empower our local LGBTQ community and produces
educational and social programming highlighting the social, cultural, ethnic, artistic and civic diversity of the Charlotte-metro region’s LGBTQ community, including the annual Charlotte Pride Festival & Parade which hosted
more than 100,000 visitors in 2014. It is one of the Southeast’s largest LGBTQ Pride organizations.
Andraya Williams, Beverly and Bill McIntyre, Champions of Pride, Janice Covington, Juan Carlos Ramos, Nancy Kraft, Tonda Taylor | cc/2020-05/en_middle_0078.json.gz/line991 |
__label__cc | 0.747573 | 0.252427 | Naming Services
Company Naming
Product Naming
Service Naming
Trademark Screening
Linguistics & Research
Why Catchword
Agency Timeline
Naming Resources
Naming Guide
Naming Glossary
CatchThis Blog
Name Reviews
Wherever you go, there we are.
Our strategic alliances with leading naming agencies such as Labbrand in China and Werner Brandl in Germany provide our clients with valuable global resources–without depleting their own. Whether it’s creative collaborations with France and Spain, or critical linguistic input from Switzerland and The Netherlands, our partnerships with like-minded naming agencies around the world allow us to provide our international clients with truly global creative and screening services.
Want to make sure that interesting but oddly coined word doesn’t mean something inappropriate in Shanghainese? Worried that maybe your final name candidate doesn’t deliver your desired associations in Argentine Spanish? Rest easy, friend, we’ve got you covered. Our global capabilities include linguistic expertise across North and South America, Europe, South East Asia, Australasia, Africa, and the Middle East. For a complete list of linguistic capabilities, please click here.
And, because Catchword clients have access to these services on an as-needed basis, they don’t have that nagging feeling that they are somehow indirectly funding their naming company’s latest architectural expenditure. Clients comment: We like this.
How to Create Great Product and Company Names.
Have you heard the Knewz? Name review of News Corp’s new site
News Corp, the mass media conglomerate that owns Dow Jones & Company (publisher of The Wall Street Journal and Barron's), the New York Post, The...
Subscribe to receive our blog and news.
© 2020 Catchword | Sitemap | Terms & Conditions
West Coast 409 13th St, 12th Flr, Tribune Tower, Oakland, CA 94612 Tel: 510.628.0080
East Coast 33 West 19th Street, 4th Floor, New York, NY 10011 Tel: 212.472.8936 | cc/2020-05/en_middle_0078.json.gz/line993 |
__label__wiki | 0.81477 | 0.81477 | South African bishop warns politicians against war rhetoric
Julius Malema, leader of the Economic Freedom Fighters, gestures during a March 31 news conference in Johannesburg following the South African Constitutional Court's finding that President Jacob Zuma had violated the country's constitution. (CNS photo/Kim Lundbrook, EPA)
By Bronwen Dachs • Catholic News Service • Posted April 26, 2016
CAPE TOWN, South Africa (CNS) — War rhetoric from South African political leaders could incite election violence and civil war, a South African bishop warned.
“We are deeply saddened to hear of war rhetoric by the leader of the Economic Freedom Fighters‚” Bishop Abel Gabuza of Kimberley, who chairs the Southern African Catholic Bishops’ Conference justice and peace commission, said in an April 25 statement.
Julius Malema, leader of the Freedom Fighters, said on national television April 24 that if the government continues to respond violently to protests, “We will run out of patience very soon and we will remove this government through the barrel of a gun.”
“We have seen the evil consequences of civil war in other African countries‚ including massive loss of lives‚ a refugee crisis and irreparable damage to the economy. We do not want our nation to take such a path,” Bishop Gabuza said. “We therefore appeal to all political parties to refrain from actions and rhetoric that could fuel election violence and civil war.”
Service delivery protests have become increasingly common and violent in recent months as anger mounts in poor communities over problems such as no running water in some areas and a lack of paved roads in others. Riot police with tear gas and stun grenades have been called in to quell many of these protests around the country.
The increase in violence by people protesting lack of service delivery and other issues “and the use of excessive force by the police” to curb the protests are deeply concerning, Bishop Gabuza said.
Excessive force as a deterrent will not solve the complex problem of violent protests‚ he said, noting that the government should tackle the causes of the protests, “including the rising economic inequalities‚ youth unemployment‚ a culture of patronage and the fierce scramble for political positions — especially when such positions are considered as an opportunity for self-enrichment.”
South African local government elections are scheduled for Aug. 3.
PREVIOUS: U.S. teens say faith strengthened at youth celebration in Rome
NEXT: Catholic agencies begin work of rebuilding after Ecuador quake | cc/2020-05/en_middle_0078.json.gz/line994 |
__label__wiki | 0.679726 | 0.679726 | The Elections and the Left: Some Thoughts June 8, 2009
Posted by Garibaldy in Irish Politics.
Bit early to be doing this given that all the results aren’t in yet, but it seems like it might be useful to have a dedicated post on which the issues resulting from the election can be debated all together. So, clearly this has been a good election for the left, both broadly defined and more narrowly. The Labour Party did the best of the parties on the broad left. Its share of the vote has gone up from 11% to around 14% (I’ve also seen 15 and 17% given). It has around 30% of the local election vote in Dublin, and is the biggest single party on Dublin City Council. So in terms of seats, vote share, and profile, it has done very well in the local elections. On top of that, they have done very well in the European elections. We shouldn’t forget that a couple of months ago, when Labour’s Dublin candidate was being discussed, there were some suggestions that De Rossa was running again at 69 because they were in a real battle to keep the seat either with or without him. As it turns out, he took the seat easily. Overall then, a very effective campaign.
The next biggest winning party on the left is the Socialist Party. I said to regular commenter Joe in the comments on a thread some weeks ago that I thought Joe Higgins had no chance of becoming an MEP. Shows you what I know. Well done to him and to the Socialist Party. I’d be interested to hear what people think happened. It seems to me that until a couple of weeks ago, people weren’t really talking about him as a likely winner, and that the campaign was realistically about building towards the next Dáil election. Then about two weeks ago he emerged as a serious candidate and kept building momentum. Not being in Dublin, it’s hard for me to judge. But clearly, the Socialist Party does not have the type of party or electoral machine to match the parties it was competing with against for the seat, except on a localised basis. As everyone knows, Higgins is an extremely articulate and able representative, well-regarded across the political spectrum. So it looks like a party machine operating at maximum capacity added to a very capable and media-effective candidate. I’ll come back to this below. In the local elections, they have taken four seats, with three candidates topping the poll. It seems their first preference vote has almost doubled since 2004. There is another candidate involved in a recount. However, Mick Murphy lost his seat in Tallaght Central. Joe Higgins looks a shoe-in for the next Dáil election in Dublin West. WBS has noted that he thinks there might be other SP TDs too. I’m not sure that that is the case, but it certainly cannot be ruled out. In short, the Socialist Party can be well pleased. The profile, money, and organisational outcome of these elections for them is very positive.
As can the People Before Profit Alliance. It also did very well, with five candidates elected. Boyd Barret has a very real chance of taking a seat at the next Dáil election, but I think it is far from certain. While equivalent alliances (or SWP electoral fronts if you prefer) in the UK have collapsed, it looks as though People Before Profit is here to stay, and it stood candidates in rural areas where the further left has little tradition.
The Workers’ Party’s Davy Walsh kept his seat in Waterford, against the predictions of many. Ted Tynan also took a seat in Cork, which is significant because it means that The Workers’ Party once again has represetantion outside Waterford. In Waterford East The Workers’ Party stood for the first time since 1991, and Joe Tobin missed a seat by 8 votes in the final count. Willie Moore missed out by about 40 votes in the final count in his constituency, where former WP councillor John Halligan topped the poll by a country mile. The other candidates in Cork did relatively well, on about 5%. In Dublin and Dundalk, the percentage of the vote taken was higher than it has been in the past. The WP also stood in the Dublin Central constituency for the first time since 1991. The performance in Dublin was more about reflecting organisational growth and redevelopment, and in that respect is a fairly satisfactory result. Overall, The WP can be pleased with the performance, doing relatively well in securing transfers athough it could easily have won double the number of seats with a few more. So positive signs for the future after a long period of disappointing elections.
Maureen O’Sullivan taking the seat in Dublin Central was a great thing for the left. Given WBS’ extensive and superb discussions, I’ll say nothing more.
To move then to those within the broad left who can not be so pleased. Firstly there is the Green Party. It now has only three councillors, none of them in Dublin where its TDs are situated. It had the biggest disaster of election. If economic conditions do not improve, it could be facing wipe-out at the next election, and without a strong local government profile to rebuild from. I think that they will probably hold at least one Dáil seat, but they can be in no doubt that their voters are thoroughly disgusted with them. An economic upturn might save more than one of them, but we shall see. Having said that, I doubt their activist base will disappear on the back of this, given that many have been active in green politics long before it was fashionable.
Gerry Adams is putting a brave face on his party’s mixed southern performance. Their performace in Dublin was, frankly, disastrous. Six seats in Dublin City Council have been lost, including Daithí Doolan’s. He has been someone in whom high hopes had been invested for the future, and he may of course come back. Overall, there was a slight slip in percentage in the locals, but an increase in seats, including in some virgin territory such as Limerick. Adams was saying that he expected a difficult time for Mary Lou, and that the loss of her seat was not a surprise. That might be true. What is a surprise is who she lost the seat to. Losing the seat to a sitting Fianna Fáil MEP would have been entirely understandable, even if a little disappointing in the present economic circumstances. Losing it to Joe Higgins will probably set alarm bells ringing. It demonstrates that there remains a huge reluctance to transfer to PSF among many in the southern electorate, and it is possible that part of Joe Higgins’ momentum was a desire to see neither Fianna Fáil nor the Provisionals in that seat. having said that, at the time of writing, Ferris remains in contention for a European seat in Ireland South. The Fine Gael candidate Burke has just been eliminated, which should benefit Kelly and Sinnott much more than Ferris. I doubt she’ll take that seat on the basis of transfers. In the north, there was success in Bairbre de Brún taking her seat on the first count, and topping the poll due to Jim Allister’s success in taking around 40% of the DUP’s vote. So a very mixed day overall, with neither major progress nor decline. But a halted momentum in current circumstances would I imagine be a big worry.
Overall then, a good set of elections for the left. But we should not get carried away. In the south, there are causes for serious pause. Firstly, Fine Gael did the best in the elections, taking 32% of the vote, and in a general election this would be 70-something seats. There is no prospect of a left-led coalition government, and there are serious doubts that any FG-led coalition would behave that differently to the current government, although that would depend on how far Labour – or indeed PSF – played hard ball. Which none of us places that much expectation in. Secondly, will Fianna Fáil ever do this badly again, or at least in a Dáil election? That will depend on where the economy is two years from now. The example of Fine Gael after 2002, or the Tories after 1997, suggest that we should not expect to see Fianna Fáil stay at this level forever. There needs to be a lot of hard work put in by the successful left candidates – especially those who took the latter seats – to save them at the next local elections. I say regular comment Wednesday on Politics.ie say that there was no chance of Joe’ Higgins’ European substitute holding that seat. I am inclined to agree, and I am sure the Socialist Party will be planning to use that seat primarily for domestic advantage. If the left continues in the fragmented state it is in now, then will we be able to do so well in two years or five years? I doubt it. We are looking at maybe three or four TDs to the left of PSF as things currently stand. If a left alliance of some sort can be put in place, then that could change, and these elections could mark a significant long-term change. We should note that there was no left candidate in the north’s European elections, despite some attempts to find a way forward to get one. That should be a worry. If the left is to stop being a mere spectator in the north, it needs to find a new approach. It seems to me that the time is right for a convention of the left to meet with the aim of securing electoral alliances to secure a serious left voice in Ireland north and south. It might be now or never.
ADDS: Bits I forgot to include.
While the results have been good, we also need to think about what the elections tell us about the strength of the parties of the left. The reality is that the left remains very geographically concentrated, even the bigger parties in the Dáil. If you look at the parties outside the Dáil, of the further left, then you see just how small and concentrated it remains. PBPA put up the most candidates – 14 – overwhelmingly in the Dublin area, but distributed a bit more widely, with candidates in Dundalk, Tralee and Roscommon. The WP put up 12 candidates, in Dublin, Cork, Waterford, and Dundalk. The SP put up 11, in Dublin, Cork and Drogheda. The west is basically out of electoral bounds, as are rural areas. We need to work on that as well.
In NI, the turnout was lower than the EU average of 49%. This represents a withdrawal from political engagement, and when you look at the Greens/Alliance vote, you see that the united community/broadly progressive vote has also suffered. This disengagement is also bad for the left.
UPDATE: Thanks to No.11 in the comments for further details confirming that The SP has taken 6 seats.
1. jc - June 8, 2009
While Labour did well compared to its recent history, it is well below its recent opinion poll highs and, more importantly, its1992 peak of 19.1%. This should be rather depressing for Labour, as a complete collapse of the FF vote should have been an opportunity to move to another level. It is true that Labour did well in Dublin, but will it be able to add second seats in Dublin constituencies or will it simply retain its existing single seats in a number of constituencies with a larger share of the first preference vote? What was also striking was the continued weakness of Labour outside the cities. Remember that Labour had seats in Sligo, Clare, Laois/Offaly, Kerry (North and South) and Louth in 1992. Does anyone seriously believe they will take seats in any of those (except Kerry on a good day) in the next election? Can any Labour member on here provide an insight into what the party’s reasonable seat target is for the next election and where the gains will come?
2. Mark P - June 8, 2009
On Joe’s campaign:
The Socialist Party will be thinking about the results over the next while and coming to a more considered conclusion but two things occur to me off the top of my head which provided a major boost during the campaign. Firstly, the MRBI opinion poll which put him level with Ryan with a week to go suddenly promoted him from also ran to dark horse in the media. Media coverage is extremely important to a candidate in a vast constituency who doesn’t have much money and before that poll, Joe wasn’t getting much despite having 7% support in an earlier poll.
Secondly, even before that poll (and probably contributing to the showing in that poll), the Socialist Party received a phenomenal number of phone calls and emails from people who aren’t our members, who we largely had never met before, who wanted to help out in the campaign. On top of our members and the supporters who have helped out in previous elections, I believe that there were more than a hundred completely new (to us) people out leafletting, canvassing, postering etc. A lot of the credit has to go to those people, who made it possible for a small organisation to run a campaign out of all proportion to our membership and financial resources.
3. alastair - June 8, 2009
Losing it to Joe Higgins will probably set alarm bells ringing. It demonstrates that there remains a huge reluctance to transfer to PSF among many in the southern electorate, and it is possible that part of Joe Higgins’ momentum was a desire to see neither Fianna Fáil nor the Provisionals in that seat.
I’d suspect there more antipathy to MLM than SF in that vote. No-one likes a cocky representative who doesn’t pull their weight in the job. deRossa might well be accused of coasting in Europe too, but he’s nowhere near as grating in defending his record.
But maybe I’m just projecting my own prejudices.
4. Garibaldy - June 8, 2009
Thanks for that Mark. I agree that that poll was vital. I hadn’t realised it was so soon before the election. Somewhat amazing when you think about it.
5. Tim Von Bondie - June 8, 2009
‘Maureen O’Sullivan taking the seat in Dublin Central was a great thing for the left. Given WBS’ extensive and superb discussions, I’ll say nothing more.’
You might tell us why the WP called for transfers to Ivana Bacik rather than O’Sullivan?
6. Brotherhood of Man - June 8, 2009
‘No-one likes a cocky representative who doesn’t pull their weight in the job.’
I suspect that if the going was good for SF nobody would give a shite how many meetings in Europe Mary Lou missed. Its when your in trouble people look at your record- when she and SF were spearheading the anti-Lisbon campaign nobody was talking about her going to the ploughing championships or whatever.
Given that she seems to be a political animal she’ll be back looking for a Dail seat I presume, though not in Dublin Central.
As for the rest- Killian Forde retained his seat easily while Seamus McGrattan (who? exactly) scraped in ahead of de brudder Ahern in Cabra. They got a couple in Tallaght, where the SP lost a seat.
I believe SF poll topped a couple of seats in Cork city, got one in Limerick city, did well in Waterford but lost in Wexford and Meath.
Noting JC’s comments, given the scale of the mess we’re in, and all the hype, Labour did not do as well as hoped, while FG clearly are cok of the walk- and who runs FG these days, in terms of driving theirt policy…come on Leo, Lucinida and now George of the cut, slash and burn school. Happy days ahead?
Drithleog - June 8, 2009
Sinn Féin LOST a seat in Waterford and went to a position where they were seen as potentially challenging for a Dail seat to just 117 votes ahead of the Workers Party across the whole city.
SF did disastrously in Dublin too.
This was discussed on a previous thread IIRC. I saw Malachy call for a vote for left candidates on the Browne show, rather than anyone in particular. This has been party policy, especially where there is no WP candidate. That statement on the website refers to the need for those in leadership positions in the Labour movement to become involved in discussions to form a serious left alternative to the right consensus shared by FG and FF, and so it is in that context I’d have thought.
Well – some of us were on the opposite side of the fence in regard to Lisbon, so the going was never good on account of that campaign afaic.
All I can tell you is that I (once again) gave Christy Burke a preference, but wouldn’t consider it for MLM. The difference? Burke can be relied on to do something other than promote himself.
9. sonofstan - June 8, 2009
Remember that Labour had seats in Sligo, Clare, Laois/Offaly, Kerry (North and South) and Louth in 1992.
An absolutely crucial point – and remember, Labour (or the Spring family) had a seat in Kerry North for ever: there was always, until the ’90s a labour seat in Louth, and one and sometimes two in Tipp. North and/or South. These weren’t Spring tide gains: they were seats rooted in the larger industrial towns, and nurtured through the trades unions over decades.
The withdrawal of that tide didn’t just lose the bien- pensant middle-classes who voted for Eithne Fitzgerald in Dublin South – it lost seats that had sustained Labour through lean years. Labour needs to work hard to get these seats back: urban Ireland isn’t just Dublin and the other cities: it’s towns like Dundalk, Drogheda, Sligo, Clonmel, Tuam and Tralee as well.
Eamonn Cork - June 8, 2009
Great point. Labour could start by seeing if they could get Bree back in the party in Sligo and the Healy people back in Clonmel. Otherwise those two constituencies are probably lost for good. Arthur Spring’s poll-topping performance, beating Toireasa Ferris, was very encouraging for the party in Kerry North. From that point of view Labour’s performance in Kildare, for example, is poor in terms of making a general election breakthrough.
Regarding Mary Lou McDonald, it’s been mentioned before that her total when elected to Europe was less than the total Sinn Fein local vote of the time. She’s not a particularly charismatic figure and I imagine all those articles written about her as the new face of SF, not like the old working class one, would piss me off if I was an activist on the ground. I wonder if SF staking so much on her as the face of the party in the Republic was a disaster. Compare how well Ferris did in a much less promising situation in Munster. Jonathon O’Brien in Cork city is another impressive young candidate.
10. Dr. X - June 8, 2009
Is Labour even capable of doing the work required in that area? Bertie labelled Ruairi Quinn (I think it was RQ) as ‘Mr. Angry of Sandymount’, because he knew that if he slinged that particular kind of mud, it would stick very effectively.
All I’ve seen over the past few years is a Labour party that is only interested in appealing to those ‘bien-pensant middle classes’. That’s the only reason I could see for the way Pat Rabitte picked a fight with Declan Bree, for example. . .
11. Pete - June 8, 2009
Labour not doing well in rural areas – who cares, its a Labour Party, I’m not aware of many landless Labourers contuning to ply their trade in bungalow Ireland. On another note where stands Gerry Adams dream of left unity? Let the Provos soak up the left vote in rural Ireland and the north, let Labour (“stickies”) rule the cities – finally put the ghosts of 69 to 94 away.
sonofstan - June 8, 2009
I didn’t say ‘rural’ areas – i specified larger, somewhat industrialised towns. And there are still landless labourers plying their trade alright, all over the place. There’s plenty of casual, unskilled labouring work going on, possibly right under your nose: way below the purview of the taxman or the unions.
12. Joe - June 8, 2009
Gari: “I said to regular commenter Joe in the comments on a thread some weeks ago that I thought Joe Higgins had no chance of becoming an MEP. Shows you what I know.”
Joe knows, Gari.
IIRC, you also dissed my suggestion several months back that FF might lose its MEP in Dublin. Joe knows.
I also know this. Bree and Healy should stay a country mile clear of the Labour Party. It’s not of the left but of the centre – see Eamonn Cork’s well made point about why he preferred SF’s Ferris to Labour’s Kelly. And I know that the left candidates who won local election seats did work on the ground in their communities, turned up at boring community meetings and put their views across and helped communities sort out problems. And if the left is to build on the modest gains it made in these local elections, that is what it has to do more and more.
13. Garibaldy - June 8, 2009
Joe, Guilty. And my Higgins prediction was related to my FF prediction. A twin-headed mistake.
You’re right on what is required at local level. My point being that even that mightn’t be enough unless we can forge some kind of left cooperation.
14. jc - June 8, 2009
Having spent my formative years in Clonmel, with family and friends still there, I can tell you that you have little understanding of “rural” Ireland. Clonmel has long had a significant industrial working class, working for multinationals like Merck and indigenous companies like Showerings (they make Bulmers cider) and Clonmel Healthcare. This is why Seamus Healy has had a significant political base there since the 1980s for a political group to the left of Labour. By the way, the Labour Party was actually founded in Clonmel. Only a small (and ever-declining) proportion of the population of rural Ireland works in agriculture. As most of the non-farm working population are not managerial or self-employed, it should be obvious that most of them are non-managerial employees and therefore a suitable target audience for any serious left party. Labour may need a change of tone to make itself viable in places like Clonmel — a little less Chardonay and a little more GAA.
15. sonofstan - June 8, 2009
BTW, and this ties in weirdly with the mention of Sligo Rovers earlier on another thread, one of the best portraits of working class life outside the cities in Ireland is contained, inter alia, in Eamonn Sweeney’s great book about supporting that club, ‘Only One Red Army’
16. Thoughts on the Elections « Garibaldy Blog - June 8, 2009
[…] Thoughts on the Elections By Garibaldy Anyone who is interested can read some thoughts I’ve put up on the recent elections in Ireland, north and south, over at Cedar Lounge Revolution here. […]
17. Brotherhood of Man - June 8, 2009
Ignorant shite from Pete. Where was that great ‘Sticky’ TD Joe Sherlock from again-Mallow.
A substantial share of working people live in the country- some of them even, gasp, work in Dublin!
The Sticks have not radiclaised labour in any way; Gilmore and co can not think beyond getting into bed with FG, and pissing away whatever gains they have made, and they haven’t actually even done that well.
18. alastair - June 8, 2009
A substantial share of Labour’s vote comes from the, gasp!… middle class. Last I heard, there’s working and middle class voters all over the bog, as well as the big smoke.
Ignore at your electoral peril.
19. No.11 - June 8, 2009
“In the local elections, they [the SP] have taken four seats, with three candidates topping the poll.”
Hi Garibaldy,
Good piece, but the SP also picked up a council seat on both Drogheda and Balbriggan town councils. Six councillors in total.
I’d be grateful if someone could let us know how the WUAG got on as well, they were tipped for big gains beforehand.
20. Mark P - June 8, 2009
The WUAG won five seats on Clonmel Town Council and one on Carrick on Suir Town Council. It also won 2 seats on South Tipperary County Council (which I believe are also held by two of the Clonmel Town councillors).
I believe that this represents only one new seat, the one in Carrick. That’s quite significant though as previously all of their representation was based in Clonmel and as far as I know this is the first time they’ve managed to break out of their stronghold.
21. Eamonn Cork - June 8, 2009
By the way, the last seat in South comes down to Alan Kelly and Kathy Sinnott. It will be decided by Ferris’s transfers. I suppose you could use it as a test case as to the nature of the SF vote as it pits a (kind of) left wing candidate against a (fairly) rght wing candidate.
I kind of agree with the man who says Healy and Bree should steer clear of the Labour Party. But I’d like to see them in it, just as I’d like to see Joe Higgins in it, because then it would be a very different kind of party. A pipedream but pipedreams are what keeps a man going.
As for the suggestion that everywhere outside the cities constitutes some kind of zone of reaction, to qoute Steely Dan, not incidentally a nickname for Dick Spring’s father, “the things that pass for knowledge I can’t understand.” I thought that notion went out with the Irish Industrial Revolution.
The Joe Sherlock reference was apposite. Bree in particular sees himself as part of a tradition stretching back to Jimmy Gralton. Some of the descendants of the landless labourers are working in pretty unrewarding poorly paid jobs. I know this because that’s who I drink, bet and generally hang out with. The property boom was built on the backs of labourers, not all of them East European by any means, whose average wage was around 600 Euros a week. I’d submit that for the work involved that’s a pretty poor return. I wouldn’t be able to put in too many days of it. They’re also the first people to have suffered from the downturn. There are also a lot of skilled tradesmen short of work at the moment who will be eating their Breakfast Rolls in other jurisdictions before long. The “harsh decisions,” are harsher on them, and that frighteningly large number of people below the poverty line, than the pundits who advocate them.
And, of course, as Alastair points out only a fool would turn down middle class votes. But there are areas which are more fruitful for Labour parties than that of the much invoked small businessman whose only feeling about trade unions, for example, is that he won’t have them in his shop because they’d drive up wages.
I agree with sonofstan that Eamonn Sweeney’s book is quite good. But then that’s probably because I am Eamonn Sweeney.
Thought I’d smoke you out…..
23. Cathal - June 8, 2009
In Louth Lab cllrs in Drogheda topped the poll in two LE areas. The rise of SF in Louth stopped chances of regaining a seat there, and Bell the former Labour TD wasn’t what you would call left wing.
I think we are missing the wood from the trees, in urban areas FF vote collapsed and that has ensured strong left gains. They have lost the benefit of incumbency and tribal voting has disappeared in our cities.
Look at the numbers in any rural area and FF support held up well. Its tribal support more than anything else, people vote for who they know and have always known.
There will always be exceptions to this with someone scraping past the FF/FG dominance in rural areas but to change this requires an almighty effort on the ground to attract the support.
FF and FG always have the twin advantages in rural areas of incumbency and tribal support which isn’t present for left wing candidates.
Its taken SF 15 years to build support up in many areas and they have been helped significantly by nationalist voters.
The challenge for Labour now is to build on gains in Louth, Meath, Donegal, Sligo, Galway, Kerry, Carlow, kilkenny,Cork and Tipp. No one said it would be easy. There are seats there to be won and over time it will happen once the organisation is continued to be built on.
Simply put Labour’s vote has grown in the Dublin area, in a European sense the only area along with Cork and greater Belfast that in this country constitutes a truly urban, industrialized region. I don’t see the small working classes of the small towns in Ireland giving Labour the amount of votes to see TDs elected that will have to pander to ‘rural concerns’ and act as drag upon the party’s attempts to bring a social democratic government to Ireland – re abortion etc Joe Sherlock was a drag on the WP and his tendency to parish plump poltics damged the party’s growth IMHO. I’m not saying that rural Ireland is per se reactionary, although Fianna Fail’s votes in Cavan and Longford would point to a certain support for corruption and narrow mindedness in at least parts of the our less developed areas. What I mean is it takes different approaches to crack a nut, and it would seem the Sinn Fein radical approach is paying more dividends in rural Ireland than Labour’s. So let Labour develop along its course in urban Ireland and the commuter belt Ireland, which saw Childers elected, and let the Shinnners develop their formula in rural areas and the North. If both parties are turely Social democratic and place these values above sham careerism and dead nationalism, they should work together to challenge the conservative hegemony – ITS A VERY BIG IF – but in my opinion it is the fastest track to social democratic government in this country, Socialism can follow later.
On whether the former sticks have made Labour more radical, who gives a shit, as they have certainly helped create more votes for the Left – taking SF, Labour and the Hard Left Indos all together support is now standing for the Left of center at around 30% quite a leap form the Lab, WP, DSP etc under 15% of the 1980s.
Line above should read
TDs elected that will NOT have to pander to ‘rural concerns’ and act as drag upon the party’s attempts
26. Omar Little - June 8, 2009
‘agree with sonofstan that Eamonn Sweeney’s book is quite good. But then that’s probably because I am Eamonn Sweeney.’
If you really are ES then your article on Rabbitte and Labour in the SINDO magazine two years ago was one of the better things written on the subject. Any links to it exist on the net?
The short answer is that I don’t know.
And believe me, no-one would claim to be Eamonn Sweeney if they weren’t.
This, by the way, is a great site. I’m an old school print snob and web sceptic but there isn’t anywhere in print you’ll find anything like the Cedar Lounge Revolution, it’s the only internet forum I’ve written a word on. Being here as the results came in was more fun than being in a pub with particularly intelligent company.
Cathal,
You are assuming that this does mark a permanent sea-change. I think that that is far from certain. Though I agree with hard work and new tactics we might be able to make it so to some extent.
As for the DL crowd. They’ve probably pushed Labour to the right, not the left.
28. Paddy Matthews - June 8, 2009
Fianna Fail’s votes in Cavan and Longford would point to a certain support for corruption and narrow mindedness in at least parts of the our less developed areas.
Corruption and narrow-mindedness is neither equivalent to or exclusive to Fianna Fáil, either down here in “our less developed areas” or in the haven of civilisation that you are presumably fortunate enough to inhabit.
A Fine Gael-controlled county council in Longford (with county councillors doubling up as property developers) presided over the smothering of half the county with poorly-built, half-finished, three-quarters-empty housing estates.
29. Eamonn Dublin - June 8, 2009
Talk of Mary Lou being given the shinners senate seat to maintain her profile. May happen after by election of Gallaghers seat.
The problem with that is that even if Doherty wins the by-election in Donegal SW, the senate vacancy would be filled by the Dáil, ensuring a seat for FF (or perhaps a consolation prize for the Greens).
31. Niall - June 8, 2009
Since we’re playing the “if you’re really Eamonn Sweeney game”, if you’re really Eamonn Sweeney, tell me what does a Paddy Nangle do?
He was my English teacher, and also the man who attempted to make a footballer out of me.
I’d have to say that set down in print, “I am Eamonn Sweeney,” looks considerably less stirring than, “I am Spartacus.”
32. WorldbyStorm - June 8, 2009
Hmmm… this thread is interesting… for lots of reasons 😉
What’s that about a senate vacancy being filled by the Dáil, is that definite?
Oh yeah, and a further question. How does this play out in terms of left seats at the next election… Healy? Boyd-Barret? etc…
Every Green seat is clearly up for grabs, and in quite a few there’s a well placed left candidate in the wings: Alex White in Dublin South (Eamonn Ryan), Clare Daly in Dublin North (Trevor Sargent), RBB in Dun Laoghaire (Chemical Cuffe) – Gormley has to be vulnerable as well, though it could be taken by anyone from SF to FG. Is there a PbP hopeful in place in Mid-West to target Gogarty?
WorldbyStorm - June 8, 2009
`Interesting, although that would suggest a cannibalisation of a broadly speaking left leaning vote…
gabbagabbahey - June 8, 2009
since Ciaran Cuffe’s seat is gone anyway (constituency resize from 5 to 4) a Boyd Barrett win would be at the expense of FF or Labour. according to RTE the FG voteshare in the Dun Laoghaire-Rathdown locals went up 10%, with Labour only up 2%. I presume that’s the PBPA eating into the Labour vote.
so my constituency would be Gilmore v. Boyd Barrett v. Hanafin/Andrews for the non-FG seats, which wouldn’t be that many (and Labour would be against three sitting FG TDs in Dublin South). some fun!
Tim Buktu - June 8, 2009
Dublin MW. Councillor Gino Kenny is in the middle of the constituency.
But the Green vote has mainly been a Lucan vote, and has its grounding in the long-standing, organised and independent) strong opposition to bad planning (as in bad on planning grounds, not simply because of the brown envelopes; The activists wiped the county manager’s eye a year or so ago on the stated impact of the Clonburris SDZ). FF has no councillor in the Lucan half of the constituency in both the outgoing and incoming elections.
Dublin MW will be interesting: Harney is not running the next time (her brother Richard told the Labour party that when it came time after the general election to take down posters — the two parties took down each other’s in different areas)
And Gogarty’s “eccentricities” will have lost him votes apart from any change in sentiment about his Party.
Should have said: Cllr Gino Kenny is PbPA
34. Starkadder - June 8, 2009
Slightly off-topic, but Mr. Ganley appears to have conceded
defeat:
http://news.eircom.net/breakingnews/15842705/
Not at all off-topic on a thread about good news for the left Starkadder!
If left voters abandon the greens, WBS, I think that would be a good thing, although obviously the left also has to take on board more environmentalism. Though as a class issue, which it is.
If the broad left moves forward you’ll find no argument from me 🙂
http://www.citizensinformation.ie/categories/government-in-ireland/elections-and-referenda/national-elections/seanad_panel_by_elections
There are still some left-leaning people in the Greens, but as the real Eamonn Sweeney suggested, they’ve been taken over by the kind of people who think ‘politics needs people like us’ – Ciaran Cuffe, in particular, is a PD in environmental clothing.
40. Tim Buktu - June 8, 2009
I think there are two issues here, one of which I will call “bean counting”. On that front, Labour has a lot of work to do to mend bridges. (For example, what ever the rights and wrongs of what Declan Bree is supposed to have done about Traveller accommodation, it was outrageous that the party leader should use the letters page of the Irish Times to make his case. And the overlooking of Denis Landy for Michael Ferris’s widow was another blunder. They risk another one emerging in Dublin Mid West where the Tuffy clan has antagonised foot soldiers in the south of the constituency.) The party needs to get its own people and new people into the tent.
Overall, I think using a bean counting approach there isn’t anything of substance to the left’s gains in the elections. What really happened is that Fianna Fáil (and the Greens) lost, and the votes and seats went to a variety of alternatives on offer, some of which are part the left.
And that leads to the second issue. If (a form of) the left is to grow to become dominant, it needs people voting for it for the sake of what it stands for rather than because it is “not the other shower”. Labour seems to me to lack that, and the other parties of the left that do have it do not seem to be able to secure engagement with it. Even Joe Higgins’s win I would see as being a recognition of and support for a man of integrity (who stood with GAMA workers, went to jail for his stance on the bin tax, etc.) than support for nationalisation of industry.
Thanks Paddy, that’s certainly clearcut and likely to make them stay their hand on shifting indviduals around…
sonofstan… there are more than some, but they’ve allowed their voice to be too muted. Not sure about CC, I think he’s a bit more left of centre than that. But I could be wrong.
42. anthony bosco oneill - June 8, 2009
Just read through this thread, took me awhile, but am enjoying it immensly.Have to say made a few bad predictions re: Christy Burke in DC but was delighted to see Maureen get it still think she is to much of a lady for leinster house though.
She polled almost 7500 first preferences almost 80% more than Tony ever managed so whether these stay with her indefinitely will be a subject for future debate.
SF in dublin lost 5 seats and gained 1 with Mary Lou also gone. Outside Dublin SF done rather well which has gone unnoticed by most media pundits with the exception of Bowman. They picked up seats in Cork LImerick Roscommon and a number of other areas where they had no representatives previously. In the Europeans which is a national poll they were only 3% behind labour although with no seat gain.
I am still undecided whether the emergence of so many other left wing groupings is a good or bad thing. Not taking away from the efforts and the dedication of the various candidates, at the end of the day the left seems to be fragmenting while the right is still represented by the 2 main parties.
Labour although having a good election are still a long way off the spring tide and it is an indication of how far they slipped that they think 14% is good. There needs to be an agreed left alternative unfortunately all i can see is gilmore in his pyjamas waiting to jump into bed with enda.
Joe taking the seat in Dublin was a nice sweetener and he has made it very clear that he is waiting for the next dail elections, perphaps he should be proposed as an agreed left candidate for lord mayor. Wouldnt that throw the shit in the fan.
43. gabbagabbahey - June 8, 2009
Mary Lou floating a left alliance on Q & A – incl. Greens.
interesting comment about CC as “PD in environmental clothing” and for the party in general. unless you’re doubting their sincerity on the environment itself, which I assume you aren’t, then there’s a couple of interesting similarities and differences to my mind: they were both socially liberal, gay rights, privacy, etc; and in fundamental economic terms environmentalism doesn’t sit will with neo-liberalism insofar as it calls for a reduction and sustainability of economic growth – which is in turn fundamental to having an equitable society.
I’d welcome a broad left focus on the environment – and it’s probably fair to say that Labour has moved away from mere lip service, e.g. Tommy Broughan is/was quite good on Transport – but I fear it’s a while before they can supplant an active Green movement on the issue.
(btw I’ve been lurking on this site for several months now – really enjoy the coverage!)
44. CL - June 8, 2009
‘Waiting for the Healer’-by Eamonn Sweeney,- a great read. Hope there’s more to come.
Thanks for the kind words. I’m writing a history of Ireland between 1973 and 1985 at the moment for Gill and Macmillan, also a novel set in Dublin in the eighties.
On the day of the election I was, funnily enough, reading up about the PAYE protests of 1979, perhaps an object lesson of how a great wave of radicalism can be dissipated into not very much.
One of the joys about reading up on the period is the unlikely sightings, young Eamon Gilmore becoming President of the USI, beating Carol Coulter (replacing one Patrick Rabbitte), young Brendan Howlin in the anti-nuclear movement in Wexford, Frank Connolly at Carnsore as well, Kevin Myers arguing in Magill that we should never forget that colonialism and the nature of the Northern state is the cause of IRA violence (seriously), Eamonn Dunphy as Magill health columnist.
And, seeing as he’s been mentioned here, Ted Tynan playing a big role in the rent strike on the North Side of Cork city in the mid seventies (along with, among others, Kathleen Lynch’s father in law) where people held out for years, went to jail, took over the council chamber, because they refused to live in houses everyone admitted were sub standard. It’s incidents like that, too little known I suspect, I’d hope to shed some light on in the book.
And, I’ve asked WBS this already, if anyone has any suggestions on books, magazines, other sources from the period which they feel might be helpful, I’d be a very grateful man. Or if anyone thinks there might be some story which, though overlooked, might be telling about those years. Thanks, and thanks again for the comradeship over the election nights.
45. Betty - June 9, 2009
Even including Joe Higgins winning the seat ahead of Ryan, even including Maureen O’Sullivan’s success – I can’t think when I’ve read a sweeter headline!
http://www.rte.ie/news/2009/0608/euroelection.html
“Ganley quits politics after conceding NW seat”
There’s a map, rather amateurishly added to, showing the areas in Dublin where FF have zero seats here: http://www.gaire.com/db1-images/04951023_fianna_fail_zero_seats_5.jpg
47. Leveller on the Liffey - June 9, 2009
From Sinn Féin Cllr Seán Crowe in Tallaght on Sunday:-
[Sinn Féin South Dublin County Councillors] call for Left alliance against cuts. Tallaght Cllr Seán Crowe called for unity against cuts and for better delivery of public services. Cllr Crowe said that the local and European election results give left-wing parties the chance to offer people what he called a Left Alternative to Fianna Fáil and, he emphasised, an alternative also to Fine Gael.
The Workers’ Party’s Davy Walsh kept his seat in Waterford, against the predictions of many. Ted Tynan also took a seat in Cork, which is significant because it means that The Workers’ Party once again has represetantion outside Waterford.
Ted Tynan got rave reviews on RTÉ Radio 1’s Late Debate on Monday night from Fergal Keane (a Corkman) and another reporter from down that way for his hard work over the years.
Ted Tynan was also, if I remember rightly, involved in the marches out to the Old Head of Kinsale where people from Cork who’d walked and picknicked over there for years protested against the fact that they’d been excluded because the amenity had become part of one of the most expensive golf courses in Europe. The manner in which they were derided by local press and politicians was a case study in modern snobbery which would have been derided as unsubtle if included in a Ken Loach movie.
Garibaldy - June 9, 2009
You do indeed remember rightly Eamonn. My inbox is still full of the emails about the campaign. It certainly was class war.
Thanks for that Leveller. I might try and get it on Radio 1. There was a thread on P.ie congratulating him started by a member of the SP. So he must be doing something right to get praise from such disparate viewpoints.
50. Wahlsplitter « Entdinglichung - June 9, 2009
[…] Zumindest in Irland ist, wie Cedar Lounge Revolution berichtet, die Welt noch einigermassen in Ordnung, Joe Higgins von der Socialist Party […]
51. Seán Ó Tuama - June 9, 2009
Since Joe is drawing attention to his own predictive abilities, may I humbly point out that I predicted a few weeks ago, on the basis of the Suday Indo poll, that MOS was likely to take the Dublin Central seat rather than FG?
I note from Pete’s comments that the old Eoghan Harris-WP urban chauvinism is still unfortunately alive in parts of the left. Will these people ever learn?
I write as a person Dublin born and bred who was active in left and union activities in Dublin and am convinced many like me despise this urban chauvinism.
Isn’t it strange how that if Ganley had won we would now be reading tons of articles about how this boded a huge seachange in Irish politics and announced the arrival of a serious new force, but that Joe Higgins’ victory is kind of getting the, “ho-hum, of course it’s all a protest vote nobody really takes his politics seriously.”
Good point, Eamonn, very good point.
One more thing before I go off and do a bit of work. Mark Hennessy in the Irish Times suggest that one way back for the Greens will come through Gormley’s imposition of water charges. You see, it will be Gormley’s idea but people will blame the local councils because their name will be on the bills.
1. If Mark Hennessy is clever enough to figure out that Gormley is behind the legislation, maybe, just maybe the voters will be too.
2. I’d like to see a government with 25% support trying to railroad through nationwide water charges.
Also, I notice that my reading of the election counts was almost always wrong. The confident predictions in favour of Burke in South and Ryan in Dublin stand out. My dreams of becoming the new Richard Sinnott lie in tatters. Maybe I’ll buy a Cara computer next time.
I also said that Labour had done badly in Kildare, this stems from a lifelong tendency to get Kildare and Meath mixed up.
Sometimes I wonder if we can be too harsh on the left for not making big breakthroughs in Ireland. The Ryan Commission report lays bare, as I don’t think had been done previously, that class was probably a greater motivator behind the operation of these gulags than sexual repression. In a society where a large amount of the poorest children were incarcerated and many of the others were emigrating, the left was never going to have an easy time. In the McGreil report, Prejudice and Tolerance in Ireland, published in 1977 only 23% of people said they would welcome a Communist as a member of the family, 29% would have welcomed criminals and the same figure would have welcomed “itinerants.” The Reds also trailed Pakistanis (24%) but did slightly better than Africans (22%). This is where we’re coming from.
Seán Ó Tuama: “Since Joe is drawing attention to his own predictive abilities,”
Sad saddo that I am, I have to also claim credit for first spotting Eamonn Red Army Sweeney on another thread. SINDO columnist on CLR – be careful, man! I wonder could we get Declan Lynch on too? I’d like that.
Keeping up the plámás, yes There’s Only One Red Army is a great read. And iirc the correct line was also taken on the Cork hurling “dispute”. I’d be afraid to ask for a retrospective view on Keane/McCarthy in case feet of clay might be revealed. But keep on writin and rockin.
PS: I am not Joe Higgins.
56. Stephen Spillane - Green Down But Not Out - June 9, 2009
[…] The Elections and the Left: Some Thoughts (cedarlounge.wordpress.com) // Share this Post[?] […]
57. Gypsy - June 9, 2009
Speaking of predictions – did anybody forsee Christy Burke leaving SF. Just been announced on IT breaking news.
Gypsy - June 9, 2009
Oops, just seen that Garibaldy has started a new thread on it.
Jesus, Burke leaving after all those years is an odd one.
Does anyone know if there are any actual political differences between him and SF, or is this all about personal and organisational disagreements?
59. Jim Monaghan - June 9, 2009
I wonder will Christy B. orient to Eirigi.
SF are paying the price for respectability. I think their willingness to go into coalition was a factor in the steady drift of people waay from them. was not Gilmore lucky that Bertie selected the Greens for the treatment.
Again it is up the the LP to show that reformism works but they will alas be happy with mercs and perks.
The FFers have a point what is the opposition plan. Besidwes just replacing the useless present government.
We need a program for government. There is a left plan for the crisis and a rightwing one.
Again who will pay for the crisis. And lest it be forgotten who will be punished.
Oh and I would like to see the orders pay for the child abuse. Like we suspect of the bankers they have moved their assets into trusts.
Nationalise the education system and the hospitals for a start.
What about it a mimimum plan for government.
I suspect that Lemass was right the LP will wrestle with its conscience and the LP will win.
60. Fergal - June 9, 2009
Eamonn Cork,
Writing a history of the country from ’73 to ’85 you lucky so and so!
As you’ve asked for ideas here’s my penny’s worth-try to get your hands on the minutes books from as many unions as possible,you could try out the various trades councils to get them.I reckon they’d be a goldmine and would fit into the whole idea of history from below.History from below as opposed to the usual “important” people/events.Howard Zinn has written a great history book in this genre called “A people’s History of the United States”.Brecht puts brilliantly in his poem “Questions from a worker who Reads”Anyway,keep it up!
Eamonn Cork - June 10, 2009
I must check out the Zinn. By the way, an absolutely brilliant book, which is described as “a people’s history of the third world,” is The Darker Nations by Vijay Prashad, a genius young Indian academic working in the States. It’s a fantastic overview of independence struggles and the post-colonial world.
Fergal - June 10, 2009
Cheers Eamon, I’ll check out Prashad’s book
61. Ferenka Fred - June 10, 2009
Eamonn,
I won’t presume to tell you how to do your job or write your book; that excellent piece you wrote on Michael O’Leary in the SINDO was one of the few articles on our beloved business leader that actually talked about class and class background and how it affects people’s world view.
I’m very interested your writing on the 70s; might I humbly suggest you have a look at the files of the SF-WP paper The Irish People for the kinds of stories they were breaking in the late 70s (lots on PAYE of course) or perhaps talk to Padraig Yeates the former editor of the IP.
There would be interesting stuff there. Look forward to reading the book.
Fred. Thanks for that suggestion. It’s an awful pity that there isn’t a full-scale history of the WP like Michael Gallagher or Niamh Puirseil’s book on the Labour Party. Whatever anyone’s political affiliation, it is a fascinating story. By the way, if anyone had any old magazines from the period, I’d love to get hold of them and would return them in pristine condition.
Have you a connection with Ferenka? One of the things that fascinated me is that although the factory closure has now become a right wing myth about the perils of union intransigence, at the time even Des O’Malley apportioned equal blame to the company and the inherent crappiness of the working conditions were widely stressed, something I don’t think would happen now. It’s striking that most industrial correspondents of the time seemed sympathetic to the unions whereas now even the ostensibly liberal ones seem to focus on the man standing at the bus station saying, “I know they’re protesting to save their jobs but I’m going to be late home from work.”
By the way, whatever happened to Philip Byrnes?
I might also add that in my opinion Zinn’s book is too polemical and lacks a bit of nuance and complexity. The annoying stuff that makes us human.
I’ve no connection with Ferenka except it loomed large in my childhood and in my teens was always held up as an example how the ‘greedy’ unions had destroyed Limerick (article on it in the early Magill which I’m sure youv’e seen). On the WP, theres a book out soon I believe.
There was supposedly graffiti in the toliets at Ferenka ‘Herrema kidnapped up years ago’! That episode also sticks in my mind.
It should be ‘us’ years ago- kind fucked up that joke didn’t I?
66. sonofstan - July 6, 2009
Late entry here, but i implore you to listen to this – Cork rapper Gerry MacCarthy’s tribute to the new Labour MEP in Munster: a new benchmark for irish political songs….
67. Bartholomew - July 7, 2009
Terrific!
If only the visuals had as much oomph as the music – ‘twould be a masterpiece, boy!
68. WorldbyStorm - July 7, 2009
It’s certainly a benchmark… just at what point? 😉
“25 year old man goes back to UCC/
To do a two year masters degree”
that’s my favourite line, only rivalled by ‘Fianna Faíl without the fadá is Fianna Fail‘
Thanks are due to my daughter for bringing it to my attention – apparently it gets played more than once at every social gathering of her friends, and they know all the words…….kids are weird….. | cc/2020-05/en_middle_0078.json.gz/line997 |
__label__cc | 0.6339 | 0.3661 | Footnote on Curious Fictions: Conversations on Creativity
In a new series called Footnote, we pair authors and other creators for heart-to-heart conversations about the creative process. Our first conversation is between Fonda Lee, World Fantasy Award-winner and author of six novels, and Michelle Rial, designer, artist, and author of an upcoming book of beautiful illustrated charts. To get notified about future installments of Footnote, follow us here.
Jade War, Fonda Lee's second installment in the World Fantasy Award-winning Green Bone Saga, will be available July 23 from Orbit.
Powell’s Indiebound Barnes & Noble Amazon
Am I Overthinking This? is a book of witty and insightful charts by Michelle Rial, and will be available August 13 from Chronicle Books.
Buy Olympia (includes free print) Powell’s Indiebound Barnes & Noble Amazon
It’s great to meet you! Your charts are delightful and make me grin every time I see them. The “Honest Artist Statements” wheel…I relate SO HARD.
© Michelle Rial
I used to make a whole lot of charts (far more boring ones) in my previous corporate job, so I love seeing information organized in a visual way. Now I work with words all day, go figure. But I think it’s that blend of analytical process and artistic expression that makes me love novel writing and is also what’s so intensely satisfying about a good infographic.
Your bio says you were born in Santa Cruz. Are you still in the Bay Area? I used to live there but am now in Portland, Oregon, where the copious plant life is currently trying to kill us all with allergens.
It looks like we both have books coming out this summer. How are you feeling about ‘Am I Overthinking This?’ almost being out in the world? (I feel like my answer to ‘Am I Overthinking This?’ is always ‘Yes’ and that goes double for anything related to the publication process.)
Hi Fonda!
So great to hear from you! I'm so happy you like my charts! It's always enlightening to see who relates to the "honest artist statements" wheel because it's so rooted in imposter syndrome (I think??) and usually people who relate are very accomplished! Like, I'm pretty sure you wrote SIX BOOKS (with multiple awards but nbd).
“It's always enlightening to see who relates to the "honest artist statements" wheel because it's so rooted in imposter syndrome.”
What was the corporate job? Or maybe more importantly, did you learn anything from it that helps you creatively? I used to work in advertising and had a lot of random jobs throughout life that taught me little things I still use, so I like to look back and think about how each experience has shaped my process. It reminds me a little bit of what Maria Popova wrote about combinatorial creativity.
I was born in Santa Cruz! My parents had to leave Santa Cruz soon after I was born because of a visa issue that another company/university offered to fix ASAP. I feel strangely tied to the Santa Cruz fact because my dad was born in another Santa Cruz (Canary Islands) and much of my family has the last name Cruz. I also never felt a connection to where I grew up (North Carolina) but that's for another time! The way my parents talked about the Bay Area always made me want to come back. So I feel lucky to now be living in San Francisco. How do you feel about Portland vs. the bay?
Yes! We both have books coming out this summer! It's my first book and I was happy with it when I saw the proofs many months ago, so I'm hoping nothing goes wrong...*screams*. How are you feeling about yours? I'm so impressed that it's your sixth book, I feel like I've been dying to write ONE book for so long and it feels good but usually, as soon as I accomplish anything it starts to feel like it was an easy thing to accomplish and it sort of evaporates into nothingness.
Ha, yeah, I know what you mean about how once you accomplish something, it seems to mysteriously evaporate. Case in point: book launches are a wonderful career milestone but also strangely anti-climactic. It’s like, “Here, everyone, I wrote a 600-page novel and it’s on sale today! You can buy it and read it!”
*stares at screen*
*sips tea noisily*
*wonders if anyone has read the book yet*
“Book launches are a wonderful career milestone but also strangely anti-climactic.”
Speaking of which, are you a coffee person or a tea person? I’m most definitely a tea person. My writing is fueled by copious amounts of tea.
Do you have any rituals or crutches when you sit down to work?
I love San Francisco and miss quite a few things about the Bay Area including world-class dim sum, fog, crazy hills (not so much when driving), and the Stanford campus. I’ll be visiting San Francisco this September, doing some bookstore events and reading at this cool event called Writers With Drinks. Portland has been home for the past 13 years though, and I think the move here turned me into a writer. Seriously. There is something in the water here. You can’t throw a rock without hitting a writer. Maybe it’s all the rain that makes us stay indoors and make up stories. Especially speculative fiction. There’s a really fantastic community of science fiction and fantasy authors here in the Pacific Northwest. I imagine San Francisco must have a pretty robust artistic community?
“All of us who create art of some type are in the business of seeing connections and mashing stuff up together.”
My previous business jobs were in management consulting and corporate strategy. Sometimes I wish I’d found my calling as a writer earlier, particularly when I meet twenty-two-year-old debut novelists, but then again, I think you’re right: everything we experience shapes us as creatives in some way. My debut novel, Zeroboxer, was about sports marketing in a lot of ways. Also, space fighting. But I wouldn't have written it without the experience of having worked in that industry (sports, that is, not space fighting).
Read An Interview With Zeroboxer Carr Luka by Fonda Lee on Curious Fictions
The Maria Popova piece reminds me a lot of Austin Kleon’s book Steal Like An Artist (and his TED talk), which I think articulates what a lot of creatives know intuitively—that all of us who create art of some type are in the business of seeing connections and mashing stuff up together. What’s the oddest or quirkiest experience you’ve had that made it into chart form?
Agh I'm very much dreading the book release moment! I think I experienced a bit of it when I announced that it was available for preorder. I heard from my editor that the book pre-order links were ready the night before my birthday. I woke up early the next morning and posted all the things on social media, and then shortly after, I was in the ER with my dad, who had pneumonia from late-stage lung cancer. The enthusiastic support for my book was distracting me from thinking too much about things that could happen in the ER, and being in the ER was distracting me from worrying too much about who was or wasn't tweeting/commenting/sharing/preordering my book. For a brief moment, it was #1 in internet humor and social media on Amazon, so my dad got to tell everyone within earshot at the hospital that his daughter was a "bestselling author."
“My dad got to tell everyone within earshot at the hospital that his daughter was a ‘bestselling author.’”
I AM A TEA PERSON! I love getting over-caffeinated on tea. I do think there's something in the water in Portland! The last time I was at Fly Awake Cafe (their chai!!!) in Portland, my brain felt incredibly lubricated and the ideas kept coming. I also really enjoyed working at a place near the Portland Art Museum (while it was raining). So, tea is one crutch, and seltzer is another but I was drinking so much seltzer that my teeth started getting really sensitive. Coffee used to be a crutch, but I have a chart about why I quit (it's always 20 min. of false genius followed by intense panic).
© Michelle Rial, “Am I Overthinking This?”
I'm putting your event (Make Out Room!) on my calendar! I've been meaning to go to more events there.
Also, the idea of space fighting sounds so effortless, and I love that it was influenced by working in sports marketing. Having been in sports marketing, how do you feel about sports metaphors in business? When I worked in advertising I used to really hate any reference to The Ball: dropping it, keeping it rolling, the court that it's currently in, touching base, etc. I tried to make a chart about that years ago but I ultimately dropped the ball on that.
“I used to really hate any reference to The Ball: dropping it, keeping it rolling, the court that it's currently in, touching base, etc. I tried to make a chart about that years ago but I ultimately dropped the ball on that.”
I love the Austin Kleon talk and it makes me feel better about any of the times I've done something close to what someone else has done (without knowing) and vice versa. In the Venn diagram of Austin Kleon + SF art stuff, Austin Kleon had a gallery show here at Mule Gallery a few years ago. I went and I enjoyed the art, but as with most gallery openings, I felt very claustrophobic and like I was the only person who didn't belong there. Do you get that feeling anywhere?
That coffee chart is just too real!
That’s very cool that you went to Austin Kleon’s gallery show, though I can definitely see how they might be claustrophobic. I get that “I don’t belong here” feeling sometimes at literary events. I’m talking about the high-brow, MFA-crowd type events where you can tell most of the people there look down on science fiction and fantasy, and young adult fiction. I don’t get that vibe too often, but when I do, I find it frustrating that people feel compelled to draw judgmental distinctions between “high art” and "commercial art.” Of course, there are differing objectives and audiences for different types of art, but I think that as creatives, we’re all just trying to express our own truth.
“I find it frustrating that people feel compelled to draw judgmental distinctions between ‘high art’ and ‘commercial art.’”
I’m impressed by people like yourself who have multiple artistic abilities like writing, design, and photography, etc. I feel like I’m lucky to have ONE artistic calling, and it’s already super hard to call upon it consistently. Do you feel like your different creative practices inform and feed into each other a great deal? And okay, I have to ask: do you have a favorite chart?
I feel the high art vs commercial art thing. It's part of what makes me feel like I have to constantly let people know I'm aware that what I do is kind of silly or "not actual art" like it says in my "honest artist statements" print.
That's nice of you to say about the artistic abilities, but I think I've just spent years trying a jack-of-all-trades strategy of trying to break into any creative field by doing all the things as best I could. I think they do inform one another, but mostly, I have to remember to take a step back and use each skill. I think it's like how you write first, then read your work as your own editor; I might illustrate something, and then have to take a break before I look at it as a graphic designer, because sometimes I just can't see it from the graphic design/layout perspective if I'm still in illustration mode.
“I start with pen and paper, get up, do a bit of crappy lighting, take a photo, go to the computer, and repeat. It's sort of a lazy art triathlon.”
What I like about employing them all when I'm doing a "real life chart" (a chart made with an object) is that I get to move around. If I'm at the computer for too long I get neck pain, so I start with pen and paper, get up, do a bit of crappy lighting, take a photo, go to the computer, and repeat. It's sort of a lazy art triathlon. By doing this I also get to let my brain breathe a bit, and sometimes that allows for an epiphany that changes it for the better. I have several charts that evolve every few months into something slightly different. Have any of your books changed in a huge way after giving them some breathing room (if time has allowed)? Also: do you have any feelings about ergonomics?
I don't have a favorite chart BUT my favorite piece of advice is from a continuing education class I took at SVA with Ed Benguiat, a type designer, who said to draw a letter, then take a sip of water, draw another letter, take another sip of water (and repeat).
I also love Earl Grey and rooibos tea! I associate Earl Grey tea with my favorite Star Trek captain, Jean-Luc Picard from Star Trek: the Next Generation (the Star Trek series of my youth, no doubt a formative influence in why I ended up a science fiction author). I also was not a fan of electric kettles until I switched to a completely stainless steel model and now I use it all the time.
“I can definitely relate to the feeling of having to disassociate different parts of your creative brain at different times.”
I can definitely relate to the feeling of having to disassociate different parts of your creative brain at different times. Like you mentioned, writing brain is different from editing brain, and sometimes it’s difficult to switch between them. I have this problem when I’m doing copyedits on one book while trying to draft brand new words on another manuscript. I’m making small technical choices on a well-polished, almost-complete piece of work, and then, I have to go back to my hot mess of a first draft and try to recapture enough creative momentum to keep going and not toss the whole thing out the window.
I also think breathing room is hugely important! Many of my books changed significantly and for the better after I came back to revise them after taking some time away and working on something else. I can remember times when I was stuck on a project, but saw the solution when I approached it with fresh eyes weeks or months later. It’s often so hard to find that necessary time when you’re under deadlines, though. Do you have a set schedule to your work, set by yourself or clients, or does it vary a lot?
Since we’re wrapping up our conversation soon, I just wanted to say that it’s been such a pleasure chatting with you! I’m definitely looking forward to picking up your book when it comes out, and good luck with everything!
I think this is supposed to be our last email, but pleeeease send this kettle info (note to anyone reading: this is not premeditated spon con!) *winks at no one*
I'm going to LA this weekend, and if I get to go to Wi Spa, I'll pick up Jade City so I can read it in the jade room and make it #immersive.
It was lovely talking to you and I hope to run into you in one of our home cities soon! | cc/2020-05/en_middle_0078.json.gz/line1006 |
__label__cc | 0.573625 | 0.426375 | High Powered Computing / Wide Angle
Enlarge / The below article has nothing to do with a Surface Pro. But after my headaches, I wanted to smash any Windows logo with a mallet.
Lora Machkovech
Sometimes at Ars Technica, a staffer has to call in “sick” for reasons other than illness, emergency, or hangover. Those are all poor working states, but I would argue that one is even worse: a computer meltdown.
Everyone on staff has suffered at least one of these (or its awful cousin, the ISP outage) and been left distracted or set back to some extent. But when the crash in question happens to the thing you’re supposed to test? That’s a problem.
And when it happens because you used official Microsoft downloads? Oh, that’s an Ars article.
1809: The sign of the Windows Update beast
TL;DR: Everything on my end is fine, after some headaches. There’s not enough here to declare that Microsoft has failed its every customer. But, seeing as this is a holiday weekend, I thought I’d use the slow-news opportunity to tell a slightly overlong tale of Windows woe. Methinks you’ll empathize.
The trouble began when I returned from a mid-November trip and offered a sing-song “honey I’m hooo-oome” to my sweet, sweet baby: the Ars PC-gaming testing machine.
Some context: I’ve been a happy owner of a Falcon NW “Tiki” build for years, which I upgraded earlier this year because I’d anticipated the launch of new, consumer-grade GPUs. I wanted any new GPUs to be met by a beefier power supply, faster RAM, and a liquid-cooled i7 processor. This system upgrade certainly helped me review Nvidia’s new RTX line of GPUs in September (with some exceptions, which I’ll get to later).
Part of the upgrade process was a system wipe and fresh Windows 10 install, which I was happy to do—always a good excuse to back up files and clear some Windows garbage. That was in April, and while I’ve faced some UWP app-license headaches since, the system has otherwise been fine.
Thus, I was excited upon my return to see a major update queued for download: Battlefield V and its fancy-pants, RTX-minded “ray-tracing” update. (BFV has had a weirdly staggered launch, with some customers playing a full two weeks ahead of standard-edition owners, but we got in as early as possible with hopes of testing this RTX update and informing our audience of PC gamers.)
I got all of my PC-patching ducks in a row. New Nvidia drivers? Check. BFV and Origin client updates? Check. Windows Update, “check for updates?” Check. I was ready to trace some rays—and thus see what Nvidia’s newfangled, super-sexy reflection pipeline would offer in an actual game, as opposed to pre-cooked demos.
Yet BFV‘s menus still had no mention of ray tracing, and jumping into a game showed no difference. Huh?
I was ready to poke the ray-tracing bear.
A quick peek at EA’s announcements confirmed what was still missing: a jump to the latest Windows 10 build number. I was running 1803, but EA locked this update to Windows 10 build 1809. Hmm. That’s a requirement I hadn’t seen before.
I quintuple-clicked Windows Update’s “check again” button in the hope of forcing an upgrade, but I was out of luck. Windows’ default, staggered approach to official updates had left me out of the approved pool. Oftentimes, that’s a good thing. I am glad to not have been part of the recent “official” wave that wiped users’ My Documents folders, for example.
But this device is a testing rig, which means it’s mostly free of valuable files. In the case of a full data wipe, I’d be more upset about having to re-download zillions of games’ gigs (especially with a #%*$ing Comcast monthly data cap) than losing crucial data. Thus, I was ready to poke the ray-tracing bear.
“Undoing changes,” “undoing changes,” “undoing changes… ”
My first force-an-upgrade step came from the Windows Update Assistant, an officially advertised Microsoft download that confirms your system’s specs and build version, then answers whether or not your PC is ready for the next Windows 10 build before beginning the download-and-install process. My PC quickly received the all-clear from this app. After a 10-minute data-download phase, the installer offered an expected “first of many restarts” notice.
Before going any further, I should note that I ran into one bit of Windows weirdness ahead of the upgrade process. In clearing out a few more gigs on my install drive, a paltry 256GB SSD, I tried to clear out prior Windows installs by digging through temp files via Windows 10’s settings panels. There, I saw an option to recover 6GB of data that was devoted to “previous Windows install files.” But doing this did two things: first, it left a “cleaning files… ” message on my screen for over half an hour, and second, when the file cleaning was completed, the option to delete that data disappeared—but I had only recovered 1GB of data.
What happened to the other ~5GB? I couldn’t tell. I no longer had a Windows.old folder lingering in my C: drive. And a dig through usual-suspect dumping grounds of “hidden” files turned nothing up.
“Undoing changes made to your computer,” insta-reboot. Repeat. Repeat. Repeat.
Back to the Windows Update Assistant. When I told this upgrade tool to proceed, its first timing indicator got up to 80 percent before rebooting my system. Then, the restarted, low-resolution screens showed a meter that reached 17 percent before a sudden reboot. Another screen briefly flashed: “Undoing changes made to your computer.” Reboot, and back to the prior Windows build, working as if I’d done nothing. I tried again, only to see the exact same percentage markers. Eighty percent, 17 percent, “undoing changes made to your computer.”
The next step was to reach out to Microsoft customer service directly through Windows’ help interface. My first chat with a customer service agent began with a stern reminder—and one I’d be remiss not to share with you—that I should wait until my Windows 10 system received an 1809 download through Windows Update. If I wasn’t getting it yet, I should cool my heels. But my heels were hot, I insisted, and I was ready to use official Microsoft downloads to get to 1809 and its ray-tracing goodness.
After I politely asked if I had any official-download options, my first agent directed me to the Media Creation Tool (which had been advertised on the same site where I’d grabbed the Windows Update Assistant). This came in two flavors: an executable to launch on the existing Windows install, or a boot-disk creation process (which either farts out an ISO or a Microsoft-tailored flash drive). I was told to go ahead with either option, so I installed the MCT executable on the affected machine and rebooted.
This time, the install process got me to a reboot, but instead of a 17-percent crawl, it flashed the “undoing changes made to your computer” message for a split-second, then rebooted. After my BIOS loaded, the same thing: “Undoing changes made to your computer,” insta-reboot. Repeat. Repeat. Repeat.
Too mad at Microsoft to use Bing
After some furious Googling, I found a few troubleshooting recommendations for “endless Windows 10 reboot” woes, which all revolved around MCT’s flash drive option. However, every possible step I could take using that utility—including repairs, system restores, and update uninstalls—failed with blank error messages. As in, I’d get a nicely phrased “unfortunately, this didn’t work” message, followed by a “Log:” note that had zero text afterward. The log was a lack of a log.
With this information in hand, I turned to Microsoft customer service once more. Nobody had a clue where to go with my specific error state. The MCT made accessing a command prompt easy, but every command I entered turned up specific errors that indicated something wasn’t loading or being recognized correctly. The language barrier with some Microsoft reps didn’t help. Upon advising me to attempt a “custom install” via the MCT, one care agent informed me that “all of your apps on all of your drives” would be deleted by doing this. When I asked for clarification—are we talking about UWP apps, or every single x86 executable?—I received the same “all apps” guidance. (Of course, the answer was “no.” My non-Windows drives would be fine, especially since I would be better served by unplugging unaffected drives before going forward with any changes to my C: drive.)
For now, I’m choosing games that are easier to back up on PC.
As of press time, I have yet to get a response from Microsoft about what it has tracked regarding the error I faced in terms of other users running into the same situation as me: finding my Windows drive unable to recover from an endless reboot loop, in spite of exhausting all troubleshooting options. We’ll update this article with any response, but the Thanksgiving holiday will likely delay that.
My next step should have been to email my Windows wizard of a coworker Peter Bright. Instead, I got hung up on a question that Microsoft’s reps failed to answer in a clear manner: was my ancient, paid Windows 8 license—which was upgraded to Windows 10 during its limited free period—in peril if I opted for a full system wipe? The answer, which took me way too long to figure out, was no. The license was fine, attached to my Microsoft account and mindful of specific hardware on my system.
Previous Article Logitech could be about to acquire Plantronics
Next Article Six people swallowed LEGOs and pored through their own poo for science | cc/2020-05/en_middle_0078.json.gz/line1008 |
__label__cc | 0.652296 | 0.347704 | Cycle2City
North Quay Pathway upgrade
Footpath and cycle path upgrade – Herschel Street, Brisbane City
The Department of Transport and Main Roads (TMR) have advised that minor work to the footpath and cycle path will be carried out along North Quay adjacent to the intersection with Herschel Street.
These minor works will provide better access for pedestrians and cyclists.
The work is expected to take place between Sunday 15 January 2017 and Monday 23 January 2017, subject to weather and construction conditions.
Hours of work will be at night, between 8pm and 4am.
Traffic control will be in place to ensure the safety of road workers, motorists, pedestrians and cyclists at all times during the construction.
These works involve:
· Removal of part of the current path and old fencing
· preparing and pouring concrete for the new path
· moving signage to create a clearer footpath
· fence construction
· Minor traffic delays and lane restrictions
· Increased noise and dust from construction equipment and activities.
· Traffic control will be in place to assist pedestrians and cyclists where necessary.
Every effort will be made to minimise disruptions throughout this project.
Department of Transport and Main Road apologises for any inconvenience.
Cycle2city members can keep up-to-date with information on road closures and traffic conditions across Queensland. Visit www.131940.qld.gov.au or call131940
Sign up for a free trial today!
© 2020 Cycle2City | Privacy Policy | Terms & Conditions | Site Map | cc/2020-05/en_middle_0078.json.gz/line1009 |
__label__cc | 0.745992 | 0.254008 | Alexis Turner: Taxidermy (Hardcover)
(BO51)
Due to its success, Alexis Turner: Taxidermy (Hardcover) is currently not available.
An unsurpassed survey of the world’s finest examples of this popular art form—in situ from the greatest private and public collections to the beautifully assembled rooms of contemporary artists, stylists, and cutting-edge interior designers. Taxidermy is everywhere these days, from hip restaurants to posh clothing stores, and practically every luxury brand can be seen offering its wares on the backs of preserved, stuffed animals or incorporating them in their interiors. This is the first volume to consider taxidermy as an art form, and it balances showcasing classic work (such as pieces by Walter Potter) alongside innovative and modern contemporary pieces by various practitioners, from traditional taxidermists to interior designers, fashionistas, stylists, and fine artists. Collected here in one volume are the greatest examples of taxidermy, freshly photographed in situ, from contemporary apartments and rarely seen private interiors to luxury fashion shoots, hipster lounges and restaurants, and museums and galleries. A who’s who of contemporary artists’ work is also featured, including Daniel Firman, Kate MccGuire, Cai Guo-Qiang, Charles Avery, Adel Abdessemed, Alex Randall, Charlotte Cory, Claire Morgan, Neil Harmon, Polly Morgan, Tessa Farmer, Iris Schieferstein, Thomas Grunfeld, Tim Noble and Sue Webster, and Wim Delvoye—artists creating inventive interpretations of the genre, reaching new audiences and bringing taxidermy further into the mainstream. This intriguing and engaging volume offers inspiration to anyone seeking to incorporate taxidermy into any type of setting, historical or modern, commercial or residential.
Long-Billed Curlew Sculpture, French, Mid 20th Century
(D544a)
Wildflower Study, Aquarelle and Gouache, 19th Century
(D204g)
Champagne Cork
Paris Metro Second Class Wooden slatted Double Bench
(D634) | cc/2020-05/en_middle_0078.json.gz/line1014 |
__label__cc | 0.668116 | 0.331884 | GET HYPE
by Nocbl2 on Sat Nov 16, 2013 10:24 am
http://thesurvivor2299.com/
Fallout 4HYPE TRAIN!
Re: GET HYPE
by Tylertlat on Sat Nov 16, 2013 12:07 pm
Fallout Wiki wrote: According to Reddit, the Morse code on the page translates to '12-22-13', or maybe '11-22-13'.
The .mp3 file can be accessed at this address which incidentally references the Connecticut city of Bridgeport.
Another file on the server (commented out currently), fall-river-6191da7f11n.mp3, references the city of Fall River south of Boston and east of Bridgeport.
Another file has been added (commented out as well), hanscom-msg-52862c3e7a30e.mp3, referring (apparently) to Hanscom AFB, Massachussets.
The domain registrant is ZeniMax Media Inc. The same spelling of the registrant, data, and even contact information are used for the main Bethesda Softworks domain (bethsoft.com). GoDaddy domain data.
This isn't unprecedented. The Warlords of Draenor domain was registered by Blizzard through GoDaddy as well. Thanks to Rob O'Neill for pointing that out.
The Google conversion id (located in the JavaScript portion at the bottom of the page) is 963805860. The same Google conversion id is used by official Bethesda Softworks webpages (eg. The Elder Scrolls.
The cascading style sheet references the Monofonto font used in Fallout 3s interface.
A div at the bottom of the page is noted as pointing towards Bethesda Softworks' own YouTube profile.
A Tumblr account that's related to this page (it seems) has been uncovered on Reddit.
Additionally, an overlooked point is that the site has now experienced massive traffic and is still up. As Rob O'Neill (thanks again, man) points out, this indicates that whomever operates the site clearly has the funds to pay for the bandwidth and traffic.
Now removed content:
The European RTMP server is stated to point to a Polish IP (5.131.13.121). The American IP (199.107.64.171) is listed as owned by ZeniMax Media. The second (199.15.249.30) resolves to a Baltimore hosting company.
The site included references to assets, including posters:
<img src="http://prepareforthefuture.com/static/00_posters/04_poster_pinch.png">
<img src="http://prepareforthefuture.com/static/00_posters/04_poster_apo.png">
<img src="http://prepareforthefuture.com/static/00_posters/04_poster_battlesh_cov.png">
<img src="http://prepareforthefuture.com/static/00_posters/04_poster_river.png">
<img src="http://prepareforthefuture.com/static/00_posters/04_poster_bst01.png">
<img src="http://prepareforthefuture.com/static/00_posters/04_poster_bk_wads_atheneum.png">
04_poster_bk_wads_atheneum.png seems to reference the Wadswoth Atheneum, an art museum in Hartford, Connecticut.
04_poster_battlesh_cov.png appears to be a reference to Battleship Cove in Fall River, Massachusetts.
It does seem similar to how Fallout 3 was teased, though remember the following things to consider before claiming it's the next coming of Fallout:
The countdown script is referred to as bscountdown.js. BS is a well known acronym for, well, bullshit.
Pinging the domain name used to resolve to the IP 5.131.13.121, which is a Polish server belonging to ViBiznes, a hosting company not used by ZeniMax or Bethesda. Currently it resolves to 199.15.249.30, which is a server belonging to a Baltimore hosting company, not on any IP belonging to the ZeniMax Media company.
However, pinging stream.thesurvivor2299.com resolves to 199.107.64.171, an IP owned by ZeniMax Media Inc.
The presence of Polish names for script variables inside the website code also indicates this may very well be a very convincing fake. Though highly unlikely, it might also mean that it was outsourced to a Polish company.
ZeniMax does not use GoDaddy for domain registration. They rely on the services of [http://www.cscglobal.com CSC are in front of months, not the other way around).
The site references assets from the defunct Prepare for the Future website, rather than a new domain.Corporate Domains, Inc.] Furthermore, it is possible to submit fake registration details while applying for a domain, allowing one to mimic a corporation.
Another issue is that the supposed reveal uses the European date format, rather than American (i.e. days
There was a 'fallout.js' (JavaScript) as a file reference on the page, but it has been since removed.
Looking up the locations on the map, they seem to be centered south and south-west of Boston, which was repeatedly rumored (without any sort of official confirmation) to be the setting of the next Fallout game. However, it should be noted that the distance between Bridgeport and Fall River alone totals 137 miles. The real world distance between the Jefferson Memorial and the western edge of the map in Fallout 3 was about 40-50 miles.
From the Reddit thread on the topic:
The design of the site does not match any known ZeniMax sites, nor does the set up and infrastructure associated with it.
Tylertlat
Architect of the Flames
Location : Detroit, Michigan
by Nocbl2 on Sat Nov 16, 2013 1:15 pm
The first reddit thread
The second
by Gauz on Mon Nov 18, 2013 9:46 am
Bethesda kind of sucks, so I really hope they don't ruin the Mojave Wasteland.
Why can't Obsidian just make all the RPG's
by Nocbl2 on Mon Nov 18, 2013 5:15 pm
From earlier evidence and a few things I can't be bothered to link, it's probable that it will take place in Boston or somewhere in Massachusets.
by Gauz on Mon Nov 18, 2013 6:35 pm
"You'll get no tips from me. But the Mojave Wasteland was a fun place to explore, wasn't it?" - Jason Bergman
Interesting you'd think that. I think you should bother yourself to link them.
by Tylertlat on Tue Nov 19, 2013 10:49 am
Nocbl2 wrote: From earlier evidence and a few things I can't be bothered to link, it's probable that it will take place in Boston or somewhere in Massachusets.
How about this link? Specificly...
Tylertlat wrote:
Fallout Wiki wrote:
Another file has been added (commented out as well), hanscom-msg-52862c3e7a30e.mp3, referring (apparently) to Hanscom AFB, Massachussets
Looking up the locations on the map, they seem to be centered south and south-west of Boston, which was repeatedly rumored (without any sort of official confirmation) to be the setting of the next Fallout game.
by Gauz on Tue Nov 19, 2013 11:30 am
MERE CONJECTURE
Well if it means Bethesda leaves the Mojave alone I'm happy.
by dragoon9105 on Tue Nov 19, 2013 3:46 pm
I think i would have prefered Chicago becuase the last bit of the enclave is there
The commonwealth works for me though, I wonder if it'll be new england or just boston.
by PiEdude on Thu Nov 21, 2013 9:43 pm
I also would have preferred Chicago
by Ruski on Sun Nov 24, 2013 6:47 pm
This was "leaked" earlier today. Its pretty well done, even if its a fake. Regardless, I cannot wait.
by Gauz on Sun Nov 24, 2013 7:24 pm
Anyone else hoping they make an actual RPG this time?
Not like Fallout 3 and Skyrim? By that I mean, one with real choices that make real impacts in the game world. That's what Fallout is about. New Vegas delivered on it so I really hope Bethesda takes some notes from Obsidian.
How awesome would have it been if in Fallout 3 you could have sided with the Enclave for whatever reason, mine would be to spite Dad, and explore the dark possibilities of genocide, eugenics in the post-apocalyptic wasteland, and create a totalitarian governmental ruling over the wasteland inhabitants.
by Nocbl2 on Sun Nov 24, 2013 9:35 pm
Yeah, I hope it's not Fallout 3 Round 2. The story was pretty crap, not gonna lie.
by dragoon9105 on Mon Nov 25, 2013 1:57 pm
Try again you couldn't even do that in Fallout 2. If you want an Rpg where you can eventually start ruling everyone you'll have to keep looking or mod the game. You could side with the bad guys in Fallout 1, but that results in a Bad end immediately.
by Nocbl2 on Fri Dec 06, 2013 10:58 pm
Aaaaaaaaaaaaaaand its fake.
by Tylertlat on Sat Dec 07, 2013 3:38 pm
Nocbl2 wrote: Aaaaaaaaaaaaaaand its fake. | cc/2020-05/en_middle_0078.json.gz/line1017 |
__label__wiki | 0.971847 | 0.971847 | O-scope’s Found Footage Comedy ‘VHYes’ Debuts, ‘Parasite’, ‘Jojo Rabbit’ Set Expansions After Oscar Noms – Specialty B.O. Preview
James Franco’s Delayed ‘Zeroville’ Saved By myCinema; Distrib’s Slate Includes Julian Fellowes’ ‘The Chaperone’ – CinemaCon
By Anthony D'Alessandro
Anthony D'Alessandro
Editorial Director/Box Office Editor
@AwardsTony
More Stories By Anthony
‘Bad Boys For Life’ So Good With $68M+; ‘Dolittle’ Still A Dud With $30M+ – Box Office Update
‘Matrix 4’: ‘Sense8’ Actress Eréndira Ibarra Reteams With Lana Wachowski On Warner Bros.-Village Roadshow Sequel
‘Amari And The Night Brothers’: Azia Squire Adapting B.B. Alston Novel At Universal For ‘Black-ish’s Marsai Martin
April 1, 2019 11:36am
EXCLUSIVE: NAGRA-KUDELSKI’s myCinema digital content distribution system has announced its full slate of films a year after it’s launch, teed off by the James Franco feature Zeroville, which the actor both directed and headlines.
Originally, Alchemy took domestic rights at the 2015 Toronto International Film Festival to Zeroville months before the company capsized due to bankruptcy. Since its pick-up at TIFF, Zeroville unfortunately became entangled in Alchemy’s financial woes and was thrown into distribution limbo until the US distribution rights were recently acquired by NAGRA. The pic will hit cinemas in September. The comedy based on Steve Erickson’s novel about a young actor who arrives in Hollywood during a transitional time also stars Seth Rogen, Megan Fox, Joey King, Will Ferrell, Dave Franco, Danny McBride, and Jacki Weaver.
myCinema delivers films over the internet which individual theaters can then licenses for any number of weeks of play. myCinema also markets the pics for exhibitors and the distribution system is currently available at 500 screens throughout the U.S. and Canada.
In addition myCinema unveiled the follow upcoming titles on its slate:
Masterpiece Films
The Chaperone written by Downton Abbey creator Julian Fellowes and directed by the award-winning series director Michael Engler. Based on Laura Moriarty’s best-selling American novel about a woman (Elizabeth McGovern) whose life is changed forever when she chaperones a young and soon to be famous Louise Brooks (Haley Lu Richardson) to New York. The first produced PBS feature takes place against the backdrop of the tumultuous times of the early 1920’s. Victoria Hill, Campbell Scott, Geza Rohrig, Blythe Danner and Miranda Otto also star. Pic hits myCinema partners on May 2019. The pic opened the 2018 Los Angeles Film Festival.
Theo Davies’ Wish Man, based on the true story of Frank Shankwitz, a founder of the Make-A-Wish Foundation. The pic which will be released in May stars Andrew Steel, Kirby Bliss Blanton and Frank Whaley. The pic covers Frank’s young life, the incidents and people who helped develop his character, and his adventures during his law enforcement career, including being killed in the line of duty and being brought back to life. Frank has a realization of what his mission in life was when he met Chris, the little boy who inspired Frank’s idea to create the Make-A-Wish Foundation.
Also there’s Rachel Carey’s Ask For Jane based on the underground abortion network that existed in Chicago between 1969 and 1973 in the years before Roe V. Wade and helped over 11K women – many under privileged, who were forced to obtain illegal abortions. Many members of the collective were arrested. The film will be promoted and supported nationwide by Planned Parenthood as well as the National Institute for Reproductive Health. The movie will open in June.
Filmmaker Brian Baugh’s The World We Make, opening this month follows the story of 18-year-old Lee, a spirited equestrian, and Jordan, an academic and football standout, are at the threshold of building a life together. But their character is tested when racial bias surfaces in their otherwise progressive small town. An interracial romantic drama that tells the tale of a young woman who falls in love with a college football player. Their different backgrounds and ethnicities turn out to be a problem as they try to pursue their dreams together. Caleb Castille, Rose Reid, Kevin Sizemore, and Greg Allen Williams star.
'The Deuce' Finale: Co-Creator George Pelecanos On NYC Porn Biz Series' Fade To Black
Director Arto Halonen’s Murderous Trance is a psychological thriller loosely based on a real-life case in 1950s Danish crime lore wherein a man commits a horrific murder while supposedly under hypnosis. Josh Lucas stars.
myCinema is featuring an array of CineLatino content, including musical entertainment and first run Spanish language movies. Among the several titles being offered throughout the year are: Los Angeles Azules, a documentary featuring a musical performance of the celebrated Mexican onda grupera band; Itinerario de una Pasion, the story of the loves in the life of Pancho Villa; The Minterita Blanco, Winner of the Best Screen Play – Miami Film Festival 2017; and Zoe- Paranormas, a dynamic documentary about the Grammy Award Winning Latin American alternative rock band, Zoe. These titles will be available via myCinema this spring.
Emperor Pictures
Rounding out myCinema’s lineup is the $170M Chinese production Legend of the Demon Cat , an epic Xianxia martial arts fantasy film directed by Palme d’Or winner Chen Kaige. Pic is based on the mystery novel Samana Kukai, authored by Japanese writer Yoneyama Mineo. Between China and Japan, the pic made close to $97M at the box office.
CinemaCon
MyCinema
Latest Box Office News
Peter Bart: Oscar-Season Frenzy Dooms Some Movies With Big Budgets And Wobbly Reviews
O-scope's Found Footage Comedy 'VHYes' Debuts, 'Parasite', 'Jojo Rabbit' Set Expansions After Oscar Noms - Specialty B.O. Preview | cc/2020-05/en_middle_0078.json.gz/line1022 |
__label__wiki | 0.913424 | 0.913424 | Defense Maven
Warrior Maven
Zumwalt Analysis: Can a Large Destroyer be Stealthy? How?
"To Join Warrior Maven Gold & CyberWar Circle CLICK HERE"
By Kris Osborn - Warrior Maven
Eluding radar, quietly sailing into enemy territory and launching long-range precision attacks from less-detectable positions all begin to paint the picture of how “stealthy” offensive surface destroyers could transform modern maritime warfare.
Can a massive surface destroyer, armed with Tomahawk missiles, deck-mounted guns, sensors, antennas and heat-generating onboard electrical power, truly be considered stealthy? Surely, tall, vertical masts, hull-mounted sensors and protruding antenna could never be a low-observable ship, yet performing these missions comprised the technical starting point from which engineers launched into building a first-of-its-kind stealth warship.
Stealth attributes are just one of a number of defining characteristics of the much-discussed Zumwalt class warships, perceived by many to represent the beginning of a transformational pivot into a new generation of warfare -- including laser weapons, artificial intelligence, expanded networking, advanced sonar and electric-drive.
All three high-tech Zumwalt destroyers are now “in the water,” Capt. Kevin Smith, Zumwalt-class Program Manager, said at the Navy League’s Sea, Air, Space Symposium. Smith detailed how each of the three new destroyers are at various stages of development. The first-in-class USS Zumwalt is preparing weapons on its way to final delivery later this year. The Zumwalt is now test-firing its weapons systems, completing an operational scenario transit through Alaska and Hawaii and advancing tactical training for the crew, as it prepares for its maiden deployment. The activation, which involves refining weapons, sensors and networks, is a vital step towards launching the destroyer for war.
“The crew has been learning a lot as far as combat activation, a lot at-sea and a lot at its home port in San Diego. The maturity of the computer system has come a long way and is now at a higher level of completion,” said Smith.
The second, PCU Michael Monsoor (DDG 1001), has begun combat availability and number three -- PCU Lyndon B. Johnson (DDG 1002) -- was christened in April of this year, on its way to a planned Hull, Mechanical and Electrical (HM&E) delivery next year. The Johnson is now 85 percent built and achieved “float-off” in December of last year.
“We’re now going through ship completion, which includes running cable, completing compartments and getting into the activation. We will energize high voltage in September,” said Smith.
Smith explained the rationale for the “split-delivery” acquisition of the three ships, which follows a path from commissioning, through a transport to a home port of San Diego for further combat preparation. While there are some differences between the three ships, such as the use of a steel deck house for the Johnson, the developmental trajectory for all three ships has been interwoven.
“All the lessons we learned in the 1000 we have rolled into the 1001, and we are in the process of rolling everything into the 1002 that we learned from the 1001,” explained Smith.
Technology of these platforms, loaded with heavy firepower, resides in advanced computing, potential for electrical power, potential for future weapons integration and, perhaps most notably, stealth. Just how possible is it to engineer a large destroyer that is significantly less visible to enemy radar?
Typically, when people think of the term stealth, they are drawn toward images of fighter jets or sleek bombers. However, it appears some of the central technical applications of that which constitutes “stealth” seem apparent in the Zumwalt destroyers.
Several years ago, during an earlier phase of the Zumwalt’s development, news reports, many of them citing Naval Sea Systems Command, claimed the Zumwalt looked like a small fishing boat during radar testing. When viewed through the lense of how stealth works, this result may be exactly what is intended. While a destroyer as large as the Zumwalt would be very unlikely to generate “no” return signal to enemy radar or sonar, its configuration seems designed to produce a rendering quite different than what it actually is -- confusing enemies. This is, in concept, fully aligned with the intended effect of Air Force fighter jets a stealth bombers; they are designed to appear like a "bird" or "insect" in the air to enemy radar.
Taking a look at the external shape of the Zumwalt, the ship lends itself to a discussion of some of these fundamentals regarding stealth properties. First and foremost, when compared to other surface ships, its shape is, of course, entirely different. There are fewer edges, a conspicuous absence of protruding structures or varied contours and a flat side, seamlessly attached to the upper deck of the ship, on a straight, yet slightly angled flat linear surface. Instead of multiple sharp, intertwined steel panels and structures, supporting an outward-facing radar system, the Zumwalt’s front exterior shows only a few rounded edges to achieve its requisite shape. Its much-discussed, wave-cutting Tumblehome hull is more narrowly built than existing destroyers, making it less detectable to enemy sonar.
Differently-shaped, external structures, with sharp angles, pointy edges and extending vertical designs naturally offer many more areas off which radar pings can bounce. Low observability, by extension, happens when radar has fewer return electromagnetic pings with which to create a rendering of the object. Since electromagnetic pings travel at the speed of light -- a known entity -- and time of travel can be determined, a computer algorithm can determine the shape, size and distance of an enemy object - if there are enough return signals. Acoustic pings operate within the same conceptual framework, simply using sound instead of electricity. Accordingly, Zumwalt engineers sought to build a ship able to elude radar and sonar detection.
Most current destroyers, for example, have multiple deck-mounted sensors, weapons systems and angular staircases visibly positioned on the deck of the ship; none of this can be seen on the Zumwalt. Some of the Zumwalt’s weapons, for instance, are housed in what appear to be rounded, cone-like structures. Simply put, the fewer edges or identifiable shapes you have, the lower the possibility that electromagnetic signals will effectively deliver an accurate picture of the object.
Another apparent technique is the use of antennas. A DDG 51, for example, has multiple antennas, sensors, masts and other narrow, vertical structures with definable contours. The Zumwalt does not. In addition, the Zumwalt’s electric-drive propulsion system not only helps generate more onboard electrical power for weapons, but is also much quieter -- giving the ship a smaller signature for overhead enemy sensors and even submarines. Interestingly, there are other “conceptual” parallels between the Zumwalt and stealthy fighters jets. Looking at the ship’s exterior, there are very few observable sensors, weapons, antenna or other structures, something which aligns with engineering techniques used to build stealth aircraft. Many sensors and antenna in stealth aircraft are, by designed, embedded or woven “into” the skin of the aircraft. There are no visible “seams” or shaped “bolts” holding parts of the ship together. With these concepts in mind, it would not seem at all surprising if many of the Zumwalts sensors, radar, sonar and other key technologies were deliberately woven into or buried in the hull or exterior of the ship. Following this technical reasoning, it makes sense, for instance, that an Air Force stealthy B-2 would not only have internally buried engines to lower its heat signature -- but also have a rounded horizontal shape with no hard edged, steep angles or perpendicular vertical structures more recognizable to enemy radar. Finally, stealth aircraft are known to use specially-engineered radar absorbing materials. While there may not be a lot of specifics regarding about the exact materials used for the Zumwalt, understandably for security reasons, it would certainly make sense if it were built with a radar absorbing exterior.
Smith also spoke at length about the ship's growth potential or technical ability to house more electrical power and "surge" capacity for new weapons such as lasers. The ship's Integrated Power System, electric drive, computing system and 78 megawatt generator all create the conditions for rapid integration of laser weapons. This is quite significant for stealth designs because lasers not only bring a host of new combat attack advantages, but they are also entirely silent. They give off a much different and less detectable signature than missiles do.
So, while on the surface, the notion of a stealthy destroyer might seem to be a contradiction in terms, Zumwalt engineers appear to have been using numerous stealth techniques, which, while not intended to make the ship invisible, are designed to confuse enemy sensors and wage war while much less detectable to the enemy.
Osborn previously served at the Pentagon as a Highly Qualified Expert with the Office of the Assistant Secretary of the Army - Acquisition, Logistics & Technology. Osborn has also worked as an anchor and on-air military specialist at national TV networks. He has a Masters in Comparative Literature from Columbia University.
More Weapons and Technology -WARRIOR MAVEN (CLICK HERE)--
--- Kris Osborn of WARRIOR MAVEN (CLICK HERE) can be reached at krisosborn.ko@gmail.com
RT Colorado
I always enjoy Kris Osborn, but at times I fear he has been to the Kool Aid bowl. Nothing as big as a Zumwalt class Destroyer is stealthy no matter how you shape it, no matter what color you paint it, no matter how automated and no matter how quiet its electric system is...it's a big chunk of metal cruising around in water. The Zumwalt class ships are stealthier than other ships, no doubt...but anyone who thinks the Russians and the Chinese don't know where they are at any given time is naive beyond belief. Yes, the stealthy attributes of the Zumwalt class ships will help when it comes to missiles attempting a "lock on"...but won't help all that much when it's twenty missiles...a few of them are bound to get through and find some metal to rub up against. The Zumwalt class, like the LCS class ships are nothing more than a test bed for systems to come later, but as real combat ships...no not really.
JohnSHenderson
These developments make guidance and targeting and actual operational status of ICBMs much more vulnerable to attack. Accordingly, various kinds of built-in defenses, sensors and warning systems are quite likely to figure prominently in the GBSD development.
here...............>inkporfit.com
Karl -Moderator
RT Colorado -- great point - how much do you think a stealth configuration will help the zumwalt?
Navy Stealthy Zumwalt Destroyer May Fire Conventional Prompt Strike Missile
The Navy’s newest destroyer may fire a not-yet-to-be fielded Conventional Prompt Strike conventionally-armed missile
Kris Osborn
Navy Strategy Fast-Tracks New Weapons for "Offensive" Attack
Navy leaders cite key weapons programs as essential for future warfare "offensive-attack" strategy
Navy Accelerates New Ship Radar to Support Emerging "Sea-Attack" Strategy
The Navy is accelerating integration of a new, much more powerful radar system intended to find and destroy enemy drones
Navy Adapts LCS Attack Strategy, Shoots HELLFIRE in Live-Fire
How Will Navy’s Littoral Combat Ship deck-launched HELLFIRE will change surface war?
Watch VIDEO: Navy Capt. Talks Laser Weapons for Stealthy Destroyer- USS Zumwalt
USS Zumwalt Program Manager Capt. Smith Explains "Laser Weapons"
ajalexxx
Navy Ships to Destroy Nuclear-Armed Inter-Continental Ballistic Missiles
Navy ships to destroy an enemy ICBM -- from a Navy ship at sea using a Standard Missile-3 IIA
New F-35-Armed Navy Amphib Completes Trials
The new ship just completed its acceptance trials in the Gulf of Mexico
Navy Block V Submarine Deal Brings New Attack Mission Ops
Virginia Block V submarines will “incorporate acoustic superiority design changes.”
Why Didn't the U.S. Navy Build More Seawolf-Class Submarines?
Navy Modifies Its Aircraft Carriers for F-35C Stealth Attack
The Navy is preparing its first two new Ford-class aircraft carriers to launch air attacks with the F-35
MMAI | cc/2020-05/en_middle_0078.json.gz/line1024 |
__label__cc | 0.571647 | 0.428353 | Eppendorf CorporateLokale WebseitenEnglish
LänderseitenDeutsch
Über Eppendorf
Wissenschaftliche Awards
Eppendorf als Arbeitgeber
Einstieg & Entwicklung
Global Award
Prize Finalists
2005 Johanna Montgomery
2005 Finalist Johanna Montgomery, Ph.D
For her essay "Synapses in a State: A Molecular Mechanism to Encode Synaptic History and Future Synapse Function." Dr. Montgomery was born and raised in New Zealand. She graduated from the University of Otago in 1999 with a Ph.D. in physiology. During her Ph.D. studies, Dr. Montgomery completed the Neurobiology Course at The Marine Biological Laboratory in Woods Hole, Massachusetts. She began postdoctoral work in the laboratory of Dr. Daniel Madison at Stanford University, where she used paired whole-cell recording techniques to reveal distinct mechanisms of synapse plasticity. She then pursued further postdoctoral training with Dr. Craig Garner at Stanford University to examine the molecular aspects of synapse function. Last year, Dr. Montgomery returned to New Zealand to establish the Synaptic Function Research Group at the University of Auckland, where she is focusing on the molecular and physiological mechanisms of synapse function and plasticity.
For the full text of the essays by the Prize Winner and Finalists, see Science Online at sciencemag.com.
Karriere bei Eppendorf
Lokale Websites
Rechtliche Hinweise & Datenschutzerklärung
Marken & Patente | cc/2020-05/en_middle_0078.json.gz/line1030 |
__label__wiki | 0.889971 | 0.889971 | Country Sports (5)
Environmental & Rural (30)
Mediawatch: “Portillo’s State Secrets,” 1st April, BBC2, 6.30pm
MEDIAWATCH: Countryside Alliance animal welfare consultant, Jim Barrington, will be on Michael Portillo’s show “Portillo’s State Secrets” from 6.30pm on BBC2 this evening, 1st April. Jim will be talking about animal welfare and hunting and reports that he thoroughly enjoyed filming with Portillo.
Universal postal service is essential to the countryside, says Alliance
Countryside Alliance Ireland welcomes the report published on the 12th March from the BIS Select Committee on Competition in the postal services sector and the Universal Service Obligation (USO) and its recognition that the USO is an “essential service” that needs to be protected by Ofcom. As our submission outlined,…
Justice Committee to seek academic advice on firearms review
The Oireachtas Joint Committee on Justice, Defence and Equality has agreed to seek a range of academic perspectives as part of its on-going consideration of a recent review of firearms licencing issues. The Committee hopes that the input of experts, with independent analysis of the current trends in Ireland and…
Updating you on our work in Europe
Countryside Alliance Executive Chairman Barney White-Spunner writes: I was in Brussels last week at a meeting of European fieldsports body, FACE, of which the Countryside Alliance is an active member. I am honoured to be FACE’s UK Chairman and to represent British sporting interests at the highest level and I…
Funding for the Environment through EU Cross-Border Cooperation Scheme
Environment Minister, Mark H Durkan, welcomes significant funding to be allocated to the environment through the Interreg Programme. Following detailed discussions with the UK and Ireland Member States, the European Commission has formally adopted a new Interreg cross-border co-operation programme for the Border Region of Ireland, Northern Ireland and Western…
Guidelines for Deer Hunters to Protect Against Lyme Disease
BADA, who exhibited alongside Countryside Alliance Ireland at Birr have produced some basic guidelines for deer hunters, to help protect against Lyme Disease and other related diseases. They are as follows: While shooting – consider wearing permethrin-impregnated clothing or treat your own clothing with permethrin-fabric spray (available from the BADA-UK…
Irish Game body merges with CAI
A decision has been made by the Executive Committee of the Irish Game Protection Association (IGPA) to merge with Countryside Alliance Ireland (CAI). As the representative body for the driven shoots of Ireland, the Association was formed in 1890 by a group of keen sportsmen to help conserve and protect…
Countryside Alliance Ireland’s Chief Executive Wins Prestigious Sporting Award
Lyall Plant, Chief Executive of Countryside Alliance Ireland was the proud recipient of a ‘Lifetime Commitment Award’ presented to him by Paul Pringle at the Press Reception for the Great Game Fairs of Ireland 2011, held recently at Shanes Castle. yall Plant, Chief Executive of Countryside Alliance Ireland was the…
Preparing a Risk Assessment for your Shoot
A recent case reported in Shooting Times magazine highlighted the importance of health and safety on shoots. Seven hunt saboteurs were acquitted on 14th April of aggravated trespass because the shoot in question did not have a written health and safety policy. A recent case reported in Shooting Times magazine… | cc/2020-05/en_middle_0078.json.gz/line1033 |
__label__wiki | 0.890767 | 0.890767 | info@countybroadband.co.uk
Ultrafast Fibre
Comment: Reaction to Labour Party’s free broadband pledge
County Broadband reacts to the Labour Party’s free full fibre broadband pledge, announced today.
Statement: Reaction to Labour Party’s free broadband pledge
Lloyd Felton, chief executive of County Broadband, which is rolling out full fibre networks across rural East Anglia, said: “The announcement highlights the importance of full fibre access for all. However, it also shows an alarming lack of understanding about the complex nature of full fibre rollouts and the fact that, unlike by comparison the rail industry that operates rail franchises, the industry has already invested billions of pounds in building its own infrastructure over which the service is delivered, in direct competition to BT.
“This proposal would almost certainly lead to delays or at worst derailment of existing full fibre investment and new network roll-outs. It is broadbrush, and makes no mention of how customers would be served and supported, and provides no recognition for what has been achieved by the many Alternative Network providers (AltNets) who are currently active in providing a competitive full fibre solution.
“The competitive nature of the current market in the UK has meant consumers already benefit from one of the lowest cost broadband services in Europe. Broadband is an essential utility and whilst we share the ambition to bring future-ready full fibre connectivity to every home and business, we believe a mix of public and private investment is the only realistic strategy to deliver the service efficiently, without the need to bring significant cost to the public purse.”
Residents and businesses can find out if they’re in a village covered in the rollout by using our postcode checker here.
County Broadband Ltd
Old Bourchiers Hall
CO6 3QU
Copyright © County Broadband Ltd
Order, Pre-Order & Service Terms | cc/2020-05/en_middle_0078.json.gz/line1034 |
__label__cc | 0.712785 | 0.287215 | "Hells Assassin's" The beginning of a series
leoshe Stories that last - Amateur Writer
We are the lost ones, the last generation to put up with the nonsense of the every day world. The kids who grew tired of waiting for the world to change, for the adults of our every day lives to take responsibility of their mistakes.
fiction seriespoweractionminesuspenceworldpowerfulgenocidegenerationcool
We are the lost ones, the last generation to put up with the nonsense of the every day world.
The kids who grew tired of waiting for the world to change, for the adults of our every day lives to take responsibility of their mistakes.
A single government system crossed the entire world and before they knew they all had made horrible mistakes, we were already gone.
The new law called for children the age of 18 or under to be all relocated to what we kids came to call "Hell On Earth".
The city where we were abused, forcibly re-educated in their propagandic ideals, and taught self sufficiency.
We were given only few rations a day to keep body fat percentage down, and forced to train in military combat until we would pass out from exhaustion.
Then we would be brought back to our grouped buildings (by age) where we would live together and bandage each other wounds.
We formed groups based on the buildings were lived in Mine being section Z of the city. The last generation of children to be born.
Raised on the compound, never seeing the outside world or my parents.
To make certain the population of the world decreased so our planet could maintain us,
as soon as the law was passed for the children to be taken away from their homes a virus was spread to the citizens of the world outside of Hell.
No one except the children of Hell, could bear children anymore. We were told that we were the future of the world.
Drilled in their new ideals we decided to take it to heart, we will take the future into our own hands, and shape it in our own ideals.
After 17 years, building Z became the last hope for the Hell's government.
All other children either grown up and deemed too unresponsive, broken, or without emotions, or they didn't make it to see the age of 18 whether suicide or accidental death.
The fate of those who made it to the age of 19 was forced breeding, in hopes to reset the expiraments to begin a perfectly controlled new world.
The now men were then suited up in military gear and sent out to kill all those remaining in the outside world. Not one country was spared this genocide.
The woman contained, locked in their designated buildings starting with A and then with each year another building until A through X was Filled.
Never allowed to leave their prisons, simply existing was their new jobs. Seeing this, those of us of building Z knew our soon to be fates.
We decided it was time to change, to join together and escape this oppressive world. We planned to save all those who are still trapped by Hell and begin a new.
In secret we trained even harder to become a force far greater than they knew.
Tunneling into the ground beneath building Z we reached access to old underground ruins and passages. We turned those places into our secret battlegrounds.
From training every day with all our might we emerged with incredible results. With incredible reflexes, speed, strength, and grace. We became unmatched.
"Hell's Assassins" were born, and it was soon time to make a change. | cc/2020-05/en_middle_0078.json.gz/line1042 |
__label__cc | 0.640257 | 0.359743 | Salamat, Cebu: Random notes on the Global Voices Citizen Media Summit
Translation posted February 27, 2015 2:41 GMT
This post has been translated into English by Marianna Breytman. The original post can be found here.
It's been a week since the Global Voices Citizen Media Summit came to a close in Cebu City in the Philippines, which I was lucky enough to attend. Forty hours of flying later, I arrived to this tumultuous and confusing country that I call home and slept for 30 non-stop hours (seriously) until I achieved something resembling a sense of balance. Not for nothing, Elena [es] told me that the soul and the body travel at different speeds: just today, after tending to a few urgent responsibilities and taking the rest of the weekend to be alone with my demons, I managed to organize a few ideas that have been floating around in my head following that beautiful and eventful week, during which I had the pleasure of seeing people I love a whole lot and hadn't seen in years, and those who I love a whole lot but had never met face to face, and finally meeting people I didn't know and who I now consider my friends.
In the upcoming days, I hope to post (be it in Spanish or English) my concrete notes about the different activities in which I participated. This post is not about that, but rather a way to acknowledge the emotional state — a mix of post-summit depression and infinite gratitude — that I find myself in upon landing back home, to reality and to everyday work again.
Global Voices is marking ten years since it was created by Rebecca MacKinnon and Ethan Zuckerman, and I have had the good fortune of volunteering for the organization for the past four years (particularly for Advocacy). Suddenly it sounds like a crazy commitment, especially when people ask why we give our time and work “for nothing in return”. Those who see it that way obviously don't know Global Voices and don't have the slightest idea as to what we get in return.
A family that reaches every corner of the world
Many of the Global Voices volunteers are migrants in one way or another; many others, although we live in our countries of origin, have serious problems feeling comfortable anywhere. In part, I think, it is because of the inescapable feeling that the world is bad, truly bad, and that there is very little we can do with respect to that, even though we keep trying. That is why the support, acceptance, and feeling of community that comes from being part of GV is possibly our greatest reward.
I always feel at home among GVers. ♥ #gv2015
— Marianne Díaz H. (@mariannedh) enero 21, 2015
It's something special being in a room with over a hundred people and feeling safe, secure, knowing that you share values and ideals with all of them, knowing that everyone, including those you don't know yet, are your friends. Not in a stupid, Hallmark card kind of way, but genuinely: knowing that you can sit next to anyone and start a genuine conversation, like the ones we had when we were five years old and inviting someone to play was enough to make him or her your friend. It becomes easy when everyone wears their heart on their sleeve, when we accept peoples’ good faith as self-evident.
It's not necessary to be at a summit either — they happen every two years — for us to feel this way. Wherever there is a GV'er, we have a place. The world suddenly stops seeming strange: it's just an enormous, immense home that you haven't gotten to know yet.
Voices for those who don't have one
I think that the most surprising thing about being part of a project that grows organically, that moves to the extent that the members of its community change, evolve, and aspire to new things, is realizing that the values on which Global Voices is founded continue to be the same as they were ten years ago, and that those values continue to guide our actions as a community, as well as our plans and projects, regardless of how much the tools change or how much the networks that we build are reconfigured.
Creemos en la libertad de expresión: en proteger el derecho a hablar – y el derecho a escuchar. Creemos en el acceso universal a las herramientas de expresión.
Con ese fin, queremos empoderar a todos los que deseen expresarse para que tengan los medios de hacerlo – y para aquellos que quieren escucharlos, los medios para oírlos. ((Del manifiesto de Global Voices))
We believe in free speech: in protecting the right to speak — and the right to listen. We believe in universal access to the tools of speech.
To that end, we seek to enable everyone who wants to speak to have the means to speak — and everyone who wants to hear that speech, the means to listen to it. (From the Global Voices Manifesto.)
For those of us who become volunteers, life can sometimes become a frustrating and painful experience. You end up feeling like nothing you do is enough, no matter how hard you try. For me, belonging to Global Voices is, in a way, a refuge from that feeling; being, at least once a week, among these extraordinary people and feeling like, while individually it may be difficult, all of us together are capable of achieving real changes and building lasting things.
2014 was an extremely difficult year for me. A year that I ended immersed in a deep depression without any desire to continue on. So when I was told that I was going to participate in the Global Voices Summit in January, I knew that I just had to bear just a few more weeks, that meeting with these people would recharge my batteries, restore hope for me, reinstate my desire to work.
As always, I was not let down.
Written byMarianne Diaz
Recent Translation posts
March 21, 2019Design
Embedding Tweets on GV: Tutorial video and updated guidelines to stop making translators sad!
March 19, 2019Activism
Violence tiptoes in on jokes, stereotypes, and lies–It catches us by surprise
February 25, 2019Announcements
Global Voices becomes primary source for global translation competition in Czech Republic
Hope all the many following years be full of happiness!
Pingback: Global Voices Community Blog » GV Board Elections 2017: Marianne Díaz Hernández
[…] the last seven years, Global Voices has been for me a home, a family (a family that reaches every corner of the world) as well as a place where my actions can help make a difference. I want to serve as a Volunteer […] | cc/2020-05/en_middle_0078.json.gz/line1047 |
__label__cc | 0.663936 | 0.336064 | in Football Manager, Tactics
Three in One Tactical Planning – Colours of the Flag
paulakanorthman December 20, 2019, 4:02 pm 1 Comment
Welcome to Three in One Tactical Planning, part of the Colours of the Flag series which will be running on Dictate the Game, in this post we will be looking at how in Football Manager 2020 you can create three tactics, all to aid and work together to get you the points needed in this virtual world of FM20. Don’t forget to head over to other posts on the website after you have enjoyed this Three in One Tactical Planning post. I recommend this Total Football DNA post by Crusadertsar.
Some clubs come with the backing of a town, others with a district, county, community or more whilst F.C. Andorra come with the backing of a nation. Imagine setting up a football club in your country to find that not only are you the only one but there is no league structure to enter and no national team for your players to aspire to play for, this was the case in 1942 when F.C. Andorra formed.
In 1942, Andorra held a population of roughly 6,000 (based on 1939 figures), this is the same amount of people that can fit inside Dagenham or Woking’s stadiums, or they could all visit Morcambe and have some seats spare for the locals to still turn up. A tiny country landlocked by France and Spain but a country with a dream, a dream of having a football team, 52 years before the Andorran FA was formed. Maybe looking up and down, F.C. Andorra decided to head south and join the Spanish league system, donning the colours of the flag, blue, yellow and Red.
So, where do we come in, F.C. Andorra interest me, a side who has spend most of its existence in the lower reaches of Spanish football but in December 2018, a group involving Barcelona defender Gerard Piqué invested in the club giving them a boost in popularity around the world and even more so in the 2019/2020 season after a side dropped out of the Spanish third tier, F.C. Andorra jumped in and purchased the spot for a reported 452,022 euros (£411,000). Now, us Football Manager (FM) geeks know them as a great club and country (c+c) challenge with the Andorra National team, other nations and clubs like San Marino who played in the Italian league before a recent merger ruined our FM dreams of a C+C with them. Do not worry though, initially I need to give my focus to F.C. Andorra alone and maybe later in this journey we can look at the National team position.
Season 1, the three in one tactical planning, the plan is to create three tactics all to work together within a 90 minute game, all designed to aid in the sole focus of 3 points and a clean sheet. The solid start, the attacking middle period and the defensive ending. Can this system of a three in one work, can you create three tactics which can work without making a substitution? Let’s be honest here, substitutions are needed when legs are tired, when players are not on form, when players have scored three goals and you want them to get a virtual standing ovation but apart from this, can we design a three in one tactical plan where players can move around the pitch depending on the minutes on the clock.
The 4-4-2: opening the game, a period of feeling each other out, a period of watching the opposition and deciding the best set up to prevent them winning and giving you the best chance of winning, do we need to stick with flat banks, will our second set up (4-2-3-1) of players between the lines give us a better control, will we need to defend deeper with our 4-1-4-1… all questions to be asked in the first 15 minutes of a game. Now with this 4-4-2 it is designed as my starting tactic, a tactic which suits my players, gives me nice solid lines of defence and midfield which also gives me a better vision of the opposition, when your team is playing with two lines of four, it is easier to see gaps that the opposition are exploiting, be it playing a defensive or offensive midfielder in the spaces. This tactic creates chances for me as well as giving me the first line of defence in my initial goals in a game, do not lose whilst trying to win.
Moving onto the 4-2-3-1, a tactic designed to find space, a tactic designed to be more offensive as well as keeping the solid two in central midfield as an aid to my defence. This side of the three in one tactic fits well as playing with two strikers, often one of them has the ability to drop back into the AMC role as well as my wide men being capable of pushing into the AMR/L role. I often will move onto this tactic after 20-30 minutes of the game and continue with it until we are at the 70/75th minute, if we have not scored a goal to give us the lead by that point, I would often settle for a point and switch to the third tactic. Now, if we are losing a game by one goal, then this tactic would be in play until we have either got back into the game or the game is over.
Final part of this three in one tactical plan is my ‘put us all back and don’t let them score’ tactic, also known as 4-1-4-1. This tactic has a lot behind it including short free kicks and corners, time wasting and no one going forward for set pieces apart from my striker, everyone else is either outside the box or they have gone short for the kick and plan on wasting even more time once they get the ball. The aim of the tactic is simple as explained above, stop the other team scoring and secure the three or one point if needed!
A look at the first 20 games of this Three in One Tactical Planning
We are 20 games into the league campaign with F.C. Andorra and sitting in 4th place, only 5 points off top place Castellón. We are expected to finish in the top half of the table but currently we are more likely to be finishing in a playoff spot and battling to win promotion to the second tier of Spanish football.
In terms of the tactical influence on this league position, it has been huge. We have had to battle in games against some very good teams like Castellón and FC Barcelona B being two top top teams in this league, shown by their current position but without a doubt the results against the smaller clubs has been the reason we are in the position we are in.
As you can see below, we have played 20 games and currently we have only conceded 3 goals in the second half of games, now straight away it shows we are poor at the start of games and our work rate, desire and tactical planning is showing in the second half but no team is perfect and after 20 games we must take positives. The defensive side of the team, to shut up shop, to see the game out and not concede a single goal in the final 15 minutes of games makes me very proud and gives me positives going into the second half of the season.
There is a long way to go with these three tactics, a lot of editing, adjustment and reworking completely for certain areas of the tactics but that is the fun of FM and football in general, you are never at a perfect point where you are completely happy and there is always work to do.
I would love to see some examples of your tactical set ups and how you deal with certain match day situations. Feel free to reply to this post below or contact me for a more one to one chat on twitter at https://twitter.com/TN_TheNorthman.
Previous article Young Devils – Total Football DNA and Two Johans
Next article Jóvenes Diablos – The Spanish 4-1-4-1 Armada
Written by paulakanorthman
Stuart Blair says:
Superb article. Love the fact you have created three systems to cover different scenarios. Lots of articles on a single system, i prefer this kind of tactical flexibility.
Look forward to seeing where this goes.
Young Devils – Total Football DNA and Two Johans
Jóvenes Diablos – The Spanish 4-1-4-1 Armada
FM20 Dictate The Podcast Season 2 Episode 3
https://dictatethegame.com/wp-content/uploads/2019/12/DTGPodS2E3.mp3
Dictate The GameFollow
Dictate The Game@DictateTheGame·
A weekend of FM and football? Sounds about right
Retweet on TwitterDictate The Game Retweeted
Unconventional Wingers@UWingers·
The first of my many articles with the boys. Enjoy 💜 https://t.co/QOmsEX5g3m
With the Canadian Premier League being a new addition. UW explores the shores of Vancouver island with @pacificfccpl, we are in for a fun adventure. https://t.co/xwlak9qnQ2 | cc/2020-05/en_middle_0078.json.gz/line1049 |
__label__cc | 0.729527 | 0.270473 | Awareness ribbons (452) + -
Heterosexuals (433) + -
Audio Interview, Ronald Gold, June 23, 1973
Homosexuality--Psychological aspects, Mass media--Public relations, Press, Homosexuality on television
Audio Interview, Mike, 1974
Transactional analysis, Masculinity, Parent and child--Family relationships, Counseling, Sex role
Audio Interview, Dean Hannotte, undated
Sex role, Masculinity, Femininity, Counseling, Gays--Counseling of
Counseling, Gays--Counseling of, Group counseling
Green Thursday, radio program, December 19, 1974, source recording
Homophobia--Prevention, Prejudices--Study and teaching
Green Thursday, radio program, February 20, 1975, source recording
Sexism, Feminism, Elections, Lesbians, Gay politicians
Video Interview, John Noble, August 2, 2012
Nonprofit organizations--Finance, Federal aid to nonprofit organizations, Homophobia, Gays--Political activity
Video Interview, Ove Overmyer, May 23, 2012
Gays--Political activity, Political Campaigns, Labor unions, Homosexuality in the workplace
Video Interview, Jackie Nudd, August 16, 2012
AIDS (Disease), HIV (Viruses), AIDS (Disease)--Patients--Services for, AIDS (Disease)--Social aspects
Video Interview, Bess Watts and Anne Tischer, January 21, 2013
Same-sex marriage, Gays--Political activity, Homosexuality--Religious aspects, Lesbians
Audio Interview, Tom Petrillo and Bill Reamy, March 15, 2012
Homosexuality--Psychological aspects, Gay lawyers, Gays--Legal status, laws, etc., AIDS (Disease), Gay psychiatrists
Audio Interview, Thomas Privitere, January 3, 2013
Domestic partner benefits, Labor unions, Labor movement, Same-sex marriage, Homophobia, Homosexuality in the workplace
Audio Interview, Michael Robertson, February 2, 2012
Homophobia, Police misconduct, Federal aid to nonprofit organizations, Discrimination in law enforcement | cc/2020-05/en_middle_0078.json.gz/line1053 |
__label__wiki | 0.734861 | 0.734861 | ✕ Powered by Google Custom Search:
UCLA Men’s Basketball Midseason Issue
PRIME: The Billion Dollar Patent
Women’s soccer’s Mal Pugh to leave UCLA for professional career
By Michael Hull
Sports, Women's Soccer
Freshman Mal Pugh has left UCLA to pursue a career in professional soccer. Pugh had just enrolled in classes for winter quarter after forgoing the fall soccer season in preparation for the U-20 Women's World Cup. (Aaron Ontiveroz/The Denver Post)
The headliner of UCLA women’s soccer’s No. 1 recruiting class for the 2016 season will not be suiting up for the Bruins for an official in-season game.
United States women’s national team starter Mal Pugh has left UCLA to pursue a professional soccer career, UCLA Athletics announced Monday.
“This decision was certainly not easy for me to make,” Pugh said in a statement to UCLA Athletics. “UCLA soccer brought amazing things to my life, and chasing after a national championship with my friends and teammates would’ve been special, but I could not turn down this opportunity.”
At the 2016 Summer Olympics, Pugh became the second youngest women’s soccer player ever to compete for Team USA, and became the youngest women’s soccer player in United States history to score for Team USA with a strike in the 60th minute against Colombia on Aug. 9.
The U.S. fell to Sweden in the quarterfinal, losing the opportunity to vie for a fourth-straight gold medal.
Pugh enrolled in classes winter quarter, having forgone the fall quarter and the 2016 NCAA season in preparation for the U-20 Women’s World Cup along with UCLA teammate Marley Canales. At the tournament, Pugh scored two goals, one in a 3-1 win over New Zealand, and another in a 1-1 draw with Ghana.
“We are sad to see Mal depart UCLA, but it’s exciting for her to have such a unique opportunity,” said coach Amanda Cromwell, UCLA Athletics reported. “We’ve seen her develop and grow into an amazing young woman and player. Mal will always be a Bruin, and we have no doubt that she is destined for great things as her career progresses.”
Pugh was set to make her debut this fall alongside Canales and a women’s soccer team that also has rising sophomore midfielder Jessie Fleming, who won a bronze medal with the Canadian national team at the 2016 Summer Olympics and was named Top Drawer Soccer’s Freshman of the Year.
Michael Hull |
Hull was an assistant Sports editor from 2016-2017. He covered men's water polo and track and field from 2015-2017 and women's water polo team in the spring of 2017.
@michaelchull
Comments are supposed to create a forum for thoughtful, respectful community discussion. Please be nice. View our full comments policy here.
LA City Council recently voted to reinstate limitations regarding homeless LA drivers living in their cars. These regulations will run until January, and states that they are prohibited from spending the night in their cars on residential streets, or live in their vehicles at any time within a block of a park, school, preschool or daycare facility. What are your thoughts on this? Reinstating these limitations could cause more issues than it could fix. Homeless drivers that use their cars as a home are not the root problem the LA City Council should be focused on addressing. It was a good idea to reinstate these limitations, since homeless drivers could possibly become intrusive and pose a threat to residential areas and places where children are most present. These limitations are neither good or bad, and does not affect me as a student because I am not homeless, nor am I living in my car. I have feelings about this that are not described in the options above. Submit View results without voting »
NEEDED: part-time after school nanny for 2 boys - ages 3.5 and 6. Must be responsible and nurturing with good references, with experience babysitting and driving kids around LA. Must have safe reliable car + clean driving record. 10-15 hours per week. Pickup from school in West LA @ 3pm and drive to playdates/park or home to West Hollywood. Hours: Mon-Fri 3-7pm, later on occasion. Looking to hire ASAP. Pls email [email protected] if interested. • Child Care Wanted
HEALTHY VOLUNTEERS wanted for CEDARS-Sinai MRI STUDY. No radiation. Up to 3.5 hours. $40.00 - $155.00. Contact study coordinator at 310-423-0075. [email protected] • Research Subjects
More classifieds »
Donate to the Daily Bruin
Content copyright © 2020 the Daily Bruin | cc/2020-05/en_middle_0078.json.gz/line1058 |
__label__cc | 0.671723 | 0.328277 | Dershal celebrates first conversion of diesel car into electric vehicle - Daily News Egypt
Business Dershal celebrates first conversion of diesel car into electric vehicle
Dershal celebrates first conversion of diesel car into electric vehicle
Dershal Company for the manufacture of batteries for electric cars celebrated the conversion of the first diesel car into an electric car on Sunday, at the company’s engineering headquarters in Wadi Houf. The ceremony was attended by the President of Dershal Company, Hassan Dessouky; the Chinese ambassador to Egypt, Song Aiguo; the Chinese Commercial Attaché …
Nour Ahmed and Zamzam Mostafa March 12, 2019 Be the first to comment
Dershal Company for the manufacture of batteries for electric cars celebrated the conversion of the first diesel car into an electric car on Sunday, at the company’s engineering headquarters in Wadi Houf.
The ceremony was attended by the President of Dershal Company, Hassan Dessouky; the Chinese ambassador to Egypt, Song Aiguo; the Chinese Commercial Attaché in Egypt, General Ashraf Dershal; the Technical Advisor to Dershal, Ibrahim Omran; the Head of the Automotive Department at Ain Shams University, Amr Helmy; the Professor of Engineering at Zewail University, Major General Amin Yahya Abdellah; the Chairperson of the Engineering Company for Automobile Industry, Major General Mohsen Al Mahlawy; the Head of the Production Sector of the Egyptian General Petroleum Corporation, Abdul Moneim Al Qadi; the Vice Chairperson of the Chamber of Engineering Industries, and a group of the Chinese embassy officials in Cairo, as well as a number of engineers and technicians from the company.
