pred_label
stringclasses
2 values
pred_label_prob
float64
0.5
1
wiki_prob
float64
0.25
1
text
stringlengths
112
962k
source
stringlengths
39
45
__label__cc
0.594754
0.405246
Jackie Guzda Past Video Segments – Ebru Today Politihoot Athletes & the Media Circus February 12, 2013 by jacquelineguzda Watch: http://www.youtube.com/watch?v=BS4fNq9I7NA Lance Armstrong, Manti Teo — great athletes, but has today’s media circus made them to appear greater than the athletes of the past? Would a Stan Musial — “Stan the Man” — who died this week, be as notable without the narrative of beating cancer, as with Armstrong, or winning an inspired game in the name of Teo’s dead “girlfriend”? Gun Control and the Media Watch: http://www.youtube.com/watch?v=LKuoQ6kExrY Is Partisan News Media Losing Its’ Power? Watch: http://www.youtube.com/watch?v=Ehv_S72fvwg After years of leading in the ratings war, FOX News’ numbers — and particularly their credibility — are starting to fade. MSNBC, who followed the business model of FOX but swung to the left, had a spike in ratings, but their credibility is down, also — watch the discussion. 2012 Campaign Ads Review Watch: http://www.youtube.com/watch?v=zhXCFCQRcms The Presidential campaign is over — Obama won, Romney lost. Let’s see who did things right, and what went wrong. Planned Parenthood/Kim Davis & the Pope
cc/2020-05/en_middle_0087.json.gz/line1337771
__label__wiki
0.950622
0.950622
Jeremy Paxman’s Newsnight Quiz 2010 There are various things about Newsnight which ought forever to remain secret. Not the least of them being the occasional tears, fist-fights, and typewriters through windows which marked the early days. Still, here are a few things you might admit to knowing. Or perhaps not. 1. Which presenter complained that they were having a difficult time on air, because "I've got Ian Smith coming in my ear"? Answer: The late, great Charles Wheeler who used to cite this as an example of why he was much better on the road than in the studio. For the avoidance of doubt, he was talking about interference in his earpiece. Ian Smith – another good reporter – tragically died after a skiing accident. 2. Which Nazi survived the Allied liberation of Berlin, only to die when invited to London for a Newsnight discussion about the legacy of his party? Answer: Albert Speer – minister of armaments and war production for the Third Reich and Hitler's chief architect – who in 1981 was flown to London for Newsnight but dropped dead at his hotel. 3. In the days when the programme had two presenters each night, who observed that the secondary role, dealing with the arts and so on, was "like being the programme wife"? Answer: The sainted Joan Bakewell, who has spent most of her life labouring under Frank Muir's sobriquet of "The Thinking Man's Crumpet". 4. Our theme tune's composer shares his original surname with a 20th century chancellor of the exchequer famously likened to a dead sheep. What is his professional name? Answer: It was George Howe – better known by his pseudonym, George Fenton. Although our theme is obviously his most distinguished and best-loved work, his other work includes scores for Gandhi, Cry Freedom, The History Boys and – no rude comments please – Groundhog Day. 5. In what context was Tony Blair asked about Skinny and Wriggly? Answer: Tony Blair was asked how he reconciled his Christian beliefs with accepting political donations from a publisher of pornographic magazines, whose titles included Skinny and Wriggly, Horny Housewives and Mega Boobs. 6. In the early days, explanatory pieces, especially about the more recondite aspects of Kremlinology, were named after one of the presenters. What were they called? Answer: Tusorials, after John Tusa, one of the original presenters of Newsnight. 7. What question caused an expression of utter bafflement to pass across Colonel Gaddafi's face during a live interview from his tent in the desert? Answer: "Isn't that rather pie in the sky, Colonel?" – the phrase seemed to have no ready Arabic translation. 8. Before the 1997 election, which Tory cabinet minister (no oil painting himself) sniggered and cried "You said it!" when a cack-handed presenter turned to Margaret Beckett with the words "Let's get it from the horse's mouth"? Answer: David Mellor. Margaret Beckett shrugged it off, saying: "Don't worry about him." 9. Whose first answer in a live Newsnight interview was a long pause, followed by: "Can we start again?" Answer: Vivienne Westwood, who had been invited on to the programme to talk about the death of haute couture. Her PA sent a note the next day saying how much Dame Vivienne had enjoyed the interview. 10. Which thriller writer once delivered a piece to camera under the quizzical gaze of Margaret Thatcher? Answer: Robert Harris, the Newsnight reporter turned bestselling author. 11. Which political reporter married a misfit, and made such a name for himself by being a nuisance at byelections that he was given a role reporting the results of the contest at Dunny-on-the-Wold in Blackadder III? Answer: It was Vincent Hanna. He married Joan Fitt, one of the five daughters of Gerry Fitt (the Miss Fitts), who formed the heart of the SDLP leader's West Belfast political machine. 12. Which foreign secretary left crucial international negotiations to take part in a Newsnight interview, only to discover that there was no camera, studio nor slot in the schedules? Answer: Lord Carrington and the incident took place during the 1979 Lancaster House negotiations to pave the way for Zimbabwean independence. Newsnight should have been on the air, but was not being broadcast due to an industrial dispute. The editor insisted that the production team turn up each day to a grungey room where they pretended they were on the air. Some especially over-caffeinated producer had booked Lord Carrington for an interview, without telling him the whole thing was an exercise in fantasy television. Carrington failed to see the joke, exploding he had better things to do than give "a fictitious interview for a fictitious programme". 13. What became of the Newsnight sandpit for the Falklands War? Answer: Peter Snow's sandpit was retired to the Imperial War Museum. 14. In the early 1990s, which economics editor was filmed consulting a Blackpool clairvoyant for insights about the state of the national finances? Answer: Graham Ingham, who subsequently became a senior official at the IMF in Washington. Stunts were especially popular as attempts to make the dismal science of economics interesting. Graham appeared as everything from a croupier to a supermarket check-out operative. For a couple of years I offered a prize of a magnum of champagne for the producer who could get him to utter the silliest piece to camera – won after he appeared dressed from head to toe in white in a 'clean room'. 15. After yet another British sporting disaster, which board game character appeared in a discussion to illustrate that there were some sports we were still good at? Answer: The world Cluedo champion, dressed as Colonel Mustard, who was interviewed for the programme in 1995. Sadly, no one had been able to find a length of lead piping before he reached the studio. 16. Which top secret item spent a couple of weeks in a corner of the Newsnight office while the nation's police forces hunted for it? Answer: In 2000, a rare Enigma encoding machine was stolen from Bletchley Parkand held for ransom. The thief subsequently posted it to Newsnight, where it sat in a cardboard box in the corner of the office for ages. Had reporter David Sells not complained about repeatedly stubbing his toe on it, it would still be there. 17. Which Home Office minister was once a Newsnight producer? Answer: Phil Woolas, who, after being chewed up and spat out by Joanna Lumley,makes frequent appearances on the programme to reassure the nation that the government has immigration under super-tight control. 18. Name the cow brought into the Newsnight studio for an interview with Peter Snow about the causes and effects of the 1990s BSE crisis? Answer: Dolly. 19. What happened to the Newsnight editors responsible for the cow, an artificial rainforest in White City to illustrate climate change, and a studio discussion inside a fake football dugout? Answer It is a trick question! They have all had plastic surgery and are living under assumed names in Uruguay, I hope. Article courtesy of The Guardian. Photograph: David Levene. Original found here. A wake-up call for those sick of politics Something’s clearly wrong with British politics but that’s no reason not to vote in the general election If I were king for a day, I would ban open-plan offices Such offices tell us what our bosses think of us – that we are employed to fulfil a mechanical task and we are interchangeable It’s only a beard but it’s a big burden Jeremy Paxman's holiday beard has become one of the most discussed topics in the news after he decided not to shave it off before appearing on air, but the reaction has surprised him Jeremy Paxman to tread the boards again A theatre production about Macbeth will see Jeremy Paxman take to the stage with TV actor Christopher Eccleston
cc/2020-05/en_middle_0087.json.gz/line1337779
__label__cc
0.545393
0.454607
KSIR 1470 AM - Estes Park Colorado Estes Valley News Estes Valley Trader Photos - Page 2 Program Hosts Brian Schaefer Bob Suarez New Radio Station for Estes Park on 1470 AM! We've learned that the Town of Estes Park has returned 1470 AM to the air as a 10 Watt Traveler's Information Station (TIS). The license was granted on November 13, 2014. It won't be like the old KSIR days though... these stations are limited to broadcasting traffic information and emergency announcements... no music and no commercials. Most operate using a recorded announcement that repeats continuously. The transmitter is located on MacGregor Avenue. The new station should cover the town site of Estes Park with a good signal, but it probably won't go too far into the park or down into the canyon at this low power. It also won't be very interesting to listen to, but at least the town's residents will have a local station that can broadcast announcements in the event of an emergency. As we know, there have have been several major floods and forest fires over the years, so this is a good thing overall. It is nice to hear a radio signal on 1470 again in the Estes Valley. We congratulate the town on this innovative way of bringing 1470 AM back to life! The call sign of the new station is WQUX980. That definitely doesn't roll off the tongue as nicely as KSIR! For those interested, here is a link to the FCC license data: Estes Park Traveler's Information Station. Edgar Reihl is the author of the KSIR1470.reihl.org web site and a former consulting engineer at the station. Comments are welcome but will be reviewed before being published. Estes Park Radio Fcc Am Query Ksir History Ksir Photos Ksir Pictures Ksir Web Site © 2007 - 2020 Klinger Lake Multimedia
cc/2020-05/en_middle_0087.json.gz/line1337781
__label__wiki
0.908495
0.908495
U.S. Supreme Court Throws Out Murder Conviction of Mississippi Man Over Removal of Black Prospective Jurors Posted 1:07 PM, June 21, 2019, by Associated Press, Updated at 05:06PM, June 21, 2019 The Supreme Court on Friday threw out the murder conviction and death sentence for a black man in Mississippi because of a prosecutor’s efforts to keep African Americans off the jury. The defendant already has been tried six times and now could face a seventh trial. The removal of black prospective jurors deprived inmate Curtis Flowers of a fair trial, the court said in a 7-2 decision written by Justice Brett Kavanaugh. The long record of Flowers’ trials stretching back more than 20 years shows District Attorney Doug Evans’ “relentless, determined effort to rid the jury of black individuals,” with the goal of an all-white jury, Kavanaugh wrote. In Flowers’ sixth trial, the jury was made up of 11 whites and one African American. Prosecutor Evans struck five black prospective jurors. In the earlier trials, three convictions were tossed out, including one when the prosecutor improperly excluded African Americans from the jury. In the second trial, the judge chided Evans for striking a juror based on race. Two other trials ended when jurors couldn’t reach unanimous verdicts. “The numbers speak loudly,” Kavanaugh said in a summary of his opinion that he read in the courtroom, noting that Evans had removed 41 of the 42 prospective black jurors over the six trials. “We cannot ignore that history.” In dissent, Justice Clarence Thomas called Kavanaugh’s opinion “manifestly incorrect” and wrote that Flowers “presented no evidence whatsoever of purposeful race discrimination.” Justice Neil Gorsuch joined most of Thomas’ opinion. Thomas, the only African American on the court, said the decision may have one redeeming quality: “The state is perfectly free to convict Curtis Flowers again.” Flowers has been in jail more than 22 years, since his arrest after four people were found shot to death in a furniture store in Winona, Mississippi, in July 1996. Flowers was arrested several months later, described by prosecutors as a disgruntled former employee who sought revenge against the store’s owner because she fired him and withheld most of his pay to cover the cost of merchandise he damaged. Nearly $300 was found missing after the killings. Defense lawyers have argued that witness statements and physical evidence against Flowers are too weak to convict him. A jailhouse informant who claimed Flowers had confessed to him recanted in recorded telephone conversations with American Public Media’s “In the Dark” podcast. A separate appeal is pending in state court questioning Flowers’ actual guilt, citing in part evidence that reporters for “In the Dark” detailed. “A seventh trial would be unprecedented, and completely unwarranted given both the flimsiness of the evidence against him and the long trail of misconduct that has kept him wrongfully incarcerated all these years. We hope that the state of Mississippi will finally disavow Doug Evans’ misconduct, decline to pursue yet another trial and set Mr. Flowers free,” Sheri Lynn Johnson, who represented Flowers at the Supreme Court, said in an emailed statement. Evans said he remained confident of Flowers guilt but hadn’t decided on retrial, according to American Public Media. However, he denied trying to exclude African Americans from the jury. In the course of selecting a jury, lawyers can excuse a juror merely because of a suspicion that a particular person would vote against their client. Those are called peremptory strikes, and they have been the focus of the complaints about discrimination. The Supreme Court tried to stamp out discrimination in the composition of juries in Batson v. Kentucky in 1986. The court ruled then that jurors couldn’t be excused from service because of their race and set up a system by which trial judges could evaluate claims of discrimination and the race-neutral explanations by prosecutors. Justice Thurgood Marshall, who had been the nation’s pre-eminent civil rights attorney, was part of the Batson case majority, but he said the only way to end discrimination in jury selection was to eliminate peremptory strikes. Flowers’ case has been to the high court before. In 2016, the justices ordered Mississippi’s top court to re-examine racial bias issues in Flowers’ case following a high court ruling in favor of a Georgia inmate because of a racially discriminatory jury. But the Mississippi justices divided 5-4 in upholding the verdict against Flowers. The state, defending the conviction, said the justices must narrow the focus from Evans’ broader record to the case at hand. But Kavanaugh said that even on the narrower basis, there is evidence that at least one prospective black juror for the sixth trial, Carolyn Wright, was similarly situated to white jurors and was improperly excused by Evans. “The trial court clearly erred in ruling that the state’s peremptory strike of Wright was not motivated in substantial part by discriminatory intent,” Kavanaugh wrote. Filed in: Nation/World Topics: Brett Kavanaugh, Supreme Court of the United States KTLA 5 News on Instagram Judge Grants Bond for Mississippi Man Tried 6 Times in Killings Supreme Court Begins Election Year Term With Stack of Big Cases Weinstein’s Lawyers Ask to Move Trial Out of NYC After Gigi Hadid Dismissed as Juror Jury Selection in Weinstein Sex Assault Case Could Prove to Be Drawn-Out Supreme Court to Take up Dispute Over Subpoenas for Trump’s Financial Records Jury of 7 Men and 5 Women Selected for Harvey Weinstein’s Rape Trial in New York As Trump Impeachment Trial Begins, Senators Are Sworn in as Jurors Under Oath of ‘Impartial Justice’ Gigi Hadid Among Potential Jurors for Harvey Weinstein’s Rape Trial In Rare Interview, Justice Ruth Bader Ginsburg Says She’s Cancer Free Bill Cosby Loses Bid to Overturn Sexual Assault Conviction Jury Recommends Death Sentence for ‘Hollywood Ripper,’ Who Murdered 2 Women and Attempted to Kill 3rd in Their SoCal Homes Harvey Weinstein Arrives at NYC Court for the Beginning of Sexual Assault Trial Boston Marathon Bomber Dzhokhar Tsarnaev Begins Appeal to Overturn Death Sentence
cc/2020-05/en_middle_0087.json.gz/line1337782
__label__wiki
0.932946
0.932946
Taylor Swift Battling Record Label for Rights to Perform Her Earlier Music at AMAs Posted 5:49 PM, November 14, 2019, by CNN Wire, Updated at 08:53PM, November 14, 2019 Taylor Swift performs at ANZ Stadium in Sydney, Australia, on Nov. 2, 2018. (Credit: Mark Metcalfe / Getty Images) Losing the rights to her early music catalog continues to cause trouble, trouble, trouble for singer Taylor Swift. Swift on Thursday claimed an ongoing dispute with her former music label has presented a new roadblock as she is being told she cannot perform many songs from her past at the upcoming American Music Awards or use it in a forthcoming Netflix documentary about her life, which has been in production for several years. Swift’s disclosure of this latest rights issue comes months after she spoke publicly about her displeasure with a deal that saw music manager Scooter Braun take control of her old catalog after he acquired her former music label, Big Machine Label Group. “I’ve been planning to perform a medley of my hits throughout the decade on the show. Scott Borchetta and Scooter Braun have now said that I’m not allowed to perform my old songs on television because they claim that would be re-recording my music before I’m allowed to next year,” Swift wrote. In July, Swift called it her “worst case scenario,” upon learning that her music catalog had been sold to a company owned by Braun. Braun’s Ithaca Holdings acquired Big Machine Label Group from founder Borchetta in late June. The deal was worth roughtly $300 million, according Billboard. “Scott Bocchetta told my team that they’ll allow me to use my music only if I do these things: If I agree to not re-record copycat versions of my songs next year (which is something I’m both legally allowed to do and looking forward to) and also told my team that I need to stop talking about him and Scooter Braun,” Swift wrote. “The message being sent to me is very clear. Basically, be a good little girl and shut up. Or you’ll be punished.” Don’t know what else to do pic.twitter.com/1uBrXwviTS CNN has reached out to Braun for comment. Swift said she thinks sharing her experience “could change the awareness level for other artists and potentially help them avoid a similar fate.” “This is WRONG. Neither of these men had a hand in the writing of those songs. They did nothing to create the relationship I have with my fans. So this is where I’m asking for your help,” she wrote. “Please let Scott Borchetta and Scooter Braun know how you feel about this.” Swift had been signed to Big Machine from her 2006 self-titled debut album through 2017’s “Reputation,” before moving to Universal Music Group. Swift alleged she only learned of the sale when it became public, a claim disputed by Jake Basden, Senior Vice President Communications at Big Machine Label Group. Basden told CNN at the time that Swift’s dad, Scott Swift, is a shareholder in Big Machine Records and that Basden first alerted all of the shareholders of the pending deal with Ithaca Holdings on June 25. “Out of courtesy, I personally texted Taylor at 9:06 p.m, June 29 to inform her prior to the story breaking on the morning of June 30 so she could hear it directly from me,” Basden told CNN. “I truly doubt that she ‘woke up to the news when everyone else did.” The sale prevents Swift from owning the first six albums in her catalog. She told CBS Sunday Morning of her plans to re-record her earlier music. The public dispute that has followed since the sale has both sides finding their defenders. In an Instagram post, Justin Bieber, who is managed by Braun, appealed to Swift, saying, “I’m sure Scooter and i would love to talk to you and resolve any conflict, pain or or any feelings that need to be addressed.” But he also took issue with Swift making the issue public, saying doing so to “get people to hate on scooter isn’t fair.” “What were you trying to accomplish by posting that blog? seems to me like it was to get sympathy u also knew that in posting that your fans would go and bully Scooter,” he wrote. Braun’s wife, Yael Cohen, also came to his defense. Meanwhile, singer Halsey, director Joseph Kahn and Iggy Azalea have shown themselves to be Team Taylor. In her post on Thursday, Swift appealed to other artists managed by Braun “who I really believe care about other artists and their work.” “Please ask them for help with this – I’m hoping that maybe they can talk some sense into the men who are exercising tyrannical control over someone who just wants to play the music she wrote,” she said. “I’m especially asking for help from The Carlyle Group, who put up money for the sale of my music to these two men.” Braun also manages Ariana Grande and the Zac Brown band. “I just want to be able to perform MY OWN music. That’s it. I’ve tried to work this out privately through my team but have not been able to resolve anything,” Swift added. “Right now my performance at the AMAs, the Netflix documentary and any other recorded events I am planning to play until November of 2020 are a question mark.” Topics: taylor swift Lizzo, Billie Eilish, and Lil Nas X Dominate Grammy Nominations Entertainment Local News ‘1917,’ ‘Once Upon a Time …in Hollywood’ Win Golden Globes Country Singer Was Drunk, Driving 102 MPH When New Mexico Crash Killed Teen and Herself Entertainment Nation/World For the First Time, 5 Top Beauty Pageants Have Crowned Black Women as Winners at Same Time Allee Willis, Writer Behind ‘Friends’ Theme Song and Other Hits, Dies at 72 Revelers Around the Globe Usher in a New Decade 25-Year-Old K-Pop Star Sulli Found Dead at South Korea Home Tennessee Teen Beats Stage 4 Cancer After 18 Months in Hospital, Will Get to Go Home for Christmas Rapper and Singer Juice WRLD Dies at 21 After ‘Medical Emergency’ at Chicago Airport Trump Impeachment Probe: Diplomat Had ‘Clear Understanding’ of Ukraine Quid Pro Quo ‘Mame,’ ‘Hello, Dolly!’ Composer Jerry Herman Dies at 88 White House Official Says Nancy Pelosi Will ‘Yield’ and Send Articles of Impeachment to Senate ‘Anybody Need a Grandma for Christmas?’: Craigslist Ad Inspires Search for Oklahoma Woman
cc/2020-05/en_middle_0087.json.gz/line1337783
__label__cc
0.659041
0.340959
Securities / 12.06.2019 Reviewing the SEC’s Regulation Crowdfunding Report – Part II By Cary Zimmerman As I noted in a previous article, this past summer the Securities and Exchange Commission (“SEC”) issued a report on its study of the impact of Regulation Crowdfunding (“Reg CF”) on capital formation and investor protection. To recap, Reg CF helps start-ups raise capital by making low-dollar securities offerings to “the crowd,” including less-sophisticated investors who don’t qualify as “accredited investors.” Reg CF offerings are limited in several respects: a $1.07 million total offering cap (over 12 months); limits on investable amounts (based on the investor’s income and/or net worth); prescribed issuer disclosures; and offerings must be conducted via registered crowdfunding portals. Part I Recap Part I of my review outlined the high-level statistics on Reg CF offerings from the SEC report. In that installment, we learned that Reg CF usage is on the rise, it is used mostly (but not exclusively) by young, cash-strapped companies, it is typically used by pre-revenue companies with some debt on their balance sheets, about half of the offerings are of equity securities and about a quarter are of debt securities, and the offerings usually extend three to four months and have significant financial and human resource costs. Part II Intro This Part II covers compliance by issuers and intermediaries, the incidence of fraud in Reg CF offerings, data on offering limits, investment caps and intermediary fee structures, all as reflected in the SEC’s report. Issuer Compliance For issuers, the SEC found the biggest compliance gaps with financial statements, annual reports (Form C-AR) and final progress updates (Form C-U). The report acknowledges that some non-compliance may be due to limited involvement of specialized outside counsel or independent auditors or the inexperience of service providers with Reg CF and/or because some of these start-ups may simply have failed (causing them to miss filing obligations, for example). The report also shares the opportunity areas cited by some market participants that could help issuers improve their Reg CF compliance, such as requiring reviewed rather than audited financial statements and a “test the waters” option to allow issuers to gauge market interest before launching a costly offering. Intermediary Compliance While intermediaries are generally aware of and attempt to satisfy their compliance obligations, due to the novelty of Reg CF and the fact that many intermediaries are relatively new businesses not ever before subject to regulatory oversight, there are compliance gaps. Some intermediaries believe that compliance is too costly (and may pass costs onto issuers in the form of higher fees), including complying with Financial Industry Regulatory Authority (FINRA) requirements and examinations. Issuer Offering Limits The report considers whether the $1.07 million offering limit is appropriate. A few key data points that support keeping the limit at its current level are: (1) for the majority of Reg CF issuers, cumulative amounts reported did not reach the 12-month offering limit; (2) an estimated 29 offerings raised at least $1.07 million; and (3) only three Reg CF issuers reported raising over $1.07 million, but in two or more offerings. Interestingly, 244 issuers used Regulation D (mostly under Rule 506(b)) to raise money before and/or after their Reg CF offerings, with an average per-offering amount raised under Regulation D of $908,780 and a median per-offering amount raised of $200,000. However, the report highlights the varied opinions of market participants on this point, with some believing the limit is so low that it deters “high-quality, high-growth issuers with substantial financing needs” and limits investment opportunities for non-accredited investors. Investor Investment Of 31,500 unique investors in a sample provided by one intermediary from May 2016 through September 2018, approximately 9% of investors were accredited, although they accounted for 40% of amounts invested. In this sample, the average amount invested by non-accredited investors was $600 per issuer, whereas the average amount invested by accredited investors was $2,030 per issuer. The average number of non-accredited investors and accredited investors per issuer was 349 and 67, respectively. While reliable, comprehensive data was not available, some of the available information suggests that most non-accredited investors do not come close to reaching their per-investor limits. Incidence of Fraud There appears to be a low incidence of fraud on the part of issuers, at least as reflected in available SEC litigation releases and in FINRA and NASAA data. Intermediary Fee Structures Most intermediaries received a percentage-based fee paid in cash or securities (with 37% receiving some amount in securities) contingent on a completed offering. The average cash compensation was 5.7% of the offering proceeds (although it ranged from as little as 0.1% to as much as 10% of the proceeds). On average, an intermediary getting compensation in securities received 2.9% of the proceeds. The average fee paid to a broker-dealer-affiliated intermediary was 7.1%, whereas the average fee paid to a crowdfunding portal was 5.5%. Please reach out to me (caz@kjk.com or 216.736.7275) or one of our experienced Securities attorneys if you need help structuring or executing your company’s capital raise or need help with any related corporate needs.
cc/2020-05/en_middle_0087.json.gz/line1337788
__label__cc
0.641511
0.358489
2014 begins with performances in Las Vegas and at the Magic Castle by knightmagic2019 | Jan 31, 2014 | Blog WOW, these past 6 weeks home in Las Vegas have flown by and it has been the busiest “vacation” we’ve had that I can remember! We enjoyed being home for the holidays and celebrated Christmas and New Year’s with family and friends, and since the props were home for the first time all year, any free time was spent doing repairs and maintenance. “Living in the Entertainment Capital of the World” has it’s perks and of course we caught some friends’ shows while in town, including “Pin Up” featuring Playmate of the Year Claire Sinclair, hypnotist Kevin Lepine and the very talented Sky Dee Miles at Tropicana Nights. “Pin Up” featuring Playmate of the Year Claire Sinclair The Magical Forest at Opportunity Village On December 30th we performed at a charity event at “The Magical Forest” in Las Vegas, benefiting Opportunity Village, a not-for-profit organization that serves people in the Southern Nevada community with intellectual disabilities. The variety show featured several performers including Scott Dorfman, Penny Wiggins, Tawney Bubbles, Emily Lauren and Andy Martello, and was hosted by Kevin Lepine. Click HERE to read a VegasNews.com article about the Opportunity Village show. Opportunity Village Show – Photo credit: www.khanhx.com January 2014 WONDERGROUND On January 16th we performed at Jeff McBride’s WONDERGROUND in Las Vegas, a magical nightclub experience with lots of variety performers throughout the evening. It’s always fun to perform at Wonderground because you know you’ll see lots of friends and you never know who will show up. On this particular night there were many fellow magicians in the audience including Criss Angel, Nathan Burton and MAGIC Magazine editor, Stan Allen. That night we were also interviewed by the Las Vegas Review Journal, which will be featuring an article on Wonderground and the different performers in early February. WONDERGROUND Las Vegas – Photo credit: Ken Elsner Article in Las Vegas Review Journal about Wonderground: http://www.reviewjournal.com/view/whitney/wonderground-variety-show-offers-gamut-performers The World Famous Magic Castle January 20-26th we had the opportunity to headline at the world famous Magic Castle in Hollywood, CA. This beautiful venue is considered the Carnegie Hall for magicians, and it’s always and honor to perform there! We shared the stage with hilarious juggler Micheal Goudeau and it was truly an amazing week. Palace of Mystery Theater at the Magic Castle – Photo Credit: Hocus Pocus Focus We saw so many entertainer friends during our week at the Magic Castle and had such a great time catching up with people we hadn’t seen in years, even some of my fellow Miss America pageant girls came to the show! We also had the pleasure of having HGTV’s “Property Brothers” Drew and Jonathan Scott and actress Nikki Reed from the “Twilight Saga” as guests in our audience on one evening, and on Saturday night actor David Arquette from the movie “Scream” was in the audience. He ended up being one of the audience volunteers during our show and gave us an enthusiastic standing ovation at the end of the show. Fellow magician and friend Christopher Hart, who played “Thing” in The Addams Family movies, also paid us a visit and take this awesome photo with us! We just finished packing up the illusions, and our equipment is now on it’s way to Celebrity Cruises Celebrity Silhouette, our venue for the next couple of months. Now we’ve got a couple weeks off to relax before we head off to the Caribbean. 2014 is definitely off to a great start! – Mistie Headlining on Celebrity Silhouette spring 2014 by knightmagic2019 | Jan 26, 2014 | News Kyle Knight & Mistie will be headlining on Celebrity Cruises from February – April 2014! Catch their show in the Celebrity Theater onboard Celebrity Silhouette, which was just rated in the Top 10 best large cruise ships in the world by Conde Nast Traveler. Kyle Knight & Mistie performing at the Magic Castle in Hollywood by knightmagic2019 | Jan 1, 2014 | News From January 20-26, 2014, Kyle & Mistie will be appearing nightly in the Palace of Mystery at the world famous Magic Castle in Hollywood, California! Showtimes will be at 8:30 PM, 10:00 PM and 11:30 PM. The Magic Castle is the private clubhouse for the Academy of Magical Arts, Inc, a very special organization devoted to the advancement of the ancient art of magic. Invitation and dress code required, and guests must be 21 years or older. For more details about visiting the Magic Castle please visit http://www.magiccastle.com/about/index.cfm Hollywood, CA 90028-8600 For reservations and information: 323-851-3313 Fax: 323-851-4899
cc/2020-05/en_middle_0087.json.gz/line1337790
__label__cc
0.523097
0.476903
Things We Love Right Now Walking the walk, singing the song blog_-_hike.jpg Peter Frigeri A hike to remember: Sawmill Canyon A WALK IN THE GRAVEL About halfway up Sawmill Canyon Road, I stopped in the shade of a piñon tree and leaned on my trekking poles to rest. As Peter caught up to me I said, “I know why Jim (Boone) doesn’t list this hike” (on his canonical website, birdandhike.com). “Why?” my husband asked. “Because it’s so stinking unpleasant,” I complained. To be honest, I used a stronger word than “stinking.” That’s how unpleasant it was. Like walking uphill in cat litter. For five miles. In 90 degrees. Worse, on our third attempt, we failed to find the supposed Sawmill Spring, which has now attained unicorn or punctual-cable-guy status in our two-person backpacking club. Thanks, Jim. Still, I love this route for a short getaway, and here’s why: Because, apparently, no one else does. Which means that once we — finally! — got out of the gravel wash and well into the ponderosa pines, we could relax, find a needle-covered flat spot to pitch our tent, and be completely, luxuriously alone. After taking off our hiking boots, cooling off and eating dinner, we were able to appreciate the multicolored wildflowers all around, the sawmill remnants (“Look! This must have been the outhouse!) strewn among the pines. I leaned against a log and read as the sun set behind John’s Peak. My husband lounged in the tent, lulled by the sounds of forest busy-work. With no neighbor dogs barking through their fences or party-house renters frolicking in their pools, we were asleep by 8 p.m. And the walk down the wash the following morning was much more pleasant, too. — Heidi Kyser A TINY PLACE (TO SING) IN CHINATOWN It’s a Saturday night, around 8:30 p.m. and you want to go out with your friends. You don’t want to go to the Strip — it’s too packed with crazy, drunk tourists who are on party mode for 48 hours. You want to go somewhere low-key. You love to sing, but you will have a panic attack if you sing in front of people, so you check out Space BBQ & Karaoke (702-888-3217), located in Chinatown. You are led to a small private room — if you bring more than four people you’ll probably be struck with claustrophobia. It has a colorful, wool-pleated bench, a flat-screen TV, a small screen from which to pick songs, two black stools, a wooden table to put your strawberry passion fruit boba slush, which you bought across the street, on, and a stuffed shark and a stuffed unicorn decorating the walls. On the small screen, all of the songs are in Japanese, and it takes a moment to figure out how to switch it to English. Once you pick out a song, you come to life. You don’t need to look at the screen to know the throwback 2000 lyrics — you know it by heart. There is no one to give you crap for sounding like a cat that got its tail ripped off. No one is there to laugh at you for dancing like your limbs are made of wood. The soundproof walls don’t disturb the people out in the restaurant, who are eating marinated duck neck while listening to the petite Asian woman wearing a black dress sing angelically. You are free from the judgmental eyes of the world. You and your friends are jamming out to Avril Lavigne, Taylor Swift, and Akon. You have the carefree spirit of a child, and that pure exuberance is just what you need. Before you know it, it’s 12:02 a.m., and you still grinning even as you approach the bar in the back to pay $100 for three and half hours of karaoke. The wall behind the bar has a neon sign that reads Space. — Desiree Sheck Space BBQ sawmill canyon road WATCH: Michelle Obama Sings Stevie, Raps With Missy, On 'Carpool Karaoke' Watch: Mal Blum Returns With 'Things Still Left To Say' Disturb This Groove: What Is The Legacy Of Soul Music?
cc/2020-05/en_middle_0087.json.gz/line1337791
__label__cc
0.638757
0.361243
Do we honor veterans or do we simply forget about them? There is an old saying: "Nobody loves a soldier until the enemy is at the gate." I have often reflected on that phrase and how at times it rings true. WBZ is reporting that the town of Hardwick has cancelled its Memorial Day Parade. Local veterans (and I'm one of them) are understandably upset. But then, the veteran has often been treated as something akin to a disposable razor: when he has served his purpose, he is promptly discarded. After returning home from Vietnam, Mr. Joe Szczepanek says, "people spit on me. I got hit in the head with a sign. I got called a baby killer." Many other veterans were treated with contempt or simply ignored altogether. My own father served in Korea and during Vietnam. As a career military veteran, he was denied a hearing aid (he had become tone deaf after serving as a Tank Commander in Korea). And when he died, I had to fight just to obtain a flag marker for his grave. You cannot begin to imagine how that made me feel. In order to understand my hurt, you would have to know the depth of my love for a great man who consecrated his entire life to the United States military - both in the U.S. Army and the U.S. Air Force. The Church had a policy years ago which was discriminatory toward military families. I addressed this in my previous Blog post entitled Cardinal Sean's rationale which may be found here. A woman named Colleen took exception to my post in a comment left at this Blog. She wrote: "Mr. Melanson, may I ask how old you are? The reason I ask is that the Church USED to, MANY years ago have a policy that families needed to be residents of the Parish associated with the Catholic school where they chose to send their children...simply because the parishioners in those days funded the majority of the happenings in the school. This ruling has been changed for YEARS now and any/all students are welcome to attend. Please get your facts straight before you falsely leading people astray. There is already enough of that going on without your help." To which I responded: "Colleen, I submit that it is you who are engaging in dishonesty. Either that or your English comprehension skills are sorely deficient. Cardinal O'Malley, in his feeble attempt to justify his decision to find a Catholic school for the ward of lesbian parents who are engaged in an illicit relationship, wrote, "Catholic schools exist for the good of the children and our admission standards must reflect that. We have never had categories of people who were excluded." The key word in this passage is "never." The Cardinal's statement constitutes [by your own admission in the comment you left] a falsehood. Which is why I responded, "But His Eminence is mistaken, As my parents can testify, I was denied admission into Catholic schools because my father was career military. My parents were told that five years of residency was required before I could be enrolled. But because my father would receive new orders every three or four years, I was denied admission. Many other children of military families were similarly denied admission into Catholic schools for this reason." Military dependents were in fact denied admission. You admit this writing that, "..the Church USED to, MANY years ago have a policy that families needed to be residents of the Parish associated with the Catholic school where they chose to send their children...simply because the parishioners in those days funded the majority of the happenings in the school. This ruling has been changed for YEARS now.." Children of military parents who were serving this great nation were excluded. This is all the more outrageous since their parents were making great sacrifices to serve this great nation. As for the child of lesbian parents, as Archbishop Chaput so eloquently put it, 'Our schools are meant to be 'partners in faith' with parents. If parents don't respect the beliefs of the Church, or live in a manner that openly rejects those beliefs, then partnering with those parents becomes very difficult, if not impossible. It also places unfair stress on the children, who find themselves caught in the middle, and on their teachers, who have an obligation to teach the authentic faith of the Church.' If anyone needs to get their facts straight to avoid 'falsely leading people astray,' it is yourself. At any rate, I stand by my statement. The Cardinal's statement was incorrect." I doubt my response will produce the slightest crack in Colleen's wall of conviction. Some people are anxious to accommodate those who "don't respect the beliefs of the Church" or who "live in a manner that openly rejects those beliefs." What a shame that my parents [cradle Catholics who remained faithful to the Church's Magisterium and who served this nation so honorably] couldn't receive at least the same level of respect as those who view the teachings of Christ's Church with contempt and or indifference. Nobody loves a soldier until the enemy is at the gate. Related reading here. Labels: Cardinal Sean O'Malley, Catholic Church, Discarded, Discrimination, Falsehood, Hardwick, Memorial Day Parade, Policy, Soldiers, Veterans, WBZ Ellen Wironken said... I don't even recognize this country anymore: God help us all. Stewart said... The Boston Archdiocese is ultra-liberal and leftist. There is too little love for Catholic teaching and too much effort to please the culture of death and the radical homosexual crowd. Do you really think two active lesbians give one hoot about having their child receive Catholic morals and values? This is just another cheap attempt to control the Church and to advance an agenda. And Cardinal O'Malley is playing along. Disgusting. ACatholicinClinton said... I'm concerned about that too Stewart. I mean there are plenty of private schools - many of which have no connection whatsoever to a Church or religious denomination. There is something else at work here. Homosexual activists want to impose their agenda. "There are evils of a physical order..." "It is a diabolical disorientation..." The Culture of Death displays its hatred... "Top kill" fails Cardinal Marc Ouellet: Equating Marriage and Homos... A Three Hour Tour... The Homosexual Hate Movement: Another form of tota... Persecution Watch: Catholic priest and homosexual ... Persecution Watch: Catholic Church compared to Maf... Do we honor veterans or do we simply forget about ... "...God is sending them a deceiving power so that ... Happy Birthday Padre Pio MacArthur: Appeasement but begets new and bloodier... Small wonder that Catholics United has been critic... "I am not a number, I am a free man.." A Crisis Made To Order... Does Cardinal O'Malley condone such violence towar... Cardinal O'Malley: False compassion supplies the s... Cardinal Sean's rationale Joe LeVangie may fly his American flag New Hampshire Residents: Stand With Joe LeVangie Rainbow Sash Movement embraces contempt for the Ch... Is the United States Department of Justice Christi... Homosexual Hate Movement: Radical Homosexual Activ... Why is America in such turmoil? Does Elena Kagan also believe that judicial power ... Does the Archdiocese of Boston respect those evang... Chief Justice John Roberts: Elena Kagan claim "sta... Pope Benedict XVI: Same-sex "marriage" an insidiou... The denial of the Ascension is as grave a departur... What the Church needs now: A fifth marian dogma The United States: En Route to Totalitarianism Elena Kagan: An Alinskyite Trojan Horse? A proper perspective on Pope Benedict XVI Toward a New Religion: A Humanist Cult of the Secu... Elena Kagan: A wish to change America The Berkshire Eagle has its own idea of what const... Solicitor General Elena Kagan has called for Socia... Degrading women at Saint Michael's Parish in East ... Culture of Sodomy: Massachusetts Attorney General ... Notre Dame President Father John Jenkins accuses t... Former Newsweek editor slams New York Times for cr... Father James Scahill's Pastoral Associate belongs ... Sister Betty Broughan, SSJ has promoted Sister The... Culture of Sodomy: Street preacher arrested for sa... An engineer comments on the oil disaster in the Gu... "...America will be destroyed economically by a se... Culture of Sodomy: Seton Hall University to offer ...
cc/2020-05/en_middle_0087.json.gz/line1337797
__label__wiki
0.59907
0.59907
Gloria J. Spurlock - Page 29 indeed, the date entries span several years. The half-page printouts are dated November 22, 2000. Those printouts contain the notation “Received-Date: 10071999”. Each of the Forms 1040 is dated September 23, 1999. The computer-generated Forms 5344(CG) contain no date. The manually completed Forms 5344 are dated May 31, 2001. The Form 4549-CG contains income tax examination changes for 1995, 1996, and 1997. Page 1 of that form contains no date. Page 2 of that form is dated October 18, 1999. The pages attached to that form, which contain computations relating to the income tax examination changes, are also dated October 18, 1999. The 30-day letter is dated October 18, 1999. We cannot agree that this conglomeration of documents, which appears to be respondent’s administrative file, would satisfy the requirements of section 6020(b) even if it were in evidence. See Cabirac v. Commissioner, supra. Section 6654(a) provides for an addition to tax in the case of an underpayment of estimated tax. We find that respondent has satisfied his burden of production with respect to the addition to tax under section 6654(a) for each of the tax years at issue. Petitioner did not file Federal income tax returns for 1995, 1996, and 1997, and she did not pay taxes on income other than those amounts the various payors withheld.21 Further, respondent 21The Forms W-2 that Ursuline prepared show Federal income tax withheld of $582.78 for 1995 and $751.29 for 1997. The Forms
cc/2020-05/en_middle_0087.json.gz/line1337803
__label__cc
0.524507
0.475493
In the 1960s, students at the University of California, Berkeley were at the forefront of the era’s political protests. As both a Berkeley undergraduate and law student, Michael Tigar aggressively advocated for the rights of students to protest and take up political causes. When he arrived at Berkeley, he became involved in SLATE, a student activist organization that was a precursor to the Free Speech Movement. SLATE was primarily focused on abolishing the House Un-American Activities Committee and on challenging the University administration’s attempts to suppress student government, association, and speech. His student activism continued in law school as the Free Speech Movement gained traction. This section includes several documents about Tigar’s involvement with SLATE and the Free Speech Movement, including a recent oral history piece about the organization. It also includes “The Brave New University of Clark Kerr”, a piece that he wrote for the Liberal Democrat newspaper, which contests then-UC chancellor Kerr’s regulations on student speech and identifies the origins of the corporatization of higher education in the United States. The piece asserts that, “the guerrilla warfare between students and administration” is “a microcosm of the conflict which ought to be taking place in society as a whole.” Other documents included here deal more generally with the rights of speech, protest, and association. By Decade Any 1960 1970 1980 2010 Unknown By Type Any Audio Awards & Certificates Book Chapter Book Review Books Cases Correspondence Diaries Essays Images Journal Articles Lectures Magazine Articles Miscellany Newspaper Articles Oral History Plays Radio Scripts Speeches Transcripts 15 archive items found. Oral History Mike Tigar: From SLATE Leader to Civil Liberties Attorney by The SLATE Oral History Project Oral History Thousands of Adventures Oral History Communist Party Student Movements Magazine Articles Article Sent by Judge Ferguson: “What’s Become of Yesterday’s Student Rebels?” Miscellany 1962 Youth Festival in Helsinki Cases Testimony of Karl Dietrich Wolff, Senate Internal Security Subcommittee, March 14, 1969 Plays The Trial of John Peter Zenger Essays Original Understanding and the Constitution Essays Can We Be Equal And Free? in The Unfinished Revolution (C. Snow ed. 1976) Book Review Concerning Dissent and Civil Disobedience Book Review Freedom and Order in the University Book Review Anti-Politics in America Book Review The American Student’s Freedom of Expression Journal Articles Introduction to Symposium: Student Rights and Campus Rules Essays The Brave New University of Clark Kerr
cc/2020-05/en_middle_0087.json.gz/line1337804
__label__wiki
0.51121
0.51121
Welcome to LEDRADIANT, your LED lighting source LEDRadiant Shopping Cart - 0 Item Reseller Inquiry Parking Lot Lights Classroom Lighting LED Warehouse Lighting Emergency and Exit Landscape Lighting Products LED Panel and Troffer Lights LED PAR MR16 GU10 LED PLUG IN LIGHTS & LAMPS LED Street and LED Parking LED Ropes Stripes More Testimonials and Projects PART: Driver up to 50W constant current 0.9A Driver for LED Product SKU: ZZS-DRV-60WCV-HH Electrical Input: Watts:60 Operating Voltage:100-240 VAC Operating Temperature:-30F - 142F Operating Humidity:max 80% Power Factor (PF):.98 Power Supply Efficiency:98% Electrical Output: Output Voltaje: 12V Max. Connected Load: 5 Amp Part of Serie: ZZS-RGB-50MOD-HH Connector: Wired Base Type: Wired Package Size:8" x 1.5" x 3" Package Weight:0.9 Lb Safety Compliance:CE, RU (UL) Environmental:RhOS EMI/RFI compliance:FCC You're reviewing: PART: Driver up to 50W constant current 0.9A Review Image 1 Common terms used in lighting, LED Technology and Glossary For those of you who need to understand this new world of LED lighting, there is some vocabulary you will need to know. We have given you some terminology that will help you understand what its all about. LED stands for "light emitting diode." A diode is an electrical component with two terminals which conduct the electricity only in one direction. With an electrical current, the diode emits a bright light around the small bulb. Lumens vs Watts LEDs that are bright enough to replace incandescents for business that is, producing the same number of lumens as standard 40- or 60-watt bulbs---typically only use 9 to 12 watts. The U.S. Department of Energy advises that business that want to replace a 60-watt bulb should look for an LED that produces close to 800 lumens; for a 40-watt bulb, look for 450 lumens. In a fluorescent lighting system, the ballast regulates the current to the lamps and provides sufficient voltage to start the lamps. Without a ballast to limit its current, a fluorescent lamp connected directly to a high voltage power source would rapidly and uncontrollably increase its current draw. Within a second the lamp would overheat and burn out. Thee are several types of ballasts, An instant start ballast does not preheat the electrodes, instead using a relatively high voltage (~600 V) to initiate the discharge arc. It is the most energy efficient type, but yields the fewest lamp-start cycles, as material is blasted from the surface of the cold electrodes each time the lamp is turned on. Instant-start ballasts are best suited to applications with long duty cycles, where the lamps are not frequently turned on and off. Rapid start A rapid start ballast applies voltage and heats the cathodes simultaneously. It provides superior lamp life and more cycle life, but uses slightly more energy as the cathodes in each end of the lamp continue to consume heating power as the lamp operates. A dimming circuit can be used with a dimming ballast, which maintains the heating current while allowing lamp current to be controlled. Programmed start A programmed-start ballast is a more advanced version of rapid start. This ballast applies power to the filaments first, it allows the cathodes to preheat and then applies voltage to the lamps to strike an arc. Lamp life typically operates up to 100,000 on/off cycles when using programmed start ballasts. Once started, filament voltage is reduced to increase operating efficiency.[5] This ballast gives the best life and most starts from lamps, and so is preferred for applications with very frequent power cycling such as vision examination rooms and restrooms with a motion detector switch. A hybrid ballast has a magnetic core-and-coil transformer and an electronic switch for the electrode-heating circuit. Like a magnetic ballast, a hybrid unit operates at line power frequency—60 Hz in North America, for example. These types of ballasts, which are also referred to as “cathode-disconnect ballasts”, disconnect the electrode-heating circuit after they start the lamps. HID/HPS High Intensity Discharge bulb. These include the Metal Halide (MH) and High Presure Sodium (HPS) among other types of bulbs that use a mixture of gases that when electrically excited produce an arc that emmits light. The color of the light depends on the gases used in the arc tube. Underwriters Laboratory is the certification which indicates that a product meets certain standards that conform with insurance company requirements for safety. An LED bulb without this designation is not of high enough quality for insurance purposes and usually indicates an inferior product. Kilowatt per hour is how you are billed by your electric company. There is a cost per Kwh on your electric bill. Index A B C D E F G H I J K L M N O P R S T U V W Additive Color Model A type of RGB color model that describes how different proportions of red, green, and blue light combine to create colors. In the additive color model, combining red, green, and blue light produces white light. Ambient Temperature (Ta) The air temperature surrounding the device. Ampere (Amp) The unit for measuring rate of flow of electrical current: Current (Amps) = Power (Watts) / Voltage (Volts) ANSI Binning The system defined by the American National Standards Institute for the binning specifications for light emitting diodes. B Top In a fluorescent lighting system or HID bulbs, the ballast regulates the current to the lamps and provides sufficient voltage to start the lamps. Without a ballast to limit its current, a fluorescent lamp connected directly to a high voltage power source would rapidly and uncontrollably increase its current draw. Within a second the lamp would overheat and burn out. Bin (Binning) LED manufacturers sort their products into bins based on lumen output and color. Fixture manufacturers specify a range of bins from which they will accept LEDs. If they only accept fixtures from bins that are very close together, the diodes are more expensive, but result in a higher quality fixture. If fixtures are built with LEDs from a wider range of bins, cost and lead-time are reduced. Manufacturers may refer to their “tightly binned” products when they want to convey that theirs is a good quality product. Black Body / Black Body Radiator An object that absorbs all electromagnetic radiation falling on it. Because it reflects no light, a black body appears black. As a black body is heated to incandescence, it radiates light in a sequence of colors, from red to orange to yellow to white to blue, depending on its temperature. This color sequence describes a curve within a color space, known as the black-body curve. Black Body Curve A curve within a color space describing the sequence of colors emitted by a black-body radiator at different temperatures. Often used incorrectly with respect to illumination as a synonym for luminous flux, an objective measurement of the visible power of a light source. The term is correctly used when describing screen brightness in a display or television. (see Nits). C Top Case Temperature The temperature measured at the LED package or case. Chromaticity An objective specification of the quality of a color, independent of its luminance, and as determined by its or saturation and hue. Color Definition The color of uniformly illuminated objects described using three terms: Hue: Describes the situation when the appearance of different colors is similar (e.g. matching blues and pinks). Lightness: Describes a range of grayness between black and white. Chroma: Describes the degree of departure from gray of the same lightness and increasing color (e.g. red, redder, pure red). Color Gamut The range of colors within the CIE Chromaticity Diagram included when combining different sources. Color Model An abstract mathematical model describing the way colors can be represented as groups of values or color components. RGB (Red-Green-Blue) is a color model with three color components, and CMYK (Cyan-Magenta-Yellow and Key (Black)) is a color model with four color components. Color Rendering A general expression for the effect of a light source on the color appearance of objects. A measure of the degree of color shift objects undergo when illuminated by the light source as compared with those same objects when illuminated by a reference source of comparable color temperature. The reference source has a CRI of 100. Color Spectrum / Visible Spectrum The visible spectrum is the portion of the electromagnetic spectrum that is visible to the human eye, typically between 390nm and 750nm. The description used to describe the effect of heating an object until it glows incandescently, the emitted radiation, and apparent color, changes proportional to the temperature; easily envisioned when considering hot metal in a forge that glows red, then orange, and then white as the temperature increases. Conformal Phosphor Coating Phosphor application process that uniformly coats the LED chip with phosphor. A device that controls the output of color-changing and tunable white lighting fixtures. Controllers typically have software components for configuring fixtures and designing and editing light shows, and hardware components for sending control data to fixtures. A description of a range of correlated color temperatures. Correlated Color Temperature (CCT) The absolute temperature of a blackbody whose chromaticity most nearly resembles that of the light source. Usually specified in Kelvin (K). The lower the Kelvin temperature, the warmer the light feels, or appears. D Top Delivered Light The amount of light a lighting fixture or lighting installation delivers to a target area or task surface, measured in footcandles (fc) or lux (lx). An object with irregularities on a surface causing scattered reflections. Direct-View Lighting Fixtures Lighting fixtures intended for viewing, rather than for illumination. For example, arrays of direct-view fixtures or nodes are used in large-scale video displays, traffic signals, and signage applications. Directional Light Source A light source that emits light only in the direction it is pointed or oriented. All LED fixtures include an LED driver or power supply. This driver can be integral to the fixture, separate from the fixture or remotely located. Typically, the driver is an important part of every LED system and you should remember it is a factor when using LED fixtures. The light output of a light source divided by the total electrical power input to that source, expressed in lumens per watt (lm/W). The percentage of total lamp lumens that a lighting fixture, luminaire, or system emits, minus any blocked or wasted light. See Luminous efficiency. Organic polymer frequently used for a dome or lens, often prone to optical decay over time, resulting in poor lumen maintenance. High quality LEDs such as LUXEON contain no epoxy in the optical system and deliver superior lumen maintenance. Eye-sensitivity Curve A bell-shaped curve describing the sensitivity of a human eye with normal vision to the spectrum of visible light. Also known as the eye-sensitivity curve. See spectral luminous efficiency function. F Top Flux / Luminous Flux Luminous flux is the measure of the perceived power of light, adjusted to reflect the varying sensitivity of the human eye to different wavelengths of light Foot-Candle (Fc) The unit is defined as the amount of illumination the inside surface of a one-foot-radius sphere would be receiving if there were a uniform point source of one candela in the exact center of the sphere. Alternatively, it can be defined as the illuminance on a one-square foot surface of which there is a uniformly distributed flux of one lumen. Forward voltage LEDs are current driven devices. If an external current is passed through the device, a forward voltage will be developed across the diode. G Top An effect that occurs when lighting fixtures in the OFF state faintly glow as a result of residual voltage in the circuit. A photometric device for testing the luminous intensity distribution, efficiency, and luminous flux of luminaires. H Top A part of the thermal system that conducts or convects heat away from sensitive components, such as LEDs and electronics. High Intensity Discharge, usually referred to bulbs that use compressed gass and when voltage is applied creates a high intensity discharge or voltaic arch like in a lighting bolt and thus emmit light. A high power LED, sometimes referred to as a power LED, is one that is driven at a current of 350 mA or higher. High-brightness High-brightness is a term that is often applied to an LED but has no measured meaning and does not indicate any level of performance. Hot / Cold Factor The relative light output performance at a temperature compared to the light output at a nominal or test temperature. For LUXEON products this is the relative light output at 100C Tj compared to 25C Tj. For “Hot Tested” products like LUXEON A it is the relative light output at 100C Tj compared to 85C Tj. High Preasured Sodium, referred to bulbs that use sodium as presurized gass to produce the high intensity discharge. Hot Testing LED performance testing and specification at an elevated temperature of 85°C. I Top The intensity of light falling on a surface area. If the area is measured in square feet, the unit of illuminance is footcandles (fc). If measured in square meters, the unit of illuminance is lux (lx). Illuminating Engineering Society of North America (IES) The recognized technical authority on illumination, communicating information on all aspects of good lighting practice to its members, to the lighting community, and to consumers through a variety of programs, publications, and services. Inboard Power Integration An approach to power management that integrates the power supply directly into a fixture’s circuitry, creating an efficient power stage that consolidates line voltage conversion and LED current regulation. Infrared (Near) Electromagnetic radiation with wavelength range from 700 nm – 3000 nm. J Top Junction Temperature Junction temperature, noted as Tj, is the temperature of the LED’s active region. K Top Kelvin Temperature Term and symbol (K) used to indicate the comparative color appearance of a light source when compared to a theoretical blackbody. Yellowish incandescent lamps are 3000K. Fluorescent light sources range from 3000K to 7500K and higher. L Top A Light Emitting Diode (LED) is a solid-state semiconductor device that converts electrical energy directly into light. On its most basic level, the semiconductor is comprised of two regions. The p-region contains positive electrical charges while the n-region contains negative electrical charges. When voltage is applied and current begins to flow, the electrons move across the n region into the p region. The process of an electron moving through the p-n junction releases energy. The dispersion of this energy produces photons with visible wavelengths. LED Array An assembly of LED packages or dies on a printed circuit board or substrate, possibly with optical elements and additional thermal, mechanical, and electrical interfaces that are intended to connect to the load side of an LED driver. LED Chip (Chip) The light producing semiconductor device that may or may not be incorporated into an LED. An electronic circuit that converts input power into a current source — a source in which current remains constant despite fluctuations in voltage. An LED driver protects LEDs from normal voltage fluctuations, overvoltages, and voltage spikes. LED Light Engine An integrated assembly comprised of LEDs or LED arrays, LED driver, and other optical, thermal, mechanical, and electrical components. LED Luminaire A complete lighting unit consisting of LED-based light emitting elements and a matched driver together with parts to distribut light, to position and protect the light emitting elements, and to connect the unit to a branch circuit. The LED based light emitting elements may take the form of LED packages, (components), LED arrays (modules) LED Light Engine, or LED lamps. The LED luminaire is intended to connect directly to a branch circuit. Light Emitting Diode (LED) L70 describes the brightness of an LED after a number of hours – often 50,000. If a product claims L70 after 50,000 hours, it means that after 50,000 hours of burning (nearly six years if the lights are on 24/7) the lights are now 70% as bright as they were when they were first installed. L70 doesn’t mean anything without the corresponding number of hours. You may also see terms such as L70 at 6,000 hours. Sometimes manufacturers will list L80 (or even L90) at 50,000 hours. This simply means that after 50,000 hours, the LEDs will be 80% (or 90%) as bright as they were initially. Be careful not to confuse L70 with LM79 or LM80. This IES document applies to LED fixtures (but not to components.) It prescribes the approved method for “Electrical and Photometric Measurements of Solid-State Lighting Products.” In the beginning, LED products were the wild, wild west. Manufacturers claimed just about anything based on their own personal “test procedures.” LM79 gave structure to the chaos and today LM79 compliance can help ensure that you are comparing apples to apples when you read LED product literature. This IES (Illuminating Engineering Society of North America)document describes the approved method for “Measuring Lumen Maintenance of LED Light Sources.” It applies to bare LED light sources and does not cover complete luminaires (fixtures.) The main story here is usable life. LED sources, like the old metal halide lamps, tend to fade over life instead of “burning out.” Again, when manufacturers are using the same test methodology, you can be comfortable when comparing products. Lumen (lm) The international (SI) unit of luminous flux or quantity of light and equals the amount of light that is spread over a square foot of surface by one candle power when all parts of the surface are exactly one foot from the light source. For example, a dinner candle provides about 12 lumens Lumen Depreciation Describes the percentage of light lost relative to the initial lumen output. See lumen maintenance for more information. Lumen Maintenance The luminous flux at a give time in the life of the LED. This is expressed as a percentage of the intial luminous flux. Lumen Maintenance Curve A graph illustrating the predicted average light output behavior over time of a single LED or solution. The total lumens emitted of a light source, system, or solution. A lighting fixture complete with installed lamps and other accessories. Luminous Efficiency The percentage of total lamp lumens that a lighting fixture, luminaire, or system emits, minus any blocked or wasted light. The SI (International) unit of illuminance, or luminous flux incident on a unit area, frequently defined as one lumen per square meter (lm/m2). M Top MacAdam Ellipse A MacAdam ellipse is the region on a chromaticity diagram which contains all colors which are indistinguishable, to the average human eye, from the color at the center of the ellipse. A widely accepted Printed Circuit Board (PCB) material with a Metal Core (MC) for better thermal performance, where LED chips are mounted. N Top Measurement of display screen brightness. 1 nit = 1 cd/m2. NTSC Color Space The range of colors within the CIE Chromaticity Diagram included when combining phosphor based RGB sources in CRTs such a televisions and computer monitors. O Top Onboard Power Integration An approach to power management that integrates the power supply into a fixture’s housing, eliminating the need for an external power supply. Organic Light-emitting Diodes (OLED) Organic light-emitting diodes (OLEDs) are based on organic (carbon based) materials. In contrast to LEDs, which are small point sources, OLEDs are made in sheets which provide a diffuse area light source. OLED technology is developing rapidly and is increasingly used in display applications such as cell phones and PDA screens. However, OLEDs are still some years away from becoming a practical general illumination source. Additional advancements are needed in light output, color, efficiency, cost, and lifetime. P Top The active power divided by the apparent power (i.e., product of the rms input voltage and rms input current of a driver). In an electronic device, such as an LED lighting fixture, a system of inductors, capacitors, or voltage converters to adjust the power factor of electronic devices toward the ideal power factor of 1.0. A method, used by LED drivers, to regulate the amount of energy to the LEDs. PWM turns LEDs on and off at high frequency, reducing total ON time to achieve a desired dimming level. R Top The total energy emitted by a light source across all wavelengths, measured in watts. The measurement of radiant energy (including light) in terms of absolute power. Compare photometry. RGB Color Model An additive color model in which red, green, and blue light are added together in different proportions to produce a broad range of colors, including white. RGB White A method of producing white light by combining the output from red, green, and blue LEDs. S Top Solid-state lighting A description of the devices that do not contain moving parts or parts that can break, rupture, shatter, leak or contaminate the environment. Spectral Luminous Efficiency Function A bell-shaped curve describing the sensitivity of a human eye with normal vision to the spectrum of visible light. Also known as the eye-sensitivity curve. Steradian The standard unit of solid angle. Describes two-dimensional angular spans in three-dimensional space. Subtractive Color Model A color model that applies to reflective surfaces such as paints, dyes, and inks. Combining red, green, and blue in equal amounts produces black. T Top Controlling the operating temperature of the product through design, examples includes heat sinks and improved airflow. Thermal Pad Temperature The measured temperature of the thermal pad during tesing. The thermal pad aides in the conduction of heat away from the component being cooled and into the heatsink. For more information refer to LUXEON® Rebel and LUXEON® Rebel ES Assemby and Handling Guide application brief 32. Thermal Resistance (K/W) The property of a material's ability to conduct heat. Tunable White Light White-light LED fixtures that combine channels of warm white and cool white LEDs to produce a range of color temperatures. U Top Ultraviolet (UV) Electromagnetic radiation with wavelength shorter than that of visible light. Useful Life The amount of light a lighting fixture delivers in an application, minus any wasted light. V Top The term used to describe the electrical potential difference between oppositely charged conductors, for example there is a 1.5V potential between the top and bottom of an AAA battery. W Top Wall Plug Efficiency This typically refers to the effectiveness of converting electrical power to light output. It is defined as the ratio of the radiant flux to the input electrical power. A description of light with a correlated color temperature between 3000K and 3500K, usually perceived a slightly yellow. The unit of electrical power as used by an electrical device during its operation. Many lamps come with rating in watts to indicate their power consumption. White Point The Coordinated Color Temperature (CCT) defined by a line perpendicular to the Planckian Black Body Curve and intersecting the measured chromaticity. Find a Qualified Electrician 8W p/meter (2.4W p/feet) LED STRIP 50 Meters (164 ft) Warm white (3,000K-3,500K) 70 Lumens p/watt 2.4W p/feet LED STRIP per foot Warm white (3,000K-3,500K) 70 Lumens p/watt 2.4W p/feet LED STRIP per foot Natural white (5,000K) 70 Lumens p/watt 8W p/meter (2.4W p/feet) LED STRIP 50 Meters (164 ft) Natural White 5000K 70 Lumens p/watt 110 AC input Power converter for single color rope ZZS-VTN-08007-32 Connection Pin for single color rope light (ZZS-VTN-08007-32) Connector for single color rope light (ZZS-VTN-08007-32) Inside L connector from tube to tube for ZZS-VTN-08007-32 End cap for ZZS-VTN-08007-32 Storefront LED lights RGB Module 24.6 Ft with 50 Modules 3 LED's each RGB Controller for storefront LED lights - 3 Channel with Remote Products Flyers and More UL Information Call us for a free consultation. Our local specialist will create a free S-ROI report. Find a Qualified Electrical Contractor Reviews and Projects 615 N 21st Avenue ARE YOU A RESELLER? Click here and fill in the form Eddy, Thank you very much for enhancing illumination for my facilities, saving money in the future with a small investment today ..... Continue reading.. Herman Alter The Ledradiant proposal said we'd save about 55%, but we got more savings. We replaced 4 fluorescents with only 3 Led tubes, as these are much brighter than the originals..more... Jorge Fidel I have replaced 32 Watt tubes with ledradiant 18 Watt in the office and 175 Watt high bay with 54 Watt solid state lamps. I was skeptical, but my electric bill is 35% down... Continue reading I would like to commend Mr. Guillermo Pecyner and the LED Radiant crew, for their professionalism and knowledge in the transition of our lightning service....more... Lisa Ann Grey 2018 LEDRadiant, LLC. All Rights Reserved. Designed & Developed by : Ledradiant, llc Advaith Starts Advaith Ends
cc/2020-05/en_middle_0087.json.gz/line1337808
__label__wiki
0.709019
0.709019
Archives for category: Hugo Award Arachne By Lisa Mason is in the Artificial Intelligence Storybundle! Lisa Mason #SFWApro Arachne by Lisa Mason High above the dangerous streets of post-quake San Francisco Island, mechanically modified professionals link minds in a cybernetic telespace to push through big deals and decisions at lightning speed. But unexplained telelink blackouts and bizarre hallucinations have marred mediator Carly Quester’s debut appearance before a computer-generated Venue—forcing her to consider delicate psychic surgery at the hands of a robot therapist, Prober Spinner. Suddenly the ambitious young mediator is at risk in a deadly Artificial Intelligence scheme to steal human souls—because the ghosts of Carly’s unconscious may be a prize well worth killing for. Arachne was Lisa Mason’s first novel published in hardcover by William Morrow, trade paperback by Eos, mass market paperback by AvoNova, and as an ebook by Bast Books. The book debuted on the Locus Hardcover Bestseller List. “Powerful . . . Entertaining . . . Imaginative.” “Cybernetics, robotics, the aftermath of San Francisco’s Big Quake II, urban tribalism—Lisa Mason combines them all with such deftness and grace, they form a living world. . . . Her characters and their world will stay with you long after you’ve finished this fine book.” –Locus, The Trade Magazine of Science Fiction and Fantasy Lisa Mason is the author of eight novels, including Summer of Love, A Time Travel (Bantam), a San Francisco Chronicle Recommended Book and Philip K. Dick Award Finalist, The Gilded Age, A Time Travel (Bantam) a New York Times Notable Book and New York Public Library Recommended Book, a collection of previously published fiction, Strange Ladies: 7 Stories (Bast Books), and two dozen stories and novellas in magazines and anthologies worldwide. Mason’s Omni story, “Tomorrow’s Child,” sold outright as a feature film to Universal Studios. Her first novel, Arachne, debuted on the Locus Hardcover Bestseller List. Visit her at Lisa Mason’s Official Website for books, ebooks, stories, and screenplays, reviews, interviews, and blogs, adorable pet pictures, forthcoming projects, fine art and bespoke jewelry by San Francisco artist Tom Robinson, worldwide Amazon.com links for Brazil, France, Germany, India, Italy, Japan, and Spain, and more! And on Lisa Mason’s Blog, on her Facebook Author Page, on her Facebook Profile Page, on Amazon, on Goodreads, on LinkedIn, on Twitter at @lisaSmason, at Smashwords, at Apple, at Kobo, and at Science Fiction and Fantasy Writers of America. The A.I. Storybundle is live, but only until April 20, 2017! Explore Artificial Intelligence and how A.I. will affect the future in Aristoi by Walter Jon Williams, The Bohr Maker by Linda Nagata, Arachne by Lisa Mason, Rewired: The Post-Cyberpunk Anthology, edited by John Kessel and James Patrick Kelly with stories by William Gibson, Bruce Sterling, Pat Cadigan, and others, Queen City Jazz by Kathleen Ann Goonan, Eye Candy by Ryan Schneider, Glass Houses by Laura Mixon, Cyberweb by Lisa Mason, Limit of Vision by Linda Nagata, and The A.I. Chronicles Anthology, edited by Samuel Peralta. Stock up your ereader for the Spring only at https://storybundle.com/ai Tags A.I., Arachne, Arachne the Novel, Artificial Intelligence, Artificial Intelligence Storybundle, Lisa Mason, Lisa Mason Fantasy and Science Fiction Author, Lisa Mason Fantasy and Science Fiction Author on Facebook, Lisa Mason on Facebook, science fiction, StoryBundle.com, The A.I. Chronicles Categories 2017, A.I., Arachne, Arachne the Novel, Aristoi, Artificial Intelligence, Artificial Intelligence Storybundle, Authors, Books, Bruce Sterling story, Cory Doctorow story, Cyberweb, Ebooks, Eye Candy, Glass Houses, Hugo Award, Hugo Award Finalist, John Kessell, Jonathan Lethem story, Kathleen Ann Goonan, Laura J. Mixon, Limit of Vision, Linda Nagata, Lisa Mason, Lisa Mason Fantasy and Science Fiction Author, Lisa Mason Fantasy and Science Fiction Author On Facebook, Lisa Mason Official Website, Lisa Mason on Facebook, Lisa Mason Urban Fantasy Author, Literary science fiction, Pat Cadigan story, Queen City Jazz, Rewired: The Post-Cyberpunk Anthology, Ryan Schneider, Samuel Peralta, Science fiction, StoryBundle, Storybundle Curator, Storybundle.com, The A.I. Chronicles, The Bohr Maker, Walter Jon Williams Excerpt from The Bohn Maker by Linda Nagata The Artificial Intelligence Storybundle! #SFWApro Just past dawn a dead man came floating down the river. The current carried him under the old river-straddling warehouse, where he fetched up against one of the fluff booms Arif had strung between the rotting pilings. Phousita found him when she came to gather the night’s harvest of fluff. He floated facedown. His head had wedged under the fluff boom; his long black hair swayed like a silk veil in the current. Phousita glanced nervously overhead. The trapdoor that opened onto the main floor of the abandoned warehouse hung open. She debated with herself a moment. It would be so easy to slip into the water, ease the dead man’s body off the boom and guide him back into the current before Arif discovered he was here. She would never have to worry about who he might have been or what bitter spirits still haunted his flesh. Let someone else farther down the river have him! But her conscience wouldn’t let her do it. Even in the dusky light under the river warehouse she could tell he’d been a wealthy man. Such fine clothes! And he might have money on him, jewels. The clan was hungry. She glanced again at the trapdoor. “Sumiati,” she called softly. The termite-eaten floorboards creaked, then Sumiati peered through the door. She had an empty bucket in her hands, ready to pass it to Phousita. “So fast today! Did you fill the first bucket already? It’s about time our catch improved!” Her dark eyes widened when she saw the body. She sucked in a little breath of surprise. “Phousita, he’s still got his clothes! Hold him! Don’t let the current take tuan away. I’ll come down. Look how beautiful his robe is. Oh, do you think we’re the first to find him?” She put the bucket down, then turned to climb through the trapdoor, moving awkwardly as she bent over her pregnant belly. She hung for a moment from the insulated wire rope, looking like some rare, ripe fruit. Then she dropped gracefully to the narrow metal plank that Arif had lashed between the pilings. It shivered under the impact. Phousita reached out a hand to steady her. Sumiati was a small woman, but even beside her, Phousita was tiny. She stood no taller than a petite child of seven or eight, though she was nearly twenty-five years old. Despite her size, her body was that of a woman: slender and beautifully proportioned, endowed with ample breasts and rounded hips, but on a scale that seemed unnaturally small. With her pretty round face, her dark eyes, and her thick black hair carefully coiled at the nape of her neck, she might have been a diminutive spirit out of some forgotten mythology. Her unusual appearance had once attracted many clients after-hours in the business district. But she’d promised Arif she wouldn’t venture down there anymore. She was hungrier these days. The clothes from this dead man would buy a large quantity of rice. And yet she hesitated. Easy wealth was so often cursed with misfortune. “I don’t like finding the tuan here,” she told Sumiati, instinctively using the traditional honorific. “There’s no telling what evil influences tuan carries with him. Let’s work quickly, then I’ll shove him back into the river.” Sumiati looked suddenly concerned. “Maybe we should call Arif.” “No!” Sumiati jerked at the sharp tone of Phousita’s voice. Phousita hunched her shoulders; she looked across at the dead man. “No,” she said more gently. “No need to wake Arif. We can do it.” Pulling the close-fitting skirt of her sarong up above her knees, she eased herself into the water until her tiny feet touched the clean gravel that cushioned the river’s concrete bed. The current swirled in cool streams around her waist, gradually soaking her faded blue breastcloth. She reached back to help Sumiati down, then grabbed the empty fluff bucket and started wading toward the dead man, one hand on the fluff boom for balance. Arif had constructed the boom shortly after he’d moved the clan into the abandoned warehouse. He’d gathered rare old plastic bottles, the kind that didn’t disintegrate in only a few weeks. He’d cut them in half and then lashed them to a plank stripped from the warehouse. They floated half-submerged in the water and when the fluff came floating down the river they trapped it, like huge hands grasping at the feast. The system had worked well for many months. It would still work, if only there were more fluff in the river . . . or fewer hungry people. Her gaze scanned the thin line of brown foam bobbing against the boom. A dismal catch. Not enough there to feed three people and there were thirty-nine empty bellies in the clan. Forty, counting Sumiati’s soon-to-be-born. Phousita tried not to think about it. Fierce rays of yellow light lanced under the river house as the sun leapt up over the city. Phousita touched the dead man’s head. Bright white flecks of bone and torn pink flesh could be seen through his black hair. The back of his skull had been caved in by a blow. The current still washed dilute puffs of blood from the wound. He must have been only minutes in the water. She lifted his head carefully by the long hair. His face was pale, nondescript European. His eyes were closed. A single kanji glowed in soft, luminescent red on his cheek. She couldn’t read it. “Look, tuan was robbed,” she said, pointing at the torn lobes of his ears where earrings must have been. Sumiati peered over her shoulder. Out of principle Phousita touched his neck, checked for a pulse. It was a ceremony the Chinese doctor insisted upon, even when the patient was obviously dead. Perhaps it helped ease the frightened spirit still trapped within the body. Sumiati looked on, a worried pout on her lips until Phousita shook her head. Sumiati smiled. “Even if tuan was robbed, he still has his clothes,” she said. “Maybe the thieves overlooked something.” She quickly checked his pockets, but found nothing. Phousita worked at the fastenings on his robe. In minutes they had the body stripped. Phousita stepped back in relief. Sumiati’s eyes glowed as she held the fluff bucket stuffed full of fine clothing. “Push him off the boom,” she urged. “Let’s hurry. We have to take these to temple market. It’s a long walk, but we’ll get the best price there. We can take some water to sell too. And then we can buy rice. Enough for everyone to eat until their stomachs complain! And clothes. Henri and Maman need new clothes. And medicines, of course. You’ll know the ones to buy. And the Chinese doctor is always glad to see you.” Phousita smiled at Sumiati’s nervous chatter. The dead man had indeed brought them good fortune. And now she could send him on his way. She reached for the dead man’s arm. Twisted it gently, to ease him off the boom. Hurry now. In a moment he would be gone. “Phousita!” Her hands jerked back in guilty surprise. She looked up as Arif dropped through the trapdoor. He landed on the metal plank. His slim, hard body—clothed only in worn shorts—was poised in a fighter’s stance. Arif was always fighting, she thought bitterly. And he’d do anything, anything at all to survive. He stared at her, cruel violet eyes so out of place amongst the swollen, exaggerated features of his laughing, yellow, bioluminescent joker’s face. Sumiati, blind to his moods, started to bubble forth in her good-natured way with the tale of their find, but Arif cut her off with a gesture. “Phousita,” he growled softly. “What are you doing?” Phousita glanced at the nude body of the dead man. Without his clothes he seemed a pale, ghostly thing. “Take the basket up, Sumiati,” she said softly. “Arif will help me now.” Sumiati nodded, confused. Arif helped her out of the river and onto the plank, then stepped back, out of her way. She climbed the rope. “Close the door behind you,” he said. He still stared at Phousita. In the harsh shadows under the warehouse, his ogre-ugly face glowed brilliant yellow with its own generated light. By his own admission Arif had been a wicked child. His mother had sold him to a sorcerer who poisoned him with a spell that exposed his sins upon his face. With his ridiculously elongated nose and chin, his cheeks as round and full as overripe guavas, and his glowing yellow complexion, he resembled one of the comical servants of the wayang theater. Except his eyes. His gaze flickered upward as the corrugated metal door closed with a creak. Soft footsteps moved off across the warehouse floor. When Sumiati was out of earshot, Arif spoke: “He’s food, Phousita.” He walked to the end of the plank. “Why would you throw away food?” Suddenly Arif dove, slicing like a sunbeam through the water, his thick black hair, tied up in a short ponytail, trailing behind him. He surfaced next to Phousita, startling her with an explosion of bubbles. He threw his swollen yellow head back and laughed, then hugged her tiny figure quickly, his arms encircling her waist. “Don’t be afraid, Phousita,” he crooned. “The old witch filled your head with all kinds of lies. It’s just a body. Tuan’s spirit is gone.” Phousita was trembling. She sank into Arif’s arms while the cool river water rushed past. “You don’t know what kind of man he was,” she whispered. “It matters if we take his body into ours.” “Not his body. Only the fluff that grows from it. You helped me plant them before. You ate the fluff.” She laid her head against his chest. He’d dismissed her reluctance then too. “Sutedjo and Piet were part of our clan,” she said. “We knew them; they would wish us no harm. But this man is a stranger; we don’t know what evil he’s done.” “It’s gone with him.” “His spirit clings to the body.” But Arif’s patience had eroded. “Spirit rides in the head and his head’s smashed in,” he snapped. “Stupid country girl, he’s gone!” He ducked under the water. A moment later, he surfaced on the other side of the boom. Grabbing the dead man’s wrists, he twisted the body roughly off the boom. “I wish you’d never met that old witch! She chased your brains away. You want to be a sorceress like her? Fah! She was just a stupid old hill woman. I’m glad she’s dead. I wish I could have planted her too!” Phousita slapped the water. “Stop it, Arif. Stop it! You pretend you know so much. You don’t know! You hear rumors on the street and you think they’re true. Shiny new magic. But even the new sorcerers don’t know everything. Arif!” He wasn’t listening. He’d turned his back on her, hauling the dead man up the river. She took a deep breath and ducked awkwardly under the boom. Fear filled her as water swirled past her face. Then she burst to the surface, gasping and splashing for air. She didn’t know how to swim. Arif had promised to teach her. Oh, why did she get angry? It did no good. Arif only wanted the best for her, for everyone in the clan. It hurt him when she let her doubt show. “Arif.” She caught up with him; helped him drag the body against the current. They reached the edge of the river house. Arif stopped. Phousita glanced down through the clear water to the gravel beneath her feet. Scattered there she could still see the remnants of Sutedjo’s bones, bright white slivers that hadn’t yet turned to fluff. She glanced up. Arif studied her with violet eyes. “It wasn’t the old witch who cured you, Phousita. It was the Chinese doctor. The old magic is dead.” He ducked under the water, hauling one leg of the dead man with him. Phousita used her tiny body as an anchor to keep the corpse from drifting downstream while Arif secured the man’s foot to a mooring stone on the bottom. He surfaced, took the other leg, hauled that down too. Over the next few days the body would slowly dissolve into a rich harvest of fluff that would float to the surface and gather downstream against the fluff boom. The clan would never know the reason for their good fortune. They’d attribute the abundant harvest to luck. Fluff hadn’t existed when the old woman was alive. That was only a few years ago. Phousita could remember it easily. She’d been perhaps twenty-one, still trapped in a child’s body. The river had been a stinking sewer then, a deadly thread of water draining the city’s filth. When the fluff first started collecting on the river’s banks, they’d paid no attention to it, assuming it was just a new kind of pollution. Then Arif had seen the rats eating it. . . . Now the river ran clear. The water was clean, drinkable, though the city’s filth still washed into it with every rain. Arif surfaced again, took the dead man’s right arm. “Help push him under,” he said gruffly. Phousita nodded. Arif stretched the arm of the corpse beyond its head, then reached underwater for the mooring stone. He found it, and glanced over his shoulder at Phousita. “Now.” She placed her palms flat against the cold, slippery chest and leaned hard, forcing the body under. Something gave way beneath her right hand. She could hear it more than feel it, a sharp metal snick! The chest opened like a blinking eye. A golden needle shot out of the black orifice, to bury itself in Phousita’s breast. She reared back in horror, swiping at the spot of blood just above her breastcloth that marked the point where the needle had disappeared. She stumbled through the water. Her chest was on fire. She could hear herself bleating like a terrified child: “Unh! unh! unh!” The corpse twisted in the current, the shoulders rolled. She saw a little white tear in the dead white chest before the corpse turned facedown again. Her gaze shifted to Arif. The horror in his eyes must have echoed her own. Help me. She tried to say it, but her mouth had gone dry. Her tongue grew puffy and swollen as the needle’s poison spread through her system. The bubbling song of the river seemed to rise in volume, building like a wall around her before it collapsed into a chaotic buzz. Her vision blurred. She could see Arif reaching for her. But the current was swifter. Her eyes closed as its cold hands caressed her face and swirled through her hair. Visit Linda Nagata at http://www.mythicisland.com Tags A.I., Arachne, Aristoi, Artificial Intelligence, Artificial Intelligence Storybundle, Cyberweb, Eye Candy, Glass Houses, Limit of Vision, Linda Nagata, Lisa Mason, Lisa Mason Fantasy and Science Fiction Author, Queen City Jazz, Rewired: The Post-Cyberpunk Anthology, science fiction, Storybundle Curator, StoryBundle.com, The A.I. Chronicles, The Bohr Maker Categories 2017, A.I., Arachne, Arachne the Novel, Aristoi, Artificial Intelligence, Artificial Intelligence Storybundle, Authors, Books, Bruce Sterling story, Cory Doctorow story, Cyberweb, Ebooks, Eye Candy, Glass Houses, Hugo Award, Hugo Award Finalist, John Kessell, Jonathan Lethem story, Kathleen Ann Goonan, Laura J. Mixon, Limit of Vision, Linda Nagata, Lisa Mason, Lisa Mason Fantasy and Science Fiction Author, Lisa Mason Fantasy and Science Fiction Author On Facebook, Lisa Mason Official Website, Lisa Mason on Facebook, Lisa Mason Urban Fantasy Author, Pat Cadigan story, Rewired: The Post-Cyberpunk Anthology, Samuel Peralta, StoryBundle, Storybundle Curator, Storybundle.com, The A.I. Chronicles, The Bohr Maker, Walter Jon Williams Wow! Look what came in the mail today! The Sept-Oct Magazine of Fantasy and Science Fiction with My Story, “Anything For You” Lisa Mason #SFWApro Wow! Look what came in the mail today! The September-October Magazine of Fantasy and Science Fiction with my story, “Anything For You.” You can order the magazine at The Magazine of Fantasy and Science Fiction. In 2015, I published two well-received stories in F&SF, “Teardrop” in the May-June 2015 issue and “Tomorrow is a Lovely Day” in the November-December 2015 issue. These were both chosen by Gordon Van Gelder, Hugo Award-winning American science fiction editor. The new story was chosen by C.C. Finlay. Thanks for the great introduction, Charlie! I’ve sold previously to F&SF when yet another editor, Kristine Kathryn Rusch, was helming the magazine. One story, “Destination,” appears in my five-star rated collection Strange Ladies: 7 Stories. I’m so honored and excited to publish again in one of the most highly respected science fiction and fantasy magazines continuously in publication since 1949. Please note: Advertisers are posting ads on my blogsite without my knowledge, permission, or endorsement. Please ignore them. Tags Anything For You, authors, C.C. Finlay, Gordon Van Gelder, Kristine Kathryn Rusch, Lisa Mason, Lisa Mason Fantasy and Science Fiction Author, Lisa Mason Fantasy and Science Fiction Author on Facebook, Lisa Mason on Facebook, Lisa Mason on Twitter, Lisa Mason Romantic Suspense Author, Lisa Mason Screenwriter, Lisa Mason Urban Fantasy Author, Magazine of Fantasy and Science Fiction, May-June 2015 Magazine of Fantasy and Science Fiction, Nov-Dec 2015 Magazine of Fantasy and Science Fiction, September-October 2016 issue of The Magazine of Fantasy and Science Fiction, Teardrop, Tomorrow Is A Lovely Day Categories 2016, Anything For You, Authors, C.C. Finlay, Diversity in SF/F, Editor of The Magazine of Fantasy and Science Fiction, Gordon Van Gelder, Hugo Award, Kristine Kathryn Rusch, Lisa Mason, Lisa Mason Fantasy and Science Fiction Author, Lisa Mason Fantasy and Science Fiction Author On Facebook, Lisa Mason Official Website, Lisa Mason on Facebook, Lisa Mason Romantic Suspense Author, Lisa Mason Screenwriter, Lisa Mason Urban Fantasy Author, Literary science fiction, Magazine of Fantasy and Science Fiction, Magazine of Fantasy and Science Fiction November-December 2015, Magazine Story, Magazines, May-June 2015 Magazine of Fantasy and Science Fiction, Science fiction, September-October 2016 issue of The Magazine of Fantasy and Science Fiction, Teardrop, Teardrop by Lisa Mason, Tomorrow Is A Lovely Day, Tomorrow Is A Lovely Day by Lisa Mason Last Call! The Story Collection Storybundle Ends Today June 2 at Midnight Eastern, 9 P.M. Pacific! #SFWApro The Story Collection Storybundle is ends today June 2 at Midnight Eastern Time at https://storybundle.com/storycollection! At StoryBundle, you the reader name your price—whatever you feel the books are worth. You may designate a portion of the proceeds to go to a charity. For The Story Collection Storybundle, that’s Science Fiction and Fantasy Writers of America (“SFWA”). SFWA champions writers’ rights, sponsors the Nebula Award for excellence in science fiction, and promotes numerous literacy groups. For $5 (or more, if you wish), you’ll receive the basic bundle of three books in any eBook format worldwide. For $12 (or more, it’s up to you), you’ll receive five bonus books as well. That’s eight stellar ebooks to add to your e-library. The basic bundle includes: Collected Stories by Lewis Shiner The extensive and multi-genre collection was prepared as an ebook for Storybundle, includes forty-one stories, and has an Introduction by Karen Joy Fowler. Shiner was a finalist for the Philip K Dick Award, the Hugo Award, and the Nebula Award. Errantry: Strange Stories by Elizabeth Hand Hand won the World Fantasy Award four times, the Nebula Award twice, the Shirley Jackson Award twice, the Mythopoetic Award, and was a New York Times and Washington Post Notable Book Author. The Green Leopard Plague and Other Stories by Walter Jon Williams Two stories in this collection won the Nebula Award. Williams was a Philip K Dick Award Finalist and placed numerous times for the Nebula and Hugo Awards. The bonus books, which complete your bundle, are: What I Didn’t See: Stories by Karen Joy Fowler The collection won the World Fantasy Award and the title story won the Nebula. Fowler wrote The Jane Austen Book Club, a New York Times Bestseller made into a film, and won the 2013 PEN/Faulkner for We are all completely beside ourselves. 6 Stories by Kathe Koja The collection was created by the author exclusively for Storybundle. Koja won the Bram Stoker Award and was a Philip K Dick Award Finalist. Strange Ladies: 7 Stories by Lisa Mason The collection received five stars from the San Francisco Review of Books. Mason was a Philip K Dick Award Finalist, a San Francisco Chronicle Recommended Book Author, and a New York Times Notable Book Author. Women Up to No Good by Pat Murphy Two stories in the collection were nominated for the Nebula. Murphy won the Nebula Award twice, the World Fantasy Award, and the Philip K Dick Award. Wild Things by C. C. Finlay The collection is an ebook exclusive for Storybundle and has a new Afterword. A multi-award-nominated author, Finlay is the editor of The Magazine of Fantasy and Science Fiction. But never mind the authors’ accolades and accomplishments. The collections are a feast for the mind—amazing, far-ranging, thought-provoking, dark, disturbing, witty, and—dare I say it?—just a damn good read. It’s difficult to locate some of the stories in anthologies and magazines that have gone out of print. The authors of the Story Collection Storybundle have done the work of assembling their collections. All you have to do is enjoy! If you love short stories as much as I do, you’ll find a delightful cornucopia of literary riches. The Story Collection Storybundle is unique and diverse. Browse selections among them or devour an author’s entire offering. That’s what I love about stories. The choice is yours! So there you have it, my friends. The Story Collection Storybundle ends today, June 2, 2016, at Midnight Eastern Time, 9 p.m. Pacific Time. Load up your ereader for summer vacation and beyond! Once it’s gone, it’s gone forever! Download yours today at https://storybundle.com/storycollection and enjoy world-class, award-winning reading right now and through the summer months. Thank you for your readership! Tags 6 Stories, books, Bram Stoker Award Winner, C.C. Finlay, Collected Stories by Lewis Shiner, ebooks, Elizabeth Hand, Errantry, Hugo Award Finalist, Karen Joy Fowler, Kathe Koja, Lisa Mason, Lisa Mason Fantasy and Science Fiction Author, Nebula Award Winner, New York Times Notable Book, Pat Murphy, Philip K. Dick Award Winner, Story Collection, Story Collection Storybundle, StoryBundle.com, Strange Ladies: 7 Stories, The Green Leopard Plague, Walter Jon Williams, What I Didn't See, Wild Things, Women Up To No Good Categories 2016, 6 Stories, Authors, Books, Bram Stoker Award Winner, C.C. Finlay, Collected Stories, Collected Stories by Lewis Shiner, Ebooks, Editor of The Magazine of Fantasy and Science Fiction, Elizabeth Hand, Errantry, Hugo Award, Hugo Award Finalist, Karen Joy Fowler, Kathe Koja, Lewis Shiner, Lisa Mason, Lisa Mason Fantasy and Science Fiction Author, Lisa Mason Fantasy and Science Fiction Author On Facebook, Literary science fiction, Magazine of Fantasy and Science Fiction, Nebula Award Finalist, Nebula Award Winner, New York Times Notable Book, Pat Murphy, Philip K. Dick Award Finalist, Philip K. Dick Award Winner, Published Stories, San Francisco Chronicle Recommended Book, Speculative Fiction, Stories, Story Collection, Story Collection Storybundle, StoryBundle, Storybundle.com, Strange Ladies: 7 Stories, The Green Leopard Plague, Walter Jon Williams, What I Didn't See, Wild Things, Women Up To No Good, World Fantasy Award Winner Why Read Short Stories? Curator’s Introduction, The Story Collection Storybundle Ends Tomorrow, June 2! #SFWApro The Story Collection Storybundle Curated by Lisa Mason I love short stories. There’s nothing like a good story to satisfy your fiction fix in the course of a busy day, a tiny universe savored over a lunch hour, on a train commute, with a glass of wine at the end of the day. Because of its compression, its fewer moving parts, a story may be more highly crafted than a novel. A famous story may represent an author’s style and vision more succinctly than any one of his or her books. Think of “The Snows of Kilimanjaro” by Ernest Hemingway, “The Lottery” by Shirley Jackson, “The Pit and the Pendulum” by Edgar Allen Poe. Or how about “What I Didn’t See” by Karen Joy Fowler, “The War At Home” by Lewis Shiner, “Love and Sex Among the Invertebrates” by Pat Murphy . . . But wait a minute! We’ve got those last three stories in the Story Collection Storybundle. And we’ve got more than stories, we’ve got multi-award-winning and award-nominated story collections. The authors have assembled their short fiction written over a decade—sometimes over two or three decades—of their careers. Stories published in wide-ranging and diverse magazines and anthologies, many which may be difficult to find now, some of which may have gone out of print. The authors have done the hard work of gathering up these amazing stories and all you, the reader, need to do is enjoy! But never mind the authors’ accolades and accomplishments. The collections are a feast for the mind—amazing, far-ranging, tragic, disturbing, thought-provoking, witty, and—dare I say it?—just a damn good read. Oh, the places you’ll go! Trek to Africa in search of gorillas in Karen Joy Fowler’s “What I Didn’t See.” Journey to Paris in search of an antique spool of recording wire in Lewis Shiner’s “Perfidia.” Explore the mysteries of a little boy’s life in Walter Jon Williams’ “Daddy’s World.” Search for the Folding Man in Elizabeth Hand’s “Errantry.” Embark on a cross-country car trip with three mysterious strangers in Lisa Mason’s “Destination.” Defy conventional society in Pat Murphy’s “A Flock of Lawn Flamingos.” Learn the dark powers of a voodoo doll in Kathe Koja’s “Baby.” Search for resources on asteroids in C.C. Finlay’s “The Frontier Archipelago.” As always at Storybundle.com, you the reader name your price—whatever you feel the books are worth. You may designate a portion of the proceeds to go to a charity. For the Story Collection Storybundle, that’s Science Fiction and Fantasy Writers of America (“SFWA”). SFWA champions writers’ rights, sponsors the Nebula Award for excellence in fantasy and science fiction, and promotes numerous literacy groups. The basic bundle (minimum $5 to purchase, more if you feel the books are worth more) includes: This extensive and multi-genre collection was prepared as an ebook for Storybundle, includes forty-one stories, and has an Introduction by Karen Joy Fowler. Shiner was a finalist for the Philip K Dick Award, the Hugo Award, and the Nebula Award. Two stories in this collection won the Nebula Award. Williams was a New York Times Bestseller, placed as a Philip K Dick Award Finalist and numerous times for the Nebula and Hugo Awards. To complete your bundle, beat the bonus price of $12 and you’ll receive another five amazing, award-winning books: The collection was created by the author exclusively for Storybundle. Koja won the Bram Stoker Award, won the io9.com award for one of the ten best first novels that shook the world, and was a Philip K Dick Award Finalist. Two stories in the collection were nominated for the Nebula Award. Murphy won the Nebula Award twice, the World Fantasy Award, and the Philip K Dick Award. The collection was prepared exclusively as an ebook for Storybundle and has a brand-new Afterword. A multi-award-nominated author translated in over two dozen languages, Finlay is the editor of The Magazine of Fantasy and Science Fiction. So there you have it! A super-collection from some of the most talented storywriters in any genre. Devour an author’s entire offering or browse stories from collection to collection. The choice is yours with the Story Collection Storybundle! Stock up your ereader with award-winning fiction that’s perfect for your summer vacation. The Story Collection Storybundle is both historic and unique, an excellent addition to your elibrary providing world-class, award-winning reading right now, through the summer, and beyond. –Lisa Mason, Curator The Story Collection Storybundle ends June 2, 2016 at Storybundle. The bundle is easy to read on computers, smartphones, and tablets, as well as Kindle and other ereaders via file transfer, email, and other methods. You get multiple DRM-free formats (.epub and .mobi) for all books. When the bundle is gone, it’s gone. So act now and download yours today! It’s super easy to give the gift of reading with StoryBundle, thanks to our gift cards – which allow you to send someone a code that they can redeem for any future StoryBundle bundle – and timed delivery, which allows you to control exactly when your recipient will get the gift of StoryBundle. Why StoryBundle? Here are just a few benefits StoryBundle provides. Get quality reads: We’ve chosen works from excellent authors to bundle together in one convenient package. Pay what you want (minimum $5): You decide how much these fantastic books are worth to you. If you can only spare a little, that’s fine! You’ll still get access to a batch of thrilling titles. Support authors who support DRM-free books: StoryBundle is a platform for authors to get exposure for their works, both for the titles featured in the bundle and for the rest of their list. Supporting authors who let you read their books on any device you want—restriction free—will show everyone there’s nothing wrong with ditching DRM. Give to worthy causes: Bundle buyers have a chance to donate a portion of their proceeds to charity. The Story Collection Storybundle forwards your donations to Science Fiction and Fantasy Writers of America. Receive bonus books to complete your bundle. When you beat our bonus price of $12, you’re not just getting three books, you’re getting eight! StoryBundle was created to give a platform for independent authors to showcase their work, and a source of quality titles for thirsty readers. StoryBundle works with authors to create bundles of ebooks that can be purchased by readers at their desired price. Before starting StoryBundle, Founder Jason Chen covered technology and software as an editor for Gizmodo.com and Lifehacker.com. For more information, visit our website at storybundle.com, Twitter us at @storybundle, Like us on Facebook, and Plus us on Google Plus. For press inquiries, please email press@storybundle.com. Tags 6 Stories, authors, books, C.C. Finlay, Collected Stories by Lewis Shiner, ebooks, Elizabeth Hand, Errantry, Hugo Award, Hugo Award Finalist, Karen Joy Fowler, Kathe Koja, Lewis Shiner, Lisa Mason, Nebula Award Finalist, Nebula Award Winner, Philip K Dick Award Finalist, Philip K. Dick Award Winner, Story Collection, Story Collection Storybundle, Story Collections, StoryBundle.com, Strange Ladies: 7 Stories, The Green Leopard Plague, Walter Jon Williams, What I Didn't See, Wild Things, World Fantasy Award Winner Categories 2016, 6 Stories, Authors, Bram Stoker Award Winner, C.C. Finlay, Collected Stories, Collected Stories by Lewis Shiner, Curator of the Story Collection Storybundle, Ebooks, Editor of The Magazine of Fantasy and Science Fiction, Elizabeth Hand, Errantry, Hugo Award, Hugo Award Finalist, Karen Joy Fowler, Kathe Koja, Lewis Shiner, Lisa Mason, Lisa Mason Fantasy and Science Fiction Author, Lisa Mason Fantasy and Science Fiction Author On Facebook, Lisa Mason Official Website, Lisa Mason on Facebook, Lisa Mason Romantic Suspense Author, Lisa Mason Screenwriter, Lisa Mason Urban Fantasy Author, Literary science fiction, Nebula Award, Nebula Award Finalist, Nebula Award Winner, New York Times Notable Book, Pat Murphy, Philip K. Dick Award, Philip K. Dick Award Finalist, Philip K. Dick Award Winner, San Francisco Chronicle Recommended Book, Short Stories, Stories, Story Collection, Story Collection Storybundle, StoryBundle, Storybundle Curator, Storybundle.com, Strange Ladies: 7 Stories, The Green Leopard Plague, The Story Collection Storybundle, Walter Jon Williams, Weird Fiction, What I Didn't See, Wild Things, Women Up To No Good, World Fantasy Award Winner Curator’s Note for The Green Leopard Plague by Walter Jon Williams, The Story Collection Storybundle #SFWApro Walter explores such far-future themes as the uploading of human consciousness into a computer-generated environment, AI, and cloning (among other amazing things). But he sympathetically grounds his tales in family relationships—parents and children, brothers and sisters, husbands and wives—so the reader experiences the dilemmas and resolutions in a satisfying way. His vigorous, vivid, multi-award-winning style in The Green Leopard Plague is a treat to read in The Story Collection Storybundle. –Lisa Mason From a STARRED REVIEW in Publisher’s Weekly: “In this provocative, entertaining collection of nine reprints, Williams (Implied Spaces) brings together tales of the College of Mystery as well as other explorations of the gray region where psyche and technology meet. Standouts include the Nebula-winning Daddy’s World, in which a young boy finds himself trapped in a nightmare not of his making; The Last Ride of German Freddie, an alternate history in which Friedrich Nietzsche meets Wyatt Earp; Incarnation Day, wherein humanity raises its children as computer programs; and the title story, another Nebula winner, about a utopian society’s birth and psychological effects. Coupled with extensive notes from the author, these stories invite readers to share and enjoy Williams’s extensive knowledge of history, psychology, and culture.” For more about Walter, his books and stories, and his expert advice and opinions about writing, visit him at http://www.walterjonwilliams.net So there you have it, my friends. The Story Collection Storybundle is live! You the reader name your price—whatever you feel the books are worth. You may even designate a portion to go to a charity. Savor traditionally published, multi-award-winning stories from diverse and varied publications which the authors have collected for you. The Bundle includes What I Didn’t See (a World Fantasy Award Winner) by Karen Joy Fowler (the New York Times bestselling author of The Jane Austen Book Club), Collected Stories by Philip K. Dick Award Finalist Lewis Shiner, Errantry by four-time World Fantasy Award-winning Elizabeth Hand, The Green Leopard Plague by two-time Nebula Award-winning Walter Jon Williams, Women Up to No Good by multi-award-winning Pat Murphy, Strange Ladies: 7 Stories by New York Times Notable Book Author Lisa Mason, Wild Things by C. C. Finlay, the editor of The Magazine of Fantasy and Science Fiction, and 6 Stories by Bram Stoker Award-winning Kathe Koja. It’s time, don’t delay. Really, you must act now. The Story Collection Storybundle lasts only five more days until June 2, 2016 at https://storybundle.com/storycollection Tags authors, books, ebooks, Hugo Award, Nebula Award Winner, Story Collection, Story Collection Storybundle, StoryBundle.com, The Green Leopard Plague, Walter Jon Williams, World Fantasy Award Winner Categories 2016, Authors, Books, Ebooks, Hugo Award, Nebula Award Winner, Philip K. Dick Award Finalist, Story Collection, Story Collection Storybundle, StoryBundle, Storybundle Curator, Storybundle.com, The Green Leopard Plague, Walter Jon Williams, World Fantasy Award Winner Five Days Left for The Story Collection Storybundle! Grab This Opportunity of a Lifetime, When It’s Gone, It’s Gone! #SFWApro The Story Collection Storybundle is ends June 2, 2016 at Midnight Eastern, 9 p.m., Pacific, at https://storybundle.com/storycollection! Two stories in the collection were nominated for the Nebula. Murphy won the Nebula twice, the World Fantasy, and the Philip K Dick Awards. The collection is an ebook exclusive for Storybundle and has a new Afterword. An award-nominated fantasy author, Finlay is the editor of The Magazine of Fantasy and Science Fiction. But never mind the authors’ accolades and accomplishments. The collections are a feast for the mind—amazing, far-ranging, thought-provoking, witty, and—dare I say it?—a damn good read. So there you have it, my friends. The Story Collection Storybundle ends in five days on June 2, 2016, at Midnight Eastern Time. Once it’s gone, it’s gone! Download yours today at https://storybundle.com/storycollection and enjoy world-class, award-winning reading right now and through the summer months. Tags 6 Stories, authors, books, Bram Stoker Award Winner, C.C. Finlay, Collected Stories by Lewis Shiner, ebooks, Elizabeth Hand, Errantry, Hugo Award, Karen Joy Fowler, Kathe Koja, Lewis Shiner, Lisa Mason, Lisa Mason Fantasy and Science Fiction Author, Nebula Award Winner, Pat Murphy, Philip K. Dick Award Winner, Story Collection, Story Collection Storybundle, Story Collections, StoryBundle.com, Strange Ladies: 7 Stories, The Green Leopard Plague, Walter Jon Williams, What I Didn't See, Wild Things, Women Up To No Good, World Fantasy Award Winner Categories 2016, 6 Stories, Authors, Books, Bram Stoker Award Winner, C.C. Finlay, Collected Stories, Collected Stories by Lewis Shiner, Ebooks, Editor of The Magazine of Fantasy and Science Fiction, Elizabeth Hand, Errantry, Hugo Award, Hugo Award Finalist, Karen Joy Fowler, Kathe Koja, Lisa Mason, Lisa Mason Fantasy and Science Fiction Author, Lisa Mason Fantasy and Science Fiction Author On Facebook, Lisa Mason Official Website, Lisa Mason on Facebook, Lisa Mason Romantic Suspense Author, Lisa Mason Talks Writing with Elle Emerson, Lisa Mason Urban Fantasy Author, Literary science fiction, Magazine of Fantasy and Science Fiction, Nebula Award, Nebula Award Finalist, Nebula Award Winner, New York Times Notable Book, Pat Murphy, Philip K. Dick Award, Philip K. Dick Award Finalist, Philip K. Dick Award Winner, San Francisco Chronicle Recommended Book, Short Stories, Speculative Fiction, Stories, Story Collection, Story Collection Storybundle, StoryBundle, Storybundle.com, Strange Ladies: 7 Stories, The Green Leopard Plague, The Story Collection Storybundle, Walter Jon Williams, What I Didn't See, Wild Things, Women Up To No Good
cc/2020-05/en_middle_0087.json.gz/line1337817
__label__cc
0.647512
0.352488
Author Alyxandra Harvey Interview and Book Contest LIVE at BittenyBooks! One lucky commenter will receive an Autographed copy of A Breath of Frost Emma Day and her two cousins, Gretchen and Penelope, are uninterested in their debutante lives. All the boring balls, tiresome curtsying and polite conversation leave much to be desired. Then a girl is found dead, frost clinging to her lifeless body, and the murder is traced to Emma. As their world is turned upside down, Emma discovers more about herself and her cousins, from her connection to the murders to the secrets of her family legacy. Now the girls must embrace their true Lovegrove inheritance in order to stop the chaos, even if that means risking their lives. Dangerously handsome Cormac Fairfax wants to help Emma - but, with secrets of his own to hide, can she trust him? The first book in a deliciously dark new trilogy. Perfect for fans of Cassandra Clare and Ruth Warburton. Go here to comment Authors Faith Hunter and Carol Malcolm Release Party and $50.00 Amazon Gift Card Contest LIVE at BittenByBooks! Authors Faith Hunter and Carol Malcolm Release Party and $50.00 Amazon Gift Card Contest LIVE at BittenByBooks! Featuring stories by SHANNON K. BUTCHER * RACHEL CAINE * LUCIENNE DIVER * CHRIS MARIE GREEN * CHRISTINA HENRY * FAITH HUNTER * CHLOE NEILL * KALAYNA PRICE * ROB THURMAN New York Times bestselling author Rachel Caine has modern-day potions witches Holly and Andrew facing off against a firebrand politician who wears literally killer boots in a Texas-sized rodeo of trouble. Boot-loving Cadogan vampire Lindsey must team up with off-again, on-again vampire partner Luc when a woman from her past is targeted by supernaturals in New York Times bestselling author Chloe Neill’s all-new adventure. And New York Times bestselling author Rob Thurman features Trixa Iktomi from her Trickster series dealing with magical vengeance and magical footwear. Taking kick-ass urban fantasy literally, USA Today bestselling authors Kalayna Price and Faith Hunter bring together the best of the genre to once again prove when you’re fighting supernatural forces, it helps to keep your feet on the ground. Jane Yellowrock is a shapeshifting skinwalker who means bad news for the undead. Now, she’s back and better than ever, as USA Today bestselling author Faith Hunter gives readers an in-depth glimpse at Jane’s world…plus an all-new Jane Yellowrock novella! The gritty, sexy, and thrilling New Orleans of the Jane Yellowrock novels is about to be exposed in a whole new way. Filled with brand new, original content, this guide is a must-have for any fan. *Delve into the history of the characters in the series, including the vampire clans. *Get better acquainted with Jane’s inner Beast with her in-depth guide to humanity. *Relive all the action with an essential timeline of Jane’s exploits as a vampire slayer and a comprehensive glossary of terms. *Experience Jane’s latest thrilling adventure in an all-new Jane Yellowrock novella. Plus, includes an exclusive sneak peek of the next Jane Yellowrock novel! Posted by Lisa Richards/alterlisa at 9:22 PM No comments: Links to this post Author Keri Lake Release Party and $50.00 Amazon Gift Card Contest LIVE at BittenByBooks! As Wrath’s fiercest son, Logan carries the scars of fifty years spent in the most dreaded prison of the underworld, for a sin he’d kill to keep secret. Enduring decades of gruesome torture has left Logan feared by and detached from others, until a female Alexi’s blood resurrects his soul from death and, with it, the pleasures he’s been denied for so long. Plagued by shame of her own, Calla is drawn to the ruthless demon, Logan, whose insatiable craving for her touch rouses buried passions and, for once, leaves her feeling desired. A dark and dangerous evil has been reawakened, however, and when Calla is drawn too close to its breeding grounds, Logan vows to summon the violence of Wrath in order to keep her safe. First, though, Calla must save him from a past riddled with deceit and corruption … but only if she can accept the chilling consequences of unearthing his vilest skeleton. Keri Lake is a married mother of two living in Michigan. By day, she tries to make use of the degrees she's earned in science. By night, she writes paranormal romance, urban fantasy and likes to craft the occasional tragic love story. Though novels tend to be her focus, she also writes short stories and flash fiction whenever distraction manages to suck her in to the Land of Shiny Things. When she isn't toiling away on plots and protagonists, she enjoys reading, music and travel. If she could create mystical powers for herself, she'd have the ability to flash to anywhere in the world. And if she could flash to anywhere in the world at this very moment, she'd be staring at the ocean from her adirondack chair on the shores of North Carolina. Like her on Facebook: http://www.facebook.com/kerilakeauthor Follow on Twitter: http://www.twitter.com/kerilake Author Victoria Danann Release Party and Book Contest LIVE at BittenByBooks! The Order of the Black Swan is a serial saga including My Familiar Stranger, The Witch’s Dream, A Summoner’s Tale, Moonlight, Gathering Storm, and NEVER BEFORE RELEASED Book 6, A Tale of Two Kingdoms. Once upon a time a girl lost everything familiar. She escaped death by being forced into an experiment that left her in another world where modern day knights, elves, vampires, werewolves, witches, demons and fae became her allies, friends and family. She discovered a place where adventure intersects fairytales, where honor is more than an ideal, and she learned that love can find you in the strangest places, when you’re least expecting it, even when you’re far, far from home. This is the story of Elora Laiken’s strange and wonderful journey. It is also the story of those whose lives she touches along the way. If you love romance, paranormal, science fiction, fantasy, urban fantasy, contemporary, this series is right for you. 17+ The entire box set (523,000 words) will be available for $0.99 through Saturday, December 14th and then it will revert to regular price of $18.99. Author Alyxandra Harvey Interview and Book Contest... Authors Faith Hunter and Carol Malcolm Release Par... Author Keri Lake Release Party and $50.00 Amazon G... Author Victoria Danann Release Party and Book Cont...