During the celebration, Dershal reviewed a pickup truck manufactured by the engineering company, which was converted from a diesel car into an electric car by 100% Egyptian hands. The company also offered a range of electric car batteries which were produced in cooperation with Chinese companies.
Hassan Dessouky, the president of Dershal, said that the process of converting the car cost about EGP 150,000, adding that the company aims in the coming period to convert pickups and minibuses into electric cars, in cooperation with the engineering company, but does not target passenger cars at the moment.
He called on the Egyptian government to support the conversion of cars into electricity in the coming period through the establishment of infrastructure for the fast charging of cars and the provision of the necessary fast charging stations on roads and streets, explaining that fast charging stations in the street are different from other chargers that are slow.
The Chinese ambassador stressed in his speech the strength of the relationship between China and Egypt in the diplomatic, industrial, and commercial fields, pointing out that cooperation between the two countries exceeded the stage of import and export. China is now going to support the infrastructure in Egypt and to enter the field of factory construction, manufacturing, and production.
He pointed out that President Abdel Fattah Al-Sisi pays special attention to the field of the electric car industry in Egypt, stressing that during his stay in Egypt, he witnessed many developments in the Egyptian economy and industry, especially the automotive industry.
Furthermore, he added that China is one of the largest international markets in the field of electric cars, and it produces 1.8m electric cars annually, adding that this will make cooperation between Egypt and China in the field of electric car industry very fruitful.
Topics: Dershal diesel car electric vehicle
Nour Ahmed
More in Nour Ahmed
AMIC’s reports between cars’ sales figures, actual sales
Awaited protocol for automotive industry between FEI, South Africa
Automotive companies’ profits are 16% of car price, ‘Let it Rust’ campaign is almost over: Masrouga
CBE interest rate cut won’t benefit automotive market: experts
Feeder industries need government support: El Kady
Individual imports of European cars, solution to crisis or unnecessary experiment?
https://dailyfeed.dailynewsegypt.com/2019/03/12/dershal-celebrates-first-conversion-of-diesel-car-into-electric-vehicle/
MG Developments launches first permanent Kitesurfing centre in Blue Blue Sokhna Resort
Banking coalition funds Al Sharqiya Sugar Manufacturing Company with EGP 3.1bn
MG Developments begins implementation of HQ project in New Cairo
Egypt, Nissan to develop local electric vehicle ecosystem
Chairperson of Kayan: Volkswagen will not enter negotiations to revive El Nasr Cars
In Detroit, carmaker Volkswagen opens arms wide to US
Fuel economy question, lubricants’ role in achieving it
Environment ministry submits a study on electric vehicles to Cabinet this month
Latin America grows fond of electric buses
Environment ministry submits a study on electric vehicles to Ministers Council this month
How Volkswagen is gearing up to be an electric car leader
Toyota in pole position as Warsaw kick-starts electric car road trip
March 12, 2019 Breaking News | cc/2020-05/en_middle_0078.json.gz/line1059 |
__label__wiki | 0.939935 | 0.939935 | 100,000 new electric cars to be launched in Pakistan
Adviser to Prime Minister on Climate Change Malik Amin Aslam said the Ministry has prepared Electric Vehicle Policy to reduce air pollution in the country. He said the draft policy will be sent to the Federal Cabinet for approval soon.
He said the policy included multiple targets including the sale of 100,000 electric cars , vans, jeeps and small trucks in the next five years.
He further said that the steps are being taken to make all cities of the country green.
Amin Aslam said that Green Vision for Islamabad Capital Territory has been approved by the Federal Cabinet.
He said the government is also working in reducing the smog issue in the country and smog-less stoves will be introduced in this regard. He said Pakistan is also facing immense fog travels from India and Islamabad will adopt it as a cross border pollution issue highlighting it on SAARC and other regional forums.
He said the world institutions are acknowledging and appreciating the steps taken by Pakistan to meet climate change challenges and taking interest to provide assistant in these projects.
Notably, as reported in 2017, the future of electric cars shows potential in Pakistan as Mian Mansha revealed that Nishat Group is trying to convince Hyundai to bring electric and hybrid cars in Pakistan.
Nishat recently entered into a partnership with the Hyundai Motors Co. to develop a greenfield project for assembly and sales of HMC passenger and 1-ton range commercial vehicles in Pakistan. | cc/2020-05/en_middle_0078.json.gz/line1060 |
__label__wiki | 0.550715 | 0.550715 | The 1,364 Units Coming to the U Street Corridor
by Nena Perry-Brown
UrbanTurf has been taking a look at the residential developments in the pipeline for various neighborhoods in the DC area. This week, we will revisit what is in-progress in the U Street Corridor.
If you missed them, here are the other neighborhoods we have covered this year:
The 1,458 New Units Coming to the H Street Corridor
The 692 New Units Coming to the 14th Street Corridor
The 1,101 Units Coming to Connecticut Avenue
The Development Rundown For Georgetown and the West End
907 Barry Place NW
The Howard University-owned warehouse at 907 Barry Place NW (map) has been vacant for quite a while. In partnership with architect Niles Bolton Associates, McKeever Services, Ambling University Development and Barry Place Partners, the 1.35 acre-site is slated to have a six-story, 319-unit mixed-use development built on the site. Fourteen of the residences will be flats on the street level along Barry Place, and another six will be two-story units along 9th Street; the remaining 299 apartments will be on the upper floors. Ten percent of the residential units will be for those making up to 80 percent of the area median income (AMI), and others will be set aside for Howard University staff. There will also be two levels of parking with 145 spaces. A raze application was filed last year and an application pending to close the public alley behind the building to make way for construction. Be sure to check out the mural on the side of the building before demolition begins!
965 Florida Avenue NW
One of the most-watched projects in the U Street area is the Whole Foods-anchored development at 965 Florida Avenue NW (map). Thirty percent of the units at the 428-unit development will be affordable, and there will also be a total of 343 parking spots on-site, 125 of which will be for residents. MRP Residential and Ellis Development also plan to widen the sidewalks surrounding the site and add a 4,400 square-foot public park to the west side of Florida Avenue. The design team consists of PGN Architects, Hord|Coplan|Macht, and mv+a.
story continues above
Grimke School Redevelopment
Last spring, Roadside Development and Sorg Architects were awarded the right to redevelop the Grimke School at 1925 Vermont Avenue NW (map) into a complex with retail, residential and community-oriented components. Out of a total of 62 residences, 13 will be affordable and 7 will be townhomes along 9 1/2 Street NW. The African American Civil War Museum will also make its home at the new project, and cultural partners will include Imagination Stage, Step Afrika!, and City Dance. The retail portion will take up 8,300 square feet of the street level.
Neighborhood Development Company purchased 2002 11th Street NW (map) from the adjacent Industrial Bank of Washington in January 2015. The bank is a contributing structure to the U Street Historic District and the facade will be restored, while the building fronting 11th Street will be razed to make way an addition of up to 10 stories with as many as 30 new residences. An application to raze the non-contributing structure was filed in February. Freelon Architects and Bonstra|Haresign round out the development team.
13/U
Currently under construction at the corner of 13th and U Streets NW (map) is a 130-unit residential building with 15,000 square feet of ground-floor retail from The JBG Companies. Amenities will include a clubroom, roof deck and gym; a Rite-Aid pharmacy trailer is currently on-site temporarily to replace the demolished store location. The architect for the development, which will also include 48 parking spots, is David M. Schwarz Architects.
1355-1357 U Street NW
The Goldstar Group is likely to bring condos designed by Bonstra|Haresign to 1355-1357 U Street NW (map), where they are aiming to add six floors to two historic rowhouses to create a 90-foot structure and furnish a total of 25 residential units. The addition would be stepped-back to preserve the scale of the street level, and only the facades will be maintained. Their proposal has generated some concerns from the Historic Preservation Review Board and will likely be revised to reduce the massing or increase the setback.
Portner Place
Portner Place is a two-part mixed-use redevelopment designed by Eric Colbert & Associates set for the 1400 block of U and V Streets NW. The garden-style Section 8 housing currently on-site will be replaced by 340-370 apartments. An eight-story wing called Portner Flats at 1440-1450 V Street (map) will contain 90-100 affordable rental units, while there will be an eleven-story wing at 1441-1449 U Street (map) with 250-270 market rate apartments and ground-floor retail. The development team consists of Somerset Development Company, Jonathan Rose Companies, and the Rose Green Cities Fund.
U Street Corridor Development
See other articles related to: u street corridor, u street condos, u street
This article originally published at https://dc.urbanturf.com/articles/blog/the_units_coming_to_the_u_street_corridor/11060
skidrowedc@gmail.com said at 6:39 pm on Wednesday April 6, 2016:
You're missing Atlantic Plumbing, Parcel C, on Florida Avenue between the Floridian and 965 Florida. Its north wing actually appears at the right side of the 965 Florida Ave rendering. As with Atlantic Plumbing A & B (completed at 8th & V Streets nearby), Morris Adjmi of NYC is the design architect, with Eric Colbert & Associates as the Architect of Record. Eric Colbert & Associates should also be credited as the architects for Portner Place, and whomever is the architect for 1355-57 U (I don't know, but UrbanTurf should!) should be credited, too.
editor2014@urbanturf.com said at 6:51 pm on Wednesday April 6, 2016:
skidrowedc, Oversight on our part. We have added the architects for both projects. Thanks as always.
RE/MAX Excellence Realty
Deb Levy
The newspaper just published an article naming DC as its top place to visit in 2020. ... read »
Why DC is The New York Times Top Place to Visit in 2020 | cc/2020-05/en_middle_0078.json.gz/line1070 |
__label__cc | 0.577022 | 0.422978 | Social Responsibility & BBBEE
Custody transfer loading and metering solutions
Fixed & portable clamp on Ultrasonic
Medium to small positive displacement & turbine
Bypass Level Indicators
Mechanical Level Indicator
Gas & Flame Detetction
Vapour Recovery Units
Precision Digital Displays
Viscosity Measurement
Tank Safety
Bursting Discs
De-humidifers
Flame Arrestors
Free Vents & Weather Cowls
Gauge Hatches
Tank Blanketing Regulators
Tank Emergency Vents
Tank PV Valves
Actuated Control Valves
Lecore Tank Valves
Oil and Gas Solutions
Chemical Industry Applications
Projects and Engineering
Contact DCM
Specialists in the Petrochemical Industry
Manufacturers & developers of industry leading products.
PROJECTS ENGINEERING
Our mission is to be the fore-runner of innovation and excellence across industries, to be respected as a provider of customer-driven solution and services, and to set standards in all that we do with integrity and leadership.
About DCM
DCM Group has forged a name in the Oil and Gas industry in South Africa, and internationally, for being a fore runner, in terms of technology, and for our dedication to the highest level of quality in all our products.The DCM Group, established in 1986, has forged a reputation of excellence in the Process Control Instrumentation and Petro Chemical Industry in Southern Africa. With offices in all major business centres and a large factory in Durban, we proudly offer a full manufacturing portfolio. The Group consists of five main business units, each with specialized capabilities covering different industries and applications, namely: Oil and Gas Solutions, Chemical Industry Applications, Pharmaceutical Industry, Paper Industry as well as Project & Engineering.
The DCM Factory
DCM products are engineered and manufactured in our factory which was founded in 1968. Products range from Flow Meter Skids, Loading Arms, Pressure Vacuum Breather Valves, Flame Arrestors, Emergency Vent Valves and Dip Hatches to name a few.
We have engineering staff who can design special skids to Petrochemical specifications. This includes engineering design, fabrication, welding, machining, assembly, testing, QA/QC, FAT and documentation to the Petroleum industry’s export standards.
Our 1200m manufacturing facility, based in Durban South Africa, has quick access to the airport and harbour, for local and export deliveries.
Our factory consists of:
Metal work CNC lathes
Welding equipment, with certified welders
3D CAD drawing office
QA /QC Managed
Documentation in accordance with ISO 9000
Our mission is to be the fore-runner of innovation and excellence across industries, to be respected as a provider of customer-driven solutions and services, and to set standards in all that we do with unmatched experience and integrity.
We've worked with these amazing clients.
Leave your contact details and we will call you.
We value your privacy! Any data you submit will not be shared with any third party.
DCM Group
DCM Group has forged a name in the Oil and Gas industry in South Africa, and internationally, for being a fore runner, in terms of technology, and for our dedication to the highest level of quality in all our products.
JHB Office
16 Skeen Blvd, Bedfordview,
Fax: +27 (011) 397 7777
DBN Office
161 Goble Road, Morningside,
strini@dcm.co.za
Fax:+27 (031) 312 8084
© 2018 DCM Group. Designed by Pixel Bay.
16 Skeen Blvd, Bedfordview, Johannesburg, 2007
mail@dcm.co.za
Open every day from 8am to 5pm | cc/2020-05/en_middle_0078.json.gz/line1071 |
__label__wiki | 0.78045 | 0.78045 | Bridging Decapentaplegic and Wingless signaling in Drosophila wings through repression of naked cuticle by Brinker
Lin Yang, Fei Meng, Da Ma, Wei Xie, Ming Fang
Development 2013 140: 413-422; doi: 10.1242/dev.082578
Lin Yang
Institute of Life Sciences, MOE Key Laboratory of Developmental Genes and Human Diseases, Southeast University, Nanjing 210096, China.
Fei Meng
Da Ma
Wei Xie
Ming Fang
For correspondence: mfang@seu.edu.cn
Supp info
Wnts and bone morphogenetic proteins (BMPs) are signaling elements that are crucial for a variety of events in animal development. In Drosophila, Wingless (Wg, a Wnt ligand) and Decapentaplegic (Dpp, a BMP homolog) are thought to function through distinct signal transduction pathways and independently direct the patterning of the wing. However, recent studies suggest that Mothers against Dpp (Mad), the key transducer of Dpp signaling, might serve as a node for the crosstalk between these two pathways, and both positive and negative roles of Mad in Wg signaling have been suggested. Here, we describe a novel molecular mechanism by which Dpp signaling suppresses Wg outputs. Brinker (Brk), a transcriptional repressor that is downregulated by Dpp, directly represses naked cuticle (nkd), which encodes a feedback inhibitor of Wg signaling, in vitro and in vivo. Through genetic studies, we demonstrate that Brk is required for Wg target gene expression in fly wing imaginal discs and that loss or gain of brk during wing development mimics loss or gain of Wg signaling, respectively. Finally, we show that Dpp positively regulates the expression of nkd and negatively regulates the Wg target gene Distal-less (Dll). These data support a model in which different signaling pathways interact via a negative-feedback mechanism. Such a mechanism might explain how organs coordinate inputs from multiple signaling cues.
During animal development, proper organogenesis is achieved by simultaneous actions of highly conserved signaling pathways. One of the best-studied examples is the Drosophila imaginal discs, in which multiple signaling molecules, including Wg and Dpp, function as organizational cues to guide patterning. Both Wg and Dpp are thought to act as morphogens that activate a set of pathway-specific target genes in a gradient-dependent manner (Cadigan, 2002; Tabata and Takei, 2004). For instance, Wg target genes are predominantly regulated by the Wnt response elements (WREs) occupied by the transcription factor T cell factor (TCF; Pan – FlyBase) (for a review, see Cadigan, 2012). Wg signal transduction is centered around the stability of the cytosolic pool of Armadillo (Arm, the Drosophila homolog of β-catenin). Wg stabilizes Arm, causing its cytosolic accumulation and translocation into the nucleus, where Arm displaces co-repressors such as Groucho (Gro) and binds to TCF (Cadigan, 2012). This switches the TCF complex from a repressor to a transcriptional activator and turns on Wg target gene expression. In the case of Dpp target gene activation, two mechanisms have been proposed (for reviews, see Affolter et al., 2001; Affolter and Basler, 2007). In the first, Dpp-dependent receptor activation induces phosphorylation of Mad, which then forms a heteromeric complex with Medea (Med) in the nucleus and functions as a sequence-specific activator (Wisotzkey et al., 1998). Alternatively, Dpp signaling can act by inhibiting Brk, a transcriptional repressor (Campbell and Tomlinson, 1999; Jaźwińska et al., 1999; Minami et al., 1999). This model has been well addressed in the developing fly wing, in which dpp is expressed in a narrow stripe across the anterior/posterior (A/P) boundary. brk is repressed in a dose-dependent manner by Dpp through a Schnurri-Mad-Med repressing complex and is expressed in complement with the Dpp gradient (Müller et al., 2003). Brk thus acts as a major interpreter of Dpp signaling in wing discs.
Developmental signaling pathways are often regulated by negative-feedback regulators, thus limiting their range of actions. Such regulation contributes to the refinement of target gene expression in cells receiving multiple signaling cues (Gerlitz and Basler, 2002; Chang et al., 2008a). nkd, expression of which is universally induced by Wg, is one such feedback inhibitor of Wg signaling in flies (Zeng et al., 2000). Nkd interacts directly with Dishevelled (Dsh) to antagonize Wnt signal transduction (Rousset et al., 2001), suggesting that nkd functions mainly to limit Wg activity in order to achieve proper activation of Wg target genes.
In general, crosstalk between signaling pathways ensures the proper balance of signaling during development. A notable example of this is in fly leg discs, in which Wg and Dpp signaling mutually repress each other to specify ventral and dorsal leg fates, respectively (Brook and Cohen, 1996; Jiang and Struhl, 1996; Johnston and Schubiger, 1996; Morimura et al., 1996; Penton and Hoffmann, 1996; Theisen et al., 1996; Morata, 2001). In addition, Wg and Dpp are both required for cell fate specification along the proximal/distal axis via direct activation of Dll, precise expression of which is crucial for leg development (Estella et al., 2008). In the wing disc, wg and dpp are expressed in perpendicular narrow stripes along the dorsal/ventral (D/V) and A/P boundaries, respectively. Unlike in leg discs, where wg and dpp are expressed in distinct domains, these two signaling molecules share a common expression pattern in the center of the wing pouch. Recent studies have suggested that Mad, one of the key transducers in Dpp signaling, might play a role in the Wg pathway in the wing. One study suggests that Mad and Arm compete for binding to TCF, with Mad serving as an intermediate through which Dpp signaling suppresses the Wg pathway (Zeng et al., 2008). Other studies, however, propose an alternative model in which Mad is required for both Wg and Dpp signal transduction depending on its phosphorylation status (Eivers et al., 2009; Eivers et al., 2011).
In this article, we uncover an additional level of Wg-Dpp crosstalk involving Nkd, a feedback inhibitor of Wg signaling, and Brk, the major transcriptional repressor for Dpp target genes. We show that Brk directly represses nkd in vitro and in vivo. The biological relevance of such regulation is exemplified in fly wing discs, where brk is required for proper expression of Wg targets in the presumptive hinge region, coincident with the fact that brk is expressed at the highest level in this area. In adult wing, altering brk levels gives rise to phenotypes similar to the gain and loss of Wg activities. Moreover, activation of Dpp signaling reduces Dll levels and increases nkd expression. Taken together, our data support a novel model in which Dpp signaling inhibits Wg outputs through a brk-nkd negative regulatory circuit.
Drosophila genetics
All lines were cultured with standard medium at 25°C. brk somatic clones were generated exactly as described (Schwank et al., 2008). P[UAS-brk] (Jaźwińska et al., 1999), P[UAS-nkd] (Zeng et al., 2000), P[UAS-tkvQD] (Nellen et al., 1996) and P[UAS-TCFΔN] (van de Wetering et al., 1997) were used in the overexpression experiments. P[UAS-brkRNAi] (VDRC# GD2919, KK101887) and P[UAS-nkdRNAi] (VDRC# GD3005) lines were obtained from the Vienna Drosophila RNAi Center. Experiments with En-Gal4 and Vg-Gal4 were carried out at 25°C, whereas those with Ptc-Gal4 were carried out at 20°C. For temporal ectopic expression of brk and tkvQD driven by En-Gal4, P[UAS-brk] and P[UAS-tkvQD] were crossed with P[En-Gal4], P[tubP-Gal80ts], P[UAS-GFP] line, and the progenies were shifted to a restrictive temperature at 29°C from the second instar larval stage and thereafter (Schwank et al., 2008). For heat-shock induction of tkvQD, P[Hsp70-Gal4]/P[UAS-tkvQD] third instar larvae were heat shocked at 37°C for 1 hour, once a day for 2 days, and total RNAs were extracted from young adult flies 4 days after eclosion. For Nkd-lacZ reporter expression, we used a line containing both upstream and intron WREs of nkd as described (Chang et al., 2008a).
Rabbit polyclonal anti-Brk antiserum was generated against a Brk fragment (361-619 aa). For western blot analyses, anti-Brk (1:5000), anti-Tubulin (1:5000, Sigma) or anti-Flag (1:5000) antibodies were used. Immunostaining of imaginal discs was performed as described (Fang et al., 2006) using the following antibodies: anti-Dll (1:500) (Panganiban et al., 1995), anti-Sens (1:1000) (Nolo et al., 2000) and anti-Wg (1:200, Developmental Studies Hybridoma Bank at the University of Iowa, USA).
Electrophoretic mobility shift assay (EMSA)
EMSA was performed with a Lightshift Chemiluminescent EMSA Kit (Thermo Scientific) according to the manufacturer’s instructions. For production of recombined GST-BrkDBD, a cDNA fragment encoding 44-99 amino acid residues of Brk (Saller et al., 2002; Cordier et al., 2006) was expressed in Escherichia coli BL21 and affinity purified. The probe sequences were 5′-acaaaacgctttgtcggtcattagctttgagtggacgccg-3′ for wild type and 5′-acaaaacgctttgtcggtcattagctttgagtgtcagccg-3′ for the mutant form.
Kc cells culture, RNAi knockdown, real-time quantitative PCR (qPCR) and reporter assay
Kc167 (Kc) cells were routinely cultured in the Schneider’s Drosophila media (Life Technologies) containing 5% FBS (Life Technologies) at 25°C. RNAi-mediated gene knockdown was performed as described (Worby et al., 2001). Double-stranded RNAs (dsRNAs) for control and gro were synthesized as described (Fang et al., 2006), and the dsRNA primer corresponding to brk were 5′-gaattaatacgactcactatagggagaaatttcaagcggcccaaggattcttcg-3′ and 5′-gaattaatacgactcactatagggagatgttgctccttctgatgctgcatttgagg-3′. A million cells were cultured in serum-free medium for 1 hour, 9 μg of a mixture of two dsRNAs (combination indicated in Fig. 1A, or the indicated one plus the control dsRNA) was added, and FBS was supplemented to reach a final concentration of 5%. Total RNAs were isolated 4 days later using the RNeasy Mini Kit (Qiagen), and 2 μg of each sample was reverse transcribed with a superscript III reverse transcriptase (Life Technologies). qPCR assays were performed with Applied Biosystems 7300 Real-Time PCR System (Life Technologies). qPCR detections for wg and brk were carried out with a FastStart Universal SYBR Green Master Mix (Roche Applied Science). The primer pairs were for wg, 5′-cgtcagggacgcaagcata-3′ and 5′-attgtgcgggttcagttgg-3′; for brk, 5′-tcgggagctttgaatttcaag-3′ and 5′-tggctgtttgtggcattctc-3′. nkd qPCR was performed with FastStart TaqMan Probe Master (Roche Applied Science). The primer pairs and probe used were 5′-cgcatccgactggaggaa-3′, 5′-ggtcgtagaacgtgaacgagaac-3′ and 5′-FAM-tcacctgcgacgtgtccgtgg-BHQ1-3′. For nkd qPCR analysis in wing discs, total RNAs were extracted from 30 wing discs of third instar larvae using the RNeasy Micro Kit (Qiagen).
The reporter gene assay was performed as previously described (Fang et al., 2006; Chang et al., 2008a), except that pArm-Arm* and pArm-lacZ instead of pAc vectors were used. Reporter constructs were generated as previously described (Chang et al., 2008a). For IntE1200, primers 5′-agctcacgcgtgctctcgggccacttcttggaa-3′ and 5′-cgcatcccggggcctgccactttgcttcagtgaga-3′, with underlined bases indicating introduced restriction sites, were used to amplify the intronic region of nkd, and subcloned into a pGL3 (Promega) vector upstream to a hsp70 minimal promoter (Chang et al., 2008a). IntE255 was as described (Chang et al., 2008a). IntE255Brkmut were generated by PCR-introduced base substitutions that were the same as in the mutant probe in the EMSA assay. pAc-Brk-2XFlag was made from insertion of a PCR-amplified full-length coding sequence of brk plus two Flag tags into pAc5.1 (Life Technologies).
Transient transfections were carried out with Fugene HD (Roche Applied Science) according to the manufacturer’s instructions. A plasmid mixture containing 100 ng reporter, 1 ng pArm-lacZ, 10 ng pArm-Arm* and 10-80 ng pAc-Brk-2XFlag were co-transfected into a million cells. The empty pAc5.1 vector was used to normalize the DNA content or as a control. For experiments with RNAi followed by reporter assay, a million cells were incubated with 9 μg control or brk dsRNA for 2 days, washed with PBS twice and then transfected with pArm-lacZ (1 ng) and pArm-Arm* (10 ng). Luciferase and β-galactosidase activities were assayed 2 days after transfection, using the Tropix Luc-Screen and Galacto-Star Kits (Life Technologies) and quantified with a Chameleon plate luminometer (Hidex Personal Life Science). Transfection efficiencies were normalized to the β-galactosidase activities.
Chromatin immunoprecipitation (ChIP)
ChIP assays were carried out according to a protocol from the Furlong lab (Sandmann et al., 2006). Briefly, about one gram of synchronized embryos were collected, fixed and sonicated with a Bioruptor sonicator (Diagenode) to generate DNA fragments of ∼500 bp in length. The immunoprecipitation were performed with anti-Brk serum (2 μl) or normal rabbit IgG (20 μg) and the subsequent steps were carried out as previously described (Fang et al., 2006). Primer pairs used in ChIP assays were 5′-accttctggctttggagcag-3′ and 5′-tgggctcctcataaactggc-3′ for CDS, 5′-tcaatcagacgtcagaggtaccg-3′ and 5′-ctgatggaagaaccgtgttgg-3′ for IntEBrk.
In situ hybridizations for nkd in imaginal discs were performed as previously described (Chang et al., 2008a). For quantifying the in situ signals, images were processed in Adobe Photoshop, converted to gray scale and inverted (supplementary material Fig. S3). The mean gray values were measured by ImageJ (NIH, v1.46). Three nonoverlapping areas in the nkd expression domain (near D/V boundary) were sampled from both anterior or posterior compartments and, for each individual disc, the mean gray values were measured and averaged, and the mean background value was subtracted from the average. Statistical analysis of the results was performed using ANOVA followed by post-hoc Tukey’s test for comparison between groups. For fluorescence in situ hybridization (FISH), an nkd probe of the same sequence was labeled with biotin. After hybridization, TSA amplification (PerkinElmer) was applied and visualized by TRITC-strepavidin (1:300, Jackson Immunochemicals) and anti-GFP antibody (Roche) staining.
Brk interacts directly with an intronic region of nkd
We have previously shown that C-terminal Binding Protein (CtBP) directly represses nkd, a direct target of the Wg signaling pathway, via an intronic region of nkd (Fang et al., 2006). In addition, the physical binding of CtBP to the nkd locus is independent of TCF (Fang et al., 2006). However, CtBP functions as a transcriptional co-repressor and is not likely to bind to DNA directly (for a review, see Chinnadurai, 2002). In exploring the potential transcription factor that would recruit CtBP to DNA, two pieces of data drew our attention to Brk, a CtBP-binding repressor in Dpp signaling (Hasson et al., 2001; Zhang et al., 2001). By RNAi-mediated gene knockdown in Drosophila Kc167 (Kc) cells, we found that Brk repressed nkd expression in parallel with Gro (Fig. 1A), consistent with the synergistic repression of nkd by CtBP and Gro (Fang et al., 2006). We took advantage of the aligned genome sequences from 12 fly species (Stark et al., 2007) and identified a putative Brk recognition site (Sivasankaran et al., 2000; Rushlow et al., 2001; Zhang et al., 2001) within a completely conserved 66-bp sequence in the first intron of nkd (Fig. 1B; supplementary material Fig. S1). In addition to the presumptive Brk site, we also noticed two perfect neighboring TCF sites (Fig. 1B) (Chang et al., 2008b). Interestingly, this 66-bp DNA region (referred to as IntEBrk) falls into a region that was previously termed IntE and has been carefully characterized as one of the major WREs directing nkd expression in response to Wg signaling (Fang et al., 2006; Chang et al., 2008a).
Brk represses nkd and directly interacts with its intronic region in vitro and in vivo. (A) Drosophila Kc cells were treated with dsRNA(s) as indicated, and nkd mRNA levels were normalized by β-tubulin56D (β-tub) expression. Note that the double RNAi treatment against brk and gro induces higher nkd expression than any of the single RNAi treatments, indicating a synergetic repression of nkd by Brk and Gro. (B) Schematic of the nkd locus showing the location and sequence of a conserved 66-bp sequence (IntEBrk) containing a presumptive a Brk site (pink) and two TCF sites (blue). The capital letters indicate the probe sequence in the EMSA assay shown in C. Regions for the ChIP analysis shown in D, IntEBrk and CDS, are indicated. Also shown are sequence regions (IntE1200, IntE255 and IntE255Brkmut) used in the reporter assays in Fig. 2, with bars standing for the predicted Brk site (pink) and TCF sites (blue) or a pink dashed bar for mutated Brk site. (C) Brk interacts with IntEBrk in vitro. EMSA shows that a recombinant GST-BrkDBD fusion protein causes a dose-dependent shift of the probe (see B) (lanes 3-6), which is abolished by 200× excess unlabeled probe (lane 7), a mutant probe (lane 8) or anti-GST antibody (lane 9). (D) Brk occupies IntEBrk in vivo, but only when Wg signaling is low. ChIP analysis using an anti-Brk antibody in fly embryos at 0-2 hours (when Wg signaling is low) and 5-7 hours AEL (when Wg is expressed) in DNA regions as indicated. DNA from ChIP was quantified by qPCR as described in the Materials and methods section. (E) Normalized mRNA levels of nkd, brk and wg relative to β-tub in the same embryos as in D. (A,E) mRNA levels were measured by RT-qPCR as described in the Materials and methods section. Data in A and D-E are representative results showing the averages from duplicate or triplicate sample sets, with error bars representing s.e.m. All experiments were carried out at least three times with similar results.
To test whether Brk interacts directly with IntEBrk, we performed an electrophoretic mobility shift assay (EMSA) using a recombined GST protein fused to the DNA-binding domain of Brk (GST-BrkDBD) (Jaźwińska et al., 1999; Saller and Bienz, 2001; Cordier et al., 2006). GST-BrkDBD caused a clear shift of a 40-bp IntEBrk probe (Fig. 1B,C) in a dose-dependent manner, indicating a direct interaction between Brk and IntEBrk. The interaction appeared to be specific: either an excessive amount of non-labeled probe or the addition of anti-GST antibody readily abolished the GST-BrkDBD-induced probe shift (Fig. 1C). Furthermore, we did not detect such a shift with a mutant probe in which three bases in the presumptive Brk site were substituted (Fig. 1C). Therefore, Brk is likely to interact with IntEBrk via the Brk site that we have identified.
We next investigated whether Brk interacts with IntEBrk in vivo and, if yes, whether such binding has any connection with Wg signaling? Therefore, we performed chromatin immunoprecipitation (ChIP) analysis on fly embryos. wg is initially expressed in embryos just prior to gastrulation, ∼3 hours after egg laying (AEL), and functions as one of the major factors directing the patterning processes in fly segmentation (Bejsovec and Martinez Arias, 1991; Dougan and DiNardo, 1992). Accordingly, as a negative-feedback regulator of Wg signaling, nkd transcript was absent 0-2 hours AEL and reached its highest level 4-8 hours AEL in embryos (Zeng et al., 2000). We therefore made extracts from 0-2 hours and 5-7 hours AEL embryos to test the binding of Brk to IntEBrk. Our data show that the physical occupation of Brk on this region was significant in 0-2 hours AEL embryos (Fig. 1D). In the 5-7 hours AEL embryos, however, the occupation of nkd by Brk was dramatically lower despite brk being expressed at a much higher level than in earlier embryos (Fig. 1D,E). These results indicate that Brk binds to nkd in vivo and that the physical occupation of nkd by Brk is inversely correlated with the level of Wg signaling.
Brk represses Arm-dependent activation of nkd intronic WRE in Kc cells
We have shown that Brk represses the Wg target nkd in Kc cells (Fig. 1A). To examine further whether Brk also influences Arm-dependent nkd activation, we carried out reporter assays in Kc cells using various fragments of the nkd intronic WRE (IntE), including IntEBrk. As previously reported (Fang et al., 2006; Li et al., 2007; Chang et al., 2008a; Parker et al., 2008), IntE reporters are highly activated by a constitutively active form of Arm (Arm*) (Freeman and Bienz, 2001) in Kc cells. We observed that a 1.2-kb IntE reporter (IntE1200, Fig. 1B) ∼4.5 kb downstream of the nkd transcription start site was activated ∼100-fold following a moderate dose of transfected Arm* (Fig. 2A). Following co-transfection with a Brk expression vector, Arm-dependent activation of IntE1200 was inhibited by Brk in a dose-dependent fashion (Fig. 2A,E). Consistent with this observation, RNAi-mediated brk knockdown in Kc cells significantly increased the Arm*-dependent activation of IntE1200 (Fig. 2B,F). Similar results have been observed in a shorter, 255-bp version of IntE (IntE255; Fig. 1B; Fig. 2C,D) (Chang et al., 2008a). To test whether the Brk site in IntE255 is responsible for the inhibitory effect of Brk, we constructed a mutant reporter in a similar manner to the mutant probe used in the EMSA (IntE255Brkmut; Fig. 1B). Although it still responded to Arm* stimulation, IntE255Brkmut was no longer affected by the Brk protein (Fig. 2C,D). Consistent with our ChIP analysis in the embryos, these results indicate that Brk directly represses the intronic WRE activity upon Wg activation. The repressive role that we observed for Brk in these experiments cannot be explained by the interaction between Mad and TCF, as suggested by previous studies (Zeng et al., 2008; Eivers et al., 2011), because excess Brk did not affect the Arm-dependent activation of dTF12 (DasGupta et al., 2005), a Wg reporter composed of multimerized optimal TCF sites (supplementary material Fig. S2).
Brk represses Arm-dependent activation of the intronic WRE in nkd. (A-D) Reporter assays in Drosophila Kc cells using the intronic regions IntE1200 (A,B) and IntE255 (C,D), as illustrated in Fig. 1B. A mutant version of the reporter for the Brk site (IntE255Brkmut) is also used in C and D. Transfection of a moderate dose of constitutively active Arm* (10 ng/well) results in ∼100-fold activation of both IntE1200 (A) and IntE255 (black columns in C). Co-transfection of a Flag-tagged Brk expression vector (10 ng, 20 ng, 40 ng and 80 ng per well) dose-dependently inhibits Arm*-dependent activation. Conversely, RNAi against brk results in enhanced Arm* activation of both reporters (B, black columns in D). Arm* readily activates IntE255Brkmut, which is no longer affected by altered Brk expression (gray columns in C,D). Data are averages of duplicate or triplicate experiments, with error bars representing s.e.m. (E,F) Western blot analysis to confirm the expression levels of Brk in these experiments.
Brk represses nkd in fly wings
We have so far shown that Brk directly represses nkd in vitro. An obvious question is whether Brk also represses nkd in vivo. We made use of a lacZ reporter that is driven by a combination of WREs in the regulatory sequences in the nkd locus (Nkd-lacZ) (Chang et al., 2008a). When we knocked down brk using a brk RNAi line (UAS-brkRNAi) driven by Dpp-Gal4, we detected an ectopic lacZ expression along the A/P boundary, as indicated by Engrailed expression (Fig. 3D-F), compared with control wing discs (Fig. 3A-C), suggesting that Brk represses nkd expression in wing discs. Consistent with this observation, by in situ hybridization we detected enhanced nkd transcript levels in the posterior half of the wing discs when brkRNAi was driven by Engrailed-Gal4 (En-Gal4) (Fig. 3G,H). Conversely, En-Gal4-driven brk overexpression caused reduced nkd transcription (Fig. 3I). These changes of nkd expression are significant when mean gray values are compared and judged by statistical analysis (Fig. 3J; supplementary material Fig. S3).
Brk represses nkd expression in the wing imaginal discs. All images are taken from the third-instar wing discs and placed anterior to the left and dorsal up. (A-F) Nkd-lacZ reporter expressions (green) in flies with genotype P[Dpp-Gal4]/+ (A-C) and P[Dpp-Gal4]/[brkRNAi] (D-F). Engrailed stainings (En, red) are used to indicate the A/P boundary. Note that the knockdown of brk causes the additional lacZ signal (white arrowheads) along A/P boundary where Dpp-Gal4 activates. (G-I) In situ hybridization of nkd in wing discs with En-Gal4 only (G, En/+), En-Gal4 driven brkRNAi (H, En/brkRNAi) and En-Gal4 driven UAS-brk (I, En/brk), as detailed in the Materials and methods section. A/P borders are marked by black arrowheads. Note that nkd is evenly expressed anteriorly and posteriorly in En-Gal4/+ wing disc (G), but is higher in posterior compartment of the En/brkRNAi wing disc (H) and is lower posteriorly in En/brk ones. Note also the posterior compartments are enlarged in En/brkRNAi and smaller in En/brk discs, presumably due to the effects on growth of the altered Dpp signaling. For brk RNAi, two independent brk RNAi lines, VDRC#GD2919 (shown in H) and VDRC#KK101887 (not shown), have been used and resulted in similar results. Scale bars: 100 μm. (J) Quantified expression levels of nkd in G-I. Data represent the average posterior to anterior ratios of mean gray values in the nkd expression domain, in flies bearing genotype of En/+ (n=14), En/brkRNAi (n=5) and En/brk (n=11), with error bars standing for s.e.m. Stars indicate P<0.001 compared with En/+ group, as judged by one-way ANOVA followed by post-hoc Tukey’s test for comparisons between the groups. (K-M) brkM68clones were heat-shock induced in flies with a genotype of yw brkM68 hsp70-flp FRT19A/yw hsp70-flp hsp70-GFP FRT19A. FISH detection of nkd in brkM68 clones shows that the loss of brk results in dramatically increased nkd transcript levels, as marked by lack of GFP (arrows). (N) RT-qPCR analysis of nkd expression in third instar wing discs with or without clone induction, indicating a higher nkd expression when brk clones are induced. Error bars represent s.e.m.
To examine this effect in a more rigorous way, we generated mitotic clones of a null allele of brk, brkM68 (Jaźwińska et al., 1999), and examined nkd transcripts in wing discs by fluorescence in situ hybridization (FISH). As expected, nkd FISH signals were dramatically increased in the brk clones (Fig. 3K-M). We noticed that nkd upregulations were more pronounced in brk clones positioned at A/P extremes, consistent with published studies that brk is expressed at higher levels in this region (Campbell and Tomlinson, 1999; Jaźwińska et al., 1999; Minami et al., 1999). In addition, we have used RT-qPCR analysis to confirm the increase of nkd transcripts in wing discs that underwent brk clones induction (Fig. 3N). Taken together, these data indicate that Brk represses nkd in wing discs.
Brk enhances Wg signaling in fly wings through the repression of nkd
To assess the role of brk in Wg signaling in vivo, we examined Wg targets, such as Dll and senseless (sens), in the wing imaginal disc. Ectopic brk driven by Patched-Gal4 (Ptc-Gal4), which is activated along the A/P compartment boundary, caused an expansion of Dll expression (Fig. 4A-F), whereas Wg expression was not affected. Based on our conclusion from Fig. 3 that Brk represses nkd, the increased Dll expression could be due to the lowered expression of Nkd, the negative regulator of Wg signaling. If so, then ectopic nkd should be able to abolish Dll expansions caused by the over production of brk. Indeed, we found that co-expression of nkd with brk gave rise to similar Dll patterns to those seen in control discs (Fig. 4G-I). These observations are consistent with the notion that brk enhances Wg signaling.
brk is required for Wg target gene expression in wing imaginal discs. (A-I) Antibody staining in late third instar wing discs for Dll (red) and Wg (blue) in flies with genotypes of P[Ptc-Gal4]/+ (A-C, Ptc/+), P[UAS-brk]/P[Ptc-Gal4] (D-F, Ptc/brk) and P[UAS-brk], P[UAS-nkd]/P[Ptc-Gal4] (G-I, Ptc/brk, nkd). The A/P boundaries are indicated by downward arrowheads. Note that ectopic brk driven by Ptc-Gal4 caused a marked expansion of Dll along the A/P border (D), compared with Ptc-Gal4/+ disc (A). Such an increase of Dll expression no longer exists in the wing disc co-expressing brk and nkd (G). No apparent alteration of Wg expression is observed in these discs (B,E,H). (J-O) Antibody staining of Dll (J-L) and Sens (M-O) in brkM68 clones, which were produced as in Fig. 3K and marked by the lack of GFP. Note the clone across hinge and wing pouch areas, indicated by arrows, in J-L. Dll is completely disrupted in hinge area but remains unaffected within wing pouch. A clone in M-O also shows reduced Sens expression (arrows). (P-R) brkM68 clones are generated in the genetic background of nkd RNAi driven by En-Gal4 driver. Note that Dll (red) expression is disrupted in brk clones (arrows) in anterior compartment but is normal in a brk clone (unfilled arrow) in the posterior half where nkd expression is knocked down. A/P border is marked by the white dotted lines according to En expression (R).
To look into the possible effects of endogenous brk on Wg signaling, we examined Dll and Sens expressions in the brkM68 clones. Dll expression in these clones was not always the same. We did not observe a detectable change of Dll expression in brk clones positioned within wing pouch areas. However, in clones away from A/P boundary, both anteriorly and posteriorly in hinge areas, we saw dramatic Dll reductions (supplementary material Fig. S4). Fig. 4J-L shows a typical brk clone across the hinge and wing pouch, in which Dll was completely absent in the hinge region but was unaffected in the wing pouch area. Such a positional effect is consistent with the observation of increased nkd expression in brk clones (Fig. 3K-M) and might reflect a dosage dependence of brk. The hinge expression of Dll depends on canonical Wg signaling, as Dll was significantly reduced in pygo clones in this area (supplementary material Fig. S5) (Parker et al., 2002). Wg was not affected in brk clones (supplementary material Fig. S6), indicating that the reduction of Dll expression was not due to a direct change in Wg expression. Similar results were observed for Sens, another Wg target in wing discs (Fig. 4M-O). Again, if it stands true that the reduced Dll level in brk clones is due to de-repressed nkd expression, it should be reversed in a loss-of-nkd background. To test this, we used a UAS-RNAi allele (UAS-nkdRNAi) generated according to nkd sequence. As shown in supplementary material Fig. S7, En-Gal4-driven UAS-nkdRNAi dramatically knocked down nkd levels in the posterior compartment. Therefore, we examined Dll expression in brk clones in this nkd RNAi background. We did observe that Dll expression was lost in anterior brk clones but not in posterior ones in the hinge (Fig. 4P-R), indicating a need for nkd in the reduction of Wg signaling in brk clones. Together, these results demonstrate that brk is required for Wg signaling in hinge area of wing discs.
The data described thus far indicate that Brk represses nkd and is required for Wg target gene expression in the wing disc. Is brk also required for adult wing structures? It is well documented that the wing margin is defined and patterned from a stripe of cells expressing wg during the third instar larvae (Phillips and Whittle, 1993; Couso et al., 1994). Loss of Wg signaling leads to defects of the adult wing margin, characterized by loss of bristles and/or notches in the wing. Conversely, elevated Wg signaling typically causes extra bristles.
Consistent with a role of brk in wing margin formation, studies from independent laboratories have shown that loss of brk results in notched wing in addition to wing outgrowths (Campbell and Tomlinson, 1999; Jaźwińska et al., 1999). To examine this in more detail, we analyzed wing phenotypes in brkM68 clones in a more quantitative way. In flies potentially bearing brk clones, we found that 19% of the flies gave rise to notches in the wing, a phenotype indicative of a loss of Wg signaling (Fig. 5C; n=163). In addition, we saw many swirled hairs in areas close to the wing notches (Fig. 5D), which are consistent with the previous finding that a timed over production of nkd gives rise to planar cell polarity (PCP) phenotypes (Rousset et al., 2001). By contrast, we only occasionally saw (5%, n=163) wing outgrowths in these flies. These results may indicate that aside from a repressive role of Brk in Dpp signaling, Brk might play an essential role in Wg signaling. In further support of this notion, in wings with ectopic brk driven by Vestigial-Gal4 (Vg-Gal4), we often observed stout bristles indicative of a gain of Wg signaling (Fig. 5E,F) (Couso et al., 1994; Zhang and Carthew, 1998; Zeng et al., 2008), although the wings were much smaller compared with wild-type flies, as previously reported (Martín et al., 2004). Furthermore, co-expression of TCFΔN, which inhibits Wg signaling (van de Wetering et al., 1997) as evidenced by causing notches (Fig. 5I,J), suppressed these stout bristles (Fig. 5G,H). We interpreted these results as evidence that Brk antagonizes Dpp signaling and promotes Wg signaling at the same time. From the experiments inducing the loss or gain of brk in fly wings, we have found phenotypes resembling those observed in the loss or gain of Wg signaling, respectively, which might have been overlooked in previous studies.
Loss and gain of brk phenocopies the loss and gain of Wg signaling in adult wings. Images of adult wings from wild-type flies (A,B), flies bearing the brkM68 clones as in Fig. 3J-L (C,D) and flies with genotypes of P[Vg-Gal4]/P[UAS-brk] (E,F, Vg/brk), P[Vg-Gal4]/P[UAS-brk]; P[UAS-TCFΔN]/+ (G,H, Vg/brk; TCFΔN) and P[Vg-Gal4]/+; P[UAS-TCFΔN]/+ (I,J, Vg/TCFΔN). Right panels are enlarged views from the corresponding left ones. (A,B) Morphology of wild-type wing displays an intact wing margin. (C,D) Adult wing bearing brk clones presents a notched phenotype (arrow), often seen in flies with reduced Wg signaling, at a penetrance of 19% (n=163), but with much less frequent (5%, n=163) outgrowth events. Defects in bristle arrangement are also observed on the wing surface as marked by unfilled arrows, similar to planer cell polarity deficits reported in wings overexpressing nkd (Rousset et al., 2001). (E,F) Ectopic expression of Vg-Gal4-driven brk results in a much smaller wing, as previously reported (Martín et al., 2004), but also stout bristles indicative of a gain in Wg signaling. (G,H) Co-expression of TCFΔN, a known inhibitor of Wg signaling (I,J) (van de Wetering et al., 1997), suppresses phenotypes caused by ectopic brk in E,F.
The Dpp pathway is also involved in the regulation of Wg targets
As mentioned earlier, brk is directly repressed by Dpp signaling (reviewed by Affolter and Basler, 2007). According to our model, increasing Dpp signaling should also increase nkd expression and inhibit Wg signaling in the wing. Indeed, TkvQD, a constitutively active form of the Dpp receptor, increased nkd expression in the wing disc and globally in adult flies (Fig. 6D,E). In wing discs, Dll is considered to be a long-range target of Wg (Zecca et al., 1996; Neumann and Cohen, 1997) and is normally expressed at a comparatively low level close to the A/P boundary, resulting in two expanded domains with one being slightly wider in the posterior region (Fig. 3A). When tkvQD was overexpressed in the posterior half by En-Gal4, Dll was expressed in a domain that was apparently narrower posteriorly than anteriorly (Fig. 6A-C), indicating a significant decrease in Dll expression. These results clearly show that Dpp signaling promotes nkd expression and suppresses Wg signaling in wing discs.
Dpp signaling promotes nkd transcription and inhibits Dll expression. (A-C) A wing disc of P[UAS-GFP]; P[UAS-tkvQD]/P[En-Gal4] (En/tkvQD) stained with Dll (B, red). In this wing disc, with ectopic Dpp signaling due to En-Gal4-driven tkvQD, Dll is apparently expressed in a narrower pattern in the posterior half than in the anterior region (B), indicating a significant decrease in Dll expression. (D) In situ hybridization of nkd in En/tkvQD wing discs shows an enhanced nkd signal in the posterior half. A/P border is indicated by an upward arrowhead. Note the apparently wider posterior half due to gain of Dpp signaling, consistent with previous studies (Schwank et al., 2008). Scale bar: 100 μm. (E) qPCR quantification of nkd in adult flies of genotypes w1118, P[UAS-tkvQD] (tkvQD) and P[Hsp70-Gal4] (Hsp70/tkvQD, subjected to heat shock as detailed in the Materials and methods section), normalized to β-tub. Note the marked increase of nkd in the Hsp70/tkvQD flies. Data are the averages of two groups of flies, and the errors bars represent s.e.m. The experiment was carried out twice with similar results.
In this study, we have shown that Brk directly represses nkd expression in vitro and in vivo. The direct repression of nkd by Brk is underscored by three of our observations. First, we have identified a Brk site in the intronic region of nkd, which Brk physically occupies in vitro (Fig. 1B,C). Second, ChIP analysis shows that Brk binds a DNA region near this Brk site in embryos in a manner inversely related to Wg activity (Fig. 1D,E). Third, our reporter analysis in Kc cells indicates that Brk represses Arm-dependent activation of an intronic WRE containing this Brk site, but only when the Brk site is intact (Fig. 2). In addition, our genetic analyses have shown that the repression of nkd by Brk is functionally significant. In the developing wing, we found that the loss of brk de-represses nkd (Fig. 3) and downregulates Wg target proteins, such as Dll and Sens (Fig. 4). Conversely, ectopic brk inhibits nkd expression (Fig. 3) and markedly enhances Dll expression (Fig. 4). Furthermore, removal of nkd prevents the loss of Dll in brk clones whereas co-expression of nkd abolishes the expanded Dll caused by ectopic brk (Fig. 4). In adult wing, the loss and gain of brk phenotypically resembles the loss and gain of Wg signaling, respectively (Fig. 5). Consistent with a repressive role of Dpp cascade on brk, we found that ectopic Dpp signaling enhances nkd and inhibits Wg signaling (Fig. 6). These results support a model in which Dpp signaling increases the expression of Nkd, a Wg inhibitor, by the downregulation of Brk, and thereby inhibits the Wg outputs. In another words, nkd might fall into a class of Dpp targets, which are de-repressed upon the activation of Dpp signaling. We have thus uncovered a previously unsuspected molecular mechanism underlying the interaction between Wg and Dpp signaling pathways in Drosophila wing development.
Until recently, little has been known about the cross-interaction between Wg and Dpp signaling in Drosophila wings, in spite of the fact that the fly wing has served as an excellent model system for the dissection of the molecular basis of these signaling transduction pathways. This is in contrast to Drosophila leg imaginal discs, in which mutual repression between Wg and Dpp signaling has long been suspected. However, several studies have indicated that manipulation of Dpp signaling levels in the wing sometimes leads to phenotypes resembling those caused by loss or gain of Wg activity. Notably, ectopic Dpp signaling increases notches in the wing (Marquez et al., 2001; Bennett and Alphey, 2002; Zeng et al., 2008), which is characteristic of reduced Wg signaling (Couso et al., 1994). However, the underlying mechanism for this effect of Dpp is not clear. Recently, independent research groups have suggested that Mad, the key effector of Dpp signaling, might play a role in the regulation of Wg target gene expression in fly wings (Zeng et al., 2008; Eivers et al., 2011). The molecular basis for their findings has mainly been the physical interaction between Mad and TCF, similar to the findings in mammals, in which several Smad proteins interact with members of the lymphoid enhancer binding factor 1/TCF family of DNA-binding HMG box transcription factors (Labbé et al., 2000; Hussein et al., 2003; Labbé et al., 2007; Minoo and Li, 2010). It remains to be determined whether the role of Mad is direct or indirect because the reporter assays in these studies were performed with TOPFlash (Korinek et al., 1997) or similar constructs in mammalian cell culture, which might not always accurately represent the complicated situation of the in vivo regulation of Wg target genes (Chang et al., 2008b). Furthermore, manipulation of Mad expression in wing discs influences Dll expression in different directions (Zeng et al., 2008; Eivers et al., 2011). Although these intriguing discrepancies can be explained by the physical interaction between Mad and TCF, our model offers an alternative interpretation based on the negative regulation of nkd by Brk, which might suggest an indirect role of Mad in Wg signaling. For example, our model could provide an explanation for the previous finding that ectopic Dpp signaling, caused by Mad, Medea, TkvQD, etc., results in notched wings (Zeng et al., 2008).
The role of Brk in Wg signaling has been previously documented in Drosophila. It has been suggested that brk is able to antagonize Wg signaling based on the activity of a midgut-specific Ubx reporter gene in which physical interactions among Brk, Teashirt and CtBP have been described (Saller et al., 2002). In leg discs, Wg signaling may directly repress Dpp morphogen expression via an Arm-TCF-Brk complex, offering a direct model for the cross-talk between Wg and Dpp (Theisen et al., 2007). However, our studies have indicated a positive role for Brk in Wg signaling through an indirect action. In addition to the repression of Dpp targets, the roles of Brk in Wg signaling described in these different models exemplify the pleiotropic actions of brk throughout development and might provide the molecular basis for tissue-specific consequences of developmental signaling pathways.
nkd was first identified as a Drosophila segment-polarity gene, mutation of which gives rise to major deficits in fly embryonic development (Jürgens et al., 1984). Its expression appears to be universally induced by Wg in fly embryos and larval imaginal discs (Zeng et al., 2000). It is interesting that although the loss of nkd in embryos has an effect similar to gain of wg, decreased nkd function in fly wings shows little impact (Zeng et al., 2000). However, none of the nkd alleles used in these studies has been well characterized at the molecular level (Zeng et al., 2000). Given the complexity of nkd transcriptional regulation (Chang et al., 2008a), it could be that these mutant forms of nkd still possess residual function in the wing. Alternately, overexpression of nkd blocks ectopic Wg signaling in the eyes and generates PCP phenotypes in the wing through a direct interaction with Dsh (Rousset et al., 2001). Consistent with these observations, we found that loss of brk can cause a dramatic increase of nkd expression in certain areas of the wing imaginal disc, leading to wing notches and PCP defects (Fig. 5D). Our findings suggest that nkd may indeed play roles, at a certain level, in both canonical and noncanonical Wg signaling in fly wings. However, a closer examination of nkd function in fly wings is needed.
In conclusion, we found that Brk influences Wg signaling by directly repressing nkd expression and could serve as a node for cross-talk between the Wg and Dpp signaling pathways. Wnt-BMP cross-interactions have been implicated in many developmental and disease processes (Itasaki and Hoppler, 2010). For example, a Wnt-BMP feedback circuit mechanism is important for inter-tissue signaling dynamics in tooth organogenesis in mouse (O’Connell et al., 2012). Our findings may therefore add new insights into cell differentiation and human cancer.
The authors thank Drs Ken Cadigan, Zhijun Shen and Haiyun Song for their critical reading and editorial help during the preparation of the manuscript; Drs Ken Cadigan, Hugo Bellen, Sean Carroll, Konrad Basler, Stuart Newfeld, Lei Xue, Helen Skaer for reagents; and Bloomington Stock Center, Vienna Drosophila RNAi Center and Developmental Studies Hybridoma Bank for flies and antibodies.
This work is supported by grants from the National Basic Research Program of China [2012CB517904] and the Natural Science Foundation of China [31070826 and 90608019] to M.F.
Competing interests statement
Supplementary material available online at http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.082578/-/DC1
Accepted November 5, 2012.
© 2013. Published by The Company of Biologists Ltd
Affolter M.,
Basler K.
(2007). The Decapentaplegic morphogen gradient: from pattern formation to growth regulation. Nat. Rev. Genet. 8, 663–674.
Marty T.,
Vigano M. A.,
Ja wi ska A.
(2001). Nuclear interpretation of Dpp signaling in Drosophila. EMBO J. 20, 3298–3305.
Bejsovec A.,
Martinez Arias A.
(1991). Roles of wingless in patterning the larval epidermis of Drosophila. Development 113, 471–485.
Bennett D.,
Alphey L.
(2002). PP1 binds Sara and negatively regulates Dpp signaling in Drosophila melanogaster. Nat. Genet. 31, 419–423.
Brook W. J.,
Cohen S. M.
(1996). Antagonistic interactions between wingless and decapentaplegic responsible for dorsal-ventral pattern in the Drosophila Leg. Science 273, 1373–1377.
Cadigan K. M.
(2002). Regulating morphogen gradients in the Drosophila wing. Semin. Cell Dev. Biol. 13, 83–90.
(2012). TCFs and Wnt/ -catenin signaling: more than one way to throw the switch. Curr. Top. Dev. Biol. 98, 1–34.
Campbell G.,
Tomlinson A.
(1999). Transducing the Dpp morphogen gradient in the wing of Drosophila: regulation of Dpp targets by brinker. Cell 96, 553–562.
Chang J. L.,
Chang M. V.,
Barolo S.,
(2008a). Regulation of the feedback antagonist naked cuticle by Wingless signaling. Dev. Biol. 321, 446–454.
Gangopadhyay A.,
Shearer A.,
(2008b). Activation of wingless targets requires bipartite recognition of DNA by TCF. Curr. Biol. 18, 1877–1881.
Chinnadurai G.
(2002). CtBP, an unconventional transcriptional corepressor in development and oncogenesis. Mol. Cell 9, 213–224.
Cordier F.,
Hartmann B.,
Rogowski M.,
Grzesiek S.
(2006). DNA recognition by the brinker repressor – an extreme case of coupling between binding and folding. J. Mol. Biol. 361, 659–672.
Couso J. P.,
Bishop S. A.,
(1994). The wingless signalling pathway and the patterning of the wing margin in Drosophila. Development 120, 621–636.
DasGupta R.,
Kaykas A.,
Moon R. T.,
Perrimon N.
(2005). Functional genomic analysis of the Wnt-wingless signaling pathway. Science 308, 826–833.
Dougan S.,
DiNardo S.
(1992). Drosophila wingless generates cell type diversity among engrailed expressing cells. Nature 360, 347–350.
Eivers E.,
Fuentealba L. C.,
Sander V.,
Clemens J. C.,
Hartnett L.,
De Robertis E. M.
(2009). Mad is required for wingless signaling in wing development and segment patterning in Drosophila. PLoS ONE 4, e6543.
Demagny H.,
Choi R. H.,
(2011). Phosphorylation of Mad controls competition between wingless and BMP signaling. Sci. Signal. 4, ra68.
Estella C.,
McKay D. J.,
Mann R. S.
(2008). Molecular integration of wingless, decapentaplegic, and autoregulatory inputs into Distalless during Drosophila leg development. Dev. Cell 14, 86–96.
Fang M.,
Li J.,
Blauwkamp T.,
Bhambhani C.,
Campbell N.,
(2006). C-terminal-binding protein directly activates and represses Wnt transcriptional targets in Drosophila. EMBO J. 25, 2735–2745.
Freeman M.,
Bienz M.
(2001). EGF receptor/Rolled MAP kinase signalling protects cells against activated Armadillo in the Drosophila eye. EMBO Rep. 2, 157–162.
Gerlitz O.,
(2002). Wingful, an extracellular feedback inhibitor of Wingless. Genes Dev. 16, 1055–1059.
Hasson P.,
Müller B.,
Basler K.,
Paroush Z.
(2001). Brinker requires two corepressors for maximal and versatile repression in Dpp signalling. EMBO J. 20, 5725–5736.
Hussein S. M.,
Duff E. K.,
Sirard C.
(2003). Smad4 and beta-catenin co-activators functionally interact with lymphoid-enhancing factor to regulate graded expression of Msx2. J. Biol. Chem. 278, 48805–48814.
Itasaki N.,
Hoppler S.
(2010). Crosstalk between Wnt and bone morphogenic protein signaling: a turbulent relationship. Dev. Dyn. 239, 16–33.
Jaźwińska A.,
Kirov N.,
Wieschaus E.,
Roth S.,
Rushlow C.
(1999). The Drosophila gene brinker reveals a novel mechanism of Dpp target gene regulation. Cell 96, 563–573.
Jiang J.,
Struhl G.
(1996). Complementary and mutually exclusive activities of decapentaplegic and wingless organize axial patterning during Drosophila leg development. Cell 86, 401–409.
Jürgens G.,
Nüsslein-Volhard C.,
Kluding H.
(1984). Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. II. Zygotic loci on the third chromosome. Roux’s Arch. Dev. Biol. 193, 283–295.
Johnston L. A.,
Schubiger G.
(1996). Ectopic expression of wingless in imaginal discs interferes with decapentaplegic expression and alters cell determination. Development 122, 3519–3529.
Korinek V.,
Barker N.,
Morin P. J.,
van Wichen D.,
de Weger R.,
Kinzler K. W.,
Vogelstein B.,
Clevers H.
(1997). Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC-/- colon carcinoma. Science 275, 1784–1787.
Labbé E.,
Letamendia A.,
Attisano L.
(2000). Association of Smads with lymphoid enhancer binding factor 1/T cell-specific factor mediates cooperative signaling by the transforming growth factor-beta and wnt pathways. Proc. Natl. Acad. Sci. USA 97, 8358–8363.
Lock L.,
Gorska A. E.,
Gryfe R.,
Gallinger S.,
Moses H. L.,
(2007). Transcriptional cooperation between the transforming growth factor-beta and Wnt pathways in mammary and intestinal tumorigenesis. Cancer Res. 67, 75–84.
Sutter C.,
Parker D. S.,
(2007). CBP/p300 are bimodal regulators of Wnt signaling. EMBO J. 26, 2284–2294.
Marquez R. M.,
Singer M. A.,
Takaesu N. T.,
Waldrip W. R.,
Kraytsberg Y.,
Newfeld S. J.
(2001). Transgenic analysis of the Smad family of TGF-beta signal transducers in Drosophila melanogaster suggests new roles and new interactions between family members. Genetics 157, 1639–1648.
Martín F. A.,
Pérez-Garijo A.,
Moreno E.,
Morata G.
(2004). The brinker gradient controls wing growth in Drosophila. Development 131, 4921–4930.
Minami M.,
Kinoshita N.,
Kamoshida Y.,
Tanimoto H.,
Tabata T.
(1999). brinker is a target of Dpp in Drosophila that negatively regulates Dpp-dependent genes. Nature 398, 242–246.
Minoo P.,
Li C.
(2010). Cross-talk between transforming growth factor-beta and Wingless/Int pathways in lung development and disease. Int. J. Biochem. Cell Biol. 42, 809–812.
(2001). How Drosophila appendages develop. Nat. Rev. Mol. Cell Biol. 2, 89–97.
Morimura S.,
Maves L.,
Chen Y.,
Hoffmann F. M.
(1996). decapentaplegic overexpression affects Drosophila wing and leg imaginal disc development and wingless expression. Dev. Biol. 177, 136–151.
Pyrowolakis G.,
(2003). Conversion of an extracellular Dpp/BMP morphogen gradient into an inverse transcriptional gradient. Cell 113, 221–233.
Nellen D.,
Burke R.,
Struhl G.,
(1996). Direct and long-range action of a DPP morphogen gradient. Cell 85, 357–368.
Neumann C. J.,
(1997). Long-range action of Wingless organizes the dorsal-ventral axis of the Drosophila wing. Development 124, 871–880.
Nolo R.,
Abbott L. A.,
Bellen H. J.
(2000). Senseless, a Zn finger transcription factor, is necessary and sufficient for sensory organ development in Drosophila. Cell 102, 349–362.
O’Connell D. J.,
Ho J. W.,
Mammoto T.,
Turbe-Doan A.,
O’Connell J. T.,
Haseley P. S.,
Koo S.,
Kamiya N.,
Ingber D. E.,
Park P. J.,
. (2012). A Wnt-bmp feedback circuit controls intertissue signaling dynamics in tooth organogenesis. Sci. Signal. 5, ra4.
Panganiban G.,
Sebring A.,
Nagy L.,
Carroll S.
(1995). The development of crustacean limbs and the evolution of arthropods. Science 270, 1363–1366.
Jemison J.,
(2002). Pygopus, a nuclear PHD-finger protein required for Wingless signaling in Drosophila. Development 129, 2565–2576.
Ni Y. Y.,
(2008). Wingless signaling induces widespread chromatin remodeling of target loci. Mol. Cell. Biol. 28, 1815–1828.
Penton A.,
(1996). Decapentaplegic restricts the domain of wingless during Drosophila limb patterning. Nature 382, 162–164.
Phillips R. G.,
Whittle J. R.
(1993). wingless expression mediates determination of peripheral nervous system elements in late stages of Drosophila wing disc development. Development 118, 427–438.
Rousset R.,
Mack J. A.,
Wharton K. A. Jr.,
Axelrod J. D.,
Cadigan K. M.,
Fish M. P.,
Nusse R.,
Scott M. P.
(2001). Naked cuticle targets dishevelled to antagonize Wnt signal transduction. Genes Dev. 15, 658–671.
Rushlow C.,
Colosimo P. F.,
Lin M. C.,
Xu M.,
Kirov N.
(2001). Transcriptional regulation of the Drosophila gene zen by competing Smad and Brinker inputs. Genes Dev. 15, 340–351.
Saller E.,
(2001). Direct competition between Brinker and Drosophila Mad in Dpp target gene transcription. EMBO Rep. 2, 298–305.
Kelley A.,
(2002). The transcriptional repressor Brinker antagonizes Wingless signaling. Genes Dev. 16, 1828–1838.
Sandmann T.,
Jakobsen J. S.,
Furlong E. E.
(2006). ChIP-on-chip protocol for genome-wide analysis of transcription factor binding in Drosophila melanogaster embryos. Nat. Protoc. 1, 2839–2855.
Schwank G.,
Restrepo S.,
(2008). Growth regulation by Dpp: an essential role for Brinker and a non-essential role for graded signaling levels. Development 135, 4003–4013.
Sivasankaran R.,
(2000). Direct transcriptional control of the Dpp target omb by the DNA binding protein Brinker. EMBO J. 19, 6162–6172.
Stark A.,
Lin M. F.,
Kheradpour P.,
Pedersen J. S.,
Parts L.,
Carlson J. W.,
Crosby M. A.,
Rasmussen M. D.,
Roy S.,
Deoras A. N.,
. (2007). Discovery of functional elements in 12 Drosophila genomes using evolutionary signatures. Nature 450, 219–232.
Tabata T.,
Takei Y.
(2004). Morphogens, their identification and regulation. Development 131, 703–712.
Theisen H.,
Haerry T. E.,
O’Connor M. B.,
Marsh J. L.
(1996). Developmental territories created by mutual antagonism between Wingless and Decapentaplegic. Development 122, 3939–3948.
Syed A.,
Nguyen B. T.,
Lukacsovich T.,
Purcell J.,
Srivastava G. P.,
Iron D.,
Gaudenz K.,
Nie Q.,
Wan F. Y.,
. (2007). Wingless directly represses DPP morphogen expression via an armadillo/TCF/Brinker complex. PLoS ONE 2, e142.
van de Wetering M.,
Cavallo R.,
Dooijes D.,
van Beest M.,
van Es J.,
Loureiro J.,
Ypma A.,
Hursh D.,
Jones T.,
. (1997). Armadillo coactivates transcription driven by the product of the Drosophila segment polarity gene dTCF. Cell 88, 789–799.
Wisotzkey R. G.,
Mehra A.,
Sutherland D. J.,
Dobens L. L.,
Liu X.,
Dohrmann C.,
Attisano L.,
Raftery L. A.
(1998). Medea is a Drosophila Smad4 homolog that is differentially required to potentiate DPP responses. Development 125, 1433–1445.
Worby C. A.,
Simonson-Leff N.,
Dixon J. E.
(2001). RNA interference of gene expression (RNAi) in cultured Drosophila cells. Sci. STKE 2001, pl1.
Zecca M.,
(1996). Direct and long-range action of a wingless morphogen gradient. Cell 87, 833–844.
Zeng W.,
Wang K.,
Gadbaw M.,
Suyama K.,
Klein P. S.,
(2000). naked cuticle encodes an inducible antagonist of Wnt signalling. Nature 403, 789–795.
Zeng Y. A.,
Rahnama M.,
Wang S.,
Lee W.,
Verheyen E. M.
(2008). Inhibition of Drosophila Wg signaling involves competition between Mad and Armadillo/beta-catenin for dTcf binding. PLoS ONE 3, e3893.
Zhang J.,
Carthew R. W.
(1998). Interactions between Wingless and DFz2 during Drosophila wing development. Development 125, 3075–3085.
Zhang H.,
Levine M.,
Ashe H. L.
(2001). Brinker is a sequence-specific transcriptional repressor in the Drosophila embryo. Genes Dev. 15, 261–266.
Thank you for your interest in spreading the word on Development.
You are going to email the following Bridging Decapentaplegic and Wingless signaling in Drosophila wings through repression of naked cuticle by Brinker
Message Subject (Your Name) has sent you a message from Development
Message Body (Your Name) thought you would like to see the Development web site.
Dosage-dependent requirements of Magoh for cortical interneuron generation and survival
GDE3 regulates oligodendrocyte precursor proliferation via release of soluble CNTFRα
Suppressor of Fused (Sufu) controls cerebellum granule cell proliferation by suppressing Fgf8 and spatially regulating Gli proteins
Show more RESEARCH ARTICLES
2019 on the Node
Read about the most-read posts, scientists on tour and a glimpse into what to look our for in 2020.
Interview – Madeleine Linneberg-Agerholm, Yan Fung Wong and Josh Brickman
Three Copenhagen-based researchers discuss their new paper, which exploits naïve human embryonic stem cells to generate in vitro models for the extra-embryonic endoderm.
Seven things that shaped preLights in 2019
As 2020 gets well and truly underway, join us as we look back at seven things that shaped preLights in 2019. From launching preLists to getting nominated for an award, it was an exciting year!
Publishing peer review reports
To continue working towards transparency around the editorial process, Development now publishes a ‘Peer review history file’ alongside published papers. Read more about the policy and see the reports for yourself in one the first papers to publish the reports (under the ‘Info & metrics’ tab). | cc/2020-05/en_middle_0078.json.gz/line1075 |
__label__cc | 0.586763 | 0.413237 | Americans keep waiting for bigger paychecks
Americans got a boost to their paychecks in November. But the increase in wages remains frustratingly low given the h...
Americans got a boost to their paychecks in November. But the increase in wages remains frustratingly low given the health of the overall job market.
Average hourly earnings rose 2.5% over the past 12 months. That's a slight improvement from the 2.4% increase the government reported for October. Still, it remains below the 3% increase that most economists (not to mention workers) would like to see.
People are finding jobs. That's not the problem. The economy added 228,000 jobs last month and the unemployment rate remained at 4.1% -- its lowest level since December 2000.
But for whatever reason, employers aren't showering workers with big pay raises.
Even President Trump's National Economic Council Director Gary Cohn seems puzzled by this trend. He noted in an interview with CNBC Friday morning that "we're still not growing wages in this country."
However, it seems that many Americans are still just happy to have a job and are not demanding bigger paychecks.
"Slow wage growth is the biggest conundrum here," said JJ Kinahan, chief market strategist with TD Ameritrade "Small wage increases are still able to attract talent. Most of us thought this would have changed by now."
Kinahan noted that one potential factor at play is that the jobs report does not take into account other perks that workers want, things like the ability to work from home more often, free meals at the office and better insurance options.
"People are increasingly looking for other benefits, and not just wage growth," Kinahan said.
Another reason why paychecks may not be growing? Inflation is still not much of a problem.
The government said in November that consumer prices rose just 2 percent over the past 12 months. So even a meager 2.5% pay raise is more than enough to offset the relatively small cost of living increases that many Americans have faced.
Related: GE is cutting 12,000 jobs
Still, Andrew Chamberlain, chief economist with job search site Glassdoor, wrote in a report Friday morning that based on inflation trends and productivity growth, wages should be rising between 3% and 4%.
There may be some hope on the horizon though.
Mark Hamrick, senior economic analyst at Bankrate.com, said that if employers keep adding jobs and the unemployment rate inches lower, companies will have no choice but to finally start paying more since workers will demand higher salaries.
Hamrick wrote in a report that wage increases "are likely headed closer to 3 percent in the coming year as long as the economy continues to expand and no dramatic black swans emerge."
There are hopes that tax reform might push companies to start paying workers more too.
But there's a debate as to whether big businesses will really start to give employees raises and hire more or just use any potential savings from a lower corporate tax rate to reward investors instead with dividend increases and more stock buybacks.
Nonetheless, there should come a point where employees will demand better pay and even feel comfortable enough to leave and find another place to work in order to get a salary boost instead of sticking at a low-paying, dead-end job.
Companies may have the bargaining edge now but it may not stay that way for much longer.
"It's not going to be an overnight change but there eventually will be pressure to increase wages," said Bodhi Ganguli, lead economist at Dun & Bradstreet. "You will have to offer people more money to fill jobs if the overall economy keeps improving."
300 people told us what they will do with their bigger paychecks
Bigger paychecks and cheap gas drive best holiday shopping season in six years
CEO under fire for $100 million paycheck
Will enough tax be withheld from your paycheck? Good question
Why you'll want to double check your paycheck in February
School support staff struggle without paychecks during walkout
Demand for tiny homes is getting bigger
The Democratic wave looks like it is getting bigger and bigger
Steyer to Axelrod on Trump impeachment: American people 'are at great risk while we wait' | cc/2020-05/en_middle_0078.json.gz/line1076 |
__label__cc | 0.719818 | 0.280182 | Southwest Airlines Expanding Air Service To Hawaii Ahead Of Schedule
Filed Under:Airline, Airline seat, DFW News, Flights, Hawaii, Hawaiian Islands, Honolulu, Lihue, Maui, Southwest Airlines
HONOLULU (CBSDFW.COM/AP) – Dallas-based Southwest Airlines expects to more than quadruple its daily number of seats flying into and between the Hawaiian islands before completion of its first year of service to the area.
The Honolulu Star-Advertiser reported that the airline credits strong customer demand for its Hawaii growth.
Officials say the airline began flying to Hawaii in March with one daily, round-trip flight between Honolulu and Oakland, California.
Southwest expects to fly between Honolulu and Lihue, Hawaii, and Honolulu and Sacramento, California, beginning in November rather than January.
The company also plans to add daily service beginning in March 2020 between the islands and California cities including Sacramento, Oakland and San Jose.
The carrier’s expansion was delayed by the Federal Aviation Administration’s grounding in March of Boeing 737 Max jets, which is ongoing. | cc/2020-05/en_middle_0078.json.gz/line1077 |
__label__cc | 0.612934 | 0.387066 | Lambay Small Batch Blend Finished in Cognac Casks
Lambay // Ireland
This Irish whiskey brand is a collaboration between Camus Cognac and the Baring Family's Revelstoke Trust. The brand launched in the US during the first quarter of 2018. This triple-distilled blend is aged first in ex-bourbon barrels. The whiskey then finishes its maturation in ex-cognac barrels which were exposed to sea air. Lambay shares its name with the island just off the coast of Dublin in the Irish Sea which the Baring Family has owned since 1904. This private island is also an animal sanctuary.
Comprised of both single malt(s) and single grain(s) often from many different distilleries; if Scotch or Irish must be aged for at least three years in oak barrels; Irish may include single pot still whiskey in the blend.
ex-bourbon & ex-cognac
"The nose gets started with a combination of caramel and molasses sweetness, along with peanut shells, and then vanilla toffee. The entry to the palate is watery and light, with raspberries, sugary fruit jams, and dark chocolate. The finish is short and sweet, with a touch of oak, and milk chocolate covered berries."
Reviewed by Jake Emen
Fruity & Vanilla
Glencadam 14 Year Oloroso Cask Finish
Jameson Distillery Reserve 12 Year
The Last Drop 48 Year Blended Scotch Whisky | cc/2020-05/en_middle_0078.json.gz/line1079 |
__label__cc | 0.74915 | 0.25085 | carrie newcomer - search results
The Beautiful Not Yet by Carrie Newcomer
Music Reviews Rev. Deb Vaughn - October 24, 2016
My first listen to this album was during the commute between my hospice patients’ homes. I was reminded that there are many points of light and joy in a world that seems so dark and inhospitable to the people of God. We hold on to "The Slender Thread" of our faith and hope, because love always calls us back. Always.
“A Permeable Life” by Carrie Newcomer
Music Reviews Rev. Deb Vaughn - April 7, 2014
It’s like a sweet cup of a caramel macchiato. The silence of the first snowfall. A porch swing on a perfect spring day. A breeze carried from the surf across your beach blanket. These are the inviting images that came to me as I listened to Carrie Newcomer’s newest album, A Permeable Life. This is Newcomer’s twelfth album, and it will not disappoint those of us who enjoy her music.
Carrie Newcomer’s “Room at the Table”
Link of the Day Blog Admin - April 2, 2014
April 2, 2014 Carrie Newcomer, noted folk artist, released a new album and companion book of essays and poetry yesterday, April 1, 2014. The album, A...
Everything Is Everywhere – Carrie Newcomer
Music Reviews Lē Isaac Weaver - October 13, 2011
I think we like music that speaks for us. I often feel Carrie Newcomer's music speaks for me. But after listening to this album many, many times, I realize that it doesn't really speak for me as much as it speaks for all of us. Everything Is Everywhere defines the people we can someday become, and the loving Spirit we, as one people, will someday embody.
Before and After – Carrie Newcomer
Music Reviews Linda Bieze - July 1, 2010
Singer-songwriter Carrie Newcomer's newest album, Before and After, features a collection of thirteen original compositions—including many contemplative, midlife songs that have grown out of Newcomer's reading and conversations with other spiritual people like Parker Palmer.
Carrie Newcomer — Several Albums
Music Reviews Linda Bieze - April 1, 2008
A gifted poet, Newcomer writes lyrics that can tell stories or share feelings. Her Quaker beliefs are evident in many of her words, but she doesn't preach at you.
FAQ Blog Anne Linstatter - June 22, 2017
The Beautiful Not Yet: Poems, Essays and Lyrics
Book Reviews Rev. Jean Rodenbough - October 24, 2016
Her essays in this volume are thought provoking, the golden prize being her commencement address this past June at her alma mater. She offered three lessons for life: “be kind, be true, and pay attention.” In her essay “Miracle, Light and Considerable Magic” (p. 70), she refers to “the mysterious nature of the Sacred,” the Light that appears in daily moments.
Letha Dawson Scanzoni - September 27, 2015
Click here to view links posted after December 31, 2012. Welcome to an archive of links chosen and annotated by Letha Dawson Scanzoni in 2012,...
Forgiveness and Boundaries
ViewPoint Blog Lē Isaac Weaver - September 17, 2012
by Le Isaac Weaver "If I can learn to forgive— if I can learn to say, “I will no longer carry this suffering in my hands. Today I will set it down”— I will then free myself from anger and pain and make the space to move into understanding and compassion. Likewise, when I make and enforce effective and appropriate boundaries, I am making it more likely that peace and love will flow freely in and through my life, and thus out into the world."
2008 EEWC Conference
Conferences and Gatherings Kay Nannet - September 20, 2008
It was an event in the planning for 20 months, so its arrival was anticipated with enthusiasm by those of us on the conference committee. We had put our hearts and souls into every aspect of this conference; and as we prayed together before we left Sharon Bowes’ house to head to the Sheraton Indianapolis City Centre Hotel.
Latest Posts on CFT
My Faith Doesn’t Discriminate Campaign
January 13, 2020 Religious Freedom Day is this Thursday, January 16th! In preparation for the plenary, to be held during our upcoming 2020 Gathering, with...
Untold Volumes Poetry January 13, 2020
Titus 3:1-15—Submission, Salvation, and Ethics
Reta's Reflections December 23, 2019
Saying No in the Community
ViewPoint Blog December 12, 2019
Titus 2:1-15—Household Organization and “Healthy Teaching”
Reta's Reflections December 9, 2019
Support CFT
Support Christian Feminism Today
We are reader supported, no advertising!
Your donation or membership keeps our original content available on the web. Memberships start at $15 per year.
Any donation amount welcome!
Click here to donate today. | cc/2020-05/en_middle_0078.json.gz/line1089 |
__label__cc | 0.745228 | 0.254772 | Best Vapes
Pod Mods
Vape Juices
e-cigreviews.org.uk
Home 9 best Portable Dry Herb Vaporizers in the UK [01/2020]
9 best Portable Dry Herb Vaporizers in the UK [01/2020]
Updated on January 2020: If you’re keen on vaping dry herbs on the move, a portable dry herb vaporizer is definitely your best choice.
With their internal oven chamber which heats to a precise temperature, these compact personal devices produce vapour from your herbs for you to inhale quickly and conveniently no matter where you are.
Not so long ago, desktop vaporizers were the only real way to vape dry herbs, however now, with so many pocket-sized dry herb vape pens on the market, you’ve got a lot more freedom and choice.
There’s a lot of variety in the styles, designs and types of units available for sale, so if you need some advice to point you in the right direction, you’ve come to the right place.
Before we go any further, please be aware that some kinds of filling material can’t be used by law in the UK – keep that in mind when vaping herbs in one of these fantastic devices.
List of Best Dry Herb Vaporizers 2020
Mighty Vaporizer
The Mighty Vaporizer comes from the well-known and popular Storz & Bickel brand, best known for its impressive Volcano desktop vape.
As you’d expect from such a premium brand, the Mighty is pretty outstanding too. Its handheld design makes it easy to take wherever you want to go, while the excellent flavour and robust vapour won’t disappoint you.
The Mighty Vaporizer is a very versatile device. It doesn’t just work with dry herbs, it also works with wax and oil concentrates, thanks to the inclusive liquid pad, so you can adjust your vaping style to suit your mood.
With a 60-second heat-up time, you’ll be vaping before you know it, and with its 90-minute battery life, you won’t run out of power too quickly.
The quality construction from plastic and steel makes this a durable device for any vaper, and since it’s fairly easy to clean, it won’t be too inconvenient to refill and reuse.
This device uses a hybrid heating method for even better performance, and thanks to the LED easy-read screen, you’ll be able to adjust the temperature right up to 210 degrees Celsius to suit your preferences.
• Fully adjustable temperatures
• Durable design and robust construction
• All-in-one device for use with dry herbs and concentrates
• Excellent vapour and flavour production
• Slightly larger than some of its rivals
• The 60 second heat-up time is slightly longer than some competitor devices
PAX 3 Vaporizer
The PAX 3 is the most recent and advanced dry herb vaping device from this brand.
A truly versatile option, it offers no less than 5 different vaping modes to suit every vaper’s preferences – efficiency, stealth, flavour, boost and standard.
That means that whatever type of experience you’re looking for, you can enjoy it in spades with this portable vaporizer.
One excellent feature of this device is the option for a half-pack rather than a full-pack, so if you’re vaping alone, you can get maximum benefit from your herbs.
The temperature settings range from 182 to 215 degrees Celsius, and you can vape either dry herbs or concentrates to suit your mood.
As you’d expect from a top-quality device, the PAX 3 is built from steel and aluminium and is highly robust, while its stainless steel vapour path is also very durable.
A clever feature of this device is its Bluetooth compatibility – you can use your tablet or smartphone to choose your customised temperature settings.
Whether you’re brand new to vaping or whether you’re experienced, you’ll find this device a breeze to use, and since it’s small and has a discreet appearance, you won’t attract any undue attention.
• Bluetooth connectivity
• Full temperature controls
• Compact and discreet
• Can vape half-pack or full-pack
• Can vape herbs or concentrates
• More expensive than many of its rivals
Da Vinci IQ Vaporizer
The Da Vinci name is well-known in the vaping industry, and the IQ is a precise and compact dry herb vaporizer which has an air path made from ceramic zirconia for the best possible flavour.
Its Smart Path Technology also adds even more convenience to your experience by automatically setting the most appropriate temperature for every vaping session.
Another top feature of this device is its super-speedy heat-up time – it gets up to the right temperature in just 16 seconds.
The temperature is fully adjustable between 120 and 220 degrees Celsius, and the 18650 battery can be replaced so you’ll never have to worry about downtime.
The brushed aluminium finish isn’t just stylish, it’s also very durable, while the Bluetooth integration allows you to monitor your usage details.
The user interface is user-friendly and, with no less than 36 LEDs it is surprisingly attractive.
• Replaceable battery for zero downtime
• Stylish and durable brushed aluminium finish
• Bluetooth integration
• Smart Path Technology for greater convenience
• Super-fast heat-up time of just 16 seconds
• Only suitable for use with dry herbs, not concentrates
Black Mamba Dry Herb Vaporizer
If you’re a complete beginner and are looking for a great value first dry herb vaporizer or if you’re on a tight budget, the Black Mamba could be perfect for you.
Boasting a big herb chamber and impressive performance, the Black Mamba has an elegant and unique design that makes it stand out from the crowd.
The single button operation makes this device a breeze for even complete novices to use, and loading the chamber couldn’t be simpler.
Thanks to the larger size of the oven, it’s also possible to vape on the go without having to reload too frequently.
Although this is a budget device, it still boasts a powerful 1600mAh battery. There are also five different temperature settings so you can find the best one to suit your preferences.
Easy to use and reload
Large ceramic chamber
3 hour charging time
Battery lasts for just 45-60 minutes
Volcano Crafty Vaporizer
This device is from the ever-popular and famous Storz & Bickel brand just like the Mighty.
This device is the Mighty’s smaller sibling and, with its user-friendly, low maintenance design, it’s perfect for vaping novices.
This device offers two different temperature selections – standard and boost – and any temperature between 40 and 210 degrees Celsius can be selected either on the device itself or on the go using the downloadable app.
Thanks to its small and lightweight design, it’s really easy to carry and use anywhere you want to vape. With its pass-through charging function, you’ll have minimal downtime while its hybrid heating method ensures every draw is cool and smooth.
Compact, lightweight and discreet
Fully adjustable temperatures
Downloadable compatible app
Pass-through charging
Low maintenance, user-friendly design
The battery isn’t replaceable
Shorter than average battery life
FireFly 2 Vaporizer
Perhaps the best feature of the Firefly 2 is its virtually instant heat-up time. It’ll be up to your chosen temperature in just five seconds after immediate vaping.
With its magnesium alloy construction, this device is also very durable and won’t break easily – perfect for use on the go.
Its power settings are fully adjustable between 170 and 215 degrees Celsius, and thanks to its dual-use functionality you can vape either concentrates or dry herbs to suit your taste on the day.
The battery life is up to two hours – ideal if you’ve to vape on the move – and with its glass vapour path, you won’t have any worries about unpleasant tastes.
This compact device fits easily into your pocket, and as it produces less odour than many other vaporizers, it won’t attract unwanted attention.
Its self-cooling technology also ensures it won’t get too hot and accidentally burn you.
There are 6 heat settings to choose from, and as the firmware of the device can be upgraded and the battery swapped out, this is an advanced vaporizer that won’t disappoint.
• 6 heat settings and fully adjustable temperatures
• Dual-use for both dry herbs and concentrates
• 2-hour battery life
• Incredibly fast heat-up time
• Durable magnesium alloy construction
• If you’re an inexperienced user, you won’t be able to get the best out of this device
Magic Flight Launch Box Vaporizer
If you’re looking for a very portable unit that offers an excellent vaping experience, the Magic Flight Launch Box could be the one for you.
Using alkaline batteries, this vaporizer has been designed to be compact enough to easily fit in a pocket or be palmed quickly for discretion.
Its ultra-speedy heating element reaches the selected temperature in only five seconds for incredibly fast vaping.
The top feature of this device is its unique design. Made from beautifully hand-crafted wood, there is no metal or plastic used in the construction of this high-quality device, and this guarantees a flavourful and rich vapour.
There is even a hand-carved philosopher’s quote in every device for a truly stylish appearance.
• Unique wooden design
• Very pure flavour and vapour
• Very fast heat up time
• Compact design to fit in your pocket discreetly
• Not the most advanced technology
Designed by the well-respected PAX Labs, the Pax 2 is a great choice for an everyday vape.
Its stylish matte finish comes in a number of colours to suit individual tastes, and if you’re on a budget, it could be the right choice for you.
It has a subtle, sleek design and boasts an impressive two-hour battery life while its deep stainless steel heating chamber ensures excellent performance and plenty of vaping time.
Portable, compact and easy to pop into a bag or pocket, it is lightweight and easy to use without compromising on reliability.
Even complete beginners will be able to load up the heating chamber quickly and easily thanks to the magnetic lid.
Its brushed metal finish is stylish and feels good in the hand, while its mouthpiece ensures a clearer airflow for a lowered draw resistance. Even better, the mouthpiece boasts lip-sensing, auto-cooling and motion-sensing technology for more advanced vaping experience.
• Stylish finish and pleasant hand-feel
• Advanced technology for a better experience
• Simple to use and fill
• Long battery life
• Compact and discreet design
• Not as advanced as its younger sibling, the PAX 3
Arizer Solo 2 Vaporizer
If you love to vape dry herbs alone, the Arizer Solo 2 could be the one for you thanks to its smaller than average oven chamber which only holds a maximum of 0.2g of dry herbs.
With its ceramic heating element and two included borosilicate mouthpieces, this device offers something truly unique in its ability to vaporize both ground herbs and those in more solid formats.
With a heat-up time of 28 seconds and the ability to adjust the temperature between 50 and 200 degrees Celsius, this device is beautifully designed and has an impressive build quality for extra durability.
Very easy to clean thanks to its low maintenance design, this device also has a powerful battery for longer than average vaping times.
Since it comes supplied with its own carry case, you’ll also be able to take it anywhere you need to go.
• Ideal for solo vapers
• High-quality build construction and materials
• Comes with its own carry case
• Low maintenance design
• Long lasting battery
• Small heating chamber
• Cannot be used for vaping concentrates
© e-cigreviews.org.uk 2013-2020. All Rights Reserved. | cc/2020-05/en_middle_0078.json.gz/line1100 |
__label__cc | 0.684928 | 0.315072 | Watercolour on card
Ivorine
Papier-mache
Sort By RECENT ITEMS PRICE: HIGH - LOW PRICE: LOW - HIGH Set Descending Direction
Possibly Richard Coote, 1st Earl of Bellomont and 12th Governor of the Province of New York Massachussett's Bay, including Boston, believed to be by P. Pears, circa 1680
A 'Davenport's Patent' plaque decorated by Charles Meigh & Son, depicting Queen Victoria, after Sir William Charles Ross
An 18th century portrait miniature of a gentleman, painted in enamel
A fine portrait miniature of a child, believed to be Janet Wishart (1788-1820) a member of the Bartleman family
An unknown Lady
A 17th century portrait miniaturen of an unknown Gentleman
A portrait miniature of a Lady
A Lady possibly the artist's wife
A portrait miniature of William Lambert (1761-1838), watercolour on ivory
George Keith (c. 1692-1778) 10th Earl Marischal of Scotland
An 18th century portrait miniature of a Young Lady with powdered hair
An attractive portrait of Mrs. Hamilton
Now Browsing by
Price £2,000.00 - £2,999.99 Remove This Item
Enamels 5 items
Oils 1 item
Vellum 2 items
A portrait miniature of a Gentleman believed to be Kit Metcalfe
A portrait miniature of n unknown lady with auburn coloured hair
19th century portrait miniature of a young girl, painted in watercolour on ivory
A portrait miniature of an unknown Lady
A gentleman believed to be John Burnaby
A very beautiful portrait of an unknown Lady
A portrait miniature of an Officer of the 113th Regiment of Foot (1794) , watercolour
An unknown Gentleman
The Rev. Dr George Hickes, Titular Bishop of Thetford (1642-1715)
Ellison Fine Art. All Rights Reserved. Powered by Antiquity Software.
Terms of Service Terms of Sale Privacy Policy
Copyright © 2019 Ellison Fine Art. All rights reserved. | cc/2020-05/en_middle_0078.json.gz/line1104 |
__label__cc | 0.722499 | 0.277501 | Learn more about your unique type of PCOS
Take the Quiz Now!
Serum Bisphenol A (BPA) and Testosterone in PCOS
Environmental, PCOS | POSTED October 19, 2018
We already know that Bisphenol A (BPA) is one of the more significant endocrine disruptors in PCOS. It has been found that a single exposure to this chemical in the womb can induce PCOS in two generations of rats! We’re not rats, however, it’s already been found that BPA levels run higher in women with PCOS.
This new study pointed to similar facts, yet elaborates on the topic further [1].
This study took 106 women with PCOS and 80 women without the condition, and matched them for age and BMI.
What they found was that women with PCOS have higher levels of BPA in their blood
The more they had, the higher their testosterone levels and their free androgen index. This index indicates how much testosterone is unbound, or freely available to affect the body.
Where is BPA Found?
Bisphenol A (BPA) is one of the most common industrial compounds with endocrine-disrupting potential. It’s used to bind or harden plastic [20], and can be found in the following:
Food cans
Plastic water pipes
Thermal paper (receipts)
Children’s toys and clothing [21]
Human exposure to this chemical includes various routes such as oral—mainly by consumption of food products and dust inhalation—and transdermal contact, e.g. with plastic products or thermal paper.
This study was actually quite eye-opening. Similarly to other studies, BPA was found in almost all of the analyzed samples, with 99% of women with PCOS testing positive. 92% of women without PCOS tested positive as well.
Yet, in women with PCOS, the levels caused testosterone to increase, unlike in women without the condition.
So, first and foremost, BPA is clearly a strong aggravator, having a similar structure to estrogen. There are several possible mechanisms:
Since testosterone must be aromatized into estrogen, it’s possible that BPA is interfering with its conversion. It’s also possible that this harmful chemical can bind to sex hormone-binding globulin, letting testosterone go free in the bloodstream to cause all of its annoying androgen excess effects.
Related: The Cause of PCOS: AMH, Androgens and Other New Updates
But Then the Question is WHY:
Why do women with PCOS consistently have higher levels of BPA?
The BPA is causing PCOS in some women, and they’re exposed due to the work they do, the foods they eat, or environmental toxicity.
Bisphenol A has an affinity to fat: it has a disproportionate affinity to deposit in fat 300% more than when compared to other tissues.[2] Women with PCOS have inherent dysfunction of fatty tissue, with a tendency to enlarged, overstuffed adipocytes. It is possible that this is a “depot” where toxins are stored and slowly excreted over time, when compared to women without fat cell dysfunction.
Of note, it has been widely believed that BPA has a half life of 5 hours and is rapidly excreted in bile after being deactivated by the liver. That said, within many tissues—including the placenta—an enzyme known as Beta glucoronidase is present . This has the ability to reactivate the chemical into its active form.
Therefore, it’s quite possible that deactivated Bisphenol A can recirculate through the body and bio-accumulate far more over time than had previously been thought. Now, evidence of its bioaccumulation is mounting and concerns over its potent impact on endocrine disorders in the population are becoming concerning.
Avoid food in cans unless they have BPA-free linings (check their labels).
Don’t use any plastic containers: use glass or stainless steel instead.
Avoid skin transfer from tainted receipts—get them emailed or avoid touching as much as possible.
As dentist if composites are BPA free.
Supplemental Calcium D Glucarate can help mitigate reactivation of BPA. Typical doses are 1500 mg per day.
Our clinic does offer testing for levels of toxins like Bisphenol A and other endocrine disruptors. Contact us to make an appointment for testing.
[1] Published in October in the journal “Reproductive Toxicology”. Konieczna A, Rachoń D, Owczarek K, Kubica P, Kowalewska A, Kudłak B, Wasik A, Namieśnik J. Serum bisphenol A concentrations correlate with serum testosterone levels in women with polycystic ovary syndrome. Reprod Toxicol. 2018 Sep 25; 82:32-37.
[20] E. Jackson, R. Shoemaker, N. Larian, L. Cassis, Adipose Tissue as a Site of Toxin Accumulation,
Comprehensive Physiology 7(4) (2017) 1085-1135.
[21] A. Konieczna, A. Rutkowska, D. Rachon, Health risk of exposure to Bisphenol A (BPA), Roczniki
Panstwowego Zakladu Higieny 66(1) (2015) 5-11.
[2] Distribution and unspecific protein binding of the xenoestrogens bisphenol A and daidzein.
Csanády GA, Oberste-Frielinghaus HR, Semder B, Baur C, Schneider KT, Filser JG
Arch Toxicol. 2002 Jun; 76(5-6):299-305.
Did you find this post helpful? SHARE IT!
Prev Post: Spicy Chicken Crock-Pot Soup Next Post: Xenoestrogens and PCOS: Triclosan
Get Two FREE PCOS Test Guides
Dr. Fiona McCulloch
BSc ND
Information and research on nutrition and women’s health | cc/2020-05/en_middle_0078.json.gz/line1113 |
__label__wiki | 0.863382 | 0.863382 | U.S. auto sales prove to be another mixed bag through September
Ford will build revived Bronco, Ranger in Michigan
Your Corner Wrench: For repairs, look beyond the deal
Nissan bucks September sales declines with 4.9 per cent boost
by Dee-Ann Durbin And Tom Krisher | October 3, 2016
Nissan is making automatic braking standard on most of its volume-selling models, such as the Rogue CUV.Handout
Light-vehicle sales in September came in much stronger than analysts had estimated, led by Nissan and Fiat Chrysler, suggesting there still may be some steam left in the U.S. auto industry’s six-year growth spurt.
General Motors, the largest U.S. automaker, estimated that the annualized selling rate adjusted for seasonal trends reached 17.8 million in September, and Ford made a similar projection. While that pace would be down from 18.1 million a year earlier, it’s faster than any analyst estimate in a Bloomberg survey. The average projection was for a 17.5 million rate.
Automakers will be reporting September results throughout Monday, giving investors new evidence to determine whether the industry’s expansion is coming to an end after a record 2015 or if there is more room for economic-driven growth. Concerns that U.S. auto sales are slowing have depressed automakers’ shares this year, even as the companies report strong profits amid consistently high volumes.
“Key economic fundamentals like a strong jobs market, rising personal incomes, low fuel prices and low interest rates continue to point toward strong industry performance,” said Mustafa Mohatarem, GM’s chief economist. “We think the industry is well positioned for a continued high level of customer demand into the foreseeable future.”
GM said Monday it saw sales decline 0.6 percent to 249,795 cars and light trucks, beating analysts’ estimates of a 1.6 percent drop. GM said retail sales to individual customers grew 1 per cent last month, as Buick sales jumped 14 per cent and Cadillac sales rose 3.1 percent. Chevrolet Silverado pickup sales fell 16 percent, while GMC Yukon sales rose 34 per cent.
Fiat Chrysler reported a decline of 0.9 per cent, compared with the average estimate for a drop of 5.1 per cent. Sales of all of its brands fell in September, except the Ram lineup, which jumped 27 percent. Ram pickup sales rose 29 percent.
Ford, which enjoyed elevated fleet sales in the second half of 2015 and first half of this year, sold 203,444 cars and light truck in September, matching analysts’ estimates for an 8 per cent drop. Ford’s car sales fell 21 percent, while its top-selling F-Series pickups declined by 2.6 percent and SUV sales dropped 3.4 percent.
‘Strong Demand’
“We continue seeing strong customer demand, especially for vans and pickup trucks,” Mark LaNeve, Ford ’s U.S. vice president of marketing, sales and service, said in a statement. “Demand for a rich mix of our all-new Super Duty pickups helped boost Ford’s average transaction prices by $1,100 versus a year ago.”
GM’s ATPs, which reflect retail transaction prices after sales incentives, were $35,804 in September, almost $5,000 above the industry average and approximately $1,000 above last September’s performance.
Nissan sold 127,797 cars and light trucks in the U.S. last month, a 4.9 percent gain from a year earlier. That compares with the average analyst projection of a decrease of 1.4 percent, as pricey SUVs continue to move off dealer lots. Sales of the Murano rose 46 percent, and the popular Rogue was up 5.6 per cent.
Toyota reported 197,260 deliveries for a gain of 1.5 per cent, missing the 2 per cent average estimate. Honda said its sales fell 0.1 per cent from a year earlier period, missing analyst estimates for a 1.6 per cent increase. Honda reported a 0.3 percent decrease in sales for its Civic, which had enjoyed double-digit increases through the first eight months of the year. The CR-V, the top-selling SUV in the U.S., continued rolling along with a 6.5 percent increase for September.
After six years of annual sales increases — the longest such streak since before World War II — the industry surprised analysts with a record 17.5 million sales last year. While some argue that more economic growth may release further pent-up demand, many analysts and executives have said they expect a decline or little change from 2015’s record high. Ford CEO Mark Fields is among those saying the growth cycle has ended.
“The industry has plateaued,” he said last week on Bloomberg Television. “We are seeing some weakness in the retail end of the marketplace that’s manifesting itself through more competitive pressures.”
Through August, sales were running 0.6 percent ahead of last year’s pace, and analysts are split on whether this year will finish up a little or down slightly. August’s annualized rate was 17 million.
September reports should show a “very, very solid month,” said Bill Fay, head of U.S. sales for Toyota’s namesake brand. U.S. consumer confidence rose last month to the highest level since before the recession on optimism about the labor market, the New York-based Conference Board said last week. Available credit and relatively low gasoline prices are also encouraging big-ticket purchases, he said.
“We’re still bullish,” he said, “that the next couple years will be — maybe not at record levels — but pretty darn close.”
Cars and Car Design
Chrysler Group LLC
Honda Motor Co. Ltd.
Mark Fields (Executive)
Mark LaNeve
Mustafa Mohatarem
Nissan Motor Co. Ltd.
SUVs and Crossovers
Buick cracks top-three in Consumer Reports' latest reliability survey
Hyundai raises price of Palisade slightly amid booming popularity
Ferrari replica from 'Ferris Bueller’s Day Off' is up for auction
NHTSA to review petition about alleged unintended acceleration in Teslas | cc/2020-05/en_middle_0078.json.gz/line1114 |
__label__wiki | 0.503161 | 0.503161 | Montreal Auto Show
Hits and Misses from the Montreal International Auto Show
Tesla wants customers to plug in its new wall charger wherever they want
Infiniti introduces I-Line models exclusive to Canada
Among the best debuts from the Quebec event were cars we know will never make it to production; and ones we really hope do
by David Booth | January 18, 2019
Vincent Cobee, Mitsubishi director of global planning at the 2019 Montreal auto showNadine Fillion / Driving
We have to admit, we were fans of most of the reveals at this year’s 2019 Montreal International Auto Show. But just to make it official, we thought we’d run down the event’s hits and misses.
Hit: Mitsubishi’s Electric Ambition
Mitsubishi showed off its latest electric vehicle concept, the e-Evolution, a future (fast-)forward-looking SUV that eschews Mitsu’s traditional dowdiness for a somewhat phantasmagorical look at what future mobility might look like.
Combining electric power with full autonomy and truly fetching looks, it’s a bold step forward made possible by the relative tiny Japanese automaker joining the Renault-Nissan alliance.
But most of what it offers is standard fare now; table stakes as poker players say. Even more impressive was the person who introduced the e-Evolution for Mitsubishi, Vincent Cobee. Mitsu’s director of global planning provided an unusually frank discussion on autonomy – “full Level Five self-driving is years away, and then will only account for one per cent of cars” – to electric motivation, noting that large-scale intra-city travel is still not something that EVs or the infrastructure that supports them can tolerate.
Most importantly, in contrast with the subsidy-seeking machine that is Tesla, Mr. Cobee is so confident that Mitsubishi PHEVs will continue their popularity – more than 5,000 Outlander PHEVs were sold in its first 12 months in Canada, making it our country’s most popular plug-in – whether they are subsidized or not.
“My job is not to look for government subsidies,” said the man responsible for Mitsubishi’s product strategy, product planning and electrification, “but to provide a total cost of ownership plan that will allow you to buy an electrified vehicle.” For providing an unusually realistic look at our low-emissions and a connected future, Mr. Cobee was the hit of the show.
Nissan’s altime-te snow-ready sedan at the 2019 Montreal auto show Nadine Fillion / Driving
Hit: Phantasmagorical Nissan Altima
What’s not to like about an Altima with tank treads? Ok, they’re really off-road truck treads and Nissan’s Altima-te AWD was an obvious exercise in marketing. But seriously, anything that looks like an escapee from a Terminator movie and bounds through the snow like a ’50s Bombardier is cool. So kudos to Nissan.
Mostly Hit: Competitive Pricing for Mazda3
Eighteen large for a Mazda 3 is downright cost-effective. A GS version with i-Activ all-wheel-drive for $26,000 ain’t half-bad, either. $31,400, however, for the range-topping Mazda3 Sport GT is well within Mazda6/Camry/non-snow-tracked-Altima territory. Mazda Canada probably won’t sell a lot of the upper-end Sport GTs, so call this nine-tenths of a hit, then.
Patrick Danielson with the Genesis G90 at the 2019 Montreal auto show Nadine Fillion / Driving
Much-Needed Hit: Genesis G90
Genesis used the Montreal International Auto Show to take the wrapper off the refresh of its G90. So, while Genesis’s flagship sedan still looks a bit the banker’s car when even the rich want to look Hollywood, it does get some pretty snazzy headlights and an aggressive new grille, as well as a new rear fascia. It’s not quite the comely BMW-beater that the new G70 is, but it’s as much of a hit as one can manage without completely changing the entire platform.
Big Hit If It Gets Built: Hyundai’s Le Fil Rouge
Hyundai’s Le Fil Rouge concept – literally, the “red wire,” but Hyundai is translating it as “a common thread” – is stunning. Oh, we’ve seen it before – at last year’s Geneva auto show, as a matter of fact – but it doesn’t change the fact it’s a comely little darling with a little Maserati in front, a little Aston to the rear. It definitely is swoopy and sporty.
Hyundai claims its “Sensuous Sportiness” is the result of the “golden ratio” that enabled Hyundai engineers “to create an aesthetically pleasing, natural-looking composition embodying charisma.” I don’t know anything about such a “common mathematic ratio found in nature.” But I do know that it will only be a hit if Hyundai actually produces it as-is, and doesn’t water it down into some latter-day Genesis Coupe.
Nissan’s ‘altima-te’ Altima swaps its wheels for truck tracks
Honda and Toyota partner up to build hydrogen refuelling infrastructure in Montreal
Surprise Hit: Hydrogen
It was hardly a surprise when Martin Gilbert, Toyota Canada’s director of corporate strategy and innovation, stood up to the podium and announced his company would be putting together a consortium to promote the construction of hydrogen refueling infrastructure: after all, customers will need to “gas up” the Mirai fuel-cell vehicles he is hoping to sell.
But then Jean Marc Leclerc, senior vice-president of sales and marketing for Honda Canada, stood up to the same podium and said he was pleased to “join in a partnership with Toyota Canada and Transition énergétique Québec that will invest in a hydrogen infrastructure project on the south shore of Montreal.”
Now never mind that Honda also has a fuel cell car – the Clarity – that needs servicing, this is like GM and Ford sharing a platform for Camaro and Mustang. Like Muhammad Ali and Smokin’ Joe going for a latte at Starbucks. Hell, what’s next? Elon Musk phoning your humble Motor Mouth for some advice on EVs?
The 2019 Felino CB7R Handout / Felino
Missed By a Mile: Felino CB7R
I’m kinda sad about this one because it comes from my homeland, La Belle Province. But no matter how well the Felino CB7R drives – and with a racing pedigree and 700 horsepower it very well should – it’s just way too overwrought. It looks like as if an especially testosterone-infused 14-year-old tried to design the car he thought he would like when he was 50, all Jessica Rabbit curves overlaid on some sort of BMW Z4 profile.
The CB7R is the Trump tweet of supercars: a little too much bombast, thank you very much, intended for someone with below-average sized, uhm, hands.
Non-Luxury
Our hits and misses from the 2020 Montreal International Auto Show
The 2020 Volkswagen Atlas Cross Sport is priced from $38,995
The 2021 Mitsubishi Mirage gets a fresh look and more driver's aids
Top 5 things to see – or not to see – at the 2020 Montreal Auto Show
First Look: 2020 Cadillac CT4 and CT5
Honda, Toyota shock the Montreal auto show with investments in hydrogen refueling | cc/2020-05/en_middle_0078.json.gz/line1115 |
__label__wiki | 0.72216 | 0.72216 | California lawmakers requested audit into abuse of disabled parking placards thanks in part to an NBC 7 Investigates story
California Assemblymen Eric Linder and Mike Gatto requested a Department of Motor Vehicle audit because rampant abuse of the disability parking placard system starts with the DMV, they said.
Gatto said after seeing news stories like the one NBC 7 Investigates aired two years ago, he wanted more to be done. Two years ago, in an undercover investigation, NBC 7 Investigates found state and city employees parking for free in downtown San Diego using disabled placards that did not belong to them.
To see the story, click here.
“I have been following this issue for quite some time and I’ve seen the reports on your station, where sting operations occur and a lot of drivers who are clearly abusing the system,” Gatto said. “The public is very sick of what’s going on out there, they have seen the stories, they have seen the streets where every single car has a placard displayed, they know there are people abusing the system and taking advantage of it.”
Linder and Gatto requested the audit last year and the results of that audit are expected to be complete in the next few weeks.
Click here to read their letter requesting the audit.
According to the audit request, the auditor is looking at a variety of issues including:
If medical providers and doctors are vouching for people who aren’t really disabled?
If some people been issued more than one placard?
How many placards are still out there even though the owner is deceased?
Gatto said the findings could lead to changes in the way DMV handles placard distribution. He also said he hopes it can provide data to support new laws.
“You have unethical members of the public that are willing to take these spots away from those that need them,” he said. “You probably have doctors that should not be issuing these placards unless they truly are disabled and then you have the government failing. The DMV should be stronger in how they handle the program.”
In an email to NBC 7 Investigates, Jessica Gonzalez, Assistant Deputy Director of Public Affairs with the California DMV said, “At this time, the DMV can’t comment on the audit since we have not seen the final audit and it has not been released publicly. The DMV takes crimes relating to disabled parking placards seriously and reviews every complaint it receives. The DMV Investigations Division attempts to conduct at least one proactive Disabled Person Parking Placard enforcement operation each month. Individual complaints are investigated as they are received. In the past three fiscal years, DMV investigators conducted 270 enforcement operations throughout the state and issued 2,019 misdemeanor citations for disabled parking placard abuse.”
In October 2015, the San Diego City Council approved a new law increasing the penalty for an able-bodied driver who uses a disability placard issued to someone else. The new fine is $740, up from $452.50. The council also approved another ordinance cracking down on disability placard abuse.
That new law classified placard abuse as a parking violation, instead of a criminal misdemeanor. Doing so will allow parking enforcement officers, not just police, to issue citations for placard misuse.
To read more about those changes, click here.
https://www.nbcsandiego.com/news/local/State-DMV-Audit-Looking-Into-Disabled-Placard-Policies-416777283.html
By Eric Linder|2019-03-07T17:17:19+00:00March 21st, 2017|In The News|Comments Off on State DMV Audit Looking Into Disabled Placard Policies
ASSEMBLY: SEIU endorsement of Eric Linder a rarity | cc/2020-05/en_middle_0078.json.gz/line1117 |
__label__cc | 0.738194 | 0.261806 | Stephen Senn: Blood Simple? The complicated and controversial world of bioequivalence (guest post)
Posted on June 5, 2014 by Mayo
Blood Simple?
The complicated and controversial world of bioequivalence
by Stephen Senn*
Those not familiar with drug development might suppose that showing that a new pharmaceutical formulation (say a generic drug) is equivalent to a formulation that has a licence (say a brand name drug) ought to be simple. However, it can often turn out to be bafflingly difficult[1].
If, as is often the case, both formulations are given in forms that are absorbed through the gut, whether as pills, oral solutions or suppositories, then so-called bioequivalence trials form an attractive option. The basic idea is that the concentration in the blood of the new test formulation can be compared to the licensed reference formulation. Equivalence of concentration in the blood plausibly implies equivalence in all possible effect sites and thus equality of all benefits and harms.
Typically, healthy volunteers are recruited and given the test formulation on one occasion and the reference formulation on another, the order being randomised. Regular blood samples are taken and the concentration time curves summarised using simple statistics: for example the area under the curve (AUC) is always used, the concentration maximum Cmax nearly always also and the time to reach a maximum Tmax, very often. These statistics are then compared across formulations to show that they are similar.
In the rest of this post I shall ignore the problem that various summary measures are employed and assume that we are just considering AUC. There seems to be a general (but arbitrary) agreement that two formulations are equivalent if the true ratio of AUC under test and reference lies between 0.8 & 1.25. In that case (at least as regards the AUC requirement) the formulations are deemed bioequivalent. The true ratio, however, is a parameter not a statistic and so the task is to see what the data can show about the reasonableness of any claim regarding this unknown theoretical quantity.
It is here, however, that the statistical difficulties begin. A simple frequentist solution would appear to be to calculate the 95% confidence intervals for the relative bioavailability and check that these lie within the limits of equivalence. Modelling is always done on the log-scale and since log(0.8)=-log(1.25) we have that limits for the log relative bioavailability of test and reference are (approximately) -0.22 to +0.22. However there is more than one 95% confidence interval and an early dispute in this field was whether a traditional confidence interval centred on the point estimate should be calculated, as Kirkwood[2] proposed in 1981 or one centred on the middle of the range of equivalence, that is to say on 0 (on the log scale) as Westlake[3] had earlier proposed in 1972 .
As O’Quigley and Baudoin pointed out[4], the difference is, essentially, between deciding whether the ‘shortest’ confidence interval is included within the limits of equivalence or whether the fiducial probability that the true relative bioavailability lies within the limits is at least 95%. The latter is always the easier requirement to satisfy. To see why consider the case where the point estimate is positive. In that case clearly the lower conventional confidence limit would never lie outside the limit unless the upper one did. Thus by lengthening the lower limit and shortening the upper in such a way to maintain the 95% probability one can make it easier to satisfy equivalence.
An alternative approach was taken by Schuirmann[5] who proposed to look at the matter in terms of two one–sided tests. Imagine that we have two regulators: a toxicity and an efficacy regulator. The former defines as toxic any drug whose relative bioavailability is greater than 1.25 and the latter as ineffective any drug whose relative bioavailability is less than 0.8. Each is unconcerned by the other’s decision and so no trading of alpha from one to the other can take place. It turns out that this requirement is satisfied operationally by accepting bioequivalence if the conventional 90% confidence limits are within the limits of equivalence. Opinions differ as to how logical this is. For example, the FDA requires conventional placebo-controlled trials of a new treatment to be tested at the 5% level two-sided but since they would never accept a treatment that was worse than placebo the regulator’s risk is 2.5% not 5%. Why should it be lower for bioequivalence?
Be that as it may, 90% confidence intervals are regularly used but they have been criticised by a number of frequentists of a Neyman-Pearson persuasion. (See for example R. Berger and Hsu[6].) The argument goes as follows. If the trial is small enough so that the standard error is large enough the width of the confidence interval, however calculated, will exceed the width of the equivalence interval. Thus the type I error rate is zero. Various proposals have been made as to how to recover the missing Type I error but they all boil down to this: given a small enough trial you could claim equivalence even though the point estimate was outside the limits of equivalence! Needless to say nobody uses such tests in practice and they have been severely criticised from a theoretical point of view[7])
The above argument is based on Normal theory tests. Horrendous complications are introduced by using the t-test if one departs from classical confidence intervals.
And don’t get me started on equivalence when concentration in the blood is irrelevant but a pharmacodynamic outcome must be used instead!
So, what seems to be a simple problem turns out to be controversial and difficult. As I sometimes put it ‘equivalence is different’.
Here there be tygers!
*Head, Methodology and Statistics Group
Competence Center for Methodology and Statistics (CCMS)
1. Senn, S.J., Statistical issues in bioequivalence. Statistics in Medicine, 2001. 20(17-18): p. 2785-2799.
2. Kirkwood, T.B.L., Bioequivalence testing – a need to rethink. Biometrics, 1981. 37: p. 589-591.
3. Westlake, W.J., Use of confidence intervals in analysis of comparative bioavailability trials. Journal of Pharmaceutical Sciences, 1972. 61(8): p. 1340-1341.
4. O’Quigley, J. and C. Baudoin, General approaches to the problem of bioequivalence. The Statistician, 1988. 37: p. 51-58.
5. Schuirmann, D.J., A comparison of the two one-sided tests procedure and the power approach for assessing the equivalence of average bioavailability. J Pharmacokinet Biopharm, 1987. 15(6): p. 657-80.
6. Berger, R.L. and J.C. Hsu, Bioequivalence trials, intersection-union tests and equivalence confidence sets. Statistical Science, 1996. 11(4): p. 283-302.
7. Perlman, M.D. and L. Wu, The emperor’s new tests. Statistical Science, 1999. 14(4): p. 355-369.
References added by Editor for readers:
1. Senn SJ. Falsificationism and clinical trials [see comments]. Statistics in Medicine 1991; 10: 1679-1692.
2. Senn SJ. Inherent difficulties with active control equivalence studies. Statistics in Medicine 1993; 12: 2367-2375.
3. Senn SJ. Fisher’s game with the Devil. Statistics in Medicine 1994; 13: 217-230.
Categories: bioequivalence, confidence intervals and tests, PhilPharma, Statistics, Stephen Senn | 22 Comments
22 thoughts on “Stephen Senn: Blood Simple? The complicated and controversial world of bioequivalence (guest post)”
Stephen: Thanks so much for your post. I am still unsure how you think we should do equivalence testing. What do you think of the union-intersection method of R. Berger?* (I assume that the question of concentration in the blood comes up after it’s already ascertained that the 2 consist of the same drug or whatever.) I have another question I’ll raise later on.
*Correction: This should be intersection-union test. See July. 31 post.
Stephen John Senn (@stephensenn)
I don’t like the Berger and Hsu method I cited for reasons I have already given. I don’t accept that maximisng power for a fixed type I error rate is a universally logical way to carry out statistical inference.
Stephen: for reasons you’ve already given here or somewhere else? I’m just trying to figure out your position on this. I vaguely remember a blogpost where the union intersection method came up in passing, and I asked R. Berger what he thought, and he seemed to defer to you (roughly, “Senn is the one who would know”).
I mentioned to you once that I had written a short section of my book on bioequivalence testing, based on a criticism you make about methods of bioequivalence testing going against a Popperian spirit of tests–but in that case the null was Ho: bioequivalence holds. So, on the face of it, with my admittedly poor comprehension of this methodology, I thought you’d prefer to have Ho assert the denial of bioequivalence, as in the union-intersection method. Anyway, as I also mentioned, I ripped out the section, deciding I didn’t really understand it well enough. I don’t plan to restore it, but I would like to understand your position about how it should be done. Another reason I’m curious is that a couple of people, years ago, said that what I was recommending was similar, they thought, to what is done in bioequivalence testing (in the case of non-reject). Finally, your book (Stat Issues in Drug Dev*) says the bioequivalence issue is primarily philosophical rather than technical. That, together with the Popper mention (someplace else), perked up my ears. OK, so any further insight would be of great interest!
* Here it is, p.372.
The business of hypothesis testing when the alternative lies in a closed interval raises several technical mathematical difficulties. The late Gunther Mehring, a one-time colleague of mine, investigated this with great rigour (from a mathematical point of view) and identified work of Samuel Karlin’s as being key.
The problem is, however, that solving the (difficult) mathematical problem of finding an optimal NP test which has the correct size and maximum power leads to a solution that is so counter-intuitive under some circumstances that nobody would accept it.
The practical problem appears to be much more simple than the techical mathematical one and I think that this is one of the cases where I would consider a Bayesian solution in principle. It would need to have as Lindley proposes a loss-function (but not the one he suggests) and also a three valued decision: accept, reject, collect more data. Odile Coudert had a look at this problem but her MSc should be regarded as interesting notes towards the solution of the problem. It’s a topic I should try get back to.
In the meantime I favour Schuirman’s two one sided tests although (in a way) having each at the 2.5% level rather than the 5% level would make more sense.
1. Mehring G. On optimal tests for general interval hypotheses. Communications in Statistics: Theory and Methods 1993; 22: 1257-1297.
Stephen: Is that the philosophical part? (whether to treat it as a decision problem?) Why it’s so different from the usual case of affirming equivalence of 2 means remains mysterious to me. If it’s so difficult, why doesn’t the brand name co. just give/sell their manufacturing process to the generic co.?
Affirming equivalence is fundamentally different from claiming a difference in a way I tried to explain in three articles I wrote in the 1990s :
(added to refs by editor)
1. Senn SJ. Falsificationism and clinical trials [see comments]. Statistics in Medicine 1991; 10: 1679-1692.
2. Senn SJ. Inherent difficulties with active control equivalence studies. Statistics in Medicine 1993; 12: 2367-2375.
3. Senn SJ. Fisher’s game with the devil. Statistics in Medicine 1994; 13: 217-230.
This difference is largely ‘philosphical’. A small example is that the role of blinding is quite different.
The technical difficulty relates to the fact that the 95% confidence intervals may be larger than the region of equivalence – implying zero size of a ‘test’ that proceeds using CIs. Hence the technical work of
1. Anderson S, Hauck WW. A New Procedure for Testing Equivalence in Comparative Bioavailability and Other Clinical-Trials. Communications in Statistics-Theory and Methods 1983; 12: 2663-2692.
2. Berger RL, Hsu JC. Bioequivalence trials, intersection-union tests and equivalence confidence sets. Statistical Science 1996; 11: 283-302.
3. Brown LD, Hwang JTG, Munk A. An unbiased test for the bioequivalence problem. Annals of Statistics 1997; 25: 2345-2367.
as well as the important but neglected work of Mehring’s already cited http://www.tandfonline.com/doi/abs/10.1080/03610929308831086?queryID=%24{resultBean.queryID}#.U5G73yiUXYg
The price that innovators put on their invention is not one that generic maunfacturers are willing to pay. Generic manufacturers are tring to cash in on a potential consumer surplus by finding a much easier route to development than full development once the patent permits them to copy (if they can!). Hence, bioequivalence studies. Occasionally companies will use the full development route but it’s very expensive. Astra dis so in developing its form (Oxis) of formoterol which was a Yamanouchi drug licensed to and developed by CIBA-Geigy (now Novartis) as Foradil, but this is rare.
The space for a Bayesian solution is there because this is a much more tightly structured problem than most. There really is only one thing that matters and that is relative bioavailability. All that prevents its being implementable is some sort of agreement on a loss-function (and a lot of technical work on backward induction!). Most attempts to be Bayesian in drug development would entail much greater complication.