cc/2020-05/en_middle_0087.json.gz/line1337819
__label__wiki
0.929376
0.929376
Arts + Scene » Screens The Mustang and Homecoming by John J. Bennett Homecoming: A Film by Beyoncé When the invitation says "causual dress." THE MUSTANG. Hope isn't the word for it, really, but then one should hardly go looking for hope in a prison movie. (Sorry, Shawshank fans). But The Mustang, the feature debut from Laure de Clermont-Tonnerre, contains notes of such delicacy and authenticity, setting connection and kindness against the cruelty and debasement of captivity, that it creates a measured uplift — cautious optimism when hope might be too much to ask for. Adapted by the French director from her own short Rabbit (2014) with writers Mona Fastvold (Norwegian) and Brock Norman Brock (British) — who, with Nicolas Winding Refn, is responsible for the transcendent obscenity of Bronson, 2008, which introduced some of us to the great Tom Hardy — The Mustang tells a story that is on its face distinctly American but is universal in its specificity. Roman Coleman (Matthias Schoenaerts), recently released from isolation back into the general population in an unnamed prison in the Nevada desert, is an angry man among angry men. Serving a sentence of indeterminate length for a vicious assault, he is defined by frustration, rage and distance. All-but estranged from his daughter (Gideon Adlon), with whom he, in his shame and fury, can barely hold a conversation when she visits him to sue for emancipation, Roman is alone, burrowing ever deeper into the comfortless security of self. But then, either by happenstance or the fortitude and foresight of the prison psychologist (Connie Britton), he is assigned a work detail maintaining the grounds of the facility. This brings him into contact with the prison's horsemanship program, overseen by a crotchety but compassionate old cowboy (Bruce Dern). In the program, inmates are charged with the task of breaking and training wild mustangs captured by the Bureau of Land Management, which are in turn sold at auction, primarily to law enforcement agencies. The real benefit of the program, though, lies in the deeply therapeutic connection between each man and the animal in his charge. Roman, in particular, has to confront the reality that he cannot approach a wild horse in anger, particularly if he wants to get past the introduction. He has to let his guard down, move past his frustration and conditioned rage response. He must allow himself to be vulnerable and open in order to establish any sort of trusting relationship with the horse. Tough stuff for almost anybody, arguably tougher for those prone to rage and violence, and trained to embrace them by incarceration. The hopeful trajectory of Roman's work with his mustang is, of course, tempered by the imposed realities of prison life. His evil cellmate forces him to smuggle ketamine out of the vet shed with threats of violence to his daughter; his friendship with the charming star of the horse program, Henry (Jason Mitchell) ends in an abrupt and devastating fashion. For every faltering step forward, Roman seems to be set back another three. And so I cannot say The Mustang is suffused or even tinged with hope; it may be too honest for that. Instead the narrative and the performances manage to distort time: Roman's days with his horse stretch out and expand into the fullness of the desert sky, becoming larger than the circumstances of confinement that created them. Schoenaerts crafts a performance that gradually reveals an opening up of Roman's emotional life, albeit a closely guarded one. There is in it, as in all of the excellent acting on display here, a balance of kindness and cruelty that is reflected, heartbreakingly, in both the movie's narrative and its visuals. R. 96M. MINOR. HOMECOMING: A FILM BY BEYONCÉ. When she asked "Who run the world?" we all knew how to answer. With this, though, it becomes clear that it's one girl in particular, indisputably: Beyoncé, Culture Queen. Largely a concert film, Homecoming details the grueling, invigorating process Mrs. Knowles-Carter undertook after she accepted an offer to headline the Coachella Valley Music and Arts Festival in 2018. Having very recently given birth to twins, she committed to an outrageously rigorous dietary and training regime to get back to fighting shape, simultaneously acting as creative director for her unbelievably epic stage show, which she also conceived an as indelible celebration of African-American culture. She drew on the stepping and drumline traditions of historically black colleges and universities, incorporating them into an intricately choreographed extravaganza equally informed by her two-decade-plus reign atop the world of pop music. With candid behind the scenes footage and deceptively casual interview-style narration, Knowles-Carter brings us into the eight-month, three-soundstage process of assembling her vision for the closing night performance. It's a herculean effort but a joyous and vital one, completely justified by the show itself. For two hours, through costume changes and soaring crane-work, dance-breaks and guest appearances, she creates something unlike anything else. Ever. Watching it, even a year later, on a screen at home instead of in the desert with a live crowd, it feels as if the whole world has stopped to watch it, too. TVMA. 137M. NETFLIX. — John J. Bennett See showtimes at www.northcoastjournal.com or call: Broadway Cinema 443-3456; Fortuna Theatre 725-2121; Mill Creek Cinema 839-3456; Minor Theatre 822-3456; Richards› Goat Miniplex 630-5000. AMAZING GRACE. A documentary with footage of Aretha Franklin singing with a choir in Watts in 1972. G. 89M. MINOR. AVENGERS: ENDGAME. What remains of the team reassembles after Thanos' snap. You made it through all the Harry Potter and Lord of the Rings movies. It's only three hours. You can do this. PG13. 181M. BROADWAY, FORTUNA, MILL CREEK, MINOR. HIGH LIFE. Your old vampire boyfriend Robert Pattison is now a prisoner who lives in deep space with his daughter, Juliette Binoche and André Benjamin. R. 113M. MINOR. WHEN HARRY MET SALLY (1989). I don't think he's ever gonna leave her. R. 95M. BROADWAY. APOLLO 11. Documentary about the moon mission with Neil Armstong, Michael Collins and Buzz Aldrin, who will apparently still punch you in the face if you insist it was faked. G. 93M. MINIPLEX. BIRDS OF PASSAGE. Drama about an indigenous family's disastrous entanglement with a drug war in Colombia. Starring Carmiña Martínez and José Acosta. In Spanish and Wayuu with subtitles. NR. 125M. MINIPLEX. BREAKTHROUGH. Drama about a boy whose pulse returned an hour after drowning, apparently through the power of prayer. Starring Chrissy Metz. PG. 116M. BROADWAY. CAPTAIN MARVEL. Brie Larson's superheroine is literally down-to-earth in a refreshing '90s-era origin story that thankfully takes a break from Marvel's massive scale and delivers more focused action and story. With baby-faced Samuel L. Jackson. PG13. 124M. BROADWAY, MILL CREEK. CURSE OF LA LLORONA. James Wan's newest scare-fest about a woman trying to protect her kids from a grabby ghost. Starring Linda Cardellini and Raymond Cruz. R. 93M. BROADWAY, FORTUNA. DUMBO. Tim Burton's live-action and CG remake of the flying elephant story. With Colin Farrell, Eva Green, Michael Keaton and Danny DeVito. PG. 152M. BROADWAY, FORTUNA, MILL CREEK. FIVE FEET APART. Haley Lu Richardson and Cole Sprouse star as young people with cystic fibrosis conducting a romance around their quarantines. PG13. 116M. BROADWAY. HELLBOY. David Harbour takes up the horns in this gory reboot with Ian McShane as his father figure and Milla Jovovich as the recently reconstituted Blood Queen they must battle amid convoluted Brit mythology and competent but uninspired CGI. R. 121M. BROADWAY, FORTUNA. MISSING LINK. Zach Galifianakis voices a yeti who enlists a pair of adventurers (Hugh Jackman, Zoe Saldana) to help him find his kinfolk. PG. 135M. MILL CREEK. PENGUINS. Ed Helms narrates a Disney Nature movie about Steve the penguin finding a mate, building a nest and raising a family in the Arctic. G. 76M. BROADWAY. SHAZAM! And adolescent foster kid (Asher Angel) turns into the D.C. comic superhero (Zachary Levi) in the red suit and cape. PG13. 132M. BROADWAY, FORTUNA, MILL CREEK. — Jennifer Fumiko Cahill Filmland Homecoming: A Film by Beyoncé The Mustang The Miniplex Mill Creek Cinema Broadway Cinema Fortuna Theatre Minor Theatre Broadway Cinema 1223 Broadway (Eureka) Fortuna Theatre 1241 Main St. (Fortuna) Mill Creek Cinema 1575 Betty Court (McKinleyville) Minor Theatre 1013 H St. (Arcata) The Miniplex 900 Samoa Blvd. (Arcata)
cc/2020-05/en_middle_0087.json.gz/line1337834
__label__wiki
0.560311
0.560311
You are here: Home / Archives for Departments Lyme Library Presents Rescheduled ‘Backyard Birding,’ Feb. 29 LYME — UPDATE: DUE TO THE INCLEMENT WEATHER, THIS PROGRAM HAS BEEN POSTPONED UNTIL FEBRUARY! Curiousas to who is composing that sweet-sounding trill? Join the Roger Tory Peterson Estuary Center at the Lyme Public Library to learn how to identify backyard birds by sight and sound this Saturday, Jan. 18, at 2 p.m. Learn who is at the feeder during each season and what their feeding habits are. Bring your binoculars for some outdoor practice. The presenter will also have some pairs available. For information and to register, call the library at 860-434-2272. Filed Under: Community, Lyme, Outdoors Celebrating ‘the Kate’s’ 10-Year-Anniversary, ‘On Golden Pond’ Runs Through Sunday OLD SAYBROOK — “On Golden Pond” opens tomorrow at the Katharine Hepburn Cultural Arts Center – the Kate — in old saybrook as part of the Kate’s 10-year-anniversary celebrations. The Saybrook Stage Company will be performing this poignant and comedic piece by Ernest Thompson, which inspired the Hollywood blockbuster movie. Appropriately, in light of the theater’s namesake, On Golden Pond was not only one of Katharine Hepburn’s most cherished performances but also earned her a fourth Academy Award for Best Actress. On Golden Pond is the love story of Ethel and Norman Thayer, who are returning to their summer home on Golden Pond for the 48th year. He is a retired professor, nearing 80, with heart palpitations and a failing memory—but still as tart-tongued and witty as ever. Ethel, 10 years younger, delights in all the small things that have enriched their long married life together. They are visited by their divorced, middle-aged daughter and her new fiancé, who then go off to Europe, leaving his teenage son, Billy, behind for the summer. Billy quickly becomes the “grandchild” the couple have longed for and Norman revels in taking him fishing and inspiring him with the classics. Norman, in turn, learns some new language and perspectives from Billy and the comedy ensues. In the final, deeply moving moments of the play, Norman and Ethel are brought even closer together as they find themselves alone again on Golden Pond. The play originally opened on Broadway in 1979 and then was made into a movie in 1981 starring Katharine Hepburn and Henry Fonda – both actors won an Academy Award for their respective performances. Jane Fonda played the couple’s daughter. Thompson was only 28-years-old when he wrote On Golden Pond; he also won a the Academy Award for Best Adapted Screenplay in 1981. The cast includes Ralph Buonocore and Mark Gilchrist of Madison, Terri Corigliano of Old Saybrook, Jim Hile of Clinton, Amy Kirby of New London and Jake Totten of Granby. Performances are Jan. 16, 17 and 18 at 8 p.m. with a 2 p.m. matinée Saturday and also Sunday, Jan. 19. Tickets can be purchased directly at www.TheKate.org or by calling 860.510.0453 Filed Under: Arts, Lyme, Old Lyme, Old Saybrook, Top Story Old Lyme Basketball Boys Extend Unbeaten Run with Wins Over East Hampton, Portland LYME/OLD LYME — The Old Lyme boys continued their unbeaten run last night with a 65-39 victory over East Hampton. Jared Ritchie scored a career high 20 points and also scoring in double digits for the Wildcats was Ray Doll, who had 11 points and five assists. Stephen Brady led East Hampton with 19 points. On Jan. 3, Old Lyme jumped out to a 19-0 lead against Portland, but Portland climbed back eventually falling to the ‘Cats 61-44. Ty Dean led all scorers with 15 points while Ray Doll, Brady Sheffield and Aiden Using added 10, 11 and 13 respectively for Old Lyme. Filed Under: Lyme, Old Lyme, Sport Two New Exhibitions Open Friday at LAA in Old Lyme Featuring Associate Artists, New Elected Artists ‘Autumn in Old Lyme’ (oil) by Associate Artist Rosemary Webber is onw of thw featured works of ‘First Impressions.” opening Jan. 17 at the Lyme Art Association. OLD LYME — Two new exhibitions open Jan. 17 at Lyme Art Association (LAA) and an Opening Reception for both will be held Sunday, Jan. 26, from 2 to 4 p.m. at the LAA, 90 Lyme St., Old Lyme, CT. The First Impressions Exhibition is a juried exhibition of work by the Association’s Associate Artist members — accomplished artists who have been successfully exhibiting in selective shows at the LAA for at least four years. This exhibit will include a variety of media and themes including landscape, portrait, and still life paintings, as well as sculpture. ‘Ghosting In’ (oil) by Park Howard is a featured work in the ‘New Elected Artists’ exhibition opening Jan 17 at the LAA. The second exhibition, New Elected Artists, features works by the six artists who were inducted into the LAA as Elected Artists in October 2019. The artists — Thomas Adkins, Howard Park, Bob Perkowski, Deborah Quinn-Munson, Diana Roberts-Paschall and John Traynor — will present a selection of their work in the LAA’s Goodman Gallery. Both exhibits run through Feb. 28. “The Annual Associate Artists Exhibition highlights the range, creativity, and excellence of our Associate Artist members. This exhibition includes a variety of subjects, media, and styles: paintings or sculptures that capture the range of human emotion, the beauty and grandeur of the Connecticut landscape, or the personal objects and surroundings of everyday life,” notes Jocelyn Zallinger, LAA’s Gallery Manager. She adds, “The New Elected Artists show in the Goodman Gallery also promises to be impressive; our new class of Elected Artists is very accomplished.” The LAA was founded in 1914 by the American impressionists and continues the tradition of exhibiting and selling representational artwork by its members and invited artists, as well as offering art instruction and lectures to the community. The Association is located at 90 Lyme St. in a building designed by Charles Adams Platt and located within the Old Lyme Historic District. Admission is free with contributions appreciated. Gallery hours are Wednesday through Sunday, 10 a.m. to 5 p.m., or by appointment. For more information on exhibitions, purchase of art, art classes, or becoming a member, call 860-434-7802 or visit www.lymeartassociation.org Filed Under: Arts, Top Story Lyme-Old Lyme Schools Asked to Consider Purchase of Lyme Academy-Owned 26+ Acres on Lyme St. Aerial photo of the 26.31 acres for sale by Lyme Academy of Fine Arts taken from the Lyman Real Estate property listing and published with their permission. OLD LYME — As part of its reinvention efforts over the past several months, Lyme Academy of Fine Arts officials recently approached the Lyme-Old Lyme Board of Education inquiring whether the district would be interested in purchasing academy-owned land abutting the public school campus off Lyme Street. The academy owns approximately 39 acres of land across the street from its main campus, which is also on Lyme Street. Approximately 26 acres of that land has been listed for $5 million through the Lyman Real Estate group … Read the full story by Mary Biekert and published Jan. 10 on TheDay.com at this link. Filed Under: News, Old Lyme, Schools, Top Story ‘The Country School’ Hosts Open House Jan. 26, All Welcome MADISON — The Country School jn Madison is holding an Open House Sunday, Jan. 26, from 1 to 3:30 p.m. This is an opportunity to meet engaged students and passionate teachers. Also, attendees can learn about the rigorous academic program and commitment to honoring the creativity, sense of wonder, and exuberance of childhood. MADISON — Learn about the school’s signature programs – STEAM, Elmore Leadership, Outdoor Education, and Public Speaking – and their rich offerings in the arts and athletics. Tour the transformed 23-acre campus and hear how alumni are thriving at top high schools and colleges across the country. Founded in 1955, The Country School is a coeducational, independent day school serving students in PreSchool through Grade 8. To learn more and register, visit this link. Filed Under: Lyme, Old Lyme, Schools, Top Story Start the New Year with a Twist … of Yoga! Classes at Saint Ann’s Thursday Mornings, All Welcome OLD LYME — Yoga With A Twist is an all-level gentle Yoga Class. It is appropriate for first-time yoga students and those who are more experienced. The class will include breath work, stretching and moving with the combined objectives of strengthening the body, and improving balance and overall well-being. Chairs will be available for those who do not want to practice on the mat. The instructor is Deb Novack, who believes that Yoga is for everyone and no matter what your limitations are, you will feel an improvement the first time you come to class. Dhe is a Hatha-style Yoga Teacher, who incorporates meditation, breathing techniques, restorative and yin poses and shapes, into her teahing. Novack is excited about, and experienced in, introducing new people to the healing modality of Yoga and meditation. Class will be held at Saint Ann’s Church, 82 Shore Rd., Old Lyme, Conn. in the Griswold Room on Thursdays from 9:30 to 10:30 a.m. beginning on Jan. 9. Bring a Yoga mat and any props you like working with (e.g., blocks, straps, blankets, etc.). Chairs will be available for use. This is a community event and all are welcome. The suggested donation is $10 and no reservation is required. Contact Deb Novack with any questions at debnovack1@yahoo.com or contact the Parish Office at Saint Ann’s #860-434-1621. Saint Ann’s is an Episcopal parish in Old Lyme, which is under the direction of the Provisional Priest-in-Charge, the Rev. Dr. Anita L. Schell. Saint Ann’s is located at 82 Shore Road (Rt. 156), two miles off I95, Exit 70. Convenient parking is adjacent to the church and the Sanctuary has ADA access. For more information, visit www.saintannsoldlyme.org . Filed Under: Community, Old Lyme Old Lyme Girls Pull Off Confident Win at H-K LYME/OLD LYME — On Tuesday, Don Bugbee’s girls traveled to Haddam-Killingworth and came away with a strong 46-32 victory. Leading scorer Sam Gray notched an impressive 19 points with eight rebounds while Emily DeRoehn added nine points with nine rebounds and five steals. Coach Bugbee commented, “It was a solid team performance overall with offensive and defensive contributions from all players.” The team’s current record is 5-2 in the Shoreline Conference. On Friday, Old Lyme meets Amistad at home and next Tuesday, Jan. 14, they face East Hampton, also at home. Filed Under: Lyme, Old Lyme, Sport, Top Story Roger Tory Peterson Estuary Center Hosts Plethora of New Programs in New Year OLD LYME — The Roger Tory Peterson Estuary Center (RTPEC) has announced an extensive range of new programs for the early months of 2020 as follows: BUDDING NATURALISTS Wednesday, Jan. 8 , 10-11am Theme: A Long Winter’s Nap – Animal Hibernation RTP Estuary Center, Old Lyme Start their love of nature early. Join us for this parent/caregiver and child nature class designed for children who are 3 to 5 years old. Activities will encourage discovery, explorations, and expression through stories, hands-on activities, and art. Adult is free with child participant. $15 members; $20 non-members. Register here OWL PROWLS Tuesdays January 14, 21, 28, February 4, 11, and Monday, February 17, 5:30 pm Perhaps no other group of birds harbor as much mystery and intrigue as owls. As we’re heading to sleep they are just starting their day. These nocturnal hunters are perfectly adapted to life in darkness, from their silent flight to their unique eyes and ears. Join us at the newest and largest Old Lyme Land Trust property as we search for the incredible birds, and learn about what makes them such perfect nighttime fliers. Bring a headlamp or flashlight (preferably one with a red light setting) and binoculars, and bundle up! Appropriate for ages 10 and up. *Limit of 12 participants per program* $5 for members, $10 for non-members Tuesday, January 14 – Register Tuesday, February 4 – Register Tuesday, February 11 – Register Monday, February 17 – Register Greater Scaup, male in foreground. Saturday, Jan. 18, 9 – 10:30 am Griswold Point, Old Lyme As the lakes and ponds of the northeast freeze over, many species of waterfowl head to the coast, to open water. Sea ducks, Loons, Grebes and more call the coast of Connecticut home during the winter. The mouth of the Connecticut River, on Long Island Sound, is the perfect place to spot these winter species gathering just offshore. Bring your binoculars, and layer up! We will provide a spotting scope, an essential piece of equipment for waterfowl watching. $5 for members, $10 for non-members, register here MLK DAY VACATION PROGRAM WITH THE RTP ESTUARY CENTER Monday, Jan. 20; 9am – 4pm Lyme Youth Services Bureau, Old Lyme Explore the natural world of winter with the RTP Estuary Center! Outdoor explorations, hands-on science experiments, games, and creative activities are in store! Winter attire required. Program is for ages 6 – 11. Each child should bring a water bottle and a nut free snack and lunch. Registration is required. $40 members, $50 non-members. Registration is required. Register here MURAL REVEAL Thursday, Jan. 30, 5 pm Join us for the grand unveiling of our new CT River Estuary mural! This volunteer collaborated acrylic mural depicts our local estuary plants and animals at both the micro and macroscopic levels. You’ll also be able to see inside our ever changing and improving center and meet one-on-one with the teacher-naturalists and artists of the mural. Learn about the different styles that each of the artists brought to this collaborative piece and their background as budding or established artists. This event is free. WHOO WANTS TO LEARN ABOUT OWLS? Whooo Wants to Learn about Owls? Saturday, Jan. 25; 10:30 – 11:30 am and 1-2 pm Saturday, March 7; 10:30-11:30 and 1-2 pm Join us for an hour with an owl! Our teacher-naturalists will be presenting Cookie, the barred owl while we learn about this local species up close including where and when they nest, what they sound like and ways you can help ensure a healthy population of barred owls in CT! We will also be examining real owl feathers, dissecting owl pellets, and identifying mammal bones. $15 members, $25 non-member, $10 for children 10 and under Saturday, Jan. 25 10:30-11:30am – Register Saturday, Jan. 25 1:00-2:00pm – Register Saturday, March 7 10:30-11:30am – Register Saturday, March 7 1:00-2:00pm – Register GREAT BACKYARD BIRD COUNT Photo by Brian Bennett Wednesday, Feb. 12, 6:30-7:30pm Thursday, Feb. 13, 6 – 7 pm Wild Birds Unlimited, Niantic FIELD SESSION Sunday, Feb. 16, 9 – 11 a.m. Connecticut College Arboretum, New London Since 1998, people all over the world have participated in the first citizen science project to collect wild bird data, the Great Backyard Bird Count! Join us at the RTP Estuary Center for an informational session about the history and background of the count, as well as how to conduct your own Great Backyard Bird Count! On Sunday, February 16 come practice your skills in the field at the Connecticut College Arboretum in New London, a designated important bird area. Whether you are a seasoned birder or a novice, this is a great opportunity to learn how to identify and count birds in the wild, and be a part of a worldwide citizen project. This program is free, but we ask that you register. Register for the RTPEC Info Session here Register for the Wild Birds Unlimited Info Session at 860-739-7302 or at wbuniantic@sbcglobal.net Register for Field Session here FAMILY WINTER WALK Feb. 22, 9-10:30am Watch Rock Preserve, Old Lyme Shake off your cabin fever, head outside and join one of our teacher-naturalists for a winter walk. We will look for tracks, listen for birds and enjoy the beauty of the woods in winter. Keep warm by trying to complete our winter scavenger hunt! $5 members, $10 non-members, children 6 and under free, register here Filed Under: Old Lyme, Outdoors Lyme-Old Lyme HS Graduate, Now Playwright, Emily Zemba Launches Kickstarter to Fund New Play in NYC January 4, 2020 by Olwen Logan Leave a Comment LYME/OLD LYME — If you’re an aspiring playwright, actually writing a play can be the relatively easy part but finding the funding to produce your play can be a major challenge. Emily Zemba Emily Zemba, a 2006 graduate from Lyme-Old Lyme High School (LOLHS), is trying a highly original approach to generate some seed money to bring her latest play to life on the stage. She explained to LymeLine, “I have recently joined forces with two other amazing female writers to form The Pool — and our mission is to “take on the soul of America in rep” with our highly theatrical plays.” Along with fellow playwrights Kate Cortesi and Brenda Withers, Zemba has launched a Kickstarter campaign, which is aiming to raise $6,000 by next Saturday, Jan. 11, to cover the initial costs of putting on their respective plays in the fall of 2020 at the New Ohio Theatre in New York City’s West Village. Asked about her play, Zemba says, “It is titled Superstitions, and is an absurd, dark comedy that links superstitions to cultural terrors and a collective national anxiety. I know, I know, anxiety is a riot! But I promise that the play is just as fun and ridiculous as it is unsettling. ” She notes that the play was nominated for 2018 Venturous Playwright Fellowship, and also that she has already received a grant from The Artists Patron Fund in support of this production. After her graduation from LOLHS, Zemba attended Sarah Lawrence College and then went onto Yale University, where she obtained an MFA from the School of Drama in May 2015. Zemba’s parents are former Old Lyme Selectman Kurt Zemba and Catherine Frank, who retired from the position of Exceutive Assistant to Old Lyme First Selectwoman Bonnie Reemsnyder in October 2019. Zemba notes that in addition to the Kickstarter, there will continue to be ways to donate directly through their website. Also, donations of $1,000 or more will be fully tax-deductible if made through their fiscal sponsor: New Georges (simply make the check out to New Georges with The Pool 2020 listed in the memo line.) But the immediate challenge is to raise $6,000 by Jan. 11. At the time of writing, $4,597 has been raised so these young playwrights are close to the finish line. The Kickstarter page states: “We may still be about 10 months out from production, but there are several up-front costs which need immediate attention, for example: The New Ohio requires a down payment a year out. We have hired a PR Rep who will help launch our marketing campaign and assist with project visibility. The directors who will helm our productions need contracts sooner rather than later, before their schedules get any busier. We are hiring a creative producer to oversee and coordinate the myriad pieces of this ambitious undertaking.” If you wish to donate to support these playwrights and help bring their plays to the stage, visit the Kickstarter page for The Pool at this link where there is more information about the project. Filed Under: Arts, Lyme, Old Lyme, Top Story Wildcat Girls Defeat Portland in Gritty Game OLD LYME — The Old Lyme girls notched an important Shoreline Conference victory yesterday when they defeated Portland 32-28. The low-scoring game was played in Old Lyme and takes the Wildcat’s conference record to 4-2. Coach Bugbee commented after the game, “After a slow start to the game, we improved throughout the second and third quarters,” adding, “We hung on through the fourth quarter for the win, against a very determined Portland team.” Emily DeRoehn scored 14 points and took seven rebounds along with two steals while Sam Gray grabbed nine points, six rebounds and two steals. Upcoming games for the girls are Tuesday, Jan.7, at Haddam-Killingworth and Friday, Jan. 10, when they face Amistad in Old Lyme. Junior Varsity games tip off at 5:30 p.m. and Varsity games at 7 p.m. All games are open to the public. Old Lyme Girls Defeat Unbeaten Valley LYME/OLD LYME — The Old Lyme basketball girls defeated Valley Regional 41-34 last Monday, Dec. 30. This was Valley’s first loss of the season and coach Don Bugbee commented, “The girls played extremely hard and stayed tough for the win against a very good Valley Team, who finished with a really strong fourth quarter comeback attempt. Game highlights included Sam Gray scoring 14 points while taking four rebounds and three steals. Meanwhile, Emily Deroehn notched 12 points and took four rebounds along with four steals. Old Lyme’s record in the Shoreline Conference is now 3-2. Wildcat Boys Enjoy Strong Start to Basketball Season with Wins Over OS, Valley LYME/OLD LYME — Kirk Kaczor’s Old Lyme boys have started the season on a high note with successive wins at home against respectively Old Saybrook on Dec. 19 and Valley Regional on Dec. 30. Old Lyme beat Old Saybrook 80-47 with Aedan Using leading the way for Old Lyme with 24 points 12 rebounds and seven assists. Meanwhile, Brady Sheffield notched 13 points and John Almy 12. Old Lyme had a total of 22 assists on 28 field goals. Davis Brown paced Old Saybrook with 32 points. In yesterday’s battle of Shoreline teams against Valley, the final score was 61-53. Leading the Wildcats in scoring was Brady Sheffield with 26 points. Aedan Using contributed a total of seven assists, five blocks, eight rebounds and two steals. Ty Dean chipped in with a career-high nine points. Valley was led by Cade Edsinger (18 points) and Gavin Grabowski (13 points). Upcoming Events at Lyme Public Library Through March LYME — The following programs, which are scheduled at Lyme Public Library, 482 Hamburg Rd, are free and open to all at. Registration at 860-434-2272 is appreciated. Lyme Library Cookbook Club: The Hungry Fan’s Game Day Cookbook Just in time for the NFL Playoffs. Choose a recipe from this cookbook or share one of your own favorites. The Cookbook Club will meet again Feb. 8, and March 14. Backyard Birding with the CT Audubon Society Roger Tory Peterson Estuary Center Fine tune bird-watching and identifying skills. If time and weather permit, attendees may go outside. Bring your binoculars. Beyond Bicept: The Real Story of Rosie the Riveter, presented by Dr. Amanda Goodheart Parks Trace the journey from propaganda poster to feminist icon. Prudence Allen: Secretary to Coretta Scott King. Sharing Stories of Time Spent with Dr. Martin Luther King Jr and his Family Raised in Connecticut, Prudence Allen supported equal rights for all, marched in civil rights marches in the 1960s, and joined Dr King and his family. She will share memories and stories of her time. Endre (Andy) Sarkany, Childhood Survivor of the Holocaust Sarkany speaks to students about his personal experiences during the Holocaust, living under the brutality of the Soviet regime in Hungary, and finding a home in the United States. Filed Under: Community, Lyme Wildcat Girls Kick Off Basketball Season With Convincing Win Over Westbrook OLD LYME — The Lyme-Old Lyme High School Girl’s Varsity team started their season strongly last Friday beating Westbrook with a convincing 53-29 victory. Playing on their home court, coach Don Bugbee commented enthusiastically, “It was a total team effort by everyone on both the offensive and defensive side of the game.” Captain Emily DeRoehn, a Junior, notched 15 points with eight rebounds and seven steals while Sam Gray, also a Junior, scored 10 points, with three rebounds and four steals. Thinking About Regifting? Read More on This and Other Holiday Confessions Thinking about regifiting one (or more) of those wonderful gifts you received on Wednesday? Well, you’re not alone since according to a Holiday Confessions Survey, published on Reviews.org, more than half of Americans (58.52%) admit that they’ve regifted a present! Read the full article with lots more confessions (e.g., more than two-thirds of us have peeked at our holiday presents early, three-quarters of us have kept a present we bought for someone else, and almost 30 percent of us have gone more than $500 into debt to pay for our holiday shopping) at this link. Filed Under: Community Lyme-Old Lyme Schools Seniors Cravinho, Wells Receive Prestigious Superintendent/Student Recognition Awards Lyme-Old Lyme Schools Superintendent Ian Neviaser stands with CAPPS Superintendent / Student Recognition Awardees Elizabeth Cravinho and Trevor Wells after the students had received their awards at a ceremony held Dec. 10, in Old Saybrok. LYME/OLD LYME — (Press Release) Elizabeth Cravinho and Trevor Wells, students at Lyme-Old Lyme High School, have been awarded the Connecticut Association of Public School Superintendents’ (CAPSS) Superintendent/Student Recognition Award for leadership service to the school, academic prowess relative to ability, and service to others in the community at a ceremony held Dec. 10, 2019 at Saybrook Point Inn. Ian Neviaser, Superintendent of Lyme-Old Lyme Schools, made the presentation as part of a program designed by school administrators to recognize students who have served their schools and communities while maintaining good scholastic progress. The Superintendent/Student Recognition Program awards a Certificate of Excellence at the discretion of the local superintendent of schools according to a distribution formula set for all state school districts. Awards are generally given during American Education Week in November in order to provide a meaningful focus for each school district and to enhance the quality of the certificate. Cravinho’s citation states: Elizabeth Cravinho is not to be underestimated. She may present as a petite young woman but beware, for she is an energetic and determined dynamo. When you give her a task, consider it done. This energy level comes in handy when you consider all that she juggles: USAG Junior Olympic Gymnast, Concert Band President, Spanish Honor Society Vice President, as well as being a member of the National Honor Society, Student Advisory Council and Student Leaders, all while taking a challenging academic schedule and exploring her career aspiration of Dentistry. Even when she took a risk and decided to give up gymnastics, which she loved and had participated in her entire life, she was planning how to spend her new-found time by taking advantage of opportunities within Lyme-Old Lyme High School and the Lyme and Old Lyme communities. Her altruistic nature motivates her to volunteer at Christ the King Church, Phoebe Griffin Noyes Library and Special Olympics. This genuine young woman is as good as they come. She has an unprecedented work ethic, strong beliefs and the conviction to stand up for them and a sense of purpose to know it is her responsibility to make things happen in her own life while knowing when others need a helping hand. Wells’s citation states: Trevor Wells is a leader and role model at Lyme-Old Lyme High School known for his determined work ethic, leadership and his undying energy and involvement in so many worthy causes. A National Honor Society member and President of the Class of 2020, Trevor takes on the most rigorous courses and thrives in an academic environment. He is motivated by his strong curiosity and thirst for knowledge but he is just as committed to goodwill and kindness. Trevor has taken every opportunity here at Lyme-Old Lyme High School; for example, he loves to explore other points of view and takes three languages, Latin, Spanish and Mandarin – and performs excellently in all three. Trevor is an athlete and an outstanding member of this community who has been recognized repeatedly with leadership roles in many areas. He dedicates numerous hours to his role as Class President, captain of the cross-country team and the outdoor track team, co-founder of the Recycling Committee, and assistant coach for the youth lacrosse team. Trevor takes initiative and is dedicated in all his endeavors, Trevor is a natural leader, garnering immediate respect from his peers, as he steps into these positions with passion and grace. Trevor has been instrumental in the success of so many clubs and activities and has truly made a mark here within the Lyme-Old Lyme High School community. His impact has been broad and extensive, and his leadership and unstoppable energy have benefited so many. CAPSS, the statewide school superintendents’ professional organization, is based in West Hartford and provides professional development, personal support, statewide conferences, legislative information and educational services to its membership. Country School’s Goodman of Old Lyme Earns All-America Status at National X-Country Championships Third-graders Laila Goodman of Old Lyme and Tillie Killam of Madison (pictured above) display their All-American awards received Dec. 14 when they took 1st and 9th place respectively in the Junior Olympics Cross Country Championships held in Madison, Wis. OLD LYME — This past Saturday (Dec. 14), in cold and windy conditions in Madison, Wis., Laila Goodman of Old Lyme and Tillie Killam of Madison earned All-America status by taking 1st and 9th place respectively among 157 runners in the Junior Olympics (JO) Cross-Country Championships. Both girls are in third grade at The Country School in Madison, Conn. Having finished 8th in the same competition last year in Reno, Nev., Goodman led the 7-8 girls’ race this year from start to finish, fending off challenges from top runners from California, New York, and 42 states to finish the 2K course in 8:01, five seconds ahead of the 2nd place finisher. Going to the National JOs for the first time, Killam needed a top-25 finish to become Country School’s third-ever All-American, and she earned it with a well-paced race and a fast finishing kick to flash across the line in 8:29. Fellow classmate Lillian Clare of Madison raced in the 9-10 year-old division and blitzed the 3K course in 13:10 to take 94th out of 242 runners. Clare, Goodman and Killam qualified for Nationals by finishing in the top 30 in Connecticut and then the top 30 in Region 1, which includes all of New England, Long Island and the Adirondacks. In national competition, Clare, Goodman, Killam and all Country School students run for Litchfield Track Club, whose 8 and Under girls cross-country team, led by Goodman and Killam, captured 4th place in the team competition Saturday against all the club teams in the United States. The competition was held at the Yahara Hills Golf Course in Madison, Wis. Over 4,000 youth runners in ages 7 to 18 took part in the all-day competition. In addition to Goodman and Killam, the Litchfield Track Club 8 & Under girls team included Gwen Krukar (Goshen) 65th, Alexa Johnston (Litchfield) 102, and Attie Bergin (Goshen) 115th. There were a total of 157 finishers in their race. The team advanced to the finals by winning the Connecticut Association meet and placing 2nd in the Region 1 Championships on Long Island in November. Due to a USATF rule that states to compete in a national event, a runner must turn age seven by December of that year, Country School 1st grader Liv Killam could not compete after qualifying for Nationals. Also competing for Litchfield Track Club in Wisconsin were Annecy Vlieks of Madison (12:03 for 94th, 11-12 girls), Abbie Johnston (105th, 13-14 girls), and Branford’s Liam Watson (188th, 11-12 boys). Founded in 1955, The Country School serves 200 students in PreSchool-Grade 8 on its 23-acre campus in Madison. The Country School is committed to active, hands-on learning and a vigorous curriculum that engages the whole child. Signature programs such as Elmore Leadership, Public Speaking, STEAM, and Outdoor Education help prepare students for success in high school and beyond. See our community in action during our winter Open House on January 26 from 1-3:30 p.m. For more information, visit www.thecountryschool.org. Filed Under: Old Lyme, Schools, Sport, Top Story
cc/2020-05/en_middle_0087.json.gz/line1337839
__label__cc
0.523037
0.476963
Spoken Language Comprehension Improves the Efficiency of Visual Referential domains in spoken language comprehension - CiteSeerX Spoken Sentence Comprehension - Language, Cognition & Brain ... Hierarchical Processing in Spoken Language Comprehension Correspondence should be addressed to Matt Davis, Medical Research Council Cognition .... to none or not very much of the sentence (little finger; button 1). Recently, the development of accurate, relatively inexpensive head-mounted eye-tracking ..... between the instrument name and the target referent name. Eye movements and spoken language comprehension - CiteSeerX a temporarily ambiguous prepositional phrase (e.g., ''Put the apple on the towel in .... it should initially construct a syntactic representation without consulting. Lexical representations in spoken language comprehension The comprehension of a spoken utterance requires the listener to integrate together ... tions participate in language comprehension, it is necessary to capture in. Prosody in the Comprehension of Spoken Language - Semantic Scholar expertise in the form of this review, and Mary Beckman, Julia Hirschberg, James McQueen, Peter .... a list (Leonard, 1974; O'Connell, Turner, & Onuska, 1968). Visual attention during spatial language comprehension - Cognitive the efficiency of information transmission of sign and spoken language Nov 3, 2011 - The Efficiency of Information Transmission of Sign and Spoken. Language .... For this reason, it is necessary to ..... For all these reasons, we. Working Memory and Spoken Language Comprehension in Young ... Chapter 22 Eye Movements and Spoken Language Comprehension Incremental comprehension of spoken quantifier ... - Semantic Scholar The VL2-Spoken Language Phonological deaf individuals do not use any spoken language or their oral language is rated as low on levels of aural ... to detect rhyme and alliteration or the use of similar consonants. PA also includes ... Studies have found a casual influence between the de The Spoken Language Navigation Task fully operational speech and natural language interface. (NLVR) to a real-time 3-D virtual reality system (Gur- ney& Klipple 1998; Gurney, Klipple, ~ Voss 1996). Evaluating Models of Visual Comprehension SPOKEN LANGUAGE RETAKE LESSON 17 Dec 2013 ... what what that Queen Mary wore cami-knickers actually. J: yeah ... did she actually wear knickers well you know (laughter) it's a big question. J:. evaluating language comprehension in The architecture of visual narrative comprehension - Core Foreign language comprehension achievement May 6, 2015 - guitarra in Spanish) are easier to learn and integrate in the lexi- con than ... non-cognate words (e.g., guitarra-guitar vs. casa-house) is a. Misunderstanding and Language Comprehension The architecture of visual narrative comprehension - Frontiers Figurative Language Comprehension You know. ...She kept saying, ...prefacing everything with, .. you know, this is not a personal attack. ..This is not a personal vendetta,. B : Yeah, yeah yeah yeah. The Challenge of Spoken Language Systems 1 downloads 0 Views 32KB Size Report visual perception plays an integral part in on-line spoken language ... modified the standard visual search task by introducing spoken linguistic input. ..... form, color, movement, and depth: Anatomy, physiology, and perception. Science, 240 ... Spoken Language Comprehension Improves the Efficiency of Visual Search Melinda J. Tyler ([email protected]) Department of Psychology, Cornell University Ithaca, NY 14853 USA Michael J. Spivey ([email protected]) Department of Psychology, Cornell University Ithaca, NY 14853 USA Abstract Much recent eye-tracking research has demonstrated that visual perception plays an integral part in on-line spoken language comprehension, in environments that closely mimic our normal interaction with our physical environment and other humans. To test for the inverse, an influence of language on visual processing, we modified the standard visual search task by introducing spoken linguistic input. In classic visual search tasks, targets defined by only one feature appear to “pop-out” regardless of the number of distractors, suggesting a parallel search process. In contrast, when the target is defined by a conjunction of features, the number of distractors in the display causes a highly linear increase in search time, suggesting a more serial search process. However, we found that when a conjunction target was identified by a spoken instruction presented concurrently with the visual display, the effect of set size on search time was dramatically reduced. These results suggest that the incremental linguistic processing of the two spoken target features allows the visual search process to, essentially, conduct two nested single-feature parallel searches instead of one serial conjunction search. Introduction For a psycholinguist studying spoken language comprehension, the visual environment would be considered “context”. However, for a vision researcher, the visual environment is the primary target of study, and auditory/linguistic information would be considered the “context”. Clearly, this variable use of the label “context” is due to differences in perspective, not due to any objective differences between language and vision. In everyday perceptual/communicative circumstances, humans must integrate visual and linguistic information extremely rapidly for even the simplest of exercises. Consider the real-time dance of linguistic, visual, and even gestural events that takes place during a conversation about the weather. This continuous coreferencing between visual and linguistic signals may render the very idea of labeling something as “context” arbitrary at best, and perhaps even misleading. The problem of “context” has traditionally been dealt with in a rather drastic fashion: researchers forcibly ignore it. If context does not influence the primary functions of the process of interest (be it in language, vision, memory, reasoning, or action), then that process can be thought of as an encapsulated module which will permit dissection via a nicely limited set of theoretical and methodological tools. For example, prominent theories of visual perception and attention posit that the visual system is functionally independent of other cognitive processes (Pylyshyn, 1999; Zeki, 1993). This kind of modularity thesis has been applied to accounts of language processing as well (Chomsky, 1965; Fodor, 1983). As a result, a great deal of progress has been made toward developing first approximations of how vision may function and how language may function. However, recent eye-tracking studies have shown evidence that visual perception constrains real-time spoken language comprehension. For example, temporary ambiguities in word recognition and in syntactic parsing are quickly resolved by information in the visual context (Allopenna, Magnuson, & Tanenhaus, 1998; Spivey & Marian, 1998; Tanenhaus, Spivey-Knowlton, Eberhard, & Sedivy, 1995). Findings like these are difficult for modular theories of language to accommodate. The present experiment demonstrates the converse: that language processing can constrain visual perception. In a standard visual search task, a target object is typically defined by a conjunction of features, and reaction time increases linearly with the number of distractors, often in the range of 15-25 milliseconds per item (Duncan & Humphreys, 1989; Treisman & Gelade, 1980; Wolfe, 1994). However, when we presented the visual display first, and then provided the spoken target features incrementally, we found that reaction time was considerably less sensitive to the number of distractors. With conjunction search displays, increased reaction times as a linear function of set size were originally interpreted as evidence for serial processing of the objects in the display, and contrasted with the near-flat function of reaction time by set size observed with feature search displays -- where a single feature is sufficient to identify the target object. It was argued that the early stages of the visual system process individual features independently and in parallel (Livingstone & Hubel, 1988), allowing the target object to "pop out" in the display if it is discriminable by a single feature, but requiring application of an attentional window to the individual objects, one at a time, if the target object is discriminable only by a conjunction of features (Treisman & Gelade, 1980). This categorical distinction between parallel search of single feature displays and serial search of conjunction displays has been supported by PET scan evidence for a region in the superior parietal cortex that is active during conjunction search for motion and color, but not during single feature search for motion or for color (Corbetta, Shulman, Miezin, & Petersen, 1995). However, several studies have discovered particular conjunctions of features that do not produce steeply sloped reaction-time functions by set size (e.g., McLeod, Driver & Crisp, 1988; Nakayama & Silverman, 1986). Additionally, it is possible to observe the phenomenology of 'pop-out' while still obtaining a significant (albeit, small) effect of set size on reaction time (Bridgeman & Aiken, 1994). Moreover, it has been argued that steeply sloped reaction-time functions may not reflect serial processing of objects in the display, but rather noise in the human visual system (Eckstein, 1998; Palmer, Verghese, & Pavel, 2000). Overall, a wide range of studies have suggested that the distinction between putatively "serial" and "parallel" search functions is continuous rather than discrete, and should be considered extremes on a continuum of search difficulty (Duncan & Humphreys, 1989; Nakayama & Joseph, 1998; Olds, Cowan, Jolicoeur, 2000; Wolfe, 1994, 1998). In a recent study, Spivey, Tyler, Eberhard, and Tanenhaus (in press b) demonstrated that the incremental processing of linguistic information could, essentially, convert a difficult conjunction search into a pair of easier searches. When target identity was provided via recorded speech presented concurrently with the visual display, displays that typically produced search slopes of 19 ms per item produced search slopes of 8 ms per item. It was argued that if a spoken noun phrase such as "the red vertical" is processed incrementally (cf. Altmann, & Kamide, 1999; Eberhard, Spivey-Knowlton, Sedivy, & Tanenhaus, 1995; Marslen-Wilson, 1973, 1975), and there is extremely rapid integration between partial linguistic and visual representations, then one might predict that the listener should be able to search items with the first-mentioned feature before even hearing the second one. If the observer can immediately attend to the subset of objects sharing that first-mentioned feature, such as the target color (Egeth, Virzi, & Garbart, 1984; Friedman-Hill & Wolfe, 1995; Motter & Holsapple, 2000), and subsequently search for the target object in that subset upon hearing the second-mentioned feature, then this initial immediate group selection should reduce the effective set size to only those objects in the display that share the first-mentioned feature – effectively cutting the search slope in half. At least two concerns remain before this basic finding can be extended and tested in the many different variations of visual search displays. First, since a slope of 8 ms per item is clearly in the range of what has traditionally been considered “parallel search”, it is somewhat unclear whether the result is in fact a halving of the effective set size or a near elimination of the effect of set size. Essentially, the question is whether the first feature extraction is a genuine “pop-out” effect and the second is a genuine serial search of those “popped out” objects (half of the set size), or are both searches “practically parallel”. A replication of the study may provide some insight into this question. Second, the experiments reported by Spivey et al. (in press b) ran participants in separate blocks of control trials and trials with concurrent auditory/visual input. It is in principle possible that practice was somehow more effective in the auditory/visual concurrent condition, or that subjects developed some unusual strategy in that condition that they didn’t use in the control condition. To be confident in the result, it is necessary to replicate it with a mixed (instead of blocked) design, where the control trials and the A/V concurrent trials are randomly interspersed. Experiment Method Participants Eighteen Cornell undergraduate students were recruited from various Psychology classes. Participants were reimbursed 1 point of course extra credit for participating in the study. Procedure The experiment was composed of two types of trials presented in random mixed order within one continuous block of 192 trials. Participants were instructed to take breaks between trials when they felt it was necessary. In one type of trial, the participant was auditorily informed of the target identity before presentation of the visual display (‘Auditory First’ control condition). In the other type of trial, the participant was auditorily informed of the two defining feature words of the target concurrently with the onset of the visual display (‘A/V Concurrent’ condition) (see Figure 1) Of the 192 trials, 96 were ‘Auditory First’, and 96 were ‘A/V concurrent.’ Legend = red = green Auditory-First Control Condition A/V Concurrent Condition Figure 1. Schematic diagram of the two conditions. In the Auditory-First condition, the search display is presented after the entire spoken query is heard, whereas in the A/V Concurrent condition, the search display is presented immediately before the two target features are heard. Reaction time is measured from the point of display onset. Trials began with a question delivered in the format of a speech file. The same female speaker recorded all speech files with the same preamble recording, “Is there a…” being spliced onto the beginning of each of the four types of target query types (“…red vertical?”, “…red horizontal?”, “…green vertical?”, and “…green horizontal?”). Each of the four types of speech files were edited to be almost identical in length, and with almost identical auditory spacing of defining feature words. Participants were instructed to press a ‘yes’ key on a computer keyboard if the queried object was present in the display, and the ‘no’ key if it was absent. It was stressed to participants that they should do this as quickly and accurately as possible. An initial fixation cross preceded the onset of the visual display in order to direct participants’ gaze to the central region of the display. Each stimulus bar subtended 2.8 degrees X 0.4 degrees of visual angle, and neighboring bars were separated from one another by an average of 2 degrees of visual angle. Trials with red vertical bars as targets and trials with green vertical bars as targets, as well as red and green horizontal bars as targets, were equally and randomly distributed throughout the session. All participants had normal or corrected-to-normal vision, and all had normal color perception. The objects comprising the visual display appeared in a grid-like arrangement positioned centrally in the screen (see Figure 1). Set sizes of objects comprising the visual displays were 5, 10, 15, and 20. Results Mean accuracy was 95% and did not differ across conditions. Figure 2 shows the reaction time by set size functions for target-present trials (filled symbols) and target-absent trials (open symbols) in the A/V Concurrent condition and the Auditory-First condition. The best-fit linear equations are accompanied by their r2 values indicating the percentage of variance accounted for by the linear regression. Overall mean reaction time was slower in the A/V Concurrent condition as a result of the complete auditory notification of target identity being delayed by approximately 1.5 seconds relative to the Auditory-First control condition. However, since spoken word recognition is incremental, participants were able to begin processing before both target feature words had been presented, and overall reaction time was only delayed by about 600 milliseconds. A/V Concurrent Target Present Target Absent 2000 y = 1627.0 + 16.56x R^2 = 0.979 Reaction Time (ms) 1600 y = 1595.5 + 3.78x R^2 = 0.295 Auditory First Target Present Target Absent 1200 y = 838.5 + 28.12x R^2 = 0.956 y = 842 + 15.42x R^2 = 0.820 10 15 Setsize Figure 2: Reaction time as a function of set size. Repeated-measures analysis of variance revealed significant main effects of Condition [F(1, 16)=230.27, p Suggest Documents Report "Spoken Language Comprehension Improves the Efficiency of Visual" Copyright © 2020 MAFIADOC.COM. All rights reserved. | About Us | Privacy Policy | Terms of Service | Help | Copyright | Contact Us | Cookie Policy
cc/2020-05/en_middle_0087.json.gz/line1337841
__label__wiki
0.55467
0.55467
Combinational products: A regulatory review J. Vijaya Dwaraka, S. G. Vasantharaju, Latif Jamadar, Syed Sajjad Hussen, D. Sreedhar, N. Udupa Department of Pharmaceutical Quality Assurance, Manipal College of Pharmaceutical Sciences, Manipal Department of Pharmacy Management, Manipal College of Pharmaceutical Sciences, Manipal A regulation with respect to combination products and FDA over view. Advances in drug, biologic and medical device development relate to both single entities and combination of each type of medicinal product. Regulatory overview of combination products is complicated by the fact that although drugs are regulated primarily under section 505 of Food, drugs and cosmetic act and reviewed by CDER, CBER, and CDRH. Combination products increasingly include state-of-art, innovative technologies with great potential to advance patient care. Combining different regulated product types, however, triggers a panoply of issues with which the Food and Drug Administration, pharmaceutical, biologic and medical device manufacturers, and other stake holders have struggled through the years. Since 1991, FDA has worked toward resolving a number of these issues, and has made some inroads in assignment of jurisdiction for combination products. We are encouraged by FDA's preliminary efforts, and look forward to further improvement in the regulatory process for combination products. International Journal of Pharmaceutical Sciences Review and Research Published - 11-2010 Drug Legislation Vijaya Dwaraka, J., Vasantharaju, S. G., Jamadar, L., Hussen, S. S., Sreedhar, D., & Udupa, N. (2010). Combinational products: A regulatory review. International Journal of Pharmaceutical Sciences Review and Research, 5(1), 52-60. Vijaya Dwaraka, J. ; Vasantharaju, S. G. ; Jamadar, Latif ; Hussen, Syed Sajjad ; Sreedhar, D. ; Udupa, N. / Combinational products: A regulatory review. In: International Journal of Pharmaceutical Sciences Review and Research. 2010 ; Vol. 5, No. 1. pp. 52-60. @article{67bafb93cd694cd4a3a7060e8ed66bfb, title = "Combinational products: A regulatory review", abstract = "A regulation with respect to combination products and FDA over view. Advances in drug, biologic and medical device development relate to both single entities and combination of each type of medicinal product. Regulatory overview of combination products is complicated by the fact that although drugs are regulated primarily under section 505 of Food, drugs and cosmetic act and reviewed by CDER, CBER, and CDRH. Combination products increasingly include state-of-art, innovative technologies with great potential to advance patient care. Combining different regulated product types, however, triggers a panoply of issues with which the Food and Drug Administration, pharmaceutical, biologic and medical device manufacturers, and other stake holders have struggled through the years. Since 1991, FDA has worked toward resolving a number of these issues, and has made some inroads in assignment of jurisdiction for combination products. We are encouraged by FDA's preliminary efforts, and look forward to further improvement in the regulatory process for combination products.", author = "{Vijaya Dwaraka}, J. and Vasantharaju, {S. G.} and Latif Jamadar and Hussen, {Syed Sajjad} and D. Sreedhar and N. Udupa", note = "cited By 0", journal = "International Journal of Pharmaceutical Sciences Review and Research", publisher = "Global Research Online", Vijaya Dwaraka, J, Vasantharaju, SG, Jamadar, L, Hussen, SS, Sreedhar, D & Udupa, N 2010, 'Combinational products: A regulatory review', International Journal of Pharmaceutical Sciences Review and Research, vol. 5, no. 1, pp. 52-60. Combinational products: A regulatory review. / Vijaya Dwaraka, J.; Vasantharaju, S. G.; Jamadar, Latif; Hussen, Syed Sajjad; Sreedhar, D.; Udupa, N. In: International Journal of Pharmaceutical Sciences Review and Research, Vol. 5, No. 1, 11.2010, p. 52-60. T1 - Combinational products: A regulatory review AU - Vijaya Dwaraka, J. AU - Vasantharaju, S. G. AU - Jamadar, Latif AU - Hussen, Syed Sajjad AU - Sreedhar, D. AU - Udupa, N. N1 - cited By 0 N2 - A regulation with respect to combination products and FDA over view. Advances in drug, biologic and medical device development relate to both single entities and combination of each type of medicinal product. Regulatory overview of combination products is complicated by the fact that although drugs are regulated primarily under section 505 of Food, drugs and cosmetic act and reviewed by CDER, CBER, and CDRH. Combination products increasingly include state-of-art, innovative technologies with great potential to advance patient care. Combining different regulated product types, however, triggers a panoply of issues with which the Food and Drug Administration, pharmaceutical, biologic and medical device manufacturers, and other stake holders have struggled through the years. Since 1991, FDA has worked toward resolving a number of these issues, and has made some inroads in assignment of jurisdiction for combination products. We are encouraged by FDA's preliminary efforts, and look forward to further improvement in the regulatory process for combination products. AB - A regulation with respect to combination products and FDA over view. Advances in drug, biologic and medical device development relate to both single entities and combination of each type of medicinal product. Regulatory overview of combination products is complicated by the fact that although drugs are regulated primarily under section 505 of Food, drugs and cosmetic act and reviewed by CDER, CBER, and CDRH. Combination products increasingly include state-of-art, innovative technologies with great potential to advance patient care. Combining different regulated product types, however, triggers a panoply of issues with which the Food and Drug Administration, pharmaceutical, biologic and medical device manufacturers, and other stake holders have struggled through the years. Since 1991, FDA has worked toward resolving a number of these issues, and has made some inroads in assignment of jurisdiction for combination products. We are encouraged by FDA's preliminary efforts, and look forward to further improvement in the regulatory process for combination products. JO - International Journal of Pharmaceutical Sciences Review and Research JF - International Journal of Pharmaceutical Sciences Review and Research Vijaya Dwaraka J, Vasantharaju SG, Jamadar L, Hussen SS, Sreedhar D, Udupa N. Combinational products: A regulatory review. International Journal of Pharmaceutical Sciences Review and Research. 2010 Nov;5(1):52-60. https://www.scopus.com/inward/record.uri?eid=2-s2.0-79952029279&partnerID=40&md5=96f3bbbc6cad28805ae7dc78c8e02e29
cc/2020-05/en_middle_0087.json.gz/line1337847
__label__cc
0.688087
0.311913
Contracts II, Pages 783–785 Sierra Diesel Injection Service, Inc. v. Burroughs Corp. Back to Contracts II Briefs United States District Court for the District of Nevada, March 17, 1987 View opinion on Lexis Advance View opinion on WestLaw View opinion on Google Scholar View opinion on Leagle Plaintiff contacted defendant to buy some new bookkeeping equipment, but defendant recommended that plaintiff buy a computer instead. Plaintiff's president, Cathey, negotiated the agreements, and written contracts were prepared by defendant and delivered to plaintiff. Cathey skimmed the agreements, except he read the parts about what was to be purchased, the price, the parties involved, and the delivery date. He did not understand computer terminology and so relied on defendant's personnel as to what should be purchased. As a result, Cathey did not actually know what he was agreeing to buy. Each of the agreements had an integration clause, which Cathey did not understand the meaning of. Were the contracts integrated when plaintiff's agent did not understand the meaning of the integration clause? Page 785, Paragraph 2 Integration requires a mutual intent by both of the contracting parties that the written agreement contain all of the agreements of the parties and the further mutual intent that the written agreement is intended to be the sole agreement Cathey did not understand the integration clause, so he could not have intended it. The contracts were not integrated.
cc/2020-05/en_middle_0087.json.gz/line1337855
__label__cc
0.558784
0.441216
Movie and TV reviews and analyses Delve in to the labyrinth of entertainment Contact with questions, requests, anything? TV Articles Five great things about Man of Steel (and five problems with it) Raelonus Movie Articles October 11, 2019 October 12, 2019 8 Minutes You can call me old-fashioned. You can call me an MCU fanboy brainwashed by Stan Lee. You can say I wouldn’t know a good movie if it hit me in the head. You can say You can call me a moron, a member of the liberal establishment, an idiot, an SJW, a guy who’s just trying to fit in with the critics, and the like. Your poor grammar is not only allowed but also encouraged. But I don’t think Man of Steel is a good movie. It’s not a bad movie and definitely has its moments of greatness but there are many things that keep me from enjoying it. This article takes a look at the best and worst parts of Man of Steel. Great: Russel Crowe as Jor-El Marlon Brando is a fantastic actor and brought a sense of seriousness and dignity to this character. But in spite of all his talent he very much took a disinterested approach to this role in spite of that which makes it surprising of how good it was. While the original Jor-El certainly had more of a commanding presence this version of him is far more active and far more direct in saving his son and guiding him through his endeavors to become the titular character. And Crowe’s performance brought good passion to all of it. Great: The overall visual style If there’s one thing that shines in any Zack Snyder movie even when it’s not good it’s that he knows how to give good visuals even if they aren’t always the right kind at a given time. My personal favorite shining point of the visual style in this movie is the overall look of Krypton. It’s a very interesting sci-fi/medieval mix with interesting wildlife that really makes it stand out from being just another alien planet. While the look of Krypton in the original was good technology wasn’t at its strongest and there’s not much, they could do with it back then. On top of that Krypton’s history is given a tad more layers and its destruction is a far more tragic with it being a result of their own people. It’s a perfect mix of style and substance that…I really wish was in the rest of the movie. Great: The Action The first Superman movie had Lex Luthor who really simply cannot match Superman in terms of physical prowess and as a result there wasn’t much in the way of action. Superman 2 brought in Zod which improved on the action but it pales in comparison to Man of Steel’s which is far bigger in scale and stakes and with years of improvements in special effects there’s a lot more to do with it and all of it is very well shot. But of course, there is a downside to this epic scaled action which I’ll get to. Great: Earth’s reaction to Superman In the original Superman movies when Superman first arrives aside from Lex Luthor the public is more than happy to welcome him. This movie has more of a realistic response of viewing him with fear and suspicion to the point that the government was more than happy to hand him over to Zod when he demands Superman be brought to him. Is it something that comes full circle by the end? Not completely. Is it definitely a somewhat realistic response? Absolutely! Great: General Zod I saved this one for last because personally I find Michael Shannon’s General Zod the best performance (and best part) of this movie. He’s not just an evil guy bent on world domination. He has legitimate and sympathetic motivations in trying to save Krypton and its people with some moderate depth to them. There are only two real downsides to his character: One is something I’ll get to in a moment and the other is well… his performance did go a tad too over the top to the point that he is chewing the scenery at some point and I do think his character could have done without this because it makes his threat practically laughable. Okay we’ve run through the good stuff now it’s time to get to the worst parts. I am warning you if you have nothing but love for this movie, please close this window right now and/or type your comments of hatred for me. You still here? You ready? Let’s go. Problem: Non-linear childhood The movie flashes back and forth between Clark’s childhood and adulthood and while I’m not against a nonlinear narrative particularly with a superhero story (MCU Spider-Man while I like it a lot, could do very well with this) it’s not well utilized here. There’s very little time devoted to talk about what Clark is going through. Some scenes of Clark learning to get accustomed to his powers do well without dialogue but they’re very much scenes that work on their own but when it comes to combining it together, we’re getting background on man whose personality we don’t know anything about. We’re not given time to understand him. Problem: A lack of distinctness Actors like Amy Adams and Laurence Fishburne are actors that have done great work in the past and seem like perfect choices to play the classic characters of Lois Lane and Perry White. And at first it seemed like Snyder wanted to put a fresh new fun spin with these guys. But as the movie progressed most of their dialogue amounted to mere exposition with almost no emotion or heart. Fishburne’s role in this movie almost rivals that of his role as Bill Foster in the MCU (and I say this as someone who likes the movie, the villains of Ant Man and the Wasp are the weakest part of it). As for Amy Adams as Lois Lane, outside of being able to piece together that Clark is Superman using her journalistic skills (which admittedly is impressive) there’s not much else she does. That one aspect goes nowhere which makes it all the more confusing as to why Zod demanded that she be brought on board when Superman turns himself over to him. The only reason she was brought on board was to make a plot device to help Superman escape later. She served no purpose of being brought on board other than that. Characters like these (and some others others) have no unique identity. If these characters weren’t given names you wouldn’t know they were these comic book characters. Problem: Death and Destruction Remember how I said there was a downside to magnitude of the action? Well yeah here it is. In fighting off these guys Superman is no better than the villains he fights. As Superman fights Zod and his men throughout Smallville and Metropolis, the damage he leaves behind is downright brutal. Metropolis in particular is reduced to rubble which makes it all the more hilarious when the army accepts Superman as a friend (which seems more out of fear than anything) and when the citizens claim “Superman saved them.” Like you guys simply got lucky. Pretty sure Superman would have fried you if it meant stopping Zod. Problem: A New Krypton This one is more personal than anything but it always confused me. Zod tells Kal-El that he has the Codex for all living things on Krypton and thus has a chance to let the planet live again. Kal questions what will become of Earth if he gives up the Codex to which Zod responds “the foundation has to be built on something” with a scene of skulls implying that he’s going to commit mass genocide against Earth and the people to build Krypton from Earth’s ashes. I mean is it really wise to tell your only hope for the future of your kind that you’re going to destroy his planet and the people he loves? I mean that’d make him more resistant and the and make the process of bringing back Krypton harder right? Also, couldn’t Zod have chosen to terraform some other planet? Feel free to correct me on this one. Problem: Jonathan Kent Oh boy. No matter what wrong Man of Steel did, nothing is going to match everything to do with this character. It’s always been my understanding of Superman lore that young Clark’s ideals as Superman came foremost from his adopted parents. They instilled a strong moral background in him. I had nothing against Diane Lane’s portrayal of Martha Kent and in both this movie and Batman v. Superman she was actually okay. Jonathan Kent on the other hand…oh boy. Throughout the movie he goes telling Clark to never use his powers even to as much as help anybody. Granted he does explain this outlook but he takes it too far. There’s a scene where young Clark saves a bus full of kids and when his dad scolds him for using his powers, he’s responds “what was I supposed to do let them let them die?” To which Jonathan replies “maybe.” That’s probably the most screwed up response ever. And before anyone says anything there was a scene in season 1 of the Supergirl TV show whether you like it or hate it that had a very similar situation but one that Kara’s adopted father handled a lot better. That aside most of Jonathan’s dialogue is mostly building him up as a symbol destined for greatness and less as a person. And of course, there’s his tragic death in a tornado in trying to save the family dog where he keeps Clark from saving his life out of fear of his son being outted even though Clark probably could have done it within minutes without there being that many questions and it all evokes nothing. Let’s just say that those two minutes of Glenn Ford’s Jonathan Kent talking to Clark in the original Superman movie spoke far more volumes than anything this version did. It may think it did but really all it did was make Jonathan Kent look bad. The simple truth is at this moment now I will always see the original Donner/Lester movies better than Man of Steel. They aren’t perfect, they are campy, and the effects certainly don’t hold up. However, the narrative is stronger, the performances were better, and most of all the characters were a lot more likable. It has a charm that Man of Steel just doesn’t have. In fact the original 1978 Superman is such a widely regarded masterpiece that Kevin Feige has recommended that several Marvel employees watch the movie before getting to work on a Marvel movie. And that shows: Beneath all the CGI whether it’s good or bad are core parts of what made the original Superman so likable: Charming characters, compelling performances, and (for the most part) strong narratives. Are there any other good or bad parts you think I missed regarding this movie? Any you disagree with? Leave your thoughts in the comments below. Published by Raelonus My name is Neal Sastry. I have a passion for movies and television which is why I started this website. While I do like others, my main passions are animation and superheroes View all posts by Raelonus Previous Post Joker (2019) Review Next Post A Look at the Spider-Man suits of the MCU
cc/2020-05/en_middle_0087.json.gz/line1337856
__label__wiki
0.531324
0.531324
Lipid rafts remodeling in estrogen receptor–negative breast cancer is reversed by histone deacetylase inhibitor Anna Ostapkowicz, Kunihiro Inai, Leia Smith, Silvia Kreda and Jozef Spychala Anna Ostapkowicz Kunihiro Inai Leia Smith Silvia Kreda Jozef Spychala DOI: 10.1158/1535-7163.MCT-05-0226 Published February 2006 Recently, we have found dramatic overexpression of ecto-5′-nucleotidase (or CD73), a glycosylphosphatidylinositol-anchored component of lipid rafts, in estrogen receptor–negative [ER(−)] breast cancer cell lines and in clinical samples. To find out whether there is a more general shift in expression profile of membrane proteins, we undertook an investigation on the expression of selected membrane and cytoskeletal proteins in aggressive and metastatic breast cancer cells. Our analysis revealed a remarkably uniform shift in expression of a broad range of membrane, cytoskeletal, and signaling proteins in ER(−) cells. A similar change was found in two in vitro models of transition to ER(−) breast cancer: drug-resistant Adr2 and c-Jun-transformed clones of MCF-7 cells. Interestingly, similar expression pattern was observed in normal fibroblasts, suggesting the commonality of membrane determinants of invasive cancer cells with normal mesenchymal phenotype. Because a number of investigated proteins are components of lipid rafts, our results suggest that there is a major remodeling of lipid rafts and underlying cytoskeleton in ER(−) breast cancer. To test whether this broadly defined ER(−) phenotype could be reversed by treatment with differentiating agent, we treated ER(−) cells with trichostatin A, an inhibitor of histone deacetylase, and observed reversal of mesenchymal and reappearance of epithelial markers. Changes in gene and protein expression also included increased capacity to generate adenosine and altered expression profile of adenosine receptors. Thus, our results suggest that during transition to invasive breast cancer there is a significant structural reorganization of lipid rafts and underlying cytoskeleton that is reversed upon histone deacetylase inhibition. [Mol Cancer Ther 2006;5(2):238–45] Lipid rafts membrane domain histone deacetylase inhibitor Establishment and clinical use of tumor markers that define invasive and metastatic breast carcinoma is critical for more individualized therapeutic strategies in the future. Because breast cancer is becoming an increasingly heterogeneous disease, the task of defining specific cancer cell phenotypes is especially challenging. Several individual breast cancer markers have been established for target-specific pharmacologic intervention. The clinically proven therapies include targeting estrogen receptor (ER) and progesterone receptor and more recently Erb2 and epidermal growth factor receptor (EGFR). Major differences in expression profiles of wide number of genes has been documented in ER(−) and ER(+) carcinomas (1). Both in in vitro studies and in the clinic, these differences were associated with either more motile and invasive phenotype or more aggressive course of the disease in the case of ER(−) breast carcinoma (2). Membrane proteins and associated cytoskeleton mediate the communication with the extracellular milieu and the composition of membrane proteins is critical for cell behavior in general and invasive and metastatic properties in particular. Among different membrane microdomains, lipid rafts are one of the least understood subcellular elements. Although their lipid composition has been investigated in several studies (3–7), protein components were not systematically compared between invasive and noninvasive cells. Because several in vitro models of breast cancer exemplify transition to more invasive and metastatic state, we have chosen this model to study changes in lipid rafts composition after loss of ER expression. Our recent finding that ER(−) breast cancer cells express high level of ecto-5′-nucleotidase, a glycosylphosphatidylinositol-anchored protein and a marker of lipid rafts, provides an early argument for the lipid raft remodeling during transition to more aggressive breast carcinoma (8). In this study, we aimed to analyze whether there is a consistent alteration in expression of cytoskeletal membrane and lipid raft protein components across a wider population of ER(+) and ER(−) cells that would suggest a coordinate expression consistent with the motile and invasive phenotype. Within this phenotype, we also investigated the expression of genes and proteins involved in adenosine generation and signaling. Although limited by the availability of suitable antibodies, our unique focus on expressed proteins, rather than mRNA profile, allowed us to directly relate protein expression with the specific cell phenotype. Breast cancer ER(+) cell lines MDA-MB-474, ZR-75-1, MCF-7 and negative SK-BR-3, MDA-MB-468, MDA-MB-435s, MDA-MB-231, BT-549, Hs578t, nontransformed MCF-10A, c-Jun-transformed MCF-7/c-Jun clone 2-33 and control MCF-7/neo clone 7-1, and human fibroblasts WI-38 were obtained from either Tissue Culture Facility at Lineberger Comprehensive Cancer Center/University of North Carolina, American Type Culture Collection (Manassas, VA), or developed as described before (9). The Adr2 and AdrR MCF-7 Adriamycin-resistant cell sublines were from Dr. Y.M. Rustum (Roswell Park Cancer Institute, Buffalo, NY). Cells were maintained in MEM supplemented with Eagle salts, NaPyr, nonessential amino acids, and 10% fetal bovine serum (most cell lines); in McCoy's supplemented with 15% fetal bovine serum (SK-BR-3 cells); in Leibowitz L-15 supplemented with 10% fetal bovine serum (MDA-MB-468 cells); and in mammary epithelial growth medium supplemented with bovine pituitary extract, human epidermal growth factor, insulin, hydrocortisone, and 10% fetal bovine serum (BioWhittaker medium for MCF-10A cells) in CO2/O2 atmosphere at 37°C, except for MDA-MB-468 cells that were grown at ambient atmosphere at 37°C. All media contained penicillin and streptomycin. Original cell stocks were stored in liquid nitrogen and each sample was kept in culture for no more than 15 passages. All general reagents were ACS or the highest purity commercially available. The following antibodies were used. Rabbit polyclonal anti-ecto-5′-nucleotidase antibodies (for Western blot) were generated as described before (10) or purchased from BD Biosciences (PharMingen, San Jose, CA; for immunofluorescence). Anti-Gαs/olf sc-383, Gαi-2 sc-7276, Gα12 sc-409, Gα13 sc-410, thy-1 sc-9163, CD24 sc-11406, Gβ sc-378, Gβ2 sc-380, ankyrin B (clone 2.20), cyclin D1 sc-8396, integrin β1 sc-8978, integrin β2 sc-6624, integrin β3 sc-6627, ERα sc-8005, fyn sc-434, lyn sc-15, lck sc-433, c-fgr sc-130, hck sc-72, MDR1 sc-8313, N-cadherin sc-8424, OB-cadherin sc-9997, caveolin-1 sc-894, PKCα sc 8393, fascin, sc-16579, lamin B1, sc-6216, and secondary horseradish peroxidase conjugated against goat and rat IgG were from Santa Cruz (Santa Cruz, CA). E-cadherin C20820, fak F15020, integrin β1 I41720, integrin α5 I55220, PKCβ P17720, PKCδ P36520, PKC[thetas] P15120, moesin M36820, EBP50 E83020, ezrin M36820, gelsolin G37820, and flotillin-1 F65020 antibodies were from Transduction Laboratories (Lexington, KY). Anti-CD44s 13-5500 antibody was from Zymed (San Francisco, CA). Anti-c-Yes antibody 06-514 and c-Src GD11 were from Upstate (Lake Placid, NY); rabbit anti-uPAR (399R) were from American Diagnostica, Inc. (Greenwich, CT); anti-β-actin was from Oncogene (Boston, MA); antifilamin antibody MAB1678, integrin αv AB1930, talin MAB1676, and vimentin AB1620 were from Chemicon (Temecula, CA); and anti-intestinal alkaline phosphatase antibodies were from Biogenesis (Kingston, NH). Antibodies against cytoskeletal proteins α-smooth muscle actin (clone 1A4), cytokeratin (clone K8.13 detecting forms 1, 5, 6, 7, 8, 10, 11, and 18; clone K8.12 detecting forms 13, 15, and 16) were from Sigma (St. Louis, MO). Lipid Raft Isolation Cell lysates were prepared by mixing equal volumes of cell pellets with 2% Triton X-100 on ice for 1 minute and subsequent dilution twice with PBS and twice further with 35% Nycodenz [5′-(N-2,3-dihydroxypropylacetamido)-2,4,6-triiodo-N,N-bis(2,3-dihydroxypropyl)-isophtalamide] in PBS. At each step, mixing was achieved by pipetting the lysate up and down several times with Eppendorf pipettor. A modified procedure for density gradient centrifugation using Nycodenz from Sigma-Aldrich (St. Louis, MO) was used to fractionate Triton X-100–soluble and Triton X-100–insoluble membrane and cytoskeletal subdomains and complexes (11). For the purpose of centrifugation, cell lysates containing 3 to 4 mg total protein were diluted 2-fold with 35% Nycodenz. Density step gradient was generated by applying 0.5 mL aliquots of increasing concentration of Nycodenz (35%, 25%, 22.5%, 20%, lysate in 17.5%, 15%, 12%, 8%, and 4%) sequentially into Beckman (Palo Alto, CA) 13 × 51 mm polyallomer tubes. Lysates were placed in the middle of Nycodenz gradient premixed in 17.5% Nycodenz. Tubes were centrifuged at 46,000 ×g for 4 hours in a Beckman 55 Ti rotor at 4°C. Following centrifugation, 0.5 mL fractions were carefully withdrawn and small pellet was resuspended in PBS containing 0.5% SDS and 1% Triton X-100 (fraction 10). Total of 10 fractions and control input lysate were analyzed for the distribution of proteins by Western blot. Typically, components of light lipid rafts and caveolae distributed into first four fractions: Soluble cell components, including cytosolic proteins, remained in fractions 5 and 6 and cytoskeleton-associated high-density fractions were distributed in fractions 7 to 9. Cell extracts, obtained by scraping cells in PBS in the presence of protein phosphatase and protease inhibitors and lysing with ice-cold 1% Triton X-100/PBS, were loaded on the SDS-PAGE at 30 μg per lane. Separated proteins were transferred onto Immobilon-P 0.45 μmol/L (Millipore, Bedford MA) polyvinylidene difluoride membrane and used for probing with specific antibodies. Two buffer systems were used during incubations with antibodies: PBS supplemented with 5% Carnation fat-free dry milk and 0.2% Tween 20 or 25 mmol/L Tris (pH 8.4) supplemented with 130 mmol/L NaCl, 5 mmol/L potassium phosphate, 5% fat-free dry milk, and 0.2% Tween 20. Blots were reused several times after mild stripping by air drying overnight at room temperature when necessary. Secondary antibodies conjugated to horseradish peroxidase and BM Chemiluminescence Western Blotting kit (Roche, Indianapolis IN) were used to develop images on Kodak (Rochester, NY) X-Mat Blue XB-1 film. Extraction of total RNA was done using TRI reagent from Molecular Research Center (Cincinnati, OH). Reverse transcription-PCR assays were done using Advantage RT and Titanium Taq PCR kits from Clontech BD Biosciences (Mountain View, CA). The following PCR oligonucleotides for adenosine receptor subtypes were used: A1 forward: AATTGCTGTGGACCGCTACCTC, reverse: CGACACCTTCTTGTTGAGCTG; A2a forward: TTGACCGCTACATTGCCATCCG, reverse: GAAGATCCGCAAATAGACACC; A2b forward: ACCAACTACTTCCTGGTGTCC, reverse: GCAGCTTTCATTCGTGGTTCC: A3 forward: ATCGCTGTGGACCGATACTTG, reverse: AATGCACCTGTCTCTTTGGAG. Amplification reactions were run at the following conditions: 1 minute each at 94°C, 62°C, and 72°C, total 40 cycles. The size of PCR products were as follows: AR1 344 bp, AR2a 305 bp, AR2b 374 bp, AR3 352 bp, glyceraldehyde-3-phosphate dehydrogenase 983 bp, and trypsin inhibitor 407 bp. We have done a broad survey of the expression of membrane, cytoskeletal, and signaling proteins in breast cancer cell lines that represent ER(+) and ER(−) phenotypes. The cell panel consists of well-characterized cell lines, which invasive and metastatic potential have been defined in previous studies (12, 13), thus enabling us to correlate protein expression with specific cell phenotypes. In this cell panel, MCF-10A cells is an example of nontumorigenic mammary epithelial control cells and SK-Br-3 and MDA-MB-468 represent ER(−) cells that are less tumorigenic than MDA-MB-435s, MDA-MB-231, BT-549, and Hs578t cells (12). Recently, we showed dramatic up-regulation of ecto-5′-nucleotidase, a glycosylphosphatidylinositol-anchored membrane ecto-protein, in ER(−) breast cancer cells (8). Here, we compared the expression of ecto-5′-nucleotidase with other lipid raft components, such as CD24 and alkaline phosphatase. The expression of proposed breast cancer marker CD24 concurred with the ER receptor status and was also found in SK-Br-3 and MDA-MB-468 cells. A reciprocal pattern was found for intestinal alkaline phosphatase (Fig. 1A ). The broader membrane and cytoskeletal protein survey revealed an alteration in expression of specific proteins in ER(+) and ER(−) cell lines with somewhat variable expression in SK-Br-3 and MDA-MB-468 cells (Fig. 1A). Although E-cadherin was expressed mostly in ER(+) and control cells, other adhesion receptor integrins β1, α5, and αV; CD44; and OB-cadherin and N-cadherin tended to coexpress with ecto-5′-nucleotidase in ER(−) cells (Fig. 1B). Similarly, cytoskeletal protein vimentin and partially smooth muscle actin, in contrast to several cytokeratins, coexpressed with ecto-5′-nucleotidase in ER(−) cells. Lamin B1 expression was independent of cell type; however, α-tubulin tended to express at higher levels in more aggressive ER(−) cells (Fig. 1A). Analysis of proteins associated with cytoskeleton show that although EBP50 and gelsolin were associated with less invasive cells, fimbrin, talin, filamin, and especially fascin and moesin tended to express at higher level in more invasive breast cancer cells (not shown). Interestingly, caveolin-1 expression strongly coincided with ecto-5′-nucleotidase, further suggesting that, in addition to ecto-5′-nucleotidase lipid rafts, caveolae may have specific function in more invasive cells. Other membrane or membrane-associated signaling molecules, such as EGFR (not shown), lyn, and PKCα, also showed similar expression pattern. On the other hand, FAK, PKCδ, PKCζ, and integrin α3 did not display cell-specific expression (not shown). Differential expression of membrane and cytoskeletal proteins in hyperplastic MCF-10A cells and in a panel of breast cancer cell lines. A, representative cytoskeletal and lipid raft–associated proteins. eN, ecto-5'-nucleotidase; ALP, alkaline phosphatase. B, representative membrane and signaling proteins with roles in adhesion. C, representative cytoskeleton-associated proteins. Note that moesin (bottom) and ezrin (top band on the bottom panel) are detected simultaneously using M36820 antibodies from Transduction Laboratories. Cell lysates were prepared in enough quantity so different proteins could be compared using the same lysate. They were loaded onto each lane (30 μg) and processed for SDS-PAGE and Western blotting procedure as described in Materials and Methods. This comprehensive analysis helped us subcategorize our breast cancer cell panel into three distinct profiles. BT474, ZR-75-1, and MCF-7 cells having epithelial and MDA-MB-435s, MDA-MB-231, BT-549, and Hs578t having more mesenchymal features. Significantly, cell lines SK-Br-3 and MDA-MB-468 fall in between: Although losing many epithelial markers, such as E-cadherin and certain cytokeratins, they did not yet acquire full set of mesenchymal features, and, as have been shown previously, are less tumorigenic (12). Interestingly, during long cell culture (>20 cell passages), we occasionally observed temporal expression of ecto-5′-nucleotidase in SK-Br or lower expression in MDA-MB-468 cells, but no change in expression in other cell lines, suggesting some intrinsic phenotypic plasticity in these particular cells. Despite their less aggressive phenotype, this could explain metastatic behavior of MDA-MB-468 cells in mouse xenograft model (14). The MCF-10A cell line, on the other hand, expresses more complex mixture of epithelial and mesenchymal markers, and thus may likely have myoepithelial origin. To further test whether transition to ER(−) status and more invasive phenotype will show similar shift in expression profile, we used two independent in vitro models of breast cancer progression. Development of drug resistance and overexpression of c-Jun in MCF-7 cells were both shown to correlate with the loss of ER expression and transition to more invasive and tumorigenic phenotype (9, 15). Results presented in Fig. 2 show that in these two models, there is a very similar shift in expression profile to that in ER(−) cells shown in Fig. 1A-C. To further analyze whether the expression of membrane or cytoskeletal proteins may differentiate between “cancer metastatic” and normal motile phenotypes, we included in this survey lysates from normal human fibroblasts WI-38. Normal fibroblasts are commonly used to represent mesenchymal phenotype. This comparison revealed that drug-resistant, c-Jun-transformed, and all other invasive cells shown in Fig. 1A-C exhibit the expression pattern of membrane and cytoskeletal proteins that is remarkably similar to fibroblasts. In addition to data presented in Fig. 2, we observed up-regulation of Src, lyn, and EGFR and down-regulation of Lck in ER(−) cells and in fibroblasts. The expression of fimbrin and flotillin-1 did not show, however, significant variation in these cells (not shown). Differential expression of membrane, adhesion, cytoskeletal, and regulatory proteins in in vitro models of breast cancer progression: drug-resistant (Adr2) and c-Jun-transformed MCF-7 cells. Comparison of expression profiles with human normal fibroblasts WI38. Experimental conditions as in Fig. 1. To determine which membrane, cytoskeletal, and signaling proteins were associated with lipid rafts, we used the modified density gradient centrifugation with Nycodenz (11) and used MDA-MB-231 and MCF-7 cell lysates as representative for ER(−) and ER(+) phenotypes. These two cell lines are very well characterized in previous studies and therefore are better suited for comparative analysis. Furthermore, MDA-MB-231 cells were shown to reexpress ERα and E-cadherin upon trichostatin A treatment (16), suggesting an intrinsic plasticity important for the purpose of this work. Other cell lines shown in Fig. 1, both ER(−) and ER(+), were also tested for lipid raft distribution of selected membrane proteins and the results were similar to MCF-7 and MDA-MB-231 cells (not shown). Preliminary experiments also determined that cholesterol, an important component of lipid rafts, distributed mostly with low-density fractions 2 to 4 (here defined as lipid rafts). As shown in Fig. 3A , ecto-5′-nucleotidase and flotillin-1, two independent markers of lipid rafts, were found predominantly in low-density fractions. On the other hand, α-tubulin (disassembled to monomers under low-temperature conditions) and adenosine kinase were distributed predominantly to fractions 5 to 7, which represent Triton X-100 soluble cell extracts (not shown). Vimentin, β-actin, and lamin B1 were distributed mostly to fractions 5 to 10, which represent heavier Triton X-100–soluble and Triton X-100–insoluble (cytoskeletal) fractions of cell lysate (not shown). Distribution of proteins from MDA-MB-231 cells after density gradient centrifugation. A and B, analysis of proteins associated with lipid rafts and cytoskeleton in MDA-MB-231 cells. Other conditions as in Fig. 1. Among signaling membrane-associated proteins, src-family members, with the exception of c-yes, distributed almost exclusively to lipid rafts (Fig. 3A). In contrast, protein kinase Cα was found exclusively in soluble cell compartment and neither associated with lipid rafts nor with insoluble cytoskeleton (Fig. 3A). CD44 and Gαi2, known lipid raft components, also distributed almost exclusively to lipid rafts. On the other hand, Gαs and Gβ2 distributed in significant part to soluble and cytoskeletal compartments (Fig. 3B). Integrin β1, EGFR, and OB-cadherin proteins highly expressed in MDA-MB-231 cells were distributed in all three cell compartments and FAK was found only in soluble and cytoskeletal fractions. Analysis of cell lysates from ER(+) breast cancer MCF-7 cells that express very low levels of ecto-5′-nucleotidase also showed lipid raft distribution of this protein, along with glycosylphosphatidylinositol-linked CD24, src, lyn, and Gαs, suggesting that this distribution is cell type independent (not shown). Previous studies showed that histone deacetylase inhibitors caused shift in expression pattern of selective protein groups. In breast cancer cells, trichostatin A has been shown to induce the expression of ERα and E-cadherin in MDA-MB-231 cells (16, 17). Based on these data, we asked whether trichostatin A may reverse the expression of a broader range of mesenchymal proteins that define the invasive and metastatic phenotype in breast cancer cells. Our preliminary studies revealed that 0.5 μmol/L trichostatin A concentration was most effective without triggering substantial apoptosis (see also ref. 16). Treatment of MDA-MB-231 cells with trichostatin A for 48 hours caused down-regulation of ecto-5′-nucleotidase protein (Fig. 4A ). Similar result was seen with ecto-5′-nucleotidase mRNA (not shown). Other proteins that have been shown to contribute to invasive cell behavior, such as CD44 (standard form), PKCα, caveolin-1, integrins β1 and α5, EGFR, OB-cadherin, and moesin, were all strongly down-regulated by trichostatin A. On the other hand, epithelial markers, such as cytokeratins (detectable with K8-13 antibody), E-cadherin, ERα, EBP50, and gelsolin, were up-regulated. The expression of CD24, another marker of lipid rafts in ER(+) cells, was also significantly increased. The expression of several other proteins, including lyn (not shown) and vimentin, was only slightly down-regulated; however, at 48 hours of drug treatment, there was increased incidence of apoptosis that may have masked further changes in gene expression. Along with the complete disappearance of CD44 standard form, we have noticed an appearance of a higher molecular form, probably a splice variant (18), that was also seen in untreated MDA-MB-468 cells (Fig. 1A). A, effect of trichostatin A on the expression of selected membrane, cytoskeletal, and associated proteins in MDA-MB-231 cells. Cells were treated with 0.5 μmol/L trichostatin A for 48 h, harvested, and processed as described in Materials and Methods. Note that some Western blots were exposed much longer than shown in Fig. 1, which caused some proteins, such as cytokeratins, EBP50, or gelsolin, to be detected in control MDA-MB-231 cells. Each experiment was repeated at least twice with similar result. B, effect of trichostatin A on the expression of adenosine receptor mRNAs determined by reverse transcription-PCR (40 cycles). The sizes of PCR products are as follows: AR1 344 bp, AR2a 305 bp, AR2b 374 bp, AR3 352 bp, glyceraldehyde-3-phosphate dehydrogenase 983 bp, and trypsin inhibitor 407 bp. Because ecto-5′-nucleotidase, the major adenosine-producing enzyme in epithelial cells (19), was dramatically down-regulated in ER(−) cells exposed to trichostatin A (Figs. 1A and 4A), we tested the expression of adenosine receptors in MDA-MB-231 cells treated with trichostatin A. As shown in Fig. 4B, expression of adenosine receptors was unevenly affected by trichostatin A: Although A2a and A2b were unchanged, the expression of A1 was decreased and A3 was increased during this trichostatin A–induced transition to epithelial phenotype (Fig. 4B). Thus, increased capacity to produce adenosine seem to correlate with increased signaling through A1 receptors in aggressive breast cancer cells and this feature is reversed by histone deacetylase inhibitors. Analysis of lipid components of membranes in breast cancer cells was done previously and revealed significantly altered ratio of phospholipids (3), increased level of gangliosides, and components of lipid rafts (4–6) in ER(−) cells. Furthermore, increased circulating levels of gangliosides were found in breast cancer patients when compared with healthy individuals (7). Although association of few membrane and cytoskeletal proteins with the ER status were reported before, no comprehensive analysis of membrane and cytoskeletal proteins in a broad cell panel of breast cancer cells has been done thus far. Among these proteins, vimentin, EGFR, CD44, fascin, and E-cadherin were shown to be highly correlated with ER status both in breast cancer cell lines and in clinical samples (17). EGFR and vimentin were shown to coexpress in specific subset of advanced breast carcinoma distinct from both erbB2(+) and ER(+) cases (17). CD44, moesin, and fascin were also found to express at higher level in advanced breast cancer (20–22). A number of functional associations between proteins that overexpress in mesenchymal cells have also been established. CD44/moesin and CD44/lyn interactions collaborate in triggering invasiveness and chemoresistance (23, 24). Vimentin and fimbrin form functional complexes in macrophages (25). Recent study found a striking correlation of CD44+ and CD24− cells derived from breast carcinoma with their tumorigenic potential (26). Our analysis of the expression of membrane, cytoskeletal, and associated proteins in 12 breast cancer cell lines show that there is a consistent shift in expression pattern between noninvasive and invasive cell phenotypes. The use of widely characterized cell lines allowed us to directly correlate the expression pattern with well-defined specific cellular phenotypes. Remarkably, the expression profile, common to all six more aggressive cell lines (MDA-MB-435s, MDA-MB-231, BT549, Hs578t, MCF-7/Adr2, and MCF-7/c-Jun), was to large extent recapitulated in normal fibroblasts. The extent of similarities, including increased expression of signaling molecules, such as EGFR, PKCα, lyn, and Gαi-2, suggests that both membrane structural proteins and a number of proteins representing regulatory circuitry has been adopted from normal mesenchymal cells. The down-regulation of EBP50 and gelsolin, two proteins independently associating with actin cytoskeleton, correlate with up-regulation of moesin, fascin, and, to a lesser extent, talin and filamin. EBP50 may associate with ERM proteins (ezrin, radixin, and moesin) and thereby regulate anchoring of lipid rafts to cytoskeleton (27). Overall, our results may provide a direct evidence for epithelial to mesenchymal transdifferentiation in breast cancer. We found that several membrane proteins residing in lipids rafts are differentially expressed in invasive breast cancer cells, suggesting that there is a major remodeling of this membrane microdomain during breast cancer progression. Glycosylphosphatidylinositol-linked proteins are typically considered markers of lipid rafts. In our study, they show most dramatic shift in expression profile. The complete down-regulation of CD24 in ER(−) cells and the emergence of ecto-5′-nucleotidase and alkaline phosphatase most likely have physiologic consequences. CD24 is a new marker for breast and ovarian carcinoma (28, 29) that coincides with ER(+) status (30). This mucin-like heavily glycosylated protein was shown to be a ligand for P-selectin and proposed to mediate rolling in endothelium (31). On the other hand, ecto-5′-nucleotidase and alkaline phosphatase, which seem to replace CD24 during breast cancer progression, both have phosphohydrolase activity and participate in dephosphorylation of extracellular nucleotides (mostly AMPs) and generation of signaling adenosine (32). Adenosine, the product of both ecto-5′-nucleotidase and alkaline phosphatase enzymatic activities (19), acting through a family of receptors, has well-established roles in adhesion, growth regulation, vasodilation, and angiogenesis. These activities are likely to be relevant for breast cancer progression (reviewed in refs. 32, 33). Although ecto-5′-nucleotidase was also reported to participate in cell adhesion (34, 35), it is at present unclear how ecto-5′-nucleotidase would specifically contribute to invasive cell behavior. Nonetheless, increased capacity to generate adenosine on one hand, and increased expression of A1 and decreased expression of A3 on the other hand, support the view that adenosine signaling may have distinct roles in epithelial and mesenchymal cells. Recent demonstration of increased ecto-5′-nucleotidase expression and adenosine formation upon wnt-1 pathway activation further collaborate this notion (36). Inhibitors of histone deacetylases, including trichostatin A, have potent effects on global gene expression, inhibit cell proliferation, and induce differentiation and apoptosis (37–39). Although histone deacetylase inhibitors caused changes in many different cell types, mesenchymal cells were proposed to be particularly sensitive (40). In particular, previous studies have shown that MDA-MB-231 cells induced the expression of E-cadherin and ERα after treatment with histone deacetylase inhibitor trichostatin A (16). Given the known genome-wide effects of histone deacetylase inhibitors, such response suggested that trichostatin A may have induced differentiation, which in the context of mesenchymal cells may be regarded as mesenchymal to epithelial transdifferentiation. Indeed, the expression of most markers that differentiate ER(−) and ER(+) cells were affected in a reciprocal manner. Thus, our expression profiling of a broader set of membrane and cytoskeletal proteins provide a strong evidence for the mesenchymal to epithelial transdifferentiation after treatment of breast cancer cells of mesenchymal phenotype with trichostatin A. Previous studies have shown that histone deacetylase inhibitors increased the expression of metastasis suppressors, such as breast metastasis suppressor 1 (41), tissue inhibitor of metalloproteinase 3 (42), and nm23 (43) and thereby may have therapeutic activity in metastatic phase of breast and other carcinomas. In this context, our results suggest that such antimetastatic activity, at least in the subset of ER(−) breast cancer cells, may be due to the reversion of intrinsically invasive and metastatic mesenchymal phenotype. We thank Dr. Elzbieta Kulig for performing reverse transcription-PCR for this study. Grant support: RO1-CA34085 and Department of Defense grant DAMD17-01-1-0351. Revision received November 29, 2005. Martin KJ, Kritzman BM, Price M, et al. Linking gene expression patterns to therapeutic groups in breast cancer. Cancer Res 2000;60:2232–8. Daidone MG, Coradini D, Martelli G, Veneroni S. Primary breast cancer in elderly woman: biological profile and relation with clinical outcome. Crit Rev Oncol Hematol 2003;45:313–25. Le Moyec L, Tatoud R, Eugene M, et al. Cell and membrane lipid analysis by proton magnetic resonance spectroscopy in five breast cancer cell lines. Br J Cancer 1992;66:623–8. Lavie Y, Cao H, Bursten SL, Giuliano AE, Cabot MC. Accumulation of glucosylceramides in multidrug-resistant cancer cells. J Biol Chem 1996;271:19530–6. Nohara K, Wang F, Spiegel S. Glycosphingolipid composition of MDA-MB-231 and MCF-7 human breast cancer cell lines. Breast Cancer Res Treat 1998;48:149–57. Lucci A, Cho WI, Han TY, Giuliano AE, Morton DL, Cabot MC. Glucosylceramide: a marker for multiple-drug resistant cancers. Anticancer Res 1998;18:475–80. Wiesner DA, Sweeley CC. Circulating gangliosides of breast-cancer patients. Int J Cancer 1995;60:294–9. Spychala J, Lazarowski E, Ostapkowicz A, Ayscue LH, Jin A, Mitchell BS. Role of estrogen receptor in the regulation of ecto-5′-nucleotidase (eN) expression and extracellular adenosine generation in breast cancer. Clin Cancer Res 2004;10:708–17. Smith LM, Wise SC, Hendricks DT, et al. cJun overexpression in MCF-7 breast cancer cells produces a tumorigenic, invasive and hormone resistant phenotype. Oncogene 1999;18:6063–70. Yegutkin GG, Henttinen T, Samburski SS, Spychala J, Jalkanen S. The evidence of two opposite, ATP-generating and ATP-consuming, extracellular pathways on endothelial and lymphoid cells. Biochem J 2002;367:121–8. Hostager BS, Catlett IM, Bisghop GA. Recruitment of CD40 and tumor necrosis factor receptor-associated factors 2 and 3 to membrane microdomains during CD40 signaling. J Biol Chem 2000;275:15392–8. Sommers CL, Byers SW, Thompson EW, Torri JA, Gelmann EP. Differentiation state and invasiveness of human breast cancer cell lines. Breast Cancer Res Treat 1994;31:325–35. Zajchowski DA, Bartholdi MF, Gong Y, et al. Identification of gene expression profiles that predict the aggressive behavior of breast cancer cells. Cancer Res 2001;61:5168–78. Walsh MD, Luckie SM, Cummings MC, Antalis TM, McGuckin MA. Heterogeneity of MUC1 expression by human breast carcinoma cell lines in vivo and in vitro. Breast Cancer Res Treat 2000;58:255–66. Vickers PJ, Dickson RB, Shoemaker R, Cowan KHA. Multidrug-resistant MCF-7 human breast cancer cell line which exhibits cross-resistance to antiestrogens and hormone-independent tumor growth in vivo. Mol Endocrinol 1988;2:886–92. Yang X, Ferguson AT, Nass SJ, et al. Transcriptional activation of estrogen receptor α in human breast cancer cells by histone deacetylase inhibition. Cancer Res 2000;60:6890–4. Wilson KS, Roberts H, Leek R, Harris AL, Geradts J. Differential gene expression patterns in HER2/neu-positive and -negative breast cancer cell lines and tissues. Am J Pathol 2002;161:1171–85. Oliferenko S, Paiha K, Harder T, et al. Analysis of CD44-containing lipid rafts: recruitment of Annexin II and stabilization by the actin cytoskeleton. J Cell Biol 1999;146:843–54. Picher M, Burch LH, Hirsch AJ, Spychala J, Boucher RC. Ecto 5′-nucleotidase and nonspecific alkaline phosphatase. Two AMP-hydrolyzing ectoenzymes with distinct roles in human airways. J Biol Chem 2003;278:13468–79. Kaufmann M, Heider KH, Sinn HP, von Minckwitz G, Ponta H, Herrlich P. CD44 variant exon epitopes in primary breast cancer and length of survival. Lancet 1995;345:615–9. Bankfalvi A, Terpe HJ, Breukelmann D, et al. Gains and losses of CD44 expression during breast carcinogenesis and tumour progression. Histopathology 1998;33:107–16. Grothey A, Hashizume R, Sahin AA, McCrea PD. Fascin, an actin-bundling protein associated with cell motility, is upregulated in hormone receptor negative breast cancer. Br J Cancer 2000;83:870–3. Herrlic P, Morrison H, Sleeman J, et al. CD44 acts both as a growth- and invasiveness-promoting molecule and as a tumor-suppressing cofactor. Ann N Y Acad Sci 2000;910:106–18. Bates RC, Edwards NS, Burns GF, Fisher DEA. CD44 survival pathway triggers chemoresistance via lyn kinase and phosphoinositide 3-kinase/Akt in colon carcinoma cells. Cancer Res 2001;61:5275–83. Correia I, Chu D, Chou Y-H, Goldman RD, Matsudaira PT. Integrating the actin and vimentin cytoskeletons: adhesion-dependent formation of fimbrin-vimentin complexes in macrophages. J Cell Biol 1999;146:831–42. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 2003;100:3983–8. Itoh K, Sakakibara M, Yamasaki S, et al. Cutting edge: negative regulation of immune synapse formation by anchoring lipid raft to cytoskeleton through Cbp-EBP50-ERM assembly. J Immunol 2002;168:541–4. Fogel M, Friederichs J, Zeller Y, et al. CD24 is a marker for human breast carcinoma. Cancer Lett 1999;143:87–94. Kristiansen G, Denkert C, Schluns K, Dahl E, Pilarsky C, Hoauptmann S. CD24 is expressed in ovarian cancer and is a new independent prognostic marker of patient survival. Am J Pathol 2002;161:1215–21. Schindelmann S, Windisch J, Grundmann R, Kreienberg R, Zeillinger R, Deissler H. Expression profiling of mammary carcinoma cell lines: correlation of in vitro invasiveness with expression of CD24. Tumour Biol 2002;23:139–45. Aigner S, Ramos CL, Hafezi-Moghadam A, et al. CD24 mediates rolling of breast carcinoma cells on P-selectin. FASEB J 1998;12:1241–51. Spychala J. Tumor-promoting functions of adenosine. Pharmacol Ther 2000;87:161–73. Merighi S, Mirandola P, Varani K, et al. A glance at adenosine receptors: novel target for antitumor therapy. Pharmacol Ther 2003;100:31–48. Airas L, Hellman J, Salmi M, et al. CD73 is involved in lymphocyte binding to the endothelium: characterization of lymphocyte-vascular adhesion protein 2 identifies it as CD73. J Exp Med 1995;182:1603–8. Airas L, Jalkanen S. CD73 mediates adhesion of B cells to follicular dendritic cells. Blood 1996;88:1755–64. Spychala J, Kitajewski J. Wnt and β-catenin signaling target the expression of ecto-5′-nucleotidase and increase extracellular adenosine generation. Exp Cell Res 2004;296:99–108. Sambucetti LC, Fischer DD, Zabludoff S, et al. Histone deacetylase inhibition selectively alters the activity and expression of cell cycle proteins leading to specific chromatin acetylation and antiproliferative effects. J Biol Chem 1999;274:34940–7. Marks P, Rifkind RA, Richon VM, Breslow R, Miller T, Kelly WK. Histone deacetylases and cancer: causes and therapies. Nat Rev Cancer 2001;1:194–202. Fuino L, Bali P, Wittmann S, et al. Histone deacetylase inhibitor LAQ824 down-regulates Her-2 and sensitizes human breast cancer cells to trastuzumab, taxotere, gemcitabine and epothilone B. Mol Cancer Res 2003;2:971–84. Ailenberg M, Silverman M. Differential effects of trichostatin A on gelatinase A expression in 3T3 fibroblasts and HT-1080 fibrosarcoma cells: implications for use of TSA in cancer therapy. Biochem Biophys Res Commun 2003;302:181–5. Meehan WJ, Welch DR. Breast cancer metastasis suppressor 1: update. Clin Exp Metastasis 2003;20:45–50. Gagnon J, Shaker S, Primeau M, Hurtubise A, Momparler RL. Interaction of 5-aza-2′-deoxycytidine and depsipeptide on antineoplastic activity and activation of 14-3-3σ, E-cadherin and tissue inhibitor of metalloproteinase 3 expression in human breast carcinoma cells. Anticancer Drugs 2003;14:193–202. Yasui W, Oue N, Ono S, Mitani Y, Ito R, Nakayama H. Histone acetylation and gastrointestinal carcinogenesis. Ann N Y Acad Sci 2003;983:220–31. You are going to email the following Lipid rafts remodeling in estrogen receptor–negative breast cancer is reversed by histone deacetylase inhibitor Mol Cancer Ther February 1 2006 (5) (2) 238-245; DOI: 10.1158/1535-7163.MCT-05-0226
cc/2020-05/en_middle_0087.json.gz/line1337861
__label__wiki
0.964757
0.964757
New employee to work exclusively with Hispanic students Josh Anderson, News Reporter|February 27, 2018 Eva Martinez Powless and Oscar Silva pose in front of the Center for Intercultural Engagement. Photo by Olivia Qualls The Office of Intercultural Engagement recently hired a graduate assistant to work exclusively with Hispanic and undocumented students. The university is working toward becoming a Hispanic-Serving Institution, which means Hispanic students will make up 25 percent of the student population. To become an HSI, it is crucial to pay close attention to the needs of Marquette’s Hispanic students, Xavier Cole said in a press conference last semester. “In Student Affairs, we put out the challenge for all of our directors to think about how we serve these populations,” Cole said. “It’s first-generation students who need particular resources than more traditional students who have parents who went to college.” Oscar Silva has worked in the Center for Intercultural Engagement since January. The CIE is a hub for many minority students, especially Hispanic students, who make up the largest ethnic population on campus, Eva Martinez Powless, director of OIE, said. Because of this, there has been a high demand for academic support services for Hispanic students. Silva also works as a high school English teacher at Ronald Wilson Reagan High School in Milwaukee. He said he often works with undocumented students in his classes, which made him a good fit for the CIE. “A lot of the stuff I was doing there for high schoolers — getting them ready (for college) — we have a lot of undocumented students, but now this is a bigger scale,” he said. “Eva and I connected in a class, and she saw what I was doing, and she was like, ‘Let’s bring him over here.’” More Hispanic students have been coming through the doors of CIE now than ever before, Martinez Powless said. Many students are looking for mentorships, coaching and guidance in navigating the college process. She said she reached the point where she was unable to help every student single-handedly. “Considering that is the largest ethnic population on campus, I really felt the need to have somebody that could be the point person for that population,” Martinez Powless said. “I’ve been serving as the point person for this office for the last 11 years, but due to my role as the director of the office, I just can’t continue adding to my plate.” Silva works with students in one-on-one and group settings, but he said he also works with several Hispanic organizations such as Sigma Lambda Beta, Marquette’s Latino fraternity. “I’ve been talking with (Sigma Lambda Beta) about marketing,” Silva said. “(I’ve been helping) the other organizations around here that are Latino-based, helping them get the word out about who they are.” Marquette’s biggest problem for its Hispanic students is its lack of representation on campus, Silva said. He said that in four or five years, he would love to see Hispanic students become comfortable accessing every corner of the university. “It just takes one person to work out of the student government office,” he said. “It takes a student in the law school to say, ‘Come study over here!’ It takes a professor to say, ‘Come over here!’” Silva said he wants to help Hispanic students become more involved at Marquette while still remaining true to who they are. “I don’t want them to assimilate,” he said. “Assimilate would essentially mean become someone other (than themselves). I want to make sure that they are welcome and comfortable in the university.” Center for Intercultural Engagement eva martinez powless Hispanic Students Hispanic-Serving Institution Oscar Silva Ronald Wilson Reagan High School Xavier Cole University ahead of pace for enrollment goal for Class of 2024 Search committee for Communication dean ‘being formed’ Counseling Center offers short-term therapy, refers students elsewhere Joe Daniels named new College of Business Administration dean Office of Community Engagement combines with Office of Corporate Engagement and Partnerships President Trump’s job approval sees little change in latest Marquette Law School Poll Trump rally and counter protest held off campus Police Chief Hudson’s first year focus on cura personalis Local politician David King runs for Milwaukee Mayor University names Kimo Ah Yun permanent provost Alumnus Thomas Werner, family donates $5 million to first-generation scholarships David A. Straz Jr., Marquette alumnus and philanthropist, dies at 77 2020-2021 tuition increase announced A Smile, A Wave and a Friendly Campaign
cc/2020-05/en_middle_0087.json.gz/line1337869
__label__cc
0.656832
0.343168
IMAGinE awards Engaging Art Museum advisors Consultant Register Support agencies Touring nationally National Exhibition Register M&G NSW’s RAP Aboriginal Language Map Grants We Administer Other grants & opportunities The Land of Lewers Lewers Learning Centre Way out west and wondering where to take the kids on the weekend? Take them to the Land of Lewers! Poised practically on the edge of the Nepean River at Emu Plains, Penrith Regional Gallery was the home (yes, the actual home) of highly accomplished Modernist artists Margo and Gerald Lewers. So it’s both heritage house and garden packaged as an active and thriving regional gallery, with plenty to entertain the kids. The Land of Lewers is everything a modern gallery should be - fun, evocative, and a real entertainment option for children and adults alike The rambling cottage garden complete with outdoor sculptures and old-world water tank is both whimsical and elegant. Children enjoy exploring the garden, looking for lizards and playing hide-and-seek. All this—while we sit in the sun with our Ross Dobson inspired coffee and cake. The house itself is divided into two distinct parts; the old homestead facing the river is connected by a covered walkway to the modernist addition. It’s here where the Lewers extensive collection is hung and from time to time you’ll see works by the likes of Hinder, Haefliger, Flugelman, Cassab, Balson and more. The heritage house originally built in 1906, now dedicated to the Lewers Learning Centre, provides a range of contemporary art inspired activities for children which put their learning styles and interests first and foremost. The Land of Lewers is everything a modern gallery should be – fun, evocative, and a real entertainment option for children and adults alike. And just one of the many delights to be found way out west! Penrith Regional Gallery and The Lewers Bequest Aboriginal Cultural Centres Consultants Register Museums & Galleries of NSW helps small-medium museums, galleries and Aboriginal cultural centres create exciting experiences for visitors and, through this, thriving local NSW communities. We don’t run museums, galleries and cultural centres but we care about those who do. We develop their skills, connect them with others in the industry, provide funding, point visitors their way, and give them access to ground-breaking exhibitions. Museums & Galleries of NSW is supported by the NSW Government through Create NSW. Museums & Galleries of NSW acknowledges the Gadigal people of the Eora Nation and all the other Traditional Custodians of the lands on which we live and work. We pay respect to them as First Nations people with continuing connection to land, place, waters and community. Subscribe to our email newsletter to be alerted to new jobs, industry updates, funding and more.