Stephen: OK weekend reading (or in 2 cases rereading from long ago) will include the 3 Senn articles.
You seem to be saying it’s easy to be Bayesian when it comes to deciding on bioequivalence. Indeed, it operates as a policy decision. But are the priors fairly straightforward? You see, I don’t know how they arrive at the generic, and what they must show before even getting to the stage of testing for bioequivalence. Nor do I know what they’d have to do next, after showing bioequivalence (e.g., figure out the dose?) It isn’t far fetched to imagine that drugs of a certain type, having already passed the test of being the “same substance” to begin with, would result in similar concentrations in the blood, etc. So I guess I can picture an empirical prior, only I’d worry about generic compound of drug X being relevantly different from the universe of generics one imagines it was randomly selected from.
On the point: “The price that innovators put on their invention is not one that generic maunfacturers are willing to pay.” Why not allow the Brand named company to get some cut of the profits in exchange for supplying the exact drug. I thought that actually happened at times. (My knowledge is limited to stocks in the biotech arena).
I wonder if this whole issue will be influenced by a recent change of law (in the U.S.) regarding generic companies and the obligation to change labels. It used to be required that they keep the exact label as the Brand name company. Now they are supposed to alter it if, for example, previously unknown side effects crop up. Moreover, I believe they can now be sued by patients. I have a couple of posts on generics I can look up later.But I think it’s silly for a generic co. to start from scratch once the patent expires. Let the Brand company keep the patent a bit longer, in exchange for selling it at a reasonable price.
The business of actually adapting the drug so that it is absorbed in the body in a useful way and an appropriate concentration is sometimes known in the industry as ‘pharmaceutical dvelopment’ and is often much harder than many suppose. I think it would be fair to start with a very vague prior that the concentration ought to be similar but one that would be completely dominated by the data. The loss function asepct is more interesting and this is the aspect of Lindley’s paper that is particularly interesting, although I don’t find the specific solution plausible.
It would be interesting to see what difference any change in the US legal framework would make. The FDA got very confused over the purpose of the legislation some years (more than 15) ago and started pursuing individual bioequivalence. This was quite illogical but a different story. See Senn S. In the blood: proposed new requirements for registering generic drugs. Lancet 1998; 352: 85-86.
Prior to the change in generic labeling, I posted this: https://errorstatistics.com/2012/03/22/generic-drugs-resistant-to-lawsuits/
Professor Senn:
I have a few questions about points in your post and comments,maybe you can explain.
“If the trial is small enough so that the standard error is large enough the width of the confidence interval, however calculated, will exceed the width of the equivalence interval. Thus the type I error rate is zero.” The type 1 error of a test associated with a 1 – a confidence interval, I thought, would be a. Why is it 0?
Another question:you have written “given a small enough trial you could claim equivalence even though the point estimate was outside the limits of equivalence!” Wouldn’t the point estimate x be within the confidence interval? x +/- e
Wouldn’t a Neymanian assign non-equivalence to the null hypothesis, in that it would be worse to declare equivalence erroneously?
Thank you for an interesting post!
Have a look at the diagram here http://www.senns.demon.co.uk/Equivalence%20examples.jpg
This gives a number of possible cases and is based on a similar diagram in Chapter 15 of Statistical Issues in Drug Development. The middle vertical line gives the point of exact equivalence and the other two lines give the boundaries of what is acceptable in terms of bioequivalence. If you look at case C, you will see that the point estimate is exactly what the generic company would hope. However the confidence interval is too wide. Even though the point estimate is perfect, the regulator will not accept a claim of equivalence and no value of the point estimate (given the width of the CI) can produce such a claim. Hence the type I error rate for the conventional 1-alpha CI is zero.
For “two wide” read “too wide” !
To pick up on the second question, the way you have to restore the type I error rate is to allow a point estimate that is sufficiently ‘close’ to the point of exact equivalence to indicate equivalence, even though the conventional confidence limits fall outside the boundaries of equivalence. As the confidence intervals get wider and wider you have to get more and more relaxed as to the definition of ‘close’. Eventually ‘close enough’ is beyond the limit of equivalence!
Hence the general rejection of Neyman-Pearson type optimisation in the context of bioequivalence.
Stephen: What does it mean to speak of the Type 1 error rate of A confidence interval?
If you operate a decision rule by saying ‘reject H0 unless the confidence interval is in such and such a region’ then the decision rule has an error rate under H0. This is the type one error rate.
Stephen: I think there is/was some confusion in my mind as to whether the null was asserting equivalence or inequivalence.
In the context of bioequivalence the null hypothesis is that the drugs are inequivalent. The alternative hypothesis is encompased by the region between the two lines of equivalence.
In the diagram I referenced http://www.senns.demon.co.uk/Equivalence%20examples.jpg
cases D, E & F would be accepted as equivalent by the regulator. Case F is interesting since the confidence limits are inside the limits of equivalence but they do not include zero so that on a conventional test the formulations are ‘significantly different’ but also ‘significantly the same’.
Keith O'Rourke
Nice way to put the rationale for Schuirmann’s “Imagine that we have two regulators: a toxicity and an efficacy regulator. The former defines as toxic any drug whose relative bioavailability is greater than 1.25 and the latter as ineffective any drug whose relative bioavailability is less than 0.8. Each is unconcerned by the other’s decision and so no trading of alpha from one to the other can take place.”
“consider a Bayesian solution in principle” is always a good idea (especially to allow sensible trading of alphas) and possibly the quickest route to a better frequency solution if the heavy mathematical analysis can eventually be worked through.
coreyyanofsky
Nice Dashiell Hammett reference. Red Harvest is a hell of a read.
Corey: Yes, when Senn gave me this title I looked it up and found the movie, which sounds like the kind of story I’d like–never saw it.
FROM TWITTER:
Stephen John Senn @stephensenn 6h @ChristosArgyrop @learnfromerror But see http://onlinelibrary.wiley.com/doi/10.1002/sim.743/abstract … for a criticism of Lindley’s proposal
The reference to Senn’s paper criticizing Lindley’s suggestion is here: https://errorstatistics.files.wordpress.com/2014/06/senn_statistical-issues-in-bioequivalence_statistics-in-medicine.pdf
I had a quick look at Senn’s “Falsification and Clinical Trials” (1991). https://errorstatistics.files.wordpress.com/2014/06/senn-falsificationism.pdf
As always, Senn’s work includes numerous intriguing philosophical points, and the Popperian spirit is largely in sync with my own views. When it comes to illuminating randomization and blindness, points on which I’m often fuzzy, there’s no one better than Senn.
Here’s the peculiarity I find in what Senn says about Popper here.
1. p. 1684: Consider an empirical counterexample to a universal claim T (e.g., Experimental condition A always produces the same effects as condition B). Such a counterexample,says Senn, “is unscientific” (on Popperian grounds), but I don’t see how this can be Popper’s view. The empirical counterexample could be described in different ways (see point 2): basically a case or cases where condition A is observed not to produce the same effect as B. As a logical empiricist Popper holds that the empirical basis for science rests on empirical claims. If they are ousted from science, there would be no conjecture and refutation, and no science.
2.The empirical counterexample to T may be (i) a singular observation claim e, or (ii) an observable (reproducible) effect E. The former might be: the blood concentrations in two groups of patients are x and y, x differs from y. Such singular observations get their scientific status for Popper from his position that anyone who has learned the proper method could detect a flaw, and the fact that there are interconnected techniques for checking mistakes about such observables. It too is fallible (so he’s not a naïve positivist), but easier to corroborate than statistical or general claims. So, viewed as a singular observation claim, e is scientific.
The latter (the empirical statistical claim (ii)) E, however, asserts a real or genuine effect.
Only claims like E are really of interest to science, Popper rightly notes, not singular observations like e. (Only simple generalizations like All swans are white are falsifiable with singular observation statements.) (EGEK, chapter 1)
3. Senn claims E is not scientific, untestable, but I say this isn’t so. How can we corroborate an empirical statistical claim like E, e.g., this is a genuine effect? (Remember a claim C is corroborated for Popper by passing a severe test, one which would have, with high probability, failed C were C false. Put aside that Popper never adequately cashed out severity, we have given a workable notion, we hope.) Empirical or experimental effects are typically inferred by means of statistical rules rejecting claims such as: the effect is not genuine or not reproducible or the like. These are typical null hypotheses of statistical tests.
4. Senn’s empirical claim E is something like this:
E: A produced or can produce an effect that differs from B.
Whether viewed as a singular observation or, more plausibly, an observable effect, it qualifies as scientific for Popper*.
Real effect E would be “falsified” by finding the effect is not reproducible, that it disappears, we cannot bring it about at will, etc. (see EGEK chapter 1).
5. Notice I put quotes around “falsified”—a Lakatosian move that reminds us that except perhaps for the least interesting generalizations, e.g., all swans are white, hypotheses are not logically falsifiable. Rather there is a convention or “decision” that takes a claim to be “falsified” once the difference between observed and expected exceed a prespecified threshold—much as with significance tests.
I’ve said nothing about equivalence trials. According to Senn, “This then constitutes the basic problem of an equivalence trials. If the trial is successful the experimenter can provide no demonstration that it was competent.”
“By competence of a clinical trial I mean the ability of the trial to detect a difference in treatments if it exists.” (p. 1688).
I do not claim to comprehend the special features of bioequivalence testing of drugs, but I don’t get Senn’s logic here, and the bulk of this article strikes me as making logical points. Perhaps having clarified the business of the scientific status of an empirical falsification or observed counterexample to theory T, one is in a better position to analyze the rest.**
*There were some early, caricatures of Popper that Lakatos called “dogmatic falsificationism”, and one could, if one wanted, characterize a singular observation statement as non-testable, but I think it’s a mistake to foist this on Popper. Admittedly David Miller holds some pretty strange views (and I notice Senn references him).
**Some of the most famous experiments in science are “null experiments”, e.g., Michelson Morley, equivalence principles in gravitational physics. So while we can agree with Senn, “Affirming equivalence is fundamentally different from claiming a difference,” it’s not clear at all that affirming equivalence in the case of drugs is fundamentally different from warranting equivalence in other cases in science.
Popper is so often caricatured that I hope at least readers are clear that the empirical counterexample to a generalization is not ousted from the realm of science from Popper. Quite apart from the business of the best way to do bioequivalence, and I can only guess what a severity assessment might produce, no condemnation of the scientific credentials of observed effects is warranted.
Moreover, it’s worth keeping in mind that we manage to warrant, with severity, the equivalence of the free fall acceleration of the moon and earth, finding the Nordvedt parameter to be extraordinarily close to 0. My point is that whatever problem the task has in the realm of bioequivalence, it isn’t a matter of logic or “philosophy”.
Null effects are actually quite powerful in physics, because they can show high competence to detect ultra-minuscule discrepancies (not the scientific term). Then the inference is a matter of setting discrepancy bounds, essentially in the form of confidence intervals, using the knowledge of the detectors. Think of the brilliant Michelson-Morley experiments quite early on–ruling out the Newtonian ether, to everyone’s shock.
Leave a Reply to editor Cancel reply | cc/2020-05/en_middle_0078.json.gz/line1118 |
__label__cc | 0.728576 | 0.271424 | Antarctica /
Cruise Antarctica
from 24 November 2016 to 9 December 2016
Departure Port : Ushuaia
Arrival Port : Ushuaia
Ship : LE SOLEAL
Ref : S241116
To begin your cruise, discover the Falkland Islands and their undulating hills and verdant moors. Farther along, South Georgia is home to imposing glaciers that tilt towards the sea and the black sandy beaches play host to thousands of King Penguins, the emblem of this faraway land.
Then,we will head South to discover the Northern Peninsula’s unique beauty: iridescent icebergs, floating ice fields and extraordinary marine mammals, such as the majestic Humpback Whale or Leopard Seals, playing in the ships’ wake.
PONANT is a voting Member of International Association of Antarctica Tour Operators (IAATO), organization founded in 1991 to advocate, promote and practice safe and environmentally responsible private-sector travel to the Antarctic. (iaato.org).
Free parka
Free boot rental
Wildlife: Huge colonies of King Penguins, many Elephant Seals basking on the black sandy beaches, large populations of Fur Seals and Macaroni Penguins in South Georgia. Also, hundreds of Gentoo Penguins, Adelie and Chinstrap and the majestic Humpback Whales in Peninsula, as well as the elegant Albatros in the Falkland.
Landscapes: Mountain chains, imposing glaciers, lush green pastures. Abandoned former whaling stations and historic centers. Drifting icebergs and sea ice in Peninsula.
Hiking possible: Grytviken, Deception Island and Fortuna Bay.
Outings in Zodiac® dinghies: Cooper Bay, New Island and Half Moon.
Instructive Discovery in the respect of Environment
* Just for example. Taking into account the state of the ice and the weather conditions.
Designed in 2013 and loyal to the PONANT spirit, Le Soléal like her sisterships embodies the subtle alliance between luxury, intimacy and wellbeing which is Ponant’s signature. The elegance of her exterior and interior lines and her intimate size (only 132 staterooms and suites)make this a rare and innovative yacht on the cruise market.
With her fluid lines and a modern colour scheme combining natural wood with shades of grey and white, Le Soléal presents references to a nautical theme.
PONT 2
Capital of Argentina's Tierra del Fuego province, Ushuaia is considered the gateway to the White Continent and the South Pole. Nicknamed “El fin del mundo” by the Argentinian people, this city at the end of the world nestles in the shelter of mountains surrounded by fertile plains that the wildlife seem to have chosen as the ultimate sanctuary. With its exceptional site, where the Andes plunge straight into the sea, Ushuaia is one of the most fascinating places on earth, its very name evocative of journeys to the unlikely and the inaccessible…
25 November 2016 – At sea
26 November 2016 – New Island, Grave Cove
Make your way through the turbulent Woolly Gut strait and emerge in the stillness of Grave Cove. Located in the northern edge of the Falkland Islands, this bay owes its name to the vestiges of whalers’ graves that overlook the beach. As you step off the boat and onto the white-sand beach, you might find yourself escorted by a few hospitable Commerson's dolphins, elegantly adorned in black and white. A stroll along the grassy dunes will lead you to a vast plain of lush green grass, tended by a few sheep. On the other side of the island you'll find one of the largest gentoo penguin colonies in the area. With some luck, you'll also glimpse a sea lion scouring the waves for his next meal.
27 November 2016▸28 November 2016 – At sea
29 November 2016 – Salisbury Plain - Fortuna Bay
30 November 2016 – Grytviken - St Andrews Bay
1 December 2016 – Gold Harbour
Majestic glaciers with a bluish sheen, waterfalls that reflect the rays of the setting sun, pitch-black volcanic sand beaches: these are just a few of the wonders to be found in Gold Harbour's landscape. This natural gem is blanketed by bright green tussocks and framed by snow-capped peaks. On this island where summer days are endless, the wildlife stays up with the sun. Fur seals, elephant seals and king penguins move about the island like tiny black dots along the landscape. Those humans who enter this kaleidoscope of colours and sensations do so as privileged and tolerated observers of the austral wildlife.
2 December 2016▸3 December 2016 – At sea
4 December 2016 – Weddell Sea
Amidst the eerie stillness of the Weddell Sea, you'll wend your way through a veritable labyrinth of majestic table icebergs. Sweeping ice platforms sculpt a landscape unlike any other, populated by fur seals, penguins, wandering albatross and other imposing seabirds. The Weddell seal, king of this realm, will welcome you to his territory with a haunting cry that pierces the surrounding silence. You'll recognise him by his dark grey coat and spotted belly. Weddell seals have the impressive distinction of being able to stay underwater for more than an hour.
5 December 2016 – Gerlache Strait
5 December 2016 – Enterprise
6 December 2016 – Deception Island
Situated just above the northern tip of the Antarctic Peninsula, Deception Island is easily recognisable thanks to its distinctive horseshoe shape. The crater of this former volcano caved in 10,000 years ago and the resulting caldera was flooded, creating a natural harbour. Deception Island still bears traces of its past as a longtime hub of the whaling industry. The vestiges of abandoned sheds that line the black sand of its volcanic beaches share space with the island's spectacular fauna: it is home to the Antarctic Peninsula’s largest colony of chinstrap penguins, as well as numerous elephant seals and fur seals.
6 December 2016 – Half Moon Island
Nestled among the South Shetland Islands in the icy waters of the Antarctic, Half Moon plunges visitors into a surreal and mystical setting. Long, jagged coastlines alternate with gently sloping bays, overlooked by petrified volcanic pipes. Camara, a former Argentine research station built at the centre of the island in 1953, still stands in the crook of a vast, crescent-shaped beach of large ash-coloured pebbles battered by icy electric-blue waves. Half Moon's wild lunar landscape is home to a number of animal species, including chinstrap penguins, fur seals, Weddell seals and Antarctic terns.
7 December 2016▸8 December 2016 – Drake Passage
If there is one place, one sea, one waterway dreaded by tourists, researchers and hardened seafarers alike, it is undoubtedly Drake Passage. Situated at the latitude of the infamous Furious Fifties winds, between Cape Horn and the South Shetland Islands, it is the shortest route to connect Antarctica to South America. Seasoned navigators will tell you that you must earn your visit to the White Continent! As the Antarctic convergence zone where cold currents rising up from the South Pole meet warmer equatorial water masses, Drake Passage harbours a very diverse marine fauna. Don't forget to look to the sky to catch a glimpse of elegant albatross and Cape petrels, playfully floating about in the wind around your ship.
Argentina: should you require a visa to travel to Argentina, we recommend you apply for a double-entry visa as a technical stop in Chile might be scheduled.
We remind you that all our ships have a doctor on board and medical facilities. However, these cannot, under any circumstances, be compared to any medical structure on land. Given the remote areas in which we will be sailing for a number of days, safety requirements mean that we are obliged to ask each passenger signing up for this program to provide us, no more than 45 days before departure, with a medical certificate from their GP, as well as the completed medical questionnaire received during registration.
Polar Expedition
Discover the unique concept of PONANT polar expedition cruises: explore the world’s extreme regions while enjoying luxurious comfort and service.
Choosing a PONANT expedition cruise means choosing a state of mind: the alliance of elegance and authenticity, of exploration and comfort, of adventure and refinement… The comfort of your ship and your stateroom, personalised and attentive service, refined gastronomy: a very special atmosphere that we take great care to maintain. In the heart of the ice floes of the Arctic and the Antarctic, our luxurious services will ensure that your expedition cruise is an unforgettable experience.
PONANT, polar specialists
With almost 20 years of experience in the extreme regions, PONANT, the world’s number 1 polar cruise company, is a real polar specialist. PONANT will take you to the most remote regions in total safety: our Captains and crew are professionals, specially trained to sail in icy waters. Our latest-generation fleet has the most modern technology to guarantee both your safety and respect for the regions visited. The size of our ships means we can get as close as possible to areas that are difficult to reach, offering a privileged access to preserved sites. Our flexibility enables us to adapt to the surprises inherent to these expedition itineraries.
After scouting missions in the field, our Expedition Leaders and their teams of naturalist guides design exceptional itineraries in the polar regions. During the cruise, they organise daily outings and shore visits in Zodiac® dinghies and hikes on land so as to get as close as possible to nature and wild fauna. In the Arctic and in Alaska, the close relationships that our teams have been able to build with the local communities will enable you to understand the life of these peoples of the Far North, and to share it for a few hours. On board, the naturalist guides will share their knowledge during various conferences on fauna, the history of the great explorations, geology and climatology…
Expeditions programs include activities such as Zodiac® outings (often with "wet landing"), moderate walks to more active hikes. All this accompanied by your expedition team of naturalist guides. Calls, landings & zodiac® cruises will depend on weather conditions, position of ice (during polar cruises) and winds and the state of the sea. These can force a change of plans at any time.
Taking into consideration the unusual and exceptional character of expedition itineraries, the calls shown are an indication only. The final route will be confirmed by the Captain and Expedition Leader, who will take into account the touristic quality of the sites and above all, the safety of the passengers. Their decision will be subject to that of local authorities and the expert pilots present on board during the navigation in polar and /or isolated zones.
Travelling to polar/isolated regions is an exhilarating experience. The raw beauty and untouched wilderness offer an unusual chance to experience a place where there is little evidence of human presence. Inevitably, there are some consequences that come with such remoteness: please remember that you are far from modern hospitals with full medical facilities, thus evacuation is highly expensive. Without the necessary medical coverage, all expenses will have to be immediately paid for with your personal funds. We urge you to subscribe a full coverage insurance, choose your insurance company very carefully and be extremely vigilant and ensure your insurance is fully comprehensive.
Dressing tips:
Water-resistant parka offered on board (for adults only) on Expedition cruises where the stamp “Parka gift” appears
Half calf rubber boots with non-slip soles, which will allow you to land in 20 cm of cold water, keeping your feet dry for walks and visits on steep paths. You can also bring water-resistant hiking boots. A boots rental will be offered onboard (for adults only) on Expedition cruises where the stamp “Boots offered” appears
Comfortable pants: classic Winter pants, warm cotton tracksuit
Water-resistant windbreaker over pants - COMPULSORY
Winter pants with water-resistant over pants is the ideal combination: water-resistance and comfort suitability of pants are essential
Pullover, sweat-shirt or fleece jacket
Thermal sweater
Fleece muffler and fleece cap or thermal beanie covering ears (avoid scarfs which do not stand still)
Water-resistant and supple gloves
Polarized sunglasses with high UV filter
Walking sticks (highly recommended)
23/11/2016 – Overnight in Buenos Aires (1 day/1 night)
Day 1 Buenos Aires
Meet and greet at the airport upon arrival of flight selected by Ponant, flight AF 394 landing at 8.55am (please note that flight information is subject to change). Look for Ponant sign.
Transfer to Intercontinental Hotel (or similar). Check-in.
Morning and lunch at leisure.
In the afternoon, panoramic tour of Buenos Aires.
You will discover the highlights of the attractive and pulsating capital of Argentina. The metropolis is famous for being the Paris of South America and the visitor will quickly figure it out it by looking at its architecture. Mainly in down town and in the central neighbourhoods, you will find testimonies of its glorious past. You will visit the heart of the city, May Square (Plaza de Mayo), with the Government House (Casa Rosada) on one side and the cathedral on the other side, and the City Hall. The Cabildo is right across the street, it is the Town Hall of colonial times. The square is also known as the "Mothers of May Square" (Madres de Plaza de Mayo), with their mute protests they started during the military government. From there, the bus drives you through San Telmo (a tango district) to La Boca, with its most famous colourful and picturesque houses on Caminito Street. La Boca is the oldest harbour of Buenos Aires and in the early 20th century, most Italian immigrants made here their first steps in their new homeland. Today, it is the favourite neighbourhood for these Italian families' descendants. At the end of the tour you will visit the northern part of Buenos Aires. The Recoleta neighbourhood with its French style wide avenues, parks and residential houses contrasts with the “Barrio de La Boca”. Here, you will visit the unique monumental cemetery, where Evita Perón and other historical people are buried.
Dinner and overnight at the hotel.
Transfer to Buenos Aires airport (airport info to be advised a few months prior to the cruise), in connection with the flight Buenos Aires / Ushuaia.
Your Hotel :
Intercontinental hotel:
InterContinental Buenos Aires brings 1930s sophistication and service to Old Town. It’s easy to feel the Argentinian spirit when you’re so close to cultural mainstays such as tango academies, theatres, traditional coffee shops and the soccer stadium. The financial district and the famous Calle Florida shopping street are within walking distance.
Amenities & services: health & fitness center, spa, hotel shops, business services, access to Internet, laundry, safe at reception.
1 night at Intercontinental or similar, with early check-in.
Hospitality desk in the morning on day 1, with English speaking assistance
Half board and beverages during diner (bottled water + 1 soft drink or 1 local beer + 1 coffee or 1 tea).
Transfers as per program
English-speaking local guide.
Gratuities for driver and local guide – we suggest the amount of USD 1 per person per day, as per local custom
Personal expenses, and other services not mentioned in the program
The local currency is the Argentinian Peso. You will be able to make most of your purchases in USD (in small denominations) or by credit card, accepted in most hotels, shopping centers and boutiques. You will also be able to retrieve Pesos from the ATM’s.
Summer season. In Buenos Aires, temperatures range between 72F and 86F. We recommend light clothing.
Seats are limited. Subject to availability. The duration of the tour is subject to change. The order of the visits may be reversed.
Buenos Aires 1091AAQ
Phone number : +54-11-4340 7100
Website:www.ichotelsgroup.com
24/11/2016 – Tierra del Fuego National Park (half-day)
The flight selected by PONANT will be communicated with your travel documents or upon request via your travel professional.
Would you like to join this program but are travelling on a different flight than the one selected by Ponant ? Please, do not hesitate to contact our travel agents or your travel professional, Ponant can organize your private transfer.
Today your afternoon will be dedicated to the discovery of the Tierra del Fuego National Park which got created in 1960 and covers 155 acres. It is located south west of the Tierra del Fuego Province on the Beagle Canal. One of his entries stands slightly over 6 miles from Ushuaia.
Mountainous landscapes, lagoons, bogs, and rivers draw a picturesque scenery reinforced by the southern position of the park itself. The Darwin Mountains, which represent the southern part of the Andes Mountains are mainly responsible for such landscape. The Park is only partly accessible to the Public and this tour will provide you with the opportunity to discover the local flora and sub- Antarctic landscapes; should you get lucky you may encounter beavers dams, birds, wild orchids etc… This is a true paradise for Nature Lovers!
At the end of your visit, you will return to Ushuaia and the port, for embarkation on your vessel.
The excursion by local bus and the entrance fees to the National Park
Transfer and visit as mentioned in the programme
The services of a local French speaking guide
Duration of the excursion: 3h30 to 4h approximately (please note that the operation of the tour as described in duration is also subject to the local weather conditions over the whole area).
Pre booking is compulsory if you wish to participate in this tour (reservation has to be done at the moment you book your cruise)
Tips for the guide and the driver are not included therefore we typically recommend 1 USD per person according to local use. A minimum participation is required to operate the tour; below this minimum, our local representative will not be able to guaranty the tour departure.
Tips for the guide and the driver are not included therefore we typically recommend 1 USD per person according to local use.
During the austral summer season, temperatures can vary a lot in Ushuaia, between 5°C to 15°C as an average.
We recommend you pack in your hand luggage some warm windproof clothes and comfortable shoes for this visit.
La durée des excursions est donnée à titre indicatif. L’ordre des visites peut être inversé.
Duration and price of the visits are given as a guide only. The order of the visits may be reversed.
22/11/2016 – Pre Cruise Overnight in Buenos Aires + Flights | cc/2020-05/en_middle_0078.json.gz/line1124 |
__label__cc | 0.525879 | 0.474121 | Talk:K-pop band 100%'s lead singer Seo Minwoo dies
Review of revision 4393310 [Passed][edit]
Revision 4393310 of this article has been reviewed by Pi zero (talk · contribs) and has passed its review at 21:49, 28 March 2018 (UTC).
Copyright: Passed
Newsworthiness: Passed
Verifiability: Passed
NPOV: Passed
Style: Passed
Comments by reviewer:
Formally he'd be Seo (family name). One of the sources refers to him that way on subsequent mentions. The other two sources refer to him on subsequent mentions as Minwoo, but only after saying a few works of explanation (iirc, one says he was common known as Minwoo, the other says he performed as Minwoo). Since we don't give an explanation for using Minwoo, and since Seo appears to be an acceptable formal alternative, that's what I went with.
As the reporter noted, one of the sources says he was 32 instead of 33. I take it that's a mistake; his birthday appears to have been in February 1985. I hope to submit an edit shortly after publication to that effect.
The reviewed revision should automatically have been edited by removing {{Review}} and adding {{Publish}} at the bottom, and the edit sighted; if this did not happen, it may be done manually by a reviewer.
Title[edit]
Care to explain what K-pop is? --SVTCobra 11:02, 29 March 2018 (UTC)
Sure. Words “band” and “singer” makes it clear that it is a music genre (few years ago, that is how I figured it out); which, by the way, was discussed on IRC if it was fine.
103.254.128.130 (talk) 11:05, 29 March 2018 (UTC)
It appears in the title, but not the article. --SVTCobra 11:09, 29 March 2018 (UTC)
I noticed that during review. It's not ideal. --Pi zero (talk) 11:10, 29 March 2018 (UTC)
Well within 24 hours to make the change.
Retrieved from "https://en.wikinews.org/w/index.php?title=Talk:K-pop_band_100%25%27s_lead_singer_Seo_Minwoo_dies&oldid=4393425"
Peer reviewed/Passed
Peer reviewed/Passed/Pi zero | cc/2020-05/en_middle_0078.json.gz/line1125 |
__label__wiki | 0.683394 | 0.683394 | Argentina national futsal team
La Albiceleste
Asociación del Fútbol Argentino
(Argentine Football Association)
CONMEBOL (South America)
Matías Lucuix
Luis Sasson
Leandro Planas
Home stadium
Home colours
Away colours
Portugal 3–4 Argentina
(Brasília, Brazil; 14 September 1987)
Indonesia 1–20 Argentina
(Kuala Lumpur, Malaysia; 4 June 2003)
Brazil 14–1 Argentina
(Santos, Brazil; 14 March 1999)
Champions (2016)
South American Futsal Championship
Champions (2003, 2015)
Grand Prix de Futsal
2nd place (2008)
The Argentina national futsal team represents Argentina during international futsal competitions. It is governed by the Asociación del Fútbol Argentino.
Argentina has qualified and participated in all eight FIFA Futsal World Cup tournaments and along with Brazil and Spain are the only national teams that have won the FIFA Futsal World Cup. Argentina has also won the Copa América twice. Argentina is ranked 4th in the FIFA Futsal World Rankings.
In FIFUSA -International Futsal Federation- Argentina won the 1994 FIFUSA Futsal World Cup and 2019 AMF Futsal Men's World Cup
In IBSA "Los murcièlagos" two times world champions of IBSA Blind Soccer/Futsal World Championship, and in 2015 won his third world title: the IBSA World Games 2015. "Los murcièlagos" also won the Blind Futsal Copa Amèrica - Copa Amèrica de Fùtbol para ciegos-. Only Brazil and Argentina won the Blind Futsal Copa Amèrica.
1 Tournament records
1.1 FIFA Futsal World Cup
1.2 Copa América de Futsal
1.3 FIFA Futsal World Cup qualification (CONMEBOL)/CONMEBOL Preliminary Competition
1.4 Futsal Confederations Cup
1.5 FIFUSA/AMF Futsal World Cup
1.6 FIFUSA/AMF Futsal U-20 World Cup
1.7 IBSA Blind Futsal World Championship
1.8 IBSA World Games
1.9 Pan American Games record
1.10 Grand Prix de Futsal record
1.11 Futsal Mundialito record
2 Squad
2.1 Argentina
Tournament records[edit]
FIFA Futsal World Cup[edit]
See also: FIFA Futsal World Cup
FIFA Futsal World Cup Record
1989 Second Round 8th 6 2 0 4 13 18
1996 First Round 9th 3 1 1 1 7 9
2004 Fourth Place 4th 8 4 1 3 21 18
2012 Quarter-Finals 5th 5 3 0 2 18 9
2016 Champions 1st 7 6 1 0 26 11
2020 TBD
Copa América de Futsal[edit]
See also: Copa América de Futsal
Copa América de Futsal
1992 Runner Up 6 0 0 0 0 0
1996 Third Place 6 0 0 0 0 0
1998 Fourth Place 6 0 0 0 0 0
2003 Champions 5 4 1 0 21 9
2008 Third place 4 3 0 1 10 8
2011 Runner Up 5 3 1 1 20 11
2015 Champions 6 3 2 1 20 11
2017 Runner Up 6 4 1 1 26 9
FIFA Futsal World Cup qualification (CONMEBOL)/CONMEBOL Preliminary Competition[edit]
2012 – Champions
2016 – 2nd place
Futsal Confederations Cup[edit]
2009 – Did not enter
FIFUSA/AMF Futsal World Cup[edit]
1982 – Seventh place
1985 – Fourth place
1991 – Fifth place
1994 – Champions (host)
2000 – 3rd place
2003 – Quarterfinals
2007 – 2nd place (host)
FIFUSA/AMF Futsal U-20 World Cup[edit]
IBSA Blind Futsal World Championship[edit]
IBSA World Games[edit]
Pan American Games record[edit]
Grand Prix de Futsal record[edit]
Futsal Mundialito record[edit]
1995 – Sixth place
Squad[edit]
Argentina[edit]
Head coach: Diego Giustozzi
Date of birth (age)
1 1GK
Nicolás Sarmiento
(1992-12-03)3 December 1992 (aged 23) Palma
2 2DF
Damián Stazzone
(1986-01-31)31 January 1986 (aged 30) Latina
3 3MF
Alamiro Vaporaki
(1983-12-01)1 December 1983 (aged 32) Boca Juniors
Gerardo Battistoni
(1983-04-21)21 April 1983 (aged 33) Latina
5 4FW
Maximiliano Rescia
(1987-10-29)29 October 1987 (aged 28) Pescara
Fernando Wilhelm
(1982-04-05)5 April 1982 (aged 34) Benfica
Leandro Cuzzolino
(1987-05-21)21 May 1987 (aged 29) Pescara
Santiago Basile
(1988-07-25)25 July 1988 (aged 28) Boca Juniors
Cristian Borruto
(1987-05-07)7 May 1987 (aged 29) Pescara
10 4FW
Constantino Vaporaki
(1990-01-06)6 January 1990 (aged 26) Boca Juniors
Alan Brandi
(1987-11-24)24 November 1987 (aged 28) Jaén Paraíso Interior FS
12 1GK
Matías Quevedo
(1984-03-11)11 March 1984 (aged 32) Ferro
Guido Mosenson
(1989-03-07)7 March 1989 (aged 27) Hebraica
14 3MF
Pablo Taborda
(1986-09-03)3 September 1986 (aged 30) Boca Juniors
^ Futsal World Ranking
Official website, at the Asociación del Fútbol Argentino's website
National sports teams of Argentina
Association football
M U-23
men's 3x3
W U-19
women's 3x3
mixed 3x3
women's u-19
Deaflympics
Futsal in Argentina
Argentine Football Association
International futsal
AMF Futsal World Cup
AMF Futsal Women's World Cup
Women's Futsal World Tournament
World University Championship
Futsal Mundialito
Futsal Awards
Futsal Championship
Women's Futsal Championship
Futsal Cup of Nations
and Caribbean
UEFA: Futsal Championship
UEFA Women's Futsal Championship
FEF: UEFS Futsal Men's Championship
UEFS Futsal Women's Championship
National futsal teams of South America (CONMEBOL)
Retrieved from "https://en.wikipedia.org/w/index.php?title=Argentina_national_futsal_team&oldid=932444358"
South American national futsal teams
Use dmy dates from June 2014 | cc/2020-05/en_middle_0078.json.gz/line1126 |
__label__wiki | 0.893625 | 0.893625 | ReGIS, short for Remote Graphic Instruction Set, was a vector graphics markup language developed by Digital Equipment Corporation (DEC) for later models of their famous VT series of computer terminals. ReGIS supported rudimentary vector graphics consisting of lines, circular arcs, and similar shapes. Terminals supporting ReGIS generally allowed graphics and text to be mixed on-screen, which made construction of graphs and charts relatively easy.
3 Sample
ReGIS was first introduced on the VT125 in July 1981, followed shortly thereafter by the VK100 "GIGI" which combined the VT125 display system with composite video output and a BASIC interpreter. Later versions of the VT series included ReGIS, often with color support as well. This included the VT240 and 241 and the VT330 and 340. ReGIS is also supported by a small number of terminal emulator systems.
ReGIS replaced an earlier system known as waveform graphics that had been introduced on the VT55 and later used on the VT105. DEC normally provided backward compatibility with their terminals, but in this case the waveform system was simply dropped when ReGIS was introduced.
Description[edit]
ReGIS consisted of five primary drawing commands and a selection of status and device control commands. ReGIS mode was entered by specifying the escape code sequence ESCP0p, and exited with ESC\. The sequence ESCP is the generic Device Control String (DCS) used in the VT series of terminals, and is also used for a variety of other commands. The digit following the DCS was optional and specified a mode, in this case mode 0. Mode 0 was the default and picked up drawing where it left off, 1 reset the system to a blank slate, and 2 and 3 were the same as 0 and 1, but left a single line of text at the bottom of the screen for entering commands.
All drawing was based on an active pen location. Any command that moved the pen left it there for the next operation, similar to the operation of a mechanical plotter. The coordinate system was 0 to 799 in the X axis, and 0 to 479 in Y, with 0,0 in the upper left. In early implementations such as the VK100 and VT125, the actual device resolution was only 240 pixels, so the Y coordinates were "folded" so odd and even coordinates were the same location on the screen. Later models, starting with the VT240 and VT241, provided the full 480 pixel vertical resolution. The coordinate system could also be set by the user.
Coordinates could be pushed or pulled from a stack, and every command allowed the stack to be used as a parameter, the "b" parameter pushed the current coordinates on the stack, "e" popped it back off again. Coordinates could be specified in absolute or relative terms;
[200,100] is an absolute position at x=200, y=100
[+200,-100] is a relative position at x=current X+200, y=current Y-100
[200] is absolute x=200, y=unchanged (same as [200,+0])
[,-100] is relative, x=unchanged, y=current Y-100
There were four main drawing commands and three control commands;
P "Position", move the pen
V "Vector", draw a line
C "Curve", draw a circle (C) or arc (A)
F "Fill", draws a filled polygon
T "Text", output the following string of text
S "Screen", a catch-all command for setting a wide variety of modes
R "Report", outputs current status
W "Write", sets the pen parameters
L "Load", loads an alternate character set
@ "Macrograph", see below
Each of these commands used the various coordinate modes in different ways, and some had additional parameters that were enclosed in parentheses. Commands could be followed by one or more parameters, allowing continued drawing from a single command. The interpreter was not case sensitive.
Some ReGIS terminals supported color, using a series of registers. These could be set with the S command using a variety of color input styles. s(m3(r100g0b0)) sets color register ("map") 3 to "r"ed using the RGB color system, while s(m3(h120l50s100)) does the same using the HSV system. The W command likewise set a wide variety of different styles, mostly for masking, fills and brushes.
Finally, ReGIS allowed commands to be stored into a macrograph and then recalled using the @ operator. Up to 10,000 characters of code could be stored in the macros, each named with a single letter. The advantage was that the series of operations in the macro could be invoked by sending only two characters over the serial port, as opposed to the entire sequence of commands.
Sample[edit]
Example ReGIS code displayed on an xterm emulating a VT340 terminal.
<ESC>P0p
S(E)(C1)
P[100,440]
V(B),[+100,+0],[+0,-10],[-100,+0],(E)
P[500,300],F(C[+100])
<ESC>\
This code enters ReGIS mode and uses the S command to erase the screen with (E) and then turns on the visible cursor with (C1). P[100,440] moves the pen to 100,440 absolute. V(B),[+100,+0],[+0,-10],[-100,+0],(E) draws a series of lines, first pushing the current pen location onto the stack with (B), then drawing three lines using relative coordinates, and then using (E) to pop the previously saved location off the stack and draw to it. The result is a rectangle 100 by 10 pixels in size.
P[500,300],F(C[+100]) then moves to a new location, and uses the "F"ill command to wrap a "C"ircle. The fill command could wrap any number of commands within its parentheses, allowing it to fill complex shapes. It also allowed the inclusion of a "temporary write" that allowed the programmer to set the fill style within the fill, and abandon it as soon as it ended.
Sixel
"VT330/VT340 Programmer Reference Manual, Volume 2: Graphics Programming", Digital, EK-VT3XX-GP-002, 2nd Edition, May 1988
"DEC ReGIS Graphics News", DEC Professional, August 1990, pg. 22
Retrieved from "https://en.wikipedia.org/w/index.php?title=ReGIS&oldid=902857006"
Graphics file formats
Vector graphics markup languages
Digital Equipment Corporation
Graphical terminals | cc/2020-05/en_middle_0078.json.gz/line1127 |
__label__cc | 0.709346 | 0.290654 | EECS showcases strengths at FUZZ-IEEE International Conference
Electrical Engineering & Computer Science’s Jim Keller served as conference co-chair and Derek Anderson as program co-chair.
MU researchers reach blood pressure breakthrough
The Mizzou team of researchers utilized non-contact hydraulic bed sensors to estimate relative systolic blood pressure — the top number in a typical blood pressure reading — by extracting features from the ballistocardiogram (BCG) signal.
EECS summer programs shed light on cyber security, machine learning
The Electrical Engineering and Computer Science Department had another busy summer, hosting its National Science Foundation-funded Research Experience for Undergraduates: Undergraduate Research in Consumer Networking Technologies and Summers@Mizzou Hacker Trackers program.
EECS professor named to AIMBE College of Fellows
Marge Skubic’s extensive and groundbreaking work in the field of eldercare and rehabilitation technology has earned several honors over the years. The latest comes from the American Institute for Medical and Biological Engineering.
NIH grant supports tailoring eldercare health alert system for consumer use
Now, thanks to a new grant from the National Institutes of Health, members of the Center for Eldercare and Rehabilitation Technology will investigate tailoring the system to alert the patients themselves or family members, providing actionable data that’s easy for non-health professionals to use.
The MU College of Engineering’s Research Experience for Undergraduates (REU) recently wrapped up its 10-week summer session, with brilliant students from around the country completing work on cutting-edge computer science projects.
EECS Professor’s research featured by KOMU
KOMU-TV featured Electrical Engineering and Computer Science Professor Marge Skubic’s research on using bed sensors to predict potential health issues for senior citizens.
Sensors increase ability to predict senior citizen falls
A sensor system developed and used by researchers at the University of Missouri produces images and sends automatic e-mail alerts that can be used to predict a fall within a three-week period.
Catching them before they fall: MU gait study aims to predict fall risk in elderly
by Kelsi Anderson
Marjorie Skubic, MU professor of electrical and computer engineering, said the study found that the speed of a person’s walk translated to how likely they are to fall.
MU researchers monitor health with bed sensors
Marjorie Skubic, MU professor of electrical and computer engineering and director of the MU Center for Eldercare and Rehabilitation Technology, said the bed sensors’ purpose is to detect any possible health problems while helping patients to “age in place” in the comfort of their own homes. | cc/2020-05/en_middle_0078.json.gz/line1130 |
__label__cc | 0.734415 | 0.265585 | TM5K & Mike Elbeck Family Fun Run
Hogback Hill Park, 8892 W Trailmark Pkwy, Littleton, CO 80127, USA
ONLINE IS NOW CLOSED. EVENT DAY REGISTRATION IS AVAILABLE STARTING AT 9 A.M.
Celebrate Fall with your neighbors and friends and join us for a morning full of fun. The festivities will include a 5K Run/Walk, and the Mike Elbeck Family Fun Run, face painting and bounce houses! But that's not all because we want to see you and yours in your best Halloween costume, prizes will be awarded for best costumes!
In honor of Mike Elbeck, our dear friend, neighbor, and all around kid at heart, the family fun run has been named in his honor. We lost Mike last just a month after last year's event unexpectedly (November).
Mike was a retired Denver Police Officer, who always was there for anyone anytime without ever asking. Too many of our kids that lived near him, he was the 2nd grandfather, he always put out a wonderful Christmas display (he decorated the house blue and had the trains on the deck) that was always so bright, we would kid Mike that we had to call DIA to ensure planes didn't land on our street. He coordinated most of the S. Holland block parties, and above all else, Mike was about enjoying family and friends. We hope you will join us in the 5K Run/Walk and/or the Family Fun Run (approx 1 mile) and enjoy your family and friends in honor of Mike. A donation will be made in honor of Mike to the American Heart Assocation. Mike had one of the biggest caring hearts!
Event Schedule: 9AM Packet Pick-up and Race Day Registration Open 10AM 5K Start 11AM Mike Elbeck Family Fun Run Start
We are looking for sponsors from neighborhood business owners. If you are interested in sponsoring part of the event, please email the Social Committee at social@trailmarkhoa.org. | cc/2020-05/en_middle_0078.json.gz/line1137 |
__label__wiki | 0.911055 | 0.911055 | Tragic Kingdom
By David Browne
Updated August 02, 1996 at 04:00 AM EDT
Pinterest Mail Email iphone Send Text Message Print Comment
If Darius Rucker was the public’s antidote to tormented flannel wearers like Kurt Cobain, is Gwen Stefani the anti-Courtney Love? On the cover of their third album, Tragic Kingdom, the Anaheim, Calif., band No Doubt boldly presented their calling card: the leggy, bleached-blond Stefani in a red plastic miniskirt — Betty Grable for the mosh-pit set. The song that transformed the album into a top 10 sleeper hit is a chirpy, ska-tinged bopper called ”Just a Girl.” It’s hard to imagine Liz Phair or Veruca Salt singing such a coquettish phrase, unless with the utmost withering irony.
The musical reasons for the band’s success are as obvious as its cover art. The 14 songs on Tragic Kingdom are a virtual Cuisinart of the last two decades of pop: a hefty chunk of new-wave party bounce and Chili Peppers-style white-boy funk, with dashes of reggae, squealing hair-metal guitar, disco, ska-band horns, and Pat Benatar, whom Stefani occasionally resembles vocally. (”Excuse Me Mr.” takes in nearly all those styles in three minutes.) Rarely have a band called alternative sounded like such savvy, lounge-bred pros. The album’s next single, ”Don’t Speak,” is an old-fangled power ballad that will no doubt further expand their fan base.
Their videos, in which band members do such uncool things as merrily leap up and down, match the splashy, three-dimensional sound of the music. Martha Quinn could have easily introduced them on MTV circa 1984. Even with their splashy graphics, the image that lingers from the video is Stefani — in particular, her belly button, eyelashes, and fire-engine-red lipstick.
All of which is business as usual, except that female rock stars like Gwen Stefani aren’t supposed to exist anymore. In our newly progressive times, women play electric guitars and openly spew their feelings. Girls with guitars are so prevalent, in fact, that hearing one on the radio or seeing a woman-led band in a video is no longer startling — which, in itself, is progress. The ”angry woman” variation on this trend has been validated by the petulant whinings of Alanis Morissette and has led to the marketing of any number of disparate singer-songwriters — Tracy Bonham, Patti Rothberg, the Beth Hart Band — as her successor.
The rub is a major one — namely, few are buying any of those albums (except, of course, Morissette’s), and they are buying No Doubt’s. Is it because most of the Alanis-ettes haven’t made memorable music, or could it be that, as anti-progressive as it sounds, the general public still wants its female rockers to look and act like stars? With her pouty voice and glamour-girl looks, Stefani is more than happy to play the starlet. Her voice verging on a girlish hiccup, she can write mewling lines like ”I’m waiting for him to rescue me” (from ”Excuse Me Mr.”) that are worthy of the rescue-me blankness of Mariah Carey’s entire repertoire.
Beneath Stefani’s girls-still-wanna-have-fun image lies some spunk. In several songs, like the single ”Spiderwebs” and ”End It on This,” she acknowledges obsessions with losers and decides to break free. In ”Happy Now?” she rebuffs a man who ended their relationship and who wants back in: ”All by yourself/You have no one else,” she taunts, savoring the moment. ”Sixteen,” cowritten by Stefani and bassist Tony Kanal, is her song of solidarity with misunderstood teenage girls throughout the land. Courtney Love can sing about being ”the girl with the most cake,” but Stefani’s ”Why do they have to force us/Through this metamorphose” is blunter and less elliptical. And despite its title, ”Just a Girl” is meant as a sarcastic rebuke to the helpless-female cliche.
Still, the success of Tragic Kingdom appears to reaffirm one showbiz tenet: Sex still sells, even when it comes to women musicians. Maybe we don’t live in such progressive times after all. C+ | cc/2020-05/en_middle_0078.json.gz/line1143 |
__label__wiki | 0.583604 | 0.583604 | Around Macomb
Mark's Message
Blog About It
Macomb County’s Health Leader Gets Diversity Award
Baseball Stadium is a Macomb Home Run
Sterling Heights Dedicates First Paddle Landing Site
Labor Day Lawn Chores
Employee Focus - Our Mr. Fix-its
Macomb's Memories - George Caram Steeh
Pets of the Month
Recipe Stop
Food Program Volunteers Recognized
On Sept. 11, the Macomb Food Program recognized more than 150 volunteers who help the program its network of more than 50 pantries throughout Macomb County.
COMTEC Shown to the World
Macomb County’s COMTEC was chosen as a tour site for the Intelligent Transportation Systems (ITS) World Congress conference at Cobo Center, Detroit last week. ITS involves technical innovations that apply to the efficiency and safety of ground transportation systems.
The tours showed visitors how Macomb County manages traffic operations. This will make COMTEC one of the most toured public facilities as a part of the World Congress.
Hackel, Randazzo Featured at Pet Conference
The Michigan Pet Fund Alliance presented Macomb County Executive Mark A. Hackel with an Elected Official's Homeless Animal Friend award during the organization's conference on Sept. 4. Macomb County Animal Chief Jeff Randazzo was also a featured speaker at the conference.
Feel free to check out any of the events listed below -- or look at our events calendar -- for additional ways to be involved either at work or around Macomb County!
NextGEN Macomb Invites Young Professionals to Attend an Informal Mixer, Participate in Survey
NextGEN Macomb, a young professionals group in Macomb County, is inviting the public to join them at a launch party from 6 p.m. to 8 p.m. on Sept. 24 at Three Blind Mice in Mount Clemens. The event is sponsored by Macomb County Planning and Economic Development. Read More...
Super Prepared!
Healthstyles Brings Lunch and Learn to Employees
Mount Clemens Santa Parade Seeks Volunteers
If you're driving around Macomb County, click here to find a list of the latest construction projects.
SEMCOG and MAC Survey Asks for Citizen Perspectives on Driving Behaviors
In an effort to impact quality of life in Southeast Michigan by keeping our roads and highways safer, SEMCOG, the Southeast Michigan Council of Governments, and its partner organization MAC, the Metropolitan Affairs Coalition, have launched a survey to gather driver perceptions on dangerous activities behind the wheel. Read More...
It’s been almost two years since Macomb Matters first graced the screens of our work computers, and during that time, it has provided the latest news and events to employees. This is more than just simple information sharing. Knowing what goes on in the workplace, where we spend a great deal of our time, also builds a sense of community.
We are continuously looking at making improvements where needed, which is why we decided to make Macomb Matters a now fully digital version. This will allow everyone to get information faster with more links to more information.
In that same idea, we recently updated our Make Macomb Your Home website with new school information just in time for the start of the school year. Visit www.makemacombyourhome.com/schools.html to read up on all the great educational opportunities available in Macomb County.
Enjoy your fall! I hope that there are plenty of football games, cider mill trips and campfires in your future.
Macomb County Executive
By Melissa Roy, Assistant Macomb County Executive
Storytelling… It’s a skill that can make gatherings more enjoyable, experiences more memorable and can give life and vibrancy to its subject matter. It’s also the latest transformation in media and communications. Blogging is a way to showcase something with more life and a humanized twist. Great media writers have been doing this for years in the New York Times (think: Russell Baker), Detroit Free Press (think: Neal Shine) or Macomb Daily (think: Chad Selewski). Read More...
Macomb County Director of Health and Community Services Steve Gold has received a Diversity Award from Corp! Magazine for his efforts in Macomb County’s OneMacomb program.
Gold began his career as a teacher in rural North Carolina before beginning an extended period of international travel in Turkey, Iran, Afghanistan, Pakistan, India and Nepal.
“My travels taught me a great deal about the importance of diversity within a community,” said Gold. Read More...
Macomb County Executive Mark A. Hackel, along with the Macomb County Planning & Economic Development Department and the city of Utica, announced a development project that will allow for the building of a multi-million dollar baseball stadium that will host independent league games.
“This ballpark is a welcomed development in Macomb County,” said Macomb County Executive Mark A. Hackel. “This minor league stadium is a great economic advantage for the city of Utica. It is also a major league quality-of-life opportunity for the region.” Read More...
Sterling Heights and Macomb County officials, business owners and area residents gathered on the banks of the Clinton River Aug. 21 to dedicate Sterling Heights’ brand-new paddle landing site.
The Sterling Heights Landing in Clinton River Park North (located off of Riverland Drive between Van Dyke and Clinton River roads) offers enthusiasts another landing site from which to explore the Clinton River, provides access to the Sterling Heights Nature Center and offers a short recreational ride in a canoe or kayak from Utica’s Heritage Park that is easy for novices and great for families. Read More...
By Kevin Frank, Michigan State University Extension, Department of Plant, Soil and Microbial Sciences
The Labor Day holiday signals the unofficial end to summer and also a great reminder that September is a key time for homeowners looking to spruce up the lawn.
It’s a busy time of year with school starting, fall sports kicking into full gear, and of course lawn chores preparing for winter. Throughout most of Michigan, the summer of 2014 will likely be remembered for cool temperatures and adequate if not excessive rainfall. Some will also remember 2014 as the summer the turf would never quit growing. Probably the biggest challenge I’ve seen with most lawns is simply a lack of fertility. With perfect growing conditions, turf has burned through fertilizer applications quicker than normal resulting in many lawns starting to lose density and becoming invaded by pests such as white clover and rust. Read More...
By Sarah Cormier
Macomb County Executive Office
It may be as simple as changing a light bulb or setting up for a meeting or as complicated as fixing a stubborn leak or painting an entire department.
Whatever the need may be, the 32 tradespeople that are part of Macomb County’s Facilities and Operations (F&O) Department can take care of the issue.
“We maintain the buildings and keep all of the facilities in operating order,” said Brian Bauman, union carpenter who has worked for the county for three years. Read More...
By Cynthia Donahue, Facilities and Operations
Born in Mount Clemens in 1919, George Caram Steeh was the son of Caram and Dora (Lappin) Steeh. George’s immigrant parents played a major role in the shaping of his remarkable career. Their values regarding hard work and the importance of a good education greatly contributed to his success
Caram George Steeh, born June 26, 1886 in Mersine, Turkey, came to the United States aboard the Lazio on September 1, 1907. He began his career with Tadross & Zahloute, an Oriental rug company in New York, under the guidance of Naumi Tadross’s nephews Naseem and Saliba Zahloute. Read More...
By Jeff Randazzo, Chief, Macomb County Animal Shelter
Hi! My name is Wilmer. I am a neutered male, pit-bull-terrier mix.
And I'm Hollywood, a domestic medium shorthair cat.
For more information on us or any other available pets, call (586) 469-5115 or visit the Adopt a Pet webpage.
LOW CARB ZUCCHINI FRIES
Ready in 1 Hour, 55 Minutes
½ cup ground almonds
½ cup grated Parmesan cheese
½ teaspoon dried Italian herb seasoning, or to taste
New Hires/Retirees
Click here for Macomb County's full list of all the June/July 2014 new hires/retirees. | cc/2020-05/en_middle_0078.json.gz/line1145 |
__label__wiki | 0.71847 | 0.71847 | Cynthia Turner Camp
History in a Liturgical Mode
Honors Option
For Former Students
Hargrett Hours
UGA Manuscripts Project
Chaucer Resources
Chaucer Online
Chaucer Print Resources
Chaucer Manuscripts
Language Aids
Pronouncing Middle English
Manuscript Resources
Medieval Pigments
Paleography
Middle English Resources
Major Authors
Romance & Arthurian Resources
Women's Culture
Writing and Citation
MLA Guidelines
Essay Grading Rubric
Women can't be studied apart from the broader history and literature of their time, but there are a variety of online resources that have been developed specifically to illuminate medieval women's experiences, literacies, and writings. In addition to the sites linked below, you'll want to consider the resources provided for the women writers gathered on the Major Authors page as well as those on the History and Culture page (esp. the sections on "Love and Sex"). I've also written up (for the benefit of other professors) my short list of Andalusian women poets in translation.
The British Library: Learning website has a section dedicated to medieval women.
McMaster University has developed a "Medieval Women" website, providing introductions to both laywomens' and nuns' lives. It is richly interactive (but somewhat older, so not all of its features still render well). The "Scriptorium" feature is particularly useful.
The British Library's "Timelines" website is an interactive flash website using treasures from the British Library's holdings to illustrate different aspects of everyday life, high culture, and political events (medieval through the present day). To focus on medieval women, after you have launched the main Timeline choose the "Everyday Life" timeline at the top of the interactive Timeline page; the site will highlight features of everyday life that may help further your understanding of medieval womens' lives (like pregnancy, literacy, and nunnery culture).
This Women Religious in the Middle Ages pathfinder from UNC-Chapel Hill is slightly out of date but still a useful starting point for researching medieval nuns and anchoresses.
Advanced/Scholarly Resources
Feminae is a bibliographic index (like the MLA) to books, chapters, and articles written on all aspects of medieval women and gender. Extremely useful for doing research on medieval women.
Epistolae, a collection of medieval letters (many in translation) by medieval women across Europe (c.400-1300), plus biographies and additional information about these women. Originally conceived by Joan Ferrante.
The Monastic Matrix website is a high-powered scholarly resource for studying female religious communities of all types across Europe, from c. 400-1600.
The Department of English
254 Park Hall
Athens, Georgia, 30602-6205
ctcamp@uga.edu | cc/2020-05/en_middle_0078.json.gz/line1150 |
__label__cc | 0.649034 | 0.350966 | Fallout 4 faction
Type Mercenary unit
Leadership Captain Wes[1]
Structure Strict, hierarchy-based military organization
Bear Nuka-World
Cyprus Nuka-World
Gunner (generic)
Kaylor Nuka-World
Lanier Nuka-World
Marcks Nuka-World
Robert MacCready (formerly)
Headquarters Gunners Plaza[2]
Notable Locations Commonwealth
Hub City Auto Wreckers
Mass Fusion building
Quincy ruins
Vault 75
Nuka-World Transit Center Nuka-World
Nuka World Nuka-World
Bradberton Overpass
The Gunners are a ruthless mercenary army that operates mainly in the Commonwealth in 2287. The Gunners are most known for their no prisoners mindset and have been known to wipe out entire settlements, like common Raiders, but are more organized and equipped.[3][4][5][6]
2 Organization
The Gunners are a violent mercenary outfit, for whom no job is too brutal to undertake.[7] They are commonly regarded as no better than common raiders, as they will attack anyone they believe is too weak to defend themselves.[8] As long as it improves their bottom line, everyone's a potential target.[9] As a result, while Gunners claim to be soldiers for hire, but throughout the Commonwealth, they have a well-earned reputation as being a highly militarized gang of thugs; with combat training considered equivalent to the Brotherhood of Steel.[10] Aggressive and fiercely territorial, Gunners are guaranteed to attack anyone who wanders into an area they’ve claimed as their own. They’re well equipped and well organized, and a group of Gunners almost always includes at least one combat-ready robot.[11]
Perhaps the most heinous crime the Gunners perpetrated was the Quincy Massacre, when they attacked the southern settlement in force. A desperate defense could not withstand their onslaught and the ruined town fell - with it, the Commonwealth Minutemen. Only twenty people made it out of there alive.[12]
Curiously, the Gunners seem to be following the orders of another party, but to date, nobody has learned who pulls their strings.[13]
Gunners take inspiration from the pre-War United States Armed Forces in their organization, with certain modifications. Their military rank system is lifted wholesale from the pre-War Army: Gunners rank from the basic recruit, through privates, all the way to colonel.[14] However, they also tattoo their members on the forehead to distinguish their membership and ensure loyalty.[15][16][5] Blood types are also tattoed, to expedite medical care.[17][18]
In terms of training, the Gunners are one of the most well trained military forces out there, on par with the Brotherhood of Steel, but lacking the corresponding moral fiber.[10] They operate in a strict military fashion, with a well-defined chain of command and procedures for dealing with unforeseen circumstances, such as losing a ranking officer in the field or running operations while off the grid (without radio contact with Gunner command.[19] To improve their power projection capabilities, the Gunners operate and operate a variety of strongholds throughout the Commonwealth, located in strategic spots that are easy to defend. Even temporary camps, such as those established during long range reconnaissance missions, are always set up in a way that makes them difficult to attack.[20]
Low-ranking Gunners are usually limited to the protection offered by simple clothing, accessories, and the occasional piece of leather armor. Gunners who have reached the rank of Private sport a few pieces of combat armor. Further promotions grant Gunners better-quality pieces of combat armor. Gunners also enjoy a vast arsenal of weapons. Combat rifles and laser rifles are popular choices—and no Gunner would ever be caught relying on a handmade pipe gun—but virtually any projectile weapon weapon has a chance of appearing in a Gunner’s hands. Even valuable plasma weapons can be found on high-level Gunners. Batons and rippers are sometimes used, as are fragmentation grenades, Molotov cocktails, and a variety of heavy guns.[11]
With all of their assets, the Gunners lack coordination on a strategic level. As a result, Gunners are deadly on a tactical level (as exemplified by the Quincy massacre, but are unable to take control of the Commonwealth.[21]
As a mercenary outfit, the Gunners will accept any contract, no matter how violent or heinous. As long as the pay's good, they will take it, much like Talon Company.[7] Despite their lack of scruples, they are one of the top choices when it comes to escorting caravans (Old Man Stockton in particular is fond of hiring these mercenaries)[22] or special orders by wealthy residents of Diamond City, particularly when they entail dealing with dangerous wildlife.[23] They also deal in the securing and extraction of technology, in the form of tech salvage missions.[24]
One thing to note is that they do not take prisoners and will kill everyone who gets in their way,[25] likely to score any potential bounties that might be out on their targets.[26] Perhaps as an extension of their violent nature, Gunners are not known to surrender.[27]
Deacon is known to be on their most wanted list, several times under different names.[28]
While they are de facto raiders, Gunners have adopted a military aesthetic and focus on acquiring pre-War military gear whenever possible. Their standard uniform is inspired by pre-War Army fatigues and typically combined with military-grade armor, primarily various types of combat armor, worn with bandanas, sunglasses, and military caps.[29] The Gunners also have access to heavy weapons such as Fat Men and missile launchers, as seen used by high ranking members such as Baker and Bridget. In certain regions of the Commonwealth, Gunners also have vertibirds at their disposal.
They are also known to use a variety of robots to bolster their ranks, ranging from Mr. Gutsy units all the way to Assaultrons and Sentry Bots.[30]
Gunners are one of the raider gangs encountered frequently throughout the Commonwealth. They are almost invariably hostile to the player and utilize a variety of military grade firearms and armor.
Their permanent emplacements are typically centered around former military areas, with the primary base located in Quincy ruins.
You can however, convince a couple of Gunners in Vault 95 to cease firing upon you, but not to "follow" you as you can command other enemies.
The Gunners appear in Fallout 4 and its add-on Nuka-World.
↑ Wes' holotape has the following script notes referring to Wes: "Calm. Collect. Professional. Gunner Boss talking to Gunner out on patrol over radio."
↑ Piper Wright: "Gunners are all based out of the GNN Building downtown. What a waste of a newsroom."
(Piper Wright's dialogue)
↑ Fallout 4 loading screen hints: "The Gunners are the Commonwealth's most well organized mercenary group. Unscrupulous and highly skilled, they will take any contract... if the price is right."
↑ The Sole Survivor: "Never heard of the Gunners. Who are they?"
Robert MacCready: "They're one of biggest gangs in the Commonwealth. Got a rep for being crazy... you know, so tightly wound, you'd think they were a cult or something. Stuck with them for a while cause the money was good, but I never fit in. That's why I made a clean break and started flying solo. Now, what about you? How do I know I won't end up with a bullet in my back?"
(Robert MacCready's dialogue (Fallout 4))
↑ 5.0 5.1 Piper Wright: "Gotta have some serious issues to think an organization requiring facial tattoos is the place for you."
↑ Robert MacCready: "Look, pal/lady. If you're preaching about the Atom, or looking for a friend, you've got the wrong guy. If you need a hired gun... then maybe we can talk."
The Sole Survivor: Maybe. Why don't you tell me who those guys were first."
Robert MacCready: "A couple of morons looking to climb the ladder of success by stepping on everyone else on the way up. You shouldn't be surprised though, that's how it goes when you run with the Gunners."
↑ 7.0 7.1 The Sole Survivor: "Who are the Gunners?"
Nick Valentine: "High-end mercenaries. No job too brutal. They're in the running as likely suspects, but they wouldn't be the ones pulling the strings."
(Nick Valentine's dialogue)
↑ Fallout 4 dialogue: "Damn Gunners, they're just raiders with fancier weapons. They'll attack anyone they think is too weak to defend themselves."
↑ Robert MacCready: "This should send a message to the Gunners to stay off my back."
The Sole Survivor: "You aren't afraid the Gunners will retaliate?"
Robert MacCready: "The way these lunatics act, you'd think they would... but I know better. For the Gunners, it's always about the bottom line. They just lost this entire waystation and that cost them big. Besides, they have no way of knowing I was involved. Anyway, I guess I owe you a favor now. After all, you hired me but I'm the one that dragged you out here."
↑ 10.0 10.1 Piper Wright: "Gunners. All the combat training of the Brotherhood of Steel, all the moral character of your neighborhood bully."
↑ 11.0 11.1 Fallout 4 Vault Dweller's Survival Guide Collector's Edition p.36: "GUNNERS
Gunners claim to be soldiers for hire, but throughout the Commonwealth, they have a well-earned reputation as being a highly militarized gang of thugs. Aggressive and fiercely territorial, Gunners are guaranteed to attack anyone who wanders into an area they’ve claimed as their own. They’re well equipped and well organized, and a group of Gunners almost always includes at least one combat-ready robot.
Gunners can be found in Mass Bay Medical Center, Hub City Auto Wreckers, and many other locations throughout the Commonwealth.
Gunner Humans
Low-ranking Gunners are usually limited to the protection offered by simple clothing, accessories, and the occasional piece of leather armor. Gunners who have reached the rank of Private sport a few pieces of combat armor. Further promotions grant Gunners better-quality pieces of combat armor. Gunners also enjoy a vast arsenal of weapons. Combat rifles and laser rifles are popular choices—and no Gunner would ever be caught relying on a handmade pipe gun—but virtually any projectile weapon weapon has a chance of appearing in a Gunner’s hands. Even valuable plasma weapons can be found on high-level Gunners. Batons and rippers are sometimes used, as are fragmentation grenades, Molotov cocktails, and a variety of heavy guns.
Gunner Robots
With the exception of custom paint jobs, Gunner robots are identical to their standard counterparts. When fighting a Mr. Gutsy, check its arms to estimate its offensive capabilities, then attack its eyes and torso. It’s often best to slow an Assaultron by crippling its leg. Simply using your most powerful weapons against a Sentry Bot is usually your best option."
(Fallout 4 Vault Dweller's Survival Guide Groups, Gangs, and Factions)
↑ The Sole Survivor: "What was the Quincy Massacre?"
Preston Garvey: "I thought everyone in the Commonwealth knew about that by now. Where the Minutemen betrayed each other, and the people they were supposed to protect. I was with Colonel Hollis's group. A mercenary group called the Gunners was attacking Quincy; the people there called for the Minutemen to help. We were the only ones that came. The other groups... they just turned their backs. On us, and the folks in Quincy. Only a few of us got out alive. Colonel Hollis was dead. So I ended up in charge of the survivors. We never found a safe place to settle. One disaster after another... you saw how it ended, in Concord."
(Preston Garvey's dialogue)
↑ Deacon: "Who's pulling the Gunners' strings? No one knows."
(Deacon's dialogue)
↑ Gunner characters appearing in the game are distinguished by rank affixed to their name.
↑ Danse: "The tattoos on their heads make for a nice bullseye."
(Danse's dialogue)
↑ Piper Wright: "Oh, story idea. I get a tattoo on my forehead and cop a bad attitude. "Gunners Undercover." It'd probably actually move some papers."
↑ Quincy ruins terminals; Gunner Terminal, Tessa and Baker
↑ See the left temple of Winlock and Barnes
↑ Bradberton Overpass terminals; Gunner Terminal
↑ Codsworth: "Quite a novel idea, building a ramshackle town on an overpass. Especially if you hate yard work."
(Codsworth's dialogue)
↑ Piper Wright: "Gunners pack a punch, but they're not coordinated. They're like Super Mutants without the charm."
↑ Human Error
↑ Private Hart's holotape
↑ HalluciGen mission brief
↑ Cait: "Remember, Gunners don't take prisoners so give it everythin' you've got."
(Cait's dialogue)
↑ Gunner taunts: "God, I hope there's a bounty on you!"
↑ Danse: "Remember, Gunners can't be reasoned with, and they don't surrender."
↑ Deacon: "Gunner's have had bounties on me. Well, me under different names and faces. I want to see how many slots I can fill on their most wanted list."
↑ Gunner equipment and appearance in the game.
↑ Gunner robots are encountered at their strongholds.
Events Quincy Massacre
Locations Gunners Plaza · Hub City Auto Wreckers · Mass Bay Medical Center · Mass Fusion building · Mass Pike interchange · Nuka-World transit center · Quincy ruins · Vault 75
Characters Captain Bridget · Wes
Colonel Cyprus
Commander Bear · Kaylor
Lieutenant Ryan
Major Jeffries
Sergeant Baker · Lanier · Lee · Marcks
Private Hart · Tyler
Unknown Barnes · Cruz · Robert Joseph MacCready (formerly) · Ryder · Winlock
Quests Main ?
Side Benign Intervention · The Devil's Due
Miscellaneous ?
Factions in Fallout 4
Fallout 4 Major factions Brotherhood of Steel · The Institute · Commonwealth Minutemen · The Railroad
Business factions Publick Occurrences
Secondary factions Atom Cats · Church of the Children of Atom · Covenant · Diamond City security · Gunners · Forged · Neighborhood Watch · Pillars of the Community · Raiders · Recon squad Artemis · Recon squad Gladius · Triggermen
Mentioned-only factions Defense Intelligence Agency · United States Army · United States Coast Guard · National Guard of the United States · United States Air Force
Add-ons Automatron Military Police Corps · Military Robotics Oversight Committee · Rust Devils · United States Army Robotics Division
Far Harbor Acadia · Church of the Children of Atom · Far Harbor · Trappers · United States Navy · United States Marine Corps
Nuka-World Disciples · Operators · The Pack · Hubologists
Retrieved from "https://fallout.gamepedia.com/index.php?title=Gunners&oldid=2140870"
Fallout 4 factions | cc/2020-05/en_middle_0078.json.gz/line1151 |
__label__wiki | 0.714996 | 0.714996 | IDP Rankings
DFS LU TOOL
Player Tracker
Fantasy Knuckleheads
Fantasy sports news, rankings, sleepers, cheat sheets, stats and tools.
Week 16 RB Fantasy Football Rankings Championship Time! ...December 20, 2019
Week 16 Tight End Rankings ...December 20, 2019
Week 16 Wide Receiver Rankings ...December 20, 2019
Week 16 Kicker Fantasy Football Rankings ...December 20, 2019
prev stop start next
25 Surprising Fantasy Stats From 2018 That Could Help You In 2019
August 19, 2019 by Jacob Trowbridge
That's a wrap on the 2018 football season, folks! Just because the season's over, that doesn't mean you should stop learning from it. Here are some surprising fantasy stats about the year that saw Pat Mahomes' breakout, Le'Veon Bell's holdout, and Derrick Henry's record-breaking resurgence. Use these nuggets of information to help secure a championship in 2019!
Note: The following stats are based on PPR formats.
1. Only 3 Top 10 QBs From 2017 Finished In The Top 10 This Year
What do Drew Brees, Russell Wilson, and Dak Prescott have in common? In case you missed the giant, bolded hint above, they're the only three quarterbacks who managed to finish inside the Top 10 at the quarterback position both of the last two seasons. And all three just barely managed the feat this year, finishing as QB8, QB9, and QB10 respectively.
2019 Impact: I wouldn't bet against Mahomes, Roethlisberger, Rodgers, Luck, or any of the top tier QBs from this season to repeat next year. But there are plenty of question marks in that group to consider over the offseason. Will any of them outside of Mahomes be considered "safe plays" going into next season? (Hint: Spoilers ahead...)
2. Drew Brees Finished As A QB1 For The 15th Straight Season
Did you know that if you rearrange the letters in Drew Brees' name it spells "consistently underrated"? (Okay, so that's obviously not true. But you do get the anagram Drew's Beer, which would be a solid name for the future Hall of Famer's microbrew business, should he choose that route after retirement.)
Brees has been by far the most consistent QB in fantasy football for well over a decade. I mentioned a version of this in last year's Fun Facts article, but it bears repeating: Brees has only fallen outside the Top 5 QBs once since 2005. Even more ridiculous? Since officially taking over from Doug Flutie in 2004, Brees has never fallen below QB12. Never.
2019 Impact: If Brees decides to keep playing next year -- he turned 40 in January -- he could once again be the safest QB pick on the board. Especially if he remains outside the Top 5 QBs in ADP.
3. Ryan Fitzpatrick Was A Top 5 QB On A Per Game Basis
Fitzmagic enjoyed by far the greatest per game numbers of his career, finishing as the QB5 on the year using that metric. And this includes the multiple games where he played basically one half, either getting benched for Jameis Winston or getting put on the field because Winston was benched.
2019 Impact: Don't be surprised if Fitzpatrick somehow finds himself onto the field again in 2019. He's a free agent, but the Bucs could hang onto him as a "Break In Case of Emergency" option with a proven track record. What Fitzpatrick was able to do in limited starts as a backup shouldn't go unnoticed, and he could once again be a viable streaming option next year.
4. Nick Foles Was QB27 On A Per Game Basis
And then there's this guy. The city of Philadelphia -- and fans of football magic in general -- rallied behind Nick Foles because he's a lovable underdog, in the mold of Rocky Balboa or Charlie Day. Pundits will spend all offseason talking about the heart he showed late in the season while guiding the Eagles to another unlikely postseason run. They'll fawn over possible landing spots for the backup QB with the touch of gold. And yet...
In his 5 regular season starts, Foles put up a paltry 15.0 fantasy points per game. That's worse than Josh Allen, Andy Dalton, Joe Flacco, Eli Manning, and Matt Barkley performed on a per game basis. Flash back to 2017, and Foles' 3 regular season starts netted him a cool 11.2 fantasy points per game. That number was below Jay Cutler, Jacoby Brissett, Blaine Gabbert, Trevor Siemian, Brock Osweiler, and was tied with Brett Hundley.
2019 Impact: If Foles does end up getting traded into a starting spot, you may not want any part of him for fantasy purposes. If you have him on your dynasty squad, now would be a good time to sell.
5. Lamar Jackson Would Have Finished As A Top 30 Rusher, Despite Starting Only 7 Games
Rushing for 697 yards on the season while starting just 7 regular season games is an impressive feat. Doing so as a quarterback is straight up bonkers. Jackson averaged 79 yards on the ground in those 7 starts, and added 4 rushing touchdowns for good measure. Using those 7 games, he was on pace for 1,257 yards rushing over a full season.
I mean...WHAT!?
Not only did Baltimore's rookie quarterback out-rush all others at his position, he put up more yards on the ground than Mark Ingram, Leonard Fournette, Isaiah Crowell, Kerryon Johnson, Dalvin Cook, Carlos Hyde, Kenyan Drake, Dion Lewis, LeSean McCoy, and Alex Collins. These people, you might have noticed, are all actual running backs.
2019 Impact: It's hard to get a better floor than what Jackson provided in 2018. If the torch is finally and officially passed from Joe Flacco, Jackson could be one of the safest plays at the position due solely to his usage in the run game.
Want More Personalized Advice? Schedule A Live Consultation With A Fantasy Expert!
6. Josh Allen Was The Leading Rusher In Buffalo
Does that sound impressive? Or...sad? Regardless, rookie QB Josh Allen was the leading rusher on the Bills squad by a wide margin. Allen put up a solid 631 yards with his legs, including 8 rushing touchdowns. Meanwhile, LeSean McCoy rushed for just 514 yards and 3 touchdowns.
If that's not strange and depressing enough, McCoy played in 2 more games than Allen. Want more? Okay! Allen finished the year with 3 games of at least 99 yards rushing. McCoy did that just once. Basically, the 30-year-old running back hit a brick wall, and the spry 22-year-old QB took it upon himself to carry his team up and over it.
2019 Impact: LeSean McCoy might finally be done. He notched a career low in nearly every major category and looked like he was running with molasses in his shoes. But Allen deserves some credit here as well, and he could carry a similar floor to Lamar Jackson next year.
7. Multiple Quarterbacks Rushed For As Many Touchdowns As Their Lead Running Back
Welp, might as well beat the living hell out of this dead horse while we're standing around it. 2018 was a quiet resurgence for rushing quarterbacks, as evidenced by the fact that 3 different QBs found the end zone just as frequently as their "star" running backs.
As previously mentioned, Josh Allen put up 5 more TDs on the ground than LeSean McCoy. Elsewhere, Dak Prescott equaled Ezekiel Elliott's 6 rushing touchdowns, and Deshaun Watson matched Lamar Miller's 5 end zone scampers. Considering that these are all considered "workhorse" running backs, that's a mighty interesting stat.
2019 Impact: Running quarterbacks have always been coveted in fantasy football, but those that can also find the end zone deserve special attention. All three QBs mentioned above have the versatility to keep fantasy owners happy moving forward.
8. One Third Of The Top 12 Running Backs Came From An NFL Team With A Losing Record
The notion that you want/need your fantasy running backs to come from "winning" teams was severely tested this year. Saquon Barkley, Christian McCaffrey, David Johnson, and Joe Mixon all came from teams with a losing record, and all of them put up RB1 numbers in PPR formats this year. Notably, Phillip Lindsay and Kenyan Drake just barely missed the cut, finishing as the RB13 and RB14, respectively. They both came from losing teams, as well.
The key to running back success in fantasy football has always been volume. So long as your guy is guaranteed 15+ touches in a game, he should be fine even if he's not a standout talent. But typically your guy is only going to get that volume if his team is winning games OR if he's also a talented pass-catcher.
2019 Impact: Every player listed in that Top 12 had at least 50 targets on the season, with 40+ receptions. That allows them to make hay for your fantasy squad even if the team they play for is constantly getting crushed. (Unless it's Theo Riddick, who only catches short passes and does little to no actual running.)
9. Saquon Barkley Led All Rookies...In Receptions
Despite playing on an offense that was overly-accustomed to playing from behind this season, Saquon Barkley still managed to excel as a rookie running back. In fact, it was because the offense was constantly trailing that Barkley needed do so much damage through the air, racking up 91 receptions for 721 yards.
To put that in context, those 721 yards helped him push past 2,000 total yards on the year. Those 91 receptions broke Reggie Bush's reception total for rookie running backs. Not too shabby.
2019 Impact: It's pretty much a guarantee that Barkley will fly off the board as the No. 1 running back next year. And considering what he did in the current Giants offense, it would seem there's nowhere to go but up. Barkley > Gurley in PPR formats? It certainly seems so.
10. David Johnson Finished As A Top 10 Running Back
If you drafted David Johnson -- likely with one of the first five picks of your draft -- you probably don't feel like you got your money's worth from the Arizona running back. Regardless of Johnson's early failings, he managed to scrape together a below-the-radar Top 10 finish. And he did this despite finishing as a weekly Top 12 RB just twice.
Johnson finished with more than 20 fantasy points in only three games this year. Back in 2016, his last healthy season, Johnson racked up 11 such games. You didn't get 2016 production out of David Johnson this year, but the topsy-turvy nature of the running back landscape still netted him the No. 9 spot at the end of the year.
2019 Impact: Johnson was stuck in an uninspired offense with a rookie quarterback still learning the ropes, but he received the 3rd-most rushing attempts of any running back, which helped balance things out. Even if DJ once again gets nothing but runs straight up the middle next year, he's still a safe option who may be had for a steep discount in next year's draft.
Get a head start on next season with a Fantasy Knuckleheads membership!
11. Nick Chubb Nearly Cracked 1,000 Yards Rushing Despite Starting Just 9 Games
With all the talk of Saquon Barkley's jaw-dropping rookie year, what gets overlooked is just how incredibly Browns' running back and fellow rookie Nick Chubb performed this year.
While Chubb was technically 4 yards shy of a cool thousand, the fact that he put up that number while playing second fiddle to Carlos Hyde for the first half of the season is mind-boggling. If he'd had a full season as the lead dog -- perhaps if Cleveland brass had moved on from Hue Jackson on a more reasonable timeline -- Chubb would be in contention for Rookie of the Year honors. Even still, an RB17 finish with only half of a season to work with deserves more kudos.
2019 Impact: Chubb is the real deal, and I fully expect him to be coveted as an RB1 next year. If he falls to the mid-or-low 2nd round, Chubb will be an absolute steal.
12. Derrick Henry Was The No. 1 Running Back During The Fantasy Playoffs
Like a hibernating bear roused awake by the promise of Charmin Ultra Soft toilet paper (those commercials just get me), it took Derrick Henry a good long time to finally reach his full potential. But then he steamrolled his way through the competition.
Though pretty well useless for your fantasy squad for the first 13 weeks of the season, if you somehow had the foresight (or sheer stubbornness) to keep him on your roster, you were served one of the finest fantasy playoff performances of the last decade. Henry averaged an unreal 31.4 fantasy points per game when it counted the most.
2019 Impact: Henry's short career paints him as a fits-and-spurts sort of running back, incapable of providing consistent fantasy value. Recency bias will skyrocket his perceived value, so I'd be selling him in dynasty. However, if he makes it to the late 4th round in redraft leagues, I'd be willing to give him a shot in the hopes that Tennessee's new offensive coordinator can finally crack the code for making Henry a more consistent player.
13. Ezekiel Elliott Was The Only Running Back To Notch 300 Carries In 2018
300+ carries (not total touches) is a big workload for a running back these days, which is why the old workhorse RB model has largely died off. Ezekiel Elliott appears to be the last of this breed. And to his credit, he seems to handle it pretty well, as he averaged 4.7 yards per carry this season.
Zeke was also the only back to carry the ball 300+ times in 2016, when he averaged 5.1 YPC. In 2017 -- when he served his 6-game suspension -- Elliott toted it for 242 attempts over 10 games, which put him on a full-season pace of 387. He averaged a career low 4.1 YPC that year.
2019 Impact: There's reason to be weary of the strain Zeke put on his body this year, and all the years before. Historically, players who have average at least 300 rushing attempts per season hit a wall sooner than later. But Dallas is committed to the run game, and it's likely Jason Garrett feeds Zeke until the wheels fall off. He's a safe bet for another 300 carries (plus an increased pass-catching workload) and a high-end RB1 finish in 2019, so long as his body can hold up.
14. "Replacement" Running Backs Accounted For 27% Of Top 12 Finishes
"Next man up" is a tired phrase in football, thought it applied pretty heavily to this year's NFL backfields. There were plenty of injuries, trades, and off-field issues that kept supposed starters on the sidelines for huge chunks this year. Players like James Conner, Phillip Lindsay, T.J. Yeldon, Giovani Bernard, Damien Williams, Gus Edwards, and C.J. Anderson all stepped into lead roles and provided immediate value in fantasy.
Excluding Week 17 -- when oodles of starters typically rest for various reasons -- there were 52 separate instances where obvious backups (i.e. not the 1B in backfield committees) put up RB1 level numbers. That means 27% of the Top 12 finishes came from backup or fill-in running backs. For reference, David Johnson finished in the Top 12 just 12% of the time. Oh, and there were also 3 times where a backup finished as THE top back in fantasy that week.
2019 Impact: I'm not going to say running backs don't matter, but it's very clear that opportunity matters just as much as talent in fantasy football. It doesn't matter where they were on the depth chart entering the season, if a running back gets guaranteed touches in a respectable offense, they deserve a spot in your lineup. It's obviously difficult to project which backups will eventually see the field, but once they get there, grab onto them and don't let go.
15. 81% Of Players Who Finished In The Top 12 Were Already There By Season's Midpoint
Fantasy analysts like to say "You can't win your league in the draft." And while that's technically true, there was a lot more consistency in the upper echelons at each position than we're used to. Of the players who finished the season in the Top 12 at their position, 39 of those 48 players were already sitting in the Top 12 after Week 8.
Yes, a handful of guys shot up the ranks later on -- for example, Dak Prescott was QB23 after Week 8, but finished the year as QB9 thanks in large part to Amari Cooper's arrival -- but in general, the top dogs held steady from start to finish.
2019 Impact: Very few top tier players hit a wall late in the season. It's a bit of an ambiguous stat, but dammit I thought it was incredibly interesting! Maybe it means fast starts aren't to be discredited by fantasy owners constantly looking for something "better" around the next corner?
16. Three Different Rams Receivers Finished Inside The Top 20 On A Per Game Basis
During the offseason, there was plenty of discussion about which Rams wide receiver you could trust, if any. General consensus had Brandin Cooks, Cooper Kupp, and Robert Woods all outside the Top 20 ADP for receivers, with Kupp outside the Top 30, and Woods falling all the way outside the Top 40.
All three notched at least 16.2 points per game, enough for Top 20 finishes all-around using that metric. It goes to show that truly prolific offenses can sustain multiple first-rate receiving options, and few have proven that quite like Sean McVay's group this year.
2019 Impact: Unless the Rams trade for an elite tight end (they won't), you can expect more of the same next year. In redraft, I'm taking whichever receiver falls the furthest.
17. Robby Anderson Was The WR2 During Fantasy Playoffs
After heating up down the stretch in 2017, Anderson was a ghost for the majority of his third season. Whether it was due to the quarterback change, his off-field issues, or simply the pains of being a New York Jet, Anderson was not a reliable fantasy asset for the first 13 weeks of football. In fact, he put up 50 yards or more just once during that stretch.
But Anderson punched the ignition switch HARD come Week 14, averaging 10 targets, 7 receptions, and 129 yards per game during the fantasy playoffs. He also scored a touchdown in each of those three outings. Only DeAndre Hopkins finished better than Anderson during your league's most crucial batch of games.
2019 Impact: Once continuity comes to the Jets' QB spot, Anderson should become less frustrating on a week-to-week basis. There's no reason he couldn't finish as at least a WR2 next year so long as Sam Darnold keeps progressing. Keep in mind, however, that Quincy Enunwa sat out weeks 15 and 16, when Anderson did most of his damage. There are still some lingering questions about how big of a role the lanky receiver can actually have in the Jets' offense.
18. Julio Jones Has 5 Straight Seasons With At Least 1,400 Yards
No other player in NFL history has hit that mark, with the closest being former Colts' great Marvin Harrison, who had 4 such consecutive seasons. Julio remains a yardage machine, but the fact that he finally broke his touchdown curse is what made him such a strong fantasy receiver this year.
Five straight 1,400-yard seasons is a ridiculous feat, no matter how few touchdowns it results in. Julio finished WR6, WR2, WR6, WR7, and WR4 during that span, end zone catches be damned.
2019 Impact: There's no reason Julio Jones shouldn't be drafted as a Top 5 receiver again next year. With Antonio Brown's status as a Steeler in limbo, Jones could now be considered the 2nd-safest WR off the board next year, just behind DeAndre Hopkins.
19. Davante Adams Scored At Least 15 PPR Points In Every Game He Played
The Packers' disastrous offensive play didn't stop the team's No. 1 receiver from getting his in 2018. Adams hit 15 points or more in every single game he stepped onto the field for, which is how he ended up the WR1 on a per game basis this season.
Including 2017, Adams has scored at least 15 points in 23 out of the 29 games he's played. The fifth-year wideout has been one of -- if not THE -- most consistent receivers in fantasy football for these past two seasons.
2019 Impact: There's at least an argument to be made for Davante Adams being the first receiver off the board in drafts next year. Of course, with Green Bay undergoing significant changes to the coaching regime, it's uncertain how they'll utilize Aaron Rodgers' current go-to target.
20. Mike Williams Scored A Touchdown On 23% Of His Receptions
Nearly 1 out of every 4 passes caught by Mike Williams resulted in a touchdown. That kind of touchdown efficiency is almost unheard of. It makes sense when you realize that 21% of Williams' targets came inside the red zone, and 6 of his 10 touchdowns came from within the 10-yard line. But still...holy cannoli.
A few other players had even more impressive touchdown-to-reception ratios -- including John Ross (33%) and Jaron Brown (36%) -- but neither of them had even 25 catches on the season.
2019 Impact: Touchdown regression is coming for Mike Williams. The Chargers were without Hunter Henry, who is bound to eat into some of Williams' red zone work. That's not to say Williams can't be productive next year, but he'll likely need more than the meager 66 targets he received in 2018 to do so.
21. James Develin Scored A Touchdown On 67% Of His Rushing Attempts
Yeah. You read that right. 2 out of every 3 times New England fullback James Develin ran the ball, he scored a touchdown. Granted, he only ran the ball 6 times all season. And all 6 of those rushes came within the 5-yard line. So there's that.
2019 Impact: It's the Patriots. Develin could be New England's leading rusher next year or he could be cut from the team this offseason. Neither move would surprise me. I can't see him as a viable draft option in 2019. Still an impressive stat, though.
22. Three Rookie Tight Ends Cracked The Top 20
This may not seem like a big deal at first glance, but it hasn't happened since 2010 when Aaron Hernandez, Rob Gronkowski, and Jermaine Gresham accomplished the feat. This year it was Chris Herndon, Mark Andrews, and Dallas Goedert challenging the notion that rookie tight ends don't produce out of the gate.
Now, I know none of those names really jump off the page as "fantasy studs." Because let's face it, their presence in the Top 20 has less to do with their individual output than it does the complete dearth of relevant tight ends in 2018.
2019 Impact: Keep an eye on all three of the names listed above, as it's possible they all take a sophomore jump in 2019. That said, much is in-flux with the Jets, Ravens, and Eagles, so I wouldn't consider any of them "must drafts" next year. I also don't believe their relative production this season belays a trend in regards to upcoming rookie tight ends. Don't overvalue the incoming TE draft class.
23. Three Tight Ends Drafted In The Top 5 Finished Outside The Top 10
Oof. What a disappointing season for the usually-dominant tight ends. Most egregious, of course, is Rob Gronkowski. No one could have predicted that a healthy-ish Gronk would make just 5 appearances inside the Top 15 this season. His recorded the 3rd-lowest targets per game, 2nd-lowest yards per game, and absolute lowest touchdowns per game of his career. But Gronk wasn't the only disappointment.
Jimmy Graham and Greg Olsen, with ADPs of TE4 and TE5 respectively, finished as the TE12 and TE25 on the season. Granted, Olsen was rarely healthy, but even when he was, it was clear Christian McCaffrey was Cam Newton's new favorite mid-field target. As for Jimmy Graham? Apparently the Green Bay curse continues for tight ends.
2019 Impact: Gronk might very well retire for real this offseason, but if he comes back for one more season, I'm not drafting him unless he falls to the 5th round. If Graham sticks around Green Bay, he'll fall off my draft board entirely. Olsen will likely make the transition to the commentator booth, but he's a big DO NOT DRAFT for me if he plays.
24. Only 4 Top 10 Defenses From 2017 Finished Top 10 In 2018
The Jaguars may have been the top fantasy defense last year, but they fell outside the top half this season. The Eagles were a Top 3 defense in 2017, but didn't crack the Top 15 this time around. The Chargers, Lions, Panthers, and Chiefs all dropped off a cliff as well.
Meanwhile, the Texans rose from the ashes, jumping from #25 in 2017 to #3 in 2018. Similarly, the Colts improved by 12 spots to crack the Top 10 this year.
2019 Impact: Think about this next year when you're on the board in Round 8 and Chicago's D/ST is sitting there, taunting you. Sure, maybe Chicago will dominate fantasy scoreboards again in 2019. But how early are you willing to roll those dice?
25. Seven Top 10 Kickers From 2017 Got There Again In 2018
Just when I was all ready to pen my yearly reminder to fantasy football owners everywhere that KICKERS CANNOT BE TRUSTED, I stumbled across this statistic. I am both humbled and exasperated that we've finally seen some year-to-year consistency at the position.
Sidenote: #10 from last year, Kai Forbath, wasn't the starting kicker on an NFL squad at the start of the year, so he wasn't being drafted in your fantasy league. So really, this could have been an even more consistent year for kickers. Woof.
2019 Impact: If you're looking for kicker impact, you're still doing this wrong. But hey, maybe it's not a bad idea to take a Top 10 guy from 2018 in next year's draft if he's still there in the last round.
Thank you for trusting Fantasy Knuckleheads to guide you through the 2018 fantasy football season. We're working on ways to provide even more content and advice for the 2019 season, so stay tuned!
Category - Fantasy Football News and Analysis - 25 Surprising Fantasy Stats From 2018 That Could Help You In 2019
Dominate Your League
About Jacob Trowbridge
Fantasy football provocateur who constantly misuses words like "provocateur." Co-host of Drinking & Talking Fantasy Football. Follow him on Twitter.
Week 16 RB Fantasy Football Rankings Championship Time!
Week 16 Tight End Rankings
Week 16 Wide Receiver Rankings
Week 16 Kicker Fantasy Football Rankings
Week 16 Quarterback Rankings
Average Draft Position (ADP) Report
Fantasy Football Draft Projections
The Best Waiver Wire Picks
Best Optimal Lineup Tool
ESPN Insider Coupon Code
Premium Fantasy Football Draft Guide
Fantasy Football Projections Video Series
Established in the summer of 2009, Fantasy Knuckleheads is devoted to providing quality fantasy football news, advice, cheat sheets, tools and services. We’re not a mega-sports-site that churns out content by the pound. We’re simply a small, tight knit group of fantasy experts turned writers that love what we do, especially when we’re right. We strive to tell you something you don’t already know that’s actionable and at the very least, informative.
Fantasy Blog Network
Fantasy Football for all you knuckleheads
Fantasy Sports Widget
Copyright © 2020 · Fantasy Knuckleheads · | cc/2020-05/en_middle_0078.json.gz/line1152 |
__label__wiki | 0.658641 | 0.658641 | 13048. Adulteration of candy. U. S. v. Sisco-Hamilton Co., Peter Sisco, and Albert Sisco. Pleas of guilty. Fine, $750 and costs against defendants jointly.1
13411. Adulteration of candy. U. S. v. Starr Confections, Inc. Plea of guilty. Fine, $1,000 and costs.1
13562. Adulteration of candy. U. S. v. Lion Specialty Co., a corporation, and Americo F. Cuneo and Dominick Franklin. Pleas of guilty. Corporation fined $1,500 and costs; each individual defendant fined $250.1
13987. Adulteration of candy. U. S. v. V. V. Candy Mfg. Co. and Sam Gertz. Pleas of nolo contendere. Defendants fined $1,000, jointly.1
1497. Adulteration of candy. U. S. v. 13, 14, 6, and 24 Boxes of Candy. Default decree of condemnation and destruction.1
Dagmar Candy Mfg. Co., Inc.2
Happiness Candy Stores, Inc.2
American Licorice Co.1
Close and Co.1
Commercial Candy Mfg. Co.1
more Defendants »
candy[remove]26
You searched for: Adjudicating Courts Northern District of Illinois Remove constraint Adjudicating Courts: Northern District of Illinois Product Keywords candy Remove constraint Product Keywords: candy Collections Foods, 1940-1966 Remove constraint Collections: Foods, 1940-1966
1. 4075. Adulteration of candy. U. S. v. Frank Urban, Edward T. Urban, and George A. Urban (Close & Co.). Pleas of nolo contendere. Frank Urban found guilty on all counts. Imposition of sentence suspended and defendant placed on probation for a period of 1 year. Remaining defendants found not guilty and discharged.
Frank Urban, Edward T. Urban, and George A. Urban, copartners trading as Close & Co.
2. 1497. Adulteration of candy. U. S. v. 13, 14, 6, and 24 Boxes of Candy. Default decree of condemnation and destruction.
Gilliam Candy Co.
3. 7761. Adulteration of candy. U. S. v. 10 Cases of Candy. Default decree of condemnation and destruction.
Feek Cigar Co.
4. 9679. Adulteration of candy. U. S. v. Close and Co. Plea of nolo contendere. Fine, $1,000 and costs.
Close and Co.
5. 8563. Adulteration of candy. U. S. v. American Licorice Co. Plea of guilty. Fine, $800 and costs.
American Licorice Co.
6. 21701. Adulteration of candy. U. S. v. D. L. Clark Co. and Duane M. Smith. Pleas of nolo contendere. Fine of $3,000 against company and $300 against individual.
D. L. Clark Co.
7. 13411. Adulteration of candy. U. S. v. Starr Confections, Inc. Plea of guilty. Fine, $1,000 and costs.
Starr Confections, Inc.
8. 13562. Adulteration of candy. U. S. v. Lion Specialty Co., a corporation, and Americo F. Cuneo and Dominick Franklin. Pleas of guilty. Corporation fined $1,500 and costs; each individual defendant fined $250.
Lion Specialty Co.
9. 13987. Adulteration of candy. U. S. v. V. V. Candy Mfg. Co. and Sam Gertz. Pleas of nolo contendere. Defendants fined $1,000, jointly.
V. V. Candy Mfg. Co.
10. 13048. Adulteration of candy. U. S. v. Sisco-Hamilton Co., Peter Sisco, and Albert Sisco. Pleas of guilty. Fine, $750 and costs against defendants jointly.
Sisco-Hamilton Co. | cc/2020-05/en_middle_0078.json.gz/line1156 |
__label__wiki | 0.960961 | 0.960961 | Netflix lead charge against Apple's 'unfair market power'
By 9Finance
Last year, every time someone paid US$11 ($A15) for Netflix through an iPhone app, Apple pocketed as much as US$3.30 ($A4.70).
Multiply that by every charge made through iPhone apps and you can see why Netflix and other companies are fed up about what they consider Apple’s unfair market power. Late last year, Netflix rebelled against Apple’s fees, which can range from 15 per cent to 30 per cent. Analysts fear other companies may follow.
And attorneys representing consumers in a pending Supreme Court case charge that Apple is an unfair monopolist in the market for iPhone apps. An adverse decision in that case could open a legal door that might eventually force Apple to cut its generous commissions.
The Netflix application is seen on an Apple iPhone. (Photo by Jaap Arriens/Sipa USA). (PA/AAP)
That could spell more bad news for Apple, which is already reeling from a slump in iPhone sales that has knocked down its shares by 25 per cent. The company has been positioning its booming digital-services business as its new profit engine. That plan could hit a snag if the app store takes a hit, since it currently generates about a third of the company’s services revenue.
Investors are now hanging onto Apple services as a “life preserver in the choppy seas” just as it’s about to float away, Macquarie Securities analyst Benjamin Schachter concluded after the Netflix move.
These app-store fees mostly hit app developers themselves, although some pass along the costs to users of their iPhone apps. Spotify, for instance, used to tack US$3 ($A4.28) onto the cost of its $14-a-month paid service – but only for users who signed up via its iPhone or iPad app.
Apple has doubled down on digital services as consumers cling to older iPhone models, hurting sales. Apple’s iPhone revenue this year is expected to drop by 15 per cent from last year US$140 billion($A200bn) , according to analysts surveyed by FactSet.
Services, by contrast, are expected to generate about US$45 billion ($A65bn) in revenue this year, according to the same survey. Schachter estimates the app store will account for US$15 billion ($A22bn) of the services revenue. By those estimates, both services and app store revenue will have doubled in just three years.
Apple didn’t respond to the AP’s inquiries about its app fees. It has previously defended the system as reasonable compensation for reviewing all apps and ensuring its store remains a safe and secure place for e-commerce. Google charges similar fees in its own app store, although its overall business isn’t as dependent on them.
Besides the app fees, Apple’s services division includes revenue from its Apple Music streaming service, iCloud storage, Apple Care, Apple Pay and ad commissions that Google pays to be the iPhone’s built-in search engine. Apple is also expected to roll out its own streaming-video service this spring, although few details are available.
iPhone sales have dropped, which has resulted in a huge loss to Apple.
The potential streaming competition from Apple may have triggered Netflix decision’s to bar customers from paying for new video subscriptions through its iPhone app. Instead, it directs users to its website, thus avoiding the extra fees. (Netflix did likewise with Google’s app store last year.)
Netflix alone won’t put a significant dent in Apple’s finances, even though it paid Apple more money last year than any other non-gaming app, according to App Annie, a firm that tracks the app market. That sum came to about US$109 million($A156m), accounting for just 0.3 per cent of the services division revenue, based on disclosures made in Apple’s earnings calls last year. More than 30,000 third-party apps now accept subscriptions through Apple’s store.
Netflix declined to discuss its reasons for ending new subscriptions through the app store. But its move drew more attention to an app store tax that other technology companies have already attacked as an abuse of the power that Apple has amassed since opening its app store years ago.
Almost three years ago, Spotify also stopped accepting new subscriptions through Apple’s app store. Its move followed the debut of Apple Music, which obviously doesn’t have to pay any commissions.
“They’re trying to have their cake and eat ours, too,” Spotify spokesman Jonathan Prince told The Associated Press in 2016. “We find it bad for consumers, unfair to consumers and ultimately something that could stifle music streaming subscriptions across the board.”
Spotify regularly harps on the unfairness of Apple’s app-fee system in its securities filings. The company didn’t respond to interview requests for this story.
Few other apps reach as many customers as Netflix and Spotify, making it unlikely that the rebellion against Apple’s app store commissions will greatly swell, said Amir Ghodrati, director of market insights for App Annie.
Apple doesn’t seem to be worried. In fact, it’s reportedly demanding an even higher commission – roughly 50 per cent – for a Netflix-like news service that it is trying to create with a variety of publishers, according to a recent Wall Street Journal report based on unidentified people familiar with the negotiations.
That proposal faces resistance from The New York Times, The Washington Post and other publishers who believe Apple is trying to exploit its market power to extract excessive fees.
Most app makers, however, are too worried about losing access to the app stores to speak out against the fees. Epic Games, maker of the popular Fortnite videogame, has been a notable exception.
Fortnite is one of the world's most popular games. (Epic Games)
Epic CEO Tim Sweeney lashed out at app fees as a “parasitic loss” at a video game conference 18 months ago, according to the trade publication GamesIndustry.biz. “We should be angry about this, and we should constantly be on the lookout for other solutions, and new ways to reach gamers,” Sweeney said at the time. The North Carolina company didn’t respond to interview requests.
Since then, Epic has refused to release its Fortnite app in Google’s Play store for Android phones, although it continues to offer an iPhone version. But Epic has opened its own app store for all videogames built for personal computers, and only takes 12 per cent of the revenue – a rate that Schachter fears Apple may eventually be pressured into adopting as well.
Sweeney broadcast a rallying cry for app maker on his Twitter account in January, not long after the news broke about Netflix abandoning Apple’s subscription system.
A 30 per cent commission “completely breaks the economics of content distribution businesses like Netflix, Spotify, Kindle, and any digital stores that aim to compete”, Sweeney tweeted. “This has got to change in 2019.”
Disneyland unveils Star Wars opening dates
IOOF slips from ASX100 in benchmark rejig | cc/2020-05/en_middle_0078.json.gz/line1162 |
__label__cc | 0.612822 | 0.387178 | What Are the Advantages of Owning Individual Stocks vs. ETFs?
By: Chirantan Basu | Reviewed by: Ryan Cockerham, CISI Capital Markets and Corporate Finance | Updated February 10, 2019
Individual stock returns are more predictable than ETF returns.
stock market image by Sydney Alvares from Fotolia.com
1. Index Trackers vs. Picking Shares
2. How Can I Buy a Stock in the Dow Jones Industrial?
3. ETF Vs. Stocks
Stocks represent ownership interest in companies and trade on regulated and over-the-counter markets. Exchange-traded funds are investment vehicles that invest in multiple securities but that you can buy trade on the markets just like stocks. You can't fully predict the difference between an ETF and a stock in terms of returns, since nobody can fully predict the market, but you can choose which is right for your investment needs.
Stocks give you more degrees of control over your individual investments and let you invest in and potentially have a say in the management of particular companies, while ETFs let you either track a larger market index or defer to the wisdom of whoever is running the fund.
Owning individual shares lets you invest in particular companies, while buying ETFs lets you track broad swaths of the market or a set of stocks picked by a professional. ETFs can be inherently more diversified than any individual stock, though they usually carry some fees that stock ownership does not.
What's an ETF?
An ETF is an exchange-traded fund, meaning one where you can buy and sell shares similarly to buying and selling individual shares of stock. They usually have ticker symbols and can be bought or sold through stock brokerage firms for the commission you would pay to trade stocks.
Many ETFs are also index funds, which track specific market indexes, like the S&P 500 or the Dow Jones Industrial Average, or groups of stocks in particular sectors of the economy like energy or housing. Such funds are traditionally cheaper in terms of fees than mutual funds that pick stocks based on insights from professional managers, but you should look into how a fund you're considering chooses its investments, the fees it charges and its historical returns.
ETF Vs. Stock: Individual Control
You have more control with individual stocks and you can invest in businesses you understand. On the other hand, you have no say in the composition of the indexes tracked by ETFs. With individual stocks, you can research the business fundamentals, earnings history and expectations for upcoming quarters before making an investment decision.
It would be difficult to monitor ETFs the same way, because they usually track indexes with dozens of companies. Therefore, the performance of your investment portfolio would depend on circumstances beyond your control.
Assessing Levels of Flexibility
Individual stocks offer more flexibility because you can pick and choose the stocks that fit your financial objectives and tolerance for risk. For example, you could implement a diversified investment portfolio with dividend-paying stocks, growth stocks and stocks of foreign companies.
ETFs require an indirect investment in all the stocks of particular indexes, which could lead to over-diversification and duplication. For example, ETFs that track the S&P 500 index and the technology industry would have several stocks in common.
Understanding Investment Predictability
The return on investment for an individual stock depends mostly on its fundamentals. You can reasonably estimate its long-term return based on certain assumptions about industry and economic conditions. It is more difficult to predict ETF returns because they could depend on the performance of stocks in different industry sectors.
For example, if the Dow Jones Industrial Average is down 10 percent, the corresponding ETF will also be down about 10 percent regardless of the performance of individual stocks within the Dow. The index could be down because of the underperformance of a handful of stocks or weakness in one particular industry. There is no opportunity to pick undervalued stocks and wait for the market price to catch up to earnings growth, cash flow and other financial fundamentals.
Comparing the Costs
The cost of owning individual stocks is usually less than owning ETFs or mutual funds. You would pay a one-time commission for buying individual stocks, unless you are trying to time the market and trading more frequently. You would pay similar commissions for buying and selling ETFs. You would also be responsible for management fees and expenses.
For example, if the Dow Jones is up 5 percent for the year, the corresponding ETF could be up about 4.75 percent because of a management fee of 0.25 percent. Although these management fees are not as high as actively managed mutual funds, they do affect your return on investment.
Investor.gov: Exchange-Traded Funds (ETFs)
Investopedia: Exchange-Traded Fund
Investopedia: Stock vs. ETF: Which Should You Buy
Wealthsimple: Q What's the Difference Between a Stock and an ETF?
The Wall Street Journal: Market Data Center
MSN Money: Top-Performing Exchange-Traded Funds
Based in Ottawa, Canada, Chirantan Basu has been writing since 1995. His work has appeared in various publications and he has performed financial editing at a Wall Street firm. Basu holds a Bachelor of Engineering from Memorial University of Newfoundland, a Master of Business Administration from the University of Ottawa and holds the Canadian Investment Manager designation from the Canadian Securities Institute.
Mutual Funds That Follow the Dow
Why Would a Person Choose a Mutual Fund Over an Individual Stock?
What Is an Abnormal Rate of Return in the Stock Market?
Advantages & Disadvantages of Stock Mutual Funds
If I Invest in an Index When Would I Get a Profit?
Quantitative Analysis for Mutual Fund Selection
How do I Buy NASDAQ Stock?
Total Stock Market ETF Advantages
What Is the Rate of Return on an Index Fund? | cc/2020-05/en_middle_0078.json.gz/line1163 |
__label__wiki | 0.987205 | 0.987205 | Thailandkeyboard_arrow_down
Special offeth
City check in
Find flight deals from Thailand to Aberdeen (ABZ)
Thailand - Aberdeen
Book flights from Thailand to Aberdeen (ABZ)
to toA Coruna, A Coruna Airport (LCG), SpainAbakan, Abakan Airport (ABA), RussiaAberdeen, Dyce Airport (ABZ), United KingdomAbidjan, Felix Houphouet Boigny Airport (ABJ), Ivory CoastAbu Dhabi, Abu Dhabi Airport (AUH), United Arab EmiratesAbuja, Nnamdi Azikiwe Airport (ABV), NigeriaAdana, Sakirpasa Airport (ADA), TurkeyAddis Ababa, Bole Airport (ADD), EthiopiaAdelaide, Adelaide Airport (ADL), AustraliaAgadir, Al Massira Airport (AGA), MoroccoAhmedabad, Sardar Vallabhbhai Patel Airport (AMD), IndiaAl Ain, Etihad Town Office Bus Station (ZVH), United Arab EmiratesAlbuquerque NM, Sunport Airport (ABQ), United States of AmericaAlbury, Albury Airport (ABX), AustraliaAlesund, Vigra Airport (AES), NorwayAlexandria, Borg El Arab Airport (HBE), EgyptAlexandroupolis, Dimokritos Airport (AXD), GreeceAlghero, Fertilia Airport (AHO), ItalyAlgiers, Houari Boumediene Airport (ALG), AlgeriaAlice Springs, Alice Springs Airport (ASP), AustraliaAlmaty, Almaty Airport (ALA), KazakhstanAlor Setar, Sultan Abdul Halim Airport (AOR), MalaysiaAmman, Queen Alia Airport (AMM), JordanAmsterdam, Schiphol Airport (AMS), NetherlandsAnapa, Anapa Airport (AAQ), RussiaAncona, Falconara Airport (AOI), ItalyAntalya, Antalya Airport (AYT), TurkeyAntananarivo, Ivato Airport (TNR), MadagascarAsuncion, Silvio Pettirossi Airport (ASU), ParaguayAthens, Eleftherios Venizelos Airport (ATH), GreeceAtlanta GA, Hartsfield Jackson Airport (ATL), United States of AmericaAuckland, Auckland Airport (AKL), New ZealandAustin TX, Bergstrom Airport (AUS), United States of AmericaAyers Rock, Connellan Airport (AYQ), AustraliaBaghdad, Baghdad Airport (BGW), IraqBahrain, Bahrain Airport (BAH), BahrainBaku, Heydar Aliyev Airport (GYD), AzerbaijanBali, Ngurah Rai Airport (DPS), IndonesiaBalikpapan, Sepinggan Airport (BPN), IndonesiaBallina, Byron Gateway Airport (BNK), AustraliaBaltimore MD, Washington Thurgood Marshall Airport (BWI), United States of AmericaBamako, Senou Airport (BKO), MaliBandar Seri Begawan, Brunei Airport (BWN), BruneiBangkok, Suvarnabhumi Airport (BKK), ThailandBanja Luka, Banja Luka Airport (BNX), Bosnia/HerzegovinaBarcelona, El Prat Airport (BCN), SpainBari, Palese Airport (BRI), ItalyBarnaul, Barnaul Airport (BAX), RussiaBasel, Euro Airport (BSL), SwitzerlandBeijing, Capital Airport (PEK), ChinaBeirut, Rafic Hariri Airport (BEY), LebanonBelfast, George Best City Airport (BHD), United KingdomBelgorod, Belgorod Airport (EGO), RussiaBelgrade, Nikola Tesla Airport (BEG), SerbiaBengaluru, Kempegowda Airport (BLR), IndiaBergen, Flesland Airport (BGO), NorwayBerlin, Tegel Airport (TXL), GermanyBilbao, Bilbao Airport (BIO), SpainBillund, Billund Airport (BLL), DenmarkBintulu, Bintulu Airport (BTU), MalaysiaBirmingham AL, Shuttlesworth Airport (BHM), United States of AmericaBirmingham, Birmingham Airport (BHX), United KingdomBloomington-Normal IL, Normal Airport (BMI), United States of AmericaBogota, El Dorado Airport (BOG), ColombiaBologna, Guglielmo Marconi Airport (BLQ), ItalyBordeaux, Merignac Airport (BOD), FranceBordeaux, Saint Jean TGV Railway Station (ZFQ), FranceBoston MA, Logan Airport (BOS), United States of AmericaBrindisi, Casale Airprot (BDS), ItalyBrisbane, Brisbane Airport (BNE), AustraliaBristol, Lulsgate Airport (BRS), United KingdomBrussels, Brussels Airport (BRU), BelgiumBrussels, Midi Railway Station (ZYR), BelgiumBucharest, Henri Coanda Otopeni Airport (OTP), RomaniaBudapest, Liszt Ferenc Airport (BUD), HungaryBuenos Aires, Ministro Pistarini Airport (EZE), ArgentinaBuffalo NY, Niagara Airport (BUF), United States of AmericaBujumbura, Bujumbura Airport (BJM), BurundiBurlington VT, Burlington Airport (BTV), United States of AmericaBusan, Gimhae Airport (PUS), South KoreaCagliari, Elmas Airport (CAG), ItalyCairns, Cairns Airport (CNS), AustraliaCairo, Cairo Airport (CAI), EgyptCalgary, Calgary Airport (YYC), CanadaCanberra, Canberra Airport (CBR), AustraliaCape Town, Cape Town Airport (CPT), South AfricaCardiff, Cardiff Wales Airport (CWL), United KingdomCasablanca, Mohamed V Airport (CMN), MoroccoCatania, Fontanarossa Airport (CTA), ItalyCebu, Mactan Cebu Airport (CEB), PhilippinesCedar Rapids IA, The Eastern Iowa Airport (CID), United States of AmericaChampaign IL, Willard University Airport (CMI), United States of AmericaChangsha, Huanghua Airport (CSX), ChinaChania, Ioannis Daskalogiannis Airport (CHQ), GreeceCharleston SC, Air Force Base Airport (CHS), United States of AmericaCharlotte NC, Douglas Airport (CLT), United States of AmericaCharlottesville VA, Albemarle Airport (CHO), United States of AmericaChelyabinsk, Balandino Airport (CEK), RussiaChengdu, Shuangliu Airport (CTU), ChinaChennai, Chennai Airport (MAA), IndiaChiang Mai, Chiang Mai Airport (CNX), ThailandChiang Rai, Mae Fah Luang Airport (CEI), ThailandChicago IL, O'Hare Airport (ORD), United States of AmericaChios, Chios Airport (JKH), GreeceChristchurch, Christchurch Airport (CHC), New ZealandCincinnati OH, Covington Northern Kentucky Airport (CVG), United States of AmericaCleveland OH, Hopkins Airport (CLE), United States of AmericaCoffs Harbour, Coffs Harbour Airport (CFS), AustraliaCologne, Cologne Bonn Airport (CGN), GermanyColombo, Bandaranaike Airport (CMB), Sri LankaColorado Springs CO, Colorado Springs Airport (COS), United States of AmericaColumbia MO, Columbia Regional Airport (COU), United States of AmericaColumbus OH, Port Columbus Airport (CMH), United States of AmericaCopenhagen, Kastrup Airport (CPH), DenmarkCorfu, Ioannis Kapodistrias Airport (CFU), GreeceCork, Cork Airport (ORK), IrelandDa Nang, Da Nang Airport (DAD), VietnamDakar, Blaise Diagne Airport (DSS), SenegalDalian, Zhoushuizi Airport (DLC), ChinaDallas TX, Fort Worth Airport (DFW), United States of AmericaDammam, Khobar SABTCO Bus Station (DMS), Saudi ArabiaDammam, King Fahd Airport (DMM), Saudi ArabiaDar Es Salaam, Julius Nyerere Airport (DAR), TanzaniaDarwin, Darwin Airport (DRW), AustraliaDayton OH, James M Cox Airport (DAY), United States of AmericaDenver CO, Denver Airport (DEN), United States of AmericaDes Moines IA, Des Moines Airport (DSM), United States of AmericaDetroit MI, Wayne County Metro Airport (DTW), United States of AmericaDhaka, Hazrat Shahjalal Airport (DAC), BangladeshDortmund, Dortmund Airport (DTM), GermanyDresden, Dresden Airport (DRS), GermanyDubai, Etihad Bus Station (XNB), United Arab EmiratesDublin, Dublin Airport (DUB), IrelandDubrovnik, Dubrovnik Airport (DBV), CroatiaDubuque IA, Dubuque Regional Airport (DBQ), United States of AmericaDunedin, Dunedin Airport (DUD), New ZealandDurban, King Shaka Airport (DUR), South AfricaDurham, Durham Tees Valley Airport (MME), United KingdomDusseldorf, Dusseldorf Airport (DUS), GermanyEdinburgh, Edinburgh Airport (EDI), United KingdomEdmonton, Edmonton Airport (YEG), CanadaEl Paso TX, El Paso Airport (ELP), United States of AmericaEmerald, Emerald Airport (EMD), AustraliaEntebbe, Entebbe Airport (EBB), UgandaErcan, Ercan Airport (ECN), CyprusEugene OR, Mahlon Sweet Field Airport (EUG), United States of AmericaEvansville IN, Evansville Airport (EVV), United States of AmericaExeter, Exeter Airport (EXT), United KingdomFaisalabad, Faisalabad Airport (LYP), PakistanFargo ND, Hector Airport (FAR), United States of AmericaFayetteville AR, Northwest Arkansas Airport (XNA), United States of AmericaFlint MI, Bishop Airport (FNT), United States of AmericaFlorence, Peretola Airport (FLR), ItalyFort Lauderdale FL, Hollywood Airport (FLL), United States of AmericaFort Myers FL, Southwest Florida Airport (RSW), United States of AmericaFort Wayne IN, Fort Wayne Airport (FWA), United States of AmericaFrankfurt, Frankfurt Airport (FRA), GermanyFresno CA, Yosemite Airport (FAT), United States of AmericaFuerteventura, Fuerteventura Airport (FUE), SpainFukuoka, Fukuoka Airport (FUK), JapanGaborone, Sir Seretse Khama Airport (GBE), BotswanaGan Island, Gan Airport (GAN), MaldivesGaziantep, Oguzeli Airport (GZT), TurkeyGdansk, Lech Walesa Airport (GDN), PolandGeneva, Geneva Airport (GVA), SwitzerlandGenova, Cristoforo Colombo Airport (GOA), ItalyGeorge, George Airport (GRJ), South AfricaGlasgow, Glasgow Airport (GLA), United KingdomGold Coast, Coolangatta Airport (OOL), AustraliaGorno Altaysk, Gorno Altaysk Airport (RGK), RussiaGoteborg, Landvetter Airport (GOT), SwedenGrand Rapids MI, Gerald R Ford Airport (GRR), United States of AmericaGraz, Graz Airport (GRZ), AustriaGreen Bay WI, Austin Straubel Airport (GRB), United States of AmericaGreensboro NC, Piedmont Triad Airport (GSO), United States of AmericaGreenville SC, Spartanburg Airport (GSP), United States of AmericaGuangzhou, Baiyun Airport (CAN), ChinaHalifax, Stanfield Airport (YHZ), CanadaHamburg, Fuhlsbuettel Airport (HAM), GermanyHamilton Island, Great Barrier Reef Airport (HTI), AustraliaHannover, Hannover Airport (HAJ), GermanyHanoi, Noibai Airport (HAN), VietnamHanover, Hanover HBF Train Station (ZVR), GermanyHarare, Harare Airport (HRE), ZimbabweHarrisburg PA, Harrisburg Airport (MDT), United States of AmericaHartford CT, Bradley Airport (BDL), United States of AmericaHelsinki, Vantaa Airport (HEL), FinlandHeraclion, Heraklion Nikos Kazantzakis Airport (HER), GreeceHervey Bay, Hervey Bay Airport (HVB), AustraliaHo Chi Minh City, Tan Son Nhat Airport (SGN), VietnamHobart, Hobart Airport (HBA), AustraliaHong Kong, Hong Kong Airport (HKG), ChinaHouston TX, George Bush Airport (IAH), United States of AmericaHyderabad, Rajiv Gandhi Airport (HYD), IndiaIndianapolis IN, Indianapolis Airport (IND), United States of AmericaIoannina, Ioannina Airport (IOA), GreeceIslamabad, New Islamabad Airport (ISB), PakistanIsle Of Man, Ronaldsway Airport (IOM), United KingdomIstanbul, Istanbul Airport (IST), TurkeyIzmir, Adnan Menderes Airport (ADB), TurkeyJacksonville FL, Jacksonville Airport (JAX), United States of AmericaJaipur, Jaipur Airport (JAI), IndiaJakarta, Soekarno Hatta Airport (CGK), IndonesiaJeddah, King Abdulaziz Airport (JED), Saudi ArabiaJersey, Jersey Airport (JER), United KingdomJohannesburg, O R Tambo Airport (JNB), South AfricaJohor Bahru, Sultan Ismail Airport (JHB), MalaysiaKagoshima, Kagoshima Airport (KOJ), JapanKalamazoo MI, Battle Creek Airport (AZO), United States of AmericaKalgoorlie, Boulder Airport (KGI), AustraliaKaliningrad, Khrabrovo Airport (KGD), RussiaKansas City MO, Kansas City Airport (MCI), United States of AmericaKaohsiung, Kaohsiung Airport (KHH), ChinaKarachi, Jinnah Airport (KHI), PakistanKathmandu, Tribhuvan Airport (KTM), NepalKavala, Alexander the Great Airport (KVA), GreeceKazan, Kazan Airport (KZN), RussiaKemerovo, Kemerovo Airport (KEJ), RussiaKharkiv, Kharkiv Airport (HRK), UkraineKhartoum, Khartoum Airport (KRT), SudanKiev, Boryspil Airport (KBP), UkraineKiev, Zhuliany Airport (IEV), UkraineKigali, Kigali Airport (KGL), RwandaKilimanjaro, Kilimanjaro Airport (JRO), TanzaniaKisumu, Kisumu Airport (KIS), KenyaKnock, Ireland West Airport (NOC), IrelandKnoxville TN, McGhee Tyson Airport (TYS), United States of AmericaKochi, Cochin Airport (COK), IndiaKoh Samui, Ko Samui Airport (USM), ThailandKolkata, Netaji Subhas Chandra Bose Airport (CCU), IndiaKos, Ippokratis Airport (KGS), GreeceKota Kinabalu, Kota Kinabalu Airport (BKI), MalaysiaKozhikode, Calicut Airport (CCJ), IndiaKrabi, Krabi Airport (KBV), ThailandKrakow, John Paul II Balice Airport (KRK), PolandKrasnodar, Pashkovsky Airport (KRR), RussiaKrasnoyarsk, Yemelyanovo Airport (KJA), RussiaKristiansand, Kjevik Airport (KRS), NorwayKuala Lumpur, Kuala Lumpur Airport (KUL), MalaysiaKuala Terengganu, Sultan Mahmud Airport (TGG), MalaysiaKuching, Kuching Airport (KCH), MalaysiaKunming, Changshui Airport (KMG), ChinaKuwait, Kuwait Airport (KWI), KuwaitLa Crosse WI, La Crosse Airport (LSE), United States of AmericaLabuan, Labuan Airport (LBU), MalaysiaLagos, Murtala Muhammed Airport (LOS), NigeriaLahore, Allama Iqbal Airport (LHE), PakistanLambert MO, St Louis Airport (STL), United States of AmericaLamezia Terme, Lamezia Terme Airport (SUF), ItalyLampang, Lampang Airport (LPT), ThailandLangkawi, Langkawi Airport (LGK), MalaysiaLarnaca, Larnaca Airport (LCA), CyprusLas Vegas NV, McCarran Airport (LAS), United States of AmericaLaunceston, Launceston Airport (LST), AustraliaLegazpi City, Legazpi Airport (LGP), PhilippinesLeipzig, Halle Airport (LEJ), GermanyLeipzig, Leipzig/Halle Railway Station (XIT), GermanyLexington KY, Blue Grass Airport (LEX), United States of AmericaLille, TGV Railway Station (XDB), FranceLilongwe, Lilongwe Airport (LLW), MalawiLimnos, Lemnos Airport (LXS), GreeceLipetsk, Lipetsk Airport (LPK), RussiaLisbon, Portela Airport (LIS), PortugalLittle Rock AR, Adams Field Airport (LIT), United States of AmericaLjubljana, Joze Pucnik Airport (LJU), SloveniaLombok, Selaparang Airport (LOP), IndonesiaLondon, Gatwick Airport (LGW), United KingdomLondon, Heathrow Airport (LHR), United KingdomLondon, London City Airport (LCY), United KingdomLong Beach CA, Daugherty Field Airport (LGB), United States of AmericaLos Angeles CA, Los Angeles Airport (LAX), United States of AmericaLouisville KY, Standiford Field Airport (SDF), United States of AmericaLuanda, Quatro de Fevereiro Airport (LAD), AngolaLuang Prabang, Luang Prabang Airport (LPQ), LaosLusaka, Lusaka Airport (LUN), ZambiaLuxembourg, Luxembourg Airport (LUX), LuxembourgLyon, Part Dieu TGV Railway Station (XYD), FranceLyon, Satolaos Saint Exupery Airport (LYS), FranceMackay, Mackay Airport (MKY), AustraliaMadeira, Funchal Santa Catarina Airport (FNC), PortugalMadison WI, Dane County Airport (MSN), United States of AmericaMadrid, Barajas Adolfo Suarez Airport (MAD), SpainMakassar, Sultan Hasanuddin Airport (UPG), IndonesiaMalaga, Malaga Airport (AGP), SpainMale, Velana Airport (MLE), MaldivesMalta, Luqa Airport (MLA), MaltaManado, Sam Ratulangi Airport (MDC), IndonesiaManchester, Manchester Airport (MAN), United KingdomMandalay, Mandalay Airport (MDL), MyanmarManhattan KS, Manhattan Airport (MHK), United States of AmericaManila, Ninoy Aquino Airport (MNL), PhilippinesMaputo, Maputo Airport (MPM), MozambiqueMarquette MI, Sawyer Airport (MQT), United States of AmericaMarrakech, Menara Airport (RAK), MoroccoMarseille, Marignane Airport (MRS), FranceMarseille, St Charles TGV Railway Station (XRF), FranceMartha's Vineyard MA, Martha's Vineyard Airport (MVY), United States of AmericaMauritius, Sir Seewoosagur Ramgoolam Airport (MRU), MauritiusMedan, Polonia Kualanamu Airport (KNO), IndonesiaMedina, Madinah Prince Mohammad Airport (MED), Saudi ArabiaMelbourne, Tullamarine Airport (MEL), AustraliaMemphis TN, Memphis Airport (MEM), United States of AmericaMexico City, Benito Juarez Airport (MEX), MexicoMiami FL, Miami Airport (MIA), United States of AmericaMilan, Malpensa Airport (MXP), ItalyMildura, Mildura Airport (MQL), AustraliaMilwaukee WI, General Mitchell Airport (MKE), United States of AmericaMinneapolis MN, Saint Paul Airport (MSP), United States of AmericaMinsk, Minsk 2 National Airport (MSQ), BelarusMiri, Miri Airport (MYY), MalaysiaMiyazaki, Miyazaki Airport (KMI), JapanMoline IL, Quad City Airport (MLI), United States of AmericaMombasa, Moi Airport (MBA), KenyaMontpellier, St Roch TGV Railway Station (XPJ), FranceMontreal, Pierre Elliott Trudeau Airport (YUL), CanadaMoroni, Prince Said Ibrahim Airport (HAH), Comoros IslandsMoscow, Domodedovo Airport (DME), RussiaMoscow, Sheremetyevo Airport (SVO), RussiaMoscow, Vnukovo Airport (VKO), RussiaMount Isa, Mount Isa Airport (ISA), AustraliaMultan, Multan Airport (MUX), PakistanMumbai, Bombay Chhatrapati Shivaji Maharaj Airport (BOM), IndiaMunich, Franz Josef Strauss Airport (MUC), GermanyMurmansk, Murmansk Airport (MMK), RussiaMuscat, Muscat Airport (MCT), OmanMykonos, Mykonos Airport (JMK), GreeceMytilene, Mytilene Airport (MJT), GreeceN'Djamena, N'Djamena Airport (NDJ), ChadNadi, Nadi Airport (NAN), FijiNadym, Nadym Airport (NYM), RussiaNagoya, Chubu Centrair Airport (NGO), JapanNairobi, Jomo Kenyatta Airport (NBO), KenyaNajaf, Al Najaf Airport (NJF), IraqNantes, TGV Railway Station (QJZ), FranceNantucket MA, Nantucket Memorial Airport (ACK), United States of AmericaNapoli, Capodichino Airport (NAP), ItalyNashville TN, Nashville Airport (BNA), United States of AmericaNay Pyi Taw, Nay Pyi Taw Airport (NYT), MyanmarNew Delhi, Indira Gandhi Airport (DEL), IndiaNew Orleans LA, Louis Armstrong Airport (MSY), United States of AmericaNew York NY, John F Kennedy Airport (JFK), United States of AmericaNew York NY, La Guardia Airport (LGA), United States of AmericaNew York NY, Newark Liberty Airport (EWR), United States of AmericaNewcastle, Newcastle Airport (NCL), United KingdomNewcastle, Williamtown Airport (NTL), AustraliaNewquay, Cornwall Airport (NQY), United KingdomNha Trang, Cam Ranh Airport (CXR), VietnamNice, Cote D Azur Airport (NCE), FranceNiigata, Niigata Airport (KIJ), JapanNizhnevartovsk, Nizhnevartovsk Airport (NJC), RussiaNizhny Novgorod, Strigino Airport (GOJ), RussiaNorfolk VA, Norfolk Airport (ORF), United States of AmericaNottingham, East Midlands Airport (EMA), United KingdomNoumea, La Tontouta Airport (NOU), New CaledoniaNovokuznetsk, Spichenkovo Airport (NOZ), RussiaNovosibirsk, Tolmachevo Airport (OVB), RussiaNovy Urengoy, Novy Urengoy Airport (NUX), RussiaNur-Sultan, Astana Airport (TSE), KazakhstanNuremberg, Nuremberg Airport (NUE), GermanyNuremberg, Nuremberg HBF Train Station (ZAQ), GermanyOdesa, Odesa Airport (ODS), UkraineOkinawa, Naha Airport (OKA), JapanOklahoma City OK, Will Rogers World Airport (OKC), United States of AmericaOmaha NE, Eppley Airfield (OMA), United States of AmericaOmsk, Tsentralny Airport (OMS), RussiaOrlando FL, Orlando Airport (MCO), United States of AmericaOsaka, Itami Airport (ITM), JapanOsaka, Kansai Airport (KIX), JapanOslo, Gardermoen Airport (OSL), NorwayOslo, Torp Sandefjord Airport (TRF), NorwayOstersund, Are Ostersund Airport (OSD), SwedenOttawa, Macdonald Cartier Airport (YOW), CanadaOzamiz City, Labo Airport (OZC), PhilippinesPadang, Minangkabau Airport (PDG), IndonesiaPalembang, Sultan Mahmud Badaruddin Airport (PLM), IndonesiaPalermo, Punta Raisi Airport (PMO), ItalyPalma Mallorca, Palma De Mallorca Airport (PMI), SpainParis, Charles De Gaulle Airport (CDG), FrancePekanbaru, Sultan Syarif Kasim Airport (PKU), IndonesiaPenang, Penang Airport (PEN), MalaysiaPenza, Penza Airport (PEZ), RussiaPeoria IL, Greater Peoria Airport (PIA), United States of AmericaPerm, Bolshoye Savino Airport (PEE), RussiaPerth, Perth Airport (PER), AustraliaPeshawar, Bacha Khan Airport (PEW), PakistanPhiladelphia PA, Philadelphia Airport (PHL), United States of AmericaPhnom Penh, Phnom Penh Airport (PNH), CambodiaPhoenix AZ, Sky Harbor Airport (PHX), United States of AmericaPhuket, Phuket Airport (HKT), ThailandPisa, Galileo Galilei Airport (PSA), ItalyPittsburgh PA, Pittsburgh Airport (PIT), United States of AmericaPodgorica, Podgorica Airport (TGD), MontenegroPonta Delgada, Joao Paulo II Airport (PDL), PortugalPort Elizabeth, Port Elizabeth Airport (PLZ), South AfricaPort Macquarie, Port Macquarie Airport (PQQ), AustraliaPortland ME, Portland Jetport (PWM), United States of AmericaPorto, Francisco Sa Carneiro Airport (OPO), PortugalPrague, Vaclav Havel Ruzyne Airport (PRG), Czech RepublicPraslin Island, Praslin Island Airport (PRI), SeychellesProserpine, Whitsunday Coast Airport (PPP), AustraliaPula, Pula Airport (PUY), CroatiaQingdao, Liuting Airport (TAO), ChinaQueenstown, Queenstown Airport (ZQN), New ZealandRabat, Sale Airport (RBA), MoroccoRail n Fly, DB German Railway Service (QYG), GermanyRaleigh Durham NC, Durham Airport (RDU), United States of AmericaReggio Calabria, Reggio Calabria Airport (REG), ItalyRegina, Regina Airport (YQR), CanadaReno NV, Tahoe Airport (RNO), United States of AmericaReykjavik, Keflavik Airport (KEF), IcelandRhodes, Diagoras Airport (RHO), GreeceRichmond VA, Richmond Airport (RIC), United States of AmericaRiga, Riga Airport (RIX), LatviaRiyadh, King Khalid Airport (RUH), Saudi ArabiaRochester MN, Rochester Airport (RST), United States of AmericaRochester NY, Greater Rochester Airport (ROC), United States of AmericaRockhampton, Rockhampton Airport (ROK), AustraliaRome, Fiumicino Leonardo da Vinci Airport (FCO), ItalyRostov, Rostov Airport (ROV), RussiaRotorua, Rotorua Airport (ROT), New ZealandRoxas City, Roxas Airport (RXS), PhilippinesSaint Petersburg, Pulkovo Airport (LED), RussiaSalalah, Salalah Airport (SLL), OmanSalt Lake City UT, Salt Lake City Airport (SLC), United States of AmericaSalzburg, W A Mozart Airport (SZG), AustriaSamara, Kurumoch Airport (KUF), RussiaSamos, Samos Airport (SMI), GreeceSan Antonio TX, San Antonio Airport (SAT), United States of AmericaSan Francisco CA, San Francisco Airport (SFO), United States of AmericaSan Jose CA, Norman Y Mineta Airport (SJC), United States of AmericaSanta Cruz De La Palma, La Palma Airport (SPC), SpainSantiago, Arturo Merino Benitez Airport (SCL), ChileSanto Domingo, Las Americas Airport (SDQ), Dominican RepublicSapporo, Chitose Airport (CTS), JapanSarajevo, Butmir Airport (SJJ), Bosnia/HerzegovinaSarasota FL, Bradenton Airport (SRQ), United States of AmericaSaratov, Saratov Tsentralny Airport (RTW), RussiaSaskatoon, J G Diefenbaker Airport (YXE), CanadaSavannah GA, Hilton Head Airport (SAV), United States of AmericaSeattle WA, Tacoma Airport (SEA), United States of AmericaSemarang, Achmad Yani Airport (SRG), IndonesiaSendai, Sendai Airport (SDJ), JapanSeoul, Incheon Airport (ICN), South KoreaSeychelles, Mahe Airport (SEZ), SeychellesShanghai, Pudong Airport (PVG), ChinaShannon, Shannon Airport (SNN), IrelandShenyang, Taoxian Airport (SHE), ChinaShenzhen, Bao'an Airport (SZX), ChinaSiem Reap, Angkor Airport (REP), CambodiaSimferopol, Simferopol Airport (SIP), UkraineSingapore, Changi Airport (SIN), SingaporeSioux City IA, Sioux Gateway Airport (SUX), United States of AmericaSioux Falls SD, Joe Foss Field Airport (FSD), United States of AmericaSkopje, Alexander the Great Airport (SKP), MacedoniaSochi, Sochi Airport (AER), RussiaSofia, Sofia Airport (SOF), BulgariaSolo, Adi Sumarmo Wiryokusumo Airport (SOC), IndonesiaSouthampton, Southampton Airport (SOU), United KingdomSplit, Split Airport (SPU), CroatiaSpringfield MO, Branson Airport (SGF), United States of AmericaSt. John's, St John's Airport (YYT), CanadaStavanger, Sola Airport (SVG), NorwayStockholm, Arlanda Airport (ARN), SwedenStockholm, Bromma Airport (BMA), SwedenStrasbourg, TGV Railway Station (XWG), FranceStuttgart, Echterdingen Airport (STR), GermanyStuttgart, Stuttgart Railway Station (ZWS), GermanySukhothai, Sukhothai Airport (THS), ThailandSundsvall, Timra Airport (SDL), SwedenSunshine Coast, Maroochydore Airport (MCY), AustraliaSurabaya, Juanda Airport (SUB), IndonesiaSydney, Kingsford Smith Airport (SYD), AustraliaTaichung, Taichung Airport (RMQ), ChinaTaif, Taif Airport (TIF), Saudi ArabiaTaipei, Taoyuan Airport (TPE), ChinaTallinn, Lennart Meri Airport (TLL), EstoniaTampa FL, Tampa Airport (TPA), United States of AmericaTamworth, Tamworth Airport (TMW), AustraliaTangier, Boukhalef Ibn Battouta Airport (TNG), MoroccoTawau, Tawau Airport (TWU), MalaysiaTbilisi, Tbilisi Airport (TBS), GeorgiaThessaloniki, Makedonia Airport (SKG), GreeceThira, Santorini Airport (JTR), GreeceThiruvananthapuram, Trivandrum Airport (TRV), IndiaTirana, Rinas Mother Teresa Airport (TIA), AlbaniaTivat, Tivat Airport (TIV), MontenegroTokyo, Narita Airport (NRT), JapanToledo OH, Express Airport (TOL), United States of AmericaTomsk, Bogashevo Airport (TOF), RussiaToronto, Pearson Airport (YYZ), CanadaToulouse, Blagnac Airport (TLS), FranceTownsville, Townsville Airport (TSV), AustraliaTrapani, Birgi Airport (TPS), ItalyTrat, Trat Airport (TDX), ThailandTraverse City MI, Cherry Capital Airport (TVC), United States of AmericaTrieste, Ronchi Dei Legionari Airport (TRS), ItalyTrondheim, Vaernes Airport (TRD), NorwayTucson AZ, Tucson Airport (TUS), United States of AmericaTulsa OK, Tulsa Airport (TUL), United States of AmericaTunis, Carthage Airport (TUN), TunisiaTurin, Caselle Airport (TRN), ItalyUfa, Ufa Airport (UFA), RussiaUmea, Umea Airport (UME), SwedenUst Kamenogorsk, Ust Kamenogorsk Airport (UKK), KazakhstanValencia, Valencia Airport (VLC), SpainVancouver, Vancouver Airport (YVR), CanadaVenice, Marco Polo Airport (VCE), ItalyVerona, Villafranca Airport (VRN), ItalyVienna, Schwechat Airport (VIE), AustriaVientiane, Wattay Airport (VTE), LaosVilnius, Vilnius Airport (VNO), LithuaniaVolgograd, Volgograd Airport (VOG), RussiaVoronezh, Voronezh Airport (VOZ), RussiaWarsaw, Chopin Okecie Airport (WAW), PolandWashington DC, Dulles Airport (IAD), United States of AmericaWashington DC, Ronald Reagan National Airport (DCA), United States of AmericaWaterloo IA, Waterloo Airport (ALO), United States of AmericaWausau WI, Central Wisconsin Airport (CWA), United States of AmericaWellington, Wellington Airport (WLG), New ZealandWest Palm Beach FL, Palm Beach Airport (PBI), United States of AmericaWestchester County NY, Westchester County Airport (HPN), United States of AmericaWesterland, Sylt Airport (GWT), GermanyWichita KS, Mid Continent Airport (ICT), United States of AmericaWindhoek, Hosea Kutako Airport (WDH), NamibiaWinnipeg, Winnipeg Airport (YWG), CanadaWroclaw, Nicolaus Copernicus Airport (WRO), PolandXian, Xianyang Airport (XIY), ChinaYanbu al Bahr, Yanbu Airport (YNB), Saudi ArabiaYangon, Mingaladon Airport (RGN), MyanmarYekaterinburg, Yekaterinburg Airport (SVX), RussiaYerevan, Zvartnots Airport (EVN), ArmeniaZagreb, Pleso Airport (ZAG), CroatiaZanzibar, Zanzibar Airport (ZNZ), TanzaniaZhukovsky, Zhukovsky Airport (ZIA), RussiaZurich, Zurich Airport (ZRH), Switzerland
toA Coruna, A Coruna Airport (LCG), SpainAbakan, Abakan Airport (ABA), RussiaAberdeen, Dyce Airport (ABZ), United KingdomAbidjan, Felix Houphouet Boigny Airport (ABJ), Ivory CoastAbu Dhabi, Abu Dhabi Airport (AUH), United Arab EmiratesAbuja, Nnamdi Azikiwe Airport (ABV), NigeriaAdana, Sakirpasa Airport (ADA), TurkeyAddis Ababa, Bole Airport (ADD), EthiopiaAdelaide, Adelaide Airport (ADL), AustraliaAgadir, Al Massira Airport (AGA), MoroccoAhmedabad, Sardar Vallabhbhai Patel Airport (AMD), IndiaAl Ain, Etihad Town Office Bus Station (ZVH), United Arab EmiratesAlbuquerque NM, Sunport Airport (ABQ), United States of AmericaAlbury, Albury Airport (ABX), AustraliaAlesund, Vigra Airport (AES), NorwayAlexandria, Borg El Arab Airport (HBE), EgyptAlexandroupolis, Dimokritos Airport (AXD), GreeceAlghero, Fertilia Airport (AHO), ItalyAlgiers, Houari Boumediene Airport (ALG), AlgeriaAlice Springs, Alice Springs Airport (ASP), AustraliaAlmaty, Almaty Airport (ALA), KazakhstanAlor Setar, Sultan Abdul Halim Airport (AOR), MalaysiaAmman, Queen Alia Airport (AMM), JordanAmsterdam, Schiphol Airport (AMS), NetherlandsAnapa, Anapa Airport (AAQ), RussiaAncona, Falconara Airport (AOI), ItalyAntalya, Antalya Airport (AYT), TurkeyAntananarivo, Ivato Airport (TNR), MadagascarAsuncion, Silvio Pettirossi Airport (ASU), ParaguayAthens, Eleftherios Venizelos Airport (ATH), GreeceAtlanta GA, Hartsfield Jackson Airport (ATL), United States of AmericaAuckland, Auckland Airport (AKL), New ZealandAustin TX, Bergstrom Airport (AUS), United States of AmericaAyers Rock, Connellan Airport (AYQ), AustraliaBaghdad, Baghdad Airport (BGW), IraqBahrain, Bahrain Airport (BAH), BahrainBaku, Heydar Aliyev Airport (GYD), AzerbaijanBali, Ngurah Rai Airport (DPS), IndonesiaBalikpapan, Sepinggan Airport (BPN), IndonesiaBallina, Byron Gateway Airport (BNK), AustraliaBaltimore MD, Washington Thurgood Marshall Airport (BWI), United States of AmericaBamako, Senou Airport (BKO), MaliBandar Seri Begawan, Brunei Airport (BWN), BruneiBangkok, Suvarnabhumi Airport (BKK), ThailandBanja Luka, Banja Luka Airport (BNX), Bosnia/HerzegovinaBarcelona, El Prat Airport (BCN), SpainBari, Palese Airport (BRI), ItalyBarnaul, Barnaul Airport (BAX), RussiaBasel, Euro Airport (BSL), SwitzerlandBeijing, Capital Airport (PEK), ChinaBeirut, Rafic Hariri Airport (BEY), LebanonBelfast, George Best City Airport (BHD), United KingdomBelgorod, Belgorod Airport (EGO), RussiaBelgrade, Nikola Tesla Airport (BEG), SerbiaBengaluru, Kempegowda Airport (BLR), IndiaBergen, Flesland Airport (BGO), NorwayBerlin, Tegel Airport (TXL), GermanyBilbao, Bilbao Airport (BIO), SpainBillund, Billund Airport (BLL), DenmarkBintulu, Bintulu Airport (BTU), MalaysiaBirmingham AL, Shuttlesworth Airport (BHM), United States of AmericaBirmingham, Birmingham Airport (BHX), United KingdomBloomington-Normal IL, Normal Airport (BMI), United States of AmericaBogota, El Dorado Airport (BOG), ColombiaBologna, Guglielmo Marconi Airport (BLQ), ItalyBordeaux, Merignac Airport (BOD), FranceBordeaux, Saint Jean TGV Railway Station (ZFQ), FranceBoston MA, Logan Airport (BOS), United States of AmericaBrindisi, Casale Airprot (BDS), ItalyBrisbane, Brisbane Airport (BNE), AustraliaBristol, Lulsgate Airport (BRS), United KingdomBrussels, Brussels Airport (BRU), BelgiumBrussels, Midi Railway Station (ZYR), BelgiumBucharest, Henri Coanda Otopeni Airport (OTP), RomaniaBudapest, Liszt Ferenc Airport (BUD), HungaryBuenos Aires, Ministro Pistarini Airport (EZE), ArgentinaBuffalo NY, Niagara Airport (BUF), United States of AmericaBujumbura, Bujumbura Airport (BJM), BurundiBurlington VT, Burlington Airport (BTV), United States of AmericaBusan, Gimhae Airport (PUS), South KoreaCagliari, Elmas Airport (CAG), ItalyCairns, Cairns Airport (CNS), AustraliaCairo, Cairo Airport (CAI), EgyptCalgary, Calgary Airport (YYC), CanadaCanberra, Canberra Airport (CBR), AustraliaCape Town, Cape Town Airport (CPT), South AfricaCardiff, Cardiff Wales Airport (CWL), United KingdomCasablanca, Mohamed V Airport (CMN), MoroccoCatania, Fontanarossa Airport (CTA), ItalyCebu, Mactan Cebu Airport (CEB), PhilippinesCedar Rapids IA, The Eastern Iowa Airport (CID), United States of AmericaChampaign IL, Willard University Airport (CMI), United States of AmericaChangsha, Huanghua Airport (CSX), ChinaChania, Ioannis Daskalogiannis Airport (CHQ), GreeceCharleston SC, Air Force Base Airport (CHS), United States of AmericaCharlotte NC, Douglas Airport (CLT), United States of AmericaCharlottesville VA, Albemarle Airport (CHO), United States of AmericaChelyabinsk, Balandino Airport (CEK), RussiaChengdu, Shuangliu Airport (CTU), ChinaChennai, Chennai Airport (MAA), IndiaChiang Mai, Chiang Mai Airport (CNX), ThailandChiang Rai, Mae Fah Luang Airport (CEI), ThailandChicago IL, O'Hare Airport (ORD), United States of AmericaChios, Chios Airport (JKH), GreeceChristchurch, Christchurch Airport (CHC), New ZealandCincinnati OH, Covington Northern Kentucky Airport (CVG), United States of AmericaCleveland OH, Hopkins Airport (CLE), United States of AmericaCoffs Harbour, Coffs Harbour Airport (CFS), AustraliaCologne, Cologne Bonn Airport (CGN), GermanyColombo, Bandaranaike Airport (CMB), Sri LankaColorado Springs CO, Colorado Springs Airport (COS), United States of AmericaColumbia MO, Columbia Regional Airport (COU), United States of AmericaColumbus OH, Port Columbus Airport (CMH), United States of AmericaCopenhagen, Kastrup Airport (CPH), DenmarkCorfu, Ioannis Kapodistrias Airport (CFU), GreeceCork, Cork Airport (ORK), IrelandDa Nang, Da Nang Airport (DAD), VietnamDakar, Blaise Diagne Airport (DSS), SenegalDalian, Zhoushuizi Airport (DLC), ChinaDallas TX, Fort Worth Airport (DFW), United States of AmericaDammam, Khobar SABTCO Bus Station (DMS), Saudi ArabiaDammam, King Fahd Airport (DMM), Saudi ArabiaDar Es Salaam, Julius Nyerere Airport (DAR), TanzaniaDarwin, Darwin Airport (DRW), AustraliaDayton OH, James M Cox Airport (DAY), United States of AmericaDenver CO, Denver Airport (DEN), United States of AmericaDes Moines IA, Des Moines Airport (DSM), United States of AmericaDetroit MI, Wayne County Metro Airport (DTW), United States of AmericaDhaka, Hazrat Shahjalal Airport (DAC), BangladeshDortmund, Dortmund Airport (DTM), GermanyDresden, Dresden Airport (DRS), GermanyDubai, Etihad Bus Station (XNB), United Arab EmiratesDublin, Dublin Airport (DUB), IrelandDubrovnik, Dubrovnik Airport (DBV), CroatiaDubuque IA, Dubuque Regional Airport (DBQ), United States of AmericaDunedin, Dunedin Airport (DUD), New ZealandDurban, King Shaka Airport (DUR), South AfricaDurham, Durham Tees Valley Airport (MME), United KingdomDusseldorf, Dusseldorf Airport (DUS), GermanyEdinburgh, Edinburgh Airport (EDI), United KingdomEdmonton, Edmonton Airport (YEG), CanadaEl Paso TX, El Paso Airport (ELP), United States of AmericaEmerald, Emerald Airport (EMD), AustraliaEntebbe, Entebbe Airport (EBB), UgandaErcan, Ercan Airport (ECN), CyprusEugene OR, Mahlon Sweet Field Airport (EUG), United States of AmericaEvansville IN, Evansville Airport (EVV), United States of AmericaExeter, Exeter Airport (EXT), United KingdomFaisalabad, Faisalabad Airport (LYP), PakistanFargo ND, Hector Airport (FAR), United States of AmericaFayetteville AR, Northwest Arkansas Airport (XNA), United States of AmericaFlint MI, Bishop Airport (FNT), United States of AmericaFlorence, Peretola Airport (FLR), ItalyFort Lauderdale FL, Hollywood Airport (FLL), United States of AmericaFort Myers FL, Southwest Florida Airport (RSW), United States of AmericaFort Wayne IN, Fort Wayne Airport (FWA), United States of AmericaFrankfurt, Frankfurt Airport (FRA), GermanyFresno CA, Yosemite Airport (FAT), United States of AmericaFuerteventura, Fuerteventura Airport (FUE), SpainFukuoka, Fukuoka Airport (FUK), JapanGaborone, Sir Seretse Khama Airport (GBE), BotswanaGan Island, Gan Airport (GAN), MaldivesGaziantep, Oguzeli Airport (GZT), TurkeyGdansk, Lech Walesa Airport (GDN), PolandGeneva, Geneva Airport (GVA), SwitzerlandGenova, Cristoforo Colombo Airport (GOA), ItalyGeorge, George Airport (GRJ), South AfricaGlasgow, Glasgow Airport (GLA), United KingdomGold Coast, Coolangatta Airport (OOL), AustraliaGorno Altaysk, Gorno Altaysk Airport (RGK), RussiaGoteborg, Landvetter Airport (GOT), SwedenGrand Rapids MI, Gerald R Ford Airport (GRR), United States of AmericaGraz, Graz Airport (GRZ), AustriaGreen Bay WI, Austin Straubel Airport (GRB), United States of AmericaGreensboro NC, Piedmont Triad Airport (GSO), United States of AmericaGreenville SC, Spartanburg Airport (GSP), United States of AmericaGuangzhou, Baiyun Airport (CAN), ChinaHalifax, Stanfield Airport (YHZ), CanadaHamburg, Fuhlsbuettel Airport (HAM), GermanyHamilton Island, Great Barrier Reef Airport (HTI), AustraliaHannover, Hannover Airport (HAJ), GermanyHanoi, Noibai Airport (HAN), VietnamHanover, Hanover HBF Train Station (ZVR), GermanyHarare, Harare Airport (HRE), ZimbabweHarrisburg PA, Harrisburg Airport (MDT), United States of AmericaHartford CT, Bradley Airport (BDL), United States of AmericaHelsinki, Vantaa Airport (HEL), FinlandHeraclion, Heraklion Nikos Kazantzakis Airport (HER), GreeceHervey Bay, Hervey Bay Airport (HVB), AustraliaHo Chi Minh City, Tan Son Nhat Airport (SGN), VietnamHobart, Hobart Airport (HBA), AustraliaHong Kong, Hong Kong Airport (HKG), ChinaHouston TX, George Bush Airport (IAH), United States of AmericaHyderabad, Rajiv Gandhi Airport (HYD), IndiaIndianapolis IN, Indianapolis Airport (IND), United States of AmericaIoannina, Ioannina Airport (IOA), GreeceIslamabad, New Islamabad Airport (ISB), PakistanIsle Of Man, Ronaldsway Airport (IOM), United KingdomIstanbul, Istanbul Airport (IST), TurkeyIzmir, Adnan Menderes Airport (ADB), TurkeyJacksonville FL, Jacksonville Airport (JAX), United States of AmericaJaipur, Jaipur Airport (JAI), IndiaJakarta, Soekarno Hatta Airport (CGK), IndonesiaJeddah, King Abdulaziz Airport (JED), Saudi ArabiaJersey, Jersey Airport (JER), United KingdomJohannesburg, O R Tambo Airport (JNB), South AfricaJohor Bahru, Sultan Ismail Airport (JHB), MalaysiaKagoshima, Kagoshima Airport (KOJ), JapanKalamazoo MI, Battle Creek Airport (AZO), United States of AmericaKalgoorlie, Boulder Airport (KGI), AustraliaKaliningrad, Khrabrovo Airport (KGD), RussiaKansas City MO, Kansas City Airport (MCI), United States of AmericaKaohsiung, Kaohsiung Airport (KHH), ChinaKarachi, Jinnah Airport (KHI), PakistanKathmandu, Tribhuvan Airport (KTM), NepalKavala, Alexander the Great Airport (KVA), GreeceKazan, Kazan Airport (KZN), RussiaKemerovo, Kemerovo Airport (KEJ), RussiaKharkiv, Kharkiv Airport (HRK), UkraineKhartoum, Khartoum Airport (KRT), SudanKiev, Boryspil Airport (KBP), UkraineKiev, Zhuliany Airport (IEV), UkraineKigali, Kigali Airport (KGL), RwandaKilimanjaro, Kilimanjaro Airport (JRO), TanzaniaKisumu, Kisumu Airport (KIS), KenyaKnock, Ireland West Airport (NOC), IrelandKnoxville TN, McGhee Tyson Airport (TYS), United States of AmericaKochi, Cochin Airport (COK), IndiaKoh Samui, Ko Samui Airport (USM), ThailandKolkata, Netaji Subhas Chandra Bose Airport (CCU), IndiaKos, Ippokratis Airport (KGS), GreeceKota Kinabalu, Kota Kinabalu Airport (BKI), MalaysiaKozhikode, Calicut Airport (CCJ), IndiaKrabi, Krabi Airport (KBV), ThailandKrakow, John Paul II Balice Airport (KRK), PolandKrasnodar, Pashkovsky Airport (KRR), RussiaKrasnoyarsk, Yemelyanovo Airport (KJA), RussiaKristiansand, Kjevik Airport (KRS), NorwayKuala Lumpur, Kuala Lumpur Airport (KUL), MalaysiaKuala Terengganu, Sultan Mahmud Airport (TGG), MalaysiaKuching, Kuching Airport (KCH), MalaysiaKunming, Changshui Airport (KMG), ChinaKuwait, Kuwait Airport (KWI), KuwaitLa Crosse WI, La Crosse Airport (LSE), United States of AmericaLabuan, Labuan Airport (LBU), MalaysiaLagos, Murtala Muhammed Airport (LOS), NigeriaLahore, Allama Iqbal Airport (LHE), PakistanLambert MO, St Louis Airport (STL), United States of AmericaLamezia Terme, Lamezia Terme Airport (SUF), ItalyLampang, Lampang Airport (LPT), ThailandLangkawi, Langkawi Airport (LGK), MalaysiaLarnaca, Larnaca Airport (LCA), CyprusLas Vegas NV, McCarran Airport (LAS), United States of AmericaLaunceston, Launceston Airport (LST), AustraliaLegazpi City, Legazpi Airport (LGP), PhilippinesLeipzig, Halle Airport (LEJ), GermanyLeipzig, Leipzig/Halle Railway Station (XIT), GermanyLexington KY, Blue Grass Airport (LEX), United States of AmericaLille, TGV Railway Station (XDB), FranceLilongwe, Lilongwe Airport (LLW), MalawiLimnos, Lemnos Airport (LXS), GreeceLipetsk, Lipetsk Airport (LPK), RussiaLisbon, Portela Airport (LIS), PortugalLittle Rock AR, Adams Field Airport (LIT), United States of AmericaLjubljana, Joze Pucnik Airport (LJU), SloveniaLombok, Selaparang Airport (LOP), IndonesiaLondon, Gatwick Airport (LGW), United KingdomLondon, Heathrow Airport (LHR), United KingdomLondon, London City Airport (LCY), United KingdomLong Beach CA, Daugherty Field Airport (LGB), United States of AmericaLos Angeles CA, Los Angeles Airport (LAX), United States of AmericaLouisville KY, Standiford Field Airport (SDF), United States of AmericaLuanda, Quatro de Fevereiro Airport (LAD), AngolaLuang Prabang, Luang Prabang Airport (LPQ), LaosLusaka, Lusaka Airport (LUN), ZambiaLuxembourg, Luxembourg Airport (LUX), LuxembourgLyon, Part Dieu TGV Railway Station (XYD), FranceLyon, Satolaos Saint Exupery Airport (LYS), FranceMackay, Mackay Airport (MKY), AustraliaMadeira, Funchal Santa Catarina Airport (FNC), PortugalMadison WI, Dane County Airport (MSN), United States of AmericaMadrid, Barajas Adolfo Suarez Airport (MAD), SpainMakassar, Sultan Hasanuddin Airport (UPG), IndonesiaMalaga, Malaga Airport (AGP), SpainMale, Velana Airport (MLE), MaldivesMalta, Luqa Airport (MLA), MaltaManado, Sam Ratulangi Airport (MDC), IndonesiaManchester, Manchester Airport (MAN), United KingdomMandalay, Mandalay Airport (MDL), MyanmarManhattan KS, Manhattan Airport (MHK), United States of AmericaManila, Ninoy Aquino Airport (MNL), PhilippinesMaputo, Maputo Airport (MPM), MozambiqueMarquette MI, Sawyer Airport (MQT), United States of AmericaMarrakech, Menara Airport (RAK), MoroccoMarseille, Marignane Airport (MRS), FranceMarseille, St Charles TGV Railway Station (XRF), FranceMartha's Vineyard MA, Martha's Vineyard Airport (MVY), United States of AmericaMauritius, Sir Seewoosagur Ramgoolam Airport (MRU), MauritiusMedan, Polonia Kualanamu Airport (KNO), IndonesiaMedina, Madinah Prince Mohammad Airport (MED), Saudi ArabiaMelbourne, Tullamarine Airport (MEL), AustraliaMemphis TN, Memphis Airport (MEM), United States of AmericaMexico City, Benito Juarez Airport (MEX), MexicoMiami FL, Miami Airport (MIA), United States of AmericaMilan, Malpensa Airport (MXP), ItalyMildura, Mildura Airport (MQL), AustraliaMilwaukee WI, General Mitchell Airport (MKE), United States of AmericaMinneapolis MN, Saint Paul Airport (MSP), United States of AmericaMinsk, Minsk 2 National Airport (MSQ), BelarusMiri, Miri Airport (MYY), MalaysiaMiyazaki, Miyazaki Airport (KMI), JapanMoline IL, Quad City Airport (MLI), United States of AmericaMombasa, Moi Airport (MBA), KenyaMontpellier, St Roch TGV Railway Station (XPJ), FranceMontreal, Pierre Elliott Trudeau Airport (YUL), CanadaMoroni, Prince Said Ibrahim Airport (HAH), Comoros IslandsMoscow, Domodedovo Airport (DME), RussiaMoscow, Sheremetyevo Airport (SVO), RussiaMoscow, Vnukovo Airport (VKO), RussiaMount Isa, Mount Isa Airport (ISA), AustraliaMultan, Multan Airport (MUX), PakistanMumbai, Bombay Chhatrapati Shivaji Maharaj Airport (BOM), IndiaMunich, Franz Josef Strauss Airport (MUC), GermanyMurmansk, Murmansk Airport (MMK), RussiaMuscat, Muscat Airport (MCT), OmanMykonos, Mykonos Airport (JMK), GreeceMytilene, Mytilene Airport (MJT), GreeceN'Djamena, N'Djamena Airport (NDJ), ChadNadi, Nadi Airport (NAN), FijiNadym, Nadym Airport (NYM), RussiaNagoya, Chubu Centrair Airport (NGO), JapanNairobi, Jomo Kenyatta Airport (NBO), KenyaNajaf, Al Najaf Airport (NJF), IraqNantes, TGV Railway Station (QJZ), FranceNantucket MA, Nantucket Memorial Airport (ACK), United States of AmericaNapoli, Capodichino Airport (NAP), ItalyNashville TN, Nashville Airport (BNA), United States of AmericaNay Pyi Taw, Nay Pyi Taw Airport (NYT), MyanmarNew Delhi, Indira Gandhi Airport (DEL), IndiaNew Orleans LA, Louis Armstrong Airport (MSY), United States of AmericaNew York NY, John F Kennedy Airport (JFK), United States of AmericaNew York NY, La Guardia Airport (LGA), United States of AmericaNew York NY, Newark Liberty Airport (EWR), United States of AmericaNewcastle, Newcastle Airport (NCL), United KingdomNewcastle, Williamtown Airport (NTL), AustraliaNewquay, Cornwall Airport (NQY), United KingdomNha Trang, Cam Ranh Airport (CXR), VietnamNice, Cote D Azur Airport (NCE), FranceNiigata, Niigata Airport (KIJ), JapanNizhnevartovsk, Nizhnevartovsk Airport (NJC), RussiaNizhny Novgorod, Strigino Airport (GOJ), RussiaNorfolk VA, Norfolk Airport (ORF), United States of AmericaNottingham, East Midlands Airport (EMA), United KingdomNoumea, La Tontouta Airport (NOU), New CaledoniaNovokuznetsk, Spichenkovo Airport (NOZ), RussiaNovosibirsk, Tolmachevo Airport (OVB), RussiaNovy Urengoy, Novy Urengoy Airport (NUX), RussiaNur-Sultan, Astana Airport (TSE), KazakhstanNuremberg, Nuremberg Airport (NUE), GermanyNuremberg, Nuremberg HBF Train Station (ZAQ), GermanyOdesa, Odesa Airport (ODS), UkraineOkinawa, Naha Airport (OKA), JapanOklahoma City OK, Will Rogers World Airport (OKC), United States of AmericaOmaha NE, Eppley Airfield (OMA), United States of AmericaOmsk, Tsentralny Airport (OMS), RussiaOrlando FL, Orlando Airport (MCO), United States of AmericaOsaka, Itami Airport (ITM), JapanOsaka, Kansai Airport (KIX), JapanOslo, Gardermoen Airport (OSL), NorwayOslo, Torp Sandefjord Airport (TRF), NorwayOstersund, Are Ostersund Airport (OSD), SwedenOttawa, Macdonald Cartier Airport (YOW), CanadaOzamiz City, Labo Airport (OZC), PhilippinesPadang, Minangkabau Airport (PDG), IndonesiaPalembang, Sultan Mahmud Badaruddin Airport (PLM), IndonesiaPalermo, Punta Raisi Airport (PMO), ItalyPalma Mallorca, Palma De Mallorca Airport (PMI), SpainParis, Charles De Gaulle Airport (CDG), FrancePekanbaru, Sultan Syarif Kasim Airport (PKU), IndonesiaPenang, Penang Airport (PEN), MalaysiaPenza, Penza Airport (PEZ), RussiaPeoria IL, Greater Peoria Airport (PIA), United States of AmericaPerm, Bolshoye Savino Airport (PEE), RussiaPerth, Perth Airport (PER), AustraliaPeshawar, Bacha Khan Airport (PEW), PakistanPhiladelphia PA, Philadelphia Airport (PHL), United States of AmericaPhnom Penh, Phnom Penh Airport (PNH), CambodiaPhoenix AZ, Sky Harbor Airport (PHX), United States of AmericaPhuket, Phuket Airport (HKT), ThailandPisa, Galileo Galilei Airport (PSA), ItalyPittsburgh PA, Pittsburgh Airport (PIT), United States of AmericaPodgorica, Podgorica Airport (TGD), MontenegroPonta Delgada, Joao Paulo II Airport (PDL), PortugalPort Elizabeth, Port Elizabeth Airport (PLZ), South AfricaPort Macquarie, Port Macquarie Airport (PQQ), AustraliaPortland ME, Portland Jetport (PWM), United States of AmericaPorto, Francisco Sa Carneiro Airport (OPO), PortugalPrague, Vaclav Havel Ruzyne Airport (PRG), Czech RepublicPraslin Island, Praslin Island Airport (PRI), SeychellesProserpine, Whitsunday Coast Airport (PPP), AustraliaPula, Pula Airport (PUY), CroatiaQingdao, Liuting Airport (TAO), ChinaQueenstown, Queenstown Airport (ZQN), New ZealandRabat, Sale Airport (RBA), MoroccoRail n Fly, DB German Railway Service (QYG), GermanyRaleigh Durham NC, Durham Airport (RDU), United States of AmericaReggio Calabria, Reggio Calabria Airport (REG), ItalyRegina, Regina Airport (YQR), CanadaReno NV, Tahoe Airport (RNO), United States of AmericaReykjavik, Keflavik Airport (KEF), IcelandRhodes, Diagoras Airport (RHO), GreeceRichmond VA, Richmond Airport (RIC), United States of AmericaRiga, Riga Airport (RIX), LatviaRiyadh, King Khalid Airport (RUH), Saudi ArabiaRochester MN, Rochester Airport (RST), United States of AmericaRochester NY, Greater Rochester Airport (ROC), United States of AmericaRockhampton, Rockhampton Airport (ROK), AustraliaRome, Fiumicino Leonardo da Vinci Airport (FCO), ItalyRostov, Rostov Airport (ROV), RussiaRotorua, Rotorua Airport (ROT), New ZealandRoxas City, Roxas Airport (RXS), PhilippinesSaint Petersburg, Pulkovo Airport (LED), RussiaSalalah, Salalah Airport (SLL), OmanSalt Lake City UT, Salt Lake City Airport (SLC), United States of AmericaSalzburg, W A Mozart Airport (SZG), AustriaSamara, Kurumoch Airport (KUF), RussiaSamos, Samos Airport (SMI), GreeceSan Antonio TX, San Antonio Airport (SAT), United States of AmericaSan Francisco CA, San Francisco Airport (SFO), United States of AmericaSan Jose CA, Norman Y Mineta Airport (SJC), United States of AmericaSanta Cruz De La Palma, La Palma Airport (SPC), SpainSantiago, Arturo Merino Benitez Airport (SCL), ChileSanto Domingo, Las Americas Airport (SDQ), Dominican RepublicSapporo, Chitose Airport (CTS), JapanSarajevo, Butmir Airport (SJJ), Bosnia/HerzegovinaSarasota FL, Bradenton Airport (SRQ), United States of AmericaSaratov, Saratov Tsentralny Airport (RTW), RussiaSaskatoon, J G Diefenbaker Airport (YXE), CanadaSavannah GA, Hilton Head Airport (SAV), United States of AmericaSeattle WA, Tacoma Airport (SEA), United States of AmericaSemarang, Achmad Yani Airport (SRG), IndonesiaSendai, Sendai Airport (SDJ), JapanSeoul, Incheon Airport (ICN), South KoreaSeychelles, Mahe Airport (SEZ), SeychellesShanghai, Pudong Airport (PVG), ChinaShannon, Shannon Airport (SNN), IrelandShenyang, Taoxian Airport (SHE), ChinaShenzhen, Bao'an Airport (SZX), ChinaSiem Reap, Angkor Airport (REP), CambodiaSimferopol, Simferopol Airport (SIP), UkraineSingapore, Changi Airport (SIN), SingaporeSioux City IA, Sioux Gateway Airport (SUX), United States of AmericaSioux Falls SD, Joe Foss Field Airport (FSD), United States of AmericaSkopje, Alexander the Great Airport (SKP), MacedoniaSochi, Sochi Airport (AER), RussiaSofia, Sofia Airport (SOF), BulgariaSolo, Adi Sumarmo Wiryokusumo Airport (SOC), IndonesiaSouthampton, Southampton Airport (SOU), United KingdomSplit, Split Airport (SPU), CroatiaSpringfield MO, Branson Airport (SGF), United States of AmericaSt. John's, St John's Airport (YYT), CanadaStavanger, Sola Airport (SVG), NorwayStockholm, Arlanda Airport (ARN), SwedenStockholm, Bromma Airport (BMA), SwedenStrasbourg, TGV Railway Station (XWG), FranceStuttgart, Echterdingen Airport (STR), GermanyStuttgart, Stuttgart Railway Station (ZWS), GermanySukhothai, Sukhothai Airport (THS), ThailandSundsvall, Timra Airport (SDL), SwedenSunshine Coast, Maroochydore Airport (MCY), AustraliaSurabaya, Juanda Airport (SUB), IndonesiaSydney, Kingsford Smith Airport (SYD), AustraliaTaichung, Taichung Airport (RMQ), ChinaTaif, Taif Airport (TIF), Saudi ArabiaTaipei, Taoyuan Airport (TPE), ChinaTallinn, Lennart Meri Airport (TLL), EstoniaTampa FL, Tampa Airport (TPA), United States of AmericaTamworth, Tamworth Airport (TMW), AustraliaTangier, Boukhalef Ibn Battouta Airport (TNG), MoroccoTawau, Tawau Airport (TWU), MalaysiaTbilisi, Tbilisi Airport (TBS), GeorgiaThessaloniki, Makedonia Airport (SKG), GreeceThira, Santorini Airport (JTR), GreeceThiruvananthapuram, Trivandrum Airport (TRV), IndiaTirana, Rinas Mother Teresa Airport (TIA), AlbaniaTivat, Tivat Airport (TIV), MontenegroTokyo, Narita Airport (NRT), JapanToledo OH, Express Airport (TOL), United States of AmericaTomsk, Bogashevo Airport (TOF), RussiaToronto, Pearson Airport (YYZ), CanadaToulouse, Blagnac Airport (TLS), FranceTownsville, Townsville Airport (TSV), AustraliaTrapani, Birgi Airport (TPS), ItalyTrat, Trat Airport (TDX), ThailandTraverse City MI, Cherry Capital Airport (TVC), United States of AmericaTrieste, Ronchi Dei Legionari Airport (TRS), ItalyTrondheim, Vaernes Airport (TRD), NorwayTucson AZ, Tucson Airport (TUS), United States of AmericaTulsa OK, Tulsa Airport (TUL), United States of AmericaTunis, Carthage Airport (TUN), TunisiaTurin, Caselle Airport (TRN), ItalyUfa, Ufa Airport (UFA), RussiaUmea, Umea Airport (UME), SwedenUst Kamenogorsk, Ust Kamenogorsk Airport (UKK), KazakhstanValencia, Valencia Airport (VLC), SpainVancouver, Vancouver Airport (YVR), CanadaVenice, Marco Polo Airport (VCE), ItalyVerona, Villafranca Airport (VRN), ItalyVienna, Schwechat Airport (VIE), AustriaVientiane, Wattay Airport (VTE), LaosVilnius, Vilnius Airport (VNO), LithuaniaVolgograd, Volgograd Airport (VOG), RussiaVoronezh, Voronezh Airport (VOZ), RussiaWarsaw, Chopin Okecie Airport (WAW), PolandWashington DC, Dulles Airport (IAD), United States of AmericaWashington DC, Ronald Reagan National Airport (DCA), United States of AmericaWaterloo IA, Waterloo Airport (ALO), United States of AmericaWausau WI, Central Wisconsin Airport (CWA), United States of AmericaWellington, Wellington Airport (WLG), New ZealandWest Palm Beach FL, Palm Beach Airport (PBI), United States of AmericaWestchester County NY, Westchester County Airport (HPN), United States of AmericaWesterland, Sylt Airport (GWT), GermanyWichita KS, Mid Continent Airport (ICT), United States of AmericaWindhoek, Hosea Kutako Airport (WDH), NamibiaWinnipeg, Winnipeg Airport (YWG), CanadaWroclaw, Nicolaus Copernicus Airport (WRO), PolandXian, Xianyang Airport (XIY), ChinaYanbu al Bahr, Yanbu Airport (YNB), Saudi ArabiaYangon, Mingaladon Airport (RGN), MyanmarYekaterinburg, Yekaterinburg Airport (SVX), RussiaYerevan, Zvartnots Airport (EVN), ArmeniaZagreb, Pleso Airport (ZAG), CroatiaZanzibar, Zanzibar Airport (ZNZ), TanzaniaZhukovsky, Zhukovsky Airport (ZIA), RussiaZurich, Zurich Airport (ZRH), Switzerland
Book the best deals on Thailand to Aberdeen (ABZ) flights from THB 57390
Bangkok (BKK) to Aberdeen (ABZ)
Departure Wed 5 Feb 2020,
Return Tue 18 Feb 2020
from THB57390*
Weather in Aberdeen
Explore flights from Thailand to Aberdeen
From Thailand
To Aberdeen
Bangkok - Aberdeen
Phuket - Aberdeen | cc/2020-05/en_middle_0078.json.gz/line1170 |
__label__wiki | 0.972062 | 0.972062 | Find the best flight offers from Baltimore to Bangkok
To Thailand
Baltimore - Bangkok
Book flights from Baltimore (BWI) to Bangkok (BKK)
to toAbu Dhabi, Abu Dhabi Airport (AUH), United Arab EmiratesAhmedabad, Sardar Vallabhbhai Patel Airport (AMD), IndiaAl Ain, Etihad Town Office Bus Station (ZVH), United Arab EmiratesAmman, Queen Alia Airport (AMM), JordanBahrain, Bahrain Airport (BAH), BahrainBangkok, Suvarnabhumi Airport (BKK), ThailandBeijing, Capital Airport (PEK), ChinaBeirut, Rafic Hariri Airport (BEY), LebanonBengaluru, Kempegowda Airport (BLR), IndiaCairo, Cairo Airport (CAI), EgyptChengdu, Shuangliu Airport (CTU), ChinaChennai, Chennai Airport (MAA), IndiaColombo, Bandaranaike Airport (CMB), Sri LankaDammam, King Fahd Airport (DMM), Saudi ArabiaDubai, Etihad Bus Station (XNB), United Arab EmiratesHong Kong, Hong Kong Airport (HKG), ChinaHyderabad, Rajiv Gandhi Airport (HYD), IndiaIslamabad, New Islamabad Airport (ISB), PakistanJakarta, Soekarno Hatta Airport (CGK), IndonesiaJeddah, King Abdulaziz Airport (JED), Saudi ArabiaJohannesburg, O R Tambo Airport (JNB), South AfricaKarachi, Jinnah Airport (KHI), PakistanKathmandu, Tribhuvan Airport (KTM), NepalKhartoum, Khartoum Airport (KRT), SudanKochi, Cochin Airport (COK), IndiaKolkata, Netaji Subhas Chandra Bose Airport (CCU), IndiaKozhikode, Calicut Airport (CCJ), IndiaKuala Lumpur, Kuala Lumpur Airport (KUL), MalaysiaKuwait, Kuwait Airport (KWI), KuwaitLahore, Allama Iqbal Airport (LHE), PakistanMale, Velana Airport (MLE), MaldivesManila, Ninoy Aquino Airport (MNL), PhilippinesMedina, Madinah Prince Mohammad Airport (MED), Saudi ArabiaMumbai, Bombay Chhatrapati Shivaji Maharaj Airport (BOM), IndiaMuscat, Muscat Airport (MCT), OmanNagoya, Chubu Centrair Airport (NGO), JapanNairobi, Jomo Kenyatta Airport (NBO), KenyaNew Delhi, Indira Gandhi Airport (DEL), IndiaPhuket, Phuket Airport (HKT), ThailandRiyadh, King Khalid Airport (RUH), Saudi ArabiaSeoul, Incheon Airport (ICN), South KoreaSeychelles, Mahe Airport (SEZ), SeychellesShanghai, Pudong Airport (PVG), ChinaSingapore, Changi Airport (SIN), SingaporeThiruvananthapuram, Trivandrum Airport (TRV), IndiaTokyo, Narita Airport (NRT), Japan
toAbu Dhabi, Abu Dhabi Airport (AUH), United Arab EmiratesAhmedabad, Sardar Vallabhbhai Patel Airport (AMD), IndiaAl Ain, Etihad Town Office Bus Station (ZVH), United Arab EmiratesAmman, Queen Alia Airport (AMM), JordanBahrain, Bahrain Airport (BAH), BahrainBangkok, Suvarnabhumi Airport (BKK), ThailandBeijing, Capital Airport (PEK), ChinaBeirut, Rafic Hariri Airport (BEY), LebanonBengaluru, Kempegowda Airport (BLR), IndiaCairo, Cairo Airport (CAI), EgyptChengdu, Shuangliu Airport (CTU), ChinaChennai, Chennai Airport (MAA), IndiaColombo, Bandaranaike Airport (CMB), Sri LankaDammam, King Fahd Airport (DMM), Saudi ArabiaDubai, Etihad Bus Station (XNB), United Arab EmiratesHong Kong, Hong Kong Airport (HKG), ChinaHyderabad, Rajiv Gandhi Airport (HYD), IndiaIslamabad, New Islamabad Airport (ISB), PakistanJakarta, Soekarno Hatta Airport (CGK), IndonesiaJeddah, King Abdulaziz Airport (JED), Saudi ArabiaJohannesburg, O R Tambo Airport (JNB), South AfricaKarachi, Jinnah Airport (KHI), PakistanKathmandu, Tribhuvan Airport (KTM), NepalKhartoum, Khartoum Airport (KRT), SudanKochi, Cochin Airport (COK), IndiaKolkata, Netaji Subhas Chandra Bose Airport (CCU), IndiaKozhikode, Calicut Airport (CCJ), IndiaKuala Lumpur, Kuala Lumpur Airport (KUL), MalaysiaKuwait, Kuwait Airport (KWI), KuwaitLahore, Allama Iqbal Airport (LHE), PakistanMale, Velana Airport (MLE), MaldivesManila, Ninoy Aquino Airport (MNL), PhilippinesMedina, Madinah Prince Mohammad Airport (MED), Saudi ArabiaMumbai, Bombay Chhatrapati Shivaji Maharaj Airport (BOM), IndiaMuscat, Muscat Airport (MCT), OmanNagoya, Chubu Centrair Airport (NGO), JapanNairobi, Jomo Kenyatta Airport (NBO), KenyaNew Delhi, Indira Gandhi Airport (DEL), IndiaPhuket, Phuket Airport (HKT), ThailandRiyadh, King Khalid Airport (RUH), Saudi ArabiaSeoul, Incheon Airport (ICN), South KoreaSeychelles, Mahe Airport (SEZ), SeychellesShanghai, Pudong Airport (PVG), ChinaSingapore, Changi Airport (SIN), SingaporeThiruvananthapuram, Trivandrum Airport (TRV), IndiaTokyo, Narita Airport (NRT), Japan
Baltimore - Bangkok flight information
From Baltimore | cc/2020-05/en_middle_0078.json.gz/line1171 |
__label__cc | 0.721396 | 0.278604 | A project of the global canopy programme
Community-Based Forest Monitoring
International Forest Agendas
Enabling sustainable forest management
Protecting forest peoples’ rights
Transparent and effective forest finance
Achieving cost-effectiveness
Project planning and initiation
Establishing a monitoring system
Data recording, collection and analysis
Data sharing and reporting: lessons from Guyana
The context for data sharing
Data management and infrastructure
Setting up a process for data access
Considerations and criteria for using digital technology
Transferring data: choosing networks
Choosing a digital device: phone, smartphone or tablet
Choosing suitable software
Drones: the pros and cons for community monitoring
Integration and scaling up
Monitoring and evaluation of success
Monitoring Themes
(-) Remove Carbon biomass filter Carbon biomass
Deforestation drivers (10) Apply Deforestation drivers filter
Land use change (7) Apply Land use change filter
Policies & measures (3) Apply Policies & measures filter
(-) Remove Wellbeing & social issues filter Wellbeing & social issues
These case studies share key insights, methodologies and indicators, challenges and successes from community based forest monitoring initiatives around the world.
Searchable by ‘monitoring theme’ and ‘international agenda’, these case studies aim to help policy-makers and practitioners understand how community based monitoring can inform national and international forest agendas such as the CBD, FLEGT and REDD+.
Community monitoring in the Chico Mendes Extractive Reserve in Acre, Brazil
This community-based monitoring initiative in the Chico Mendes Extractive Reserve in the state of Acre, Brazil, had the following objectives.
(1) Create learning...
Acre, Brazil
Community-based forest monitoring in North Rupununi, Guyana
Since 2011, the project has been working with sixteen Amerindian communities of the North Rupununi, Guyana. It aims to build local capacity to develop and run a community based monitoring system...
Northern Rupununi, Guyana
Carbon biomass
Wellbeing & social issues
Deforestation drivers
Kyoto: Think Global, Act Local (K:TGAL) - community forest monitoring in 30 locations around the world
The ‘Kyoto: Think Global, Act Local’ (K:TGAL) project trialled community-based forest monitoring in 30 sites in 7 countries between 2003 and 2009. It developed and tested a methodology and survey...
Guinea Bissau, India, Mali, Mexico, Nepal, Papua New Guinea, Senegal and Tanzania
Assessing the accuracy and cost-efficacy of community-based monitoring for REDD+
Community involvement and participatory monitoring have been advocated as important sources of information for REDD+....
Indonesia, Laos, Viet Nam and China
Community Measurement, Reporting and Verification by the Wai Wai of Kanashen, Guyana
Indigenous people are among the largest titled landowners in Guyana. Establishing a Community-based Measurement, Reporting and Verification (CMRV) system with them is therefore a key step forward...
Kanashen Community-Owned Conservation Area, Region 9
IGES-FPCD Community-Based Forest Monitoring Project in Papua New Guinea
The Community-Based Forest Monitoring Project (CFMP) was launched in 2010 and is being implemented in Madang Province, Papua New Guinea (PNG), across six clans, each of which owns forest patches...
Madang Province, Papua New Guinea
Improving forest governance through independent monitoring – Moabi-DRC pilot project
This initiative piloted a community-based REDD+ safeguard monitoring system in an area within Maï Ndombe Province, in the Democratic Republic of Congo (DRC), where the company...
Maï Ndombe Province, Democratic Republic of Congo (DRC)
Mapping, monitoring and management of forest corridors: a partnership between local forest owners, the Jane Goodall Institute and Global Forest Watch
JGI is working with around 1 800 local landowners in Western Uganda to reduce deforestation, promote sustainable livelihoods, train forest monitors, and prepare local communities to benefit from...
Budongo Forest Reserve (Masindi District), Bugoma Forest Reserve (Hoima District), Uganda
Participatory monitoring by Project Fauna
Project Fauna was a collaborative project between indigenous communities in the Rupununi area of Southern Guyana and researchers at Stanford University and the State University of New York-ESF....
Rupununi Region, Southern Guyana
RuaiSMS: an initiative that links text messaging and local media to report forest incursions in Borneo
RuaiSMS is a non-profit citizen journalist news service. It uses mobile phone text messaging (SMS) as a way for indigenous and rural communities in remote areas of Borneo to disseminate...
West Kalimantan, East Kalimantan and Central Kalimantan, Indonesia
Policies & measures
The Community Carbon Accounting (CCA) action research project in Indonesia
The Community Carbon Accounting (CCA) Action Research Project in Indonesia is based on the premise that activities to reduce emissions from deforestation and forest degradation and enhance forest...
Semoyo Village (Gunung Kidul District), Terong Village (Bantul District), Yogyakarta Province, Indonesia
The Suruí Forest Carbon Project
The Suruí Forest Carbon project aims to reduce deforestation on the Paiter Suruí people's territory in the Brazilian Amazon, Sete de Setembro Indigenous Territory (TISS), by providing economic...
Sete de Setembro Indigenous Territory (TISS), Rondonia and Mato Grosso States, Brazil
not case study
Community Monitoring, Reporting and Verification (CMRV) systems in Maï-Ndombe, DRC
A CMRV initiative is currently underway in the Mpelu and Kemvuma villages in the Bolobo Territory in the east of Maï-Ndombe Province. This monitoring system is part of a payment for environmental...
Maï-Ndombe province
Remote sensing and REDD+ feasibility at sub-national level in Vietnam
Through its ongoing programme of support and technical cooperation in Quang Binh Province, Vietnam, Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH has conducted a range of...
Quang Binh Province, Vietnam
The Bolsa Floresta Programme: direct incentive payments for forest conservation
The Bolsa Floresta Programme (BFP) is an initiative that was launched in 2007 by the State of Amazonas, Brazil, in order to implement incentive-based forest conservation : one of the first...
Amazonas State, Brazil
Who is Forest COMPASS?
Who is GCP?
Sign up to our list
Privacy/cookie notice
Copyright © 2014 Global Canopy Programme. All rights reserved.
What are the advantages of mobile technology in data collection?
What are the disadvantages of mobile technology in data collection?
What are the key criteria for mobile technology to be a feasible option? | cc/2020-05/en_middle_0078.json.gz/line1174 |
__label__wiki | 0.731386 | 0.731386 | Movies/Books
FAQ / Forum Rules
You are currently viewing our forums as a GUEST.
This allows you to read, but not participate in our discussions.
This also prevents you from downloading attachments and seeing some of our specialized sub-forums.
Registration is free and painless and requires absolutely no personal information other than a valid email address.
You can register for our history forums here. [this reminder disappears once you are registered]
Terrorist Sympathizers
TactiKill J.
General of the Forums
Trump has ignored the threat of domestic terror from day 1:
White House officials rebuffed efforts by their colleagues at the Department of Homeland Security for more than a year to make combating domestic terror threats, such as those from white supremacists, a greater priority as specifically spelled out in the National Counterterrorism Strategy, current and former senior administration officials as well as other sources close to the Trump administration tell CNN.
"Homeland Security officials battled the White House for more than a year to get them to focus more on domestic terrorism," one senior source close to the Trump administration tells CNN. "The White House wanted to focus only on the jihadist threat which, while serious, ignored the reality that racial supremacist violence was rising fast here at home. They had major ideological blinders on."
The National Counterterrorism Strategy, issued last fall, states that "Radical Islamist terrorists remain the primary transnational terrorist threat to the United States and its vital national interests," which few experts dispute. What seems glaring to these officials is the minimizing of the threat of domestic terrorism, which they say was on their radar as a growing problem.
https://www.cnn.com/2019/08/07/polit...ism/index.html
In addition to crippling organizations who were trying to stop it.
Set aside the question of whether President Donald Trump’s rhetorical flirtations with white nationalism enabled Saturday’s mass shooting in Pittsburgh. What’s undeniable is that his administration has hobbled the infrastructure designed to prevent such murders.
In the waning days of Barack Obama’s administration, the Department of Homeland Security awarded a set of grants to organizations working to counter violent extremism, including among white supremacists. One of the grantees was Life After Hate, which The Hill has called “one of the only programs in the U.S. devoted to helping people leave neo-Nazi and other white supremacy groups.” Another grant went to researchers at the University of North Carolinawho were helping young people develop media campaigns aimed at preventing their peers from embracing white supremacy and other violent ideologies. But soon after Trump took office, his administration canceled both of these grants. In its first budget, it requested no funding for any grants in this field.
https://www.theatlantic.com/ideas/ar...rogram/574237/
The new right wing: hate Muslims, preaches tolerance for Nazis.
You cannot coexist with people who do not want to be coexisted with.
Still asking the tough question. Aside from reinstating the grants mentioned, and forwarding similar ones, what other concrete solutions can anyone propose to "defeat this evil"? It would seem we have solidly been able to name or identify the problem. What should be done??
ljadw
Originally posted by TactiKill J. View Post
Given the origine and bias of these sources .........
If you don't agree with it, or you refuse to believe it, then find and post something that refutes it. Your sourcing is usually just a little thin with little or no analysis on your part.
'White House officials rebuffed efforts by their colleagues at the Department of Homeland Security for more than a year to make combating domestic terror threats, such as those from white supremacists, a greater priority as specifically spelled out in the National Counterterrorism Strategy, current and former senior administration officials as well as other sources close to the Trump administration tell CNN.'
'"Homeland Security officials battled the White House for more than a year to get them to focus more on domestic terrorism," one senior source close to the Trump administration tells CNN. "The White House wanted to focus only on the jihadist threat which, while serious, ignored the reality that racial supremacist violence was rising fast here at home. They had major ideological blinders on."'
'The National Counterterrorism Strategy, issued last fall, states that "Radical Islamist terrorists remain the primary transnational terrorist threat to the United States and its vital national interests," which few experts dispute. What seems glaring to these officials is the minimizing of the threat of domestic terrorism, which they say was on their radar as a growing problem.'
'"Ultimately the White House just added one paragraph about domestic terrorism as a throw-away line," a senior source involved in the discussion told CNN. That paragraph mentions "other forms of violent extremism, such as racially motivated extremism, animal rights extremism, environmental extremism, sovereign citizen extremism, and militia extremism." It made no mention of white supremacists. (A separate paragraph in the report mentions investigating domestic terrorists with connections to overseas terrorists, but that does not seem to be a reference to white supremacists.)'
Moved earth and heaven; that which we are we are; One equal temper of heroic hearts
Made weak by time and fate but strong in will
To strive to seek to find and not to yield.
Actually, he hasn't ignored the threat from domestic terrorism. Read page 10 of the National Strategy that is linked in you post. Then read the rest of the document.
CNN is not a good source, they reference the document and then twists the story to fit their agenda. It appears that they hope people won't bother to read the National Strategy document.
"I don't discuss sitting presidents," Mattis tells NPR in an interview. "I believe that you owe a period of quiet."
How was the story by CNN 'twisted'?
Making the accusation without any demonstration of the agenda that you support is not evidence-it is merely opinion-in this case biased opinion.
Originally posted by Massena View Post
I clearly stated how they twisted it and I also referenced the page in the National Strategy document that calls out domestic terrorism. The first 10 pages of the document give the 'who' the following pages gice the 'how' it is to be combatted.
I didn't make an accusation, I posted facts based off of how CNN reported it and what the National Strategy document says. What I posted was not opinion based, what CNN did was leave out mentioning page 10.... the results of that lead to misleading threads like this. CNN twisted the facts...again.
Your opinion of how CNN 'twisted' the article and story. You haven't demonstrated any proof at all and are merely taking a shot at CNN because you believe it to be a 'liberal' news service.
Perhaps you could explain what you mean by liberal or what your understanding is. May I remind you that the United States was founded as a liberal republic that eventually came to be a liberal democracy and that the Founders were the liberals of their day.
Check the title of this thread....it is misleading.
Check the reporting that CNN did...it is misleading.
Finally read the National Strategy document that is linked in the article. Again, page 10 clearly calls out domestic terrorism. It is facts not opinion that I am discussing.
Had CNN included the domestic terrorism that is called out in the document....they wouldn't have a story, we wouldn't have this thread.
There comes a time when people really need to apply critical thinking.
Originally posted by Nichols View Post
Once again there is no supporting evidence for your conclusions except an opinion.
Critical thinking is indeed necessary and not blind devotion or obedience to a corrupt president.
Again, page 10 of the National Strategy document that is linked in the article clearly calls out domestic terrorism....not an opinion, that is a fact. CNN has twisted the news to fit their agenda again.
Didn't CNN state that there was a paragraph dedicated to domestic terrorism and that was put in as an afterthought?
Keep defending a corrupt and incompetent administration-it's your right.
Do you honestly think CNN was a part of writing the National Strategy document?
"put in as an afterthought" how could they possibly know that?
Again CNN is twisting the story to fit their agenda. The National Strategy document calls out domestic terrorism and actions to take to combat it. There is no "Terrorist Sympathizers" as CNN and this thread wants us to believe.
HistoryNet.com RSS
ArmchairGeneral.com RSS
HistoryNet.com Articles
America's Civil War
Civil War Times
MHQ
ACG Online
ACG Magazine
War College
Tactics 101
Carlo D'Este
ACG Gaming
ACG Network
Sites We Support
HistoryNet.com
The Art of Battle
Game Squad
Mil. History Podcast
Russian Army - WW2
Achtung Panzer!
Mil History Online
Former Congressman Collins Goes to Jail
by Massena
https://www.msn.com/en-us/news/polit...cid=spartandhp
Channel: North America
Why Did the National Archives Do This?
Censorship without an explanation, or just plain censorship is not a function of the National Archives:
https://www.msn.com/en-us/news/u...
Rudeness is as Rudeness Does...
Senator McSally is demonstrating a lack of character...as well as leveling a false accusation.
https://www.msn.com/en-us/news/politics/s...
Copyright © 2004-2018 Armchair General L.L.C., All rights reserved. Reproduction in whole or in part without permission is prohibited. | cc/2020-05/en_middle_0078.json.gz/line1178 |
__label__wiki | 0.6556 | 0.6556 | The Human Touch
A poster from our youth said, "Hugs, not drugs." Another poster said, "Keep hands, feet, and objects to yourself." Like two trains sharing the same track, these divergent directives were bound to collide.
HANDS OFF. Kilmer Middle School in Vienna, Virginia has a strict no-touching policy: no slaps or punches, but also no patting, no handshakes, no high-fives, and absolutely positively no hugging. That last one got student Hal Beaulieu sent to the principal's office after some inappropriate contact with his girlfriend.
School officials say the rule helps keep crowded hallways and lunchrooms safe and orderly, and ensures that all students are comfortable. But Hal, 13, and his parents think the school's hands-off approach goes too far, and they are lobbying for a change.
"I think hugging is a good thing," said Hal, a seventh-grader, a few days before the end of the school year. "I put my arm around her. It was like for 15 seconds. I didn't think it would be a big deal."
The school defends the policy on the basis of overcrowding:
Deborah Hernandez, Kilmer's principal, said the rule makes sense in a school that was built for 850 students but houses 1,100. She said that students should have their personal space protected and that many lack the maturity to understand what is acceptable or welcome.
"You get into shades of gray," Hernandez said. "The kids say, 'If he can high-five, then I can do this.' "
Is this not a school? Shouldn't the faculty educate students on what is and is not appropriate contact instead of writing a blanket policy that ducks the question? And if the school is crowded, people are going to be touching anyway -- hopefully not up to the ceiling, but touching nonetheless.
But if students can't hug or offer a hearty handshake in greeting, maybe they should bow and curtsy. This is Virginia, after all, still awash in colonial heritage.
ONWARD CHRISTIAN DRIVERS. The Vatican has issued 10 commandments for good drivers.
As quoted in The Guardian:
2. The road shall be for you a means of communion between people and not of mortal harm.
3. Courtesy, uprightness and prudence will help you deal with unforeseen events.
4. Be charitable and help your neighbor in need, especially victims of accidents.
5. Cars shall not be for you an expression of power and domination, and an occasion of sin.
6. Charitably convince the young and not so young not to drive when they are not in a fitting condition to do so.
7. Support the families of accident victims.
8. Bring guilty motorists and their victims together, at the appropriate time, so that they can undergo the liberating experience of forgiveness.
9. On the road, protect the more vulnerable party.
10. Feel responsible toward others.
A lot of people are having trouble with Number 5.
Praying while driving? We gather it's permissible, as long as you keep your eyes on the road.
We at your Lightning Round felt the need to add a few more commandments, phrased in commandmentese.
* Thou shalt learn thy difference between straight and angled parking and orient thy vehicle accordingly.
* Thou shalt leave sufficient distance between thy right door and thy drivers-side door of thy neighbor.
* Thou shalt not leave heap-a-junk cars to collect in thy front yard like a plague of rust upon thy land.
* Thou shalt not crank thy sound system, particularly thy sub woofer, to a level inducing of earthquake in small European nations.
* Thou shalt realize air freshener trees are no substitute for thy good shampooing.
* Thou shalt not covet thy neighbors spinners, paint job, tricked-up suspension or anything that makes thy neighbors' ride hype.
* Thou shalt honor thy back seats as a place for sitting. Enough said.
IF I DOWNLOADED IT. Legal action is pending against celebrity gossip site TMZ.com for briefly offering the full text of O.J. Simpson's canceled crime hypothetical If I Did It. The Goldman family wants to publish it as Simpson's confession, thus keeping the profits and getting something from their long-standing, yet-to-be-fulfilled $30 million judgment from a wrongful-death suit.
TMZ.com says it didn't do anything wrong, even though it did pull the book off the site... but not before it got into the hands of the BitTorrent community, which continues to pass it around.
Somewhere, O.J. is smiling.
THE GREEN SCARE. If a polar ice cap melted, and nobody saw it, did it really melt? That's what Czech president Vaclav Klaus is suggesting.
His response to a reader question on FT.com:
Do you really “see” any damage caused by current warming? I do not. I would prefer more snow for skiing during this winter but we are – in Central Europe – enjoying warm evenings this May and June, which is very pleasant. Do you see meltdown of glaciers and icebergs? You may see some retreating of continental glaciers, but they represent only 0.6 per cent of the planet’s ice. There is no meltdown either in Greenland or the Antarctic just now.
Klaus also suggests forms of environmental activism are the new socialist threat.
Using Klaus' own comparisons, we'll believe it when we see them hoisting a green flag with a hammer and sickle.
THANKS FOR NOTHING. A man in Jacksonville, Florida heard his neighbor screaming and ran to the victim with shotgun in hand. He treated her bleeding leg and likely saved her life. His neighbor was also his boss, and she expressed her gratitude by firing him.
From the Jacksonville Times-Union:
[Colin] Bruley, a leasing agent at the Oaks at Mill Creek, said he lost his job after being told that brandishing the weapon was a workplace violation, as was failing to notify supervisors after the incident occurred.
We point out Bruley never fired his gun, and he was a little shaken to be following some bureaucratic protocol.
Our beleaguered hero, however, seems to be taking things in stride:
Bruley said he is considering contacting a lawyer about his dismissal, but will first look for another job and possibly another home. He promises he won't shy away from aiding others in need.
"If I'd lose my job again for helping some girl's life ... I'd do it over and over," Bruley said.
Surely somebody out there has an opening for a hero. We hope. Just don't take a job at Home Depot.
-- Christopher at 12:24 AM
Down And Out On Capitol Hill
Shake Your Booty!
Bud Foster's New Assignment
The Balance Of Imbalance
Reel To Reel: Ocean's Thirteen
Dan Vs. Katie Vs. The News
The Emissary
Death Be Not Cramped
News 4 Goes 24
Court To FCC: Get A Grip
Randy Returns
Rise From The Water
Yabba-Dabba-Do You Believe? | cc/2020-05/en_middle_0078.json.gz/line1181 |
__label__cc | 0.74038 | 0.25962 | REENTRY: COMING HOME
SERVICES THAT REBUILD LIVES
ADVOCACY THAT CHANGES MINDS
Direct all media inquiries to Colleen Roche of LAK Public Relations, Inc., who can be reached via email or by phone at (212) 329-1413.
For more information about our monthly television program, Both Sides of the Bars, click here.
NYC Moves Forward on $82M Affordable Project
“Bronx Pro Group acquired the site at 1080 Washington Ave. in partnership with the United Methodist Church in December 2017. The developer is now working with Enterprise Housing Credit Investments LLC, New York State Homes and Community Renewal (HCR), the New York City Department of Housing Preservation and Development (HPD) and The Fortune Society to bring the 12-story building to fruition.”
Read more at Multi-Housing News Back
Our vision is to foster a world where all who are incarcerated or formerly incarcerated will thrive as positive, contributing members of society.
Long Island City (Main Office)
29-76 Northern Boulevard
info@fortunesociety.org
SUBSCRIBE TO THE FORTUNE WEEKLY
Learn how Fortune Society can help you | cc/2020-05/en_middle_0078.json.gz/line1184 |
__label__cc | 0.728881 | 0.271119 | On the Border Mexican Grill & Cantina Coupons
Home » CT » Orange » Restaurants » Mexican » On the Border Mexican Grill & Cantina Coupons
Deals and Coupon Codes near On the Border Mexican Grill & Cantina
Take Reservations: Yes
Serves Alcohol: Yes
In search of some terrific printable restaurant coupon codes and deals for On the Border Mexican Grill & Cantina totally free?
On the Border Mexican Grill & Cantina is a Mexican restaurant. It is located at 220 Indian River Rd in Orange, CT 6477.
About On the Border Mexican Grill & Cantina in Orange
There are bunch of places near On the Border Mexican Grill & Cantina giving great discounts. This discounts range from $ to $. The discount ought to provide you with a total of $.
People online claim that On the Border Mexican Grill & Cantina is . On the Border Mexican Grill & Cantina also offers Mexican cuisine, accepts credit card, and no parking . FriendsEAT Members have given the restaurant a rating 5 out 10 based on 20 total reviews.
This means this restaurant needs more positive reviews. The average price of a meal at this Orange restaurant is under $20 per entree.
Coupons for On the Border Mexican Grill & Cantina
On the Border Mexican Grill & Cantina
220 Indian River Rd
Orange, CT
Rating for On the Border Mexican Grill & Cantina is 6 out of 10 based on 25 reviews.
On the Border Mexican Grill & Cantina Orange Discounts
On the Border Mexican Grill & Cantina Orange Deals
On the Border Mexican Grill & Cantina Orange Holiday Deals
On the Border Mexican Grill & Cantina Orange Christmas Specials
Written By: Stephanie A.
Edited By: Steven V.
Mexican in Orange Near On the Border Mexican Grill & Cantina
See all Hotels Discounts in Orange
See all Shopping Deals in Orange
See all Theater Discounts in Orange
See all Spa Deals in Orange
See all Event Deals in Orange
American Restaurant Coupons in Orange
Chinese Restaurant Coupons in Orange
French Restaurant Coupons in Orange
Indian Restaurant Coupons in Orange
Italian Restaurant Coupons in Orange
Japanese Restaurant Coupons in Orange
Mexican Restaurant Coupons in Orange
Pizza Restaurant Coupons in Orange
Vegetarian Restaurant Coupons in Orange | cc/2020-05/en_middle_0078.json.gz/line1187 |
__label__wiki | 0.567562 | 0.567562 | Tag Archives: Married life
by Marcus Ampe | 2015/10/08 · 8:28 am
72 Synod Fathers on the topic “The vocation and mission of the family in the Church and the contemporary world”
World Youth Day is a popular Catholic faith themed international youth event initiated by Pope John Paul II but those very enthusiast youngsters do not always come out very happy families and often meet lots of friends from new assembled families (Photo credit: Wikipedia)
72 Synod Fathers got together at the Vatican to look after family life, debating at the Synod on Marriage and Family from October the 4th until the 25th.
The Vatican spokesman Fr. Federico Lombardi said this synod wants to give more space to the various language-specific groups (circuli minores) and under the new proceedings, there will be a commission of ten Synod Fathers nominated by the Pope, who will follow the work of the assembly.
Pope Francis I in his brief speech underlined that this Synod is to develop in continuity with last year’s Extraordinary Synod. He said that
“three documents from the last Synod are to be considered official: the opening speech, the concluding speech and the final relatio synodi.”
The clergy has a year time to go locally in debate and to come to some conclusions which should be further discussed in Rome. Additions were made to this concluding document between the 2014 assembly and the start of this October gathering, with contributions received by the Synod secretariat, which then turned it into the Instrumentum laboris – the Ordinary Synod’s working document – “with the Pope’s participation”.
Catholics and those interested in the Catholic Faith should know that
“Catholic doctrine on marriage has not been touched, no one called it into question in this assembly or in the Extraordinary assembly. It has been preserved in its integrity”.
the Vatican spokesman Fr. Federico Lombardi said, adding,
“We must not let ourselves be conditioned or limit ourselves seeing the question of communion for remarried divorcees as the only problem”. Instead, “the Instrumentum laboris requires a broader outlook.”
When the cardinals a few years ago choose a cardinal coming from a free-thinking religious society known to question Vatican directives and church teachings, they probably had not expected the new elected pope would become so popular and so forthcoming to the general public; Question is now how much does this pope wants to be open to the changed society where some governments even to introduce a third sex, taking into account those who have a dual sex or have changed their sex and want to have normal relationships as well. As the first Jesuit pontiff, Pope Francis I is also working in response to a 1990 call by Pope John Paul II in his Ex corde Ecclesiae (From the Heart of the Church), for closer ties between the church and Catholic colleges.
Those who hoped that Ex corde would usher in rapid change have also been disappointed. Many advocates maintain that the bishops have never fully enforced its guidelines. Catholic colleges still remain highly autonomous and do more or less what they want. When I talk to American Catholics outside academe, most draw a blank when Ex corde is mentioned. When Pope Benedict XVI addressed Catholic educators during his visit to the United States in April 2008, he made no direct reference to the Apostolic Constitution. {Catholic Colleges 20 Years After ‘Ex Corde’}
“Catholic identity” and “faith and reason” since that call have been circulating, bolstered by Pope John Paul II’s 1998 encyclical Fides et Ratio (Faith and Reason), which was widely discussed on Catholic campuses worldwide. But the Catholic Church did not seem to come to reason and had even more difficulties to address other gender feelings than in the 1960ies. The clergy came to exclude more and more people. Also having difficult family issues made even more Catholics shunned by their church. The exclusion of many parishioners made the churches run faster empty. Feeling the water at their mouth, nearly drowning some Catholic church fathers are aware that there must come an end to exclusionary language and a strong emphasis on embracing reality as it is.
“We should not be afraid of new and complex situations.”
says Basilian Father Thomas Rosica, the Vatican’s English speaking language spokesperson,who was speaking at the briefing of the Synod’s second day in the Vatican press office, with its director, Father Federico Lombardi, Italian Archbishop Claudio Celli, and Canadian Cardinal Paul-Andre Durocher.
Fr. Rosica Speaks on Synod Delegates, Fathers Discussing the Need to Embrace People Where They Are
The importance of changing language used to address certain difficult situations, Fr. Rosica said, was highlighted.
“The language must be renewed,”
he said, noting how this is especially appropriate and linked to the Extraordinary Jubilee Year of Mercy which Pope Francis has declared, December 8, 2014 – November 20, 2015.
“The Jubilee of Mercy requires a language of mercy,”
he stated. Father Rosica underscored how language ought to always be inclusive, rather than exclusive, particularly for homosexuals.
“In particular, when speaking about homosexuals or gay persons,”
“we recognize them for who they are: They are our sons, our daughters, and brothers, sisters, neighbours and colleagues.”
Not only the Catholic Church is struggling with that subject of feelings people can have for people of the same sex. When you look at the net in Christian circles the gay matter may be a seriously discussed parcours where some so called Christians may use a terrible language or send horrible messages to those who are having other preferences than the mainstream people in our society.
Healthy seriously sane people are sensible enough to approach this matter with much caution and are aware that it is much more complicated than it looks at first sight. Most religious organisations from whatever denomination do know that it is not easy at all to convince people of the value of God’s Word. They all know also how difficult it is nowadays to build up an ecclesia or church and to have that church grow. It might well be that it looks like we are living in a marvellous world, people over here are confronted with loads of problems and often need social, psychological and communal help. There is a huge need today for pastoral work. Also the Catholic Church knows that a better approach is needed for couples living together, to welcome and help them move forward toward a fulfilling married life, one which says:
“Look, God loves you as and where you are, but God doesn’t want you to stay there. He wants you to go further.”
A common suggestion of the delegates, Father Thomas Rosica noted, was not only for greater preparation before entering into marriage, but to continue into its early stages to help couples adapt to their lives as spouses.
Moreover, the synod fathers and delegates spoke about the role and treatment of the elderly, especially for their importance in transmitting the faith and values with in families.
There are Americans who think that dissident Catholic pressure groups — aided by the liberal media — are feverishly working to dismantle vital Church teaching on marriage and family at this Synod on the Family in Rome. The American TFP was joining forces with over 20 more pro-family groups around the world to collect as many signatures as possible before this Synod started. They want others to believe that
they are bombarding the Holy Father and the Synod Fathers right now with messages of revolt against traditional moral values as they lamor for “change, change, change” inside the Church. {Filial Petition to Pope Francis}
Find also:
Two synods and life in the church community
A synod not leading to doctrinal changes because it is about pastoral attention
Different assessment criteria and a new language to be found for communicating the faith
People of 2013
Liberation, salvation and the Latin American voice entering the Vatican
Slum pope joins Catholic jamboree on famous beach of Copacabana
Marriage covenant
Marriage vows
Same-sex marriage or Gay marriage
A philosophical error which rejects the body as part of the human person
Helping against or causing more homophobia
A so called man of God say Christ was wrong about marriage
Antichrist and The Most Hated Family in America in crisis
Westboro Baptist Church and Catholic Truth against Nelson Mandela
Tony Campolo Calls for Full Inclusion of LGBT Into the Church
Mixed marriages
Bible Guidelines for a happy marriage
That We May One is a book for married couples about awesome marriages
Manifests for believers #1 Sex abuse setting fire to the powder
Manifests for believers #2 Changing celibacy requirement
What’s church for, anyway?
Liberal and evangelical Christians
Catholic Colleges 20 Years After ‘Ex Corde’
Celibacy and the Priesthood
A Brief History of Celibacy in the Catholic Church
Reflections on Clerical Family Life
Being a Catholic Priest—and Married
Priest gives up his vocation, not his religion, for love
Vatican Dismisses Official for Declaring He’s Gay and Has a Partner on Eve of Synod
Tracing the Glorious Origins of Priestly Celibacy
The Wiles and Guiles of a Campaign Against Priestly Celibacy
The World-Wide Scandal of Christian Child Abuse Which The Child Welfare Charities Kept Hidden From Your Gaze
Sex-abuse crisis is a watershed in the Roman Catholic Church’s history in America
Paedophile Priests Scandal Rocks The Church of Rome
Child Abuse in the Catholic Church
Bishop(ess) Proposes Church Remove all Christian Symbols… to Create Space for Muslims
How Fundamentalist Prohibitions Cause Needless Suffering and Pain
As an Unbeliever, Is it Possible to Have Christian Family and Friends?
Right Wing Family Values and the World’s Greatest Freak Show
For Victims of Sexual Abuse, Pope’s Visit Recalls Childhood Trauma
5 Ways Pope Francis Has Recently Caused Conservative Christians’ Heads to Explode
The communion rail
Disenfranchised Catholics Discuss Pope Francis With Thomas Roberts
After the Pope Francis and Castro love fest in Cuba, John Paul II must be turning in his grave
Donna Crilley Farrell was there with Pope John Paul II and is running the show for Pope Francis
GRETA TALK: Former Speaker Newt Gingrich on the “Electrifying, Complicated” Pope Francis
Great analysis of the “spin” of last year’s Synod on the Family. Fr. Z rants.
Pope plans to duck dissidents in Cuba, spawning criticism
Pope makes surprise visit to Little Sisters of the Poor as “sign of support” against Obama mandate…
Filed under Headlines - News, Lifestyle, Religious affairs, Social affairs
Tagged as 1960s, Catholic doctrine, Christian church, Christians, Church community, Church fathers, Church membership, Church sacraments, Churchgoers, Claudio Celli, Couples, Divorcees, Ecclesia, Ex corde Ecclesiae (From the Heart of the Church), Extraordinary Synod, Faith, Family, Family life, Federico Lombardi, Fides et Ratio (Faith and Reason), Gay people, Gender problems, Homosexuality, Homosexuals, Human society, Instrumentum laboris, Jesuits, Jubilee of Mercy, Making church, Marriage, Married life, Pastoral work, Paul-Andre Durocher, Pope Benedict XVI, Pope Francis I, Pope John Paul II, Relatio synodi, Religious organisations, Religious society, Same sex couples, Synod of Bishops, Synod on Marriage and Family, Thomas Rosica, Traditional moral values, Values, Vatican, Vatican directives | cc/2020-05/en_middle_0078.json.gz/line1188 |
__label__wiki | 0.916481 | 0.916481 | Mizzou Logo
Panhellenic Association
FSL on Engage
Community Conduct History
Explore Fraternities and Sororities
Fraternity & Sorority Life is composed of four governing councils. Together they build a community of outstanding individuals who lead in every corner of campus.
Discover Which Council Best Suits You
Explore the dozens of fraternities and sororities that make their home at Mizzou.
Benefits of Fraternity & Sorority Life
When you join a chapter, you get:
Supportive friends
Scholastic resources
Leadership and career opportunities
Opportunities to take part in service projects and philanthropic fundraising
Access to a national network of alumni
2019 marks the 150th year of fraternity and sorority life on the Mizzou campus. It’s also marks:
35 years of Mizzou FSL partnership with the Special Olympics.
30 years of partnership with the Red Cross during Greek Week.
20 years that Alpha Phi Gamma National Sorority Inc. Eta Chapter, the first and only Asian-interest sorority in Missouri, has been at Mizzou.
More than half of all fraternity and sorority members at Mizzou made the dean’s list in spring 2018. The average GPA for fraternity and sorority members at Mizzou traditionally exceeds 3.0. See our community’s grades and statistics.
Service is an essential value at Mizzou. Our fraternities and sororities do a lot of good. Each year, chapters raise more than $500,000 in charitable donations.
Tweets by Mizzou FSL
FSL Review
Concerned About a Student?
2500 MU Student Center
Email: fsl@missouri.edu
© 2020 — Curators of the University of Missouri. All rights reserved. DMCA and other copyright information. An equal opportunity/access/affirmative action/pro-disabled and veteran employer. | cc/2020-05/en_middle_0078.json.gz/line1189 |
__label__cc | 0.643287 | 0.356713 | SCHOOL FUNDRAISING EXPERTS
Specialists in fundraising for schools
Funding Solutions for Education are a small agency who are dedicated and passionate about helping schools raise additional funds. The current budget cuts throughout the education sector make it challenging for school leaders which is why we offer free marketing materials and fundraising to schools throughout the UK.
We've been pretty good at what we do for over 15 years' and in that time we've worked with over 600 schools to raise them additional funds to spend on everything from Classroom ipads and Computer Suites through to School Trips - as well as providing free marketing folders that give the school a professional edge.
If you would like to find out more about our free fundraising projects, then give the team a call on 01933 303520 - we're a friendly bunch and are always keen to help as many schools as we can!
SCHOOLS WE HAVE WORKED WITH
JUST SOME OF OUR HAPPY CLIENTS
The Bourne Academy, Dorset
"I just wanted to say an enormous thank you for the cheque for The Bourne Academy. We are so grateful to you for suggesting the folder project to us and for working so hard on our behalf to make the folders so beautifully, with great advertising and funds left over to plough into the school at the end of it too. It is such a great and appealing service. Your support to the Academy is so very much appreciated and we very much look forward to working with you again in the future."
Ecclesfield School, Sheffield
"We used FSE to produce document wallets for our school. We were initially apprehensive as it seemed to good to be true, however it isn't. FSE secured us over £2,250 in additional funding and 3,000 free professionally designed document wallets. Maximum return for little effort. We would highly recommend using FSE."
Bower Park Academy, Essex
“We have used FSE to receive free Marketing Folders. We were also given a cheque for £1,500 that will support two of our students on a Future Leaders Course in New York, in the New Year. The folders are a great way to communicate with Parents and the local community. The professionalism and glossy folders add a sophistication to our Academy. A great project, for little effort and well worth giving it a go!"
Our Lady's Convent High School, London
"WOW! Just wanted to say a HUGE thank you to everyone involved in our beautiful folders! It was a joy to work with your company and everyone was so helpful. Thank you again for all the hard work that’s gone into the folders, I love them!"
WE FUNDRAISE FOR SCHOOLS ACROSS THE COUNTRY
THE STATS SO FAR
Years We've Been Fundraising
Schools We've Worked With
The Amount We Aim To Raise Each School (£)
How Many Free Folders Each School Receives | cc/2020-05/en_middle_0078.json.gz/line1191 |
__label__cc | 0.715047 | 0.284953 | Sales Wit And Wisdom
By Furniture World Magazine on 6/9/2004
Don't make 'em drink; make 'em thirsty... Don't sell 'em and empty box... Don't fight 'em; join 'em... Make 'em glad, not mad or scared.
Half a century has passed since Elmer Wheeler, called America's greatest salesman in his day, came up with what came to be known as the Wheeler Points of Selling. In this article I'd like to revisit four of those points and add a fifth from Michael Le Boeuf's book, "How to Win Customers and Keep Them for Life."
The first of the Wheeler Points is "Don't make 'em drink; make 'em thirsty." The thinking behind that directive is that customers will "drink" only when they are thirsty enough.
There is an interesting analogy to this I'd like to offer based on the practice of some African tribesman whenever they first capture a monkey by an ingenious method. They place some nuts in the hollow of a tree to entice the monkey to reach in with its paw to extract the bait. The opening to the hollow is large enough for the monkey to insert its open paw but not large enough for the animal to extract its paw once it is clutching the nuts. The monkey could easily let go of the bait and pull its hand out, but its appetite for the nuts prevents it from doing so. That allows the tribesman to feed it a heavy dose of highly salted food. After several days of this they release the monkey whose avid thirst forces it to go in search of water. By following the monkey, the tribesmen find out where there is water. They don't make the monkey drink; they make it thirsty.
How can salespeople make their customers thirsty? By first finding out what their customers want by asking open ended questions like, "Mind telling me a little about the room you'll be putting your new sofa and love seat in?" or, "Mind telling me what's wrong with your mattress?" Second, by listening carefully without ever interrupting until you feel you have a clear understanding of the customer's concerns so that you can offer solutions or opportunities. Remember this truism: the more you listen and get your customers to talk, the smarter you'll appear to them. Third, when you listen to your customer's concerns, listen for their desires, a word sparks. No wonder some of those veteran salespeople were fond of the jingle, "Fan the fires of their desires and you'll not fail to make the sale." An excellent way to fan those fires is to demonstrate your products keeping in mind the principle of "Not shown when told remains unsold." Fourth, find out your customer's fears, then confirm those fears as needs with a closed probe. For example, if the customer expresses a fear about ending up with a fabric that won't wear adequately, you might say, "What I hear you saying is you insist on being sure that this fabric will last long before you invest in this sofa. Is that it?" As you probe for customer fears, keep in mind that the customers' fear of loss is greater than their desire for gain. You simply cannot get customers to act on their desire for gain until you have put to rest their fear about loss. Fifth, put your customer in the spotlight. Make 'em big; make yourself little. Customers do not care how much you care about them. Sixth, keep in mind the four basic human needs: the need to feel important, the need to feel appreciated, the need to feel liked, and the need to follow the path of the least resistance which Elmer Wheeler expressed as the need to save steps. The best, the easiest, and the surest way to honor your customer's four basic needs is by acknowledging what they tell you. You acknowledge by proper eye contact, by attentive listening, and by making acknowledging statements. These are psychological bridges you build between yourself and the customer, which are referred to as rapport, empathy, bonding, and relationships. Recently a salesperson shared with me an example of her acknowledging. She told me how her customer, while in her store, suddenly exclaimed; "Take a look at all this furniture. It just makes me drool!" The salesperson took full advantage of that statement by acknowledging it with a touch of humor: "It is great furniture, isn't it. What you just said about the furniture making you drool reminds me of why we all need to have our upholstery treated to protect against stains." Not only did she go on to sell the furniture; she also sold the fabric protection.
The second of the Wheeler Points of Selling is. "Don't sell'em an empty box." I'd like to apply this Wheeler Point to the technique of preventive selling. It is designed to help prevent overselling and underselling one's products, each of which cause customers to end up with an empty box. The way not to fall into either trap is to match product features and store services to customer needs. I call that BENEFEATURING, a term I coined to describe the supporting of customer needs with related benefits. Benefeaturing should be practiced not only during the sale but after it. Too often salespeople promise customers a delivery date their company can't possibly meet. As a result, customers end up feeling duped. The way to prevent that from happening is to under promise and over deliver.
The third Wheeler Point of Selling is "Get in step with 'em" or "Don't fight 'em; join 'em." This third point can be especially helpful in handling customer objections and not trying to overcome them. Too many selling systems continue to discuss "overcoming" objections. "Overcome" suggests an adversarial situation. How should salespeople handle objections? By looking upon all objections as implied needs. Whenever the customer says, "This is more than I wanted to spend," don't begin to argue with the customer with a 'but' statement. ("But it's well worth the price, Sir"). Instead, win agreement. You might say something like the following: "What I really hear you saying is that you have no intention of paying more than you have to." Nod as you tell the customer that. You'll find that your customer will generally nod along with you, a sign that you have won agreement. Then go on to review how your product's benefits provide your customer with a value that exceeds the price you are asking.
The fourth Wheeler Point of Selling is, "Make 'em part of the act." If Wheeler were alive today, he'd probably fit his fourth point into the idea of relationship selling. Relationship selling goes beyond the fuzzy cuddling up to customers and into involving them in the selling process. One example of this is a formula I developed for starting off a bedding sale. After the initial greeting, finding out who the sleepset is for and the size, the salesperson might say: "I know bedding inside out, but I don't know your comfort level. With your cooperation we'll find that out easily enough." One woman customer I told that to immediately answered: "I know what you mean. It's your knowledge and my back." The truth of what she said went further than she intended, for I believe all of selling involves "their backs" and our knowledge. "Their backs" symbolize their needs; our knowledge stands for whatever information they need from us to make the best buying decision, as John Lawhon puts it. We do this by involving customers in the selling process. One salesman I knew did that from the outset of the sale. Once he had greeted the customer, he didn't ask what they were looking for, instead he asked, "What are we looking for today?" nor did he ask the feeble "How can I help you?" He knew better. He'd let the customer know up front that it was he who needed their help. "Would you mind helping me out a little?" Then he'd ask an open probe or two to uncover their "secrets" as he called them, or "the need behind the need" as Learning International, Inc. refers to this. Little gets customers to reveal those secrets as much as involving them in the sale. Have them lie on your mattresses, sit in your chairs, feel the hand of a fabric, sketch the basic dimensions of a room, touch a smoothly finished surface, smell the fragrance of your tanned leathers, listen to the silence of a recliner's mechanism or to the marvelous sound of its ratchet system. Involve, involve, involve. That's how learning takes place and it's also how sales take place.
I'd like to add a fifth point of selling which I feel may well serve as a summary of Wheeler Points. It's the directive from Michael Le Boeuf's book, "How to Win Customers and Keep Them for Life": "Make 'em glad, not mad, or scared. Le Boeuf's directive is a consummate formula for successful selling. Note the insets which list "Things that make 'em glad" and "Things that make 'em mad, sad, or scared:
Revisit with Elmer Wheeler as often as you can. His Wheeler Points can help you to consistently end up with satisfied customers,. That is... customers who are glad.
Corporate trainer, educator and speaker Dr. Peter A. Marino has written extensively on sales training techniques and their furniture retailing applications. Questions on any aspect of sales education can be sent to FURNITURE WORLD at pmarino@furninfo.com.
Furniture World is the oldest, continuously published trade publication in the United States. It is published for the benefit of furniture retail executives. Print circulation of 20,000 is directed primarily to furniture retailers in the US and Canada. In 1970, the magazine established and endowed the Bernice Bienenstock Furniture Library (www.furniturelibrary.com) in High Point, NC, now a public foundation containing more than 5,000 books on furniture and design dating from 1620. For more information contact editor@furninfo.com. | cc/2020-05/en_middle_0078.json.gz/line1193 |
__label__cc | 0.626965 | 0.373035 | Elsewhere in Asia/Pacific: Cooking & Baking
Regional Cuisine
India, China, Japan, & Asia/Pacific
Elsewhere in Asia/Pacific
Mongolia. Seriously.
By Ellen Shapiro, September 11, 2003 in Elsewhere in Asia/Pacific: Cooking & Baking
Ellen Shapiro
eGullet Society staff emeritus
To read all the parts of this series please click: Part I; Part II; Part III; Part IV; Part V; Part VI; Part VII.
"You're going where? And what exactly is it that you'll be doing there?"
"Is that inner or outer you're going to?"
"Do they have Mongolian barbecue there?"
"Will you sleep in a yurt?"
This was the standard litany directed at me regarding my impending departure for Mongolia, and when you plan a trip to Mongolia your departure impends for a long time -- you don't get there by subway. I didn't have any pat answers to these frequently asked questions, and still don't. I had been interested in the country since I was a young child, the people always seemed exotic and the land so far away, I knew it was the seat of the largest empire the world has ever seen (past or present), the people have lived through the worst of the rise and fall of communism and endured endless hardship and hostile neighbors, and the nomadic lifestyle and the idea of living in a ger (don't use the word yurt; it's the Russian term and is now in extreme disfavor) fascinated me.
"Oh, I've always been interested in Mongolia; it seems like a really cool place," is the best I could muster.
If there are levels of off-the-beaten-path destinations ranked on a scale of 1-10, Mongolia is surely a 10, or a 9 if you anchor the scale with the moon. On account of a refreshing, and also somewhat terrifying at times, lack of tourism infrastructure, my visit to Mongolia was a comedy of errors -- a very long comedy, kind of like the length of all 171 episodes of Everybody Loves Raymond shown all at once, five times over. There were lots of high points, and there were so many low points I lost count sometime on the first or second day -- so much went wrong so often, it became an issue of keeping track of the greatest hits rather than letting any given incident become too bothersome. Storytelling value was often the light at the end of the tunnel.
Cue Lawrence of Arabia music, please.
Well, maybe it's not quite the desert in the Ansel Adams photos or the David Lean movies. It's a real desert. Mongolia is not only culturally rich, but the landscape and scenery are truly like nothing I had ever seen before. It certainly doesn't feel like planet Earth: it's a seemingly untouched and never-ending series of vast open spaces with nothing around for miles -- that's nothing as in no people, no buildings, no trees, just occasional patches of desert grass. The sky seems so close to the horizon that it always feels within reach. The sand dunes in the Gobi Desert are a mighty challenge -- none of us reached the top. The roads, if you can call them that, are barely discernible dirt paths running through the expanses -- the only paved roads we traveled were in Ulaan Baatar, the capital city, and along the route to one of the most visited tourist attractions, the Erdene Zu monastery about 200 kilometers outside of the city. In most cases you can follow the tracks of the jeeps that have come before or just as easily pick your own.
We were greeted at the airport by our guide, which was the last thing to go completely right for the next couple of weeks. Actually, there had already been mechanical trouble on one leg of the plane flight (no fault of the Mongolians -- this was in Japan) and our guide turned out not to be a guide. She was a translator by training (actually, she was an English teacher at the local middle school but it's Mongolia -- let's not get too technical), not a guide, and though she spoke English she didn't know all that much about our planned destinations.
Nor did she know what those destinations were supposed to be. Our first tipoff was that there was an old (really old, like the kind of old you see in Cuba old) Nissan (or was it a Datsun) sedan waiting for us -- hardly the piece of equipment necessary for a week in the Gobi dessert. By the time we arrived at the restaurant where we were to have our orientation meeting thirty minutes later -- the restaurant was bizarrely named "California" -- it became clear to us that somewhere along the way we had fallen through the cracks and our guide was operating from an early draft of our itinerary (one we had rejected and not the actual itinerary we had approved). And this was the serious guide company -- the one personally recommended to us by a National Geographic journalist who had been to Mongolia many times over the past 3 years and had surely covered every inch of ground we were to cover -- and then some.
Our translator/guide, on the one hand, had us scheduled to spend 5 days in the aforementioned Erdene Zu monastery and its environs, something that might take an eager tourist one afternoon at most -- unless you have a very specific interest in this particular Buddhist site, spending 5 days there would be like going to Washington, DC, for a week and spending 5 days at the Lincoln Memorial.
We, on the other hand, had us scheduled for a week in the Gobi Desert, traveling by jeep.
My dear friend and traveling companion -- my friend J, with whom I have in the past spent 2-1/2 weeks in a shared tent in Nepal enduring days of pouring rain and blood-sucking leeches -- was already starting to cough like a whooping crane (does SARS incubate so quickly, we wondered?) and in her eagerness to embrace the country she got us trapped into eating Mongolian food for lunch at the hotel, I mean restaurant, California.
Innocently J asked our guide and short-lived driver: "Oh, what are you having for lunch?" We learned very quickly that for 99% of Mongolians the answer to that question will always be mutton. In an instant, all my dreams of culinary diversity (not to mention my hopes that we would encounter unusual Mongolian interpretations of pizzas, pastas, and hamburgers) were cast aside as I was shamed into ordering one of the four Mongolian dishes on the menu.
J chose the horhog: fried mutton dumplings -- approximately three times the size of standard Chinese dumplings -- with chunks of mutton, mutton fat, mutton gristle, mutton skin, and maybe a little mutton fur, sealed inside. And, I noticed, she was having difficulty swallowing -- I took that to be a very bad sign. I, on the other hand, ordered the very authentic lamb cooked in a red wine reduction. Well, I actually never saw even so much as a trace of this kind of cuisine out in the countryside, but it was written right there in black and white on the menu, "Mongolian Food," so I ate every bite (except for that which I shared with J).
Over the course of lunch we told our translator/guide about the itinerary we were supposed to have. She chatted with the driver in Mongolian and then turned back to us. Clearly we'd have to get another car and driver if we were going to go to the Gobi. And she'd have to call the company's owner's wife and confer with her (the owner was away, guiding a larger group) about these changes. Plus we would have to change our departure date for the western part of Mongolia and that entailed changing plane tickets during the high tourist season. Throughout lunch we gently pressed our agenda and our translator/guide slowly realized the plan had to be scrapped and that we intended to pursue the itinerary we had agreed to with the owner of the company. This all sounds like pretty basic consumerism to those of us who live in the parts of the world where eGullet members tend to dwell, but rest assured by the standards of Mongolian commerce we were radicals.
Ulaan Baatar (which, if you're in the know, you call "UB") is a city -- complete with some very lovely mid-century Soviet labor-camp-style architecture -- but people still ride horses right alongside the cars. A Mongolian may very well ride a horse to the minilab for one-hour photo processing.
We went to the bus station after lunch. That's where all the jeeps and drivers hang out, waiting to be hired by the likes of us. After much discussion and gesticulation (J and I remained in the Nissan) a driver and his Russian jeep were hired. Our bags were transferred from the Nissan to the jeep, we bade farewell to our old driver (little did we know how dearly we'd miss him), and we set off with our new driver and vehicle. After making countless stops in preparation for our newly configured trip (we needed warm blankets in case we had to sleep out, we had to buy food and water and snacks for the same reason, and we had to get some Togrog -- Mongolian money), we got on the road. And what a road it was. There were so many potholes that we thought, surely, the dirt roads would have to be better. Oh, we were so very wrong.
We arrived at our ger camp at about 10:00 that night (not that it made any difference what time it was, given that we had just flown halfway around the world) and before we knew it we were sharing a ger with our guide and driver. Um, what?
The week in the Gobi gave us a taste of Mongolian culture but because we were traveling the closest thing Mongolia has to a well worn tourist road the locals weren't always overly eager to invite us into their gers. Bear in mind that tourism in Mongolia only began when the iron curtain fell so it's still a very new industry, and it hasn't grown much at that. It no doubt helped that we were a small group, and on the occasions when we stopped at the roadside ger "canteens" we paid for our food anyway so we were always welcome there.
Because we stayed in ger camps (essentially a collection of traditional gers set up for travelers, with beds and a stove in the center of each, a bathroom, and a ger dining room) our breakfast was typically bread, butter, jam, one egg (usually fried), and tea. Some of the other groups, who had more organized tours, had a much more extensive breakfast spread including sliced mutton, sliced yellow cheese (in Mongolia they identify and differentiate cheeses by color and age), tea, coffee, and some pastry type things -- none of which, excluding the tea and bread, are actual Mongolian breakfast foods.
Lunch was always some form of mutton. Whether it was "vegetable soup" (with mutton and hunks of mutton fat and assorted other sheep bits and pieces) or horhog (with the same, uh, inclusions) or mutton stew (which also regularly included the sheep's fur as well and sometimes included some of the grass and dirt upon which the sheep were grazing before they became boiled mutton) -- one thing you could bet the family herd on: mutton was always on the menu.
Despite my desire for immersion in the local culinary culture, I became pretty savvy about eating around the mutton. The soup part of the soup was usually good, so when presented with no other option I ate the broth and the noodles and tried to fish out any slivers of vegetables and choice pieces of actual mutton meat, leaving behind "the parts," which I'm happy to report, someone certainly ate after our departure . In "restaurants" (which were often closed, so it would take some running around the gers to find someone to open up shop for us) we were often able to get eggs and a cabbage salad of sorts. J ate lots of French-fries and rice. Another thing we learned in the course of our early Mongolian culinary educations was that any and all vegetables seemed to be mixed with mayonnaise, which to me, when I'm craving fresh veggies, altogether ruins the experience.
Did I mention that no one has refrigeration? They're nomads. They live in the middle of Mongolia, which has earned its status as a metaphor for "nowhere." Of course they lack electricity. They mostly store their meat on the roof of the ger.
The Erdene Zu monastery was a highlight, and I can hardly convey what an unusual treat it is to be able to take photographs inside a major Buddhist site. I've been to so many, and in all but a few cases I have only the memories. But this time I was able to get some photographs as well.
Here I am modeling some of the latest Mongolian fashions.
My favorite food items in the Gobi were the airag (fermented mare's milk), the milk tea with the floating yogurt "skin" added in lieu of cream, the white cheese (more on that later), and, hands down, the very good yogurt (notwithstanding the hair and fur that was always an integral part of each of these delicacies). Everyone was milking the herds (primarily sheep, goats, camels, and horses) to make dairy products to eat day-to-day and to store for winter. It was difficult to find the yogurt in the Gobi, because that's more of a Kazakh food, but I knew I would have more of it in the western part of the country (the second week of the trip), which is primarily inhabited by Kazakhs.
Here's some butter being stored in a sheep's stomach.
Moving right along . . . a sampling of the dairy-oriented lifestyle of the Gobi:
At the end of the first week we had amassed plenty of memories. It was a week of 10-12 hour days spent driving around the Gobi Desert in a jeep on crazy bumpy paths. I often hit my head on the roof on account of the velocity at which our driver progressed and the quality of the terrain we were traversing. We had no set itinerary. Our guide had never been to the Gobi Desert and knew less about it than we knew from reading the guidebook we got at Barnes & Noble in New York. Our driver turned out to be relatively psychotic -- we were told later by our guide that he had been persistent about asking her to have sex with him from day one, even though they were perfect strangers, both married. We had made a pilgrimage to an "ice cavern" where the ice had already melted. Apparently the ice lasts until July; we were there the third week of August and while there were indeed still some bits of ice, it certainly didn't seem worth the many hundreds of kilometers and four or more additional hours that we spent in the jeep getting to this famous destination. I think the driver just wanted a break -- it was his idea that we go there. J, meanwhile, had progressed to what sounded like bronchitis and perhaps even pneumonia so all of this was less than amusing at the time. But our only options were to laugh or cry -- and we chose laughter as often as possible.
I can't decide which was better: the trip to the ice cavern with no ice, or the trip to the place where we were told by our driver via our translator/guide that we could see dinosaur bones but which upon further questioning (after we drove there and walked around in the desert trying to determine which thing could possibly be the dinosaur bones that were left behind -- and for that matter, why exactly didn't they take them if they found them?) turned out to be a place where some dinosaur bones had been found long ago. But most likely the best bit of tourism had to be the time when, despite all of our protestations and urgings, our driver decided to drive through what appeared to be a lake (it was the rainy season but we had been fortunate to miss most of it) because he said he wanted to follow the "road" rather than go around where there was none. Surprise! We got stuck. And there was no one around. We were not just figuratively in the Gobi Desert. We were ACTUALLY IN THE GOBI FUCKING DESERT. It's not like we could dial up AAA (or MAA) on the cell phone and ask for someone to come pull us out and maybe bring us a few TripTiks. In fact, even if we could have, they sure as hell wouldn't have been so stupid as to drive in there to fish us out because they would have gotten stuck too. I guess that incident would have to claim the crown as the hi/low of the week in the Gobi. And, on top of it all, that night we slept at a gas station, on the floor -- after we ran out of gas, that is.
I don't say this very often (I doubt anybody does), but we were pretty eager to return to Ulaan Baatar. By that time it seemed like an oasis in the middle of the dessert. A Soviet-style, bleak oasis, but when you need an oasis you take whatever oasis you can get.
www.byellen.com
Jinmyo
Location:Ottawa, ON, Canada
An excellent account by an excellent Ellen.
Wonderful photographs.
any and all vegetables seemed to be mixed with mayonnaise
Whaaaa?
"I've caught you Richardson, stuffing spit-backs in your vile maw. 'Let tomorrow's omelets go empty,' is that your fucking attitude?" -E. B. Farnum
"Behold, I teach you the ubermunch. The ubermunch is the meaning of the earth. Let your will say: the ubermunch shall be the meaning of the earth!" -Fritzy N.
"It's okay to like celery more than yogurt, but it's not okay to think that batter is yogurt."
Serving fine and fresh gratuitous comments since Oct 5 2001, 09:53 PM
Jason Perlow
Location:FL
Wow, uh, wow.
But did you get to play any Golf?
Co-Founder, The Society for Culinary Arts & Letters
offthebroiler.com - Food Blog | View my food photos on Instagram
No but they play billiards outdoors.
But I'm getting ahead of myself. That's for Part II.
maggiethecat
Location:Chicago Burbs -- West
Ellen: You sure put the Adventure in "Adventures in Eating!" This is a wonderful piece.
I'm wondering if the veg/mayo combo is a kind of post-Soviet Salade Russe?
Edited to add: I hope you bought the hat!
Edited September 11, 2003 by maggiethecat (log)
Margaret McArthur
"Take it easy, but take it."
A sensational tennis blog from freakyfrites
margaretmcarthur.com
Suzanne F
legacy participant
Wow. When the book comes out, can we get autographed copies?
And whom do you want to play you in the movie? I'm thinking either Julianne Moore or Tilda Swinton.
Edited September 11, 2003 by Suzanne F (log)
Julianne Moore or Tilda Swinton.
Either would be excellent.
Who do we cast as Steven?
Gary Coleman?
Steven A. Shaw aka "Fat Guy"
Co-founder, Society for Culinary Arts & Letters, sshaw@egstaff.org
Proud signatory to the eG Ethics code
Director, New Media Studies, International Culinary Center (take my food-blogging course)
Ellen what an amazing experience. Your pictures really bring the post to life. It seems to be an amazing place -- lost in time somewhere. Inspite of some of the misadventures ( ) you had, it seems like it must have been a fascinating trip. I am definately looking forward to reading more. This is the real way to travel. I feel sometimes that my hubby and I travel way to organized and too touristy -- this is really the only way to experience a different country.. Excellent piece.
The dumplings that you have shown in the picture -- what are they-- they remind me of an Indian/Nepali dish called MOMOS..
I was fascinated with the picture of the butter in the sheep's stomach. Now there is a shot you dont see everyday!
Also not to be to personal, but what did you do for showers and bathrooms?
The dumplings that you have shown in the picture -- what are they-- they remind me of an Indian/Nepali dish called MOMOS.
I'm going to give you one guess what was in them!
And yes, they're a bit momo-like in appearance (you know our bulldog is named Momo, right?), but then again they're similar to a lot of different types of rustic dumplings you'd find all over Asia.
what did you do for showers and bathrooms?
In a lot of cases, the answer to that is, "What showers? What bathrooms?" For much of the latter part of the trip, I used the same bathroom the cattle used, aka the great outdoors. It's not like there's any lack of space!
But in the Ger camps and the city, bathrooms were pretty normal -- a mix of Western and Eastern toilets -- and showers were plentiful (though usually lukewarm and sometimes cold).
Location:Raleigh, North Carolina
Oh my god! This is the best piece I've read on eGullet in some time!! Yeah, Peter Mayle can have Provence, Frances Mayes has Tuscany, and you have Mongolia. Fantastic writing and photos. Can't wait to see more, Ellen. And I'm glad you're home safe and sound. Makes Nepal seem like a walk in Central Park, eh?
Dean McCord
VarmintBites
jhlurie
Kick-ass hat, El!
Great piece. I predict Mongolia will be the next big vacation spot!
Visit Mongolia 2003 site!!! (warning: REALLY slow site)
Some great quotes...
The Cabinet of ministers has officially announced at its regular session the 2003 as "Visit Mongolia Year" and has approved the staff of the National Committee on the organization for this year.
The Government proclaimed the Year of 2003 as the Year of "Welcome To Mongolia". In connection with this, it has started to issue a new designed visa to foreigners who intend to travel Mongolia.
So it's BOTH "Visit Mongolia year" AND "Welcome to Mongolia Year"? Wow! I feel doubly welcome!
The airliner "BOEING 737" has been rented specially for the Visit Mongolia Year.
"The" one? "The" 737? The only one?
So, does EVERYONE in Mongolia have those broken blood vessels in their cheeks from the cold (at least I'm assuming that's the reason)? It looks like even you were developing them...
Jon Lurie, aka "jhlurie"
I can't wait until we get the avatars database back, because you *know* what we're going to do with that hat photo.
Jon, this exact verbiage was reiterated in the MIAT (Mongolian Airline) in-flight magazine! I'm planning to provide some very informative excerpts in the second part of this account.
Who knows? It's all oral history and everybody has a different story, usually made up on the spot, about how things got to be the way they are. There's no Mongolian Larousse Gastronomique or even Bobby Flay so there's nobody to ask. There's some food professor at the university in UB, but what I read by him (I'll give some quotes in part-the-second) is about as informative as the Visit Mongolia 2003 site that Jon linked to. Maybe they just like mayonnaise?
RossyW
Amazing post!!!
I've always been in love with Mongolia, for some reason. It is unquestionably one of the top 5 countries on my list of places to visit. I love wide open spaces, I love fields! And I love diets almost entirely based on meat and dairy!
Beautiful and inspirational! Thank you!
-Ross
Maybe they just like mayonnaise?
But it's completely, deeply, and weirdly out of their historical background.
And yet consonant with the Japanese/Taiwanese etc current fascination (last 30 years or so) with the stuff.
Bottled, I presume. Hellman's? Yeo's? Monlap's?
This is fascinating stuff.
Maybe it's Tartar sauce.
(sorry, I couldn't resist, really, I couldn't help myself)
Please behave.
They get the majority of their imports from Russia and Germany. The ubiquitous mayo is some Russian garbage out of a tube. But we are definitely at the very far end of my expertise. I can also say, though, that there are a lot of Korean and Taiwanese connections with Mongolia. There are restaurants in UB with names like Seoul and the whole "Mongolian barbecue" trend came via Taiwan I think. I'll try to get this Mongolian food professor's e-mail address so we can ask him some of these questions!
[Edit: because I remembered about the tube]
Steven, dear, you should have.
But seriously, that piece by Ellen is the best report I've ever read on eGullet. I can't wait for the next installment.
Michael aka "Pan
Location:SoCal Scruburbia
Ellen, may I say it is just charming how that Keeshond has curled up on your haid!
Incredible photos! Incredible copy! It's National Geographic, right here on eGullet! I am thankful to know that the much-bandied-about "yurt" is wordana non grata.
And surely, surely, the mayonnaise-based, mayonnaise-laced, salads, as Maggie said, have to be Russian cultural lag ... I'd bet cash money.
Writer, cook, & c. ● #TacoFriday observant ● Twitter ● Instagram
Adam Balic
Very interesting, thank you.
There are big plans to introduce large amounts of cattle to the Mongolian grasslands (well at least to the bit that it is part of China), so you cow-free shots may become a rarity in the next twenty years or so.
The Sheep's stomach looks like a inside out rumen form a fairly young animal. Did you notice if they used one of the other (four) types of sheep stomach to store different types of dairy produce? Rennet is produced in the true-stomach of young animals and it would be interesting to know if they make their cheese by storing milk in this stomach.
The Art and Mystery of Food
If you can verify the mayonnaise as being part of the Russian cuisine (I haven't been there and last I checked going to Little Odessa didn't quite qualify for getting my passport stamped), I absolutely agree that this is where the mayo comes from. It certainly didn't come from the Chinese and it had to have come from one border or the other (or, apparently, from California). | cc/2020-05/en_middle_0078.json.gz/line1194 |
__label__cc | 0.684631 | 0.315369 | Damn Girl
Featuring will.i.am
Produced by Jawbreakers
Album FutureSex / LoveSounds
Damn Girl Lyrics
[Refrain: Justin Timberlake]
Damn girl, damn girl, damn girl, damn girl, damn girl, damn
Listen to me, uh, ah
[Verse 1: Justin Timberlake]
I've been around the world, seen a million honey's
Really special girls, gave all my time and money
But there something 'bout ya, something that's kinda funny
That is what you do to me, oh
Don't need no Maybelline, 'cause you a beauty queen
Don't need no L'Oreal, 'cause, bitch, you're bad as hell
If I'm a Casanova, then you're a supernova
Girl, it's what you do to me that's got me saying
[Chorus: Justin Timberlake]
Damn girl, you're so fine
The way you let me put it down, girl, blows my mind
I guess I gotta put it down tonight
I gotta put it down, oh, oh, oh, damn
Give me something, uh
I said there's somethin' 'bout the way you do the things you do
And when you do the things you do, it's got me (Oh, oh, oh)
I said there's something' 'bout the way you do the things you do
I said, don't need no Maybelline, 'cause you a beauty queen
If I'm Casanova, then you're a supernova
I gotta put it down, oh, oh, oh
[Verse 3: will.i.am & Justin Timberlake]
Woo-woo-woo-woo, woo-woo, woo-woo, woo-woo-woo
Baby, give me some of your tasty
Cinnamon, give me your feminine gelatin
'Cause got a sinner man goin' crazy
Hey, b-b-b-b, b-b-b-baby
You the one I've been feenin' for
When I'm dreamin', I'm dreamin' of you
When you're gone, I've been screamin' for ya
So why don't you be my chick and stuff?