cc/2020-05/en_middle_0087.json.gz/line1337873
__label__cc
0.675945
0.324055
Middlesex Connector A Monthly Crowd-sourced eNewsletter from the Office of the President On February 21, 2018 February 22, 2018 By Middlesex CC Updates from the President Smart Start for Success I have always found the start of the semester an exciting time. When I taught, I would get the jitters before every new class. I still thrive on the energy of the first few days when excitement, nervousness, and hope permeate the college. I recognize how much planning and hard work go into making the start of the semester a success – and for MCC, getting students on the path to success has been an ongoing endeavor. For the last three years the college has been working hard to provide a robust New Student Orientation (NSO) that engages students and gets them connected and on the path to success. Initial efforts on both campuses were focused around a dynamic half-day NSO on the Tuesday after the Labor Day weekend. While much thought, planning, and hard work went into making this a success, this model had inherent flaws that made it less successful than it could be. Last fall, as part of a more comprehensive Smart Start initiative, the college engaged faculty and staff in a more comprehensive two-day mandatory NSO. This, combined with On Time Enrollment, was designed to give students greater opportunities to connect with other students, interact with faculty, and receive more comprehensive advisement. The goal was to have students better prepared for the start of the semester and improve retention rates. While there is still much work to be done, the results from the first year of the Smart Start initiative are encouraging. The Fall to Spring retention rates was 16% higher (61% v. 77%) for the new students who attended orientation versus those that did not. The retention rate was 4% higher in 2017 than in 2016 (73% v. 77%). In 2017, 978 students attended NSO representing 55% of the 1,651 new students eligible. The goal in 2018 will be to increase the number of students who attend NSO and make the NSO even more engaging. To do this, we will need your support and ideas, so we can get every student on the path to success. A group of more than 12 staff members from across the institution have already begun meeting to plan this pivotal student event. Two equally important faculty- and staff-focused events are Fall Opening Forum and Professional Day. Fall Opening Forum will be an experiment this year. In order to allow everyone at the college to participate, I will prepare an opening video statement with the ability for asynchronous dialogue. This will enable those who are serving students to participate as their schedule allows, with an option to ask questions and view the ensuing dialogue. We will, of course, asses the effectiveness of this approach. Professional Day is another very important activity that succeeds because of the involvement of a wide range of faculty and professional staff. Because of scheduling issues, we will be doing Fall Professional Day on Tuesday, Oct. 23, this year. With your participation, I am confident this will be another great opportunity for reflection and professional development. – Jim Mabry February 27, 2018 — 20th Anniversary Celebration of MCC’s Online Education Program — 6 p.m., Lowell Campus March 1, 2018 —DHE Statewide Trustees Conference—11 a.m., Doubletree Hotel in Westborough. March 6, 2018 — Middlesex Community College Foundation Scholarship Awards, 3:30 p.m., Bedford Campus March 21, 2018 — MILES Opening Session — 2 p.m., Bedford Campus March 26, 2018 — Spring Mini-mester II Begins March 27, 2018 — Lowell Open House — 5:30 p.m., Lowell Campus Middlesex CC to Host Transition Program Info Session (Bedford Patch, 2/8/18) MCC Radiologic Tech Student Saves Infant’s Life with CPR Skills MCC plans FAFSA Day to help with financial aid http://www.lowellsun.com/news/ci_31642105/middlesex-community-college-plans-fafsa-day-help-financial (Lowell Sun, 2/4/18) Café features young faces and their passions http://www.eagletribune.com/news/merrimack_valley/cafe-features-young-faces-and-their-passions/article_89617809-fc96-5307-8e06-45489a5c0acd.html (Lawrence Eagle-Tribune, 2/2/18) From Botswana to Lowell: Civil Engineering Student Finds His Way Jeanne D’Arc Credit Union announces new Chairman of the Board https://www.cuinsight.com/press-release/jeanne-darc-credit-union-announces-new-chairman-board (CUInsight, 1/31/18) MCC Biotechnology Programs Receive Highest Industry Rating (Bedford Patch, 1/30/18) MLK Celebration http://www.lowellsun.com/lifestyles/ci_31627617/passing-ball-dr-king-slideshow (Lowell Sun, 1/29/18) Current Grant Initiatives AANAPISI Grant Update On February 1, the Program for Asian American Student Advancement (PAASA) hosted a screening of the film “First They Killed My Father.” The film is an adaptation of Cambodian author and human rights activist Loung Ung’s gripping memoir of surviving the deadly Khmer Rouge regime from 1975 to 1978. The story is told through her eyes as a child soldier when the Khmer Rouge came to power, and depicts the indomitable spirit and devotion of Loung and her family as they struggle to stay together during the Khmer Rouge years. Following the film, the audience had an opportunity to engage in a dialogue with a distinguished panel of community members about the film’s topic. The panel included Dr. George Chigas, Senior Lecturer in Cambodian Studies at the University of Massachusetts, Lowell; Tim Chan Thou, founder of Angkor Dance Troupe; Yary Livan, Adjunct Professor of Ceramics at Middlesex Community College; and Sovann Khon, Adjunct Professor of World Music at UMass Lowell. The event was organized in collaboration with the Office of Student Engagement, UMass Lowell Office of Multicultural Affairs, The Cambodian Mutual Assistance Association, and The Lowell Community Health Center. MCC 360 Update On January 2, MCC leaders convened for “The Future of Data at MCC: A Summit” to discuss the College’s current and future needs for information and analysis. The importance of data was underscored in MCC’s most recent strategic plan under the goal of Institutional Effectiveness and the College’s commitment to the objectives outlined in the Title III-supported MCC 360 project. The Summit was facilitated by Frank DeRose of DeRose Consulting Services and was organized to draw upon the collective experiences and expertise of those who use data to make decisions or who play major roles in the management of information. On January 10, the College had a day-long series of workshops related to the adoption of EAB Navigate. At this meeting, four build-teams were formed whose members included faculty, staff, and students from across the College. These teams were tasked with addressing four areas related to the college-wide adoption of EAB Navigate: Advising, Onboarding, Communications and Academic Planning. In addition, the EAB team meets virtually with the leadership of the build-teams and the technical team on a regular basis. After user training, full implementation of EAB Navigate is expected for the fall, depending on the internal team’s ability to meet expectations. On January 30, as part of our efforts toward obtaining a CRM to store and organize our institutional data, representatives from MCC met with administrators & IT staff at UML to discuss UML’s experience with Salesforce, a comprehensive CRM built to address multiple communication and case management needs, including recruitment, retention, workforce development, and financial aid. The Salesforce CRM also serves as a ‘solutions center’ for faculty, staff, and students who have any type of question. Staff in the Advising Center are currently assisting students with summer registration and developing their academic plans for fall registration, which opens March 26. We encourage all advisors at the college to connect with their assigned students to prompt early registration for both summer and fall terms. Every step we take to encourage early registration of returning students ensures they are prepared to be successful and in your class on the first day. State University / University of Massachusetts Transfer Fairs This week, we held our annual State Transfer Fair. Representatives from public institutions throughout the Commonwealth were on the Lowell campus February 21 and Bedford campus February 22. The fairs were a huge success, focusing on degree completion and utilizing MassTransfer Pathways and agreements to simplify the transfer admission process. Jane Fain, Coordinator of Transfer Affairs, and the advising staff worked diligently to pull off the event and encourage students to attend. A special thank-you to faculty and staff for prompting their students to attend and to thoroughly participate in the plan, incorporating transfer into their academic plan. Advising Summaries The Advising Center is incorporating an overview of theoretical approaches to advising in online resources and in virtual training sessions. Whether you prefer an intrusive/proactive approach, appreciative approach, or developmental approach to advising, reviewing the following resource can assist in developing an advising method that works for you and your students. You can find the following document on our Academic Advising Institute website. Advising Refresher Sessions This semester, all Advisor Refresher Workshops will be held virtually online! Faculty and Professional Staff will be able to log in from their desktop, laptop, or mobile device. Each session will run 60-75 minutes and participants will be able to interact via your microphone or the chat function. Simply sign up with Jessica Frost at frostJ@middlesex.mass.edu to ensure you receive the link via email. Our online sessions will be: February 28 @ 2 p.m. March 8 @2 p.m. March 8 @ 3:30 p.m. March 14 @ 3:30 p.m. EAB Navigate We encourage all advisors at the college to create an account with EAB. As a member institution, all of us are allowed to create an account to access more information on the EAB Navigate platform, and additionally Student Success research forums, articles and resources. To create an account, visit the following page, enter Bedford, Massachusetts, as your location, and select Middlesex Community College. EAB – Member Registration Website NACADA NACADA | The Global Community for Academic Advising, provides webinars on their YouTube page for free. Topics include Learning Outcomes for Academic Advising, Effective Academic Advising Strategies, The Role of Academic Advising in Student Persistence, and much more. We encourage all advisors to bookmark this page and review webinars to impact their practice of advising students. NACADA Executive Office – YouTube Page Commonwealth Commitment / MassTransfer Thank you for referring students to participate in the Commonwealth Commitment at Middlesex Community College. This past fall semester we awarded 27 Commonwealth Commitment rebates, providing these students with 10% savings off their fall overall cost. We are also proud to report that we have our first potential graduates of the program this spring and summer! This work would not be possible without your efforts in promoting the program and encouraging students to sign up. With changes to the program being considered for Fall 2018, we’re hopeful that more students can participate in the program. We will keep you updated! Classroom Visits Advisors at the college are available for classroom visits. Whether you want a staff member to provide an overview of academic maps, DegreeWorks, Career or Transfer Services, simply reach out to our department and we’ll work with you to have a visit take place. Simply email Bryan Wint at wintb@middlesex.mass.edu or Jessica Frost at frostj@middlesex.mass.edu for more information. First-Year Experience FYE/IDS Spring Semester Pilot – An exciting experience for our students! “IDS 101 Freshman Seminar,” “IDS 102 Service-Learning” and “IDS 103 Leadership” — What do these three one-credit courses have in common? They are all part of a pilot whereby students are enrolled in all 3 IDS courses for the spring semester, with each course lasting 5 weeks, meeting twice a week. In addition to the integration of the Freshman Seminar, Leadership and Service-Learning curriculum, students in this cohort are also reading Liz Murray’s “Breaking Night: A Memoir of Forgiveness, Survival, and My Journey from Homeless to Harvard,” the common book for all three courses. Guided reading, reflections, thought-provoking questions and discussions are all part of this three-IDS model. The first of the three courses is “IDS 101 Freshman Seminar,” in which students are also introduced to the area of service and prepared by getting to know Service-Learning folks and sites. This course started in January and will soon end. “IDS 103 Leadership” is the second course, in which the preparation and theme will continue. Then, “IDS 102 Service-Learning,” is the final course, ending in May. In the “IDS 102 Service-Learning” course, students will complete 22 hours of service. Among the service options is Mill City Grows and the Merrimack Valley Food Bank. The students will also be able to complete some of their 22 hours in the Bedford Campus Food Pantry (awareness, tabling events, etc.), and the Community Garden (primarily preparing the garden). FYE Faculty, Lorrie DiBona-Jones, Lauren Ellis and Pavithra Giridharan developed the curriculum and coordinated the activities, events and the Service-Learning component in the three courses, which included the Common Book. The story of Liz Murray, who went from homeless to Harvard, has been integrated throughout the three courses, culminating with the 22 hours of service. This new IDS model is an exciting experience for both faculty and the cohort of students who have been attending class on the Bedford campus. During the fall semester 2018, there will also be a section of this new model on the Lowell campus. The coordination and collaboration of any new pilot and college initiative takes an entire community who believe that our students should have positive and lasting experiences. Therefore, our thanks go out to the many areas of the college that have been supportive in our efforts. Scholarship of Teaching and Learning (SoTL) The MCC Scholarship of Teaching and Learning (SoTL) Community has launched an initiative to create a culture of persistence and student success at the College. Over the past six months, we have presented the concept to senior administration and faculty, formed a launch group composed of eight faculty members and the dean of institutional planning, and hosted a retreat to attract faculty to take on our mission. At a retreat in January, 22 faculty committed to participating in the 100% Course Completion Initiative, a project in which full- and part-time faculty will document explicit efforts to retain 100% of the students in one course without sacrificing academic standards. Business, Education & Public Service MCC Sweeps the DECA Regionals! The Business and Economics Club, representing the DECA chapter of MCC, participated in the Annual Regional DECA competition at Johnson and Wales University, Providence R.I., on February 2, 2018. A team of two students led by Accounting Professor Vikram Sharma participated in Accounting and Marketing competitions. Daniel Iknanian (Accounting) and Stephen Collins (Marketing) won two Gold Medals each, for a total of four Gold Medals. Daniel also won the Rhode Island Accounting Scholarship. He secured the highest score of all tests in all categories! It is important to note that our students were competing against students from four-year institutions. The DECA chapter of MCC was started in 2013 under the leadership of Dean Judy Hogan. The present DECA advisors are Professor Rob Kaulfuss (Economics), Professor Stacie Hargis (Entrepreneurship) and Professor Vikram Sharma (Accounting). The club would like to thank Dean Judy Hogan, Kirsten Morrow, and Steve Rossi (Office of Student Engagement) for their continued support in all our endeavors. Ashli Ree and a group of students attended MAGIC in Las Vegas, which is the largest apparel and accessories trade show in the United States. They also visited Zappos headquarters to learn about company culture. In addition, students spent a day at the Grand Canyon National Park. Students in the online fashion course had lunch together to meet the instructor and other students. They shared course/transfer information, employment opportunities, and more. MCC faculty member and flutist Orlando Cela recently released a CD on the Ravello label, titled “Shadow Etchings: New Music for Flute.” The recording features works by contemporary composers Jean-Patrick Besingrand, Lou Bunk, Robert Gross, Dana Kaufman, Stratis Minakakis, Maxwell Dulaney (former MCC faculty member), and Ziteng Ye, written utilizing extended techniques for the flute, for the purposes of helping promote these great works and to encourage daring new works for the flute in general. The CD review by Naxos states ” ‘SHADOW ETCHINGS’ demonstrates Orlando Cela’s ingenious ability to navigate complexities of postmodernism in chamber music and the avant garde with this rich recording of flute and piccolo treasures for the curious ear… Cela’s flawless delivery leads the way. ‘Shadow Etchings’ is unapologetically unconventional yet simultaneously accessible to even the untrained ear. If you are looking to expand your horizons, this is the place to start.” A World of Music Concerts Sunday, March 4 at 3 p.m. MCC faculty member Raley Beggs, guitar, will be joined by Celia Zhang, violin, for a vibrant program of works by Nicolo Paganini, Johann Sebastian Bach, Astor Piazzolla , Domenico Scarlatti and Luigi Legnani. Friday, March 16 at p.m. This concert will feature seven new works for saxophones, each written to pair with a piece of artwork by MCC faculty member Jan Arabas. The composers include MCC faculty member David Janssen and Anne Guzzo, Forrest Pierce, Timothy Miller, Jack Wilds, Shawna Wolf and Allison McIntosh. The saxophonists are Sean Mix, Bennett Parsons, Morgan Smallwood and Andy Wilds. Most of the art featured is inspired by the natural beauty of Grand Teton National Park, creating an exciting fusion of art, music, and nature. 13th Annual Women in STEM Luncheon The annual Women in STEM Luncheon will be held on Wednesday February 28th from 1 to 3 p.m. in the college’s Campus Center, Café East. The Women in STEM Luncheon will feature a panel of women who contribute to the fields and advancement of STEM (science, technology, engineering and mathematics). Michele Stein has organized this year’s event which allows students to learn about their exemplary careers and current research projects, and network with these extraordinary women over lunch as they launch their own STEM careers. Sally Quast and Iveta Dinbergs will represent Middlesex at the statewide MassTransfer Pathways convening sponsored by the DHE at Fitchburg State University on Feb. 23. The focus of the conference is to align the Chemistry and Biology majors throughout the Mass Higher Ed for easy transfer and efficient scheduling to help achieve graduation. Both Jane Fain from advising and Kate Sweeney will attend the convening as well. Dora Ottariano, Aisha Arroyo, Tonka Zelenkova and Mike Williamson held practice sessions for students to prepare for the Student Math League competition. On Feb. 20th 35 students took the exam and will compete for the highest score among other community college students here in the Northeast and across the country. Aisha Arroyo, Robyn McDonough and Linda Dart-Kathios continue to work with the Department of Higher Education on Math Pathways and co-requisite models for math. Banner 9 Going Live in May Are You Ready? Banner 9 will be going live in early May. Banner users can log in to the Banner 9 test system at any time to begin testing your processes and becoming comfortable with the new interface and navigation. Look for the “Banner 9 Test: BANLT” link on the MyMCC portal links list to log in. Banner 9 Drop-In Lab Times It can be difficult to find time to test Banner 9. Computer Labs in Bedford and Lowell have been reserved so you and your colleagues can have a quiet space and uninterrupted time to practice using Banner 9. Drop in when you can: Lowell – LC 213A 9 a.m. to 5 p.m. each Friday, now through April 27, 2018 Bedford – AR LIB3 9 a.m. to 5 p.m. each Thursday, now through April 26, 2018 Report any issues or problems you discover during your Banner 9 testing to servicedesk@middlesex.mass.edu. Classroom Emergency App for Technology Now Available MCC is pleased to offer a Classroom Emergency App for faculty to report technology related classroom issues. The app allows faculty to quickly send an alert to all on-site/on-call technicians that technical help is needed in the classroom. A classroom emergency is defined as a technology problem in the classroom experienced by a faculty member on campus at the start of or during class time which prevents the faculty member from continuing with their class. Some examples might be: Classroom projector is not working Classroom computer\monitor is not working Cables are missing Classroom network Issue The Classroom Emergency App should ONLY be used for technology issues in an MCC classroom, not for any other kind of emergency. The Classroom Emergency App is free and available from the Google Play store and the Apple App store. Additional information including how to use the app is available on our MCC Technology Center website. The Office of Admissions and Student Recruitment is gearing up for a busy spring recruiting season. In addition to our regular visits and college fairs, many of our counselors have taken the initiative to book ‘On-the-Spot-Admissions’ days at some of our local high schools. These days give seniors early access to pre-admission advising for the fall 2018 semester. On-the-Spot-Days were held at the following high schools: Greater Lawrence Technical High School, Assistant Director Camille Brown North Reading and Wilmington high schools, Assistant Director Jennifer Migliozzi Nashoba Valley Regional High School, Assistant Director Jason Reynolds and Director Jeffrey Tejada In addition to our high school population, we are also focused on expanding access to our community partners. Assistant Director Alison Handy held information sessions at the Woburn YMCA, and together with our partners in the LINKS Program she will be bringing members of the Methuen YMCA to the Lowell campus next week. Assistant Director Jason Reynolds visited the Instrumentation Laboratory Company in Bedford, to speak to staff about educational opportunities. This was in collaboration with MCC Workforce Development, an area with which we often partner. We are always looking to grow our list of community partners and company contacts and welcome insight from the College community. Lastly, we have just passed the deadline (February 1) for our selective health program applications for the Dental Hygiene, Radiologic Technology, and Diagnostic Medical Sonography programs. Qualified applicants work very hard to put together competitive applications for a limited number of seats. If you encounter any students with questions about this process during your advising sessions or in the classroom, please feel free to refer them directly to the Admissions office or email us at admissions@middlesex.mass.edu. Spring 2018 Semester Key Dates Summer 2018 Registration opened on February 15, 2018. Go to https://www.middlesex.mass.edu/summer/ for information on MCC’s Summer Sessions. Fall 2018 Registration will begin on March 26, 2018. Students should be receiving letters on Fall registration beginning the week of March 19. Drop for Nonattendance Grades Due • Minimester II April 5 Last Day for students to Withdraw • Mini-mester I March 2 • Full-Term April 18 • Mini-mester II May 4 Final Grades Due • Mini-mester I March 21 at 10 a.m. • Full-Term and Mini-mester II May 23 at 10 a.m. The Spring 2018 Final Exam Schedule with exam dates and times for Day, Evening and Online classes can be found at https://www.middlesex.mass.edu/finalexams/. Detailed room locations will be posted in April 2018. International & Multicultural Affairs The Office of International & Multicultural Affairs has developed a new series of dialogues to address current events. Intercultural Dialogues is a series of discussions regarding critical matters that affect members of the campus community. The first Session was held Tuesday, Feb 13, titled “I Am Not Black, You Are Not White.” The students present engaged in a lively discussion on race and what it means to them personally. Our next session is “Focus on Wealth Inequality in America.” Every other Thursday, we will facilitate current topics related to diversity and inclusion. All are welcome to come and participate. Program for Asian American Student Advancement (PAASA) On January 19, the Program for Asian American Student Advancement took 17 students on a field trip to New York City. The purpose of the trip was to continue to build upon the strong relationships and connections with new and current students during spring orientation. A highlight of the trip was an opportunity to visit New York University (NYU) and explore their transfer options. NYU’s Center for Multicultural Education and Programs presented a panel of students who shared their experiences and the benefits of being engaged students. Students were also able to tour a residence hall in Union Square, where they learned just how small New York City apartments can be! We closed the day by exploring the Rubin Museum of Art, where students explored Himalayan Asia through art. Exhibits on display included a Tibetan Buddhist Shrine Room, where students could experience firsthand a traditional household shrine. After a long day, we caught a quick glimpse of the robust diversity and vast career options that a place like New York City can offer. Dawn Gross, Coordinator of MCC’s ICE Program, hosted the annual mid-year MAICEI Coordinators Meeting for the Massachusetts’s Inclusive Concurrent Enrollment Initiative on January 11. Program Coordinators from UMass Boston, UMass Amherst, Salem, and Framingham, Westfield and Bridgewater state universities, as well as Mass Bay, Massasoit, Northern Essex, Holyoke, Cape Cod and Bunker Hill community colleges met to discuss statewide updates and look at best practices with Glenn Gabbard, MAICEI Coordinator, Department of Higher Education. The agenda also included an engaging conversation with Thomas Heir, Silvana and Christopher Pascucci Professor of Practice in Learning Differences, Harvard University Graduate School of Education. Tom served as director of the U.S. Department of Education’s Office of Special Education Programs from 1993 to 1999. As director, he was responsible for federal leadership in implementing the Individuals with Disabilities Education Act (IDEA). MCC continues to be a model for best practices in this movement for inclusive practices to support diverse learners on public higher education campuses. For more information about MAICEI and MCC’s ICE Program, please visit: http://www.mass.edu/strategic/read_maicei.asp and https://www.middlesex.mass.edu/disabilitysupport/iceprogram/default.aspx The Veterans Resource Center sponsored a visit from the Commonwealth of Massachusetts Office of the Treasurer, Veterans’ Bonus Division, on the Bedford and Lowell campuses February 15. The Welcome Home Bonus provides bonus payments to family members of deceased eligible veterans and service members who have served in the United States Armed Forces. Many MCC student veterans took advantage of the campus visit and discovered they were eligible to receive a one-time bonus of up to $1,500. The Veteran Resource Center is eager to sponsor this event each semester. Showcasing Student Stories Rad Tech Student Saves Baby with (Required) CPR Skills Before student Ebonie Seriam could be accepted into the Radiologic Technology Program, she had to complete one more class: A four-hour course in CPR. It never occurred to her that one nagging requirement would help her save the life of a baby. Here’s the full story: http://bit.ly/2ELXqYE Kathy Gehly, Dean of Allied Health, and Bill Darmody, Rad Tech Department Chairman, tipped us off to this AMAZING story and it attracted lots of interest via our social media channels. If you have an interesting story about students, faculty or staff in your area, please let Marketing Communications know. We love to share good news about MCC! (Email story ideas to: marketing@middlesex.mass.edu) MCC Lapel Pins New to the college? You may have noticed colleagues around the college wearing an MCC pin. You can request a MCC lapel pin from Marketing Communications. (And we now have extra lapel-pin replacement backs, in case you’ve lost yours.) To request pins or replacement backs, please use this form. MCC Foundation Scholarship Awards Ceremony The MCC Foundation Scholarship Awards Ceremony will be held Tuesday, March 6, at 3:30 pm in the Bedford Campus Center. The entire college community is welcome to the event that honors our student recipients and acknowledges the MCC Foundation scholarship donors. This year, 49 scholarships will be presented to 41 students totaling more than $48,000 in award funds. View the list of the 2018 Scholarship Awardees. If you would like to attend the event to congratulate the students, please email Amy Lee at leea@middlesex.mass.edu. Looking for MCC Employee Alumni The Alumni Office is looking for MCC employees who are also MCC grads. If you are an employee and an alum, please email Amy Lee, leea@middlesex.mass.edu in the Alumni Office. 2018 Middlesex Fund The MCC Foundation Middlesex Fund provides funding for student scholarships, academic enrichment, and faculty initiatives. By supporting the Middlesex Fund, you are helping our students achieve their goals and dreams. Your gift can: Empower a young student who struggles to finance his/her college education Support an adult who needs new skills and education to begin a new career path Provide funding for innovative, sustainable academic enrichment and campus projects Address areas of greatest need for the college You may choose to direct your donation to a particular area or existing fund, such as a named scholarship for faculty grants. Give online today. Full-time employees may give via payroll direct deposit. The payroll form can be found at this link: https://www.middlesex.mass.edu/foundation/downloads/payroll18.pdf For any questions regarding the Middlesex Fund, please Amy Lee at leea@middlesex.mass.edu or 978-656-3028. Remember the MCC Foundation while shopping online. If you choose the MCC Foundation for your charity on Amazon Smile, Amazon will donate 0.5% of the price of the purchase to the MCC Foundation. Thank you for your generosity and support! Corporate Education and Training Corporate Education and Training delivered or will be delivering: Customized training for English Speakers of Other Languages (ESOL) at Center for Manufacturing Technology in Woburn. Emotional Intelligence training at E Ink in Billerica. Instructor Training Session for the Massachusetts Association of Accessing Officers (MAAO) at the East Café in Bedford. First Aid/CPR and Medication Administration trainings for LifeLinks. The courses are conducted at MCC in order to provide employees exposure to taking classes in a college setting. Collaborated with the Early Childhood Department to offer “English Composition I” at the Lowell campus through the Region 3 Professional Partnership Grant. Applying Basic Leadership Skills training at Pace Industries in Billerica. Accuplacer testing sessions at Raytheon in Andover. Collaborated with Resource Development to complete and submit a Workforce Training Fund Small Business Direct Access Program Grant that will be focused in training for Non-Technical Professional Skills and Management/Supervisory/ Leadership Skills. The training topics will consist of Effective Business Writing, Workplace Team Building, Time Management, Management and Supervisory Skills, Dealing with Difficult Customers, and Change Management. Community Education and Training Summer is here! College for Kids summer 2018 enrollment began February 20. Check out our multiple offerings on both the Bedford and Lowell campuses. This year, we are welcoming a new programs: “Medical Laboratory Science” with Program Coordinator, Suzanne McHale; “Golf 101,” “Exploring Mono-types and Collages,” “Artwork in the Making,” and “Zip and Zap: Principles of Electricity.” Don’t forget about our ever-popular programs, exploring topics such as veterinary science, aviation, and Legos, and our popular Children’s Theater program, led by Performing Arts Chair Karen Oster. The performance this summer is “Peter Pan Jr.” A special thank you to Lura Smith and the Lura Smith Foundation, for opening doors for Lowell youth to experience College for Kids. The foundation will provide 6 scholarships this summer for children connected to Girls Inc. of Greater Lowell, the Cambodian Mutual Assistance Association, and the Greater Lowell Boys and Girls Club. We were excited to offer our first babysitter-training class, in partnership with the American Red Cross, during February school vacation week. This babysitter training is a new endeavor supporting the expansion of youth programs. Led by R.N. instructor Kathy Regan, 10 children, ages 11-15, learned the skills necessary to safely provide care for children and infants. Community Education is supporting Massachusetts K-12 educators in a variety of areas now that Middlesex is registered with DESE as a Professional Development Provider. In addition to our online MTEL exam prep classes, a new class on Feb. 21 provided resources on how to navigate the MA teacher state licensure process, titled “SOS – Teacher Licensing in the State of Massachusetts.” Do you know a Massachusetts K-12 educator who needs to earn PDP’s to keep their license current? CET’s course with Susan Woods, titled “Effective Strategies and Instruction for Students with Disabilities,” began Feb. 5. By completing this course, licensed K-12 educators will earn 15 PDPs towards recertification. More classes will be offered fall 2018 for K-12 educators. Workforce training programs that began this month include Pharmacy Technician with CVS Pharmacy, MS Excel, CE class for dental hygienists: Safe and Effective Local Anesthesia, SHRM HR Certification Exam Prep, Digital Media Marketing, Business of Photography, and Energy Auditing. Government & Community Relations Director of Compliance Alisa Chapman and Rebecca Newell attended a joint meeting of Title IX Coordinator and Student Conduct officers at MBCC. This meeting was to have the groups converse and understand the role all areas play in the investigation of Title IX cases. Alisa Chapman also assisted colleagues at Mass Bay CC with Sexual Harassment & Sexual Violence training and Quinsigamond CC with Bystander Intervention training over the past month. On Friday, February 9th Alisa Chapman conducted training on “Working with Pregnant and Parenting Students in the Classroom.” Alisa has also conducted Bedford and Lowell sessions of “Title IX: Understanding the College’s Policy Against Sexual Harassment & Sexual Violence.” If deans, department chairs or supervisors would like these trainings to be held during a staff meeting time, please contact Alisa Chapman at chapmana@middlesex.mass.edu Director of Public Safety Daniel Martin and Bedford Campus Resource Officer Craig Naylor conducted Active Shooter Training that was open to all faculty and staff. This training provided a general presentation of what to do in an active shooter event. As part of the College’s mission to ensure best practices in public safety, these trainings will be held on a monthly basis on alternating campuses, with the next scheduled training to take place in Lowell on Monday, February 26th. These trainings can also be conducted for individual departments/geographical areas by contacting Dan Martin at martind@middlesex.mass.edu Dan Martin continued to update shuttle transportation services for the College community, making adjustments to shuttle schedules as needed to best serve our students. Dan is working to ensure that all shuttle drivers are properly trained and maintain a high level of customer service. Lowell Campus Resource Officer Tom Hickey assisted Lowell Police detectives with a possible B&E in the building to the rear of the Blue Taleh restaurant at the end of January. Officer Hickey worked with library staff to identify an individual who was using library computers to access inappropriate material. Officer Hickey checked the individual with the LPD and determined that the individual had a record with the LPD. Officer Hickey issued no-trespass orders for these instances. Bedford Campus Resource Officer Craig Naylor conducted investigations on campus dealing with child neglect and shoplifting from the campus cafeteria. Officer Naylor also attended police training/baton certification. Alisa Chapman, Dan Martin, Abby Vergados and Officer Naylor attended the #MeToo – Survivors’ Stories panel discussion held on the Bedford Campus. This event allowed attendees to hear a first-person account from a survivor of sexual violence.
cc/2020-05/en_middle_0087.json.gz/line1337875
__label__cc
0.673646
0.326354
Ovulation signs Ovulation kits Tests & Calculators Fertility Calculator Conception Calculator How Many Weeks Pregnant Are You Gender Predictor Test Baby Height Predictor Blood Type Calculator Thyroid and menstrual cycle Dr Anique Ali February 19, 2019 menstrual cycle No Comments The thyroid gland is a butterfly-shaped gland present in the neck. It produces two hormones T3 (triiodothyronine) and T4 (thyroxine). The thyroid gland is a very important gland with wide-ranging effects on the body. Its major function is in increasing the metabolic rate of the body. The secretions of the thyroid gland are controlled by the secretions of the hypothalamus and pituitary glands (the hypothalamic-pituitary axis). Abnormalities in the secretions of the thyroid gland: There can be two abnormalities in the secretions of the thyroid gland one can face. Either the thyroid gland is producing too little secretions (termed as hypothyroidism) or the thyroid gland is producing too much secretion (termed as hyperthyroidism). Both these conditions have adverse effects on the body and the menstrual cycle. Thyroid gland and the menstrual cycle A normal functioning thyroid gland is vital for a normal menstrual cycle. Both abnormal conditions of the thyroid gland, hypothyroidism, and hyperthyroidism, can affect the menstrual cycle and make it abnormal. Effects of hypothyroidism on the menstrual cycle: As already mentioned, hypothyroidism is the condition in which the thyroid gland is producing insufficient secretions. It may occur due to iodine deficiency, at a late stage in the inflammation of the thyroid gland or after the thyroid gland is surgically removed (eg. in case of a tumor in the thyroid gland). Hypothyroidism may affect the menstrual cycle in a variety of ways. Its effects range from heavy frequent menstrual bleeding to even absent menstrual bleeding. 1. Early menstruation: Hypothyroidism may cause early menstruation. The average age of puberty is 12 years. Reaching puberty before 10 years of age is called precocious puberty. Hypothyroidism is a cause of precocious puberty i.e periods at an earlier age than normal. 2. Heavy menstrual bleeding: Hypothyroidism is a cause of heavy menstrual bleeding (menorrhagia). Heavy menstrual bleeding is defined by the ‘American College of Gynecologist’s and Obstetricians’ as Bleeding that lasts more than seven days Bleeding that soaks through one or more tampons or pads every hour for several hours in a row Needing to wear more than one pad at a time to control menstrual flow Needing to change pads or tampons during the night Menstrual flow with blood clots that are as big as a quarter or larger. So if you consult your doctor with these symptoms, he will get your thyroid levels done as hypothyroidism is a cause of heavy menstrual bleeding. 3. More frequent menstrual periods: Hypothyroidism may cause periods to become more frequent. This condition is known as polymenorrhea. For example, you may find that your period comes every 21 days, for example, instead of the average 28-day cycle. 4. Absent or infrequent menstruation: Hypothyroidism may also cause a missed period and or it may lead to infrequent and irregular periods. You may also bleed very lightly and for fewer days than normal. This is called oligomenorrhea. This is also seen in some cases of hyperthyroidism. Effects of hyperthyroidism on the menstrual cycle: Hyperthyroidism is a condition in which thyroid gland is producing too many secretions. You may experience symptoms like heat intolerance, tremors in hand and a fast heartbeat (tachycardia). This condition may occur due to an autonomously secreting nodule in the gland or a functioning benign tumor. It also occurs in the early stages in the inflammation of the thyroid gland. It may have the following effects on the menstrual cycle. 1. Delayed menstrual periods: Like hypothyroidism may lead to precocious puberty, hyperthyroidism may cause delayed puberty. Puberty is called delayed if a girl does not start her menstrual periods by 15 years of age. 2. Lighter menstrual periods: Hyperthyroidism may cause bleeding in the menstrual cycle to be lighter than usual. For example, if she normally uses 2 pads per day, she will have to use just one pad per day. 3. Shorter periods: Hyperthyroidism may cause the duration of the bleeding days to be shorter. For example, say a woman the bleeding phase of a woman lasted for 6 days normally (the duration of these days is different for different women). Hypothyroidism may reduce this duration from 6 days to 3 days. 4. Infrequent/ missed menstrual periods: Hypothyroidism may cause missed periods. The periods may not occur regularly. They start to occur sporadically. Their duration keeps varying. Like one period is of 40 days, the next can be of 60 days etc. This is called oligomenorrhea. This can be caused by both hypothyroidism and hyperthyroidism. 5. Absent menstrual periods: Hyperthyroidism may cause the complete absence of the menstrual periods. The woman will stop bleeding altogether. This is called amenorrhea. Effects of thyroid disease on fertility: Thyroid disease may reduce fertility. This effect can be attributed to two causes 1. Anovulation: Anovulation means the failure to release an egg. If you are not releasing an egg, you can not become pregnant. 2. Short luteal phase: The luteal phase is the time period between the ovulation (release of the egg) and when the bleeding starts. You need a luteal phase of around 14 days, this allows a fertilized egg enough time to successfully implant and develop. If your luteal phase is too short, a fertilized egg may end up being expelled during your menstrual period, making it unable to implant in the uterus even if it gets fertilized. So if you are having any abnormality in your normal menstrual period, see your doctor. You might be facing a thyroid issue. Ten Teachers Gynaecology 20th edition. Davidson’s principles and practice of medicine (22nd edition) https://www.ijrcog.org/index.php/ijrcog/article/viewFile/3718/2946 https://www.healthcentral.com/article/how-your-thyroid-affects-your-menstrual-period https://www.verywellhealth.com/menstrual-problems-and-thyroid-disease-3231765 Implantation Bleeding or Period – How to Recognize It How to Delay Your Menstrual Cycle The Effects of L-Arginine on Your Menstrual Cycle Dr Anique Ali Ali Anique holds an MBBS degree from the Nishtar Medical University and currently works as a doctor at Nishtar Hospital, the biggest hospital of south Punjab province in Pakistan. What’s the Chance of Getting Pregnant If You Had Unprotected … Menstrual Cycle After Abortion Can you Get Pregnant Just After Your Period Ends When Should You Take a Home Pregnancy Test Best Formula for Constipated Baby Menstrual Cycle After Tubal Ligation Can You Get Pregnant in a Pool? Can You Get Pregnant With a Condom? Menstrual-cycle-calculator.com website helps women to calculate their period and understand how their menstrual cycle works. Please refer to our About, Medical Disclaimer & Privacy Policy pages for additional info. Calculate How Many Weeks Pregnant Are You Calculate When You Conceived Calculate Days of Implantation Try our Online Pregnancy Quiz Affiliate Disclosure & Disclaimer Menstrual-Cycle-Calculator.com Copyright © 2020.
cc/2020-05/en_middle_0087.json.gz/line1337881
__label__wiki
0.703742
0.703742
Military Aviation History Military Aviation Chronicles RCAF & RAF-Americans Vietnam Conflict Handley Page Halifax Gulf Wars Editor Bio Bomber Command Museum of Canada Halifax Aircraft Network Halifax 57 Rescue (Canada) Military Aviation Chronicles’ Partners About Military Aviation Chronicles Airplane Hunters HomeIDFAn IDF legacy of mercy from the ground up An IDF legacy of mercy from the ground up Photo: IDF.com / IDF Spokesman. IAF Unit 669 during a training exercise. November 2012 | Israel. The month of November 2012 was a busy time in Israel. Southern skies periodically contained the streaks of incoming rockets from Gaza. Within days the Israel Air Force (זרוע האוויר והחלל) or “IAF” commenced targeted strikes (Operation Pillar of Defense) as part of an effort to reduce the manufacture and stockpiles of the missiles. Tons of aid went to the Gaza border, and a number of Gazans came to Israel for medical treatment. Elsewhere, exchanges of fire were taking place along the Syrian border. Furthermore, thousands of reservists were returning to active service. Amidst all of the foregoing, the “Austere Challenge 12” joint U.S. Military-Israel Defense Forces or “IDF” (“Zahal” צה”ל) exercise was underway. Ecclesiastes 3:8 states that there is “a time of war, and a time of peace.” The introduction to Collins/Jane’s Warships of World War II mentions a Latin phrase that complements this biblical advice. A rough translation follows: “In times of peace, prepare for war.” With an emphasis on life, the IDF Medical Corps’ motto supplements the previous statements. The axiom is, “He who saves one soul, it is as if he saves a whole world.” Heeding the spirit and wisdom of such maxims, IDF Medical Corps soldiers and civilians went about their never-ending tasks at the medical support base during the author’s visit. Addressing a group inside a meeting room, the base commander stressed that, “No job here is unimportant.” The “sgan aluf” (equivalent to the rank of lieutenant colonel) or “sa’al” (סא”ל) obviously knew that behind any successful operation one will usually find those who serve in unglamorous support roles. One example is in the book titled The War in the Air: The Royal Air Force in World War II. This volume contains a photo of two men in fatigues straining to free a Supermarine Spitfire from its muddy entrapment. The accompanying caption reads as follows: “They also served who only stood and pushed . . . .” Comparably, all around the IDF installation one could see Sar-El volunteers, under the supervision of Logistics Corps conscripts, eagerly contributing without expectation of any remuneration or reimbursement. Their motivation was simple: The IAF and other units within the IDF continually need medical supplies. During a routine visit to the facility, the Logistics Corps “rav seren” (equivalent to the rank of major) or “rasan” (רס”ן) in command of the conscripts made a noteworthy remark. He stated that the “IDF has been at war since the nation’s founding in 1948, and the IDF gradually learned the best ways to aid the injured.” Over time two lessons became apparent: Aerial access to the injured and quick evacuation to medical facilities save lives. The maturing of what eventually became known as CASEVAC (casualty evacuation) and MEDEVAC (medical evacuation) only came after bloody experience and technological improvement. The fact is that during the 1940s and 1950s the flying machines were inadequate. During World War II ill-equipped Americans drafted even the fixed-wing Piper L-4 for limited MEDEVAC and CASEVAC. However, the primitive Sikorsky R-4 Hoverfly helicopter, and Bell H-13 (Bell 47) during the Korean Conflict, demonstrated a realistic and beneficial potential for medical airlift. Photo: Eric Van Gilder – http://vg-photo.com. A former IAF Douglas Dakota / C-47. In the late 1940s and 1950s, young and financially strapped Israel also found that rotary-winged assets were invaluable and slowly obtained aircraft. These acquisitions included the Bell 47, Sikorsky S-55 (H-19) and S-58 (H-34). Fixed-winged Douglas Dakotas / C-47 Skytrains handled evacuations over longer distances. However, these types were still lacking. In terms of providing an impetus for quick improvement, the year 1973 and the Yom Kippur War proved to be pivotal. As if on cue, the sounds of a Yanshuf’s (Sikorsky UH-60) engine and rotor blades brought to the author’s mind an engrossing Israeli film titled Kippur. This purportedly factually based story is about an ad-hoc IDF search and rescue team utilizing a Bell UH-1 (or Augusta-Bell 205) during the 1973 Yom Kippur War. In some scenes viewers also see a Sikorsky CH-53 “Yas’ur” (Sea Stallion) joining the effort. During the actual fighting, teams completed over 5,000 extractions, and the rasan emphasized through his talk that the “IDF developed many emergency treatments for airlifting wounded.” Thus, like their “Dustoff” counterparts in Vietnam during the 1960s and early 1970s, the Israeli military learned to expeditiously airlift patients using helicopters. Not unexpectedly, the success of the airborne search and rescue teams demonstrated to the IAF the need for and value of organized and dedicated CASEVAC and MEDEVAC units. In April 1974, the first, known as “Airborne Rescue and Evacuation Unit 669” of the IAF’s Special Air Forces Command, came into existence. The men and women of Unit 669 established a fine legacy. In addition to military sorties, Unit 669 also rescues civilians who have become lost or injured in remote or areas possessing limited access. Photo: Nehemia Gershuni (www.NGPhoto.biz). All rights reserved. Unit 669 and CH-53 during exhibition. Medical personnel naturally try to prepare for any and all contingencies. To this day, the extraction members, including physicians, nurses, and paramedics, undergo extensive paramedic training. Additionally, the IDF reports that each year IAF medics participate in a three-work course involving classroom study, and they complete a drill that simulates an evacuation of casualties aboard a Karnaf (Lockheed C-130 Hercules). IDF Medical teams deploy via aircraft near and far. One depiction of an actual operation that included medical support is the 2004 film Operation Thunderbolt. This motion picture realistically recreates the 1976 Entebbe rescue. More commonly these days, long-range efforts take place in the aftermath of natural disasters around the world. To punctuate this point, the rasan noted several recent high-profile medical outreach missions. He explained, “One was to Haiti after the 2010 earthquake, another to Japan in the aftermath of the 2011 tsunami and a third to Turkey after an earthquake earlier this year.” Photo: Author’s collection. An IDF ambulance in late 2002. All service members connected in any way to the medical arts and sciences remain busy with their ongoing work. One thing is a certainty. The Medical Corps and IAF will continue to go about their efforts to maintain readiness and proficiency. The author (John T. Stemple) sincerely thanks the Israel Defense Forces and IDF Spokesman in general, and Sar-El in particular, for their cooperation and assistance during the preparation of this article. He also thanks Eric Van Gilder and Nehemia Gershuni for permitting the author to use their excellent photos. Sources & Suggested Readings *Scripture quotation is from the Jewish Family Bible London Edition 1881 (as revised by Michael Friedlander, Principal, Jews’ College, London). Beautiful reprints of this classic English / Hebrew publication are available from Sinai Publishing in Tel Aviv, Israel. Fire exchanges on Syrian border; IDF jeep damaged Operation Pillar of Defense: Summary of Events http://www.idfblog.com/2012/11/22/operation-pillar-of-defense-summary-of-events/ http://en.wikipedia.org/wiki/Operation_Pillar_of_Defense Israel Air Force http://www.iaf.org.il/4929-en/IAF.aspx Israel Defense Forces http://www.idf.il/ IDF Medical Corps http://dover.idf.il/IDF/English/units/branches/medical/Medical_Corps/default.htm Kerem Shalom and Erez crossings open for humanitarian aid to Gaza http://www.mfa.gov.il/MFA/HumanitarianAid/Palestinians/Kerem_Shalom_Erez_crossings_humanitarian_aid_Gaza_18-Nov-2012.htm Bernard Ireland, Collins/Jane’s Warships of World War II (The Jane’s Gem Series), HarperCollins Publishers, Glasgow, 1996, p. 21. Gavin Lyall, ed., The War in the Air: The Royal Air Force in World War II. New York: Ballantine Books, 1968. Kippur, a Michel Propper & Amos Gitai film, Kino Video, 2000. Operation Thunderbolt, a Menahem Golan film, Golan Globus Production, MP Productions, 2004. http://en.wikipedia.org/wiki/Unit_669 http://www.shadowspear.com/israel-special-operations/1034-unit-669.html http://www.iaf.org.il/2570-30205-en/IAF.aspx http://www.idfblog.com/?attachment_id=10185 IAF paramedics train to provide medical care in mid-air www.idf.il/1283-16749-EN/Dover.aspx The IDF will help those in need, even on the other side of the globe MEDEVAC Flight in WWII http://www.helis.com/stories/burma45.php Home Page January 14, 2018 Designed by WebOrator
cc/2020-05/en_middle_0087.json.gz/line1337885
__label__wiki
0.696188
0.696188
Millennial London The Dramatic Arts Tag Archives: ldntheatreblogger Features, Interviews, The Dramatic Arts Paper Creatures Theatre: Section 2 – an honest portrayal of mental health May 25, 2018 Sarah Louhichi Leave a comment A year after their successful debut production Flood,Paper Creatures Theatre are back at it again. This time they’re showcasing their play, Section 2, about mental health as part of the Breaking Out season at the Bunker Theatre. Section 2 | Paper Creatures Theatre Jon Tozzi and Nathan Coenen, the founders of Paper Creatures look back at their first year: “We knew that it was a great show and that we had a great team behind us. Having a sellout run, with lovely reviews confirmed to us that we need to keep doing this and that it wasn’t just a one off for us. We were passionate about it. We met loads of new people and hopefully gained new audiences and now is our chance of spreading that net wider and reach new people”. For their new show, the duo found playwright Peter Imms. Section 2 tells the story of Cam who is sectioned and how this affects him and the people around him. “When we read the script, both Jon and I were really blown away by how glaringly honest it was – a portrayal of what being in a mental health facility and being sectioned was.” Coenen continues: “There’s a lot of mental health plays being done right now, but something about sectioning specifically and doing it in such a realistic way, really piqued our curiosity”. Their goal for this new production is to demystify potential misconceptions about sectioning and the people that are sectioned. “People who’ve been sectioned have told us that they don’t really want to talk about it publicly because they’re afraid it might affect their careers or relationships. The desire to do this play has now spiraled into this passion to be able to hopefully create a piece of theatre that has a lasting effect on the audiences that come to see it, and hopefully create more of an awareness of this subject of sectioning”. Jon: “We were very keen that it wasn’t just a production about what it’s like to be a patient. That’s something that Peter Imms wanted to address, that it should be a piece about the people around them as well and the importance of that and how it doesn’t affect just one person but it affects so many people.” Paper Creatures got director Georgie Staight on board. “They sent me the first draft and it was the writing that spoke first and even that first draft was completely beautiful which meant that I wanted to work with them.” Jon: “I think it’s a very educational piece. The audience will come out of this knowing a lot more than they did before going in. The audience should feel like they’re a fly on the wall with this production. That they’re watching a real situation just pan out, because it’s coming from a place of such honesty”. Director Georgie on working with the space in the Bunker Theatre: “The story focuses around these people surrounding Cam. You see Cam in different kind of stages of distress and comfort. I’m interested in how we stage and play out Cam’s mental state. A lot of it can be portrayed physically and metaphorically and through sound and staging. The Bunker is an interesting space, you have to tailor it specifically”. Another thing that was important to them was to raise awareness and start a conversation about mental health and being sectioned. “We know with the play there has to be an element of outreach to it. So from the get go we got in touch with the charity Mind and they’ve been so generous with their time. I’ve spoken to about eight individuals who’ve previously been sectioned. We have some short films for the public to see and open up the conversation. We’re also going to do post-show talks with the creative team, people who have been sectioned and charity representatives so we can contribute to this debate.” Section 2 plays at the Bunker Theatre on Tuesdays and Fridays from 11 June to 7 July. Tickets can be booked here. bloggerfringe theatreInterviewsjournalismldntheatrebloggerlondonmental healthmillenniallondonnew writingplaytheatre addicttheatre companytheatreblogger Reviews, The Dramatic Arts Muted | Review December 12, 2016 Sarah Louhichi Leave a comment ★★★★★ Interval Productions, The Bunker Theatre Sarah Henley’s heartbreakingly beautiful story of loss and love enchants the audience with emotional songs and astonishing voices. Muted | Savannah Photographic Michael is the frontman of a band called Lost Boy. He and his friends are an inch away from becoming a success. Then his mother suddenly dies from a hit and run accident and he never speaks a word again. His friends desert him and he lives with his uncle. Years later, his ex-girlfriend Lauren and his friend Jake who is now Lauren’s boyfriend, want to make things good again. When the band gets another shot at stardom, Jake tries to get Michael back in the band, because the label wants him to be the frontman once again. When Lauren tries to bring Michael back to normal, old feelings are re-emerging and a dark truth uncovered. Teenage Michael ( Ed Campbell Bird) | Savannah Photographic Jamie Jackson’s direction of the musical is fresh, artistic and contemporary, which works well with the venue, the story and the songs. The teenage version of Michael, played by Ed Campbell Bird, appears as the inner voice of him, while he stays muted the teenage Michael sings and expresses his inner feelings. During flashbacks with the mother that explains their relationship, which was sometimes difficult, due to his mothers drinking and disappointment of his father leaving them. His uncle Will had to deal with the loss of the sister but couldn’t mourn her loss having cared for his nephew at a young age. Now he is torn between living his own life and staying with his nephew. Lauren ( Tori Allen-Martin) and Micheal (David Leopold) | Savannah Photographic Michael played by David Leopold has the ability to show Michael’s pain and sorrow of losing his mother. His life being turned upside down, the confusion of not knowing who the driver was and his friends suddenly abandoning him weighs on him heavily. His facial expressions and body language convey his feeling’s perfectly, making you instantly connect with Michael. He is a lost boy, which coincides with the name of his former band. Tori Allen-Martin is not only an incredible musician and writer, she plays her part as the ex-girlfriend that was driven away by her guilt and, feeling helpless but unearths old feelings for Michael. Her voice also touches everyone in the audience. It is soft, yet strong, beautiful and emotional. Muted runs at the Bunker Theatre until 7 January 2017. bloggerfringe theatrejournalismldntheatrebloggerlondonmusicalMutedreviewthe bunkertheatretheatreaddicttheatrebloggertheatrelover Pride and Prejudice | Review December 2, 2016 Sarah Louhichi Leave a comment ★★★★☆ Two Bit Classics, Jermyn Street Theatre This play is an intelligent and heartfelt adaption of the Jane Austen classic. With witty and creative uses of narration, this story tells of one of the most romantic novels of all time. Photo is courtesy of Carrie Johnson When Mr Bingley moves to Netherfield Estate, Mrs Bennet gets excited as she hopes one of her daughters is to marry him. Having five daughters, she’s constantly trying to marry them off. Mr Bennet is a relaxed man compared to that of his wife, who is not as eager as his wife. When Jane meets Mr Bingley, they seem to have a mutual interest in each other. However, his sister doesn’t agree with their possible relationship. Meanwhile, Mr Darcy, a handsome and proud aristocrat, doesn’t make a good first impression with Elizabeth. Joannah Tincey adapted the play, creating a theatrical experience of the novel. Starring two actors playing 21 characters that are distinguished and clear, finding the line between narrator and character. Her genius of exploring the 200-year-old story and turning it into a play that only uses Austen’s own words, is well thought and works brilliantly in the small space of the Jermyn Street Theatre. Nick Underwood’s portrayal of Jane Bennett is elegant and feminine and an audience favourite. His coughing as Kitty creates laughter from beginning to end. Mrs Bennet (Joannah Tincey) and Mr Bennet (Nick Underwood) | Carrie Johnson Director Abigail Anderson created an engaging romantic play, bringing famous personas from British Literature to the stage. She uses the third person narrative that introduces a dialogue between two characters, and by addressing the audience, they create a sense of relationship. Whereas it is slow at points, once you pick up the story, it’s easy to get lost in it. It also seems slightly confusing, the actors are running around, changing characters and it takes a while until you catch on. After understanding which person possesses what characteristic, it’s easy to follow their journey. Jane Bennet (Nick Underwood) and Elizabeth Bennet (Joannah Tincey) | Carrie Johnson The show uses a creative approach of narration in order to change characters. Underwood and Tincey narrate while acting and therefore explaining who is speaking. One element that makes this play so beautiful are the little differences between each character. A pipe for Mr Bennet, a handkerchief for Mrs Bennet. A change of tone, accent or body language. Those details accentuate the amazing character work by the two actors, showing that they know their characters very well. Pride and Prejudice runs at the Jermyn Street Theatre until 21 December. @TwoBitClassics @jstheatre #PrideAndPrejudice bloggerfringe theatrejane austenjermyn street theatrejournalismldntheatrebloggerlondonplaypride and prejudicereviewromantic noveltheatretheatrebloggertheatrelover Scrooge and the Seven Dwarves | Review November 29, 2016 Sarah Louhichi Leave a comment ★★★★☆ The Sleeping Trees, Theatre 503 Directed by Simon Evans, Scrooge and the Seven Dwarves is wonderfully creative and a hilarious spectacle that ignites the imagination. John Woodbury (Scrooge), James Dunnell-Smith (One of the Seven Dwarves), Joshua George Smith (Snow White) | David Monteith-Hodge The Sleeping Trees trio, John Woodburn (Scrooge, Santa Claus), James Dunnell-Smith (Mrs Claus, Wicked Witch) and Joshua George Smith (Bob Cratchit, Snow White) have created their third wonderfully chaotic panto that keeps throwing Christmas at you until you can’t help but feeling festive. Christmas is ruined, the Wicked Witch of the West has stolen all the Christmas spirit, so who else but grumpy, old Ebenezer Scrooge to the rescue. Mrs Clause sends him on a journey, where he encounters the seven Dwarves (played by two actors) and Snow White. A T-Rex and Mary Poppins also make an appearance throughout the show. Meanwhile, the trio encounter their own problems. Forgetting to book the 30 actor strong cast, they, again, have to put on the whole show themselves. Will the talent agent watching the pantomime choose them to be the new Hollywood superstars? Ben Hales (Musician and Composer) on the far left | David Monteith-Hodge The threesome are witty and have the ability to keep the entire audience intrigued. Playing several characters each, they’re showing versatility and the ability to create characters that stand out. Ben Hales (Musician and Composer) perfectly plays the part of the puzzled audience member who gets dragged into the show. Chaotic at points but with a catchy and repetitive song, they bring the show home whilst you find yourself singing along and feeling excited for the holidays. They throw Christmas at you with immense amount of insanity, and a lot of ingenious stage charisma. All in all, this panto is the work of three incredibly talented comedian actors, making you laugh from start to finish. Scrooge and the Seven Dwarves runs at Theatre 503 until Saturday 7 January 2017 Twitter: @wesleepingtrees @theatre503 #Scrooge503 bloggercomedyfringe theatrejournalismldntheatrebloggerlondonpantoplayreviewtheatretheatrelover Dead Funny | Review November 4, 2016 Sarah Louhichi Leave a comment ★★★★☆ Vaudeville Theatre, Dead Funny Terry Johnson wrote and directed an homage to comedians Benny Hill, Tommy Cooper and co. while reflecting their not so funny private lives in a laugh-out-loud spectacle. Official Poster (Vaudeville Theatre) It’s 1992, everything’s a laugh. Richard is the President of the Dead Funny society and for him and his friends, Lisa (Emily Berrington), Nick (Ralf Little) and Brian (Steve Pemberton) nothing could be better than slipping famous routines of their favorite comedians into their lives and society meetings. All could be great if it wasn’t for Katherine Parkinson’s character, Eleanor (the star of the show) ruining their meeting with her cynical attitude and always infuriatingly funny, snappy and belittling comments towards her husband’s and friends’ obsessive love for dead comedians. She’s unhappy and struggling with her own life, but she wants a baby. Desperately. All she can think about is getting pregnant and sleeping with her husband, who is pre-occupied with his own internal battles. It’s clear from the beginning that he feels rather uncomfortable in her presence and tries to avoid physical contact with her. Their long-term friend Brian adds to the comedic value of the show. He seems to have the talent of always turning up at the wrong time or the perfect time, depending on who’s side your on. His somehow innocent characteristics makes him immediately likable. It almost seems like you’re watching two plays at the same time. One about a struggling relationship and the other a satirical play on dead comedians, and their long-term admirers who have created the society. Those collide when Benny Hill dies and the society holds a honorary meeting at Eleanor’s and Richard’s house. However, if you’re unfamiliar with all these comedians, many jokes and anecdotes might easily be missed. What makes this play so funny is the mix of the cynical and admiration of old comedians and the clash of two different worlds. The climax happens when secrets are uncovered and pies fly into faces. It’s a perfect way to celebrate iconic and traditional English comedy. Dead Funny runs at the Vaudeville Theatre until 4 February 2017. Get you tickets here. benni hillbloggerDead Funnyjournalismldntheatrebloggerlondonplayreviewtheatretheatrebloggertheatrelovertommy coopervaudeville theatrewest end 1984 | Review October 5, 2016 Sarah Louhichi Leave a comment ★★★★☆ Playhouse Theatre, 1984 An intense, powerful and somewhat traumatizing experience with fantastic performances that make this play a must see of the season. Winston Smith, a comrade of the outer party, opens a diary that will change his life forever. By doing so, he commits ‘thoughtcrime’ that is punished by death. He lives in a post-war world that is split into three countries, Oceania, Eurasia and Eastasia. The Government controls everything, what people eat, by rationing food, what they do, with constant surveillance through telescreens that can’t be turned off. Sex and love are forbidden. People are meant to dedicate their life to the party and therefore relationships are not allowed, and sex is only for the reproduction of party members. Even thinking is controlled by the government through newspeak, the language of Oceania, that decreases its vocabulary yearly and therefore ‘thoughtcrime’ will become impossible. People are brain washed and therefore don’t realise that they’re being told what to do and think. Winston, who works in the Record Department has realised Big Brother’s control over everything and started to question his life. In the search for liberty, he meets Julia, a young comrade and falls in love. They join The Brotherhood, a secret organization by Emanuel Goldstein, an ex-Inner Party member who turned against Big Brother and is now the symbol of the rebellion. However, Big Brother is always watching. The direction by Robert Icke and Duncan Macmillan is brilliant through and through. The timing reinforces intensity of certain scenes keeping the audience on the edge of their seats. However, if you’re not familiar with the story, it takes some time to understand the storyline and what is actually happening on stage, as there isn’t much background information that explains this distorted world. Winston Smith is played by Andrew Gower, who delivers a magnificent performance that follows his journey as a frail man, who has trouble differentiating reality from false memories to opposing a suppressive government. Catrin Stewart, who portrays Julia is an excellent addition to Winston, as a young and energetic woman who knows how to lie properly in order to survive in Oceania. The staging is not only clever and efficient but also so versatile. It makes you hold your breath. One minute, we’re in Winston Smith’s home, the next in the canteen and then at the train station. This spine-tingling play leaves a bitter sweet aftertaste. Resonating with a world that had Snowden revealing that the USA secretly used the internet for mass surveillance to spy on people and governments. So did George Orwell predict the future? Are we all being brainwashed without realising it? These questions stay in mind, even hours after leaving the theatre. 1984 is currently running at the Playhouse Theatre until 29 October 2016 1984bloggergerorge orwelljournalismldntheatrebloggerlondonmillennialmillenniallondonplayplayhousetheatrereviewtheatretheatreloverwestend Features, The Dramatic Arts Theatre etiquette: Do’s and Don’ts September 14, 2016 Sarah Louhichi 3 Comments You’re sitting in a red velvet seat in a beautiful old theatre, awaiting a wonderfully touching play and ready to be immersed into a different world. You’ve turned your phone off and have had a glance through the £4 programme. All you need now is for the show to start, and you can enjoy an unforgettable evening. Unfortunately, others around you have a different idea of a great evening. Talking, eating and rustling with plastic bags is part of their theatre routine. Most of the time “those” people are clueless as to why you’ve rolled your eyes at them for the third time. Just in case, here are a few Do’s and Don’ts to get you started. Don’t talk throughout the show. Yes, this should be common sense. Yet, some people still don’t grasp the concept of theatre. So, let me quickly explain this to you. A play or musical is live, there are actual human beings on stage, pouring their soul into this performance. It doesn’t only disturb other theatre goers when you suddenly have to talk to your friend about that amazing thing you did last week, just because one scene in the show reminded you of that. It might also not be a great idea if you need to explain to them what is happening on stage or translating it into a different language. That’s what a post-show drink at the pub is for. Don’t eat your way through a bag of M&M’s or any other bag of sweets for that matter. You’re not on your couch in sweats and watching a film on a Saturday evening. I never understood the need to eat during a two-hour show, especially if there’s an interval where you have 20 minutes to stuff your face. However, if you’re absolutely starving then check out TodayTix the theatre app. They have just launched Silent Snacks, these are currently only available at In the Heights and American Idiot for a short time only. This might be a great innovation for all the snackers in the theatre. Do get up and dance if they tell you to. A lot of shows, well musicals, have a big finale at the end of their performances. Many times, the actors encourage you to get up and dance or even just clap along. It’s a fun way to end an evening full of energetic songs and head bopping hits. So don’t be shy, nobody cares what you look like when you rock along to Lola at the end of Sunny Afternoon. It just shows the cast that you actually had a great time and weren’t dragged to the show by someone who’s a theatre enthusiast. Do tweet after the show. Many plays and musicals, particularly the small productions would love and need your support. Become part of a greater discussion, rather than just telling your friends about your thoughts on the show. Feel free to tweet the show and tell them how much you loved it and why, or if you enjoyed a performance by a particular actor, tweet them. In most cases, they’re happy to hear your thoughts and sometimes even reply. This is a great way to connect with the actors without waiting at stage door, as well as help promoting a good production. Going to the theatre isn’t rocket science. People should be able to figure out that using your phone throughout a performance is not only distracting to other audience members and the actors, but also incredibly rude. The same counts for making any unnecessary noise. You want to be captivated by the performance and emerged into the world that the show takes you, without getting disturbed every few minutes. bloggerdos and dontsetiquettejournalismldntheatrebloggerlondonmillenniallondontheatretheatrebloggertheatreloverwestend The Dramatic Arts (32) Millennial London Gallery
cc/2020-05/en_middle_0087.json.gz/line1337887
__label__cc
0.673102
0.326898
Mozillian for 2 years Jan 2018 Bengaluru, Karnataka, India 21:03 Asia/Kolkata Sachin Hebbar I am the Club Captain of Mozilla Campus Club in NITK I am currently pursuing Electrical and Electronics Engineering at NITK, Surathkal. My love for hands-on science and my interest in understanding how things work made me choose Engineering. I was introduced to Mozilla Campus club in my second year, I believed in Mozilla's mission and wanted to be an active part of it, also I am very interested in organizing events and holding different events that would support open and safe web would be a lot of fun, so I became the Club Captain of Mozilla Campus Club in NITK. I have organized a Rust event, knowledge exchange programs on Web VR and Blockchain as a part of Mozilla Campus Club. I would love to continue this work and spread awareness about open source software. Mozilla has helped me develop both technical and management skills. ,python, c programming, digital signal processing, digital system design, image processing, matlab, octave, pytorch, simulink, tensorflow, verilog English, Hindi, Kannada Jyotsna Gupta Sachin has been contributing to Mozilla for the last couple of years. Being a club captain, he has organized various events at his college NITK Surathkal. He has been working effortlessly to support the Mozilla's mission. I have worked with him for the two events happened at NITK: Add-ons and Go workshop. Happy to vouch for him, hope to see more from him in the future. Keep rock'in the open web Sachin \o/ Manjesh shetty sachin is promising club captain of Mozilla Campus Club in NITK, Surathkal. He believes in the mission of Mozilla, which has led him to work towards achieving the mission. Recently he has organized Rust Event in his campus and also contributed towards mozactivate projects. His skillsets are revolving around Web VR, Blockchain and Cyber Security, hence he deserves this vouch.
cc/2020-05/en_middle_0087.json.gz/line1337893
__label__cc
0.610586
0.389414
NM05.05.07 : Continuous, Size and Shape-Control Synthesis of Hollow Silica Nanoparticles Enabled by a Microreactor-Assisted Rapid Mixing Process Undergraduate Research AssistantUniversity of California, Riverside Yujuan He1 Chih-hung Chang1 1, Oregon State University, Corvallis, Oregon, United States Hollow silica NPs (HSNPs) have been studied widely as a promising material for various field of applications such as catalysis, drug delivery, cell-labeling, and optical coatings, due to its attractive features like biocompatibility, controllable surface areas and large void volumes, as well as suitable chemical and thermal stability. The template method is a facile and straightforward approach to synthesize HSNPs. Hard templates such as inorganic nanoparticles, polystyrene nanoparticles, and hydroxyapatite nanoparticles, were employed to produce the uniform HSNPs with uniform and tunable void space and shell thickness. High temperature (around 500 °C) post-processing is normally required to remove the hard templates. In contrast, soft templates such as emulsion micelles7, and vesicles could be simply washed away by using a selective solvent at room temperature. However, the preparation of soft templates with a uniform size under 100 nm typically required at least two surfactants and relatively tedious stabilization procedures. Herein, we introduced a microreactor-assisted system with a hydrodynamic focusing micromixer (HFM) to control the conformations of the HSNPs with poly(acrylic acid) (PAA) as soft template. The PAA can self-assemble into globular when meets with the “unfavorable” solvent such as ethanol. Following this self-assembled conformation which is called thermodynamic-locked (TML) conformation, like the other single surfactant/polyelectrolyte, PAA TML in solution has a strong tendency towards aggregation before the growth of silica shells. In the batch reaction, due to the uneven mixing between free PAA chains and “unfavorable” solvent, PAA chains were under the different transition or aggregation stages which finally led to a broad size distribution of the PAA templates. In our system, with the assistance of the HFM in which the transition and aggregation of PAA chains are controlled by varying the mixing time through flow rates, flow rate ratio and PAA concentration, we can obtain the HSNPs only in ~30 nm. By modifying the PAA concentration, the necklace conformation of PAA TML were successfully preserved by the silica shells. COMSOL Multiphysics was performed to investigate the fluidic profile in the microreactor system. The quality of these HSNPs was demonstrated by fabricating anti-reflective coatings on the top of monocrystalline PV cells. Our HSNPs thin film exhibited much higher enhancement of the power conversion efficiency (PCE) than their batch counterparts. Composition & Microstructure - Featuresnanostructure SymposiaNM05: Colloidal Nanoparticles—From Synthesis To Applications Synthesis & Processing - AssemblySelf-Assembly
cc/2020-05/en_middle_0087.json.gz/line1337895
__label__cc
0.714056
0.285944
Montana 2020 Indoor Track & Field Meets Select a Season and Year All Cross Country Indoor Track Outdoor Track Road Racing Current 2021 2020 2019 2018 2017 2016 2015 2014 2013 2012 2011 2010 2009 2008 2007 2006 2005 2004 2003 2002 2001 2000 1999 1998 1997 1996 1995 1994 1993 1992 1991 All December January February March All Youth Middle School High School College Open Pro/Elite Or Search for a Meet by Name Date Event Location Results 12/6 Bobcat Preview Bozeman, MT 1/6 - 1/7 Montana State Multi's Bozeman, MT 1/19 The Showcase Hillside, IL 2/13 - 2/15 Simplot Games Pocatello, ID 3/13 - 3/14 NCAA DI Indoor Championships Albuquerque, NM 3/13 - 3/14 NCAA DII Indoor Championships Birmingham, AL 3/13 - 3/14 NCAA DIII Indoor Championships Winston-Salem, NC 3/13 - 3/15 New Balance Nationals Indoor New York, NY On The Line, Episode 1: The VA Showcase Pod Breaking Down Tamari Davis' 200m Breaking Down Justin Robinson's 400 MileSplit #HOTin2019 Yule Log MileSplit LIVE: Our Big Holiday Show Generated by 10.1.2.221 from cache (3332) in 34 milliseconds
cc/2020-05/en_middle_0087.json.gz/line1337898
__label__cc
0.649542
0.350458
Dropdead’s Ben Barnett gives update on Bob Otis’ recovery We reported last week that Bob Otis, vocalist of Decibel Hall of Famers Dropdead, had been in a motorcycle crash and a gofundme had been set up to help out Otis with his considerable health-related fees. We since caught up with Dropdead guitarist Ben Barnett to find out how Otis is doing. “After a second round of visits to two hospitals last Tuesday July 24, Bob is back home and getting more mobile every day,” Barnett told us on Friday, July 27. “Still in a lot of pain, but he has had a rotating cast if friends coming by to assist and keep him focused on the healing process.” Barnett says that the gofundme has been a “huge help” and that friends from all over the place have been sending donations and notes of encouragement to Otis. “Other than that, there are a few benefit shows in Providence in the works,” says Barnett. “We should have details soon. We are looking for raffle prize donations for the shows. If any people, labels, bands or businesses have anything they want to donate for that, they can mail them to: Bob Otis Recovery Fund c/o Armageddon Shop, 436 Broadway, Providence RI, 02909.” The gofundme raised over $10,000 in one day (the goal was $15,000). As of Friday, July 27, it had surpassed its goal, sitting at $17,027. In regards to that initial 24-hour surge, Barnett says it makes him feel like “there’s a big family out there caring for each other.” “It’s been overwhelming, the response has just been so positive,” says Barnett. “Bob is blown away.” As for the benefit shows coming up in Providence, there will be one at Dusk on August 24 and one at AS220 on September 21, and Barnett says there’s a third in the works for October at Machines with Magnets. “Details on all forthcoming,” says Barnett. “Got a few things to wrap up this week, then will have those booked and promoted properly pretty quickly.” The post Dropdead’s Ben Barnett gives update on Bob Otis’ recovery appeared first on Decibel Magazine. Previous Previous post: Viking Metal Warrior Women SAPPHIC MUSK Announce Their First East/West European Tour Next Next post: ORGY Announces Two New Members
cc/2020-05/en_middle_0087.json.gz/line1337902
__label__cc
0.553019
0.446981
Home / Destinations / Findlay Private Jet and Air Charter Flights Findlay Private Jet and Air Charter Flights Monarch Air Group provides private air charter in Findlay, Ohio. Our clients benefit from top-notch service, unrelenting dedication to safety, wide selection of aircraft, and years of experience in chartering private jets. To obtain a free quote, please use our online quoting tool provided below, or call toll free 1-877-281-3051 Charter a private jet in Findlay, OH: About Findlay, Ohio, United States Monarch Air Group offers a wide variety of private jet charter options to and from Findlay, Ohio, United States. Situated in the northwest region of Ohio, 40 miles south of Toledo, Findlay is the county seat of Hancock County and a vibrant and well-established city in Ohio. The city has a population of about 42,000 residents, making it the second largest city in Northwest Ohio, and is home to the University of Findlay. Findlay boasts an historic downtown, a myriad of lodging, business opportunities, excellent dining, high quality of life, amazing shopping, and tons of recreational activities. Findlay hosts the Findlay’s Hot Air Balloon Festival, Oktoberfest, Riverside Wine Festival, and Rib-Off on Broadway. The most visited tourist attractions include the Northwest Ohio Railroad Preservation, Hancock Historical Museum, Mazza Gallery Findlay, Perennial Plant Peddler, Jeffrey’s Antique Gallery, and Red Hawk Run Golf Club, among the others. The nearest major airport to Findlay is Toledo Express Airport, which is located 48 miles from the city center and provides domestic flights. Findlay, OH Airports within 70 miles 1. ADG, Lenawee County, Adrian, United States 2. AOH, Allen County, Lima, United States 3. AXV, Neil Armstrong, Wapakoneta, United States 4. CQA, Lakefield Airport, Celina, United States 5. DCR, Decatur Hi-Way, Decatur, United States 6. DFI, Memorial, Defiance, United States 7. FDY, Findlay, Findlay, United States 8. GQQ, Galion, Galion, United States 9. MFD, Lahm Municipal, Mansfield, United States 10. MNN, Municipal, Marion, United States 11. SKY, Griffing Sandusky, Sandusky, United States 12. TDZ, Toledo, Toledo, United States Hotels in Findlay, OH 1. Fairfield Inn & Suites Findlay, 2000 Tiffin Avenue, Findlay 2. Hampton Inn Findlay, 921 Interstate Drive, Findlay 3. Comfort Suites, 3700 Speedway Drive, Findlay 4. Findlay Inn & Conference Center, 200 East Main Cross Street, Findlay 5. Quality Inn, 1020 Interstate Court, Findlay 6. Drury Inn & Suites Findlay, 820 West Trenton Avenue, Findlay 7. Holiday Inn Express & Suites Findlay, 941 Interstate Drive, Findlay 8. Country Inn & Suites By Carlson, Findlay, OH, 903 Interstate Drive, Findlay 9. TownePlace Suites Findlay, 2501 Tiffin Avenue, Findlay 10. Hilton Garden Inn Findlay, 1050 Interstate Drive, Findlay 11. Beer Barrel Pizza & Grill, 900 Interstate Drive, Findlay 12. Logan’s Irish Pub, 414 South Main Street, Findlay 13. Japan West, 406 South Main Street, Findlay 14. West End Tavern, 506 West Main Cross Street, Findlay Destinations Tags: air charter Findlay, air charter Ohio, Findlay private jet, Ohio private jet
cc/2020-05/en_middle_0087.json.gz/line1337906
__label__wiki
0.708684
0.708684
Tony Gittelson True-ish detective: Unpacking “Manhunt: Unabomber” on Netflix streaming The eight-part Discovery Channel series Manhunt: Unabomber is one of the most thoroughly captivating, entertaining pieces of bullshit in the entire canon of true-crime TV. Bullshit because Manhunt takes narrative liberties that are extreme even for Hollywood. The fabrication starts with a focus more on the FBI Unabomb investigation than on Ted Kacyznski. Nothing wrong with this approach, of course. But when a minor player in the real case (profiler Jim Fitzgerald, here Sam Worthington in the lead role) is turned into a modern-day Sherlock Holmes—and his near-omniscience is only exaggerated by pitting him as a stereotypical underdog genius—the formula might be hard to swallow for true-crime die-hards looking for the level of point-by-point attention to historical detail that, say, Zodiac obsessed over. On the flip side, if you view this thing merely as an exercise in historical fiction (rather than the true-crime retelling it poses as), you’d be hard-pressed to find a more engrossing piece of detective TV over the past couple years. Not exactly selling itself… While we’re on the subject of missteps by an otherwise- phenomenal series, I’d be remiss if I didn’t mention the reason it took me a year to get around to watching this: piss-poor marketing. Take the reason half the world has seen Mindhunter (a series incredibly similar, and no more compelling) and not this: With the dubious Discovery Channel stamp on a bland, gray canvas featuring an unrecognizable actor posing as the Unabomber, the cover art here suggests a hammy, low-budget direct-to-DVD thriller. This couldn’t be further from the truth. Again, A-lister Sam Worthington stars (Netflix has increased his facial presence on its streaming page since they picked this up in late-2017). Manhunt also spares no expense on its strong cinematography, recreation of period and place, and reputable side cast (Jane Lynch as Janet Reno, Mark Duplass as Kaczynski’s brother). It actually feels a lot closer to the high-quality cinematographic and suspense work of Fincher in Mindhunter and Zodiac than it does, say, Lifetime’s Jodi Arias story. UNABROTHER: Mark Duplass as David Kaczynski And where Worthington does a fine job in a hyperbolized role, one of the greatest accomplishments of Manhunt is Paul Bettany’s dynamic portrayal of Kazcynski. Rarely do serial killer stories so impactfully display the humanity of their… serial killers. And that’s probably a good segue to get into the narrative meat of the show. The first episode opens with a calm-yet-sinister voiceover imploring: “I want you to think about the mail, for a minute. Stop taking it for granted like some complacent, sleepwalking sheep. And really think about it. I promise you, you will find the U.S. mail a worthy object of your contemplation.” This device (Bettany reading from the Unabomber letters and manifesto) is employed periodically throughout the series, both as a tool to get into Kaczynski’s mind and also as an empathic ploy that begins to explain why our protagonist (Worthington) becomes dangerously smitten with Kaczynski’s theories. “Mind. Blown.” As Fitzgerald ascends from average-Joe Philly beat cop to he-man detective, he’s brought in by the FBI to build a profile on the elusive Unabomber. With the help of a faithful assistant (Keisha Castle-Hughes), Fitzgerald probes the case from new angles, identifying patterns in the Unabomber’s letters that lead to what he dubs “forensic linguistics.” As bosses second-guess him at every turn, Fitzgerald continually saves face with last-moment revelations. This is not a spoiler, as Fitz and Ted face-off early on—part of Manhunt‘s effective nonlinear narrative. (They never met in real life, if you were wondering.) While Worthington’s Fitzgerald is clearly a fabricated hero-character constructed for the sake of thrilling cinema, that construction is quite effective. Perhaps part of what makes Manhunt so intriguing is that as Fitz’s Kaczynski obsession begins to manifest in his personal behavior and ideologies (down to living in an isolated cabin in the woods and growing a laughably fake beard), we are confronted with a dark and ugly truth: Ted Kaczynski, the man responsible for the brutal murder and disfiguration of so many innocents, was in fact a sane, brilliant ideologist whose theories were, by and large, very relatable to good people. Like Fitz. Or you. Or me. “He just has the courage to live according to his ideals,” Fitz says at one point when refuting the popular notion that Kaczynski, was insane. “I respect that.” There’s no denying that Kaczynski is painted with a very sympathetic brush in this series—one that might understably offend families of the innocent people who Kaczynski maimed and killed. But again, part of what makes the Unabomber case so interesting is that Ted Kaczynski wasn’t a psychopath or lunatic, but rather a passionate human who did some horribly misguided shit to get his desperate plea about the state of humanity across to the rest of humanity. One particularly poignant and haunting scene shows Bettany frolicking in the woods to a classical symphony played on an old gramophone. Here, he looks like some ethereal pan creature—a hybrid of Thoreau and Baryshnikov—enchanted by the sublime beauty of nature, and an inextricable part of it. It’s this side of Kaczynski that’s relatable. Bettany brings a disturbing level of gravity to his portrayal of Kaczynski, showing his many sides: the idealistic naturalist who cares for and is enchanted by the world; the creepy, angsty social outcast; the egomaniacal tortured genius who decided to play god. In all, this is an expertly crafted detective series with an incredible turn by its antagonist. I’d be playing spoiler if I were to get into my views about why this series is both Grade-A cinema and Grade-A bullshit. Suffice it to say that you’ll probably see what I’m talking about as it unfolds. Tags Andrew Sodroski, best detective shows on netflix, best of netflix 2018, best serial killer series, best series on netflix, best thrillers on netflix, david fincher, Greg Yaitanes, Jane Lynch, Jim Clemente, Manhunt: Unabomber, Mark Duplass, Mindhunter, Paul Bettany, Sam Worthington, serial killer shows, Ted Kaczynski, Tony Gittelson, zodiac
cc/2020-05/en_middle_0087.json.gz/line1337909
__label__cc
0.62633
0.37367
A Pasadena Employment Law Firm Committed to Helping Workers About Ramit Mizrahi About John Schwab About Kathryn Crandall [SELECT]About Mizrahi Law- About Ramit Mizrahi- About John L. Schwab- About Kathryn CrandallMizrahi Law’s PhilosophyClient TestimonialsHow to Find the Best Employment Lawyer for YouContact InformationMizrahi Law Blog Gov. Brown Signs Important #MeToo Bills Legislation, Posted by Ramit Mizrahi Acting on the momentum of the #MeToo and #TimesUp movements, California legislators have leapt into action, putting forward legislation to protect employees who have been subjected to or opposed sexual harassment. They sought to limit confidentiality and nondisparagement provisions, restrict mandatory arbitration, increase recordkeeping and training obligations, extend the statute of limitations, and create individual liability for retaliation. In June, I wrote about the importance and potential impact of these bills in Sexual Harassment Law After #MeToo: Looking to California as a Model, published in the Yale Law Journal Forum. On September 30, 2018, Governor Brown signed into law a number of the bills aimed at addressing sexual harassment and abuse. He vetoed several others, to the disappointment of employee rights advocates. Overall, however, the new laws are cause for celebration. SB 820, The Stand Together Against Non-Disclosures (STAND) Act SB 820 prohibits confidentiality provisions in the settlement agreement of any civil or administrative action that states a cause of action for: sexual assault; workplace harassment or discrimination based on sex; failure to prevent workplace harassment or discrimination based on sex; sexual harassment in a business, service, or professional relationship; and sex discrimination, harassment, or retaliation by the owner of a housing accommodation. The law permits restrictions on disclosure of the settlement amount. An employee is entitled to request confidentiality. The STAND Act will make it more difficult for employers to support and protect serial harassers. AB 3109 makes a provision in a contract or settlement agreement void and unenforceable if it waives a party’s right to testify in an administrative, legislative, or judicial proceeding concerning alleged criminal conduct or sexual harassment. SB 1300 is a comprehensive bill that helps combat sexual harassment in a number of ways. Among other things, it: Prohibits nondisparagement agreements that gag employees from disclosing information about sexual harassment and other unlawful acts (often presented to employees at the outset of their employment as a condition of employment); Prohibits releases of claims presented in exchange for a raise, bonus, or as a condition of continued employment; Holds employers liable for failing to prevent all forms of unlawful harassment by third parties, not just sexual harassment; Confirms that prevailing defendants are entitled to fees and costs only when the action is frivolous, notwithstanding CCP section 998. This means that an employee need not fear that if she loses her case, that she may be forced to pay the company’s legal costs; Declares legislative intent regarding sex harassment, including that a single incident can constitute sex harassment, even absent extreme circumstances, that an employee’s work performance need not have suffered, and that summary judgment should rarely be granted; Makes sexual harassment training more robust. AB 1619 increases the statute of limitations for civil action for sexual assault of an adult to 10 years. SB 826 requires publicly held corporations with principal executive offices in California to have at least one female on its board of directors. SB 1343 requires employers with five or more employees to provide at least two hours of sexual harassment training to all supervisory employees and at least one hour of sexual harassment training to all nonsupervisory employees by January 1, 2020, and once every 2 years thereafter. SB 224 strengthens the Unruh Civil Rights Act, creating protections against sexual harassment by an investor, elected official, lobbyist, director, or producer. It eliminates the element that the plaintiff prove there is an inability by the plaintiff to easily terminate the relationship. It further makes it an unlawful practice to deny or aid, incite, or conspire in the denial of the rights created by Section 51, 51.5, 51.7, 51.9, 54, 54.1, or 54.2 of the Civil Code (including related to sexual harassment claims under the Unruh Civil Rights Act). Vetoed Bills AB 1870, which had broad support, would have increased from one to three years the time that an employee had to file an administrative complaint with the government for harassment, discrimination, and/or retaliation. AB 3080 would have prohibited forced arbitration and retaliation for refusing to sign away certain rights. AB 3081 would have created a rebuttable presumption of retaliation for complaining about sexual harassment under certain circumstances. AB 1867 would have increased recordkeeping requirements so that records of sexual harassment complaints would need to be maintained for at least five years after the last day of employment of the complainant or alleged harassed, whichever is later. Also Worth Noting I also wanted to bring attention to SB 1038, which was previously ordered inactive. Under the FEHA, employees can sue the people who harass them individually. However, they cannot sue them for discrimination or retaliation. This creates incentives for harassers to silence their victims so that they do not report them. This bill would have allowed individuals to be held personally liable for retaliation, as they are for harassment. Unfortunately, it did not gain the traction it needed to pass. Photo via Office of Governor Edmund G. Brown Jr., Press Releases Gov. Brown Signs Important #MeToo Bills was last modified: October 3rd, 2018 by Ramit Mizrahi Ramit Mizrahi’s article featured in Cal. Labor & Employment Law Review Articles, Cases, Ramit Mizrahi Speaking about Leave Rights at CLA Employment Law 101 Conference (2/6/20) Leave Laws, Study Finds $1 Increase In Minimum Wage Connected To Drop In Suicides Motherboard Interviewed Ramit Mizrahi About Pregnancy Discrimination In Tech 2019 CA Employment Law Legislative Update Employment 101 How Employers Get It Wrong Leave Laws Search The Mizrahi Law Blog Enter phrase Mizrahi Law, APC 201 S Lake Ave, Ste 305, Pasadena, California 91101 contact@mizrahilaw.com I didn't know it was possible to have such a caring and compassionate attorney. From the moment I met Ramit Mizrahi she was was supportive and professional. She counseled me in areas I was not familiar with in regards to employment law and worked with me to get my case settled to my satisfaction out of court. I hope I never have to hire an employment attorney again but if I do there is no other attorney I would chose. Mizrahi Law, APC is a Professional Corporation | Disclaimer Mizrahi Law represents workers in Pasadena, the Greater Los Angeles Area, and throughout California. Ms. Mizrahi is also licensed in New York and will handle select cases there. © 2013-19 Mizrahi Law, APC. All rights reserved.
cc/2020-05/en_middle_0087.json.gz/line1337912
__label__cc
0.72697
0.27303
Shareholders To Get Flour Mills N1.20 Kobo Dividend On Friday Following the approval of N1.20 kobo dividend by the shareholders of Flour Mills of Nigeria Plc, shareholders are expected to receive their dividend on Friday September 6, 2019. The approval was given on Wednesday September 4, 2019, at the company 59thAnnual General Meeting (AGM) in Lagos. The dividend is 20 percent above N1.00 that was paid to shareholders in 2018. Although the dividend was declared out of the company accumulated pioneer profit. The meeting afforded existing shareholders the opportunity to deliberate on the company operations and the way forward. Areas of concerns from some shareholders that commented on the company performance, includes, flood issue that affected their sugar cane farm, Apapa traffic issue, reductions in cost of finance among others. John Coumantaros, Chairman of the company, while responding to shareholders questions, explained that in 2019, they will continue to focus on their strategy of improving efficiency and synergy, while driving profitability in all key segments of the group. According to him “with the accelerated expansion in the B2C segments of the business, proper alignment and restructuring of our agro-allied businesses, and the optimal operation of our supply chain, we are confident that the business will remain in a position of strength and continue to generate growth and create value for shareholders in the coming year” Flour Mills of Nigeria Plc, was incorporated on 29th September, 1960 as a private limited liability company with a paid-up share capital of N1 million and converted to a public company in November, 1978. The beneficial interest in the company’s equity is held by Nigerian and Overseas shareholders. Presently, two foreign shareholders own about 56 percent of the company’s paid-up share capital. The balance is held by over 75,000 individuals and institutional investors. Its share price closed at N13.53 kobo on Wednesday September 4, 2019. Categories: Business, Metro, News, Politics / by Friday Ekeoba September 4, 2019 Ijaw Youths Flex Muscles With PHEDC Over, N16.5 bn Debt, Shutdown Of Operations In Bayelsa By Amos Okioma The Ijaw Youths Council (IYC) has challenged the Port Harcourt Electricity Distribution Company (PHEDC) to... NLNG Takes Final Investment Decision for Train 7 Nigeria LNG Limited (NLNG) has taken the Final Investment Decision (FID) for its Train 7 Project, which will increase its production by 35... Business Read More Sanwo-Olu Pardons Convicts, Calls For Modesty At Christmas The Lagos State Governor, Mr. Babajide Sanwo-Olu, has signed pardon for convicted prisoners in the state as a Christmas package and urged... SEC Moves to Tackle Unclaimed Dividends The Securities and Exchange Commission, SEC has said that it has outlined a number of initiatives in a bid to resolve the issue of... World Bank Warns CBN Against Support For Undercapitalised Banks The World Bank has warned that the assets of Nigerian commercial banks may deteriorate if the Central Bank of Nigeria continues to support... Niger State Under Siege By Armed Robbers, As Residents Seek Police Assistance Ijaw Youths Flex Muscles With PHEDC Over, N16.5 bn Debt, Shutdown Of Operations In Bayelsa December 28, 2019 Niger State Under Siege By Armed Robbers, As Residents Seek Police Assistance December 28, 2019 NLNG Takes Final Investment Decision for Train 7 December 28, 2019
cc/2020-05/en_middle_0087.json.gz/line1337917
__label__cc
0.692834
0.307166
DELTA Impact Prevention Project NCCADV believes in the importance of prevention. Increasing awareness of domestic violence is an important first step. But to prevent people from perpetrating domestic violence in the first place, we need to address the root causes of violence. NCCADV works to address these root causes at the state level and by building capacity for local prevention practitioners. NCCADV participates in a prevention program called DELTA Impact, funded by the Centers for Disease Control and Prevention (CDC). NCCADV’s DELTA Impact project aims to improve the following root causes of violence: Gender norms, Norms about aggression, Family economic stress, Coordination of community resources, and Family support and connectedness. NCCADV’s state-level work includes two main projects related to these root causes. One of our projects is to increase access to paid family leave. The other focuses on helping organizations improve policies and become more trauma-informed. NCCADV’s DELTA Impact project also supports local work in middle schools and colleges in Wilmington, North Carolina. These programs promote gender equity, safe school environments, and bystander intervention. NCCADV has participated in the CDC’s DELTA program since it began in 2002. NCCADV’s DELTA Impact project builds on our history of working with diverse partners to create community- and societal-level change. NCCADV Prevention Resources and Tools PreventViolenceNC.org Prevent Violence NC has resources and research to help build prevention programming. The site focuses on how to build key community, family, and individual strengths. Prevent Violence NC is a cooperative effort by NCCADV and four statewide agencies. Intimate Partner Violence and Sexual Violence Data Source Inventory This inventory summarizes each data source and the type of data it offers. Practitioners can easily identify data sources that will be useful to their work. EVE’s PEACE Toolkit This toolkit helps faith leaders improve practices and policies related to domestic violence. Topics include: Shifting community norms, attitudes and beliefs, Increasing support of healthy relationships, and Improving congregations' response to domestic violence. The toolkit can be used independently and in addition to training on preventing and responding to domestic violence. It was developed by NCCADV in collaboration with faith leaders from across the state. Catalog of Evidence-Based And Promising Practices This catalog of evidence-based and promising practices was compiled in 2009. It can help users decide which dating violence prevention and programming to use. These promising practices apply to community, faith, and school-based settings. Catalog of Intimate Partner Violence Prevention Programs and Curricula for Post-Secondary Institutions. This catalog offers practices for IPV prevention on college and university campuses. It provides summaries and other important information for program implementation. National Prevention Resources and Tools PreventIPV Information, resources, tools, and examples of prevention work from across the United States PreventConnect Web conferences, podcasts, videos, articles, and a wiki about intimate partner and sexual violence prevention VAWnet Resource library for gender-based violence Coordinated Community Response Latinx Services Program LGBTQ Domestic Violence Response Initiative Data Collection System: Osnium Economic Advocacy and Justice Program Silent Witness Program Health Impact Assessment of House Bill 2 and House Bill 142 on LGBTQ+ North Carolinians
cc/2020-05/en_middle_0087.json.gz/line1337919
__label__wiki
0.520323
0.520323
Hi, please take a moment to read this! we pride ourselves for providing useful and freely accessible content, and a website that is fast and easy to use. This is only possible because we use analytical cookies to understand how visitors like you use our website and which content attracts their attention. We do not need to record personal information to improve what we do; anonymous aggregate statistics are more than enough. Here is where you come in: be part of making this corner of the Internet a better place, and accept cookies - no calories involved! And do not forget to read our Privacy Policy Home Services Insights People News Contact ? Enter your query Insights - How mass-market services degenerate to commodities. How mass-market services degenerate to commodities. by Dr. Thomas Papanikolaou on May 25, 2014 Looking back in history, and with the benefit of hindsight, it is relatively easy to see why the telecommunications industry has been pushed to accept a commodity role. In fact, one can argue that the context telecommunication companies (Telcos) have been operating within, made it inevitable that telecommunications would be forced downwards to a commoditised position in the value chain. Anecdotically, some will say the reason for commoditisation were the Internet players, who took a free ride on the expensively-built telecommunications infrastructures, offering similar services “for free”. Others will claim that telecommunication providers have been over-protective of, and have excessively monetised communications: a resource that should be equally available to everyone (a discussion closely related to Net Neutrality) The actual reason is, uncharacteristically, not somewhere in between. Let us explain this, by contrasting and comparing telecommunications operators, to Google and Facebook. The comparison easily extends to Twitter and the Internet of Things (IoT), but for the sake of simplicity we will use Google and Facebook. LARGE-SCALE INFRASTRUCTURE Telco: yes Google: yes Facebook: yes MASS-MARKET SERVICE SERVES A BASIC NEED Telco: communication and connectivity Google: information access and communication Facebook: social networking and communication Telco: data Google: analytics data Facebook: relationships data CHARGES ON VOLUME Telco: number of megabytes Google: number of impressions Facebook: number of impressions BUSINESS MODEL BEST CASE Telco: client always uses less than they paid for Google: everyone/thing is searchable Facebook: every private info has been shared Google: no Facebook: no What the above table illustrates is that Telcos, Google and Facebook are not as different to each other as they would like to portray themselves. Telcos, Google and Facebook are all in mass-market, volume-type of business. Telcos represent Web 1.0 and Google and Facebook Web 2.0 (see Walled Garden 2.0). If there are any conclusions to draw from this type of comparison those are: Google and Facebook are extending into communications i.e. aim to serve the basic need Telcos have been serving up to now (see for example Facebook’s WhatsApp acquisition). Telcos, on the other hand, try to extend into connectivity and, more and more, analytics and big data. Google and Facebook are not regulated to the (extreme) extend Telcos are. With extended market reach (billions of users), Google and Facebook should, however, expect increased scrutiny from the regulator. This is already happening and several policy-driven regulatory actions around privacy exist, the latest being Google being forced by the European Union to amend links to information on request . Also recently, Facebook had to respond to calls for changes in its default privacy settings that put users at risk of accidentally over-sharing content. How far such regulatory action can and will go in the future depends on several factors. However, as Google and Facebook get nearer to becoming synonyms for "being able to find information" and "being able to connect socially", they approach a de facto monopoly status that has historically raised regulatory interest. In particular in the US. One could claim that, unlike Telcos who charge for communication, Google and Facebook do not charge for information access and social networking. How can something that is provided “for free” be a monopoly or be further commoditised? The answer is that the commoditisation we are referring to is not one of price. It is one of Google and Facebook services becoming synonymous to “having electricity” or “having running water”. It is about their services becoming so fundamental (as in human rights), that Google and Facebook will have to start complying with Net Neutrality 2.0. “Net” being here Google and Facebook infrastructure, data centers, core services, offering “neutrality” towards new, Web 3.0 Over-The-Top players. Think Google and Facebook evolving to bit-pipes for Web 3.0 companies. Ironically, Google and Facebook extending into communication only accelerates the broader adoption of their services as basic needs and their future as a bit-pipe for Web 3.0. The more voice, video, messaging and free internet access Google and Facebook offer, the more similar they become to total communication providers, and the faster they lose service differentiation. With a demographic evolution that sees digital technology reaching out to a younger generation of users (e.g. school kids) this process will only speed up. In summary, serving a basic need successfully for a mass-market is a sure road to becoming a commodity. Regulation takes care of that. This is not good or bad. It is natural evolution. CREDITS & REFERENCES For the avoidance of doubt, Neos Chronos is not affiliated with and has no financial interest in any of the companies mentioned in this article. All names and trademarks mentioned herein are the property of their respective owners. Please observe the Neos Chronos Terms of Use. The Guardian: EU court backs ‘right to be forgotten’: Google must amend results on request . The Guardian: Facebook bows to pressure on privacy settings for new users . Google: Google website. Facebook: Facebook website, WhatsApp acquisition. Twitter: Twitter website. Wikipedia: Internet of Things (IoT), Machine-To-Machine (M2M). INTRIGUED? For more information on how our advisory services could help you uncover emerging trends that could disrupt your business, please contact us to arrange an introductory meeting or Book a Discovery Session now! No cost, no commitment. Previous Up Next Neos Chronos Neos Chronos are an advisory services firm for startups and large enterprises. We care that enterprise executives solve their hardest strategic issues and avoid disruption, and startup founders accelerate growth and avoid business-critical mistakes. Copyright © 2013-2020 by Neos Chronos Limited - registered in England and Wales, number 08407585. VAT number GB159503400.
cc/2020-05/en_middle_0087.json.gz/line1337924
__label__cc
0.623637
0.376363
Pop-cultural Apocalypse By Michelle Cottle I'm sorry, but I'm not sure how anyone in my age cohort can be expected to work today. Michael Jackson and Farrah Fawcett both gone? That's an entire childhood's worth of pop cultural icons struck down--poof--with one turn of the clock. Like most of the free world, I recognized Michael as a genius, albeit a deeply screwed-up one. Of course, during the Billie Jean and Beat It era, we had no inkling of how far the littlest Jackson would sink into his own tragic Neverland. We just thought of him as a gifted singer with mind-blowing dance moves and a slightly quirky fashion sense. I prefer not to think about how many hours of my youth were lost to attempts at moon walking. And those weird zombie moves in the "Thriller" video? Beyond. I caught the 1984 "Victory" tour, though my seats were so high I needed an oxygen mask to get through the show. And while I never had the feverish, scream-yourself-silly, tatoo-his-visage-on-your-butt emotional attachment to The King of Pop that so many around the globe clearly did--truth be told, my adrogynous, eccentric, gyrating, black pop-god of choice was Prince--Michael, his music, and most definitely his videos defined a chunk of my generation's adolescence. That said, long before my girlfriends and I were paying attention to Michael, we idolized Farrah. Farrah. Farrah. Farrah. There will never be another like her, in part because, as the WaPo point out, today's cultural landscape is too fragmented for any one hottie--no matter how big the smile and how jiggly the assets--to hold such sway. We are talking about a woman who prompted an entire nation of girls to try and force their hair into those flipped-back feathered wings. For a gal like me who grew up in the swampy humidity of the South with stubbornly fine, straight hair, this was an unattainable dream. Oh, how I envied my friends Cathy and Stacy, who could, with one head toss and a liberal coating of hairspray, transform their whole heads into beautiful wings. I have often suspected that at least 20% of that whole ozone-hole problem could be laid at the feet of 1970s girls trying to attain Farrah hair. But Farrah wasn't just any old hottie. She was a particular kind of quasi-feminist hottie so popular in the '70s--when mainstream America was just getting used to the idea that women could be bad-asses and would even consider watching them do so on TV, provided, of course, that the asses in question were sexy enough. (The satin shorts craze helped enormously in this regard.) Female cop shows were all the rage. Angie Dickinson in "Police Woman." Teresa Graves in "Get Christie Love!" And, of course, Farrah and the gals in the unrivaled king of the genre, "Charlie's Angels." Impossibly, Farrah was only a regular character for the first of the show's five-season run, with sporadic appearances later on. But she is the Angel that everyone remembers and so many of us wanted to be. In hindsight, of course, Farrah was a problematic role model. Scanning the entire hot-cop lineup, she was by far the most kittenish, the most little-girl-like and least threatening--which unquestionably added to her popularity, especially among men. (Not that the curves and hair weren't enough.) In that way, she was a bit like Marilyn Monroe, simultaneously girlish and yet jaw-droppingly sexual. (Or, more recently, Scarlett Johansson--who, my husband shrewdly observes, has stormed to acclaim as an overgrown little girl with enomous knockers.) But my six-year-old friends and I never thought in those terms; we were years away from understanding the concept of "Jiggle TV," much less why it might be a bad thing. We liked the guns and the gowns and the karate kicks and the sight of a bunch of really pretty ladies getting the best of the bad guys. And, oh yes, we loved the fact that, week after week, the chicks dashed out to save the day while their faithful handler, John Bosley, functioned as a genial, glorified manservant; I vividly recall our neighborhood recreations of the show featuring much abuse of poor Bosley. What can I say? Even in the Deep South in the '70s we were tired of the guys having all the fun. And now. It's all over. No more King of Pop. No more Queen of Jiggle TV. There's nothing left to do now but get drunk, download "Thriller" onto the i-pod, and spend the day cruising YouTube for classic Angels clips. But first, I've got to dig out my old curling iron and AquaNet. I need just one more shot at those feathers in tribute to my fallen youth. --Michelle Cottle The Plank, Farrah Fawcett
cc/2020-05/en_middle_0087.json.gz/line1337926
__label__cc
0.55947
0.44053
Accuride International To Demonstrate ‘Infinite Possibilities,’ E-Commerce for Woodworkers at WMS 2019 SANTA FE SPRINGS, CALIF. (PRWEB) OCTOBER 31, 2019 Accuride® International, the world’s largest designer and manufacturer of sliding hardware, will show woodworkers at WMS 2019 the wide array of innovative, reliable solutions it offers to help them serve customers and stay ahead of competitors. WMS will be held at The International Centre in Toronto from Oct. 31 - Nov. 2. Exhibiting in Booth 1060, Accuride will provide interactive application displays, individual tours, and personalized demos. In addition to demonstrating its product solutions, the company will share information on its recently-launched online store and new website, which add convenience, education and support to the user experience. “Accuride helps the woodworking community explore and pursue infinite possibilities – encompassing all the rooms of a home or business, any size project, traditional or experimental design, and all kinds of furnishings,” said Sid Kalantar, Senior Vice President of Sales and Marketing for Accuride. “Professional cabinetmakers, furniture manufacturers and hobbyists count on us for myriad innovative and inspiring solutions.” Canadian popularity Many Canadian woodworkers depend on Accuride. For example, Devin Chisholm, of Bad Wolf Woodworking in Ontario’s Niagara Region, said: “The diversity in the Accuride lineup keeps me coming back. I know that whenever a customer has an odd request, I will find an Accuride product to address the requirement – whether, for example, the customer needs an extremely short slide, a slide for a pocket door in a closet, or a high-strength slide for a truck-bed extension. And I never have to worry about quality because it’s always top-notch. Accuride makes my job easier.” Visitors to Accuride’s WMS booth will learn how to use the company’s BHMA- and AWI-certified products for drawers, shelves, trays, doors, panels, computer screens and other fixtures. They will get to try out such features as Easy-Close, Touch-Release and Self-Close. Highlighted solutions Accuride will showcase these innovations: 116RC Heavy-Duty Linear Track System, a state-of-the-art, ADA-compliant solution for sliding doors that also supports such structures as large screens, panels, movable walls, and movable countertops Two-Way Travel Slides, which offer double extension where it’s needed most, including in kitchen islands, pass-through shelves, dining or entertainment bars, medical carts, and drawers or trays at drive-through pharmacies or banks Online-store benefits To expand access to its products, Accuride earlier this year launched an e-commerce site for North American customers, which it will demonstrate at AMS. “We created the online store to meet customers’ needs to be able to order a broad selection of our solutions anytime, anywhere and on any device,” Kalantar said. “Our e-commerce option closes geographical distribution gaps, letting customers purchase a full range of specialty products, as well as popular slides, including undermount and heavy-duty solutions.” Accuride solutions for woodworkers: https://www.accuride.com/woodworking-cabinetry Woodworker customer stories: https://www.accuride.com/blog/woodworking-blogs/workmanship-and-mastery-in-motion-get-inspired-innovative-with-three-woodworker-stories/ About Accuride® International: Founded in 1958 as a small tool and die shop, Accuride International is the world’s largest designer and manufacturer of sliding hardware. The company offers the broadest selection of movement solutions across markets and applications, as well as unmatched innovation, quality and dependability. Accuride produces light-duty, medium-duty and heavy-duty drawer and door slides for commercial and residential uses, and it is the leading producer of specialty slides. The company has nearly 1 million square feet of manufacturing space, spanning three continents. Its products are certified, compliant and warrantied, and they are widely specified by architects, designers and engineers. Heavy-duty draw latch Concordville, Pennsylvania – Southco Inc.’s heavy-duty 37 lever assist latch accommodates misalignment of heavier doors and panels. The newest 37 lever assist latch provides tight latch grip and additional clamping force in challenging operating conditions. Southco’s 37 latch series features a flexible design and substantial handgrip area that allows the latch to easily engage in challenging field conditions, even with gloved hands. Constructed of corrosion resistant, flexible rubber, 37 latches absorb and reduce vibration and will remain closed even when the application flexes or moves. Southco’s 37 draw latch series offers reliability in harsh outdoor environments, providing a robust, flexible latching solution for a broad range of challenging industry applications including off-highway, industrial machinery, and transportation. Global Product Manager Jim Grady adds, “Southco’s 37 draw latch series allows heavy panels to be latched securely, even when there are large variations in alignment and tolerance. With its rubber body construction, the 37 draw latch series eliminates vibration and noise, and prevents common paint or finish damage that may be caused by metal-on-metal contact.” 3634 + 3634EC Heavy-Duty for Wider Drawers Model 3634EC is a heavy-duty slide designed for wide drawers and includes an Easy-Close feature to bring drawers to a smooth, gentle close. Santa Fe Springs, CA – Accuride expands the company’s heavy-duty product line with the addition of model 3634 and its Easy-Close counterpart (3634EC), soft-closing slides designed for drawers up to 42″ wide and loads up to 150 lbs. The 3634EC fulfills the market need for a reliable soft-closing slide solution for wide-drawers–perfect for a range of commercial applications. The optional Easy-Close feature brings drawers to a smooth and gentle close, helping to prevent the shifting of contents when closing. Both 3634 models have the same cabinet member hole pattern as Accuride’s 3832 slides, simplifying installation and saving valuable time in high production environments. Additional features for both 3634 + 3634EC include 1″ of over-travel to provide full access to drawer contents, and silencing to ensure quieter operation. These products are unhanded and offer a lever disconnect to facilitate drawer removal. Both products are available in clear zinc (C) or electroplate black (CB) finishes, in lengths of 12″–28″. The 14″ length is full extension only (no over-travel). Model 3634 (without Easy-Close), supports loads up to 200 lbs. when side-mounted and 75 lbs. when flat-mounted. The 3634 includes a hold-in detent feature to help keep drawers in a closed and secure position. These slides are the ultimate solution for wide drawer applications supporting kitchen pots and pans, dishware, and small appliances. Commercial applications include file or supply storage in business and medical offices, as well as retail displays and fixtures. Stay tuned for more information from Accuride. About Accuride International: For more than 50 years, Accuride International has been a leader in the design and manufacture of ball bearing slides and movement solutions for a broad range of applications across a variety of industries. Offering engineering and product design, application solutions, manufacturing expertise, and more, Accuride is a worldwide presence that can collaborate with companies in any industry, anywhere. For more information, visit http://www.accuride.com. Micro-Living with Accuride in Action The micro-living movement continues to grow, featuring affordable and efficient designs for different, adaptable lifestyles Accuride solutions are used in a variety of micro-living builds, such as tiny homes, rental campers, renovated buses, and overland trucks Popular choices in micro-space projects include our 3135EC Easy-Close Undermount Slides and 9300 series for functionality and reliability The practice of micro-living—an ongoing movement to live tiny, affordably, and efficiently—is growing larger. In a previous blog post, we told you about the history of micro-living and how you, too, could start living smaller and smarter with innovative designs. Today, we want to spotlight the many ways Accuride solutions have made downsizing possible. Get inspired by these examples of micro-living with Accuride in action, at home and on the road. Tiny Homes and ApartmentsDownsizing your house is one way to minimize expenses, allowing you to expand your lifestyle elsewhere. At the forefront of the micro-living movement are tiny homes. No matter how big or small your living space is, Accuride has a solution for your build. FutureHAUS is one bold and inventive tiny home featuring Accuride’s slides. Joseph Wheeler, a professor at Virginia Tech’s College of Architecture and Urban Studies, led a team that designed this energy-efficient, modular concept home, which occupies merely 900 sq. ft. Most impressive is FutureHAUS’ adaptability and movable environment. Fixtures, lighting, and spaces automatically adjust to the size of the user. For every movable portion of the home, Accuride products are used. For example, our 116RC Linear Track System provides an affordable, lightweight solution for smooth, linear movement to the upper and lower cabinets in the kitchen. You might also consider our 115RC Medium-Duty Linear Track System as an alternative for lighter loads. Tiny homes don’t have to be houses. In small apartments, designers are constantly inventing new ways to maximize storage and organization. For instance, our 2907 Light-Duty Slides were used to make this slide-out eating counter—one useful way to expand your cooking and dining area. TrailersThe micro-living movement extends beyond stationary homes. On the road, micro-living with Accuride can be seen in trailers of all shapes and sizes. For example, Carapate Aventure designed a dreamy, functional homage to teardrop trailers with this mini-caravan that answers nature’s call to adventure. The trailer offers a stylish living space, equipped with a bed for two, wide windows for a sprawling view, and an indoor/outdoor kitchen for maximum efficiency. Carapate Aventure chose our 9301E Heavy-Duty Slides, which can support up to 600 lbs. and are perfect for boosting weighty pullout pantries. There are countless Accuride solutions for trailer designs, as demonstrated by The Modern Caravan. This creative duo enlisted Accuride 3135EC Easy-Close Undermount Slides for kitchen drawers and under-bed storage in a renovated trailer called “Hope.” Kate Oliver and Ellen Prasse, the married couple who founded The Modern Caravan, have remodeled nine custom vintage Airstream trailers together. The owners’ passion for quality materials led them to Accuride. Our 3135EC slides, in particular, use Accuride’s patented Easy-Close technology, ensuring your cabinets won’t slam or rack while you live on the go. With Accuride’s slides, you never have to sacrifice storage for a compact home on the road. VansIf you’re looking for a temporary micro-living solution, check out camper rentals, such as Voyager Campervans, which offer small-scale leisure breaks. Based in Minneapolis and founded by Grady Linder, Voyager Campervans provides eco-friendly rentals for travelers looking to explore nature comfortably. To maximize space in these compact cargo vans, Voyager Campervans’ vehicles offer innovative storage solutions and hidden pullout furniture, including a sleeping bunk, a pullout kitchen, and rear storage. For these pullouts, 9308E Heavy-Duty Lock-In & Lock-Out Slides provide effortless movement with a crucial locking feature that keeps drawers and trays closed or opened. Overland VehiclesAccuride solutions are used not only in homes and on the road, but also off the road in overland vehicles. In fact, our drawer slides are transforming outdoor living with their versatility and dependability in robust projects. Into The Wild Overland, for example, designs sturdy trailers that can handle tough terrain. Founder Matt Reichel likens his trailers to Swiss army knives. The comparison is apt, given that these trailers are packed with amenities to fit all your needs. Those include a 100-watt solar panel, a bed for two, a hot-water shower, and a fully-equipped pullout kitchen. That’s where our 9300 Heavy-Duty Slide Series comes in. Matt chooses Accuride to handle heavy loads and ensure security in his overland trailers. For epic trips, check out Corey Whitaker of Overland Dad. Father to twins and owner of a modified Land Cruiser 200, Corey shows us that Accuride solutions look great in any vehicle. His rear cargo system makes the most of our 9301E Heavy-Duty Full Extension Drawer Slides’ increased load capacity and shock-absorbing ball-bearing space bumpers. Wherever your adventure takes you, Accuride solutions will help you get there. Whether you build the tiny home of your dreams or hit the road to see the world, Accuride has the perfect space-saving solution for your project. At Accuride, we’re always moving forward, because we know you are, too. Where will micro-living take you? Have you designed a remarkable tiny living space? We want to see it! Show us your crafty homes and renovated vans, trucks, and buses. Tag us on Instagram or use the #Accuride for a chance to be featured among our inspiring builders and DIYers. Follow us on Facebook, LinkedIn, Pinterest, Twitter, and YouTube for the latest on the possibilities with micro-living. Southco's R4-82 Rotary Latch with Paddle Actuator Southco, Inc. has recently expanded its successful line of rotary latching solutions with the launch of the R4-82 Rotary Latch with Paddle Actuator. The newest addition to the R4 Rotary Latch series combines a compact rotary latch with a heavy duty, square paddle actuator, enabling direct actuation without the need for a connected cable. Available in steel with corrosion resistant zinc plating or black powder coat finishes, the R4-82 offers versatile key locking security. By combining both rotary latch and actuator into one solution, the R4-82 simplifies installation without sacrificing strength or performance. With high ultimate load for heavy duty applications and options for thru hole or stud mounting, the R4-82 is an excellent solution for exterior applications that require robust performance. The R4-82 Rotary Latch includes an integrated bumper for reduced vibration, and is available with single or two-stage latching for enhanced safety and security. Global Product Manager Cynthia Bart adds, “The R4-82 Rotary Latch with Paddle Actuator is a comprehensive solution that simplifies design and installation. The R4-82 builds off of our current rotary solutions, but features a reinvented paddle with a square shape that complements the modern exterior design of Industrial Machinery, Rail and Off-Highway applications.” For more information about Southco’s complete line of R4 Rotary Latching solutions, please visit New Lever-Actuated Plunger from Southco Saves Time When Removing Electronic Components CONCORDVILLE, Pa., October 16, 2019 — Southco, Inc., a global leader in engineered access solutions, has extended its successful line of captive hardware with a new version that features lever-actuated operation for faster and easier latching and unlatching of electronic components. Southco’s compact lever-actuated 56 Spring-Loaded Plunger offers an improved grip for simplified hand operation and saves time when installing or removing components in tight spaces. Southco’s lever-actuated 56 Spring-Loaded Plunger boasts a useful hold-open feature when the lever is actuated, providing clear visual confirmation when the plunger is unlatched and keeping the plunger in a retracted position for easy removal. Actuated with a single motion, the lever-actuated 56 Spring-Loaded Plunger saves time in comparison to current round knob, hold-open versions requiring a two-step lift and turn operation to unfasten. Additionally, the lever-actuated 56 Spring-Loaded Plunger is available in prism colors for differentiation between application zones and is available in thread-in, flare-in and press-in installation options. Global Product Manager Jim Grady adds, “The easy to grip lever-actuated 56 Spring-Loaded Plunger provides quick hand operation for latching and unlatching, facilitating the installation and replacement of components used in various electronics applications including HDD carriers, metal trays and power supplies.” For more information about Southco’s complete line of Captive Screw solutions, please visit southco.com, email the 24/7 customer service department at southco.com/contact/en, call 610-459-4000 or fax your inquiry to 610-459-4012. About Southco Southco, Inc. is the leading global designer and manufacturer of engineered access solutions. From quality and performance to aesthetics and ergonomics, we understand that first impressions are lasting impressions in product design. For over 70 years, Southco has helped the world’s most recognized brands create value for their customers with innovative access solutions designed to enhance the touch points of their products in transportation and industrial applications, medical equipment, data centers and more. With unrivalled engineering resources, innovative products and a dedicated global team, Southco delivers the broadest portfolio of premium access solutions available to equipment designers throughout the world. ABB’s Steel City® 8-inch recessed poke-through floor box named a NECA Showstopper The Steel City® 8-inch recessed poke-through (RPT8) floor box from ABB Electrification’s Installation Products business was among the Showstopper winners announced at the National Electrical Contractors Association (NECA) Show held in Las Vegas, Sept. 14-17. The Showstopper winners were chosen from a showcase of 157 new products that exhibitors submitted for consideration for use by electrical contractors on the job. Each winner was selected from one of five categories. The Steel City RPT8 floor box was recognized in the Low Voltage category. The Steel City RPT8 floor box features five gangs and is round to fit into an 8-inch diameter drilled hole. Two gangs are dedicated for power, while the remaining three gangs can be individually configured for any combination of power and data. A unique feature is the center compartment, which is rated for a wiring device of up to 50 amps and can accept ground-fault circuit interrupters (GFCIs) and twist-lock devices. There is also a bottom compartment that can be configured for separate emergency power. In commercial applications, the increased use of laptops and mobile devices has driven demand for more outlets. The 2017 National Electrical Code (NEC) includes section 210.71, which requires the installation of floor boxes in commercial building meeting rooms of more than 215 square feet. The new NEC requirement seeks to reduce the safety hazards that occur when cables run from a table or desk to wall outlets. “Given the limitations on the number of holes that may be drilled into a floor, it’s important to maximize the outlet capacity of each location,’’ said Michael Martin, senior product manager at ABB Installation Products. “The new NEC requirement and the increase in the use of cabling creates a unique opportunity for contractors, in not just new commercial construction, but also in upgrading the even larger pool of existing commercial building spaces. The Steel City RPT8 floor box is ideal for these installations on the second floor and above in commercial buildings.” The Steel City RPT8 floor box also features a core-drilled design that eliminates the chance of error when the floor box is installed in a hole that is core-drilled after all walls and cabinetry are set. These errors would otherwise result in costly jackhammering and concrete repairs ABB’s Electrification business recently announced $120m in investments to its U.S. operations, including building and production expansions, new hires and equipment improvements. ABB (NYSE: ABB) is a pioneering technology leader with a comprehensive offering for digital industries. With a history of innovation spanning more than 130 years, ABB is today a leader in digital industries with four customer-focused, globally leading businesses: Electrification, Industrial Automation, Motion, and Robotics & Discrete Automation, supported by its common ABB Ability™ digital platform. ABB’s market‑leading Power Grids business will be divested to Hitachi in 2020. ABB operates in more than 100 countries with about 147,000 employees. New Exoskeleton Shoulders Rehab Burden for Stroke Patients Device assists physical therapists in improving functionality for stroke patients. Bob Whitford is not a man who gives up easily, not in his personal or professional pursuits. Whitford, a senior occupational therapist at St. David’s Medical Center in Austin, Texas, lost his arm as a young boy but overcame his disability to achieve success in competitive cycling. He eventually won a bronze medal in cycling while competing for the USA Paralympic team. At St. David’s, Whitford strives to help patients show the same determination in their rehabilitation paths, especially patients who have suffered a stroke, one of the nation’s leading medical concerns. In 2014, St. David’s opened a center to provide a continuum of care for stroke patients who survived strokes at a young age. The center is one of the few in the nation that focuses on meeting the unique goals and rehabilitation needs of younger and active stroke patients. A new bilateral upper extremity device called Harmony, is assisting Whitford and patients in their rehabilitation journey. “Upper limb exoskeletons are emerging in the rehab market due to recent technology advancements that have made it possible,” Whitford said. “I believe we are just scratching the surface on exoskeleton technology development and we will continue to make rapid progress as industrial robotic technologies drive the industry in biotech applications.” Shoulders and their intricate anatomical patterns provide a unique challenge for designers of exoskeletons. Strokes often cause paralysis or weakness of one or more of the muscles in the arm or shoulder, and shoulder pain is common. Treatment and rehabilitation begin shortly after the stroke occur. Harmony, which was developed by Harmonic Bionics in Austin, Texas, tracks the shoulder joint as well as the scapular movement of the shoulder girdle. The exoskeleton maximizes the range of motion of the human shoulder and the shoulder girdle while ensuring safety with physical and programmed interlocks. Harmony allows physicaltherapists to work with the patients to improve the functionality and healing from neuromuscular damage. “Our target is to get stroke patients moving the hemiparetic arm (the arm on the side impacted by the stroke) more efficiently and fluidly, which leads to improved outcomes,” Whitford said. “Increasing range and coordination of movement is always the goal with our neuro-injured clients.” “Our robotic solution frees the therapist to do what they do best and that is to interact with the human, which is an underrated but critical part of the recovery process,” said Rohit John Varghese, Harmonic’s head of product development. “It creates an intimate dynamic between the therapist, the patient and the robot. The result is that survivors of stroke will get better faster and more effectively.” Ensuring Alignment With The Patient The critical piece in Harmony is a unique shoulder mechanism that powers coordinated motions of five joints in the shoulder complex, which is the key to shoulder rehabilitation according to Professor Ashish Deshpande, director of the ReNeu Robotics Lab where the project was conceived. The project began in the ReNeu Robotics Labat The University of Texas’ Cockrell School of Engineering in 2011 with funding from the National Science Foundation. Ensuring alignment between the exoskeleton and the patient is critical to prevent stress on the patient's joints and protect them from injury. Each side of the robot moves the patient’s arm and shoulder through the full natural range of motion. It can be adjusted for people of all shapes and sizes. The Harmonic team used information from extensive databases to collect its anthropometric size data. Based on that data, Harmony can be adjusted to fit more than 95 percent of the American population. To be effective in a clinical setting, it is important for the exoskeleton to quickly and smoothly change its physical dimensions to align with different body sizes. Oil-based lubrication for the linear bearings causes many issues, including the accumulation of dirt, which allows for bacteria to accumulate. In addition, the resizing mechanisms need to be highly compact to allow room for the electronics and actuators. All linear bearing mechanisms need to lock once in position to prevent unwanted changes in size. The Harmonic team solved multiple issues by choosing linear bearings from igus, the Germany-based manufacturer of motion plastics. The company runs its operations out of Providence, R.I. The bearings allow for smooth and bind-free size adjustment without lubrication and size and weight reduction. Harmony includes six iglide J bearings, a versatile endurance performer that exhibits low wear against different shaft materials and low coefficients of friction in dry operation. They are cost-effective bearings when low-pressure loads are needed, and are frequently used in automation, printing, packaging technology and aerospace engineering. A custom bearing housing retains a drylin R linear plain bearing liner, which reduces the size significantly compared to previous models of the exoskeleton. drylin R products are made with the iglide J material, and are frequently used in packaging, food processing, and lab automation equipment. The shoulder mechanism also includes drylin R bearings, which operate dry and are resistant to the chemicals used for frequent cleanings. dryLin T rail guide systems manufactured by igus ensure high rigidity in the stand for the exoskeleton. The guides are extremely resistant to dirt and offer a low coefficient of friction and wear. They are also frequently used in machine building, machine tools, package handling and the woodworking industry. “We needed to design the exoskeleton to have some kind of linear motion that is reliable across the life of the robot,” Varghese said. “It needed to be lightweight, and it needed to be clean. We could not introduce greases and oils into a medical setting. The igus components met all of these conditions. They were exactly what we were looking for.” Focusing on The Shoulder Incidents of stroke are forecasted to rise significantly over the next 10 years, which was one of the primary reasons Harmonic dedicated its research toward developing an exoskeleton for stroke patients. “As medical care gets better, people live longer,” Deshpande said. “Also, trend lines show increasing incidences of stroke among younger populations. That results in lost productivity and a longer duration of suffering.” Many assistive devices have focused on ambulation, improved functionality of the legs. “Thanks to thesuccess of the ADA in the United States, a lot of that problem is being solved with wheelchair accessibility,” Deshpande said. “But the next stage to enabling the basic activities of daily living, is helping stroke survivors and other people with neuromuscular diseases to become more independent and restore function to the upper body.” Research on improving physical therapy techniques of the shoulders is greatly hindered by the highly subjectivemetrics that are used for assessment of recovery. “The gold standard assessment scale for recovery is still a subjective assessment by the therapist on the scale of 1-5,“ Varghese said.“It’s difficult to come up with an alternative form of measurementwithout a device like Harmony, especially for the shoulder. It’s such a complicated joint—not just the ball and socket—but thecomplex motion of the shoulder girdleas well. We must make sure the arm and the shoulder move in coordination. The exoskeleton re-teaches that coordination.” Long Rehab Journey There is no quick fix for stroke patients in their rehabilitation. The path toward regaining functionality is time-consuming and arduous, and many patients express frustration at the inability to make swift, significant strides. “The biggest challenge with stroke survivors is the duration required to retrain the injured brain to a function level and the patience required by the survivor to persist in their own rehab journey,” Whitford said. “Many patients give up too soon or develop bad habits that persist throughout the rest of their lives.” Harmony helps gives immediate and accurately measured feedback. For him and other therapists, it will be a valuable tool in helping a stroke patient advance towards normalizing movement. “We are limited at the clinic, and sometimes it takes years of therapy to become functional,” Whitford said. “There is a misconception that normal use and movement will be restored fully. Our hope is to provide an adjunct to existing strategies in clinics and at home with stroke patients.” 6 Discrete Designs Using Accuride Slides In this blog post, we want to inspire you with projects that offer more than meets the eye: secret drawers and surprise compartments, to name a few. Whether you’re looking to increase security or expand storage space in your home, Accuride has a solution for your needs. Here are six hidden designs that transform everyday furniture into extraordinary opportunities for extra space. What might you spy with your little eye? 1. Pocket DoorsCounter space isn’t always readily available in a kitchen. Give yourself a little more room with pocket doors. Pocket doors “disappear” into wall crevices, creating more space in a super sleek way. They are also are an easy way to revitalize your cabinets in a hallway, dresser, or closet. Our CB1321 Pro Pocket Slides have an auto-open feature that gently springs doors forward, ensuring your pocket doors are extended fully before closing. They are also designed to eliminate scuff-and-scrape-causing impacts on your pocket doors. Impress house guests with more than just your savory cooking—conceal kitchen appliances with this secret compartment, made possible only with pocket doors. 2. Pantry PulloutAre you still looking for more kitchen space-saving solutions? Check out this custom-built pantry pullout from Curtis Doeve. Curtis knows a lot about making the most of the small spaces you have. His work turns everyday cabinets into something more useful and unique. We may not think about pantry pullouts as secret compartment furniture, but their hidden design adds storage space with subtle elegance. Store spices, canned foods, condiments, and non-perishables here to free up more room in your kitchen shelves. We recommend our 3634EC Medium-Duty Slides with Easy-Close for pantry pullout projects like this. Features such as easy-close and quiet operation add a feeling of luxury, making this secret design one keep an eye out for. 3. Puzzle Coffee TablePuzzle lovers rejoice! The missing piece to your living room has been found. Dede Bailey of Designed Decor crafted this beautiful coffee table, which features compact, covert drawers that can easily be hidden or put on display. For this project, we recommend our 3832E Light-Duty Slides. These tried and trusted slides fit a wide range of uses, including the pullout drawers featured in this build. You can have it all with this hidden design: your gorgeous, functional coffee table and your unique, communal puzzle space. Transform your living room into a game room in an instant, and then turn it back with none the wiser. 4. Secret Bookcase DoorSome secrets are worth sharing. This bookcase, which doubles as a secret door, is one we have to talk about. Designed by Ryan Scurfield of Scurfield Woodworks, this multipurpose shelf beautifully displays your book collection, photographs, and curiosities—and then opens into an entirely new room! We love the beautiful walnut finish of this particular build, which adds an extra layer of elegance to the build. Our 116RC Heavy-Duty Linear Track System is the perfect movement solution for this hidden door, instead of traditional hinges, to keep operations subtle and smooth. Alternatively, you can try our 115RC Medium-Duty Linear Track System for lighter projects. Invite a little magic into your home with this exciting addition. 5. Concealed DesktopYour home office is an essential part of your living space. When work responsibilities spill over into the weekend, you need a place to get work done reliably. Why not make the most of this space with a secret compartment for your most valuable technological asset: your computer? To achieve this concealed desk transformation, use our Ascent CBLift-0019. This technical lift is uniquely engineered with a slim and compact design and allows you to lower and raise your device from your work area with a simple push. For additional tidiness, add a keyboard tray using our 2109 Light-Duty Slides, which allow you to effortlessly hide your keyboard under the table to free up space. Organization has never been so slick or so simple. 6. Secure CabinetryWhen it comes to security, collectors know only the best will do. Keyholes and keypads, however, can detract from the careful design of showcases. If you want a secure way to present collectibles, consider Senseon. Senseon is an award-winning system that brings building access control to the cabinet-level. Commercial-grade concealed locking systems such as Senseon’s RFID locking system guarantee that your valuables will stay safe while stored in your home. Jim, a collector, uses Senseon because it’s a low-profile and easy-to-use locking system that he could install once and not have to tend to it regularly. With this build, you can protect your collectibles without sacrificing design, so your treasured collectibles are the only things on display. Secret storage spaces don’t have to be complicated. These hidden designs provide polished aesthetics, as well as practical functionality. We love the versatility displayed in plain sight and the extra belongings stored away safely. Accuride can help you build it, secure it, and store it securely. There are infinite possibilities for what furniture you might repurpose—what will you create next? Have you designed secret compartment furniture before? Show us your top-secret projects! Tag us on Instagram or use the #Accuride for a chance to be featured. Follow us on Facebook, LinkedIn, Pinterest, Twitter, and YouTube and keep an eye out for more hidden designs. Keysight Technologies, Integrated Device Technologies Collaborate on Component Characterization of 5G mmWave Beamforming Integrated Circuits Keysight’s 5G solutions enable beamformer provider to accelerate performance validation of designs for 5G NR base stations SANTA ROSA, Calif.--(BUSINESS WIRE)--Keysight Technologies, Inc. (NYSE: KEYS), a leading technology company that helps enterprises, service providers and governments accelerate innovation to connect and secure the world, announced an extended collaboration with Integrated Device Technologies, Inc. (IDT), a wholly owned subsidiary of Renesas Electronics Corporation (TSE: 6723), on component characterization of 5G new radio (NR) mmWave integrated circuit (IC) beamformers to accelerate development of 5G NR base stations. .@Keysight and Integrated Device Technologies Collaborate on Component Characterization of #5G #mmWave Beamforming Integrated Circuits. Keysight’s enables @RenesasAmerica to accelerate performance validation of designs for #5GNR base stations Tweet thisNetwork equipment manufacturers (NEMs) use beamforming technology in 5G NR base stations to improve reliability and efficiency in the mmWave frequency spectrum. Beamforming uses multiple antennas (a phased array) to transmit the same signal, thereby increasing the signal strength to and from a chosen direction to extend cellular coverage, delivering higher data rates and an improved radio environment. “Our close collaboration with Keysight enables us to validate that our 5G beamformers and other components deliver the high performance and low-power consumption essential for 5G network infrastructure equipment,” said Naveen Yanduru, vice president and general manager of IDT’s RF product division. As the bandwidth of integrated circuits using 5G technology increases, it is important to characterize their performance over wider frequency ranges. This is why IDT uses Keysight’s high performance family of vector network analyzers (VNAs) to validate the performance of its beamformer ICs. Keysight solutions enable IDT, and other leading designers of ICs, to measure key parameters such as scattering (S) parameters, 1dB compression point (P1dB), third-order intermodulation products (IM3), and error vector magnitude (EVM). “Our extended collaboration with IDT demonstrates how Keysight’s 5G beamformer IC test solutions enable designers of beamformers to validate performance using high precision measurement and simulation tools, ensuring reliable and efficient designs,” said Kailash Narayanan, vice president and general manager of Keysight's wireless test group. The two companies will use the Keysight Streamline USB VNA to demonstrate IDT’s active beamforming radio frequency integrated circuit (RFIC) for 5G NR at the 2019 IEEE International Symposium on Phased Array Systems and Technology (Array2019) taking place October 15 – 18, 2019 in Waltham, MA. Achieving Big Solar O&M Savings by Focusing on the Smallest Part How NEXTracker saves time, money, and labor on installation of solar power plants. ​Fasteners are a key but often overlooked aspect of racking system installation and maintenance. NEXTracker, one of STANLEY® Engineered Fastening’s premier customers, designs, manufactures, builds, and services the world’s most advanced single-axis solar tracker systems for small to utility-scale power plants around the world. As the cost of panels drop, improving fastener efficiencies have proven to be an unexpected opportunity to save time, money and labor on the installation and maintenance of their solar plants. NEXTracker has performed considerable cost evaluations of the tracker portion of operations and maintenance (O&M) budgets on sites small and large. O&M costs represent the annual expenditures required to operate and maintain a solar CSP plant over its lifetime of 30 years. In their analyses, they’ve found that conventional linked-row trackers typically use 85% more fasteners than are used on their NX Horizon™ self-powered trackers. That’s because the majority of these fasteners are permanent and "swaged" or fastened, requiring little or no maintenance. In order to deliver the best value and highest performance to our customers, we invest in new technologies that will reduce installation cost and improve long term durability and reliability.— Dan ShugarChief Executive Officer, NEXTrackerMaintaining the system hardware of a panel’s mounting structure can be a tedious and costly process. Dispatching crews to check the torque on screws or lubricate joints are activities that can add thousands of hours to an annual O&M budget, but in a centralized single-axis tracker (SAT) it must be done since failure of a single component can impact system performance dramatically. "In order to deliver the best value and highest performance to our customers, we invest in new technologies that will reduce installation cost and improve long term durability and reliability," states NEXTracker CEO Dan Shugar. "We are always looking for ways to reduce our environmental impact by eliminating waste and improving our operating efficiency.” System hardware that does not require torquing, but instead relies on the tension between components will reduce the need for manual checks. Torquing, the twisting force required to spin a nut up a bolt, is by nature inexact because of the many factors that can affect friction—from surface texture to debris, rust and humidity. By contrast, "tension” involves the use of battery-powered or hydraulic tools to stretch screws and swage to fasten bolts to a structure. ln fact, the swaging of a lockbolt is five times stronger than its nut-and·bolt counterpart fastening system. Regular nuts and bolts have a gap which can cause loosening by vibration. NEXTracker uses highly durable, permanent fasteners, developed in part with STANLEY Engineered Fastening, that do not loosen over time, thereby eliminating the need for periodic torque checking. No oils or lubricants are required in the maintenance of the system, as all motors and gears are sealed. Additionally, NEXTracker relies on installation tools like the PB2500N NeoBolt® cordless lockbolt tool to provide enhanced mobility in the field without the constraints of cords and air-compressors, improves accessibility to narrower spaces and maximizes output and reduces operator fatigue thanks to its lightweight, ergonomic design. The cordless installation tool from Stanley Assembly Technologies has delivered huge improvements in the speed and efficiency with which we install our solar trackers. Instead of carrying a heavy generator and compressor around a large jobsite and spending hours maintaining and refilling this equipment — our teams have the freedom of a battery powered tool," explains NEXTracker CEO Dan Shugar. Another way NEXTracker reduces time and labor costs on the maintenance of NEXTracker solar systems is because the sturdier fasteners and hydraulic installation tools they use help minimize damage during hurricanes and other extreme weather events. According to GCube, a leading renewable energy insurance provider, weather is the #1 source of insurance claims. In fact, issues related to fastener and equipment performance are further exacerbated by extreme weather risk, with events such as wildfires, hurricanes and tornadoes now occurring out of season and rising to 15% of all claims in 2018. Fastener installation and maintenance may not be the most expensive component of the solar tracking system. But NEXTracker knows that improving fastener efficiencies by tapping into proven and emerging fastening technologies can lead to big O&M savings and enhanced protection against extreme weather risk Striking a Better Chord The piano is one of the world’s most popular musical instruments, but its mechanics and design are much the same as those made a century ago or more. Now, an English piano builder—who is an engineer and a pianist as well—devised what is being called a unique hammer system incorporating 3D-printed tribopolymer components that produce improved sound as well as durability and climate resistance. Phoenix Pianos founder Richard Dain became interested in improving piano design as far back as 2003, work that led to design of a carbon fiber soundboard, said Phoenix’s James Bacon, who advised on and built the prototype. He next turned his attention to the hammer assembly, which strikes the piano’s strings to create sound. A traditional hammer assembly—unchanged since the 19th century—consists of three parts made from hornbeam wood: the hammer flange that is fixed in place; a hinged shank that defines the flight of the hammer; and the hammer itself. Although hornbeam is very hard and durable, it suffers from changes in temperature and humidity. Over time, the assembly warps and drifts, causing irregular strikes that affect the sound. Technicians must adjust or replace the assembly to ensure predictable and quality sound. Further Reading: Additive Manufacturing: From Prototypes to Manufacturing Transformation Dain wanted to replace the wood with carbon-fiber and create a bush-less hinge assembly and approached Cologne-based igus because of its work with plastics and polymers. Bushings are made from cylindrical felt inserts to provide an interface between center pins and wooden parts. Fitting them properly is critical but tedious; they must be snug enough so the hammer does not wobble but still allow smooth operation. Eliminating the bushing could create a more efficient system. Bacon said igus engineers produced CAD drawings of the new design and suggested its tribopolymer material used in industrial applications as the replacement for wood. Bacon said the material is key to the new assembly’s success. Polymer piano hammer was designed and produced with Germany’s igus. Photo: igus “In a traditional wooden hammer assembly, you might think of it as a fork and blade assembly, there is a part in that system called the drop screw, which is part of the regulation of the piano, it's absolutely critical,” Bacon said. “And in a traditional wooden action it actually goes into blade, which is the center part. And they are very easily broken, because you're drilling quite a substantial hole through a very thin piece of wood and the amount of material either side is minimal.” “It is an inbuilt intrinsic weakness to that system. So the first thing Richard did was to design this part the other way around, so the drop screw goes through the fork. After a number of iterations, we have gravitated upon using a 2.5-millimeter roller bearing. It's a very, very smooth and strong system and is highly effective in controlling the hammer’s flight,” Bacon said. Further Reading: Six Innovative Ways to Use 3D Printing The pins are center points for the bush-less system. With a 30 percent increase in diameter, they are stronger, smoother and more dimensionally precise than traditional wire center pins, he said. “It’s 3D-printed material, we can create our parts from our files, which are enormously accurate,” Bacon noted. He added that the material is very easy to ream, ensuring a firm fit for the center pins, and is not subject to temperature or humidity variations. A pianist himself, Bacon said the new assembly also better stands up to more powerful strikes that often cause the traditional wooden assembly to drift. The assembly has been rigorously tested on a player piano and Phoenix now is manufacturing them for its line of pianos.
cc/2020-05/en_middle_0087.json.gz/line1337927
__label__cc
0.582155
0.417845
Condo Amenity Charts Your new condo search starts HERE Everything for your condo under our roof! SkyTower – the latest phase of Pinnacle One Yonge aims high at 95 storeys December 30, 2019 Communities, Condo LifeAnson Kwok, new condo Toronto, new condos Toronto, One Yonge, Pinnacle International, Pinnacle One Yonge, SkyTower, TorontoRegina Gadacz With so many condominiums being created across the GTA, some developers feel they need to keep themselves front of mind for prospective buyers. They hope that a high-profile team means a trusted team. That isn’t always the case. Sometimes, it’s the companies working quietly that are doing the most notable work and building the most solid reputations. For more than 40 years, Pinnacle International has let the quality of its buildings do the talking. A leading builder of luxury condominium residences, masterplanned communities, hotels and commercial developments, Pinnacle has more than 25 projects in the Vancouver area alone. And with more than 10 million sq. ft. now under development in North America, Pinnacle’s output speaks volumes. “Our projects are large in scale, and they can take up to 10 years to develop,” explains Anson Kwok, Pinnacle’s vice-president of sales and marketing. “As a result, the residents in our master-planned communities stay loyal to us. It’s a big repeat-customer base and we, in turn, commit to staying engaged with them.” That measure of relationship-building allows Pinnacle to build its brand organically, through word of mouth from satisfied clients. That satisfaction stems not just from the care that Pinnacle puts into suite layout and amenities. The team really does remain involved with its buildings, even after completion. “Many of us at Pinnacle are residents of highrise buildings and we understand the lifestyle,” says Kwok. “I’ve been living in condos for 16 years and, like me, everyone on the team can relate to the nuances of what makes a building a great place to live. We understand the importance of good maintenance and management, so we remain hands on.” It’s a corporate philosophy the company believes serves it well, as Pinnacle looks to further enhance the Toronto skyline. And plans for Pinnacle One Yonge in Toronto are creating a lot of buzz. “Pinnacle One Yonge is such an exciting and important project for us and for the city of Toronto,” says Kwok. “From the magic of the location, where the lake meets the foot of Yonge Street, to the history of that parcel of land (site of the Toronto Star building), we knew we had to develop in a way that not only delivered upon and improved the luxury residence experience, but serviced the greater area in progressive ways.” Pinnacle One Yonge does exactly that, with plans for more than 50,000 sq. ft. of community centre space, and 2.5 acres of park space. But it’s the bold design of SkyTower, the most recent offering at Pinnacle One Yonge, that really affirms Pinnacle’s place as an elite developer. SkyTower’s expansive 840 units will rise to an unprecedented 95 storeys, making this beacon of luxury living the tallest building in Canada. With distinctions like these on display, need Pinnacle say more? To be among the first to learn about SkyTower, register online. Pella Windows & Doors of Toronto With a foundation built on respect, integrity, honesty, and responsibility, it’s no wonder homeowners in the greater Toronto area choose Pella for their residential or commercial window and door needs.
cc/2020-05/en_middle_0087.json.gz/line1337932
__label__wiki
0.676776
0.676776
Bradley Manning sentenced – has already served three years, to serve 32 more 21 Aug 2013 11 Data loss, Law & order Previous: US science fund pumps $20 million into cybersecurity research Next: 5 tips to make your Facebook account safer by Paul Ducklin The news is out on Bradley Manning’s sentence: 35 years of imprisonment. Manning, 25, is a US army private who famously (or infamously, according to your point of view) spilled secret US data to WikiLeaks, including a huge tranche of diplomatic cables from the US State Department. Manning, who was arrested in May 2010, has already served more than three years while awaiting trial and sentencing. He now nevertheless still faces more than three decades inside, though he may be eligible for parole in one third of that time. He was recently acquitted of “aiding the enemy,” a charge that could have seen him locked up for the rest of his life. The story of how Manning is said to have exfiltrated decades of State Department communications from a secure area is now legendary. Apparently, he pretended to bop along to music by Stefani Joanne Angelina Germanotta (better known as Lady Gaga) that was supposedly playing from a rewriteable CD; in fact, he was burning hundreds of thousands of diplomatic cables to the disk instead. The musical miming supposedly provided visual cover for the fact that the CD light advertised that the device was busy. Germanotta distributed a message in support of Manning after his sentence hit the news. You’ll find it on her Twitter feed, amongst the ads for her just-released new album. Julian Assange, the WikiLeaks personality who handled Manning’s leaked data, remains a free man, strictly speaking. However, Assange is as good as incarcerated: he sought and was granted political asylum in Ecuador, and is currently holed up in a small diplomatic flat in London that is considered Ecuadorean territory. He is unable to leave the flat because he would be re-arrested in the UK, having jumped bail on an extradition matter related to various sexual assault charges against him in Sweden. Assange himself has issued a press release calling the sentence “a significant tactical victory for Bradley Manning’s defense, campaign team and supporters.” Whether Mr Manning agrees with this assessment is not known. Quite a story, all told. If you hold sensitive data of any sort, you are obviously at risk of a data leak. Could a insider in your organisation, no matter how trusted they might be, make off with CD after CD of protectively marked data without any sort of warning being raised? 11 comments on “Bradley Manning sentenced – has already served three years, to serve 32 more” Wolf_Star says: It's a shame that Bradley Manning is being punished while those who work behind the scenes to do the things his actions brought to light are allowed to get off scott-free. It's more a testament to the fact that the American people are no longer really in control of their government, but are happy to just go along with whatever so long as it doesn't inconvenience them. Unless all of government is held accountable for its actions, then Bradley Manning should be released with time served and receive nothing less than a General Discharge. What a fiasco. I can't wait to see the devout breast-beaters who support Mr. Manning's 35-year sentence start foaming at the mouth and sputtering that he will now be Paying His Debt To Society™…as though letting him rot in jail at taxpayers' expense somehow pays anything to anyone. Then there will be those who say, "No, no…the reason for the stiff sentence is to make an example of Bradley Manning, which will have a deterrent effect on others who might be considering the same crimes." Yeah, right…I love that story. But…uh, somehow, the deterrent effect didn't seem to work in Mr. Manning's case, did it. That doesn't matter, evidently. The important thing is that the rituals and forms of due process are performed, so as to maintain the illusion that justice has been served. It pegs the absurdity meter. Only the need for punishment (revenge) has been served. Bradley Manning's "crimes" have been processed by the machine, but the crimes he revealed have been swept under the rug. True justice isn't blind, but pseudo-justice sure is. roy jones jr says: As I don't have the extra details maybe someone could answer this: Why was Manning releasing these documents? Arerifx says: I'm not American and not Lady Gaga fan too but I'm pretty agree with her..Bradley Manning don't deserve for that imprisonment and America's law is injustice. I believe manning should be in prison. Bottom line is he released classified information to unauthorized people, that is against the law. Regardless of what was contained in the information, he knew the consequences for disclosing classified information to unauthorized people. He made a decision and now must suffer the consequences for making that decision. More than just manning should have been punished. There had to of been failures at multiple levels for him to be able to download that information without others knowing and also be able to get that information out of the facility. Would an editor be able to fix this article to reflect Chelsea Manning’s proper name and gender identity? Thank you. Paul Ducklin says: That would make the article incorrect, considering the time at which it was written (it would imply we could somehow see into the future). Your comment should serve as a reminder that the identity of the person in the article changed subsequently. Leonie Blah says: I can't stand inaccurate reporting. Julian Assange did NOT skip bail and run off the UK to avoid sexual assault charges made against him in Sweden. He was NEVER charged with anything and was NEVER on bail at any time. He was given permission to leave the Sweden by the authorities. What is so hard to understand about that? He has not broken any law anywhere in the world! markstockley says: The article didn’t say he’d skipped bail and run off to the UK. Julian Assange was arrested in the UK on an extradition warrant and was bailed. He then sought asylum in the Ecuadorian embassy and by staying in embassy he is in breach of his bail conditions. Why does my comment have to be approved before others read it? Why do I have to provide my identity to you in order to speak? What are you so scared of? Truth perhaps! We try to maintain a high signal to noise ratio in our comments and so we moderate all of them. It's a significant undertaking but moderation improves the quality of the discussion significantly and we think it's worth it. Unfortunately it means that sometimes you will have to wait a while for your comment to appear. You don't have to provide your identity and you are free to comment anonymously. Assange arrested, faces extradition for hacking by Mark Stockley Bradley Manning: guilty of espionage but not aiding the enemy. But was justice served? [POLL] by Lisa Vaas Lax security blamed for 100,000+ sensitive files found on Manning’s PC
cc/2020-05/en_middle_0087.json.gz/line1337937
__label__wiki
0.855664
0.855664
Vacancies in this Asian banking job have fallen 25% in just two years by Simon Mortlock 05 September 2017 Compliance hiring in Singapore and Hong Kong has fallen by a quarter in just two years as contracts run out, banks focus on specialist roles and technology takes over jobs. Led by Citi, Standard Chartered and HSBC, banks in the two cities recruited hundreds into their middle offices between 2012 and 2015, some of whom took fixed-term contracts to work on urgent remedial compliance projects. Many of these contracts are not being renewed as they now come to an end, says Jessica Chau, director of compliance at G.R.A.C.E. Recruitment. “As some projects come closer to finishing, the immediate need for compliance staff has reduced. Contractors who exceeded expectations get the chance to stay, but a lot have been cut.” It’s not only contractors who have been affected as the Asian compliance job market sours. Vacancy levels across the sector have slumped by about 25% compared with 2015, says Duncan Kennedy, Hong Kong manager at Eames Consulting Group. While compliance hiring is still strong in insurance, banks in Asia have now largely met their headcounts needs, he adds. Meanwhile, the generalist (and more plentiful) hiring of the recent past has given way to more niche recruitment, including in financial crime compliance and in regulatory compliance focused on equities, fixed income and other products. “Two years ago, when there was a shortage of candidates, banks hired staff who had good experience and could manage teams but didn’t have a deep enough understanding of regulatory changes,” says Kennedy. “Banks now need senior specialist staff who can ensure adherence to specific regulatory developments.” Chau says 70% of the Asian compliance jobs that her firm handles are now at the mid or senior level. “This year compliance departments in Asia are also letting go of below-average performers, especially those on inflated salaries who were hired during the recruitment frenzy a few years ago,” says Chau. “Banks are looking to rationalise themselves and to use their current teams in the most efficient way.” “Regtech and automation have also been replacing manpower, while the fear around the potential of regulatory fines has dropped over the last two years,” adds Pathay Singh, managing director of recruitment agency Compliance Grid in Hong Kong. “After the initial splurge, compliance costs in Asia are now under the microscope.” Still, compliance professionals in Hong Kong and Singapore are more sought after than many other job seekers in the banking sector. Banks may be trimming underperformers and not adding new headcount, but they continue to replace most employees who leave of their own accord. “The initial compliance boom was a result of the remedial efforts of banks, following some hefty fines. But compliance remains one of the hottest areas in the job market, where qualified candidates are still in high demand and come at a premium,” says Nishita Mohnani, a senior consultant at recruiters Hays in Hong Kong. Image credit: mayo5, Getty Follow @SimonMortlock Killer questions that Singapore banks will use to trip you up at job interviews How to write an outstanding compliance resume Seven of the most exciting jobs at Hong Kong banks right now Transfer Agency, Associate AIS Fund Admin Manager, AVP
cc/2020-05/en_middle_0087.json.gz/line1337943
__label__cc
0.671635
0.328365
Yorktown's Winter Weather Advisory for the Hudson Valley Region: A winter Weather Advisory has been issued for the area by the National Weather Service for the Hudson Valley region. A WINTER WEATHER ADVISORY REMAINS IN EFFECT UNTIL 1 AM EST ON SUNDAY... * WHAT...Snow. Additional snow accumulations of 2 to 4 All Seasons Wine & Spirits Grand Opening: The public is invited to join the Yorktown Chamber of Commerce in welcoming All Seasons Wines & Spirits to Yorktown on Friday January 24th at 12:15pm. Lunch will be provided after the ceremony so please RSVP by Sunday 1/19 infoallseasonswineny com Cold Weather Art with Judika at the Somers Library: Cold Weather Art with Judika at the Somers Library Mondays 1/27, 2/3, 2/10, & 2/24 (Snow Date - 3/2), 10:30 am - 12:30 pm. On cold winter days, warm up with us for some art by experimenting using acrylics, watercolor, water soluble oil Sen. Harckham on ConEd’s Approved $1.2 Billion Rate Hike: “This Will Hurt” : New York State Senator Pete Harckham released the following statement in response to the state’s Public Service Commission (PSC) approval of a whopping $1.2 billion rate increase requested by ConEd for its gas and electric customers over the next three Taxpayers should remember these tips when searching for a tax preparer: The tax filing season is upon us, and many people will be looking for someone to help them file a tax return. These taxpayers should choose their tax return preparer wisely. This is because it’s ultimately the taxpayer who is responsible for all the National Taxpayer Advocate delivers Annual Report to Congress: focuses on Taxpayer First Act implementation, taxpayer service, and IRS funding: Acting National Taxpayer Advocate Bridget Roberts today released her 2019 Annual Report to Congress. Key challenges highlighted in the report include implementation of the Taxpayer First Act, inadequate taxpayer service and limited funding of the agency. Roberts also released the third edition of the National Taxpayer Advocate’s 2020 Home Show at the Jefferson Valley Mall: The Yorktown Chamber of Commerce in conjunction with the Jefferson Valley Mall and JilCo will be presenting the 2020 Home show on Saturday February 8th, 2020 from 11 am until 4 pm at the Jefferson Valley Mall. On hand will be Maloney Votes to Protect Students and Reject DeVos’ Giveaway to Predatory, For-Profit Colleges: Rep. Sean Patrick Maloney (NY-18) voted to reject Department of Education Secretary Betsy DeVos’ elimination of student loan borrower protections and rollback of safeguards preventing low-quality schools from scamming students, veterans and taxpayers. The resolution, H.J. Res. 76, will block DeVos’ new Borrower Maloney announces his 2019 VALENTINES FOR VETS Program: REP. SEAN PATRICK MALONEY INVITES YOU TO PARTICIPATE IN HIS 6TH ANNUAL VALENTINES FOR VETS Valentines may be mailed or dropped off at Representative Maloney's Newburgh Office located at 123 Grand St., Second Floor, Newburgh, NY 12550 Valentines are due Horror Film Screening: The Thing: Chiller Vision at Mahopac Public Library Horror Film Screening ofTHE THING (1982)Monday, February 36:30 pm Members of an American scientific research outpost in Antarctica find themselves battling a parasitic alien organism capable of perfectly imitating its victims. They soon discover that this Westchester’s Winter Wonderland Returns to Kensico Dam Plaza Published on Thursday, 21 November 2019 14:09 Written by Margaret Carey New Santa’s Village at the North Pole with Live Reindeer All New Circus Attractions Including: Motorcycle Thrill Drivers in the Giant Thunder Dome International Clown Hall of Fame & Westchester Native Greg De Santo Westchester’s Winter Wonderland returns to Kensico Dam Plaza in Valhalla on Friday, November 29 at 5 p.m. for its sixth exciting season. Starting the day after Thanksgiving, the festive celebration takes place six consecutive weekends through January 4, 2020, plus weekday bonus days during the school holiday. For one $20 all-inclusive ticket price, guests can enjoy unlimited access to Santa’s Village, amusement rides, a live circus performance, ice skating rink plus free skate rental, a dazzling holiday light show featuring favorite elves Ned and Albert, and one of Westchester’s tallest (40ft) lighted Christmas Tree. For the sixth straight year, Westchester Medical Center is the host of the circus and presenting partner of the annual event, which kicks off on Friday, November 29 at 5 p.m. The official tree lighting ceremony will start at 6 p.m. led by County Executive George Latimer and Westchester Parks Foundation Executive Director Joe Stout and sponsored by Robison Oil. New platinum sponsors for 2019 include Wegman’s and Verizon. They will be joined by returning platinum sponsors Con Edison and Party Line Rentals and M&T Bank, sponsor of the family-friendly New Year’s Eve Ball Drop on December 31. New this year is the addition of Santa’s Village at the North Pole with live reindeer. Parents can take their own photos or jump in to take a family selfie! Visitors can also visit live reindeer, mail letters to Santa, and see the real-life frozen “North Pole,” a total Santa experience! The heated double-poled, yellow and red striped Winter Wonderland Holiday Circus tent presents up to five performances nightly, with thrilling circus acts that will entertain and delight children of all ages. New acts this year include Motorcycle Thrill Drivers in the Giant Thunder Dome reaching speeds of 55 miles an hour; Miss Perla the Human Pretzel contortionist; the skills of Senor Soto on the glittering trapeze; and circus legend Greg DeSanto, one-time Director of Clowning on the Ringling Brothers Barnum & Bailey Circus. DeSanto is originally from Eastchester, NY and was just elected President of the International Clown Hall of Fame. “There is no better way to welcome the holiday season than at Westchester’s Winter Wonderland” said Westchester County Executive George Latimer. “Grab your family and friends and come out to our beautiful Kensico Dam Plaza for a visit with Santa at the North Pole, ice skating, or our very own Ball Drop on New Year’s Eve. It is the perfect way to celebrate this wonderful time of year, and I invite everyone to join me for the Tree Lighting Ceremony for Westchester’s largest lighted tree.” “Westchester’s Winter Wonderland is a place where families can make priceless memories that will last forever,” stated Joanne Fernandez, Chairperson of Westchester Parks Foundation. “We are thrilled to once again partner with Westchester County to transform the iconic Kensico Dam Plaza into the most spectacular holiday destination in Westchester. We are also grateful to all our sponsors this year, especially Westchester Medical Center who is our presenting sponsor for the sixth year in a row. Events like this are created for people to not only learn about their County parks, but also enjoy seasonal celebrations close to home while giving back.” Westchester County Parks Commissioner Kathy O’Connor said: “There are so many ways to enjoy Westchester’s Winter Wonderland, from the circus, to the brilliant light displays, themed character nights and amusement rides for the young and young-at-heart, unlimited skating and free rental skates all covered in the admission price. We look forward to a great season and especially to the opening night, a truly magical experience.” New rides will be added to FUNderland Village, including a 55-ft high Ferris Wheel. Kids will have unlimited access to eight rides total including: Winter Hay Ride, Wonderland Train Ride, Holiday Carousel, 40ft high heated Fun Slide, Holly Jolly Dragons, Pony Sleighs and Tubs of Fun. Lights of Wonder, sponsored by Verizon, will feature favorite elves Ned and Albert and holiday music! Magical displays include angels, snowflakes, elves tossing wrapped holiday gifts and a message of good will towards all. Guests can also skate away on Westchester Winter Wonderland’s huge ice rink, the same size as NYC Rockefeller Center. (Skate rentals are free). Pose for photos in front of Westchester’s largest lighted Christmas Tree; or take a break from the cold to enjoy food and refreshments in the heated Wegman’s Holiday Dining Tent. Beer and Wine is available for purchase for those 21 and older including a special Captain Lawrence Brew called Red Nose Ale, available only at Westchester’s Winter Wonderland. Proceeds from this event benefit WPF and allow the organization to advocate for and invest in the preservation, conservation, use, and enjoyment of the 18,000 acres of parks, trails, and open spaces within the Westchester County Parks system. For more information, visit http://www.wwinterwonderland.com For complete information and to purchase tickets, visit www.wwinterwonderland.com Follow Yorktown HamletHub
cc/2020-05/en_middle_0087.json.gz/line1337944
__label__cc
0.598764
0.401236
Ministry Newsletters The Arab Christian Community The Ethiopian Community The International Community Biblical Holidays Torah Teachings Archeological Discoveries Music & Worship Videos AllMinistry NewslettersPersonal StoriesPrayerSoldiers Book Release – I Am Miriam by Deanna Malespin Karen Royel - Jan 17, 2020 In a new short story about Miriam of Nazareth, modern Galilean mother Deanna Malespin paints a relatable picture of one of the most elevated... New Book calls Israeli youth to “Believe… that there is another way.” Kehila News Israel Staff - Jan 16, 2020 On January 13th Bat-El "Betty" Tegen held a launch event for her debut book. It is the first book ever that is written in... “We have turned ‘the Family’ into an idol” says Machase CEO Sara came to Israel from the Netherlands and married an Israeli non-believer. He abused her for many years, but the Messianic congregation she attended... First Annual Israeli Worshiper’s Meeting The first annual Israeli Worshiper's meeting will take place this month between January 30th and 31st in Beit Yedidia, Haifa. On the website, the event... AllBiblical HolidaysBiblical TeachingsTorah TeachingsBooks Taking a step in faith Tuvia Pollack - Jan 16, 2020 Taking risks that require great faith is scary. On the one hand, I want to be the one who dares to trust in God.... AllArcheological Discoveries Weekly News Summary: January 4th – 10th Netanyahu likely to face trial before elections: Likud party officials admitted on Thursday that efforts to delay Netanyahu’s indictment until after the election are likely... Top Stories This Week (December 29th – January 4th) Kehila News Israel Staff - Jan 1, 2020 Leviathan Gas Field starts pumping gas: The Leviathan natural gas field began pumping natural gas Wednesday. The natural gas field is located offshore, 125km (77mi)... Israel to allow Christians from Gaza to celebrate Christmas in Bethlehem, Jerusalem Kehila News Israel Staff - Dec 23, 2019 Israel announced it will issue permits for Christians in the Gaza Strip to visit Bethlehem, Jerusalem and the West Bank for Christmas after initially... Weekly Israel News Summary: December 6 to 13, 2019 Israel returning to elections, right-wing maneuvers to build a coalition: Israel will return to elections for the third time in less than a year. The... AllMusic & Worship VideosTeaching VideosTestimony VideosVideo Blogs [VIDEO] Recruited Chad Holland - Jan 12, 2020 The Kingdom of God nor the Kingdom of Darkness ever take a day off, you are being recruited constantly
. We should have confidences in... Has the Moment in History Arrived for all Jews to Seriously Consider Aliyah? Cookie Schwaeber-Issan - Jan 8, 2020 If you’ve been following the news, you have, undoubtedly, noticed the sudden surge in anti-Semitic attacks worldwide – a phenomenon which, although up until... New radio app AGAPE.FM – Hear the latest Messianic music from Israel! One For Israel Staff - Jan 2, 2020 One For Israel is excited to offer their new Radio Agape App to Apple Alexa and Android devices! Listen to the latest Israeli Worship... [VIDEO] Pastor was shocked with this revelation about Israel!! Home Israel News Archeological Discoveries Treasure trove of ancient Jewish ‘freedom coins’ just in time for Passover Treasure trove of ancient Jewish ‘freedom coins’ just in time for Passover Tzippe Barrow 'Freedom' and 'Redemption' Coins from Ophel Cave, Photo, Dr. Eilat Maza JERUSALEM, Israel – Hebrew University archaeologist Dr. Eilat Mazar uncovered a rare treasure trove of bronze coins from the time of the Jewish revolt against the Romans more than 1,900 years ago. They were found at the Ophel excavation in Jerusalem’s Old City. Located below the southern wall of the Temple Mount, the Ophel excavation was recently renewed after a four-year hiatus. “A discovery like this – ancient coins bearing the words ‘Freedom’ and ‘Redemption’ – found right before the Jewish Festival of Freedom, Passover, begins is incredibly moving,” she said. Mazar, a third-generation archaeologist, loves sharing how her discoveries inexorably link the biblical history of Israel with the Jewish people. Dr. Eilat Mazar, CBN News Interview, Screen Capture These coins tell an extraordinary story. Mazar explained that Jewish residents hid in a large cave from invading the Roman Empire’s siege of Jerusalem – from 66 to 70 CE (AD) until they destroyed the Second Temple and the city of Jerusalem. The coins, she said, are the last remnants of the four-year Jewish revolt against the invading Roman Empire. While several of the bronze coins date to the revolt’s early years, the majority date from its final year, known as “Year Four,” according to Mazar. During the final year, the Hebrew inscription was changed from “For the Freedom of Zion” to “For the Redemption of Zion,” reflecting their state of mind as they hid from the Roman soldiers. Mazar said the well-preserved coins are decorated with Jewish symbols, including the four biblical plant species: palm, myrtle, citron and willow. There’s also an image of the goblet used in the Temple service. She attributed their state of preservation to the relatively short time they were used. Just after the Six-Day War, her grandfather, Prof. Benjamin Mazar, discovered a similar trove of “Year Four” coins in excavations for Hebrew University’s Institute of Archaeology. He found them near Robinson’s Arch, close to the Western Wall, just after Jerusalem was reunited under Israeli sovereignty. Prof. Ben Mazar in 1936, Photo, GPO archive, Kluger Zoltan What Mazar finds extraordinary about this latest find is that the large cave dating to the Second Temple Period remained undiscovered for years. That makes the cave “a veritable time capsule of life in Jerusalem during the four years its residents fought off the Roman invasion.” These latest finds were discovered directly above a layer dating to the Hasmonean Period. A complete report of these find will be published in the third volume of the Ophel excavations. Volume two is being published this week. Mazar included the following information in her press release: The Ophel excavations are located within the walls surrounding the Jerusalem National Park. The National Parks and Gardens Authority and the Eastern Jerusalem Development Company manage the park. The Herbert W. Armstrong College of Edmond, Oklahoma, funds the excavation. Students from the college come to Israel to take part in the excavations. The Hebrew University of Jerusalem is Israel’s leading academic and research institution, producing one-third of all civilian research in Israel. This article originally appeared on CBN News, March 27, 2018, and reposted with permission. Previous articleVIDEO: The Lord’s Passover Next articleNetanyahu: Taylor Force Act powerful signal from the US which is changing the rules Tzippe Barrow is the CBN News Internet Producer - Jerusalem. She and her husband made aliyah (immigrated to Israel) nearly two decades ago. Barrow hopes that providing a biblical perspective of today’s events in Israel will help people in the nations to better understand the centrality of this state and the Jewish people to God’s unfolding plan of redemption for all mankind. Christian archaeological team brings the Bible to life after finding altar horns in Tel Shiloh [Israel 101] The Challenges for PM Netanyahu of Building a Coalition in the Knesset A biblical explanation of Israel’s days of remembrance Sign up for KNI weekly updates Kehila News Israel (KNI) Twitter "...the first book ever that is written in #Hebrew by a #Messianic believer for Messianic teenagers in #Israel." ~ Kehila News Israel. https://buff.ly/2uVw9Sz #kehilanewsisrael Sometimes a coffin can make all the difference by Eric Tokajer, author. https://buff.ly/38bw5MU "Teach me to do Your will, because You are my God; Let Your good Spirit guide me on ground that is level." Psalm 143:10 "On that day a great shofar will sound. Those lost in the land of Ashur will come, also those scattered through the land of Egypt; and they will worship Adonai on the holy mountain in Yerushalayim." Isaiah 27:13 Some Thoughts on False Prophets by Aaron Hecht, Jerusalem Assembly. https://buff.ly/3aeCNn6 Kehila mean "community" or "congregation" or "assembly" or "church" in Hebrew. Kehila.org is a community news & online information portal of the Messianic/Christian Community in Israel. The vision of Kehila.org is to connect the millions of Christians around the world who love Israel with the Messianic community in Israel. About Kehila.org © ©2015 - 2020 | Kehila Ministries International | All rights reserved
cc/2020-05/en_middle_0087.json.gz/line1337945
__label__wiki
0.603839
0.603839
Sekiro: Shadows Die Twice PS4 No. 28 at Japan retail BUSINESS • PLAYSTATION 4 Famitsu this month said Activision Publishing, Inc.’s Sekiro: Shadows Die Twice for Sony Corp.’s PlayStation 4 ranked as a best-selling title in the latest retail data from the Japan. Between June 10 and June 16, Sekiro: Shadows Die Twice sold 1,102 units to rank as the No. 28 best-selling title for the week. It ranked at No. 21 the week prior. Developed by From Software, Sekiro: Shadows Die Twice is a third-person action title based in feudal Japan. The protagonist is equipped with a bionic arm to grapple and attack enemies. The title sold more than two million units in fewer than 10 days of release. Samurai Shodown to battle PS4, Xbox One this week Monster Hunter: World Iceborne beta to battle PS4 Nintendo eShop holds Sega and Atlus New Year Sale
cc/2020-05/en_middle_0087.json.gz/line1337946
__label__wiki
0.98354
0.98354
Turkey unveils first fully homemade car in $3.7 billion bet on electric Autoblog December 27, 2019 See Full Image Gallery >> ISTANBUL — Turkey unveiled its first fully domestically-produced car on Friday, saying it aimed to eventually produce up to 175,000 a year of the electric vehicle in a project expected to cost 22 billion lira ($3.7 billion) over 13 years. The project has been a long-time goal of President Tayyip Erdogan and his ruling AK Party as a demonstration of the country's growing economic power. Speaking at the unveiling ceremony, Erdogan said Turkey aimed not only to sell the car domestically but also wanted it to become a global brand, starting with Europe. "We're all together witnessing Turkey's 60-year-old dream become reality," he said, referring to failed plans in the past to build a fully home-produced car. "When we see this car on roads around the whole world, we will have reached our goal." Following his speech, a red SUV model of the car and another grey sedan one were raised onto the stage, sporting the TOGG label of the consortium that is building them. Erdogan said the charging infrastructure for electric cars would be ready nationwide by 2022. Turkey is already a big exporter to Europe of cars made domestically by firms such as Ford, Fiat Chrysler, Renault, Toyota and Hyundai. The new project, launched in October, will receive state support such as tax breaks, and establish a production facility in the automotive hub of Bursa in northwest Turkey, according to a presidential decision in the country's Official Gazette. Five models of the car will be produced, the statement said, adding the government had guaranteed to buy 30,000 of the vehicles by 2035. Erdogan first revealed plans in November 2017 to launch a car made entirely in Turkey by 2021. The consortium, called Turkey's Automobile Initiative Group (TOGG), was established in mid 2018 by five industrial groups: Anadolu Group, BMC, Kok Group, mobile phone operator Turkcell and Zorlu Holding, the parent of TV maker Vestel. TOGG's CEO is former Bosch executive Gurcan Karakas and its chief operating officer is Sergio Rocha, former General Motors Korea chief executive. It said it would begin production in 2022 with compact SUVs. In October, Volkswagen said it had postponed a final decision on whether to build a car plant in Turkey amid international criticism of an October Turkish military operation in Syria. ($1 = 5.9339 liras) Cyprus brands Turkey 'pirate state' in gas drilling row Western leaders have disregarded Libya for years – these peace talks are too little, too late Cyprus says Turkey 'pirate state' in gas drilling dispute 2020 Chevrolet C8 Corvette Stingray Coupe sells for $3 million at Arizona auction Disney’s ‘Frozen 2’ is hitting theaters this weekend Twitter CEO Jack Dorsey reveals restrictive diet 'Get Your Mops & Buckets Ready!': Trump's answer to rising seas Schwab's Chief Investment Strategist on market rally and record highs How startup Seedlip is capitalizing on the alcohol-free trend This company is revamping presentation software First Mid-Engine Chevy Corvette Sold for $3 Million at Auction
cc/2020-05/en_middle_0087.json.gz/line1337947
__label__wiki
0.832495
0.832495
Home » Music » Halsey Channels Shania Twain, Lady Gaga & More in You Should Be Sad'' Halsey Channels Shania Twain, Lady Gaga & More in You Should Be Sad'' 01/10/2020 Halsey, Sha, you should be sad Halsey dropped her new single “You Should Be Sad” and its corresponding music video on Friday. In the video, the 25-year-old singer channeled a few superstars—including Christina Aguilera, Lady Gaga, Carrie Underwood and Shania Twain. “Xtina, Gaga, Carrie, and of course Shania, this was one loaded with nods to badass idols of mine,” she tweeted. “Had the vision to do a ‘before he cheats’ but instead about after he does haha.” So, what were some of these nods? For starters, eagled-eyed fans noticed Halsey wore the same leopard print ensemble the 54-year-old country star wore in the video for her ’90s hit “That Don’t Impress Me Much.” “Was so hard not to post 100000 pics of this,” Halsey tweeted alongside some side-by-side photos of her rocking the same outfit as Twain. “I peaked in life here.” It looks like Twain was a fan of the nod, too. “Oh yes! Love it!! Flattered to be one of your badass idols @halsey,” she tweeted. In addition, social media sleuths noticed she wore the same eye makeup Underwood sported in the music video for her 2018 hit “Cry Pretty” and gave nods to Aguilera’s early 2000s track “Dirrty.” But that’s not all. Halsey even donned a long, blonde ‘do a la Mother Monster. “It’s me referencing Gaga who was referencing Bianca Jagger in AHS Hotel,” she tweeted. When asked what inspired the country song, Halsey explained that the “most petty and heartbreaking songs all come from country.” “I wrote ‘YSBS’ on my living room floor on my guitar,” she tweeted. “Lots of time in Nashville too.” After some fans wondered if this meant her entire upcoming album was going to be a country one, Halsey clarified that “every song has its own identity.” “I’ve always said ‘the album changes its mind as often as I do,'” she tweeted. She also reminded her followers that “you don’t write the song the day before it’s released.” “The topics are relevant to the time the song was written,” she continued. “It’s visceral when it happens. The writing part helps it go away.” Watch the video to hear the song and see the references. The song is the third track on her studio album Manic, which drops Friday, Jan. 17. ← Pakistan mosque blast kills at least 13: police Unbelievable 'Sleeping Beauty' Proposal Video Goes Viral → Thirsty koala desperate for water risks life to lick road rainwater in Australia
cc/2020-05/en_middle_0087.json.gz/line1337948
__label__cc
0.573234
0.426766
Professor helps craft U.S. bill to aid women fleeing abuse It is not uncommon for a woman to flee, with her child, from an abusive spouse, hoping to start fresh elsewhere. Some even seek refuge in a new country. Often, though, problems aren’t so easily... Implications for teens in trend of legal pot for adults Kevin Haggerty graduated from high school in 1977 – among the foggiest, Cheech-and-Chongiest years ever in terms of U.S. teens smoking marijuana, government data says. For more than 25 years, he has... Maple Valley teen is NFL's guest at Super Bowl Zack Lystedt's long road back from a 2006 head injury included moments of bliss this past weekend. Not only did he watch his beloved Seahawks win the Super Bowl, but he and his parents were at the... Ideas shared on reshaping of UW's medical education Curriculum renewal took center stage in late January, generating enthusiasm in a well-attended public forum. About 100 faculty, staff and students heared presenters discuss ideas to integrate the... Preparing future doctors under ACA's realities The UW School of Medicine is reshaping its curriculum to better prepare future doctors for the new realities of healthcare under the Affordable Care Act. Healthcare professionals are expected to work... An envelope opens and the near-future crystallizes It was a whirlwind of celebration and tears, most of them joyous. On March 21, 222 students graduating from the University of Washington's School of Medicine simultaneously learned, with thousands of... School of Medicine launches 'Next Generation WWAMI' in Spokane The University of Washington School of Medicine announced plans today, March 26, to establish Spokane as the center of an effort called "Next Generation WWAMI." The UW, in partnership with the city's... UW suicide prevention program instrumental in new state effort Suicide prevention in Washington state took a significant step forward March 27 when Gov. Jay Inslee signed House Bill 2315, a bill that requires basic training in suicide assessment, treatment, and... photography (12) Apply photography filter (-) Remove legislation filter legislation (-) Remove School of Medicine filter School of Medicine (-) Remove obstetrics filter obstetrics (-) Remove Seattle filter Seattle (-) Remove Valley Medical Center filter Valley Medical Center Harborview Medical Center (45) Apply Harborview Medical Center filter
cc/2020-05/en_middle_0087.json.gz/line1337950
__label__cc
0.569744
0.430256
MechWarrior 5: Mercenaries - Review Crashing through exciting mech battles and a challenging small business simulator. byTj Hafer Posted Dec. 11, 2019, 2:11 a.m. After a tense run-in with some House Kurita forces, I see that one of my employed MechWarriors is apparently going to be out for 57 days with injuries. Oh, come on! That’s more paid time off than I’ve ever had in my entire life! Take the weekend to rest up and be back in the Jenner on Monday, you slacker! I have a demanding business to manage here and, more importantly, buildings to gleefully stomp on and a huge variety of giant robots to blow up. MechWarrior 5 brings some great old school joy, and it certainly hasn’t developed much sentimentality in its time away. It’s been almost two decades since MechWarrior 4, but it seems like Piranha Games has gone to quite a bit of effort to not mess up the task of picking up where it left off. Mercenaries includes over 50 mechs to pilot, from the spritely Locust to the hulking Annihilator, and each comes with a handful of variants with different weapon loadouts. These can each be further customized in truly impressive fashion with a variety of destructive lasers, missiles, and ballistic weapons. You can even fine-tune the armor on every part of your mech down to each individual point… or there’s a handy “Deck me out fam” button that does a decent enough job filling in the gaps for those of us who don’t want to get that granular. There are a couple classic features I’ve gotten used to from playing sister game BattleTech that are absent from the mix, like stealth, electronic warfare, and melee attacks. I did miss them, but the sheer variety of what’s here still satisfied me with that modular, freeform feeling of optimizing my death machines that’s essential to MechWarrior. Assuming Direct Control The control options are fairly exhaustive to boot. There’s both mouse/keyboard and gamepad support, the latter of which works surprisingly well for such a complex game. But I was also pleased to find full joystick support with an editable HOTAS remapping file, as that’s how I most fondly remember playing MechWarrior back in the day. I discovered shortly after digging out my Logitech Extreme 3D Pro that I’m not any good at it anymore, but I was glad to have the option. Moving a mech's torso independently of the direction your legs are pointed isn't super intuitive, but it feels great once you get into the groove. Once inside the cockpit, there’s a definite learning curve if you’re new to the series or just very rusty like I was. Managing your throttle and moving the mech torso independently of the direction your legs are pointed isn’t super intuitive (and never has been), but it felt great once I got back into the groove. MechWarrior has always been about trying to wrangle this enormous, lumbering hunk of steel and destruction, and MechWarrior 5 recaptures that internal battle admirably. Heat management and location-based damage return as major considerations, filling out MechWarrior’s signature tactical depth. Whether I was stomping an enemy stronghold to dust or dueling another mech in the tight confines of a cramped canyon, I was usually having a blast. My AI lancemates could feel like more of a burden than an asset early on, as they seemed more likely to get themselves deep in trouble and lose me some expensive hardware unless I treated every op like an escort mission. But their usefulness scales well with their pilot skill as they level up, and the ones who stuck around were eventually able to more than pull their weight, making some tricky shots and saving my bacon by covering blind spots. The Mission Is Clear Most of the missions I faced were pretty straightforward, even though there’s a good variety between blowing up enemy facilities, assassinating enemy VIPs, and raiding strongholds for salvage. Every once in awhile, they’ll throw an extra twist like a jamming tower you have to destroy to get your HUD working, but it didn’t stop the endless string of contracts from starting to feel a bit rote and repetitive after a while. If the combat wasn’t satisfying by itself, it might have even become a slog. Luckily, mechs can handle quite differently from one another, and being able to afford and try out new hardware along the way continued to inject more variety. And the maps themselves can be quite diverse, from Hoth-like ice worlds to volcanic hellscapes with randomized terrain. And sure, this isn’t the best-looking game I’ve ever played. The textures definitely look muddy and dated, even on higher settings. Buildings and terrain are noticeably blocky when you slow down enough to get a good look at them. But the mechs and the environments have a lot of style and retro flair I appreciated. Plus, the heavy, distorted guitars that make up the soundtrack made me want to crank up some early 2000s Firewind tracks and headbang my way to victory. Heavy Metal Management Managing the open-ended single-player campaign isn’t always as exhilarating. It takes place on an almost dauntingly large interstellar map of BattleTech’s Inner Sphere during the tumultuous days of the Third Succession War. There is a loose story with some fairly good voice acting woven throughout, but it often faded into the background as my attention was on the theoretically endless task of exploring the stars, taking mercenary contracts, and trying to keep the business afloat while bolstering my reputation. Early on you'll be spending a lot of your earnings on repair bills while waiting around for wounded warriors to get better. Especially early on, the economics of it all can feel a bit oppressive. The lighter, weaker starting mechs with inexperienced pilots tend to take a lot of damage, which means you’re paying out a lot of your take in repair bills and waiting around for wounded warriors to get better. Until you have the time and cash to build up a stockpile of extra mechs and spare components to swap in for the ones that get blasted beyond repair, you can end up in a financial death spiral fairly easily. It even costs money to jump between systems, which is a workable way of making sure you don’t wander into dangerous waters before you’re ready, but also really restricts your ability to explore and get a bearing on your surroundings. Part of me likes this feeling of being desperate, broke, and hungry for the next job. Maybe it’s relatable, as a freelance writer. But it can be frustrating to have to reload a save or start over when you realize you’re too far in the hole to climb out. As I developed a bigger operation with more mechs and a stronger bench, these problems faded away and I became more worried about profit margins and reputation. The rep system is a nice touch: every potential employer will be pitting you against one of the others, so you can’t do anything nice for someone without pissing someone else off. You’ll make enemies no matter what, but the friends you stay loyal to will grant you perks like increased pay or a greater share of salvage after a battle. On top of this, there’s an online co-op mode that lets you run premade scenarios or have a friend drop into your campaign as one of your lance mates, which works great and is usually a lot more fun than lone-wolfing it. MechWarrior 5: Mercenaries checks most of the boxes I would have asked for out of a modern revival of the series. There are tons of mechs that can be kitted out in tons of ways, and they’re all a lot of fun to drive. The campaign is expansive, complex, and reactive, though at times it can also be aggravating and directionless. The mission structure can also feel a little repetitive after a while, but a variety of exciting environments serve to mitigate this. And casually plowing directly through a row of high-rises in an Atlas? Well, that never gets old. Developer: Piranha Games Publisher: Piranha Games Release Date: Dec. 31, 2018 MechWarrior 5: Mercenaries Review MechWarrior 5: Mercenaries checks most of the boxes I would have asked for out of a modern revival of the series. The Best Dell and Alienware Deals of 2020: Gaming PCs, Laptops, Monitors, and More How to Upgrade to Windows 10 for Free Street Fighter 5's PC Netcode Problem Reportedly Fixed By Modder AMD Introduced Two New FreeSync Tiers for Gaming Monitors
cc/2020-05/en_middle_0087.json.gz/line1337957
__label__wiki
0.94616
0.94616
Roger Bomgaars (from left), Aaron Bomgaars, Amy Bomgaars and Jane Bomgaars plan to donate $50,000 towards the new ag facilities at Northeast. Bomgaars family donates to Northeast Nexus campaign Special to the Daily News Agriculture and youth are important to the Bomgaars family, and those priorities are why the family is investing in the Nexus project at Northeast Community College in Norfolk, according to a Northeast media release. Aaron Bomgaars, vice president at Bomgaars Supply Inc., has announced that the company will contribute $50,000 to the project to build new ag facilities at Northeast. “Agriculture is the foundation of the economy of the Midwest states served by Bomgaars,” he said. “And the future of agriculture is the future of Bomgaars.” Bomgaars Supply Inc. is a family-owned retail chain of farm and ranch supply stores with its headquarters in Sioux City. Bomgaars serves customers in Colorado, Idaho, Iowa, Minnesota, Nebraska, South Dakota and Wyoming. Bomgaars stores can be found in 10 communities in the 20-county area served by Northeast Community College. Bomgaars said his family is excited to be part of the Nexus project. “Northeast is training students to be the next generation of farmers and ranchers,” he said. “Those students will become the future residents of the small rural communities where Bomgaars stores are located. These new ag facilities at Northeast will attract more students who will help local communities grow and thrive.” College officials welcomed the support. “At Northeast Community College, we share the Bomgaars family’s support of agriculture and youth,” said Dr. Tracy Kruse, associate vice president of development and external affairs, and executive director of the Northeast Foundation. “Each year, 350 students enroll in agricultural classes at Northeast, making it the single largest program of study on the campus.” Kruse said Northeast grants more associate degrees in agriculture than any other college in Nebraska and the eighth most two-year degrees in agriculture in the nation. “We have an excellent faculty and outstanding programming,” she said. “We are now trying to bring the ag facilities up to that same standard.” Funding for the $23 million Agriculture & Water Center for Excellence project is being solicited to enhance and expand the agricultural facilities at the college. In addition to Northeast’s commitment of $10 million, the institution is seeking at least $13 million in private funds to begin the initial phase of construction, which includes a new veterinary technology clinic and classrooms, a new farm site with large animal handling facility and other farm structures for livestock operations, a farm office and storage. The new facilities will be near the Chuck M. Pohlman Ag Complex on East Benjamin Avenue in Norfolk. In August, the Acklie Charitable Foundation (ACF) announced a $5 million lead gift to the Nexus project. ACF was founded by the late Duane Acklie and Phyllis Acklie, both Madison County natives and graduates of Norfolk Junior College, a predecessor institution of Northeast Community College. Aaron Bomgaars Northeast Community College Tracy Kruse LONDON (AP) — Goodbye, your royal highnesses. Hello, life as — almost — ordinary civilians. Norfolkan missing from Lincoln corrections center A Norfolk man arrested last summer by the Nebraska State Patrol, Norfolk Police Division and the U.S. Marshals Service Fugitive Task Force is missing from the Community Corrections Center in Lincoln. Witherspoon, Washington team in front of and behind camera PASADENA, Calif. (AP) — Tired of others influencing her career choices, Reese Witherspoon launched her own production company eight years ago. She has been calling the shots on both sides of the camera ever since, often in collaboration with other high-profile actresses. Meryl Streep to lend her voice to Apple animated short film NEW YORK (AP) — Meryl Streep is getting animated: The Oscar-winner will lend her voice to a short illustrated film celebrating the Earth. Steve Martin and Martin Short to star in Hulu comedy series PASADENA, Calif. (AP) — Steve Martin and Martin Short are taking their touring act to television with a new Hulu comedy. Weather wreaks havoc in Nebraska A plane slid off an icy taxiway in Kansas City and blizzard-like conditions made driving treacherous in parts of Nebraska, South Dakota and Minnesota. Report: Disney dropping the ‘Fox’ from movie studio names NEW YORK (AP) — Disney is dropping the word “Fox” from the movie studios it acquired as part of last year’s $71 billion purchase of Fox’s entertainment business, according to published reports. AGONCILLO, Philippines (AP) — Philippine officials said Saturday they’re bracing for a long crisis whether the Taal volcano erupts more disastrously or simmers precariously for weeks or months, as massive numbers of displaced villagers languish in emergency shelters. Chadron State, Wayne State propose new bachelor of science in nutrition, dietetics LINCOLN — The Board of Trustees of the Nebraska State Colleges has approved a proposal for a new baccalaureate program in nutrition and dietetics, which was jointly submitted by Chadron State College and Wayne State College. Watch: Norfolk brimming with weekend activity Watch: Firefighters called to house on Andy's North Shore Watch: Commissioners vote to abandon road NEWS POLLS Tweets by NorfolkNews AGONCILLO, Philippines (AP) — Philippine officials said Saturday they’re bracing for a long … CAPE CANAVERAL, Fla. (AP) — Rough seas prompted SpaceX on Saturday to delay the emergency es… ODDS AND ENDS STORIES
cc/2020-05/en_middle_0087.json.gz/line1337959
__label__cc
0.625936
0.374064
Secondary Curriculum Linked Imagine you are suspending a cube from one vertex and allowing it to hang freely. What shape does the surface of the water make around the cube? Painting Cubes Imagine you have six different colours of paint. You paint a cube using a different colour for each of the six faces. How many different cubes can be painted using the same set of six colours? In the game of Noughts and Crosses there are 8 distinct winning lines. How many distinct winning lines are there in a game played on a 3 by 3 by 3 board, with 27 cells? The diagram shows a rectangular box (a cuboid). The areas of the faces are $3$, $12$ and $25$ square centimetres. What is the volume of the box? The areas of the faces of a cuboid are p, q and r. What is the volume of the cuboid in terms of p, q and r? Surface and surface area. Generalising. Creating and manipulating expressions and formulae. Place value. Cubes & cuboids. Curious. Mathematical reasoning & proof. Pythagoras' theorem. Visualising. Volume and capacity.