Take you out to dinner, catch a flick and stuff?
If we spend time, I'll never get enough
Baby, so fine, make a dope brother blush
Got me looking like a black grape and stuff
First time I sayin' it, you had me gon' crush
And if you ever give it to me, give it to me rough
You got me sayin'... (You got me sayin')
You got me sayin'
The way you let me put it down, girl, just blows my mind
So now I guess I gotta put it down tonight
I'm saying, damn girl, you're so fine
The way you let me put it down, girl, blows my mind, baby
Sing it with me, go
Uh-huh, uh-huh, uh
"Damn Girl" Track Info
Written By will.i.am & Justin Timberlake
Vocals will.i.am & Justin Timberlake
Bass Caleb Speir
Keyboards will.i.am
Drum Programmer will.i.am
Pro Tools Engineer John Hanes
Mixing Engineer Serban Ghenea
Recording Engineer Padraic “Padlock” Kerin
Assistant Recording Engineer Scott Elgin & Rob Montes
Mastering Engineer Herb Powers
Label Jive Records
Recorded At Encore Studios (Burbank, CA)
Release Date September 8, 2006
FutureSex / LoveSounds Justin Timberlake
1. FutureSex/LoveSound
2. SexyBack
3. Sexy Ladies / Let Me Talk to You (Prelude)
5. LoveStoned / I Think She Knows (Interlude)
6. What Goes Around... / ...Comes Around (Interlude)
7. Chop Me Up
8. Damn Girl
9. Summer Love / Set the Mood (Prelude)
10. Until the End of Time
11. Losing My Way
12. (Another Song) All Over Again | cc/2020-05/en_middle_0078.json.gz/line1200 |
__label__cc | 0.689784 | 0.310216 | Tag: El Paso Natural Gas
Welcome to GasNewsOnline.com! As severe weather pounds the plains of Oklahoma and Texas again today, spot natural gas prices are rebounding slightly in advance of June’s NYMEX close.
Today, we’ll also review the latest interstate pipeline company critical notices plus provide an update on latest energy news and give you the latest National Weather Service temperature forecast for the month of June, too.
At the New York Mercantile Exchange (Nymex) today, the price of the June 2019 contract increased by nearly four cents to about $2.67/MMBtu on Monday. The price of the 12-month strip averaging June 2019 through May 2020 futures contracts has gained about six cents the past week to nearly $2.81/MMBtu.
From the US Energy Information Administration’s “Natural Gas Weekly Update” publication…
Net injections to working gas totaled 106 billion cubic feet (Bcf) for the week ending May 10. Working natural gas stocks are 1.653 Tcf, which is 15% lower than the five-year (2014–18) average for this week.
The natural gas plant liquids composite price at Mont Belvieu, Texas, rose by five cents, averaging $5.73/MMBtu for the week ending May 15. The price of ethane and natural gasoline fell by 2% and 1%, respectively. The price of propane, isobutane, and butane rose by 3%, 2%, and 1%, respectively.
According to Baker Hughes, for the week ending Tuesday, May 7, the natural gas rig count remained flat at 183. The number of oil-directed rigs fell by 2 to 805. The total rig count decreased by 2, and it now stands at 988.
Global investment firm KKR and Western Natural Resources, LLC (“Western”) today announced a new partnership to acquire producing and undeveloped oil and gas assets in the Williston Basin.
Western’s CEO Heath Mireles and his team bring extensive operating experience to the partnership, having drilled, completed and operated thousands of wells over the Williston Basin’s long history. The Western team will leverage their collective experiences from time spent at large public operators as well as other private companies to acquire, manage and develop producing wells and drilling locations throughout the play.
Ben Conner, Director on KKR’s Energy Real Assets team, said, “The Williston continues to be a core area of focus for us as we see a significant opportunity to acquire high quality producing assets with attractive long-term value creation opportunities to be delivered through superior technical and operational execution. We have known Heath and members of his team for years and believe our partnership is well positioned to acquire and manage assets in the Williston for the long run.”
Western is a private company focused on the acquisition and exploitation of upstream oil and gas assets. Headquartered in Oklahoma City, Oklahoma, its primary objective is to build and operate a large-scale portfolio of producing oil and gas wells and drilling locations in the Williston Basin.
Today, NRG Energy, Inc. agreed to acquire Dallas-based Stream Energy’s retail electricity and natural gas business for $300 million plus working capital in an all-cash transaction.
“This transaction will strengthen NRG’s position as a growing, customer-driven energy company. It represents another step in perfecting our integrated business model,” said Mauricio Gutierrez, president and chief executive officer, NRG Energy. “Stream Energy’s retail energy business provides NRG an attractive opportunity to increase our national retail leadership position and potential for growth.”
Stream Energy, one of the largest direct selling companies in the energy market and one of the nation’s fastest growing retailers, serves more than 600,000 Residential Customer Equivalents (RCEs) in nine states and the District of Columbia. The transaction is expected to increase NRG’s market share in Texas, Pennsylvania and a number of other markets in the Eastern U.S., accelerating the pace of growth in these markets. The combination will also enhance NRG’s multi-brand strategy.
The transaction is expected to close in the third quarter of 2019 and is subject to various customary closing conditions, approvals and consents, including the Federal Energy Regulatory Commission (FERC), Georgia Public Service Commission, and antitrust review under Hart-Scott-Rodino.
Late last week, Freeport LNG announced that it has received approval from the U.S. Federal Energy Regulatory Commission (FERC) to site, construct and operate its fourth natural gas liquefaction train, to be integrated into its existing natural gas liquefaction and LNG export facility on Quintana Island near Freeport, Texas. Approval from the U.S. Department of Energy for the export of Train 4 volumes to non-Free Trade Agreement countries is anticipated later this quarter.
Freeport LNG’s Train 4 is expected to add over 5 million tonnes per annum (mtpa) of LNG production to its existing project, increasing the total export capability of the 4-train facility to over 20 mtpa. Approximately 13.5 mtpa of this capacity has been contracted under 20-year tolling agreements to Osaka Gas Trading & Export, LLC, JERA Energy America, LLC, BP Energy Company, Toshiba America LNG Corporation, and SK E&S LNG, LLC, and approximately 0.5 mtpa has been contracted to Trafigura PTE LTD under a 3-year sale and purchase agreement commencing in 2020.
Train 4 operations are anticipated to commence in 2023.
Now, let’s check the latest critical notices from the interstate natural gas pipeline grid:
Columbia Gas Transmission, LLC (TCO) continues to work with upstream operators due to the operational event experienced by Markwest at the originally referenced Salem Plant. Markwest has since clarified that the outage was on a line feeding the Hopedale Fractionation Plant in Salem, WV.
TCO encourages customers to coordinate with its upstream operator regarding scheduled volumes for Gas Days Monday, May 20, 2019 and Tuesday, May 21, 2019.
At this time, the operational event is anticipated to be resolved later today, May 20, 2019. TCO will provide an update as soon as information becomes available. Please contact your Customer Services Representative with any questions.
***Previous Posting***
Columbia Gas Transmission, LLC (TCO) has been notified of an operational event at the Markwest Salem Plant that is impacting scheduled deliveries into TCO. TCO is working closely with Markwest and upstream operators to assess the impact, as well as a timeline for repairs. The Markwest Salem Plant impacts deliveries into TCO at the following points:
642452 – CMG Majorsville
643053 – Gibraltar III
643106 – Majorsville-LXP
642645 – Sherwood1
642824 – Smithfield-Mobley
643185 – Sherwood-MXP
842867 – Braxton
The current estimated impact is a reduction in supply on the TCO system of approximately 2.1 MMDth, necessitating a curtailment of scheduled volumes by the upstream point operators effective ID1 Cycle for Gas Day Sunday, May 19, 2019 and Timely Cycle for Gas Day Monday, May 20, 2019.
EPNG remains concerned about delivery point operators taking their gas according to their scheduled quantities as a result of the forecast below average temperatures in the Desert Southwest. The SOC Warning for a high linepack condition issued on May 17, 2019 (Notice No. 605375) remains in effect.
Washington Ranch is on maximum injection.
Delivery point operators are encouraged to continue to take gas according to their scheduled quantities. If the situation fails to improve EPNG will declare an SOC for a PACK condition.
Supply operators are encouraged to reduce and/or maintain their deliveries into the EPNG system at their scheduled rates.
Payback to the system, such as Payback (Imbalance Payback to TSP), may be limited or denied due to operational concerns related to the potential for a high linepack condition. For scheduling questions, please call your scheduling representative at (800) 238-3764.
Also from El Paso:
EPNG will be conducting bottom hole surveys at the Washington Ranch Storage Facility starting Monday, June 10, through Friday, June 14. During this scheduled maintenance, operational flexibility will be extremely limited as no injection or withdrawal from the storage facility will be possible.
Shippers are strongly encouraged to closely monitor their receipts and deliveries to ensure that their transportation is balanced during this time frame. If significant and persistent imbalances are experienced, EPNG may need to issue an SOC or COC, and/or take the necessary action to limit excess receipts into the system.
Northern Natural Gas:
The results of the recent in-line inspections for sections of Northern’s pipeline system between the Beaver, Oklahoma and Mullinville, Kansas compressor stations have come back favorable and no additional reduction in operating capacity for Beaver North (Group 1025) is necessary.
The outage capacity will remain at 820,000 Dth for the group. As a result, Northern is willing to sell incremental capacity up to 62,259 Dth through Beaver North for Gas Day May 21, 2019.
Due to high inventory levels at the Jackson Prairie storage facility (JP), Northwest is no longer accepting IT storage injections at JP beginning gas day Wednesday, May 22, 2019.
Northwest is not currently requesting SGS-2I storage customers vacate the facility. Northwest will provide notice to begin the interruptible service vacate process when the Jackson Prairie facility balance is approximately 90 percent full. Discretion will be used to determine the percentage each interruptible storage customer will be required to vacate allowing Northwest to meet its firm obligations at the facility. Upon said notice, SGS-2I shippers will have seven (7) days to comply.
Northwest would also like to remind its shippers that the storage inventory levels as well as Park and Loan availability is posted each morning on Northwest’s website at www.northwest.williams.com.
Please contact your Marketing Services Representative or the Northwest Pipeline Hotline at (801) 584-7301 if you have any questions.
On Tuesday May 21, 2019, Southern will post the May/June/July and other 2019 Maintenance projects.
On Wednesday, May 22, 2019 at 1:30 PM (Central Time) Southern will conduct a conference call/WebEx meeting and review the posted information. For more information on how to participate in the conference call/WebEx, please review the Southern Natural Gas EBB posting dated May 20, 2019.
The National Weather Service has published their initial temperature forecast for the upcoming month of June. Temperatures are expected to be warmer than average along the Atlantic coast as well as along the Pacific coast. Meanwhile, several states in the midsection of the country from the Dakotas and Nebraska down to Texas are shown with cooler than seasonal weather for June.
That’s all for this Monday edition of GasNewsOnline.com. Please let your friends in the natural gas scheduling and transportation business know about us!
Also, our companion audio podcast is available via Apple Podcasts. Subscribe today – it’s FREE!
Author Methane1Posted on May 20, 2019 May 20, 2019 Categories Gas Pipeline EBB, Gas weather, Natural Gas NewsTags Columbia Gas Transmission, El Paso Natural Gas, Freeport LNG, KKR, National Weather Service, Northern Natural Gas, Northwest Pipeline, NRG Energy, Southern Natural Gas, Stream Energy, US Energy Information Administration, Western Natural Resources
Welcome to GasNewsOnline.com! We always review the country’s largest interstate natural gas pipeline companies for their most recent critical postings and bring you information about changes in gas pipeline operating conditions.
From the US Energy Information Administration, working natural gas in storage increased by 92 Bcf for the period ending Friday, April 19. Natural gas volumes in storage are 369 Bcf or 22% below the five-year average for the same week.
On the New York Mercantile Exchange, the May, 2019 natural gas futures price climbed nearly five cents on Thursday to close at nearly $2.51/MMBtu.
Will there be a bidding war for Anadarko Petroleum? After last week’s bid by Chevron to acquire Anadarko, Occidental Petroleum Corporation submitted a competing bid for the company on Tuesday.
Occidental delivered a letter to the Anadarko Board of Directors setting forth the terms of a superior proposal by Oxy to acquire Anadarko for $76.00 per share, in which Anadarko shareholders would receive $38.00 in cash and 0.6094 shares of Occidental common stock for each share of Anadarko common stock. The Occidental proposal represents a premium of approximately 20% to the value of Anadarko’s pending transaction from Chevron.
Occidental believes its proposal is superior both financially and strategically for Anadarko’s shareholders, creating a global energy leader with the scale and geographic diversification to drive growth and deliver compelling value and returns to the shareholders of both companies. The combined company will be uniquely positioned to leverage Occidental’s demonstrated operational and technical expertise, producing greater anticipated synergies than Anadarko’s pending transaction. The 50-50 cash and stock transaction is valued at $57 billion, based on Occidental’s closing price on April 23, 2019, including the assumption of net debt and book value of non-controlling interest.
“Occidental is a leader in using technological innovation to create value, and we will deploy our expertise to enhance the performance and productivity of Anadarko’s assets not only in the Permian, but globally,” said Vicki Hollub, Oxy’s President and Chief Executive Officer said, “Occidental and Anadarko have a highly complementary asset portfolio, providing us with a unique opportunity to realize significant operating, cost, and capital allocation synergies and achieve near-term cash flow accretion.”
Vicki Hollub continued, “We have been focused on Anadarko for several years because we have long believed that we are ideally positioned to generate compelling value from a combination with them. We look forward to engaging immediately with Anadarko’s Board and stakeholders to deliver this superior transaction.”
Murphy Oil Corporation announced Tuesday that its wholly owned subsidiary, Murphy Exploration & Production Company – USA (“Murphy”), has entered into a definitive agreement to acquire deep water Gulf of Mexico assets from LLOG Exploration Offshore, L.L.C. and LLOG Bluewater Holdings, L.L.C.. The accretive, cash flow providing Gulf of Mexico assets currently produce approximately 38,000 barrels of oil equivalent per day net (Boepd) and are expected to add approximately 66 million barrels of oil equivalent net (Mmboe) of Proven (1P) reserves and 122 Mmboe of Proven and Probable (2P) reserves1.
Murphy will pay a cash consideration of $1.375 billion. Additional contingent consideration payments are based on the following: up to $200 million in the event that revenue from certain properties exceeds certain contractual thresholds between 2019 and 2022; and $50 million following first oil from certain development projects. The transaction will have an effective date of January 1, 2019 and is expected to close in the second quarter, subject to normal closing adjustments.
The acquisition will be funded by a combination of cash on hand and availability under the company’s $1.6 billion revolving credit facility. Total outstanding borrowings under the revolving credit facility, including the current balance of $325 million, are expected to be fully repaid immediately following the closing of the previously announced $2.127 billion divestiture of Murphy’s Malaysian assets.
“This immediately accretive transaction continues to strengthen our Gulf of Mexico portfolio by adding quality assets at a very attractive price. We expect these newly acquired assets to generate meaningful cash flow over the next several years that will provide us with additional flexibility for future capital allocation,” stated Roger W. Jenkins, President and Chief Executive Officer.
There are several changes in the major interstate natural gas pipeline companies’ operating conditions to be aware of heading into the weekend. Let’s take a look:
ANR will begin planned pipeline and compressor maintenance along its Michigan Leg North Segment located in the Northern Fuel Segment (Zone 7). This will reduce the total Bridgman Northbound (Loc ID #226632) capacity by the following:
325-MMcf/d – (leaving 1,276 – MMcf/d available) 6/10 – 8/12
Based on current nominations through Bridgman Northbound, it is anticipated that this posting may result in the capacity allocation reduction of IT and Firm Secondary.
Also on ANR:
Willow Run Capacity Reduction (Updated 4/25/19)
ANR will continue planned pipeline maintenance between its Defiance Compressor Station and Willow Run Meter Station located in the Northern Area (Zone 7), which will result in the following capacity reduction:
Wilow Run Delivery (DRN #42078)
80-MMcf/d (leaving 777-MMcf/d available) 4/25
167-MMcf/d (leaving 690-MMcf/d available) 5/3 -5/11
Based on current nominations, it is anticipated that the above reductions may impact interruptible and firm secondary services.
Columbia Gas Transmission, LLC (TCO) reminds customers of upcoming pigging on Line LEX (LXP) that will impact scheduled volumes for certain hours in the gas day between Lone Oak Compressor Station and Summerfield Compressor Station (May 1, 3) and between Summerfield Compressor Station and Rockbridge Regulator Station (May 4, 6).
TCO is working with operators for hourly operational assistance during the pigging. As a result of this work, the following impact is anticipated at this time:
Gas Day May 1:
743093 – Stagecoach-LXP – 55,000 Total Capacity
743103 – Eureka – 200,000 Total Capacity
LONEOAKA – Lone Oak A MA41 – 100,000 Total Capacity
LONEOAKB – Lone Oak B MA41 – 565,000 Total Capacity
LXPSEG – LXPSEG MA41 – 550,000 Total Capacity
Dominion Energy Transmission, Inc. (DETI)’s Cornwell Station (West Virginia) will be out of service for planned maintenance from Friday, April 26, 2019 to Friday, May 3, 2019.
During this outage, all production flowing on the Dominion Gathering and Processing (DGP) system to the DETI facilities listed below, must be shut in. DETI will make another posting when production can be turned back in line.
The facility shut in dates and requirements are as follows:
All gathering wet system production flowing to Cornwell Station 7 and 8 will need to be shut in by 7:00 am EDT on Friday, April 26. Direct Taps on TL-585 will need to be shut in by 7:00 a.m. EDT on Monday, April 29. DGP Production Bubbles to be shut in: 2206, 2303, 2304, 2305, and 9912. Producers in bubbles 2301, 2306 and 9913 that can physically flow off system via H-18155 can do so. This includes production behind Oscar Nelson Station, Searls Station, Shadd Station, Panther Station, Oozley Station, and Hardman Station.
DETI will make another posting if allocations become necessary. Delivery nominations during this period from 10, 12 and 13 will be kept whole by DETI. Delivery nominations during this period from EB005, EB045, EB145, EB335, EB460, EB620 and EB635 will be kept whole by DETI. Please monitor these postings for further updates.
El Paso Natural Gas is pleased to announce the new Graphical Pipe screen in the iDART system. This new screen will enable shippers to view nominations, priorities, and entitlements based on segment for a given gas day and cycle. The new Graphical Pipe screen is located in the Scheduled Quantity folder under the Nominations folder in the iDART system.
Please contact the scheduling hotline at 1-800-238-3764 Option 1 if you have any questions about this new screen.
This Operational Alert is being issued pursuant to Section 20, GT&C of EGT s Tariff to notify all parties of planned maintenance on EGT s Line BT-1 in the North Pooling Area beginning April 27, 2019, with an expected completion date of May 13th, 2019.
During this maintenance, a series of integrity digs will be conducted along EGT s Line BT-1. Be advised, there is no capacity impact associated with the integrity digs, but should a determination be made that a repair is necessary, there could be a capacity reduction associated with the repair. Depending upon the nature of any required repair, the announcement of a capacity reduction could come at short notice.
This alert will remain in effect until further notice and will be updated as more information becomes available.
Effective Gas Day April 26th at the Timely Nomination Cycle, GTN is lifting the Force Majeure related to the repairs at the Ione Compressor Station 9 (Oregon).
The operationally available capacity for the Flow Past Kingsgate location has been increased to 2126-MMcf/d.
The operationally available capacity for the Flow Past Station 8 Location is 1865-MMcf/d.
As a reminder to customers, planned maintenance at Compressor Station 8 continues until May 10th.
SEGMENT 11 – SOUTH OF STA 106 – AT OPERATING CAPACITY
Effective for gas day Friday, April 26, 2019, and continuing until further notice, Natural is at operating capacity for northbound flow through Compressor Station 106 located in Gage County, Nebraska (Segment 11 of Natural’s Midcontinent Zone). AOR/ITS and Secondary out-of-path Firm transports are at risk of not being fully scheduled.
Also from NGPL:
SEGMENT 13 – STA 107– AT OPERATING CAPACITY
Effective for gas day Friday, April 26, 2019, and continuing until further notice, Natural is at operating capacity for northbound flow through Compressor Station 107 located in Mills County, Iowa (Segment 13 of Natural’s Amarillo Mainline Zone). AOR/ITS and Secondary out-of-path Firm transports are at risk of not being fully scheduled.
Rockies Express Pipeline (REX):
CHANDLERSVILLECOMPRESSOR STATION MAINTENANCE
On Gas Day Wednesday, May 1, 2019 through Gas Day Friday, May 3, 2019, REX will be performing maintenance at its Chandlersville (Ohio) Compressor Station. Operating capacity will be limited to 2.935 Bcf/d through pipeline Segment 380. At this capacity level, primary and secondary firm quantities, as well as ITS/AOR are at risk of not being scheduled.
TransColorado Gas Transmission:
The Force Majeure (FMJ) declared at Blanco Hub Compressor Station, Segment 310, in notice #118680 has been lifted.
TransColorado Gas Transmission Company, L.L.C. (TC) has repaired the compressor station and, as such, is lifting the Force Majeure that was in effect. The capacity will return to 250,000 Dth effective Gas Day April 25, Cycle 4 (Intraday 2) and Gas Day April 26, Cycle 1 (Timely).
Effective: Saturday, April 27, 2019
The National Weather Service six-to-ten day forecast for the first few days of May is showing some cooler weather on the way for the northern plains states as well as New England. Otherwise, May will be ushered in with average temperatures across much of the nation. In the South, though, temperatures may be slightly above average for the first week of the new month.
Author Methane1Posted on April 25, 2019 April 25, 2019 Categories Gas Business News, Gas Pipeline EBB, Gas weatherTags Anadarko Petroleum Corporation, ANR Pipeline, Chevron USA, Columbia Gas Transmission, Dominion Energy Transmission, El Paso Natural Gas, Enable Gas Transmission, Gas Transmission Northwest, Murphy Oil Corporation, National Weather Service, Natural Gas Pipeline Company of America, Occidental Petroleum Corporation, Rockies Express Pipeline, TransColorado Gas Transmission, Transcontinental Gas Pipe Line Company, US Energy Information Administration
Edition 44 – Monday, March 4, 2019
https://gasnewsonline.com/wp-content/uploads/2019/03/GasNewsOnlineEdition44.mp3
Welcome to this busy Monday edition of GasNewsOnline.com. With cold weather gripping much of the United States, we will cover the latest critical postings from the interstate gas pipeline grid along with a few news stories from the energy business, and, of course, take a look ahead at the temperature forecast from the National Weather Service. It is all FREE from GasNewsOnline.com.
Cheniere Energy, Inc. and Bechtel Oil, Gas and Chemicals, Inc. announced today that Substantial Completion of Train 1 of the Corpus Christi liquefaction project was achieved on Thursday, February 28, 2019. Commissioning is complete and Bechtel has turned over care, custody, and control of Train 1 to Cheniere.
“Train 1 at Corpus Christi has achieved Substantial Completion, becoming the first liquefaction train placed into operation at a greenfield liquefaction facility in the lower 48 states,” said Jack Fusco, President and CEO of Cheniere. “This momentous achievement was made possible by Cheniere’s professionals and our EPC partner, Bechtel, who worked diligently together to ensure a seamless transition from construction to operations. I’d like to thank the Cheniere team and Bechtel for their world class execution, which has enabled us to continue our impeccable record of bringing trains online safely, ahead of schedule, and within budget.”
“The entire Bechtel team is very proud of our contribution to Cheniere’s success on the U.S. Gulf Coast, as we hand over custody of this historic first Texas LNG train,” said Brendan Bechtel, Chairman and Chief Executive Officer of Bechtel. “It was three years ago that we were able to support Cheniere’s entry into the LNG export market with Train 1 at the Sabine Pass Liquefaction project. With five trains now completed and operating well ahead of schedule, we are excited to continue working alongside Cheniere to deliver their next wave of trains with the reliability of outcome that Cheniere and Bechtel have become known for delivering. This program is a great example of how a one-team approach can bring world-class results, and I want to congratulate Jack and the Cheniere team for fostering this environment of collaboration and mutual success.”
Under sale and purchase agreements (“SPAs”) with Endesa S.A. and PT Pertamina (Persero), the date of first commercial delivery is expected to occur in June 2019, upon which the term of each of these SPAs commences. Additionally, bridging volumes are expected to begin in June 2019 under an SPA with Iberdrola, S.A.
Last Friday, Cheniere announced that Midship Pipeline Company, LLC has issued Notice to Proceed to Strike, LLC, M.G. Dyess, Inc., TRC Pipeline Services, LLC, and Cenergy, LLC to construct the Midship natural gas pipeline and related compression and interconnect facilities (the “Midship Project”). The Midship Project received final Notice to Proceed from the Federal Energy Regulatory Commission in February 2019 and is expected to be placed in service by the end of 2019. Midship Pipeline is indirectly and jointly owned by Cheniere and EIG.
To complete financing of the Midship Project, Midship Pipeline entered into senior secured credit facilities with total commitments of up to approximately $680 million. The credit facilities consist of an approximate $615 million construction loan facility and a $65 million revolving credit facility. Proceeds from these credit facilities will be used to fund a portion of the costs of developing, constructing, and placing into service the Midship Project, to fund working capital requirements, and for related general corporate purposes.
The Midship Project is being developed to create pipeline capacity of up to 1,440,000 Dekatherms per day of firm transportation to connect production from the emerging STACK and SCOOP resource plays in the Anadarko Basin in Oklahoma to growing Gulf Coast and Southeast markets. The Midship Project is expected to consist of approximately 200 miles of 36 inch diameter new mainline pipeline, several laterals, compressor stations and interconnects that will provide receipts from STACK and SCOOP processing plants and provide deliveries to Bennington, Oklahoma, as well as access to downstream markets including the TexOk hub near Atlanta, Texas, and the Perryville Hub near Tallulah, Louisiana. Midship Pipeline has secured commitments from subsidiaries and/or affiliates of Cheniere, Devon Energy Corporation, Marathon Oil Corporation, and Gulfport Energy Corporation.
Also on Friday, TransCanada Corporation announced the Federal Energy Regulatory Commission (FERC) had approved the full in-service of its Mountaineer XPress (MXP) project, allowing the company to increase the flow of gas on MXP and begin operating its Gulf XPress (GXP) project. The projects are a vital link between Appalachian natural gas supplies and growing markets in the U.S. and beyond.
“Mountaineer XPress and Gulf XPress are extremely important to TransCanada as they provide much-needed takeaway capacity for our customers, while also growing our extensive footprint in the Appalachian Basin,” said TransCanada President and Chief Executive Officer Russ Girling. “Both projects will also deliver attractive long-term returns and stable cash flow for our shareholders.”
Designed to deliver clean, affordable, domestically produced natural gas, MXP is comprised of 170 miles of 36-inch-diameter pipeline, three new compressor stations, and modifications to three existing compressor stations – representing an investment of approximately US$3.2 billion. The pipeline is capable of transporting 2.7 billion cubic feet of natural gas per day to the TCO Pool and Leach markets on the Columbia Gas Transmission System. MXP is underpinned by long-term contracts with customers.
Partial in-service of the approximately US $600-million GXP project includes placing into service four new compressor stations located in Kentucky, Tennessee and Mississippi. Together, these facilities will provide additional capacity of 530,000 million cubic feet of natural gas per day on the Columbia Gulf Transmission System, which equates to approximately 60 percent of the project’s total capacity. GXP is also underpinned by long-term contracts with customers and is expected to be placed into full service in the coming weeks.
With cold weather gripping the majority of the nation on Monday, several interstate gas pipelines posted operational notices on their electronic bulletin board systems to start the new week:
ANR is performing planned maintenance at its LaGrange Compressor Station on its Tie-Line located in Indiana in the Northern Fuel Segment (Zone 7). ANR will reduce the LaGrange Westbound location (LOC #314515) capacity by the following:
Pipeline Conditions – Permian Basin Weather Concerns
The Permian supply basin is experiencing significant underperformance issues related to the winter weather that moved in overnight. Actual receipts into the system are approximately 545 MM below scheduled quantities for Gas Day March 4 (79% of schedule). A combination of freeze-offs and power outages coupled with road closures are impacting the ability of receipt point operators to restore supply to the system. The Permian Basin overnight lows tomorrow morning are forecast again to be significantly below the seasonal average and additional supply underperformance is anticipated.
Delivery point operators are encouraged to review their scheduled supplies to ensure that they are aligned with their flowing quantities. Supply operators are encouraged to maintain their deliveries into the EPNG system at their scheduled rates. Underperformance caps will be placed on underperforming supplies and if necessary EPNG will declare an SOC for DRAFT condition.
Imbalance payback off the system, such as Make-Up Delivery (MD) transactions, may be limited or denied due to operational concerns related to maintaining adequate linepack.
Washington Ranch is fully operational.
Index 300 Maintenance Pig Run: March 20 – March 21, 2019 and again beginning March 27 – March 28, 2019
Mobile Bay Delivery Scheduling Group – Capacity could be impacted by up to 150,000 dth/d for the duration of the maintenance.
Moss Point System Scheduling Group – Capacity could be impacted up to100,000 dth/d for the duration of the maintenance.
Northern Border Pipeline:
Effective immediately, Northern Border Pipeline is issuing an OFO watch.
Northern Border is concerned about the operational integrity of its system as a result of extremely cold weather. The OFO watch is in effect through gas day March 8th, in order to allow for the Northern Border pipeline system to regain its operational integrity. Northern Border has limited flexibility to manage imbalances and strongly encourages all shippers manage their system requirements to ensure the matching of receipts and deliveries daily. Absent voluntary imbalance management by shippers to ensure daily balancing, Northern Border may be required to take further action, including the immediate issuance of an imbalance Operational Flow Order.
If further action is required, it may be necessary for that action to become effective immediately, with no additional prior notice available.
A System Overrun Limitation (SOL) has been called for all Market Area zones (ABC, D and EF) with 0% System Management Service (SMS) available for Gas Day Tuesday and Wednesday, March 5 and 6, 2019, due to lower than normal forecasted system weighted temperatures.
Effective for gas day Wednesday, March 6, 2019 and until further notice, Northwest is revising its current Overrun Entitlement as follows:
Receiving Party locations north of the Plymouth South constraint point, including the Spokane and Wenatchee laterals, will be revised from a Stage I (3%) Overrun Entitlement to a Stage III (13%) Overrun Entitlement.
For Receiving Party locations between the Kemmerer compressor and the Plymouth South constraint the Stage II (8%) Overrun Entitlement will be lifted.
Even though the Entitlements are being changed or lifted, Northwest is not allowing balancing off the system. Customers can avoid future Entitlements by procuring sufficient supply for their market needs.
Panhandle Eastern Pipe Line:
On Sunday, March 3, Panhandle Eastern Pipe Line experienced a rupture downstream of the Centralia Compressor Station. This outage will require a section of the 400 Line to be shut-in for repairs, reducing mainline capacity.
Effective immediately, until further notice, Panhandle will be limiting nominations through Haven to 1,125,000 MMBtu/day, with gas scheduled in accordance with Section 8.8 (c) of Panhandle’s FERC Gas Tariff. This outage will be considered a Force Majeure event pursuant to Section 20 of Panhandle’s FERC Gas Tariff.
Shippers are encouraged to bring in physical flowing gas from their Primary receipt point, or physical market area receipt meters downstream of this outage in order to avoid the constraint, and potential scheduling reductions of their nominated activity.
The cold weather restrictions outlined in Critical Notice ID 8196 will remain in effect. Panhandle will be requiring all Enhanced Firm Transportation (EFT) shippers to limit their physical deliveries (takes) to a one-sixteenth hourly rate of the nominated volume.
Updates on the impact to shipper nominations will be posted as they become available.
Based on the weather forecast predicting colder temperatures as well as the corresponding increase in projected demand on Southern’s north and south systems, we are notifying all Shippers that the existing Type 3 Level 1 OFO is being upgraded to a Type 3 Level 2 OFO and is also being expanded to include all of the following groups listed below effective the start of the gas day, Tuesday, March 5, 2019 until further notice.
OFO Type 3 Level 2: Daily Demand Exceeds Capacity
TARIFF SECTION 41.2
EFFECTIVE DATE: March 5, 2019
EFFECTIVE TIME of OFO: 9:00 AM (CCT)
PENALTY: $15.00 + Highest Regional Daily Price* per Dth for quantities taken in excess of the tolerance
TOLERANCE: Greater of 102% of the Daily Entitlement or 200 dth
Southern Star Central Pipeline:
System Advisory Notice:
Southern Star Central Gas Pipeline is issuing a Storage notice to protect the integrity of SSCGP’s storage facilities. A number of storage customers have inventory levels at or below five percent (5%). This issuance requires all TSS, STS, and FSS customers to have inventories at or above zero (0 %) and asks TSS and STS customers to also ensure they have at least one (1) day of inventory available. Failure to voluntarily comply could result in the issuance of an Operational Flow Order (OFO).
EMERGENT REPAIR AT STATION 323A – SEGMENT 324 – EFFECTIVE 3-05-19
Pursuant to Article XII of the General Terms and Conditions of Tennessee’s FERC Gas Tariff, Tennessee is posting notice of an emergent repair issue impacting a unit at Station 323A in Pike County, PA. Tennessee has personnel on site and repairs are underway. Tennessee is estimating the current impact to be up to 200,000 Dths at Segment 324 (FH). Based on current nominations, Secondary Out of the Path nominations and Secondary In Path nominations pathed through Segment 324 (FH) are at risk as early as Timely Cycle for the Gas Day of Tuesday, March 5, 2019.
Also on Tennessee Gas…
Due to a forecast of colder weather and higher demand moving across most of the system, effective for the Gas Day of Monday, March 4, 2019, and until further notice, Tennessee Gas Pipeline, L.L.C. (“Tennessee”) is implementing an OFO Daily Critical Day 1 for all of Zones 2, 3, 4, 5 and 6 for all Balancing Parties (including LMS-PA, SA contracts acting as balancing parties, LMS-MA, and LMS-PL balancing parties). This action is pursuant to Article X, Section 4 of the General Terms and Conditions of Tennessee’s FERC Gas Tariff.
All delivery point operators in all of Zones 2, 3, 4, 5 and 6 are required to keep actual daily takes out of the system equal to or less than scheduled quantities regardless of their cumulative imbalance position. All receipt point operators in all of Zones 2, 3, 4, 5 and 6 are required to keep actual daily receipts into the system equal to or greater than scheduled quantities regardless of their cumulative imbalance position. In addition, it is essential that delivery point operators schedule gas at meters commensurate with takes within the affected areas. All LMS-PA, SA contracts acting as balancing parties, LMS-MA and LMS-PL Balancing Parties are required to maintain an actual daily flow rate not exceeding 2% of scheduled quantities or 500 dths, whichever is greater for under-deliveries into the system and over-takes from the system. Customers will be assessed a rate of $5.00 plus the applicable Regional Daily Spot Price per dekatherm for that portion of physical quantities related to under-deliveries by receipt point operators and over-takes by delivery point operators which exceed this tolerance.
Due to impending colder weather, in order to maintain the operational integrity of the system, TE is issuing an Operational Flow Order (OFO) pursuant to Section 4.3 of the General Terms and Conditions of TE’s FERC Gas Tariff effective 9:00AM CCT Tuesday, March 5, 2019 to all parties, with the exception of those governed by a FERC gas tariff, in Texas Eastern’s Market Area Zone M2-30.
This OFO does not affect the ability of TE to receive or deliver quantities of gas for scheduled nominations to any customer or pipeline.
During the effectiveness of this OFO, all parties must be balanced such that actual deliveries of gas out of the system must be equal to or less than scheduled deliveries out of the system. The penalty shall apply to each dekatherm of actual delivery quantities that exceeds the greater of 2,000 Dth or 102% of scheduled delivery quantities.
During the effectiveness of this OFO, all parties must be balanced such that actual receipts of gas into the system must be equal to or greater than scheduled receipts into the system. The penalty shall apply to each dekatherm of actual receipt quantities that are less than scheduled quantities minus 2,000 Dth or 98% of scheduled receipt quantities.
The penalty will be equal to three times the daily Platts Gas Daily “Daily Price Survey” posting for the High Common price for the geographical region, as defined in Section 8.5(a) of the General Terms and Conditions of TE’s FERC Gas Tariff for the day on which such violation occurred. In addition, TE will not permit retroactive nominations to avoid an OFO penalty.
TE may be required to issue an hourly OFO pursuant to General Terms and Conditions Section 4.3(H) to impose further restrictions in order to maintain the operational integrity of the system.
Below normal temperatures have moved into the Texas Gas service area for the first part of this week. While it is fully expected that all primary firm service obligations will be met, the following services/activities are subject to scheduling reductions until further notice:
Imbalance Payback from Transportation Service Provider
Park Withdrawal
ISS Withdrawal
FSS Overrun Withdrawal
Interruptible and out-of-path Firm Transportation
Additionally, Texas Gas is requesting all shippers take deliveries within their contractual hourly rights so that receipts and Deliveries match their associated scheduled quantities.
If shippers do not voluntarily comply with these provisions, Texas Gas may be forced to issue an Operational Flow Order, which could result in penalties for shippers.
Transcontinental Gas Pipe Line Company:
Subject:Operational Flow Order – Imbalance
Effective: Tuesday, March 5, 2019 and until further notice
OFO Areas: Zone 6
Tolerance %: 5% for gas Due from Shippers
The National Weather Service six-to-ten day forecast into March 14 is showing that Texas and most areas east of the Mississippi River will show a warming trend while temperatures remain below normal over the Upper Midwest, the Rockies, and the West Coast regions.
That’s all for this chilly Monday edition of GasNewsOnline.com. Please come back on Thursday for an update on the interstate gas pipeline conditions expected for the weekend.
Author Methane1Posted on March 5, 2019 March 5, 2019 Categories Gas Business News, Gas Pipeline EBB, Gas weatherTags ANR Pipeline, Bechtel Oil Gas and Chemicals, Cheniere Energy, El Paso Natural Gas, Gulf South Pipeline, Midship Pipeline Company, National Weather Service, Northern Border Pipeline, Northern Natural Gas, Northwest Pipeline, Panhandle Eastern Pipeline, Southern Natural Gas, Southern Star Central Gas Pipeline, Tennessee Gas Pipeline, Texas Eastern Transmission, Texas Gas Transmission, TransCanada Corporation, Transcontinental Gas Pipe Line Company
Edition 27 – Thursday, January 3, 2019
Happy New Year! Welcome into 2019 with GasNewsOnline.com! We review the latest natural gas pipeline and energy news from publicly available sources and summarize it here.
Over the holidays, the weather has been less than frigid across much of the country. Unfortunately, natural gas prices are starting to feel the pinch as the NYMEX natural gas futures price for February has dived below $3/MMBtu already. Caveat emptor!
We’ll take a look at the upcoming weather forecast just a bit later, but let’s start with a few large corporate deals consummated as we begin 2019.
On Wednesday, Dominion Energy, Inc. and SCANA Corporation announced that they have completed their proposed merger, benefiting customers and communities in Georgia, North Carolina and South Carolina.
“Dominion Energy is pleased to add SCANA’s fast-growing, high-performing Southeastern businesses to our 18-state footprint,” said Thomas Farrell, Dominion’s chairman, president, and chief executive officer. He added, “Together, we are committed to providing safe, dependable, affordable and clean energy to the communities served by SCANA and to maintaining its excellent record of reliability and customer service.”
The combination expands Dominion Energy’s operations in Georgia and the Carolinas, where the company had already operated an electric utility serving 120,000 customer accounts in northeastern North Carolina, a 1,500-mile interstate pipeline principally in South Carolina, and nearly 1,000 megawatts of gas, hydro and solar generating capacity in all three states.
SCANA Corporation will be a first-tier, wholly owned subsidiary of Dominion Energy. Its operating companies – including South Carolina Electric & Gas Company (SCE&G), Public Service Company of North Carolina, Incorporated (PSNC Energy), and SCANA Energy Marketing, Inc. (SEMI) – and its services company will be managed by a new operating segment, the Southeast Energy Group.
At the merger’s completion, each SCANA share was converted into 0.6690 shares of newly issued Dominion Energy common stock. The conversion resulted in a transaction value of approximately $6.8 billion, in addition to the assumption of approximately $6.6 billion in existing consolidated SCANA net debt.
Also on Wednesday, Sempra Energy announced that its subsidiary has entered into an agreement to sell its non-utility U.S. natural gas storage facilities to an affiliate of ArcLight Capital Partners (ArcLight) for $332 million in cash, subject to adjustments for working capital. The facilities will become part of the Enstor natural gas storage platform, which ArcLight acquired in 2018.
The gas storage assets included in the sale to ArcLight are the Mississippi Hub storage facility in Simpson County, Miss., with a working capacity of 22.3 billion cubic feet (Bcf) of natural gas, and the Bay Gas storage facility in Southwest Alabama, which comprises five underground caverns with a working capacity of 20.4 Bcf of natural gas.
The sale of the non-utility natural gas assets to ArcLight is expected to be completed in the first quarter 2019, subject to customary closing conditions. At closing, ArcLight will own 100 percent of the Mississippi Hub and Bay Gas storage facilities.
With much of the United States getting a brief respite from the cold weather, there are fewer critical notices from the interstate gas pipeline companies posted on their electronic bulletin boards. Let’s check out a few:
AGT Operational Flow Order
In order to maintain the operational integrity of the system, Algonquin Gas Transmission, LLC (AGT) is issuing an Operational Flow Order (OFO) pursuant to Section 26 of the General Terms and Conditions of AGT’s FERC Gas Tariff effective 9:00 AM CCT, January 6, 2019, to all parties, with the exception of those Operational Balancing Agreements required by FERC regulations, on the AGT system.
Dominion Energy Questar Pipeline
Beginning Gas Day January 4, 2019 total withdrawal capacity from Clay Basin will be 540 Mdth/d. Northwest Pipeline withdrawal capacity will be 320 Mdth/d. Injection capacity will be 200 Mdth/d plus 25 Mdth/d Park and Loan for a total of 225 Mdth/d.
Please contact your Marketing and Contracting representative or the Customer Services hotline at 801-324-5200 should you have questions.
WARNING OF STRAINED OPERATING CONDITION (SOC) – DRAFT
Currently the EPNG system is experiencing a high draft condition. Linepack currently is at 7,650 MMcf to start the morning but falling due to significant deliveries in excess of scheduled quantities. The continued draft of the EPNG system could lead to a low linepack condition.
Washington Ranch is on maximum operational withdrawal given the pipeline constraints through Guadalupe.
Delivery point operators are encouraged to review their transport to ensure that their takes are in balance with their supplies and to ensure their scheduled supplies are performing as expected. If the situation fails to improve, EPNG will declare an SOC for a DRAFT condition.
Underperformance caps have been placed and will continue to be placed on underperforming supplies.
Imbalance payback off the system, such as Make-Up Delivery (MD) transactions, will be denied due to operational concerns related to maintaining adequate linepack.
For scheduling questions, please call your scheduling representative at (800) 238-3764.
Northern Border OFO Watch (Posted 1/02/19)
Due to cumulative operational imbalance issues, Northern Border Pipeline is posting an OFO Watch for the following locations: Aberdeen (DRN# 19589) Grundy Ctr (DRN# 120859) Hazel (DRN# 1395646) Ivanhoe (DRN# 92252) Ledyard (DRN# 98993) Marshall (DRN# 11936) Ventura (DRN# 4680) Webster (DRN# 92254) Welcome (DRN# 11958) Westbrook (DRN# 112525)
The issuance is per Northern Border Tariff Section 6.10.6 Interruption of Service.
The OFO Watch is effective immediately and extends through gas day January 8th, in order to allow the interconnecting parties to remediate the cumulative operational imbalance issue. If an interconnect operator is unable to remediate the issue within the given timeframe, Northern Border will, pursuant to Northern Border Tariff Section 6.10.6 Interruption of Service, issue an OFO requiring curtailment of interruptible services and/or forced balancing of nominations and actual flows at these interconnects.
Interconnecting parties should contact Gas Control with to arrange payback on OBA imbalances: Loren Charbonneau 832-320-5674
To All Southern Natural Gas Company Shippers
RE: Open Season Announced for Firm Transportation (FT)/Expansion
Southern Natural Gas Company, L.L.C. (“SNG”) has placed into service its Fairburn expansion project and new interconnection with Transcontinental Gas Pipe Line (“Transco”) in Fayette County, GA (receipt pin 50069, Transco/SNG, Fayette County, GA). As a result, approximately 15,000 dth/day of incremental firm transportation capacity is available from this new interconnect to delivery locations on (i) SNG’s North Main Line as far west as the AGL-SNG Atlanta Suburbs Area (pin 940018), and (ii) along SNG’s South Main Line, west of SNG’s Thomaston compressor station, including limited deliveries to the South Georgia Lateral. Of this quantity, approximately 5,000 dth/day is also available as far east as the AGL-SNG West Macon Area Point (pin 940055), east of the Thomaston Compressor Station.
This open season is being made to solicit short term bids for the aforementioned 15,000 dth/day which will be operationally available for the remainder of the winter season (a period ending April 30, 2019). The capacity available to be awarded may not be available in the same increments to all locations along SNG’s South Main Line. SNG reserves the right to reject any bids at less than maximum tariff rate. Any shippers interested in a term longer than April 30, 2019 should contact their Account Manager or Darryl Outlaw.
This open season will commence as of the date and time this notice is posted and end at 10:00 a.m. CCT on January 8, 2019.
1/02/19 – Pipeline Conditions – Low Line Pack – Cold Weather
Transwestern is working to maintain and/or increase current line pack. This notice is due to cold weather in the Permian and the San Juan basins this week.
Customers are encouraged to review their transport to ensure that their flowing quantities are aligned with their scheduled supplies and to ensure their scheduled supplies are performing as expected.
Correspondingly, Transwestern plans to issue Under Performance Cut Notices to Receipt Point Operators that are flowing less gas into Transwestern than scheduled.
Any such UPR cuts will be handled by separate notices.
No Make-Up Deliveries or over burns due to operational concerns related to maintaining adequate line pack.
If you have any questions, please contact Gas Control or your Marketing Representative.
If the six-to-ten day temperature forecast holds, then January’s typical cold weather will have to wait a bit longer. The National Weather Service map shows warmer than seasonal weather for nearly all of the US through mid-month. Golf, anyone???
Thanks for joining us at GasNewsOnline.com. Please let your friends in the natural gas transportation business know about us. Our information and services, as always, are FREE!
Author Methane1Posted on January 3, 2019 January 3, 2019 Categories Gas Business News, Gas Pipeline EBB, Gas weatherTags Algonquin Gas Transmission, ArcLight Capital Partners, Dominion Energy Inc., El Paso Natural Gas, National Weather Service, Northern Border Pipeline, SCANA Corporation, Sempra Energy, Southern Natural Gas, Transwestern Pipeline
Edition 26 – Thursday, December 27, 2018
Welcome back to GasNewsOnline.com for Thursday, December 27, 2018. The New Year is right around the corner, so we will check out the latest natural gas news and gas pipeline information which may affect your business through early next week. All for FREE!
January’s natural gas futures contract looks to be up ten cents today and near $3.64/MMBtu for the new month at the Henry Hub in Louisiana.
From the US Energy Information Administration’s Natural Gas Weekly report:
The natural gas plant liquids composite price at Mont Belvieu, Texas, fell by 52¢/MMBtu, averaging $6.21/MMBtu for the week ending December 19. The price of natural gasoline, ethane, propane, butane, and isobutane all fell for that reporting week.
According to Baker Hughes, for the week ending Tuesday, December 11, the natural gas rig count remained flat at 198. The number of oil-directed rigs fell by 4 to 873. The total rig count decreased by 4, and it now stands at 1,071.
Let’s check out the latest postings from the electronic bulletin boards of the major interstate gas pipeline companies around the United States:
In order to maintain the operational integrity of the system, Algonquin Gas Transmission, LLC (AGT) is issuing an Operational Flow Order (OFO) pursuant to Section 26 of the General Terms and Conditions of AGT’s FERC Gas Tariff effective 9:00 AM CCT, December 29, 2018, to all parties, with the exception of those Operational Balancing Agreements required by FERC regulations, on the AGT system.
Line 3100 Outage Update (5)
East Tennessee Natural Gas, LLC (ETNG) is providing the following update on its progress in returning to service the 3100 Line near its Dixon Spring compressor station. As posted on December 21, 2018, ETNG is working diligently to return the capacity thru Dixon Springs to approximately 300,000 Dth/d. The updated progress report is as follows:
Progress Report: ETNG continues to be diligent on the three major construction activity work streams required to return the pipeline back to service. The three major work streams are: (1) Testing and installing new section of pipeline, (2) Installing temporary pig launchers/receivers and cleaning of the pipeline around incident location and (3) Removing temporary pig launcher/receivers and returning pipeline to service.
As of December 26, 2018, the testing and installation of the new section of pipeline has been completed. As previously posted, ETNG has commenced and continues its pigging operations to clean the pipeline around the incident location. ETNG is projecting the final pig runs and other commissioning activities, such as the purging and packing of the system, to be completed on December 29th. There are various factors that could potentially change the projected return to service date, such as, but not limited to: weather conditions and unforeseen events due to existing pipeline conditions that could lengthen the work schedule. Based on the current schedule and progress made to date, ETNG is now projecting returning to service approximately 300,000 Dth/d of capacity thru Dixon Spring on DECEMBER 30, 2018.
Looking Ahead: ETNG will continue to provide updates on its progress until the 3100 line has been restored to full capacity. ETNG is committed to prioritizing the work in a safe and efficient manner in order to increase system capacity as quickly as feasible.
Pipeline Conditions – Increasing Linepack in Advance of Weather
EPNG is concerned about the winter weather forecast to move into the Permian and San Juan basins Friday afternoon into Saturday morning and the potential for a loss of supply due to freeze offs. EPNG will be maintaining higher linepack until the winter weather moves out of the supply basins. Drafting of the system will undermine EPNG’s ability to increase and maintain linepack in advance of the potential supply underperformance.
Delivery point operators are encouraged to review their scheduled supplies to ensure that they are aligned with their flowing quantities.
Supply operators are encouraged to maintain their deliveries into the EPNG system at their scheduled rates.
Underperformance caps will be placed on non-performing supplies.
FORCE MAJEURE – COMPRESSOR STATION 760 – LIFTED
KMLP has completed repairs at Compressor Station 760 in Acadia Parish, Louisiana (CS 760). Therefore, effective for gas day Thursday, December 27, 2018, Intraday 1 Cycle and continuing thereafter, the force majeure will be lifted and flow will resume to normal operations. All transport services are available.
MAIN LINE UTILIZATION SPW
Due to the potential for maximum utilization of northbound firm Main Line capacity causing a potential supply deficiency in the Market Zone, MRT is issuing a System Protection Warning (SPW) effective 9:00 a.m. Saturday, December 29, 2018 and continuing until further notice.
1) MRT may not schedule any IT or AOR volumes for delivery north of Glendale.
2) Firm volumes may be limited to their primary direction of flow on the system north of Glendale.
3) MRT may not schedule volumes that result in a daily short position in either the Market or Field Zones.
4) The use of imbalance positions may not be scheduled.
5) Pool transfers will not be permitted from MRT s Field Zone to its Market Zone.
6) Customers with primary delivery points in the Field Zone north of the Glendale Compressor station and a receipt point that utilizes South to North transportation, will be required to nominate and source all, or a portion of, their total nomination at primary receipt points and/or at available Market Zone supply locations, not to exceed applicable maximum receipt point quantities in order to support their primary deliveries.
7) Shippers whose firm transportation contracts have Texas Gas Boardwalk ( Boardwalk ) and/or EGT Olyphant ( Olyphant ) and/or Noark listed as primary receipt points, must schedule the full amount of their primary receipt point quantity each of those points or, if the primary receipt point is Boardwalk and/or Olyphant, at an alternative Main Line receipt point that is north of their primary receipt point (Olyphant and/or Noark) if they desire to fully utilize their contract MDQ. Shippers may elect to forego nominating their full primary receipt point quantity at any/all of these points, however, such shipper’s maximum scheduled and confirmed contract quantity shall be limited to their contract MDQ less any primary receipt point quantity at Boardwalk and/or Olyphant and/or Noark that is not scheduled and confirmed.
Shippers whose deliveries are affected by any of the Seven (7) conditions above are encouraged to source supply at their primary receipt points, MRT’s East Line, MoGas, or reduce applicable delivery volumes.
Failure to comply with this SPW may result in Customers being issued an individual OFO. Nominations will be confirmed and scheduled in accordance with MRT s Tariff.
SEGMENT 11 – CS 104 – FORCE MAJEURE
Natural is experiencing electrical issues at Compressor Station 104 (CS 104), located in Barton County, Kansas (Segment 11 of Natural’s Midcontinent Zone). As a result, Natural is required to reduce the maximum operating capacity through CS 104. This is a Force Majeure event that limits Natural’s throughput capacity northbound through CS 104.
The scheduling constraint will be at CS 104; therefore, any gas received south of CS 104 for delivery north of CS 104 will be impacted for the duration of this outage. For scheduling purposes, the Midcontinent Pool (LOC 25078) is located south (upstream) of the constraint. Additionally, firm transportation nominated from receipt points south of CS 104 (including the Midcontinent Pool) and transports associated with withdrawals from all Amarillo Storage points will be impacted. Receipt points north of CS 104 will not be impacted.
As such, effective for gas day, Friday, December 28, 2018, Timely Cycle and anticipated to continue until further notice,Natural will schedule Primary Firm and Secondary in-path Firm transports to no less than 75% of contract MDQ through CS 104. Actual nomination levels and changes in pipeline conditions could result in changes to the percentages scheduled (lower or higher) on subsequent gas days. AOR/ITS and Secondary out-of-path Firm transports continue to not be available.
The stated scheduling percentage is based upon the current level of firm capacity contracted for during this outage and is subject to change based upon operational conditions and Shipper utilization. Permian Zone delivery points will be available as an alternative. The Trailblazer Gage (LOC 902900), Rex Jefferson (LOC 42499), and Northern Border Harper (LOC 908090) receipt points, as well as other supply points downstream of this constraint will also be available.
Southern Star Central Gas Pipeline:
Winter Weather Advisory – Effective December 28, 2018 Cold weather is being forecasted across much of the Southern Star system beginning Friday, December 28, 2018, through Sunday, December 30, 2018. Southern Star is issuing a weather advisory effective gas day Friday, December 28, 2018, and requests that operators and shippers monitor weather conditions and ensure their business plans consider the temperatures forecasted. Southern Star will issue underperformance notices to each point operator not delivering the scheduled quantities they had confirmed. Southern Star will unilaterally reduce scheduled quantities per the tariff to match actual flow if the delivering operator does not remedy the underperformance in accordance with the notice.
Transwestern Pipeline Company:
Pipeline Conditions – Low Line Pack – Cold Weather
Transwestern is working to maintain and/or increase current line pack. This notice is due to cold weather moving into the Permian and the San Juan basins this week.
Correspondingly, Transwestern plans to issue Underperformance Cut Notices to Receipt Point Operators that are flowing less gas into Transwestern than scheduled.
No Make-Up Deliveries or over burns due to operational concerns related to
maintaining adequate line pack.
If you have any questions, please contact Gas Control or your Marketing
Representative.
Taking a look ahead to temperatures in the first week of January, the National Weather Service six-to-ten day forecast shows below average temperatures across much of the Midwest and Mid-continent regions with normal temperatures across the Great Lakes and Northeast. The West Coast and Southeast may see slightly warmer temperatures than average.
Thank you for reading GasNewsOnline.com! Have a safe weekend, and a HAPPY NEW YEAR!
Author Methane1Posted on December 27, 2018 December 27, 2018 Categories Gas Business News, Gas Pipeline EBB, Gas weatherTags Algonquin Gas Transmission, Colorado Interstate Gas, East Tennessee Natural Gas, El Paso Natural Gas, Kinder Morgan Louisiana Pipeline, Mississippi River Transmission, National Weather Service, Natural Gas Pipeline Company of America, Southern Star Central Gas Pipeline, Transwestern Pipeline, US Energy Information Administration
Like George Bailey on the bridge in It’s A Wonderful Life, the natural gas business is hoping for a wintertime miracle to give another boost to natural gas prices for the coming year.
Welcome back to GasNewsOnline.com! We take care of wrapping up the packages of natural gas news and gas pipeline bulletin board postings for you – all for FREE! Ho, Ho, Ho!
Before we take a look at a large number of critical notices from the interstate pipeline companies, let’s check out some of the latest natural gas news today:
From the US Energy Information Administration‘s “Weekly Natural Gas Storage Report“, working gas in storage decreased by 141 Bcf from the previous week. Natural gas stocks were 720 Bcf or 20.6% below the five-year average.
Oklahoma Gas & Electric, the utility subsidiary of OGE Energy Corp., announced today that it will acquire two existing power plants to meet customers’ energy needs. The plants will replace capacity currently provided by power purchase contracts set to expire in 2019.
The company announced it will acquire the Shady Point plant near Poteau, Oklahoma, and the Oklahoma Cogeneration plant in Oklahoma City.
The Shady Point facility is a 360 MW coal- and natural gas-fired plant utilizing circulating fluidized bed boilers that produce lower emissions due to their design features and emissions controls.
The Oklahoma Cogeneration facility is a 146 MW natural gas-fired combined-cycle plant.
The company will pay approximately $53 million for the two plants, which currently serve OG&E customers.
“In the past five years, we’ve completed several critical projects that advance our commitment to deliver energy reliably and affordably to customers in an environmentally responsible way. Today’s announcement builds on that commitment,” said OGE Energy Corp. Chairman, President and CEO Sean Trauschke. “Our diverse energy portfolio of natural gas, wind, solar and coal gives us the versatility to meet a variety of economic and environmental needs. The result is our electric rates are 29 percent below the national average, which is a driver of economic development, and OGE is among industry leaders in emissions reduction performance.
ENGIE Resources today announced the acquisition of Plymouth Rock Energy based in Woodmere, NY. The transaction, which has received approval from the Federal Energy Regulatory Commission and became effective December 19, 2018, will enable ENGIE Resources to expand its natural gas and electricity presence in seven states and by more than 20,000 customers.
The combined organization expects to benefit from complementary products, geographies, and systems in addition to shared information technology and billing and service economies.
The interstate gas pipeline network is getting ready for the long Christmas break by posting a number of critical notices to shippers and customers. Let’s take a look:
During the effectiveness of this OFO, all parties must be balanced such that actual deliveries of gas out of the system must be equal to or less than scheduled deliveries. The penalty shall apply to each dekatherm of actual delivery quantities that exceeds the greater of 4,000 Dth or 104% of scheduled delivery quantities. The penalty will be equal to three times the daily Platts Gas Daily “Daily Price Survey” posting for the High Common price for”Algonquin, city-gates” for the day on which such violation occurred as indicated in AGT’s General Terms and Conditions Section 26.8. In addition, AGT will not permit retroactive nominations to avoid an OFO penalty.
Effective December 20, 2018 for the ID1 cycle, the Kinder Morgan La. interconnect, Meter 4206 is now designated as bidirectional and available for delivery nominations on Columbia Gulf Transmission, LLC (CGT). This meter is located in Evangeline Parish, LA on CGT’s Mainline.
Dominion Energy Questar Pipeline’s fuel reimbursement rate is changed for January 1,2019 from 1.87% to 1.57% pending FERC approval by the end of December. If there are any changes to the rate, the approved rate will be reposted.
Line 3100 Outage Update
Enbridge is working with PHMSA towards a timely in-service of East Tennessee Natural Gas’ (ETNG) 22-inch natural gas pipeline impacted by the incident that occurred in Pleasant Shade, Tennessee, on December 15, 2018.
Safety is a fundamental principle in everything we do and we are ensuring all construction and restoration operations are completed safely. We continue to refine our return to service plan, and currently do not have an estimated time of restoration.
Enbridge is committed to bringing the affected section of its East Tennessee Natural Gas system back to operation in a safe manner. We will provide further updates as future milestones are achieved or as circumstances warrant.
Pipeline Conditions – Weekend Linepack Concerns
Currently EPNG linepack is within acceptable limits going into the holiday weekend. However, EPNG is concerned that the forecasted milder weather across our service area could result in a high linepack situation.
Customers are encouraged to review their transport to ensure that their flowing quantities are aligned with their scheduled supplies.
Delivery point operators are encouraged to take gas according to their scheduled quantities. If the situation warrants, EPNG will declare an SOC for a PACK condition.
Payback to the system, such as Make-Up Receipt (MR) transactions, may be limited or denied due to operational concerns related to the potential for a high linepack condition.
REVISED PLND BYARS LAKE MAIN
New Information Posted December 19th, 2018
This Operational Alert is being issued pursuant to Section 20, GT&C, of EGT’s Tariff to notify shippers of planned maintenance at EGT s Byars Lake Compressor Station.
Effective February 6, 2019, at 9:00 a.m. and continuing through February 7, 2019 (previously January 9 through 10), EGT will conduct planned maintenance on its Byars Lake Compressor Station, located in McClain County, Oklahoma and in EGTs West 2 Pooling Area. During this maintenance, capacity through EGT’s Allen Compressor Station will be limited to approximately 780,000 Dth/d; point operators will experience higher pressure.
Based on current nominations, EGT expects impacts to its services, including potential impacts to firm service. During the planned maintenance, shippers whose receipts are in the West 1 and West 2 pooling areas West of the Allen Compressor Station should nominate point to point in order to maintain the highest priority level of service.
Olla (Louisiana) Compressor Station Maintenance – Update
Effective date: December 20, 2018 End Date: December 28, 2018
For the Marksville Deliveries Scheduling Group, capacity could be impacted by as much as 100,000 dth/d for the duration of the maintenance.
In an effort to provide timely and useful information that may impact customers’ decisions regarding nominated volumes, and to assist shippers in scheduling their transportation and storage services, Northern is providing advance notice of the Carlton Sourcing Obligation, System Underrun Limitation (SUL), and System Overrun Limitation (SOL) for the holiday weekend.
Based on temperatures that are currently forecast for the Market Area throughout the holiday weekend, the following system conditions will be in effect to ensure adequate line pack and delivery pressures.
The Carlton Sourcing Obligation will be as follows:
Gas Day Saturday, December 22, 2018, will be 0%
Gas Day Sunday, December 23, 2018, will be 0%
Gas Day Monday, December 24, 2018, will be 0%
Gas Day Tuesday, December 25, 2018, will be 0%
Gas Day Wednesday, December 26, 2018, will be 0%
SUL and SOL status for both the Market and Field Areas will be as follows: No SUL or SOL
Holiday Weekend Temperatures Projected to be Warmer-Than-Normal
The likelihood of storage injection allocations is at a higher probability for the extended holiday weekend due to the forecast of warmer than normal temperatures. These conditions could lead to the allocation of interruptible storage injections, including firm deferred delivery overrun injections.
Although Northern does not anticipate calling an SUL, Northern may be required to allocate overperforming receipt points and/or underperforming delivery points located in the Permian basin to actual flowing volumes during an intraday nomination cycle in order to maintain adequate supply/market balance. As performance improves at these receipt and delivery points, allocations would be lifted.
Effective December 21-23, 2018, Jackson Prairie will be undergoing maintenance. Nominations that net to an injection or withdrawal of 50,000 Dth/d will be accepted. Northwest requests that customers stay on rate to avoid the issuance of an Entitlement.
Northwest will schedule up to 10,000 Dth at $0.10 for both Park and Loan at JP for December 21-23.
Northwest is NOT allowing interruptible in or out of JP December 21-23.
Northwest is asking Shippers to voluntarily reduce nomination through the Rangely compressor station to avoid the issuance of an OFO over the holidays. Operational capacity is 370,000 Dth/d. If nominations exceed 370,000 Dth/d Northwest could issue an OFO.
Northwest encourages you to continue scheduling your supply so that sufficient gas is being delivered to Northwest to cover your market.
Northwest Pipeline reserves the right to cut secondary gas to protect the operational integrity of its pipeline. This includes cutting secondary gas at any compressor in a constrained corridor; moving balancing gas to and from Clay Basin and Jackson Prairie; or to minimize OFOs for primary irm shippers.
PG&E – California Gas Transmission:
Due to the completion of maintenance on Line 300 A/B, pipeline inventory limits will be restored to the following ranges starting on today’s gas day, December 20, 2018:
Total System Demand above 2,800 MMcf will change back to 4,350-4,000 MMcf from 4,200-3,850 MMcf
Total System Demand at 2,800 MMcf or below will change back to 4,300-3,900 MMcf from 4,150-3,750 MMcf.
Line Segment 130 Force Majeure (UPDATE #13):
Southern Star Central Gas Pipeline (Southern Star) posted a Force Majeure Update on Line Segment 130 Tuesday, June 19, 2018. Southern Star continues working to fully restore service for Line Segment 130.
Additional work has been completed, Effective TIM Cycle Gas Day December 20, 2018, and Southern Star will increase capacity at the Kansas Hugoton Receipt constraint to 383,000 Dth/d.
TE Imbalance Notice – UPDATE
As previously posted, Texas Eastern (TE) has limited operational flexibility to manage imbalances. As result, effective immediately, TE requires all delivery point operators in Market Area Zones M1-24 and M2-24 to keep actual daily takes out of the system equal to or less than scheduled quantities regardless of their cumulative imbalance position unless otherwise coordinated with your operations account representative. All receipt point operators in Market Area Zones M1-24 and M2-24 are required to keep actual daily receipts into the system equal to or greater than scheduled quantities regardless of their cumulative imbalance position unless otherwise coordinated with your operations account representative.
Additionally, TE requires all shippers and point operators in Access Area Zones STX, ETX, WLA and ELA and Market Area Zone M1-30, M2-30 and M3 to carefully review demand for gas and schedule gas consistent with daily needs and to tender and receive gas consistent with confirmed nominations regardless of their cumulative imbalance position unless otherwise coordinated with your operations account representative.
Correspondingly, effective immediately, the previously posted imbalance notice is no longer in effect.
Trailblazer Pipeline:
TRAILBLAZER MECHANICAL ISSUE–COMPRESSOR STATION 603
Trailblazer Pipeline Company LLC (“Trailblazer”) has recently identified a mechanical issue with one of the two compressor units at Compressor Station 603. The unit is currently unavailable and is not expected to be available until early April 2019. At this time, secondary firm quantities, as well as ITS/AOR are at risk of not being scheduled.
Trailblazer will post updates as additional information becomes available.
Subject: Operational Flow Order – Imbalance
Beginning: Friday, December 21, 2018 and until further notice
OFO Areas: Zones 4, 5, and 6
Tolerance %: 10% for gas Due from Shippers or Due to Shippers
The National Weather Service has posted its January, 2019 temperature forecast. The picture shows average to slightly colder than average temperatures across the central and eastern portions of the United States. The Rockies and West Coast will again see warmer than average weather.
Have a very MERRY CHRISTMAS and enjoy the holiday season! Please tell a friend in the natural gas transportation business about GasNewsOnline.com! Subscribe to our FREE audio podcasts on iTunes.
Author Methane1Posted on December 21, 2018 December 21, 2018 Categories Gas Business News, Gas Pipeline EBB, Gas weatherTags Algonquin Gas Transmission, Columbia Gulf Transmission, Dominion Energy Questar Pipeline, East Tennessee Natural Gas, El Paso Natural Gas, Enable Gas Transmission, ENGIE Resources, Gulf South Pipeline, National Weather Service, Northern Natural Gas, Northwest Pipeline, OGE Energy, PG&E, Southern Star Central Gas Pipeline, Texas Eastern Transmission, Trailblazer Pipeline, Transcontinental Gas Pipe Line Company, US Energy Information Administration
Welcome back to GasNewsOnline.com! We hope to give you a little holiday cheer with publicly available news and information about the natural gas business and a glimpse of warmer weather in the extended forecast for the week of Christmas.
First, let’s take a look at what is making news in the energy business:
The US Energy Information Administration published their weekly natural gas storage report today. Below is a summary of the report:
EIA Natural Gas Storage Data
Total (12/07/18): 2,914 Bcf
Net change: -77 Bcf
Year ago stocks: 3,636 Bcf
% change from year ago: -19.9
% 5-year avg stocks: 3,637 Bcf
% change from 5-year avg: -19.9 %
Cheniere Energy, Inc. announced Wednesday that the first commissioning cargo of liquefied natural gas (LNG) has loaded and departed from its Corpus Christi liquefaction facility in Texas, marking the first export of LNG from the state and from a greenfield liquefaction facility in the lower 48 states. The LNG was loaded on the LNG carrier Maria Energy, chartered by Cheniere Marketing, LLP.
“Exporting the first commissioning cargo of LNG from Texas demonstrates Cheniere’s ability to deliver projects safely and ahead of schedule, including the first greenfield LNG export facility in the lower 48 states,” said Jack Fusco, Cheniere’s President and CEO. “This milestone further reinforces Cheniere’s position as the leader in U.S. LNG, with a world-scale liquefaction platform that provides significant competitive advantages as we continue to execute on our growth strategy.”
The Corpus Christi liquefaction facility consists of three large-scale LNG production units — or trains — and supporting infrastructure, with an additional seven smaller trains proposed. The facility’s first train produced first LNG in November and is expected to reach substantial completion in the first quarter of 2019. Train 2 is expected to reach substantial completion in the second half of 2019, and Train 3 in the second half of 2021. The facility will also feature three LNG storage tanks with capacity of approximately 10.1 billion cubic feet equivalent and two marine berths.
In other energy news:
Houston-based Parker Drilling Company announced Wednesday that it has entered into a restructuring support agreement (“RSA”) with holders of the Company’s securities. To implement that agreement, Parker has voluntarily filed for Chapter 11 protection in the U.S. Bankruptcy Court for the Southern District of Texas.
The existing management team is expected to remain in place, and the Company expects to complete the restructuring process in the first quarter of 2019.
The Company anticipates that its cash flow and existing liquidity will be sufficient to support global operations during this period. The proposed Plan, which is subject to Court approval, reduces approximately two-thirds of funded debt and injects $95 million of new equity capital.
“Our operational results have continued to improve this year, and we anticipate new opportunities for profitable growth across our drilling and rental tools businesses. The steps we are announcing today will ensure that we have the appropriate capital structure to take advantage of these opportunities to strategically grow our assets, our global footprint, and our suite of products and services,” said Gary Rich, Chairman, President and Chief Executive Officer.
The interstate gas pipeline grid is shifting from an early winter mode of operation and providing the industry a brief chance to replenish storage levels as some warmer weather is upon us. Let’s take a look at some of the critical postings:
SW Area Capacity Restriction
New: ANR will begin unplanned compressor maintenance at its Mooreland Compressor Station located in Woodward County, Oklahoma, in the Southwest Area (Zone 4). During the period of December 13th, 2018 through January 13th, 2019, ANR Shippers can expect higher than normal pressures in the pipeline segment upstream of the Mooreland Compressor Station.
Effective start of gas day, Friday, December 14, 2018, PL-1 restrictions will be lifted (supersedes Notice ID: 209910).
Additionally, Dominion is lifting capacity restrictions on its Northern, TL-400, and Oakford operating areas on Friday, December 14.
In-line inspection results for JL47 indicate that remediation is necessary on a portion of the pipeline. Dominion Energy Questar Pipeline (DEQP) has scheduled the repair for December 18, 2018. To facilitate the work, Altamont MAP 145, Randlett Tap MAP 419, Pleasant Valley Tap MAP 413 and Brundage Mtn Tap MAP 144 will all need to be shut-in and nominations will not be accepted for cycles Timely through ID2 with volumes, returning to normal in cycle ID3.
ETNG Operational Flow Order – East of Boyds Creek — LIFTED
Effective today (Thursday, December 13), East Tennessee Natural Gas (ETNG) is lifting the Operational Flow Order for meters east of Boyds Creek issued on December 5, 2018.
ETNG has limited operational flexibility to manage imbalances. ETNG requires all delivery points located east of Boyds Creek to carefully review demand for gas and schedule gas consistent with daily needs and to tender and receive gas consistent with confirmed nominations regardless of their cumulative imbalance position unless otherwise coordinated with your operations account representative.
Additionally, ETNG requires all delivery points on its 3200 line located between Tracy City to Topside and on the 3500 line to keep actual daily takes out of the system equal to or less than scheduled quantities regardless of their cumulative imbalance position. All receipt point operators on the 3200 Line between Tracy City to Topside and on the 3500 line are required to keep actual receipts into the system equal to or greater than scheduled quantities regardless of their cumulative imbalance position.
The Force Majeure event that was declared on December 7, 2018 (Reference Critical Notice 603991) at Dimmitt Compressor Station will be lifted effective for Gas Day December 13, 2018 Cycle 3 (Intraday 1). The net capacity at AMAR N returns to 283,100 dekatherms consistent with El Paso Natural Gas Company’s December Maintenance Report (Reference latest Maintenance Notice 603975).
This Operational Alert is being issued pursuant to Section 20, GT&C, of EGT Tariff to notify shippers of planned maintenance at EGT’s Byars Lake Compressor Station.
Effective January 9, 2019, at 9:00 a.m. and continuing through January 10, 2019, EGT will conduct planned maintenance on its Byars Lake Compressor Station, located in McClain County, Oklahoma and in EGT’s West 2 Pooling Area. During this maintenance, capacity through EGT’s Allen Compressor Station will be limited to approximately 780,000 Dth/d. Point operators will experience higherpressure.
Based on current nominations, EGT expects impacts to its services, including potential impacts to firm service. During the planned maintenance, shippers whose receipts are in the West1 and West 2 pooling areas West of the Allen Compressor Station should nominate point to point in order to maintain the highest priority level of service.
Florida Gas Transmission:
FGT is performing planned pipeline maintenance upstream of FGT Compressor Station 10. This maintenance began on December 3, 2018 and is to be completed by the end of gas day December 21, 2018. During this maintenance FGT will schedule up to 1,100,000 MMBtu/day through Station 10. During normal operations, FGT schedules up to 1,300,000 MMBtu/day through Station 10.
FGT is performing maintenance on pipe near the FGT/Tennessee Carnes Interconnect (POI 10258). This maintenance began on December 3, 2018 and is to be completed by the end of gas day December 21, 2018. During this maintenance zero volumes will be scheduled at the FGT/Tennessee Interconnect. During normal operations, FGT schedules up to 60,000 MMBtu/day through the FGT/Tennessee Carnes Interconnect.
Compression associated with the Sabine Pass Expansion Project, (Docket No. CP 17-22-00), is expected to go into service on December 13, 2018. KMLP will begin assessing fuel gas on the “North to South Transportation Path” as defined in Section 1.30 of KMLP’s General Terms and Conditions.
Effective December 13, 2018, the Fuel Gas Total Reimbursement Percentage will increase from 0.00% to 0.72%. This percentage was approved by FERC on November 27,2018 in KMLP’s filing in Docket No. RP19-197-000. The Unaccounted For Gas Total Reimbursement Percentage remains at 0.00%. Shippers are advised to schedule quantities with the revised percentages.
Natural has experienced horsepower issues on the Amarillo mainline at Compressor Station 103 (CS 103),located in Ford County, Kansas (Segment 11 of Natural’s Midcontinent Zone). This is a Force Majeure event that will require Natural to reduce temporarily the maximum operating capacity northbound through CS 103 during this restriction.
The scheduling constraint will be at CS 103; therefore, any gas received south of CS 103 for delivery north of CS 103 will be impacted. The Midcontinent Pool (PIN 25078) is located south (upstream) of the constraint. Additionally,transports associated with storage withdrawals will be impacted.
As such, effective for gas day Thursday, December 13, 2018, Timely Cycle, and anticipated to continue until further notice, Natural will schedule Primary Firm and Secondary in-path Firm transports to no less than 82% of contract MDQ through CS 103. Actual nomination levels and changes in pipeline conditions could result in changes to the percentages scheduled (lower or higher). AOR/ITS and Secondary out-of-path Firm transports continue to not be available during this event.
Effective for the Gas Day of Friday, December 14, 2018, and until further notice, Tennessee Gas Pipeline, LLC (“Tennessee”) is lifting the Daily Critical Day 1 OFO for all areas east of STA 219 on the 200 Line (including the Niagara Spur) and on the 300 Line. However, it is imperative that customers continue to match physical flows with scheduled volumes in this area in order to avoid the issuance of any additional actions in these zones.
Texas Eastern Transmission (TE) has experienced an outage impacting capacity through its Bernville compressor station in Pennsylvania. This outage results in a capacity of approximately 2,947,000 Dth/d through the Bernville compressor station beginning on Gas Day December 14, 2018. TE anticipates the outage will last for approximately 2-3days.
Effective today (Thursday,December 13), Texas Eastern (TE) is lifting the Market Area Zone M3 Operational Flow Order effective on December 4, 2018.
As previously posted, TE has limited operational flexibility to manage imbalances. TE requires all delivery point operators in Market Area Zones M1-24, M2-24 and M3 to keep actual daily takes out of the system equal to or less than scheduled quantities regardless of their cumulative imbalance position unless otherwise coordinated with your operations account representative. All receipt point operators in Market Area Zones M1-24, M2-24 and M3 are required to keep actual daily receipts into the system equal to or greater than scheduled quantities regardless of their cumulative imbalance position unless otherwise coordinated with your operations account representative.
Additionally, TE requires all shippers and point operators in Access Area Zones STX, ETX, WLA and ELA and Market Area Zone M1-30 and M2-30 to carefully review demand for gas and schedule gas consistent with daily needs and to tender and receive gas consistent with confirmed nominations regardless of their cumulative imbalance position unless otherwise coordinated with your operations account representative.
Furthermore, due to impending colder weather, in order to maintain the operational integrity of the system TE is issuing an Operational Flow Order (OFO) pursuant to Section 4.3 of the General Terms and Conditions of TE’s FERC Gas Tariff effective 9:00AM CCT Monday, December 17, 2018 to all delivery parties, with the exception of those governed by a FERC gas tariff, in Texas Eastern’s Market Area Zone M3.
During the effectiveness of this OFO, all parties must be balanced such that actual deliveries of gas out of the system must be equal to or less than scheduled deliveries out of the system. The penalty shall apply to each dekatherm of actual delivery quantities that exceeds the greater of 2,000 Dth or 102% of scheduled delivery quantities. The penalty will be equal to three times the arithmetic average of daily Platts Gas Daily “Daily Price Survey” posting for the High Common price for the geographical region, as defined in Section 8.5(a) of the General Terms and Conditions of TE’s FERC Gas Tariff for the day on which such violation occurred. In addition, TE will not permit retroactive nominations to avoid an OFO penalty.
According to Santa’s friends at the National Weather Service, the eight-to-ten day temperature forecast is showing that most of the United States may see normal to above-average readings heading into Christmas! Ho, Ho, Ho, indeed!
Enjoy a weekend of fewer operational flow orders on the pipelines for a change!
Thanks for visiting GasNewsOnline.com! Please tell a friend in the gas transportation and scheduling/trading business about us. Our information is FREE!
Author Methane1Posted on December 13, 2018 December 13, 2018 Categories Gas Business News, Gas Pipeline EBB, Gas weatherTags Cheniere Energy, Dominion Energy Transmission, East Tennessee Natural Gas, El Paso Natural Gas, Enable Gas Transmission, Florida Gas Transmission, Kinder Morgan Louisiana Pipeline, National Weather Service, Natural Gas Pipeline Company of America, Parker Drilling Company, Tennessee Gas Pipeline, Texas Eastern Transmission, US Energy Information Administration | cc/2020-05/en_middle_0078.json.gz/line1206 |
__label__wiki | 0.973226 | 0.973226 | Iran plane crash: Tributes to three British nationals killed
Facebook/LinkedIn
Mohammed Reza Kadkhoda Zadeh, Sam Zokaei and Saeed Tahmasebi were all on board
Tributes have been paid to three British nationals who died when a Ukrainian plane crashed in Iran.
Mohammed Reza Kadkhoda Zadeh, who owned a dry cleaners, BP engineer Sam Zokaei and PhD student and engineer Saeed Tahmasebi were all on board the flight.
They were among the 176 people from seven countries who died in the crash.
Ukraine International Airlines flight PS752 crashed just after taking off from Imam Khomeini airport at 06:12 local time (02:42 GMT).
The airline said the plane underwent scheduled maintenance on Monday.
A Downing Street spokesman said the UK was “working closely with the Ukrainian authorities and the Iranian authorities” over the crash, and there was “no indication” the plane was brought down by a missile.
As well as the three Britons, the victims in the crash included 82 Iranians, 63 Canadians, 11 Ukrainians – including all of the crew, 10 Swedes, four Afghans and three Germans, Ukraine foreign affairs minister Vadym Prystaiko said.
Rescue teams have been sent to the crash site but the head of Iran’s Red Crescent told state media that it was “impossible” for anyone to have survived the crash.
Ukrainian passenger plane crashes in Iran
Tributes were paid locally to Mr Kadkhoda Zadeh, 40, who ran a neighbourhood dry cleaners in Hassocks, West Sussex, and had a nine-year-old daughter.
Steve Edgington from the pet shop next door said he had known Mr Kadkhoda Zadeh for 14 years, and described him as a lovely, hardworking man who was good at his job and loved by staff.
Savvas Savvidis, 36, who rented a room in Mr Kadkhoda Zadeh’s home in Brighton, said he was a “super-nice person”.
“It’s so sad. Before he left we had a conversation, he told me that he spent all his life working, working really hard, and now finally he wants to start to enjoy life a bit more.”
Mr Savvidis described Mr Kadkhoda Zadeh as a humble man who loved his daughter very much.
The dry cleaners closed on Wednesday, with neighbouring businesses telling the BBC that staff were too upset to stay open.
A sign on the window of Mr Kadkhoda Zadeh’s dry cleaners in Hassocks
Meanwhile, in a statement, BP said “with the deepest regret” that its employee Mr Zokaei, 42, from Twickenham, was among the passengers.
Mr Zokaei had been on holiday. He had worked for BP for 14 years and was based at the company’s site in Sunbury-on-Thames in Middlesex.
“We are shocked and deeply saddened by this tragic loss of our friend and colleague and all of our thoughts are with his family and friends,” BP said.
A friend of Mr Zokaei, who did not wish to be named, told the BBC they were “still in shock”.
“He was a highly accomplished person. Very clever and very friendly. Always smiling and full of positive energy. He will be sorely missed.
“He was always trying new adventures. He cycled and toured Europe on bikes a few times. He also loved travelling to interesting far out places.”
Also killed was Mr Tahmasebi, 35, who worked as an engineer for Laing O’Rourke in Dartford.
Last year, Mr Tahmasebi married his Iranian partner, Niloufar Ebrahim, who was also listed as a passenger on the plane.
“Everyone here is shocked and saddened by this very tragic news,” said Laing O’Rourke.
“Saeed was a popular and well respected engineer and will be missed by many of his colleagues. Our thoughts are with his family and friends at this most difficult time and we will do all we can to support them through it.”
‘Humble and generous’
Mr Tahmasebi – whose full name was Saeed Tahmasebi Khademasadi – was also a part-time PhD student at Imperial College London’s Centre for Systems Engineering and Innovation.
A spokeswoman for the university said: “We are deeply saddened at this tragic news. Saeed Tahmasebi Khademasadi was a brilliant engineer with a bright future.
“His contributions to systems engineering earned respect from everyone who dealt with him and will benefit society for years to come.
“He was a warm, humble and generous colleague and close friend to many in our community. Our thoughts and sincere condolences are with Saeed’s family, friends and colleagues, as well as all those affected by this tragedy.”
At Prime Minister’s Questions earlier, Boris Johnson and Labour leader Jeremy Corbyn both said their thoughts were with the families of those killed.
A UK Foreign Office spokesman has said: “We are deeply saddened by the loss of life in the plane crash in Iran overnight.”
They said it was “urgently seeking confirmation” about how many British nationals were on board and would be supporting any families affected.
Melinda Simmons, British ambassador to Ukraine, said her thoughts are with those affected.
Ukraine’s state aviation service has forbidden its national airlines from using Iranian airspace from Thursday, with the restrictions in place until an investigation into the cause of the crash has concluded.
Ukraine’s embassy in Tehran and Iranian state television both initially said technical issues caused the crash.
But the embassy later removed this statement and said any comment regarding the cause of the accident prior to a commission’s inquiry was not official.
Ukraine said its entire civilian aviation fleet would be checked for airworthiness and criminal proceedings would be opened into the disaster.
The country’s president warned against “speculation or unchecked theories regarding the catastrophe” until official reports were ready.
Flowers were laid outside the Canadian embassy in Kiev in remembrance of the 63 Canadians on board the flight
Ukrainian International Airlines said the flight disappeared from radar just a “few minutes” after take-off.
The Ukrainian national carrier said according to preliminary data there were 167 passengers and nine crew members on board but its staff were “clarifying the exact number”.
“The airline expresses its deepest condolences to the families of the victims of the air crash and will do everything possible to support the relatives of the victims,” a statement said.
The airline, which is investigating the crash, said the aircraft – a Boeing 737-800 – was built in 2016 and had its last scheduled maintenance on Monday.
There was no sign of any problems with the plane before take-off and the airline’s president said it had an “excellent, reliable crew”.
A statement from Boeing said its “heartfelt thoughts” were with all those affected following the “tragic event”.
There are several thousand Boeing 737-800s in operation around the world which have completed tens of millions of flights. They have been involved in 10 incidents, including this crash, where at least one passenger was killed, aviation safety analyst Todd Curtis told the BBC.
This is the first time a Ukraine International Airlines plane has been involved in a fatal crash.
replacement glass charlton
January 8, 2020 Glaziers Charlton Tags: British, crash, Iran, killed, nationals, plane, tributes Categories:
Man who robbed and murdered drug courier jailed
Brighton 1-1 Chelsea: Jahanbakhsh’s stunning effort earns Seagulls point
London’s City Hall provides Christmas meals for homeless
Labour leadership: Emily Thornberry to run for Labour leadership
Bathroom Glass Shelves Installation In Charlton, SE7
Bespoke Splashbacks Installation In Charlton, SE7
Boarding Up Charlton, SE7, 24 Hour Emergency Boarding Up
Coloured Splashbacks Installation In Charlton, SE7
Crushed And Cracked Ice Glass Repair In Charlton, SE7
Double Glazed Units Replacement In Charlton, SE7
Double Glazing Installers In Charlton, SE7
Double Glazing Repairs Charlton, SE7, 24 Hour Emergency Double Glazing Repairs
Double Glazing Window Handles Replacement In Charlton, SE7
Double Glazing Window Locks Replacement In Charlton, SE7
Emergency Glazing Charlton, SE7
Enclosures Glass Table Tops Installation In Charlton, SE7
Floating Glass Shelves Installation In Charlton, SE7
Glass Cutting Service In Charlton, SE7
Glass Fitters In Charlton, SE7
Glass Processing In Charlton, SE7
Glass Shelves Installation In Charlton, SE7
Glass Shower Screens Installation Charlton, SE7
Glass Splashbacks Installation In Charlton, SE7
Glass Wall Shelves Installation In Charlton, SE7
Glass Worktops Installation In Charlton, SE7
Glaziers Charlton, SE7, Glazing
Glazing Repairs In Charlton, SE7
Kitchen Splashbacks Installation In Charlton, SE7
Obscured And Privacy Glass Installation In Charlton, SE7
Painted Glass Splash Backs Installation Charlton, SE7
Polished And Beveled Edge Glass And Mirror Installation In Charlton, SE7
Replacement Glass Charlton, SE7, 24 Hour Emergency Replacement Glass
Safety Glass Installation In Charlton, SE7
Sandblasted Glass Installation In Charlton, SE7
Sash Window Repairs Charlton, SE7, 24 Hour Emergency Sash Window Repairs
Secondary Double-Glazing Installation In Charlton, SE7
Secondary Glazing Installation In Charlton, SE7
Splashbacks Installation In Charlton, SE7
Structural Glazing In Charlton, SE7
Toughened Safety Glass Installation In Charlton, SE7
UPVC Double Glazing Replacement Charlton, SE7
Window Repairs Charlton, SE7, 24 Hour Emergency Window Repairs | cc/2020-05/en_middle_0078.json.gz/line1208 |
__label__cc | 0.670175 | 0.329825 | Home > Products > Bearings > Dual-Purpose Bearings
Dual-Purpose Bearings
The Hallite 533 glass-filled polyamide bearing is designed to provide an extremely effective, hard wearing, and easy-to-use bearing solution for reciprocating, oscillating, and slow rotary movement applications. The Hallite 533 is capable of withstanding high side loads and preventing metal-to-metal contact between the piston and the bore or the rod and the gland. The PA…
Max speed 5m/sec
Design The Hallite 533G bearing is a version of the Hallite 533, which has axial grooves to allow fluid bypass. This bearing is most often used in hydraulic ram application where such a feature is required. Like the standard 533 bearing the 533G is compatible with hydraulic and lubricating oil. It is not suitable for…
Design The 533 Piston bearing is molded with 33% heat stabilized, glass reinforced Nylon 66. The design of the 533T is a “t-shape” cross section which allows full bearing contact while also offering the advantage of a t-groove form of retention that does not require side land near the working surface of the wear band….
The Hallite 540 bearing is a high performance thermoplastic molding material reinforced with a mineral filler to provide the mechanical properties required by Dynamic Seals. The Type 540 material is used in Dynamic Seals’ precision bearing rings, both the heavy wall machined bearings used as replacements for bronze, cast iron, powered metal and phenolic materials…
The Hallite 87 bronze-filled PTFE bearing strip is designed to provide an extremely effective, hard wearing, and easy-to-use bearing solution for lubricated or non-lubricated reciprocating, oscillating, and slow rotary movement applications. Hallite recommends using the Hallite 87 in light-duty applications and particularly for small diameters where the flexibility of the strip makes installation into a… | cc/2020-05/en_middle_0078.json.gz/line1217 |
__label__wiki | 0.718213 | 0.718213 | Hike BC
The National Hiking Trail: The Footpath across Canada
Contact Hike BC
Not-for-Profit Organizations
Lower Goat River and East Twin Trails
Upper Goat River Trail
Sunshine Coast Trail
Lower Goat River / East Twin
Upper Goat River
1861 Gold Rush Pack Trail
Blackwater Trail
Grease Trail
Trail Triage
Fraser Headwaters Alliance
Hike Canada
Wonderful blog covers year-round hiking opportunities on the Sunshine Coast
Posted on 2014-11-19 by nationalhikingtrail
http://sunshinecoastcanada.com/blog
History of the National Hiking Trail of Canada – British Columbia
Hike BC and the National Hiking Trail
In 1969 at a Boy Scout Convention in Ottawa an idea was born: Why not create a ‘footpath’ across Canada. So began the start of the National Hiking Trail. This was the first foot trail to begin to cross Canada.
By 1971, the National Trail Association of Canada was created (now Hike Canada). Slowly the new footpath began to expand across Canada. Doug Campbell of Canmore, Alberta, headed up the effort.
In the late 1980s, the BC portion of the National Hiking Trail was proposed for British Columbia across the southern portion of the Province. This effort did not get off the ground beyond drawing lines on maps.
A second attempt was initiated in 1998 when Hike Canada approached the Federation of Mountain Clubs of BC to search out a route across BC. The FMCBC looked for areas that were primarily Crown Land.
By the year 2000, a rough route was proposed from Bella Coola across to the Rockies where it would link up with the trail in Banff National Park. This route included several heritage trails including the Alexander Mackenzie Heritage Trail (It was one of the First Nation trading trails commonly referred to as a “Grease” Trail), Collins Telegraph Trail, 1861 Gold Rush Pack Trail, and the Goat River Trail. Heritage and historic trails are included in the mission statement of Hike Canada.
From the Alberta border to The Fraser River the route is large undeveloped and only a route, There are short sections with existing trails but much is rugged bush and should be attempted only by skilled outdoor people People wanting to do this part of the route should contact Dave King of Hike B.C prior to attempting it as he is one of only a handful of people who have travelled this section.
Last year, members of the Fraser Headwater Alliance cleared the Goat River trail from the Fraser to border of Bowron Lakes Park leaving the trail in good shape. The section in and by the park needs marking and brushing. At this time there is no designated route from the Bowron Park headquarters to Barkerville and we recommend hikers follow the road connecting them.
The 1861 Goldrush trail to Keithly and Likely is in need of brushing. Most of the trial is easy to follow but the southerly end has been messed up by logging activity. The route from Likely to Quesnel remains ill defined but mostly follows the northerly side of the Quesnel River. There are sections, especially closer to Quesnel where the route follows existing trails.
Through Quesnel it is necessary to follow city trials and roads until about 15 km northwest of the town where one picks up the Collin’s Telegraph Trail. The telegraph trail to the Blackwater River (officially the West Road River) was fully cleared by Dwight Dodge last year and is reasonable shape.
The Alexander Mackenzie Heritage Trail has had some work done on it by personnel of Recreation Sites and Trails. While most of the trial is okay, there are sections which have become overgrown. Much of the trail is in an area hard hit by the Mountain Pine Beetle 7-8 years ago and now the dead pine is falling down so that is the major problem. A major challenge to hikers is the three or four crossings of the river if the water is up.
As the year 2000 approached, it became apparent that many clubs involved in the effort did not belong to the FMCBC and that a new non-profit organization was needed. Hike BC was founded to coordinate the development of the NHT in BC. The FMCBC has remained involved.
As the northern section of the trail began to come together by 2005, it was determined that a connection to the Lower Mainland, Vancouver Island, and Sunshine Coast was needed. Since a director of Hike BC resided in the Lower Mainland, he took on this task. Since 2005, a route has been established from Peace Arch to Tsawwassen through the communities of Surrey, White Rock, and Delta with the help of Metro Vancouver. Hike BC is also part of the South Surrey/Delta Greenway and Experience the Fraser project. The Sunshine Coast Trail from Powell River to Saltery Bay was included in 2005. This trail was built and is maintained by Powell River PAWS (Park and Wilderness Society). In 2010, the regional district of the Sunshine Coast-Squamish okayed the use of the trail they were developing from Earl’s Cove to Langdale. From there, one can catch a ferry to Horseshoe Bay where the Black Mountain trail starts for Cypress Provincial Park.
The local governments have endorsed the project enthusiastically. NHT trail markers have now been posted throughout these communities.
The National Hiking Trail has also been endorsed by the cities of Courtenay, Cumberland, Squamish, Quesnel, and Wells; and by the regional districts of Metro Vancouver, Sunshine Coast, and Cariboo; and by BC Parks though Cypress, Shannon Falls, and Squamish Chief Provincial Parks. Hike BC has a verbal agreement to use the Sea to Sky Trail from Squamish to Pemberton.
Working with the FMCBC since 1998 on a possible route on Vancouver Island has been the most challenging because of the private land issues. By 2005, a route had been worked out from Victoria to Port Hardy (where a ferry is available to Bella Coola). As mentioned previously, two communities gave their support in 2006 to this idea. Since that time, a non-profit organization, the Vancouver Spine Trail organization, has been formed to pursue this idea in conjunction with Hike BC. This project will take many years to complete.
Hike BC continues to negotiate agreements with local communities in order to complete the dream of a Footpath from Coast to Coast. A new and improved website is being developed. For now, check out www.nationaltrailofbc.ca.
On behalf of Hike BC,
Pat Harrison
Welcome To The National Hiking Trail of British Columbia
www.nationaltrailofbc.ca
Pat on Wonderful blog covers year-rou… | cc/2020-05/en_middle_0078.json.gz/line1225 |
__label__cc | 0.745898 | 0.254102 | 2012 GoldenSprint Challenge Invitational Best Male and Best Female athletes
Runners from area high schools and colleges competed at the Utah Olympic Oval March 9 in the first annual GoldenSprint Challenge Invitational track and field sprint event. Sprinters competed in 60 meter race and/or a 200 meter race.
The meet, sanctioned by the USA Track and Field Association, is the dream of Akwasi Frimpong, 2012 Dutch Olympic hopeful and UVU student. He hopes to inspire more youth to participate in sports – especially track and field. To kick off this goal, he partnered with the Utah Olympic Oval to put together this meet, and future plans are to make this an annual international meet to promote local and international athletes.
The name of the meet, “GoldenSprint,” is one of Frimpong’s nicknames he earned when racing as an illegal African immigrant in the Netherlands. His Dutch coaches gave him golden track shoes after his first Dutch National win.
The fastest men’s and women’s sprinters at the GoldenSprint Challenge followed Frimpong’s footsteps and took home the first GoldenSprint Spikes Trophies. Sarah Palmer, Dak Kleven, Tiera Hansen and Javier Coles gained this coveted honor. Frimpong received the award for being the best male athlete, but gave it away to the runner up, Javier Coles.
“I already have one and I want to inspire Coles to keep up the good work,” Frimpong said. “He was a great competitor and I hope this will inspire him to one day give away his golden spikes to inspire someone else.”
The GoldenSprint Challenge Invitational was a great success and Frimpong is fielding calls from coaches, athletes and sponsors to be involved next year.
“I want to promote sprinting and training in Utah, and involve local students, athletes and the community,” Frimpong said. “With the long winters in Utah, it’s important to be able to train indoors at the legendary Utah Olympic Oval. Plus, it’s a very fast track.”
Frimpong said he and his team would not have been able to put this event together without the following partners and sponsors: Utah Olympic Oval, Utah USATF Officials, Bonzy Design, Neways Inc., Alleviate, Acai Action, McGee’s Stamp and Trophy, Runner’s Corner and Carrabba’s Italian Grill. The Proceeds of the event will be donated this week to Special Olympics Utah.
2012 GoldenSprint Challenge Invitational best male and female athletes. Sarah Palmer, Dak Kleven, Tiera Hansen, and Javier Coles.
Results and other information concerning the annual GoldenSprint Challenge Invitational can be obtained by emailing goldensprintchallenge@gmail.com or visiting our website www.goldensprintchallenge.com.
← 2012 GoldenSprint Challenge Invitational
2012 GoldenSprint Challenge Invitational Donates to Special Olympics Utah → | cc/2020-05/en_middle_0078.json.gz/line1227 |
__label__wiki | 0.674768 | 0.674768 | Data Library Overview
GoodLands has curates and develops maps illuminating the Catholic Church’s people, presence, and impact around the world. The categories listed to the right pertain to select geo data sets and maps GoodLands has developed or is in the process of preparing for web launch.
Select sets can be explored in our GeoHub, which will be launched on September 22, 2019 during the Social Good Summit.
Data Categories:
(1) Boundaries (5) Climate and Environment (9) Property
(2) People and Presence (6) Aid and Emergency Resonse (10) Communications Infrastructure
(3) Leadership (7) Healthcare and Wellbeing
(4) Economic Development (8) Child Care and Care for Vulnerable People
Forum: Geospatial Infrastructure for the Catholic Community
Data Usage and Terms
Geodata Sets:
Diocesean Boundaries Province Boundaries Episcopal Conference Boundaries
Dioceses, Name in English Provinces, Name in English Diocese by Type
Dioceses, Name in Latin Episcopal Conference, Name in English Metadata Map: Data by Year
Principal Contributors
Most Recent Date of Update: September 2019
GoodLands’ polygon data layers, version 2.0 for global ecclesiastical boundaries of the Roman Catholic Church:
Although care has been taken to ensure the accuracy, completeness and reliability of the information provided, due to this being the first developed dataset of global ecclesiastical boundaries curated from many sources it may have a higher margin of error than established geopolitical administrative boundary maps. Boundaries need to be verified with appropriate Ecclesiastical Leadership. The current information is subject to change without notice. No parties involved with the creation of this data are liable for indirect, special or incidental damage resulting from, arising out of or in connection with the use of the information.
Chief Cartographer: Molly Burhans
Contributors: Jennifer Bell, Debra Burhans, Richie Carmichael, David Cheney (Catholic Hierarchy), Mark Deaton, Thomas Emge, Bob Gerlt, John Grayson, Jim Herries, Hugh Keegan, Andy Skinner, Mark Smith, Carol Sousa, and Alexander (Sasha) Trubetskoy.
Additional support with topology integration and information validation was generously provided by teams of software engineers and GIS professionals at Esri.
Global Diocesan Boundaries:
Burhans, M., Bell, J., Burhans, D., Carmichael, R., Cheney, D., Deaton, M., Emge, T. Gerlt, B., Grayson, J., Herries, J., Keegan, H., Skinner, A., Smith, M., Sousa, C., Trubetskoy, S. “Diocesean Boundaries of the Catholic Church” [Feature Layer]. Scale not given. Version 1.2. Redlands, CA, USA: GoodLands Inc., Environmental Systems Research Institute, Inc., 2016.
Using: ArcGIS. 10.4. Version 10.0. Redlands, CA: Environmental Systems Research Institute, Inc., 2016.
We referenced 1960 sources to build our global datasets of ecclesiastical jursidication. Often, they were isolated images of dioceses, historical documents and information about parishes. These sources can be viewed here:
https://docs.google.com/spreadsheets/d/11ANlH1S_aYJOyz4TtG0HHgz0OLxnOvXLHMt4FVOS85Q/edit#gid=0
The development of this data would not have been possible without the generous financial support of Esri, the WGR Foundation, and private donors.
Maintenance and hosting of this data was partially covered by The Porticus Foundation and Loyola Foundation between 2018 – mid-2019.
The Yale Saint Thomas More Center generously provided the support to acquire the hardware necessary for this project.
Additional support has been provided by private partners and pro bono contributions of data management hours.
If you are interested in sponsoring the continued availability and maintenance, server hosting, and public access of this data for $2000 / month at GoodLands please contact burhansm@good-lands.org – We also strongly encourage donations to support the hosting and maintenance of our partner at Catholic Hierarchy: http://www.catholic-hierarchy.org/
These data will be launched for public use on September 22, 2019, it protected under a Creative Commons Attribution-NoDerivatives 4.0 International.
Creative Commons Attribution-NoDerivatives 4.0 International:
This license is one of the more restrictive Creative Commons licenses. Users can share your dataset if they give credit to you, but they cannot make any additions, transformations or changes to your dataset under this license.
Liability Notice:
No parties involved with the creation of this data are liable for indirect, special or incidental damage resulting from, arising out of or in connection with the use of the information.
The Catholic Church’s People and Presence
Ecclesiastical Jurisdictional Geodata Sets:
Parishes per Diocese Secular Priests per Diocese Brothers per Diocese
Change in Parishes per diocese 2000 – 2016 Religious Priests per Diocese Catholics per Brother
Catholics per Diocese Catholics per Priest Population per Brother
Catholics per Parish Parishes per Priest Change in Number of Brothers 2000 – 2016
Catholics per Total Population Change in number of Priests 2000 – 2016 Deacons per Diocese
Change in number of Catholics 2000 – 2016 Sisters per Diocese Deacons per Priest
Change in Catholics 2000 – 2016 as percent of population Catholics per Sister Total Population per Diocese
Amount of non-Catholics per Diocese Population per Sister Change in Population per Diocese
Total Priests per Diocese Change in number of Sisters from 2000 – 2016
The Catholic Leadership global maps information is derived from the Annuario Pontificio, which is curated and published by the Vatican Statistics Office annually, and GoodLands global diocesan boundaries. Our partners at Catholic Hierarchy facilitate the digitization of the statistical information from the Annuario Pontificio. GoodLands then facilitates the cleaning, geographically joining, and mapping of the data.
Principle Contributors: Richie Carmichael, David Cheney, Mark Deaton, Thomas Emge, Bob Gerlt, Mark Smith
Cheney, D. M. (n.d.). The Hierarchy of the Catholic Church. Retrieved from http://www.catholic-hierarchy.org/
Burhans, Molly, et al. “Global Boundaries of the Roman Catholic Church (2.0).” GoodLands, 2019
Burhans, M., Cheney, D., Deaton, M., Emge, T., Gerlt, B., Smith, M.. “People and Presence of the Roman Catholic Church (2.0).” [Geodatabase] Date Updated: August 2019. GoodLands.
Using: ArcGIS. 10.4. Version 10.6.1. Redlands, CA: Environmental Systems Research Institute, Inc., 2019.
Statistical Information:
Cheney, D.M. “Catholic Hierarchy of the World” [Database]. Date Updated: August 2019. Catholic Hierarchy. Using: Paradox. Retreived from Original Source.
Burhans, Molly, et al. “Global Boundaries of the Roman Catholic Church (2.0).” [Geodatabase] Date Updated: August 2019. GoodLands.
Annuario Pontificio per l’Anno .. Città del Vaticano :Tipografia Poliglotta Vaticana, Multiple Years.
The data for these maps was extracted from the gold standard of Church data, the Annuario Pontificio, published yearly by the Vatican. The collection and data development of the Vatican Statistics Office are unknown. GoodLands is not responsible for errors within this data. We encourage people to document and report errant information to us or directly to the Vatican.
Read Press Release 2018 Annuario Pontificio :
https://press.vatican.va/content/salastampa/it/bollettino/pubblico/2018/06/13/0440/00957.html
The update and maintenance of this data was supported by GoodLands volunteer network, the Loyola Foundation, and Environmental Systems Research Insitute, Inc.
If you are interested in sponsoring the continued availability and maintenance, server hosting, and public access of this data please contact philanthropy@good-lands.org – We also strongly encourage donations to support the hosting and maintenance of our partner at Catholic Hierarchy: http://www.catholic-hierarchy.org/
Country-Scale Geodata Sets:
Women with Temporary Vows to Religious Life Years of Global Data: 1982, 1983, 1984, 1985, 1986, 1987, 1988, 1989, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016
Women with Permanent Vows to Religious Life Years of Global Data: 1982, 1983, 1984, 1985, 1986, 1987, 1988, 1989, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016
Novices Years of Global Data: 1982, 1983, 1984, 1985, 1986, 1987, 1988, 1989, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016
Postulants Years of Global Data: 1982, 1983, 1984, 1985, 1986, 1987, 1988, 1989, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016
Temporary members Years of Global Data: 1988, 1989, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016
GoodLands worked with the GHR Foundation and UISG (International Union of Superior Generals) to map women religious around the world using data mined from the Annuarium Statisticum Eccleasiea.
The workflows and data models developed for this project can be used to map any global, historical country-scale data in a time-series map while accounting for country boundary changes. GoodLands created proprietary software that enables mining the Annuarium Statisticum Eccleasiea (see Software and Program Library at the bottom of this page for details).
Burhans, Molly A., Mrowczynski, Jon M., Schweigel, Tayler C., and Burhans, Debra T., Wacta, Christine.
GoodLands Inc.
Integrated Geodatabase: The Catholic Foortprint of Women Religious Around the World
Burhans, Molly A., Mrowczynski, Jon M., Schweigel, Tayler C., and Burhans, Debra T., Wacta, Christine. The Catholic Foortprint of Care Around the World (1). GoodLands and GHR Foundation, 2019.
Catholic Statistics Numbers:
Annuarium Statisticum Ecclesiae – Statistical Yearbook of the Church: 1980 – 2018. LIBRERIA EDITRICE VATICAN.
Historical Country Boundary Geodatabase:
Weidmann, Nils B., Doreen Kuse, and Kristian Skrede Gleditsch. The Geography of the International System: The CShapes Dataset. International Interactions 36 (1). 2010.
GoodLands created a significant new data set for GHR and the UISG of important Church information regarding orphanages and sisters around the world as well as healthcare, welfare, and other child care institutions. The data were extracted from the gold standard of Church data, the Annuarium Statisticum Ecclesiae, published yearly by the Vatican. It is inevitable that raw data sources will contain errors. GoodLands and its partners are not responsible for misinformation within Vatican documents. We encourage error reporting to us at data@good-lands.org or directly to the Vatican.
The GHR Foundation supported data extraction and cleaning, and the development of maps, infographics, and applications of Women with Temporary Vows to Religious Life and Permenant Vows to Religious Life.
GoodLands’ investment supported the development of maps, infographics, and applications that display Novices, Postulants, and Temporary Members.
Bishops in Each Diocese (regular updates, last update September 2019) Ordinary Bishop’s Birthdays by Month in Diocese Ordinary Bishop’s Age in Dioceses Ordinary Bishop’s Religious Order (when applicable)
Curial Voting Rights per Bishop Bishops Year of Ordination Bishops Ordained Before the Dallas Convocation in the USCCB Bishops Ordained Before the Extraordinary Synod on Child Protection
Time Between Priestly Ordination and Bishops Ordination Retirement Heatmap
Historical Bishop Data 1950 – Present
The Catholic Leadership global maps information is derived from the Annuario Pontificio, which is curated and published by the Vatican Statistics Office annually, and GoodLands global diocesan boundaries. Our partners at Catholic Hierarchy facilitate the digitization of this information. GoodLands then facilitates the cleaning, geographically joining, and mapping of the data.
Principle Contributors: Burhans, Molly A., Cheney, David M., Deaton, M., Emge, T., Gerlt, R..
Burhans, M., Cheney, D., Deaton, M., Emge, T., Gerlt, B.. “Leadership of the Roman Catholic Church (2.0).” [Geodatabase] Date Updated: September 2019. GoodLands.
Leadership Information:
Additional information about regular changes in bishops and sees comes from a variety of public diocesan and news anouncements.
Data Sets:
Landuse % By Diocese GDP Per Diocese Estimated 2068 GDP without effects of climate change Estimated 2068 GDP with effects of climate change
Happiness Index per Episcopal Conference Electricity Availability per Diocese Living Standard per Episcopal Conference Diocese and multihazard risk
High risk Diocese Agriculatural Land per Diocese Education Index Per Episcopal Conference
Undernourished percentage of the total population over the years 1990 – 2013, and Catholic dioceses
GDP Projection
The Catholic Landscape: Economic Development global maps are derived from GoodLands datasets and additional data sets listed in the tabs. The information shows the relation of Catholic populations and leadership to economic development.
Burhans, Molly A., Cheney, David M., Deaton, M., Emge, T., Gerlt, R..
Students from the Yale School of Forestry and Environmental Science and UPenn Design have contributed to some of our work, including but not limited to: Kashdan, Alix; Tokarz,Elizabeth; Johnson, Nicholaus; Szeto, Sabrina
See Category Tabs
Global Diocesan Land Use:
Burhans, M., “Global Land Use in Dioceses.” [Geodatabase] Date Updated: March 2019. GoodLands.
Using: ArcGIS. Version 10.6.1. Redlands, CA: Environmental Systems Research Institute, Inc., 2019.
Land Use Data Set:
Channan, S., K. Collins, and W. R. Emanuel. 2014. Global mosaics of the standard MODIS land cover type data. University of Maryland and the Pacific Northwest National Laboratory, College Park, Maryland, USA.
MODIS standard data product attribution: Friedl, M.A., D. Sulla-Menashe, B. Tan, A. Schneider, N. Ramankutty, A. Sibley and X. Huang (2010), MODIS Collection 5 global land cover: Algorithm refinements and characterization of new datasets, 2001-2012, Collection 5.1 IGBP Land Cover, Boston University, Boston, MA, USA.
Dataset found at: http://glcf.umd.edu/data/lc/
Average GDP per Diocese:
Tokarz, Elizabeth. Derived from “Global Migration Risk in Diocese.” [Geodatabase]. Fall 2019. Yale School of Forestry and Environmental Sciences and GoodLands.
GDP Per Dicoese (review)
This global dataset represents the gross domestic production (GDP) of each grid cell. GDP is given in 2011 international US dollars. The data is derived from GDP per capita (PPP) which is multiplied by gridded population data HYDE 3.2 (the years of population data not available (1991-1999) were linearly interpolated at grid scale based on data from years 1990 and 2000). Dataset has global extent at 5 arc-min resolution for the 26-year period of 1990-2015. Detail description is given in a linked article and metadata is provided as an attribute in the NetCDF file itself.
Global Episcopal Conference:
Burhans, M., “The Happiness of Episcopal Conferences.” [Map and Geodatabase] Date Updated: Summer 2019. GoodLands.
Happiness Data
Global Episcopal Conference Boundaries:
Global Diocesan Electricity, Beta Estimate:
“Dicoeses Electricity Access.” [Raster Tiles, Geodatabase] Date Updated: 2018. GoodLands.
Using: ArcGIS. Version 10.6.1. Redlands, CA: Environmental Systems Research Institute, Inc.,.
Earth at Night
Source: ESRI, NASA – Visible Earth
This layer presents a nighttime view of the Earth that provides an informational and educational view of our planet at night. The image was produced by mosaicking Defense Meteorlogical Satellite Program (DMSP) Operational Linescan System (OLS) satellite images. This map presents the locations of permanent lights on the Earth’s surface. These data are derived from 9 months of observations superimposed on a darkened land surface. ESRI georeferenced these data to a real-world coordinate system. The layer is suitable for display to a largest scale of 1:18,500,000.
World Population Density Estimate 2016
Source: ESRI, https://cgisc.maps.arcgis.com/home/item.html?id=0f83177f15d640ed911bdcf6614810a5Frye, C. et al., (2018). Using Classified and Unclassified Land Cover Data to Estimate the Footprint of Human Settlement. Data Science Journal. 17, p.20. DOI: http://doi.org/10.5334/dsj-2018-020.
“Global Risk in Diocese.” [Layer Overlay]. Fall 2019. GoodLands.
Multihazard Mortality Risks and Distribution
Center for Hazards and Risk Research – CHRR – Columbia University, Center for International Earth Science Information Network – CIESIN – Columbia University, and International Bank for Reconstruction and Development – The World Bank. 2005. Global Multihazard Mortality Risks and Distribution. Palisades, NY: NASA Socioeconomic Data and Applications Center (SEDAC). https://doi.org/10.7927/H41J97NM. Accessed DAY MONTH YEAR.
ENW (EndNote & RefWorks)†
RIS (Others)
Dilley, M., R.S. Chen, U. Deichmann, A.L. Lerner-Lam, M. Arnold, J. Agwe, P. Buys, O. Kjekstad, B. Lyon, and G. Yetman. 2005. Natural Disaster Hotspots: A Global Risk Analysis. Washington, D.C.: World Bank. https://doi.org/10.1596/0-8213-5930-4.
Due to the sensitivity of this data set it will not be shared.
Global Diocesan Agriculture, Beta Estimate:
“Global Diocesan Agricultre.” [Raster Tiles, Geodatabase] Date Updated: 2018. GoodLands.
Farming the Planet: 1. Geographic Distribution of Global Agricultural Lands in the Year 2000
University of Minnesota – Institute on the Environment – Global Landscapes Initiative – visit http://www.earthstat.org for more information
The Global Croplands data set represents the proportion of land areas used as cropland (land used for the cultivation of food) in the year 2000. Satellite data from Modetate Resolution Imaging Spectroradiometer (MODIS) and Satellite Pour l’Observation de la Terre (SPOT) Image Vegetation sensor were combined with agricultural inventory data to create a global data set. The visual presentation of this data demonstrates the extent to which human land use for agriculture has changed the Earth and in which areas this change is most intense. The data was compiled by Navin Ramankutty , et. al. (2008) and distributed by the Columbia University Center for International Earth Science Information Network (CIESIN).
Source: SEDAC
Currently obtaining source information from collaborator.
Education Ranking in Episcopal Conferences:
Burhans, M., “Education in Episcopal Conferences.” [Map and Geodatabase] Date Updated: 2019. GoodLands.
World Bank – Education Duration and Starting Age
Created: Jan 11, 2012 The World Bank – http://data.worldbank.org/, United Nations Educational, Scientific, and Cultural Organization (UNESCO) Institute for Statistics. Primary School Starting Age: Primary school starting age is the age at which students would enter primary education, assuming they had started at the official entrance age for the lowest level of education, had studied full-time throughout and had progressed through the system without repeating or skipping a grade. Data is for 2009.
Secondary School Starting Age: Secondary school starting age is the age at which students would enter secondary education, assuming they had started at the official entrance age for the lowest level of education, had studied full-time throughout and had progressed through the system without repeating or skipping a grade. Data is for 2008.
Primary Education Duration: Primary duration refers to the number of years of full-time equivalent duration in primary education in the school system according to ISCED. Data is for 2008.
Secondary Education Duration: Secondary education, duration (years) is the number of grades (years) in secondary school. Data is for 2008.
Global Malnourishment and Dioceses
“Global Diocesan Nourishment.” [Raster Tiles, Geodatabase] Date Updated: 2016. GoodLands.
World Countries 50M Food_Security TimeSeries
Prevalence of Undernourishment (% of Population) by country, repeated for each of the following years: 1990, 1995, 2000, 2005, 2010, 2013 to enable time-series display using the YEAR attribute. This data shows the percentage of the population whose food intake is insufficient to meet dietary energy requirements continuously. For example, 7.5 means less than 7.5% of the population is undernourished. Data source: Food and Agriculture Organization (FAO) of the United Nations (http://www.fao.org/publications/en/) via World Bank (World DataBank) and FAOSTAT, Country shapes from Natural Earth 50M scale data.
Ecclesiastical Jurisdicition Data Sets:
Amphibian Biodiversity per Diocese Overall Biodiversity per Diocese Diocese with greatest Sea Level Rise Impacts (Sea Level Rise, Population Impacted)
Mammalian Biodiversity per Diocese Avian Biodiversity Threatened Development Pressure Changes in Growing Days per Diocese
Avian Biodiversity per Diocese Mammalian Biodiversity Threatened Carbon Corridors in Dioceses Diocese Ranking: where the Catholic Church is the most important nonstate actor for biodiversity preservation
Amphibian Biodiversity Threatened Tree Cover per Diocese Carbon Footprint per Episcopal Conference and % Catholic
Global Forest Watch: Deforestation per Diocese 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015
Deadly Heat Impacts on Roman Catholic Dioceses RCP2.6, RCP4.5, RCP6, and RCP8.5; years 2010, 2020, 2025, 2050, 2100 for each scenario
Development Pressure
Tree Cover
Carbon Corridors
Sea Level Rise Impact
Climate Impacts on Growing Days
Deadly Heat
The Catholic Landscape: Climate Change and The Environment global maps are derived from GoodLands datasets and additional data sets listed in the tabs. The information shows the relation of Catholic populations and leadership to economic development.
Burhans, Molly A., Cheney, David M., Deaton, M., Emge, T., Gerlt, R.. and additional donated professional staff from Esri.
Students from the Yale School of Forestry and Environmental Science and UPenn Design have contributed to some of this work.
The Global Human Influence Index:
Wildlife Conservation Society – WCS, and Center for International Earth Science Information Network – CIESIN – Columbia University. 2005. Last of the Wild Project, Version 2, 2005 (LWP-2): Global Human Influence Index (HII) Dataset (IGHP). Palisades, NY: NASA Socioeconomic Data and Applications Center (SEDAC). https://doi.org/10.7927/H46W980H. March 2018.
All Biodiversity Mapping:
Burhans, M., Gerlt, B.. “Global Biodiversity in Relation to Catholic Diocese.” [Geodatabase]. March 2019. Updated: Summer 2019. GoodLands, Inc. and Environmental Systems Research Institute, Inc.
Biodiversity Data:
Jenkins, CN, SL Pimm, LN Joppa (2013) Global Patterns of Terrestrial Vertebrate Diversity and Conservation. PNAS 110(28): E2602-E2610. doi: 10.1073/pnas.1302251110 (PDF)
Pimm, SL, CN Jenkins, R Abell, TM Brooks, JL Gittleman, LN Joppa, PH Raven, CM Roberts, JO Sexton (2014) The biodiversity of species and their rates of extinction, distribution, and protection. Science 344(6187): 1246752
IUCN 2018. The IUCN Red List of Threatened Species. Version 2018-1. http://www.iucnredlist.org.
BirdLife International and Handbook of the Birds of the World (2018) Bird species distribution maps of the world. Version 7.0. Available at http://datazone.birdlife.org/species/requestdis.
Tree Cover Data
This data set, a collaboration between the [GLAD](http://glad.geog.umd.edu/) (Global Land Analysis & Discovery) lab at the University of Maryland, Google, USGS, and NASA, displays tree cover over all global land (except for Antarctica and a number of Arctic islands) for the year 2000 at 30 × 30 meter resolution. The data were generated using multispectral satellite imagery from the [Landsat 7] (http://landsat.usgs.gov/) thematic mapper plus (ETM+) sensor. The clear surface observations from over 600,000 images were analyzed using Google Earth Engine, a cloud platform for earth observation and data analysis, to determine per pixel tree cover using a supervised learning algorithm.
For the purpose of this study, “tree cover” was defined as all vegetation taller than 5 meters in height. “Tree cover” is the biophysical presence of trees and may take the form of natural forests or plantations existing over a range of canopy densities.
Due to variation in research methodology and date of content, tree cover, loss, and gain data sets cannot be compared accurately against each other. Accordingly, current (post-2000) tree cover cannot be determined by subtracting figures for annual tree cover loss from year 2000 tree cover.
Using: ArcGIS. 10.4.1. Version 10.0. Redlands, CA: Environmental Systems Research Institute, Inc., 2010.
Vegetation Carbon Stock Corridors
A high resolution dataset of vegetation carbon stock was used to map corridors traversing areas of highest biomass between protected areas in the tropics. Corridors contain close to 50 gigatons of carbon in aboveground biomass, which represents 14% of the total unprotected amount in the tropical region. A large number of corridors have carbon densities that approach or exceed those of the protected areas they connect, suggesting these are suitable areas for achieving connectivity and climate mitigation benefits. For more information and to download the physical dataset files, please visit the following Woods Hole Research Center URL: http://whrc.org/publications-data/datasets/vegetation-carbon-stock-corridors/
This dataset has been developed by NASA Applied Sciences program, in coordination with SERVIR. SERVIR is a joint USAID-NASA project. For more information on SERVIR, visit http://www.servirglobal.net Additional support comes from the Gordon and Betty Moore Foundation, the Packard Foundation, and the Google.org Foundation.