cc/2020-05/en_middle_0087.json.gz/line1337963
__label__wiki
0.55933
0.55933
CONCEPT SERIES Ironboy Web Series, Sports Drama ∣ June 2013 (EU) Tagline: 70.3 Miles is just the beginning. Producers: Olga Martinez, Andrew Moody Director: Normann Bjorvand Writers: Normann Bjorvand (screenplay), Andrew Moody (Story) Stars: Marc Lovatt Release Date: 15 May 2013 (UK) Also Known As: Forging the Dream Filming Locations: UK, Austria Production Co: Cine Craft Collective, Runtime: 8X10min Sound Mix: Dolby Digital Based on the documentary Forging the Dream (2012), the Ironboy series is a concept for an original web series following Marc Lovatt, a young triathlete, as he pushes himself further and deeper into the limits of his physical and mental potential. Marc has never done this before, but the 21 year-old is now competing in Ironman UK 70.3, the world’s most grueling 70.3 triathlon event. He swims 1.2 Miles in a lake, then cycles 56.4 Miles up and down 52 hills, then runs 13.1 Miles to finish. The Ironboy series follows Marc’s story as he prepares; being specially fitted to his bike; the day-to-day pressure of balancing training and full time work; the half marathon, the triathlon and the Ironman training camp. The kick is that Marc Lovatt is doing all of this in support of Shelter Box, an organization that provides first response aid in disaster areas, including the tragedy in Haiti. Intertwined within the story of Marc facing these challenges of physical endurance is the portrayal of his personal journey and his deeper motivations. The Ironboy series is a gritty, fast-paced storytelling; yet heart-warming as it allows the viewer to experience the inspiration that comes from an individual’s self-reflection as he tries to make the world a better place. The series was designed to be linked with Channel 4’s sports coverage of the 2012 Ironman UK event, raising the profile of this coverage, by providing a personal portrayal of an entrant, oppening opportunities for a cross-media platform. The Ironboy series was designed to be released online at intervals leading up to the event, building an audience and developing social media networks.
cc/2020-05/en_middle_0087.json.gz/line1337964
__label__wiki
0.611407
0.611407
Sharing Faith Through Communication Bishop Hying Column Bishop Melczek Column Columna del Obispo About Bishop Hying About Bishop Melczek Bishop Pastoral Letters and Statements Mark Plaiss Adeline Torres Father Kenneth Doyle Effie Caldarola Priest Memorials Order Diocesan Directory Circulation Issues Special Issue Dates Advertising Packet Bishop's Column Bishop's Schedule NWI Catholic @NWICatholic NWICatholic The Pastoral Center in Merrillville (where the NWI Catholic office is located) will be closed tomorrow Jan. 30 because of extreme cold. NWICatholic "This horror is the antithesis of everything that Jesus Christ and the Church purport to be about." Read more this… https://t.co/bgy28ODR3j Aug 24 • retweet • favorite NWICatholic "Nurture the garden of your soul. Walk there with the Lord in the early light of dawn or the cool of the evening. S… https://t.co/gUZG67EYkN Jul 17 • retweet • favorite NWICatholic St. Kateri Tekakwitha, patron of the environment, ecology and those in exile, pray for us! Memorial July 14. Join u… https://t.co/JZbsuC42H2 NWICatholic In Bishop Donald J. Hying's recent column, he writes about narcissism and entitlement, both of which call us to con… https://t.co/HKixiv8SHK Jun 20 • retweet • favorite NWICatholic In this week's column, Bishop Donald J. Hying talks about the Eucharist as the center and summit of our faith, a pr… https://t.co/FetmBtZWqF NWICatholic The new documentary, "Pope Francis: A Man of His Word," is scheduled to be shown locally starting Friday at Scherer… https://t.co/er18dHrAd5 May 14 • retweet • favorite Cremation and burial at sea Q. I am a lifelong Catholic and served 28 years in the Navy. As a junior officer, I saw the ashes or bodies of deceased sailors buried at sea; I decided at the time that this is what I want done with my body after I die, and I have not changed my mind. Recently, I shared that decision with some of my fellow parishioners, and one of them said that a new directive from the Church provides that a Catholic can no longer be buried at sea. (In fact, he said that if someone were to be buried at sea, a priest is prohibited from celebrating any type of funeral service in a Catholic Church.) If that is really the case, I don't see what I am doing remaining in a Catholic parish; in fact, it might be time for me to change to a different Christian denomination that will be there for me at the end of my life. (Virginia Beach, Virginia) Q. I am aware that the Catholic Church has traditionally discouraged cremation, but I am confused as to why. For centuries, cremation has been accepted by most cultures as a somewhat more humane way of dealing with the remains of a loved one. With a standard burial, the person's remains are left to "rot in the ground." Does it have something to do with an eventual "resurrection"? And is the presence of a body required for that resurrection? If so, what would be left of Christians from, say, A.D. 200? Surely by now there is nothing left of them to raise. (Corydon, Indiana) A. The two letters above are typical of many that I receive and reflect people's continuing fascination with the disposition of bodily remains. That interest was heightened in October 2016 when the Vatican issued an instruction regarding burial practices for Catholics. That document was issued at the request of bishops in several nations in response to the growing practice of cremation and the lack of specific Church guidelines on the disposition of cremains. The instruction reiterates that the Church, while not opposed to the practice of cremation, continues to recommend a traditional burial. The document specifies that either the body or the ashes of the deceased should be buried in sacred ground and that cremains should not be kept in private homes or scattered on land or at sea, nor "preserved in mementoes, pieces of jewelry or other objects." Burial in sacred ground, said the Vatican, prevents the deceased from being forgotten and encourages family members and the wider Christian community to remember the deceased and to pray for them. Historically, cremation was linked to the burial practices of pagans, whose religious beliefs did not include the expectation of eventual resurrection and viewed death as the definitive obliteration of the human person. The Catholic Church began to allow cremation only in 1963, as it became more commonplace for both economic and sanitary reasons. But the Church's Code of Canon Law has continued to express the preference for burial over cremation because the burial of human remains, in the Church's mind, reflects a greater esteem for the deceased and more clearly expresses the Christian belief in an eventual resurrection, when the person's body and soul will be reunited. As the Vatican's 2016 instruction says, "Burial is above all the most fitting way to express faith and hope in the resurrection of the body" and shows "the great dignity of the human body as an integral part of the human person, whose body forms part of their identity." That same instruction does note, though, that "cremation of the deceased's body does not affect his or her soul, nor does it prevent God in his omnipotence from raising up the deceased body to new life." In response to the Indiana letter writer's concern about the decomposed remains of the Christian buried in A.D. 200, we don't know mechanically how the eventual re of body and soul will occur and leave that - as the Vatican does - to the wisdom of the Lord. And as for the Virginia writer's preference for burial at sea, he can relax. The new Vatican guidelines do not prohibit that, so long as the body or cremated remains are buried in a dignified and well-protected container. (Catholics should consult with their diocese for further instructions, since standards can vary from diocese to diocese.) The Church's Order of Christian Funerals has a specific prayer for such a burial, asking that the Lord who calmed the sea in Galilee may grant peace and tranquility to the person deceased (No. 406). Questions may be sent to Father Kenneth Doyle at This email address is being protected from spambots. You need JavaScript enabled to view it. and 30 Columbia Circle Dr. Albany, New York 12203. See more content! To view more articles and search our website register with NWICatholic.com. Home | Contact Us | Mission Statement | Privacy Policy Designed by Northwest Indiana Catholic Publications.
cc/2020-05/en_middle_0087.json.gz/line1337965
__label__cc
0.575627
0.424373
Hesed (Loving-Kindness) urjnetworkadmin Rabbi 0 Our goal was to communicate that a synagogue in Florida has not stopped thinking of Gilad and his plight. We live in a sound bite, news junkie generation in which we are constantly bombarded with information and updates. The positive of this culture is our access to current events in real time and our acute awareness of happenings around the world as they unfold. The negative of the short news cycle generation is how quickly we move on and forget events and tragedies that while they happened we claimed affected us so deeply and profoundly. When that animal terrorist attacked Itamar and murdered many members of the Fogel family, memorials were held, monies were raised and the statement that we will never abandon the surviving Fogel children was pledged. But in truth, the Fogels became yesterday’s tragedy and now the Jewish community, perhaps correctly so, is obsessed with the murder of Leiby Kletzky. Projects have been initiated in his memory, funds are being collected on his family’s behalf and a baby was even named for him this week. But how long will it take until the Jewish community forgets about the Kletzkys and moves on to the next crisis, emergency or tragedy? As the three weeks have begun, we would do well to remember that a commitment to unity, an effort to be part of one big close knit Jewish people, means never forgetting or moving on from both those that have caught our nation’s attention and those that suffer in anonymity. Over five years ago, a young soldier, Gilad Shalit was taken captive by our evil enemy dedicated to our destruction. One shudders to think under what conditions Hamas is housing Gilad. We said then we won’t rest until he is home and yet, here we are over five years later with no meaningful progress made. This week, my family and I visited with Gilad Shalit’s father, Noam, outside the Prime Minister’s residence where he sits in vigil for his son. Though only the return of his son will bring true comfort, our goal was to communicate that a synagogue in Florida has not stopped thinking of Gilad and his plight. May we merit a time in which we only share good news and move from one happy event to another. Shabbat Shalom from the Holy Land Tolerance is a double edged sword. Morning and Bedtime Rituals for Children Let’s be like Avraham and Sarah and change the world one person at a time. You only get one opportunity to make a first impression. We are a people only because of the book I must admit, I am confounded and conflicted in my emotions. webmaster@ohrshalomgj.org Congregation Ohr Shalom Mailing Address: P.O. Box 1311, Grand Junction, Colorado 81502 © Congregation Ohr Shalom 2020
cc/2020-05/en_middle_0087.json.gz/line1337970
__label__wiki
0.836357
0.836357
acid deposition (7) CAPMoN (7) Government of Canada (1) Open Government Portal roles Kalman filter open government modelling CO2 LocalLogic PM speciation partners Blueprint 2020 CMIP speaking notes satellite presentation Directive on Open Government - The next step in the evolution of public secto... Includes roles and responsibilities of departments and department officials advancing the Directive on Open Government, and provides international context. Directive on Open Government Presentation for Canadian Heritage Includes Open Government expectations for departments, implementation plans, and defining open data and open information. Please note that content is available in English only. Directive on Open Government - The next step in the evolution of public sect... Includes roles and responsibilities of departments and department officials advancing the Directive on Open Government. Open Government in Canada 101 This is a presentation on the fundamentals of open government in Canada delivered on August 25, 2016. Please note that content is available in English only. Remote Sensing of Arctic and Boreal Atmospheric Composition from a Highly Ell... The presentation at the European Geoscience Union (EGU) meeting describes plans and progress for a proposed Canadian satellite mission that would provide unprecedented measurements of atmospheric composition in high latitude regions. Please note that content is available in English only. Investigating the effects of nudging on the dynamical-chemical consistency of... Poster presented at the 2016 International Global Atmospheric Chemistry (IGAC) Science Conference, Breckenridge Colorado, September 26-30, 2016. Please note that content is available in English only. Vertical propagation of the CO2 flux signal from in istu versus GOSAT data Poster presentation made by Saroja Polavarapu at the North American Carbon Program meeting in Washington D.C. on March 28, 2017. Please note that content is available in English only. CanESM5 - The Canadian Earth System Model version 5 CMOS 2017 presentation providing a preliminary overview of the CanESM5 model, its sub-components, and upcoming applications for CMIP6 and IPCC AR6. This is a work in progress and not finalized. Please note that content is available in English only. CAPMoN Workshop Air Module presentation CAPMoN Workshop Air Module. Please note that content is available in English only.
cc/2020-05/en_middle_0087.json.gz/line1337971
__label__cc
0.591705
0.408295
TV NEWS FOR NOV 1: VAMPIRE DIARIES MATT DONOVAN, L.J. SMITH WITCHES SERIES AND SUPERNATURAL PROMO Nov 1 Dawn Source: vampirediaries.net THE VAMPIRE DIARIES MATT DONOVAN: USELESS CHARACTER? There’s an article up on BuddyTV titled “5 Ways to Make Matt Interesting on The Vampire Diaries”, and the reason for the article is explained is: “While I don’t mind Matt being alive, the truth is that there’s no real reason for it. More than any other character on The Vampire Diaries, Matt serves no purpose. The only extended storyline he’s ever had was a dull relationship with Caroline that ended as soon as she was turned into a vampire and became interesting.” Wow. (See the article here…) The folks over at VampireDiaries.net have something to say about this… He’s already an interesting character for one very simple reason. Humanity. Let me explain… One of the most obvious things about Matt is that he’s one of only two main characters left who are unaware of the supernatural, and aside from his little mind-whammy from Katherine over the course of Plan B and Masquerade, he’s not really been consciously drawn into that world. All of the other main characters are neck-deep in it. Stefan, Damon and Caroline: vampires. Tyler: werewolf. Alaric and Jeremy: vampire hunters with magical rings. Source: hollywoodcrush L.J. SMITH WITCHES SERIES: THE SECRET CIRCLE It’s not a big surprise that The CW has a soft spot for author L.J. Smith. After all, she gave the network one of their biggest hits, “The Vampire Diaries,” based off of her series of the same name. (Not to mention the show also gave us the beautiful trio of Nina Dobrev, Ian Somerhalder and Paul Wesley) The CW is heading back to L.J.’s works, this time adapting her series “Secret Circle, Vulture reports. Last October, we contemplated which of L.J.’s other novelswould make the best small screen adaptation. L.J. herself said her vote was for “Night World,” yet “Secret Circle” seems to have won out. Writing and producing duo Elizabeth Craft and Sarah Fain, who were behind both “The Vampire Diaries” and “Angel,” are spearheading the effort with screenwriter Andrew Miller penning the pilot. NEW PROMO FOR SUPERNATURAL ‘FAMILY MATTERS’ Check out the new promo for the next episode of Supernatural. I have to agree, keeping Matt oblivious to the supernatural happenings around him lends a human quality to the show that would be missing otherwise. The whole Katherine mind massage takeover story line could not have happened had Matt been aware. What are your thoughts? Do you think Matt is a useless character? Do you think another series based on L.J. Smith characters will be as huge a hit as Vampire Diaries? Are you a Supernatural fan? Posted in News BlogTagged l.j. smith, promos, supernatural, The Secret Circle, the vampire diaries, TV News, witches
cc/2020-05/en_middle_0087.json.gz/line1337973
__label__cc
0.618522
0.381478
Mirabile translatu: Translating women and the miraculous in the later Middle Ages Christine F Cooper, University of Connecticut Literature, Medieval|Religion, History of|History, Medieval|Literature, English The dissertation explores how illiterate holy women in the later Middle Ages were imagined to serve as both Latin and vernacular translators through the gift of xenoglossia, the sudden, miraculous ability to speak, understand, write, or read a foreign language. It argues that holy men and women experience their gifts of miraculous translation in strikingly different ways. Because gifts of xenoglossia could potentially challenge the clergy's control over scriptural access and interpretation, the clerical authors of the women's vitae strongly emphasized the limits experienced by the holy women in their practice and performance of their xenoglossic gifts, thereby demonstrating that the women translated in socially acceptable ways. ^ The first two chapters, “Mirabile Translatu: Gifts of Vernacular Tongues in the Later Medieval Vitae of Holy Men and Women” and “Novice Translators: Donum Latinitatis in the Vitae and Visionary Texts of Medieval Holy Women,” explore the vastly different roles for women as public and private vernacular and Latin translators in medieval saints' lives. These roles range from holy women rejecting their xenoglossic gifts because they consider it inappropriate for women to practice scriptural translation, to women engaging in all aspects of literate activity, including translating the Gospel discreetly for their confessors and teaching Scripture to fellow nuns. The third chapter, “Miraculous and Mundane Translation in The Book of Margery Kempe,” examines the Book's preoccupation with Margery's experiences of miraculous (xenoglossic) and mundane (everyday, non-miraculous) translation. It argues that both Margery and her scribe claim events of xenoglossic and mundane translation in the Book in order to associate Margery and her text with other saintly and visionary models, as well as to demonstrate her desire to control both her own access to religious practice and her own representation as a holy women. The fourth chapter, “Translating Women in The Canterbury Tales: Xenoglossia in the Tales of Custance and Canacee,” explores how Chaucer adapts the popular trope of women's Latinate and vernacular xenoglossia in order to explore questions of women's “appropriate” practice of translation in the genres of romance and hagiographic romance. ^ Cooper, Christine F, "Mirabile translatu: Translating women and the miraculous in the later Middle Ages" (2004). Doctoral Dissertations. AAI3134776.
cc/2020-05/en_middle_0087.json.gz/line1337974
__label__wiki
0.863547
0.863547
Liberties taken with the Book of Enoch? ARCHANGEL METATRON WATCH: Ignition describes El Shaddai: Ascension of the Metatron as a "retelling of the Book of Enoch," except the team have "taken some liberties" with the material. Do tell. Background here. Steven Weitzman, "Solomon: The Lure of Wisdom" THE SOLOMON LEGEND is the subject of a new book: King Solomon: Stanford scholar considers how the man who had everything ended with nothing Scholar Steven Weitzman's new book on Solomon is a meditation on the "lust to know." But how much can we really know about the legendary king who was the first Faust and inspired the voyage of Columbus? BY CYNTHIA HAVEN (Stanford Report) What can we learn from the wisest man who ever lived? Maybe not as much as we think, according to Stanford Jewish studies scholar Steven Weitzman. His new book, Solomon: The Lure of Wisdom (Yale University Press) has been called a meditation on the "lust to know." Yet it's curious we know so little about the man at the center of the book. We don't even know what Solomon looked like, though Biblical writers note that his father and siblings were handsome. One thing he is famous for, though: "According to Jewish tradition, he knew everything. He knew as much as God knew," said Weitzman, a professor of Jewish culture and religion. "As a scholar, I'm attracted to knowing everything. Because I feel I don't know anything." Hence, the book. "It was a lot of fun," Weitzman said of the work he calls "an unauthorized biography." It does sound like fun. Relegere: Studies in Religion and Reception RELEGERE: Studies in Religion and Reception is a new open-access online journal on reception history. (Via the BNTS list.) Rollston on the Mariam Ossuary again CHRISTOPHER ROLLSTON has a new blog post on the Miriam/Mariam ossuary inscription: ‘Priests’ or ‘Priest’ in the Mariam (Miriam) Ossuary, and the Language of the Inscription. His earlier post on this inscription is noted here. Also, two reviews of Professor Rollston's new book Writing and Literacy in the World of Ancient Israel: Epigraphic Evidence from the Iron Age have just been published by Johannes Schnocks and Ian Young in the Review of Biblical Literature. Controversy over Syriac names in Turkey ARAMAIC WATCH: Turkey’s Syriacs demanding right to own names Vercihan Ziflioğlu ISTANBUL- Hürriyet Daily News Turkey’s Syriac community, who adopted Turkish surnames, now want their original surnames back. Yet, a top cour says that the laws don’t allow such a move. Members of Turkey’s Syriac Christian community are leading a legal struggle to adopt last names that reflect their identity despite a Constitutional Court ruling earlier this year that barred one Syriac from altering his last name. The issue may be brought to the attention of the European Court of Human Rights. (HT Abu 'l-Rayhan Al-Biruni.) "The Magdalene" gets unenthusiastic reviews THE MAGDALENE, now playing Off-Broadway, is getting unenthusiastic reviews. From the NYT: A Married, Reimagined Jesus By CATHERINE RAMPELL The creators of “The Magdalene,” a musical based on an alternate telling of the story of Mary Magdalene, have achieved the seemingly impossible: they have managed to take stunningly incendiary material and douse it with blandness and bathos. From the New York Press: Oh, Mary Mary Magdalene gets the superstar treatment in a new musical By Mark Peikert Forget the prostitute we all love, the one who belts “I Don’t Know How to Love Him” in Jesus Christ Superstar. According to The Magdalene (and the Gnostic texts left out of the Bible as we know it), Mary Magdalene was a feisty spitfire with a Mia Farrow pixie cut, who questioned the treatment of women by church officials and society and turns out to have known how to love Jesus all along. She also likes to belt out a few tunes herself, though none of them as catchy as the ones in the Andrew Lloyd Webber-Time Rice musical. There’s very little that’s catchy in this new musical, staged in the round at Theater at St. Clement’s, a choice that makes the piece feel more amateurish than it might otherwise. ... I don't recall the pixie cut from the Gnostic gospels, but it's been a while since I read them. Background here (bottom of post). Teologías, Escrituras, y Siberia THIS BLOG by Tomás García-Huidobro has been around since late 2009, but I've only just found it: Teologías, Escrituras, y Siberia: Temprano misticismo judío, cristiano y gnóstico como medios para iluminar los origenes cristianos. Jewish artifacts at the ROM (with aside on fake metal codices) THE ROYAL ONTARIO MUSEUM has a new exhibition with items of interest: Jewish artifacts are displayed in a new ROM gallery By SHELDON KIRSHNER, Staff Reporter (Canadian Jewish News) TORONTO —The Royal Ontario Museum has unveiled an ensemble of four new galleries on the ancient empires of Rome, Byzantium and Nubia, all sup­plemented by videos shot on location in Europe, the Middle East and Africa. Ring with a menorah Janet Carding, the director and chief ex­ecutive officer of the museum, said this was “a key moment” for the Toronto museum. These civilizations span 2,500 years of history and had a lasting influence on art, esthetics, architecture and religion, said Carding. The galleries – which add ap­prox­i­mately 7,000 square feet of exhibit space to the museum – were open­ed on July 1. The new galleries consist of the Eaton Gallery of Rome, the Joey and Toby Ta­nen­baum Gallery of Byzantium, the Joey and Toby Tanenbaum Gallery of Rome and the Near East, and the Gal­leries of Af­rica: Nubia. Several Jewish objects from an­cient Pa­lestine are ex­hi­bited in the Joey and Toby Tanenbaum Gallery of By­zan­tium – a jar with a menorah, a ring with a men­orah, etrog and lulav and a bread stamp with a menorah and cross. They date back to the period from 300 to 614 CE. The jar and the ring were most likely made for Jews visiting holy sites in Jeru­salem. The bread stamp engraved with a menorah and a cross is extremely rare because the portrayal of images was considered idolatrous, said Paul Denis, the assistant curator of the Greek and Roman collections. The ring is quite interesting. Could it be another inspiration for the fake metal codices (follow those links)? Below: genuine early-Byzantine metal ring with seven-branched menorah. Note the etrog on the lower left and the lulav (palm branch) on the lower right. Below: fake metal codex. Note the seven-branched menorah on the lower left. And could that wreath under it be partly inspired by the etrog and lulav on the image above? KJB@400: Dead Sea Scroll at Oklahoma City exhibit KJB@400 WATCH: More on the exhibition at the Oklahoma City Museum of Art: OKC Museum of Art: "Passages" exhibit Brianna Joyce, Oklahoma City Travel Examiner This season's special exhibit at the Oklahoma City Museum of Art is truly incredible. Art aficionados, bibliophiles, young and old, and members of all faiths will enjoy the Passages exhibit celebrating the 400th Anniversary of the King James Bible. Passages explores the Bible's history from its origins in Jewish scripture to its important English translation under King James. For those interested in exploring the story behind each artifact, the exhibit provides headphones that give detailed explanations for many scrolls and books. The tour begins with a stunning collection of containers that held scrolls of the Torah. There is also a stone menorah that stood in the Temple of Jerusalem at the time of Christ. The beautiful lines of Hebrew are preserved on parchment, and a glass case contains a fragment of the Dead Sea Scrolls. No word on which Dead Sea Scroll is exhibited, and the exhibition website is no more forthcoming. UPDATE (19 July): The fragment is of Genesis 32:3-7. More here. The Magdala Center and archaeological site THE MAGDALA CENTER and archaeological site are the subject of a Travel piece in the Jerusalem Post: Archaeological site inspires gospel reminiscing By NICOLE JANSEZIAN, TRAVELUJAH The Magdala Center's new guesthouse, along with a uniquely written Catholic mass will bring to life New Testament times in the Galilee. A new guesthouse, an archaeological site and a uniquely written Catholic mass will bring to life New Testament times in the Galilee. The Magdala Center, Notre Dame Pontifical Institute's planned guesthouse, is on the shores of the Galilee and hosts a peek into the time of Jesus. Even though the Gospels barely mention the city, Magdala (or Migdal) played a historic role in the 1st century as revealed in the ongoing archaeological dig on the site. The entire archaeological area uncovered is exclusively 1st century, which is rare. Most sites, even those nearby, usually show an overlap of periods. This one so far is purely Roman era. It has also revealed a community that was likely very wealthy. “In this synagogue they had a great leader – not common, very rich,” he said. [Father Juan Maria] Solana listed some of the impressive findings in the excavations including a synagogue, a marketplace, a villa, a perfectly preserved mosaic, rooms paved with well-cut stones and three arches, one of which is still standing. The synagogue contains mosaics, a carved stone menorah and frescoes. Another key find is the port of Magdala, some 50 meters from the current shoreline and near the marketplace. On one side of the port is all the remnants of the lake that had lapped against the wall. Background here and links. Jerusalem Museum of Tolerance gets building permit JERUSALEM MUSEUM OF TOLERANCE UPDATE: Museum of Tolerance gets final go-ahead By MELANIE LIDMAN (Jerusalem Post) The building permit was awarded by the Interior Ministry, rather than the Jerusalem Municipality, due to the sensitivity of the site. Talkbacks (1) After more than a decade of sitting empty in downtown Jerusalem, the controversial Simon Wiesenthal Museum of Tolerance received final approval for its new campus on Tuesday. The building permit, from the Ministry of the Interior’s District Planning and Construction Committee, means that work can begin on the site immediately. Background here and many links. Ancient Hebrew Shabbat boundary marker NEW INSCRIPTION: Shabbat boundary rock with Hebrew etching discovered By OREN KESSLER (Jerusalem Post) Inscription, discovered by chance by visitor in Lower Galilee, appears to date from the Roman or Byzantine period. An ancient rock inscription of the word “Shabbat” was uncovered near Lake Kinneret this week – the first and only discovery of a stone Shabbat boundary in Hebrew. The etching in the Lower Galilee community of Timrat appears to date from the Roman or Byzantine period. News of the inscription, discovered by chance Sunday by a visitor strolling the community grounds, quickly reached Mordechai Aviam, head of the Institute for Galilean Archeology at Kinneret College. “This is the first time we’ve found a Shabbat boundary inscription in Hebrew,” he said. “The letters are so clear that there is no doubt that the word is ‘Shabbat.’” Benjamin Z. Kedar interviewed in Haaretz THE OUTGOING CHAIRMAN OF THE BOARD OF THE IAA is interviewed by Haaretz: Professor B.Z. Kedar, is Israeli archaeology an 'old-boys club'? The Israel Antiquities Authority has been attacked for not doing enough to preserve the Temple Mount antiquities, on one hand, but also for supposedly being a tool of extreme nationalist groups. By Nir Hasson Prof. Benjamin Z. Kedar has been chairman of the board of the Israel Antiquities Authority for 11 years. He is also the deputy chairman of the Israel Academy of Sciences and Humanities. Kedar will leave his position at the authority at the end of July. Haaretz reported yesterday on an amendment to the Antiquities Authority Law, proposed by Culture and Sports Minister Limor Livnat, that would make it easier for her to find a replacement for Kedar. At present, the chairman of the Antiquities Authority board must belong to the Israel Academy of Sciences and Humanities. Livnat's bill would require only that the chairman be a "leading scholar in the field of history or archaeology." Senior archaeologists criticized Livnat on Sunday, claiming that the purpose of the amendment was to enable her to appoint archaeologists who are identified with the right or who will toe the establishment line. Livnat's critics say the bill reflects the anti-intellectual winds blowing through the government ministries. Kedar rejects this interpretation, but cautions against amending the law. He also expresses doubt that the Essenes wrote the Dead Sea Scrolls and comments on many other archaeological and political issues. Read it all. Background to MK Livnat's proposed amendment is here. KJB@400: Lecture series in Oklahoma City KJB@400 WATCH: Cool lecture series in Oklahoma City: Oklahoma City Museum speaker series connected to Bible exhibit set for debut ‘Passages' speaker series calendar A speaker series connected to the “Passages” Bible exhibit will debut July 19 at the Oklahoma City Museum of Art in downtown Oklahoma City. BY CARLA HINTON chinton@opubco.com (NewsOK) Renowned scholars and authorities in ancient texts and manuscripts will discuss recent research and developments during lecture presentations connected with the “Passages” exhibit at the Oklahoma City Museum of Art. The “Passages” Speaker Series will begin July 19 in the Noble Theater at the museum, 415 Couch Drive. “Passages,” a 14,000-square-foot traveling exhibit, opened in May to celebrate the 400th anniversary of the King James Bible. The interactive exhibit features nearly 300 items from the Green Collection, one of the world's largest private collections of rare biblical texts and artifacts. Here is the list of lecturers and their topics: The following guest speakers and lectures will be presented as part of the free 11-week “Passages” Speakers' Series at the Oklahoma City Museum of Art, 415 Couch Drive. Each lecture will be from 6:30 to 7:45 p.m. Tuesdays. • July 19: David Lyle Jeffrey, Ph.D., Baylor University, “Beyond the Renaissance: Critical Texts and Bible Translation.” • July 26: Peter Flint, Ph.D., Canada research chair in Dead Sea Scrolls studies, “The Contents and Challenges of the Dead Sea Biblical Scrolls.” • Aug. 9: Gordon Campbell, Ph.D., University of Leicester, United Kingdom, “The Making of a Bible Classic: The Translation of the King James Bible.” • Aug. 16: Edwin Yamauchi, Ph.D., Miami (Fla.) University, “The Greatest Archaeological Discoveries and the Old Testament.” • Aug. 23: Scott Carroll, Ph.D., director of the Green Collection, “The Green Collection: Scientific Breakthroughs and Bible Translation.” • Sept. 6: Scot McKendrick, Ph.D., British Library, “Manuscript Discoveries and Bible Translation.” • Sept. 13: Dirk Obbink, Ph.D., Oxford University, “Papyri Discoveries and Bible Translation.” • Sept. 20: Alister McGrath, Ph.D., King's College, United Kingdom, “What Do William Tyndale and C.S. Lewis Have in Common.” • Sept. 27: Ralph Hanna, Ph.D., Oxford University, “Richard Rolle's Impact on the English Bible.” • Oct. 4: Jerry Pattengale, Ph.D., director of the Green Scholars Initiative, “Answers to New Theories Regarding How We Got the Bible.” • Oct. 11: Robert Cooley, Ph.D., Gordon-Conwell Theological Seminary, “The Greatest Archaeological Discoveries and the New Testament.” For more information, go online to www.explorepassages.com. Politics and IAA board of directors SPEAKING OF POLITICS: Archaeologists: Right-wing culture minister making appointments based on politics Top archaeologists slam Limor Livnat's bid to change make-up of Israel Antiquities Authority's board of directors, say move will allow her to appoint officials identified with the political right. By Nir Hasson (Haaretz) Senior archaeologists are up in arms over an amendment to the Antiquities Authority Law proposed by Culture and Sports Minister Limor Livnat , which they say will shift the political slant of the Israel Antiquities Authority's board of directors to the right. Critics say Livnat has proposed the legislation to prevent the appointment of Prof. Yoram Tsafrir as chairman of the board of directors of the authority and to allow her to instead appoint archaeologists identified with the political right. Opponents of the bill also say Livnat has also been changing the makeup of the country's senior archaeological body, the Archaeological Council, which advises the director of the Israel Antiquities Authority and the minister who oversees the Israel Antiquities Authority. Livnat's amendment states that the minister "would appoint a senior scientist from the realm of history or archaeology, after consultation with the Israel Academy of Sciences and Humanities." The explanatory notes accompanying Livnat's bill state: "The law currently obliges the minister to choose from a limited list of scientists, while in fact there are many worthy candidates who are not members of the Israel Academy of Sciences and Humanities." Over the past year,three new members were appointed to the Archaeological Council: Dr. Gabriel Barkay, Dr. Ronny Reich and Dr. Eilat Mazar. All three are known for their work in excavations funded by Elad in East Jerusalem. Reich was elected head of the council. Archaeologists critical of Livnat's moves also say scholars from Bar-Ilan University have a greater representation on the Archaeological Council than other universities. Livnat replies: "The source of this limitation is a law going back 33 years. Since then, the number of archaeologists and historians who are senior researchers has increased significantly and there is not reason to prevent worthy candidates from heading the board. ... It seems that claims against opening up the appointment to additional worthy candidates stems from extraneous interests and the desire to force a certain appointment as chairman of the board." UPDATE (12 July): More here. Iraqi Jewish archives update IRAQI JEWISH ARCHIVE WATCH: Tug-of-war over Iraqi Jewish trove in US hands (AP). Lots of new information, especially about the web of politics in which the archive is now snarled. But the good news is that $3 million has be set aside for the restoration of the manuscripts. (HT Gerald Rosenberg. Background here and follow the many links back to 2003.) BMCR review responses and reviews BMCR review responses and reviews: First, two responses to this review from March: Bar-Kochva on Wyrick on Bar-Kochva, The Image of the Jews in Greek Literature. Pelling on Bar-Kochva on Wyrick on Bar-Kochva. Then, a couple of recent review of possible interest: Daniel C. Snell, Religions of the Ancient Near East. Cambridge/New York: Cambridge University Press, 2011. Pp. xii, 179. ISBN 9780521683364. $25.99 (pb). Reviewed by Corinne Bonnet, Université de Toulouse II – Le Mirail & Institut Universitaire de France (cbonnet@univ-tlse2.fr) Présenter l’ensemble des religions du Proche-Orient en 179 pages est un défi. Daniel C. Snell l’a courageusement relevé et propose à ses lecteurs une synthèse agréable à lire qui balaie les principales thématiques, aires géographiques et périodes en 17 chapitres. La qualité majeure de cet ouvrage est la conjonction entre une érudition vaste et profonde et une présentation accessible aux non spécialistes. Certes, parfois, on y perd en précision ou l’on tombe dans certaines généralisations que les spécialistes regretteront, mais l’objectif est de fournir un premier panorama que les indications bibliographiques permettront, le cas échéant, d’approfondir. Dominique Charpin, Writing, Law, and Kingship in Old Babylonian Mesopotamia (translated by Jane Marie Todd). Chicago/London: University of Chicago Press, 2010. Pp. 182. ISBN 9780226101583. $55.00. Reviewed by Rochelle Altman, Sivan College (willaa@netvision.net.il) In Classical studies, since the 1990s, it has become increasingly clear that literacy was more widespread in society than had been previously thought. While many Assyriologists maintain that literacy was the exclusive domain of professional scribes and even kings, clergy, and generals are classed among the illiterate, Dominique Charpin has come to similar conclusions about Classical Babylonia. In this volume, Charpin focuses on the relationship between writing and law and, as we could expect from his previous works, makes a strong and convincing case for writing as a more wide-spread phenomenon than has been assumed. A Metatron schism? AN IMPENDING METATRON SCHISM? El Shaddai will be 'divisive' in America, says Ignition. That can happen. Jewish artifacts at the ROM (with aside on fake m... KJB@400: Dead Sea Scroll at Oklahoma City exhibit... Jerusalem Museum of Tolerance gets building permit...
cc/2020-05/en_middle_0087.json.gz/line1337984
__label__cc
0.643973
0.356027
Is the Market Wage the Just Wage? A Reassessment of Factor Pricing and Distributive Justice Erasmus Journal for Philosophy and Economics 11, no. 2 (2018): 124–143. 20 Pages Posted: 16 Apr 2018 Last revised: 28 Oct 2019 See all articles by Peter J. Boettke George Mason University - Department of Economics Rosolino Candela Mercatus Center at George Mason University Kaitlyn Woltz Date Written: March 30, 2018 Do markets generate a “just” wage? The answer to this question will depend upon the particular theory of the market that the political economist employs. By comparing actual labor markets with the neoclassical theory of competitive equilibrium as its normative benchmark, Joseph Heath (2018) argues that factor pricing is orthogonal to normative issues such as distributive justice. We argue that Heath’s conclusion, though not invalid, is misplaced since it is directed towards a model of the market rather than the market itself. Though indeed classical political economists and early neoclassical economists failed to deliver an explicit theory of distributive justice, what Heath overlooks is that implicit to their understanding of the market process was an institutional theory of distributive justice. From this theory, distributive justice is evaluated on the degree to which institutions generate the conditions necessary for individuals to not only realize, but also increase their marginal product of labor. By arguing in terms of an equilibrium, Heath avoids the more relevant question of a comparative institutional nature, which is to understand under which institutional conditions a just wage can be discovered. Therefore, Heath evaluates factor pricing without taking into account the institutional conditions within which factor prices emerges in the first place. Keywords: Income Distribution; Joseph Heath; Marginal Productivity Theory JEL Classification: B1; D33; D41; P51 Boettke, Peter J. and Candela, Rosolino and Woltz, Kaitlyn, Is the Market Wage the Just Wage? A Reassessment of Factor Pricing and Distributive Justice (March 30, 2018). Erasmus Journal for Philosophy and Economics 11, no. 2 (2018): 124–143. . Available at SSRN: https://ssrn.com/abstract=3153138 or http://dx.doi.org/10.2139/ssrn.3153138 George Mason University - Department of Economics ( email ) Rosolino Candela (Contact Author) Mercatus Center at George Mason University ( email )
cc/2020-05/en_middle_0087.json.gz/line1337986
__label__wiki
0.556689
0.556689
← Πεθαίνοντας στην Μεσόγειο… εκατοντάδες χιλιάδες νεκροί ..παρείσακτοι παράνομοι λαθρό… Πόλεμοι φτώχεια κέρδη για τις πολυεθνικές οι αιτίες..Και εμείς ως ρατσιστές τους βάζουμε φυλακή (Σιακαλή κ σία) 19 χιλιάδες νέα μέλη κομματοσκουλίκια για να εκλέξουν..δημοκρατικά τον άγγονα του πολυεκατομμυριούχου Λεβέντη ή τον σελέμπριτι Μάριο….Το επίπεδο του πολιτικού λόγου….φάε δημοκρατία, τάισε τις τράπεζες και δόξα τα λεφτά έχουν θεό…δούλευε ψήφιζε και σκάσε → 5 Οκτωβρίου, 2013 · 12:55 μμ Εφημερίδα Cyprus Mail Συνέντευξη Fighting the system http://cyprus-mail.com/2013/10/04/fighting-the-system/# Far from having his eyes glaze over when meeting a lwayer specializing in ill treated migrants THEO PANAYIDES meets an energetic anarchist A few hours after meeting Michalis Paraskevas, I realise it’s impossible to explain to friends and colleagues why I’m so impressed with him. It’s a sad fact of life that people’s eyes glaze over when they hear words like ‘migrants’ and ‘human rights’, and that’s what 36-year-old Michalis does – he’s a lawyer specialising in cases of ill-treated migrants. It didn’t sound like the most exciting interview, at least on paper. I fully expected to be nodding piously while being lectured on how we can all Do Better – but instead I got rage, charisma and waves of furious energy. You wouldn’t think a small, second-floor office on a quiet Nicosia side-street could contain so much energy. He spits out statute, precedent and relevant statistics with impressive felicity. “I know the law. I know their system – OK?” he explains, ‘they’ being the banks, vested interests and “media of mass deception” behind the system. That “OK?” is one of his repeated phrases (carrying a slight edge, as if to say ‘You got a problem with that?’, an impression reinforced by his savage crew-cut and prominent features), another being “re koumbare”, the Cypriot version of ‘mate’. But it’s not just what Michalis says that makes an impact – it’s also the way his green eyes flash, or the way he’ll rock back and forth in his chair as if about to explode, or the way he’ll bang a fist down on his desk to underline a point, or the way he’ll raise his arms, as if offering himself to an invisible firing squad, when he says something like “I’m an anarchist! Yes, I-am-an-anarchist! But I don’t mean Molotov cocktails and shit like that – OK?”. Above all, perhaps, it’s the way his mobile phone keeps ringing – eight or nine times in the 90 minutes I spend in his office (there are no secretaries or other lawyers; he’s completely alone, maybe because helping migrants isn’t exactly lucrative work). Most of the calls relate to ongoing cases, though one is from his older brother Marios, who’s just arrived from Greece; there’s also a younger brother who – like Michalis – studied Law in Thessaloniki, the Greek influence being very strong because that’s the kind of family he grew up in, a nationalist family that flew the Greek flag and was proud of it (his dad was a teacher, his mother a school administrator). “My childhood influences were ‘Greece, Cyprus, Enosis’,” he recalls – and he’s outgrown that phase but retains a certain nostalgia: he runs a blog at osr55.wordpress.com (there’s also a YouTube channel at youtube.com/user/osr555, where he uploads videos on a regular basis), the ‘55’ standing, symbolically, for 1955, the year of EOKA. And the ‘osr’? That stands for ‘Only Solution, Revolution’. It’s easy to scoff at such fiery posturing – but Michalis is one step ahead of the scoffers. “That’s automatism,” he points out when he talks of anarchist communities in Catalonia in 1936 and I wonder (as most people would) if that can really work in the long term. “What you just did there is an automatic response, which we’ve been taught by our family, the schools, the media of mass deception. An automatic response. Automatically, as soon as you hear something like that, you’re like ‘Oh, but human nature…’ and crap like that”. Anarchism can work, he believes, citing not just Catalans but Native American tribes – anarchism in the strict sense of living without a central authority. One of his dreams, which he and his wife are slowly putting into practice, is to build a house that’s entirely “autonomous”, with its own solar power,generators and a plot of land to grow vegetables and raise chickens; “So I won’t need anyone, neither governments nor corporations”. But the real reason why it’s hard to scoff at Michalis’ revolutionary talk is because he’s not spouting these ideals from the comfort of a desk job or trust fund: he’s in the trenches, fighting the system – so he says – every day and twice on the weekend. He mentions lots of cases in the course of our 90 minutes, most of them punctuated with indignant cries of “they’re crazy, re koumbare!”. The case of the Iranian migrant who spent 55 months in jail while his case was pending. The case of Senthil Thevathas, a former Tamil rebel deported back to Sri Lanka (where he’s now hiding out, trying to avoid execution) – even though the Supreme Court specifically ordered that Thevathas shouldn’t be deported till his case had been examined, an order that was simply ignored by the Department of Migration. The case of a Syrian mother and her 12-year-old child, who only wanted to go to Sweden – and tried to leave Cyprus with a fake passport, which admittedly was wrong, but Migration’s response was to arrest her, leave the child to fend for itself, and order her deported back to war-torn Syria! immigrants in nicosia Migration is clearly his nemesis; the Department, says Michalis scathingly, “operates like a common racist”. Most of what he says about department head Anny Shakalli is unfortunately libellous, though he doesn’t care: “Let her sue me, no problem” (he’s already been hauled before disciplinary boards twice, and won his case on both occasions). The stories he tells offer few fist-pumping triumphs; mostly they involve applications for habeas corpus being dismissed, judges being apathetic (or worse), Michalis ranting and raving at heartless officials – all while migrants rot in jail and weep copiously. “Why are you treating us this way?” he recalls the Syrian woman asking, and shakes his head: “I was ashamed. I was ashamed of my country.” But after all, I venture, there’s a crisis now. We don’t have room for migrants. “That’s ridiculous!” he snaps back. “First of all, there’s a war in Syria. You think they know Cyprus, and they’re coming here for the halloumi? Most Syrians – maybe 99.9 per cent – want to go to Sweden or Germany. They don’t want to stay in this stinking place!”. What’s his opinion of Cypriots generally? “They’re skatopsyshi,” he replies vehemently, meaning they have ‘shit for souls’. “We’re among the most skatopsyshi nations. This society is rotten to the core, there’s no sense of solidarity – you can see that by how they treat the weakest. This society, when they see a weak person lying on the ground, they’ll go and kick them when they’re down. That’s all I have to say”. The phone rings again. It’s one of his current cases (he has about 80 ongoing cases, which explains why he’s usually in the office from early morning) – an EU citizen married to an Asian man. They have a three-year-old child, with a legally-issued birth certificate naming the man as the father – but the authorities now claim it’s a marriage of convenience, and when the woman went to find out why she wasn’t allowed to work “our friends the stinking cops, the dirtbags, arrested her right in front of her child. Even though you aren’t allowed to jail a mother even for a criminal offence, only for drugs. And she’s a European citizen!” The woman’s been in jail since August 6 (it’s now September 20) – and indeed they’d been planning to deport her that same day, leaving the child behind. “They’re such liars, re koumbare, they’re such liars. I mean, they claim the man isn’t the father – so what, you’re going to leave the child with a stranger?” Michalis intervened, and blocked the deportation – but this morning, right before our interview, had an application for an interim order dismissed by a judge. “Yes, hi,” he says on the phone now. His English isn’t perfect, and the woman is clearly distraught. “I’m – yes, Michalis, your lawyer, yes…” A long pause. He listens. “Listen, listen to me,” he says at last. “Today the judge, unfortunately, they reject the application. We have to make another application. But this will take at least one month…” Another long pause. “Listen to me, listen to me, listen to me. I understand. Don’t – listen – when they call you, don’t talk with these people. Don’t talk to them. Tell them ‘call my lawyer’. You understand what I’m telling you?” Another pause. He raises his voice, as if to drown out her wailing. “Don’t talk – listen – listen to me very carefully, what I’m gonna tell you. When these people call you, and they say that is from the Immigration, tell them ‘I have a lawyer. Don’t talk with me, talk to my lawyer’. And turn off the telephone. OK? I will make another application on Monday, and we will see what happens…” He goes on for a few more minutes, ending with a promise to visit her later today at the detention centre where she’s being held “in the middle of nowhere”. It must take its toll, dealing with such cases day after day, trying to calm the distraught and desperate – but Michalis Paraskevas wouldn’t be half as impressive if he were simply doing good work, or even if his anger were a bitter, unhappy kind of anger. What’s great, and invigorating, is the way his anger is creative. It nurtures and sustains him, and goes hand-in-hand – despite everything – with dreams of a better future. “I have no delusions on what I can offer,” he admits. “Anyone who thinks world revolution is going to start from Cyprus is out of his mind”. But he is nonetheless an anarchist – or a “libertarian socialist,” as he likes to call it – trying to be what 19th-century writer Peter Kropotkin called a “revolutionary spirit” (Kropotkin is one of his influences, along with Bakunin, Malateste and Berkman; he found their texts online, the internet being the new revolutionary frontier). “Nothing is ever lost,” he asserts. “Every struggle leaves something behind”. Even when it feels like he’s banging his head against a brick wall, he can make a tiny difference, or inspire some younger person. “Another world is possible,” he says. “It doesn’t mean it’s coming tomorrow, nor the day after. Maybe I won’t even be alive.” But the hope – the conviction – is there. Michalis is an athlete. That’s important to note: he’s been cycling all his life, was a Cyprus champion in his teens, won the silver for the whole of Northern Greece during his college years. He talks like an athlete, as when speaking of a televised debate he had with MP Zacharias Koulias: “I demolished him in five minutes!” he says gleefully. “With arguments,” he adds, as if he and Koulias might’ve arm-wrestled instead, or raced their bikes. When he thinks about his life – his work, his beliefs, the seemingly inviolable System – I suspect he thinks like an athlete: it’s all about stamina and determination, and refusing to give up till you’ve wheeled across the finish line. “Everyone makes their choices in this life,” says Michalis firmly. He cites Pavlos Fyssas, the Greek leftist killed by Golden Dawn supporters in Greece recently; not that he himself wants to die, he adds quickly, but that’s what you do, “you do what you believe in and hope for the best… Today we’re alive, tomorrow we’re not. It goes without saying that I have plans for the future, I want to start a family – but everyone makes their choices. If you want to be a slave, and a worm, and to crawl, then go ahead and do it, my friend – but I don’t accept that. OK? I’ll keep doing what I’m doing, and let them do what they want to me.” Some may despise him, and that’s okay too: “You see how I am as a person: you either like me or you don’t like me!” But the point is revolution, and “revolution begins in the mind,” he says earnestly. “I chose to be in society. I’m in the system – I’m a lawyer, obviously – and I’m fighting within this system. “You know what the easiest thing in the world is, Theo? To wear torn clothes, and grow my hair Rasta-style, and go get my fix” – he makes the universal gesture for puffing on a joint – and say ‘I’m an anarchist’. No, my friend, that’s not being an anarchist. An anarchist is a fighting man, who’s fighting for a better society”. Like I said, impressive. Filed under "δικαιοσύνη", "θεσμοί", "οικονομική κρίση", Asyl in der Republik Zypern, Cyprus Mail, ρατσισμός, Άνθρωπος κοινωνικά καθορισμένος, Αυτοοργάνωση Αυτοδιαχείριση, Αναρχισμός, Αναρχοσυνδικαλισμός, Ανθρώπινα Δικαιώματα, Κροπότκιν, Παύλος Φύσσας Αντιφασίστας δολοφονημένος από θρασύδειλους χαυγίτες, Παγκόσμιο Σύστημα-Αλήθειες κρυμμένες, Συνέντευξη, Τζορτζ Οργουελ Αναρχικός Δημοσιογράφος Συγγραφέας, Το Επαναστατικό Πνεύμα Κροπότκιν, αναδημοσιεύσεις, δικαιώματα μεταναστών 9 responses to “Εφημερίδα Cyprus Mail Συνέντευξη Fighting the system” strovoliotis Κάποιες πλευρές σου πράγματι εντυπωσιάζουν 🙂 Τουλάχιστον στην αρχή 😉 Achilleas Chrysostom (@achilleas999) ωραιος nasosmor εκτος απο τον ατομικο σου αγωνα που ειναι αξιοθαυμαστος τι αλλο εχετε συγκροτησει ; Νάσο μέχρι πρόσφατα συμμετείχα σε μια κίνηση πολιτών το wake up cyprus από την οποία έχω αποχωρήσει για λόγους που έχουν να κάνουν με τον τρόπο λειτουργίας/οργάνωσης σε συνάρτηση με τα ιδεολογικά πολιτικά πλαίσια που θα έπρεπε να δεσμευτούμε γραπτώς ότι θα κινούμασταν πχ όχι εθνικιστκά συνωμοσιολογικά κλπ καθώς επίσης και για την μη καταγραφή άμεσων στόχων που θα έπρεπε να επιτευχθούν αλλά και η απουσία ουσιαστικών πρακτικών προτάσεων για το τι είναι αυτό που προτείνουμε και θέλουμε να γίνει βραχυπρόθεσμα και εν τέλει ποια είναι η πρόταση μας για τον τρόπο που θέλουμε να λειτουργεί η κοινωνία εν γένει δεν έχω σταματήσει να έχω επαφή με πολιτικές ομάδες αλλά και άτομα και συνεχίζω να συμμετέχω με όποιο τρόπο μπορώ σε πολιτικές διαδικασίες, όπως ήταν πχ η αντιφασιστική πορεία, η προβολή ντοκυμαντέρ στον αυτοδιαχειριζόμενο κοινωνικό χώρο ζέρμιναλ στην Λεμεσό αλλά και πρόσφατα στην συζήτηση που διοργάνωσε το «Γρανάζι» στο πανεπιστήμιο Κύπρου σε σχέση με το ξεπούλημα της δημόσιας υγείας άυριο η ώρα 8 στο καφενείο Έλευσις στην παλιά Λευκωσία μαζί με τον Χάρη που έχει το καφενείο θα έχουμε την προβολή του ντοκυμαντέρ Κατασκευάζοντας συναίνεση με το Νόαμ Τσόμσκυ αλλά την περίληψη/κολλάζ που έκανα και έχω στο κανάλι στο you tube και είναι μικρότερης διάρκειας από ολόκληρο το ντοκυμαντέρ και θα ακολουθήσει συζήτηση θα κάνω αμέσως τώρα σχετική ανάρτηση μη με παρεξηγησες δε σε ρωτησα ωσαν να ηθελα να σε κριτικαρω για ατομικη μονο προσπαθεια ! σε ρωτω καθαρα γιατι καποια φορα θα ηθελα απο περιεργεια και σαν μια επαφη να παρευρεθω. απλα 90% οσων εχω δει να δημοσιευεις ειναι στη λευκωσια και με 2 μωρα το ενα νεογεννητο και με φορτο εργασιας δεν ειναι ευκολο .. λεμεσο γινεται κατι αναλογο ποτε? μα δεν παρεξήγησα απλά σου ανέφερα πως βλέπω τα πράγματα και τι προσπαθώ να κάνω προσωπικά, στην Λεμεσό πάντως γίνονται πράγματα εκδηλώσεις και προσπάθειες αυτοοργάνωσης αυτομόρφωσης και τέλος Αυγούστου https://osr55.wordpress.com/2013/08/30/ Κοινωνικός Πολυχώρος “Ζερμιναλ” στην Λεμεσό! Συγχαρητήρια στην προσπάθεια των παιθκιών!! Χτες έγινε προβολή ντοκυμαντέρ The take αυτομόρφωση συζήτηση..Ένας άλλος κόσμος είναι εφικτός φτάνει να τον δημιουργήσουμε θα γίνονται εκδηλώσεις και προβολές από τα παιδιά στο στέκι του Ζέρμιναλ οπότε την επόμενη φορά ίσως τα καταφέρεις ok ευχαριστω. το προγραμμα των εκδηλωσεων αναρταται καπου? 12 Οκτωβρίου, 2013 στο 5:00 πμ Are you registered on Facebook? There is a Facebook group of «free thinkers of Cyprus». I thought that it might be a good idea to seek their opinion on immigration-related issues, so I’ve made a post there seeking opinion on a recent video by KISA. Here is a link to the group: https://www.facebook.com/groups/cyprusfreethinkers/ Care to join the discussion? 12 Οκτωβρίου, 2013 στο 11:43 πμ νάσο τα παιδιά έχουν σελίδα στο facebook https://www.facebook.com/zerminalcy χτες είχαν συζήτηση μεταξύ μαθητών και θα γίνονται εκδηλώσεις τακτικά, είναι σημαντικό να στηρίξουμε αυτή την προσπάθεια γιατί τα παιδιά που το διαχειρίζονται κάνουν ό,τι κάνουν καλόπιστα μετά και από πολλές προσπάθειες και αναποδιές που πλήττουν τον λεγόμενο «χώρο» max i dont use the facebook anymore, but thanx about the link! As far as concern the labels «free»thinkers etc and the labels in general iam a little bit suspicious! Παρέμβαση στο Active Radio για το σύνδρομο γονικής αποξένωσης 28/4/2017 Ντοκυμαντέρ Food Inc (Ελληνική Υπότιτλοι) Η Βιομηχανία Τροφίμων...Αν ξέραμε τι τρώμε ΔΕΝ θα το τρώγαμε
cc/2020-05/en_middle_0087.json.gz/line1337988
__label__wiki
0.5694
0.5694
Category : Figures & Dolls > Scale Figures Your Guide to Bishoujo Figures Of the many collectible figurines and statues of Japan, bishoujo figures are perhaps the most widely popular. Bishoujo (or Bishōjo, literally meaning “beautiful girl”) is the Japanese term for an attractive young girl. Bishoujo figures are collectible figurines of pretty female characters from anime, manga, games and other media, mostly from Japan. Unlike action figures from the West which are usually made to be played with, the bishoujo figures of Japan are made mainly for collection and display. Unarticulated figures tend to be sculpted with incredible detail and appealing poses and expressions that look stunning on display, while articulated figures allow you the fun of positioning your figure in a new pose to enjoy on display every day. Bishoujo figures allow collectors to enjoy the presence and sight of their favorite fictional female characters as glorious, three dimensional, full-color sculptures. Now tell us you wouldn’t want that on your desk. How are they made? The process begins with an illustration. Sometimes figure companies will decide to turn an existing illustration of a character into a figure, and sometimes they will have an illustration drawn from scratch. (Famous Japanese illustrator who goes by the name Tony, for instance, is known for his illustrations of bishoujo characters, and has had hundreds of his illustrations picked up and sculpted into gorgeous bishoujo figures.) The illustration chosen to be made into a figure is then drawn to scale from multiple angles in order to plot out how the figure will look in 3D. Sometimes the images are hand drawn, while in other cases they are modelled using 3D modelling software. It is the sculptor’s job to recreate that illustration as a figure. The individual parts of the figure (the head, torso, arms, legs, etc.) are usually created separately and pieced together at the end. Nowadays, the parts can also be printed out directly using the 3D modelling data and a 3D printer. The parts of the prototype figure are used to create molds (which are used to produce more copies of the figure). Once the colors of the figure are decided, the prototype figure, which usually starts off grey or white, is painted by hand. The product photo you see of pre-order figures is usually the hand-painted prototype. When the figure is finalized, pre-orders open for a limited period of time, and a release date a few months from then is announced! Manufacturers gage how many figures they should produce based on the number of pre-orders received. Then, the figures go into production! The factory receives the molds and prototypes and mass produce the figure. Every single individual figure is painted by hand (can you believe that?!) to ensure that the details are perfect. The completed figures are then sent off to distributors, from which you receive your long-awaited figure! Most of the time, a figure only goes into production once, so if you don’t pre-order your figure within the pre-order period, welp. You can only hope to obtain one second-hand or from some other source later on. Very rarely, the manufacturer will decide to do a reproduction, meaning that the figure will be open for pre-order once more and another batch of the figure will be produced. This only happens if the figure was extremely popular. What companies can I choose between? Of the countless figure manufacturers out there, one of the most famous and long-standing is Kotobukiya, founded in 1953 and known as “Japan's #1 Collector Toy Company.” Kotobukiya makes scale figures and model kits of high quality and detail. In recent years they have also released their Cu-Poche series, a line of adorable chibi figures with magnetic stands and magnets on the character’s feet for stable posing. They are known for figures not only of anime, manga, and game characters from Japan, but characters from Western media as well, including Marvel superheroes, Star Wars characters, and more. Another newer but no less well-known company is Good Smile Company. If there’s a popular anime or game, you can count on GSC to release high-quality scale figures and adorable Nendoroids for them. Nendoroid, GSC’s specialty, is line of articulated chibi figures that come with multiple face parts (expressions), hand parts, sometimes hair parts, and props, so that you can have fun posing and recreating the character in various situations. Good Smile Company also produces many figures in collaboration with Max Factory, another Japanese figure company capable of elaborate, top-quality scale figures. If you’re looking for the centerpiece of your collection - a bishoujo figure sporting a fluid and dynamic pose, with impressive props, incredible detail, and maybe even a special stand - Max Factory and Good Smile Company’s 'Wonderful Hobby Selection' series is a sure bet. Be prepared for a price tag that matches that quality, though! Max Factory is also known for figma, their line of articulated action figures, allowing you to choose your own dynamic poses for your favorite characters. If you’re looking for a lower price point without sacrificing the kawaii, Banpresto is a good choice. Banpresto is a Japanese toy company that makes everything from plush toys to keychains, and of course a wide selection of bishoujo figures. Known for figures with well-designed poses at low prices, usually within the 2000~ JPY (about $20~ USD) range. One of their most well known bishoujo figures are the Madoka and Homura figure set based on Puella Magi Madoka Magica the Movie: Rebellion. The two figures are posed peacefully curled up as if sleeping, and the two pieces fit together perfectly to form the image of them gracefully lying side by side. At only around $25 USD each, too! They are also known for their Chibi Kyun Chara series of adorable mini chibi figures. Myethos is a relatively new figure manufacturer based in Hong Kong, and while their selection is still quite small, every single piece they produce exhibits incredible attention to detail and quality. They are known for their gorgeous Fairy Tale series, with bishoujo versions of characters such as Alice, the Queen of Hearts, and Little Red Riding Hood in fabulous ruffly dresses atop specially designed stands. Other companies that you simply cannot go wrong with for quality and detail include Alter and Phat! If you’re looking for a bishoujo figure that brings the character to life, these manufacturers know just how to pose the character and exactly what details will give their figures soul. Their figures also come with price points to match, however, so be prepared to pay for the quality you get! Saya no Uta Saya 1/7 Scale Figure (Re-run) Gate Rory Mercury 1/7 Scale Figure (Re-run) DC Comics Bishoujo Statue Supergirl Returns (Re-run) Fate/Grand Order Saber/Nero Claudius (Bride) Non-Scale Figure (Re-run) Fate/Grand Order Berserker/Minamoto-no-Raikou 1/7 Scale Figure (Re-run) Sword Oratoria Ais Wallenstein: Bunny Ver. 1/4 Scale Figure (Re-run) Fate/Grand Order Lancer/Scathach 1/7 Scale Figure (Re-run) Fate/Apocrypha Assassin of Red Semiramis 1/8 Scale Figure (Re-run) Sword Art Online Asuna: Swimsuit Ver. Premium 1/6 Scale Figure (Re-run) BanG Dream! Girls Band Party! Vocal Collection Yukina Minato from Roselia 1/7 Scale Figure (Re-run) The Idolm@ster Cinderella Girls Uzuki Shimamura: Hajikete Summer Ver. 1/7 Scale Figure (Re-run) Ichiban Figure One Piece Onami Guilty Gear Xrd -Sign- Elphelt Valentine 1/7 Scale Figure (Re-run) Sword Art Online: Alicization Asuna Yuuki: Swimsuit Ver. 1/7 Scale Figure EXQ Figure Love Live! Rin Hoshizora One Piece Glitter & Glamours Okiku ArtFX J Kakegurui xx Mary Saotome Pop Up Parade Racing Miku 2010 Ver. Date A Live III Kurumi Tokisaki: Red Cat Ver. 1/7 Scale Figure Iron Saga Judith 1/8 Scale Figure God Eater 3 Claire Victorious 1/7 Scale Figure My Teen Romantic Comedy SNAFU Too! Yukino Yukinoshita: Lingerie Ver. 1/7 Scale Figure Evangelion: 2.0 You Can (Not) Advance Asuka Shikinami Langley: Test Plugsuit Ver. Eva Store Limited Edition 1/4 Scale Figure Is the Order a Rabbit?? Syaro: Cafe Style 1/7 Scale Figure Elf Village Second Villager Siika 1/6 Scale Figure Elf Village First Villager Archeyle 1/6 Scale Figure (Re-run) Arpeggio of Blue Steel Mental Model Takao 1/8 Scale Figure (Re-run) Arpeggio of Blue Steel Mental Model Iona 1/8 Scale Figure (Re-run) Re:Zero -Starting Life in Another World- Rem: Oniyome 1/7 Scale Figure $100 and Above (224) Chibi Figures (155) Plastic Models (8) & Up (259)
cc/2020-05/en_middle_0087.json.gz/line1337989
__label__cc
0.572783
0.427217
Franjione Pens Press Just 1 Point This Time… February 16, 2016 February 16, 2016 Brad Franjione2/15/2016, Bjugstad, Bryan Rust, Buford's Kitchen, Crosby, Fleury, Franjione Pens Press, Johnston, Jokinen, Just 1 point this time..., Kessel, Kunitz, Malkin, Mark Madden, overtime, Panthers, Penguins, Pens, Pittsburgh, Sheary, shootout, SullivanLeave a comment Just over a week ago, the Penguins played the Florida Panthers in Florida, just like they did tonight. The Panthers scored a goal towards the middle of the 3rd period, and a shorthanded one at that, to put them ahead 2-0. All hope seemed lost. Then, with 5 minutes left, the Penguins began their comeback magic. They scored 2 goals, tying up the game, and then winning it in overtime on a goal by Kris Letang, his second of the game. This game tonight played out in a similar fashion. Florida jumped out relatively early in the first period on what I believed to be somewhat of a lucky goal. Alex Petrovic fed the puck through the slot, and I swear it went by almost every Penguins player, and at first, I was mad they weren’t playing good defense. However, it ends up that the puck deflected off of a Penguins stick, which then caused the puck to hop over Kessel’s, but the puck still landed perfectly on Bjugstad’s stick and he made it 1-0. Florida, in general, dominated the first period. Fleury kept them in it, but the Penguins needed to pick things up. The second period was better for the Penguins, but they still couldn’t find the back of the net. Sid had some chances to shoot, but passed up on some opportunities. In the words of Mark Madden, who I got to watch the game with today down at Buford’s Kitchen in downtown Pittsburgh “Crosby is at his best when he’s shooting the puck. He needs to shoot there.” Couldn’t agree more, Mark. Anyways, the Penguins entered the 3rd down 1-0. Hagelin had a breakaway shorthanded early in the period, but he tried to go five-hole on Montoya and was denied. When the game was in the late stages of the 3rd period, all hope seemed lost. But then… The Penguins found a spark that gave them a chance in Florida once again. This time, it came off of the stick of Chris Kunitz. Crosby tied his man up on the faceoff to Montoya’s left, and Kunitz came in and dug the puck out. He skated to the slot and absolutely rifled a shot off of the crossbar and in past Montoya to tie the game with 3:19 remaining. The game would go to overtime, where I believe the Penguins outplayed the Panthers but were unable to score. Bryan Rust had 2 glorious chances that would not go, Letang had a great chance…but the greatest chance of all came off of the stick of Phil Kessel. Crosby skated the puck into the zone and the entire Florida team flocked to him, only for him to find Kessel streaking down the middle of the ice. The guy has a dangerous shot, and he was as wide open as wide open can get in the 3 on 3 overtime, but Montoya denied him. Also, honorable mention to Crosby who somehow disrupted a Florida 3 on 1 chance. It was a tremendous defensive play and at the moment, gave the Penguins a chance to get an extra point. Then…onto the shootout. Huberdeau was first for the Panthers. The left-hander skated from right to left and tried to fool Fleury with a wrist shot and wait Fleury out. Well, he did fool Flower, but the post gave Fleury some love. Crosby then shot for the Penguins and scored on Montoya. Crosby loves to go high glove or 5-hole (between the goalies legs). Tonight, he went 5-hole and put the Penguins up 1-0 in the shootout. Next shooter for the Panthers was USC guy Vincent Trocheck. Trocheck tried to open up the 5-hole of Fleury, but Fleury made sure that he closed the door. The Penguins now had a chance to win it. Onto the ice came Chris Kunitz. He made a great move, as the left-hander skated right ro left, faked the shot, and went backhand. Unfortunately for Kunitz, Montoya made a fantastic glove save. However, the Penguins had yet ANOTHER chance to win, and Fleury just needed to stop Bjugstad, but could not. Fleury went with the poke-check, but Bjugstad’s long reach allowed him to go to the backhand and avoid Fleury’s poke-check to keep the shootout going. Despite Fleury not being able to make the save, the Penguins once again had to chance to win the shootout on the stick of Letang, who had just won them a shootout on Friday night. Letang tried to make a similar backhand move, but Montoya was ready for it and didn’t buy what Letang was selling. Reilly Smith then shot for the Panthers, but he was quickly poke-checked by Fleury, as he came to a dead stop right in front of the net. Kessel then had a chance to end it for the Penguins. He came in flying and just took a straight up wrist shot. My goodness was it a rifle, but it pinged right off of the crossbar and back out. Montoya had no chance of stopping the shot, it was just a fraction of an inch too high. Florida then had its chance to go on top, and who else but former Penguin Jussi Jokinen. He did the same move as Huberdaeu essentially, but he did not hit a post. He found the back of the net. Cullen then came in with a chance to tie the shootout. He deked a few times, tried to go 5-hole, but was denied by Montoya. Not the same result for the Penguins as last time they were in that building… I know he has not been producing, but I am really high on Bryan Rust right now. The guy has some serious speed and has been creating chances for himself. I think he will benefit once some of the veterans come back, and I do not think he will leave the lineup. Flower had a strong performance. The team has struggled to score goals in its past 3 games, but it should be noted they have gotten 0 production from their bottom 6 AHL guys and they are without Geno. Hopefully he is ready to go on Thursday against Detroit. I have heard he is progressing, so we will see what his status is come Thursday. The Penguins shot low on Montoya a lot. I do not know if he is not as good when the puck is shot low or if that’s just where the puck was going tonight. Ironically, the only goal in the game came on a shot from Kunitz where he DID go high on Montoya. Just felt that was an observation I should share… Well hey, you win some you lose some, but the fact that the Penguins could get a point out of this game where they were down for the majority of it is still a huge confidence booster, even though they had the potential to get 2. Don’t be concerned about this game or even the Penguins 3 game funk with goal scoring. When 39-year-old journeyman Matt Cullen is centering your 2nd line of Hagelin and Kessel, your team is not going to score many goals. That is not, however, a knock on Cullen. He is a good hockey player, but he is a fourth line center and PK guy. He shouldn’t be centering 2 speedy snipers. Malkin will be back soon, the bottom 6 will no longer be all AHL guys soon enough (although I do like Sheary and Rust), and the team will improve. There is no doubt about that. The fact that the Penguins got a point out of tonight…I’m happy with that. I can confidently say this: the Penguins would have NEVER got that point under Johnston. This team has much more resolve/comeback ability under Sullivan and will only get better as the injured guys get healthy again. Looking forward to see what’s to come… I really do want to try my best to keep up with the recap articles, so I will do my best to post one after the Thursday game against Detroit. Let’s hope they get Geno back for that one. Until next time…Let’s Go Pens.
cc/2020-05/en_middle_0087.json.gz/line1338000
__label__wiki
0.940967
0.940967
Thank you, Kurt: 700 Club co-owner Kurt Wunder is a Philly revolutionary worth remembering At the end of 1997, before opening his 700 Club with bartending pal Chris Sey and Mel's Rockpile bassist Tracy Stanton, Kurt Wunder spoke with me about his then newly purchased butcher shop turned corner saloon. A.D. Amorosi At the end of 1997, before opening his 700 Club with bartending pal Chris Sey and Mel’s Rockpile bassist Tracy Stanton, Kurt Wunder spoke with me about his then newly purchased butcher shop turned corner saloon. Situated on the corner of 2nd and Fairmount long before Northern Liberties became whatever the hell one would call it today (ask Sey and he readily refers to the then battered-and-sparsely lived in neighborhood as “not tainted”), Wunder, who lived in Old City at the time, explained the direction for his bar-playhouse, which he referred to as “kitsch without being hokey.” In a former life, Wunder was a bartender at Khyber and played a fish while shirtless in an earlier incarnation of Mel’s Rockpile. He also served a stint as the suave DJ and host of Rat Pack nights at Silk City. To top it off, he became a bar owner and scene explorer. All of this made him a revolutionary. The opening of his corner bar was in an area not yet touched, but it was destined to explode due Wunder’s long time in the biz, his hard work and his hard-earned success. Of the 700 Club’s intended audience, Wunder said at the time, “We want rich alcoholics standing next to bell-bottomed types — just like the Khyber’s old happy hour.” What Wunder got in life and in droves for 21-plus years at the 700 Club — a bar sold in late May to old Philly friends Gina and Sean Butler-Galliera — he also got in death, with a second line memorial parade on Aug. 18 that walked the walk from the home he shared with wife Margo and their children, Georgia, 18, and Spencer, 16, to the Mummers Museum. Wunder died at home on Aug. 10 of glioblastoma and leptomeningeal disease. “Upon realizing that his medications would never involve tequila, Kurt William Wunder acquiesced and peacefully surrendered his battle,” Margo wrote in a loving death notice at the Baldi’s-Pennsylvania Burial Co.’s website. On Sunday afternoon, I rolled out of my door and ran behind the crew of fellow Mummers to catch the New Orleans’ style funeral parade at its start. It was one last time to remember Kurt, who was my neighbor in both South Philadelphia and Old City. He routinely talked to my greyhound, Django, on the corner while he sipped a heady libation… Wunder, that is. Not my dog. The soundtrack of this celebration from the Mummers was an exquisite choice as the crew played homage to Wunder, who himself was a trumpeting Mummer with the Rabble Rousers comic brigade. Together with a crew of musician-members of the Big Mess Orchestra, they filled Wharton Street, playing what sounded like a mix of “Angel Eyes” and “St. James’ Infirmary,” and met the Wunder family on the corner. Together, a throng of people walked procession-like but joyful up the street to Wharton Park. Dozens of umbrellas bounced and old friends cried, laughed and clapped while “Swing Low, Sweet Chariot” and “Just a Closer Walk with Thee” played on. After promenading up Two Street, some 700 (no joke) marchers stood before the Mummers Museum with the Wunder family, played more music, then entered the museum where speeches were made. Drinks were drunk, food was eaten and loving vibes were shared. Fellow band members, South Philly neighbors, hockey players, artists, actors and rich alcoholics all stood in thousand degree humidity to honor Wunder. The only thing that was missing from the most fun and emotional funeral walk ever — as surmised by Live Nation’s Jim Sutcliffe — was “big name tags,” so to remember exactly who was among the countless faces that recognized each other but perhaps had difficulty placing names. Sean Butler-Galliera confirmed on Sunday that he and his wife Gina had purchased The 700 Club and would leave it pretty much the same as they found it once they both resettled in Philly from their current home in Los Angeles. But that’s a conversation for another time. Lionizing Kurt Wunder is the issue at hand. Like the recently deceased punk rock venue Firestarter David Carroll, Wunder found literal and figurative unclaimed territory, and he put a freak flag in it. Few could have believed the swagger of Sinatra’s Rat Pack and the dressed-to-the-nines nature of silken Sy Devore — AKA the bachelor pad suave of the late 1950s and Kennedy-era 1960s — could be a thing in the grunge-listenin’, flannel-clad ‘90s. Yet Wunder rolled about in a roll lapel tux, spinning “Fly Me to the Moon” and “Ain’t That a Kick in the Head” to men in similar sartorial gear and cocktail dress-wearing women with dark red lipstick at Silk City, a spot that would soon become a mecca for adventurous hip hop with Back to Basics. Even fewer could have guessed that N. 2nd Street, home to nothing at all, could become a mecca of millennial money-spending, pre-craft beer and designer distiller tipplers and louche loungers that was 700 Club at its start and at its heart. Wunder brought both and in his wake created a wave of casual cool and casual hangs in handsome clothes and theatrically-designed settings tailored for maximum fun, frolic and ease. If he wasn’t creating Sinatra-filled atmospheres or comfortable nights out, Kurt Wunder was an IMDB-credited special effects guy on Philly-filmed flicks such as “Creed” and “Creed II,” the upcoming Chadwick Boseman-led “21 Bridges,” and, not surprisingly, “It’s Always Sunny in Philadelphia.” He was also an avid hockey aficionado who attempted to make all around him puck heads. Maybe most importantly, he was a lover of his wife, his kids and life itself. For all of the above, Kurt Wunder will be missed and never forgotten. In lieu of flowers, the Wunder family requests donations to the Rizzo Rink and Ed Snider Youth Hockey Foundation. TWITTER: @ADAMOROSI @adamorosi A.D. Amorosi is a Philadelphia-based journalist who, along with Philadelphia Weekly, writes for numerous local, national and international publications including Variety and the Philadelphia Inquirer. Up Next in News The kids are crying III The final chapter chronicling the despair that comes from dealing with DHS Need to address: City jails combat influx of drugs on the inside, recidivism with MAT program Paul Robbins recently spent about six months in Curran-Fromhold Correctional Facility (CFCF), a Philadelphia’s men’s jail, for drug-related charges. Open book: Hakim Hopkins tells his story about Black and Nobel’s relocation and legacy “I look at books like people's spirits on paper, not just a story,” said Hakim Hopkins. “I think that they are alive.”Hopkins, 47, is the founder of Black and Nobel, a bookstore that sells African-American literature and ships books to… A peek inside the Love City Satanists, Philadelphia’s rapidly growing lovers of all things Lucifer
cc/2020-05/en_middle_0087.json.gz/line1338006
__label__wiki
0.999833
0.999833
Photos / saif ali khan Photogallery saif ali khan Photos Last updated on Jan 4, 2020, 16.56 Saif Ali Khan and Ajay Devgn See more of: ajay devgn, Saif Ali Khan Kareena Kapoor and Saif Ali Khan's holiday p... See more of: Kareena Kapoor, Saif Ali Khan Saif Ali Khan and Kareena Kapoor See more of: Karisma Kapoor, Kareena Kapoor, Varun Dhawan, Saif Ali Khan Kareena Kapoor Khan and Saif Ali Khan weddin... See more of: Kareena Kapoor Khan, Sara Ali Khan, Saif Ali Khan Top 10 Indian Weddings of the decade... See more of: Kareena Kapoor Khan, Saif Ali Khan Alia Bhatt and Ranbir Kapoor party pictures See more of: Kareena Kapoor Khan, Taimur Ali Khan, Saif Ali Khan Alia Bhatt parties hard with beau Ranbir Kap... See more of: Karisma Kapoor, Kareena Kapoor Khan, alia bhatt, ranbir kapoor, neetu singh, Saif Ali Khan Alia Bhatt and Ranbir Kapoor pictures See more of: Karisma Kapoor, Kareena Kapoor Khan, alia bhatt, ranbir kapoor, neetu singh, Taimur Ali Khan, Saif Ali Khan See more of: Sara Ali Khan, Saif Ali Khan Bollywood star kids who created more sensati... Sara Ali Khan's pictures Inside pictures from social media star Taimu... See more of: Saif Ali Khan See more of: Taimur Ali Khan, Saif Ali Khan Kajol, Ajay Devgn and Saif Ali Khan See more of: kajol, ajay devgn, Saif Ali Khan Saif Ali Khan, Kajol and Ajay Devgn Bhushan Kumar, Om Raut, Saif Ali Khan, Kajol... See more of: kajol, ajay devgn, Bhushan Kumar, Om Raut, Saif Ali Khan Stylish celebrity homes you always wanted to... Armaan Jain and Anissa Malhotra’s roka pictu... See more of: Karisma Kapoor, Kareena Kapoor Khan, reema jain, Tina Ambani, Saif Ali Khan
cc/2020-05/en_middle_0087.json.gz/line1338008
__label__cc
0.693541
0.306459
Don Pilzer Applying? 5 Mistakes in Applying For Benefits Widow or Widower Benefits Denied? Steps Social Security Uses to Determine Disability Illiteracy and Social Security Disability Social Security Disability for Interstitial Cystitis What Do Vocational Experts Say at Social Security Disability Hearings in Greenville? Directions from Spartanburg Directions from Anderson Directions from Taylors Directions from Seneca Directions from Mauldin Social Security FAQs Find Out if You Qualify for Social Security Disability Benefits Get My Free Lawyer Consultation! How to Meet the Eligibility Rules and Receive Monthly Checks Your health has gotten worse, and you can’t work anymore. You’re facing a financial nightmare. It’s time to call in the law firm that’s helped thousands of people win Social Security Disability benefits—the Law Office of Pilzer Klein. While it’s obvious to you that you qualify for benefits, you can’t win if you don’t meet the strict requirements set by the Social Security Administration. Your future’s at stake. When you can’t work and earn an income, the monthly checks that come with disability benefits can bring a sense of peace back to your life. Get an experienced lawyer from Pilzer Klein to analyze your eligibility. We’ll be up-front and honest with you about what it will take to win. Social Security Disability is all we do. Contact Pilzer Klein » What Disability Qualifications Do I Need? Social Security has three basic requirements you must meet to win disability income: You can’t continue at your job because of serious health problems. Your health is bad enough that you also can’t switch to a new line of work. Your condition will last at least a year, or it could be life-threatening. It’s not good enough just to tell Social Security that you meet these three qualifications. You have to prove it. That means showing them records of ongoing medical treatment for your health problems. It could mean explaining your situation to a Social Security administrative law judge. Save yourself the work of preparing your case and get an experienced attorney. A recent government report found that people who brought representatives with them to their disability hearings were almost three times more likely to win benefits. Pilzer Klein is dedicated to helping people in the Carolinas. We don’t charge anything to analyze your case and tell you your options. Get My Free Consultation » Get your free evaluation: Hear from a Pilzer Klein Client: “The Don Pilzer law firm was very helpful from the beginning. When I met with Mr. Klein, he explained what was required and made me feel better about the position I was in. I HIRED THE FIRM IN LESS THAN 24 HOURS after the first meeting. The gentleman that was assigned to help me with the process was very prompt and courteous. Always answering my questions. Thank you for that. I would RECOMMEND THE PILZER/KLEIN LAW FIRM TO ANYONE without hesitation.” -Frances Disclaimer: I agree that by contacting you that no client-lawyer relationship has been created. The information that I provide will not be kept confidential. The information on this website is general information and does not constitute legal advice and the reader should not rely on it to solve their individual problem. Contact us today for a free consultation on your Social Security Disability claim. Our mission is to help you. 864.507.2705 Hours of Operation: 8:30am – 5:00pm 509 West Butler Road Greenville, S.C. 29607 No representation is made that the quality of legal services to be performed is greater than the legal services performed by other lawyers. © 2020 HSR Group, d/b/a Firmidable.
cc/2020-05/en_middle_0087.json.gz/line1338014
__label__cc
0.647066
0.352934
Process Server Institute What’s New for Process Servers in 2020 Dinner Event – So. San Francisco What’s New for Process Servers in 2020 Dinner Event – Los Angeles Books and Materials The Registered Process Server’s Guide to Service of Process in California, 5th Edition The Registered Process Server’s Guide to Service of Writs of Attachment and Writs of Execution, 3d Edition Affidavit and Proof of Service Requirements Guide, California Edition Continuing Education Materials California Process Serving Laws California Registered Process Server Law California Appellate Decisions US Process Serving Laws US Laws Prohibiting Interference with Service of Process US Trespass Laws – Process Servers California Process Serving Cases and Opinions Fillable Proofs of Service Forms Process Server Resources Wiki How to Become a California Registered Process Server Criminal Trespass in California – Process Servers Tag: Civil Code § 1788.61 Changes to Debt Collection Law September 12, 2015 PSIAdmin CA Service Laws 9/14/15 Update. The governor signed both of these bills and they will become effective on July 1, 2016. The new formula will result in a change to the Earning Withholding Order form in an effort to try to explain this to an employer withholding wages to comply with the garnishment. Two California senate bills will affect the process of consumer debt collections providing relief to judgment debtors. SB 501 amends CCP § 706.050 and changes the formula for calculating the percentage of disposable income subject to a wage garnishment, giving some relief to low income judgment debtors. Under current law, a wage garnishment is a continuing levy that orders the employer to withhold 25% of the employee’s disposable income. This change will limit that amount to an amount not to exceed the lesser of 25% of the employee’s disposable income, or 50% of an amount 40 times the local or state minimum wage. In 2016, the state minimum wage increases to $10 per hour, and local cities may be higher. Quoting from the Assembly Legislative Analysis, “[a]ccording to the author, to illustrate operation of the revised formula, a worker living in a city paying the state minimum wage who earns $25,000 per year, a 10% garnishment rate would apply…” This lower cap on the garnishment amount will only apply to those making minimum wage, with graduated multipliers for above minimum wage. Those making twice minimum wage will continue to cap out at 25%. This law would be operative on July 1, 2016, and would be repealed on January 1, 2017 unless the legislature extends it. SB 641 amends the Fair Debt Buying Practices Act (FDBPA) affecting consumer debts that were sold or resold after January 1, 2014, and adds a new section, Civil Code § 1788.61. Under current law, a judgment debtor may file a notice of motion and motion to set aside a default or default judgment and for leave to defend an action relating to the debt up to 2 years after a default judgment is entered. This amendment would allow a judgment debtor of a sold or re-sold consumer debt up to 6 years after that date, or 180 days after actual notice of the action. There is a special provision for those victims of identity theft. The judgment debtor who files the motion must also include “an affidavit stating under oath that the person’s lack of actual notice in time to defend the action was not caused by his or her avoidance of service or inexcusable neglect.” Further, “[e]ither party may introduce, and the court may consider, evidence in support of its motion or opposition, including evidence relating to the process server who appears on the proof of service of the summons and complaint.” What this means for a process server is unclear. “Evidence relating to the process server” might mean evidence of the service of an action for a sold or re-sold consumer debt, such as server’s service instructions, notes, photos, GPS tracking, evidence of evasion, attempts, etc. All would relate to an effort to defend the service, and or attack the defendant’s avoidance of service, or the service itself. If that is what “evidence relating to the process server” means, it may require record retention of the server’s notes for at least 6 years, or 180 days after actual notice of the action – an unknown period of time. For instance, if a judgment is entered in 2016, and 8 years later the plaintiff serves a wage garnishment or deposit account levy, the judgment debtor may file a motion 180 days after actual notice of the action. One comment CCP § 706.050, Civil Code § 1788.61, Fair Debt Buying Practices Act, levy, wage garnishment PSI Seminars and Events What's New for Process Servers in 2020 Dinner Event - Los Angeles PSI Facebook Group PSI Notifications Please sign up for our Process Server Institute Notification Service. You may limit the emails you receive from us by indicating where you are located - or where you want to attend a PSI event to make a tax deductible business and marketing trip out of it! We usually send out about 6 to 10 notifications per year to the areas where we conduct seminars and dinner events. If you sign up for "The Works", you'll receive them all. Notification Preferences: General Interest - The Works Northern California Only Central California Only Southern California Only No Emails Subscribe/Listing: Find a Process Server.com Listing AB5 Alternative Service Assault and Battery CCP § 415.21 CCP § 706.050 Civil Code § 1788.61 consumer notice criminal Dynamex Fair Debt Buying Practices Act HIIPA Independent Contrsctor levy medical records obstruction of justice Officer of the Court service in private houses wage garnishment F: 415/495-8730 tony@psinstitute.com
cc/2020-05/en_middle_0087.json.gz/line1338032
__label__wiki
0.539662
0.539662
The PROFESSORS' BLOG – Science, Culture & Human Rights For All For geopolitical analyses go to THE INDICTER Magazine [theindicter.com]. The Professors' Blog, founded 2005, is Sweden's earliest blog written by univerisity professors (In Swedish: "professorsblogg"). Founded by Prof. Marcello Ferrada de Noli Ph.D. (Med. dr. i psykiatri, Karolinska Institutet) Professor Em. Epidemiology. Prof. de Filosofía. Former Research Fellow & Lecturer in Social Medicine, Harvard Medical School THE INDICTER Magazine | LIBERTARIAN BOOKS – Sweden | Authors & materials | Book “Human Rights Issues In The Swedish Case VS. Assange” Sweden will grant extradition of Assange to US if not stopped by international political pressure artedenoli / November 4, 2011 Updated analysis 25 April 2012 By Marcello Ferrada de Noli Correcting the Member of the Swedish Parliament Fredrik Federley, who today in the National Swedish TV4 showed not being sufficiently informed on the factual record of Sweden regarding extradition praxis to the U.S.:In fact, regarding the open extradition requests from the USA since 2000, Sweden has granted such extradition in the TOTAL OF CASES in which the prisoner was in Swedish territory. This is based in statistics according to Sweden’s Justice Ministry (see below section “The myth on that Assange’s extradition from Sweden to US is not likely”). Important Update (March 2014). Up to the present we had knowledge on that US prosecutors have drawn up secret charges against WikiLeaks founder Julian Assange, this according to a confidential internal email obtained from a private US intelligence company, Stratfor. (Read more in: Charges against Assange drawn up in US). However, a new research posted recently in Professors blogg by investigative journalist Alexa O’Brien, details the entirely process with help of documents obtained directly by her from US legal authorities. See US investigation of WikiLeaks now entering 5th year. By Alexa O’Brien . In the Future Life of Glauco Marino. Inchiostro di china su carta metalizzata, Ferrada de Noli, Rome 1974 The perils posed by these revelations on a prospective indictment, makes urgent to re-consider political issues of the situation Julian Assange would face now in Sweden, in case been extradited there. In spite of Sweden’s official silence, and the denial by the mainstream media articles, the extradition of political prisoners in Sweden is ultimately decided at a political level. Ergo, the risks for an extradition of the Wikileaks founder to USA – in case it will be requested – cannot be assessed solely attending to juridical arguments. According to a recent interview with Julian Assange and lawyers Jennifer Robinson and Geoffrey Robertson [1], the USA shall most certain seek the extradition of the Wikileaks founder. The reason – as mentioned in the interview – being that a US Grand Jury investigation has been on-going in Washington since last year – preparing aggravating charges on espionage. Such charges, most likely in connection with the WikiLeaks Pentagon-disclosures, would entail for Julian Assange “up to ten-years in a maximum security prison”, according to the legal experts. Meanwhile, a recurrent misconception – or deliberately misinformation – published in the international media, is to consider the deportation of Julian Assange from Sweden to the USA as, statistically speaking, “highly unlikely”. As I have recently expressed in a exclusive RT interview aired March 29, (see below) the preparations for these trials in the U.S. are seeking a connection between WikiLeaks and Bradley Manning in terms of making Julian Assange accountable. Previously, According to an interview with Julian Assange and lawyers Jennifer Robinson and Geoffrey Robertson [1], it become clear that the USA shall most certain seek the extradition of the Wikileaks founder. The reason – as mentioned in the interview – being that a US Grand Jury investigation has been on-going in Washington since last year – preparing aggravating charges on espionage. Apparently, efforts aims to Such charges, most likely in connection with the Wikileaks Pentagon-disclosures, would entail for Julian Assange “up to ten-years in a maximum security prison”, according to the legal experts. Meanwhile, a recurrent misconception – or deliberately misinformation – published in the international media, is to consider the deportation of Julian Assange from Sweden to the USA as, statistically speaking, “highly unlikely”. But facts reveal the contrary: Regarding the open extradition requests from the USA since 2000, Sweden has granted such extradition in the TOTAL OF CASES in which the prisoner was in Swedish territory. This is based in statistics according to Sweden’s Justice Ministry (see below section “The myth on that Assange’s extradition from Sweden to US is not likely”). I put forward the above also in a brief interview conducted at the Royal Court’s premises in London on December 5th, after the verdict on the WikiLeaks founder Julian Assange’s appeal to the Supreme Court [Click on this Youtube link for this brief “interview”]: It is exactly this risk of extradition/rendition to the USA from the part of Swedish officials that made Julian Assange reluctant to come to Sweden (after the Swedish extradition request and the smear campaign that ensued in Sweden). I also refer the reader to the post This is Why, in which the reasons for this apparently Swedish revenge are summarized. This analysis was previously treated in the Professors blogg’s article “Sweden will grant extradition of Julian Assange to US if not stopped by international political pressure NOW” As the media campaign against Assange is on the increase (DN-1,DN-2,SvD, Aftonbladet), the Swedish government anxiously hopes for a judgment at the Supreme Court in London which, they believe, it would help to distract domestic opinion from the on-going scandal “Arms-agreements with Saudi Arabia“. Professors blogg was first in Sweden to draw attention to the sensitive issue of the then phantom funding of the cover company (Swedish Security Technology and Innovation, SSTI) used for the intelligence and weaponry-trade operation with the Saudis. It has been now disclosed it was one of the Defence Intelligence apparatus which put up the financing to FOA. When the scandal was in the eve to break, FOA accused Assange and WikiLeaks of blackmailing Swedenin order to create nationalistic momentum for the “defence of Sweden” against its “enemies”. Assange was referred then as Number One public enemy of Sweden. Now that the investigations on the arms scandal pursues regardless the resignation of Minister Sten Tolgfors, the government of Sweden expect anew to play the chauvinistic “Assange card” with the help of the MSM. For its own political purposes the Swedish authorities press upon the extradition of Assange more than ever. It has become indeed the Swedish government case against Assange. This analysis demonstrates that the ultimate decision of the extradition of Assange to the U.S. will be political. Therefore, we call for the international monitoring of the steps taken by the government around this issue, and also the behaviours by the Swedish MSM. From the part of official Sweden and the geopolitical interests this country represents, the reasons for the “legal” actions and corresponding smear campaign against Wikileaks founder Julian Assange, are solely political. This, aside Sweden’s own vengeful campaign motivated by the Wikileaks revelations with regard to some government wrongdoings. Corollary, the situation (confronted by Wikileaks) should not be understood as primarily juridical. Together with a brief review of the actual Swedish statistics on extradition cases as requested by the US, the aim of this article is to call for the examining of political answers around the extradition-issues. In my opinion, the debate has maintained a quasi-excessive focus on the legal aspects. Obviously, the tremendously positive impact that Wikileaks have already in the world developments is to the highest extent political. Further, it is precisely Wikileaks geopolitical potential for revolutionary changes (not only regarding changes in government-ethics or local redistribution of political power, but also changes in the economic distribution and in societal structures) what also might explain the participation of the various NATO-countries (full members or vassal countries) involved in the current offensive against the Wikileaks organization. The bottom-line here, regarding the juridical discussion on the extradition “risks”, is that Sweden does not really need sophisticated legal arguments to comply with its own part of the geopolitical assignment. If asked to, they will extradite Julian Assange, in one or another formula. Different political traditions and legal systems The second source for confounding in this (international) debate is to equate the legal system or legal traditions of Sweden – and the Swedish modality of implementing justice or legal matters – with what occurs in the USA or some other countries in Europe including the UK. USA and the UK enjoy highly legal or even “legalist” traditions. In Sweden the administration of justice is not that clear-cut, and sentences or evidence gathering in the onus probandis are not that restrictive like in USA or UK courts. Things in Sweden work out more in the searching of consensus, and for consensus to be reached among a variety of opinions (in Sweden interests are called “opinions”) the determinant is not the objective truth (which one might eventually find in a rigorous application of known law). The determinant is to find compatibility of the interests involved. Sweden is a highly pragmatic country. This pragmatism might help to explain the enormous economic success and international prestige Sweden achieved by wavering the “neutrality” position in the post World War II era. No wonder why Sweden is still the second largest weapon export-country per capita in the world; or that Third World countries – at least until a few years ago – opted for the purchasing of Sweden’s manufactured goods irrespectively of other disadvantaged items, such as economic or technical, which normally are included in such decisions. The idea of making business with the “right” country, with a neutral and non-aligned Sweden, was paramount. But now we painfully now that from the Swedish part, it was pure pragmatismo. After the Berlin wall collapsed, as the so-called Campo Socialista collapsed, also as consequence of the revolutionary apathy in the rest of the world (meaning, the cause was not only the political decimation from-within of the domestic Soviet power), facts started to be known – in much thanks to the Wikileaks cables – bringing unequivocal clarity on the issue of Sweden’s “neutrality”. In fact, the emerged truth was that Sweden’s real political sympathies had always been actively for the Americans; at least among the right-wingers that now rule both government and the leadership of the main opposition party – the social democrats. Minister Sten Tolgfors may have summarized the pro-American devotion of the Swedish leadership – even if symbolic expressed – when he declared openly at the times of the drastic increasing of Swedish troops in Afghanistan under US command: “I love America”. According to a US Embassy cable disclosed by Wikileaks, the Ambassador reports that Minister Tolfors had expressed (in a meeting at the US Embassy in Stockholm) how easy is for him to gather political support for Swedish troops in the war (Afghanistan) under NATO command. The Cable further states that “Tolgfors told the Ambassador that he loves the USA” (”Tolgfors berättade för ambassadören att han älskar USA”). [Published here in the Swedish newspaper Aftonbladet the 2 December 2010]. [2] But Sweden’s pro-US commitment is far far more concrete than such candid declarations of sympathy from the part of its current rulers. It has much more to do with corporate, multinational ownership or common profit interests, than with purely cultural identifications – or imitations. And it has to do with the loyal status of Sweden in the NATO, as clearly demonstrated elsewhere in the fields of Intelligence and civil-population surveillance [See Note 3, FRA-lagen), or in direct large-scale military operations with Swedish occupation troops under USA command, as in the case of Afghanistan; or in the Swedish participation in the Iraq war with artillery-weaponry assistance; or in the Swedish Air Force direct participation in the recent NATO operations in Libya. The Sweden democrats (Sverige demokrater) was the only party which opposed the Swedish intervention in Libya. All the rest, from left-wingers to right-wingers endorsed the pro-NATO government proposition). Sweden will surely comply with a US request for the extradition of Julian Assange, if so asked. Who knows if this is already scheduled. This would correspond exactly with both Sweden’s record and statistics on this matter (at least from 2000 and onwards), but paramount because this correspond to the current Sweden’s direction in the context of a legendary line of “pragmatism” in international politics. Some illustrations. At the time of Tolgfors’ love declarations above, which were political words stated in a political context, we witnessed the drastic increasing in Swedish troops, under US command, in the military occupation of Afghanistan. And at the same times the Swedish Parliament approved the Surveillance Law (FRA-lagen) as it has been requested to the Swedish government by the US. And the trial against The Pirate By went on. And it went on at the same time that America put pressure on the Swedish government on such legislation to preserve American music/film industrial interests. Bottom line: Official America put forward American business and interests, capitalists have always done the same and why would they do different in the name of surplus-value, which is capitalist’s God and raison d’etre. And Sweden? Sweden’s rulers apparently run in Sweden also America’s rulers interests. What is the explanation of this? I will come back to it in another post. And, who doesn’t “love America” Minister Tolfors? I heard Julian Assange himself saying in the CBS 60′ minutes interview that he praises the American Constitution, from the early libertarians. And I happily agreed. Nevertheless, one main reason of my respect for those people, my American colleagues or friends (I lived in Boston in several periods during the 90’s, while researching and lecturing at Harvard Medical School) it is exactly because no one there would ever accept, or even think, that their government and Parliament would change or shape some American legislation because the Embassy of another country is asking them in secret to do so. Do I explain myself clear? Sweden’s record in extradition, deportation Looking back into history in the record of Sweden with regard to political extraditions or political deportations, we find unfortunate, nasty illustrations. We might find Russians forced to deportation to the former Soviet Union during the Stalin era. We might find political refugees deported with Swedish police escort to their countries of origin to stand torture and death. And we might find asylum seekers delivered in secrecy at Stockholm airports to the US intelligence services for being transported to torture elsewhere that in the USA. What I mean is that Sweden has been capable – for political reasons in the believe of own national interest (I do not accuse Swedes of bad or “diabolic” intentions) to crucify their own juridical principles when it comes the moment of international political transactions that are judged critical. The history of Finland is a living proof of that. And the reference to the deals with Germany during the 40’s, which I recently took in my article Sweden, NATO and Assange, should also be considered in the context of Sweden’s realpolitik when it has come to decide matters of political extradition or deportation in the context of international governmental pressure. That is why I have said that – In response to the risk of Assange’s deportation to the USA – the most effective answer has to come in the form of an international political pressure. This means that Wikileaks supporters must try to find echo in their local political parties, their own constituency and their elected people. To knock the doors of the mass organizations, trade unions, student organizations, the offices of decent people with position in government, decent journalists, etc. To get and build support out of the box. With the above I do not mean that the legal efforts would be secondary. Not at all. Just put them together in a political strategy. The main struggle is in the political arena and its rules have not been designed by us. Otherwise we would have chosen the ideological front, why not philosophy. But rules of engagement are not decided by our dreams. The reality of this important episode in the young life of Wikileaks has been decided by old and experimented masters of political confrontation and psychological warfare. The myth on that Assange’s extradition from Sweden to the US is not likely In the labyrinth of news around the court deliberations in London on the Assange-extradition, I have traced the origins of such myth to a dispatch by Malin Rising, a Swedish journalist working as correspondent for Associated Press. The journalist had published time ago a “Question & Answers” article headed “Questions and answers about the Julian Assange sex crimes case and Swedish extradition rules”. The piece was also distributed word-wide by Yahoo news and it is found in numerous sites among other ABC News, Salom.com, etc. To start with, Julian Assange has not been convicted of any crime at all. He has not been in trial for such crimes, at all. He has not even charged with any such crime. On the extraditions issues, one of the items read: “Q: Assange’s lawyers say there’s a “real risk” that Sweden would hand him over to the U.S. How likely is that? “A: . . . Swedish legal experts say he would be no more likely to be handed over from Sweden than from Britain. Because of the current extradition proceedings between Sweden and Britain, handing him over to a third country would require approval from both countries, says Nils Rekke, legal chief at the Stockholm prosecutor’s office. Rekke notes that Britain is a closer ally to the United States.” However, Sweden has not excluded it would be willing to go along with a US demand on extradition: Rekke did not deny that Sweden would be willing (or “like”) to hand over Assange to the USA, what he really said is that “Sweden cannot do as Sweden likes” in that specific matter “before asking Britain first”! This is instead what Christian Science Monitor wrote quoting Rekke: “If Assange was handed over to Sweden in accordance with the European arrest warrant, Sweden cannot do as Sweden likes after that,” and, “If there were any questions of an extradition approach from the US, then Sweden would have to get an approval from the United Kingdom”. Is there any doubt that the meetings held in London by top government leaders of USA, UK and Sweden – exactly on the days of the verdict on Assange’s extradition, were also a top opportunity to decide issues on the above? The fact is, regarding the “open” requests of extradition from the USA, Sweden has granted extradition to the USA in ALL OF CASES in which the asked person was in Swedish territory: “Q: How common is it that people are extradited from Sweden and Britain to the U.S.? A: Since 2000, the U.S. has requested the extradition of seven citizens from Sweden, according to the Swedish Justice Ministry. Five of the requests were approved, and two were rejected because the suspects were no longer believed to be in Sweden. Britain and the U.S. signed a fast-track extradition treaty in 2003 intended to speed the transfer of terror suspects. Since it came into force in April 2007, 23 people have been extradited from the U.K. to the U.S., according to British government figures. Extradition lawyer Karen Todner said Assange would probably stand a better chance of resisting extradition to the U.S. if he were in Sweden than if he were in the U.K.” Again: Regarding the “open” requests from the USA, Sweden has granted extradition in the TOTAL OF CASES in which the prisoner was in Swedish territory. This is a fact. “Death penal” argument Another argument is that Swedish law would ultimately inhibit any deportation or extradition to a country that – like in the case of USA – exercise death penalty. But it also has been put forward that Sweden – thanks to international agreements of Temporary surrender [4] could be able to legally “borrow” a convicted person for interrogation elsewhere. It would be certainly a way for Sweden to by-pass the legal restriction referring to “Death-penal countries”. What it would happen afterwards with Assange – for instance if he is taken to a military trial and sentenced to ten years in a maximum-security prison elsewhere – it would be claim by the Swedes it is not their responsibility as they acted in “good faith”. Nevertheless, the “death penalty” argument is also negated by known, proven Swedish praxis. Sweden had in fact deported individuals (even refugees applying for asylum in Sweden) to countries with full active death penalty. We have also the case of the extraordinary renditions to USA of people under arrest in Sweden (see below). Let us not forget that Sweden has in fact been sanctioned by International Human Rights organizations due to this praxis. Just one illustration on those events: The United Nations Committee Against Torture ruled 19 of May 2005 that Sweden had violated the International Ban of Torture. This, for Sweden’s direct collaboration in the CIA rendition flights, rendering to the Americans asylum seekers while those were under the “custody” of Sweden. Deportation by illegal “rendition” Sweden has a record of giving – in clandestine operations – prisoners categorized by USA as terrorists. That was during the so-called rendition, or extraordinary rendition times. As a matter of fact, Julian Assange has been already signalled as such in the USA (see below). The most notorious among these cases was the rendition in Stockholm of political prisoners that were taken by CIA personnel and taken Egypt. A particular aspect in he context of the “legal” processes agitated in the case Assange is that as main collaborator with the mentioned CIA operation was signalled the lawyer and former Minister of Justice Thomas Bordström. He is the co-owner and legal partner of Claes Borgström, the lawyer representing the nominal accusers of Julian Assange. In fact, Claes Borgström was the instigator of the re-opening of the case against Assange. And also the fact is that Thomas Bordström has publicly bragged in his blog from USA “Bordström samhället”, that is his company (“our law firm”) the one representing the plaintiffs in the Assange accusations. Thomas Bordström’s responsibility in the secret arrangements arises with the times clearer and clearer. Bordström first denied direct involvement or knowledge of the events. However, Margareta Zetterström, who was a close associate to the late Anna Lindh -Swedish Minister of Foreign Affairs at the time of such events -, revealed in her book that Boström did know about it. Zetterström’s article in Aftonbladet [5] mentioned that Thomas Bordström declared in an interview in Dagens Nyheter, that even if he had the information before the rendition took place, “That it should not have made any difference, we would not have stopped anything” (Thomas Bodström). In regard to the praxis of “rendition of terrorists” from the part of Sweden to the USA – and for which no of such legal niceties as extradition agreements or permissions are required – the question would be to which extent Julian Assange is also considered being a “terrorist”. Well, a “Cyber terrorist” Assange has been already called, and by no less than the Pentagon, according to this report. And it gets “better”. Vice President Biden, who actually was the one attending the above-referred conference in London representing the USA government, had likened Julian Assange to a “high-tech terrorist” according to the Guardian. Let us hope that neither in this case the Guardian is saying the truth. [1] Foreign Correspondent Andrew Fowler’s interview with lawyer Jennifer Robinson, Journalist/Publisher Julian Assange and lawyer Geoffrey Robertson. The interview has been recently aired by Youtube. Follow this link to see the interview. [2] Josefine Sköld, “Moderaterna: “Vi älskar USA”. Aftonbladet, Stockholm, 2 December 2010 http://mobil.aftonbladet.se/nyheter/article12687187.ab?partner=www [3] M Ferrada-Noli, “The Swedish Surveillance Law (FRA-Lagen) debate”. The Professors blogg, 22 September 2008 http://ferrada-noli.blogspot.com/2008_09_22_archive.html [4] Sweden Versus Assange. Extradition/ US Extradition http://www.swedenversusassange.com/US-Extradition.html [5] M Zettersröm, “Vi har rätt att få veta”. Aftonbladet, Stockholm, 20 January 2009 http://www.aftonbladet.se/debatt/article4219230.ab Labels Wikileaks, J Assange, Assange, yttrandehefrihet, tryckfrihet, transperans, wikileaks, intressant, November 4, 2011 in Uncategorized. A political solution to the legal stalemate in the case Assange – Government guarantees against extradition. Sweden’s political decision on the extradition of Assange to the U.S. Amidst discussion in Sweden on dropping the “case” VS. Assange, US Justice Minister Eric Holder arriving to meet Swedish counterpart & lecture in Parliament ← On Sweden, NATO and Assange Swedish government affirms is not militarily aligned. Facts severely contradict → 2 thoughts on “Sweden will grant extradition of Assange to US if not stopped by international political pressure” Mark Klamberg says: You write: "Sweden has granted extradition in the TOTAL OF CASES in which the prisoner was in Swedish territory"What research have you made to reach this conclusion?It took me 2 minutes to find NJA 1982 s 830 where the Supreme Court of Sweden refused extradition to the U.S. Marcello Ferrada de Noli (Italy) says: What I wrote (quoted from the article above) is this:“The fact is, regarding the “open” requests of extradition from the USA, Sweden has granted extradition to the USA in ALL OF CASES in which the asked person was in Swedish territory:”This counting is based in the following information given by the Associated Press article of Swedish journalist Malin Rising ("Questions and answers about the Julian Assange sex crimes case and Swedish extradition rules"). The article was published in several news-sites all over the world, also in Yahoo news. The following is given in the Associated Press report (I quote again from my article). Please do note that the figures given are "according to the Swedish Justice Ministry": “Since 2000, the U.S. has requested the extradition of seven citizens from Sweden, according to the Swedish Justice Ministry. Five of the requests were approved, and two were rejected because the suspects were no longer believed to be in Sweden.”As I am reproducing in my article the complete text from AP, it is clear in the article that it referred to the cases – again, as expressed in the text – from year 2000 (“Since 2000”)Ergo, according to the quoted figures from the ministry of Justice: The five US requests approved correspond to the extradition of the five requests asked with regard to individuals that were in Swedish territory. That is ALL OF CASES (or TOTAL of cases) IN WHICH THE ASKED PERSON WAS IN SWEDISH TERRITORY because, 5 of five cases is not more not less than ALL the cases! Which is what I said in my article.Now, those are the cases asked to Sweden on the "open", i.e. known by the public. I do not know how many other "CLANDESTINE" cases of extraordinary renditions have been done in secrecy (not in the open), approved by Sweden, under the time Thomas Bodström was Minister of Justice. One case, which became fairly exposed, was that of the asylum seekers in Sweden taken to torture in Egypt from a Stockholm airport, given to CIA personnel by the Swedish police with the knowledge of the Swedish authorities [M Zettersröm, “Vi har rätt att få veta”. Aftonbladet, Stockholm, 20 January 2009 http://www.aftonbladet.se/debatt/article4219230.ab%5DWhat it is also widely known, in reference to the above, by the international opinion (not much discussed in Sweden) is that Sweden was ruled by NU of severe violation of the NU Absolute Ban on Torture:[Human Rights Watch, "Sweden Violated Torture Ban with U.S. Help." U.N. Committee Rebukes Sweden for Sending Terror Suspect to Torture". 19 May 2005http://www.hrw.org/news/2005/05/19/sweden-violated-torture-ban-us-help]. Search in Professors blogg Iraq war: ‘Neutral Sweden’s participation in US bombing of Baghdad civilian shelters Sweden’s unethical – and unlawful ­­– arms deals with ‘ISIS-backing’ Saudis WIKILEAKS – 10 YEARS. The top 10 greatest hits of WikiLeaks and other important documents The Vatican Gallery of Geopolitical Infamy Over 60 professors, four Nobel Prize winners, demand UK to respect the UN ruling on Assange’s freedom Second Anniversary of the ODESSA MASSACRE of 2 May 2014 Edu Montesanti interviews Professor Mads Andenæs on Assange, UN & human rights Amnesty Sweden rather defends the ‘rights’ of the government than the human rights Paid agent of Swedish security services implicated in second disinformation campaign against Assange “Men are animals” The psychiatric origins of Swedish State- Feminism. An analysis of the Satanism-theses of Eva Lundgren The anti-scientifc method of state feminism theorists On the Swedish Origins Of State Feminism Former paid agent of Swedish Security Police dictated Amnesty Sweden’s stance against Assange 1,5 Million Swedes and THE UNCONTROLLED non-refugee migrant influx into Sweden How involved is ‘Neutral’ Sweden in helping U.S. military drone-killings? Analysis of war-crime allegations around Turkey’s downing of the Russian SU-24 Naked emperor behind refugee crisis Assange, Montgomery and Pinochet Facts and libel in the international campaign VS. Valentina Lisitsa – Analysis Västländers agerande orsak till flyktingkrisen Den svenska kampanjen mot världsberömda artisten Valentina Lisitsa styrs till synes från Ukraina. Av Swedish Doctors for Human Rights Överenskommelsen mellan 6 svenska partier för att minska migrationsflöde till Sverige skall komma ha den motsatta effekten Trollhättan school-killer not ‘Jihadist’, but a white Swede with Nazi sympathies. Immigrant victims Essential clarifications on the so-called “Refugee” crisis Authors find flaws & contradictions in the Dutch report on MH17. Updates “Where is the smoking gun?” An essential question to the Dutch MH17-Report En granskning av flyktingstatusdefinitionen, samt uppdatering av kriterierna för politisk asyl. Analys A redefinition of the concept refugee and of asylum eligibility criteria Uttalande av Swedish Doctors for Human Rights med anledning av bombningen av Läkare Utan Gränser sjukhus i Kunduz, Afghanistan. The aerial bombing of Doctors Without Borders hospital in Kunduz, Afghanistan. Statement by Swedish Doctors for Human Rights Swedish Doctors for Human Rights condemns alleged participation of Swedish military in NATO drone-killings decisions in Afghanistan. Case Assange – Deutsche Welle interviews SWEDHR chairman Prof. Marcello Ferrada de Noli Sweden risks being a primary target – In a military conflict of NATO VS. Russia New findings may indicate that Malaysian Airlines MH17 was shot down by Ukraine forces Sputnik News interviews Swedish Doctors for Human Rights Chairman, on UN Security Council draft resolution ref. MH17 MH17 – The facts and the libel The geopolitical aim in the Ukraine Civil War, and the economic consequences for the Ukrainian people – By John Goss Was the shooting down of MH17 a false-flag operation? Dramatic pictorial of the recent bombardment by Ukraine forces on Donetsk Hospital N23, Gorlovka School N°15, and other civil areas The brave anti-war crusade of Viktoria Shilova, who demands Poroshenko’s government to stop the civil war against the people of Donbass. Epidemiological estimation of casualties caused by drone strikes, by authors at SWEDHR Human rights of Julian Assange continuously infringed by Swedish institutions and media The scandalous political case of the Swedish prosecutor vs Julian Assange Swedish Doctors For Human Rights RESEARCH & REPORT on war-crimes & HR abuses others are silent about Why Arming Ukraine Extrapolates War Versus Russia Sweden’s Russophobic press & TV lobbying for war Sweden NOT prosecuting top-politicians on serious allegations of war crimes in Libya, but capriciously detain four years leader of the war crimes-denouncing org. WikiLeaks Brief analysis on the publicized “all-war risk” situation around Ukraine conflict “We need to separate the artist from the artwork”. By Nicholas Ringskog Ferrada-Noli in DN.
cc/2020-05/en_middle_0087.json.gz/line1338038
__label__cc
0.657518
0.342482
Ushio to Tora – 17 The temple elders are visited by a beautiful ghost, Jiemei (voiced by Hanazawa Kana) who reports that Ushio’s body has been overthrown by the Beast Spear, making him a true beast. The only way to save him involves his dad, the Kouhamei Sect, the comb that his mother gave him…and none other than all of the girls he’s saved on the way to Asahikawa. One by one, to my increasing delight, Jiemei pays a visit to those girls: Yuu, Saya, Reiko, Mayuko, and Asako. And when they hear their Ushio is in trouble, they don’t ask about the danger, or why a green ghost goddess is talking to them: they drop what they’re doing and GO. I should have known this was coming: after spending most of last season saving these girls, the time would come when they’d be able to return the favor. And let me just say, it’s a delight to anyone who’s been following the show closely and enjoying it to behold this episode assembling the “Dream Team.” Ushio is in rough shape, and it wouldn’t be as satisfying if some new priest or shaman or youkai stepped in to save him with some kind of miracle spell or ritual. Ushio’s soul is under siege, and these girls who touched that soul are the best chance to break that siege. Naturally, Haniwa, Jun, Satoru, and Nagare are also on board. And let’s not forget Tora, who wants to restore Ushio to his human state so he can eat him…and because, c’mon, the big lug loves the guy. To save Ushio, the girls have to comb his hair with the heirloom comb, but the comb is on his person. Enter Izuna, the fleet green jackal-weasel-fox thingy who fights through Beast-Ushio’s black tendrils and snatches the comb up. Easy part over. As Ushio’s dad and the sect members prepare for an approaching Ushio (followed closely by a massive horde of hiyou), the girls introduce themselves. The sudden melding of these girls’ personalities and histories with Ushio is exceedingly fun to watch, especially how Mayuko tries to kid around with Asako’s feelings, only for it to get more serious when Yuu reacts to Asako’s usual defense mechanism of running down Ushio and claiming not to care about him. Yuu calls her the hell out, causing Asako to cry and admit the truth: she’d have come running earlier had she known what was going on. Once Ushio arrives, Reiko is the first to volunteer to go at him with the comb. He tries to shove her aside, but she successfully gets the comb in his hair, tearing off a big lock. But once she’s done, Ushio is racing straight at the other girls. Saya trips trying to run, but Asako puts her body between her and Ushio. When the injured Asako thanks God no one else got hurt, Yuu realizes she was harsh on Ushio’s childhood friend. She’s the real deal. Hinowa manages to trap Ushio in a magic barrier, something Saya is able to punch through due to her status as a white-haired woman. Like Reiko, Ushio saved Saya from a life of despair and servitude, so she’s no less committed to freeing Ushio from his demonic prison. She gets a lock off too, but Hinowa’s barrier breaks, leaving the next girl, Mayuko, exposed to Ushio’s wrath. That’s when ZZZZAP, Tora unleashes a lightning storm that half-destroys the bridge, saving his “future food” Mayuko along with Saya. Everything happens bang-bang-bang in this episode, and even when it doesn’t, the scenes are full of great character interaction. Like Asako and Yuu, Hinowa and Jun quickly get over their mutual animosity when the latter saves the former by helping her maintain the barrier on Ushio. While they’re not part of the group of girls who must comb Ushio’s hair, there’s no doubt Ushio saved Jun from a life of despair by saving her bro, while Hinowa can’t help but respect him, considering how many others are willing to put their lives on the line for him. Yuu’s up next (Asako will probably be the last, for dramatic purposes and all), and she too is steeled by witnessing the love and devotion of the others. They may have been saved in different ways, but they were all saved by the same goofy, hard-headed, kind, selfless guy. And they’re going to get him back. Author magicalchurlsukuiPosted on Fri, 23 Oct 2015 Tue, 29 Dec 2015 Categories Anime Reviews, RABUJOI World Heritage List, Summer 2015, Ushio to ToraTags akiba nagare, aotsuki ushio, asahikawa, うしおととら, beast spear, chosen four, comb, consumed, girls, guilt, hakumen no mono, hanazawa kana, hanyuu reiko, hiyama yuu, hiyou, inoue mayuko, izuna, jiemei, Kouhamei sect, monster, moritsuna jun, moritsuna satoru, nagatobimaru, nakamura asako, sekimori hinowa, soul, teamwork, tora, youkai Noragami Aragoto – 04 Well, looks like Kugaha took Kurama too…Damn! That makes things trickier for Yato. Oh yeah, and Yato seems to believe, quite understandably so, that Hiyori was kidnapped under Bishamon’s orders, rather than Kugaha acting alone. Let’s just say Yato gets a little hot-blooded the moment he knows Hiyori is in enemy hands. He’s going to get her back; nothing else matters. When Yukine hears what’s happened, he’s quick to join. It’s a race against time, as Hiyori can only survive so long outside of her body. But she and Kurama are stuck, so it’s as good a time as any to explain the beef between Bishamon and Yato. Turns out, as we more or less knew, Bishamon’s entire cadre of regalias were wiped out by Yato, and Kurama was the only survivor. But Kurama also lets us know how a God can be resurrected after being destroyed, which is what Kugaha’s aim seems to be. Kugaha wants Yato to kill Bishamon for him so a new Bishamon will be born: one he’ll be the exemplar for (rather than Kurama) and will likely be able to mold into more compliance than the current, “spoiled” Bishamon, whom Kugaha also believes is too “soft-hearted” to carry the mantle of God of War. And he may not even be wrong. Thanks to Tenjin, Yato and Yukine are able to travel to the realm of Bishamon’s mansion (in exchange for being kept out of it, plus one other thing Yato understands without him saying), and the fight begins. Because Kugaha is basically using Aiha’s corrupted body to weaken Bishamon, the lack of a steady exemplar like Kurama means her power flies out of control easier, which results in tougher attacks but at a risk to herself and her regalias. Trapped in a dungeon and unable to intervene even if “Veena” heard him, Kurama laments the fact that it was he who got his fellow regalias wiped out by Yato. That’s right: Yato wasn’t only a rabid monster killing indiscriminately (though he was certainly in Nora’s thrall at the time): he was a rabid monster killing indiscriminately because he was asked to, by a young Kurama who didn’t know what else to do. When Bishamon’s body became riddled with corruption, and the regalia culprit wouldn’t come forward, discord was sown among them all, and all it took was one spark from someone who’s lost their temper to start fighting amongst themselves. Kurama couldn’t bear to watch Bishamon be destroyed in the chaos, so he exercised the nuclear option: hire a calamity god, Yato, to cut out the rot, to save Bishamon. In the present, Yato seems to sense Bishamon is corrupted again, but Bishamon insists none of her regalias are betraying her this time—words that make Aiha tear up, because she and Kugaha are betraying her. In the past, Kurama’s quick, decisive action saved Bishamon, but I don’t think Bishamon wanted to be saved that way, even though things had gone to far to save her regalias. The collective pain of their fighting and deaths would have probably destroyed her, but better she die than watch them die. It’s the reason she takes on every lost soul she can, even if they’re not useful. She blames Yato, but she blames herself just as much for what happened. Now, things are on the verge of going past the point of no return, and everything is going according to Kugaha’s plans, with Yato and Bishamon fixed on one another and their colorful pasts, unable to see the forest for the trees. Vastly outnumbered, Yato gets separated from Yukine, is encased in a tripartite barrier, and Bishamon’s killing blow for him is caught by Yukine, shattering him into pieces. This was a brutally intense episode culminating in an equally intense cliffhanger. I can’t quite believe Yukine is dead, since that would surely be curtains for the unarmed Yato, but who knows? It’s a very unfortunate situation. Kugaha has truly made a mess of things, and it’s going to be interesting to see if and how it’s cleaned up. Author magicalchurlsukuiPosted on Fri, 23 Oct 2015 Categories Anime Reviews, Fall 2015, Noragami AragotoTags aiha, ノラガミ, betrayal, bishamon, chess game, confrontation, ebisu kofuku, exile, expulsion, far shore, flashback, god of calamity, hiyori iki, kazuma, kidnapping, kugaha, leverage, lower realm, manipulation, near shore, nora, pawn, phantoms, plot, regalia, reincarnation, reintroduction, sacrifice, shinki, suzuha, villain, war god, yato, yukine Weekly ED: Sakurako-san no Ashimoto ni wa Shitai ga Umatteiru Happy Friday! Why not chill out with the ending theme to Beautiful Bones, a soothing, ethereal little number called “Uchiyoserareta Boukyaku no Zankyou ni” (打ち寄せられた忘却の残響に, no help from Google Translate: “The reverberation of heave are forgetting”) by TECHNOBOYS PULCRAFT GREEN-FUND, which is a wonderfully ridiculous name for a band any way you slice it. Author magicalchurlsukuiPosted on Fri, 23 Oct 2015 Categories Video, Weekly EDTags beautiful bones, sakurako's investigation, technoboys pulcraft green-fund1 Comment on Weekly ED: Sakurako-san no Ashimoto ni wa Shitai ga Umatteiru
cc/2020-05/en_middle_0087.json.gz/line1338046
__label__wiki
0.503373
0.503373
Home About Artists Supporters Playlist Contact Melanie Dyer— Artist: Melanie Dyer Track: Memphis T-Shirt Single: Memphis T-Shirt Following her previous pop-country single hits Fresh and Save My Cents, Melanie Dyer returns with her next smash-hit single, Memphis T-Shirt. On a month-long song-writing trip to America last year Melanie took a road trip to Memphis with a few good friends. Wandering around Graceland, visiting the home of Elvis and seeing his collection of vintage cars and private jets, there was something magical about the visit. Melanie says, “The next morning I had a songwriting session in Nashville. I put on the Memphis T-Shirt I purchased and looked in the mirror. It was like a light-bulb moment, I knew that today I would write a song about Memphis. I quickly recorded a few voice memos on my phone with the lyrics ‘Memphis on my mind’, took it to the session and we built the song from there.” While it may not be normal to meet two complete strangers and pour out your thoughts and feelings, when Melanie met co-writers Karen Kosowski and Emma-Lee they were into the idea and the song came to life organically. “I think we were having so much fun with it that we knew this song had something special,” she says. Website: Melanie Dyer See more artists featured this month © 2017—2020 Copyright Radio 876
cc/2020-05/en_middle_0087.json.gz/line1338047
__label__cc
0.672165
0.327835
Cherokee County Airport (JSO) 903.586.1521 Aircraft Ready Crew RidgeAire in the Media What today is RidgeAire Worldwide, began back in 1975 as Ridgley Aviation in Bay City, Texas. That was 35 years ago and Bud and Fran were just getting started. A move to Cherokee County Airport (JSO) in 1978 and a brief expansion into Tyler in 1984 were in the future for the devoted couple and parents of six. The Ridgley children were raised around aviation and for the past twenty years, son Brian has been at the controls, efficiently taking the family's company to new heights. Brian knows that buying and selling aircraft in today's market demands innovation, determination and devotion to every aspect of your RidgeAire experience. He and his staff continually work to provide clients the opportunity to experience smoother transactions and an impeccable inventory with a wide range of choices. With such a rich family history in the business, there is no firm better equipped or more knowledgeable to serve your aviation needs today and into the future. RidgeAire has always put their clients first and the corporate slogan remains the same today as it was 35 years ago: "People are More Important Than Airplanes". Click on a photo to see a larger version. From Vref Market Leader Aircraft Value Reference IV: "There is definitely a 'What's Hot' group in the tuboprop segment, and it's practically the entire group. Late model Beech King Air C90Bs, B200s, 300s and 350s are up again and continue to be red hot, especially if they are ready for service today. Brian Ridgley of RidgeAire in Texas said it this way, 'Values have stabilized. Buyers will pay top dollar for airplanes that are worthy!' Prices are edging up on most turboprops despite a slight increase in availability from one year ago. According to Jetnet, almost 8% of the B200s are for sale. Last year, less than 7% were available. Just over 10% of the Conquest IIs are on the market, up from 9% a year ago. Even with the very light jet market debut just around the corner, there is no downward pressure on existing turboprops." Brian Ridgley, President and CEO I took my first flying lesson when I was 9 years old. Cherokee County Airport (JSO) and aviation in general looked alot different back then. I'm one of those guys that can talk about how things used to be and tell stories with the best of them. Singles, multi, turbine, you name it, I love flying it! I believe I was destined to become my dad's successor at RidgeAire! It just seemed the natural thing for me to do. Dad patiently nurtured me through an eight year internship following my service in the US Navy and I'll admit, I was impatient at times. Dad wanted to make sure I was ready to take care of our clients. Today, I'm a husband to Laurissa and the father of Brianna, Macie and Zack. Devoted to God and to my family, I'm also devoted to seeing that the reputation my father has always enjoyed in this business is respected and guarded. It's important to me that when you contact us, you understand that you're not just doing business, you're becoming a member of our aviation family, too! BAR@RidgeAire.com Bud Ridgley, President Emeritus I might know everybody in aviation. Lord knows I’ve been in it long enough! My first flight was when I was 10 years old and that, put mildly, was a while back. That first flight introduced me to what was to be my life’s work. As a teen, I “earned” flight time by working at Beaver Aviation in Des Moines. I soloed on my 16th birthday. In 1955 I moved to Houston with my wife Fran. While there, I bought my first plane, a Luscombe 8E. I’ve never looked back. I took the Aircraft Sales Manager position at Hunt Pan Am in Brownsville and moved to Texas in 1972. Several years later, my wife, Fran, and I established Ridgley Aviation at Bay City (TX) Municipal. Fran even invented one of, if not the first “self serve” gas pumps while we were there. It was marvelous. I stayed busy with the FBO and a flight club that sold shares rather than the traditional fractional ownership of one airplane. This allowed me to continually rotate the airplanes in use and made everyone in the flying club happy enough that it stayed full during it’s entire existence! Around the end of 1978, an opportunity to establish an FBO at Cherokee County Airport presented itself and we quickly made the move. We expanded to Tyler, TX, selling Texaco branded fuel, arranging charters, running a flight school, renting hangar space and operating a maintenance facility. Almost 20 years later, we slowed down. My son, Brian, came into the business as my apprentice and I devoted full time to teaching him everything I had learned. Brian bought the business and Fran and I retired in 1997, leaving our “baby” in very capable hands. With pride, we watched Brian grow the firm, expanding his markets and blazing new trails. He does all things first class and has added acclaim to the Ridgley name. It was no surprise to anyone but me, probably, but last year, I grew bored of my “lifestyle decision” and determined that I wanted back in. The current economy made it challenging and I felt that my experience and contacts would benefit my son’s company. So, without hesitation, (and after consulting my wife of 57 years) I came back to Ridgley Aviation (now known as RidgeAire Worldwide) and am having fun again! It seems I get reacquainted with old aviation friends every day. Make no mistake, the world of aviation and aircraft sales has changed a lot in my time away. Things move much more quickly now, thanks to cell phones and the computer. I’ve even had to learn a whole new language thanks to innovations such as the G1000 and advances in GPS technology. I’ve embraced these changes (call me on my iPhone or send me an email) and marvel at their contributions to the industry. This fascinating, amazing, ever changing world of aviation is my life long passion, no doubt about it. If you’re wondering what that means to you as a potential client of RidgeAire Worldwide, call us. I’ll explain it to you and maybe tell you a story or two if you have the time. Read Bud's account of a harrowing incident while flying in January, 1991. Bud@RidgeAire.com Jan Crawford, Comptroller jac@ridgeaire.com HOURS: Monday-Friday 9-5 Central Time After-hour appointments are available. Call our Aircraft Specialists 24/7! About RidgeAire Group M7 Design
cc/2020-05/en_middle_0087.json.gz/line1338049
__label__cc
0.737925
0.262075
These Blancpain Watches are Based on Legendary Chinese Beauties Wei-Yu Wang Great Beauties Blancpain has looked eastwards before. Amongst the catalogue of the exquisite, handcrafted art watches that make up the Metiers d’Art collection are some inspired by the Chinese zodiac, and others created with old Japanese techniques. Four new timepieces join them, this time inspired by historical and legendary figures of feminine beauty. Each piece depicts one of these renowned women from different eras of ancient China: Xi Shi, from the Spring and Autumn period (722-481 BC) whose looks caused fish to forget to swim; Diao Chan, a fictitious character from Romance of the Three Kingdoms (the Three Kingdoms period lasting from 220-280 AD), whose radiance startled the moon; Wang Zhaojun from the Western Han dynasty (206 BC-9 AD) caused birds to waver from flight; and Yang Guifei from the Tang dynasty (618-907 AD), whose beauty put even flowers to shame. Blancpain’s mastery of enamelling techniques is on full display. Xi Shi and Wang Zhaojun make use of the demanding Grand Feu and champlevé techniques, while Yang Guifei is painstakingly painted. The results are vividly colourful, and offset with highlights of materials such as gold, mother-of-pearl and wood marquetry that lend a three-dimensional effect. Moments of creative genius abound; with Xi Shi, for instance, the enamel depicting the stream is translucent, and the engraved carp will appear to shimmer beneath depending on the angle of the light. The moody patina of Diao Chan was implemented with shakudo, a traditional Japanese method of chemically staining metal. Essentials for enamelling work. Hand-enamelling by artisans. Mechanically, the watches are classically styled time-only two-handers, sporting 42mm red gold cases. The manually wound 13R3A movement boasts of an impressive eight-day power reserve, and its meticulous hand-finished elegance is visible through the display case-back, a keen match for the consummate artistry of the dial.
cc/2020-05/en_middle_0087.json.gz/line1338057
__label__cc
0.71458
0.28542
Assessing eGovernment systems success: A validation of the DeLone and McLean model of information systems success Yi Shun Wang, Yi Wen Liao Department of Information Management With the proliferation of the Internet and World Wide Web applications, people are increasingly interacting with government to citizen (G2C) eGovernment systems. It is therefore important to measure the success of G2C eGovernment systems from the citizen's perspective. While general information systems (IS) success models have received much attention from researchers, few studies have been conducted to assess the success of eGovernment systems. The extent to which traditional IS success models can be extended to investigating eGovernment systems success remains unclear. This study provides the first empirical test of an adaptation of DeLone and McLean's IS success model in the context of G2C eGovernment. The model consists of six dimensions: information quality, system quality, service quality, use, user satisfaction, and perceived net benefit. Structural equation modeling techniques are applied to data collected by questionnaire from 119 users of G2C eGovernment systems in Taiwan. Except for the link from system quality to use, the hypothesized relationships between the six success variables are significantly or marginally supported by the data. The findings provide several important implications for eGovernment research and practice. This paper concludes by discussing limitations of the study which should be addressed in future research. Government Information Quarterly https://doi.org/10.1016/j.giq.2007.06.002 Published - 2008 Oct 1 Wang, Y. S., & Liao, Y. W. (2008). Assessing eGovernment systems success: A validation of the DeLone and McLean model of information systems success. Government Information Quarterly, 25(4), 717-733. https://doi.org/10.1016/j.giq.2007.06.002 Wang, Yi Shun ; Liao, Yi Wen. / Assessing eGovernment systems success : A validation of the DeLone and McLean model of information systems success. In: Government Information Quarterly. 2008 ; Vol. 25, No. 4. pp. 717-733. @article{5b3174dd76b84227be895918c75036d5, title = "Assessing eGovernment systems success: A validation of the DeLone and McLean model of information systems success", abstract = "With the proliferation of the Internet and World Wide Web applications, people are increasingly interacting with government to citizen (G2C) eGovernment systems. It is therefore important to measure the success of G2C eGovernment systems from the citizen's perspective. While general information systems (IS) success models have received much attention from researchers, few studies have been conducted to assess the success of eGovernment systems. The extent to which traditional IS success models can be extended to investigating eGovernment systems success remains unclear. This study provides the first empirical test of an adaptation of DeLone and McLean's IS success model in the context of G2C eGovernment. The model consists of six dimensions: information quality, system quality, service quality, use, user satisfaction, and perceived net benefit. Structural equation modeling techniques are applied to data collected by questionnaire from 119 users of G2C eGovernment systems in Taiwan. Except for the link from system quality to use, the hypothesized relationships between the six success variables are significantly or marginally supported by the data. The findings provide several important implications for eGovernment research and practice. This paper concludes by discussing limitations of the study which should be addressed in future research.", author = "Wang, {Yi Shun} and Liao, {Yi Wen}", doi = "10.1016/j.giq.2007.06.002", journal = "Government Information Quarterly", Wang, YS & Liao, YW 2008, 'Assessing eGovernment systems success: A validation of the DeLone and McLean model of information systems success', Government Information Quarterly, vol. 25, no. 4, pp. 717-733. https://doi.org/10.1016/j.giq.2007.06.002 Assessing eGovernment systems success : A validation of the DeLone and McLean model of information systems success. / Wang, Yi Shun; Liao, Yi Wen. In: Government Information Quarterly, Vol. 25, No. 4, 01.10.2008, p. 717-733. T1 - Assessing eGovernment systems success T2 - A validation of the DeLone and McLean model of information systems success AU - Wang, Yi Shun AU - Liao, Yi Wen N2 - With the proliferation of the Internet and World Wide Web applications, people are increasingly interacting with government to citizen (G2C) eGovernment systems. It is therefore important to measure the success of G2C eGovernment systems from the citizen's perspective. While general information systems (IS) success models have received much attention from researchers, few studies have been conducted to assess the success of eGovernment systems. The extent to which traditional IS success models can be extended to investigating eGovernment systems success remains unclear. This study provides the first empirical test of an adaptation of DeLone and McLean's IS success model in the context of G2C eGovernment. The model consists of six dimensions: information quality, system quality, service quality, use, user satisfaction, and perceived net benefit. Structural equation modeling techniques are applied to data collected by questionnaire from 119 users of G2C eGovernment systems in Taiwan. Except for the link from system quality to use, the hypothesized relationships between the six success variables are significantly or marginally supported by the data. The findings provide several important implications for eGovernment research and practice. This paper concludes by discussing limitations of the study which should be addressed in future research. AB - With the proliferation of the Internet and World Wide Web applications, people are increasingly interacting with government to citizen (G2C) eGovernment systems. It is therefore important to measure the success of G2C eGovernment systems from the citizen's perspective. While general information systems (IS) success models have received much attention from researchers, few studies have been conducted to assess the success of eGovernment systems. The extent to which traditional IS success models can be extended to investigating eGovernment systems success remains unclear. This study provides the first empirical test of an adaptation of DeLone and McLean's IS success model in the context of G2C eGovernment. The model consists of six dimensions: information quality, system quality, service quality, use, user satisfaction, and perceived net benefit. Structural equation modeling techniques are applied to data collected by questionnaire from 119 users of G2C eGovernment systems in Taiwan. Except for the link from system quality to use, the hypothesized relationships between the six success variables are significantly or marginally supported by the data. The findings provide several important implications for eGovernment research and practice. This paper concludes by discussing limitations of the study which should be addressed in future research. U2 - 10.1016/j.giq.2007.06.002 DO - 10.1016/j.giq.2007.06.002 JO - Government Information Quarterly JF - Government Information Quarterly Wang YS, Liao YW. Assessing eGovernment systems success: A validation of the DeLone and McLean model of information systems success. Government Information Quarterly. 2008 Oct 1;25(4):717-733. https://doi.org/10.1016/j.giq.2007.06.002 10.1016/j.giq.2007.06.002
cc/2020-05/en_middle_0087.json.gz/line1338064
__label__cc
0.618619
0.381381
Queensland Law Handbook Online Your Practical Guide to the Law in Queensland About Caxton Legal Centre Contact Caxton Legal Centre Factsheets and Self-Help Kits The Australian Legal System Where Law Comes From The Court System Accessing Legal Assistance and Resolving Disputes Self-representation Post-Separation Parenting Spousal & Child Maintenance and Child Support Property Division when Couples Separate Same-sex Relationships Surrogacy and In Vitro Fertilisation Parents, Children and the Law Children, Work and Other Rights Children and Education Contracts, Money and Property Consumers and Contracts Consumer Credit and Banking Social Security Payments Laws Relating to Individual Decision Making Disability and the Law Accidents and Injury Living and Working in Society Neighbourhood Disputes Changing Your Name Buying, Selling and Building a Home Other Accommodation Options Laws Affecting the Environment Incorporated Associations Offenders and Victims Introduction to Criminal Law Arrest and Interrogation Court Processes in Criminal Matters Street Offences Dishonesty Offences Assisting Victims of Crime Children and the Criminal Law Prisons and Prisoners Counter-terrorism Laws, Offences and Other Provisions Complaints against Government – Administrative Law Complaints against Professionals Right to Information and Freedom of Information Discrimination and Human Rights Copyright and Moral Rights Temporary Work Visa HomeThe Queensland Law HandbookYour Rights and ResponsibilitiesImmigrationTemporary Work Visa Key temporary work visas include: Skilled Regional (provisional) visa (subclass 489) Training and Research visa (subclass 402) Temporary Work (short-stay activity) visa (subclass 400) Temporary Work (long-stay activity) visa (subclass 401) Temporary Work (entertainment) visa (subclass 420) Special Program visa (subclass 416) Working Holiday visa (subclass 417) Work and Holiday visa (subclass 462). Temporary Work (skilled) visa This is by far the largest group of temporary residents in Australia. This visa allows Australian businesses to employ overseas workers for up to four years in skilled occupations. Australian or overseas businesses that are unable to meet their skill needs from the Australian labour market can sponsor skilled overseas workers under the standard business sponsorship arrangement, which is the most common route to sponsor overseas workers. There are three stages to the Temporary Work (skilled) visa application: sponsorship—the employer applies to be approved as a standard business sponsor nomination—the employer nominates an occupation for a prospective or existing temporary work visa holder visa application—the worker nominated to work in the occupation applies for the visa. Applicants have to prove that they are being sponsored by an approved Australian or overseas business in connection with a business activity in Australia, and the tasks must be listed on the combined list of eligible skilled occupations. The applicants will have to be paid market rates for their occupation, and this cannot be less than the Temporary Skilled Migration Income Threshold. The applicant must prove that they: and their occupation are the subject of an approved nomination have a genuine intention to perform the occupation and that the position associated with the occupation is genuine have the necessary skills and experience to perform the occupation meet the English language proficiency (unless exempt) have the relevant licence and registration if required. If there are special market circumstances not covered by standard business sponsorship arrangements, an employer can enter into a labour agreement with the Australian Government, which allows for the recruitment of overseas workers. Skilled Regional (provisional) visa This temporary, points-based visa is for skilled workers who are nominated by a state or territory, or sponsored by an eligible relative living in a designated area in Australia. The visa is valid for four years, and a visa holder must live and work in a specified area. Certain family members can be included in the application. An applicant for this visa must nominate an occupation that matches their skills and qualifications and is listed on the Skilled Occupation List. The applicant must be invited to apply for the visa after registering an expression of interest with the Department of Immigration and Border Protection. This visa also allows holders of visa subclasses 495, 496, 475 and 487 to stay in Australia for an additional period. Training and Research visa The Training and Research visa is for people who want to come to Australia to undertake occupational training, conduct or observe research as a visiting academic or participate in a professional development program. The Training and Research visa has three streams: Occupational Trainee stream Research stream Professional Development stream. This is for people who require structured training to enhance their skills in their current occupation, area of tertiary study or field of expertise. The training program should be a minimum of 30 hours per week and at least 70% of this training must be workplace based. The visa is valid for the period of the training or up to two years. This is for international professional academics or researchers to visit Australia on a temporary basis to observe or participate in an Australian research project. An applicant for this visa has to show a significant record of achievement in their field. The visa is valid for the period of the research or up to 12 months. A subclass 402 visa holder under the research stream cannot receive remuneration other than a contribution towards travel and living expenses. Professional Development stream The Professional Development stream is for professionals, managers or government officials to undertake a professional development training program in Australia. The visa applicant must have an overseas employer and the position must be arranged by that overseas employer. The sponsor must be satisfied that the applicant’s English language proficiency is sufficient for the purposes of undertaking the professional development program mentioned in the visa application. The subclass 402 visa under this stream is valid for the period of the position or up to 18 months. Temporary Work (short-stay activity) visa This visa allows for up to six weeks of short-term, highly specialised, non-ongoing work or to participate in an event or events on a non-ongoing basis at the invitation of an Australian organisation. Temporary Work (long-stay activity) visa This visa is for people who want to come to Australia on a temporary basis two years after the date the visa is granted or a lesser period if specified by the Minister for Immigration and Border Protection. This visa can be issued for a period of up to two years and has four streams: Exchange stream Sport Stream Religious Worker stream Domestic Worker (executive) stream. This visa is for a skilled person. The applicant must be nominated by a long-stay activity sponsor who is a party to an exchange agreement or an exchange sponsor. The exchange agreement must be in place, allow a named Australian citizen or permanent resident to undertake a reciprocal exchange, and must be of benefit to both parties. The Sport stream is for professional sportspeople and other person related to sports (e.g. coaches and judges or adjudicators) who want to come to Australia to participate in a sporting competition. The applicant or sportsperson needs to be nominated by a long-stay activity sponsor who is a sporting organisation or a sport sponsor. An applicant willing to be a full-time religious worker and serving the religious objectives of a religious organisation in Australia can apply for this visa. Work to be engaged in could include providing spiritual leadership, conducting worship, teaching or guidance in religion. The applicant’s nomination needs to be related to an activity that directly serves the religious objectives of the long-stay activity sponsor, who is a religious institution, or the religious worker sponsor. Domestic Worker (executive) stream Domestic servants may be brought to Australia for temporary stay and work full time in the household of certain senior foreign executives. The applicant needs to be sponsored by an approved long-stay activity sponsor such as the sponsor of a subclass 403 (Temporary Work (international relations)) or subclass 457 (Temporary Work (skilled)) visa. The sponsor must show that they could not find local labour to work as a domestic servant or that there are compelling reasons for employing the visa applicant. The applicant must be over 18 years of age and must have relevant experience of working as a domestic worker. The applicant is to be employed in Australia in accordance with the standards for wages and working conditions of relevant Australian legislation and awards. Temporary Work (entertainment) visa People in this category may be considered for temporary entry for a maximum of two years if they are nominated by an approved organisation, government or foreign government agency, or by an eligible individual as sponsor. Broadly, the applicant must be sponsored to work as performer or in a support or production role in relation to an entertainment project. Special Program visa This visa is for people who would like to participate in approved programs for cultural enrichment and community benefit that can help to strengthen international relations. Applicants for this visa must be under 31 years of age and need to show a genuine intention to stay temporarily in Australia to undertake the approved special program. Approved programs include the School to School Interchange Program, the School Language Assistant Program and the Seasonal Workers Program. Also, applicants for this visa need to demonstrate that they have adequate means of support to cover all expenses associated with their stay in Australia. This visa is generally granted for three to twelve months. The aim of the Working Holiday Maker Scheme is to promote international understanding by providing opportunities for young people to gain experience in other countries. The scheme makes it possible for young people, who are resourceful, self-reliant and adaptable and who wish to holiday and travel in Australia, to work to supplement their funds. To be eligible for entry or stay in Australia as a working holiday maker, a person must (subclass 417, sch 2 Migration Regulations 1994 (Cth)): be over 18 years and have not yet turned 31 years old be a national of one of the countries with which Australia has a working holiday maker arrangement not be accompanied by dependent children during their stay. In all cases, applicants must: lodge an application for a Working Holiday visa (and pay the prescribed fee) satisfy the Minister for Immigration and Border Protection that: they have sufficient funds for a return fare and to support themselves in Australia for the initial part of the proposed holiday period the prime intention is to holiday in Australia and that any work performed will be incidental to that purpose and will not exceed six months with the same employer they will have reasonable prospects of obtaining temporary employment to supplement holiday funds they will depart Australia at the end of the temporary stay. Working holiday makers may apply for a second 12-month Working Holiday visa if they can show that they have worked at least three months in particular primary industries (e.g. fishing, pearling, butchering, forestry or seasonal harvest, or building construction work in regional Australia). Work and Holiday visa This visa is for tertiary educated people aged 18 to 30 who are interested in a working holiday of up to 12 months in Australia, but who do not come from one of the countries with whom Australia has a working holiday arrangement. The Work and Holiday visa allows applicants to supplement the cost of their holiday through periods of temporary or casual employment. PREVIOUS, NEXT, Visas for People Wishing to stay in Australia Permanently Share or Print Search the QLH and Factsheets Immigration Chapter Contents The Need for a Visa Visa Criteria for Temporary and Permanent Visas Submitting a Visa Application Visas for Visitors to Australia eVisitor Visa Electronic Travel Authority Medical Treatment Visa Visas for People Wishing to Stay in Australia Temporarily Permanent Family Migration Visa Permanent Skilled Migration Visa The Points Test Applicable to Certain Visas Refugee and Humanitarian Visas Onshore Protection Visas Off-shore Protection Visas Loss of Australian Citizenship Removal or Deportation of Unlawful Non-citizens Consequences of Deportation or Removal Administrative Appeals Tribunal Review of Deportation Decisions Administrative Appeals Tribunal Review of Cancellation Decision Review of Migration Decisions The Role of Federal Courts in Deciding Immigration Matters Freedom of Information—Access to Documents Held by the Immigration Department Migration Agents Registration Scheme Caxton Legal Centre 1 Manning Street, South Brisbane Qld 4101 Administration hours 9am - 4.30pm Evening Advice Sessions (by appointment) 5.45pm - 7.15pm The Queensland Law Handbook is produced by Caxton Legal Centre Inc (ABN 57 035 448 677) with the assistance of volunteers with legal experience in Queensland. The Handbook is intended to give general information about the law in Queensland as at July 2016. The content of the Queensland Law Handbook does not constitute legal advice, and if you have a specific legal problem, you should consult a professional legal advisor.
cc/2020-05/en_middle_0087.json.gz/line1338066
__label__wiki
0.640901
0.640901
Failed Entrance November 25, 2007 at 3:28 pm (Humor, Random memories, The Global Crowd, The Ilonggos, The Manilenos, The Negrenses) Ducking the Pecking It was a delightful privilege to be in the grand “sala” of the Lopez “Nelly Gardens” mansion in Iloilo on a cool July morning, seeing a light mist blanket the vast front garden, and listening to The Raconteur recount stories of Old Iloilo [ and Bacolod ] Society as he expertly played wonderful songs on the grand piano… “Oh, so many wonderful, and not-so-wonderful things happened here, and are still happening. So many parties. So much laughter. I remember She [ a Lopez lady ] stood right there…” he recalled as he gestured towards the center of the grand room. “She liked to sing. She liked to think she could sing. Her ‘piece-de-resistance’ was the song ‘Ang Maya’…” “Back in those days, no hotel in Iloilo would accommodate her because she liked to sing ‘Ang Maya’ accompanied by sixteen live ‘maya’ birds let loose around her. You can imagine the mess…” “But because this house, the ‘Nelly Gardens,’ belonged to her uncle, Don Vicente Lopez, She could do as she pleased. So she arrived with the sixteen ‘maya’ birds in cages for her recital.” “After several songs, it was time to sing her ‘piece-de-resistance,’ ‘Ang Maya.’ Her staff let the ‘maya’ birds loose and some did settle on her as she began to sing the lilting melody. ‘Ah-hahah-hahah’…” “ICK!” she winced as a “maya” bird pecked on her hand. The family and their friends smiled at each other but bit their lips. “Ah-hahah-hahah…” she continued. “ICK!! ICK!!” she screeched as two “maya” birds pecked on her arm. The family and their friends stifled their laughs. “Ang Mayaaa…” she continued. “ICK!!! ICK!!! IIICCCKKK!!!” she shrieked as three “maya” birds pecked on her alabaster white shoulders and neck, which were exposed by her beautiful “terno” dress. The family and their friends started giggling. So much for politesse!!! “So She was ducking the pecking of the pesky ‘maya’ birds all throughout the song… It was hilarious!!! She had all these red marks afterwards!!!” “I will forever remember that crazy afternoon!!!” The Raconteur declared as he shook his head and laughed heartily. Mwahahahahah!!! 😛 😛 😛 TransPacific Conversations November 25, 2007 at 3:19 pm (Angst, Family Traditions, Humor, Manila Houses, Random memories, The Cebuanos, The Global Crowd, The Ilonggos, The Manilenos, The Negrenses, The Pampanguenos, Tristesse) In a Northern American city, in a multimillion dollar penthouse overlooking a great park and the sea, lives Tita Fabulous… She has more in common with the sharp and sophisticated wives of New York billionaires, the intellectual and cultured peeresses of London, and the soignee grande dames of Paris than the inevitably dowdy ladies of Forbes Park, Dasmarinas Village, The Fort, and Ayala Alabang. Her immediate family is still the richest branch of a prominent, wealthy, and elegant Spanish mestizo Manila family [ with its wealth, as always, rooted in its Chinese antecedents ]. Her mother was the daughter of a famous Visayan family, which, even today, is associated with staggering wealth. In her pampered youth during PreWar, She was given over to elegant jewelry, to expensive dresses by a young Ramon Valera, and to the endless parties of a truly cosmopolitan Manila. But as World War II neared, She developed a sense of social responsibility which was only heightened by her chastening experiences throughout The War. In the PostWar, She became a beacon of charity, of work, and of simplicity. The jewelry, the dresses, and the parties — although still parts of her life —were no longer the priorities of her existence. She became a real partner in the actualization of her visionary husband’s manifold plans. Her tireless efforts contributed significantly to the formation of a business empire which included vast holdings in real estate, manufacturing, and education, among others. Her father, dashingly handsome and expensively educated, was an aristocrat of the Old World. His eminent father, of good family from the Visayas, had made a fortune from his excellent legal practice in Manila, but it was his mother’s birthright — her Spanish mestiza lineage and her blood relations to the best and the brightest of insistently Spanish Manila [ even in the 1910s – 20s ] — that assured his unimpeded entree to the corridors of Power and Influence. In his late age, he very nobly donated a substantial part of his large fortune to an educational institution which would educate the marginalized youth of the country. High Contemporary November 25, 2007 at 7:50 am (Design and Decoration, Manila Houses, Random memories, The Cebuanos, The Global Crowd, The Manilenos) This Sunday afternoon, I received a call from a dear friend. She was looking for some discreetly luxurious trifles to give her loved ones this Christmas and She was wondering if I had any ideas… I simply adore my dear friend and her husband. They TRULY are one of Manila’s most stylish couples. Viscerally, from the guts. That means that their Style is innate and highly individual, and it does not come “store bought,” meaning that it does not emanate from the mere possession and use of “things” from Hermes, Asprey, Bulgari, Christian Louboutin, Philippe Starck, et. al. — which, stupidly enough, to a lot of Manila ladies [ and gentlemen too 😛 ], is already The Essence of Style. *rolls eyes* For me, they are the Manila equivalent, in taste and style, of the legendary tastemakers [ Vicomte & Vicomtesse ] Charles and Marie-Laure de Noailles of 1920s Paris. For their style is essentially French and specifically Parisian, not at all Manila, and not at all Philippine. Style — a very cerebral one — oozes from their pores. Like the two legendary Parisians, their home is filled with contemporary art [ “But only from friends.” they say. ], artistic furniture, unusual and rare “objets,” walls of good books, and absolutely contemporary living. Like the two, their circle includes the most talented and most avant garde artists of our time — painters, musicians, poets, writers, etc.. Their gatherings at home are like French “salons,” with the best of people. Like the two, their style of living is effortless and spontaneous, and rather devoid of rigor. But completely unlike the two, their romantic lives are uncheckered, as they are totally devoted to each other. And the best thing — indeed the mark of authenticity — is that they claim they do not have any style at all. “And how is your beautiful home?” I asked her. “The same as usual.” “I know it’s “social death” for you two, but I’m sure magazine editors have approached you wanting to feature your home…” “Oh, they do. One Editor — of that magazine one only reads at beauty salons — sent a writer to interview me and a photographer to take test pictures.” “The Editor took one look at the photographs and declared: “It’s not grand.” “Grand”???!!! Laughoutloud!!! But “Grand” as an “IT” adjective went out with the 1980s!!! Some people just don’t know what Style is even when it’s already staring them in the face!!! *snickers like “Muttley” the dog cartoon character* “The Undying Swan” November 19, 2007 at 4:31 pm (Family Traditions, Humor, Random memories, The Global Crowd, The Ilonggos, The Manilenos, The Negrenses) I’m having a field day watching the ballet greats on YouTube: Anna Pavlova, Galina Ulanova, Maya Plisetskaya, Margot Fonteyn, Natalia Makarova, Svetlana Zakharova, Rudolf Nureyev, Yuri Soloviev, Fernando Bujones, Mikhail Baryshnikov, et. al.. I was simply born too late to be able to watch them perform live in their prime. Watching the great performances reminded me of [ yet ] another funny story from Old Iloilo… True to their “sweet” nature, the heiresses of Old Iloilo were invariably taught to play the piano and to dance the ballet, among several other social graces. As befitting the daughters of the province’s two grandest families, the daughters of the Lopezes and the Ledesmas were subjected — oftentimes tortured — with piano and ballet lessons, with many of the other “social” arts thrown in. One of the Lopez ladies [ famous for her unique and highly personal style of maquillage and coiffure ] did like to dance the ballet, enough to do it for years. She even went to New York and studied at a renowned ballet school [ I forget which one ] to hone her dance skills. To cap her arduous training, She learned to dance “The Dying Swan,” a solo act choreographed in 1905 by Michel Fokine with and for Anna Pavlova, set to the music of “Le Cygne” by Camille Saint-Saens. Back in Iloilo, the proud ballerina announced to Everybody that she would dance “The Dying Swan” at an evening performance. And so Everybody, curious to see what she had learned in faraway New York, came to watch her. Everybody was initially beguiled, and quite teary, at her interpretation of “The Dying Swan.” There were already sniffles heard in the audience. But somehow, The Swan was taking too long to Die. Much too long. The Swan kept on flapping her wings and bowing, about to expire, when she would flap her wings and bow again, and again…!!! A smart-alecky male friend of The Swan heckled from the audience: “Manang!!! Dapat mapatay ka na!!! Hay, ka-dugay man sa imo!!! Nga-a indi ka pa ya mapatay???!!! Sige dalian na!!!” [ “Hey, Lady!!! It’s time for you to die!!! You’re taking too long!!! Why don’t you die already???!!! C’mon!!!” ] The crowd started to snicker and giggle… But The Swan, unperturbed, proceeded with her Death slowly, slowly, slowly… Now, that’s what’s called Poise!!! Mwahahahahah!!! Sheer Fear November 5, 2007 at 2:26 pm (Humor, Random memories, The Global Crowd, The Manilenos) Eldest Presidential Daughter was having a fitting with Talented Designer in her bedroom at the Malacanang Palace in the 1970s… The First Lady peered into the room and saw her daughter fitting a beautiful gown by Talented Designer. “O, Mommy, ano’ng tingin mo rito?” [ “Oh, Mommy, how do you like it?” ] asked Eldest Presidential Daughter. “Maganda, maganda.” [ “Nice, nice.” ] replied the First Lady, who already had a practiced eye for fabric, cut, silhouette, and details. She appreciated the beautiful gown. She turned to Talented Designer and asked: “O, kailan mo ako igagawa ng gown???” [ “Oh, when will you create a gown for me???” ] “Ikararangal ko po, Ma’am!!!” [ “It would be my honor, Ma’am!!!” ] replied Talented Designer enthusiastically. “O sige, gawin mo na. Ipadala mo na bukas ng maaga para masuot ko na.” [ “Alright, make it already. Send it early tomorrow morning so I can wear it already.” ] commanded the First Lady in her charming, and alarming, manner. It was already six in the evening… Out of Sheer Fear, Talented Designer and his staff, like the fairy tale elves, worked all night to design, cut, embellish, and sew the gown. Of course, it turned out beautifully. Out of Sheer Fear. The instant but exquisitely beautiful gown was already at the Malacanang Palace by 6:00 a.m.. And true to her word, The First Lady wore his gown that day. The First Lady liked the gown. She made it known that she wanted more… Eldest Presidential Daughter called her friend, Talented Designer. She asked him: “Bakit hindi ka na pumupunta rito sa bahay???” [ “Why don’t you come here to the Palace anymore???” ] “AYAW KO NA!!!” [ “NO WAY!!!” ] refused Talented Designer. Out of Sheer Fear. Lest he be commanded to do overnight gowns again!!! Bwahahahahah!!! 😛 😛 😛 Marcos Era Fashion Show [ Note: This is a story which the senior couturiers like to recall about their legendary colleague SLIM Salvacion Lim-Higgins. When I inquired with SLIM’s children Sandy and Mark Higgins if it was true, they didn’t know if it was. However, they admitted that SLIM was occasionally “fetched” on orders of the First Lady Imelda Marcos during ungodly hours for discussions about the latter’s dresses. ] Friends in the fashion industry were reminiscing about the “Bagong Anyo” fashion show which was staged during the Marcos years. All the fashion designers involved were required to be present at the venue by 4:00 p.m.. They were to present their creations directly to Madame Imelda Romualdez-Marcos, who would approve or reject them. All the fashion greats of the time were present at the appointed hour. Lo and behold, Madame Marcos finally arrived nine hours later at 1:00 a.m.. Everyone got up and put their best foot forward for the very powerful First Lady. Remember, it was the Marcos Era and one wrong move… The models strutted the runway. Madame Marcos nodded in approval at some of the gowns. And then there was one number that did not please her… “Ano yan??? Parang “amoeba”!!! Hindi ko gusto iyan!!! Mamaya fully-beaded na ito, hah???!!!” Madame Marcos commanded. [ “What’s that??? It looks like an amoeba!!! I don’t like that!!! Make sure it’s fully-beaded later, OK???!!! ] There was a sudden commotion at the back of where the fashion designers were standing. The designer of the offending gown had fainted at the prospect of fully-beading her gown in a matter of hours, or even beading it at all. It was Salvacion Lim-Higgins. One of the greatest of Filipino fashion designers ever.
cc/2020-05/en_middle_0087.json.gz/line1338068
__label__wiki
0.506607
0.506607
Home Recent News Zorlu Sells Award Winning Levent 199 Zorlu Sells Award Winning Levent 199 Qatari funds, which have put their names to serious investments, have now purchased Levent 199, the second largest real estate project of the Zorlu Group. The Qatari fund reached agreement for the 40 storey office building on Büyükdere Caddesi (street), following lengthy negotiations. They have shaken hands for 440 million dollars It is rumored that Levent 199 has been sold for a record price. Zorlu Holding has sold Levent 199, which is its second important project in the field of real estate, to a Qatari fund. The parties had been in negotiations for some time for the 40 storey office building which is situated immediately next to the head office building of Zorlu Holding on Büyükdere Caddesi. The sales price being talked about for Levent 199, which was completed in 2014, is 440 million dollars. 250 million dollar investment target The group, which has targeted 250 million dollars of investments in the fields of energy, retailing and textiles in 2016, will increase its cash flow strength with this sale. A senior manager at Zorlu Holding admitted that there were discussions on this matter, but only stated that nothing had yet been finalized or become clear. It cost 280 million dollars Levent 199, the second project of Zorlu Real Estate following Zorlu Center, was completed in 2014, with an investment cost of 280 million dollars. Zorlu Levent 199 The signature of Tabanlıoğlu All of Levent 199, which was developed by Tabanlıoğlu Architecture, was built as offices. There are executive offices on the top 4 floors and a helicopter landing strip on the roof of the the tower of Levent 199, which was built on a 12 thousand square meter area of land, and possesses a total construction area of 122 square meters. The 40 storey building on Büyükdere Caddesi plays host to important Turkish and global companies. The total capacity of the smart building is 3 thousand 500 people. Zorlu Holding, which operates in the fields of textiles, technology and energy, had moved into the real estate sector with Zorlu Real Estate, which it established in 2006. Its first investment was the 2,5 billion dollar Zorlu Center. Each of Tabanlıoğlu Architects Projects are Award-Winning Zorlu Center Project has Something for Everyone Great Interest in Zorlu Shopping Mall Rent per sqm at Zorlu Center Reaches 250 Euros Zorlu Center Istanbul luxury project Previous articleThe Different Names of Istanbul Next articleTAV Wins 1,1 Billion Dollar Tender in Bahrain
cc/2020-05/en_middle_0087.json.gz/line1338077
__label__cc
0.666222
0.333778
Rhinovirus – causes, symptoms, diagnosis, treatment, pathology Learning medicine is hard work! Osmosis makes it easy. It takes your lectures and notes to create a personalized study plan with exclusive videos, practice questions and flashcards, and so much more. Try it free today! Human Rhinovirus (HRV) is a communicable, infectious virus that causes inflammation of the nasal mucosa, or rhinitis. It mainly causes upper respiratory tract infections, and gets its rhino- name, meaning nose, because it commonly causes a runny nose, nasal congestion, and sneezing, as well as a sore throat and cough. There are over 100 serologic known types and all of them can cause a “common cold” in humans! Now, rhinovirus belongs to the picornaviridae family of viruses. They are naked viruses, about 30 nanometers in diameter, and they’re surrounded by an icosahedral capsid, which is a spherical protein shell made up of 20 equilateral triangular faces. And they’re “naked” because the capsid isn’t covered by a lipid membrane. They’re also single-stranded, positive-sense ribonucleic acid, or RNA, viruses. This means that their RNA is actually mRNA, which the host cell ribosomes use to make viral proteins. Unlike other picornaviruses, rhinoviruses are acid labile. That means they can be destroyed by stomach acid, so they don’t typically infect the GI tract and don’t spread through a fecal-to-oral route. On the other hand, rhinoviruses commonly infect the epithelium of the respiratory mucosa, which lines the nasal cavity. So rhinovirus transmission occurs through contact with infected respiratory secretions, like snot and aerosols, particularly from nose blowing or sneezing. Touching an infected surface, like a door handle or shaking hands, and then touching an uninfected respiratory mucosa is a main way to transfer an infection – that’s because rhinoviruses can survive up to 2 hours on the skin, and 4 days on surfaces. Once rhinovirus has been introduced to the respiratory mucosa, it targets cell surface receptors expressed at the surface of nasal epithelial cells. Rhinoviruses can target a few specific receptors for entry, but one in particular is intercellular adhesion molecule-1, or ICAM-1. This attachment allows for rhinovirus to be eaten, or endocytosed, into the host cell. During the endocytosis process, the icosahedral capsid breaks open, allowing the single stranded RNA of Rhinovirus to gain access to the host cell cytoplasm. In the cytoplasm, the host cell ribosomes take over viral protein production, helping the virus replicate. Now, when the host cell realizes it’s been infected, it releases proinflammatory proteins, like cytokines and chemokines, to activate and attract immune cells to the site of infection, and recruit even more immune cells from blood vessels in the lamina propria, the layer just under the epithelium in the respiratory mucosa. And the end result is local inflammation. Rhinovirus infections can occur in any individual, but there are some groups who are more susceptible, like young children, the elderly, and individuals who are immunocompromised, or have underlying respiratory diseases like chronic obstructive pulmonary disease, asthma, or cystic fibrosis. The symptoms of a rhinovirus infection are actually those often associated with the “common cold”. Symptoms usually begin about 1 to 2 days after infection, and can last for about 2 weeks. And typically, they include nasal congestion and irritation, which can mean a runny nose; sneezing; pressure in the head that results in headaches, or sinus, ear or facial pressure; or a loss of smell and taste. But can also include fatigue, malaise, or loss of appetite; and other symptoms of an upper respiratory infection like a sore or irritated throat; a cough; or hoarseness. And while symptoms are usually mild, factors like age, immunocompromised states, and underlying respiratory diseases can result in much more drastic, and sometimes even more complicated, life-threatening symptoms. Rhinovirus is mainly diagnosed clinically; especially when “common cold” symptoms are present without additional complications, concerning physical findings, or relevant medical history. A definitive diagnosis can be made with PCR testing of cultures from nasal secretions or washings, but this is typically only done in more complex cases, like if an individual is immunocompromised or has an underlying respiratory disease. Now, because rhinovirus infections tend to be mild and self-limited, treatment typically centers on relieving symptoms and preventing other people from becoming infected. So, common symptom relievers include rest, hydration, and age-appropriate over the counter medications, like first generation antihistamines, NSAIDS, and nasal decongestants. And general precautions should be taken to limit spreading the virus, including covering coughs and sneezes, thorough hand-washing especially after nose blowing, and regular disinfecting of surfaces. Ok, so to recap: Rhinovirus is a type of picornavirus which is the leading cause of the common cold. It infects the epithelium of the respiratory mucosa, typically through a nasal route of transmission. A consequence of the inflammatory response from immune cells leads to rhinitis and the hallmark symptoms of the common cold, including runny nose, nasal congestion, and sneezing. A clinical diagnosis is usually made and treatment tends to center on symptom relief and preventing the spread of infection to others. EQUIP Snake Bite Kit Inclusions & Benefits Explained ! Enjoy the Outdoors! Leptospira – causes, symptoms, diagnosis, treatment, pathology 13 thoughts on “Rhinovirus – causes, symptoms, diagnosis, treatment, pathology” Henry Freeman says: Do a video on keloids please!!!!! Love these videos thanks Abdirisaq Jacda says: Wow thank you osmosis LackMLg 2 says: Make one on Yersinia Pestis Ziaul Haque says: Naufal Harahap says: The dislikes are from hrv Star Wars x EXO Collab says: Ugh! I suffer for chronic allergic Rhinitis and it sucks ! Dr. NARESH says: Thank you! So much team osmosis very much helpful Edwin Zaofery says: so what is the difference between rhinitis by virus and bacteria? Raza Medical Mnemonics says: Rhinovirus may play an important role in asthma exacerbations in children and in atopic individuals. Muffin Knight says: I really like to see your channel to succeed Lung and Sleep says: Such a great explanation of how Rhinovirus makes those infected feel so terrible. Also makes me as a respiratory specialist very busy over the winter season. Naweena Laxmi says: Please , can u make a separate n easy understanding video of HYPOTHYROIDISM ?? 🙏🙏 Armadillo88 says: Can you make a video about Naegleria Fowleri. Recent cases young girl died from this brain eating amoeba. Thanks.
cc/2020-05/en_middle_0087.json.gz/line1338079
__label__cc
0.544032
0.455968
Effects of the characteristics of a force-driven bulkhead on the structural acoustics of an elastic cylinder Langdon C. Heath, Naveendra Fernando, Hongmei Sun, David Matthews, Jie Pan To study the structural acoustics of propeller-excited marine vessels, the hull and bulkhead, against which the thrust bearing is mounted, are often modelled as a circular cylinder and a cross-section plate. This paper concerns the effects of the characteristics of the cross-section plate on the vibration and radiated sound from the cylinder. The critical aspect is the coupling between the plate and cylinder, as this affects the input power of the excitation force at the plate and energy transfer from the plate to the cylinder and eventually to the radiated sound. The study compares the input mobility, averaged vibration response of the cylinder, and the radiated sound power with respect to the driving force for full-plate and half-plate configurations. Conditions associated with large sound power radiation from the cylinder are assessed through detailed measurement of the distributed sound intensity and vibration on the surface of the cylinder. The results demonstrate the drastic differences in the radiated sound power when different cross-section plates are used, and indicate the importance of coupling between the hull and bulkhead structure for controlling the radiated sound power from the propeller-driven hull–bulkhead structure. Proceedings of Acoustics 2016 - The Second Australasian Acoustical Societies Conference Ian D. M. Hillock, David J. Mee Australian Acoustical Society Second Australasian Acoustical Societies Conference - Brisbane, Australia Duration: 9 Nov 2016 → 11 Nov 2016 Second Australasian Acoustical Societies Conference elastic cylinders sound intensity circular cylinders Heath, L. C., Fernando, N., Sun, H., Matthews, D., & Pan, J. (2016). Effects of the characteristics of a force-driven bulkhead on the structural acoustics of an elastic cylinder. In I. D. M. Hillock, & D. J. Mee (Eds.), Proceedings of Acoustics 2016 - The Second Australasian Acoustical Societies Conference (pp. 1-10). Australian Acoustical Society. Heath, Langdon C. ; Fernando, Naveendra ; Sun, Hongmei ; Matthews, David ; Pan, Jie. / Effects of the characteristics of a force-driven bulkhead on the structural acoustics of an elastic cylinder. Proceedings of Acoustics 2016 - The Second Australasian Acoustical Societies Conference. editor / Ian D. M. Hillock ; David J. Mee. Australian Acoustical Society, 2016. pp. 1-10 @inproceedings{b53454a892f5460bb52626b9036b5830, title = "Effects of the characteristics of a force-driven bulkhead on the structural acoustics of an elastic cylinder", abstract = "To study the structural acoustics of propeller-excited marine vessels, the hull and bulkhead, against which the thrustbearing is mounted, are often modelled as a circular cylinder and a cross-section plate. This paper concerns the effects ofthe characteristics of the cross-section plate on the vibration and radiated sound from the cylinder. The critical aspect is the coupling between the plate and cylinder, as this affects the input power of the excitation force at the plate and energy transfer from the plate to the cylinder and eventually to the radiated sound. The study compares the input mobility, averaged vibration response of the cylinder, and the radiated sound power with respect to the driving force for full-plate and half-plate configurations. Conditions associated with large sound power radiation from the cylinder are assessed through detailed measurement of the distributed sound intensity and vibration on the surface of the cylinder. The results demonstrate the drastic differences in the radiated sound power when different cross-section plates are used, and indicate the importance of coupling between the hull and bulkhead structure for controlling the radiated sound power from the propeller-driven hull–bulkhead structure.", author = "Heath, {Langdon C.} and Naveendra Fernando and Hongmei Sun and David Matthews and Jie Pan", isbn = "978-0-909882-26-6", editor = "Hillock, {Ian D. M.} and Mee, {David J.}", booktitle = "Proceedings of Acoustics 2016 - The Second Australasian Acoustical Societies Conference", publisher = "Australian Acoustical Society", address = "Australia", Heath, LC, Fernando, N, Sun, H, Matthews, D & Pan, J 2016, Effects of the characteristics of a force-driven bulkhead on the structural acoustics of an elastic cylinder. in IDM Hillock & DJ Mee (eds), Proceedings of Acoustics 2016 - The Second Australasian Acoustical Societies Conference. Australian Acoustical Society, pp. 1-10, Second Australasian Acoustical Societies Conference, Brisbane, Australia, 9/11/16. Effects of the characteristics of a force-driven bulkhead on the structural acoustics of an elastic cylinder. / Heath, Langdon C.; Fernando, Naveendra; Sun, Hongmei; Matthews, David; Pan, Jie. Proceedings of Acoustics 2016 - The Second Australasian Acoustical Societies Conference. ed. / Ian D. M. Hillock; David J. Mee. Australian Acoustical Society, 2016. p. 1-10. T1 - Effects of the characteristics of a force-driven bulkhead on the structural acoustics of an elastic cylinder AU - Heath, Langdon C. AU - Fernando, Naveendra AU - Sun, Hongmei AU - Matthews, David AU - Pan, Jie N2 - To study the structural acoustics of propeller-excited marine vessels, the hull and bulkhead, against which the thrustbearing is mounted, are often modelled as a circular cylinder and a cross-section plate. This paper concerns the effects ofthe characteristics of the cross-section plate on the vibration and radiated sound from the cylinder. The critical aspect is the coupling between the plate and cylinder, as this affects the input power of the excitation force at the plate and energy transfer from the plate to the cylinder and eventually to the radiated sound. The study compares the input mobility, averaged vibration response of the cylinder, and the radiated sound power with respect to the driving force for full-plate and half-plate configurations. Conditions associated with large sound power radiation from the cylinder are assessed through detailed measurement of the distributed sound intensity and vibration on the surface of the cylinder. The results demonstrate the drastic differences in the radiated sound power when different cross-section plates are used, and indicate the importance of coupling between the hull and bulkhead structure for controlling the radiated sound power from the propeller-driven hull–bulkhead structure. AB - To study the structural acoustics of propeller-excited marine vessels, the hull and bulkhead, against which the thrustbearing is mounted, are often modelled as a circular cylinder and a cross-section plate. This paper concerns the effects ofthe characteristics of the cross-section plate on the vibration and radiated sound from the cylinder. The critical aspect is the coupling between the plate and cylinder, as this affects the input power of the excitation force at the plate and energy transfer from the plate to the cylinder and eventually to the radiated sound. The study compares the input mobility, averaged vibration response of the cylinder, and the radiated sound power with respect to the driving force for full-plate and half-plate configurations. Conditions associated with large sound power radiation from the cylinder are assessed through detailed measurement of the distributed sound intensity and vibration on the surface of the cylinder. The results demonstrate the drastic differences in the radiated sound power when different cross-section plates are used, and indicate the importance of coupling between the hull and bulkhead structure for controlling the radiated sound power from the propeller-driven hull–bulkhead structure. UR - http://www.acoustics.asn.au/conference_proceedings/AASNZ2016/ SN - 978-0-909882-26-6 BT - Proceedings of Acoustics 2016 - The Second Australasian Acoustical Societies Conference A2 - Hillock, Ian D. M. A2 - Mee, David J. PB - Australian Acoustical Society Heath LC, Fernando N, Sun H, Matthews D, Pan J. Effects of the characteristics of a force-driven bulkhead on the structural acoustics of an elastic cylinder. In Hillock IDM, Mee DJ, editors, Proceedings of Acoustics 2016 - The Second Australasian Acoustical Societies Conference. Australian Acoustical Society. 2016. p. 1-10
cc/2020-05/en_middle_0087.json.gz/line1338084
__label__cc
0.735325
0.264675
Photo about the Forest Video about the Forest RAW media files Media about the forest Letter from local inhabitants to UNESCO delegates A letter to UNESCO delegates and other foreign ambassadors in Poland was written and circulated by a group of local inhabitants. The letter represents the standpoint of the growing part of the local community that disagrees with the logging and suffers from it, also for economic reasons. The letter is a response to Minister Szyszko’s call on the ambassadors and his persuasion that Bialowieza Forest should be crossed out from UNESCO Natural Heritage List. During Minister and ambassadors’ visit to Bialowieza (June, 22) no party expressing a different opinion than the one of the Ministry of Environment was given the floor to speak and present the statements contained in the letter. The visit was kept secret until the very last moment and no open discussion bearing on the merits of the situation in the Forest was held. Białowieża, June 21st, 2017 Honourable Ambassadors, We are addressing you as the representatives of the local community of the Białowieża Forest region to bring your attention to the negative processes taking place there. This last piece of primeval European lowland forest and UNESCO World Heritage Site is under the threat of destruction. The State Forests have been conducting heavy logging in its area. Moreover, they have banned public access to two out of three forest districts. We would like to point out that a continuously growing part of the local community strongly disagrees with the existing situation. The mass logging and fully artificial regeneration of the forest has devastating consequences for the landscape. It also drastically decreases biodiversity and inhibits natural processes. It should be highlighted that the cuttings were to be conducted only for sanitary and safety reasons, and solely along roads and tourist routes. Regrettably, they turned into a regular commercial logging, also in over hundred years old forest stands. In view of the above, we are deeply worried that the UNESCO World Heritage site will soon suffer irredeemable damage. We are also concerned by the fact that voices of respected scientists and the scope of their research have been constantly disregarded by the Polish Ministry of Environment. The ministry claims (against scientific knowledge) that the forest was planted by men and cannot survive without human intervention. In fact, such standpoint appears to be a justification of the escalating devastation of the last remnants of the natural forest under the State Forests’ administration. We strongly believe that natural ecosystems constitute an especially valuable part of not only Polish but European legacy. It is our responsibility to preserve wilderness for future generations. Therefore, we want to ask you for your support of the Bialowieza Forest conservation and for joining our call to stop the destructive logging. on behalf of concerned local citizens: Joanna Łapińska Arkadiusz Smyk Katarzyna Androsiuk Agata Smoktunowicz Halina and Wiktor Kabac Agnieszka and Mirosław Jakoniuk Nela Szuka Marcelina and Grzegorz Zimny March for the Forest in WarsawInterrogations and legal procedures against activistists Q: Where can I stay in Białowieża? A: There is the Camp for the Protection of the Forest in one of the forest villages. Learn more » A group of people who disagree with the mass logging taking place in the Bialowieza Forest. We share our standpoint with recognized scientists, environmental NGOs and the local community. What brings us all together is the commitment to protect the primeval Forest as a common good, defending it against the exploitative logic of the market. This website was created to share the news about what is going on in the Forest itself but also about all related events taking place in Poland and in Europe. info@naszapuszcza.org This site content is licensed under a Creative Commons Attribution 4.0 International License if not stated otherwise.