Using: ArcGIS. Version 10.4.1. Redlands, CA: Environmental Systems Research Institute, Inc.,
Smith, M.. “Change in Growing Days in Diocese.” [web application and dataset] Date Updated: 2016. GoodLands.
Suitable Days for Plant Growth:
Mora, Camilo, et al. “Suitable Days for Plant Growth Disappear under Projected Climate Change: Potential Human and Biotic Vulnerability.” PLOS Biology, vol. 13, no. 6, Oct. 2015, doi:10.1371/journal.pbio.1002167.
Global Diocesan Boundaries
“Global Diocesan Desforestation.” [Web Application, Geodatabase] Date Updated: 2016. GoodLands.
Tree Cover Loss, Tree Cover Gain: Global Forest Watch
Hansen, M. C., P. V. Potapov, R. Moore, M. Hancher, S. A. Turubanova, A. Tyukavina, D. Thau, S. V. Stehman, S. J. Goetz, T. R. Loveland, A. Kommareddy, A. Egorov, L. Chini, C. O. Justice, and J. R. G. Townshend. 2013. “High-Resolution Global Maps of 21st-Century Forest Cover Change.” Science 342 (15 November): 850–53. Data available on-line from: http://earthenginepartners.appspot.com/science-2013-global-forest.
Accessed October 2016.
Deadly Heat:
Mora, Camilo; Dousset, Bénédicte; Caldwell, Iain R.; Powell, Farrah E.; Geronimo, Rollan C.; Bielecki, Coral R.; Counsell, Chelsie W. W.; Dietrich, Bonnie S.; Johnston, Emily T.; Louis, Leo V.; Lucas, Matthew P.; McKenzie, Marie M.; Shea, Alessandra G.; Tseng, Han; Giambelluca, Thomas W.; Leon, Lisa R.; Hawkins, Ed; Trauernicht, Clay. Global risk of deadly heat. Nature Climate Change. 7. (2017). 501–506 . June 17, 2017.
Accessed pre-publication.
Aid and Emergency Response
Live Hurricane Data in Relation to Dioceses Live USGS Data for Earthquakes in Relation to Dioceses State Stability / Fragility and Dioceses
Active Hurricanes, Cyclones and Typhoons in Relation to Dioceses
Earthquakes in Relation to Dioceses
State Stability/Fragility and Dioceses
The Catholic Landscape: Aid and Emergency global web-based applications are derived from GoodLands data sets and additional data sets listed in the tabs. The information shows the relation of the Catholic footprint to disasters and in relation to state stability/fragility.
“Hurricanes in Relation to Dioceses and Population.” [Web Mapping Application] Date Updated: September 2016. GoodLands.
Active Hurricanes, Cyclones and Typhoons
his data is provided by NOAA National Hurricane Center (NHC) for the East Pacific and Atlantic, and the Joint Typhoon Warning Center for the West Pacific and Indian basins. For more disaster-related live feeds visit the Disaster Web Maps & Feeds ArcGIS Online Group.
Dataset found at: http://arcg.is/0ezPznhttp://glcf.umd.edu/data/lc/
Live Earthquakes in Relation to Dioceses
“Live Earthquakes in Relation to Dioceses.” [Web Mapping Application] Date Updated: September 2016. GoodLands.
Live Earthquakes Service:
This service presents recent earthquake information from the USGS Prompt Assessment of Global Earthquakes for Response (PAGER) program. In addition to displaying earthquakes by magnitude, this service also presents earthquakes by impact. Impact is measured by population as well as models for economic and fatality loss. For more details, see: http://earthquake.usgs.gov/earthquakes/pager.
“State Stability/Fragility of Diocese.” [Dataset and Print Product] Date Updated: March 2019. GoodLands.
State Fragility:
Fragile States Index Presented by the Fund for Peace.” Fragile States Index Presented by the Fund for Peace, 2018, fundforpeace.org/fsi/data/http://arcg.is/0ezPznhttp://glcf.umd.edu/data/lc/
Healthcare and Well Being
Country-Scale
Catholic-Affiliated Hospitals Years of Global Data: 1980, 1981, 1982, 1983, 1984, 1985, 1986, 1987, 1988, 1989, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016
Catholic-Affiliated Dispensaries Years of Global Data: 1980, 1981, 1982, 1983, 1984, 1985, 1986, 1987, 1988, 1989, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016
Catholic-Affiliated Communities
and Institutions for Individuals with
Hansen’s Disease (Leprosy)
Years of Global Data: 1980, 1981, 1982, 1983, 1984, 1985, 1986, 1987, 1988, 1989, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016
Catholic-Affiliated
Matrimonial Advice Centers
Unspecified Welfare Institutions
Reeducation Centers
GoodLands worked with the GHR Foundation to map Catholic Healthcare around the world using data mined from the Annuarium Statisticum Eccleasiea.
Integrated Geodatabase: The Global Catholic Foortprint of Healthcare
The GHR Foundation supported data extraction and cleaning of this information.
GoodLands’ supported the development of maps, infographics, and applications for all healthcare data.
Child Care and Care of Vulnerable People
Catholic-Affiliated Orphanages* Years of Global Data: 1980, 1981, 1982, 1983, 1984, 1985, 1986, 1987, 1988, 1989, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016
Catholic-Affiliated Homes for
the Chronically Ill, Infirm, and
Handicapped*
Catholic-Affiliated Children’s Nurseries* Years of Global Data: 1980, 1981, 1982, 1983, 1984, 1985, 1986, 1987, 1988, 1989, 1999, 2000, 2001, 2002, 2003, 2004, 2005, 2006, 2007, 2008, 2009, 2010, 2011, 2012, 2013, 2014, 2015, 2016
GoodLands worked with the GHR Foundation and UISG (International Union of Superior Generals) to map Catholic Care for Children and Vulnerable People the world using data mined from the Annuarium Statisticum Eccleasiea.
Integrated Geodatabase: The Global Catholic Foortprint of Care for the Vulnerable and Children
GoodLands created a significant new data set for GHR and the UISG of important Church information regarding orphanages and sisters around the world as well as healthcare, welfare, and other child care institutions. The data was extracted from the gold standard of Church data, the Annuarium Statisticum Ecclesiae, published yearly by the Vatican. It is inevitable that raw data sources will contain errors. GoodLands and its partners are not responsible for misinformation within Vatican documents. We encourage error reporting to us at data@good-lands.org or directly to the Vatican.
The GHR Foundation supported data extraction and cleaning of this information and maps, infographics, and applications of orphanage data.
GoodLands’ pro bono investment supported the development of maps, infographics, and applications for homes for the chronically ill, infirm and handicapped, and children’s nurseries.
Catholic-Affiliated Property
Property-Scale
Catholic Property in the USCCB* Catholic impacts of habitat connectivity and green infrastructure USCCB* Drivetimes to Catholic Schools USCCB*
Parish demographic summary dashboard USCCB* Average income around Catholic Parishes USCCB* Transit Accessibility, Catholic Parishes USCCB*
Projected Sea-Level Rise and Human Migration:
Impacts on Catholic Diocese in the United States* Heat waves, Catholic Properties USCCB* Catholic insitution students (catechist and educational) by number*
Due to the sensitivity of property-scale data we are limiting what we share with the public.
We partnered with the Official Catholic Directory and were donated a nation-wide assessors dataset from a real estate company to generate accurate property records of Catholic holding in the United States. We use these data to support property planning, pastoral planning, and parish boundary development. All projects completed with joint data development must be willing to pay for our data providers subscription services.
Catholic Communications Infrastructure in Africa
Catholic Radio Stations in Africa* Internet Delivery Suitability* Potential reach of radio stations*
Short-wave vs. Long-wave
comparison* Population # within 5, 20, and 90km of each Catholic radio station* % Catholic of area surrounding radio station*
Catholic radio stations density per diocese. Catholic radio stations with the most reach per diocese* Cellphone ownership in Episcopal Conferences.
Due to the sensitivity of this data we are limiting what we share with the public.
To complete this we partnered with the Vatican Radio and combined their data with our diocesan data and additional sets of information.
Software and Program Library
Annuarium Statisticum Eccleasiea Miner 1.2
To map The Catholic Foortprint of Care Around the World GoodLands developed proprietary software programs to mine and map data from the Annuarium Statisticum Eccleasiea that can be tweaked to extract data from additional sections, such as education institutions, in a highly efficent manner. This software integrates machine learning, ensuring that each additional time that we use it the quality of data mined improves and costs for future data development are reduced.
This sofware is a viable tool for scraping select sections of the Annuarium Statisticum Eccleasiea.
Religious Order Miner 1.0
For one of our client projects we developed software capable of mining a non-databased set of webpages hosting a global religious order’s house and member information and organizing it into a geodatabase. The program is specific to the Religious Community and datasource. However, its development has given us a profound knowledge about data structure and religious communities.
Generative Parish Boundaries (under development)
We are currently working with a diocese to develop a program to determine parish boundaries based on data about parishioners, local demographic information, and Catholic programs within a diocese. Once complete, this can be used by dioceses with similar condiations wishing to re-draw their parish boundaries by using data, to help them make more informed decisions for pastoral and programmatic planning.
Financial and Staff Projections (beta)
GoodLands developed a piece of software that projects staffing and financial needs for complex data development and geodesign projects. It projects staffing, revenue, hours and schedules and can calculate the amount of money saved by transitions to full-time staff verses part-time contractors and breakpoints for transitioning to FT. Over time we hope to improve this or partner with a business intelligence company to further develop its usability and applciation.
If you are interested in working with us to use any of these tools or to develop new custom tools, please contact us at: | cc/2020-05/en_middle_0078.json.gz/line1229 |
__label__wiki | 0.872307 | 0.872307 | GOSSIPONTHIS.COM Music MUSIC VIDEO: Mindless Behavior – “Keep Her On The Low” (ft. Sean...
MUSIC VIDEO: Mindless Behavior – “Keep Her On The Low” (ft. Sean Garrett)
Dustin Gary
Updated February 15th, 2013 at 11:44 am
Mindless Behavior is back with new music, and the boys are on a mission in the video for their next album’s first single “Keep Her On The Low,” featuring producer/songwriter Sean Garrett.
With wardrobe inspired by the movie “Men in Black,” the teen sensations — Prodigy, Princeton, Roc Royal and Ray Ray — act as special agents while showing off their fancy footwork in the Erik White-directed clip.
“We come into this abandoned warehouse and we find this briefcase and our manager, aka Agent Walter Millsap, is giving us directions on how to get on top of the roof in five minutes to throw a house party,” Princeton explained.
Mindless Behavior’s sophomore album ‘All Around the World’ will be available on March 12, followed by the release of their documentary “Mindless Behavior: All Around the World” — opening exclusively at AMC Theaters on March 15.
Watch Mindless Behavior’s video for “Keep Her On The Low” below:
Published February 15th, 2013 at 8:44 am
MIndless Behavior
Vine Star Jay Versace Dragged on Twitter for Outing Princeton Perez from Mindless Behavior As Gay
MUSIC VIDEO: Mindless Behavior – “All Around the World”
Lauryn Hill Diss Upsets Beyonce at the 2012 BET Awards + Mindless Behavior Apologizes | cc/2020-05/en_middle_0078.json.gz/line1231 |
__label__cc | 0.748905 | 0.251095 | Always in the Middle…
MIDDLE GRADE BOOK REVIEWS, GIVEAWAYS, & WRITING TIPS
← D-DAY—The World War II Invasion That Changed History
MMGM for 9/17/18 →
ABSOLUTE EXPERT SERIES
Posted on September 16, 2018 by Greg Pattridge
It’s another MARVELOUS MIDDLE GRADE MONDAY!
This new effort by National Geographic Kids hits all the right spots in providing detailed information on topics middle grade kids crave. Along with awe inspiring photos and drawings, each edition features support from a leading in-the-field expert with personal stories, experiences, and knowledge.
Four separate books start us off: DINOSAURS, DOLPHINS, SOCCER, and VOLCANOES. Future topics include DOGS, CATS, ROCKS, and OUTER SPACE. Here are five things I love about ABSOLUTE EXPERT:
They are hardback but the perfect size (7.5 by 9.5 inches) and page count (114 pages), making them easy to pull out and read in the car or anywhere else where space is at a premium.
The information presented is detailed and full of reading challenges . There are of course fun pieces, but the focus is on understanding each topic to its fullest extent.
The books have four chapters, each ending with an interactive feature to get you involved even deeper. You might be making something or taking a visual quiz.
The layout is spectacular and fits in with the visual learning style of so many young readers. This begins with the Contents page and continues right through to the end.
They couldn’t have done a better job choosing the experts. These people are in the middle of the action and you might find yourself wanting to follow in their footsteps.
Hold on tight… Below is a little background on each of the first four volumes. I’ve included my own thoughts and a favorite fact in the field (from literally hundreds to choose from in each book).
Chalked full of information, DINOSAURS will have you learning about these creatures from a different era with surprise and envy. I never knew there were so many dinosaurs, including ones just discovered. Very much appreciated was the pronunciation guide in the back pages. I needed a little help on KUEHNEOSAURUS (KWAIN-ee-o-SORE-us).
Absolute Expert: Dinosaurs by Lela Nargi and featuring in-the-field expert Dr. Steve Brusatte, a National Geographic Explorer and Paleontologist – Dr. Brusatte has named more than 15 new species, traveled the world searching for dinos and is particularly interested in the origin and evolution of dinosaurs. Throughout this book Steve shares his stories, adventures, discoveries and insights about his life as a paleontologist and the amazing dinosaurs that he studies. Every page contains rich details and drills down into all aspects of dinosaurs — different species, how they evolved, their behaviors, fossil science and so much more.
MY FAVORITE IN THE FIELD FACT: The sounds dinosaurs made is called closed-mouthed vocalization. They probably sounded like ostriches and cassowaries.
One look through DOLPHINS will bring a smile to your face. They have that instant effect. The text takes you under the surface and gives you a realistic portrayal of these beautiful creatures. Conservation is the backbone because we never want dolphins to disappear off our earth. Start in any chapter and learn new things on every page.
Absolute Expert: Dolphins by Jennifer Swanson and featuring in-the-field expert Justine Jackson-Ricketts, a National Geographic Explorer and marine biologist — Comprehensive coverage of all things dolphin, including all the different species, a nose-to-tail look at these amazing mammals, their habitat and behavior, how to study them, career opportunities in the field, and the importance of conservation efforts. Justine, who studies rare Irrawaddy dolphins in the Gulf of Thailand, acts your guide as she shares with the reader the work she is doing to save this species of dolphins whose numbers are dwindling.
MY FAVORITE IN THE FIELD FACT: While humans use goggles or masks to see underwater, dolphin’s eyes are special. They secrete a special oil to make them see better and it keeps the water out.
SOCCER is where you’ll learn the rules and a description of the player positions, but what makes this special is the historical angle. Find out how soccer was named and the success at making it a worldwide sport. World Cup, MLS, Olympic, and women’s soccer are all given their space and each is full of history.
Absolute Expert: Soccer by Eric Zweig and featuring in-the-field expert Mark Geiger, a Major League Soccer and Olympic referee (and one of only two U.S. referees officiating at this year’s World Cup) — Covering sports history, the latest gear, facts about little-known regulations, high profile athletes and so much more, this title has it all. Professional ref Mark Geiger shares his personal stories of what it’s like working the Olympic games and the World Cup, how to train to be a professional referee and the importance of good sportsmanship. Throughout this year’s World Cup, Mark has had to pull the yellow and red card quite a bit — and his explanation of how and when he uses them is fantastic. Fresh off the World Cup and heading into soccer season, this title is extremely timely.
MY FAVORITE IN THE FIELD FACT: Bert Patenaude was an American soccer star and in 1930 he scored three goals in a World Cup match against Paraguay. He was the first player to score this special hat trick. Unfortunately, a discrepancy kept the record out of the books until almost 76 years later. Bert has already passed away and never knew he finally received the official credit.
A global journey is in store for you as Volcanoes from around the world are featured. See the different types of volcanoes and eruptions and how they occur. I found the feature on Mount St. Helens fascinating as it tells and shows how nature recovered in the thirty plus years since the eruption.
Absolute Expert: Volcanoes by Lela Nargi and featuring in-the-field expert Arianna Soldati, a National Geographic Explorer and Volcanologist — The ongoing eruption of Kilauea has brought volcanoes — the science behind them, their combustible beauty and the massive damage they cause — back into the headlines. This timely title contains the latest information on all types of volcanoes around the world, which ones are in danger of erupting and what it takes to get up close to study the science behind the eruptions. Arianna has done field work all over the globe and acts as the reader’s guide to these combustible natural wonders.
MY FAVORITE IN THE FIELD FACT: A caldera is formed when the outside structure of a volcano collapses, leaving a giant bowl shape in the ground. Yellowstone has one of the biggest and scientists think some day it may erupt again. If it does they expect climate will be affected around the world for many years.
I received these books from the publisher in exchange for an honest review. Make a comment below. I enjoy reading all of them.
About Greg Pattridge
Climbing another mountain...writing middle grade novels.
View all posts by Greg Pattridge →
This entry was posted in Middle Grade Book Reviews, non fiction and tagged Absolute Expert series, Dinosaurs, Dolphins, Middle Grade Book Reviews, Middle Grade Non-Fiction, National Geographic Kids, Soccer, Volcanoes. Bookmark the permalink.
7 Responses to ABSOLUTE EXPERT SERIES
Natalie Aguirre says:
Writing non-fiction that keeps kids interest isn’t easy. These sound like they do it though. Loved that you shared your favorite facts, all new to me.
Joanne R. Fritz says:
I never knew that about dolphin’s eyes. And I would have needed that pronunciation guide too! A very thorough post, Greg. Thanks.
I’m sold. 🙂 I need books to have an appealing layout in order to hold my interest, and I’m grown; it’s even more important for kids. These sound great.
These will be great books for great grandson in a few years. Right now at 4 yrs., he adores the National Geographic books for younger kids on dinosaurs, ocean life, bugs and planets. These are such great books for kids who love details and are interested in the world.
June McCrary Jacobs says:
I love the Geographic Kids books, and this new series sounds awesome. I enjoyed the fact you shared about volcanoes. Thanks for sharing this post with us for MMGM!
Sue Kooky says:
National Geographic KIDS used to be some of my FAVORITE books when I was littler! I’m super happy to see that they are still making them! Their books are always filled with interesting facts and I’m glad to see they still make them as entertaining as ever. Thanks for the review!
rosihollinbeck says:
I love all the National Geographic books you feature. I will have to check these out. Thanks for the review.
Place your thoughts here with a comment Cancel reply
Greg Pattridge
*ALWAYS in the MIDDLE* is your home for…
POP FLIES, ROBO-PETS, AND OTHER DISASTERS by Suzanne Kamata
BOY BAND OF THE APOCALYPSE—WASHED UP
MMGM for 1-13-2020
BOY BAND OF THE APOCALYPSE
MIDDLE GRADE: IN THE NEWS 1/10/2020
Follow ALWAYS IN THE MIDDLE via Email
Middle Grade News
MMGM Links | cc/2020-05/en_middle_0078.json.gz/line1232 |
__label__wiki | 0.609175 | 0.609175 | What was the first big scale (over 50 tanks used) battle with the use of tanks in WW1?
Please note that the typical examples don't constitute good answer:
Battle of Flers-Courcelette (Somme) was the first use of tanks but definitely not >50.
Battle of Cambrai (November 1917) - which seems to be the standard answer on Google search - appears to be incorrect: as per Wiki, there were earlier battles with over 50 tanks fielded, though there were no good details/references.
Second Battle of Villers-Bretonneux, France (1918) is notable for being first tank-vs-tank battle, but it was mere 3 against 3 quantity-wise.
weapons world-war-one tanks
Good question; I'd be interested in the answer to this. If I rightly recall, more than 60 tanks set out for the battle of Fleurs-Courcelette, but rather fewer than that arrived, tanks being what they were in those days. I look forward to seeing what we can find. – Brian Hooper Dec 20 '11 at 21:50
Good question? You do not ask for much. What is meant by "successfull"? The question is simply senseless! – Gangnus Jan 28 '12 at 23:17
The Germans didn't build many tanks during WWI so there are no examples of large tank v tank battles. The Germans built around 20 of their A7V tanks and also used around 50 captured allied tanks, but there's no record of any battle involving more than 3 German tanks as mentioned above. – davidjwest Sep 30 '12 at 14:38
Since when is 50 a mass? – Oldcat Apr 6 '15 at 22:52
@Oldcat - if you never had 50 tanks advance on you, it may not seem like "mass". – DVK Apr 7 '15 at 13:54
A likely candidate seems to be the Battle of Messines, which took place in June 1917. According to John F. C. Fuller in Tanks in the Great War, 1914-1918, 88 tanks were employed (p. 110). He says 40 tanks advanced with the start of the attack at dawn, and an additional 22 set out with infantry in the afternoon.
NSNoob
mgkrebbsmgkrebbs
Not the answer you're looking for? Browse other questions tagged weapons world-war-one tanks or ask your own question.
Are tanks the only reason for the abandonment of trench warfare?
What was the outcome of the first tank battle?
Was WW1 generally foreseen?
How did the US fall behind in airplane technology from 1909-1917?
Why didn't Syria operate the Panzerkampfwagen V Panther tank? | cc/2020-05/en_middle_0078.json.gz/line1242 |
__label__cc | 0.67076 | 0.32924 | July 14, 2006 greatbong80 Comments on Look Who Is Coming to Dinner
Look Who Is Coming to Dinner
Apple may have packed their bags and left. Some other companies may have realized that the relative cost-benefits of outsourcing to India may not be as great as originally thought.
Bad times for Bharatvarsh?
Because Al Qaeda, the world’s one-stop terror shop, has arrived in India.
Al Qaeda is no stranger to our country. However, in the past, it operated in India through local franchisees like Lashkar-e-Toiba and Jaish-e-Mohammed while itself pulling strings from Terrorist Park —an ultra-modern business incubation facility maintained by ISI and President General P (Prick) Musharaff in the land of Pakistan.
However with recent events making the company bullish about its future in India, Al Qaeda has decided to cut out the middleman and jump right in. Relying on its universal brand-name recognition, this league of distinguished gentlemen hope to carve out a large share of the terror, decapitation and dismemberment market.
In a press release, company officials today announced the setting up of its corporate office in Kashmir –thus adding to its enviable presence in the world. For now, they will be setting up their terror-manufacturing units based on turn-key technical know-how supplied by the Pakistanis and the Chinese in Kashmir only—but they have plans of expanding to other cities soon.
In order to meet its staffing needs, Al Qaeda has engaged in a strategic partnership with the HR powerhouse, SIMI (Students Islamic Movement of India also known as Simple Indians Misunderstood Internationally) who have been contracted with the task of supplying a steady stream of ‘field associates’ each with a minimum qualification of B.J. (Bachelor of Jihad).
Many resumes from Bangladesh have also been received by the Al Qaeda staff.
Readers may recall that SIMI was in the news recently, when the Samajwadi Party, a political party consisting of the greatest Indian patriots ever born and some exalted individuals like Salman Khursheed, cast doubts on the B.J. degree by asserting that “SIMI is not a terrorist organization”—-a statement that was greeted with shock and laughter by the SIMI administration.
In response, SIMI has sent an emailed lawyer’s letter to the Samajwadi Party and reasserted their credentials in Mumbai.. laying to rest any doubts about their commitment to quality terrorism.
Besides initiating a promotional campaign that promises to hit Indian centers of population with a bang, Al Qaeda has reputedly roped in celebrity Miraz Khaled Nor, (the Osama Bin Laden lookalike who campaigned for both Laloo and his opponent Paswan during the Bihari election) for their ad blitz which has as its theme the Eric Clapton-inspired song: “Would you feel the same if there were no virgins in heaven?”
As cries of “Mubarakan mubarakan” echo from Bangladesh to Pakistan at this development, it will be interesting to see how Al Qaeda’s arrival impacts the situation in India.
Yeh raha Aaj Tak. Intezar kijiye kal tak.
Categories India, Politics
80 thoughts on “Look Who Is Coming to Dinner”
Daaku July 14, 2006 — 4:35 am
The scariest part is that it appears terrorism in India has suddenly had a shot of adrenalin. Wonder if the present government will be able to find time from dirty votebank politics and deal with it
dEbOLiN July 14, 2006 — 4:53 am
Finally Al Qaeda has arrived in India physically.
So far they had been carrying out their (sorry for the typo….spelling corrected) operations by outsourcing jobs to lesser known local vendors like Lashkar-E-Toiba and Jaish-E-Mohammed.
As a matter of fact they were one of the very first organizations to have outsourced some of their work to Indians.
Now they have decided to take charge on their own.
What remains to be seen is how the physical presence of Al Qaeda is going to affect India and Indians.
After one IT (Information Technology) boom it’s going to be another IT (Indian Terrorism) boom for sure.
Let’s keep our fingers crossed to see how and from where they start off.
Many of us can very appropriately conclude that our days are numbered unless of course, the embryo of Al Qaeda India is destroyed before the birth.
varsha July 14, 2006 — 5:21 am
only u could decode SIMI and the P in Musharaff’s name.
Arnab July 14, 2006 — 5:53 am
The embryo of Al Qaeda India cant be destroyed, because its no longer in its nascent stage. The whole organization (and all other subsidiaries of AQ Inc) needs to be uprooted-we really have no other option….
And GB, did you forget to mention that Honbl Mr.Mulayam Singh Yadav, has promised SIMI with a 5000 acre SEZ?? And also airport modernization and of course ‘first class’ train compartment revamp projects….not surprisingly, SIMI in return is going to recruit 10,000 more BJs in the coming years, for their massive expansion projects…
An AQI spokesperson, in condition of anonymity is reported to have said that by this year end they’ll surely open another franchise in Kolkata, possibly in Rajarhat…the gala opening of which is scheduled during Durga Puja, preferably on the auspicious day of Ashtami…
dhananjay July 14, 2006 — 5:53 am
I am more appalled at leaders like Mulayam and Khurshid. Even after these blasts, these leaders continue to behave as if SIMI is innocent just because UP goes to polls. Bloody eunuchs. In fact, my apologies to the eunuchs for insulting them.
amitabha July 14, 2006 — 6:05 am
With ref to your B. J. (Bachelor of Jehad)-
If we were in Pakistan our options in education would be:-
1. IIT – Islamic Institute of Terrorism
2. JEE – Jehadic Entrance Exam
3. IIM – Institute of Infiltration Management
4. CAT – Career in Al-Queda & Taliban
5. IAS – Iraq After Saddam
6. M Tech – Masters in Terror Technology
7. GATE – General Apptitude in Terror & Extremism
Want to add more acronyms to this list?
‘P’ for Paki itself is a much more appropriate, politically correct and effective way of addressing Mushi in an abusive way than ‘P’ for P*ick.
Paki‘s, along with Al Qaeda are giving all Muslims worldwide a bad name.
It’s high time we forget history, keep aside ego and join Mr Bush despite all his idiosyncrasies in dealing with terrorism in real hard ways.
But I really doubt if it’s going to take shape in reality as the Indian Government by nature and by tradition is more concerned about the ‘huge’ vote-bank belonging to ‘minorities’ than the rise in terrorism in the country.
Looking at the Reservation issue and the Terrorism issue one can’t really be labeled ‘wrong’ if one feels it’s the ‘minorities’ who constitute most of our population in different forms.
A Amitabha:
IAS – Islamic Al-Qaeda Services (mainly killing and bombing)
IEEE – Institution of Excellence in Exclusive Exremism
@ Amitabha:
divi July 14, 2006 — 6:46 am
dear GB,
VERY RELEIVED. YOUR BACK TO WHAT YOU ARE GOOD AT. WRITTING SATIRICAL POSTS, WITHOUT DISTORTING THE ISSUE.
AND THE BEST THING IS I HAVE STILL NOT BEEN ABLE TO DIAGONISE YOUR IDEOLOGICAL TILT.
anon July 14, 2006 — 6:46 am
YOURFAN writes:
@GB:I have seen SIMI official (forgot his designation) in TV vehemently denying any link to the bomb blast in Mumbai. His logic (besides uttering several times that we had no role to play) was that our own community people also travel by the train in large number. Yes sure, as if they are not familiar with the term ‘collateral damage’ used by the terrorists. I think that is precisely the reason they targeted the first class compartment so that the impact on their community will be far less.
I said this in my comment in the ‘Man Has Created Death’ post and I will say it again. We all will have to be lucky everyday just to be alive and the terrorists will have to be lucky just once. That is the most bloodcurdling thought.
1indian July 14, 2006 — 7:12 am
Taking Ms. Saha’s comment seriously and being sure that our defence minister, being a bong, would be regular – though silent – visitor of this blog, here are a few “dare you” suggestions:
1) Cut off Indian kashmir from Indian mainland. Don’t consider all the bull about innocent civilians etc. Innocent civilians would suffer if one of them receive/make phone calls after/before terrorist attacks. Only have the army standing guard to stop infiltration, and stopping people from across border sending food-stuff and “other” supporting material (as far as you can ie)
2) Ask RAW to strike across border, each time “they” strike inside border. The strikes should be around double the numbers here like 7 blasts to 14 blasts – you got the drift.
Sir, you don’t have a vote bank as it is. As they say around here “Nange khuda se nahi darte”. To your Super PM, remind her the accolades her mom-in-law/idol got for the bangaldesh war.
Sick of saluting mumbai spirit.
1Indian
Rahul Razdan July 14, 2006 — 7:39 am
Haha. This takes serious talent to write on a subject like this without losing your cool.
Gourav July 14, 2006 — 7:57 am
Also, working with the industry, Pakistan (for the sake of a “freedom struggle”) is helping float some finishing schools (completely paid for, of course), they guarantee placements in most of the multi-nationals like Al-quaeda and lucrative overseas postings!!!
sach1tb July 14, 2006 — 8:15 am
I don’t know what to say — LOL or cry out loud.. it’s funny, but scary !!
Sandeepan July 14, 2006 — 8:32 am
I live in mumbai and on the day of blast i saw amazing cooperation within people and i really felt “wow”. The next day when some mumbaikars went for work (and not great many as the media reports have potrayed), one could only sense the tension telling from their faces. Then I thought “How long will people chant “Spirit of Mumbai”.The reality is that they will have to earn for their family. Because that is the most important thing that Mumbai offers. (apart from very good general behavior, of course)
This spirit-wirit of Mumbai is all creation of incompetent Administrators, Media and Politicians. The more they talk of it, the more administrators and Poltu-kakas(politicians) become lax. Everytime an incident happens, these scums chant “The spirit of Mumbai” It is probably the time the junta of Mumbai gets somewhat more violent so that the “Spirit” of Mumbai haunt the jokers for some time.
scipio July 14, 2006 — 8:58 am
GB… First of all, congrats on the excellent write up.
But did you notice the hate that such posts seem to gather?
One important thing that we need to remember is that such a huge terrorist attack would have never been possible without local support.
If the locals are ready to kill their own countrymen, then I believe it is time for some serious introspection. The main objective should be that foreign elements receive no support whatsoever from Indians… I believe that the government should be working towards this.
Don’t think of me to be a pacifist… I would probably qualify as a right winger when it comes to foreign policy, but this incident is as much an internal issue as it is an external terrorist attack.
Before other readers start throwing hate filled comments back at me, let me make it clear that I am a Hindu.
hopeless! July 14, 2006 — 9:22 am
http://www.expressindia.com/fullstory.php?newsid=71039
Mumbai Police sources said that the use of commonly used explosive material like dynamite or ammonium nitrate in the present serial bomb blasts not only dilutes the theory of involvement of bigger terrorist groups like the LeT but also gives credence to the possible involvement of lesser sophisticated local groups.
Disappointed, are we? (-:
@ scipio ….be reasonable man…..would this attack be possible without pakistani “freedom fighters?”….if you expect all Indians to be perfect citizens….WILL NOT HAPPEN…u r not being realistic about it..this is not about religon..chota rajan is a hindu isn’t he….he is the same scum…..agreed the internal shit has to be cleaned too….but it will be a lot easier if there is no garbage outside the house!!!
amitabha July 14, 2006 — 11:17 am
7/11 terror in Mumbai has taken 200 lives and injured more than 700 people. But the Mumbaikars and their children(may be, not many) went back to their offices, schools and colleges, the next day. There are debates whether returning to normalcy is really normal and whether people should stop their work for some days and protest against terrorist acts.
Stopping work and hence, damaging the economy will only help the ‘terrorists’ in achieving one of their goals. I will not say that the Mumbaikars are numb or nonchalant; they are brave in defying the terrorist acts.
Should we also have a debate on saluting the Mumbaikars (I will not use ‘the spirit of Mumbai’ as the phrase has become a cliché and is hated by many people, now)? Are we so sick and tired of the international games of terrorism that we forget one simple fact? The fact that living in Mumbai, under continual threats of bomb-blasts, requires lots of courage? Are we so angry and depressed that we do not recognise the brave common man of Mumbai and we can not stop telling others, ‘Look, he had to go to his workplace on Wednesday, anyway’?
Please think.
Let’s not forget the fact that Americans wailed after 9/11 but did not stop working. The Americans wailed because they had thought themselves to be protected by oceans and so, invincible. The Londers wept after 7/7 but did not stop working. India has been bleeding for more than 50 years (more if you consider the communal riots before Independence of India). When India had been bleeding itself in Nagaland, Mizoram, Assam and Tripura (Manipur has not cooled down and there is transitory lull in other States of North-Eastern India) few people noticed because the drama of terrorism had been unfolding itself in North-Eastern theature. Punjab bled but the bleeding has stopped. The scar remains. Kashmir is bleeding but not the way Prez Mush wants, always. So, it’s natural for the Jehadis to shift the theature elsewhere and to the commercial capital of India to get propaganda, hope ‘retaliation’ and get more publicity to their perceived cause and then recruit Jehadis from amongst the affected people if retaliation takes place.
Let’s also not forget the fact that this is a war, a proxy war added with verbal acrobatics (in fact, Psy operations) from Prez Mush from time to time. Please have no doubt about the proxy war. And we have political rulers who think that ‘reservation’ and ‘divestment’ are the most important issues in India because they have already solved problems like proxy war, inflation, unemplyment and so on and so forth.
I will end up with a quote from Moustache (character in ‘Irma la Douce’, the movie).
“…shows you the kind of world we live in. Love is illegal – but not hate. That you can do anywhere, anytime, to anybody. But if you want a little warmth, a little tenderness, a shoulder to cry on, a smile to cuddle up with, you have to hide in dark corners, like a criminalâ€.
Please think again.
An Ideal Boy July 14, 2006 — 11:19 am
I and the public know.
What all schoolchildren learn.
Those to whom evil is done.
Do evil in return.
-W.H. Auden, poet (1907-1973)
Simple!! But some people never get it.
anonymous coward July 14, 2006 — 11:34 am
http://countercurrents.org/ind-beg140706.htm
a bleeding heart liberal take ….
oh! we are to blame for the suffering of the terrorists!!
Suyog July 14, 2006 — 12:22 pm
I was asked by a colleague (and this is real) yesterday, that:
Whether I think if India is being attacked this frequently, and Al Qaeda is attacking India this frequently because “American” jobs have moved to India?. I had no words for him 😦
So, now that explains why Al Qaeda has outsourced to India 🙂 – I heard they are opening a back office operations and a call center to provide 24/7 help to their brethern in USA. Now, terrorists in USA have 24/7 Live support at their hands – and it comes from India! Ye!
PS: I am being sarcastic, and dont intend to offend BPO or anything.
I am surprised that our multi-media singh has not made any comments… maybe he is planning a economic package and tax breaks for them mayhaps?
Suyog
scipio July 14, 2006 — 1:18 pm
@Gourav – I totally agree with you Gourav… I reiterate my comments. I am a right winger when foreign policy, I agree that stern action needs to be taken against Paki/Bangladeshis if they are involved in this shit.Just take a look at Israel, they are frying the Lebanese with bombs coz two… yes TWO of their soldiers have been kidnapped. Compared to that where the hell is the Indian Govt.’s resolve
But some/many Muslims are disgruntled (there may be many reasons for this) and these are the ones that are aiding the terrorists. The only point I am trying to put across is that this is as much a serious issue as the Pak/any other country hand in these blasts. I believe that we should work in making sure that there is no internal strife…
Finally I also have to state that Muslims have to accept the fact that no religion is perfect. This includes every religion in the world. I as a Hindu see this fact. Hope for the same response from Muslims too.
Sameer July 14, 2006 — 1:29 pm
SIMI jokes to lighten up:
* are they called SIMIans ?
* Whats SIMIlar to LeT, JeM and other 3 letter acronymous organizations which hate people generally ?
* SIMIle – as in nutty like simians
Seriously, is there anything called the Al Qaida or is it a bunch of (dangerous, crazed) loonies claiming to be a ‘moral’ compass to assorted crazed loonies all over the world – a little like the pole star, which provides some direction, and is known to be around all the time, but you still need competent crew to navigate (especially thru the Amazon in daylight)
Methinks its an attention grabber – the Al’s are everywhere and nowehere all the time. Truly, its the homegrown variety of loonies, marxists, ranvir and other senas et al we have to tackle through assorted means to establish the fact that there is a constitution, and its to be followed. Bushlike wildfires all over the globe will not cut it – no one’s really solved anything like we’ve solved Punjab for good, so the lessons are all around us, really.
mohanvee July 14, 2006 — 1:32 pm
It is easy for Israel to take a hardline stance against someone, because in their case, the enemy is on the outside. How do you cope with the enemy within ? And it is not possible to evolve a simple strategy to do that, since it is just a few rotten apples who are giving the entire Muslim community a whole load of bad PR.
As the Indian govt, what do you do ? Look at all Muslims with suspicion ? You then risk antagonizing and further alienating the ones who are India sympathisers, and you end up making it easier for SIMI/ISI/ to recruit for their cause.
IMO, India is doomed to be a mediocre nation; We make small strides but are quickly pulled back to our knees by these internal divisive forces. Depressing, but too real…
Sandesh Aravind July 14, 2006 — 2:49 pm
Arjun Singh has announced 7.11% reservation for graduates with Bachelor of Jehad degree 😉
Sanjay July 14, 2006 — 3:08 pm
@Scipio on Local Support and on Israel:- Do you really think what Israel is doing is right ? Trust me you wouldn’t want India to end up Israel way. Honestly, Which is safer Israel or India ?
This whole terrorism thing is mostly due to our politics than because of anything else. Politicians created a mess in Punjab in the 70s-80s, now they are creating a mess in all over the country.
@Sanjay – I am not talking about whether what Israel is doing is right or wrong. As in any conflict there are two sides of the coin to look into. The fact that I am trying to point to is that Israel has the resolve to take firm steps in response to terrorism. This is something that the Indian polity lacks.
@Mohanvee –
“How do you cope with the enemy within?”
This is the question that I have tried to put forth. I don’t have an answer for this but we must make sure that no further enemies are created within the country.
IMO, India is doomed to be a mediocre nation
Indeed we are… if everyone starts thinking like you.
dOne July 14, 2006 — 5:51 pm
As usual, only you could have pulled this Satire. Great work, enjoyed everybit.
I should also mention, articles of this quality was long overdue from you. Not that I want to belittle, your other articles. But I enjoy the satires you write.
Lotus Eyes July 14, 2006 — 6:11 pm
Hi GreatBong,
I think I first came to your site via a link from Rashmi Bansal’s blog.
I have been visiting your site all these days and never left a comment. How impolite of me:(! I really admire your talent, especially your sense of humour. I laughed out loud reading your posts on Bollywood personalities and Mithun.
Your serious ones like those on reservation and the Andaman prisons left a mark, too.
However, this one takes the cake. The way you decoded SIMI is an example of awesome original thinking. And to put such a serious issue in a funny tone without demeaning its worth or the victims of these attacks, takes a lot of brains.
Looking forward to more posts.
@Debolin and @amitabha,
Terrific full forms for these acronyms! My, my..even the Americans with all their articles on these subjects would be hard-pressed to find something similar:).
psamtani July 14, 2006 — 6:31 pm
Let’s not forget that Israel is only picking fights with countries that it knows CAN NOT respond. An all-out Israel-Lebanon war would decimate Lebanon, but there’d be minimal damage to Israel. There’s a much larger risk in attacking terrorist cells in Pakistan (compared to Palestine and Lebanon). Resolve is a lot easier to turn into action when there’s little or no risk of hurting yourself.
@mohanvee: About the mediocre nation comment, its self-deprecating white-man worshippers like you who present India in a negative light.
swati July 14, 2006 — 6:42 pm
everyday, should i be grateful that no one has pointed their wand at my family and said ‘Avada Kedavra’?
i wonder if voldemort will die in book seven ’cause the voldemorts in our world seem to spring up like the mythological raktabeej.
Anonymous July 14, 2006 — 7:01 pm
I wonder what our dear friend Ms Arundhati Roy and her cronies have to say about this. Hmm.
TracerBullet July 14, 2006 — 7:04 pm
Oops that was me.
dipesh July 14, 2006 — 7:11 pm
Did you guys check out the Have Your Say section in BBC ? Lots and lots of commentators (many are actually British non-muslims) have commented that somehow India’s “atrocities” in Kashmir are responsible for this and hinted that somehow we deserved it. Disgusting really.
Kannan July 14, 2006 — 7:17 pm
The satire was great. Keep the barbs coming.
I am a person born and brought up in Mumbai. I have been here all my life. I have always been produ to be a Mumbaikar/Bombayite. But today, I will hang my head in shame. The shame lies in the way we reacted. Mumbai is a cosmopolitian city. We have so many disparate groups who dont care what happens to anyone else. Unelss it is something that affects me at the deepest personal level, i wont react. Everyone is abusing the city, using the pesudonym “Spirit of Mumbai”. I cannot believe that we are calling it such. how many times do we have to hear that the wheels of the economy cannot be derailed? Are we here only to be abused like this and have the money taken out to be pumped somewhere else?
I am too tired of the politicians, of the IB, police , of the pesudo secular people trying to potray that we are all united. I am though most tired of being cynical about everything. We have to create aspersions on everything. If the police says that we have got clues, we end up saying that they are bringing in some puppets to save their asses. Aren’t the police too people of this country? have they not taken up the task of trying to maintain law and order? And yes they are human too. and they too fail. But can we for one moment try to not think irrationaly and not create aspersions. Let them do the work. Lets be vigilant, but not capricious. We have politicians like Mulayam Singh yadav who actually stopped short of caling SIMI innocent babies. Why do we not have a real backlash against them. you know why?
Because he has in his control something known as the Muslim votebank. You know why? Because Muslims as a whole vote for one particular party, one man.
If you want to actually have that kind ofpower, think. With 20 % population, they are able to leverage 50% of the power. We with 80 % of the population can leverage only 50%. it is because we do not vote for a party. We do not vote against a party. we just vote like headless chickens. Why not the next time when you vote, vote for a party or just plain vote against a party. You are a citizen of the country. YOu do not like some one. vote against them. YOU like someone vote for him/her. you find both of them evil, guess what choose the lesser evil. But go out and vote. We deserve the government we get, becuase we as a peole have failed the country individually and collectively. Leverage every bit of the power you have. Guess what we wont have anythign stopping us. Think clearly. Think well , and go out and vote. Be it your local ward, your municpal corporation, your panchayat, your state, your country. IT counts.
We cannot wish them away. We have to drive them away.As it is said, God helps those who help themselves.
I also need an answer from some sane person.
If terrorists do not have a religion, why is it that even if 5% of the muslims are bad, 100% of the terrorists are muslims? and 100% of the populace, irrespective of religion get affected. You know it should be.
The terrorised have no religion. They are from all religions.
I am not overtly suspicious of Muslims. But dont kid anyone for God sakes. What you see there is the truth.
I am sorry for all the sermonising on your commentspace, but what i have seen and observed is something i wanted to say. I would like to thank you for letting me express them here, if you apporve the comment.
God bless all of us. Let him give us all the strength and direction.
greatbong July 14, 2006 — 7:32 pm
@Daaku: Well the infiltration of terrorist elements from Nepal and Bangladesh has been going on for some time now…this was inevitable.
@deBOLiN: Technically not outsourcing. LET operated in India and created mayhem in India. LET was a franchisee. It would be outsourcing if AQ used SIMI people to fight in Afghanistan(on-site) or used SIMI people to send threat calls to their enemies in Iraq.
@Varsha: 🙂
@Arnab: Now I really do feel schizo. Mr. Yadav is a very dangerous man and even more so the men in his party who have made UP the playground of SIMI activists.
@Dhananjay: True. Especially galling is Salman Khurshed who happens to be a member of the Congress party: the same ruling party that is putting the blame on SIMI.
What’s great fun is the UP government denying the presence of SIMI in UP a DAY after the DGP said that raids were conducted in SIMI hideouts.(http://timesofindia.indiatimes.com/articleshow/1748686.cms)
@Amitabha and deBOLiN: The jargon of the next generation—the ones that will be left alive that is.
@divi: That’s good ! Seriously though, I try not to have any prejudices and biases—however even the most off-center guy thinks that about himself/herself.
@Yourfan: SIMI official? If he says he is so, he should be behind bars as its a banned organization. As to why they targeted the first class compartments…that indeed is a thought I did not have.
@1Indian: Pranab Mukherjee veeeseeting thees blogg ?
@Rahul Razdan: I have lost my cool for a long time now with respect to these SIMI/LET/HUJI for some time now.
@Gourav: Yes and these “terrorist” schools impart practical training unlike the bookish stuff our institutes push on us. Only thing is that I hope that their alumni conduct their reunions in graves.
@Sach1tb: Scary indeed.
@Sandeepan: True. Its our papi pet that make us go to work the next day…not that we want to send a message to the terrorists.
@Scipio: The way this looks—it is an inside job. SP politicians who are providing political cover are all Indians. Only the training and the money comes from Pakistan but the talent is local—the same model used for Mumbai blasts, 93. The bombs are also local-made which reduces the chance of Pakistan getting egg on its face like the time unused RDX crates for the 93 bomb blasts were found to have originated from Pakistan.
@hopeless!: Sir, the use of low-tech explosives does not rule out the involvement of SIMI (ref my last comment reply). Don’t be elated so soon….or needlessly.
@Amitabha: Pakistan has realized that the theatre cannot be just Kashmir. It has to be “anywhere’ in India—-the message is “Nowhere are you safe”. Not in Mumbai. Not in Delhi. Not in Varanasi. And not on the campus of IISc.
@An Ideal Boy: So has evil been done to SIMI?—I must confess I didnt quite get the context here.
@Anonymous Coward: Oh let’s not even bother with them…
@Suyog: All out customer representatives are currently busy beheading other customers.
@Sameer: Al Qaida is a symbol. Opening a AQ branch is just a means to get attention from the Middle East for Kashmir. The fact is that the real Islamic world—the Middle East could not care less for Kashmir and India—all they want is the obliteration of Israel. By opening a AQ branch, these people are trying to bring Kashmir into the world-wide jihad movement…..
@Mohanvee: Mediocre nation? I think not. Not too many countries would react with the maturity and tolerance that India has with respect to what happened in Mumbai.
@Sandesh: Damn.
@dOne: Thanks
@Lotus Eyes: Under happier circumstances I hope.
@psamtani: True. Israel can flex its muscle because it knows how weak their opposition is. India just cannot put the army into Pakistan without being big time burned.
@Swati: Raktabeej…very apt.
@TracerBullet: Ms. Roy? The lady that justifies murders by Naxals. That lady? We all know what she has to say.
@Dipesh: The same thing that the Paki ambassador said. There is world-wide support for Islamic fundamentalism from many non-Muslims and this is because these terrorists have managed to spin themselves as the oppressed ones.
@Kannan: It indeed is a paradox of democracy that the majority is always the least represented because our minds never allow us to think like a “majority”. We always try to align ourselves into “minority” groups—religion, caste, language…..and align our interests along those lines.
@Psamtani: Even thought not relevant to this post and since we are already talking about Israel, I would add this. Israel also takes on neighbours or regional enemies who are bigger and/or equally stronger. Many might not recall Israel’s daring raid on Iraq’s nuclear plant in the 80’s destroying it completely. Iraq was a then a strong country under Saddam. And no way can we compare 80’s Iraq with today’s Lebanon.
Also I don’t have to remind anyone of Entebbe incident and our own IC-814 incident. Entebbe was under Idi-Amin-Dada – president for life and was hostile to Israel. So was Afghanistan. Ok leave Afghanistan, IC 814 was in a Indian airport for some hours before flying to UAE…
I think political will is lacking among our leaders. Even though I don’t like Indira Gandhi for her policies, I always admired her courage. Sadly noone in Congress has that legacy!!
@Sandesh – Israel’s enemies are nothing compared to its power and the backing of super daddy of all Big Bad USA. Compared to that I dont even comfortable going on an all out attack on Pakistan with our fully indegniously developed and corrupted Arjun MBT, I dont feel comfortable loading our nuclear weapon on AGNI, I dont feel comfortablw with any of our other Missiles Naag, Akash, Trishul all fancy names and that’s it. I have a feeling that If we are to attack Pakistan today, it will end in stalemate ala Kargil that too after the interference of Big Daddy.
Secondly, let’s not glorify Ms. Gandhi for 1971. She just happened to be at the right position @ right time. Infact it is due to her(and her father’s and her son’s ) mistake that Whole Punjabe burnt for 25 years and now we have this Al-Qaida threat within our country.
@Sanjay. I agree to your points on Indira Gandhi. I said in my previous comment that I never liked her policies. But she had the will to do things which today’s politicians don’t have.
Whatever you said is the debate that is going on in our country right now. How to react to this terror unleashed by Pakistan?
Some Indians like you believe we cannot go into a war with them. Some like me believe that we need limited military response in POK backed with strong diplomatic measures (including using BigDaddy) to prevent escalation.
We have tried for 15 years the option of meaningless rhetoric and motherhood statements like We stand Tall in the face of crisis…No one can shake us or We will uproot terror from the face of earth…blah blah
I feel its time for trying out newer approaches.
The Illusionist July 14, 2006 — 8:54 pm
Alrite, i read through most of the comments. I found it sad that some commentors had to state their religions so that others could reason with them and not hate them.
Yes we need to think about our foreign policy and shun any country which supports terorrism. And yes we need to clean up within our system. But somewhere and more importantly we need to clean up within ourselves. for years we have been made to fight amongst ourselves on the name of religion, to hold prejudices and form lasting impressions from the little that is evident, to believe we are the best and criticize other communities,religions, faiths and races and to hide under the pseudo shelters provided by weak rituals. and the bitter truth is that all of us have played into the hands of our lesser selves by closing ourselves within the boundaries imposed on our minds. I feel no more for Muslims being killed in some part of the world than for those who died three days ago. For it is the death of a life and trauma of a family. I would never state my faith in a blog comment but i guess this time i will. I’m a muslim and you can “throw hate filled comments at me” if it suits u.
Yes scpio no religion is perfect.. I accept it!!!!
She had the will because there was USSR backing anyone and everyone going against US or Its 3rd world allies. Also I am not against going to war with Pakistan, I just fear that we are not strong enough to beat Pakistan. As much as I would like us to be friends with Pakistan, I have always found all the rhetoric about Bhai bhai as useless.
@Sanjay – My point is about Indira’s Gandhi’s will power and ability to take decisions. USSR’s support for India is very very questionable as we know now since Kremlin archives have been exposed. Soviet Union was not entirely supportive of India at any point as India chose the middle path. Thats a different topic altogether.
I am talking about Mrs Gandhi’s ability to take drastic decisions like imposing Emergency, Operation Bluestar, arresting opposition leaders, nationalizing banks etc. Even though I don’t agree with or support any of the above mentioned actions, she was one person who had the guts to do things. Today’s leaders are mostly spineless.
mental baba July 15, 2006 — 3:16 am
Now that the hors d’oeuvre is done, we can expect the main course to be served pretty soon. With the presence of celebrity chefs to lend a helping hand, there is bound to be delectable fare served.
It remains to be seen how the dessert(s) will turn out. Thanks to the recipes of extremely capable in-house chefs like Mulayam Singh and Arjun Singh, they might just be the thing the doctor ordered.
On a slightly different note, Fortune magazine may also want to revisit some of its ranking methodologies to reflect the corporate economy of the 21st century being spearheaded by the likes of the Al-Qaeda Corporation.
# Gross Revenue (amount required to rebuild lives / infrastructure destroyed)
# Gross Profit (no. of innocent civilians killed)
# Any else that is gross
# Growth rate (% increase in no. of new cities / civilians targeted)
# Earnings per bomb blast
# Capitalisation on the Terror Index
# Brand Value (no. of newspaper headlines / most wanted lists adorned)
# No. of employees and total bonus paid out (in kind by virgins in heaven)
# Catchiness of company motto (such as Allah-o-Akbar)
@Dipesh: Should we care for them and their foolishness in believing the terrorists. After 7/7, they shud have had some sense drilled in their heads about the reality of the corporate called AlQaeda. There also, it was locals who did the couriering. After this also if they are idiotic enough to believe in the terrorists’ lies then it means that the Americans got competition in terms of dumbness quotient.
dear great bong,
GIVEN THE TRAFFIC ON YOUR BLOG,VISBLE FORM THE LONG LIST OF COMMENTS YOU HAVE THE POTENTIAL TO MAKE THIS PAID BLOG.
Ohh forgot about Ms. Roy. Now where are her bleeding heart comments?? Where are her blazing speeches calling India names. Looking at the dumbness of the West, I would not be surprised if she makes a speech in London saying that it was the Mumbaikars’ fault because we were not polite to the jihadis and the SIMIans. Hell, she has the Readers’ Digest survey as proof!!!
Sandipan Mondal July 15, 2006 — 6:46 am
A good post as usual. I would laugh, if reality weren’t so depressing. The fight on terror is supposedly a global war, but in this battle that rages on without any end in sight, we stand alone.
@GB, who said the army has to cross over? All one has to look for is rush hours at some Karachi trains, like our dear friends!
ankan July 15, 2006 — 8:15 am
You are a fascist! A hindu fundamentalist son of a….. You! You!
smug :))
Anonymous July 15, 2006 — 8:26 am
Its not about going to war with Pakistan. We have to act fast to destroy their terrorist camps. Intelligence operations are the key. We have to create turmoil in the other side of the border like they are doing here.In a secret way like Pak is doing not like Israel and US.
I am also a peacenik but these incidents make me angry.As I said we have to destroy terrorist infrastructure by clever,secret methods.
Thanks Ankan.
And on second thoughts, Ankan, isn’t it of some importance that after fifty years of the partition you still know that the one who wants to do this to Pak is a hindu?
yourfan2 July 15, 2006 — 5:09 pm
India can never be an Israel. Temperamentally we are not the same …also when it comes to netional security, the Israelis are one for all and all for one. But India itself has so many bleeding hearts who like to dig their own graves. I have been amazed to read some of the views published in the internet by some Indian bloggers about terrorism. Some seem to be more concerned about the safety of Muslims …and tend to downplay the main act itself- the explosions. Not one except GB has said anything about Simi…but I find that they mention Gujrat and Babri Masjid in every second of their posts. Clearly, this ‘temples may burn but mosques should not be touched ‘ idea fetches them brownie points with the western media , many of whose components think that India has a Hindu fundamentalist regime and that Muslims in India live like Jews in Nazi Germany. How simplistic it is of these motherfuckers then to demand that status quo should be maintained. If things go on like this, then events like these will repeat themselves with monotonous regularity. Also I wanna see those people who in GB’s early posts said stuff like “Terrorists are human too”. Oh yeah …please definitely say that again when your ass is blown off. These are the same people who will jump at your throat if you even mention the word Islamic terrorism. “Not all apples are bad”, they shout . Now I’m just tired of listening to that shit again and again. If I say Islamic Terrorists, I say so because in 99% of cases terrorists turn out to be followers of that faith…its like a female paedophile…by that I just mean that the paedophile is a female…and Im not meaning that all females are paedophiles. But I am just amazed to hear guys squirm and blush and refusing to acknowledge the bleeding obvious.
All political parties and even Muslims should acknowledge this fact. And the government would be well advised to nip in the bud fledgling terror organizations like SIMI. But how can this be possible with the ideology of the party at the center and mothefuckers like Mulayam and Lalu? The sad thing about all this is that people in cities are no more safe- wheather at schools colleges or public transport. Every moment of life from now on will be as tense as Bruce Lee in that multiple mirrored room in the movie ‘Enter the Dragon’ – you never know which image is the real one. Beware people.
Again I repeat India should not become Israel. The international reaction against India will be bad and that’s something that India can least afford. As I said a proxy war is the key. Not against innocent civilians but against terrorist camps.It should be done in a secret manner.
Bindu July 15, 2006 — 10:03 pm
Well written. It’s not easy to present anguish with a humorous spin.
mohanvee July 15, 2006 — 11:33 pm
Neither am I a “subservient, self-deprecating, white-skin worshipper” nor a pessimist/defeatist.
The hard reality is that as a nation, India is so fragmented that it is easy for anybody to divide people into factions and recruit for their causes.
“Unity in Diversity” is not necessarily a great thing I guess… We need all unity and no diversity for some issues. When your neighbor is planning to bomb a train, you should tell on him, even if you are both of the same religion.
But with all sorts of jackasses running the govts and the places of worship and in some cases, beacons of academic excellence attached to places of worship ( which incidentally are above and beyond the law of the land ) , I just do not see how this will happen.
Whatever its motives, this is what an alleged “Communal Party” has been asking for, a uniform civil code. Can someone explain to me why that is not feasible ?
I think in this discussion we should not forget that political parties such as the BJP, Shiv Sena, VHP and their likes are also responsible to some extent for the unleashing of the wrath of these terrorist organizations. Ofcourse the whole bulls**t about ‘Kashmir ki Azadi’ has been around for longer than the growing political clout of the above parties. I feel its key to note that the blasts came just one day after the Shiv Sena lumpens created havoc over the ‘insult’ of the dead Mrs. Bal Thakarey’s statue.
This whole Kashmir issue is also very complicated. In my university where I study, I have to sit through one hour long lectures of pristine hogwash about how ‘Hindus’ i.e. the Congress did unjustice to ‘Muslims’ by keeping Kashmir to itself. Hari Singh’s decision doesnot hold value supposedly because he was a ‘Hindu’ and he couldnot have represented the Muslim majority in Kashmir. Or so the Prof. has been teaching for years. Students are taught that Kashmir should have gone to the ‘Muslims’ (Pakistan). Mind you, this is a prof. of Indian origin now settled in US. Why she teaches this bull is known only to her. And she’s not the only one who does so. Considering that these well-known (that she is) intellectuals are spreading this message to the ‘Gobal Thaneddar’ (read Uncle Sam) on the issue of Kashmir, these attacks get projected as a ‘freedom struggle’ to the common American and the powerful lobbyists in the corridors of the Senate. Thus there is a complete new twist given to the addage ‘one’s country’s freedom fighter is another country’s terrorist’.
I think this is a very disturbing trend I see in South Asian academia in the US. So the way we approach the issue in India becomes nothing but merely a matter of state propaganda we Indians have imgested since 1947.
All this horrifies me to no end. My worry is how long will the Muslim youth in India silently observe and endure being an item of suspect for many of us??
dipanjan July 16, 2006 — 6:51 am
I feel its key to note that the blasts came just one day after the Shiv Sena lumpens created havoc over the ‘insult’ of the dead Mrs. Bal Thakarey’s statue
Yes, of course. A terrorist operation of this scale can so easily be co-ordinated in less than a day.
USA’s South Asian academia’s anti-India rhetoric is half cold war leftover and half perenially anti-USA (hence currently pro-Muslim and anti-India) shrillness. They need to be fought, but in the big scheme of things I doubt how much they matter.
Bored July 16, 2006 — 9:42 am
Nothing will change. Nothing. This bloodshed is going on in assam for the last three decades. And nothing has changed. The fault lies in the basic structure of our indian government. Damn it, we dont even know whom we are are electing to be our next prime minister or chief minister for that matter.
We elect some bull shit spewing sycophants and they in turn elect the best sycophant among them. What with the 2/3rd majority rule and 60% of the votes being undecided before polling, we have a sure fire recipe for perenial alliances that ensures maximum benefit to the parties and maximum screwing of the general populace. Can somebody spell ‘common minimum program’ ?
And than we have a screwed up ratio of seats in the parliament, with some states having way more seats than others.
It all goes a long way to make sure, no governement can take a hard stance or do the right thing without their alliance partners threatening them to pull the plug.
The entire process and rules of electing and forming a government has to change for any real effect to happen.
Untill than there are 100 crore living indians to be used as disposable human shields.
Vinay July 16, 2006 — 12:18 pm
Great post GB,
I find it funny no end that media should equate the 1 day shiv sena violence that at most injured a dozen people, with a serial bomb blast that killed 200! There is no doubt whatsoever that what the shiv sena did was totally shameful; But to equate it with j*eha*i terrorism is enormously lame!
Another observation:
99% of “some people” are (supposedly) as peaceful as everybody else..
But if the ruling party takes action against the 1% (terorrists), 80% (this is to say a wide majority) of “some people” vote it out of power in the next election.
@anon: You said: “I think in this discussion we should not forget that political parties such as the BJP, Shiv Sena, VHP and their likes are also responsible to some extent for the unleashing of the wrath of these terrorist organizations. ”
Let us for a moment assume that Shiv Sena, BJP etc etc ….from tomorrow become the biggest caretakers of Muslim interests….to such an extent that it even leaves the Congress red faced. Do you think this act will be reciprocated by hugs and kisses and that it would stop terrorists from ‘unleashing their wrath’?
Now you may argue that it adds fuel to the fire, but my point is that the fire started for a different reason can sustain itself without that kind of fuel. Im not saying that you subscribe to their views, but Ive been appaled at some writers recently about trying to lessen the atrocity of terrorism by drawing instances from history like Ayodhya and Gujrat. Cartain hard mesaures will be needed…but I wonder how they will be implemented in real life when you have people in powerful positions exonerating groups like SIMI. This act should also be an eye opener to the Indian govt that confidence building measures with Pakistan have zero results as far as thwarting terrorism is concerned. There will always be a steady supply of indocrinated bastards who will pick up arms and cause these kind of acts- under the order of the despotic military regime of Pakistan who live only for the purpose of causing harm to India and her citizens. After the act of terror, good people from both sides of the border irrespective of their religion will condemn the act. But …as a Led Zepplin song line goes, “The song remains the same”.
The second part of your comment was disturbing indeed. While I agree with Dipanjan that it wont have much effect on the current state of affairs, I find it disturbing because if most US unis have teachers like this, then this twisted view will get seeped down to the American student body, a few of whom may go on to become policy makers, diplomats and senators later on.
Sayon July 16, 2006 — 5:07 pm
gb – great blog. rather a amusing way to look at a chilling topic.
a general comment on some of the comments to your post: i thought i’d put my two bits in, because the tenor seems to be that most armchair hotheads in india seem to have.
the reason that the war on terror will not be won is because there is no solution – once the strategy of engaging the nation state with clandestine war has been understood, there can be stopping it. if you remain liberal and understanding, you will remain a soft target. if you become a hardliner, match force with force, dead terrorists will become martyrs and inspire the next generation of terrorrists.
israel, for all its hardline stance, has not been able to prevent the formation of palestine. attacks and killings will only harden Palestine against them.
the might of the soviet union couldn’t prevent a debacle in afghanistan, or in chechenya, for that matter.
and the sole superpower is making a royal mess in the same way, maybe worse, having opened up more fronts.
its easy for you and me to advocate a hard stance on terror – the government should bring in laws like POTA, or fight terror like in punjab. its easy, when we are comfortably sitting in our room in front of the computer. not so when the police has picked up your brother on a faint suspicion late at night, and you know deep down that he will never return (Ask any civilian who lived in punjab at the time of KPS gill, or those who survived the naxal era).
india has often been hotblooded enough to want to fight a war, or at least blow up the terrorist camps in pakistan, but the army has clearly warned that the battle would not be won if we invade a nuclear enabled pakistan.
my feeling is that once humanity achieves a critical density, wars and terrorism are nature’s way to cut it down to proper limits. sort of bio-feedback. nothing you can do about it, except to try and make is as painless as possible for the survivors, like trying to build a decent society, that believes in justice and due process of law. even for terrorists.
Dipanjan and Yourfan:
You are right that an attack on such a scale would have needed days of preparation, but the timing should not be mistaken. I do feel that the current state of viciousness is also being perpetuated by the Sangh parivar and the rest. In a state like today’s India, communal disharmony is the last thing we need. One needs to read the reports on how Muslims as a community are being targeted every time there is a terror attack in India to understand how intolerant our society is gradually becoming. Ofcourse being secular doesnot mean that these attacks will stop. But the point is that why are our own youth joining organizations such as SIMI (this accepting for argument sake that it is all in all a terrorist organization)? Money maybe/is a part of the reason, but I also think that there is something deeper than that, what I would call an ideological affinity towards an anti-India stand. And it is here that I think there is a chance of a marginalized Muslim youth joining these organizations. And such a malicious outlook of suspicion towards Muslims is being perpetuated by the Parivar. To deny this is to ignore the obvious. And I do agree that there is no point in bringing back a self defeating argument of ‘they’ did this to ‘us’, so desecrate ‘their’ mosques. In today’s India which has so much potential, we can hardly afford to slow down the pace of our economic growth due to a civil war or communal riot. This is pure and simple economics.
Regarding the second point of my previous comment, I think (assuming, and I may be wrong here, you are both either engineers/software professionals, working in the US) the realm of your social interaction is such where such discussions are perhaps not carried out with your American colleagues. You need to just talk to one of these scholars to know what kind of an image they have portrayed of India in general and Hindus in particular on the issue of communal interactions. Its also easy to say that they don’t matter in the big picture. But the prof I had in mind is an advisor to the US Senate on Islamic affairs in South Asia so her baised views have the scope to hit the nail right on the head. Also, the students (both grad and undergrads) are also voters, they write in newspaper columns, have their own blogs, write scholarly papers and many will reproduce her ideas and in turn influence public opinions. To ignore this all together is undesirable, in my view. You got to sit in these classes to realize and see what goes on. In general, I feel that in most US universities, the South Asia faculty in general is spreading the opinion that the retaining of Kashmir after Independence was unjustified to Muslims and its the Indian state which has encroached upon what rightfully belongs to Pakistan. Check out Ayesha Jalal’s “The Sole Spokesman” (on Jinnah) and you’ll find it features in atleast one course on South Asia in 8/10 US universities today.
i wish a kashmiri would comment on this issue here.
i wish an indian muslim would write in here.
there is a neo-malthusean sayon. is there a collective lemming like behaviour that prompts us to self destruct in case of overcrowding?
psychologists, please write in.
dipanjan July 16, 2006 — 8:00 pm
I disagree that Muslims as a community have been targeted after every terror attack. Overall Indian tolerance and resilience, in the face of terrorism and vested interests, have been remarkable. I am not sure at all our society is gradually becoming more intolerant. Even if there is growing anger and intolerance, it is because of our government and media’s apathy to loss of Indian lives. How do the efforts to soften the impact of terrorism by rationalizing it help there?
Regarding the second point, first please let’s not get into assumptions about what I (we) do and my (our) daily interactions.
My point, which I admit I did not expand, is US foreign policy is primarily determined by a balance of corporate – which includes the military complex – interest and electoral calculations. The role of ideology has always been small and post cold-war, it is diminishing even more.
Whatever the future senators and congress representatives are learning in their South Asian History 101 courses in Ivy league universities and liberal arts colleges will be forgotten once they grow up and sit with the board of directors of Fortune 500 companies and hedge fund managers who are also managing their personal portfolios; and their constituent is less worried about Hari Singh’s authority than lost call center jobs and prices at Wal-Mart.
Winning the academic battle of gaining mindshare is not totally useless, but integrating and embedding Indian economy with the global(US) economy is far more important.
Amit July 16, 2006 — 10:57 pm
Hi Arnab (and all regular visitors here),
In my opinion, the Muslims need to “re-identify” their religion. I might sound very awkward, but please read ahead.
When I see any muslim gentle man, one of the first things that strike my mind is ..”is he a moderate muslim or a radical one”. If find him radical (perpetually dressed in kurta, bearded, burkha, etc), I think twice before opening up in front of him. And also I really feel pity for the moderate ones (like few of my friends), who just decide to keep their mouth shut whenever topics like these surface. I am sure, that they feel that they are being looked down upon for something they do not have any control over – just thrusted over them owing to the religion they follow.
The basic problem lies in the fact that we lack open minded clergies in India for Islam. Someone, who would not think that “Islam is in danger” and advocate “Jihad”. Someone, who can talk at length about the goodness of Islam, and can present it as it is existing in India – without putting the Afgan and Palestine muslims in the same bucket. The Indian muslim community is one of the most prosperous comminities in the world, and they should learn to identify themselves like that.
I am sure, that once they identify themselves like that – they can openly distinguish between a jihadi type the moderate types. And if this comminity feeling is strong enough, they only can raise their voice and outcast the anti-socials as anti-islamists. From the history, we know that peaceful coexistance of religions occured twice in India, during the reign of Ashok and Akbar – because both of them were liberal and re-defined conflicting religions (Akbar mainly).
I really want to see the Imam of Jama-Masjid come to National television, and address about the Bombay Blasts to the Muslims of India (not the entire world).
“I am not sure at all our society is gradually becoming more intolerant. ”
Dipanjan, aapke muh mein ghee shakkar (as they say) if only this was true. In my heart of hearts thats what I would love to believe in, but trust me thats not a fact sadly in India today. This whole usage of terms like “moderate”/”progressive” Muslim itself is pitched against an ‘Othering’ as it were of a retrograde religion of bigots.
Its not a question of one over the other. Both are equally important.
“Whatever the future senators and congress representatives are learning in their South Asian History 101 courses in Ivy league universities and liberal arts colleges will be forgotten once they grow up and sit with the board of directors of Fortune 500 companies…”
I think this again is a limited scope of outlook. There is a bigger world which has its own ways of making an impact and which *doesnot* comprise of the Fortune 500 clique. It does make a difference if we want global support from the biggies which–whether we like it or not–determine international decisions. If the general outlook is that India is the enchroacher, then we cannot hope to get international support in our fight against terrorism. So when Manmohan Singh does to the G8 and speaks on terrorism, it is taken as good as Musharraf’s rhetoric on Kashmir.
BTW, I was not talking of mere S.Asia 101s, these are hardcore Grad school seminar classes. People who sit around that table next to me are all future South Asian specialists, many of who will have key roles to play in influencing both common and state persepctives on the sub-continent. There is a world beyond the white collared job circuit.
Shan July 17, 2006 — 6:22 am
@Dipanjan, Yourfan, and Anonymous:
Why does this have to be an either/or scenario? Why can’t both hindu fundamentalism and muslim extremism be the reason for terrorism, the former for branding Muslims as terrorists and breaking mosques, and the latter for wanting to unite the world under the Muslim ummah and killing kafirs? Neither side can be absolved of culpability, I feel
@Arnab:
Let me tell you of something that happened to us (colleagues and me) at AbuDhabi on a business trip that proved to us that religious leaders in the Muslims actually DO incite common people.
We got into a cab, that was driven by (maybe) a Pakistani. He was listening to something (sounded like Azaan) on his tape before we got in. As soon we got in, he switched tapes to an urdu one so that we (obvious) Indians and out of country people could understand. It seemed a deliberate move on his behalf because the tape was that of some cleric who was asking all to follow the path of jehad and Allah. As we sat there disbelievingly, stunned, the guy on the tape went on to describe in gruesome detail what would happen to those who did not follow the holy path, in “jehannum”. Their flesh would be steamed as “in a pressure cooker” and they would be forced to “eat the pus from their suppurating sores” etc.
Now the fun part. He then switched to the followers, saying that those who followed the holy path would get, hilariously, “ek ticket mein bahattar mazey” and that there would be 72 “hoors” waiting for them in “Jannat” willing to do their every bidding!
I remember thinking –
A) This 72 virgins thingie was actually true! Not an invention by the Americans for propaganda!
B) Wow, no sex on Earth – sex being dirty and disgusting, and unholy, and a western concept – but if you followed the path of jehad, you are rewarded with sex in heaven!
We did not say a word during the ride, knowing that any adverse reaction was liable to get us arrested for blasphemy. At the end of the ride the cab driver took our money with a knowing smirk and drove off, his mission to befuddle us complete!
An Ideal Boy July 17, 2006 — 9:38 am
‘I and the people’ are those who have been wronged.
Not SIMI.
Amit, people like you need to get their perspective right. Not everyone who wears a beard or Burqa is a radical muslim.
Pushan July 17, 2006 — 7:42 pm
A true was story is never moral. It does not instruct nor suggests models of proper human behaviour, nor restrain men from doing these things men have always done. If at the end of a war story you feel that a small bit of rectitude has been salvaged from the larger waste then you have been made victim of a very old and terrible lie.
Ashish July 17, 2006 — 7:45 pm
To reduce some tension, look who is coming to bollywood –
http://in.rediff.com/movies/2006/jul/17mimoh.htm
Its Mimoh, mithun da’s own! 😀
greatbong July 17, 2006 — 10:45 pm
@Mental Baba: Very funda-mental.
@Divi: Paid site? No mam. I believe in the Desibaba philosophy.
@Sandipan: You are alone in any battle. Lets not expect other countries to stand by our side.
@1indian: Mm..
@yourfan2: Point accepted at this tendency of certain bloggers to drag their “liberal” angle into this…their burning indignation at other events contrasts sharply to their ambivalent apologism in these cases.
@Bindu: Thank you
@Bored: True. We do not value our own lives.
@Vinay: I also found statements of the form:” islamic fundamentalist violence is usually accompanied by a backlash” as something not supported by raw facts—I am referring to the “usually” part.
@Sayon: Hmm.
@Swati: Me too…there was one who did…I wonder where he is now.
@Amit: Open-minded clergy is a contradiction in terms. Muslims have been historically marginalized and when the Muslims try to find an answer for this the maulvis say the Hindus did this to you.
@Shan: Amazing anecdote !
@Pushan: Hmm.
@Ashish: Yes I know…let his movie come out before I start my worship.
@Shan: Fascinating story, thanks for sharing. Of course it does not have to be either/or – terrorism and violence of all sorts must be despised equally. My comments were triggered by anon’s framing of the bomb blasts as a reaction to Shiv Sena’s lumpen acts and his assertion that
Muslim community has recently been targeted after every terror attack. I disagree.
@Anon: There is a world beyond the white collared job circuit
I have been inside too many US universities to deny the existence of that world. The doubt is about the impact of academics and their ideology on people and policy, particularly when they are pitted against corporate interest and electoral calculation.
When I read the history of 1946 riots in Calcutta and Noakhali, 1947 riots in Punjab, accounts of what happened in East Pakistan in early 70s and then compare it with what has been going on in India in the last couple of decades despite extreme internal and external provocations from both sides, I see no reason to be as pessimistic as you seem to be.
VG July 18, 2006 — 8:11 pm
http://mrzine.monthlyreview.org/rao170706.html
Take a look at the link above. All we need is some more people like this and we can carve up the country into smaller pieces to be controller by China, Bangladesh and Paksitan.
Pingback: Click me you gay
Pingback: Lipitor grapefruit juice.
qCQwNIOWnWTdYDgGZJc April 18, 2008 — 8:17 am
fo033.txt;2;5
Leave a Reply to dhananjay Cancel reply
Previous Man Has Created Death
Next Lessons Learnt From the Ban on Blogger | cc/2020-05/en_middle_0078.json.gz/line1245 |
__label__cc | 0.548252 | 0.451748 | GreysonWHY
Conlangs, GURPS, and more
Greyfolk language
Tag: netflix
It’s a life update!
This is mostly for me, really, but you might learn some fun things too!
The weather was warm today! That was nice. I’m slowly recovering from my cervical radiculopathy, I think.
I’ve been listening to the My Brother, My Brother, and Me podcast as well as the audiobook for A Memory of Light from The Wheel of Time series.
What about video games? Grim Dawn just got its Forgotten Gods update. I love that game and I’ve been meaning to get back to it once the update came out! Deep Rock Galactic also just got a substantial update. It’s been a minute, but I’ve also been enjoying Stardew Valley a lot. Also, both Borderlands 3 and Borderlands: Game of the Year Edition were just announced, so that’s really exciting. It’s also Pokémon season—supposed leaks about Pokémon Sword and Shield have been everywhere. Super Mario Maker 2 and Crash Team Racing Nitro-Fueled are both coming out in June. There are rumors about two new Nintendo Switch console versions being released. I’ve been meaning to play some more of Wargroove ever since the update for that came out. And I’m always on Metroid Prime 4 and Animal Crossing watch. I’ve got a bunch of other games in my backlog like Divinity: Original Sin 2, which I’ve been dying to give another shot. And they just announced Divinity: Fallen Heroes, which looks pretty cool. And there’s Pillars of Eternity II: Deadfire which is getting a turn-based mode reminiscent of what I love so much about the Divinity series. And what about Dwarf Fortress and Halo: The Master Chief Collection coming to Steam? And what’s this about Risk of Rain 2? That looks really interesting, though I couldn’t much get into the first one. It’s a good time to be alive… and I’m starting to think that this post was just a subconsciously-created excuse to talk about all of the overwhelming feelings about video games I apparently have. I don’t even consider myself a gamer, but look at all of those great games!
I’ve been reading the manga of and watching the anime of JoJo’s Bizarre Adventures, and, boy, has it been an incredible journey. オラオラオラオラ! Not only do I finally understand all of the memes, but it has been deeply inspirational.
There’s also The Great British Bake Off, which I’ve been watching with my girlfriend. And Daredevil, which I’ve been watching with her and my dad—it’s been a bit disappointing. I still need to watch Get Out and also The Cat Returns. My girlfriend also told me that Legally Blonde is on my list. Like, she told me that just now. Oh, and we just watched Incredibles 2! That was nice.
The GURPS-related DFRPG Kickstarters for Dungeon Fantasy Monsters 2 and The Citadel at Norðvorn were both big successes as far as I could tell. I’ve also been watching the development of Ooblets over on Patreon, which could also go under video games, but talking about Kickstarter is what made me think of it. Oh, and, likewise, I’m also watching out for Littlewood.
March 28, 2019 May 20, 2019 greysonwhyanimal crossing, anime, audiobook, book, borderlands, cervical radiculopathy, crash bandicoot, daredevil, deep rock galactic, dfrpg, divinity, dwarf fortress, gaming, get out, grim dawn, gurps, halo, incredibles, jojo, jojo's bizarre adventure, kickstarter, legally blonde, littlewood, manga, mbmbam, metroid, metroid prime, movie, netflix, ooblets, patreon, pillars of eternity, podcast, pokémon, risk of rain, stardew valley, steam, steve jackson games, studio ghibli, the cat returns, the great british bake off, the wheel of time, video game, wargrooveLeave a comment
Late to 2020: Reviewing 2019
End of November writing report
End of October greyfolk language report
Is it Greyfolk or greyfolk?
New greyfolk language typeface, syllable blocks, numerals
Conlang Stuff (21)
Greyfolk Language (21)
GURPS Stuff (4)
Project Sirocco (1)
Writing Stuff (1) | cc/2020-05/en_middle_0078.json.gz/line1249 |
__label__wiki | 0.748986 | 0.748986 | The Knowledge to Act
IISD Staff
Employment and Consulting
Through our research and science, IISD develops and delivers innovative solutions to some of the world's biggest challenges.
Economic Law and Policy
SDG Knowledge
By generating and sharing knowledge that spurs action, our work affects economies, communities, ecosystems and lives in nearly 100 countries.
IISD Experimental Lakes Area
SDG Knowledge Hub
Global Subsidies Initiative
NAP Global Network
IGF on Mining, Minerals, Metals and Sustainable Development
NAFTA Renegotiations
IISD takes a big-picture view, addressing issues such as ecological destruction, social exclusion, unfair laws and economic rules, and a changing climate
Agriculture, Water and Investment
Stay connected with our email newsletter, or on our social networks.
Sign up to our Newsletter Donate Now
© 2015 International Institute for
Publication Overview
IISD
Karla Zubrycki, Henry David Venema
2012 IISD
EcoHealth: Health, Well-Being and Watersheds
This brochure summarizes the watershed-based approach to ecohealth taken by the International Institute for Sustainable Development, in partnership with the Network for Ecosystem Sustainability and Health.
It provides the rationale for approaching public health at the watershed level and illustrates how the ecohealth concept can be applied through case studies on the Cowichan Watershed in British Columbia and the Seine Watershed in Manitoba.Ecohealth thinking can improve the efficiency of health care investments by proactively protecting people from threats and improving their day-to-day surroundings and sense of security. Preventive public health through watershed management may, in fact, be a more efficient allocation of scarce resources than standard health spending.
For the full details on the Ecohealth and Watersheds: Watersheds as Settings for Health and Well-Being in Canada project, click here to view the report.
Participating experts
Karla Zubrycki
Henry David Venema
Watersheds and the Bioeconomy
Water Innovation Centre
Subscribe to IISD's email list to stay up-to-date on the latest news, research and analysis related to sustainable development
AODA FEEDBACK | cc/2020-05/en_middle_0078.json.gz/line1256 |
__label__cc | 0.645196 | 0.354804 | I beg to difer
The slave trade
Part of a much larger mural along Rogers Avenue. If you look at the mural in Street View, you can see that Google's automatic face-blurring software has blurred the faces of almost everyone honored in the mural!
Temporarily out of service
The cavity behind the sign currently contains three magazines and zero alarms.
Barberz #4
Out of bizness, sadly
St. Jerome’s R.C. Church
I feel like I’m being watched
It's the NYPD SkyWatch!
Look familiar?
It's another FDNY communications dispatch office (here's a better comparison picture — look how similar they are!), or at least it was until 2008. Fittingly, the Russell D. Ramsey Memorial Triangle is catty-corner to this structure.
Brooklyn Botanic Garden construction wall
I had never heard this before, and I can't find any confirmation of the claim, but I hope it's true! There's not much left of Ebbets Field — its former site is occupied by high-rise apartments.
Something else I learned from this informative wall: "Before its original 39 acres were designated for a botanic garden in 1897, the Garden's land was covered in trash, construction rubble, and ashes from its history as a city dump."
Dr. Ronald E. McNair Playground
As indicated, this innovative playground is located between Lexington and Third Avenues, between East 122nd and East 123rd Streets, in Manhattan. This sign, however, is located about nine miles away, near the intersection of Washington Avenue and Eastern Parkway, in Brooklyn, at the entrance to Dr. Ronald E. McNair Park.
Carroll Street pedestrian bridge
Over the Franklin Avenue Shuttle tracks
Day 219: Lantana | cc/2020-05/en_middle_0078.json.gz/line1259 |
__label__wiki | 0.851097 | 0.851097 | Ice Cream Convos
Serving Delicious Scoops Of Entertainment
Jenifer Lewis Sues Her Ex After Learning He’s An Ex-Con & Con Artist: ‘My Heart Was Shattered’
Jenifer Lewis is shattered, but not broken.
The “Black-ish” star filed a lawsuit against her ex-boyfriend after learning he’s an ex-con and a con artist hours before her mother’s passing.
In a statement released on her social media pages, Jenifer wrote, “Hours before my mother passed away, I learned that the man I planned to build a life with was a convicted felon and con artist whose criminal career spans more than 25 years, with a special skill in swindling women.”
The Jenifer admitted, “It was like my soul was shattered.”
Read Jenifer’s full statement via Facebook below:
On September 11, 2015, only hours before my mother passed away, I learned that the man I planned to build a life with was a convicted felon and con artist whose criminal career spans more than 25 years, with a special skill in swindling women. This man, whose name is Tony Wilson, had been sentenced in 2010 to four years in federal prison for conning investors out of $4 million and was currently out on parole. I learned also that his name wasn’t Tony Wilson—it was Brice Carrington.
By searching online, I learned that Tony Wilson is a convicted felon and con artist. By searching online, I learned that Wilson, as Brice Carrington, had falsely claimed to be a three-time “Oscar winner” in sound design and had paid a jeweler to create fake Academy Award Oscar statues to lure unsuspecting investors for his sound effects business. By searching online, I learned that Tony Wilson’s current alias—Dr. Antonio M. Wilson, an Oxford-educated Ph.D. in Theology who lectures at UCLA, and who is a self-published author of religious books and a former Navy SEAL—was concocted while Wilson was incarcerated in federal prison.
Unfortunately, I learned the truth about Tony Wilson only after he conned me into investing more than $50,000 into the exact same sound effects business for which he had plead guilty, for which he had served time, and for which he was currently on parole.
Tony Wilson, an LA Fitness Club Manager, introduced himself to me while I was working out at LA Fitness. What began as a professional relationship became a personal one. When I learned the truth about Tony Wilson, I immediately notified LA Fitness. The purpose of notifying LA Fitness was to urge LA Fitness to take action to protect its members, especially its women members. Instead of LA Fitness protecting its members, LA Fitness protected Tony Wilson. LA Fitness protected Tony Wilson by telling me that I should stop accusing its Club Manager of being “a fraud and a con artist.” LA Fitness protected Tony Wilson by “advising” me to stop going to the LA Fitness location where I worked out because Tony Wilson was the Club Manager.
Ironically, LA Fitness protected Tony Wilson by providing him with an email confirming that LA Fitness was notified that Tony Wilson was “a fraud and a con artist.” Tony Wilson then used the email provided by LA Fitness as evidence against me in court. The LA Fitness email allowed Tony Wilson to allege that I had “wrongfully attempted” to have him fired from his job at LA Fitness by bringing to LA Fitness’ attention that he was “a fraud and a con artist,” which, in fact, he was—and is.
That was in October 2015, more than 15 months ago. As I testified in court, “It was like my soul was shattered.” Since then, I have had to pick myself up, put myself back into therapy and take good care of myself. I am of course still mourning my mother and doing my best to trust again.
I have worked hard and now feel emotionally capable to take the final step in my healing, which is to protect others.
Therefore, I have brought suit against Tony Wilson and LA Fitness, given that LA Fitness has continued to protect Tony Wilson and has continued to place him in a position to prey on LA Fitness’ members, especially its women members, as Tony Wilson is still—TO THIS DAY—gainfully employed by LA Fitness.
WOW! Who would have ever thought.
Kudos to Jenifer for going the extra mile to keep this man for taking advantage of another woman.
Has this ever happened to you? Let me know in the comments below.
Tags: Jenifer Lewis
Previous ArticleNEW MUSIC: Alicia Keys – ‘Sweet F-ing Love’
Next ArticleWE FALL DOWN: Meek Mill Takes A Nasty Spill Down His Mother’s Steps (Video)
Get The Scoop Daily!
© Copyright 2020 Ice Cream Convos. All Rights Reserved.
Ice Cream Convos App
scoop@icecreamconvos.com | cc/2020-05/en_middle_0078.json.gz/line1262 |
__label__wiki | 0.710473 | 0.710473 | Exercise-induced orgasm and pleasure among women
Debby Herbenick, J. Fortenberry
Pediatric Adolescent Health
Orgasm is typically considered to be a sexual experience. However, orgasms occurring during physical exercise have been occasionally documented. The primary objective of the current study was to understand more about women's experience with exercise-induced orgasm (EIO) including the types of exercise that women have noted have led to EIO and associations with self-reported sexual experiences. A secondary purpose was to understand and assess women's experiences of exercise-induced sexual pleasure (EISP) among a convenience sample of women who had never experienced EIO but who had experienced sexual pleasure during exercise. A total of 530 women completed a cross-sectional, anonymous, Internet-based survey. The average age of first EIO was 18.9 years old. Among the most common exercises reported to induce orgasm were abdominal exercises, climbing and lifting weights. Women reporting EISP, but not orgasm, frequently identified biking/spinning, abdominal exercise and lifting weights as associated with their experiences. Self-consciousness during exercise was commonly reported by women in the EIO group. However, sexual thoughts or fantasy related to EIO were only rarely reported. Findings challenge the idea that women's orgasm is an intrinsically sexual experience. Implications related to the scientific understanding of orgasm processes and clinical recommendations are discussed.
Sexual and Relationship Therapy
sexual physiology
Herbenick, D., & Fortenberry, J. (2011). Exercise-induced orgasm and pleasure among women. Sexual and Relationship Therapy, 26(4), 373-388. https://doi.org/10.1080/14681994.2011.647902
Exercise-induced orgasm and pleasure among women. / Herbenick, Debby; Fortenberry, J.
In: Sexual and Relationship Therapy, Vol. 26, No. 4, 11.2011, p. 373-388.
Herbenick, D & Fortenberry, J 2011, 'Exercise-induced orgasm and pleasure among women', Sexual and Relationship Therapy, vol. 26, no. 4, pp. 373-388. https://doi.org/10.1080/14681994.2011.647902
Herbenick D, Fortenberry J. Exercise-induced orgasm and pleasure among women. Sexual and Relationship Therapy. 2011 Nov;26(4):373-388. https://doi.org/10.1080/14681994.2011.647902
Herbenick, Debby ; Fortenberry, J. / Exercise-induced orgasm and pleasure among women. In: Sexual and Relationship Therapy. 2011 ; Vol. 26, No. 4. pp. 373-388.
@article{27bfae1dd7ed43debff8161ff881334b,
title = "Exercise-induced orgasm and pleasure among women",
abstract = "Orgasm is typically considered to be a sexual experience. However, orgasms occurring during physical exercise have been occasionally documented. The primary objective of the current study was to understand more about women's experience with exercise-induced orgasm (EIO) including the types of exercise that women have noted have led to EIO and associations with self-reported sexual experiences. A secondary purpose was to understand and assess women's experiences of exercise-induced sexual pleasure (EISP) among a convenience sample of women who had never experienced EIO but who had experienced sexual pleasure during exercise. A total of 530 women completed a cross-sectional, anonymous, Internet-based survey. The average age of first EIO was 18.9 years old. Among the most common exercises reported to induce orgasm were abdominal exercises, climbing and lifting weights. Women reporting EISP, but not orgasm, frequently identified biking/spinning, abdominal exercise and lifting weights as associated with their experiences. Self-consciousness during exercise was commonly reported by women in the EIO group. However, sexual thoughts or fantasy related to EIO were only rarely reported. Findings challenge the idea that women's orgasm is an intrinsically sexual experience. Implications related to the scientific understanding of orgasm processes and clinical recommendations are discussed.",
keywords = "anorgasmia, female, orgasmic disorder, sexual physiology",
author = "Debby Herbenick and J. Fortenberry",
journal = "Sexual and Relationship Therapy",
T1 - Exercise-induced orgasm and pleasure among women
AU - Herbenick, Debby
AU - Fortenberry, J.
N2 - Orgasm is typically considered to be a sexual experience. However, orgasms occurring during physical exercise have been occasionally documented. The primary objective of the current study was to understand more about women's experience with exercise-induced orgasm (EIO) including the types of exercise that women have noted have led to EIO and associations with self-reported sexual experiences. A secondary purpose was to understand and assess women's experiences of exercise-induced sexual pleasure (EISP) among a convenience sample of women who had never experienced EIO but who had experienced sexual pleasure during exercise. A total of 530 women completed a cross-sectional, anonymous, Internet-based survey. The average age of first EIO was 18.9 years old. Among the most common exercises reported to induce orgasm were abdominal exercises, climbing and lifting weights. Women reporting EISP, but not orgasm, frequently identified biking/spinning, abdominal exercise and lifting weights as associated with their experiences. Self-consciousness during exercise was commonly reported by women in the EIO group. However, sexual thoughts or fantasy related to EIO were only rarely reported. Findings challenge the idea that women's orgasm is an intrinsically sexual experience. Implications related to the scientific understanding of orgasm processes and clinical recommendations are discussed.
AB - Orgasm is typically considered to be a sexual experience. However, orgasms occurring during physical exercise have been occasionally documented. The primary objective of the current study was to understand more about women's experience with exercise-induced orgasm (EIO) including the types of exercise that women have noted have led to EIO and associations with self-reported sexual experiences. A secondary purpose was to understand and assess women's experiences of exercise-induced sexual pleasure (EISP) among a convenience sample of women who had never experienced EIO but who had experienced sexual pleasure during exercise. A total of 530 women completed a cross-sectional, anonymous, Internet-based survey. The average age of first EIO was 18.9 years old. Among the most common exercises reported to induce orgasm were abdominal exercises, climbing and lifting weights. Women reporting EISP, but not orgasm, frequently identified biking/spinning, abdominal exercise and lifting weights as associated with their experiences. Self-consciousness during exercise was commonly reported by women in the EIO group. However, sexual thoughts or fantasy related to EIO were only rarely reported. Findings challenge the idea that women's orgasm is an intrinsically sexual experience. Implications related to the scientific understanding of orgasm processes and clinical recommendations are discussed.
KW - anorgasmia
KW - orgasmic disorder
KW - sexual physiology
JO - Sexual and Relationship Therapy
JF - Sexual and Relationship Therapy | cc/2020-05/en_middle_0078.json.gz/line1270 |
__label__wiki | 0.800663 | 0.800663 | Short term exposure to a violent video game induces changes in frontolimbic circuitry in adolescents
Yang Wang, Vincent Mathews, Andrew J. Kalnin, Kristine Mosier, David Dunn, Andrew Saykin, William Kronenberger
Despite evidence of effects of violent video game play on behavior, the underlying neuronal mechanisms involved in these effects remain poorly understood. We report a functional MRI (fMRI) study during two modified Stroop tasks performed immediately after playing a violent or nonviolent video game. Compared with the violent video game group, the nonviolent video game group demonstrated more activation in some regions of the prefrontal cortex during the Counting Stroop task. In contrast to the violent video game group, significantly stronger functional connectivity between left dorsolateral prefrontal cortex (DLPFC) and anterior cingulate cortex (ACC) was identified in the nonviolent video game group. During an Emotional Stroop task, the violent video game group showed more activity in the right amygdala and less activation in regions of the medial prefrontal cortex (MPFC). Furthermore, functional connectivity analysis revealed the negative coupling between right amygdala and MPFC in the nonviolent video game group. By contrast, no significant functional connectivity between right amygdala and MPFC was found in the violent video game group. These results suggest differential engagement of neural circuitry in response to short term exposure to a violent video game as compared to a nonviolent video game.
Brain Imaging and Behavior
Gyrus Cinguli
Functional magnetic resonance imaging
Media violence
Cellular and Molecular Neuroscience
Wang, Y., Mathews, V., Kalnin, A. J., Mosier, K., Dunn, D., Saykin, A., & Kronenberger, W. (2009). Short term exposure to a violent video game induces changes in frontolimbic circuitry in adolescents. Brain Imaging and Behavior, 3(1), 38-50. https://doi.org/10.1007/s11682-008-9058-8
Short term exposure to a violent video game induces changes in frontolimbic circuitry in adolescents. / Wang, Yang; Mathews, Vincent; Kalnin, Andrew J.; Mosier, Kristine; Dunn, David; Saykin, Andrew; Kronenberger, William.
In: Brain Imaging and Behavior, Vol. 3, No. 1, 03.2009, p. 38-50.
Wang, Y, Mathews, V, Kalnin, AJ, Mosier, K, Dunn, D, Saykin, A & Kronenberger, W 2009, 'Short term exposure to a violent video game induces changes in frontolimbic circuitry in adolescents', Brain Imaging and Behavior, vol. 3, no. 1, pp. 38-50. https://doi.org/10.1007/s11682-008-9058-8
Wang Y, Mathews V, Kalnin AJ, Mosier K, Dunn D, Saykin A et al. Short term exposure to a violent video game induces changes in frontolimbic circuitry in adolescents. Brain Imaging and Behavior. 2009 Mar;3(1):38-50. https://doi.org/10.1007/s11682-008-9058-8
Wang, Yang ; Mathews, Vincent ; Kalnin, Andrew J. ; Mosier, Kristine ; Dunn, David ; Saykin, Andrew ; Kronenberger, William. / Short term exposure to a violent video game induces changes in frontolimbic circuitry in adolescents. In: Brain Imaging and Behavior. 2009 ; Vol. 3, No. 1. pp. 38-50.
@article{bde0ebe48abb4b09999858b4a3951cef,
title = "Short term exposure to a violent video game induces changes in frontolimbic circuitry in adolescents",
abstract = "Despite evidence of effects of violent video game play on behavior, the underlying neuronal mechanisms involved in these effects remain poorly understood. We report a functional MRI (fMRI) study during two modified Stroop tasks performed immediately after playing a violent or nonviolent video game. Compared with the violent video game group, the nonviolent video game group demonstrated more activation in some regions of the prefrontal cortex during the Counting Stroop task. In contrast to the violent video game group, significantly stronger functional connectivity between left dorsolateral prefrontal cortex (DLPFC) and anterior cingulate cortex (ACC) was identified in the nonviolent video game group. During an Emotional Stroop task, the violent video game group showed more activity in the right amygdala and less activation in regions of the medial prefrontal cortex (MPFC). Furthermore, functional connectivity analysis revealed the negative coupling between right amygdala and MPFC in the nonviolent video game group. By contrast, no significant functional connectivity between right amygdala and MPFC was found in the violent video game group. These results suggest differential engagement of neural circuitry in response to short term exposure to a violent video game as compared to a nonviolent video game.",
keywords = "Amygdala, Functional magnetic resonance imaging, Media violence, Prefrontal cortex, Video game",
author = "Yang Wang and Vincent Mathews and Kalnin, {Andrew J.} and Kristine Mosier and David Dunn and Andrew Saykin and William Kronenberger",
journal = "Brain Imaging and Behavior",
T1 - Short term exposure to a violent video game induces changes in frontolimbic circuitry in adolescents
AU - Wang, Yang
AU - Mathews, Vincent
AU - Kalnin, Andrew J.
AU - Mosier, Kristine
AU - Dunn, David
AU - Saykin, Andrew
AU - Kronenberger, William
N2 - Despite evidence of effects of violent video game play on behavior, the underlying neuronal mechanisms involved in these effects remain poorly understood. We report a functional MRI (fMRI) study during two modified Stroop tasks performed immediately after playing a violent or nonviolent video game. Compared with the violent video game group, the nonviolent video game group demonstrated more activation in some regions of the prefrontal cortex during the Counting Stroop task. In contrast to the violent video game group, significantly stronger functional connectivity between left dorsolateral prefrontal cortex (DLPFC) and anterior cingulate cortex (ACC) was identified in the nonviolent video game group. During an Emotional Stroop task, the violent video game group showed more activity in the right amygdala and less activation in regions of the medial prefrontal cortex (MPFC). Furthermore, functional connectivity analysis revealed the negative coupling between right amygdala and MPFC in the nonviolent video game group. By contrast, no significant functional connectivity between right amygdala and MPFC was found in the violent video game group. These results suggest differential engagement of neural circuitry in response to short term exposure to a violent video game as compared to a nonviolent video game.
AB - Despite evidence of effects of violent video game play on behavior, the underlying neuronal mechanisms involved in these effects remain poorly understood. We report a functional MRI (fMRI) study during two modified Stroop tasks performed immediately after playing a violent or nonviolent video game. Compared with the violent video game group, the nonviolent video game group demonstrated more activation in some regions of the prefrontal cortex during the Counting Stroop task. In contrast to the violent video game group, significantly stronger functional connectivity between left dorsolateral prefrontal cortex (DLPFC) and anterior cingulate cortex (ACC) was identified in the nonviolent video game group. During an Emotional Stroop task, the violent video game group showed more activity in the right amygdala and less activation in regions of the medial prefrontal cortex (MPFC). Furthermore, functional connectivity analysis revealed the negative coupling between right amygdala and MPFC in the nonviolent video game group. By contrast, no significant functional connectivity between right amygdala and MPFC was found in the violent video game group. These results suggest differential engagement of neural circuitry in response to short term exposure to a violent video game as compared to a nonviolent video game.
KW - Amygdala
KW - Functional magnetic resonance imaging
KW - Media violence
KW - Prefrontal cortex
KW - Video game
JO - Brain Imaging and Behavior
JF - Brain Imaging and Behavior | cc/2020-05/en_middle_0078.json.gz/line1271 |
__label__wiki | 0.897437 | 0.897437 | Watch trailer: Kunal Kohli, Jennifer Winget's search for love in ‘Phir Se’
Watch trailer: Kunal Kohli, Jennifer Winget’s search for love in ‘Phir Se’
The trailer of Kunal Kohli and Jennifer Winget's 'Phir Se' gives us that ‘been here, seen that’ feeling.
Written by Sunitra Pacheco , Edited by Sarika Sharma | Mumbai | Updated: April 7, 2015 4:25:18 pm
Kunal Kohli and Jennifer Winget play divorced individuals, who are in search of love for the second time around.
Known for his directorial ventures including ‘Hum Tum’ and ‘Fanaa’, among them, this is the first time that filmmaker Kunal Kohli will be seen on the silver screen.
Playing a divorced middle-aged handsome man, living in London, Kunal is joined by television actress Jennifer Winget, who is also marking her debut to the films with ‘Phir Se’.
The duo play divorced individuals, who are in search of love for the second time around. While the subject may be a bit new to Bollywood, the trailer of the film gives us that ‘been here, seen that’ feeling. Some of the scenes do seem cut and pasted from Hollywood romantic classics.
Directed by Ajay Bhuyan and Kunal Kohli, ‘Phir Se’ also stars Rajit Kapoor, Sushmita Mukherjee and Dalip Tahil among others. It is slated to release on May 8.
kunal kohli
Sunitra PachecoSunitra Pacheco is a Correspondent with the Online news desk at the In... read more
Kriti Sanon gets upset with passenger watching pirated version of ‘Dilwale’ on flight, posts pic on Twitter
Dilwale, Bajirao Mastani: SRK-Kajol, Deepika-Ranveer’s movies are today’s mega releases
Dilwale, Bajirao Mastani: Reasons why it can’t be called a clash | cc/2020-05/en_middle_0078.json.gz/line1274 |
__label__wiki | 0.689016 | 0.689016 | Forgotten Kingdom
Directed by: Andrew Mudge
Stars: Christia Visser, Edwin van der Walt, Nicola Hanekom
Music by: Robert Miller
Written by: Andrew Mudge
Produced by: T.R. boyce, JR Pieter lombaard, Cecil Arthur Matlou, Andrew Mudge
Drama, Adventure
Atang Mokoeyna (mid-20s) is an unemployed, aimless young man who spends his days idling in the slums of Johannesburg. When his father dies, Atang must give up his selfish ways and fulfil his father’s humble last wishes: to be buried in the rural, mountainous Kingdom of Lesotho, a place they left 15 years earlier in the hope of a better life.
Atang feels like a stranger in the land of his birth, but finds an instant connection with one person: his childhood friend, Dineo. A beautiful and compassionate young woman, Dineo takes care of her younger sister, Nkoti, who is sick with HIV/Aids. However, Dineo’s tyrannical father thwarts their budding romance and relocates his family to a remote village where he can better hide his shame over Nkoti’s illness.
Try as he might, Atang simply cannot get Dineo out of his mind. He befriends a precocious 11 year-old orphan boy, and together they make the arduous journey across the breath-taking, rugged mountains to find Dineo. Along the way, the two undergo experiences that force Atang to surrender to the rhythm and traditions of the land, and to make peace with his father and the life he once led. A changed man, Atang finally reaches Dineo, but must overcome one last obstacle to win her father’s approval. | cc/2020-05/en_middle_0078.json.gz/line1275 |
__label__cc | 0.603559 | 0.396441 | 419 jobs - Livermore, California, United States
Browse for Jobs in Livermore, California, United States. Find the job of your dreams on CareerCast IT & Engineering Network today!
Sr. Compensation Analyst
Performant Financial
Regular Full Time Responsibilities: Performant has a great opportunity for a multi-faceted and highly analytical HR/Compensation professional is looking for an opportunity to make an impact in a diverse, fast-paced business environment. You will recommend and approve compensation related employee ac...
Regular Full Time Responsibilities: Performant has a great opportunity for a multi-faceted and highly analytical HR/Compensation professional is...
Payroll Accountant, Jr. (Part-Time)
Agency/Temp Responsibilities: The Jr. Payroll Accountant will be responsible to assist the payroll team with preparing Payroll Financials and entering the results into the General Ledger. Responsibilities also include account reconciliation, accrual analysis, and calculations of tax liabilities for ...
Agency/Temp Responsibilities: The Jr. Payroll Accountant will be responsible to assist the payroll team with preparing Payroll Financials and...
HR Representative
Regular Full Time Responsibilities: Do you have solid office support skills, including use of office systems and MS Office applications, and thrive in a fast-paced, dynamic environment? Do you want the opportunity to grow your skills and knowledge in Human Resources while making a positive impact in...
Regular Full Time Responsibilities: Do you have solid office support skills, including use of office systems and MS Office applications, and...
Sr. Staffing Specialist (Temporary Project)
Agency/Temp Responsibilities: Apply your passion for attracting and selecting the best talent to meet business needs, and expertise in full cycle recruiting, recruiting strategies, branding and advertising, staffing programs and on-boarding to make a strong impact in a dynamic and diverse organizati...
Agency/Temp Responsibilities: Apply your passion for attracting and selecting the best talent to meet business needs, and expertise in full cycle...
HR Clerk I (Temp)
Agency/Temp Responsibilities: The HR Clerk I provides administrative and functional support to the Human Resources Department, and answers general Human resources related questions regarding policies, procedures, benefits and employee record information. Essential duties: •Provides general clerical ...
Agency/Temp Responsibilities: The HR Clerk I provides administrative and functional support to the Human Resources Department, and answers general...
Classified Computing Information Technologist (Experienced)
Livermore, CA US
: Are you passionate about your work and want to utilize state-of-the-art facilities to explore solutions? Do you want to join a dynamic team that solves challenging issues for the nation's security? If so, you could be the highly motivated individual we are seeking to join our team. We are se...
: Are you passionate about your work and want to utilize state-of-the-art facilities to explore solutions? Do you want to join a dynamic team...
R&D Materials Scientist (Experienced)
: We have a new R&D technical staff position opening focusing on materials science problems with applications in the areas of alternative energy and national security. The role will emphasize experimental plasma-surface interactions studies in support of our Fusion Energy Sciences programs, which...
: We have a new R&D technical staff position opening focusing on materials science problems with applications in the areas of alternative...
Intern - Engineering Sciences Summer Institute (ESSI) R&D Grad Summer
: We are seeking an Intern - Engineering Sciences Summer Institute (ESSI) R&D Graduate Summer. Sandia established the Engineering Sciences Summer Institute (ESSI) to engage graduate engineering students in cutting-edge research and development of capabilities for predictive simulation, multidi...
: We are seeking an Intern - Engineering Sciences Summer Institute (ESSI) R&D Graduate Summer. Sandia established the Engineering Sciences...
Deputy Associate Program Leader for Nuclear Materials
Join us and make YOUR mark on the World!Come join Lawrence Livermore National Laboratory (LLNL) where we apply science and technology to make the world a safer place; now one of 2020 Best Places to Work by Glassdoor! We have an opening for a Deputy Associate Program Leader for Nuclear Materials. Yo...
Join us and make YOUR mark on the World!Come join Lawrence Livermore National Laboratory (LLNL) where we apply science and technology to make the...
Communications Modeling and Simulation - Computer Scientists or Engineers
Join us and make YOUR mark on the World!Come join Lawrence Livermore National Laboratory (LLNL) where we apply science and technology to make the world a safer place and now one of 2020 Best Places to Work by Glassdoor! We have multiple openings for Computer Scientists, Engineers, or Operations Res...
Linux Systems Architect
Join us and make YOUR mark on the World!Come join Lawrence Livermore National Laboratory (LLNL) where we apply science and technology to make the world a safer place; now one of 2020 Best Places to Work by Glassdoor! - Experience with virtualization technologies including hypervisors (e.g., Xen, KV...
Postdoctoral Researcher-Modeling
Join us and make YOUR mark on the World!Come join Lawrence Livermore National Laboratory (LLNL) where we apply science and technology to make the world a safer place; now one of 2020 Best Places to Work by Glassdoor! We have an opening for a Postdoctoral Physicist/Engineer. You will work on modelin...
Environmental Analyst
Join us and make YOUR mark on the World!Come join Lawrence Livermore National Laboratory (LLNL) where we apply science and technology to make the world a safer place; now one of 2020 Best Places to Work by Glassdoor! We have an opening for an Environmental Analyst (EA) within the Environment, Safet...
Design Drafter
Join us and make YOUR mark on the World!Come join Lawrence Livermore National Laboratory (LLNL) where we apply science and technology to make the world a safer place; now one of 2020 Best Places to Work by Glassdoor! We have multiple openings for Mechanical and/or Electro-Mechanical Design Drafters...
Join us and make YOUR mark on the World!Come join Lawrence Livermore National Laboratory (LLNL) where we apply science and technology to make the world a safer place; now one of 2020 Best Places to Work by Glassdoor! We have an opening for a Department Administrator. You will apply your talents and...
Project Controller (Experienced)
: We are seeking qualified Project Controllers for several departments at our California site to partner with our engineering teams. Are you passionate about project controls? You would join our dynamic and multi-disciplinary team to use your expertise to manage and analyze project status and rep...
: We are seeking qualified Project Controllers for several departments at our California site to partner with our engineering teams. Are you...
Clinical Research Scientist
Postdoctoral Appointee
Control Systems Engineer
Deputy Clerk
Electrical System Engineer
Electro-Optical Engineer
Emergency Management Planner
Environmental Advisor
Hardware Analyst Computer Systems
Lead Systems Analyst
Machine Tool Operator
Mechanical Systems Engineer
Senior Technologist
Student Intern | cc/2020-05/en_middle_0078.json.gz/line1280 |
__label__cc | 0.673456 | 0.326544 | ACF Nationals Thanks and Discussion
The King's Flight to the Scots
Post by The King's Flight to the Scots » Sun Apr 23, 2017 9:37 pm
Congrats to Maryland and Jordan Brownstein for their gripping win in the finals of ACF Nationals 2017! Our editing team - me, Tommy, Evan, Rohith, Austin, and Ike - worked extremely hard over the past months to bring this tournament to you, and it was awesome to see our work culminate in that game. I'd like to thank all the editors on that team, who were universally diligent and on the ball throughout the entire process. The editors' packets were greatly improved by comments from playtesters, including Will Alston, Chris Manners, Brian Stack, Tejas Raje, Susan Ferrari, and Jonathan Magin. Magin in particular freelanced for and commented on many categories in the set, and deserves great credit for how well the music and social science filled out. Will also provided consulting services and freelance questions on many of my categories, especially history. Our proofreaders, who amended grammatical and substantive errors that we'd missed in the last couple weeks of the set, were Susan Ferrari, Matt Weiner, Naveed Chowdhury, Tejas Raje, Will Alston, and Saul Hankin. Rob Carson added pronunciation guides, and Cody provided essential IT and logistical support at every stage in the process.
I'd like to pre-emptively apologize for the handful of repeated easy parts, which were pretty much entirely my fault. Usually those came because of wires crossed between me and Evan, since Other Arts/Painting and American History/CE tended to have porous boundaries. I should have been on the lookout for those as head editor and found them. In retrospect playtesting the submitted packets, in addition to the editors' packets, probably would have uncovered most of them in time.
I think the tournament had a distinctive character that you may legitimately praise or criticize on your own, so I won't start this off with any manifesto on principles. Discuss away!
Matt Bollinger
UVA '14, UVA '15
Communications Officer, ACF
Panayot Hitov
Location: Northfield, MN
Re: ACF Nationals Thanks and Discussion
Post by Panayot Hitov » Sun Apr 23, 2017 10:02 pm
I thouroughly enjoyed myself! Also, *as a film major*, I thought the changes in the fine arts category were great! I had a great time with those questions, especially the one on theory in the UVA/WUSTL/Toronto/Florida/Amherst packet.
Paul Kirk-Davidoff
Oakland Mills High School '14
Carleton College '18
vinteuil
Post by vinteuil » Sun Apr 23, 2017 10:47 pm
This tournament (except some inconsistencies in the science—physics noticeably harder than biology for instance) rocked my socks.
Could we see who edited what?
Jacob Reed
Chicago ~'25
Yale '17, '19
East Chapel Hill '13
"...distant bayings from...the musicological mafia"―Denis Stevens
Post by The King's Flight to the Scots » Sun Apr 23, 2017 10:57 pm
vinteuil wrote: This tournament (except some inconsistencies in the science—physics noticeably harder than biology for instance) rocked my socks.
I edited history, social science, philosophy, and visual arts; Evan did visual Other Arts, Geo/CE/Other, and Religion; Tommy did literature and music + opera/film; Rohith did biochem; Austin did physics some othersci + myth; Ike did compsci and math + freelancing.
grapesmoker
Contact grapesmoker
Post by grapesmoker » Sun Apr 23, 2017 11:10 pm
I too would like to offer my congratulations to Maryland, and of course especially to Jordan, who was electrifying over the course of the last two days, putting in an all-time great Nationals performance. And congratulations should go out to Michigan, who fought back from a tough loss to force the final and played a great tournament overall.
As always, thanks go out to the editors for their hard work on this set. Matt and his team did some great work; from the standpoint of questions this was one of the most polished Nationals I've ever experienced. From the logistics side, I would like to thank all of the staffers who came out to help us run this tournament; I especially want to recognize the triple-threat of Jon PInyan, Sarah Angelo, and Cody Voight, who did some amazing work making sure that the stat room was running smoothly and adjusting the schedule after a last-minute drop by Ohio State due to airline problems. Jon in particular was a true quizbowl hero, driving back out to Bergen to pick up two buzzers to bring them to the tournament.
This of course brings us to the negative part of this weekend. As I started processing teams for check-in on Saturday morning, I realized that we were dealing with two distinct though related problems. The first was that a number of teams (it's not clear to me how many, but a sizable minority for sure) had never received invoices for Nationals, nor any instructions indicating how they were supposed to pay. Many other teams told me that they had only received invoices within the last few days and thus had not had the opportunity to submit them for payment to the appropriate finance officers at their schools. Without doubt, this was an organizational failure on our part, and for that failure I apologize to all the teams so affected. The issue of invoices is one that should have been settled weeks before the tournament, not the day of; it's obviously embarrassing to us as an organization to drop the ball in this way, and to me in particular as the TD. After the Saturday rounds concluded, we (ACF) had our annual meeting and of course this issue was front and center in our discussions. We are committed to revisiting our payment and invoicing system in the interests of making it more efficient and more responsive to teams' needs, and while I realize that this is cold comfort to teams who were thrown into chaos by our inadequate attention to these issues, I hope that the changes we plan to make will let us regain clubs' trust.
The second issue, related to the first, was of course the issue of the buzzers. As in, there weren't enough of them. This is related because at least a few teams told us that they decided not to bring their buzzers because their invoices indicated that they would not be getting discounts for them. Of course, mistaken invoices (especially coming as late as they did) are our fault; however, I have to say that I cannot understand the mindset of a team that is driving to a tournament, has registered buzzers, and then decides not to bring them without telling anyone. I know I've sent at least 3 or 4 emails in the runup to the tournament, so I know for a fact that everyone who registered a team had my contact information. If you were confused about anything at all, a brief email to me would have provided you with the requisite guidance. Instead, a bunch of teams decided to just not do something that as a quizbowl club you are just expected to do pretty much automatically, which is bring buzzers to a tournament.
Everyone in this game, especially those who have more than a few years of high school and collegiate experience, should understand that buzzers are necessary hardware to make a tournament happen, and that teams bringing their buzzers are likewise necessary. There is no excuse, no matter what some invoice says or doesn't say, for not doing this very basic thing. By our count, there were 13 buzzers that were allegedly promised and were not delivered! This is absurd, people. If you want tournaments to happen and to run properly, you need to do your part, and that involves either bringing the buzzers that you said you'd bring, or notifying us that you cannot bring them. If we'd had even a day or two of advance notice, we might have scrounged some buzzers from local high schools; instead we had people playing slap-bowl, because teams that indicated that they were bringing multiple buzzers brought nothing. When I asked those teams why they didn't contact me or notify us in any way, I got the blankest of stares in response.
None of this is intended to absolve ACF of our failure to supply you with proper, correct invoices weeks in advance. But at the same time, teams need to understand that quizbowl works by you, the team, bringing your buzzer to tournaments. I don't care what the invoice says, I don't care what someone told you, or what you heard from a teammate, just bring your buzzer. Unless the TD tells you not to, you should just always assume that every email from a TD contains an implicit postscript in 36-point font, that says "BRING YOUR BUZZERS." This is not a new thing either, as we've had teams routinely fail to bring their buzzers to Nationals for years, but fortunately every year that I've been doing this, up until this one, we managed to scrape together enough sets to run the tournament. I don't imagine anyone enjoyed playing in a room without a buzzer, so let's all do our part to make sure that never happens again. I've already said that ACF is going to work hard to make sure you get your invoice (and your money too, if you're a host) on time and make it accurate. Reciprocally, we need you, the teams, to commit to bring your buzzers, to each and every tournament, always and forever, without exception, until the end of time.
Ok, that ends my apology/harrangue. On a lighter note, I'd like to say that I was super happy with the way the rooms were staffed up this weekend. Once we got past the initial problems with the buzzers, we kept the tournament moving fairly quickly; we got you out at around 7:15 on Saturday, and my estimate for Sunday turned out to be just about right, as the ceremony concluded at 1:30. That again is due to the hard-working staffers that came out from across the country to help make this happen, as well as the large Columbia contingent. Thanks again to all of those folks.
One more thing: in the next week or so, I'm going to send out a survey to teams that both attended Nationals and those who had bids but turned them down. It would help us greatly if you could fill out that survey within a few days of getting it. The survey will have some questions that will help us decide about the placement of Nationals for next year, as well as what we can do better logistically and otherwise to improve your experience. Thanks for coming, and we hope to see you at ACF Nationals 2018, wherever that ends up being.
Jerry Vinokurov
ex-LJHS, ex-Berkeley, ex-Brown, sorta-ex-CMU
code ape, loud voice, general nuissance
Doga (Dog Yoga)
Post by Doga (Dog Yoga) » Sun Apr 23, 2017 11:30 pm
Hi, I just wanted to post a brief thing. Thanks to Matt for letting me do this, Andrew Wang for his help with editing and writing a few of the chem tossups (TEMPO/7/Lanthanides/Mossbauer), Billy for editing and general expertise, and all of the other proofreaders who provided input. I tried to write about stuff that I thought was cool that I encountered by reading about/doing/being interested in science. So a lot of the ideas for questions came about like this (daptomycin/sputnik/ammonium cations to name a few). Hope you enjoyed.
Rohith Nagari
Brown '17
Post by Banana Stand » Sun Apr 23, 2017 11:55 pm
The literature in this set was really really good. It was very accessible across the board while offering a great challenge on interesting hard parts and early-middle clues. Common links probing core works of famous authors including the ones on teachers and the beach(which I unfortunately negged with Paunamok instead of Paumanok) were refreshing to hear at this level. Not that recent Nats have felt like "title-bowl", but I think this one is a perfect example of how well the concept of hard questions on "easy" answerlines can be done, which is definitely a testament to Tommy's editing. I also really enjoyed the increase in social science and thought it was a step in the right direction. I still think it's pretty absurd that even with a buff, the portion of the distro covering psychology, economics, anthro, sociology, and linguistics takes a backseat to European history, but I digress.
Thanks to the editors and staffers, and congrats to Jordan for simultaneously being a total sicko and a wicked nice guy, which I think will contribute to the Lebron comparison in future GOAT conversations.
Jack Mehr
St. Joe's NJ '14
UVA '19
heterodyne
Post by heterodyne » Mon Apr 24, 2017 12:12 am
I'll write more later but I really liked this tournament. Cool philosophy questions on things that actually matter! Fun deep core literature! Cool stuff. (I also had issues because I'm a quizbowler playing a tournament but like I had food poisoning Saturday and it was still a super fun day of qb which is a testament to the work of the editors for sure)
Alston [Montgomery] Boyd
Bloomington High School '15
UChicago '19
UChicago Divinity '21
he/him/his or they/them/their
jonpin
Forums Staff: Moderator
Location: BCA NJ / WUSTL MO / Hackensack NJ
Post by jonpin » Mon Apr 24, 2017 12:43 am
Continuing a fine tradition from three years ago at ACF Nats 2014 Columbia... I lost the power cord from my laptop. Specifically, I have the wrong power cord.
At some point on Sunday morning, someone else asked to charge their laptop in the control room, and it appears that I took their laptop cord. I think that towards the end of the tournament, there was a power cord in the lost-and-found, and that may be mine. The other possibility is that the person whose laptop cord I took, in turn took my own. I have no idea who that person might be, so: if you do not have your laptop cord because I took it, please email me. If, conversely, you have mine (or if someone at Columbia has mine), please email me.
Jon Pinyan
Coach, Bergen County Academies (NJ); former player for BCA (2000-03) and WUSTL (2003-07)
HSQB forum mod, PACE member
Stat director for: NSC '13-'15, '17; ACF '14, '17, '19; NHBB '13-'15; NASAT '11
"A [...] wizard who controls the weather" - Jerry Vinokurov
Galadedrid Damodred
Post by Galadedrid Damodred » Mon Apr 24, 2017 12:46 am
I may post in more detail at some point regarding my overall quizbowl philosophy as it manifested in my contributions to this set, but for now, I want to make a few scene-setting remarks:
I wrote almost all of the tossups in physics, astronomy, earth science, and mythology from scratch, as well as many of the bonuses in those categories in the submitted packets. What I mean by "almost all" is that the tossups on canonical transformations, cube roots in astronomy, and spherical harmonics (the latter of which was a tiebreaker) were the only ones I edited from submissions. I used some submitted bonuses directly and also converted some tossup submissions to bonuses, but generally speaking my categories ended up looking like a housewrite. A lot of this had to do with when I had the most time to work on the set, which was largely in August and September and certainly before packets started coming in around the end of January. But it also turned out that way because it was just easier for me to work at my own pace without worrying about editing the questions for each combination of submitted packets during the week or two between seeing the submissions and needing to submit edited ones. I hope that the quality of my work was high enough that people do not have much of a problem with this approach, but if you do, definitely don't blame the submissions.
I suggested to Ike that we split the other science 30/30/20/20 to give more space for math and computer science, since I felt there was more material to cover in those categories than in astronomy and earth science, and Ike agreed with me. So the overall breakdown across 20 packets was 6/6 math, 6/6 CS, 4/4 astronomy, and 4/4 earth science. I felt somewhat vindicated in the decision we made when it became clear from the submitted packets that people didn't generally want to write earth science questions (which in my view is a sign that the category is "played out" to some extent, like mythology - more on that in just a bit). However, there were several good astronomy submissions, both tossups and bonuses, that didn't make it into the tournament because there wasn't space for them, so to those writers, my apologies and please keep up the good work. I encourage editors of future tournaments to consider similar experimentation with the science subdistribution, perhaps even going so far as to reduce chemistry slightly or fold astronomy into physics. The relative weights shouldn't be set in stone; if you feel that one category should be given more room to breathe and another is getting a little stale, why not modify the distribution somewhat for a regular season tournament and see how it goes?
Because there was only 10/10 mythology in the set, which is significantly less than in recent years of ACF Nationals, I wanted to prioritize myth systems with the most well-known source texts and the most academic exposure. For example, I decided I'd rather write a tossup on literary criticism of the Odyssey than try to find fresh early clues for {insert Native American / Mesoamerican deity here}. Hence the dominance of Greek and British Isles content, which accounted for 6 of the 10 tossups. Those two myth systems, together with Norse and Indian, made up 75% of the total number of tossups and bonuses, which is maybe a little higher than the norm but pretty close to what I'd recommend as the ideal subdistribution going forward. I should note at this point that the decision to reduce the amount of mythology was made before I joined the editing team, so I had nothing to do with that, but I have no problem with the idea in principle. Where I disagree with some of the people who have argued for less myth is when they say that there are hardly any fresh clues left to use, even at Nationals difficulty. That may be true for some myth systems that don't have that much askable content to begin with, but it's certainly not true for the more important ones. Part of my goal in editing mythology for this tournament was to disprove the notion that there isn't anything new that can be done with this category. I'd like to think that I succeeded, but you may disagree.
In addition to the people Matt mentioned in the OP, I want to thank Billy Busse and Seth Teitler, who playtested about 75% of the physics tossups and 25% of the astronomy/earth science tossups way back in the first half of September.
This tournament marks the end of my involvement in quizbowl, so if you have anything to say about a particular question in one of my categories or a more abstract aspect of my writing (I say writing because as mentioned before, I didn't really do much in the way of editing), please speak up in the next 3 weeks or so before I stop visiting the forums! I welcome everyone's comments.
Austin Brownlow
Louisville '14, Stanford '16
Muriel Axon
Post by Muriel Axon » Mon Apr 24, 2017 1:06 am
I'm not sure if this is the right place to ask about this, but is there any word on the reasoning behind the apparent decision to accept "Secret Chronicle" for the tossup on the "[Mongol] Secret History" protest?
Shan Kothari
Plymouth High School '10
University of Minnesota '20
Post by The King's Flight to the Scots » Mon Apr 24, 2017 9:09 am
We ruled that even though "Secret Chronicle" was a rarely-used name, it should be acceptable under the "acceptable translation" rule for foreign-language titles.
wcheng
Post by wcheng » Mon Apr 24, 2017 9:27 am
I would like to thank the editors for producing an excellent set, which was challenging yet restrained in difficulty. I thought that the religion questions in this set were, for the most part, excellent, since they avoided the worst tropes of high-difficulty question writing in those categories (forcing people to name things about random obscure religions like Tenrikyo and Seicho-no-Ie or whatever) and explored interesting new material like Islamic jurisprudence. I also enjoyed the econ questions since they emphasized important concepts and not "which economist wrote which paper." There were a few questions that I found odd, like the tossup on "names" that used "these objects" as the pronoun, but I don't think that they diminish the editors' achievements.
Weijia Cheng
Centennial '15
Maryland '18 (Fall)
women, fire and dangerous things
Location: Örkko, Cimmeria
Post by women, fire and dangerous things » Mon Apr 24, 2017 10:46 am
This tournament was exemplary, particularly the literature. There were many, many questions that probed interesting aspects of important topics (the tossup on "nothing" from Shakespeare stands out as probably my favorite example).
Will Nediger
-Proud member of the cult of Urcuchillay-
University of Western Ontario 2011, University of Michigan 2017
High-volume writer, NAQT
Post by vcuEvan » Mon Apr 24, 2017 11:35 am
I edited religion, other arts except film and opera, and CE/geo/other academic. Matt Bollinger, Tommy Casalaspi, Jonathan Magin and Ike Jose contributed some excellent questions to those categories. Also, I think I speak for all the editors in thanking the teams that really worked hard on their submissions. Maryland and Michigan in particular submitted excellent packets.
I won't go manifesto on those categories because I wasn't really trying to break any new ground. I was particularly inspired a lot by Matt Jackson's work for the religion, Stephen Liu's side tournament for the other arts, and Mike Bentley's technology tournaments for the CE/geo/other academic. The "other academic" category is always kind of a wildcard, and I was really gratified to see teams use that slot to embrace the "answers that don’t quite fit into any of the preceding categories" language from the announcement post. Even if I couldn't use all of them, I really liked the spirit of the submissions in that category, such as "the Crystal Palace", "armadillos", "the British Museum", "shark attacks" and "tweets".
Finally, I want to apologize to Berkeley A. While I think the protest ruling that the tournament directors reached was correct under the ACF rules, I should have included "ballet sets" as an acceptable answer for the "stage design" tossup. That was a big oversight on my part and I'm sorry it cost you a game.
The Billiards Fool
Post by The Billiards Fool » Mon Apr 24, 2017 12:03 pm
Insofar as I can actually comment on this (given my skill level), I really enjoyed the history (from game 8 on, since I was not there before and cannot comment on it). There were some creative answerlines, most notably the "denying the link between HIV and AIDS" tossup that, even though I didn't get it, was fun and interesting to listen to. Same with homophobia. I also liked the bonuses on failed coups (don't remember/Equatorial Guinea/Seychelles) and female rulers of Africa (I don't actually remember the phrasing but I remember the first and last parts were Asante (using Yaa Asantewaa) and Nzinga so I'm assuming). The only question I remember being salty at was the 10th Amendment question, but I'm almost positive its because I learned/read Garcia v. SAMTA and National League of Cities v. Usery in the context of the commerce clause not 10th amendment and failed to rethink that fast enough during the tossup, not because the TU was actually bad in any way.
I'd also be curious to see where Nina Simone fits in to the distribution (history? I recall some history of her in the civil rights movement clues I think?).
I'm not really experienced enough to comment too extensively at this level, though I may try when I have the packets in from of me as I'm currently cherrypicking examples from my memory while ignoring my stats lecture. Overall, thanks to all the editors for an awesome first Nats experience and Matt for history that I thought was very engaging!
Emmett Laurie
East Brunswick '16
Rutgers University '20
felgon123
Post by felgon123 » Mon Apr 24, 2017 12:16 pm
wcheng wrote: There were a few questions that I found odd, like the tossup on "names" that used "these objects" as the pronoun, but I don't think that they diminish the editors' achievements.
I wrote this tossup and can attest that the pronoun phrase used throughout was "these things," and that the phrase "these objects," which would indeed have been misleading, does not appear in the question.
Harvard...let's say '23
2008-09 Male Athlete of the Year
Post by Cody » Mon Apr 24, 2017 12:29 pm
I'd also like to apologize to teams for the scheduling snafus (repeated games, mystery room 305). While they wound up being the least of our problems and were corrected fairly quickly, both were my fault and shouldn't have happened. I'd like to thanks teams (and the staff) for being great about adjusting -- even with the confusion, no teams played the wrong games.
We'll be doing a few new things next year to avoid this problem, including posting the schedule beforehand.
Cody Voight, VCU ‘14. I wrote lots of science and am an electrical engineer.
VCU Tournament Director ‘13-‘17. HSAPQ President ‘15-16.
Hero of Socialist Quizbowl Labor (NSC ‘14). “esteemed colleague” of Snap Wexley, ca. 2016. Stats Hero (Nats ‘16).
Quizbowl at VCU
Post by vcuEvan » Mon Apr 24, 2017 12:59 pm
We'll be reading the only unused packet from this weekend, Finals 2, in the #quizbowl IRC channel at 9 PM eastern tonight.
Last edited by vcuEvan on Mon Apr 24, 2017 1:20 pm, edited 1 time in total.
Post by wcheng » Mon Apr 24, 2017 1:20 pm
felgon123 wrote:
Hmm, must have been my mistake, then. Sorry about the confusion.
Post by felgon123 » Mon Apr 24, 2017 1:59 pm
I edited all of literature, music, opera, and film. I wrote the majority of the literature and music in the set from scratch, as well as all of the opera and film. The European and World/Other literature includes about 20 excellent questions written by Matt and Evan, and Jonathan Magin freelanced 3/4 very fine music questions to fill gaps in submitted packets on the homestretch (Naples, 5/4 time, Boulanger, album leaf/Für Elise/Reger, galliard/lute/oud, Van der Aa/violin/LA Phil, sight-reading/pitch/Ut queant laxis). I also chipped in some tossups to philosophy, religion, and other academic (Rousseau, What is Enlightenment?, "Structure, Sign, and Play," "Experience," imagination, names, whirlwinds, Gesualdo).
Like my co-editors, I don't have any elaborate editorial philosophy to expound here: you've played the questions, and they exemplify my ideas better than any abstract declaration of principles could. The bottom line is that I tried to write the kinds of questions I would be happiest to hear as a player, and it was deeply gratifying to both see and hear about so many extraordinary buzzes on my tossups coming from excited players throughout the field. (Special shout-out to Jacob Reed and John Lawrence for confirming in jaw-dropping fashion that a great many early clues in my music tossups were both knowable and useful.) A final note on distribution: I told Matt and Evan that I conceived of this as a tournament with "something for everybody," and accordingly did my best to write questions spanning the full historical and generic range of literature and classical music. So while it is inevitable that my areas of expertise received a bit more attention than others, hopefully no one felt that they had been shortchanged by editorial whims and that their favorite era or genre had gone unrepresented, and hopefully everyone had at least a few buzzes or 30s that particularly pleased them.
Post by Sam » Mon Apr 24, 2017 2:25 pm
felgon123 wrote: A final note on distribution: I told Matt and Evan that I conceived of this as a tournament with "something for everybody," and accordingly did my best to write questions spanning the full historical and generic range of literature and classical music.
I thought the tournament did an excellent job of this, and not only in the literature in music. For idiosyncratic, personal reasons I remember most of the economics answer lines better than other subcategories, and even at that level of granularity there was a healthy mix of micro/macro, stuff you'd learn in class/stuff you'd learn reading the newspaper, contemporary/historical, etc. The answer lines were also almost all perfectly matched to the topic: given the notability and exposure people have to Shakespeare, asking on a specific word in several of his better known plays works beautifully. For a tossup on John Osbourne's work, it's much better to just ask on the title. For a Virginia Woolf essay that's probably more widely known than Look Back in Anger but not as well known as, say, Hamlet, focusing on a specific thought experiment fits nicely.
Matt thanked them in the opening post, but I'd like to continue the habit of praising the proofreading of sets. I remember at most maybe four instances of readers being tripped up by confusing syntax, and as a player I was never confused by what the question was asking for.
I was a little confused by the scheduling. Barring travel mishaps that aren't the fault of any team or ACF, the total number of teams seemed an odd choice. Was the tournament constrained by the rooms available?
Sam Bailey
Minnesota 'xx
Chicago '13
Post by grapesmoker » Mon Apr 24, 2017 2:28 pm
As a spectator, I really enjoyed the tossup on "venture capital" firms, which I thought was testing just the right kind of mix of historical and contemporary knowledge. Good job, whoever wrote that.
Sam wrote: I was a little confused by the scheduling. Barring travel mishaps that aren't the fault of any team or ACF, the total number of teams seemed an odd choice. Was the tournament constrained by the rooms available?
Originally, we had a schedule worked out for a 42 team field, which is what we thought we were getting. At the very last minute, there was a series of drops that brought us down to 39 teams. Cody then worked out a schedule for 40 teams that did not necessitate double byes, and I tried to find a 40th team; I was unsuccessful in doing so. At the very very last minute, Chris Ray texted to inform me that Delta had screwed OSU and they would not be able to make it. This brought us to 38 teams, which is a real shitty number for tournament purposes. With 40 teams, we would have been able to give you a single-bye schedule with 5 brackets of 8, but with 38 teams there wasn't much we could do besides punch a hole in the bracket affected by the OSU drop and soldier on, because we didn't have the packets to radically reconfigure the field. I know that this was less than ideal, but I think this was the best thing we could have done under the circumstances.
Post by Cody » Mon Apr 24, 2017 2:32 pm
We were constrained by the number of teams that wanted to come (and the number of packets). We had a 3-stage format for 42 teams. As the field dropped to 40 teams, I drew up a 2-stage limited single-bye schedule for the tournament. (A format I will write up at some point.) Is there any thing in particular you're confused about?
Cody wrote: We were constrained by the number of teams that wanted to come (and the number of packets). We had a 3-stage format for 42 teams. As the field dropped to 40 teams, I drew up a 2-stage limited single-bye schedule for the tournament. (A format I will write up at some point.) Is there any thing in particular you're confused about?
Not anymore, your and Jerry's posts explained it well. I didn't know about the last minute drops. Based on forum posts it had seemed like there were more teams who wanted to come than could, which would make choosing 39 a weird upper bound. After a slow start in the morning the tournament was run efficiently, and you all did a great job dealing with the new constraints that were suddenly imposed on you.
Sam wrote:
Yeah, I apologize for not updating the forums as frequently as would have been ideal. It was a real harried time for me personally and I was trying to put out a lot of fires with team drops happening all over the place. Basically what happened was that a number of teams that really wanted to come couldn't find affordable transportation options and had to bow out.
Periplus of the Erythraean Sea
Post by Periplus of the Erythraean Sea » Mon Apr 24, 2017 6:29 pm
From a moderator's perspective, I found this set quite enjoyable to read. I read for the bottom bracket in the playoffs, and it seemed that most teams were engaged with the questions and at least with the middle and easy parts of bonuses - the games were meaningful and most players had at least a few questions per round that engaged them. From what I perceived, the main frustration was with repeated topics - something that I think could have been fixed with more thorough outside proofreading.
Playtesting this tournament was a blast, too, and the editors' willingness to discuss and reason through questions was particularly welcome. In particular, from a history player's perspective, I think this set marked a huge step up from previous incarnations of ACF Nationals I've seen/read/played, and did a good job of explaining why institutions/events were important, how people interacted with them, etc. Major props to Matt and Evan.
Last edited by Periplus of the Erythraean Sea on Mon Apr 24, 2017 6:33 pm, edited 1 time in total.
Will Alston
Bethesda Chevy Chase HS '12, Dartmouth '16, Columbia Business School '21
NAQT Writer and Subject Editor
cornfused
Post by cornfused » Mon Apr 24, 2017 6:30 pm
vcuEvan wrote: We'll be reading the only unused packet from this weekend, Finals 2, in the #quizbowl IRC channel at 9 PM eastern tonight.
Out of curiosity, how many packets went entirely unused (at least Princeton and Northwestern, right?), and how were those packets chosen? Quality? or was it just that they were late submissions?
Northwestern University '18
Lawrence University '11
Maine South HS '07
"a decent player" - Mike Cheyne
Banned Tiny Toon Adventures Episode
Post by Banned Tiny Toon Adventures Episode » Mon Apr 24, 2017 7:41 pm
Set was excellent. Interpuncts were used a little excessively to the point that some words were kind of hard to read
Andrew Wang
Illinois 2016
Location: outside the Perimeter
Contact 1.82
Post by 1.82 » Mon Apr 24, 2017 8:25 pm
grapesmoker wrote:
On a related note, how did people feel about Columbia as a location? It seems like teams not being able to find affordable transportation options is a problem that could be averted or at least minimized. Last night on IRC there was discussion about whether having ACF Nationals at a high school might be a better option logistically; I think this is worth discussing.
Naveed Chowdhury
Maryland '16
Georgia Tech '17
In my experience in Virginia, a high school is much less ideal than a college, for many reasons. (Consider hotel availability, as just one example.)
The site for ACF Nationals was discussed after the tournament, and Jerry's survey is part of that.
Borrowing 100,000 Arrows
Post by Borrowing 100,000 Arrows » Mon Apr 24, 2017 11:34 pm
Chandrapur Super Thermal Power Station wrote: It seems like teams not being able to find affordable transportation options is a problem that could be averted or at least minimized.
Oklahoma was definitely in this boat. A trip to NYC would have cost us roughly three times as much as last year's trip to Ann Arbor. Columbia seems like less than ideal site given the cost of lodging and travel in NYC. I'd be curious to know what other schools, if any, submitted bids. That said, I agree with Cody, hosting Nats at a high school seems like a pretty bad alternative.
Caleb K.
Maryland '24, Oklahoma '18, Norman North '15
Benin Rebirth Party
Location: Farhaven, Ontario
Post by Benin Rebirth Party » Tue Apr 25, 2017 12:30 am
What are the roadblocks with ACF Nationals moving to a hotel?
Joe Su
Lisgar 2012, McGill 2015, McGill 20--
FINALIST -- 2017 ILQBM MEME OF THE YEAR
Post by Banned Tiny Toon Adventures Episode » Tue Apr 25, 2017 12:39 am
Aaron Manby (ironmaster) wrote: What are the roadblocks with ACF Nationals moving to a hotel?
it's expensive
Post by grapesmoker » Tue Apr 25, 2017 10:45 am
the fact that we're not made of money
Amizda Calyx
Post by Amizda Calyx » Tue Apr 25, 2017 2:24 pm
I liked the bio tossups in this set quite a bit. The A. tumefaciens, CYP450, and poly-A tails ones were fresh and pretty interesting. I wasn't a fan of the ketogenesis tossup, though. I spent quite a bit of time wondering if it wanted a specific fatty acid metabolism process like β oxidation, but refrained from buzzing with that since the clues just didn't seem to always match with it. I ended up negging with "ketone production", which wasn't prompted but I followed up with "ketolysis" anyway and that was ruled even more incorrect. For some reason I had been under the impression that general ketone body metabolism was at play, but I would have to see the clues again. I was also not particularly fond of the Warburg hypothesis tossup, since it was similarly difficult to parse whether certain sub-processes referenced in the clues were acceptable or not. I messed up on the SNAREs tossup too, but that was mostly my fault for somehow never actually learning that syntaxin, synaptobrevin, etc. — which I know quite a bit about — were in this superfamily.
On the other hand, I was quite disappointed by the bonuses in this set. In particular, I felt that the non-biochem/mol bio was absurdly easy. This impression is mostly based on having been a TA for intro bio at Rutgers for a year; if my students, who are only in this class if they didn't take/pass AP bio and include a fair number registered solely to satisfy their "science requirement", can 20 or 30 ACF Nats questions, I think there's a problem. Like, this class is literally as basic a bio class as you can get without being remedial (although for some bizarre reason they spend five weeks learning about like unikonts and other taxonomic classes or whatever…I would have killed a question on the Derived Traits of Ecdysozoa).
•Mullerian/Sertoli/Y – Mullerian really isn't that difficult for anyone who has taken intro anatomy, but my main quibble is with Sertoli as a medium part, given mention of Leydig cells. My students, who are baffled by how urine gets out of the body, can compare and contrast Sertoli and Leydig cells. In fact, one of the workshop topics they had to do recently required this knowledge.
•SA node/Valsalva/something easy – this was even easier. My teammate Sam, who hasn't thought about bio whatsoever since high school, easily 20'd this and had certainly heard of the Valsalva maneuver despite us both just blanking on the name.
•dendritic spines/axon/Purkinje – dendritic spines is *really* not a hard part. Purkinje could be if the heart stuff wasn't mentioned. Sam also 20'd this.
•EMT/mesoderm/neural crest cells – this one wasn't too bad, but taken together with all the other easy bio bonuses I think something harder than a really basic element in tumorigenesis could've been used.
•prolactin/oxytocin/voles – this was the most egregious in my opinion. Sam 20'd this. My students would 20 this. Undergrads in the UW intro bio series, intro psych, intro neuroscience, and intro physiology could reasonably 30 this. Prolactin was a (albeit unreasonable) tossup at HSNCT.
One or two of these kinds of bonuses isn't a problem in Nats, but it honestly seemed like a system-wide problem for anything that wasn't molecular bio or biochem. Like, there's no way Streptomyces is equivalent in difficulty to any of those medium parts. I recognize that not everyone has the physiology background that I do, but…neither do my teammates. I would have loved to have heard more bonuses like the one in the finals (cyclins/something medium/ATM), which seemed a lot more satisfying to answer than the five I outlined above.
On another note, was there any ecology or plant content (other than Agrobacterium, I guess) in this tournament? Also, four organism/virus tossups seemed a bit much...
Joelle Smart
Ellensburg High School, 2006–10
University of Washington, 2010–14
Rutgers University, 2015–20??
HSAPQ biology editor, 2014–2017
It is a mistake to think you can solve any major problems just with potatoes.
Nice hockey Cote d'Azur
Post by Nice hockey Cote d'Azur » Tue Apr 25, 2017 3:03 pm
As a staffer, I just wanted to thank Cody, Jerry and Jon again for the amazing work they did organizing the tournament despite the various snafus. And of course, thanks to Matt, Tommy, Evan, Austin, Rohith and Ike for producing a fantastic set, I was glad to see that teams of all levels enjoyed playing it.
Tejas Raje
Cornell '14
Rococo A Go Go
Post by Rococo A Go Go » Tue Apr 25, 2017 3:19 pm
Steph Curry-Dwight Howard Isomorphism wrote:
We expected to have school funding for ACF Nats that fell through, and by late March we noticed that plane tickets were nearly $400 per person from Louisville to NYC and that we weren't going to be able to scrape together that kind of money; therefore we dropped from the field. I don't know if travel costs are an issue at Columbia that some equal number of teams don't experience at a different site (like Michigan) but that's definitely something that should be considered.
I don't have any inside info from ACF as to how many schools submitted bids, but I heard from some friends on another team not far from us that they had submitted a bid. I would imagine there were more than just a couple, but maybe not.
Nick Conder
"Your Honor, years ago I recognized my kinship with all living beings, and I made up my mind that I was not one bit better than the meanest on earth. I said then, and I say now, that while there is a lower class, I am in it, and while there is a criminal element I am of it, and while there is a soul in prison, I am not free."--Eugene V. Debs
Post by Cody » Tue Apr 25, 2017 3:22 pm
On balance for the whole ACF Nationals field (most of which is, historically, along the East Coast), I think you will find that NYC is among the least expensive destinations for ACF Nationals. The cost of lodging will be higher, but the difference in lodging is typically going to be much less than the cost of flights for alternate sites.
I am not very surprised to hear that flights from SDF -> NYC were hideously expensive under 1 month away because you were screwed by your university, but I don't think there's anything ACF can do in selecting a site to account for that.
Last edited by Cody on Tue Apr 25, 2017 3:32 pm, edited 1 time in total.
Post by Doga (Dog Yoga) » Tue Apr 25, 2017 3:24 pm
Amizda Calyx wrote: I liked the bio tossups in this set quite a bit. The A. tumefaciens, CYP450, and poly-A tails ones were fresh and pretty interesting. I wasn't a fan of the ketogenesis tossup, though. I spent quite a bit of time wondering if it wanted a specific fatty acid metabolism process like β oxidation, but refrained from buzzing with that since the clues just didn't seem to always match with it. I ended up negging with "ketone production", which wasn't prompted but I followed up with "ketolysis" anyway and that was ruled even more incorrect. For some reason I had been under the impression that general ketone body metabolism was at play, but I would have to see the clues again. I was also not particularly fond of the Warburg hypothesis tossup, since it was similarly difficult to parse whether certain sub-processes referenced in the clues were acceptable or not. I messed up on the SNAREs tossup too, but that was mostly my fault for somehow never actually learning that syntaxin, synaptobrevin, etc. — which I know quite a bit about — were in this superfamily.
i thought it was probably better to err on the side of making things easier rather than too hard, but oh well
also s/o to harrison wang for help w the blue tossup
Last edited by Doga (Dog Yoga) on Tue Apr 25, 2017 4:16 pm, edited 1 time in total.
I understand that, but it seemed like this "caution" applied only to the physiology/cell bio. Biochem had stuff like an easy part on tryptophan where the easiest clue was that it has an indole group...and then you have a neuro bonus with the easy part on axons after axons had already been mentioned in the question.
I also heard troubling things about the approach to writing the (nonexistent) ecology, which I do think is an issue that should be addressed.
Post by vcuEvan » Tue Apr 25, 2017 6:15 pm
The set is posted here.
UlyssesInvictus
Post by UlyssesInvictus » Tue Apr 25, 2017 7:01 pm
Just wanted to chime in and generally say I really enjoyed this year's set. It seemed extremely accessible (relative to ACF Nats-difficulty of past years, anyway), the questions were creative, and I had a lot of fun. Thank you to everyone involved in writing and staffing!
Raynor Kuang
quizdb.org
Harvard 2017, TJHSST 2013
I wrote GRAPHIC and FILM
Post by Victor Prieto » Tue Apr 25, 2017 7:43 pm
vcuEvan wrote: The set is posted here.
Can a zip file be made? For science?
Secretary, PACE
Tower Hill School '11 | Rice University '15 | Penn State University '20
Writer: NAQT (2019-present) | Writer, Editor: HSAPQ (2013-2016)
Member (and lots of other stuff): PACE (2015-present)
otsasonr
Post by otsasonr » Tue Apr 25, 2017 9:00 pm
I thought this tournament was good, but there were several problems with physics questions over the course of the tournament:
The tossup on viscosity includes a prompt for "momentum diffusivity", but not for the broader category of "diffusion coefficient", even though the question says "form of this quantity", which leaves it ambiguous what it's actually looking for.
The tossup on the distribution function had a completely useless clue saying something like "the time derivative of this function can be calculated as its Poisson bracket with the Hamiltonian", which applies to literally any function of the canonical coordinates in Hamiltonian mechanics.
The tossup on curl used a lead-in describing it as being computed at every step of the Yee algorithm, which led to a swift neg with "finite differences". That should be prompted at least (since that's what is actually computed), or better yet the phrasing of that clue should be changed to something to the effect of "a numerical approximation of this operation is computed at every step of the Yee algorithm", which clarifies what the question is looking for.
I thought the AdS/CFT correspondence was a bit early in the de Sitter tossup, but that might just be a bias.
Did anyone convert sawtooth collapse in the tokamak bonus? I've taken a whole course on fusion reactors and didn't, but I might just be salty.
Describing what the six-factor formula calculates as a property of neutrons themselves is a pretty serious abuse of terminology.
While I will grant that Goldstone's theorem is the more common name, it is also definitely referred to as Nambu's theorem and the Nambu-Goldstone theorem, so those answers should be acceptable
The first clue of the pendulum tossup is not unique, and is completely unhelpful. Two-timing analysis and effective potentials are used to analyse many different systems, not just Kapitza's pendulum.
I enjoyed that there was a good amount of software engineering content in this set (thinking of map, inheritance, the Facebook tossup focussing on software they have developed, etc.). I wish that other fields of engineering were as represented in other categories.
I thought the philosophy tossups skewed towards the continental, but that might just be a feeling.
The math felt like it had more stats than in other tournaments, which is definitely not a bad thing. But some of those tossups felt much easier than other math tossups, most notably the tossup on Student's t-distribution.
The only other thing that I will say is in response to Austin's decision to write almost all of his categories from scratch, instead of editing submissions. I think it's disrespectful to participating teams to have them contribute questions to those categories if it is known that they are not going to be used. It's one thing for questions to be cut if they are repeated or of poor quality, completely another to knowingly let people write questions which will not be used even if they are good and unique. I understand that things like this are not necessarily known beforehand, but since this pattern apparently began back in August, I think this could have been foreseen.
Rein Otsason
University of Toronto 1T6 + PEY
University of Toronto 1T9
Yus vs. Jews wrote:
It's been added.
Post by The King's Flight to the Scots » Wed Apr 26, 2017 11:02 am
A couple points I'd like to ask about:
- Difficulty. We followed a system roughly similar to what we used for VCU Open, designating "Nationals canon" tossups {3} and "extra-canon" tossups {4}, with 8 "{3}"'s and 2 {4}'s allowed per round. In practice we generally undershot those caps; still, while reading it I felt like there were more canon-busting tossup answers in this set than in last year's, accompanied of course by lots of easy common links.
At its best, this approach drove up difficulty for the top brackets and drove down difficulty for the bottom, making the set both enjoyable and formidable for all. There's little that matches the excitement of an early buzz on a topic that's never been a tossup before. There were also moments when we may have overshot the mark with tossups that were excessively daunting. What were people's general experiences on the set's harder questions?
- Distributional changes. We added extra social science, cut down on myth, and packed sculpture/photography within painting to make room for true "other arts." How did people feel about these changes? Did they make room for more underexposed material? Are they replicable in future events?
Post by vinteuil » Wed Apr 26, 2017 6:02 pm
I thought the distributional changes didn't feel drastic (in a good way), and I really liked the balance that resulted. I also appreciated the amount and execution of the "other" category, as opposed to "pure" geography and current events like we've had in the past.
One thing that hasn't been brought up: I appreciated the many literature and arts questions that made judicious use of salient, knowable biographical and historical clues—I think they provide a great model for that kind of question.
Sygyt/Kargyraa
Post by Sygyt/Kargyraa » Wed Apr 26, 2017 7:16 pm
I liked the "other" questions as well. In terms of the myth and social science distribution though, I feel like my team (Toronto B) found the social science the most intimidating part of the tournament, and as much as that reflects on us more than the tournament, I wonder if increasing social science at the expense of myth would make the distribution less accessible to newer players (not that accessibility needs to be the focus of Nats, of course).
Zhenglin Liu
University of Toronto MechEng 1T9+PEY, Engineering Science dropout | cc/2020-05/en_middle_0078.json.gz/line1287 |
__label__wiki | 0.830422 | 0.830422 | Looking back 60 years in North Simcoe takes a look at archived photographs and newspapers from the local area to give a glimpse of what life was like 60 years ago.
Huronia Museum – Looking Back 60 Years Ago in North Simcoe – December 22nd to 31st 1956
Dec 24th, 1956, the Midland Penetang Advisory Committee of the CNIB held their annual Christmas party at the Midland YMCA, the young man is Doug MacMillan.
Sorting it out at the Midland Post Office are, C. R. (Chuck) Stelter, A. Marion and R. Mitchell. Ten extra staff were hired bringing the Christmas rush total to 27.
Amid a sea of cards, staff at the Midland Post Office had a busy time this week. Al Hennin, Clarence Dingman, R. White and postmaster W. F. Bourrie. (The employee on the right was cropped out of the photo in the newspaper.)
Waiting for Santa Claus, at the Y’s Men’s Christmas party for member’s children Tuesday night, Mary Jane Walton, 4, and Wendy Walton, 7, can hardly wait.
Waiting for Santa Claus, at the Y’s Men’s Christmas party for member’s children Tuesday night, Jimmy Courtemarche looks a little apprehensive. He is two and a half.
Dec 24th, 1956, at the Y’s Men’s Christmas party held at the Midland YMCA, Mrs. Cy “Sadie” Ney and daughter Geraldine, 2, and brother Ricky, 6.
Half century of membership in Midland’s Caledonian Lodge, A. F. and A. M. was the reason for this happy gathering at St. Andrew’s Hospital last Sunday. J. J. Robins presented a veteran’s jubilee metal (50 year jewel) to R. G. Nesbitt, who at 94 is still able to smile his appreciation. Left to right, Gilmour Nesbitt, J. W. Bald, Capt. Ed Burke, Charles Flowers, Sidney Thompson and R. S. King.
Chris Brasher of London England is showing local doctor and twin brother Peter Brasher the gold medal he received in the 3,000 meter steeplechase at the Melbourne Olympics last month.
Mr. & Mrs. Eldon Brown and son Johnny, 3, are part of the many people who took advantage of the lack of snow on Boxing Day to enjoy the ice on Little Lake. Note the lack of snow in the background.
Ad: The best New Year’s Party is Always at the Parkside – Music by Harold NcNamara and his band.
Notice: Canadian Steamship Lines – Warning the C.S.L. tug “Tiffen” will be breaking ice in Midland, Port McNicoll and the Tiffen and Aberdeen wharfs.
There are two “First Baby” contests, one in Midland and one in Penetang. Penetang contestants will come from Penetang and Tiny Township, Midlands’ from Tay, Medonte, Matchedash and Baxter.
Ontario Department of Health suggests that Midland PUC seek financial and technical help from the newly formed Ontario Water Resources Commission regarding its municipal water supply. The Department feels that Georgian Bay is the long term answer to Midland’s water supply but not until a sewage treatment plant is installed. [Ultimately deep artesian wells would supply our drinking water]
A special Christmas edition of the County Herald is filled with Christmas and New Years greetings from nearly every local merchant, politician, professional and industry.
Did You Hear? The Midland Social Week. – Captain Dick Simpell of the S. S. Soreldoc is home for the winter. Captain Mel Buckland is also with his family for the winter months from his ship the S. S. Penetang. Captain Norman Donaldson from the S. S. Elgin and Captain G. Kirk of the Star Ship Enterprise S. S. Gleneagles. Jack Simpell is home from the S. S. Goderich.
W. H. “Bill” Cranston, executive vice-president of the Shoe Corporation of Canada Ltd., told more than 350 employees of the firm at a Christmas dinner held at the Parkside Inn Wednesday, that their “family of employees” may increase by 100 persons next year.
New vehicle licence plates for 1957 will feature white numerals on a black background. The plates are made at the Ontario Reformatory in Guelph.
We published this Christmas menu from the Hotel Brulé previously, but it sounds too good not to do it again; – Fruit Cocktail, Shrimp Cocktail, Royal Consommé, Celery Hearts with Stuffed Olives, Sweet Crunchy Pickles, Roast Young Turkey (sage dressing and cranberry sauce), Roast Domestic Goose (thyme dressing), Roast Long Island Duckling (with apple fritters), Baked Sugar Cured Ham (with fried pineapple ring), Creamed, Mashed or French Fried Potatoes, Mashed Turnips or Asparagus Tips, Steamed Christmas Plum Pudding (with caramel brandy sauce), Hot Mince Pie, Deep Apple Pie with Whipped Cream, Christmas Cake and Mixed Nuts, Vanilla Ice Cream, Tea Coffee or Milk. $3.00
A blast furnace moved from Midland’s smelter in 1918 to Algoma Steel’s plant at Sault Ste. Marie is to undergo a major remodelling job after 38 years of service. The No. 4 blast furnace will get a $700,000.00 upgrade. In 38 years No. 4 has produced more than 4 million tons of pig iron.
For 42 years, beginning in 1913, sisters Mrs. M. P. Worden of Melville Sask. and Mrs. E. H. Piggott of Midland have been exchanging the same Christmas card. The little card only measures 1 1/2 inches by 3 inches and simply says “One of the happiest things about Christmas is you”. Each year they inscribe the date on it.
Edwards Specialty Shop announces that they will be closing all day Wednesday during January, February and March. [At this time many stores closed half days on Wednesdays]
HAPPY NEW YEAR FROM THE COLLECTIONS DEPARMENT AT HURONIA MUSEUM
Huronia Museum – Looking Back 60 Years Ago in North Simcoe – December 8th to 21st
Click on Photos to Enlarge Mrs. John Hare, left, who celebrated her 93rd birthday November 25th, looks at pictures of her two great-great grandchildren with her daughter Mrs. R. J. Wilson of Waubaushene. Born four years before Confederation, Mrs. Hare had lived in Midland for almost 50 years before moving to Coldwater to live with her daughter. Married at 16 to John Hare, 19, the couple moved to Midland where John managed a brick yard, helped build the Aberdeen Elevator and continued to work there for several years, he also served on the Midland Police Force before his death in 1928. Of the thirteen children born to the Hares only three daughters and one son are still living.
Over 200 years of service to the CPR and its steamship service is represented in this picture taken aboard the S.S. Assinaboia at a dinner marking the retirement of Capt. Joseph Stewart Friday night. Front, Capt. Frank Davis, 83 and retired 18 years from Toronto; Capt. Stewart; S. H. Binns retired locomotive foreman for the Ontario Division, Toronto; back row, Tom Morgan, Port McNicoll, retired chief clerk; Louis Belanger, retired first mate; W. S. Struthers of Midland, who retired recently after 36 years, many as a chief engineer; W. A. Piitz, Penetang, retired first mate with 35 years of service.
Five day trip from Toronto to Port McNicoll turns into a twenty-one day adventure as these two tugs encountered bad weather. The tug “Sipat” under the command of Capt. C. Courtemarche of Midland left Toronto Nov 16th with the much larger tug David Richard in tow. The 130 foot “David Richard”, was once used to maintain navigational aids in the area and was called the “Murray Stewart”. The big tug is owned by the Waubaushene Navigation Co. and was manned by two employees, Leo Montgomery and Joe Brousseau. At one point on Lake St. Clair sixty mile per hour winds broke both tow cables. On Lake Huron more high winds caused a 12 ton winch to break loose on the David Richard. On Monday the big tug was moved to the Midland Shipyards where cranes removed equipment to make room for a new diesel engine to be installed at Waubaushene over the winter months.
Three members of the Midland Lion’s Club are seen in Gord Boyd’s basement refurbishing and sorting toys for distribution throughout the area at Christmas. Gordon Boyd, Cec Launder and Gordon Paice.
More Midland Lions repairing toys for Christmas. Jack Frame, Harold McAllen and Charlie Rutherford.
Dec 24th 1956, the Midland Penetang Advisory Committee of the CNIB Christmas party was held at the Midland YMCA, Mel Lavigne with the fiddle and Bill Jivcoff. Pianist Ab Clarke is hidden. They all donated their time.
Appropriately dressed, Glen Nicholls reads from the works of Robert Service at a special assembly at MPDHS Thursday morning. Students of 12B acted out the Shooting of Dan McGrew.
Cecil Parker, deputy Reeve of Tay Township, was instantly killed Friday night when his car slammed broadside into a tree on Highway 27. The accident happened on the first curve north of Waverly and a blown right front tire is suspected. The picture taken at Carruthers Garage in Wyebridge.
Industrial Safety in Ontario was the subject under discussion at an oratorical contest held Thursday morning at MPDHS. In the top photo the judges are Gordon Moss of Canadian Nameplate, Jan Ulrichson and Bryce Moffatt of Penetang. In the bottom photo are the judged, Hartmut Bezner, Sylvia Silvie the winner and Glen Mount.
Children of St. Paul’s United Church, Midland, on Sunday combined with the adult congregation for the annual white gift service. Here Brian Gazley, son of Mr. & Mrs. Bruce Gazley, deposits his white gift while Peggy Bray, daughter of Mr. & Mrs. Frank Bray, and Gudrun Mandler, daughter of Dr. & Mrs. Walter Mandler, await their turn. Manger scene was erected by Florence Broad, Gladys Robinson, and R. W. Irwin. Lambs were made about two years ago by the late Mrs. Walter Auld. Yuletide decorations at the King Street entrance were installed by Len Martin, Alex Ayers, Don Edwards, Watson Battrick and Woodrow McConnell.
Five hundred Midland and Penetang youth wait eagerly every year for the Little Hockey League to open for the season. Typical age and size of the three groups are; John Argue, Toronto Leafs; Jerry Beteau, AHL Hershey Bears and Earl Scott, a whirlwind on skates for the Junior OHA Marlboros.
Woodcarving has proven an entertaining hobby for Frank Shulman of Midland, owner of Shulman’s Furniture. Here he is seen with three statues he created.
Coldwater Santa Claus parade December 1956. Jovial Lloyd Letherby, MPP for Simcoe East takes a back seat to Santa.
Seventy-one year old town employee Joseph Chapman killed by fall from sanding truck. (we older Midlanders will remember when two men stood in the back of a dump truck and shovelled sand into a spreader towed behind the truck) Mr. Chapman and Sam Butineau had just finished sanding Bay Street, the truck, driven by Herman Latanville, had turned around in the Nameplate parking lot and was crossing the double tracks when Mr. Chapman fell. The men had finished sanding and were standing against the back of the truck cab. Several witnesses at the inquest confirmed that the truck was moving very slowly over the tracks. The only recommendation made was for the provision of hand rails in the truck box.
Monsignor Castex lays the corner stone for the new Knights of Columbus Hall in Penetang Sunday afternoon.
District Knights of Columbus donate a life-sized nativity scene to the Victoria Harbour Knights to be erected in the village.
Many Penetang stores to remain open until 9 p.m. Christmas Eve.
The United States paid Russia $7,200.00 for Alaska in 1867, the equivalent of two cents an acre.
Cumming and Nicholson are selling the “Desert Boots”, $7.95 to $12.95 per pair.
Port McNicoll council ends the year with a $6,000.00 current surplus, consider purchasing a new fire truck for the village. Also recommended by the Reeve was a small loader, “no one likes loading gravel by hand anymore” he said. Reeve Calvert pointed out that only $16,000.00 of local taxes are available to council, the rest goes to the County, education and other costs.
Former Midlander Bob Vanstone is playing bit parts in a million dollar movie being made on a 120 acre estate 25 miles from Toronto. The TV serial movie is “The Last of the Mohicans”.
The PUC’s plan to test Little Lakes ability to supply a million gallons of water a day to cost over $100,000.00.
Waubaushene father of three, George Allan Fallowfield, was killed in a tree felling accident Wednesday morning. The tree he cut struck a smaller one that was rotten part way up, the top fell striking him on the head.
Four young men, one local, are sentenced to four years in prison for indecently assaulting a 16 year old girl at a house party. The judge also ordered that each should be given three lashes three times during their imprisonment.
S.S. Assiniboia and S.S. Keewatin tie up after another season. S. F. Malin, steamship superintendent, said the two boats carried 10,563 passengers this year, an increase of 141 over the previous year. The ships also carried 125,000 tons of cargo, up more than 2,500 tons over 1955.
Victoria Harbour councillor Edmund Walker died in Penetanguishene General Hospital Wednesday morning, he was 66. Mr. Walker, who was retired, was formerly the owner of the Victoria Harbour Dairy.
Hydro Electric Power Commission of Ontario is celebrating 50 years of supplying power to Ontario. The first hydro power was turned on at Berlin on October 11, 1910. Niagara power was delivered in 1911 to Midland and Penetang who were 25th and 26th to receive hydro in Ontario. The hydro commissions first new build was opened at Wasdell Falls on the Severn River in October of 1914. The Big Chute station, also on the Severn, was built in 1909 by the Simcoe Railway & Power Company and purchased by the HEPCO in 1914. (Renamed “Ontario Hydro” in 1974)
Arrangements have been made for a 40 member choir from Regent and Parkview schools to sing carols at the hospital. The public school board expressed their gratitude to Laval Dubeau for offering free bus transportation for the choir.
Major fire in Wasaga Beach destroys part of the municipal building, including the fire hall and police station. (Midland would follow in a few years when their municipal building and fire hall burnt)
Sixteen freighters are wintering, eleven in Midland, five in Port McNicoll, as the navigation season closes. This represents over five million bushels of wheat to be unloaded over the winter months. Last winter there were twenty two vessels but some were barges and tugs.
Meredith Wilson announces that Wilson’s Taxi has been purchased by Joe Lavechia.
Christmas turkeys are selling for 38 cents per pound.
Mr. & Mrs. Wally Hook wish to announce the birth of their daughter Wendy on November 29th.
Mr. & Mrs. Stanley Shaw announce the engagement of their daughter Shirley Elizabeth to William Gordon Wallace, only son of Mr. & Mrs. J. W. Wallace.
Second annual ski school will be conducted at the Midland Ski Club by Budd Watson December 26th to 29th.
Milk customers of Armstrong’s Dairy, Dubbin’s Dairy and Jone’s Farm Dairy are reminded there is no milk delivery December 25th or 26th and January 1st and 2nd.
John Diefenbaker to lead the Conservative Party.
“Twirp Season” is in full swing at MPDHS according to the Hi-Sterics column and Kay and Elaine. TWIRP stands for “The woman is requested to pay”.
In 1955 the annual average Canadian income went up 8% to $4,460.00.
Land swap, the town of Midland has received a triangular parcel of land east of Olive Street and five acres of property on the northeast corner of Vinden & Fifth Street. The CNR in exchange is getting a strip of land lying south of their right of way near Manley Street. (In 1956 Manley Street is still being spelled in honour of its namesake, Manley Chew)
At The Roxy – Walt Disney’s “Song of the South”
Do you remember? McGuire’s Furniture, Simcoe St., Penetang – Zoschke Footwear, Simcoe St., Penetang – Singer Sewing Center, King St. – Morrison’s Rexall Drugs, Main St., Penetang – Sushan Custom Furs, King St. – MacNeil Motors, Vinden St. – Harrison Iron Works, 180 Manley St. – Blondin Sales & Service, 102 Robert St. W. – Onley & Haig Barristers, 217 King St. – Household Finance, 222 King St. – The Wool Shop, 307 King St. – The Grigg Co., King St. – Flos Hatland, 217 Hugel Ave. W. – Del Hastings Men’s Wear, 276 King St. – Gignac’s Children’s Wear, Penetang – Economy Stores, Main St., Penetang – Walter Woods Shoe Store, 277 King St. – Roebucks, King St. – Peoples Store, King St. – Dunlops of Moonstone – Meads, Penetang – Sally Shops, 265 King St. – Marchildon Hardware, Lafontaine – Hollister Sporting Goods, Penetang – Maher Shoe Store, Penetang – Struther’s Drugs, King St. – Graham Swales Men’s Wear, Midland – O’Leary’s Fashions, Main St., Penetang – Hartman’s Hardware, 258 King St. – Central Shoe Repair, Jack Martin, Midland – McNamara Food Market, Penetang – Harvey Ellison Limited, 259 King St. – Ted Lounsbery Men’s Wear, 285 King St. – Fenton’s Welding, Midland – Eleithia Shoppe, King St. – Jim Crawford Men’s Wear, King St. – Eisenberg’s Radio & TV, Main St., Penetang – Livingston Men’s Wear, 201 King St. – To Name A Few.
Huronia Museum – Looking Back 60 Years Ago in North Simcoe – December 1st to 7th 1956
Burned out of house and home just about a year ago these pupils of Crossland Public School now have a brand new building, opened officially by George G. Johnston, MPP, Friday night. About 30 children attend the one room school where Miss Marlene Strath is the teacher. Classes have continued in the nearby community hall, the former Methodist Church.
New one room Crossland Public School in Flos Twp. southwest of Elmvale, officially opened November 30th, 1956. The old school burnt on January 11, 1956 and construction began on August 1. The building is now a private residence and no longer looks like it did in 1956.
Mr. & Mrs. Joe Strath served as caretakers of the old Crossland Public School for 18 years before it burned down on January 11th of this year. They will continue to look after the new school which has cost $26,000.00 to build and equip, including air conditioning.
President of the Midland YMCA, James Playfair, (son of Norman Playfair the stepbrother of Midland industrialist James Playfair), is seen addressing nearly 100 new and youthful members of that organization at induction ceremonies in the “Y” last Wednesday night. Demonstrations on the floor followed the more solemn part of the program.
Group of first year members of the Midland YMCA demonstrate tumbling during a parents night at the “Y”.
Open house night at the Midland YMCA last Wednesday night gave new youth a chance to demonstrate some of the abilities learned at the “Y”.
Twenty-five officers and men of “C” squadron, Grey & Simcoe Foresters staged a wood cutting bee at R. J. Gilmore’s farm on the 3rd of Tay (Midland Point) on Sunday to aid their comrade who is seriously ill in St. Andrew’s Hospital. Two buzz saws were used to cut 18 bush cords of wood into furnace size. Ten cords were piled in the basement, the rest close to the house.
Captain Joseph Stewart and his wife in the wheelhouse of the Assinaboia on the occasion of his last trip of the season and of his 36 year career with CPR steamships and 50 years of sailing.
Harold Gibson, CNR freight agent at Penetang, said yesterday that the last carload of Christmas trees left Penetang for the United States Monday afternoon. Mr. Gibson said that the 57 cars shipped this year was about average. All trees shipped by rail from Penetang are exported, with the majority going to mid-U.S. centers. One carload went to Corpus Christi, Texas. (Photo of Penetang station is undated)
Not too many years ago, when Anthony Blouin was learning the trade, contact to ships from shore was by Morse key or primitive wireless transmission. Now Mr. Blouin can pick up the phone and talk to almost any ship on Georgian Bay, as far away as the Soo. Telephone connection between the ship and its headquarters in Toronto, Montreal or elsewhere is also made through the Midland Marconi station.
For the past five years, Anthony Blouin has taken great pride in keeping the grounds and buildings of the Canadian Marconi station in Midland in trim shape. Mr. Blouin watches his son Emile, a teacher at MPDHS, apply white paint to the trim of the radio building.
For those who do not remember the wireless tower, myself included, it can be seen in the background of this photo taken at the corner of Donalda and Irwin Streets. Other stations in Tobermory and Port Burwell had two towers, does anyone remember if there were two here as well?
Estimate loss at $75,000.00 in stubborn fire in the Grise block. Chief Tippin said the blaze was the worst King Street fire since the Dudley block burned in 40 below zero weather in 1949. There were no soaring flames but the fire burned in the ceiling of the first floor in the middle of the building and took five hours to bring under control. Thick smoke kept firefighters from getting at the source of the blaze.
Huge mess in the Cross Country Cut Rate store about 3:00 a.m. Thursday morning after Midland firefighters poured thousands of gallons of water on a stubborn fire in the Grise block. This store, Martin’s Shoe Repair, Onley & Haig Barristers, The Royal Bank and the office of Dr. Ed Grise were all badly damaged by smoke and water.
Veterans of politics in Port McNicoll are pictured during nominations last Wednesday night. Clerk Treasurer B. J. Brownell, seated, clerk for 23 years, was able to name Reeve Albert Calvert to his uncontested position for 1957, his ninth term in that office.
Seven men have qualified for four council seats in Port McNicoll ensuring a lively election on December 17th. Cyril Larkin, George H. Burns, T. E. Lewis, Steve Thoms, Jack Fisher and seated Alec McCullagh. Absent was Jack Zummach.
Signing up all the youngsters in Midland and Penetang who wish to join Little League Hockey is a big job, as is finding equipment, ice time and coaches. Front, David Scott, Bobby Ruston, coach Freddie Scott of Penetang and Jim McKinnon. Rear, Rev. Len Self, director of Midland LHL and Bob Morgan, a director of the Penetang league.
Mayor Charles Parker acclaimed for his seventh term as Midland’s mayor. Elections were held annually in December at this time.
Well known Midland accountant Frederick “Freddie” French died suddenly at St. Andrew’s Hospital Sunday in his 61st year. Mr. French had recently purchased the home of the late Dr. J. D. McPhee of Port McNicoll. For many years Mr. French was the bookkeeper for the D. S. Pratt Co. and prior to that worked for the old Manley Chew Lumber Co.
Flos Reeve, Walter Middleton, acclaimed for his 15th term. He has served Flos council for 24 consecutive years.
Seventeen students receive certificates at commencement exercises at Port McNicoll Continuation School.
The regular court room in the band hall on Dominion Ave. was tied up with four polling booths, Magistrate K. A. Cameron found himself presiding over court from behind a table in Fire Chief Arnold Tippin’s office in its temporary quarters on Bay Street.
25 YEARS AGO 1931 – Capt. W. A. Lavigne, skipper of the Gleneagles, was instantly killed when the car in which he was riding struck a freight train between Fort William and Port Arthur. — The first snowfall of the winter hit Midland on December 1st — Midland’s new arena, under construction, was said to be “the best looking arena north of Toronto”. It was to feature “gleaming white walls and a roof of slate-coloured three-ply asphalt.” —Dr. J. M. Nettleton reported to Penetang council that the town had the second highest infant death rate in the province. Of 87 local births, 10 died before the end of the first year. — One of the most modern barns in the district, owned by Howard Smith on Penetang Road, was destroyed by fire. Although most of the stock was saved, 12 pigs and 3 calves were lost. — The new Ritz restaurant was destroyed in a fire that also damaged surrounding stores. Damaged by smoke and water from the blaze was McKillen Bros. Men’s Wear.
Three people had run into the new glass walls in the entrance to Regent School in one day. Red placards have been put up as a warning.
Penetang solicitor A. B. Thompson, (“Great escape” veteran) wins the only ballot facing voters, the mayoralty. Mr. Thompson received 612 votes against 277 for his opponent George Kerr. Penetang’s first mayor, when it was incorporated in 1882, was Alfred A. Thompson, grandfather of the mayor elect. Father of the new mayor, also A. B. Thompson, served this area for many years in the provincial legislature. Another member of the Thompson family who entered civic life was Wm. A. Thompson who served as mayor before receiving an appointment as Crown Attorney for Simcoe County.
Onley and Haig, barristers, wish to announce that their office is now located at 217 King Street, formerly Strathearn’s Jewellers.
Coldwater sees 80% turnout of voters due to efforts of the Junior Chamber of Commerce.
$25.00 reward offered for information on the theft of a boat and motor from the dock behind the Boat Works, signed Howard Dragoman, Cities Service Station, Bay & First Sts.
The tree that wasn’t there last year on top of the Midland Simcoe Elevator isn’t there again this year. The tree is made up of strings of coloured lights festooned from the flag mast. The tree illusion is created at night only, in the daytime it disappears.
Odeon Theatres Canada appealed the assessment on the Capitol Theatre they own on King Street as it has not been used for several years as a theatre. Midland Foundry and Machine appealed the assessment on their Manton Foundry building on Manly Street that is being assessed by the cubic foot. C. E. Onley on behalf of Midland Foundry argued that the 40 foot high roof had been designed to fit the needs of the previous owners and that present operations only required a 15 to 20 foot ceiling. They were awarded a $1,500.00 reduction on their $23,040.00 assessment. The Jesuit Fathers of Upper Canada were also awarded a reduction on the 30 acres they own between the Wye River and the CNR tracks which they were renting out for $25.00 per year as pasture.
Two Toronto men will spend two years in jail for stealing the cash register containing $91.00 from Wilford’s Service Station on October 22nd.
Midland election results, Reeve, W. H. Keller; Alderman, Clinton Smith, Bill Orr and Doug Haig; PUC, Bill Logan and Charles Stevenson; Public School Board, Frank Bray, Mrs. McIntyre and Jack Thompson. Turnout of voters was 42.6% compared to 38% in 1955.
Huronia Museum – Looking Back 60 Years Ago in North Simcoe – November 16th to 30th 1956
Click on photos to enlarge New Wyebridge community hall is completed on the west side of Highway 27 in Wyebridge. Local Women’s Institute has catered hundreds of local events in the last few years to raise the needed funds.
George Dudley QC of Midland, barrister and secretary manager of the Amateur Hockey Association, was interviewed in his office Wednesday night by cameraman Bob Crone for CBC Television News. He said that the association, by a vote of 13 to 10, had decided in the light of Russian actions in Hungary, not to send a team to Moscow in February for the world championships. The cup in the background is the world championship trophy won by Canada in 1950.
[Read more about George and other area athletes at the Midland Sports Hall of Fame web site.] http://www.midlandonsportshalloffame.com/george-dudley.html
Yard engine belonging to the Century Coal Co. in Midland has been converted from steam to diesel. The new engine is actually being repurposed from a Canadian military Sherman tank.
Among other improvements Century Coal Co. has recently replaced the old 400 foot wooden dock with cement and steel.
First snowman of the season, built by sisters Mary Ellen McCormick, 10, and Cheryl, 3, of 268 Midland Ave.
Unamotus Hi-Y members with a radio blaring peppy music in the background prepared to clean and paint the hall entrance to the YMCA dance floor Wednesday afternoon. Back to front, Wayne Broad, John Bell, John Edwards, Bryson McQuirter and Don Green.
First Midland winner of the annual oratorical contest sponsored by the Simcoe County Trustees and Ratepayers Association, Winston Schell, 13, of Horrell Ave. displays the trophy he won Friday night in Barrie. Father Norman Schell looks proudly on.
High honours were heaped on these two graduates of Elmvale District High School at commencement exercises in the school auditorium Friday night. Wilmur Giffen and Edith Robertson were winners of Dominion-Provincial bursaries. Wilmur also won the Canadian Legion scholarship. Both have chosen teaching careers.
Midland’s Caledonian Lodge had enough Y’s Men among its numbers to form a team for the master mason’s degree, exemplified for Ken McCaughen and Haig Abbott last Monday. Back Row, Harold Boyd, Ken Ellis, William Mutch, Tom McCullough, Wells Hartman, George Ingram, Charles Vent, L. S. Wallace, Ange Hartman, Frank Whiteman; front row, John Krocho, Frank Powell, Bev Keefe, candidates Ken McCaughen and Haig Abbott, Mac Perrin and Bill Setterington.
Coffee tasted extra good to these three Midlanders who weathered a rough passage from Thunder Bay to Port McNicoll on the Paterson freighter S. S. Bricoldoc, especially November 21st. They encountered 100 MPH winds, 40 foot waves and a ship that rolled beyond the 23 1/2 degrees considered a safe maximum. Four Midland people were on the crew, Ernst McKeown, 2nd mate, Mrs. Mary Clay, 1st cook, Doug Robitaille, oiler and Cecil Leclair, porter
Crewmen and workers at the CPR elevator in Port McNicoll are using hot water to de-ice the hatches of the S. S. Bricoldoc, a scene that will be common until the end of the navigation season. Bricoldoc was 36 hours late reaching Port McNicoll and had a ten degree list to port, but high winds and huge waves were the reason, not icing.
Nio Gianetto is seen hanging up deer and bear in the walk-in cooler at his store. Nio was part of a gang that hunted near Dorset that included; Ed Copeland, Hugh Blair and Clarence Hall of Midland, A. L. Fitzgerald, Cleo Genier and his father, from Penetang, Charles and Bill Watson and Jack McTavish of Newmarket.
Three young forwards are being counted on by coach Garnet Armstrong to supply a lot of scoring punch for Midland’s junior “C” team this year. They are Dennis Turner, “Buzz” Deschamp and Doug Campbell. Turner was with Elmvale’s OMHA juvenile champs last winter. Deschamp starred with Midland midgets. Campbell also performed in juvenile ranks in Orillia.
Replaced by electronic gear the old hand operated Morse key is still music to the ear of veteran operators like Anthony Blouin who has worked for the Canadian Marconi Co. for forty years and is currently the operator at Midland. Mr. Blouin has worked in the Soo as well as several Quebec stations. Anthony was on duty in 1914 at Grosse Isle in the St. Lawrence and heard the Empress of Ireland’s distress call the night she sank with the loss of 1,012 souls, eight more than Titanic two years earlier.
Tony Blouin, the “wireless” operator at Midland, explains the operation of a “Maggie” detector to K. V. Rainberg. This equipment is now a museum piece although in use during Mr. Blouin’s career. They are surrounded by all the electronics now used in a modern Marconi station.
Midland’s wireless station, call letters VBC, was located at what was then the south end of William Street at the highest location on the west side. The station and the operator’s house are still standing. A Midland contractor (I am searching for the name) built the identical stations in Midland, Kingston, Tobermory and Port Burwell. The Midland station operated from 1912 till 1961.
Things are a little easier for the picketers manning the line at the Canadian Name Plate plant on Bay Street during the recent strike, by the erection of a shelter to give some relief from the cold.
The November 30th County Herald contained an article regarding this two week old strike by the 126 UAW workers. It was presented as a discussion, with the union representative making a point and Mr. Gordon Moss responding to it. The points on both sides seemed quite reasonable.
Upside Down Cake? – Dempster’s bread truck headed to Midland and driven by Ernest M. Foster of Barrie got into trouble on the slippery road at the south end of King Street. No charges were laid, damage estimated at $50.00.
Simcoe County forester Joe Lea retires after 28 years of building the forests of the county.
Ontario Department of Highways has refused Tay Townships request for a 30 MPH speed limit on Hugel Ave. W. from Eighth Street to Hwy 27. The township is concerned because there are no sidewalks past Eighth Street, 750 pupils have to walk on the roadway.
Ad in the paper announcing that Walter Zimmerman has taken over the Meat Market formerly operated as Argues Meat Market in Victoria Harbour.
MPDHS to get $400.00 electric timer and scoreboard for the gym.
Realtor W. J. Sansford is offering a stucco bungalow in the south end, 3 bedrooms, hardwood floors, oil heating, clothes closets in all bedrooms, laundry tub, 4 piece bathroom, built-in cupboards. Heated last year for $72.00. Full price $8,500.00.
PUC still looking to increase towns water supply and Little Lake is still the best new resource with water always testing “Grade A” and Department of health supporting the plan.
Realtor Vic Strickland at a public meeting suggested that more citizens would run for public office if the stipend was increased. Clerk Wm. Hack explained that currently $2,000.00 is distributed among the mayor and councilors annually, using a graduated scale based on attendance at meetings. The Mayor maintains it is a duty to serve your community. Alderman Clint Smith felt it was an honour to be elected to public office.
Newcomer A. B. Thompson, Penetang barrister, will run against the present mayor of Penetang, George Kerr.
The real estate firm of W. J. Sansford has launched a new subdivision across the bay behind the Midland Simcoe Elevator. Jim Bennett, the firms representative, said “Sunnyside Heights” would be limited to $10,000.00 and over homes with a possible shopping center behind if interest warranted it.
Start will be made next year on the four lane super highway from just east of Barrie (Crownhill) to Coldwater.
Bourgeois Motors announces that their car lot for both new and used vehicles is now located at their Midland Avenue site, just north of Hugel.
Maritimer A. MacNeil acquires the local General Motors franchise and will open on the former Warman property on Vinden Street, recently occupied by Bourgeois Motors.
Local Canadian Tire Store closes half day owing to the death of the firm’s founder, J. W. Billes.
Midland’s downtown merchants to circulate a petition proposing a five day work week except during the tourist season.
Tenders for the sale of properties owned by the town of Midland – #1 Community Center 311 King street, 2 1/2 story brick veneer, hot water heating, stoker, full basement, modern plumbing, apartment on upper floor. (currently CompuSolve) – #2 Band Hall, 218 Midland Ave. corner of Dominion, 1 1/2 storey brick hall, oil heating, basement, 6 room apartment on upper floor with separate entrance. (currently Better Life Chiropractic) – #3 Town Garage, Yonge Street E., solid brick, 50′ x 49′, concrete floor, two 12′ x 12′ folding doors. (currently 382 Yonge St. former home of the McCuaigs)
Winner of the 3,000 meter steeplechase at the Olympic Games in Melbourne this week, Britain’s Chris Brasher is a brother of Dr. Peter Brasher, Midland.
More than 6,000 residents are eligible to vote in the upcoming municipal elections in Midland & Penetang.
Steel windows for the new municipal building, promised for August from a British company, have not yet arrived.
Le Camp’s Clothing Store at First and Ney in Port McNicoll is going out of business due to sickness, everything being sold at cost. “P.S. – We’ll sell the store too.”
Midland’s first advanced poll will take place on December 1st from 10 a.m. to 6 p.m. at the rear of town hall, off Dominion Ave. Those eligible must sign a declaration stating they will be absent on the day of the regular election. Those allowed will be railway workers, armed forces, transport drivers and others whose business makes it impossible for them to be in Midland on the regular polling day.
In 1945 sixty six percent of Canadians who paid income tax earned less than $2,000.00, in 1953 only twenty two percent were below $2,000.00.
Two local hunters are wounded during the deer hunt. Port McNicoll postmaster and popular citizen Jack Reedy managed to shoot himself in the foot while hunting in the Cognashene area. Joe Barden, Coldwater photographer and poolroom operator was shot in a hunting accident east of Bracebridge. Shot fired from another hunter 300 yards away fractured his shoulder, broke three ribs and punctured a lung.
Vasey United Church Sunday School superintendent Nathan Edwards reported that 85 children were enrolled last year with average weekly attendance of 64.
OBITUARIES – Mrs. Damasse Lalumiere died November 5th at her home, she was in her 91st year. She came to Penetang with her parents at age 15 and married Damasse in 1882. She is survived by Aimer at home, Eugene in Buffalo, Adolph in Galt, Lea (Mrs. Simeon Moreau), Anna (Mrs. Theophile Marchildon), and Melina (Mrs. Isreal Robitaille). – A lifelong resident of Coldwater, Mrs. Sarah Rachel Sallows nee Howell died at home on Nov 7th, she was 66. She is survived by her husband Reuben, two sons, Henry and Theodore and a daughter Margaret, Mrs. Walter Rose of Fesserton. – Mrs. Septimus Lowes nee Mary Ellen Jackson, died at her home Sunday in her 82nd year. She is survived by her husband, and three sons, Kenneth and Francis of Midland, and Tom of Oshawa. – Mrs. Frederick Norman Carruthers nee Edna Lois MacDonald of Wyebridge died November 11th in St. Andrews Hospital in her 64th year. Predeceased by her husband in 1947 and son Allan in March of this year. Survived by one son, Clayton of Midland. – Mrs. Joseph J. Fallis, nee Mary Tinney, who died in the Beechwood Nursing home on November 11th in her 90th year. Predeceased by her husband 22 years ago and a daughter Rita 30 years ago. Survived by two sons, Harvie and William of R.R. Midland a daughter Hazel, Mrs. William Taylor of Vasey. – Andrew McLawrence Lovering died on November 23rd at the age of 83. An active participant in his community, he served for eight years on council, telephone commission for 15 years, school board trustee for 18 years and captain of the Coldwater fire brigade for 30 years. He and his wife, the former Maude Hawke, farmed the original Lovering homestead deeded from the Indians. He is survived by his wife, a daughter Ruth, Mrs. Charles Danby and two sons, Walter and Horace.
WEDDINGS – Muriel Blondin, daughter of Mr. & Mrs. Martial Blondin, Lafontaine and Richard Lesperance, son of Mr. & Mrs. Albert Lesperance, Perkinsfield, at Holy Cross Church. Anatole Charlesbois sang two pieces accompanied by his wife on the organ. – Catharine Ann Reid, daughter of Mr. & Mrs. James F. Reid and Douglas Wm. Fagan, son of Mr. & Mrs. Cecil Fagan, Wyebridge, at St. Mark’s Anglican in Midland, Nov. 10th. – Germaine Bellisle daughter of Mr. & Mrs. Arthur Bellisle, Penetang, and OPP Officer John W. Ambeau, son of Mr. & Mrs. George Ambeau, Midland at St. Ann’s, October 29th.
25 YEARS AGO, 1936 – Following a week of below freezing temperatures the thermometers jumped to 68 and 70 degrees. – An old landmark was destroyed when the Waubaushene Inn owned by Henry Gouett burned to the ground in a midnight fire. – Midland YMCA won the 33 mile marathon race from Midland to Orillia for the second time and established a new record by clipping seven minutes off of their previous years record. Midland runners were Stan Symington, Dudley Tushingham, Horace Scott, Charles Noquet, Harold Hornsby, L. Larmand of Victoria Harbour, Cliff Davis, Capt. Merkley, Borland, Switzer, McKenzie, Bremner, Edwards, Coombs and Vosper.
Huronia Museum – Looking Back 60 Years Ago in North Simcoe – November 8th to 15th 1956
Parkview School held a Remembrance Day service Friday morning directed by teacher Jack Yelland. Grade Eight student Charles Ward stands before the backdrop that was prepared by Mrs. (Joan) Wm. Barnett’s Grade Six class. Bugler Jim Ingram played the last post and Len Wiles, the caretaker and legion member, made the cross.
The Bracebridge Legion Pipe Band led Legion members, Ladies Auxiliary and Penetang Firemen through the rain and sleet to the cenotaph on Monday, November the 12th. Under the guidance of Legionnaire W. H. Hewson, the groups, which included a small number of townspeople, joined in singing hymns, the National Anthem and O Canada. The names of those who fell in all wars were read by Auxiliary president Miss Kathleen Dubeau and G. J. Robillard was the bugler.
The new safety booklet issued Wednesday to Midland elementary school children by Branch 80, Canadian Legion, receives the serious attention of Chief Robert Cameron, Regent School principal, Morgan Lewis, student Barbara Dalrymple and legionnaire H. A. Wiles, past zone commander.
Winner of the Branch 80, Canadian Legion scholarship, Ross Hindmand receives a cheque for $100.00 from Branch 80 treasurer Howard Henderson, Ivan McConnell, left, Branch 80 publicity director looks on. Ross plans to enter the University of Toronto when he graduates from MPDHS and later enroll in law school.
Oratorical contest winner at Regent School Friday night was Winston Schell of Regent. He is receiving his prize from John Dalrymple of the Midland Lions Club. Winston gave a humorous account of his experience as a golf caddy. There were twenty entries this year which resulted in a marathon session lasting over three hours.
Arm waving is out at public speaking contests but these young contestants had some fun after the contest imitating the days of dramatic elocution. Betty Jean Walkinson of Parkview laughingly admonishes her listeners.
Diane Peutz of St. Mary’s school confronts the audience with a firm stand.
A bit of a quiz to see who is up on their barn identification. Clue, located in Tay Township.
John Powers reports in his column “Outdoor Diary” that “a few flocks of geese have been seen landing in the Lafontaine area”. Now in 2016 it wouldn’t be unusual to see a flock of geese in your back yard.
This week a party from Coldwater including Forester G. R. Lane ad MPP Lloyd Letherby motored up the new section of Trans-Canada Highway from Port Severn to the site of the new Six Mile Lake campsite and park being laid out by the Department of Lands and Forests. Good progress has been made and the park should be ready for visitors next season. Further graveling and other work is still to be done on the new highway before paving can be done.
At the Pen, “The Great Waltz” with Louise Rainer and Fernand Gravet. At the Roxy, “High Society” with Bing Crosby, Grace Kelly and Frank Sinatra.
Midland Curling club members give the rink a fresh coat of paint before the season begins.
WEDDINGS, Rita Jean Martin, eldest daughter of Mr. & Mrs. Joseph Martin and Andrew Gauthier, son of Mrs. Zed Gauthier at St. Ann’s, October 6th.— Elaine Roselyn Gerow, only daughter of Mr. & Mrs. G. W. Gerow of Midland and David Frederick Milner, only son of Mr. & Mrs. Cam Milner of Midland and Honey Harbour, at St. Mark’s Anglican October 20th.
— Bernice Florence Leonard, daughter of Mrs. B. MacDonald and the late Lorne Leonard of Wyebridge and Donald Roy Abbott son of Mrs. E. Abbott of Toronto at St. Mary’s Anglican Toronto.
— Anita Patricia Gravelle, youngest daughter of Mr. & Mrs. Albert Gravelle Penetang and Robert F. Lamoureux youngest son of Mr. & Mrs. Fred Lamoureux Midland at St. Ann’s October 8th.
— Helen Margaret Hounsome, daughter of Mr. & Mrs. Charles Hounsome Wyebridge and William Crippin son of Mrs. Peter Crippin Penetang at the Church of the Good Shepherd Wyebridge on October 20th.
— Marie Marchand daughter of Mr. & Mrs. Celestin Marchand and B. Johnson, son of Mr. & Mrs. Jacob Johnson Toronto at St. Ann’s.
— Rejeanné Marchildon daughter of Edmond Marchildon and Jean Baptiste Marchand son of Romeo Marchand all of Lafontaine at Holy Cross on October 6th.
— Joan Stewart daughter of Mr. & Mrs. Thomas Stewart Penetang and Marcel Maurice son of Mr. & Mrs. Arthur Maurice North West Basin at St. Ann’s October 13th.
— Erna Ostertag daughter of Mr. & Mrs. Donald Ostertag Penetang and Lionel Duquette son of Mr. & Mrs. Anthime Duquette Pentang at St. Ann’s October 20th.
— Jeanette Ruth Oliver daughter of Mr. & Mrs. Stan Oliver North River and Douglas Hebner son of Mr. & Mrs. Elmer Hebner Midland at Knox Presbyterian October 27th.
New 21 inch “big screen” Admiral TV can be seen at Eisenberg’s, 47 Main Street Penetang.
At Eplett’s TV and Appliance in Midland it’s a free turkey with every TV purchase.
Midland Council changes insurance company and saves $1,600.00 on Arena Gardens insurance. Coverage will be $184,000.00.
Barber & Haskill Limited opens their new store at 278 King Street, formerly McKinley Automotive. The store had been located on the east side of King ten years ago then moved to a new location on Yonge Street. The Owen Sound brothers-in-law now have a staff of five, electricians Bruce Spicer, Gordon Duggan and Charlie Spiker, salesman Clint Truax and heating specialist Dave Hudson.
TEN YEARS AGO — First new Cadillac to be seen in Midland since the war was on display at Bertrand Motors. — Mayor Charles Vent unveiled a new memorial plaque at the cenotaph on Remembrance Day. — Midland and Penetang hospitals recorded 54 births in the month of October.
At the Victoria Harbour cenotaph Cpl. John Bernard unveiled a bronze tablet honouring the dead of World War I and Sgt. William Quinlan another honouring those who died in World War II.
Three Hannah Street residents request sewers and will have them installed by the town at a cost of $200.00 each.
Huronia Museum – Looking Back 60 Years Ago in North Simcoe – November 1st to 7th 1956
Four prominent figures who have been involved with the progress of St. Andrews Hospital since its inception in 1918 are seen following ceremonies to open the new James Playfair wing at the hospital Wednesday night. R. J. Pinchin, president of the board, Mrs. Emma Baker, superintendent for some 30 years and after whom a wing has been named; Stuart Playfair who unveiled a plaque honouring the contributions of his brother the late James Playfair, donor of the original building. Another plaque was unveiled honouring the services of Dr. J. Ross Parrott, right, and his associates, who did much of the planning for the new building opened last year.
New laundry facilities at St. Andrews are examined by John Burke, building committee chairman, W. A. Robinson, M.P., and former nurse, Mrs. John Burke.
Ground Observer Corps members Mrs. Don Tuttle and chief observer Alf Tuttle are proud of their new table for plotting aircraft flights over the area. Mr. Tuttle made it himself and it is an exact replica of the one used at the RCAF filter center in Barrie. The fifteen member group report that 48 sighting calls were made to the filter center last month, the largest since the group started.
Laying the section of the new Trans Canada Highway that runs from Waubaushene to Port Severn is a job that requires big machinery and big material. These large slabs of rock provide excellent fill for the many marshy areas.
Over 300 delegates attend the annual meeting of District 8, Ontario Secondary School Teacher’s Federation held at MPDHS on Friday. Students helping in the cafeteria to feed all the guests are, Karen Wilcox, Robin Benson, Gerry Geere, Allan Kirkup and Shirley Foster.
More than seventeen members of the Georgian Bay Hunters and Anglers were present at a building bee last weekend at the clubs new site back of the Martyr’s Shrine. Studying plans are president Bill Russell, Jim Duncan and Lloyd Wilson.
Forty years of service as a volunteer fireman on Midland’s fire brigade was honoured Thursday night at the Parkside Inn. Henry Woods, 2nd Liet., watches as Bill Crawford, center, is presented with a wallet and money by Jack Argue, chairman of the fireman’s finance committee.
In the bottom photo Earl Allsopp, secretary and 1st Lieut., on the left, and Dalton Jennett, captain, on the right, join in on congratulating Bill Crawford and presenting him a certificate.
S. C. “Bert” Hanly hands over his waterfront crane to Midland Machine Shop operator Lloyd Atkinson, who has purchased the historic equipment from its long-time owner and operator. Bert built the hand operated crane about 1917 at a cost of $1,100.00 but previous to that had performed the same function from an oak bottomed scow equipped with two cranes. There was no set fee, the charge was estimated by the “bigness” of the craft, beam and draft being as variable as length. He averaged about 300 boats per year. Tomorrow he sets off on the annual deer hunt, a tradition since 1896. Bert is 83.
Delegates to a boys’ rally, sponsored jointly by the Boys’ Work Board and the Christian Education Committee of Simcoe Presbytery of the United Church, register at St. Paul’s United Church, Midland. The rally Saturday afternoon featured games, stunts by the boys and their leaders, talks and films.
[This photo was on the front page of the Free Press on November 7th 1956 but none of the names were included, please comment if you recognize anyone.]
It has been suggested that the the lad in the plaid shirt is Harry DeVries, the one in the leather jacket is Frank Okenka and the one on the extreme left is Winston Schell. Looking at other photos of these young men I would agree except Frank is hard to judge without a better look at his face. (Tom at the museum)
Major damage in the fire at St. Mary’s Separate School early Friday morning occurred in the class room which was occupied by grades 5 and 6. The room was completely destroyed. The students have been accommodated in surplus rooms at Parkview and Sixth Street schools. Four other class rooms were badly damaged by smoke and water.
Wendy Howard of the MPDHS junior girls volleyball team gets ready for a smashing serve over the net at the high school tournament Saturday morning. Orillia won top place of the four teams entered.
In a letter to the editor a local group seeking liquor outlets in town has turned down any request for beverage rooms, their objective is to have a liquor and beer store only in Midland. They also want organizations to be able to obtain a liquor license for special events so that groups would be less likely to take events outside of Midland.
The first two of the Ontario government’s historic site markers were unveiled last week in Toronto. Midland’s W. H. “Bill” Cranston, chairman of the Ontario Archaeological and Historic Sites Board opened the ceremonies with remarks. Premier Frost paid tribute to Midlander J. H. “Herbert” Cranston whom he described as a “great Canadian” in pioneering the preservation of the province’s historical heritage.
Every week there is a “gossip column” in the paper called “Did You Hear, The Midland Social Week”. The Penetang column is called “On Dit”. In the County Herald, November 2nd we learn that Mr. & Mrs. Nap Laurendeau will leave Malton by plane Saturday to fly to Winnipeg for a few days. — Mrs. Charles Hardy entertained members of Lady Parkhill Lodge, LOBA (Lodges of the Ladies Orange Benevolent Association) after their meeting of October 19. — Miss Marion Evans, to be married to Arthur Argue tomorrow at Knox Church, has been the guest of honour at several miscellaneous showers. On Oct. 25, thirty five friends and neighbours were present at the home of Mrs. F. E. Lowes, Fifth Street, which had been decorated with pink and white streamers. The previous Monday, 25 employees of Wagg’s Laundry gathered at the home of Mrs. Roy McConnell. — Miss Pat Perrin will be in Toronto until the end of this month. She is working and studying florist work in the shop of Eunice Denby. — Mrs. Jack White, Mrs. Flora Banting and Mrs. Edward Jeffery Sr. are leaving Tuesday morning for the south. They will spend the next six months in St. Petersburg, Fla. — Miss Joan MacEachern, daughter of Mr. & Mrs. Donald MacEachern, who is a nurse in training at the Royal Victoria Hospital in Barrie, visited her parents Sunday, prior to leaving for Toronto where she will spend three months affiliation training at the Hospital for Sick Children.
Beaver Lumber is advertising everything the handy man needs to create that new room in the house called the “Recreation Room”. They suggest you “Start now in your after supper hours -“
Cinema usherette in the dentist chair when asked which tooth was giving her trouble replied, “Second from the left in the balcony” —– “I don’t like the look of your husband” said the doctor gravely. “Neither do I” the wife replied “but he’s kind to the children.” These little bits of humour, used as space fillers are found in most of the Free Press and County Herald papers.
Singer Sewing Center, machines rented by the week or by the month.
In Penetang police court , 19 year old Leo Patrick Dier, giving his residence as Penetang, pleaded guilty before Magistrate K. A. Cameron on a charge of obtaining liquor while under age. Unable to pay the $25.00 fine he was remanded in County jail for the alternative 10 days. Sometime later in the Penetang police office next to the court, Provincial officer Mervin Robinson noticed a wanted poster on the wall for a Leo Patrick Deir, also 19, of Brockville. Despite the difference in spelling it turned out to be the same person and he was returned to Brockville. [I included this article wondering how often, before we had our sophisticated computer systems, criminals were able to get away from officers undetected.]
In the PMCS News column, Judy Quesnelle reported that an election was held on Oct 8th to elect new officers for the Port McNicoll Continuation School for 1957.
Alfred Simon, a twenty year old roofer from Toronto, died in Penetang hospital from injuries received when he fell from the roof of the new Simcoe County Home for the Aged in Penetang.
A lifetime spent in the lumber business came to an end Monday when Marcel Tessier died following a heart attack. Owner of Tessier Planing Mill in Penetang, which he has managed since the death of his father 25 years ago. The only other sibling, Father Phillip Tessier is returning from Brooks Alberta to attend the funeral.
Established in Orangeville 36 years ago by A. J. Grigg, the Grigg Company will open a new branch store in Midland Friday. Termed a junior department store, the new addition to Midland’s downtown will be located in the building formerly occupied by Loblaws Limited.
Thirty-eight teams in Midland and Penetang have been organized for Little League and Midget hockey this year.
25 YEARS AGO THIS WEEK — Fire of unknown origin destroyed a boat storage building owned by Gidley Boat Company of Penetang. Thirty-three boats including several launches stored for the winter were lost. Damaged was estimated at $50,000.00. — A football tournament at Beck’s field in Penetang went on despite heavy rain that made the field a sea of mud. Both Midland’s junior and senior teams were defeated by Orillia, but Penetang juniors carried home town honours by defeating Balmy Beach 3-0. Some of the Penetang players were, Trilsbeck, Don & Ed Copeland, O’Hearn, Crippen, Grise and Quigley. Penetang juniors were Ontario semi-finalists in 1930. — Three adjacent cottages in Waubaushene that had just been completed in the summer, were destroyed by fire. The cottages were owned by Toronto residents and had been vacated for the winter. — Exactly one year after the Ontario Cafe and adjoining beauty parlour were destroyed in an early morning fire, flames devoured a two-story frame building on Bay St. near the Canadian Department Store. The blaze was discovered by a Mr. Byrne, who also discovered the fire the year previously. [Is that a coincidence or is his name an even bigger coincidence.] — Nine helpless inmates of the Ontario Hospital in Penetang died when a men’s sleeping cottage was destroyed by fire. The cabin destroyed housed aged cripples, who could do little to help themselves.
In 1911 the Roman Catholics of Midland had no church or meeting place large enough for their growing congregation to celebrate Mass. Father Laboreau of Penetanguishene was the priest in charge of a large parish that extended to the Coldwater area. The Reeve of Midland at the time and Master of the Orange Lodge, Lorenzo MacFarlane, offered Father Laboreau the Orange Hall for services. After overcoming his surprise Father Laboureau accepted the offer.
Fire destroyed a 30 by 14 foot boathouse on Picnic Island owned by Cecil Shaw of Welland. Two sixteen foot boats and a canoe were lost in the blaze. One was the first of its type built by Alfred H. Gidley of Penetang and the other was the last boat built by Mr. Gidley, who is Mrs. Shaw’s father.
Midland Brass Band requires boys 10 years old and up, instruments available.
Huronia Museum – Looking Back 60 Years Ago in North Simcoe – October 16th to 31st
Apple Day headquarters 1956 is a room in Knox Presbyterian Church. Scouts Gary Blake and Jerry Berriault receive their apples and money cans from Assistant District Commissioner Harvey Boyd and Cubmaster Ida Gardiner. In the back row are Cubmaster Wilf Hamelin, Scoutmaster Tom Gilbert, Assistant Cubmaster Art Richards and District Scoutmaster Charles Roberts look on.
Saturday was Apple Day for Cubs and Scouts all over Ontario. Billy Cameron and Billy Graham tidy up their baskets before continuing their rounds of Port McNicoll homes. They are members of the 1st Port McNicoll pack.
Yeggs’ strike local IGA store. Manager George MacFarlane points to the tiny hole drilled into the store safe in an unsuccessful attempt to open it. The safe was embedded in concrete at the front of the store. Two display stands had been moved to conceal their activities. Stealing is hard work and the would-be thieves had to take a break, consuming two pops and a large chocolate bar.
Midland’s new municipal building is taking shape on the old Central School grounds between Second & Third Streets on Dominion Ave. Late in arriving, steel for the new building has been erected this week , which will permit other work to proceed.
Getting ready to feed the hundreds of guests expected at the opening of the new public school in Coldwater are members of the Home and School Association, Mrs. Mervin Abott, Mrs. Clem Swailes and Mrs. James Emslie, convener of the group.
This new addition, on the left, to the Waverly United Church was dedicated at services Sunday afternoon. Termed a Christian Education and fellowship room, it will also serve as a general auditorium. Many members of the congregation provided volunteer labour on the addition which cost around $8,000.00.
Well equipped kitchen is included in the new addition to the Waverly United Church which will be dedicated Sunday afternoon. Mrs. Elmer French and Mrs. Reg Drinkill examine a storage rack under the serving window which will hold more than 65 pies. First customer at the counter is Rev. Wesley Glazer.
Homeowners in the new Ingram Subdivision of Tay Township were all smiles Saturday as workmen completed the first layer of pavement for the new street, a continuation of Hugel Ave. The street is now more than two miles long and runs from William Street in Midland’s east end to Highway 27 in the west.
The girls, members of the Tironae Club of Midland YMCA, are sorting rubber footwear for cleaning and repairing before sending it to the Salvation Army. Elsewhere in the room another group is sorting clothing for the same destination. Carol Fox, Karen Robinson, Mary Ann Nicholson, Sheila Barber and Shirley Ann Silver.
The young lads are getting a few pointers on how to build up muscles through exercises on the parellel bars. They are one of the many groups who receive weekly instructions on gymnastics at the Midland YMCA. Boys are David Carpenter, Ronnie Gosselin, John Thomas, Randy Jones, Paul Henderson, Jerry Beteau, instructor Alex Owen, Edo Wensveen and Gerald Karch.
There were seldom any empty seats during the five days that Loblaws held their cooking school in the Capitol Theatre, King Street, Midland, last week.
In a rustic setting, these white washed stones direct the visitor to the Simcoe County Camp of the Ontario Department of Reform Institutions near Hillsdale. In spite of the open gateway there were no escapes attempted this summer at the experimental project where 50 prisoners worked under a few unarmed guards.
This sturdy bridge on the conservation farm was built by prisoners in nine days at a cost of about $15.00. With the extensive rockery lining the stream, dammed up when the photo was taken, it will add much to the scenic beauty of the Kiwanis property.
Caretaker at Parkview School, Len Wiles, boards up another broken window, part of a long string of senseless vandalism occurring in Midland recently. Window to the right has a hole in it as well, just to the left of the pumpkin.
Good progress is being made on Midland’s newest industrial building, that of Pinecrest Products Limited. Located at the extreme easterly end of Bay Street, the new factory will produce unfinished furniture.
Dressed for initiation these four students are attending the Collingwood vs. Midland junior football game last week. Members of the HiY Unamotus Club the boys are; Ernie Somers, Ron Parker, Gary Woods and kneeling, Bill Swann.
Simcoe District teachers inspect a new text book during a meeting at Regent School, Midland. Henry Bergen of Christian Island; Ken Cowan, Midland; Wesley Anderson and Walter Black of Christian Island.
Barbershoppers are featured in this week’s “Pot Luck” in the editorial column of Wednesdays paper. Bottom, Glen Campbell, Ray Trew, Lloyd Atkinson and Archie Campbell.
MPDHS almost beats Collingwood junior football team, lose 22-16 despite Larry Leroux on the left catching three touchdown passes thrown by John Dubeau on the right.
Keri Beteau pulls the winning ticket at the recent cooking school sponsored by Loblaws and H. J. Thompson and Sons Ltd. at Midland’s Capitol Theatre. The winner of a new stove supplied by Thompsons was Mrs. Charles Robb of RR 2 Penetang. With Keri on stage are sponsor Bill Thompson, Mrs. Elsie Clay Rogers, who conducted the school and E. G. Saigle, a promotion official with Loblaws.
October 17th was a happy day for downtown shoppers in Midland as the public works staff began the job of removing and storing all of the parking meters until spring. Ken Walker, left, smiles as Constable Tom Currie tells him to put his money away. Removing the meter is Sam Butineau.
St. Andrew’s Hospital board member H. G. W. Paice, left, receives a cheque for $1,000.00 from Lions Club president Bill Jeffery.
Midland’s newest nonagenarian is Philip Henry Blake who marked his 90th birthday at his Yonge Street home Saturday. A native of Ottawa, Mr. Blake has been a resident of Midland for 51 years, most of which time he was engaged as a lumber inspector.
People from all walks of life attend the funeral services at St. Paul’s United Church for A. D. Tushingham, recently curator of Huronia Museum and retired manager of the Bell Telephone Company in Midland. Mr. Tushingham died of a heart attack while on a motor trip with his wife and daughter to the east coast, he was 73.
Big thermometers on the corner of King & Hugel and King & Colborne will indicate the progress of Midland YMCA’s campaign for $8,500.00 with which to operate its many services during the coming year. With the hammer is Jack Courtemarche, Haig Abbott, Alex Owen and Frank Hartman. By Wednesday noon the amount was $2,432.00, eventually $9,500.00 was raised. [Note the Pentecostal Assembly Church in the background on Colborne St., now with a second storey it is an apartment complex.]
No trouble cleaning this fish as the owner is a butcher by trade. Isadore Arbour of 242 King (now 264) caught this 12 pound, 36 inch Northern Pike off the Tiffin Elevator last week with a Canadian Wiggler. Guy Hebner and Clarence Cowie were in the party.
Workmen applying a new “all metal” roof to the Midland Arena Gardens.
Msgr. Castex throws the first ball to open Penetang’s new bowling lanes.
Grew Boats receives an order for two, 50 foot RCMP patrol boats. Manager Andy Morrison feels that extra staff will need to be hired and full staff will be needed all winter to supply current orders. The new patrol boats feature twin 350HP gasoline engines and sleeping quarters for the crews.
Consumers Gas Company seeks a franchise from Midland Council to provide natural gas to the community. Supply will be available as soon as the Trans-Canada pipeline from Alberta passes east of here, sometime in the spring of 1958. The company is supplying American natural gas from Toronto as far north as Richmond Hill.
Two towns plan joint interlocking schedules and administration for the coming Little Hockey League this winter. It is expected that 400 boys will take part in the Penetang league sponsored by the Penetang Boys Club and 450 to 500 in the Midland League sponsored by the Lions Club. Penetang will play in the Arena Gardens until the natural ice is available in Penetang.
1st Battalion The Canadian Guards will be holding a recruitment drive at the Midland Armouries, Thursday October 25th.
Injured recently when his overalls became entangled in the shaft of a wood cutting machine, Robert Mosely Jr. awoke Thursday morning to the sound of tractors in his farm yard. By nightfall all of his fall plowing had been finished. While his neighbours worked Mr. Mosley remained in the fields on his crutches and his wife prepared lunch for the men.
Resident of Penetang for 51 years, death came unexpectedly to Prosper Beausoliel on Saturday, October 20th at his Robert Street home. Born in Lafontaine he moved to Penetang in 1905 and has been a funeral director for the past 32 years.
Sixty students, largest class ever, have enrolled in the Midland Business College.
John Henry Reynolds of Penetang marks his 90th birthday, he has been a resident for 74 years. “Everywhere I worked you never got holidays, six days a week, often twelve hours a day, I guess I will take them now that I am retired.” His daughter-in-law with whom he lives says he is up every morning at five and until two years ago cut and split nine cords of hardwood every year for the furnace.
The new James Playfair wing of St. Andrew’s Hospital will be officially opened by his brother Stewart Playfair of Toronto on Wednesday evening.
Attendance at “Kitchi” hits a 37 year record.
Father of three small children, Clarence Cousineau 28, of Honey Harbour, died in St. Andrew’s Hospital early Sunday morning from a gunshot wound received in a hunting accident 15 miles north of Honey Harbour about 4 p.m. Saturday. Mr. Cousineau was sleeping in the front of a fifteen foot boat when the shotgun of one of his two companions discharged.
Party of ten ready for deer hunt. Ten members of the Midland Hunt Club will leave this week for their camp at Eagle’s Nest bay on the French River. Madore Latour, Gerrard Berriault, Elmer Contois, Peter Clause, Rex Downer, Charlie Scott, Stan Brooks, Gerry Gammon, Bill Johnson and Stan Sturgeon.
Rumour is that a group is planning to petition the town to take a vote on a brewer’s warehouse and liquor store in Midland. Midland has been dry since January 7, 1907. An attempt to repeal the by-law during a municipal election in 1915 was unsuccessful. In order to force a vote the signatures of 25% of eligible electors is needed, that would be 1,155 names.
Believed to be the town’s oldest native citizen, Mrs. S. A. Jelly recalls early days, written by Ken Somers, Free Press, Wednesday, October 24th, 1956.
“Although she makes no claims to the fact, perhaps the oldest native resident of Midland is Mrs. Simon A. Jelly of 306 Fourth Street (now 352 just off Yonge). Daughter of the late Mr. & Mrs. H. S. Ruby, who themselves were among the earliest residents of Midland, Mrs. Jelly was born here 78 years ago, August 30th, 1878.
Three years earlier her father, one of Midland’s first bakers, had moved his family to Midland from Barrie. The Ruby’s had eight children, all of them girls but one. Mrs. Jelly is the last survivor of that big family. Born Mabel Louisa Ruby in the home that adjoined her father’s bake shop on Midland Ave., she started her schooling in the old Manly Street School, the only one in the town at that time. The old Central School that burnt a few years ago, was being built then, and Mabel Ruby also attended that school for a few years.
The Manly Street School was a four room frame building on the site of the brick school built some years later and now occupied as a dress firm. [Glen Mohr Frocks then Fabulous Formals and now a private residence] The Baptist Church was right next to the school. The principal at Manly Street was Tom Truman, who also taught at Central.
Midland was pretty much a lumber town in Mabel Ruby’s younger days. Most of the buildings and what sidewalks there were had been built of wood. The area around her home on Midland Ave. was one of the busiest in town, with her father’s bake shop on one side and a grist mill and a woolen mill just across the street.
In addition to his bake shop , where he sold huge loaves at 10 cents each, Mr. Ruby also had an ice cream parlour and china shop in the downtown section at the north end of King Street. Crawford’s Men Shop is located on the same site at present. There was only one flavour, vanilla, which Mrs. Ruby made in her own home. Nearly all of Midland’s stores back in Mrs. Jelly’s childhood were located in the two blocks between Hugel Ave and Bay Street. There was one hotel she remembers away up at the corner of King and Yonge.
The young people of that day often passed the old hotel, especially to go swimming on a hot summer afternoon after Sunday School. Little Lake, then as now, was a popular spot with the younger set, although getting to it was a different matter than it is now. There was just a trail in from the south end of King Street, with several stiles to climb and a marshy path to thread. The area around the lake was not cleared for some years after it was given to the town by Squire Fraser.
Mable Ruby was married to Simon Jelly on January 31st, 1917. Although her husband’s employment took him to Toronto for many years, Mrs. Jelly always stayed in Midland. The couple had no children of their own but Mabel has nieces and nephews that visit her frequently. They have no trouble finding her as she has lived at 306 Fourth Street since 1910 and has no intention of moving.”
[Mable Ruby died in Midland on March 13th, 1962 at the age of 84 and her husband Simon “Andrew” Jelly followed her 19 days later.]
Midland YMCA’s Camp Kitchikewana received one of only eight citations awarded in the British Commonwealth this year from the Royal Life Saving Society in London for promoting and furthering the aims of the society. The citation was signed by Admiral the Earl of Mountbatten of Burma, K.G., P.C., G.C.S.I., G.C.I.E., G.C.V.O., K.C.B., D.S.O.
A Barrie man, James Lynn, has purchased the former Bishop Funeral Home in Elmvale from William P. Hutchinson. It will now be known as the Bishop-Lynn Funeral Home. [James and wife Joan eventually moved to Midland and operated the James H. Lynn Funeral Home on First Street]
Chris Gardner, Midland’s man of mystery, this year celebrates his 52nd year in magic, 32 of them in Midland.
Penetang taxi operators announce a fare increase commencing November 1st. Town trips .50 cents, one stop, .10 cents for additional stops.
Huronia Museum – Looking Back 60 Years Ago in North Simcoe – October 1st to 15th 1956
Grey and Simcoe Foresters from North Simcoe participated in “Operation Mandible” a training exercise at the Meaford tank range. Pictured is a formidable line of Sherman tanks. Over 700 men from Canadian Army militia units of the Central Command were involved.
Photo of four Free Press newspaper carriers in front of the Free Press office on King Street, Wallace Crawford, Gary Blake, Elizabeth Cowan and Graham Shaw. Midland Free Press employs 38 carriers, each running their own business. Every publishing day they draw their quota of papers and at the end of the month they are billed for the number they have purchased. Then they collect 35 cents from each customer and out of this monthly amount they average about 14 cents per customer.
Beautiful cheerleaders Elmvale style pictured at the fair last weekend, kneeling, Stephanie Shaw and Betty Marcellus, standing, Bonnie Flotron, Lois Rowntree and Myrna Ingleton.
Bill Swann is seen winning the heat in the junior 100 yard dash during the MPDHS track and field meet last week. Bill later won the final in the same event and will represent his school at the Tudhope Meet in Orillia.
A true Thanksgiving is in store for the family of Pat Arthurs who was killed in a car accident August 30th. His wife and six children were left destitute and have been living in this tar paper shack just off Second Street in Port McNicoll. A fund administered by Rev. Leo Austin reached nearly $1,600.00 and made possible the new home where Father Austin is pictured with five of the children. The house was built with volunteer labour.
Port McNicoll Parish Priest Rev. Leo J. Austin is seen offering good wishes to his successor on the left, Rev. Frank Sullivan, former chaplain at St. Joseph’s Hospital, Toronto. Father Austin left Saturday to become pastor of St. John the Evangelist in Whitby.
Adeline Carpenter married Peter Smith at the age of 20 and they farmed most of their lives, over 50 years, on a farm on the 2nd concession of Tiny Twp., moving to Midland 20 years ago. Mrs. Smith is ninety-two. Several of her nephews still live in the Waverly area, Walter, Jack and Fred Carpenter, Mrs. Frank Reynolds in Waverly, Mrs. Henry Reynolds in Wyebridge and Mrs. Percy Woods in Ebenezer are nieces. It has only been the last 12 years or so that Mrs. Smith has been sightless but continues to knit hundreds of pairs of socks and mittens for local children.
New taxi with 1,300 miles on it ends up in the bay off the town dock. The driver was Dalton Crawford who went down with the car but managed to roll down a window and escape. Owner of the taxi is Bert Martin. Several attempts had to be made by Ken Beatty before the heavily damaged vehicle was salvaged.
New MPDHS cheer leading squad bolstered by the addition of two boys. Front, Gerald Sibbald, Sheila Barber, Linda Contois, Shirley King, Janice Switzer and Don Biggs, rear, Sylvia White, Marilyn Thompson, Gail Gamna, Gail Marshall, Lucille Duquette and Rosemary Shields.
Often called the greatest invention of the 20th century and credited with saving hundreds of lives, workers paint the white lines on the newly surfaced highway through Victoria Harbour.
New choir leader and organist at Knox Presbyterian Church Midland is Stanley Harman seen relaxing in his Manly Street home. Recently retired after serving 30 years as an official with the CNR in Toronto and Montreal.
Huge boulders and lots of stone were encountered by contractors as they extended the Tiny Township portion of Hugel Ave. out to Highway 27. Many of the larger boulders were re-buried in pits alongside the new road.
Midland Parks Commission crews are removing and cutting into firewood about twenty mature trees in Little Lake Park which have been considered unsafe. Chairman W. J. Murray said that sixty, four year old pine, larch, elm , maple, polar, oak, walnut and butternut trees have been moved from the arboretum at the park’s west end and transplanted. Two photos below from 1953 show the planting of the arboretum.
Scouting youth and leaders as well as Midland Parks Commission staff are seen examining newly planted seedlings on the North side of Little Lake. Twenty two different varieties have been planted, signs mark Norway Spruce and European Larch. St. Margaret’s Scout group help weed the Midland Parks Board arboretum seed bed. Men in the photo are Scoutmaster Ted Johnstone, Park Board Chairman William Murray , Parks Superintendent Harold (Mac) McAllen. Boys in the group are John Barber, Francis Cadieux, Lloyd Kaus, Bill Deschamp, Larry Deschamps, George Johnstone, Doug Blake, Phillip Charlesbois and Ronnie Dalziel.
Rover Scouts Bill Lavigne and Guy Johnstone; Scouts, Ross Lavigne and Ronnie Larmand and Cubs Bernie Montgomery and Wayne Lavigne weed seedling trees. Little Lake is in the background.
Courses in basic English and citizenship for new Canadians operated by the Midland – Penetanguishene High School Board will open Tuesday October 9th. Registration begins at the YMCA at 7:30 p.m. Friday, October 5th.
The board of the Protestant Separate School in Penetang has found it necessary to open a new classroom this term and has been successful in finding a new teacher. Board chairman Ed Webster said attendance at the school has increased by 42 students during the past three years, from 172 to 214.
CKVR TV in Barrie seeks to increase the power of its transmission much to the dislike of many local viewers. While few viewers were happy with the allocation of channel 3 to Barrie because of the virtual block-out of channels two and four from Buffalo, the increase in power will extend that interference to a larger part of the province.
Lawrence Fournier of Penetang, while playing cribbage with fellow Beatty employees, was dealt a perfect hand.
Wood for sale; 4′ lengths $10.00 per cord, 16″ lengths $12.00 per cord.
Perkinsfield farmer fined $25.00 by magistrate K. A. Cameron for not filing his 1952 income tax return. His defense included, “I don’t know whether I made a dollar or spent one, I don’t keep any records. It’s all the same to me, I can’t read or write anyway.”
At the Pen, Lucille Ball and Desi Arnaz in “The Long, Long Trailer”.
At the Roxy; Gary Cooper, Charles Bickford, Ralph Bellamy and Rod Steiger in “The Court Marshall of Billy Mitchell”.
Advertisements: Hillsdale – Waverly Bus Line to Midland, daily except Sundays. Parkside Pavillion, A Jamboree of Country Rock & Roll starring the fabulous Red Monroe and the Country Mainliners. Bourgeois Motors, see the magnificent 1957 Meteor today at our Vinden Street showroom. Fall Fashion Show accompanied by live models, put on by Edwards and held at the community hall in Wyevale. Mrs. Olive Brunelle wishes to announce that the Chalet Beauty Salon at 248 King Street will no longer be open for business. Thanksgiving Dinner at Bourgeois Lakeshore Dining Room, $1.50 for either turkey, fried chicken, roast beef or pork chops and $1.75 for T-Bone steak. Gammon Tires, 189 Dominion Ave., Don’t wait until the snow falls, winter tires, 670-15’s, $29.00 a pair. Cottage Lots, now available for lease on Christian Island Reserve. Opening October 15th, Major Hairdressing at 215 King Street, Gertrude Major proprietress. G&M Shoppe and Watson’s Ladies Wear , Elmvale, are promoting “Teena – Paige” fashions sizes 7-15 and “Harbrook” English sweaters.
Plastics division of Percy Harmant Co. becomes the Plastic Division of Midland Industries Limited, 36,000 square foot addition to Elizabeth Street plant to start immediately. Harmant has been in the plastics business for 20 years operating from a six storey factory on King Street in Toronto.
H. J. Payette, son of Mr. & Mrs. Napoleon Payette and a native of Penetang, received papal honours when he was elevated to knight commander of St. Gregory the Great in a ceremony in London Ont. where he now works for the Catholic School Board.
Ontario vehicle registrations in 1955 were 1,617,000, forty percent of Canada’s total. In 2015 the total was 7.9 million, thirty six percent of the national total.
Doug Strathearn moves his jewellery business from 215 King to 245 King, the former site of Ted McKillens clothing store. The store operated by his grandfather, George Strathearn, was originally located near the Queen’s Hotel at the corner of King and Bay and was advertising in the Free Press in 1872. It then moved to where the Bank of Montreal is located, then to 215 King where it has been for 28 years.
Jim O’Hearn is to manage the Knights of Columbus bowling alley that is to be officially opened Friday night.
St. Andrew’s Hospital Auxiliary is holding a “Pantry-shelf Pick Up” Thursday and Friday. Includes Jams, Jellies, Juice, Fruit, Vegetables, Pickles, etc. Labelled contributions to be placed in a conspicuous spot on your veranda by 10 a.m. Sealers only will be returned empty, if name and address is on the label.
Georgian Bay Propane formerly situated on the town dock has moved to 207 Hugel Ave. E., the Georgian Block.
25 YEARS AGO, 1931 – Foundations for the new $34,900 post office and customs building at Main and Robert Streets in Penetang, had been started. May 1932 was the date set for completion. Stanley Dobson of Midland broke his own junior shot put record in the eight-pound event at the track and field meet at the Barrie Fair. He also won the 12-pound event. In a relay race from Victoria Harbour to Midland, a Victoria Harbour team defeated a Midland aggregation. First lacrosse game in Penetang in 20 years , saw Penetang gain a 3-2 win over a team from Barrie. Midland council, under the direction of Mayor Roebuck, held a special meeting to draft a program of work for the town’s unemployed. Fire which broke out in Lionel Bourgeois’ service station in Victoria Harbour about 9.30 a.m. October 7th, completely destroyed the building. Only the cash register, a desk and chair were saved. A severe electrical storm swept across North Simcoe causing major damage to hydro lines in Midland. Transformers at St. Andrew’s Hospital, Midland Shipyard, on Queen, Johnston, William and Yonge Streets were in some cases damaged beyond repair.
Keith Preston of Midland out-fiddled nine other contestants last week at Elmvale to win the old time fiddlers contest at that community’s fall fair.
Huronia Museum – Looking Back MPDHS Official Opening Oct 3rd 1956
From sugar bush to super school, only a few short months ago George Ingram’s sugar bush occupied the land on which sits this million dollar building, the new Midland Penetanguishene District High School. Pressed into use last January the building will be officially opened Wednesday (Oct 3, 1956) afternoon and evening.
The official opening and laying of the cornerstone by former MHS principal J. J. Robins for the new MPDHS high school in Tay Township just west of Midland. Mr. Robins had been principal of MHS for 32 years prior to his retirement. At an evening function Mr. Robins was presented with a television set in recognition of his long service to the community. Rev. B. G. Brightling of Penetang conducted the dedication service. J. J. Robins speaks at the official opening.
J. J. Robins, retiring principal of MPDHS was once a pupil of the Hon. W. J. Dunlop, minister of education for Ontario. The two men and spouses met again during the official opening of the new MPDHS in Tay Township.
Relaxing on the lawn after the serious business of laying the cornerstone of the new MPDHS, officials are Tom M. McCullough, chairman of the board and W. H. Morrisson vice-chairman; Dr. W. J. Dunlop, minister of education for Ontario; board members, Clarke Edwards and Dr. J. R. Parrott. Facing sideways on the right is Rev. B. G. Brightling of Penetang who conducted the dedication service.
Program for the official opening was; Laying of the corner stone before the entire student body at 2:45 PM. Rev Arthur J. Lewis of Penetang to perform the dedication. [He was taken ill and replaced by Rev. B. G. Brightly of Penetang] Ex-principal J. J. Robins will lay the cornerstone followed by the presentation of the trowel by trustee Dr. J. R. Parrott. Following a banquet for invited guests, the evening program begins at 8 p.m. with selections by the school glee club, directed by R. C. Ireland. Guests will be introduced by MPDHS board chairman T. M. McCullough. Trustee Clarke Edwards will make a presentation to J. J. Robins. Trustee W. H. Morrison will introduce the guest speaker, Hon. Dr. W. J. Dunlop, Minister of Education for the province of Ontario. Principal L. M. Johnston will address the gathering, after which the public will have an opportunity to inspect the school. Light refreshments will be served in the cafeteria.
Clarke Edwards presented the gift of a TV and Tower TV hookup to retired MHS principal J. J. Robins with these words. “As a representative of the board, it is my pleasure to express appreciation to J. J. Robins, who retired as principal of MPDHS 2 years ago, after 33 years in the position. Mr. Robins began teaching in the MHS in September, 1920. In 1923 he received his high school principal certificate and was appointed principal of the school, the youngest high school principal in the province at that time. In the beginning he had 110 pupils and 5 staff and over the years this increased to 18 teachers and 575 pupils. During this time two additions were built on the school. Mr. Robins achieved the amazing record of not missing one day of school for the first 30 years, and then only due to an operation.”
The first high school board in Midland consisted of chairman W. J. Parkhill, and members James Playfair, Peter Potvin, F. J. McCallum, F. W. Jeffery, A. A. Osborne, I Freeman and T. I. Trueman. That was in 1904 when E. Simpson was engaged as the first principal of the new four roomed building on Sixth Street south. Midland’s first venture into secondary education. Eighty-five students enrolled in the first school, built by J. M. Wallace and A. Cook. D. Patchell was supervisor of construction and T. J. Campbell installed the heating and ventilation system. Principal Simpson died in 1909 and was succeeded by W. A. Glass who resigned in 1922. Miss E. M. Boyle , who had been in the school for seven years, was the next principal followed a year later by J. J. Robins. Contractors Webb and Cumming built a new wing on the school in 1923. That year also saw the first edition of the year book the “Tattler”. Never to be forgotten, are the 28 young men who gave their lives in World War II and the scores of former members of the school cadet corps who served in time of war.
In June, 1953, Midland and Penetang councils first approved the building of a joint high school for the Georgian Bay area in Tay Township. Strong support in promoting the decision to the councils came from W. H. Morrison and Msgr. J. M. Castex in Penetang, and T. M. McCullough in Midland.
School cost estimates close. When the MPDHS board met in mid May of this year, it had about $3,500. “leeway” after raising and spending just over one million dollars on the new school building.
Jane Lippert, young Toronto artist works on the huge mural that will decorate the main hallway of the new Midland Penetanguishene District High School in Tay township. School board members Tom M. McCullough, chairman Clarke Edwards and Karl Bertrand.
We have no names for these five. The photo was used in the paper but the boys were not identified. They may be grade eight students on orientation. Please comment if you know any of them.
Serving counter in the new cafeteria at MPDHS.
Bright sunny classrooms like this one on the west side of the new Midland Penetang District High School are designed with a new type of move-able desks that add to the adaptability of the room.
Midland Penetang District High School new combination gym and auditorium can seat 1,000 people and be divided in two by giant folding doors for various functions. The fine stage area will feature a grand piano and in the future will host many events. (When I attended we used the gym also as a cafeteria and it was informally called the cafatorium)
Midland Penetang District High School industrial arts wood working room.
Penetang High School, in fifty years, produced its full share of pupils whose names are heard daily in the professions, on Parliament Hill and in many countries of the globe. Set high on a hill to the East of Church Street, the old school commanded a beautiful view of Penetang Bay and the hills beyond. Today (1956) the old school , now owned by the municipality, is still dispensing education. Since September 1955 it has been used to take the overflow of boys from the Public Schools. A Mr. Allingham opened high school classes in the town hall in 1905 while the new school was being built. Mr. Keoh and Mr. Hutchinson were teachers in the new school with Mr. Allingham the first principal. A short time after the opening R. D. Keefe, father of Midland’s Beverley and Neville Keefe, assumed the duties of principal. In the early thirties Mr. Keefe moved on to the Department of Education and W. H. Bolger became principal. He was followed by Emmett Doris. The last principal was R. C. Gauthier, now assistant principal at the new MPDHS.
Many contractors and suppliers placed ads in the newspaper congratulating the school board and community on the completion of the new high school. T. G. Wilcox, of Midland, excavating, grading and sodding. Cuthbert Annand of Midland, roofing and flashing. A. Barrie & Sons of Midland, furniture for the ladies staff room and dining area. Sutherland-Schultz Electric Co. of Kitchener, electrical work. Page & Steele architects. Wood’s Sanitation for the Nation, janitorial equipment. Edwards of Midland, flooring, draperies. Preston – Noelting Co. of Stratford, office furniture. National Show Case Co. Ltd., laboratory desks, teachers desks, all office fixtures. George Price & Co. Ltd. of Coldwater, plumbing and heating. Hospital & Kitchen Equipment Co. of Toronto, kitchen and cafeteria equipment. Ball Bros. Ltd. of Kitchener, general contractors. Gestetner Canada Ltd. of Toronto, duplicators. Terrazzo Mosaic & Tile Co. Ltd. of Toronto, tile and terrazzo.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – September 24th to 30th, 1956
Busiest men in Elmvale this week were R. W. Bertram, fall fair president and his secretary, J. A. Robertson. The fair was deemed a success despite the weather. Another sour note was the refusal by the musicians union to allow the army band from Camp Borden to participate in the parade.
Three members of the Elmvale 4-H Calf Club are seen with their prize-winning dairy calves at the Elmvale Fall Fair. Calder Hunter, left, had the best calf and placed second in showmanship, Barbara Strath had the third place calf but placed first in showmanship and Donald Palmer took second with his calf and third on showmanship.
Judged the best float entered by a one room school at the Elmvale Fall Fair was the one from SS #8, Flos. Taking care of Humpty are Eelke Tjweedsma, Jackie Thurlow and Earl Cooper.
One of the best school fairs in Simcoe County is the one held in conjunction with the Elmvale Fair. First prize for public school float was won by Elmvale Public School. Melodie Ritchie, 6, was Little Miss Muffet.
Another fine float entered by Waverly Public School had little Debbie Currie, 5, as queen of the fair.
Elmvale main street during fall fair parade, school children, SS #15 Gibson float and marchers.
Sheaves of golden grain such as this one displayed at the Tiny-Tay Fair are a rarity this year as rain has spoiled many of the field crops in Ontario. Dale Jackson, right, and Gail Morden of Midland are seen looking at the prize-winning sheave.
A large group of public school children pictured at the ball diamond during the Midland Fall Fair.
Community Concert Association officials pictured at their campaign dinner in the YMCA Monday night are, seated, Mrs. (Art) A. H. Tweedle and Mrs. (Bill) W. E. Hannah (Joan), standing, J. Stuart Nall, Mrs. Ken J. Ellis and president Charles E. Onley.
Local contractor Tom Laidlaw removes the bell tower from the Salvation Army Citadel on Dominion Ave. The tower was a prominent part of the second Baptist Church in Midland when it was dedicated in 1899. It was acquired by the Salvation Army when a new Baptist church was purchased on Midland Ave. from the Methodist congregation who had moved into their new church on King Street in 1902.
Held up for nearly a week due to inclement weather, the first track meet on the new MPDHS grounds was held Tuesday. Helping to keep things on schedule and recording the results are Dean Nicholls, Doug Swales and John Dalrymple.
Diesel locomotives in Port McNicoll to test the trestle. Steam is being replaced by diesel across the CPR, Port will be the last place in Ontario to use regularly assigned steam locomotives. The scene is beside the coal chute in the Port McNicoll yard. Officials were concerned about the weight of the engines affecting the trestle, their combined weight was 518,000 pounds. The first train pulled across the 2,740 foot long trestle by diesels contained 63 loads of grain bound for the East Coast.
T. A. “Bert” Armstrong is the new man in charge at the CPR elevator in Port McNicoll. Bert takes over from J. B. Winfield who died last July. Well known in sporting circles in Midland and area, Bert has been a local resident since he was eight years old and started his CPR career in 1926.
Marino Construction Co. Ltd. of Toronto has been awarded a town contract to install sewers, water mains and roads in the Ward Four Beauchamp subdivision, work to be completed by November 23rd. The $48,664.00 contract is for the southern section of the subdivision where several homes are already under construction, the land is largely owned by Ernest Leitz Co. and H. J. Beauchamp. Mr. Marino owns considerable property in Midland.
Earliest snow in 116 years whitens North Simcoe Thursday evening but the Collingwood – Orangeville area received four to six inches.
Huronia Museum, after a successful season with 12,000 visitors, will close on September 30th, announced curator A. D. Tushingham.
Thirteen year old Elmvale lad killed in an accident with the family farm tractor he was driving to Wyevale School to pull their fall fair float. Trustees cancelled fair plans and the school was closed until after the funeral.
Kiddies pure nylon snow suits, quilted lining, regular $6.00, special sale $3.99, Cross Country Cut Rate Ltd. King Street.
Imported Dutch bulbs, .69 cents per dozen or $5.50 per hundred at Mac Perrin’s Flower Shop, King Street opposite the Post Office.
PMCL offering Autumn Color Tour to Algonquin Park this Sunday.
Public Notice, Town of Midland proposes a by-law to close Lilly and Ella Streets in the town of Midland and those affected will be heard at a council meeting to be held on October 15th. [Ella & Lilly ran parallel between Railway and Center Streets, the current site of Midland’s Water & Waste Water Treatment Center.]
More than 100 local residents motored to Toronto on Sunday to attend the mass rally of more than 12,000 Anglicans at Maple Leaf Gardens.
Footings were poured for a new curling rink in Elmvale, located west of the Memorial Arena.
Captain D’Alton Hudson to bring his 400th cargo into the port of Goderich this week. His first was back in 1918.
MPDHS board anticipates a record crowd for the official opening of the new high school on Wednesday evening.
Penetang’s population according to the recent census is 5,317 which includes 600 persons at the Ontario Hospital.
J. A. Gervais, Department of Transport inspector and son of Mrs. C. W. Gervais of Waubaushene, has been in town recently logging the geographical location of each radio transmitting station. The four stations in Midland not including the Marconi Wireless station are; Georgian Bay Airways, Deluxe Taxi, Wilson Taxi and the Town of Midland.
According to Gregory Clark, noted author, the best paddles and oars made anywhere along Georgian Bay, are fashioned in the Penetang workshop of Levi Simon, formerly of Christian Island. “They are worth twice what he asks for them.”
Walpole Island, Island 41 in Six Mile Lake, to be sold at public auction to recover tax arrears of $27.90.
Wednesday night was moving night for five bowling alleys for the new Knights of Columbus Hall in Penetang. Stored since last winter, the heavy, cumbersome alleys were carried nearly a block by seventy volunteers. A sixth alley is on order from a supplier.
Ten shippers were forbidden to ship milk and 15 others warned after a series of tests by Simcoe County Health Unit officials found the milk to be low-grade. Main cause was found to be faulty cooling and improper care of milking machines.
Weddings; Margaret Dundas, daughter of Earl Dundas, Wyebridge and Morley Marchant, son of Mr. & Mrs. George Marchant, RR 1 Midland, at St. Mark’s. Theresa Lalonde, daughter of Mr. & Mrs. Herb Lalonde, Perkinsfield and Herman Quesnelle, son of Mr. & Mrs. Andrew Quesnelle at St. Patrick’s. Ida Gillespie, daughter of Mrs. Stella Gillespie and John Evans Gardner Jr., son of Mr. & Mrs. J. E. (Chris) Gardner, Midland, at Knox. Betty Beausoleil, daughter of Mr. & Mrs. Clement Beausoleil, Penetang, and Marcel Bidan, adopted son of Mr. & Mrs. Marcel Grenier, Tiny Twp., at St. Ann’s. Rena Merle Wilson of Midland and John Horace Bell of Waubaushene were married in a quiet ceremony at St. Paul’s. Marlene Marie Paradis, second daughter of Mr. & Mrs. Felix Paradis, Penetang and Paul Marson, son of Mr. & Mrs. Ed Marson, Toronto, at St. Ann’s.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – September 16th to 23rd 1956
Tight semi-final series between Midland & Allenwood softball teams came to a climax when Allenwood took a 4-3 verdict to win the series 3-2. Allenwood will now meet Elmvale for the Georgian Bay title. Midland team members are, front row; Bill Yorke, Jim Johnson, Ted Brady, Jack Toole, Les Scott, George McFarlane. Back row; Connie Adams, Garnet Drinkle, Charlie Spiker, Jerry Borsa, Murray Yorke, Fred Hook and “Buck” Rogers.
Foundation for Midland’s newest factory, Pinecrest Products, a manufacturer of unfinished furniture. The building is being constructed by Webster Smallwood of Midland and will have 8,000 square feet of space. It is located on the south side of Bay Street between Olive and William and owned by Robert Holt.
Burglary equipment found on the roof of Walker Store Ltd. on King Street is displayed by chief Constable Robert Cameron Monday after an unsuccessful break in attempt.
Mrs. Annie Ridley is celebrating her 89th birthday at her home on Third Street in Port McNicoll Wednesday. Born at Burton-on-Trent, England, Annie came to Canada as a girl of 12 and has lived in Port for the last 8 years.
Five of the six men connected with boy’s athletics at the new MPDHS are pictured here. Bill Kennedy, assistant coach in charge of junior rugby; Doug Swales, head coach who pilots the senior teams; Bill Setterington, head of the physical education department; Tom Cavanagh, who is assisting the junior football program; Emile Blouin, track and field coach. Absent is Don Kenwell.
Football season is just around the corner at MPDHS and Doug Swales is seen watching the lads in the backfield during a practice. Bob McIntyre, Joe Huston, Ed Trudeau; back row, Jerome St. Amant, Frank Holmes, Vic Zabzinski. Quarterback is Connie Maurice.
Hive of activity is this gravel pit filled with pieces of equipment just north of the overhead railroad bridge in Victoria Harbour. Operated by the Beamish Construction Company the pit is being used to supply the new surface to Highway 12 between Midland and Waubaushene. The work is nearly completed.
[There were many Fall Fair photos in the Free Press during this week in 1956, but the negatives are not in our collection. Most of the photos, for which we have negatives, are being shown in this blog each week except for the mangled automobiles and the many fish photos. Below are two more negatives from 1954]
Bill Barnett handing trophies to three young boys who are also wearing ribbons on their gym shirts. Tom Tushingham center, Central School junior champ in the Midland Public School’s track and field meet. Paul Crawford grade eight at Regent School intermediate champ and John Koeing grade seven at Sixth Street, senior champ.
Champions of the girls division of the Midland Public Schools track & field meet held at the town park. Joan Budarick , grade six at Central School and Elizabeth Swales Grade Six at Regent School tied for junior girls champ. Carol Cowan grade eight at Sixth Street School, intermediate champ and Pat Fraser grade eight at Regent School, senior champ. All holding trophies and wearing award ribbons.
TEN YEARS AGO 1946; The bell of the corvette “Midland” was presented to the town by the Department of Naval Affairs at a ceremony in the Arena Gardens. The bell was to rest in the town hall. — Henry Laroche, a 24 year old from Dosquit PQ, suffocated when he fell into the grain hold of the Bryn Barge while it was docked at the Simcoe Elevator. — Midland’s active service veterans from World War II were to be presented with wallets inscribed with “Presented by the Town of Midland to Veterans of World War II”. Presentation was to be made by mayor C. M. Vent at a civic reception in the Arena Gardens. — A valuable diary containing the story of this community and the people in it for a period of forty years was destroyed when the owner accidentally burned it while housecleaning. —- A 6400 series CNR steam engine , one of the most modern and mightiest, arrived from Toronto with an excursion for the Martyr’s Shrine. It was the first time one of the streamlined monarchs had ever been on local lines. —- Plans had been completed and tenders called for Midland’s new theatre by Toronto architect H. G. Drurr. The new theatre has been designed to seat 850 patrons and was to be entirely fireproof.