cc/2020-05/en_middle_0087.json.gz/line1338099
__label__cc
0.540489
0.459511
Product Testing & Quality Control Colostrum for Calves, Lambs & Kids What products are available for my pet? Is colostrum safe for my pet? Colostrum for People Kids, Calves, & Lambs Oligosaccharides Explained News Oligosaccharides Explained Did you know other factors beyond IgG can attribute to a healthy gut in your calves? Oligosaccharides in colostrum and transition milk serve as potential mediators of a healthy calf gut. In this issue of The Colostrum Counsel, we will explain just how these factors work in optimizing the overall health of your calves. The Colostrum Counsel: Oligosaccharides Explained Calves rely on the timely feeding of good-quality colostrum to provide them with passive immunity, since there is no transfer of immunoglobulins from the dam to the calf in utero. Due to the importance of passive immunity, most research in bovine colostrum and transition milk has focused on the quantity and quality of IgG. Yet, colostrum is also rich in additional nutrients and bioactive factors that are necessary for the proper development and maturation of the gut. These factors are just beginning to gain popularity in the field of colostrum research. Among these bioactive factors are oligosaccharides (OS). These molecules are essentially “simple sugars” and have been hypothesized to play a key role in the development of the newborn gut. In particular, OS help establish healthy gut bacteria, inhibit pathogenic bacteria, and may also enhance the absorption of IgG from colostrum into the blood. Structures and Concentrations in Colostrum As mentioned previously, OS are simple-sugar compounds with lactose being the core structure of all OS. In order to create structurally different molecules, fucose (neutral charge) or sialic acid (acidic charge) residues are added onto the lactose core in the mammary gland. Approximately 40 different OS compounds have been identified in bovine colostrum and milk, with the majority (>70%) of bovine OS having a sialic acid residue attached (Tao et al., 2008; Figure 1). Bovine OS are different from OS produced by humans, as the carbon chains of human OS are longer and only a small amount (5-15%) have a sialic acid group attached (Ninonuevo et al., 2006). The most abundant OS in bovine colostrum is 3’sialyllactose (3’SL), which is 4 times higher in colostrum compared to mature milk, followed by 6’sialyllactosamine (6’SLN) with the second highest concentration (Martin-Sosa et al., 2003; Figure 1). In contrast to IgG, the concentrations of OS do not decline as rapidly after the colostrum milking. In fact, it has been shown that 3’SL, 6’SLN and 6’sialyllactose (6’SL) have higher concentrations at 2 days after calving compared to 7 days after calving (Nakamura et al., 2003; Figure 2). The majority of farms often feed 1-2 meals of colostrum after birth, followed immediately by an abrupt transition to milk replacer or whole milk. The elevated concentrations of OS, along with an abundance of additional bioactive molecules in transition milk (milkings 2-6) demonstrate that there is likely value in feeding transition milk to the gut health of young calves on farm. Functions of Oligosaccharides The majority of OS can reach the intestine quickly since they can resist the acidic pH of the stomach and cannot be broken down by any of the calf’s gut enzymes. Most researchers assumed the majority of the OS would reach the large intestine in tact, however Janschter-Krenn et al. (2013) demonstrated these compounds can actually change structure and may play a role in the small intestine as well. So, what exactly are these small simple sugars doing in the small and large intestines? Energy Source for Healthy Gut Bacteria Several beneficial groups of bacteria in the small intestine and colon have a variety of enzymes that allow them to break down OS and utilize them as an energy source. It has been shown that the beneficial bacteria Bifidobacteria can consume 3’SL, the major OS in bovine colostrum, to promote its growth (Yu et al., 2013). Moreover, recent studies demonstrated that newborn calves have a higher amount of Bifidobacteria in the small intestine when higher concentrations of OS are provided in colostrum (Fischer et al., 2018; Malmuthuge et al., 2015). A higher amount of Bifidobacteria in the calf intestine likely contributes to an overall healthy gut bacterial community, since they are able to produce short chain fatty acids that have positive effects on colon cells, as well as stabilize the gut mucosal barrier and improve the immune system of the gut to prevent the overgrowth of pathogenic bacteria (Picard et al., 2005; Yasui et al., 1995; Boffa et al., 1992). Additionally, another beneficial group, known as Bacteroides, can uniquely use the sialic acid portion of the OS to promote their growth and establishment in the neonatal gut (Marcobal et al., 2011). Inhibition of Pathogenic Bacteria In addition to promoting the growth of beneficial bacteria, OS have also been shown to prevent pathogenic bacteria from establishing themselves in the gut. In order to invade the host tissues, pathogens must bind to sugars that are structurally similar to OS, known as “host glycans”, on the surface of intestinal cells. Since the structures of glycans and colostrum and milk OS are so similar, OS can act as “receptor decoys” and bind to the pathogen. This inhibits their ability to bind to the host and cause subsequent infection and disease (Zivkovic et al., 2011). Specifically, it has been demonstrated that two of the major OS in bovine colostrum and transition milk, 6’SL and 6’SLN, can block the binding of enterotoxigenic E. coli (Martin et al., 2002). Additional colostrum and milk OS can also bind to rotavirus (Huang et al., 2012), Vibrio cholera (Coppa et al., 2006), and Streptococcus pneumoniae (Andersson et al., 1986), which demonstrates their diverse capability to maintain a healthy and balanced gut microbial community. Enhance Immune Function As mentioned previously, beneficial gut bacteria can utilize colostrum and milk OS, which allows them to positively regulate the immune system through multiple pathways. For instance, bacteria that consume OS induce higher expressions of anti-inflammatory compounds and decrease pro-inflammatory compounds, compared to bacteria that consume an alternative energy source (Chiclowski et al., 2012). Bacteria that grow on OS can also up-regulate the amount of tight junction proteins between intestinal cells, which basically means they “tighten” the gaps so pathogenic bacteria cannot go between the intestinal cells and enter the blood stream (Chiclowski et al., 2012; Ewaschuk et al., 2008). One fascinating aspect about the sialic acid portion of an OS is when sialic acid is bound to the intestine, it can actually enhance the binding of IgG to the intestinal cell, as well as its uptake into the cell (Gill et al., 1999). This may explain why bovine colostrum has such a high abundance of OS with sialic acid residues compared to human colostrum, in which only a small portion have sialic acid. In humans, there is passive transfer of immunoglobulins during pregnancy from the mother to the fetus, where as in bovine animals, the calf can only obtain IgG from colostrum since there is no passive transfer during pregnancy. Therefore, since the passive transfer of IgG is one of the most important factors in promoting the health and survival of the newborn calf, the high abundance of sialic acid in colostrum may actually be present to assist IgG in gaining access to the calf’s blood stream¬–kick-starting the immune system. What about mannan-oligosaccharides? Mannan-oligosaccharides (MOS) are frequently supplemented to the calf in milk replacer (e.g. Bio-Mos®) during the first weeks of life. In contrast to bovine-derived OS, mannan-OS are derived from the cell wall of yeast, namely Saccharomyces cerevisiae. Mannan-OS have “brush-like” structures which allow them to attach to pathogenic bacteria, such as Salmonella and E. coli, thus blocking them from binding to the intestinal cell wall and causing subsequent infection. Calves fed MOS in milk replacer show a reduction in faecal E. coli counts (Jacques et al., 1994), improvements in fecal score (Morrison et al., 2010), and better growth performance (Sellars et al., 1997). Due to the positive effects observed when supplemented in milk replacer, researchers sought out to determine if similar effects might also be seen when supplemented in colostrum or colostrum replacer. Unfortunately, a study that supplemented MOS in colostrum replacer found no effect on passive transfer at 24h of life, or on the incidence of disease (Robichaud et al., 2014). Moreover, additional recent studies that supplemented MOS in fresh bovine colostrum actually found a negative effect on passive transfer when compared to calves fed unsupplemented colostrum (Brady et al., 2015; Short et al., 2016). The structure of an oligosaccharide is a major determinant of biological function and the calf gut is evolutionarily tailored to respond to compounds secreted by the dam into colostrum. Since bovine-derived OS are “more natural” for the newborn dairy calf, it may be possible that their supplementation during the first days of life may lead to increased passive immunity and better gut health when compared to those supplemented with MOS. Take Home Message The high abundance of oligosaccharides produced by the dam into colostrum and transition milk can have positive effects on gut health, specifically by acting as an energy source for healthy gut bacteria, inhibiting pathogens, and by enhancing the immune system. Therefore, feeding transition milk or milk supplemented with a quality colostrum replacer may offer increased gut protection for the newborn calf. Additional research should focus on the possibility of supplementing OS in traditional milk replacers, or even in whole milk, to ensure maximum protection of the newborn calf gut. The structures of the two most abundant oligosaccharides in bovine colostrum and transition milk. A study conducted by Nakamura et al. (2003) determined the concentrations of the primary oligosaccharides (3’SL, 6’SL and 6’SLN) in colostrum, transition milk, and mature milk. Andersson, B., O. Porras, L.A. Hanson, T. Lagergard, and C. Svanborg-Eden. 1986. Inhibition of attachment of Streptococcus pneumoniae and Haemophilus influenzae by human milk and receptor oligosaccharides. J. Infect. Dis. 153:232-237. Boffa, L.C., J.R. Lupton, and M.R. Mariani. 1992. Modulation of colonic epithelial cell proliferation, histone acetylation, and luminal short chain fatty acids by variation of dietary fibre (wheat bran) in rats. Cancer Res. 52:5906-5912. Brady, M.P., S.M. Godden, and D.M. Haines. 2015. Supplementing fresh bovine colostrum with gut-active carbohydrates reduces passive transfer of immunoglobulin G in Holstein dairy calves. J. Dairy Sci. 98:6415-6422. Chiclowski, M., G. De Lartigue, J.B. German, H.E. Raybould, and D.A. Mills. 2012. Bifidobacteria isolated from infants and cultured on human milk oligosaccharides affect intestinal epithelial function. J. Pediatr. Gastroenterol. Nutr. 55:321-327. Coppa, G.V., L. Zampini, T. Galeazzi, B. Facinelli, L. Ferrante, R. Capretti, and G. Orazio. 2006. Human milk oligosaccharides inhibit the adhesion to Caco-2 cells of diarrheal pathogens: Escherichia coli, Vibrio cholerae, and Salmonella fyris. Pediatr. Res. 59:377-382. Ewaschuk, J.B., H. Diaz, L. Meddings, B. Diederichs, A. Dmytrash, J. Backer, M. Looijer-van Langen, and K.L. Madsen. 2008. Secreted bioactive factors from Bifidobacterium infantis enhance epithelial cell barrier function. Am. J. Physiol. Gastrointest. Liver Physiol. 295:G1025-G1034. Fischer, A.J., N. Malmuthuge, L.L. Guan, and M.A. Steele. 2018. Short Communication: The effect of heat treatment of bovine colostrum on the concentrations of oligosaccharides in colostrum and in the intestine of neonatal male Holstein calves. J. Dairy Sci. 101:401-407. Gill, R.K., S. Mahmood, and J.P. Nagpaul. 1999. Functional role of sialic acid in IgG binding to microvillus membranes in neonatal rate intestine. Biol. Neonate. 76:55-64. Huang, P., M. Xia, M. Tan, W. Zhong, C. Wei, L. Wang, A. Morrow, and X. Jiang. 2012. Spike protein VP8* of human rotavirus recognizes histo-blood group antigens in a type-specific manner. J. Virol. 86:4833-4843. Jacques, K.A. and K.E. Newman. 1994. Effect of oligosaccharide supplements on performance and health of Holstein calves pre- and post-weaning. J. Anim. Sci. 72(Suppl 1): 295. Jantscher-Krenn, E., C. Marx, and L. Bode. 2013. Human milk oligosaccharides are differentially metabolized in neonatal rats. Br. J. Nutr. 110:640-650. Malmuthuge, N., Y. Chen, G. Liang, L.A. Goonewardene, and L.L. Guan. 2015. Heat-treated colostrum feeding promotes beneficial bacteria colonization in the small intestine of neonatal calves. J. Dairy Sci. 98:8044-8053. Marcobal, A., M. Barboza, E.D. Sonnenburg, N. Pudlo, E.C. Martens, P. Desai, C.B. Lebrilla, B.C. Weimer, D.A. Mills, J.B. German, and J.L. Sonnenburg. 2011. Bacteroides in the infant gut consume milk oligosaccharides via mucus-utilization pathways. Cell Host Microbe. 10:507-514. Martin, M.J., A. Martin-Sosa, and P. Hueso. 2002. The sialylated fraction of milk oligosaccharides is partially responsible for binding to enterotoxigenic and uropathogenic Escherichia coli in human strains. J. Nutr. 132:3067-3072. Martin-Sosa, S., M.J. Martin, L.A. Garcia-Pardo, and P. Hueso. 2003. Sialyloligosaccharides in human and bovine milk and in infant formulas: variations with the progression of lactation. J. Dairy Sci. 86:52-59. Morrison, S.J., S. Dawson, and A.F. Carson. 2010. The effects of mannan oligosaccharide and Streptococcus faecium addition to milk replacer on calf health and performance. Livest. Sci. 131:292-296. Nakamura, T., K. Kimura, Y. Watanabe, M. Ohtani, I Arai, and T. Urashima. (2003). Concentrations of sialyloligosaccharides in bovine colostrum and milk during the prepartum and early lactation. J. Dairy Sci. 86, 1315-1320. National Animal Health Monitoring System. 2011. Dairy Heifer Raiser, 2011. US Dept. of Agric-Anim. and Plant Health Insp. Serv.-Vet. Serv., Ft. Collins, CO. Ninonuevo, M.R., Y. Park, H. Yin, J. Zhang, R.E. Ward, B.H. Clowers, J.B. German, S.L. Freeman, K. Killeen, R. Grimm, and C.B. Lebrilla. 2006. A strategy for annotating the human milk glycome. J. Agric. Food Chem. 54(20):7471-7480. Picard, C., J. Fioramonti, A. Francois, T. Robinson, F. Neant, and C. Matuchansky. 2005. Review article: Bifidobacteria as probiotic agents- physiological effects and clinical benefits. Aliment. Pharmacol. Ther. 22:495-512. Robichaud, M., S.M. Godden, D.M. Haines, D.B. Haley, D.L. Pearl, J. Rushen, and S. LeBlanc. 2014. Addition of gut active carbohydrates to colostrum replacer does not improve passive transfer of immunoglobulin G in Holstein dairy calves. J. Dairy Sci. 97:5700-5708. Sellars, K., M. Burril, J. Trei, K.E. Newman, and K.A. Jacques. 1997. Effect of mannan oligosaccharide supplementation on performance and health of Holstein calves. J. Dairy Sci. 80(Suppl. 1): 188. Short, D.M., D.A. Moore, and W.M. Sischo. 2016. A randomized clinical trial evaluating the effects of oligosaccharides on transfer of passive immunity in neonatal dairy calves. J. Vet. Intern. Med. 30:1381-1389. Tao, N., E.J. DePeters, S. Freeman, J.B. German, R. Grimm, and C.B. Lebrilla. 2008. Bovine milk glycome. J. Dairy Sci. 91:3768-3778. Yasui, H., J. Kiyoshima, and H. Ushijima. 1995. Passive protection against Rotavirus-induced diarrhea of mouse pups born to and nursed by dams fed Bifidobacteria breve YIT4064. J. Infect. Dis. 172(2):403-409. Yu, Z-T., C. Chen, and D.S. Newburg. 2013. Utilization of major fucosylated and sialylated human milk oligosaccharides by isolated human gut microbes. Glycobiology. 23(11):1281-1292. Zivkovic, A.M., J.B. German, C.B. Lebrilla, and D.A. Mills. 2011. Human milk glycobiome and its impact on the infant gastrointestinal microbiota. PNAS. 108(1):4653-4658. Posted in News, The Colostrum Counsel Amanda Fischer, MSc. SCCL and Research Assistant at the University of Alberta The Colostrum Counsel - MAR 2018 Economic Impact Of Insufficient IgG Consumption A practical guide to on farm techniques to ensure healthy calves Esophageal Tube vs. Bottle Feeding Colostrum What Is A Veterinary Biologic And Why Is It An Important Designation? Use Of Colostrum Replacement Products As An Alternative To Reduce Antibiotic Treatment In Pre-Weaned Dairy Calves SCCL 30 Molaro Place Saskatoon, SK, Canada S7K 6A2 Phone: (+1) 866-242-3185 (toll free in Canada and the USA) Fax: (+1) 306-373-5766 Email: support@sccl.com THE COLOSTRUM EXPERTS
cc/2020-05/en_middle_0087.json.gz/line1338100
__label__wiki
0.631095
0.631095
Home Artificial Intelligence World champion Go player retires: AI ‘cannot be defeated’ World champion Go player retires: AI ‘cannot be defeated’ Selected by Science and Tech One of South Korea‘s most celebrated professional Go players, master Lee Se-dol, has retired, citing the futility of raging against the machines as a motivating factor. Speaking to reporters from the Yonhap News Agency in Seoul earlier this week, Se-dol said: With the debut of AI in Go games, I’ve realized that I’m not at the top even if I become the number one through frantic efforts. Even if I become the number one, there is an entity that cannot be defeated. Se-dol’s 24-year career includes wins over dozens of the world’s top players, including a stint as world champion. He faced DeepMind’s AlphaGo in five matches during March of 2016 where he managed to come away with just a single win. Prior to the bouts, Se-dol predicted he’d win by “a landslide,” and by all reports he was flat-out stunned when the AI repeatedly beat him. Still, Se-dol remains the only player to date to have beaten AlphaGo in straight-up official tournament play. This makes his retirement all the more worrisome — he’s one of the only humans on the planet capable of going toe-to-toe with the machine. It’s worth pointing out that Yonhap News Agency further reports Se-dol’s retirement was also related to an ongoing legal dispute: Lee didn’t deny that his retirement decision was also influenced by a conflict with the KBA over the use of membership fees. He actually quit the KBA in May 2016 and is now suing the association for the return of his membership fee. When we think about AI disrupting industry and displacing workers we usually consider factories and farmers. But here, we see evidence that the rise of AI has a potentially curbing effect on human competitiveness at the elite, world-class level. That’s certainly some cause for concern. Moment’s new 14mm lens promises razor-sharp super-wide photos Previous articleA Private Equity-Owned Doctors’ Group Sued Poor Patients Until It Came Under Scrutiny Next articleMoment’s new 14mm lens promises razor-sharp super-wide photos Life will soon be like ‘Her’ — and we’ll fall in love with AI Smart homes will turn dumb overnight as Charter kills security service Chevy simply exposed the convertible variation of its brand new Corvette (GM) Here are the Star Wars video games on sale for May the fourth scienceandtech - May 4, 2019 Ultrasound may end up being a brand-new method to handle diabetes Crowds Collect Weekly In Wisconsin To Enjoy Their Groups Play Ball– In Snowshoes scienceandtech - July 16, 2019 Elon Musk walks size of Boring’s ‘disturbingly lengthy’ LA tunnel
cc/2020-05/en_middle_0087.json.gz/line1338107
__label__wiki
0.767089
0.767089
Whiskypedia Whisky Industry Dave Broom Becky Paskin Ask the professor The whisky virgin Famous whisky drinkers Whisky heroes Collecting & Investing Legendary Bottlings Magazine > ‘South Pole Scotch’ bottled in world first 01 February 2018 by Matt Evans The ‘world’s first’ Scotch whisky to travel to the South Pole and back is to be bottled as part of a commemorative blend. Mission complete: Robert and Barney Swan fly the flag for Ardgowan distillery at the South Pole Explorer team Robert Swan OBE and son Barney Swan set off for the Antarctica in November, taking two small flasks of unidentified malt whisky provided by Ardgowan distillery. The duo reached the South Pole on 15 January, and are now on their way back to Scotland where one of the flasks will be presented back to the distillery. Ardgowan chairman Willie Phillips will then blend the contents with other malts to create a commemorative Ardgowan Expedition bottling. The limited edition release is set to be available in the spring, while work is due to start on Ardgowan’s new distillery later this year in time for a 2020 opening. Meanwhile, the other sample of Ardgowan was enjoyed by the explorers on Hogmanay, to ring in the new year. ‘At the end of each day we were exhausted,’ said Barney Swan. ‘On Hogmanay it was great to look forward to a dram – no doubt the most southerly New Year toast in the world. It really lifted our spirits.’ Swan and his father journeyed with the Scotch for 56 days and 600 nautical miles using only renewable energy to raise awareness of environmental issues. Distillery CEO Martin McAdam has pledged a proportion of the sales of the Ardgowan Expedition bottling to support the explorers’ ongoing environmental work. Although the Scotch is considered the first to travel to the South Pole and back to Scotland, it's not the first time whisky has been to Antarctica. Following his failed 1907 expedition to the South Pole, three crates of Mackinlay’s Rare Old Highland Malt were later discovered beneath Ernest Shackleton’s base camp at Cape Royds in 2011. However there is no evidence the whisky made it all the way to the South Pole. Chilled whisky: Robert Swan braved freezing temperatures to take the aluminium decanter of whisky to the South Pole Happy New Year: Barney Swan enjoys a dram of Ardgowan Expedition on Hogmanay Latest news 11 September 2018 First Ardgowan ‘South Pole Scotch’ released Ardgowan Expedition is a 20-year-old blended malt containing whisky that has visited the South Pole. New Whiskies 21 September 2018 Ardgowan’s Expedition, Glenmorangie Grand Vintage and four indie Macduffs and Miltonduffs. Ardgowan to release Coppersmith blended malt The yet-to-be-constructed distillery unveils its second limited edition blended malt. Latest news 15 October 2018 Ardgowan distillery reveals revised plans The new Inverkip distillery is scheduled to open in 2020, with a new malts series due next year. Latest news 15 November 2017 Ardgowan distillery wins £1m grant Scottish Government award will help fund construction at the £12m project west of Glasgow. Copyright © ScotchWhisky.com 2020. All Rights Reserved. Enter your email address below to keep updated with the latest news from Scotchwhisky.com
cc/2020-05/en_middle_0087.json.gz/line1338108
__label__wiki
0.807062
0.807062
Research ArticleMetabolism Free access | 10.1172/JCI64801 2-Aminoadipic acid is a biomarker for diabetes risk Thomas J. Wang,1,2,3,4 Debby Ngo,1,5 Nikolaos Psychogios,1 Andre Dejam,1 Martin G. Larson,3,6 Ramachandran S. Vasan,3,7 Anahita Ghorbani,2,3 John O’Sullivan,1 Susan Cheng,3,8 Eugene P. Rhee,1,9,10 Sumita Sinha,1 Elizabeth McCabe,11 Caroline S. Fox,3,12,13 Christopher J. O’Donnell,2,3,13 Jennifer E. Ho,3,7 Jose C. Florez,10,14,15 Martin Magnusson,16,17 Kerry A. Pierce,10 Amanda L. Souza,10 Yi Yu,18 Christian Carter,18 Peter E. Light,18 Olle Melander,17,19 Clary B. Clish,10 and Robert E. Gerszten1,2,10 1Cardiovascular Research Center and 2Cardiology Division, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts, USA. 3Framingham Heart Study of the National Heart, Lung and Blood Institute and Boston University School of Medicine, Framingham, Massachusetts, USA. 4Division of Cardiovascular Medicine, Vanderbilt University, Nashville, Tennessee, USA. 5Pulmonary Division, Harvard Medical School, Boston, Massachusetts, USA. 6Department of Mathematics and Statistics and 7Preventive Medicine Section, Department of Medicine, Boston University, Boston, Massachusetts, USA. 8Cardiovascular Division, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts, USA. 9Renal Division, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts, USA. 10Broad Institute of MIT and Harvard, Cambridge, Massachusetts, USA. 11School of Public Health, Boston University, Boston, Massachusetts, USA. 12Division of Endocrinology, Brigham and Women’s Hospital, Harvard Medical School, Boston, Massachusetts, USA. 13National Heart, Lung and Blood Institute Division of Intramural Research, Bethesda, Maryland, USA. 14Diabetes Unit and 15Center for Human Genetic Research, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts, USA. 16Department of Cardiology, Skåne University Hospital, Malmö, Sweden. 17Department of Clinical Sciences, Lund University, Malmö, Sweden. 18Alberta Diabetes Institute, Department of Pharmacology, University of Alberta, Edmonton, Alberta, Canada. 19Center of Emergency Medicine, Skåne University Hospital, Malmö, Sweden. Address correspondence to: Robert E. Gerszten, Cardiology Division and Cardiovascular Research Center, Massachusetts General Hospital, 185 Cambridge Street, Boston, Massachusetts 02114, USA. Phone: 617.724.8322; Fax: 617.643.3451; E-mail: rgerszten@partners.org. Or to: Thomas J. Wang, Division of Cardiovascular Medicine, Vanderbilt University Medical Center, 2220 Pierce Ave, 383 Preston Research Building, Nashville, Tennessee 37232-6300, USA. Phone: 615.936.1717; Fax: 615.936.2029; E-mail: thomas.j.wang@vanderbilt.edu. Authorship note: Thomas J. Wang, Debby Ngo, and Nikolaos Psychogios are co–first authors. Find articles by Wang, T. in: JCI | PubMed | Google Scholar Find articles by Ngo, D. in: JCI | PubMed | Google Scholar Find articles by Psychogios, N. in: JCI | PubMed | Google Scholar Find articles by Dejam, A. in: JCI | PubMed | Google Scholar Find articles by Larson, M. in: JCI | PubMed | Google Scholar Find articles by Vasan, R. in: JCI | PubMed | Google Scholar Find articles by Ghorbani, A. in: JCI | PubMed | Google Scholar Find articles by O’Sullivan, J. in: JCI | PubMed | Google Scholar Find articles by Cheng, S. in: JCI | PubMed | Google Scholar Find articles by Rhee, E. in: JCI | PubMed | Google Scholar Find articles by Sinha, S. in: JCI | PubMed | Google Scholar Find articles by McCabe, E. in: JCI | PubMed | Google Scholar Find articles by Fox, C. in: JCI | PubMed | Google Scholar Find articles by O’Donnell, C. in: JCI | PubMed | Google Scholar Find articles by Ho, J. in: JCI | PubMed | Google Scholar Find articles by Florez, J. in: JCI | PubMed | Google Scholar Find articles by Magnusson, M. in: JCI | PubMed | Google Scholar Find articles by Pierce, K. in: JCI | PubMed | Google Scholar Find articles by Souza, A. in: JCI | PubMed | Google Scholar Find articles by Yu, Y. in: JCI | PubMed | Google Scholar Find articles by Carter, C. in: JCI | PubMed | Google Scholar Find articles by Light, P. in: JCI | PubMed | Google Scholar Find articles by Melander, O. in: JCI | PubMed | Google Scholar Find articles by Clish, C. in: JCI | PubMed | Google Scholar Find articles by Gerszten, R. in: JCI | PubMed | Google Scholar First published September 16, 2013 - More info Published in Volume 123, Issue 10 on October 1, 2013 J Clin Invest. 2013;123(10):4309–4317. https://doi.org/10.1172/JCI64801. First published September 16, 2013 - Version history Received: January 11, 2013; Accepted: July 20, 2013 Improvements in metabolite-profiling techniques are providing increased breadth of coverage of the human metabolome and may highlight biomarkers and pathways in common diseases such as diabetes. Using a metabolomics platform that analyzes intermediary organic acids, purines, pyrimidines, and other compounds, we performed a nested case-control study of 188 individuals who developed diabetes and 188 propensity-matched controls from 2,422 normoglycemic participants followed for 12 years in the Framingham Heart Study. The metabolite 2-aminoadipic acid (2-AAA) was most strongly associated with the risk of developing diabetes. Individuals with 2-AAA concentrations in the top quartile had greater than a 4-fold risk of developing diabetes. Levels of 2-AAA were not well correlated with other metabolite biomarkers of diabetes, such as branched chain amino acids and aromatic amino acids, suggesting they report on a distinct pathophysiological pathway. In experimental studies, administration of 2-AAA lowered fasting plasma glucose levels in mice fed both standard chow and high-fat diets. Further, 2-AAA treatment enhanced insulin secretion from a pancreatic β cell line as well as murine and human islets. These data highlight a metabolite not previously associated with diabetes risk that is increased up to 12 years before the onset of overt disease. Our findings suggest that 2-AAA is a marker of diabetes risk and a potential modulator of glucose homeostasis in humans. The burden of type 2 diabetes mellitus (T2DM) is increasing, with an estimated 366 million cases worldwide. Given the availability of proven interventions for delaying or preventing diabetes, early identification of individuals at risk is a public health priority (1–4). Emerging technologies have enhanced the feasibility of acquiring detailed profiles of a human’s metabolic status (metabolite profiling, or metabolomics) (5–9). These techniques, which allow the assessment of large numbers of metabolites that are substrates and products in metabolic pathways, have the potential to identify biochemical changes before the onset of overt clinical disease. Ongoing improvements in metabolomics technologies now provide sufficient sample throughput to make studies of epidemiological cohorts more feasible (6–9). In an initial “proof-of-principle” study, we found that branched chain and aromatic amino acid concentrations had a significant association with future T2DM in individuals with normal glucose tolerance (8). We recently developed a liquid chromatography–tandem mass spectrometry (LC-MS/MS) method capable of profiling 70 intermediary organic acids, purines, pyrimidines, and other compounds that had not been assayed previously in our population-based studies (8, 9). Using this method, we sought to identify new metabolite biomarkers of diabetes risk in 2 large, epidemiologic cohorts with more than a decade of follow-up. We then studied the functional effects of the strongest metabolite predictor in cell-based and animal studies. 2-AAA predicts future diabetes in the Framingham Heart Study. Baseline clinical characteristics are shown in Table 1. Cases and controls were similar with respect to age, sex, BMI, and fasting glucose. From a screen of 70 metabolites, 2-aminoadipic acid (2-AAA) had the strongest association with future diabetes (P = 0.0009, with a higher fasting concentration in the cases). Results for all metabolites profiled are shown in Supplemental Table 1 (supplemental material available online with this article; doi: 10.1172/JCI64801DS1). Conditional logistic regression models were performed adjusting for age, sex, BMI, and fasting glucose (Table 2). Each SD increment in log marker was associated with a 60% increased odds of future diabetes (P = 0.002). Individuals in the top quartile of plasma 2-AAA concentration had a 4-fold higher odds of developing diabetes over the 12-year follow-up period compared with those in the lowest quartile (adjusted odds ratio 4.49, 95% CI, 1.86 to 10.89). Results were similar after further adjustment for parental history of diabetes, total caloric intake, and dietary protein, fat, or carbohydrates (data not shown). There was no interaction between follow-up year and the case-control difference for 2-AAA (P > 0.10), suggesting a stable association with new-onset diabetes during the follow-up period. The association with 2-AAA was similar in analyses restricted to diabetes cases diagnosed 8 or more years after the baseline examination. In this analysis, the odds ratio for individuals in the highest quartile of 2-AAA was 4.16 (95% CI, 1.26–13.8). 2-AAA and the risk of future diabetes 2-AAA is associated with insulin resistance and β cell function. Results for biochemical measures of insulin resistance and β cell function are shown in Supplemental Table 2. Fasting concentrations of 2-AAA were moderately correlated with fasting insulin (age- and sex-adjusted partial correlation, r = 0.25; P < 0.001), homeostasis model assessment of insulin resistance (HOMA-IR) (r = 0.24; P < 0.001), homeostasis model assessment of β cell function (HOMA-B) (r = 0.25, P < 0.001), and 2-hour glucose during oral glucose tolerance testing (r = 0.14; P = 0.006). Baseline concentrations of 2-AAA and hemoglobin A1c (HbA1c) were not significantly correlated (r = 0.05; P = 0.37), consistent with the nondiabetic status of all individuals at baseline. The association of 2-AAA levels and incident diabetes was unchanged even after adjusting for these measures of insulin resistance and β cell function (Table 3). There were also no significant associations between 2-AAA and dietary intake of fat, protein, carbohydrates, or lysine assessed using a food frequency questionnaire (ref. 10 and data not shown). Relation of 2-AAA levels to the risk of future diabetes, with adjustment for insulin measures Replication of the results. We performed replication studies in the Malmö Diet and Cancer Study (MDC). As in the Framingham Heart Study (FHS), concentrations of 2-AAA were significantly higher in cases compared with matched controls (P = 0.004; pooled P < 0.0001). There was a 57% increased odds of future diabetes per SD increment in 2-AAA (P = 0.004), nearly identical to that found in FHS (Table 2). Individuals in the top quartile had an adjusted odds for incident diabetes of 3.96 (95% CI, 1.63 to 9.59). Findings are not attenuated by amino acid biomarkers. Since we have previously demonstrated that elevated levels of branched chain (isoleucine, leucine, and valine) and aromatic amino acids (phenylalanine and tyrosine) are associated with future diabetes, we examined the relationship between 2-AAA and these metabolites. Concentrations of 2-AAA were poorly correlated with both the branched chain amino acids (r = 0.04 to 0.24) and aromatic amino acids (r = 0.01 to 0.13). Adjustment for amino acids did not substantially attenuate the association between 2-AAA and future diabetes risk in FHS or the MDC (data not shown). Relation with metabolites in other pathways. 2-AAA is generated by lysine degradation and may also serve as a substrate for enzymes downstream of tryptophan metabolism. Thus, we examined age- and sex-adjusted correlations between 2-AAA and selected metabolites in these pathways. Modest correlations were noted between 2-AAA and lysine (r = 0.38, P < 0.001), kynurenic acid (r = 0.19, P < 0.001), and anthranilic acid (r = 0.27, P < 0.001), though only 2-AAA predicted incident diabetes. Confirmation of the results in whole cohort analyses. The case-control analyses were enriched for individuals with “high-risk” features, such as obesity and elevated fasting glucose. Thus, to assess the generalizability of the results in a more heterogeneous cohort, we performed metabolomic profiling on an additional 1,561 randomly selected subjects from the FHS Offspring Study cohort. As expected, the individuals in the extended sample had a lower mean fasting glucose and BMI compared with the original case-control samples (shown in Table 1). In multivariable Cox regression analyses adjusted for age, sex, fasting glucose, and BMI, 2-AAA levels remained associated with future diabetes development (adjusted odds ratio 1.37 per SD increment, P = 0.0003; Table 4). The results were unchanged when models were further adjusted for estimated glomerular filtration rate. Model discrimination was assessed using the net reclassification improvement (NRI) and the C-statistic. The NRI was highly significant when comparing models with and without 2-AAA (0.36, 95% CI, 0.22 to 0.49; P < 0.0001). The increase in the C-statistic was modest (0.91 to 0.92, P = 0.11), largely due to the very high baseline value (11). Relation of 2-AAA levels to the risk of future diabetes in the whole sample and subgroups In the whole cohort sample, individuals with 2-AAA values in the highest quartile had an approximately 2-fold risk of developing diabetes compared with individuals in the lowest quartile (Supplemental Table 3). This risk was comparable to that observed in individuals with insulin and HbA1c values in the top quartile and lower than the risk observed for individuals in the top quartile of BMI or fasting glucose. Additional adjustment for the presence of prediabetes (defined as HbA1c 5.7%–6.4% or fasting glucose 100–125 mg/dl) did not alter the results, in either the FHS or the MDC samples. We also performed separate analyses in the subgroups of individuals without and with prediabetes (Table 4). Our findings in the FHS were similar in individuals without prediabetes (n = 781; multivariable-adjusted hazard ratio per SD increment, 1.56, 95% CI 1.04–2.35) and individuals with prediabetes (n = 696; 1.42, 1.18–1.70), indicating that the predictive value of 2-AAA was not restricted to individuals with prediabetes. In the MDC, near identical results were also obtained in both subsets (prediabetes: OR 1.93 [1.09–3.42] vs. without prediabetes: 1.82 [1.06–3.12]). Normative values for 2-AAA levels in the FHS cohort are detailed in Supplemental Table 4. Studies of 2-AAA in mice and tissues. We first examined the effects of a Western-style diet on circulating 2-AAA levels in mice. Animals fed a high-fat diet (HFD) had a 33% increase in baseline glucose concentrations and a 17% increase in insulin levels after 4 weeks. Circulating 2-AAA levels were 51% higher in animals on an HFD compared with those fed the standard chow diet (SCD) (n ≥ 11 mice per group, P = 0.01). Using an isotopically labeled standard and MS, we verified that the 2-AAA content was negligible in both the HFD and SCD (data not shown). We then determined whether 2-AAA might play a contributory or compensatory role in glucose homeostasis by performing 2-AAA intervention studies in mice. Four cohorts of 24 C57BL/6 male mice entered the study protocol at 6 weeks of age. Two cohorts received an SCD and 2 cohorts received an HFD. Half of the mice assigned to each diet received 2-AAA (500 mg/kg of body weight/d) via the drinking water for 5 weeks. Mice supplemented with 2-AAA had 33% higher plasma levels of this metabolite by 1 week of treatment (P = 0.018). We found consistently lower baseline fasting glucose levels in the 2-AAA–treated mice on both diets (P < 0.001 by 2-way ANOVA analysis after 5 weeks; Figure 1). For mice on the SCD, fasting glucose levels were 109.5 ± 3.8 mg/dl for the 2-AAA–treated animals as compared with 124.5 ± 4.9 mg/dl for the untreated controls after 5 weeks (P < 0.01, Figure 1). For mice challenged with an HFD, fasting glucose levels were higher and the differences due to 2-AAA treatment were accentuated (134.5 ± 5.9 vs. 153.0 ± 6.0 vs. mg/dl at 5 weeks; P < 0.01; Figure 1). There were no significant differences in food intake or weight between treated and control mice (Supplemental Figure 1). Fasting plasma glucose levels were measured weekly in mice fed either SCD (left) or HFD (right) beginning at 6 weeks of age, with simultaneous 2-AAA treatment via drinking water (500/mg/kg/d) or water alone for the subsequent 5 weeks (n = 24 mice per condition). *P < 0.05; **P < 0.01; ***P < 0.001. We also performed studies using acute physiologic challenges, including acute glucose and insulin administration. As expected, mice fed an HFD had more pronounced glucose excursions following the glucose challenge (Figure 2). In mice fed both the SCD and HFD for 5 weeks or more, peak glucose concentrations following the glucose challenge were lower in the 2-AAA–treated mice. We also observed increases in fasting insulin levels in the HFD animals as compared with the SCD controls (1.040 ± 0.203 vs. 0.411 ± 0.061 ng/ml, respectively; P = 0.013), which was further augmented by the administration of 2-AAA (Figure 3). Following acute insulin challenge, 2-AAA had no effect on the rate of decline in glucose levels (Supplemental Figure 2), indicating no difference in peripheral insulin sensitivity. Taken together, these findings highlight a role for 2-AAA in modulating glucose levels in vivo. 2-AAA treatment appears to augment circulating insulin concentrations without altering peripheral insulin resistance. IPGTTs were performed after completion of the 2-AAA chronic treatment in mice fed either the SCD or HFD (n = 12 mice per condition). *P < 0.05; **P < 0.01. Fasting plasma insulin was measured following completion of the 2-AAA treatment (5 weeks) in the mice on both diets (n = 12 mice per condition). *P < 0.05; **P < 0.01. To better understand the source of 2-AAA and the organ in which it might be playing a functional role, we used LC-MS/MS to measure 2-AAA levels in metabolically active tissue (muscle, liver, fat, and pancreas). We studied mice both at baseline and following the chronic administration of 2-AAA on either an SCD or an HFD. We used an isotopically labeled standard for our studies to facilitate absolute quantitation of the metabolite of interest in the setting of the different biological matrices. These studies demonstrated that 2-AAA was most abundant in the pancreas, though it was also present in all of the tissues tested in varying amounts. Furthermore, in the pancreas alone, we documented higher 2-AAA levels following the administration of the HFD as compared with SCD (49.31 ± 5.75 vs. 35.54 ± 2.54 nmol/g tissue, P < 0.05), as well as a striking increase in 2-AAA levels following 2-AAA administration (SCD control vs. SCD treated: 35.54 ± 2.54 vs. 69.4 ± 5.66 nmol/g tissue, P < 0.001; HFD control vs. HFD treated: 49.31 ± 5.75 vs. 115.88 ± 18.57 nmol/g tissue, P < 0.002; Figure 4). 2-AAA levels in liver, muscle, fat, and pancreas were measured using an isotopically labeled standard (see Methods). 2-AAA levels were increased following the administration of the HFD as compared with the SCD and further augmented following 2-AAA administration (n = 12 per condition). *P < 0.05; **P < 0.01; ***P < 0.001. These findings suggested a connection between 2-AAA and the pancreas. Thus, we studied insulin production by a pancreatic β cell line that was acutely and chronically exposed to 2-AAA. 2-AAA induced insulin secretion from BTC6 cells in a dose- and time-dependent fashion at both 2.5 mM ambient glucose concentration during the incubation period (Figure 5A), and 5 mM ambient glucose concentration (Supplemental Figure 3). The concentrations used to elicit secretion were in the physiologic range. By way of comparison, clonidine (a known inhibitor of insulin secretion) decreased insulin levels to 60% ± 3% of control and phentolamine (a known potent stimulator) increased insulin secretion to 172% ± 8% of control, which was comparable to the peak secretion triggered by 2-AAA (Figure 5B). Glutamate and aspartate, acidic amino acids with some structural similarity to 2-AAA, did not augment insulin secretion in BTC6 cells, highlighting the specificity of the 2-AAA effect in vitro (Figure 5B). 2-AAA stimulated insulin secretion in BTC6 and islet cell systems. (A) BTC6 cells were incubated with 2-AAA at concentrations ranging from 0 to 100 μM for 0.5 to 72 hours to assess whether this compound increases insulin secretion in a time and/or dose dependent fashion. (B) We then compared the extent of 2-AAA–stimulated (30 μM) insulin secretion to the effects of clonidine (100 μM) and phentolamine (100 μM), which inhibit and stimulate insulin secretion in islet cells, respectively. Glutamate (30 μM) and aspartate (30 μM) did not elicit insulin secretion over baseline. (C) 2-AAA also augments insulin secretion in primary murine islets and human islets at a basal glucose concentration (2.5 mmol/l). This 2-AAA augmentation effect observed on insulin secretion is reduced in the presence of an insulin stimulatory glucose concentration (11.1 mmol/l). Insulin secretion is normalized to total intracellular insulin content. Data from n = 3 replicates of 15 murine islets or 25 human islets are shown. *P < 0.05; **P < 0.01; ***P < 0.001. To further examine the physiologic relevance of our findings, we performed similar experiments on isolated primary murine islets. Consistent with the findings in the cell line, 30 μM 2-AAA augmented insulin secretion in murine islets under low glucose (2.5 mmol/l) conditions (2-AAA vs. control: 2.8% ± 0.1% vs. 1.5% ± 0.1% of total insulin content, P = 0.02, n = 3, Figure 5C). Under high glucose (11.1 mmol/l) conditions, the effect of 2-AAA was attenuated (n = 3). Of note, there was no increase in insulin content in the intact islets as a result of 2-AAA incubation, arguing against de novo insulin synthesis as a mechanism of increased 2-AAA–induced insulin secretion. While these studies on BTC6 cells and isolated murine islets strongly indicate a direct effect of 2-AAA on insulin secretion, it is also important to determine whether 2-AAA directly stimulates insulin secretion from human islets. In this system, 30 μM 2-AAA significantly increased insulin secretion under low glucose conditions (2.5 mmol/l) when compared with control (2.6% ± 0.4% vs. 1.3% ± 0.1% of total insulin content, P = 0.005, n = 3, Figure 5C), though the augmentation was again less prominent under high glucose conditions (11.1 mmol/l; n = 3). These observations suggest that during periods of low (basal) plasma glucose, elevated 2-AAA levels may be sufficient to induce insulin release. This signal is attenuated as the physiological glucose stimulus becomes more dominant. In summary, we identified a metabolite biomarker (2-AAA) that predicts the development of diabetes in normoglycemic individuals. Individuals with high plasma 2-AAA concentrations had up to a 4-fold risk of future diabetes, a finding observed in 2 independent cohorts. Follow-up experiments provide evidence that this small molecule may modulate glucose homeostasis in vivo, while in vitro studies support an effect of 2-AAA on insulin secretion in a pancreatic β cell line and in isolated islets. Taken together, our findings highlight a pathway not previously associated with glucose homeostasis and suggest a new metabolic marker that could aid in diabetes risk assessment. An important strength of the current investigation is the use of 2 well-characterized longitudinal cohorts with long follow-up periods. All individuals in our study were free of diabetes at the time the blood samples were collected, minimizing potential confounding from medical or lifestyle interventions. Indeed, we found that circulating 2-AAA was elevated many years before the onset of diabetes. Furthermore, the relative risk associated with elevated 2-AAA concentrations was not attenuated by adjustment for standard biochemical measures of insulin resistance in the fasting state or for branched chain and aromatic amino acids, previously validated risk predictors for diabetes. We also found no evidence that differences in 2-AAA levels in cases and controls were attributable to differences in renal function. However, because we lacked concurrent urine samples, we were not able to measure the fractional clearance of 2-AAA directly. 2-AAA is a poorly characterized product of lysine degradation. The ε-amino group of lysine residues in proteins can undergo deamination by metal-catalyzed oxidation to form the intermediate allysine, which in turn undergoes further oxidation to form 2-AAA (12). 2-AAA may appear in the circulation from degradation of whole tissue or plasma proteins. Alternatively, 2-AAA might be generated from circulating lysine by some unknown enzymatic pathway. Previous studies of 2-AAA in humans are limited. It has been reported that 2-AAA levels are elevated in acid hydrolysates of processed skin from older individuals with diabetes, and this group has postulated that 2-AAA may be part of a carbonyl stress pathway in diabetes (13, 14). To our knowledge, no prior studies have documented the presence of elevated circulating plasma levels of this metabolite in individuals before the onset of overt disease. Tsutsui and colleagues (15) previously performed metabolite profiling in obese ddY mice and observed increased peak areas corresponding to 2-AAA and other lysine pathway metabolites in obese mice as compared with controls, though only semiquantitative analyses were performed. One other study has documented increased concentrations of 2-AAA in Zucker diabetic rats (16). Our experimental findings extend this prior work by demonstrating higher 2-AAA levels in hyperinsulinemic mice fed an HFD. Furthermore, we demonstrate that administration of this small molecule to mice leads to a reproducible decrease in fasting glucose levels in the setting of multiple physiologic challenges. Metabolite profiling studies of tissues highlighted the pancreas as a potential organ of action for 2-AAA, and in vitro studies suggest that chronic administration of the metabolite increases β cell insulin secretion. The development of impaired glucose tolerance (IGT) and T2DM is characterized by decreased insulin sensitivity with an initial compensatory upregulation of insulin secretion. IGT and T2DM result when insulin secretion can no longer compensate (17). Recent studies by multiple groups have highlighted a hyperaminoacidemia in prediabetes, a finding that was originally described by Felig and colleagues (18). Elevated circulating levels of amino acids in prediabetes may be secondary to increased dietary intake and/or related to decreased uptake of amino acids by skeletal muscle in the setting of insulin resistance (19, 20). Branched chain amino acids have particularly pleiotropic effects, serving as insulin secretagogues (21), and may also further modulate peripheral insulin sensitivity themselves via activation of the mTOR and p70S6 kinase pathways (22, 23). 2-AAA is endogenously produced, and levels may be augmented as a compensatory response to the hyperglycemia induced by an HFD, for example. In turn, 2-AAA augments insulin secretion in cell-based, islet, and animal model systems. Thus, we hypothesize that this particular amino acid breakdown product contributes to a compensatory mechanism by which insulin secretion is upregulated to maintain glucose homeostasis in early insulin resistance. Accordingly, 2-AAA conveys information that is not reflected by conventional insulin resistance markers. Of note, we have also investigated other potential physiologic effects of 2-AAA, though we found no consistent effects on gluconeogenesis in H4IIE hepatoma cells or glucose uptake by L6 myocyte cells (data not shown). Treatment with 2-AAA had no effect on peripheral insulin sensitivity in mice as demonstrated by insulin tolerance tests (ITTs). In addition, there was no evidence that supplementation resulted in reduced food intake or reduced obesity to explain its effect on fasting glucose levels. We pursued the 2-AAA finding in the replication cohort and mechanistic studies because it demonstrated the strongest initial association with incident DM (P = 0.0009). Though the initial FHS p-value exceeded a strict Bonferroni threshold (P < 0.0007), we successfully replicated our findings in an independent cohort and the final P-value (P < 0.0001) was well below the Bonferroni threshold. We used a “targeted” approach that couples liquid chromatography with a triple quadrupole tandem mass spectrometer (LC-MS/MS). This methodology provides unambiguous identification of analytes and the ability to quantify absolute analyte concentrations. The platform used for the present study was optimized to detect small molecules that preferentially ionize using negative mode electrospray ionization, including intermediary organic acids, purines, pyrimidines, and other compounds. The purpose of this approach was to provide coverage of metabolites not amenable to previously described approaches (8, 9), though limited coverage of the human metabolome remains a limitation of our studies. In conclusion, the application of a new metabolite profiling technique highlighting intermediary metabolites identified 2-AAA as a novel predictor of the development of diabetes. The relative risk associated with elevated 2-AAA concentrations was not attenuated by adjustment for standard biochemical measures of insulin resistance. This investigation provides motivation to test whether plasma measurements of this molecule might help identify candidates for interventions to reduce diabetes risk and to elucidate the precise molecular pathways by which 2-AAA modulates insulin secretion, glucose homeostasis, and susceptibility to diabetes. Study samples Plasma samples were obtained from 2 cohorts. The discovery analyses were performed on individuals from the FHS Offspring Study, which was initiated in 1971 when 5,124 individuals enrolled into this longitudinal cohort study (24). Samples came from the fifth examination, which occurred between 1991 and 1995. Metabolite profiling was performed on samples from 1,937 attendees who were free of diabetes at baseline (376 propensity-matched cases and controls and 1,561 randomly selected individuals). The replication analyses were performed in the MDC, a Swedish population-based cohort of 28,449 persons enrolled between 1991 and 1996. From the cohort, 6,103 persons were randomly selected to participate in the MDC Cardiovascular Cohort (25). Fasting plasma samples were obtained from 5,305 subjects in the MDC Cardiovascular Cohort, of whom 564 had prevalent diabetes or cardiovascular disease prior to baseline. Of note, 456 subjects had missing covariate data, leaving 4,285 subjects eligible for analysis. Detailed descriptions of the clinical assessment, diabetes definition, and subject selection have been previously described (8). Metabolite profiling We employed a methodology similar to our reported technique for profiling polar plasma metabolites using hydrophilic interaction LC (HILIC) and LC-MS (8), though for this analysis we focused on small molecules preferentially ionized using negative mode electrospray ionization under basic conditions. Data were acquired using an ACQUITY UPLC (Waters) coupled to a 5500 QTRAP triple quadrupole mass spectrometer (AB SCIEX). To develop the method, we determined chromatographic retention times and multiple reaction monitoring (MRM) MS settings for more than 150 reference compounds, of which 70 could be detected in human plasma in the archived FHS samples. Of the 70 metabolites, 41 were detectable in more than 99% of the human samples. Samples were prepared by the addition of 120 μl of extraction solution (80% methanol [VWR] plus the internal standards inosine-15N4, thymine-d4, and glycocholate-d4; Cambridge Isotope Laboratories) to 30 μl of plasma. The samples were centrifuged (10 minutes, 9,000 g, 4°C), and the supernatants were injected directly onto a 150 × 2.0 mm Luna NH2 column (Phenomenex) that was eluted at a flow rate of 400 μl/min with initial conditions of 10% mobile phase A (20 mM ammonium acetate and 20 mM ammonium hydroxide [Sigma-Aldrich] in water [VWR]) and 90% mobile phase B (10 mM ammonium hydroxide in 75:25 vol/vol acetonitrile/methanol [VWR]) followed by a 10-minute linear gradient to 100% mobile phase A. The ion spray voltage was –4.5 kV, and the source temperature was 500°C. Raw data were processed using MultiQuant 1.2 (AB SCIEX). Data were normalized relative to pooled plasma reference samples that were analyzed in the sample queue after sets of 20 study samples. We performed additional studies with an isotope-labeled reference compound for 2-AAA (d3; C/D/N Isotopes Inc.), the novel biomarker identified. We demonstrated that peak areas were greater than 2 orders of magnitude above the lower limit of quantitation (as defined as a discrete peak 10-fold greater than noise) and fell well within the linear range of the dose-response relationship (representative data are provided in Supplemental Figure 4). We determined the median level for 2-AAA in the FHS control population using these data. No quantitative findings in other human populations are available for comparison. C57BL/6 male mice (Jackson Laboratories) were housed in separate cages with free access to food and water. Mice were fed an SCD containing 22.5% protein, 52% carbohydrates, 6% fat, 6% ash, and 4% fiber (Prolab Isopro RMH 3000) or an HFD containing 20 kcal% protein, 20 kcal% carbohydrate and 60 kcal% fat (DIO formula, D12492; Research Diets Inc.) as indicated. The total energy equivalent was 3.46 kcal/gm for the SCD and 5.24 kcal/gm for the HFD. For studies testing the role of 2-AAA on glucose homeostasis, 4 independent cohorts of 24 mice entered the study protocol. Two cohorts received the SCD and 2 cohorts received an HFD. Half of the mice assigned to each diet received 2-AAA (500 mg/kg/d equivalent to a starting dose of 12.03 ± 0.30 mM) via the drinking water for up to 5 weeks. Preweighed food and water was administered to each cage. Food and water intake were monitored weekly. Fasting insulin levels in mice were measured by an ELISA kit (Crystal Chem Inc.). After 5 weeks of 2-AAA treatment, and following a 6-hour fast, each group of mice was administered an intraperitoneal glucose tolerance test (IPGTT); 1.5 mg/g of body weight; 75 mg/ml of glucose solution or an ITT; 0.00075 U of insulin/g of body weight, 0.15 U/ml insulin solution (Sigma-Aldrich). For the IPGTT, venous blood samples were obtained from the tail vein immediately prior to glucose injection and then serially at 30, 60, and 120 minutes following the injection. For the ITT, venous blood samples were obtained from the tail vein immediately prior to the insulin injection and then serially at 15, 30, 45, and 60 minutes following the injection. Upon study completion, tissues were harvested for metabolite profiling analysis. For homogenization of liver and pancreas, 25 mg of tissue sample were mixed with 250 μl of a 50:50 methanol/water solution. For the skeletal muscle, 25 mg of tissue was mixed with 250 μl of HPLC water (J.T. Baker). All tissue samples were then homogenized for 4 minutes at 25 Hz in a TissueLyser II (QIAGEN). 200 μl of the resulting homogenates were extracted following a modified Bligh-Dyer method (17), and the resulting aqueous phase was dried down and reconstituted in methanol containing labeled isotope standards (L-phenylalanine-d8 and L-valine-d8) as performed with the plasma samples. For the perigonadal adipose tissue, metabolites were first extracted by mixing harvested tissues with 6 μl per 1 mg of adipose tissue of a methanol/chloroform solution (2:1 vol/vol). The extracted adipose tissues were then homogenized for 4 minutes at 25 Hz in a TissueLyser II. The resulting homogenates were mixed with chloroform and water (2 μl per 1 mg of adipose tissue for each solvent) and centrifuged at 10,000 g for 20 minutes at 4°C. The upper aqueous layers were dried down and reconstituted in a methanol solution containing labeled standards (L-phenylalanine-d8 and L-valine-d8), as previously described (26). A calibration curve using 2-AAA d3 (C/D/N Isotopes Inc.) was generated for absolute quantitation of 2-AAA in plasma and tissue samples. LC-MS/MS analyses were then performed using the same methodology as described above for human plasma. Insulin secretion experiments BTC6 cells. These cells are an established model to examine insulin secretion. BTC6 cells were used at passage number 4–7, grown in DMEM (2002-30; ATCC), 15% FBS, with penicillin/streptomycin (100 IU/ml/100 μg/ml). Cells were plated on 24-well collagen plates at 40,000 cells per well and incubated with 2-AAA at varying concentrations ranging from 0 to 100 μM for 0 to 72 hours. On the day of experimentation, the cells were washed with PBS and the medium was changed to DMEM without FBS or glucose to which 0.1% BSA was added. After 1 hour of incubation, this medium was changed to serum-free medium containing 2.5 mM or 5.0 mM glucose, as indicated. Insulin production was measured in the supernatant after 1 additional hour of incubation. To assess the time response relationship, 2-AAA was added to the cells after plating on collagen and incubated for 0.5, 2, 6, and 72 hours. Murine islets. We also performed studies in murine islets isolated from male C57BL/6J mice as previously reported (27). Islets were obtained by collagenase digestion of the pancreas, purified by Ficoll density gradient, handpicked, and then cultured for 24 hours. For insulin secretion experiments, 15 islets were placed in each microcentrifuge tube and incubated in islet secretion buffer containing 120 mmol/l NaCl, 5 mmol/l KCl, 1 mmol/l CaCl2, 1.2 mmol/l MgCl2, 24 mmol/l NaHCO3, 10 mmol/l HEPES, and 2.5 mmol/l glucose, bubbled with 95% O2/5% CO2 and supplemented with 0.5% (wt/vol) BSA. Experiments were performed by incubating islets in 1 ml of secretion buffer containing either 2.5 or 11.1 mmol/l glucose in the presence or absence of 30 μM 2-AAA for 6 hours at 37°C, 5% CO2, similar to the conditions for the BTC6 cells. Insulin was assayed using the Meso Scale Discovery Multi-Array Assay System for mouse/rat total insulin. Secretion was normalized to islet insulin content. Human islets. Human islets were provided by the Clinical Islet Transplant Program (University of Alberta) and isolated from cadaveric pancreases with appropriate donor consent using similar procedures as described for murine islets. For insulin secretion assays, 25 human islets were placed in each microcentrifuge tube and incubated in islet secretion buffer containing 120 mmol/l NaCl, 5 mmol/l KCl, 1 mmol/l CaCl2, 1.2 mmol/l MgCl2, 24 mmol/l NaHCO3, 10 mmol/l HEPES, and 2.8 mmol/l glucose, bubbled with 95% O2/5% CO2 and supplemented with 0.5% (wt/vol) BSA. Experiments were performed by incubating islets in 1 ml of secretion buffer in the presence or absence of 30 μM 2-AAA containing either 2.5 or 11.1 mmol/l glucose for 1 hour at 37°C, 5% CO2. Insulin was assayed using the Meso Scale Discovery Multi-Array Assay System for human insulin. Secretion was normalized to islet insulin content. For human studies, metabolite concentrations were log transformed to reduce heteroscedasticity of case-control differences. Initially, cases were compared with propensity-matched controls using paired t tests. We considered metabolite findings with a P value of less than 0.01 to take to replication analyses. We performed conditional (matched pairs) logistic regression analyses relating baseline metabolite values to future diabetes risk. Metabolites were treated as continuous and as categorical variables. We adjusted for age, sex, BMI, and fasting glucose. In additional analyses, we further adjusted for parental history, serum triglycerides, HDL cholesterol, hypertension, intake of dietary protein, amino acids, and total calories. Subgroup analyses were performed in individuals with and without prediabetes, defined as HbA1c 5.7%–6.4% or fasting glucose 100–125 mg/dl; classification of prediabetes status was not related to the case-control designation, which was based solely on whether the participant developed overt diabetes after the baseline examination. A Bonferroni-corrected P value threshold of 7 × 10–4 (= 0.05/70) was used to denote significance in the pooled analyses. For assessment of model discrimination, we used the C-statistic and NRI, as previously described (11). We calculated Pearson correlations between metabolite concentrations and other biochemical measures of insulin action: fasting insulin, HOMA-IR and HOMA-B (28). We then assessed whether metabolite concentrations predicted risk incrementally over these other biochemical measures. All analyses in the human cohorts were performed using SAS Statistical Software (version 9.3). For the animal studies, all data are expressed as means with error bars showing SEM. Comparison of end points was performed using an unpaired 2-tailed Student’s t test. For the time-course studies, 1-way ANOVA with repeated measurements was used. P < 0.05 was considered significant. For the cell culture studies, the 2-AAA dose response was evaluated by an unpaired 1-way ANOVA using Dunnet’s multiple comparison test to determine the level of significance of individual 2-AAA doses. An unpaired t test using Welch correction for unequal variances was used to compare differences between control versus metabolite treated cells. P < 0.05 was considered significant. All analyses for the animal and cell culture studies were performed using GraphPad Prism (v. 5.02). Study approval The human study protocols for metabolite profiling were approved by the Institutional Review Boards of Boston University Medical Center, Massachusetts General Hospital, and Lund University, and all participants provided written informed consent. All animal experiments were approved by the Subcommittee on Research Animal Care at the Massachusetts General Hospital. This work was supported by NIH contract NO1-HC-25195, R01-DK-HL081572, the Leducq Foundation, the Canadian Institutes of Health Research, and the American Heart Association. P.E. Light received research funding as the holder of the Dr. Charles A. Allard Chair in Diabetes Research. Conflict of interest: R.E. Gerszten, R.S. Vasan, M.G. Larson, and T.J. Wang are named as coinventors on a patent application relating to amino acid predictors of diabetes. J.C. Florez has received consulting honoraria from Novartis, Lilly, and Pfizer. P.E. Light has received consulting honoraria from Merck. Reference information: J Clin Invest. 2013;123(10):4309–4317. doi:10.1172/JCI64801. Thomas J. Wang’s present address is: Division of Cardiovascular Medicine, Vanderbilt University, Nashville, Tennessee, USA. Pan XR, et al. Effects of diet and exercise in preventing NIDDM in people with impaired glucose tolerance. The Da Qing IGT and Diabetes Study. Diabetes Care. 1997;20(4):537–544. Tuomilehto J, et al. Prevention of type 2 diabetes mellitus by changes in lifestyle among subjects with impaired glucose tolerance. N Engl J Med. 2001;344(18):1343–1350. Knowler WC, et al. Reduction in the incidence of type 2 diabetes with lifestyle intervention or metformin. N Engl J Med. 2002;346(6):393–403. Gerstein HC, et al. Effect of rosiglitazone on the frequency of diabetes in patients with impaired glucose tolerance or impaired fasting glucose: a randomised controlled trial. Lancet. 2006;368(9541):1096–1105. Gieger C, et al. Genetics meets metabolomics: a genome-wide association study of metabolite profiles in human serum. PLoS Genet. 2008;4(11):e1000282. Suhre K, et al. Metabolic footprint of diabetes: a multiplatform metabolomics study in an epidemiological setting. PLoS One. 2010;5(11):e13953. Suhre K, et al. Human metabolic individuality in biomedical and pharmaceutical research. Nature. 2011;477(7362):54–60. Wang TJ, et al. Metabolite profiles and the risk of developing diabetes. Nat Med. 2011;17(4):448–453. Rhee EP, et al. Lipid profiling identifies a triacylglycerol signature of insulin resistance and improves diabetes prediction in humans. J Clin Invest. 2011;121(4):1402–1411. Rimm EB, Giovannucci EL, Stampfer MJ, Colditz GA, Litin LB, Willett WC. Reproducibility and validity of an expanded self-administered semiquantitative food frequency questionnaire among male health professionals. Am J Epidemiol. 1992;135(10):1114–1126. Pencina MJ, D’Agostino RB, D’Agostino RB, Vasan RS. Evaluating the added predictive ability of a new marker: from area under the ROC curve to reclassification and beyond. Stat Med. 2008;27(2):157–172. Requena JR, Chao CC, Levine RL, Stadtman ER. Glutamic and aminoadipic semialdehydes are the main carbonyl products of metal-catalyzed oxidation of proteins. Proc Natl Acad Sci U S A. 2001;98(1):69–74. Fan X, et al. Mechanism of lysine oxidation in human lens crystallins during aging and in diabetes. J Biol Chem. 2009;284(50):34618–34627. Sell DR, Strauch CM, Shen W, Monnier VM. 2-aminoadipic acid is a marker of protein carbonyl oxidation in the aging human skin: effects of diabetes, renal failure and sepsis. Biochem J. 2007;404(2):269–277. Tsutsui H, et al. Practical analytical approach for the identification of biomarker candidates in prediabetic state based upon metabonomic study by ultraperformance liquid chromatography coupled to electrospray ionization time-of-flight mass spectrometry. J Proteome Res. 2010;9(8):3912–3922. Wijekoon EP, Skinner C, Brosnan ME, Brosnan JT. Amino acid metabolism in the Zucker diabetic fatty rat: effects of insulin resistance and of type 2 diabetes. Can J Physiol Pharmacol. 2004;82(7):506–514. Weyer C, Bogardus C, Mott DM, Pratley RE. The natural history of insulin secretory dysfunction and insulin resistance in the pathogenesis of type 2 diabetes mellitus. J Clin Invest. 1999;104(6):787–794. Felig P, Marliss E, Cahill GF. Plasma amino acid levels and insulin secretion in obesity. N Engl J Med. 1969;281(15):811–816. Wahren J, Felig P, Cerasi E, Luft R. Splanchnic and peripheral glucose and amino acid metabolism in diabetes mellitus. J Clin Invest. 1972;51(7):1870–1878. Wahren J, Felig P, Hagenfeldt L. Effect of protein ingestion on splanchnic and leg metabolism in normal man and in patients with diabetes mellitus. J Clin Invest. 1976;57(4):987–999. Liu Z, Jeppesen PB, Gregersen S, Chen X, Hermansen K. Dose- and glucose-dependent effects of amino acids on insulin secretion from isolated mouse islets and clonal INS-1E β-cells. Rev Diabet Stud. 2008;5(4):232–244. Um SH, D’Alessio D, Thomas G. Nutrient overload, insulin resistance, and ribosomal protein S6 kinase 1, S6K1. Cell Metab. 2006;3(6):393–402. Newgard CB, et al. A branched-chain amino acid-related metabolic signature that differentiates obese and lean humans and contributes to insulin resistance. Cell Metab. 2009;9(4):311–326. Kannel WB, Feinleib M, McNamara PM, Garrison RJ, Castelli WP. An investigation of coronary heart disease in families. The Framingham offspring study. Am J Epidemiol. 1979;110(3):281–290. Persson M, Hedblad B, Nelson JJ, Berglund G. Elevated Lp-PLA2 levels add prognostic information to the metabolic syndrome on incidence of cardiovascular events among middle-aged nondiabetic subjects. Arterioscler Thromb Vasc Biol. 2007;27(6):1411–1416. Roberts LD, Souza AL, Gerszten RE, Clish CB. Targeted metabolomics. Curr Protoc Mol Biol. 2012;Chapter 30:Unit 30.2.1–30.2.24. Hamming KS, et al. Inhibition of beta-cell sodium-calcium exchange enhances glucose-dependent elevations in cytoplasmic calcium and insulin secretion. Diabetes. 2010;59(7):1686–1693. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis model assessment: insulinresistance and beta cellfunctionfromfasting plasma glucose and insulin concentrations in man. Diabetologia. 1985;28(7):412–419. Version 1 (September 16, 2013): No description Version 2 (October 1, 2013): No description
cc/2020-05/en_middle_0087.json.gz/line1338110
__label__cc
0.608836
0.391164
", "request_appointment_url": "http://hillman.upmc.com/difference/contact-us", "tags": "brain surgery,fluorescent-guided imaging,surgery,treatment of brain cancers,tumor", "behav_cats": "concerned", "primary_behav_cat": "care", "additional_input_tagging": "", "Personalization Category": "cancer-care-con", "personalization_category": "cancer-care-con", "personalization_script_category": "Cancer Care", "HasPersonalizedContent": "false", "url": "https://share.upmc.com/2018/09/what-is-awake-craniotomy/", "image_link": "https://share-cdn-prod.azureedge.net/wp-content/uploads/2018/05/Awake-craniotomy.jpg", "image_link_list": "https://share-cdn-prod.azureedge.net/wp-content/uploads/2018/05/Awake-craniotomy-330x141.jpg", "image_link_hero": "https://share-cdn-prod.azureedge.net/wp-content/uploads/2018/05/Awake-craniotomy.jpg", "Available": "Y", "Emphasized": "N", "ReleaseDate": "2018-09-25 09:00:08", "PublicationDate": "2018-09-25 09:00:08", "ContentSeason": "", "ExcludeReco": "false", "excludePersonalization": "false", }; console.info('TrackingJSON Object', TrackingJSON); console.info('PRIMARY CATEGORY', TrackingJSON.primary_category); console.info('PRIMARY CATEGORY RAW', TrackingJSON.primary_category_RAW, TrackingJSON.request_appointment_url); console.info('ExcludeReco', TrackingJSON.ExcludeReco); console.info('excludePersonalization', TrackingJSON.excludePersonalization); Awake Brain Surgery Helps Surgeons Remove Tumors in Sensitive Areas Imagine having a surgeon cut into your skull while you are wide awake. Sounds like the stuff of fiction—and yet awake surgery is allowing doctors to remove complex tumors in some of the brain’s most sensitive areas. Awake craniotomy—or brain surgery done while the patient is awake—has been around for more than 50 years, but only a handful of medical centers around the country have the expertise to perform such surgery on a routine basis UPMC has been a leader in awake craniotomy. In fact, about 20 percent of all brain cancer surgeries performed by neurosurgical oncologists at UPMC are done while the patient is awake. UPMC neurosurgeons have developed an awake craniotomy model that includes advanced imaging techniques to allow aggressive surgical treatment of brain cancers while preserving critical brain function, and they perform more than 60 of these surgeries each year. How Awake Craniotomy Works “The most important surgical principle when removing brain cancers is to provide the maximum safe resection,” says Nduka Amankulor, MD, a specialist in the surgical treatment of complex brain and spine tumors at UPMC’s Department of Neurological Surgery. “We come to the very limit of brain tumor surgery with many cases. Remove any more tumor and we’d hurt the patient; remove any less, and we’d leave residual tumor that could have been resected.” Knowing where that fine line is takes a multimodal imaging approach. Dr. Amankulor uses fluorescent-guided imaging and intraoperative ultrasound techniques to visualize the tumor prior to removing it. “We inject a fluorescent marker that causes the tumor to light up while we are removing it,” he says. “And simultaneously, while the patient is awake, we stimulate the patient’s brain to identify and map the critical areas of language, motor function, and sensory function so we don’t damage them.” A sophisticated anesthesiology team makes sure the patient does not feel any pain throughout the surgery and neurophysiologists conduct advanced neurophysiological monitoring to report critical changes in brain function to ensure that brain stimulation does not induce seizures. “Awake craniotomies are fascinating in part because the patient becomes part of the surgical team; they can participate and help us by providing constant feedback on their neurological function,” he says. This approach allows Dr. Amankulor to operate on brain tumors in locations that many surgeons might deem inoperable, enabling the team to offer this surgery to patients who need it. This combination of advanced imaging tools and surgical expertise provides a better chance that tumors can be completely removed. In addition to the surgery, Dr. Amankulor emphasizes that brain tumor treatment relies on concurrent research using tissue obtained from each surgery. Lung CancerLung Cancer 101: The Facts and Figures You Need to Know Cancer CareThe Value of Taking Part in a Clinical Trial Gynecologic CancerCervical Cancer: Advances in Treatment and Prevention Beyond Surgery: Treating Recurrent Brain Tumors “Brain tumor treatment is more than just doing surgery—it includes all the research behind decision-making for each patient, including research that spurs development of clinical trials,” says Dr. Amankulor. “We study these tumors in the laboratory and use that information to design new trials with innovative drugs for use after surgery.” Because brain tumors often come back, the team has used tumor samples from their surgeries to develop new therapies to treat recurrent brain tumors. This research recently led to the design of a clinical trial of an FDA-approved drug that targets a subset of brain cancers and has shown good early success. How do patients react when Dr. Amakulor recommends awake craniotomy? Surprisingly well, he says. “The majority of my patients say, ‘Let’s do this!’ when they understand the rationale for surgery, and most of those who undergo the surgery do very well,” he adds. “Half of my patients say they’ve seen the surgery on ‘Grey’s Anatomy’ on TV!” brain surgery | fluorescent-guided imaging | surgery | treatment of brain cancers | tumor
cc/2020-05/en_middle_0087.json.gz/line1338116
__label__cc
0.655968
0.344032
Articles+ start Subject "Arab countries Economic conditions." Remove constraint Subject: "Arab countries Economic conditions." Source type Magazines Remove constraint Source type: Magazines Academic Journals459 Magazines[remove]288 Conference Materials62 Electronic Resources18 Dissertations1 Non-Print Resources1 arabic53 undetermined9 arab countries -- economic conditions178 economic development26 arab spring uprisings, 2011-19 arab countries -- politics & government15 petroleum industry14 gulf cooperation council13 economic indicators12 international trade12 charts, diagrams, etc.11 infrastructure (economics)10 unemployment10 conferences & conventions8 arab countries7 economics -- periodicals.7 petroleum product sales & prices7 arab countries -- politics & government -- 1945-6 economic history.6 foreign investments6 petroleum sales & prices6 stock exchanges6 corporate finance5 economic forecasting5 high technology industries5 international finance5 internet bookstores5 middle east-united states relations5 new business enterprises5 periodicals.5 petroleum reserves5 real property5 tax havens5 arab countries -- economic policy4 arab countries -- social conditions4 arabs4 asset forfeiture4 authoritarianism4 budget deficits4 business planning4 construction projects4 economic conditions in africa4 economic reform4 educational attainment4 egypt -- politics & government -- 2011-4 failed states4 finance -- arab countries -- periodicals.4 financial crises4 arab countries72 arab countries -- economic conditions -- periodicals.64 dubai (united arab emirates)6 arab countries -- economic conditions -- periodicals4 arab countries -- politics and government -- 1945- -- periodicals4 meed: middle east economic digest44 economist36 middle east10 new republic8 foreign affairs7 bloomberg businessweek6 middle east executive reports6 mit technology review5 national geographic5 finance & development4 foreign policy4 newsweek (atlantic edition)4 newsweek (pacific edition)4 banker middle east3 businessweek online3 forbes.com3 fraser forum3 iba global insight3 time magazine3 u.s. news & world report3 washington report on middle east affairs3 african business2 atlantic (01606506)2 business week (journal collection (h.w. wilson))2 earth negotiations bulletin2 iese insight2 internationale politik2 library journal2 new yorker2 wilson quarterly2 world press review2 atlantic1 international policy digest1 middle east intelligence bulletin1 new york review of books1 newsweek1 prospect1 vital speeches of the day1 world education news & reviews1 world today1 meed media fz llc44 economist newspaper limited36 tme media 21 limited10 bloomberg, l.p.9 forbes inc.9 newsweek llc8 tnr ii, llc8 middle east executive reports, ltd.6 al-amanah al-ʻammah lil-ittihad al-ʻamm li-ghuraf al-tijarah wa-al-sinaʻah wa-al-ziraʻah lil-bilad al-ʻarabiyah5 international monetary fund4 national geographic partners llc4 american educational trust3 fraser institute3 international bar association3 syndigate media inc.3 time usa, llc3 us news & world report, l.p.3 [s.n.]2 atlantic media inc.2 conde nast publications2 deutsche gesellschaft fur auswartige politik e.v. (dgap)2 escwa2 hww temp2 ic publications ltd.2 iese business school2 international institute for sustainable development2 media source, inc.2 stanley foundation2 woodrow wilson international center for scholars2 [s.n.1 al-amanah1 al-jamʻiyah1 al-kulliyah1 al-maʻhad1 american university in cairo1 atlantic media company1 bashariya1 dar al-islam lil-tibaʻah wa-al-nashr1 economist intelligence unit1 majlis al-wahdah al-iqtisadiyah al-ʻarabiyah, al-amanah al-ʻammah1 markaz al-buhuth al-ʻarabiyah1 mcmurry inc.1 national geographic society1 new york review, inc.1 newsweek/daily beast company llc1 world education services1 Harvard Library Bibliographic Dataset82 Complementary Index23 Education Full Text (H.W. Wilson)16 Readers' Guide Retrospective: 1890-1982 (H.W. Wilson)11 Supplemental Index11 Center for Research Libraries4 Environment Index4 The New Republic Archive2 Historical Abstracts with Full Text1 Index to Legal Periodicals and Books (H.W. Wilson)1 Index to Legal Periodicals & Books Full Text (H.W. Wilson)1 Humanities & Social Sciences Index Retrospective: 1907-1984 (H.W. Wilson)1 Library Literature & Information Science Index (H.W. Wilson)1 Art Full Text (H.W. Wilson)1 288 articles+ results 1. A Different Story from the Middle East: Entrepreneurs Building an Arab Tech Economy. [2017] Schroeder, Christopher M. MIT Technology Review. Sep/Oct2017, Vol. 120 Issue 5, p64-69. 6p. 3 Black and White Photographs. New business enterprises, High technology industries, Internet bookstores, Economic policy, Economic history, Arab countries -- Economic conditions, and Cloud computing -- Social aspects The article reports on the growth of new businesses in the Arab countries, particularly in the area of technology. It mentions how the United Arab Emirates (UAE) has created an environment to support these industries and describes some of the businesses such as online bookseller Jamalon and cloud communications company Unifonic. Full text View/download PDF 2. The Middle East's Lost Decades: Development, Dissent, and the Future of the Arab World. [2019] Yahya, Maha Foreign Affairs. Nov/Dec2019, Vol. 98 Issue 6, p48-55. 8p. MIDDLE East history -- 1979-, MIDDLE East-United States relations, ARAB countries -- Economic conditions, ARAB countries -- Politics & government, and ARAB Spring Uprisings, 2011- The article describes the situation in the Middle East since the September 11, 2001 terrorist attacks in the U.S. Topics discussed include the attitude of the U.S. toward Arab development during the second half of the 20th century, factors which resulted in several interconnected development challenges in the Arab countries, and economic and political conditions that produced the Arab Spring. 3. Optimism prevails despite turmoil. [2014] DUDLEY, DOMINIC MEED: Middle East Economic Digest. 6/27/2014 Supplement Economic Review, p5-8. 4p. 2 Charts. Economic forecasting, Unemployment, Arab countries -- Economic conditions, and Internal security The article examines economic conditions in Arab countries in 2014. Optimistic forecasting for the economies of those countries by Christine Lagarde, director of the International Monetary Fund (IMF) is considered. The threat to development posed by the near collapse of internal security in Iraq is discussed. The high rate of unemployment, particularly among youth and young adults, in Arab countries is examined. Full text View on content provider's site 4. City on a Hill. [2004] Molavi, Afshin New Republic. 2/9/2004, Vol. 230 Issue 4, p11-13. 3p. ECONOMIC policy, ECONOMIC development, FOREIGN investments, INFRASTRUCTURE (Economics), TOURISM, INTERNATIONAL finance, TAX havens, ECONOMIC history, ARAB countries -- Economic conditions, and ARAB countries Explains why the Persian Gulf city of Dubai, part of the United Arab Emirates, is thriving, while most of the Arab world suffers from economic stagnation. Details of a discussion about the economic problems of the Arab countries at the annual IMF/World Bank meeting, held in Dubai in September; Report that Dubai has attracted foreign investment by slashing corporate taxes and cutting tariffs, upgrading its port and airport, wiring the city for Internet access, and building facilities to house financial firms; Details of Dubai's efforts to attract upscale tourists; Report that the policies of Sheikh Mohammad bin Rashid Al Maktoum, the crown prince of Dubai, are behind the city's success; Details of the city's economic growth; Argument that the other Arab countries should emulate Dubai by giving the private sector access to capital, providing investment opportunities, nurturing small- and medium-sized enterprises, advertising their strengths in global financial media and encouraging free markets. 5. Dial-a-Caravan. [2017] OLSON, PARMY Forbes; 6/29/2017, Vol. 199 Issue 7, p41-44, 3p, 2 Color Photographs RIDESHARING services and ARAB countries -- Economic conditions The article profiles the ride-sharing firm Careem, which focuses on Arab countries, as a rival to the ride-sharing firm Uber Technologies Inc. Topics include the hiring of engineers for the firm who are leaving the U.S. due to policies of the administration of U.S. President Donald Trump, and the backgrounds of firm cofounders Magnus Olsson and Mudassir Sheikha. 6. TWO BAD SEASONS FROM DISASTER? [2011] Blanche, Ed Middle East. Jun2011, Issue 423, p12-17. 6p. ECONOMIC forecasting, POLITICAL stability, FOOD prices, MIDDLE East -- Economic conditions, and ARAB countries -- Economic conditions The article discusses issues in the Middle East. Critical issues being discussed include political unrest, increasing food prices, and global food crisis. The United Nations Food and Agriculture Organization (FAO) expects that over the last ten years global food prices have increased by an average of 83%. Abdolreza Abbassian, senior economist, presents his forecast regarding the crisis. 7. Brot, Freiheit und Gerechtigkeit: Fatalismus ist fehl am Platz. Der nächste Arabische Frühling kommt bestimmt. [2018] Gaub, Florence Internationale Politik; mai/jun2018, Vol. 73 Issue 3, p46-51, 6p ARAB Spring Uprisings, 2011- and ARAB countries -- Economic conditions The article presents the author's views on the poor economic condition of Arab region, and discusses fatalism in Arab states, investments against autocracy and Arab Spring. 8. FOUR YEARS after the SPRING. [2015] Mazarei, Adnan and Mirzoev, Tokhir Finance & Development. Jun2015, Vol. 52 Issue 2, p55-57. 3p. INTERNATIONAL trade, MONOPOLIES, ECONOMIC policy, ARAB countries -- Economic conditions, ARAB Spring Uprisings, 2011-, ARAB countries -- Politics & government -- 1945-, and ARAB countries The article reports on the economic conditions of Arab countries after the 2011 Arab Spring Uprisings. The barriers to the fast transition of the countries' economies are discussed including isolation from the global economy, trade and monopolistic markets, and weak governance. The importance of new visions for economic institutions and policies in the successful transition of these countries is mentioned. 9. Top Companies Report. [2004] Yedder, Omar Ben and Ford, Neil Middle East. Nov2004, Issue 350, p28-31. 4p. 1 Chart. RATINGS & rankings of business enterprises, CAPITAL market, CORPORATE image, EMPLOYEES, and ARAB countries -- Economic conditions The article focuses on list of the top companies in the Arab World for 2004. Conducting such an exercise brought about heated debate. What about the number of employees, corporate responsibility, employee satisfaction, the benefits generated to the local economy? Furthermore in economies where many of the bigger Arab companies are still in the hands of the state, and where published results are hard to get hold of this exercise would prove to be a highly difficult one. The aim of the exercise, rather than simply ranking companies, was to look at which industries shaped the region, which businesses were thriving, the health of the stock markets, regional and international integration, all of which help to understand a market, an economy and get a better feel of what the future may hold 10. Jumpstarting Arab Reform: The Bush Administration's GreaterMiddle East Initiative. [2004] Gambill, Gary C. Middle East Intelligence Bulletin. Jun/Jul2004, Vol. 6 Issue 6/7, p12-16. 5p. 1 Black and White Photograph. ECONOMIC development, POLICY sciences, CONFERENCES & conventions, and ARAB countries -- Economic conditions The article presents information that the American policymakers subsequently drafted a plan, the Greater Middle East Initiative (GMEI), to promote political and economic reform in the region in conjunction with the G-8 group of the world's leading industrial powers. Since GMEI was intended to be revised in consultation with Arab governments, the most important early measure of its impact is not so much the scale of revisions, U.S. President George W. Bush's administration was willing to make, but what it got in return for them. G-8 governments approved two documents at the Sea Island summit: a 12-point overview entitled Partnership for Progress and a Common Future with the Region of the Broader Middle East and North Africa, and a much more detailed document, entitled G-8 Plan of Support for Reform. Full text View on detail page 11. This title is not available for guests. Log in to see the title and access the article. 12. ISSUES IN THE NEWS. [2001] Wattad, Nizar and Cheema, Zainab Washington Report on Middle East Affairs. Nov2001, Vol. 20 Issue 8, p38. 4p. POLITICAL development and ARAB countries -- Economic conditions Presents the political and economic issues in Arab countries. Aims of the media campaign; Rate of consumption on fresh water resources; Establishment of a council for women in formulating state policies. 13. Cheap oil poses long-term risk. [2015] WILKINSON, PHILIPPA MEED: Middle East Economic Digest. 1/14/2015, Vol. 59 Issue 2, p30-31. 2p. 1 Chart. Renewable energy industry, Petroleum sales & prices, Economic indicators, Green technology, and Arab countries -- Economic conditions The article provides an overview of the energy industry in the member countries of the Gulf Cooperation Council for the Arab States in 2015. It discusses issues concerning the declining prices in renewable energy generation and hydrocarbons as well as issues related to export and budget policies. Information about several renewable energy projects in the region is also provided. 14. Oil price fall reignites tax debate. [2015] Spong, Rebecca MEED: Middle East Economic Digest. 1/14/2015, Vol. 59 Issue 2, p20-21. 2p. Petroleum sales & prices, Value-added tax, Economic indicators, and Arab countries -- Economic conditions The article provides an overview of the economic condition in the member countries of the Gulf Cooperation Council for the Arab States. It highlights the need for GCC governments to diversify their revenue streams as well as to limit their dependency on the hydrocarbons sector following the decline of oil prices in the region. Information about the GCC-wide value-added tax (VAT) is provided. 15. Agenda. [2014] MEED: Middle East Economic Digest. 12/5/2014, Vol. 58 Issue 49, p20-21. 2p. 2 Charts. Budget deficits, Public finance, Arab countries -- Economic conditions -- Congresses, Petroleum product sales & prices, Bahrain -- Politics & government, and Kuwait -- Economic conditions -- 1991- This section offers news briefs related to the economic conditions of Gulf Cooperation Council (GCC) countries compiled as of December 2014. Saudi Arabia is likely to record budget deficit in 2015 because of lower petroleum prices. Bahrain is the most likely to be affected by low oil prices because of uncertainty in public finance and political problems associated with the Shia majority. Kuwait can withstand prolonged low oil prices, according to Moody's Investors Service. 16. Riding out low oil prices. [2014] Crisp, Wil MEED: Middle East Economic Digest. 12/5/2014, Vol. 58 Issue 49, p18-19. 2p. Budget deficits, Government revenue, Arab countries -- Economic conditions, and Petroleum product sales & prices The article reports on Gulf Cooperation Council (GCC) countries' concerns about budget deficit after the Organization of the Petroleum Exporting Countries (OPEC) decided not to offer support for low petroleum prices. Topics covered include the GCC region's loss of more than 480 million dollars in daily government revenue because of lower oil prices and the loss of more than 110 billion dollars in potential revenue. 17. LARGEST TRADING PARTNERS. [2014] MEED: Middle East Economic Digest. 6/27/2014 Supplement Industry Report, p22-23. 2p. 10 Charts. CHARTS, diagrams, etc., International trade, and Arab countries -- Economic conditions Tables are presented on international trade statistics for Arab countries including Algeria, Egypt and Kuwait. 18. Assessing the GCC's Economic and Business Climate. [2017] Nell, Emily Washington Report on Middle East Affairs. Jan/Feb2017, Vol. 36 Issue 1, p53-53. 1p. 1 Color Photograph. POLITICAL stability, ECONOMIC development, and ARAB countries -- Economic conditions -- Congresses The article discusses panel discussion to assess the future of the Arab Gulf economies, during National Council on U.S.-Arab Relations (NCUSAR) conference on October 27, 2016. Topics discussed include comments from Danny Sebright of the U.S.-UAE Business Council, on economic development with the 2014 decline in oil prices, Patrick Theros of the U.S.-Qatar Business Council, on Qatar and Shireen Said, commercial attache at the Embassy of the Sultanate of Oman, on political stability. 19. Making a hash of finding the cash. [2013] Economist. 5/11/2013, Vol. 407 Issue 8835, p63-66. 3p. 2 Color Photographs. FOREIGN banking industry, REPOSSESSION, LARCENY, ARAB countries -- Economic conditions, ARAB Spring Uprisings, 2011-, and ASSET forfeiture The article focuses on the challenges faced by Arab countries in their attempts to recover money stolen by former regime leaders. Topics include the offshore accounts of the former leaders, the impact of the Arab Spring revolutions on Arab economies, and the value of assets seized by foreign governments. Information is provided on asset recovery. 20. Oil producers spend windfall wisely. [2006] Ford, Neil Middle East. Aug/Sep2006, Issue 370, p46-48. 3p. PETROLEUM industry, ECONOMIC policy, NONTARIFF trade barriers, ARAB countries -- Economic conditions, and REVENUE The article focuses on the economic trends of the Arab oil producing countries. According to the report, the Middle East and North Africa Region: Economic Developments and Prospects 2006, governments are investing high oil revenues to improve their long term economic prospects. Slowly trade barriers are being relaxed and governance is improving.