Local firm, Allgerow Enterprises owned by George Gerow has been awarded a $41,500.00 plumbing contract for 100 houses being moved by the city of Hamilton from the downtown to a residential area.
Ken Williams (May) set a new record for both male and female bowlers when she scored a 412 game in league competition, 12 more than the previous record set by Mrs. Bruce Spicer (Dorothy) last year. The men’s best is a 407 bowled by Ross Cioe. A perfect game is 450.
Tiny Township police chief Raymond Belcourt reports that a cottage was broken into and the only thing stolen was the toilet.
Advertisement for Romey’s Grill, 231 King Street.
Seventeen schools march in Coldwater’s Huronia Fair parade. Fourteen were one room schools.
The Free Press in 1956 is still very much geared to the local farmers. Article in the paper urges growers to watch out for “ring rot” in your potato crops.
Simcoe County CAS has 449 wards currently in their care, in boarding homes, on adoption probation, in wage or free homes, at Ontario hospitals, training schools and elsewhere.
Canadian Nameplate posts a half page letter explaining its position in the contract negotiations with its unionized work force.
Article on the history of the R.C. Church in Honey Harbour states that services dated from 1878 when Jesuit priests came from Manitoulin Island once or twice a year. The first recorded baptism was Christina Lalonde in 1868. The first church ws built in 1909 by Father Cabot, S. J. with organ, prayer books and pews provided by Father Barcelo of Midland.
The mayors of Midland & Penetanguishene proclaim the week of September 24, 1956 to September 29, 1956 officially as Community Concert Week.
Ontario’s Attorney General’s Office has ordered that sellers of used cars must provide a certificate of mechanical fitness to purchasers.
The first Canadian census was taken in 1666 and showed 3,215 inhabitants exclusive of first peoples.
D. L. Nicholls Funeral Home announcement that during enlargement and renovation of their facility, funerals will be conducted from the former R. E. Simpson & Sons Funeral Parlour, entrance off Elizabeth Street.
Many advertisements in the paper for merchants showing at the Fall Fair, inviting people to visit their booths.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – September 8th to 15th 1956
90 Ton punch press is used by Canadian Name Plate in its new Midland plant for blanking and forming stove and refrigerator panels and trim. Operated by one of the many female employees at the plant.
A sample board in the front entrance of the Canadian Name Plate Co. Ltd. plant on Bay Street displays only a few of the hundreds of panels and trim manufactured for the automobile and appliance industry. Adding another item is employee Mrs. Dora Taylor.
Foreman of the polishing department of Canadian Nameplate, Gordon Higgs is seen inspecting a piece of metal that has come out of the automatic polishing machine.
Electroplating is one of the many operations carried out at the Canadian Name Plate plant in Midland. Rudolph Pheiffer examines a rack of stove panels that he processed in the nickel tank.
Ferric chloride acid is used for etching copper and brass at the plant. Art Miller, foreman of the etching department is checking a rack of samples.
This big power off-set printing press is used for printing acid resisting ink onto sheet metal. Foreman in the white coat is Tom Boast.
Bill Edwards displays his first Muskie which he caught off Present Island. Bill and his companion, former Midlander Brian Dunfield, were trolling when Bill caught this 43 inch 20 pound fish.
Mount St. Louis school marches to the Coldwater Fall Fair, complete with their own clown.
Pretty girls and pretty flowers at the Coldwater Fair. Miss Glenda Gill and Mrs. Iris Beach , both of Coldwater, admire the display of the Huronia Horticultural Society.
Former Penetang councillor and WW 2 veteran Jack Robbins has been appointed plant superintendent at Canadian Name Plate, Midland.
Near perfect circle formed by two large trees and lower shrubbery is plainly visible to north bound drivers on Highway 27 a mile south of Wyebridge.
The museum’s Free Press negative collection begins in 1953, we started the blog in November of 1954, so we will include a few images of 1953/54 from time to time.
March 1954. Midland Shearlings 25,000 square foot plant on Yonge Street E. is destroyed by a fire which started in a drying room, loss valued up to $250,000.00. Ninety people are out of work. Local partner and manger is Henry Bernick. The building was torn down in 1957.
April 1954. Midland Red Wings hockey team pictured on the ice at the Midland Arena Gardens. Back home at 4:00 AM after winning the Junior “C” Championship in Ingersoll Friday night. Back row, Jack Reid, Ken Webb, Homer Barrett, stick boy Barry Crawford, Murray Yorke, Jack Hendrickson, Ken Simms, Stan Ritchie, Middle row, Larry Reid, secretary Cliff Newburn, Bruce Calvert, Gerry Gerow, Bud Quinn, Don Hudson and Charlie York, kneeling; Mike Belejac team captain, Johnny Lizotte, Mervin James, trainer Harold Jackson.
Parking meters are coming off on October 15th for the winter season.
Eight Midland streets got a face lift within the past week. Crushed stone and tar, “chip & tar”, have been applied to Hanley [sic] Street, Donalda, Ruby, William from Ruby to Hanley, Eighth to Dominion, Seventh to Hugel, Montreal to Seventh.
Tay Township and Midland agree on sewage charges, Tay to pay for connecting the new MPDHS in Tay and residential lots on Hugel Ave. to the Midland system.
CNR petitions the Board of Transportation Commissioners to remove the grade crossing warning device on Robert St. W., scene of a fatal accident last winter. Installed in 1915 when four passenger trains and two freights plus extras used the line daily, now reduced to one freight three times a week. Railway would replace the signal with manual flagging.
Yeggs (burglars) steal $800.00 from two vaults in the Waubaushene general store of W.H.F. Russell and Sons.
Midland Council opens four bids for sanitary landfill services, lowest bid for a five year contract was $6,495.00 annually. Bidders were Thomas Wilcox, Charles Morden, Herman Latanville and Charles Stewart. The proposed site is the old Letherby mill property. Council deferred action. [The dump eventually went to what is now Tiffin Park. The garbage was collected in trucks and was dumped over the edge of the south facing hill.]
Five hundred Lamprey Eels and three thousand suckers were removed from the Sturgeon River this year by Robert Thomson working for the Department of Lands and Forests. Mr. Thomson noted that the eels are most active from sunset until 2 a.m. and when water temperatures are warmer.
Toronto bridegroom spent his honeymoon in jail after being charged by Const. Murray Tamblyn with drunk driving. His bride and another couple spent the night in their car at a Fergusonvale garage.
Shoe Corp. of America and Monsanto Canada form a new company, United Shoe Plastics Limited. It will lease office and manufacturing space in the planned expansion of the shoe factory on Elizabeth Street and employ a dozen persons initially.
Twenty five thousands visitors tour the Huron Indian Village this summer reports the Midland Y’s Men’s Club.
MPDHS board will pay the same for milk this year as it has since the school opened. Five tenders opened at Wednesday’s meeting all quoted the same price, 5 cents per half pint and 19 cents per quart. The dairies have been alternating on a monthly basis supplying the school.
Midland Drive-In, their Monday – Tuesday special this week is free admission for lady drivers.
Argue’s Meat Market, Midland and Victoria Harbour, is selling government inspected baby beef, front quarters .29 cents/lb and hind quarters .39 cents/lb.
Effective this Saturday the chartered banks in North Simcoe will be raising the interest rate paid on savings accounts to 2-1/2 %.
PUC secretary Stewart Holt tells the inaugural meeting of the commission that water tests taken from the bay “were very bad” although Little Lake water consistently tested satisfactory. “Without a sewage treatment plant health officials will never allow the town to use bay water.” Staff were instructed to price the enlargment of the current reservoirs.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – September 1st to 7th 1956
Ceremonies marking the end of the Ignatian year highlighted events at the Martyr’s Shrine Sunday. St. Ignatius founded the Jesuit Order with which the Martyr’s Shrine and Ste. Marie are linked. The caption talks about the possibility of Russian spies in the crowd due to the majority of those present being Polish.
Newly inducted to the three point charge of Victoria Harbour, Port McNicoll and Ebenezer is Rev. N. Bruce McLeod seen with his mother, father and wife. Norman McLeod, father of the young minister, is chairman of the board of finance of the United Church in Canada. The event took place in Port McNicoll Thursday night. The Rev. N. Bruce McLeod became the youngest moderator (leader) of the United Church of Canada in 1972.
Proud of his flower beds is Midland Footwear and Midland Plastics Ltd. caretaker John Hewitt. Admiring his work along the front of the joint plants on Elizabeth Street East are Alice Schmitz and Dana Zapletal, members of the office staff.
Pamela Leduc, held by Tom McCullough, draws the winning ticket in the Lion’s Club boat raffle. The winner of the $2,500.00 craft was three year old Rickey Cuffe of Hydro Glen. The location is the Midland Curling Club. [I have seen this same ticket tumbler in a Penetang Lion’s Club photo being used at the Penetang arena]
Helping to keep the big Simcoe County golf tournament running smoothly at the Midland Golf & Country Club are Les Marsell, “Moe” Beteau and Jack Danby, the home club captain. A total of 91 players took part in the 27 hole event.
Mrs. Pat Arthurs, right, lost her husband and eldest daughter in a motor crash near Coldwater last week. Shown here with her mother, Mrs. Ida Kent, the Port McNicoll woman said she has been touched by the offers of help from both friends and strangers after she was left destitute with six small children.
This unused frame dwelling in Port McNicoll, Rev. L. J. Austin says, may be renovated for the use of Mrs. Arthurs and her six children. A fund has been set up and with donations of money and labour it is hoped the home can be ready soon.
An area man, 23 year old Ronald Lea of RR# 1 Midland, died from injuries received when this car went out of control and careened into a ditch on the curve just north of Wyebridge early Monday morning. Mr. Lea was unmarried and lived with his mother at Firth’s Corners.
Two boats collide and sink on the Severn River at 3:30 a.m. Sunday. Severn Fall’s resort operator charged with dangerous operation of a vessel.
65 year old Toronto tourist was struck and killed by a CNR train while taking scenery photos from the railway bridge at Hydro Glen.
18 year old Port McNicoll sailor Bernard Swales injured in Toronto Harbour while operating a steam winch on the freighter Charles L. Huntley. Bernard is the son of Mr. & Mrs. Andrew Swales of Port. Andrew Swales is the second mate on the Assinaboia.
Body of Roger Gauthier is discovered in a Sudbury Hotel. Mr. Gauthier, aged 43, had left Penetang Saturday for Sudbury where he was to teach in a primary Separate School. The son of Mr. & Mrs. Henry Gauthier, Roger had taught all his life, including SS #18 Tiny. Death was the result of coronary thrombosis.
While her husband was returning from early Mass Sunday morning Mrs. Adolph Charlesbois barely escaped with her life as their home on Poyntz Street was completely destroyed by fire. Everything was lost and there was very little insurance.
Midland Free Press wins Mason Trophy again, emblematic of the best all-round large circulation paper in Canada.
Harry Gill of Coldwater, one of a triumvirate of Athletes produced in North Simcoe at the turn of the century, dies in Orillia hospital at the age of 81. Like his compatriot Walter Knox, Gill was a track and field star. He later coached at the University of Iowa, Beloit College and the University of Illinois.
TEN YEARS AGO – Workers at the Shipyard signed a new agreement giving them a 44 hour work week instead of 48, for the same take home pay. — Rev. Basil S. Ellard has been appointed to succeed Father McNamara as parish priest at St. Margaret’s. — Prof. T. J. McIlwraith of the ROM announced that he believed archaeologists working near Warminster had discovered Cahiague, the greatest of all Huron villages. — Five Penetang High School students had been awarded scholarships valued at $100.00. Douglas Gendron, Evelyn Gendron, James Chillcott, Clarence Marchand and Doris McLaren.
Four hundred and eighty Simcoe County children learned to swim this summer through the Simcoe County Recreation Service, thirty-nine in our region.
Entries are now being received for the Old Tyme Fiddlers contest and the Horseshoe Pitching contest at the Tiny Tay Agricultural Fair, contact Jack Blackburn, secretary.
Wanted at once, twenty girls and women for fitting room work in Midland and Penetang. Apply to Fern Shoe Co. Ltd. Penetang or Midland Footwear Manufacturing Co. Ltd., Midland.
“Baby’s Night” (Age 21 to 101) “She’s in for free if she’s on your knee” when you purchase your ticket to the Midland Drive-In, Monday and Tuesday, September 10 and 11. Monday, blondes only; Tuesday, brunettes; redheads both nights. Free to the ladies every night throughout the week, Rosepoint Dinnerware.
Midland Public School teachers for 1956; Regent School, enrolment 545 including 57 Kindergarten pupils. Margaret Marks, Kindergarten, Mrs. Blanche Trew 1A, Mrs. Harold Cleaver 1B, Mrs. Frances Bell 2A, Miss Helen Laidlaw 2B, Mrs. Leona Lukes 3A, Miss B. McGrath 3B, Miss Hazel Healey 4A, Miss Annie Ross 4B, Miss Jessie Carson 5A, Mrs. Eleanor Mahoney combined 5B and 6B, Miss Margaret Duffett 6A, Don Brickett 7B, vice-principal Bill Barnett 8B, principal Morgan Lewis 7A and 8A. —- Parkview School, enrolment 370 . Miss Margaret Hood, Kindergarten, Miss Genevieve Drysdale grade 1, Mrs. W. Watkinson grade 2, Mrs. Orchard Marshall grade 3, Miss Pauline McMullen grade 4, Jack Lyle grade 5 and 6, W. D. Duncan grade 7, Jack Yelland grades 7 and 8, principal James Robinson grade 8. — Sixth Street School, enrolment 185. Miss N. G. Mullen grade 1, Miss Alberta Heasman grade 2, Mrs. Ken (Betsy) Cowan grades 3 and 4, Leslie Davidson grade 5, Miss Francis Kerr opportunity class, principal Ken Cowan boy’s promotion class.
Liquor vote in Wasaga Beach, wets lose.
Well known local man dies, Theodore King, 54, operator of King’s “Bad River” Camp near the mouth of the French River. Survived by his wife, one son Theodore and three daughters, Yvonne, Rebekah and Barbara.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – August 1956
Sorry, August has been a busy month and I have fallen behind with our weekly blog, what follows is a quick review of the month’s happenings, 60 years ago.
Visiting Midland last week, Miss Jill Edward of Sudbury found many things to interest her, especially around the harbour. The deck of the yacht “Captain Ed” proved a good vantage point for Miss Edward and her uncle, Jack Wiggins. Miss Edward was a guest of her grandparents Mr. & Mrs. J. W. Preston, Elizabeth Street, during her visit.
Ceremonies marking the end of the Ignatian year, highlighted events at the Martyr’s Shrine Sunday. Among the many dignitaries was James Cardinal McCuigan seen in the center of the procession wearing his mitre and carrying the crozier. St. Ignatius founded the Jesuit Order with which the Martyr’s Shrine and Ste. Marie are linked.
This old thread spool dispenser brings back memories for Carson Brown and William J. Edwards of Vasey. For many years it was one of the store fixtures of the 70 year old country store at Vasey purchased by Mr. Brown in 1945. Already replaced by a brand new store the old building is being torn down to clean up the property. The spool dispenser and a few barrels are all that is left.
Not worried, smiles Camp Kitchikewana kitchen staffer Eva Koenig of Midland, she’s got the dishwasher. But she and six other workers still have a busy time feeding more than 200 campers and counsellors at the Midland YMCA camp on Beausoleil Island.
New sign erected near the base of the new ski jump hill at County Road 6 proclaims the Midland Ski Club, site of the Canadian Ski Jumping Championship, February 23rd and 24th, 1957. Joan Reid, Diann Flynn and Barbara Allsopp.
Many individuals and groups have helped build a new home for Mrs. Amy Moreau in Victoria Harbour, whose husband died several months ago. Mr. Moreau had served the village as a councillor, fireman and village foreman. In this photo Mrs. Moreau tends 3 month old Roberta while cousin Bobby Moreau works on laying new flooring in the new five room home near the sub-station.
Religious summer schools called “Good News Clubs” were held in Midland and Penetang last week and attracted more than 120 local youngsters. At Midland’s Nameplate Park a band has formed using instruments provided by the Child Evangelism Fellowship.
Midlander Fred McClung, now 82, captained the fabulous Hillsdale ball team in 1910 and will relive those days tonight when eight of the nine team members meet for a reunion and dinner in the village.
Memories of games of the past came flooding back for these members of Hillsdale’s great ball team of 1910 gathered for a banquet in Hillsdale’s United Church Wednesday night. All but Lance Rumble in the white were regular members of the team. Front row, Joe Hutton, Fred McClung and Mr. Rumble; back row, Ed McClung, Gordon Hough, Ernie Scott, Bill Davenport, Fisher Ganton and Albert McAvoy. Only members missing were Lionel Shortreed and the late Art McDonald.
Mr. & Mrs. Ben Wright of 11 (now 645) Quebec Street celebrate their golden wedding anniversary. On hand to help celebrate is Judy Lemieux one of their 21 grandchildren. Mr. Wright who came to Midland in 1915, operated one of the province’s largest fish bait businesses for many years.
Parks commissioners John Burke, Gordon Boyd, Bill Beaton, Al Perkins and secretary Bill Hack watch Chairman William Murray cut the ribbon to open the new tennis courts behind the armory in Little Lake Park.
Costume prize winners at Legion Carnival Friday night are; front Elaine Onley, second row, Lenny Roach, Joan Ward, Billy Ward and Carol Scott; back row, Roger Parrish and Bjorn Pettersen. Judges were Mr. & Mrs. Bill Barnett, Wm. H. Keller, Charles Onley and J. J. Robins.
Elaine Onley receives her prize as best costumed 5-7 year old from Legionnaire Len Wiles who represents the sponsors of the Carnival, Midland Branch 80 Royal Canadian Legion.
Do it yourselfers watch as employees of Midland Reinforced Plastics Ltd. coat an old 14 foot cedar strip boat with the first coat of resin before applying plastic cloth supplied by Midland’s Bay Mills. How to make an old boat new again? Fiberglas. The Crealock`s “Royal Ann” is in the background as is the “City of Dover”. A pop truck is re-supplying the Dover.
Both tourists and residents complain there are too few spots and amenities at the government dock in Midland and that this is not encouraging cruising tourists to dock here.
Ted Pearson, veteran Midland barber greets S. G. Chamberlain of Chatham who is the honorary president of the Canadian Bandmasters Association which held its convention in Midland over the weekend. Now 72, Mr. Chamberlain played in the Midland IOOF band with Ted more than 50 years ago.
Ted Pearson started with the Town Band in 1906, which disbanded after a few years and Midland had no band until the Boys Band was formed after WW2. It has since become the Midland Citizens Band. One of the first bandmasters was Jack Roberts, father of Mrs. Fred French.
Scaffolding erected around Midland’s Post Office so that re-pointing can be done and removal of some heavy gabling. Local contractor Lloyd Murday expects the work to be done in three to four weeks. The Post Office was on the ground floor, Customs and Inland Revenue were on the second and there were quarters for the caretaker in the attic. The contract for the construction of the building was let to Mr. E. A. Bleakeney of Ganonaque for $47,700.00 and it took 20 months to complete. The building became the Midland Public Library in July of 1967 and was renovated again in the 1980’s and 90’s. An expansion was built in 2012.
Work on the new municipal building in Midland is right on schedule despite some concerns caused by the shortage of concrete. Alfred Rei of Midland is the general contractor and the building should be ready by early December.
The experts agree on the winner at the Midland Horticultural Society flower show held Friday at the Knox Presbyterian auditorium. Charles McElroy, society president, Miss Paulene McMullen and judge Harry Stainton.
A. Gibson, 45, of London Ontario takes over as secretary-manager of the Midland Chamber of Commerce.
Council and Midland’s police force reach two year agreement on wages and working conditions. It confirms the appointment of Patrol Sgt. George Wainman at an annual salary of $3,400, three officers at $3,300, and wages of two officers at $3,000. The men must purchase their own clothing.
R. Y. Eaton, president of the T. Eaton Co. Ltd. for 20 years, died at 8:45 p.m. Saturday, in St. Andrew’s Hospital, Midland.
Remember the Eastern Star penny sales, the names of the winners were listed in the paper.
The recently re-opened Breithaupt Leather plant has shipped 25 tons of pickled hides from Penetang to its Campbellford plant for finishing. The plant employs seven men.
46 year old DeNure and Son Transport has been sold to Haslam Transportation of Hamilton.
Peter Brasher, Bristol England, joins the medical practice of Dr. T. J. Johnston.
Penetang Fire Brigade wins three first place trophies in the annual Ontario Fireman’s Association tournament in Port Colborne.
Ball Bros. of Kitchener, the contractor who built the new MPDHS building, wins the contract to build a 150 cell addition to the Oak Ridges Ontario Hospital in Penetang. Work on the two million dollar addition is to begin in three weeks and will employ 200 men.
Work has begun to lengthen and lower the base of the ski jump at the Midland Ski Club’s property. Pete Pettersen expects jump distances to increase by twenty feet.
Miss Anna Magnus given highest honour by 38,000 member Federation of Women Teachers Association to be held at the Royal York in Toronto. 45 years of teaching, 34 of them in Penetang, she will be made an Honourary Member.
Bay Mills and Textile Worker’s Union employ conciliator to end disputed contract. Main focus is the elimination of the 48 hour work week.
New Trans-Canada Highway being built north of Waubaushene has started a boom in the sale of lakefront cottage property.
Beausoleil Motors, proprietor J. R. Beausoleil, opens BA gas station at the corner of Bay & Second Streets.
Ten Years Ago; Four nurses graduated from St. Andrew’s Hospital school of nursing, Mary Duncan, Phyliss Bernice Jennett, Doris Lapp and Bernice Laidlaw. — Organized in the spring of 1946, the Midland Boy’s Band was preparing for its debut before the public at a concert in Little Lake Park. — Penetang’s Phil Marchildon pitched the Philadelphia Athletics to a 4-1 victory over Detroit. It was his ninth win of the year. — St. Ignace ll, a Huron village of 1,200 was uncovered on the banks of the Sturgeon River about a mile south of Highway 12. — A new record was set at St. Andrew’s Hospital when Dr. D. C. Swan attended at the birth of five babies between the hours of 4 and 5 a. m. July 15th, 1946 — Arena Gardens was crowded to capacity when Canada’s Oscar Peterson and his trio came to town. One of the main attractions was the bass player, former Midlander Bert Brown. — An ex serviceman from Toronto, Bruce Armstrong purchased the “Porter House” hotel in Waubaushene. — Beck’s box factory in Penetang was forced to close due to a shortage of nails arising from a steel strike.
Workmen began widening Main Street in Penetang north of Simcoe by removing the boulevards and curbs, new paving will be full width in the business section.
Earlier in the month a vacationing woman at Six Mile Lake had been bitten by a rattlesnake she had picked up, mistaking it for a water snake. The paper had several articles declaring rattlesnake bites had never proven lethal, procedures to follow in the event of a bite and statistics showing how most bites were harmless. She died in Orillia hospital eight days after the bite.
Brand new look for Parkview School in the fall. $10,000 has been spent on windows, paint, flooring and other repairs and maintenance over the summer.
W. L. Weckman has been appointed director and general manager of Pillsbury of Canada Limited with headquarters in Midland. William H. Pinchin, former manager, became vice-president of Pillsbury Canada. The company operates four mills here and in Calgary.
Percy Crawford, superintendent of construction at the new Simcoe County Old People’s Home in Penetang has unearthed what he estimates will be two to three hundred pounds of honey in the walls of the old hospital building being demolished. Trick will be to get by the swarm of bees, local keeper has been unsuccessful to date.
Giuseppe “Joe” Tersigni retires after 44 years in the retail and wholesale business. Joe is simply closing his 15 Simcoe Street location and saying thank you.
Knights of Columbus Hall on Poyntz Street is nearly completed. All summer, volunteers have worked evenings and weekends to complete the structure. The attached bowling alley will be open to the public.
Free Press Herald again rated the nation’s best all-round weekly, first or second five times in the last seven competitions. Awarded the 1956 Mason Trophy. Editorial thanks editor Wils Harrison for being a big part of the success.
New bridge over the Wye River west of Wyebridge was to be completed August the 15th, first pilings are just being driven now.
Marilyn Monroe in the “Seven Year Itch” is playing at the Roxy. The poster shows that famous scene with the skirt.
Tay Township police chief William Magnus has his police cruiser stolen.
“Church in the Pines” at Cawaja Beach continues to draw one hundred or more worshippers during the summer months as it has for 30 years.
New phone exchange overloaded, in operation only a few weeks the new exchange may already be too small. “There have been several occasions when the long distance volume was so great we could not keep up with it on our ten position board” said H. A. Kilroy, manager.
Waggs Laundry and Midland Foundry and Machine receive Department of Defence contracts worth $35,000 and $15, 250 respectively.
Fred Miller wishes to thank all the customers of his Supertest Station & Grill, Victoria Harbour. As of August 1st Tony Snyder will manage the station and welcomes all former clients.
Hearty congratulations to the Toronto Dominion Bank on its 100th birthday.
Claiming a traffic survey failed to show they were warranted , Ontario Department of Highways has refused Midland Council permission to erect traffic lights at the King – Yonge intersection.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – Sunday July 16th to 30th 1956
The end of a long ride for Debbie Currie of Wyebridge and Glenda Edwards of Vasey who rode in the Orangeman’s Parade in Midland, Thursday. They are both five years old and their mothers belong to the Waverly LOBA (Ladies Orange Benevolent Association).
Portraying “King Billy” upon his spirited charger is Cecil Wood of Waverly, county Marshall of the East Simcoe Orange Lodge. Mr. Wood led the July 12th parade in Midland and has been with the lodge for forty years.
Seven and seventy-seven. Age doesn’t matter when it comes to a parade, everyone turns out. Herman Trew, 77, of Waverly LOL 589, or seven-year olds like William L. Black of the Midland lodge juveniles.
Pictured with their banner, previous to the July 12th Orangemen’s parade in Midland, are these laughing members of Waverly LOBA 781, all past mistresses of the lodge, Mrs. John Miller, Mrs. Herman Trew and Mrs. Wallace Wood.
[Not to diminish the injustices done over the decades on both sides, but the sentiment of many Canadians about the Twelfth is summed up by Stan Rogers in his song the “House of Orange”, Google the “House of Orange Stan Rogers” ]
Parade on King Street, band being led by majorettes in conjunction with the Canadian Bandmasters Association convention being held in Midland.
Looking quite confident that she can master the French Horn with one lesson from Sgt. F. Reidstra of the Royal Canadian Dragoons band is Debra Waiman, daughter of Mr. & Mrs. Ronald Wainman of 380 (now 496) King Street. Debra went to Little Lake Park Saturday to hear a band concert arranged in conjunction with the Canadian Bandmasters Association’s convention.
Allan Rees, 9, of Brantford, doesn’t think he will take up the tuba right away. He is helped by Al Reid who plays for the Orillia Kiltie Band and is here for the concert in the park in connection to the Canadian Bandmasters Association convention being held at the Parkside Inn.
Carrying flowers for the decoration of graves of departed members, representatives of the Oddfellows, Rebekah, Orange Lodges, LOBA and the Canadian Legion march to Lakeview Cemetery for the united memorial and decoration service.
Photo related to the one above but not used in the newspaper, no description.
Freak twister on Sunday, July 8th, wrecked this 30 by 90 foot frame building on the Green farm in Tiny Township, uprooted trees in the nearby orchard, whirled over the top of Thunder Bay Beach and finally blew itself out over Georgian Bay.
Passing tourists stop and stare at the new ultra modern Roman Catholic church, St. John the Baptist, just outside of Port Severn on the road to Honey Harbour. The one storey structure is situated near the Trans Canada Highway now under construction in that area. [Before the Trans Canada the route to Honey Harbour from Midland passed through Port McNicoll, Victoria Harbour, Waubaushene, Coldwater, North River and Port Severn.]
Members of the summer school of archaeology working at the Forget Site were lunch guests of Mr. & Mrs. Fred Cook at the Grange in Wyebridge on July 4th. Front row; Leonard Laurin, Penetang; Thelma Sovey, Midland; Ross Channen, Barrie; Bea Ivey, Port Dover; second row, Elizabeth Cook, Wyebridge; Miss Josephine Phelan, Toronto; D. A. MacKenzie, Woodbridge; David Darker, a student at Upper Canada College Toronto; Eleanor Thompson, Cobourg; Lois Jackson, Sarnia; Miss Elizabeth Loosely, Oakville; back row, Wilfred Jury University of Western Ontario archaeologist; Cindy Reid, Toronto; Mrs. Fred Cook, Mr. Cook, Wyebridge; Mrs. Jury; F. C. Jennings and Harry Williams, London.
Free Press staff member Barbara Allsopp dons a giant puff-ball as a hat. Fifty inches in circumference it was found at the rear of A. W. Bath’s plumbing shop by Eddie Doyle of Dominion Ave. He found a second one that measured 46 inches in circumference.
Demonstration of the sanitary land fill method of garbage disposal on a vacant Vindin Street lot, Midland. Process was being demonstrated by W. L. Ballentine Company Ltd. with a specially fitted bulldozer designed for the job. System is being used in many towns including Orillia.
Midland Boat Works president T. M. McCullough signs the navy acceptance form during commissioning ceremonies for the HMCS Cormorant at Midland town dock Monday. The ship’s sponsor Mrs. Murray Wagg can be seen to the left of the microphone stand. Commander Henning, representing naval headquarters, and Lt. Cmd. C. R. Manfield, commanding officer, watch the signing. At right is S/Lt. Don C. Young.
Old soldier, George Finley Walmsley, 85, of Port McNicoll shows his World War 1 medals to his 10-year-old grandson Bobby Duncan.
At the Downer family reunion in Tiny Township on July 21st, Rev. A. W. Downer of Duntroon, MLA for Dufferin – Simcoe is surrounded by children. Midland alderman Ossie Downer is also in the picture and is host of the event this year at his home on “The Mountain” west of Midland. All are descendants of two brothers, William and Henry Downer, who came to Canada from County Cavan, Ireland in 1842. The original Downer’s settled near Peterborough but most of Henry’s descendants were born in Tiny Twp.
Mrs. Ed Jeffery Sr. presents the trophy to the ladies champ at the Midland Golf & Country Club. L to R; Mrs. H. L. Wilson, Mrs. Jeffery, Mrs. Cecil English, winner of the event and also last year’s club champion; Miss Jean Wallace and Mrs. A. J. Preston.
Parkview Public School, graduating class of 1956. Note that this photo was taken in the multipurpose room at Regent School, I wonder why, construction perhaps at the newly acquired Parkview School?
Regent Public School graduating class of 1956. I have to point out my sister, Ellen Barber, third from the left, front row. I recognize several others.
Amateur archaeologist Gordon Baker of Hamilton puffs on an Indian pipe he found near the Maxwell farm at Port McNicoll. The large soapstone bowl was fitted with a reed stem, three budgie feathers and some modern tobacco. Mr. Baker’s best finds were a pair of French iron scissors and a copper arrow-head. The same paper writes that drivers delayed by bulldozers doing roadwork near the Dutton farm (OSPCA) were unearthing native artifacts that they were collecting as they waited. From the previous paper, Mr. Tushingham, the Huronia Museum curator, informed the paper that Beamish Construction had inadvertently dug up what he believes was a native ossuary on the nearby Maxwell Farm.
Beating the July heat in North Simcoe:
These ladies have solved the problem of beating the heat by moving their lawn chairs into the water at Little Lake Park Wednesday afternoon.
Within a few short years, Port McNicoll’s Paradise Point has become one of North Simcoe’s major beaches. Once known as Flat Point due to the flat limestone formations, the area had few cottages but a boom began when village council sold many acres to a Toronto developer.
Rugged shoreline of flat limestone rocks is preferred by many cottagers and visitors who come to Port McNicoll’s Paradise Point. The rock extends only a few feet into the water before giving way to a fine sand bottom. Enjoying the sun are Mrs. W. A. McLeod, Toronto, in the foreground, and Judy Parliament of Port McNicoll.
After a long swim these young campers at YMCA Camp Kitchikewana on Beausoliel Island enjoy some “Loafing’ In The Sun” time.
“Flyin Flivver” manufactured by Midland Reinforced Plastics Ltd. of Ellen Street is demonstrated in Midland Harbour by company official Bob Yates, accompanied by Karen Gracie of Toronto.
Shuffle board court at Little Lake Park provides some shaded activity for players and spectators.
Moreland Lynn of Penetang, Wendy Large and Beverly Balmer of Toronto and Honey Harbour are riding in the new “Le Capitaine” model Grew boat with fiberglass reinforced hull by Midland Reinforced Plastics Limited. [Moreland told me that as a Grew employee he had the “job” of bringing this boat to a Midland boat show.]
Midland Parks Commission bans motors of 5 HP or more on Little Lake to protect swimmers.
Midland Press Limited owner of the Midland Free Press and County Herald newspapers and associated printing and publishing business will now be known as Midland Printers Limited. The restructuring involves no changes to employees or operations except the addition of J. Robert Chittick as vice-president in charge of sales and the promotion of James Lennox to vice president in charge of production.
James Alan, minister of highways, announces an increase in speed on the 400 highway from 50 to 55 miles per hour for non commercial vehicles only.
Value of Midland building permits doubles in the first six months of 1956, $221,100 compared to $101,075 in 1955. But that is well below the first six months of 1954 when permits totalled $690,800 and ended the year at 1,334,725.00.
Mayor Charles Parker has moved his 18 hole miniature golf course, which until now had been located on the corner of Yonge and Eighth Streets, to the basement of his Parkside Pavilion.
Midland Parks Commission requested that park booth concessionaire John Deakos obtain a paper cup soft drink dispenser. The request was made in view of the number of swimmers who are suffering cut feet on broken soft drink bottles.
Members mark the 120th anniversary of the historic St. James on the Lines Church. Only modernization allowed has been the installation of electric lights. A faithful reproduction of the church was built by patients at the Ontario Hospital and is on display in the church.
Former Midlander Robert (Bert) Holt has let a contract to Midland construction firm Webster Smallwood for a 6,000 square foot plant on the south side of Centre Street (Bay East of William). The new plant will house Mr. Holt’s Pinecrest Products furniture company that has been operating in Toronto for the past seven years and will employ 20 staff.
One of the largest institutions of its kind in the Georgian Bay area, the Iron City Fishing Club, this week marks its 75th anniversary. The club is located in the Sans Souci area and a majority of the club members hail from Pittsburgh PA. Every summer for many years a big express car would arrive at Midland’s CNR dock siding from which personal effects of the members would be loaded onto the “City of Dover” or “Midland City” for transport by water to San Souci.
Midland’s telephone exchange conversion to a direct dial system also changes the way our public pay phones work. Previously a caller didn’t put their nickel in until the operator made the connection. Now you put in your nickel to acquire a dial tone and the ingenious device returns it to you if the line is not answered or is busy.
From the “Outdoor Column” by John Power, “Remember, snapping turtles destroy an enormous number of fish and should be trapped and killed whenever possible”. [This of course is incorrect as snapping turtles eat mostly vegetation, carrion and slow moving bottom feeding fish.]
“Notice” Ken Puddicombe has purchased the M.S. Waterbus and business.
At the Pen Theatre, “Rebel Without a Cause” James Dean.
House for sale – Nine room brick home partially furnished, $3,500.00, early possession.
Superintendent of Midland’s Aberdeen Elevator, Murray Lattimore, received severe electrical burns while working in the plants sub-station Monday morning. Dr. I. T. Weldon said Mr. Lattimore received first, second and third degree burns to his face, neck, right arm and hand.
Guy and Bill Hebner advertising chartered boat trips for all occasions and fishing charters.
TEN YEARS AGO this week 1946;
Beatty Brothers (Spencer Division) Penetang was planning an expansion. Two new buildings were built and more than 50 new employees were to be hired.
Mr. & Mrs. James Lazonby of Coldwater celebrated their 43rd wedding anniversary by taking a canoe trip, as they had done each year since their marriage. [The canoe is in the collection of Huronia Museum.]
Victoria Harbour’s newest citizen was Thorbjorn Pettersen of Drammen, Norway, who operates a taxi and service station. A skilful ski jumper, Mr. Pettersen had hopes of organizing a district ski club and training local jumpers.
Melville Wilkie, inmate at the Ontario Hospital, Penetang, made his first of several breakouts.
Midland’s town dock became a veritable “Times Square” when 200 sea cadets and all their kit struggled their way down the dock while 400 passengers from the S. S. North American were making their way toward the main street. The cadets were boarding the “City of Dover” and the “Midland City” on the last leg of their journey to the island camps. Interested spectators from Midland and many tourists jammed the docks with bicycles, baby carriages and cars, making the congestion worse.
St. James on the Lines, Anglican Church, celebrated the 110th anniversary of its founding. Organist for the occasion, Miss Laura Kemp had held the position of organist for 60 years.
25 YEARS AGO this week 1931;
Boat trips from Midland to Honey Harbour, Minnicog and return, had a fare of 75 cents. Moonlight excursions were 50 cents and a three-day cruise to Point Au Baril was $121 return fare.
For the first time since its purchase in 1921 the Georgian Bay Shipbuilding and Wrecking Company’s floating dry dock was moved from its position at the foot of the company’s yards. The occasion, to make room for the self-unloading coal freighter S. S. J. E. Savage which arrived with 2,000 tons of coal.
Simcoe County’s two largest towns, Midland and Orillia, were to be joined by a paved highway. The road was authorized as a King’s highway.
A new Gospel Hall building was opened at Midland and Dominion Avenues, to replace the smaller building on Dominion Ave. near First Street.
One of the top movie hits of 1931 , “A Connecticut Yankee” starring Will Rogers, was playing at the Bijou Theatre in Penetang.
Busiest day in the history of Little Lake Park was recorded when thousands thronged the park to escape the heat wave which had hit the district. Nearly 200 tents dotted the slopes of the camp site.
Obituaries;
25 year veteran of the Midland PUC, David Hurrie, 76, died in St. Andrew’s Hospital July 19th.
Former Penetang mayor William Douglas Hunter dies in Barrie on July 19th. Mr. Hunter came to Penetang in 1926 and purchased the drug store that is now known as Hartt’s Drug Store. At one time he also owned a Midland drug store now operated by W. W. Struthers. In 1951 he moved to Barrie to operate a drug store in Allandale.
Norman Lyon Playfair an outstanding citizen of this community for 55 years died July 18th at his 338 King Street home (now 414, formerly owned by Clint & Bev Truax) at the age of 85. He was associated for many years with Milton Bray in the Midland Planing Mills and was a half-brother to Midland’s James Playfair. He is survived by two sons John and James of Midland and a brother Stuart B. Playfair of Toronto.
Mrs. Phil Blake, nee Marguerite Irene Sharlow, died at her home at 161 Yonge Street (now 389) on July 3rd. Born in Port Huron Michigan, August 4, 1893, she married Phillip Blake on September 17th, 1913 in Penetang. She had lived in Midland for 58 years.
Mrs. Wilfred Vaillancourt, nee Philomene Juneau, died on July 1st in Penetang General Hospital. She was born in Lafontaine in 1881, coming to Victoria Harbour at age 13 has resided there for 62 years. She married in Midland in 1901 and is survived by four sons and a daughter.
John Bruce Winfield in his 64th year, died July 13th of a coronary occlusion en route to Midland hospital. He was born and educated in Victoria Harbour and married Grace Malcolm there in 1916. He was well known as the superintendent of the CPR elevator on Port McNicoll.
Weddings;
Anne Louise Sweeting, daughter of Mr. & Mrs. Gerald Sweeting formerly of Midland and Gordon Johnston, son of Mr. & Mrs. Wesley Johnston were married in St. Catherine’s July 7th.
Isabel Ellen Woodrow daughter of Mr. & Mrs. James Woodrow, Coulson, and James A. Reynolds, son of Mrs. Thomas Reynolds, Waverly, were married in the Hobart United Church July 7th.
Rita Dumais, daughter of Mr. & Mrs. Gilbert Dumais, Penetang, and William Leclair, son of Mr. & Mrs. Willard Leclair of Midland were married at St. Ann’s RC Church.
Beatrice Bechard, daughter of Mr. & Mrs. Andre Bechard, Penetang and John Dusome, son of Mr. & Mrs. Levi Dusome , Penetang, were married in St. Ann’s on July 2nd.
Cecile Beausoliel, daughter of Mr. & Mrs. Andre Beausoleil, Penetang and Richard Desroches, son of Mr. & Mrs. Constant Desroches, Lafontaine, were married in St. Ann’s.
Anita Teresa Robitaille daughter of Mr. & Mrs. Clement Robitaille, RR 2 Midland and Arthur Joseph Beausoliel, son of Mr. & Mrs. Prosper Beausoliel, Penetang, were married at St. Patrick’s Church, July 2nd.
Eleanor Marchildon, daughter of Etienne Marchildon and Stan Therrien, son of Mr. & Mrs. Leonard Therrien, Penetang, were married at St. Patrick’s Church.
Bernice Lacroix, daughter of Mr. & Mrs. Treffle Lacroix, Penetang, and Henry Hamelin Jr., son of Mr. & Mrs. Henry Hamelin, Penetang, were married at St. Ann’s Church, July 2nd.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – Sunday July 15th 1956 – 3:01 A.M. Bell Telephone Converts Midland to Direct Dial
[The information in this article was obtained from the Huronia Museum’s Free Press collection, the County Herald newspaper dated July 13, 1956 and the Midland Free Press Herald dated July 18, 1956.]
The first manufactured telephone to reach Midland was around 1880, shortly after the incorporation of the Bell Telephone Company of Canada in April of that year. Owner of the first pair of telephones, installed between his bakery and his retail outlet two blocks away, was Henry S. Ruby who had come to Midland in 1875 from Barrie to establish the bakery. Acoustic telephones like Mr. Ruby’s required a straight piece of iron wire stretched between the two stations, no bends. Bells rigged up over the phones were rung by simply shaking one of the units. Ruby’s “acoustic telephone” is in the collection of Huronia Museum and is displayed below by former curator A. D. Tushingham. Mr. Tushingham was telephone manager and later “wire chief” at Midland from 1930 until his retirement in 1949.
The phone systems that developed at that time were privately or municipally owned. Bell Telephone entered Midland in 1886 when a long distance line was constructed between Midland and Penetang. John White became the initial Bell agent and the exchange was set up in his grocery store at 243 King Street (now 261). He had six telephone customers. Two years later a long distance telephone line was constructed linking Penetang and Barrie. The line took more than 28 miles of poles and 42 miles of copper wire and linked Midland to the expanding telephone network in other parts of Ontario, Quebec and the United States.
The November 1889 Midland Telephone Directory listed 17 customers, all of them businesses. The listings were: Anderson, Jas., Anderson Fish and Tacking Co.; Clarkson House, J. B. McNaughton prop; Coutermanche, N., merchant King Street; Free Press office, P. J. Ryan editor, King Street; Grand Trunk Rwy. elevator; Grand Trunk Rwy. station, Dominion Ave.; Lynett, Rev. John, residence, Hugel Avenue; Midland Manufacturing Co., Third Street; Miscampbell, A., lumberman, mill office; Ontario Lumber Company, mill office; Peters, C.M., hardware merchant, King Street; Queen’s Hotel, William Rogers prop., King Street; Raikes, Dr. R. M. Midland Ave.; Sneath, C. R., drug store, King Street; Steers and Ambrose, barristers, King Street; Western Bank, King Street; White, John, grocer, King Street.
In January of 1890, Midland was incorporated as a town. The population was getting close to two thousand and the number of telephone customers had risen to 21. In 1892 a fire destroyed Mr. White’s store and the telephone exchange. The salvaged equipment and grocery business was re-established at 234 King (near the Free Press ffice). The exchange was moved twice more before 1920, first to 197 King (now 221) and later to its current (1956) location, 260 King (near Johnstones). Also in 1892 a long distance line connected Lafontaine to Penetang.
A major changed occurred in May of 1900 when continuous 24 hour service was provided. A total of 70 listings appear in the Midland directory of December 1900. By July 1902 there were 86 subscribers and any remaining iron lines were replaced with copper wire resulting in a general improvement in transmission. In 1903 there were 100 phones in Midland and by 1910 there were 260 in use. A line from Elmvale to Penetang was constructed that year as well as a long distance line linking Midland and Orillia.
John White was listed as agent for the last time in the April 1912 Midland directory. He had served the company for 26 years and his daughter Lilian, who had been Midland’s first operator, took over as agent. There was very little expansion during the war years. In 1919 the local staff consisted of Miss Lilian White, chief operator, Edward Robitaille, lineman, Frank Harbour, lineman, and operators Ada Smith, Mary Smith, Jean Ayres, Chilina Smith, Zada Molan and Ella Gillbanks.
On May 5th, 1926, after years of “cranking” their telephones to get the operators attention, the system was updated to battery power and the switchboard enlarged to accommodate up to 1,200 customers. The chief operator was Helen L. McGrath.
In 1931 there were 1,298 customers, but due to the stock market crash of 1929 and the ensuing depression, by 1935 there were only 984 customers. A. D. Tushingham became the local manager in 1931 and retired 19 years later.
During the second world war resources were in short supply and the number of phones in Midland in December 1945 was 1,301, little changed from 1931. However by December 1949 the number had risen to 2,223. Bell employees in Midland numbered 26 and an average of 785 toll calls together with 9,698 local calls were being placed daily.
In 1950 the Bell Telephone Co. purchased property on the corner of Hugel and Midland Avenues. In 1951 the business offices were moved to 276 King St. (now 296 Leisure Sports former Midland Beauty Parlour). Before the end of the year, three new switchboards were added to the exchange for a total of seven local positions and nine long distance positions. More than 30 operators were busy placing an average of 900 long distance and 11,500 local calls daily. At present (July 1956) there are 2,870 phones in service.
August 1955. Sidewalk superintendents keep a close watch as the first piles are driven for the new Bell Telephone exchange and office building at Midland and Hugel Avenues. It was an added step when it was discovered that the ground was wet and unstable. The machine is placing large wooden timber mats upon which it traverses the wet ground. This was the site of the former Midland Woolen Mill. Bourgeois Motors can be seen in the background.
November 1955. Pouring cement pillars on the upper floor of the new Bell Telephone Co. dial exchange building, southwest corner of Hugel and Midland Avenues. The building incorporates poured cement foundation, floors and roof, which is the reason for all the wooden forming and wooden support pillars. The general contractor for the project was the Emery Engineering and Contracting Company of Barrie.
February 8, 1956. Despite the cold weather the brickwork is nearly complete on the new Bell Telephone exchange building on the corner of Hugel and Midland Avenues. The building is scheduled to open early next summer.
The building will house the complex dial equipment on the first floor with the wire room and power supply equipment in the basement. The second floor will contain the new long distance exchange. The building is fireproof throughout with brick exterior and was designed to harmonize and add to the attractiveness of the neighbourhood. The 33 by 31 foot business office will be housed in the single storey area to the right.
Business office staff were also busy prior to changeover obtaining and checking new listings, writing service orders and so on. Derys Stoodley, Rita Martin and Yvonne LeBlanc.
As part of the companies program to make sure all customers are familiar with the equipment employees have been calling customers in recent weeks to demonstrate the various tones heard and asking them to place a test call. Karen Small, pictured here, also visited local schools to demonstrate the dial system to the children. Bell had been installing dial phones or phones that could be converted to dial for quite some time before the actual change over.
Training on the new long distance switchboard board was given to all permanent operators, the system will go into service with the conversion to dial. Operator Ruth Shaubel is seen putting through a test call as chief operator Helen L. McGrath observes. Miss Shaubel is using a set of keys, similar to those on an adding machine, to send out the number of a telephone in a distant city.
This crew of installers was busy for many weeks preparing for the cut over by placing new dial phones and services in local homes and businesses. Seen behind the new building with their trucks are; Jim Adlam, Bob Taylor, Ross Smith, Paul Hetherington, installation foreman Gordon Scott, Manfred Leimgardt, Bob Dunlop and Joe Markle.
Part of the change over was the splicing of every phone line in Midland to the huge cables leading into the new dial exchange building on Hugel Ave. Stan Gilchrist, Bell splicer, is seen in at work splicing wires in a man hole on King Street.
A Bell tower, two and half miles west of Midland in Tiny Township, was also put on line and will bring public phone service to Cognashene Island, Gloucester Pool, Six Mile Lake and Mclean Lake. Later this summer Go Home Bay will be added to the system. Some 1,000 cottages and several large summer hotels and lodges will be within reach of the new public phones.
A check of the dials and indicators on the main power control board in the basement of the new dial telephone exchange reveals all is in readiness for the cutover of the Midland system to dial operation. Sim Panfound, central office expert, makes sure the battery charging equipment is functioning properly as he inspects the voltage regulation controls.
Eric Renkl, skilled Northern Electric employee is seen at work on the main distributing frame in the new Midland dial telephone exchange building. The frame provides the link between the cables serving the town and the dial switching equipment. Each pair of wires among the thousands leading from the cables must be matched with the corresponding pair leading to the dial switches and soldered together.
Claude Kimball, Bell technician, checks the operation of some of the switches at the new Midland exchange. Normally the switches are covered with metal canisters to protect them from dust and dirt. The floors of this room are never swept, only wet mopped to prevent dust in the air and the room is air conditioned.
This is the last photo of the manual phone exchange. All permanent employees will still be needed to staff the new long distance, information and assistance switchboards. From the moment it was decided to convert Midland to automatic dialing provisions were made for staff. All permanent staff were guaranteed their employment, staff retiring or leaving were encouraged to stay until the switchover and new operators were hired on the understanding their jobs were only temporary. Standing left is Mrs. Laura Bacon supervisor and Miss Adilene Bell of Collingwood a chief operator who filled in for two weeks before the change.
With the building complete and all preparations made the day arrived when the familiar “number, please” would be replaced by the hum of a dial tone. Bell selected a day and time when there would be very little activity on the lines and few people would be inconvenienced for the few moments, less than two minutes, it would take to cutover the new system.
It took just 35 seconds early Sunday morning for Bell Telephone technicians to take Midland’s manual system out of operation and put more than 3,000 telephones on dial service. When the exchange “went to dial” all telephone numbers were simultaneously changed to the new “LAkeside6” (526) designation. Shortly before 3 A.M. Sunday morning operators asked customers using their phones to hang up and reconnect in two minutes using the dial. At the command “pull coils” a group of Bell employees standing behind the old main frame pulled on cords attached to hundreds of fuses, two for each line, littering the floor in seconds. With the fuses removed the old common battery switchboards were dead. Using a special phone line word was passed to the new exchange building to activate the dial equipment. Another group of men, stationed in front of the rows of switching equipment, pulled on cords attached to hundreds of blocking tools, little plastic insulators which were keeping the dial equipment from functioning. Direct dial had come to Midland.
Five staff wait for the call to activate the dial system by pulling the cords and removing the blockers. Pictured are Warren Aikin, Grant Morrow and Claude Kimble.
Practically all those waiting for telephones in Midland will get service with the switch to the new dial system, states H. A. Kilroy, Midland Bell manager. Twenty five additional telephones will be placed in service. Recent upgrades to rural lines will also improve service and reduce party lines to eight or less. The new long distance switchboard on the second floor is the most modern available and is almost noiseless in operation, no bells ring, no telephones jangle. The timing of long distance calls is done by electric calculagraphs at each switchboard position. Similar to punch clocks used in factories, the operator punches a card when the call begins and when it ends. Room lights in this room are connected to an emergency power supply in the event municipal power is interrupted.
The new system is powered by large storage batteries located in the basement. DC power is supplied and the batteries are charged using AC power. If the AC supply from the local utility is interrupted the system will continue to work for at least eight hours on the storage batteries.
The new Midland directory, the Blue Book, contains 9,817 new and changed listings, including Barrie, Collingwood, Alliston, Beeton, Bradford, Camp Borden, Cookstown, Penetanguishene, Port McNicoll, Thornbury, Tottenham and Waubaushene. Listing are now in three columns on pages much larger than the previous books. For the second year in a row the directory features a drawing of the county court house in Barrie on its cover.
The two editions of the newspaper that covered the conversion to direct dial were also full of advertisements from local merchants that highlighted their new phone numbers. Several that kept their number for many years, Hebners Taxi 526-2217, Midland Free Press until 2013 when it closed 526-5431, Wagg’s Dry Cleaners number is now used by French’s Dry Cleaners 526-5436, Chalet Blue Motel now the Silverstar still has the same number 526-6571 as does the Midland Drive-In Theatre 526-2411.
This amazing technical advance took only 80 years from the day in 1876 when Alexander Graham Bell called Watson in the other room. It has been 60 years since direct dial came to Midland and technology has moved on, now we are switching to cell phones that not only let us see and talk to one another but give us access to a world of knowledge and information on the internet.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – July 8th to 15th 1956
Five year old Michael Dorion, son of Mr. & Mrs. Alfred Dorion, Tiny Township, comforts his puppy after a freak twister damaged their home and flattened a nearby stable.
Jean Chretien, Mrs. Alfred Dorion, daughter Theresa, sons Basil and Michael and Captain Mike Chretien were witnesses to a freak tornado that damaged the Dorion home and created a water spout near the boat Captain Chretien was piloting.
Lloyd Douglas Bowman, known as “LD”, in front with a knife on his belt and Bob Popple of Penetang demonstrate a life saving hold practised on land at Camp Kitchikewana as they work towards their Royal Life Saving Society award.
Midland Y’s Camp Kitchikewana director J. W. Smith, entering his 30th camping season, explains the camping scene to his three year old grandson Lee Morris.
Mr. & Mrs. Harvey Archer of Third Street, Port McNicoll, celebrated their 50th wedding anniversary Wednesday, are seen with their granddaughter Dorothy, 4, and Darlene who is 3.
Missed death by inches. Harold Copecog, 23, of Honey Harbour was sitting in the front of his boat around midnight Monday night when the stern was completely cut off in a collision with another boat in the South Channel. Driver of the 16 foot outboard Eddie Lizotte, 27, was thrown several feet in the air by the impact and was drowned.
Displaying luscious strawberries grown in Wyebridge on the farm of R. W. Preston are Molly Swales, a member of the Loblaw’s staff and Merritt McCue of Christian Island, head picker for Mr. Preston. The big berries were developed by Mr. Preston in conjunction with the late Dr. E. A. Smith of Ohio. It has taken five years to get the plants to production stage.
Flash Fire Races Through Kitchen – Seventy-seven year old man rescues women eighty-six. The presence of mind of her 77 year old neighbour, Joseph Cripps, prevented Mrs. Sarah W. Morris, 86, of 363 Queen Street (now 465) from being burned to death. Mr. Cripps, an employee of the town and the Midland Free Press, was out in his back yard when he noticed smoke pouring from the Morris home. He wrenched open the front door of the burning home and made his way through the smoke to the kitchen and led Mrs. Morris to safety. She suffered first degree burns to her forearms, shoulders and face. Paraffin wax was being melted on the stove to seal the jars of preserves she was making.
Summer dig students at the Forget Site native village southeast of Wyebridge have discovered it to be one of the few known double palisaded native communities. The two palisades range from four to seven feet apart. “There was a double palisade across one end of St. Ignace near Sturgeon Bay, but not around the entire village,” explained professor Wilfrid Jury of the University of Western Ontario.
Thieves steal more than thirty fur coats from Edwards Specialty Shop, forced rear freight door to gain access.
Constable Mike Chapman injured when the police cruiser driven by fellow officer George Winter was struck broadside at Firth’s corner by a westbound car.
Midland and district Orangemen prepare for a big parade in Midland on the twelfth. Lodges from Coldwater, Warminster, Uhthoff, Orillia, Seabright, Hawkestone, Craighurst, Vasey, Waverly, Elmvale, Allenwood, Wyevale, Penetang and Gravenhurst are expected to join in.
Two Penetang lads injured in a motorcycle accident on County Road 6 near Perkinsfield Thursday night as their machine went into the ditch. Rene Martin has been unconscious since the accident and was rushed to Toronto General Hospital Sunday for emergency surgery to relieve pressure on his brain. [Local people will remember Rene Martin as the ever friendly ticket seller around Penetang for many years]
A fourteen year old Coldwater boy admits to placing a bolt on the CNR track near Coldwater to see if it would be flattened. This was within an hour of the accident that took the life of Darwin Raymond of Waubaushene, when the track car he was riding on struck a bolt in the same area.
Charged with drunk driving, a 30 year old soldier from Base Borden is sentenced by Magistrate K. A. Cameron in Penetang court. [I find it interesting that the penalty I believe is more severe than today. There was no other history mentioned and no one else involved when his car left the road and ended up in a farmer’s field, yet he received seven days in jail, lost his licence for a year and had his car impounded for 3 months.]
Two new navy ships to be commissioned, the HMCS Mallard built by Grew Boats and the HMCS Cormorant built by the Midland Boat Works were launched several weeks ago and will now be officially commissioned. The participants and dignitaries will attend a joint reception at the Midland Armory.
All Midland telephone numbers will change with the cutover to the dial system early Sunday morning. Midland numbers will be LAkeside 6-6123, that is the police number, and calls can be completed by just dialing the last five digits but all seven will be required for long distance calling. To call long distance or obtain assistance, dial the “operator”. Directory information can be reached by dialing 113.
Jack Blackburn, special constable in charge at the Midland docks, yesterday issued a warning that Midland Harbour waters are unfit for swimming. He said the Simcoe County Health Unit have posted signs indicating the water is polluted and unsafe. [At this time Midland sewage went directly into the harbour.]
During July and August the Brewer’s Retail stores in Penetang and Port Severn will be open until 8PM on Fridays and Saturdays.
Lucky Friday the 13th at the Midland Drive-In, free admission to all drivers with a “13” on their licence plate, the driver of every 13th car, all families of “13” arriving in one car and the girl friend of any driver with a “13” on his driver’s licence.
Thirteen Midland home owners face fines if they fail to immediately take action to connect to the municipal sewer system and install proper toilet facilities.
220 boys attending Camp Kitchikewana as it opens for its 37 the season.
The Midland Library is inviting summer cottagers to take out a membership, only .10 cents for the summer with a $5.00 refundable deposit.
Singer Sewing Machine Company opens a store in Midland at 203 King Street (now 227).
The asking price for even a stoney water front lot on Georgian Bay runs from $10 to $15 per foot and good shore property is selling on average from $20 to $25 per foot.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – July 1st to 7th 1956
I think the Free Press photographer was on holidays the last week of June and the first week of July 1956, there are very few photos and they come from correspondents, previous news items or Rolfoto and Budd Watson. The Watson photo is a good one of our town band in the band shell at Little Lake Park.
This photo appeared on the bottom right corner of the front page of the Free Press, July 4th, 1956. Unfortunately the corner was torn, taking away 90% of the caption. The heading is “Natural Science Lesson” and the only name we can make out is Clifford Ga?? A Harbour is mentioned so it could be Honey Harbour or Victoria Harbour. We pulled out the original copy of the paper and confirmed that the corner is missing.
Let us know if you can identify this group!!
Activities for another year wound up at SS #15 Tay, June 29th, with a picnic and open house. Gathered around a social studies project are Alma Galbraith, Ruth Galbraith, Lois Todd and Vernon Morris, teacher of the 16 pupil school at Sturgeon Bay.
To fill out the photo section we will include some local photos from a collection acquired by the Free Press that relates to a 1956 booklet called “The Story of Simcoe County” published by the County of Simcoe and edited by the Honourable E. C. Drury. The photos depict agriculture, leisure activities, tourist locations, historic sites and the natural beauty of Simcoe County.
Little Lake Park in the winter prior to 1956. The log cabin was a gift from Dr. Garnet Tanner and was used as a post office for the campers. It was removed in the spring of 1956. The second photo shows the old store, also prior to 1956 and the band shell. The third, taken at the west end of the park, shows the small cabins that ended up in back yards all over the area.
Row boats for hire, Little Lake Park.
The GTR / CNR roundhouse and service facilities at the Tiffin. The roundhouse has been reduced to what appears to be five stalls and by 1956 the steam locomotives had disappeared and these facilities, such as the water tower to the right in the photo, would no longer be needed. The roof of the Aberdeen or Tiffin #1 can be seen on the left as well as the smoke from the town dump. By 1956 the town was looking for a better way to handle its waste.
CPR summer station at Port McNicoll with the ice house in the background. For years this was one of the most photographed sites in Simcoe County, not just by the passengers but it was a popular spot to visit by locals on a family outing.
Martyr’s Shrine before the reconstruction of Ste. Marie. Note the passenger shelter used by tourists that arrived by passenger train and the small house behind it.
The Parkside Inn on Yonge Street Midland.
Government dock at Victoria Harbour.
Owl Pen, the home of Kenneth Wells and Lucille Oille in Medonte Township near Creighton.
There were many “glamour” shots like this one with women in bathing suits on the beach, in boats and canoes and mostly sitting on rocks, but only this one was used in the book, but with a young man driving. The photographer certainly made an effort to get a good selection.
For the second year in succession the Midland Citizens’ Band has brought home the Canadian championship for Class 1 junior brass bands.
A thirteen year old girl from Hamilton was struck and badly injured by a power boat while swimming at Little Lake Park. The Parks Commission is seeking a ban on high horsepower boats on the lake.
Midland and district public and Catholic schools published promotion lists
Ted McKillen is closing his men’s clothing business at 245 King Street after 38 years. When brother Lloyd returned from overseas they set up shop in the Georgian Coffee Shop under the name McKillen Brothers
Lloyd Letherby, MLA for Simcoe East announces a new million dollar super highway to be constructed from Highway 400 to Gravenhurst. The original plan called for a two lane highway paralleling Hwy 93 from Crown Hill to Craighurst then branching off to Coldwater to meet Hwy 12. The new plan calls for an extension from Coldwater through Matchedash and Orillia Twp’s to Hwy 11 at Gravenhurst. (As we know this road was never built. The 400 extension went as far as Coldwater where it joined #12 which joined the Trans Canada Highway #103 at Waubaushene. With the bypass of Coldwater built several years ago and the widening of the 400 extension to four lanes the 400 highway now goes as far as Parry Sound and will soon reach Sudbury.)
Two Midlanders, Lionel Bourgeois and Siegfried Appelt, have both been charged after being involved in a traffic accident at Fourth and Quebec Streets.
In Canada the poisoning of lakes and re-stocking with game fish has become a proven tool for restoring lakes where coarse fish have taken over. (Really!!)
Mr. & Mrs. Amos Mateff wish to announce the arrival of their son, Glen Howard, a brother for Lana and Karen.
Mr. & Mrs. Howard Leonard wish to announce the engagement of their daughter Carolyn Maureen, to John Ralph Fagan, son of Mr. & Mrs. Cecil Fagan of Wyebridge.
The Roxy is showing “The Man in the Gray Flannel Suit” with Gregory Peck, Jennifer Jones and Frederic March. The Pen Theatre has live stage entertainment as well as their screen performance. The first one hundred patrons receive a free Elvis photo.
The areas newest dining spot is the Grange in Wyebridge. Once a community meeting hall, jail, home of group of seven artist Franz Johnston, the new restaurant is owned and operated by Mr. & Mrs. Fred Cook.
Midland Parks Superintendent Harold McAllen told this newspaper yesterday that results of a water test by the Simcoe County Health Unit show the water in Little Lake to be satisfactory.
Promotion results from Moore’s Corner. Grade 8 to 9, Shirley Holm, Tom Smith – Grade 7 to 8, Mary Holm, Maizie Mount, Garnet Sallows – Grade 6 to 7, Eldon Irish, Karen Sallows, Sharon Sallows, Brian Webb – Grade 5 to 6, Eleanor Holm, Neal Mount, Shirley Sallows – Grade 4 to 5, Wanda Russell – Grade 3 to 4, Judy Bumstead, John Holm, Allen Mount – Grade 2 to 3, Jennifer Bumstead, Mary Burnie, Sharon Rumney, Rodney Sallows – Beginners to Grade 1, John Burnie, Bruce Rumney
BBQ’d chicken now available at Midland IGA Foodliner, barbequed before your eyes with our new “Sun Valley” Rotis-O-Mat, $1.29 for regular bird and $1.49 for a stuffed bird.
25 YEARS AGO – Port McNicoll Masons, who a few weeks previous had purchased the old Star Theatre in the village, dedicated their new lodge rooms in the second story of the building – Increase in postal rates took effect July 1st, letter rates were two cents for local mail and three cents for anywhere else in Canada, the new rate is one cent more. – North Simcoe is in the grip of a heat wave, the temperature has been 96 degrees for three days.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – June 24th to 30th 1956
Some of Midland’s “shut-ins” were entertained at the Salvation Army Citadel Thursday night. Front row; Mrs. F. Wadge, Mrs. M. Drinkle, Mrs. A. Edwards, Miss Mae McCallum, back row; Mrs. Emma Fallis, Mrs. D. Prescott, Mrs. E. Walters, Mrs. C. Woods, Mrs. K. Keller. A program of music and song was provided for the ladies.
Getting ready for the wedding are these members of the Elmvale School of Ballet, pictured at a dress rehearsal Saturday morning. The bride at center is Mary Corbett and the attendants are Betty Trace left, and Adele Caesar. Mother of the bride is Nan Roberts, instructor at the school for the last four years.
Elmvale School of Ballet is holding a recital at the Elmvale Community Hall and these two fire flies are in it. Nan Roberts is the instructor for the ten pupil class and mother to Nancy, center, and Carolyn. Piano pupils of Mrs. W. W. Shaw will also be taking part.
This photo, connected to the previous ones regarding the Elmvale School of Ballet was not used in the newspaper leaving us with no description, but with the power of the internet we were able to contact a relative from Elmvale who was living in Vancouver and discovered an interesting twist to the story.
Adele Caesar is the girl bending down (far left) and Betty Trace is the girl endpoint on the far right. Dad says he thinks the girl next to Adele is Mary Corbett. ( he’s sending it on to his sister Nancy to check, I’ll let you know). This is where it gets good. The ‘girl’ in the front row with the tambourine is actually my uncle, Bruce Roberts, and the ‘girl’ standing behind him in the back row with the tambourine, is my dad, Douglas Roberts. Apparently gran (Nan Roberts) used to make them join in when they were short on girls! If the photo is from ’56, then dad was 11 and Bruce was 7 or 8.
Constable Ernie Bates who is parked at the town dock demonstrates the new two way radio system as he communicates with police chief Robert Cameron. Radios have a range of 25 to 30 miles. (The actual photo in the paper included a photo of chief Cameron on the phone, one the paper had used the year before showing the chief working in his temporary office on Bay Street, not on the radio with Ernie.)
Staff from the provincial fish hatchery in Collingwood perform a census of fish stocks in Little Lake. Lorne “Flash” Hutchinson holds a nice two pound bass while John Hunt at left and Fred Chew, Midland’s conservation officer, look on. Mr. Hunt, manager of the Collingwood hatchery, said bass form 90 percent of the lake’s fish population, only intruders found were gar pike.
St. Paul’s Presbyterian Church in Victoria Harbour celebrates its 50th anniversary Sunday. The week-long celebration came to an end Sunday, pictured are local native Rev. J. P. Schissler, guest preacher, soloist Mrs. A. B. MacQuarie of Fergus, wife of former Harbour public school principal MacQuarrie and Miss Bessie Winfield the oldest member of the congregation. Miss Winfield taught Mr. Schissler at Victoria Harbour Public School.
They were there fifty years ago when the Victoria Harbour Presbyterian Church was opened. Shown at the special anniversary service Sunday are, Mrs. Wm. Hazelton of Vasey, Miss Kate Brown, Mrs. George Cooper, William Moore, Mrs. J. L. Winfield and Miss Laura Gill.
John Waldie Jr., son of the late John Waldie who was the owner of the Victoria Harbour Lumber Company and who donated St. Paul’s Presbyterian Church to the village, is seen with his daughter after the morning service at the church. Behind are elders, Capt. W. A. Stewart and Douglas McNabb.
Senior pupils of the Christian Island United Church Public School are shown with their teacher F. E. Kempling in front of the YMCA following a tour of the Midland Free Press Friday afternoon. Group also visited a grain elevator, Midland Footwear, Midland Reinforced Plastics, Canadian Nameplate and played a baseball game with Sixth Street School following a picnic lunch in Little Lake Park.
Rare blooms for this part of Canada, this rhododendron in the garden of Douglas Grant at 298 Midland Ave.(now 344) is the finest seen north of Windsor, states local florist Mac Perrin. The four year old plant requires heavy protection during the winter months.
Two veterans of their communities were pictured at the annual CNIB picnic held at Little Lake Park Wednesday. Mrs. George Wyles, 91, of Barrie and William Archer of Elmvale, a healthy 92 year old. Mr. Archer, whose father was one of the first settlers in North Simcoe, comes from a family known for their longevity.
Loss of sight hasn’t diminished the spirit of this nonagenarian, one of the guests at the CNIB picnic in Little Lake Park Wednesday afternoon. Mrs. Sophia Hart of Craighurst, who marked her 95th birthday December 11th and who looks quite capable of hitting the century mark. Mrs. Hart is a member of one of the pioneer families of the district.
Top students at Midland public schools are receiving awards from Ken Ellis public school inspector for the area. Hugh Gunn, Bill Clause, Lynn Johnson, Ellen Barber and Lois Cowan. Marjorie Bolt was absent.
Veteran teacher in Midland public schools but now retired, Miss Ethel Wagg presented books on behalf of the Midland branch of the IODE to these two grade eight students from Parkview School at graduation exercises held in the Regent School auditorium Tuesday night. Award is given for the highest marks in social studies and the winners are Gerry Wittig (Mueller) and Wayne Farqhuar.
The highest marks in social studies at Regent School won awards from the Midland branch of the IODE, Mrs. Thomas Brandon presents books to Karen Blair and Ross Hebner during the graduation exercises held at Regent School. (Karen, and Gerry Wittig from the previous photo, married)
Piano pupils present recital – Pupils of Margery Olmstead were heard in recital Thursday night before a capacity audience in the Calvary Baptist School hall. Beginners solos, Barbara Jones, Susan MacFarlane, Judith Rankin, Lorna Lyons, Freddie Hacker, Judith Coughlin, Tamie Morrisson, Brian Clark, Margaret Walker Davis Glazer, Ruth Webster, Susan Schell, Reta Rutherford and Karen Wood. Grade I, II and lll selections were played by Sharon Park, Jerrold Karch, Ardythe Boden, Peggy Krochko, Ruth Blackmere, Allan McElroy, Eden Morrisson, Kenneth Trew, Peggy Robertshaw, John Cranston, Linda Marchand, Mary Louise Parker and Helen Farrow. (I took lessons from Miss Olmsted but she would have agreed that I was better at cutting her lawn.)
Grand opening of Farmers Snack Bar in Orr Lake
Bill Hack shoots a 33 on the nine hole Midland Golf & Country Club course.
Johnstone’s (Music) are advertising beach balls, swim rings, life preservers, swim fins, masks and snorkels. 262 King Street
Holiday dancing at Mel’s in Honey Harbour
Popular Waubaushene resident Darwin Raymond dies when the “jigger” he was riding on struck a bolt on the CNR tracks east of Coldwater, vandalism is suspected.
TEN YEARS AGO JUNE 1946 – Violence against lake ship operators and non union crews broke out in Midland. Twenty men on the crew of the Altodoc were forcibly removed and their belongings thrown to the dock. – Collingwood’s population of 7,027 tops Midland by 147. Barrie has a population of 10, 153. – Seven girls and two men were injured when a portion of the dance floor at the Parkside Pavilion collapsed. Forty persons and a telephone booth were catapulted into the basement. Recent basement excavations had weakened the supports. – Work had started on the demolition of Dr. Garnet Tanner’s residence on the corner of King and Elizabeth Streets to make way for the new theatre. – More than 4,800 pounds of serviceable clothing and bedding was donated by Midland residents for destitute families in Europe.
Juveniles, aged 10 and 15, steal a case of beer from a Brewers Retail truck in Dollartown.
Veteran of two world wars, islanders elect Riley Root as Chief of the Christian Island Band.
Department of Highways releases plans for the new intersection at Firth’s Corner, the scene of many serious accidents. Intersection of Highways 12 and 27, now Hwy 93 and the Balm Beach road. Yonge Street used to go straight through, to the north of Full Line Electronics, Sundowner Road is the remains of it. The curve into Midland from the south on Hwy 27 can still be seen east of the present intersection.
Mr. & Mrs. Milton Bray celebrate their 50th wedding anniversary. Effie Eugenie Sherwin lived in the farming district of Port Hope where she met her husband. When they moved to Midland it was to live in the new two story house on Seventh Street that he had built himself and where they are still living. They have five children.
1,500 buy tickets to midget wrestling at the Arena Gardens, more than the three previous weeks combined.
From John Powers column “Outdoor Diary”; Sunday morning Chuck Stelter, Ted Holder and myself arose and shone well before the sun and the chickens – 3:45 a.m. to be exact. With the mist rising off the water of our favourite trout stream we caught trout after trout, keeping 41 fish in all and returning about 50 under eight inches.
Huronia Museum’s authentic Indian Village, which hosted 20,000 visitors last year re-opens Saturday afternoon for the new season. A highlight of the opening will be a performance of dances by Indians from the Six Nations Reserve near Brantford. The village will be in charge of curator William Barnett, assisted by Ken Cowan, Carol Cowan and Stewart Guthrie.
Kids Saturday Matinee at the Roxy, Gene Autry in “Last of the Pony Riders” plus Three Stooges and 3 cartoons. “Mister Roberts” is playing at the Pen.
Midland’s per capita debt is now $150 compared to $390 in Edmonton, $238 in Toronto and $180 in Ottawa.
Walkers Store celebrates 31st anniversary. Advertising children’s denim jeans for .88 cents.
Lightning destroys the barn of Henry Pauze a mile south of Perkinsfield on the County Road. Family loses calves, chickens, pigs, milking equipment and a large stock of berry baskets needed to harvest the strawberry crop that is now ripe. Milking herd was sold at a loss Wednesday as they have no equipment left to milk with. Their house was struck last summer, a bolt that removed plaster from the walls and splintered wood work.
New factory on Highway 12 outside Coldwater is nearly complete and still there is no announcement of what it will produce, latest rumour is metal tubing.
Bruce Duncan launches his latest home built cabin cruiser the “Torna B III”. Built in his garage in Port McNicoll over the winter the craft is 23 feet long and 8 feet wide, powered by a 30 hp engine and will sleep four.
Veteran marine instructor and chief engineer for CPR steamships, John Moses dies at 70. Long time friend and fellow instructor at the local Marine School, Capt. Robert Mitchell also died within the last year leaving the school without its two veteran instructors. Mr. Moses was working as a night watchman and engineer for Wagg’s Laundry in Midland and that is where he died, being found by arriving staff.
Severe electrical storm kills Eli Vaillancourt as he is tying up his boat in Penetang Bay. His son Jack was standing beside him when the lightening bolt struck and threw his father into the water.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – June 16th to 23rd 1956
Four of more than 200 grade eight pupils who toured the new MPDHS building get their first taste of higher math from Mrs. J. Cardenas. Bernadette Hamelin, Penetang; Claudia Reynolds, Parkview; Donald Daoust, Perkinsfield and Karen Blair, Regent.
Midland ‘s main street gets a much needed face-lift, new asphalt from the CNR tracks to Yonge Street.
It Was Only Three Days – When the re-surfacing was being done last week several local wags offered odds on how long it would be before the new pavement was torn up again. It was just three days. The work shown is being done by Bell Telephone, installing cable for the new dial exchange coming in July.
Last Rites for a War Hero – One of the five drowning victims in the Southern Georgian Bay region this year Captain Anthony Van Steeden of Vancouver was accorded military honours at his internment in Lakeview Cemetery Midland. Holder of the OBE, MC and MM, Capt. Van Steeden was engaged in secret service work during World War II. Members of Branch 80 Royal Canadian Legion and the OPP detachment at Victoria Harbour attended the service. Bugler at right is Norman Jackson of Midland.
Mrs. Walter McMann (Helen) of 392 (516 new) Russell Street shows a white tulip that produced five blossoms on one stem.
Public School Field Day Champs – The girls are, Ellen Barber on the left, intermediate champ; Lynn McAllen junior champ; Carolyn Bath won the senior title but was not present for the photo. Boy’s winners were Gary Carr, intermediate; Gerald Wotherspoon, senior and Tom Jenkinson junior.
Thirty years ago, Fred Mitchell, an MPDHS student, would have been the envy of all his classmates, for this 1926 Auburn was then an elegant limousine. The Prince Albert suit he is wearing is the one his grandfather, Henry Gouett of Waubaushene, bought for his wedding in 1900. Fred purchased the car recently, it hadn’t been run for three years but started right up with a fresh battery. Purchased by the late Fred Hill for $3,400.00 back in 1926 when the average price of a car was under $1,000.00. The car has 36,000 miles on it. Fred lives at 338 (402 new) Frederick Street.
Midland Lions Club members attending their annual meeting at the Delawana Inn in Honey Harbour, relax on the front lawn.
(We have no names for this photo, help would be appreciated, I recognize Jean Somers, Marg and Harold McAllen)
Officials of the Midland Friendship Club check over the program during a picnic held at Little Lake Park Saturday, Jack Moore president and Mrs. James MacLeod are seated, Ted Rivers, Mrs. George Whitaker and Robert Wiles secretary treasurer, standing.
Four top golfers from each of the four towns competing in the ladies county cup match at the Midland Golf & Country Club Thursday are seen gathered around the big scoreboard. Mrs. Keith Robinson, Collingwood, who had a 91 gross; Mrs. J. A. Hepburn, Orillia, 97; Mrs. John Ough, Barrie, whose 85 was the best score of the day; Mrs. Sandow, representing MG&CC and Mrs. Ken Lewis who headed the Midland contingent with a 90.
A fine example of the new homes being built in the Ingram Subdivision in Tay Township near the new high school. This one, well advanced towards completion, is being built for Mr. & Mrs. Jack Argue of Midland.
The new Loblaws store at the corner of King and Elizabeth Streets is slated to open Thursday, June 21st, 1956. Shelves are being stocked and last minute items completed in the building. Note the H.S. St. Amant & Sons panel truck parked in front, the well known local business provided all of the plumbing and heating for the new building. Other local suppliers included Walker’s Electric, Jeffery’s Hardware and Midland Planing Mills.
Getting ready for the big opening, Bill Howard, right, manager of Midland’s new Loblaws store, makes last minute checks with his chief superintendent A. R. Wallace of Toronto. All of Mr. Howard’s seventeen years with the company have been in Midland including five as store manager.
Over one thousand customers attend the grand opening of the new Loblaws market on King Street with hundreds lined up to receive free gifts distributed to the first thousand shoppers.
National Cancer Institute of Canada holds its second national conference at the Delawana Inn. One hundred of the finest doctors and research scientists in the world are attending, including guests from Israel, France, England and the United States. The conference discussion has been divided into five categories; the cell, Leukemia, chemotherapy, hormone and cancer immunity.
A hole was burned in the wall of a classroom in Elmvale District High School last week when some chemicals exploded.
Ernst Leitz Sr. head of Ernst Leitz, Wetzlar, died at Wetzlar Friday in his 86th year. Dr. Leitz was the second generation of his family in the optical company and when his elder brother Ludwig was killed in 1898, he took over at the age of 27 the direction of the firm that now employs more than 6,500. Surviving are three sons, Ernst and Ludwig of Wetzlar and Guenther of Midland.
The twice-weekly CPR boat train is back in operation for the summer season, leaving Toronto at 12:01 PM Wednesdays and Saturdays and connecting with the Assinaboia and Keewatin at Port McNicoll.
IGA is offering a taxi ride home for with your order if you live in town and your order is $10.00 or more, cost .15 cents.
Newest item for building patios, the concrete patio slab is being produced in North Simcoe by Wyevale Concrete Products.
$8,462.00 worth of cigarettes stolen from DeNure and Sons Transport warehouse on Easy Street. $5,000.00 worth of cigarettes were stolen from the same warehouse on May 9th.
300 children attend St. Paul’s United Church Sunday School picnic at Little Lake Park Wednesday afternoon.
Polio vaccine proving successful, only six cases reported in Ontario so far this year, none in a vaccinated child.
Simcoe County council spent Thursday afternoon cruising Georgian Bay on the Penetang Eighty Eight.
Wrestling at the Arena Gardens Monday June 25th at 8:445PM. Pat O’Connor vs. Lord Athol Layton. Special midget tag team match, Fuzzy Cupid and Sky Hi Low vs. Little Beaver and Cowboy Bradley.
Esteemed wife of United Church pastor, Mrs. W. R. Auld dies. The former Mary Elizabeth Clark was born at Mountain Ont. in 1889.
Midland PUC introduces lawn watering restrictions. New hours are 7:30 to 8:30 AM and 6:30 to 7:30 PM.
The Dam Busters and The Glenn Miller Story are playing in local movie houses.
Leitz constructing another 2,000 square foot addition.
Port McNicoll School Board decides not to join MPDHS area, cites full complement of teachers in place and classroom space available. Port McNicoll students who wish to gain their senior matriculation (Grade 13) will continue to enroll for their final year at MPDHS.
Every issue of the paper has “gossip” columns from the area’s towns and villages, the “who visited whom” section, submitted by local correspondents. This is the Honey Harbour report from the County Herald, Friday June 22, 1956. As I read it many of the names were very familiar, how many do you recognize? ‘Mr. & Mrs. Henry Gamelin of Victoria Harbour week ended with their son-in-law and daughter Mr. & Mrs. Ed Boucher Jr. – Miss Yvonne Boucher and Ronald Murphy of Toronto were weekend guests of Miss Boucher’s family, Mr. & Mrs. Ed Boucher Jr. – Miss Beatrice Macey and Bob Massey of Toronto week ended with Mr. & Mrs. Frank Macey. – Floyd Oulette of Peterborough visited his mother, Mrs. Margaret Oulette, over the weekend. – Jack Gillard and Cal Cook visited Mr. & Mrs. Frank Rourke (O’Rourke) over the weekend. – Miss Carol White who has been attending Nardin Academy School for girls in Buffalo N.Y. for the past year, and Mrs. Louise Parish will spend this coming weekend with Mr. & Mrs. Art White. – David Jacques of Preston visited his brother and sister-in-law, Mr. & Mrs. Joe Jacques during the weekend. – Mrs. Tom Curry and son have returned from the Bahamas and are residing in Honey Harbour for the summer with Mrs. Curry’s brother-in-law and sister, Mr. & Mrs. Joe Jacques. – Mr. & Mrs. Clifford Paradis, caretakers at Brebeuf lighthouse, and their daughter and son-in-law Mr. & Mrs. Herman Lacroix of Midland, visited Mr. & Mrs. Wilfred Paradis during the weekend.’
Basic salaries of municipal employees has nearly doubled in the last eight years, mayor tells local Kiwanis Club. Police Chief $2,370 in 1948 to $3,700 in 1956. Senior constables $1,800 to $3,300. Fire chief $2,100 to $3,200, senior firemen $1,920 to $3,000. Public works labourers .55 cents per hour to $1.05, truck drivers .66 cents to $1.15. Public school teachers $1,870 to $3,350.
Over thirteen million trees have now been planted in Simcoe County forests since 1922, 401,000 in 1955. This far sighted project has been a huge success and a great benefit to the residents of Simcoe County. http://www.simcoe.ca/dpt/fbl/about#ui-id-1
Huronia Museum – Looking Back 60 Years ago in North Simcoe – June 8th to 15th 1956
While regular MPDHS students stayed home to prepare for exams, 243 public school pupils from the area visited the new school in Tay Township for orientation. Glendola Haliburton of Hillsdale tries her hand at the modern sewing machine in the home economics room while instructor Mrs. I. Rayner looks on. Watching are June Elliot of Parkview School, left, and Gail Brand of S.S. #8 Tay, Port Severn.
New instructor of instrumental music at MPDHS, W. A. “Bill” Bartlett explains the operation of the euphonium to local grade eight students during the recent orientation day at the new high school. Listening are Lynn Johnston, Regent School, Lois Cowan, Parkview, Yvonne Cheetham, Waubaushene and Ken Copeland, Hillsdale.
On the same orientation day Perkinsfield twins Lorraine and Ellen Lalonde enjoy lunch from their matching dinner pails. Daughters of Mr. & Mrs. Herb Lalonde.
Grade eight students visit the shop area of the new MPDHS while on orientation day. R. C. (Dick) Moffatt, instructor, explains the use of a “Brake” to bend metal to Orland French, Waverly, and Maurice Dusome, Penetang Public School, both seated and Tom Smith, Moore’s Corner and Winston Gillespie, Regent School.
The Martyr’s Shrine has an extensive program to increase the natural beauty of their large property on the Wye River. William Doney, head gardener digs the holes while his assistant George Leduc transplants white lilies along a newly opened path. At 72 Mr. Donley was assistant head gardener at a large Cornwall, England estate before taking up farming in Saskatchewan forty years ago. After one year of retirement he took on the job at the Shrine. The men have 1,500 bedding plants to put out in the next two weeks.
Eight pound nine ounce pickerel, one of forty caught by Ted Holder, pictured in the photo, Alex Smith and Harold Fox at the Port Severn lock last week using minnows. The men kept fourteen of the forty.
Jim Stephenson, who this week opened Midland’s newest industry, Bay Meat Packers on William Street, is seen in his large walk-in cooler surrounded by pork carcasses and freshly strung sausage.
Canadian Tire Store on Bay Street, built only a few years ago, has been completely remodeled to give a wide open effect on the display floor. Dave Finch, proprietor, checks fishing gear with manager Murray McComb.
Canadian Tire Store on Bay Street (north side of Bay between King and Midland Ave.) has been remodeled including the lawn and garden display. Vic Denise is seen arranging a display of the new style plastic garden hoses.
Eight graduates of the citizenship classes sponsored by the MPDHS School Board and held at the YMCA are seen with two of their teachers. Six achieved marks between 95 and 99 percent in English and civics and the other two were over 90 percent. Front left, Mrs. D. H. Wray instructor, Mrs. Frans Wensven, Mrs. J. W. Smith instructor, Mrs. Paul Wittig, Mrs. Guenther Hille, back row, Horst Befort, Frans Wensven, Frank Van Putte, Paul Wittig and Guenther Hille.
New Bank of Nova Scotia opens in Penetang June 11th on the site of the former Pen Bowling Alley.
J. S. Corcoran (Helen) was re-elected president of the Midland Home & School Association. She will be assisted by Mrs. Leonard Reynolds and Mrs. James Cowan.
Miss Barbara Hanes receives her nursing diploma from the RVH Nursing School in Barrie with a prize for the highest standard in bedside nursing. Iris Wilson and June Church, both of Midland, also graduated.
Eleven Cubs of the First Penetang Pack receive their first star and are considered to have “One eye open to wisdom”. Bill Robbins, Stephen Galt, David Hook, Harry O’Hearn, Donald Caughey, Rex Mason, Bob Binkley, Gary Bryant, Robert Larmand, Terry Lapere and Eddie Svoboda.
New vibrated cement blocks available at Penetang Concrete Products, Louis Gignac proprietor.
The old North Simcoe Baseball League disappeared from the sports picture at a meeting in Stayner Tuesday night. In its place, a Bruce League grouping will accommodate the Midland Indians, the lone survivor of the North Simcoe.
Delawana Center books seven conventions this summer.
Retreads by Gammon’s Tire Shop, 189 Dominion Ave, phone 1740.
Midlanders to use old phone books until dial system comes on line in July, other areas in the same book such as Barrie and Collingwood have the new book already.
The Phys-Ed department at MPDHS announced that participants in their programs will need to refrain from smoking entirely during the playing season. They are prepared to withdraw their teams from competition if needed.
Pepsi-Cola Canada has a full page ad thanking Midland and district for making their product the fastest growing beverage in Canada. Ad was placed by the Hinds Beverage Company Orillia.
National Employment Service office manager at Midland, Harold Humphries told this newspaper he has 40 unfilled jobs in applications from local employers and doesn’t know how they will be filled.
Three and a half year old Stewart Duncan, son of Mr. & Mrs. Russell Duncan, Midland Ave., is listed in satisfactory condition after being run over by a car on King Street and suffering multiple chest and head injuries.
Penetang Tourist Information booth moved to a new site at the entrance to town near the Penetang Bottling Company.
Expect 1,000 attendees at annual Alcoholics Anonymous picnic to be hosted by the Midland chapter and held for the ninth time at Little Lake Park.
Pete Lepage’s Eighty-Eight is almost ready to begin another season among the 30,000 Islands and features many improvements made over the winter.
Fifth drowning victim in the area and only the middle of June; 9 year old boys drowns in a pond near Waverly, two boys drowned in the open bay off Tiny Twp, one man drowned at the Musquosh River and another in Orr Lake.
Peggy Turcotte, nee Watson, wins award as a top ornamental swimmer in Toronto. Peggy holds swimming instructor certification and a silver medal in lifesaving.
TEN YEARS AGO THIS WEEK JUNE 1946 — Mayor William Thompson of Penetang informed council that considerable headway had been made with the Wartime Housing Corporation for the erection of 30 houses in Penetang, each to cost about $4,000.00. — Fuel dealers in Midland & Penetang were stock-piling wood for winter use as coal supplies from the United States appeared uncertain. — Citizens of North Simcoe communities were making a concerted drive for clothing, to be sent to destitute people in Europe.– An estimated $1,000.00 in cash and postal orders was stolen from the Elmvale Post Office.
An incensed gardener in Flos shoots three of his neighbours cattle after months of trying to stop them from entering his property. Fined $100.00.
Items from the Midland Public Schools Board monthly meeting; resignation of Alex Docherty accepted with regret, accounts totalling $14, 724.56 were ordered paid, truant officer was called once to Sixth Street School, twice to Parkview and nine times to Regent in the previous month, Parkview principal James Robinson was authorized to purchase two new radio record layers at a cost of $100.00, Fenton’s Welding were contracted to supply three 30 foot flagpoles at a cost of $208.35 and Don Brickett of Parry Sound and Leslie Davidson of RR 2 Midland were officially engaged on the full time teaching staff.
Victoria Harbour staff removed two fences along the public beach at Robbins Point Friday morning as directed by council, Friday afternoon they were back up, Sunday afternoon a group of irate citizens again removed them.
Embassy Theatre in Coldwater closes.
Auto Races every Saturday night under the lights at Wasaga Beach Speedway
Harbourmaster D. G. Hewis told this paper that the scheduled visit next Tuesday of the U.S. cruise ship North American had been cancelled.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – June 1st to 7th 1956
Lumberman’s Safety Association presents Joe Charlesbois a Turtle Club award certificate. Joe won the exclusive award while employed by Mr. Ed Copeland in forestry operations. A heavy limb fell 20 feet striking him on the head but he was saved by wearing his safety gear, the hard hat.
Gleaming OPP pennant displayed by Corporal Blake Ball will identify three new craft delivered by Grew Boats, Penetang, for service in Simcoe and Muskoka waters. The boats are the “Seamaster” type, 20 feet long with an 8 foot beam and 105 horsepower Buchanan motor giving speeds of 27 mph. One will be stationed in Midland, one in Baysville and one in Bracebridge.
Pat Ivey, a University of Western Ontario student holds one of the native masks that will be on display this summer at the Y’s Men’s Club Indian Village in the Little Lake Park.
Mrs. D. H. Wray and Mrs. W. H. Cranston arrange Iroquoian masks in preparation for the opening of Huronia House Museum on June 1st for the 1956 season.
Tom Shaughnessy Sr. caught this seventeen pound, forty inch pike Sunday while fishing with Murray Wagg and Joe Trottier near Fred Hewitt’s Camp in the Minnicog area. Tom Shaughnessy Jr. stands beside his granddad Robert Thompson of Waubaushene who is holding the fish which is almost as long as Tommy is tall.
Eight pound, twenty seven inch Pickerel caught on Sunday by Bev Day above the locks at Port Severn using a minnow from the dock. His mates Ted Holder and Alex Smith caught three between them.
Midland Penetang Huronias play in the Simcoe Soccer Association league, team members are; front row, Andy Clapperton, Wolfgang Jaenisch, Ernst Schneider, Eugen Engelsberger, Siegfried Zingel; back row, Karl Lehr, Gerd Dobkowitz, Wilhelm Schwartz, Berhard Baumann, Rudolph Sindermann and Horst Hasenier.
The formal gardens at the CPR passenger dock in Port McNicoll are readied for another season. Mike Tersigni, assistant to head gardener John Bell, does the work. Staff are inspired by Superintendant S. F. Malin’s interest in the gardens.
Mrs. N. J. Carlson chairman of the CLGU par committee for the Ontario Division has just knocked four strokes off the official ladies par at the Midland Golf & Country Club which now stands at a tough 72. Front row, Mrs. F. H. Bell, Mrs. Carlson, Mrs. Ken Lewis, Miss Jean Wallace, Mrs. Verne Wilson, back row, Bob Sandow, former pro at the club, Mrs. Sandow, Bob Sandow’s father Marc, Mrs. Charles White and Mrs. Gord Moss.
Mary Ann Charlesbois, daughter of Mr. & Mrs. P. Charlesbois, Penetang, received her degree of Doctorate of Dental Surgery from the University of Toronto last Friday and will practice in Toronto.
Penetang merchants find the change from Saturday to Friday night opening has not hurt their trade and in some cases such as the grocery store, business has increased.
At the Roxy, “Guys & Dolls” with Marlon Brando, Frank Sinatra, Jean Simmons and Vivian Blaine. “Forever Darling” with Lucille Ball and Desi Arnaz.
At the Pen, “The Naked Spur” with James Stewart and Janet Leigh. “You’re Never Too Young” with Dean Martin and Jerry Lewis.
Kenneth Wells and Lucille Oille return from their 6,000 mile journey in “Moonstruck ll” their 18 foot outboard cruiser. Leaving Toronto last November, the Wells cruised down the Ohio River to the Mississippi, to New Orleans, Gulf of Mexico and Florida. After spending six weeks in the Caribbean they headed up the inland waterway to New York, the Hudson River, Erie Canal, Buffalo, Welland Canal to Toronto. As the Trent-Severn waterway is closed, the boat will be returned to Midland by truck.
Pro wrestling returns to the Arena Gardens Monday June 4th and every Monday night. Main event is Pat O’Connor vs. Fred Atkins.
Ad rates for the Midland Free Press and the weekend County Herald are .75 cents for the first 15 words and extra words are .03 cents each.
Coldwater Dairy ups the price of milk by 2 cents per quart, from 18 to 20 cents, citing increased cost of production.
Victoria Harbour council orders cottagers to remove fences obstructing beach front at Point Beach. (Robbins Point)
Leo “Lefty” St. Amant has been promoted from parts department manager to salesman at Gropp Motors, joining Ken Tannahill on the sales team.
Alex Docherty, for seven years the supervisor of music in Midland’s public schools and high school, and organist and choirmaster at St. Paul’s United Church, has resigned. Mr. Docherty will take up new duties at Simcoe District High School in September. Main reason for moving was the loss of vocal music beyond grade nine in Midland.
“Heavy Rains Cut Runnels in Tiny Roads” (In sixty years many words have fallen out of common use in Canada, including runnels. The Free Press often uses the word “yeggs” to describe burglars.)
Unable to purchase the final two properties needed to build a road from Hwy 27 to the new high school, Tiny Township has started expropriation procedures.
25 YEARS AGO, June 1931 — The Ralph Budd docked at the Midland Simcoe Elevator with a cargo of wheat from Fort William. She towed the Glen Bogie also loaded with wheat. It was her fourth trip in a month. — Two softball fields had been constructed in Little Lake Park for the use of campers. — The Bijou Theatre in Penetang had announced its re-opening date. The renovated theatre had installed sound equipment. Leslie Letherby, brother of owner Arthur E. Letherby of Barrie, was to be manager. — A resident of Port McNicoll for nine years, Gabriel Gardy was electrocuted when he attempted to cut power on a switchboard near the docks. — The Letherby-Terry-Nicholson mill was to be reopened . Between 140 and 150 men were to be employed for several months.
First orientation day set for 240 grade eight students to visit MPDHS. Regular students will be home studying for exams (maybe).
Tests made by the Simcoe County Health Unit revealed that the water in Little Lake is in A-1 condition. Tests were taken in eight locations.
County Road 6 between Elmvale and Penetang to be paved.
Huronia Museum opens June 1st for the season with curator Arthur Douglas Tushingham and Dr. Arthur Douglas Tushingham, director of Archeology at the Royal Ontario Museum, performing the ceremonies.
Do you remember “Sunbeam Bread” with Miss Sunbeam on the wrapper.
Announcing the opening of a Brewer’s Retail at Port Severn June 1st.
Midland Citizens Band will perform in their new uniforms Tuesday evening when they march from the band hall at Dominion and Midland Avenues to the Parkside Inn where they will perform concert.
Highways Minister James Allan has let tenders for the grading, culverts and granular base on Highway 103 from Waubaushene to Port Severn. Contractors are now engaged in re-surfacing Highway 12 between Waubaushene and Midland and into Port McNicoll.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – May 24th to 31st 1956
Monsignor Castex celebrates his 60th anniversary in the priesthood. Over 100 clergy of the Roman Catholic Church attended. Most Rev. B. I. Webster, D.D. Bishop of Peterborough, Rt. Rev. J. M. Castex, James Cardinal McGuigan of Toronto and Rt. Rev. E. Brennan Toronto, toastmaster.
85 year old Monsignor Castex at a reception for his 60th Anniversary in the priesthood. Chatting with Crown Attorney Wm. Thompson, QC. (Monsignor Castex died in 1971 at age 99.)
Mr. A. L. Fitzgerald’s retirement as superintendent of Beatty Bros. Foundry. Mr. Fitzgerald is speaking to Alf Atkins, on left, one of three men who were working at Beatty Bros. when Mr. Fitzgerald started 32 years ago. The other two were Jack Russell and Archie Cote.
Girl Guide Cookies. Doreen Moreau, 2nd Midland Guides, Mrs. Thomas Shaughnessy district commissioner and Ann Davidson 3rd Midland Brownie Pack get ready for the annual event which takes place in Midland this Saturday.
Looking deserted because of the unseasonable weather is John Deako’s (Johnny fries) new park store at Little Lake. All cement block construction is a big improvement over the wooden booth that occupied the site for many years. Band shell in the background.
Seventy year old Mrs. Midas King was found by her son Clifford at Basswood Point on Gloucester Pool Channel early Sunday afternoon. Wet from the rain and wearing only her underclothes and no shoes she was found some eight air miles from her home, she had been missing for over 48 hours.
Searchers helping to locate Mrs. Midas King, nee Simons, near Honey Harbour over the weekend. Soldiers from Base Borden, local police, neighbours and relatives all tromped the wet bush between Honey Harbour and Gloucester Pool. Mrs. King had been spotted twice over the three days in the area of the new Trans Canada Highway and was finally found by her son Clifford near Gloucester Pool Channel. Andy Simons Mrs. Kings brother, Adam King, Mrs. Dave Tobey (a sister), Mrs. Violet Simons and Larry Simons.
Sixty-six members of the RCASC (Royal Canadian Army Service Corps) School at Camp Borden regroup to resume the search for Mrs. Midas King along the route of the new Trans Canada Highway north of Port Severn.
Excavator owned by contractor Thomas G. Wilcox & Sons loads waiting dump trucks as they prepare the site of the new municipal building on Dominion Ave.
Top athletes at MPDHS honoured at an awards banquet in the new cafeteria Thursday night. Marlene Gouett was the top girls athlete and Mel Windover the most valuable player on the senior boys basketball team.
Five MPDHS athletes receive their letter at the athletic dinner Thursday night. Letter awards are based on an accumulation of points over your high school career. Carol Cowan, Judy McIntyre, Frank Holmes, Bob Marshall and Bruce Calvert. Not present, Angela Cronin.
Donna Kinnear (Mrs. Jim Nicholson) receives the J. J. Robins trophy for competition between Georgian Bay Schools junior basketball teams from Mr. Robins the former MDHS principal. Donna is the captain of the Midland team which won this past season. Since first awarded in 1935-36 Midland has won it all but six times.
Result of a crash on Bay Street early Saturday morning, two identical model cars with near identical damage. Total cost was estimated at $1,400.00 by Midland police.
Midland council OK’s $27,000.00 contract to repave Kings Street from the town limits to the CNR tracks; from King west on Yonge to Fifth; from King west on Bay to Fourth and thence north to the junction of Vinden Street and the county road. Brennan Paving Co. will begin immediately as they are now completing the paving of Highway 27 from Wyebridge to Elmvale.
Three seaman’s unions sign new wage agreement with the Lake Carriers Association after a nine day strike. 5,000 men are affected by the new agreement that sees the monthly rate for a deckhand go from $190 to $284.
Tourist promotion fizzles, 21 Midland merchants met a week ago and enthusiastically called for a promotion planning meeting Thursday morning but only four members showed up.
Georgian Bay Hunters and Anglers members plant five thousand Scots Pine and one thousand permanent trees including Larch and White Pine on their new club site below the Martyr’s Shrine.
Tomato plants and a good selection of annuals for sale at Vivian Gardens, 365 Hugel Ave. W.
Waitresses wanted, both full time and summer help, Totem Pole, Penetang.
Last of a series of narratives written by Rev. James Evans, a Methodist missionary, 120 years ago. “Called to Council, the Ottawa’s and Chippewa’s , each of whom claimed the Munnedoolin Island, relinquished the same on condition that the Governor should secure it to both and their heirs forever. It was likewise proposed that the Chippewa’s from Saugeeng should relinquish all title to their extensive territory on Lake Huron, retaining only the peninsula between the said lake and the Georgian Bay, the line to commence at the bottom of Owen’s Sound and to extend directly across the peninsula. Thus the Indians again were removed from the spot to them dearest on earth and constrained to give place to those who, receiving greater encouragement, make consequently greater improvement.” Rev. James Evans took exception to a great many statements in Sir Francis Head’s official reports regarding these transactions and published a series of articles in the April 11 and May 9, 1838 issues of the Christian Guardian.
For the first time in the history of organized ski competitions in Canada, one club has been granted the Canadian Championship two years running. Midland Ski Resorts Limited will again host the Canadian ski jumping contests February 23 and 24, 1957.
Ten Years Ago – 1946- A Tiger Moth plane, en route from Oshawa to the Muskoka Airport, made a forced landing in the field back of Regent School; The Small Holdings Branch of the Department of Veterans Affairs announced the purchase of the 43 acre M. J. McCullough farm on Highway 12 (Yonge Street) west of Midland. The land was to sub-divided into 2 acre lots for a veteran’s housing development; Midland High School track star Doug Kettle captured three firsts in an Ontario Athletic Commission meet at Geneva Park, Orillia. With entry limited to three events, Doug chose high jump, running broad and hop step and jump, easily winning all three; The SS Capt. George Hindman ran aground on a sand bar at the entrance to Midland harbour; Henry Gauthier, 34 year old Penetang veteran, was appointed Indian agent at the Christian Island Reserve.
Cartoon section of this weeks paper includes Blondie, Muggs and Skeeter, Elsworth and POGO.
Over 400 attend the unveiling Sunday afternoon in Bradford the plaque honouring Prof. W. H. Day. originator of the Holland Marsh.
Midland Council orders dog catcher Jos. Proulx to crack down on dogs running loose. Any dog unclaimed within 24 hours will be destroyed.
Deaths on Simcoe County roads totalled 45 in 1955 and 1,111 provincially. (In 2015 there were 299 deaths on OPP patrolled roads in Ontario. There were 1.5 million vehicles registered in Ontario in 1955, in 2015 there were 11.5 million.)
Penetang Bottling Co. Ltd. announces the new “King-Size” bottle. King-Size, 6 bottles for 41 cents and Standard-Size, 6 bottles for 36 cents (plus deposit). Actual volume of the bottles is not given in the ad.
Boyce Garage at 190 Dominion Ave E. is advertising the new Studebaker models.
87% of Ontario farms are served by electricity in 1956
Anthony Van Steedon, 41, captain of Toronto furrier Jack Creed’s luxury yacht drowns in the Haystack Rapids on the Musquosh River, local Capt. T. O. Light survives as their small boat capsizes.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – May 8th to 15th 1956
Girls Corps at MPDHS marched on the field during the annual cadet inspection on what was a very cold afternoon for shorts and a blouse. Leaders of the corps; front row, Sylvia White, Vera Sibbald, Simone Beauchamp, Betty Binkley, Doris Hyde, Murielle Martin; back row, Marie Lepage, Jean King, Hazel Boucher, Lucille Duquette, Ruth Gibson and Marita Lalonde. (Short hair was in)
Dancing around the Maypole was one of the highlights featured during a program in the MPDHS gym following the annual cadet inspection Wednesday afternoon. Performers included, Ann Williams, Carol Cowan, Trine Ulrichsen, Kathleen Vincent, Nancy Jardine, Helen Parker, Linda Contois, Pat Fraser, JoAnn Holmes, Diane Ball, Ruth Humphries, Pat Fitzgerald, Dorthea Reynolds, Barbara Piitz, Jackie Jenkinson and Frances Marchant, directed by Miss Barbara Murphy.
Getting bigger every year, the MPDHS Cadet Corps is seen at their annual inspection on the playing field of the school. Some cadets had to appear in partial uniform due to the increase in numbers. At a meeting the same day a motion was approved to increase the size of the corps from 235 to 350. The Girls Corp can be seen in white sweaters to the right. Also attending was the Midland Citizens Band and a platoon of Sea Cadets. (Many of the houses in the background along Yonge St. were constructed by military veterans of WW 11 under the Veteran’s Land Act of 1942. Over 140,000 ex-servicemen took advantage of the low cost long term loans. Recently a new subdivision was started on the vacant property shown here and the heavy hardwood bush that grew up on this open field over 60 years was cut down. Also note the ski jump towering on the horizon.)
A feature of the annual cadet inspection at MPDHS was a gymnastics display under the direction of instructor Doug Swales. Mel Windover and Gary Baker are seen flying over six of their mates.
Philip Arbour Post Master at Victoria Harbour for the past 28 years, right, has reached retirement age. A Harbour resident for 60 years Mr. Arbour meets with Ken Pelletier his successor.
Field secretary for the CNIB, Wm. Murdoch, Mrs. A. H. Tweedle, past president of the Midland Canadian Club and Doug McMillan, president of the Unamous Hi-Y Boys, chat after Mrs. Tweedle had officially opened the boys tea in the YMCA Saturday afternoon. The tea and bake sale funds were donated to the CNIB. ( I suspect this photo is reversed as four people appear to be left handed.)
A familiar landmark at Midland’s Little Lake Park the old log cabin is being removed completely. A gift from the late Dr. Garnett E. Tanner, it served as the post office for the campers for a number of years and was then made into living quarters.
Mike Dion of the Columbus Jets gets a hit as the season gets underway for Midland Lions Club Little Baseball League. Catcher for the Montreal Royals is Johnny Thomas and the umpire is Fred Scott.
Huge new bottling machine installed recently at the Penetang Bottling Co. turns out soft drinks at the rate of 240 cases an hour, a 50 percent increase over previous equipment. Process starts with the top photo where Ed Charlesbois is shown putting full cases of bottles onto the endless belt which takes them through the washer. A pneumatic machine lifts all 24 bottles from the case at one time. The delivery end of the washer is shown in the second photo, where bottles travel past an inspection point with Mrs. Phillip Quesnelle (nee Exilda Contois) shown searching for dirty, chipped or broken bottles. Heart of the whole machine, third photo, is where the bottles receive a charge of syrup, then a charge of water and carbonation and finally the all important cap. The last photo is the delivery line where half way along the mixer turns the bottles over and over to thoroughly mix the contents. At the far end Martin Quigley takes the bottles from a turntable and places them into a case for delivery.
Official sod turning for Midland’s new municipal building on Dominion Ave, former site of Central Public School. Mayor Charles Parker did the honours about 5:15 PM Monday evening using a gold or was it bronze handled shovel. James Clarkson, H. G. W. Paice, L. R. Diver, Neville Keefe, Mrs. Paice, Mrs. Ross Willett (Pat Carroll), Robert Cripps, alderman Ossie Downer, Charles Onley, Clint Smith, Bill Logan, R.G. Gilles, contractor Alfred Rei and deputy reeve Bill Cranston.
Seventeen teen aged drivers turned out to take the Midland Jaycee’s Road-e-o course at the town dock. Drivers had to complete various maneuvers and tests during the competition, a large crowd turned out despite the poor weather. Norm Eisenberg was the overall winner and will advance to the regional finals in Woodstock.
Commencing May 25th Penetang stores will be open late Friday nights instead of Saturday.
Workmen’s Compensation premiums to become mandatory for retailers, January 1, 1957.
25 YEARS AGO this week– Canadian Department Stores celebrating its third year of operation in Midland, employed a staff of fourteen under management of Larry Barnum and was located at Bay and King Streets. — Midland Steam Laundry and Bon Marche Manufacturing Company, owned and operated by N. K. Wagg, re-opened with modern equipment following a fire which destroyed the former plants. — The Ontario Government decided to proceed with construction of two buildings for the mentally insane at Penetang at a cost of $500,000.00 and planned removal of all criminally insane from Guelph to Penetang, leaving Guelph to be used as a reformatory for first offenders. — James Hamilton died at Orr Lake at 90 years of age on the farm owned by his father and operated as a wayside inn for travellers in the district’s pioneer days (Penetanguishene Road). — Midland Kiwanis Club provided more than 10,000 bottles of milk to various Midland schools and 30 members undertook supervision of 30 boys as part of their good citizenship training.
Excerpt from a narrative written by Methodist missionary Rev. James Evans which first appeared in the Christian Guardian September 28th, 1836 and was re-published in eight parts in the County Herald under the title “Mission Tour on Lake Huron”. Monday August the 8th Munnedoolin Island: This morning the ground, excepting the bark wigwaums and red faces reminded one of a fair in the happiest of lands; — all astir, walking, running and in high glee. But there is one difference which has been a subject of remark among us – that among about 2,000 adults, we have never heard an angry word, or seen an angry look; much less have any of them come to blows, either in anger or diversion. About sixteen hundred men, women and children received their presents from the British Government. In this manner the Indians were annually supplied with clothing and many had spent nearly the whole summer months in journeying to the place of distribution. What was distributed; Deserving Chiefs, 2 1/2 yds woolen cloth, 1/2 yd stroud (a course woolen fabric), 3 yds linen, 1 three point blanket, 1 cotton shawl, 1 oz thread, 4 needles, 1 comb, 1 awl, 1 knife, 4 lbs tobacco, 3 lbs ball, 9 lbs shot, 4 lbs powder, 6 gun flints and if needed a gun. Deserving Warriors: 2 1/2 yds rateen (a course loosely woven cloth), 2 1/2 yds cotton, 1/2 oz thread, 3 lbs tobacco, 2 lbs ball, 7 lbs shot, 3 lbs powder, 4 flints and 1 blanket. Common Warriors: Same as last except 1 lb less tobacco. Deserving Women (being the wives of chiefs or warriors who had been in actual service during the late war): One 2 1/2 point blanket, 2 1/2 yds cloth, 1 1/4 yds molton ( a twill fabric with a velvet like nap on one side) , 2 1/2 yds printed calico, 1 oz thread, 4 needles, 1 awl, 1 knife and 1 comb. The remainder of the women received the same except lesser quantities. Boys from 10 to 15 years of age: One two point blanket, 1/2 yard rateen, 1/2 yd stroud, 2 yds cotton. Boys from 5 to 9 years of age: 3/4 yd caddies (?), 1/4 yd stroud, 1 1/2 yds cotton and one 1 point and a half blanket. Girls 10 to 15 years of age: 3/4 yard caddies, 1 1/4 yd stroud, one 2 point blanket and 2 yds calico. Girls 5 to 9 yers of age: 1/2 yd caddies, 3/4 yd stroud, 1 1/2 yd calico and one point and a half blanket. Children under 5: 1/2 yd stroud, 1 yd calico and one 1 point blanket. Pork and flour was also distributed to all.
Description of Hudson Bay Point Blankets from Wikipedia: The short black lines woven into the blanket just above the bottom set of stripes are referred to as “points.” About four inches in length (except in the case of half points, which are two inches), they indicate the finished overall size (area) of a blanket and allow a blanket’s size to be easily determined while remaining folded. The “point” system was invented by French weavers in the mid-18th-century since then, as now, blankets were shrunk as part of the manufacturing process. The word point derives from the French empointer, meaning “to make threaded stitches on cloth.” Although the company had been selling blankets since its founding in 1670, the first Hudson’s Bay “pointed” blankets appeared in 1780. A four point blanket today is approximately a double bed size.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – April 16th to 30th 1956
IGA grocery store promotion of fresh Florida oranges comes to Regent Public School. Ruth Newman, Miss Florida Sunshine, distributes oranges to every child in Midland primary classes. Brenda Dalziel and Shirley Hornsby and teachers Bill Barnett and Mac Wilson watch from behind.
Mrs. M. Adamson celebrating her 85th birthday on April 12. She has been a Midland resident for 20 years.
Hero of Dieppe where he won the V.C., Major John W. Foote, minister of Reform Institutions for Ontario has agreed to establish a pilot project for a conservation farm in North Simcoe at a meeting in Midland Thursday night. Greeted here in the Midtown Motel by Simcoe North MPP Lloyd Letherby of Coldwater, left, and Reeve Fisher Ganton, center, whose Medonte Township is ideal for the project. This is a reform school for juvenile delinquents, know to us as Camp Hillsdale.
Eugene Ladoucer, left Midland for British Columbia in 1907 and this is his first trip back home since then. He visits with his brother Peter, on the right, of 173 Lindsay Street. A sister, Jenny, Mrs. Joe Lefaive of Perkinsfield was surprised to see her brother. The three are the only survivors of 5 boys and four girls of Mr. & Mrs. Eugene Ladoucer Sr., originally from Cedar Point. Eugene has had his own cattle ranch near Kamloops most of his working life.
Young players from MPDHS perform the play “Happy Journey” in the hall at St. Paul’s United Church part of a district high school drama festival. Patsy Perrin greets bride and groom Vera Sibbald and Dennis Murphy and their attendants in the back seat, Anne Shiels and Frank Okenka.
“Happy Journey” had a happy ending Friday night for these students from MPDHS when their play won the top award in the Georgian Bay Drama Festival staged at St. Paul’s auditorium. Dennis Murphy, Frank Okenka, Anne Shiels, Wayne Parker, Patsy Perrin and Vera Sibbald.
Three area sightless citizens are seen at the Midland YMCA receiving knitting instruction from Miss Emily Philpott of the Barrie CNIB office. Meetings are held every two weeks. Seated are; Mrs. George Smallwood, Midland; Miss Georgina Robitaille, Penetang; Miss Cassie Campbell, Midland.
John Fraser, veteran Scottish baker loves living and working in Midland. John came here in 1924 and worked for A. W. Ruby. When Ruby sold to Ontario Bakers John moved to Timmins returning in 1926 when Ruby got back into business. He worked in Toronto during the war returning to Midland he worked for Art Fry, Stoneburghs and finally Burnies on Elizabeth Street.
1950 model car pulled from the bay Sunday at the Simcoe Elevator slip. Owned by Leonard Archer of Elmvale who had parked it 66 feet away from the water while he visited a friend on board a freighter only to be notified it had rolled into the bay. The ship crushed the roof as it moved away from the dock and the car is a right off. The location is behind Boyd’s service station on the south east corner of Yonge and King Streets. Good view of the entrance to Wagg’s Laundry on Yonge Street.
Permanent paving coming for Penetang streets. Province to fund 50% of the five mile project and 80% of the replacement of the bridge over Copeland Creek. Councillor Ray MacDonald explained that doing a larger project reduced the cost and that a 20 year debenture would be used. It currently costs $4,500.00 per year to oil the streets.
Shirley Ann Thompson, daughter of Mr. & Mrs. Robert Thompson, Midland, marries James Albert Park, son of Mrs. and the late J. H. Park, Midland. The flower girl was the grooms niece Mary Jane Park. March 24th at the Calvary Baptist Church, Midland.
$15,000.00 bequest from the estate of Emily A. Bryson gives hope that St. Andrew’s Hospital may break even this year.
Public Utilities Commission in Midland studies a proposal to meter water to town residents.
Georgian Bay Hunters and Anglers plans to proceed with scheduled projects on its 50 acre property below the Shrine, President Bill Russell revealed. Plans include a club house, trout ponds and reforestation.
Construction started on Wednesday April 18th of the new County Aged Home by local contractor W. G. How, estimated cost, $275,000.00. Emery Electric will do the electrical, George Price & Co. of Coldwater the plumbing, W. Lalonde of Midland will do the painting and decorating. Percy Crawford of Midland will superintend the project.
Polio shots available to all elementary students in the County this year, with parental consent.
Mostyn’s advertising two stores to serve you, 234 and 238 King Street.
Hay selling for $20 to $25 per ton this spring in North Simcoe.
Public Notice – Parking meters will be in operation in Midland, Monday, April 30th. (they still put them away every winter)
Door to door peanut canvas by the Midland Y’s Men’s Club to raise money for playground equipment.
Public Notice – All putrid and decaying animal or vegetable matter shall be removed from all cellars, buildings, out-buildings and yards on or before the 1st day of May each year. Simcoe County Board of Health
Midland Community Concert Association holds last event Monday night, advent of television blamed for declining numbers. Soprano Ethel Barrymore Colt headlined the final event.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – April 8th to 15th 1956
With several of her sister ships, CSL’s Stadacona ploughed her way through thick ice fields Thursday and headed for the lakehead. The Georgian Bay cleared Port McNicoll harbour at 5:00 PM Wednesday. One ship is already reported Midland bound with grain for the empty elevators.
Midland’s only championship winning hockey team this season is seen in the lobby of the Georgian Hotel having just returned from Parry Sound Saturday night. They won the junior OHA section of the provincial Little Hockey League finals. Front row, Bill Argue, Doug Scott, Cecil Merkley, Jim Cleaver, Mike Dubeau; seated on chesterfield, Barry McIlvarey, Willard Perrault, Jim Dubeau, John Swan captain, Dennis Abbott, Wayne Holden, Chester Graham; standing, Jerry Beteau, Morley Bath, Paul Devillers, Herbie Wright and Doug Faint. Men at rear, Rev. Len Self, Jack Doughty, Clare Holden and Jack Gouett.
Joanne Cruise, dressed up as a lady bug for the Midland Figure Skating Club’s annual carnival sponsored by the Midland Lions Club.
Two senior members of the Midland Figure Skating Club drew rounds of applause for their performance in the “Ice Follies of 1956” sponsored by the Midland Lions Club. Mary Ann Nicholson and Donna Kinnear.
“Midland Ice Follies of 1956” tin soldiers give a snappy salute, Kennedy Self and David Walker.
Many hours of hard work by parents goes into costumes for a skating carnival. Midland Figure Skating Club participants Lorraine Jones, Jane Moss and Dianne Marcellus make convincing fairies.
“Men About Town” seen at the Midland Figure Skating Club’s “Ice Follies for 1956” Friday and Saturday night are Linda Stewart and Judy Hack.
Scout leaders John Reynolds and Jack O’Hara of Penetang chat with conservation expert Stan Hudson of the Ontario Department of Lands and Forests after a conservation rally at the Parkside Inn last week. Mr. Hudson was the chief speaker.
Theophile Fortier (left) had been working on the CPR railway for 44 years when this photo was taken inside the locomotive shop in Port McNicoll Friday afternoon. He is receiving a wallet, with cash, from Jack R. Lloyd division master mechanic on the occasion of his retirement. Mr. Fortier was raised on a farm on Conc. 19, Tiny Twp. and has worked for the railway since March 17, 1916.
After 25 years as a Great Lakes captain Charles H. Cole had never earned a “topper” for opening the season in any port until this year. First into Sault Ste. Marie, Port Arthur and now Port McNicoll. The master of the John E. F. Misener of the Colonial Steamship Ltd. shakes hands with Reeve Albert Calvert, while Chief Engineer J. H. McCleverty of Wales Ont. and councillor Jack Fisher look on. The Misener delivered 600,000 bushels of wheat to the almost empty elevator.
Elmvale Bantam team were runner-ups in the Ontario Minor Hockey Association finals, both the first place Juvenile team and the Bantams will be given jackets at a banquet to be held in the community hall April 25th. Team members front row; Raeburn Lawson, Andy Copeland, Bill Hogg the captain holding the Harold Dunk Trophy, Elvin Frankcom, Earl Spring; middle row, Russell Ritchie, Nelson Jordan, Ross Heacock, Bill Large; back row, C. M. French manager, Ed Bumstead, Sky Flotron, Bob Greenlaw and Larry Simpson. Absent, Tory Stevens.
It’s a long way to Peterborough where members of the Midland Hi-Y Club attended a convention of clubs in the canoe city. Bob McIntyre, Sandra Kettle, Bob Thompson, Helen Smith, Bev Day and Jane Bell. Bob Megaw and Shirley Perrin also attended.
George Ingram stokes his evaporator and fills his maple syrup tins in his sugar shack at the end of Hugel Avenue as he has for thirty years. His sugar bush is soon to become the site of MPDHS.
Syrup – Oui, Maple – Non, Canned Cane. One gallon cans of coloured cane sugar labelled in French are being sold as maple syrup locally, better to buy from local sugar bushes.
Midland PUC and Local 1932 of the International Brotherhood of Electrical Workers signed their first agreement Friday afternoon. Signing for the workers was Morland Mount, Lloyd Alsopp and Elgin West.
Midland Housing Authority is having trouble with wet basements in the new low rental housing development on Donalda Street.
$200,000 subdivision for west end of Midland, builder to start Monday. Russell J. Peever, general contractor from Weston and local real-estate agent V. B. Strickland plan to build seventeen three bedroom brick homes in the Ingram subdivision opposite the new high school. Two versions, one at $11,200 (38 x 26) and a larger home for $11,700, (41 x 25).
Waverly youth, Warren K. French wins $800.00 bursary, he will pursue his post graduate studies in organic chemistry.
Didace Grise announces the construction of 24 more suites at the Delawana Inn this year bringing the total capacity to 250 guests.
A list of all the citizens, organizations and businesses that contributed to the new hospital building fund in 1956 was printed in the April 13th paper along with the amount donated.
Huronia Museum – Looking Back 60 Years ago in North Simcoe – April 1st to 7th 1956
Easter Sunday proved a perfect day to parade your Easter finery, these girls were on their way to church. Margaret Cadeau, Anne Doran and Colleen Pearson. | cc/2020-05/en_middle_0078.json.gz/line1291 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.