cc/2020-05/en_middle_0087.json.gz/line1338119
__label__wiki
0.82177
0.82177
VIFF 2019: The Wild Goose Lake (Diao Yinan, 2019) September 24, 2019 ~ Sean Gilman ~ 1 Comment One of the most anticipated Chinese titles of this year’s Vancouver International Film Festival is Diao Yinan’s follow-up to his Berlin winning 2014 film Black Coal, Thin Ice. Like that film, The Wild Goose Lake is a moody Chinese noir, full of morose characters trapped in a world of violence they cannot understand. It’s also significantly more interesting to look at than the majority of Chinese noirs that have afflicted the festival circuit in the wake of Black Coal‘s triumph. Sure, it has more than its share of torrential downpours and black nights of the soul, but Diao mixes the morose setting with yellows, greens, and reds (along with some delightfully sickly neon pinks) more reminiscent of Bi Gan’s Long Day’s Journey Into Night and the first third of Jia Zhangke’s Ash is Purest White than the dull grayness of movies like The Looming Storm or Savage or Lush Reeds. Unfortunately, the same cannot be said for his characters, who are nowhere near as vibrant as the film’s images. Hu Ge, who had a small role in Shunji Iwai’s Last Letter, stars as an ex-con and gangster who finds himself the target of a manhunt after he accidentally shoots a cop. The setup to this is extremely promising, with Diao melding the highbrow style of Bi and Jia with a classic Triad-type story, involving gang rivalries and a motorcycle-stealing contest that ends in a shocking bit of violence. But it quickly shifts into a different kind of film entirely, with Liao Fan as the cop in charge of hunting him down and Gwei Lun-mei as the prostitute with a heart of gold who tries to help him escape (both Gwei and Liao starred as well in Black Coal). Liao and the cops come off much better, as the blankness of their personalities matches the just-the-facts proceduralism of their pursuit, Liao himself bringing a necessary weight and professional authority to the role. But Gwei and Hu are blank slates, almost entirely affectless, with nary a hint of personality to mitigate their mopey sadness. Gwei is usually an actress of considerable charm, but there’s nary a hint here of the performer who stole scenes left and right in Tsui Hark’s Seven Swords and Flying Swords of Dragon Gate a decade ago. Instead she walks determinedly, if directionlessly, around the frame, face pinched in a perpetual scowl, while Hu (hobbled as his character is by multiple gunshot wounds) merely looks depressed. The motivations and actions mostly make sense, but it’s hard to care anything about them when they aren’t the least bit interesting. Compare them to the wit and will Zhao Tao showed in Ash, or Liao Fan’s weaselly over-confidence in that same film, or the mystery and passion of Tang Wei and Sylvia Chang in Long Day’s Journey, and you’ll see what Wild Goose Lake is missing most. But for all that, at moments the film is wonderful. There are at least three expert showdowns, built slowly and without dialogue, actors carefully arranging themselves in a well-defined space, communicating only with looks (or just as much: by not looking at all). Diao heightens one by having one group wearing shoes that have neon lights around their soles, such that our hero (such as he is) is seemingly hunted by circles of eerie pale green light, stark against the blackness of night. Another is set in a dilapidated concrete apartment complex, reminiscent of so many such structures in Hong Kong films, with their tangled hallways and noisy neighbors. In scenes like this, The Wild Goose Lake approaches the best of Johnnie To (the showdowns are nothing if not a nod to The Mission). If only the rest of the movie were so free. VIFF 2019 Preview September 24, 2019 ~ Sean Gilman We here at Seattle Screen Scene are very much looking forward to once again covering the Vancouver International Film Festival this year. It’s shaping up to be a pretty strong festival, with a number of titles we can’t wait to catch. We’ve already seen a few of the movies playing this year, though, as we covered them at festivals earlier this year. Here is a compendium of links to our previously published reviews of VIFF films that played at the Toronto Film Festival and the New York Asian Film Festival. Blood Quantum (Jeff Barnaby) – Evan in the Georgia Straight: “TIFF kicked off for me with the First Nations zombie movie Blood Quantum, but the moment that I walked out of the theater, I ejected it from my consciousness like a spent shotgun cartridge (though one dumbfounding line—delivered with perfect seriousness—will rent a room in my memory palace for eternity: “They look at me like my vagina is Pandora’s box!”)” Hard-Core (Nobuhiro Yamashita) – The latest from the director of Linda Linda Linda, one of the great films of the century thus far, was a disappointment for Sean, who wrote at the Notebook that, “Hard-Core is simply lost in itself, its collection of losers as charmless and uninteresting as the film’s forced whimsicality.” A Hidden Life – (Terrence Malick) – Lawrence at InReview Online notes that Malick’s latest is a “vision of breathtaking natural expanses and solid manmade enclosures [which] remains every bit as formally radical as any of his films this decade.” While Evan is very much looking forward to seeing it again, as he wrote for the Georgia Straight that while he was initially disappointed, he “sat down for the next film, the lights dimmed, and then, suddenly, they came back up. How long had I been here? Sometimes, at a festival, a movie gets sacrificed on the pyre when the film that precedes it sparks something in the soul. Turns out I spent two hours replaying A Hidden Life in my head—everything else passed by in a blur. Sorry Beanpole [also playing VIFF], Terrence Malick set my mind on fire.” It Must Be Heaven – (Elia Suleiman) – Evan was not a fan of Suleiman’s latest, noting at InReview Online that, “Suleiman possesses maybe two or three visual ideas, though he strongly prefers one: sometimes things over here look like things over there. Because warmed-over humanism is his chosen mode, his facile symmetries are meant to reinforce — as the press notes say — the “unexpected parallels” that he discovers while travelling the globe. They’re also meant to be funny. That they fail as comedy is perhaps forgivable. That they turn disparate places and people into easily readable mirror images, which provide us the comfort of the familiar only because they reflect back a portrait of ourselves, is more worthy of condemnation.” Krabi, 2562 – (Anocha Suwichakornpong & Ben Rivers) – At Reverse Shot, Lawrence writes that Suwichakornpong & Rivers’s collaboration “present[s] the viewer with sundry moving parts buttressed by fulsome textural detail and all manner of disorienting edits. If the pieces don’t quite fit together by the end, linked somewhat arbitrarily by the film’s temporal flattening—the entirety of the Holocene is folded into the present, 2562 being the current year of the Thai Buddhist calendar—that irresolvability is at least part of the point” Marriage Story (Noah Baumbach) – At InReview Online, Lawrence sees the risk-averse Baumbach attempting a bit more formal experimentation, such that his new movie “might eventually come to feel like a transitional work within his filmography.” As an example: “Baumbach sets up the formal template of the film, which introduces exaggerated, even caricatured types, then offers sundry details to modulate or even overturn the typification — which is also to say the opposite of what goes on during divorce proceedings, where small slippages are turned into deadly character flaws.” Parasite (Bong Joon-ho) – In the Georgia Straight, Evan writes that Bong’s “images possess the graphic panache and pith of a comic book panel, and in Parasite, he tosses them off with characteristic ease. But as Bong bulks up his visual prowess with each new film, his characterological muscle only atrophies further. We’ve reached an unhealthy point: the internal and external stimuli that motivate his people are now second order concerns at best, always subordinate to the next punchy composition.” Portrait of a Lady on Fire (Cèline Sciamma) – Writing in the Georgia Straight, Evan was not a fan of Sciamma’s “finicky attention to candlelight and 18th century domestic fripperies [which] can’t hide the fact that Portrait of a Lady on Fire actually takes place in the present. And like any ready-made facsimile, the historical varnish is merely a concession to bourgeois tastes, a decorative contrivance, and therefore entirely dishonest.” Synonyms (Nadav Lapid) – Evan in the Georgia Straight: “Lapid sees a neat correlation between his behaviorist approach to character—which abstracts human behavior into a series of violent tics—and the unstable psychogeography of Israeli selfhood. It’s unclear, however, that his style alone is sufficient to explicate his subject, at least to anyone living outside the confines of Nadav Lapid’s skittish mind—which is to say, the rest of us.” The Twentieth Century (Matthew Rankin) – At InReview Online, Lawrence notes that while “Comparisons to fellow Winnipeg filmmaker Guy Maddin are inevitable, as both share an evident interest in lost and/or defunct film forms, artificial staging, and wild humor.” But, “the difference seems to be that the incongruous, borderline surreal turns of Maddin’s singularly fecund oeuvre feel touched by genuine madness, whereas Rankin’s film registers as merely mannered.” Vitalina Varela (Pedro Costa) – Evan is conflicted on Costa’s latest, noting in the Georgia Straight that while “his images are as striking as any in contemporary cinema; they are incredible things to witness on a movie screen” but that “it also raises a question that both Costa and his fans are intent on avoiding. If Vitalina Varela truly belongs to the woman at its center, who lends the film her name and her life story, shouldn’t Costa bend his style around her?” White Lie (Calvin Thomas & Yonah Lewis) – At InReview Online, Sean wrote that this Canadian indie from the team that brought Spice It Up to last year’s VIFF, about a woman pretending to have cancer is “like a straight version of a Seinfeld episode, with Katie (Kacey Rohl) as the Costanza at the center of it all, barely afloat atop a sea of deceit.” White Snake (Amp Wong & Ji Zhao) – Reviewing this Chinese animated fantasy at the Mubi Notebook, Sean wrote that “aside from showing a bit too much skin and having a decided lack of songs, White Snake might as well be a Disney product.” But also, “it’s standard fairy tale romance stuff, but done with enough verve and belief that old clichés can be forgiven. It’s not Tsui Hark, but it might be a kids version of House of Flying Daggers.” The Wild Goose Lake (Diao Yinan) – Evan was mixed on the latest from the director of Black Coal, Thin Ice, writing in the Georgia Straight that, “the eccentric mise-en-scène scrambles important plot information just as often as it transmits it with ingenuity. In other words, Diao is a less sophisticated storyteller than he is a stylist, and the narrative convolutions eventually throw a wrench in things. The film breaks down as it approaches its end, and the final beat, which should register with the emphatic force of a full stop, instead trails off like an ellipsis.”
cc/2020-05/en_middle_0087.json.gz/line1338120
__label__wiki
0.753534
0.753534
Order Individual & Back Issues Where Sidelines is Sold Printed Classifieds Sidelines Directory Sidelines Business What’s Happenin’ Thursday, January 19 2012 / Published in 02-2012, Off Centerline Off Centerline A New Partner for the New Year: Pat Stempal of Roundabout Farm in Loxahatchee Florida has a new horse that has her smiling from ear to ear. Danilo is a 8 year old beauty and the perfect match for Pat according to trainer Shelly Francis Catching up: Jane Savoie says she’s started taking Ballroom and Latin dance lessons at the Dance All Night studio and she’s having a BLAST! “I ran into Caroline Roffman there and she’s taking lessons, too. I’m stunned and pleasantly surprised by the similarities to riding! I tried to get Rhett [her husband] to go…he might – but hasn’t started (He doesn’t look too enthusiastic yet) LOL!” Jane says. She takes lessons five days a week from Eric Ocando. “It’s actually good for me because my tendency is to want to lead. (Hmmm…Wonder what that says about my personality?!?)…But He’s 6’3” and just “blocks” me with his body when I try to take over. “My only regret is that I didn’t start this sooner,” she continues, “I can’t tell you how much fun I’m having!” We’re just about ready to sign up for lessons ourselves after this! [The Editor] Kudos to Isabell Werth, who made a public statement by wearing a helmet at an FEI level competition at the 2011 CDI-W Frankfurt, a national show circuit finals for small tour horses. Isabell Werth is competing Flatley but not top hat for her; she’s chosen uvex as her helmet supplier and she signed a long term contract with the protection specialists based inFürth,Germany. “The high safety and protection standards, comfort and optimal ventilation of their helmets, as well as their range of classic, elegant designs suitable for dressage, have completely won me over.” 2011 was huge for Karin Offield’s Brek-n-Ridge Farm in Northern Michigan. “We had close to 200 children and adults pass thru our doors for lessons this summer, so we kept busy! Kate Etherly manages the farm and Eliseo, who took care of Lingh, came back to help with the farm. Karin says she’s teaching Eliseo how to ride and so when he returns toMexico to stay with his family he will be able to train the young horses. Lingh graced the cover of ST.GEORG Germany’s most famous equestrian magazine and the Win a Ride on Lingh winner was announced in the December 2011 issue. Karin went toGermany and taught the 13 year old winner a lesson on Lingh! International Horse Sport Palm Beach is launching its 2012 season with new footing in all of the rings at The IHS Champions Park at Equestrian Estates, site of the Palm Beach Dressage Derby and IHS Series Shows. The first to view and approve this tremendous upgrade was an elite committee representing the United States Equestrian Federation. The committee, consisting of Eva Salomon, Anne Gribbons, and FEI rider representative, Heather Blitz recommended approval to the Dressage and Executive Committees of USEF. The IHS Palm Beach Managing Partners include FEI riders and trainers Ed Borresen and Lars Petersen, together with well-known show organizers Noreen O’Sullivan and John Flanagan. Congratulations to Jim Wofford, recipient of the USEF Lifetime Achievement Award. Jim is a legend in Eventing. A decorated athlete, Jim has helped shape an industry as a trainer, clinician, author and administrator. His lifelong involvement with equestrian sports and his incredible list of accomplishments have secured his place in history. American WEG Team bronze medalist Leslie Morse has retired her 17-year old Swedish Warmblood stallion Tip Top 962 from competition to stand him at stud. The dark bay licensed stallion has been one of America’s most successful dressage horses in the past five years. Leslie says she is seeking stallion owners interested in leasing Tip Top for the 2012 breeding season so she can continue to focus on training Tip Top’s and Kingston’s offspring. Interested stallions stations can inquire via email or by visiting Morse’s official website www.lesliemorsedressage.com The 2011 USDF Convention was a weekend of highlights for California-based dressage rider Amelia Child who was on cloud nine as a big winner during the convention. While the 19 year old Young Rider earned her bronze and silver medals, it was hearing her name drawn as the final winner in Custom Saddlery’s year-long All American Saddle Fit Challenge contest that had her bubbling over with enthusiasm. Child was the fifth person to win a custom dressage saddle from Custom Saddlery, makers of handcrafted custom-fit dressage, jumping and event saddles. For all the gossip and photos subscribe! News to share: New baby, engagement, pickup truck? On the move, having parties, falling off horses? Share what’s happenin’ with your dressage friends by e-mailing us at editor@sidelinesnews.com. Be sure to put “News Off Centerline” in the subject line. Download Sidelines Digital now from your favorite app store! Update iOS app. Re-download Google Play and Amazon app. Stay updated with Sidelines Magazine news! Example: Yes, I would like to receive emails from Sidelines Magazine. (You can unsubscribe anytime) By submitting this form, you are consenting to receive marketing emails from: Sidelines Magazine, 3598 Wild Plum Rd, Johns Island, SC, 29455, http://sidelinesmagazine.com. You can revoke your consent to receive emails at any time by using the SafeUnsubscribe® link, found at the bottom of every email. Emails are serviced by Constant Contact Sidelines Articles by Email Subscribe to Sidelines Magazine Articles by Email Sidelines Blogs: What’s Happenin’ The Knox School is seeking Equine Instructional Assistant Olympic Qualifying Event Runs November 14-17 at the Ocala Jockey Club Corro: Putting the Horse Before the Shopping Cart Sidelines Blogs: Show World Select Category 01-2011 (1) 01-2012 (5) 01-2013 (5) 01-2014 (5) 01-2015 (5) 01-2016 (5) 01-2017 (3) 01-2018 (3) 01-2019 (3) 01-2020 (3) 02-2012 (5) 02-2013 (5) 02-2014 (5) 02-2015 (5) 02-2016 (5) 02-2017 (3) 02-2018 (3) 02-2019 (3) 03-2012 (5) 03-2013 (5) 03-2014 (5) 03-2015 (5) 03-2016 (5) 03-2017 (3) 03-2018 (3) 03-2019 (3) 04-2011 (5) 04-2012 (5) 04-2013 (4) 04-2014 (5) 04-2015 (5) 04-2016 (3) 04-2017 (3) 04-2018 (3) 04-2019 (3) 05-2011 (4) 05-2012 (5) 05-2013 (5) 05-2014 (5) 05-2015 (5) 05-2016 (3) 05-2017 (3) 05-2018 (3) 05-2019 (3) 06-2011 (4) 06-2012 (5) 06-2013 (5) 06-2014 (5) 06-2015 (5) 06-2016 (3) 06-2017 (3) 06-2018 (3) 06-2019 (3) 07-2011 (5) 07-2012 (5) 07-2013 (5) 07-2014 (5) 07-2015 (5) 07-2016 (3) 07-2017 (3) 07-2018 (3) 07-2019 (3) 08-2011 (5) 08-2012 (5) 08-2013 (5) 08-2014 (5) 08-2015 (5) 08-2016 (3) 08-2017 (3) 08-2018 (3) 08-2019 (3) 09-2011 (5) 09-2012 (5) 09-2013 (4) 09-2014 (5) 09-2015 (5) 09-2016 (3) 09-2017 (3) 09-2018 (3) 09-2019 (3) 10-2011 (5) 10-2012 (5) 10-2013 (6) 10-2014 (6) 10-2015 (5) 10-2016 (3) 10-2017 (3) 10-2018 (3) 10-2019 (3) 11-2011 (5) 11-2012 (5) 11-2013 (5) 11-2014 (4) 11-2015 (5) 11-2016 (3) 11-2017 (3) 11-2018 (3) 11-2019 (3) 12-2011 (5) 12-2012 (6) 12-2013 (5) 12-2014 (5) 12-2015 (5) 12-2016 (3) 12-2017 (3) 12-2018 (3) 12-2019 (3) Announcements (3) Asides (60) Contests (2) Front Cover (105) General (930) Ingate (104) Junior Blues (5) Letter from Editor (1) Off Centerline (59) Pony Kids (1) Side Shots (5) Sidelines Feature (192) Sidelines Spotlight (180) Sidelines TV (162) Special Focus Issues (1) Weekly Feature (258) Z-Blogs (3,159) Adventures with Angelea (19) Along for The Ride (6) An American in Germany (21) Between the Ears (12) Beyond the Track (79) Chasin’ (50) Editor’s Notes (196) Higher Education (11) Horse Country Chic (1) In the Irons (32) Injecting Perspective (23) Lauren Gallops (103) Notes from the Field (8) Olympic Sidelines (51) On the Line (45) Onward, Upward (18) Pacer Pride (63) Pony Tales (29) Pony Up! (41) Show World (930) Tails & Trails (172) The Classic Insider (575) The Hopeful Amateur (12) The Offside (3) Tucker The Wunderkind (36) What’s Happenin’ (621) Kady Abrahamson: Balancing School with Riding, and Winning at Both By Britney Grover, Portraits by Shawna Simmons ... Coursewalk with Heather Caristo Coursewalk with Heather Caristo - "How is team ... Unbridled With Debbie McDonald By Jan Westmark - Debbie McDonald and Brentina,... Mona Snell: Through the Eyes of an Artist & Horsewoman By Shya Beth - No two living things are exactly... Eventing with Boyd Martin Boyd was honored and privileged to go to Japan ... Copyright © 1987 - 2019 Sidelines Magazine Privacy Policy · Returns & Refunds Policy · Hosting by Lucian Web Service · Login
cc/2020-05/en_middle_0087.json.gz/line1338125
__label__wiki
0.673282
0.673282
https://simkl.com/movies/69046/the-lazarus-project 2008-10-24T00:00:00Z The Lazarus Project DVD • October 24, 2008 • 1h 39m • PG-13 • Budget $9M • Box Office $558,000 After Ben Garvey foolishly turned back to crime, he thought his life was over when he was sentenced to death by lethal injection. But his death sentence isn't quite what it seems, as Ben regains consciousness near an eerie psychiatric ward, where he's told he's been hired as the groundskeeper. With the ... More state of his soul in question, and the love for his wife and daughter all the more real and powerful, Ben must figure out if he's truly cheated death, or if he's become part of something far more sinister. Less The Lazarus Project - ... The Lazarus Project | The Lazarus Project - Trailer Sub Genres: prison, symbol, criminal past, dallas texas, chain saw, lethal injection, robbery, death penalty, secret, ex convict Release Date: DVD 10/21/2008, Theatre 10/24/2008 Box Office: $558,000 (Foreign) Age Rating: PG-13 Director: John Glenn (as John Patrick Glenn) Links: IMDB, Official Website, TMDB Vehicle 19 The Death and Life of Bobby Z Takers Joy Ride The Skulls Hours(Movie), Vehicle 19(Movie), The Death and Life of Bobby Z(Movie), Brick Mansions(Movie), Running Scared(Movie), Into the Blue(Movie), Takers(Movie), Timeline(Movie), Joy Ride(Movie), Noel(Movie), The Skulls(Movie), Pawn Shop Chronicles(Movie) Top movies with similar genre to The Lazarus Project Walking Tall: Lone Justice Prison Break: The Final Break Pusher II: With Blood on My Hands We Belong Together, The Life of David Gale, 11:14, Son of a Gun, Walking Tall: Lone Justice, The Prestige, Prison Break: The Final Break, A History of Violence, Pusher II: With Blood on My Hands ABOUT #THELAZARUSPROJECT Newest Oldest Top Replies Top comments Top Memos Most Helpful Most Likes 1. Avengers: Endgame 8.5 2. Star Wars: The Force Awakens 7.9 3. Avengers: Infinity War 8.5 4. Jurassic World 7 5. The Lion King 7
cc/2020-05/en_middle_0087.json.gz/line1338126
__label__wiki
0.556558
0.556558
Sparklings Homemade beers Line Bar Gastronomic products TOP SPIRITS SPECIAL EDITION PassioneVino: Online and wholesale sales of wines and gourmet products RUM LIMITED EDITION Whisky Oban 14 y.o. Whisky Lagavulin 16 y.o. Negroamaro Salento igp 2014 Aglianico del Vulture doc 1992 - Don Anselmo Ron Esclavo 12 yo MANUFACTURER: Esclavo ALCOHOL : 40 CONTENT : 0,70 l DESCRIPTION: The Ron Esclavo is part of a selection of Solera rums from the Dominican Republic, blended by Oliver y Oliver in collaboration with 1423. The Solera method is a process for the aging of distillates for which several vintages are mixed together through a pyramidal system . In this way, the finished product is a mixture of different ages. Ron Esclavo 12 is the first of the Esclavo line which means in Spanish slave. The Rum is called this way to pay tribute to the people who paid the highest price to make us taste this fantastic liqueur today. On the nose: sweet caramel and vanilla. On the palate: Sweet and soft with notes of vanilla, caramel, plum, marzipan and burnt wood. Persistent finish... MANUFACTURER: Esclavo ALCOHOL : 38 CONTENT : 0,70 l DESCRIPTION: The Ron Esclavo is part of a selection of Solera rums from the Dominican Republic blended by Oliver y Oliver in collaboration with 1423. The Solera method is a process of aging of distillates for which several vintages are mixed together through a pyramidal system. In this way, the finished product is a mixture of different ages. The Ron Esclavo 15 is the second of the Esclavo line and is a pleasant rum, perfect for rum enthusiasts, but is also well appreciated by liquor specialists. The word Esclavo means in Spanish slave. The Rum is called this way to pay tribute to the people who paid the highest price to make us enjoy this fantastic liqueur. Al Naso: Sweet and round with hints of vanilla and caramel. On the palate: Sweet and delicate notes of vanilla, caramel, honey and cinnamon. Final long and slightly spicy, strengthened by the alcohol content... Ron Esclavo XO 23 yo MANUFACTURER: Esclavo ALCOHOL : 42 CONTENT : 0,70 l DESCRIPTION: The Ron Esclavo is part of a selection of Solera rums from the Dominican Republic blended by Oliver y Oliver in collaboration with 1423. The Solera method is a process of aging of distillates for which several vintages are mixed together through a pyramidal system. In this way, the finished product is a mixture of different ages. The word Esclavo means in Spanish slave. The Rum is called this way to pay tribute to the people who paid the highest price to make us enjoy this fantastic liqueur. The Ron Esclavo XO is the third of the Esclavo line and is a mixture of rum aged 23 years. Al Naso: Round and spicy fragrances of vanilla and caramel. On the palate: Sweet and soft taste of vanilla, honey, caramel and cinnamon with a long and spicy finish. The alcoholic degree accentuates the intensity of the flavor... Ron Esclavo XO Single 23 yo MANUFACTURER: Esclavo ALCOHOL : 65 CONTENT : 0,50 l DESCRIPTION: The Ron Esclavo is part of a selection of Solera rums from the Dominican Republic blended by Oliver y Oliver in collaboration with 1423. The Solera method is a process of aging of distillates for which several vintages are mixed together through a pyramidal system. In this way, the finished product is a mixture of different ages. The word Esclavo means in Spanish slave. The Rum is called this way to pay tribute to the people who paid the highest price to make us enjoy this fantastic liqueur. Ron Esclavo XO Cask is "the grand finale" in the Esclavo line. This rum is the elder brother of Ron Esclavo XO. The Ron Esclavo XO Cask is bottled without any dilution. On the nose: Very spicy with hints of vanilla, caramel. On the palate: Warm and delicious with notes of vanilla, caramel and wood. This is a powerful rum with a long and persistent finish... Rum Karukera Vieux Agricole COUNTRY: Guadeloupe MANUFACTURER: Karukera ALCOHOL : 42 CONTENT : 0,70 l DESCRIPTION: The range sees the Rhum Blanc 50% alone reeds bleue, the Gold aged in barrels, the Vieux cask aged ex-cognac from 350 liters, the Special Reserve, assembly of French oak and American oak for more than 5 years , and again in 2000 thousandth 46.5 ° Sauternes finish, and the top of the range, the Cuvée Colomb... Rum La Cruz Vintage Single Barrel 1982 COUNTRY: Panama ALCOHOL: 40.0 CONTENT: 0,70 l The wine shows a regal walnut color obtained through aging in oak barrels. The nose shows and more intense with hints of spice, balanced aromas of wood and tobacco that abound in the land that gave birth to this magnificent selection. In the mouth appears to be balanced, full-bodied and very persistent.. Rum Last Ward 2009 MANUFACTURER: Velier ALCOHOL : 59 CONTENT : 0,70 l DESCRIPTION: The vintage rums are also produced in total collaboration with the producers of the Caribbean, so it is not a selection of rums but a real one research work and innovative proposals together with the last Caribbean using the pots stills. Aged on the spot in full in tropical climate, with a superior angel share at 8% per year, they are bottled with barrel proof, without cold filtrations, without addition of sugars or caramel. Last Ward 2009 triple distillation pot still for two thousandths distilled at Mount Gay Rum Refinery from the experience of Frank Ward, aged in ex Bourbon. The name is a tribute to the family of Frank Ward, former owner of the former distillery acquisition by Remy Cointreau.. Rum Single Barrel Selection Barbados 2000 16 yo MANUFACTURER: West Indies Rum Distillery ALCOHOL : 54 CONTENT : 0,70 l DESCRIPTION: S.B.S Barbados 2000 comes from a single cask, which produced 224 bottles. Rum is distilled from the West Indies Rum Distillery (W.I.R.D), which is located in Barbados. W.I.R.D was inaugurated in 1893 and has always used the most advanced distillation techniques to guarantee the production of top quality rums. W.I.R.D uses different distillation methods: the continuous one in 'four columns continuous still' (column alembics) and the discontinuous one also called double distillation, in 'pot stills' (copper stills). On the nose: hints of vanilla biscuit and Danish gingerbread with marzipan notes. On the palate: Ripe red apples. Tea, hazelnuts, toasted bread, hints of smoke, butter and dry oak... Rum Single Barrel Selection Barbados 2008 9 yo MANUFACTURER: Foursquare ALCOHOL : 55 CONTENT : 0,70 l DESCRIPTION: S.B.S Barbados 2008 comes from a single cask, which produced 371 bottles. It is a rum based on molasses, distilled in 2008 by Foursquare Distillery, in Barbados, and bottled in November 2017. S.B. Barbados 2008 has achieved a perfect finish thanks to a 12 month aging. Rum ages in barrels that previously contained Marsala for 5 years. On the nose: the alcohol content is dominant but without being aggressive. In order the perceived aromas are of marsala, dried orange and muscovado (unrefined cane sugar). On the palate: Dry tannin, green bananas, figs, milk chocolate, toasted cane sugar. Marsala is sweet on the palate... Rum Single Barrel Selection Belize 9 yo MANUFACTURER: Travellers Liquors Ltd ALCOHOL : 46 CONTENT : 0,70 l DESCRIPTION: The acronym S.B.S stands for Single Barrel Selection. This Rum from Belize is the number one in the product range of the S.B.S. brand. It comes from a single cask that made 272 bottles. This Belize rum ages 9 years and is not the result of a mixture of different vintages. On the palate it is very aromatic with a tempting fragrance. It is a rum with a complex taste and a more classic style, the sweet taste of sugar does not stand out simply because it is not added to it. Compared to other rums of the S.B.S. brand, Belize is a more delicate version... Rum Single Barrel Selection Guyana 1998 19 yo MANUFACTURER: Uitvlugt ALCOHOL : 62,4 CONTENT : 0,70 l DESCRIPTION: S.B.S Guyana 1998 comes from a single cask, which produced 157 bottles. It is distilled in the famous 'Double Wooden Pot Still' still in Port Morant. Since the alembic was brought to the Uitvlugt Distillery during the period of production, Uitvlugt is the distillery declared on the label. After the closure of this, in 2000, the alembic was transferred to the Distillery located in Diamond. To obtain a perfect finish, the rum ages for 7 months in Oloroso barrels of Montilla Moriles, coming from Spain. On the nose: hints of caramel, dried figs and light orange. Delicate scent of Muscovado (unrefined cane sugar), light coffee and chocolate. On the palate: You immediately feel the alcoholic consistency, followed by notes of dry wood and delicate acidity. Bitter notes followed by hints of Irish coffee, honey and burnt sugar... MANUFACTURER: Diamond ALCOHOL : 62,8 CONTENT : 0,70 l DESCRIPTION: S.B.S Guyana 2003 comes from a single barrel, which produced 264 bottles. It is distilled in the 'Single Wooden Versailles Still', which once belonged to the Versailles Distillery, originally located on the west bank of the Demerara. Today the distiller has been moved to the Diamond Distillery (owned by the Demerara Distilleries), in Guyana. It is rumored that the alembic was built at least 150 years ago, but it could be much older since there is no documentation on the period of its construction. Al Naso: old wood of Marsala, ripe bananas, almonds, vanilla sugar, toasted bread, prunes and raisins. On the palate: You immediately perceive the alcoholic consistency that leaves the mouth dry. The taste buds are then wrapped in pleasant hints of wood, light caramel, bitter citrus fruits such as pomelo, aniseed, licorice and cinnamon brighten the taste buds.. Rum Single Barrel Selection Jamaica 2005 13 yo MANUFACTURER: Worthy Park Distillery ALCOHOL : 58,6 CONTENT : 0,70 l DESCRIPTION: S.B.S. Jamaica 2005 comes from a single cask, which produced 227 bottles. The name of the distillery of this rum is not revealed. But this is a typical Jamaican rum. Jamaica is among other things known for its funky and important style of its rum. Rum is a fundamental part of Jamaican culture, and if you count all the small rum rooms along every little street, there's almost a bar for every third-party citizen. On the nose: notes of concentrated apple juice, dried strawberries and sandalwood. On the palate: hints of apples and delicate tobacco, hazelnuts and leather... Rum Single Barrel Selection Panama 2001 15 yo MANUFACTURER: ALCOHOL : 55,6 CONTENT : 0,70 l DESCRIPTION: S.B.S Panama 2001 comes from a single cask, which produced 252 bottles. No distillery is indicated on the label of this Panama Rum, but it has been chosen specifically for the S.B.S line because it only selects the best spirits. Although Panama is mainly known for its channel that connects the Pacific Ocean with the Atlantic Ocean, the country has much more to offer: some high quality rums are produced here, thanks to the large amount of sugar cane in the country. The raw material contributes to the production of Panama rum stocks. On the nose: tropical citrus, orange jam, cinnamon, vanilla cream, chestnuts, ripe apples, plums and caramel. On the palate: light and dry notes of young wood, rich in vanilla. Strong cinnamon, pomelo and bitter citrus, banana, cocoa, toasted bread, brown sugar and wild apples fragrances... Payments and shipments WINE & DESIGN S.A.S. di Campesato Daniela Via T. Albinoni, 9 - 36025 Noventa Vicentina (Vi) +39 347.1504391 - info@passionevino.net © Copyright - All right reserver. 2010 - 2020 Close More info
cc/2020-05/en_middle_0087.json.gz/line1338127
__label__cc
0.740543
0.259457
« Morocco Sapiens 315,000 Old, Generalizing Humanity Covenant (With Plutocracy) » Islam: Religion Of Fighting, Says Caliph! [Those who are tired of my all too learned discourses, should go directly to the smart, yet simple, video linked below; and suffer through the first minute of half deserved “conservative” rant, before the interesting part.] Strange Disease Of Islamophilia Condemned By Youth, At Last! The admiration for, and lies about, Literal Islam, is the miracle which keeps on giving. To world plutocrats. Islam took over what had been, for millennia, the richest, most innovative and most civilized part of the world, and turned it into the poorest, dumbest, and most war-torn wastes, until oil was found. Any question? Well, some had questions. As the president of Senegal, Abu Diouf, said, Saudi style, Salafist Wahhabi Islam is “not my religion”. This is why 100 severely different versions of Islam were created. In opposition to Salafist Islam. However, Salafist Islam is now propelled by Arabian oil (and Wall Street, and Washington power standing behind since the 1930s: the swamp Trump talks about is full of oil…) The Caliph has spoken. In Some Ways, The “Islamist State” Is More Honest Than Main Stream Intellectuals In The West A young and slick Utuber looked into ‘Avallone Hunter’, looked into Islam, and made a good job at it. He particularly got it right on “moderate Muslims”, who, according to the Qur’an are hypocrites, thus to be killed. Anyway, the video is good, once you pass the gratuitous attack and passing conflation of “progressives” with their opposites, at the beginning of the work (I am a progressive, so I didn’t appreciate that!) https://www.youtube.com/watch?v=4d8GDo49QKY Do not despair of youth: they learn. Showing in great numbers, contrarily to habit, and expectations, the less than 24 years old just helped Theresa May, the plutocratic fanatic UK PM, lose her majority in the UK Parliament. The youth in the UK is pro-Europe and anti-xenophobic. They know more, and have a more appropriate mood than their elders. Alleluia! Terrorism will go away, once the youth is aware of why it appeared in the first place. The “West” by the way, is the descendant, in more ways than one, some cultural, some genetics, of that richest, most innovative, and most civilized part of the world, which I call not the Middle East, but the Middle Earth, because it is what it is. Italians are partly, genetically, Iraqis: Mesopotamians migrated over to the north shore of the Mediterranean, with their bio-engineered grain and know-how, bringing themselves and agriculture. 5,000 years before Greek civilization. This migration was recently genetically traced through the islands of the Aegean. Much “Greek” math was Egyptian, Sumer cities, 5,000 years ago, started the alphabet, and “Europa” was a Phoenician Princess (who travelled over to present day Europe; actually she would have been kidnapped…) Considering the logic of Islam, it’s easy to see why all the gold it touches turns to poisonous mercury. Islam is an essentially hypocritical faith, saying science has to be pursued, but then “disbelievers” have to be killed. That’s, at best, absurd: how can one develop science without disbelief? How can want to develop science without feeling that creation, as it happened, is not perfect, but, instead, requires thorough explanation?Doesn’t Islam say we should stick to revelation, as transmitted by Mr. Messenger, an epileptic analphabet hallucinating in the desert? Islam seems to have aimed at making into a capital offense all and any behavior that would not make Muslims reproduce like rabbits, to feed those vast armies of conquerors and jihadists. So women are supposed to be baby machines, and any man not inclined to engross them, within strict guidelines, is a traitor. This all happened in the lifetime of one person. The Ferocity Of Islam Insured Fast, Gigantic Conquests, Before Resistance Could Be Mustered. After the tremendous defeats of Islam at the hands of the Franks, Islam was broken, never to grow again until very recently… (Except for the conquest of Turkey, and the slow drip into Africa…) Islam is the war religion par excellence, and Adolf Hitler admired it for that. The irony, of course, is that the Islam superstition, by separating men and women, is intrinsically homosexual: after, men are supposed to be with men, and women, with women. Actually, it’s even better than that: women are supposed to be out of sight. So Muslim men intrinsically only love to have around other men, they have androphilia (men loving men). The ferocity with which homosexuals are killed in Islam is precisely because Islam is so homosexual. It’s both a lie and a lifeline. An attempt to disguise what is going while avoiding the accusation of sodomy by the West which helped to destroy the Aztecs. Violence in Islam is no accident, coincidence or consequence. It’s intrinsic. Violence, the violence of armies, is what made Islam possible. In a few years, Islam conquered the largest empire the world had ever known. Precisely because those who (claim to) die for Allah are promised paradise. The question then becomes: why did such a monster superstition become an object of adoration on the part of so many intellectuals in the West? Because many intellectuals in the West developed a hatred for civilization, shortly before or coincident and causally related to Stalinism, Nazism, Fascism and Maoism… Much of the anti-colonialist struggle, however justified, resorted to hating civilization all together… Although it’s civilization which had made it possible in the first place! Many intellectuals became rich, powerful and influential this way. Hating civilization became their business model. And in Islam they found an ideology which had been created to hate the “West”, the Greco-Roman empire, and also the other civilization, the Persian Sassanid empire. Muhammad led the first attack against Rome. Within ten years, Persia was destroyed and the richest parts of the Roman empire had been conquered by the Islamists. Muhammad didn’t see it: he died by surprise, in great pain, screaming on his deathbed in Mecca, for days, that he had been poisoned. By fellow Muslims. That’s the drawback of a lethal, dictator friendly religion: it kills a lot. So many Western intellectuals loved Islam, because Islam hated the “West”, and they, themselves, made a (dishonest) profession of hating the “West” (which fed them so well). The hater of my enemy is my friend, some say, forgetting about crocodiles, which show that the eater of their enemy is not really friendly. So did Hitler love Islam, and hate the “West”. In general, plutocrats hate civilization, so they are natural enemies of Islam. The Qur’an orders to follow dictators as if they were god, as long as they are Muslims… Consider: https://patriceayme.wordpress.com/2008/10/02/god-hates-democracy/ US oilmen and sneaky British imperialists saw, as early as the 1930s, that they would gain by instrumentalizing Islam. So here we are. All Islam propaganda goes through Western fibers and satellites. The problem of Islam is thus way larger than just Islam. Yes, Islam is the religion of desert raiding, it was established that way by a caravan raider. Yes, Islam is ideal for brutal military conquerors, and dictators, thus many of these, from the Turks to the Mongols, adopted it. But Islam is more than that. Islam is an ideology, one of many, of the sort which serve a much bigger species of monsters, always devouring civilizations. Islam is the tool of something maximally monstrous: unchained, free ranging plutocracy. Let’s finish on a lighter, enlightening note on how public opinion gets durably molded. I just saw a Suisse Romande report on what happened in 1971, when six high level reporters and producers were fired from TSR (called RTS now), the state (and only) French-speaking TV in Switzerland. The present Swiss TV, RTS was able to access the documentation of the time, and interviewed both the leftists and the police officers, or their superiors, involved at the time. Basically what happened is that there was a “political police” in Switzerland (it was secret that there was a political police). So important TV personalities and producers were followed by the secret police and information was gathered anonymously (as Google, Facebook and company are doing now). Patterns were established: some were living with someone else while not married, some were heard saying things which were deemed to be revolutionary. In the end the secret police sent a list of six persons, asking them to be fired. The TV TSR did so. TSR accused the six of “subversion and sabotage“. It was alleged that they had relations with foreign powers (Cuba). The six fired alleged defamation (in truth they were simple middle class, with nearly no rebellious spirit about them, and no connection with organizations or foreign powers). There was a trial for defamation; the chief of the federal police (equivalent to the FBI) came and said the TSR was justified, so the judges sided with the TV channel. All of this happened because those six wrote TV shows disturbing to the political class. (They more or less won in appeal, because the Federal police chief was unwilling to reveal a secret police was spying on the citizenry). However those six and others connected to them were excluded from TV, and thus wide influence, for the next thirty years… These sorts of manipulations is happening all over the world, making sure that We The People think and feels just what the ascending plutocracy cares about (like sport teams scores). To this day, one of two principals in this affair, Rene’ Schenker, says that he cannot tell what happened, because if he did, justice would have to re-open an inquiry. The other principal obeying orders from above says that: “Yes, we fired with canon at flies“. This is still happening. Look at the New York Times: it bans all my comments, one of many media to do so. The idea is that my ideas and observations should not be known. Probably thousands of others are in the same situation (interesting commenters have disappeared at the NYT). However, the New York Times enjoys privileges (say sits in attendance at the White House). Thus a propaganda system is established: Islamophobia is racism, Obama is a great progressive, etc… If Islamophobia is racist, any analysis of why Islam, that enemy of the Middle Earth, re-appeared, coincident with the supremacy of oil and Wall Street, and the discussion of the deal with Abdulaziz Ibn Saud in 1945, is excluded. And so on. Last week, I read some extracts of the Qur’an to good, left, progressive, socialist, rabidly pro-Clinton voters, sensitive souls who cried when Trump got elected instead. It was a little experiment, but I was surprised by their overwhelming incredulity. They were astounded, they were aghast, they couldn’t believe it, their gaping mouths went into huge Os. They were so astounded, they thought I was making it up, and they came over to read the Qur’an by themselves. They had never did it before, but they though they knew Islam… Strange times, indeed… All too many people do not even know what it is to know. They feel they know, what they couldn’t possibly know… except if they believed fully whatever the authorities want them to believe. https://patriceayme.wordpress.com/2009/06/22/some-violence-in-holy-quran/ Tags: Hypocrites, Qur'an This entry was posted on June 10, 2017 at 4:34 pm and is filed under Abrahamism, Islam, Systems Of Mind, Systems Of Moods, Systems Of Thought. You can follow any responses to this entry through the RSS 2.0 feed. You can leave a response, or trackback from your own site. 7 Responses to “Islam: Religion Of Fighting, Says Caliph!” SDM Says: whether you like Hitchens or not, he was right about Islam – and religion generally, especially Abrahamic religion at its most literal Voltaire diagnosed Islam as intolerant, and wrote a play entitled: ‘Islam or Intolerance’. Now the play can’t be played anymore!!!!!#!! $##%! $! If we can’t solve the problem of Islam, how can we solve the problem of plutocracy? Picard578 Says: picard578 This is a first paragraph of an article / essay / whatever I am going to write about liberalism: “Liberalism is all about sweeping generalizations. “All people are equal”, “all religions are the same”, “all cultures are worthy of respect”. To be a liberal, person does not have to have any knowledge of reality and history, does not need to do research, and does not need to think. Modern liberalism is easy, and so modern generations who expect everything to be given to them on a silver platter – opinions included – are attracted to it. Everything can be placed in the same basket, no work necessary. Second main factor is liberalism’s idealism. Liberals get so focused on ideals that they forget reality. Since reality is less than ideal, ignoring it can make people feel better as they forget their troubles. This is why rich people and their kids tend to be liberals – they have no connection to reality, and are thus free to dream. Since rich people also tend to be better educated, this gives a false impression that education somehow causes people to become more liberal.” This explains why liberals like Islam. Because both modern liberalism and Islam are hostile to free thought, to critique, to anything not fitting their doctrine. They both create societies best described as the beginnings of the Borg collective. As for your comment: Ancient Middle East is very different from Medieval Middle East. In Antiquity, the Fertile Crescent was the most fertile area in the world (and site of the Biblical Eden). This allowed various civilizations to thrive, but long-term human presence had consequences – the land was exhausted, eventually turning into desert. Islam, even though it comes from the Middle East, originates from very different conditions. It originated in the desert, where resources were limited, and wars were constantly fought over oases. Warfare was the norm, and high civilization could not develop in such conditions. Islam developing as it did is thus no surprise – it is a codification of warring mentality of desert raiders (Romans fought the Saracens – Arabs – under Diocletian and even earlier, long before Islam appeared). Islam is totalitarian war religion by nature, and this totalitarianism shows itself in all aspects – including relationship towards women. Poor environment has created poor brains, and poor brains have thus created stupid religion. And stupidity is infectious, hence Islam spread rapidly. Violence is actually a consequence of this totalitarianism – violence of the mind inevitably manifests itself as physical violence (just see how modern-day liberals tend to become violent when their beliefs are contradicted – you can find good footage from US college campuses). And Islam has codified this physical violence as a jihad. I think modern hatred for civilization goes deeper than what you are describing. As I had described, modern liberalism is extremely opposed to free thought. Yet it is free thought which makes civilization possible. But to tell them that they are basically Nazis is to cause a screaming fit. This is because today’s liberalism is in the service of plutocracy (just take a look at who finances liberal movements: George Soros, Rockefeller, and other plutocratic mafia). And plutocracy cannot exist if free thought is allowed, hence idiots have to be created (“idiotes” was originally a term for people who did not partake in political process because they were self-centered and concerned only with private affairs. Quite apt description for modern self-centered liberals). Plutocracy requires idiocracy, and idiots are created by teaching people not to think. Hence modern concern about insulting people, manifesting itself as political correctness – truth is always insulting, and if you are afraid of telling the truth, you become an idiot. Modern educational system is no better, teaching people WHAT to think as opposed to HOW to think – if people are taught HOW to think, there is no telling what conclusions and solutions they will reach. I found this as well, may interest you: http://karlboyken.blogspot.hr/2008/03/idiotes-and-idiocracy.html Al Hein Says: Al-hein There are also MANY gruesome things in the Bible, especially in the old testament. Better remind that Christian extremists created the inquisition which was pretty ugly to ‘infidels’ and Hulagu-Khan, who was allegedly “Christian”, has spilled mountains of blood, killing near the 2 millions of inhabitants of Baghdad. I bet that many who now support the Dalai-Lama against China, had they lived in the Tibetan theocracy, would have applauded when China invaded. Just get info on how their justice used to punish people by making them blind, cut a hand+a foot and other nice things… Worshippers of Kali in Hinduism have left an English word behind them : “thugs”. Actually, all religions had their issues and so have all political ideologies. What sucks big league with Islam is its conservative extreme forms i.e. wahhabism/salafism, while Alewis or Sufis are not an issue. It’s clear that with countries like Qatar, Saudi-Barbaria funding mosques everywhere to place their extremist preachers in, so Turkey already felt in this trap, but also Somalia, etc, with the infamous Muslim Brotherhood acting as a 5th column, these are the real issues as most of the Muslims are in the same case as most of Christians : they are so because their parents brainwashed them into their religion while themselves had a limited knowledge of this religion Nevertheless, no media consider what’s happening in Congo where just 6 millions people lost their lives in the recent years, including 3 millions children under 5y old of age, but hey, who left the barbarian who did the massacres in Rwanda or Uganda flee to Congo? And well, there are serious resources to take so shhhhhhhhh, don’t talk about it in MSM, let’s not ruin the big capitalism projects… And it’s so convenient to use proxies to do the dirty job, exactly as all those low IQs have been tooled to do serious shit in Syria while the real goal was to clear the way for the Qatar->KSA->Syria->Turkey->EU gas pipeline while, at the same time, the GazProm->EU pipeline was cut by the Soros+DoS backed coup, thus placing Poroshenko and his fascists in power and strangely, Poland was given F-16s in order to challenge GazProm from gaining full access to EU’s northern OPAL pipeline system. We’d better consider sticking to reality by taking a look at the geopolitics before unjustly charging some categories of populations for their religion or falling in pretty dubious nationalism or any ideology that already proved itself at claiming blood. Let’s face reality : there’s a bunch of very wealthy criminals with high profile political connections gained through briberies doing their habitual shit and this is nothing new seeing them tooling extremists to make a whole lotta money and gain more power than they already have. East India Company, Triangular Trade, etc etc etc, were already working the same way and in the last centuries, hundreds of millions died without even knowing why… THIS is REAL-POLITIK and geopolitics! It’s all about the money. Any other reason we’re told about is a smokescreen. Now, it’d be much better that this usually interesting blog avoided to slip into an out of subject political rant. Frankly, if explaining i.e. geopolitics is totally OK with such a themed blog, I’m not sure that beginning to flirt with ideologies with potential derives to some extremism, no matter what they are, will be constructive. BTW, European extremists are even much more dangerous than the few loonies that have been brainwashed into blowing themselves with a explosive belt, here in Dar-el-Kuffar… Actually, there are much more chances ending assassinated by your spouse than getting killed by some terrorist too and even many many more to die in a car crash… I have long condemned the situation in Congo, long directed from the USA, and probably the genesis of the Rwandan civil war and genocide: Kagame, Rwanda’s dictator/president/civil war leader was friendly to the powers that be in the USA. See my “Book Hypocrisy @ Face Value”: https://wordpress.com/post/patriceayme.wordpress.com/10390 I will answer some of the very interesting rest when I find time… Another Day, Another Islamist Attack: Outlaw The Preaching! | Patrice Ayme's Thoughts Says: […] https://patriceayme.wordpress.com/2017/06/10/islam-religion-of-fighting-says-caliph/ […]
cc/2020-05/en_middle_0087.json.gz/line1338129
__label__cc
0.716012
0.283988
My questions for Christine Smith Posted in 2008 Elections, campaigns, Christine Smith, elections, Libertarian Party, politics, POTUS '08, Thinking of Denver 2008 on 2007.11.30| 6 Comments » Christine Smith put out a somewhat controversial essay which said that, unlike some other libertarians, she would not compromise principle. The first time I saw it was on the LP Radicals yahoo group, and given that I have recently volunteered to help the caucus members make more informed decisions about the various LP Presidential candidates, I thought of a few questions to ask. They have been up for several days, and I also since posted them on several other yahoo groups on which Christine Smith posted the same message. I am hoping that the candidate sees the questions and responds to them. Several people have said that she is not very good about getting back to people, but this is the first time I have personally tried to get a hold of her, so for now I will keep an open mind. I’m guessing she’s just been busy, so I hope maybe posting them here will help bring these questions to her attention. OK, here they are: I have gathered there are no issues on which you think the 2004 platform was too extreme. Is my understanding correct? If not, what do you think may have been too extreme? Are there any issues on which you think the 2004 platform was not libertarian enough? If so, what issues, and what was inadequate about Do you think the platform should be about the length of the 2004 platform or that of the 2006 platform? Somewhere in between? Longer than both? Shorter than both? What issues, if any, do you think are the most glaring omissions? When did you join the Libertarian Party? Prior to running for President, in what ways were you involved in the Libertarian Party or libertarian movement? What other libertarian movement groups have you been involved with, and what was the extent of your involvement? In what ways do you plan to be involved if you do not get the Presidential nomination? If you lose the Presidential nomination and are offered the VP nomination, would you consider it? Have you ever run for office with another party or as an independent candidate? If so, where and when, and for what office? Have your views changed during this campaign? If so, on what issues Do you plan to share all contacts your campaign generates with the national party? Would you characterize your present working relationship with LPHQ and/or LNC to be friendly or somewhat adversarial? Do you have any significant involvement in issue organizations or political coalitions which intersect with libertarianism but also include significant numbers of non-libertarians? (for instance, Steve Kubby has been active in medical marijuana legalization and the drug policy reform movement; George Phillies is active with his local ACLU chapter; Wayne Root claims he can reach out to internet gamblers on a large scale). Steve Gordon has criticized your position on the middle east wars, claiming that you said that you would evacuate the troops and leave their equipment behind. Is that an accurate description of your position? Do you believe the national party platform (past or present) would be adequate to serve as your campaign platform, or do you plan to have a separate campaign platform if you are nominated? Are there any innovative ways in which you hope your campaign will work to surpass all previous LP Presidential results, and what do you think your chances are of doing that? How much of an emphasis do you plan to put on working with local candidates and building state and local LPs? Ballot access? Youth and college outreach? Have you spoken to large crowds not just of libertarians? (For example, Steve Kubby spoke at Hempfest, estimated attendance 50,000, and I believe George Phillies said he spoke at MassCann, which is also a large legalization event). Also: have you played a significant role in passing any legislation that actually made people more free? (Steve Kubby helped write and pass prop 215, California’s medical marijuana law). As I mentioned, Steve Gordon also has some questions for Ms. Smith which he has been trying to get her to answer through several phone and email attempts for several days. Steve Kubby has some concerns, too. Hopefully we’ll hear back! Loretta Nall Sends Troy King Appropriate Sex Toy Posted in Uncategorized on 2007.11.17| 6 Comments » In the great state of Alabama, we are “blessed” with many weird, kinky, strangely sex-obsessed religious whackos, and many of them are bent on non-concensual bondage and domination through the legislative/law enforcement process. Southern Baptist minister, and good friend of Jerry Falwell, Gary Aldridge died in June of “accidental mechanical asphyxia” and was found hogtied and wearing two complete wet suits, including a face mask, diving gloves and slippers, rubberized underwear, a head mask, and a dildo with a condom on it in his ass. Other than a few aberrant cases like this, sex toys are usually safe, and most reasonable people would consider them to be a private matter, and certainly none of the government’s business. But reasonable people would not include the Alabama legislature, which in is great wisdom passed a law banning dildos, vibrators, and other weapons of mass stimulation. Not content with the law as it stands, Alabama Attorney General Troy King wants the legislature to make the law even more draconian. I remember Troy from college. He was always a little weird. He used to write frequent letters to the CW, which described in detail his disgust with homosexuals hooking up in public toilets (well before Larry Craig), a subject he seemed to be intimately familiar with, and exhorted readers to go eat at Cracker Barrel, which at the time was under fire for a policy of discriminating against having gay employees. Troy always seemed just a little too obsessed with homosexual perversion. He also often defended the shady antics of the machine, a secretive coalition of traditionally all-white fraternity and sorority members designed to influence campus politics (sometimes through violence and intimidation), founded by famous segregationist Lister Hill, and compared to “a cross between the KKK and the mafia” by a national magazine. Enter Loretta Nall. Vowing that Troy King can have her vibrator when he gets it from her cold, dead fingers (careful, Loretta…he might just be kinky like that), Loretta organized a campaign to send Troy some sex toys. Ultimately, she settled on an inflatable, penetratable, blow-up piglet. As Loretta explains, You gotta admit that Troy King has been begging for someone to slap him around a little bit for a very long time. This whole sex toy/anti-obscenity crusade he puts on is nothing more than a distraction from his failures as AG. The guy is a joke. Some people have asked me why I did it. Well, to humiliate King for starters. Of course, I never really expected it to get this much play. That seems to be a recurring theme with me. I was really just being a smart-ass again. Also, since the 11th circuit ruled that Alabamian’s do not have a constitutional right to sexual privacy (and King still says that isn’t enough) then we must have a constitutional right to sex publicly…right? Or do we not have a constitutional right to sex at all in the state of Alabama? If that is the case then somebody’s got some ‘splanin’ to do Since King wanted to make us the laughing stock of the nation AGAIN I figured a little table-turnin was in order. Some people have failed to understand the signifigance of me sending a pig to the AG. Yeah…I know that is really hard to believe. I almost feel like if they don’t get the pig symbolism then I shouldn’t bother to explain it because they probably wouldn’t be able to follow along anyway….but I will explain it just this once. Troy King is the top law enforcement officer in the state. Law enforcement officers are often referred to as ‘pigs’ by citizenry. Also, as I mentioned before I didn’t want to encourage Troy to breed outside his species by sending a human blow-up doll. I’ve also considered dressing up in a penis costume and attending the next press conference on this issue….however, I am afraid that in such a costume I might be mistaken for Troy King or any of the many dickheads that inhabit Montgomery, AL. The story has since been picked up by major media, including J. D. Crowe in the Mobile Press-Register who explains, The beauty of this gesture has my heart squealing with joy. If there’s anything I enjoy more than drawing uptight, arrogant authority figures in perverted attire, it’s drawing pigs. Any time I can shovel all my favorites into the same cartoon and still make some sort of editorial point is Birthday Cake Ice Cream. And since ToyBoy King has been in the news for allegedly targeting only Democrats for investigations, all this toon needed for a little smattering of significance was an abused inflatable donkey…excuse me while I lick the icing off my face. Troy has been unsually absent from the public eye since receiving Loretta’s gift, no doubt putting it to good use repeatedly. Just what you might expect from Troy and his like. The Government Agent in my Rearview Mirror Posted in Uncategorized on 2007.11.17| 41 Comments » By Steve Kubby FORT BRAGG, CA — The cream white American car in my rearview mirror has an “E” on the license plate, the official designation for California State agency vehicles. The driver exited my private road and then did a U turn when he saw me turn and head down my road. When I arrive at my gate, I leave my car and turn to meet the intruder. With an odd sort of smile on his face, he hands me an official envelope from the California Secretary of State. He tells me to have a nice day and quickly leaves. As I ponder what might be waiting for me inside the envelope, I reflect upon the overdose of government that has been my constant companion since helping to pass a law the police and prosecutors don’t like. For a moment, I am transported in my head back to a time when I found myself lying shivering and vomiting on the concrete floor of a freezing jail cell, wondering how any society can treat a cancer patient like this. Then I think about how my fellow activists and I answer to a higher authority. Whatever might be in the envelope will not change my determination to live free or die. Suddenly, I find myself energized by this realization that I will never give up and that I will fight for freedom with my last breath. I open the envelope and read the message from Debra Bowen, California Secretary of State. It is a letter of congratulations, informing me that my name will appear as a Libertarian candidate for President of the United States, on the California Primary Election Ballot, to be held February 5, 2008. So I will be on the ballot as the ultimate long shot for winning the Presidency. Those odds may be fearsome, but I remind myself that of all the candidates running, I am the only candidate who has done something that brought some freedom into people’s life, instead of robbing them of one right after another. Running for President and receiving a letter from the California Secretary of State should be a happy affair, but in these days of government poking its ugly nose into every aspect of our private lives, I find myself relieved, more than anything else, that I haven’t been accused of yet another bogus violation of their fraudulent legal system. Thomas Jefferson said: “When the people fear their government, there is tyranny; when the government fears the people, there is liberty.” Yeah, I’m going to be on the ballot and the government should be worried, very worried, because I have a bad attitude about government, especially the federal government. I will be speaking up for liberty on a national forum and telling people about how we must end this federal tyranny and finally live free. LP Radicals Antiwar Resolution Posted in antiwar on 2007.11.13| 101 Comments » This is a work in progress. The original (text in black) was written by Mike Renzulli and adopted by the LP of Arizona. We are working on a final version which we hope that LP National and all state and local parties adopt. WHEREAS American foreign policy should seek an America at peace with the world, and conduct foreign policy based on the enlightened principles of non-intervention as espoused by George Washington and Thomas Jefferson; and [Susan Hogarth] I also would leave out the references to George Washington (definitely) and Jefferson (maybe). Washington was no libertarian, and only looks like one because the crap in office now is so appalling they’d make Alexander Hamilton blush for shame. WHEREAS the United States government should return to its historical libertarian tradition of avoiding entangling alliances, foreign quarrels and imperialist adventures, while recognizing the natural right to unrestricted trade and travel; and WHEREAS the United States has intervened in the affairs of Iraq and Afghanistan, nations that neither directly attacked nor threatened America, and our invasion of their sovereign territories is an attempt to impose our values on people in other lands; and WHEREAS such overt hostilities are immoral and contrary to the principles of the philosophy of libertarianism and the Libertarian Party; and THEREFORE, BE IT RESOLVED that the Libertarian Party of the United States demands that the President of the United States and U.S. Congress act to immediately end the occupations of Iraq and Afghanistan; and BE IT FURTHER RESOLVED that the Armed Forces of the United States have the full support of the Libertarian Party of the United States. We believe that the immediate withdrawal of U.S. forces will better ensure their safety and create a more manageable situation for the governments of Iraq and Afghanistan to maintain civil order; and I also am not a fan of the ‘we support the troops’ language. I PITY them (on a good day), but I damned sure don’t SUPPORT them. They are engaged – willingly! – in unlawful and immoral acts!!! Let’s stop this pandering to warmongerers. BE IT FURTHER RESOLVED that the Libertarian Party of the United States calls upon the United States Congress to impeach President George W. Bush for lying to the American public about the reasons for invading Iraq and Afghanistan; violating the War Crimes Act of 1996, the 4th, 5th, 6th and 8th Amendments of the Bill of Rights and Article 1 Sections 8 & 9 of the United States Constitution by allowing the illegal surveillance of American citizens; approving the illegal torturing of prisoners of war; sanctioning the holding of prisoners of war without formal charges, legal representation or a trial by jury; invading sovereign countries without a Congressional declaration of war and illegally using government funds for domestic political propaganda related to the war on drugs; and BE IT FURTHER RESOLVED we also call for the cessation of covert or military activities of the United States government geared towards directly or indirectly provoking hostilities with the Republic of Iran. BE IT FURTHER RESOLVED the passage of this resolution will be communicated by the Secretary of the Libertarian Party of the United States to the President and Vice President of the United States, the heads of both Congressional chambers and all major national news media outlets. Starchild: Not Guilty Posted in starchild, Uncategorized on 2007.11.08| 28 Comments » Posted on CALibs yahoo group. As some of you may have heard, the jury in my prostitution case came back with a unanimous verdict yesterday, after a little less than three hours of deliberation: Not Guilty! Needless to say, I and all the folks who were there to support me were very happy. Once we had a jury selected, a process that took all of last week, things went pretty rapidly. The actual trial started Monday with the opening arguments, followed by the testimony of Officer Heather Fox, the Fremont Police vice cop who lied and pretended to be a client in order to lure me into this entrapment. I do feel she was honest in her testimony about the events, though I have serious doubts about her testimony when we recalled her outside the presence of the jury. District Attorney Suzanne Simpkins was required by law to turn over to us any documents the police had relating to this arrest or to undercover sting operations in general, and she told us there were no such documents. On the witness stand however, Officer Fox mentioned being given about a week prior to the arrest a list of slang terms used on the Internet, for help in deciphering ads such as mine. Even judge Keith Fudenna, who was no friend to me or to justice during most of this case, appeared to agree that this would have been covered under the discovery request. But when we were able to query Officer Fox about it, she (1) said that she no longer had a copy of the document, (2) did not know whether any other officers were given copies of the document, (3) did not know whether the Fremont Police Department still had the document, and (4) reaffirmed the D.A.’s previous contention that the FPD does not have any written policies, procedures or documents relating to undercover sting operations. I think this was a pack of lies, especially #4 which is just not credible, but unfortunately there appears to be little we can do to prove it, since the judge did not press them on it. The D.A. surprised us by calling no further witnesses after Officer Fox, so the following morning I testified in my own defense, followed by a client of mine who was good enough to volunteer to come forward and testify as a character witness. After both attorneys got to ask all their questions of the various witnesses, they gave their closing arguments. Erica’s closing argument was terrific, one of the strongest parts of her whole performance on this case, for which I already give her high marks. I would strongly recommend her as a criminal defense attorney to anyone who might be in need of one. While it got off to a rocky start when the judge prohibited her from talking about the Fremont police chief’s memo to the community letting people know the department would no longer investigate burglar alarms unless there was a verified problem, and was cutting back on auto theft, robbery, and street crime investigations, all due to an alleged lack of resources — “alleged” because they seemed to have no lack of resources for entrapping prostitutes on the Internet for intending to engage in sexual activities among consenting adults — it was all uphill from there. Erica demolished the contention that the cop saying “OK, that works” in response to hearing my rates for time which could include “being fucked” meant that we had an actual agreement, noting that if you go to Best Buy and a salesman is telling you about various TVs and how much they cost, and you say “OK, that works” but nothing subsequently happens such as you taking a TV to the register, it does not mean that you have committed to purchasing one. She also recounted a recent phone conversation in which someone from the D.A.’s office in San Francisco had called her and let her know that some motions would be filed, and she said “OK.” Then when she was in court, the D.A. tried to say Erica had not objected to these motions, but as Erica explained, she was simply acknowledging the D.A.’s statement, not agreeing to what was being stated. I suspect that these personal, common-sense examples had a powerful effect on the jury. The juror who had been the foreman (Charlie Messinger, who happens to be an elected member of the Newark School Board) and stayed around to talk with a few of us after the trial concluded yesterday afternoon, confirmed this, saying that the jurors felt my attorney Erica Franklin was very persuasive in explaining how no actual crime was committed, and how the D.A. had not proved the three elements she needed to prove for them to convict (intent, an agreement, and an act in furtherance). More soberingly however, he also added words to the effect of “there might have been a crime if they’d waited another 10 minutes before making the arrest.” He also told us the jury felt I was likable and honest in my testimony. He said that when I mentioned that I would have had sex with the two female vice cops for free, he said “us four guys in the back were all going ‘Me too!'” The conversation was a pointed indication that despite the favorable verdict, I could have easily been convicted if the circumstances of the case had been only very slightly different in any number of different specifics. I do not think the jurors “got it” as far as understanding that prostitution is not a real crime, or that this arrest was a travesty and an injustice from the get-go. Messinger said he had never heard of FIJA (the Fully Informed Jury Association), and appeared to be unaware of jury nullification (I talked about it a little bit, and wrote down FIJA’s website for him — http://www.FIJA.org). Clearly more public education in these matters is desperately needed. Meanwhile however, those of us who believe in freedom can savor this hard-earned VICTORY! It is the best outcome I could have realistically hoped for, and justice was at least partially served — the police and D.A.’s office will not face any penalties for violating my rights, and I’m still out a few thousand dollars and many hours of my life plus the small amount of property I believe the cops stole from me when I was arrested, but at least I have the satisfaction of knowing that the Fremont authorities put in a substantial amount of time, money and resources into this, and after nearly two years came away totally empty-handed except for the taxpayer money that they are all sucking up as a normal part of their jobs. I want to get a copy of the transcript of this trial and put it on the Internet for the benefit of sex workers and others who may have to fight such injustices in the future and could be helped by knowing more details, but I have learned that obtaining it will mean paying the court reporter $2.50 per page, or a total of several hundred dollars more, despite the fact that as the official record of a public trial it should be public information. Just one more way the system is designed to rip people off! If you have not already supported me with a donation or your presence or both, a small contribution toward covering this last expense would be most welcome. Likewise I will also be publishing the various motions we filed in this case, as well as the details of my police report, the transcript of the undercover tape the cops made of the arrest, and whatever other info I can get out there (minus only a few details of personal information such as my driver’s license number and so on that I will redact). If anyone has any specific questions or comments about this case, please feel free to email me or call me while it’s relatively fresh in my memory and I will be happy to give you more details, at least until I get tired of recounting them. 8) Love & Liberty, ((( starchild ))) Posted in energy independence on 2007.11.08| 16 Comments » I don’t comment at TPW anymore. However, occasionally I still read the conversations there. On one thread someone claimed that energy independence has to, in every case, be government mandated. Naturally, I disagree. In fact, I believe big government is currently responsible for a lack of energy independence. How so? Here are just a few of the ways. Corporate personhood and non-concensual limited liability. By shielding polluting petrochemical corporations from legal responsibility, the regime gives them an unnatural advantage over cleaner alternatives. Corporate welfare. Large, established corporations line up at the trough to receive billions of dollars of stolen tax loot; petrocorps are no exception. Military-industrial complex. Sure, plundering the Middle East’s oil is not the only reason why the Bush gang has plunked half a trillion dollars of your money into a sand hole. But do you really think it wasn’t one of the reasons? Interstate highway system. A big government incentive to sprawl, along with others such as subsidized utility extensions, clearing of inner city neighborhoods in the name of urban renewal, occupational licensing and taxes and regulations making mass transportation and taxis less affordable, and many others. Speaking of taxes and regulations there are insufferable multitudes of them, and they keep innovative new startups – such as those which might develop alternative forms of energy in a free market – from ever getting off the ground and competing with the established big players on an even field. Big corporations have lobbyists who help tailor the regulations, lawyers and accountants to keep them in compliance and fill out the paperwork, money to make regulators look the other way or pay fines if and when absolutely necessary, and more. Small new companies are at a distinct disadvantage in this arena. Marijuana prohibition has been used as a rationale to keep industrial hemp from being cultivated, even though it can’t get you high (unlike gasoline, which can fuck you up if you huff it) and has many promising uses, including as fuel. Other government disincentives to venture capital and entrepreneurship include the social security pyramid scheme and linkage of employment to health insurance. The latter parlays with regime intervention in the health care market, which has caused a price spiral. Not a complete list by any means, but there you are. Massachusetts End the Income Tax Amendment I’m up in Massachusetts working on the End The Income Tax petition, as well as marijuana decriminalization. The End the Income Tax campaign has asked me to see if anyone is interested in coming in to Massachusetts for the last week or so of the signature gathering. End the income tax is paying $1.50 a signature, and marijuana decrim is paying $2.00 a signature. I’ve been having most people sign both. The campaign has room to house at least one more person, and travel costs are negotiable. They are also looking for donations. You can call 508-358-4247 or email info@smallgovernmentact.org
cc/2020-05/en_middle_0087.json.gz/line1338130
__label__cc
0.569037
0.430963
Gender Gap: Where do Indian Women figure in the World? Women Paycheck Women Paycheck Articles Gender Gap: Where do Indian Women figure in the World? Article describes working life of Indian women, gender gap, salary information, compensation, average salary and discrimination against women in India. https://paycheck.in/career-tips/women-paycheck/articles/gender-gap-where-do-indian-women-figure-in-the https://paycheck.in/@@site-logo/wageindicator.png Article describes working life of Indian women, gender gap, salary information, compensation, average salary and discrimination against women in India. Emerging global giant India treats its women poorly. As a result, the country has created a huge gap between men and women in economic participation, education, political empowerment and health. Jobs and salaries are a part of the critical factors that determine the Gender Gap. According to the World Economic Forum, India ranks a low 98 in a list of 115 countries as far as the Gender Gap is concerned. It prepared the list last year (2006), along with the London School of Economics and Harvard University. While no country in the world has achieved 100 % equality between men and women, only Sweden, Norway, Finland, and Iceland have closed the Gender Gap by about 80 %. While India ranks 98 among 115 countries in Gender Gap, China ranks better at the 63rd position. So, what does the survey mean to the working woman in India? Quite simply put, India is growing stronger economically, but the fruits of development are not shared equally. Men and women are not equal at the work place. It means that pay and position are not the same for both. As a woman, are you getting what a man would? Tell us how much you earn, so that we can tell you the truth about Gender Gap at work. Also Check: Other Women Paycheck Articles MonsterIndia.com supports Paycheck.in Career Cite this page © WageIndicator 2020 - Paycheck.in - Gender Gap: Where do Indian Women figure in the World?
cc/2020-05/en_middle_0087.json.gz/line1338132
__label__wiki
0.510062
0.510062
Soundtrack Details Register or log in to rate this soundtrack! Couldn't find your soundtrack in the database? Tell us about it and maybe we will add it. Buy from CD and LP.com Go to the Internet Movie Database Laserdisc Database Buy posters from Allposters.com buy posters from moviegoods buy this soundtrack from cdandlp.com Search eBay for Airplane! (1980) Flying High (1980) Buy it at: Total number of members who have this title in their: Collection: 380 Wish list: 33 There are 4 labels for this title. There is 1 bootleg for this title. There are 3 compilation albums for this title. Update this title Add new label to this title Image supplied by Wilson Maffetano Astor Records ALPS1065 Members who have this label in their: Collection: 1 Wish list: 0 Update this label Enter a track listing La-La Land Records LLLCD 1093 8-2692-41093-2-8 Limited edition of 3000 copies. Including a 20 page booklet. 1. Main Title (01:54) Contains "Theme from Jaws" by John Williams, Duchess Music Corporation (BMI) 2. Kiss Off (00:48) 3. Ambulance Arrives* (00:32) *track not contained in film 4. Hari Krishna / Ticket / Nervous** (02:45) **contains music not used in film 5. Lisa / Farewell / Take Off** / Another Meeting (03:18) 6. Fighting Girls (00:47) 7. Love Theme from AIRPLANE! (01:07) 8. From Here to There (02:08) 9. Head / Memory (01:14) 10. Shimmer / Molumbo (01:02) 11. Zip / Eggs / Roger, Take Over (02:34) 12. Wild Violins / Sickness / Idea (02:26) 13. Thar She Blows! / Flash / Panel (02:23) 14. "Where the Hell is Kramer?"* / Trouble (01:02) 15. Mayday (00:56) 16. Punch-Up / Kramer (01:14) 17. Clumsy (00:56) 18. Dog Fight / Failure / Pep Talk / Notre Dame Victory March / Master (03:45) Contains "Notre Dame Victory March" by Michael J. Shea, J.H. O'Donnell & John F. Shea, Edwin H. Morris & Co., a division of MPL Communications, Inc. (ASCAP) 19. News (00:56) 20. "Runway is Niner"* / "The Gear is Down and We're Ready to Land"** (01:03) *track not contained in film, **contains music not used in film 21. Crasher (04:02) 22. Resolution / Tag (01:52) Contains "1812 Overture, Op. 49" by Peter Tchaikovsky 23. Notre Dame Victory March (02:01) Michael J. Shea, J.H. O'Donnell & John F. Shea 24. Tavern (00:35) 25. Everything's Coming Up Roses* (00:20) *track not contained in film, (Stephen Sondheim and Jule Steyn, Arr. Elmer Bernstein)Chappell & Co., Inc. (ASCAP) 26. Instruments (00:13) 27. Disco** (00:31) 28. Kiss Off (Alternate)* (00:47) 29. Fighting Girls (Alternate)* (00:44) 30. From Here to There (Instrumental) (02:08) 31. Molumbo (Alternate)* (00:52) 32. Zip (Original Version) (00:32) 33. News (Alternates)* (01:49) 34. Dog Fight (Short Version) (00:37) 35. "Runway is Niner" (Alternate)* (00:31) 36. "The Gear is Down and We�re Ready to Land" (Alternate)* (00:30) 37. Tag (Instrumental) (01:15) Track listing contributed by JuPe s.tonkens Regency RY 9601 Regency WEAN 58309 1. Side 1 (17:06) Contains 1. Theme From Jaws (John Williams) 2. Stayin' Alive (Bee Gees) 3. Everything's Coming Up Roses (Stephen Sondheim) 4. River Of Jordan (Peter Yarrow) Contains 1. Notre Dame Victory March (Michael Shea, J.H. O'Donnell/John Shea) 2. Love Theme From Airplane (Elmer Bernstein) Track listing contributed by Piet van de Merwe Jaws 80.78.97 Also contains music from: 1. No Title (02:28) Tracks #1 - #16 Are From "Airplane!" 10. No Title (03:17) 17. Suite #1 (07:21) Track listing contributed by Corey Caudill Colosseum VSD (CVS) 6704 High And The Mighty, The Those Magnificent Men In Their Flying Machines, Or How I Flew From London To Paris In 25 hours 11 mi Boy Who Could Fly, The First Of The Few, The Spirit Of St. Louis, The Great Waldo Pepper, The Last Starfighter, The Tuskegee Airmen, The This label refers to the following compilation album: High And The Mighty - A Century Of Flight, The 1. THE HIGH AND THE MIGHTY: Suite (06:46) Composed by Dimitri Tiomkin 2. THOSE MAGNIFICENT MEN IN THEIR FLYING MACHINES: Suite (04:58) Composed by Ron Goodwin 3. THE BOY THAT COULD FLY: Main Theme (03:03) Composed by Bruce Broughton 4. SPITFIRE: Prelude (04:24) Composed by Sir William Walton 5. SPITFIRE: Fugue (04:18) 6. ET THE EXTRATERRESTRIAL: Flying Theme (04:01) Composed by John Williams 7. THE SPIRIT OF ST.LOUIS: Ireland (04:20) Composed by Franz Waxman 8. THE GREAT WALDO PEPPER: March (02:24) Composed by Henry Mancini 9. OUT OF AFRICA: Flying Over Africa (06:20) Composed by John Barry 10. 633 SQUADRON: Main Title (03:05) 11. AIRPLANE!: Suite (04:39) Composed by Elmer Bernstein 12. THE LAST STARFIGHTER: Main Title (03:16) Composed by Craig Safan 13. THE TUSKEGEE AIRMEN: Suite (05:18) Composed by Lee Holdridge 14. STAR TREK THE MOTION PICTURE: End Credits (03:56) Composed by Jerry Goldsmith 15. A Century of Flight (05:24) Composed by Brian Shyer Track listing contributed by Wilson Maffetano 2 CD's. Magnificent Seven, The Buccaneer, The American Werewolf In London, An Age Of Innocence, The Comancheros, The Johnny Staccato Hollywood And The Stars Zulu Dawn Great Escape, The Man With The Golden Arm, The Sons Of Katie Elder, The Shootist, The Birdman Of Alcatraz Hallelujah Trail, The Bridge At Remagen, The Scalphunters, The Ten Commandments, The Essential Elmer Bernstein Film Music Collection, The Disc/Cassette 1 1. The Magnificent Seven (04:53) Conducted by: James Fitzpatrick 2. To Kill A Mockingbird - Suite (08:22) 3. The Buccaneer - Overture (03:30) Conducted by: Paul Bateman 4. Walk On The Wild Side (04:33) The National Youth Jazz Orchestra, conducted by: Bill Ashton 5. An American Werewolf In London - Metamorphosis (05:06) Conducted by: James Fitzpatrick / Premiere recording 6. The Age Of Innocence - End Titles (04:25) 7. The Comancheros (02:38) Conducted by: Nic Raine 8. Ghostbusters (03:12) 9. Heavy Metal - Taarna's Theme (05:36) 10. Johnny Staccato (03:22) The Daniel Caine Orchestra, conducted by: Daniel Caine 11. True Grit - Rooster Cogburn / A Warm Wrap-Up (04:39) 12. Hollywood And The Stars (02:06) 13. Zulu Dawn - River Crossing (04:28) 1. The Great Escape (02:18) 2. The Man With The Golden Arm (05:25) 3. Far From Heaven (05:56) 4. The Sons Of Katie Elder (02:13) 5. Airplane - Suite (04:28) Conducted by: Nic Raine / Crouch End Festival Chorus (Choir Master: David Temple) / Premiere recording 6. The Shootist - Main Title (03:21) 7. Hawaii - Overture (04:18) 8. The Birdman Of Alcatraz - Finale (02:43) 9. The Hallelujah Trail - Overture (06:15) Conducted by: Nic Raine / Crouch End Festival Chorus (Choir Master: David Temple) 10. The Bridge At Remagen (02:30) 11. Thoroughly Modern Millie - Sky-Hi (02:44) 12. The Scalphunters (02:53) 13. The Ten Commandments - Overture (07:54) Track listing contributed by Mitch Castle Varese Sarabande 302 066 704 2 1. The High And The Mighty- Suite (06:46) Dimitri Tiomkin 2. Those Magnificent Men In Their Flying Machines - Suite (04:58) 3. The Boy Who Could Fly - Main Theme (03:03) 4. Spitfire - Prelude (04:24) Sir William Walton 5. Spitfire - Fugue (04:18) 6. E.T. The Extraterrestrial - Flying (04:01) 7. The Spirit Of St. Louis - Ireland (04:20) 8. The Great Waldo Pepper - March (02:24) 9. Out Of Africa - Flying Over Africa (06:20) 10. 633 Squadron - Main Title (03:05) 11. Airplane - Suite (04:39) 12. The Last Starfighter - Main Title (03:16) Craig Safan 13. The Tuskegee Airmen - Suite (05:18) Lee Holdridge 14. Star Trek: The Motion Picture - End Credits (03:56) Brian Shyer Track listing contributed by micjo197 If you know of another release, why don't you tell us about it, so we can add it to our database.
cc/2020-05/en_middle_0087.json.gz/line1338139
__label__cc
0.608111
0.391889
Select category Black & White (1) Jenn Fletcher, BlondeShot Creative blondeshotcreative@gmail.com http://blondeshotcreative.com Professionally trained, award-winning, and internationally exhibited photographer and artist wit... MWT Photography Photography Black & White mt@mwtphotography.com https://www.mwtphotography.com/ "I feel it is in the heart, not the eye that should determine the content of the photograph. What... The Art of the Image - Nathan Dean Photography nathan@nwdphoto.com http://www.nwdphoto.com Nathan Dean is a fine art photographer whose taut and elegant compositions have been shown in gal... Johnny Crawford Jcrawfordajc@gmail.com https://www.johnnycrawfordphotography.com/index Johnny Crawford is a visual storyteller and educator based in Atlanta, Georgia, who has documente... Kelley Krohnert kelley@kelleykphotography.com http://www.kelleykphotography.com I am a portrait and fine art photographer based in Smyrna. In addition to my portrait business, I... Patricia Scott & Tom Scott Photography Pottery pbstjs@hotmail.com http://www.pbstjsinteriors.com Patricia is a GA State registered interior designer and member of ASID, clay artist, & photog...
cc/2020-05/en_middle_0087.json.gz/line1338140
__label__wiki
0.762719
0.762719
Articles ft. Sports RadioArticles ft. TelevisionArticles ft. the AvalancheArticles ft. the Nuggets Altitude Sports and Entertainment Television was launched fifteen years ago today; September 4, 2004. The regional sports network was built by Kroenke Sports Enterprises to compete with what was then Fox Sports Net Rocky Mountain (now AT&T Sports Net) and to provide company-prepared coverage of KSE’s local squads – the Nuggets, Avalanche, Rapids and Mammoth. In 2015 Kroenke Sports Enterprises continued its ascent of the regional media mountain when announced the creation of a new subsidiary, KSE Radio Ventures, to purchase three Denver-area radio stations from Wilks Broadcast Group. Those stations were KIMN (Mix 100), KXKL (Kool 105) and KWOF. the call letters of the latter would be changed to KKSE and the signal, 92.5 FM would become Altitude Sports Radio to provide KSE with a radio outlet with which to present game broadcasts as well as sports talk with a particular focus on discussing and promoting the KSE teams. Both Altitude television and Altitude Sports Radio have done an exemplary job with sports programming in the Denver market. The talent these outlets have assembled has been second-to-none since their inceptions and have only continued to grow and get better. Altitude TV currently features Scott Hastings, Chris Marlow, Katie Winge, Bill Hanzlik, Chris Dempsey, Todd Romero and Vic Lombardi on the Nuggets beat and Mark Moser, Mark Rycroft, Kyle Keefe, John Michael-Liles and Peter McNab handling Avalanche broadcasts with Marcelo Balboa and Richard Fleming presenting the Rapids. That’s an all-star crew for a regional sports network. Clearly, the pursuit of Altitude Sports and Entertainment Television is to deliver first-rate sports broadcasting for its viewers. An assemblage of talent that deep is rarely found – even in much bigger markets. Altitude Sports Radio hasn’t cut corners with its product, either. Sharing some big name talent from the television side, KKSE offers a strong lineup from morning through night on weekdays with the Vic Lombardi show in the morning (featuring Mark Moser and Brett Kane), Ryan Harris, Scott Hastings and Josh Dover mid-day, Nate Kreckman and Andy Lindahl in afternoon Drive and Mark Bertagnolli in the evenings. Altitude radio offers competitive and entertaining programming in all time slots. Sports fans in Colorado have come to cherish Altitude – both the television version and the radio version. But is it all downhill from here for this beloved regional sports network? It’s well documented that the TV network is in a fight for its life with the three biggest cable and satellite providers, Comcast, DirecTV and Dish Network. Somehow the network allowed it’s broadcast agreements with all of them to expire at the same time which has left it with little to no leverage as these massive providers seemingly collude to water down Altitude’s value and force the network into accepting less favorable terms and less money. Altitude wishes to remain part of each carrier’s basic package and continue to be brought into all subscriber households while the carriers want Altitude to accept an “eat what you kill” type of deal that would relegate the regional sports network into a special sports tier that subscribers will be forced to pay extra for. AT&T Sportsnet Rocky Mountain is currently available as part of such a tier. In the wake of the well-documented clash on the TV side come whispers that Kroenke Sports Enterprises is looking to divest its radio interests. According to two sources close to the situation Altitude Sports Radio (along with KOOL 105 and MIX 100) are for sale. Potential buyers include conglomerates Entercom Entertainment and Bonneville International. FCC rules limiting the number of stations a company can operate in the same market have been in the crosshairs of deregulation for some time. A relaxing of those rules would open the door to one of these companies to purchase KSE’s stations. Bonneville International, which owns 104.3 the Fan (among several other properties) could potentially become the new parent company of Altitude radio. If it were to it would stand to reason that it would not want to compete with itself in the sports talk realm. In that instance it’s likely that Avalanche, Nuggets and Rapids play-by-play would be relegated to one of the company’s lesser signals while the sports talk aspect of Altitude radio would simply cease to exist. It’s also very possible that Altitude Sports and Entertainment Television may cease to exist. One distinctly possible (if not somewhat likely) outcome of the network’s battle with the cable and satellite carriers would be for it to be absorbed by AT&T Sports Net Rocky Mountain. That outlet currently only carries the Rockies and lacks programming altogether six months out of the year. AT&T owns DirecTV as well as regional sports networks from coast to coast – most of which are currently offered as part of an elective sports “tier” for which subscribers pay extra in the fashion the cable outlets want Altitude viewers to. The model is already in place. Were AT&T to take on the Avalanche, Nuggets, Rapids and Mammoth they would probably also bring in much of the on-camera talent that currently resides at Altitude TV – but certainly not all of it. This would mean massive job losses, make no mistake about it. Producers, directors, camera people, sound people and all kinds of workers behind the scenes would be jettisoned. It’s a worst case scenario – both for the people at Altitude AND for fans of Denver sports. But it makes a ton of sense. It also makes a ton of sense that KSE Radio Ventures is attempting to sell off its radio interests. The radio business is really tough and KSE came into it with no experience operating stations. Stan Kroenke is a proud man and he doesn’t give up easily but he’s also a rich man and he is not in the habit of losing money – at least not for long. Look, I don’t want any of this to happen. I want to wake up tomorrow morning, read that Altitude TV has come to terms with the carriers and then flip on the Vic Lombardi show on 92.5 FM and have a chuckle with Vic, Mos and the boys. I don’t want anything to change. I love Altitude sports. I love everything about it. I love the radio station and I love the television station. But I have been covering the sports media in Denver long enough to know that nothing stays the same. It’s like Denver weather. Sometimes it’s sunny and then it just starts raining. Right now it’s pouring and the folks at Altitude are praying the sun comes out again. Here’s wishing the best to all of the wonderful people both on and off air who make Altitude sports such a wonderful asset to the Denver sports community. Here’s hoping that it’s not all downhill from here. Tagged as 104.3 the fan, altitude, altitude radio, at&t, at&t sports net, avalanche, bonneville international, comcast, directv, dish network, entercom, katie winge, kkse, mark moser, mark rycroft, nuggets, radio, rapids, scott hastings, TV, vic lombardi. Radio Row: Will Orange and Blue 760 survive to see football season? Colin D. | April 23, 2019 Radio Row: First Nalen, now another former Broncos joins the lineup at...
cc/2020-05/en_middle_0087.json.gz/line1338143
__label__cc
0.725372
0.274628
Get News & Updates: The Columbia Studio Recordings (1964-1970) Track Number: And here’s to you, Mrs. Robinson Jesus loves you more than you will know, wo wo wo God bless you please, Mrs. Robinson Heaven holds a place for those who pray, hey hey hey We’d like to know a little bit about you for our files We’d like to help you learn to help yourself Look around you, all you see are sympathetic eyes Stroll around the grounds until you feel at home Hide it in a hiding place where no one ever goes Put it in your pantry with your cupcakes It’s a little secret, just the Robinsons’ affair Most of all, you’ve got to hide it from the kids Coo coo ca-choo, Mrs. Robinson Sitting on a sofa on a Sunday afternoon Going to the candidates’ depate Laugh about it, shout about it When you’ve got to choose Where have you gone, Joe DiMaggio? A nation turns its lonely eyes to you, wo wo wo What’s that you say, Mrs. Robinson ‘Joltin Joe’ has left and gone away, hey hey hey Simon & Garfunkel Music The Complete Columbia Albums Collection (Vinyl) The Concert In Central Park (CD/DVD & Vinyl) The Complete Albums Collection Bridge Over Troubled Water: 40th Anniversary Edition The Essential Simon & Garfunkel Live From New York City, 1967 iTunes/Google Play Simon And Garfunkel’s Greatest Hits Wednesday Morning, 3 A.M. The Concert In… The Complete Albums… Bridge Over… The Essential Simon… ..view all albums » Send Us Feedback | Privacy Policy/Your Privacy Rights | Terms and Conditions | Why Music Matters
cc/2020-05/en_middle_0087.json.gz/line1338149
__label__wiki
0.574385
0.574385
27341 All 10 Adult 642 Animation 511 Biography 3092 Comedy 1505 Crime 729 Documentary 4843 Drama 865 Family 942 Fantasy 22 Film-Noir 2 Game-Show 1608 Horror 221 Musical 825 Mystery 60 Reality-TV 1519 Romance 1104 Sci-Fi 17 Talk-Show 3071 Thriller 446 War by IMDb rating 17 Sep 2016, USA #FollowFriday 20 Dec 2015, USA #Horror 11 Jan 2009, USA $5 a Day 14 Jan 2014, USA $50K and a Call Girl: A Love Story 23 Feb 2010, Israel $9.99 27 Feb 2015, UK '71 26 Sep 1986, Australia 'Crocodile' Dundee 08 Dec 1974, USA 'Twas the Night Before Christmas 01 Oct 2011, USA 'Weird Al' Yankovic Live!: The Alpocalypse Tour 17 Jan 2009, USA (500) Days of Summer 16 Aug 2010, USA (Alien vs. Predator) AVP Redemption 23 Oct 2009, USA (Untitled) 18 Dec 1987, USA *batteries not included 10 Dec 2013, USA +1 (Plus One) 19 Oct 1979, USA ...And Justice for All. 05 Oct 1979, USA 10 24 Jul 2015, USA 10 Cent Pistol 11 Mar 2016, USA 10 Cloverfield Lane 27 Sep 2019, Canada 10 Minutes Gone 09 Sep 2013, USA 10 Rules for Sleeping Around 31 Mar 1999, USA 10 Things I Hate About You 05 Oct 2012, USA 10 Years (Ten Year) 07 Mar 2008, USA 10,000 BC 14 Aug 2015, USA 10,000 Saints (Ten Thousand Saints) 28 Jun 2013, Australia 100 Bloody Acres 13 Apr 2013, USA 100 Degrees Below Zero 20 Oct 2009, USA 100 Feet 31 Jul 2012, USA 100 Ghost Street: The Return of Richard Speck 10 Mar 2017, Spain 100 metros 13 Jan 2017, UK 100 Streets 06 May 2011, India 100% Love 29 Dec 2016, Germany 1000 Mexicans 21 Apr 2006, USA 10th & Wolf 11 Nov 2011, USA 11-11-11 01 Nov 2011, USA 11/11/11 22 Jul 2014, USA 112 Weddings 11 Oct 2005, USA 11:14 04 Mar 2009, Russia 12 14 Apr 1957, USA 12 Angry Men 19 Jun 2017, USA 12 Feet Deep (The Deep End) 26 Nov 2015, USA 12 Gifts of Christmas 31 Jan 2014, USA 12 OClock Boys 27 Mar 2009, USA 12 Rounds 04 Jun 2013, USA 12 Rounds 2: Reloaded 11 Sep 2015, USA 12 Rounds 3: Lockdown 25 Jan 2019, Japan 12 Suicidal Teens 08 Nov 2013, USA 12 Years a Slave 04 Sep 2010, USA 127 Hours 08 Nov 2011, USA 13 02 Jul 2011, Japan 13 Assassins Movie facts: computers or laptops give the simplest approach to individuals to Streaming Movies Online and Watch Movies Online and subsequently, they have gotten to be progressively prominent among them as of late on the grounds that they assume an imperative part in empowering them to dodge the need to pay enormous aggregates of cash so as to watch their most loved motion pictures. You Tube, which is a site that makes the HD online streaming movies conceivable, has ended up being the most ideal route for individuals who affection to HD Streaming Films Online and Watch Movies Online and subsequently, it has turned into the top decision among all the numerous ways that are accessible. You Tube assumes a crucial part in empowering individuals to not just transfer a wide mixture of features, for example, creatures, web tips, tunes, excercises, music and considerably all the more yet it additionally makes it feasible for them to watch these features by streaming them. Despite the fact that the utilization of You Tube needs a great deal of imagination from the individuals who use it to Watch HD Films Online, it is the first choice of its kind to permit them to do so free. Consequently, it is fitting for the individuals who use it to guarantee that they search for the most suitable magic words to procure greatest profits when viewing their motion pictures on their machine screens. You Tube normally works by showing up features that match the catchphrases that individuals who Streaming Movies Online and Watch Films Online enter since it can offer them fitting web search tools that make it workable for them to sort the watchwords that match whatever they want to see. Despite the fact that there are a large number of alternatives that make it workable for individuals to have a good time by viewing films on the web, You Tube is the most prevalent in light of the fact that it offers extra streaming profits for features and music features. All the more essentially, this streaming website,which empowers individuals to watch films that they have for a long while been itching to see for a long time while doing different exercises, for example, sitting in their front rooms or going by transport, has turned into the most helpful decision for them since they can do so anyplace, whenever. This is on account of all that is important to accomplish this goal is the Internet, which has made in unnecessary for them to sit in gathered motion picture theaters. The Internet, which empowers individuals to send messages to their companions effortlessly, makes the procedure of HD online streaming movies and Watch Movies Online much simpler and hence, it is changing the day by day propensities of a huge number of individuals over the world, for example, correspondence and the viewing of motion pictures and TV in a progressive way.
cc/2020-05/en_middle_0087.json.gz/line1338150
__label__wiki
0.568368
0.568368
The 1998 Lee Atwater Invitational Dead Pool Darrell Clauson This list was submitted by USER02926 for The 1998 Lee Atwater Invitational Dead Pool. 10 Milton Berle March 27th, 2002 93 9 Pope John Paul II April 2nd, 2005 84 8 Robert Young July 21st, 1998 ? 7 Glenn Ford August 30th, 2006 90 6 Victor Mature August 4th, 1999 ? 5 Lady Bird Johnson July 11th, 2007 94 4 Al Lewis February 3rd, 2006 82 3 Johnny Cash September 12th, 2003 71 2 Bob Hope July 27th, 2003 100 1 Strom Thurmond June 26th, 2003 100 8 points 1 hit The oldest and most celebrated brothel owner in history. It's said that she once gave Confucius a hand-job. (d) October 23rd, 2003
cc/2020-05/en_middle_0087.json.gz/line1338157
__label__wiki
0.94217
0.94217
City Entertainment Cut Through The Noise Music Reviews School clubs and activities Features Columns Meet the Athlete ‘Rare’ shows new side of Selena Gomez Third solo album expresses confidence, love Fair use from Interscope Records: Cover album for "Rare" by Selena Gomez. Sadie Yarosh Selena Gomez’s newest album “Rare” released Jan. 10 is an upbeat, joyful album that will make you want to get out of your seat and dance. Five years since her last album, Gomez comes back a new person. There have been many obstacles she has had to overcome including heartbreak, depression and surgeries. She found a way to escape that dark feeling, which has contributed to the themes prevalent in this album: confidence and self-love. The opening song “Rare” talks about how there is no need for someone in your life who doesn’t appreciate your true self. Each individual is unique and has the freedom to express themselves in any way possible. Gomez does a great job addressing her own opinion and is not afraid of what others think. The beats used are catchy and very positive, which completes the song. “Dance Again” is an optimistic, cheerful song that expresses self-confidence. Gomez sings about not letting negativity bring her down, but rather using it as motivation to become even better. She lets go of all that she has struggled with and begins to find happiness once again. Gomez describes a freedom she received once she gained back confidence. A few songs later, the fourth track, “Lose You to Love Me” is an emotional reflection of her life and all the hardships she had to endure. Gomez shocked all her fans by releasing this song as a single about a year before “Rare” was released. Gomez incorporated a piano rather than electric beats which shows this is a more serious song. She used powerful lyrics throughout the song to depict a time where she struggled and was hopeless. She then overcame that darkness and shows listeners that there is a light at the end of the tunnel. The album wraps up with the final track, “A Sweeter Place” (ft. Kid Cudi). These two artists describe a euphorian place where all the stress from reality disappears. Its unique, electric beat throughout the song adds to the storyline, displaying the desire to feel joy in a better place than where they are now. Both Gomez and Cudi struggled with depression, so the meaning of this song is deeper to them than anyone could understand. Overall, this album is very uplifting and its beats bring listeners into the songs. Gomez spent five years making this album and it truly paid off. You can tell each lyric has a personal meaning and was well thought out. Gomez beautifully displayed the message that although times can be tough, there is always a way to find happiness again. “Rare” is unlike anything Gomez had produced in the past and is a great new album to listen to in this new decade. “Rare”: ★★★★☆ Sadie Yarosh, Sports Editor Yo! My name is Sadie and I’m the sports editor for the Echo this year!!! I love summertime, hanging out with my friends, going on lake drives and blasting... The Echo intends for this area to be used to foster healthy, thought-provoking discussion. Comments are expected to adhere to our standards and to be respectful and constructive. Furthermore, we do not permit any of the following inappropriate content including: Libel or defamatory statements, any copyrighted, trademarked or intellectual property of others, the use of profanity and foul language or personal attacks. All comments are reviewed and approved by staff to ensure that they meet these standards. The Echo does not allow anonymous comments, and requires a name and valid email address submitted that are variable. This email address will not be displayed but will be used to confirm your comments. Online comments that are found in violation of these policies will be removed as quickly as possible. Please direct any further questions to slpecho@gmail.com. Gymnastics pulls off big win at Breck Talia Lissauer Reflecting on their meet against Breck, junior captain Maddie Olson said the team was strongest on beam, but will continue to work on the execution of the routines. “Our varsity beam went really well.... Talmud Torah hosts commemoration of Martin Luther King Jr. Day Marta Hill and Talia Lissauer After speaking to families at a Jewish commemoration of Martin Luther King Jr. Day, chairman of the Human Rights Commission and senior Amaya Fokuo said she was invited to speak to share her views on youth... Theater prepares for one act Abigail Prestholdt According to theater director Jodi Schifsky, this year’s one-act will bring many emotions to the audience through the differing relationship stories it tells. “It is unique because it's all two-person... Boys’ swimming defeats Richfield 49-34 Tobias Khabie According to coach Amanda Forsberg, she was satisfied by how her team performed in their weaker events, which led to its win against Richfield Jan. 9. “Kids stepped up in their off events. You couldn't... $4 bet waged to outlast, brave elements Cutting through the complaints: is the sports budget fair? Four ultimate players selected to play on Minnesota All-Star team Theater renovations to update lights, stage, dressing rooms Second semester editorial staff 2019-2020 ‘The Witcher’ highlights the potential for fantasy genre ‘Harley Quinn’ entertains, delights ‘You’ season two turns tacky ‘Little Women’ strikes a chord Luigi checks into the Last Resort ‘Nancy Drew’ proves entertaining for fans and newcomers alike ‘The Mandalorian’ is out of this world Harry Styles defines sound with ‘Fine Line’ ‘Knives Out’ portrays unique mystery ‘Cats’ got my tongue The student news site of St. Louis Park High School The Echo • © 2020 • Privacy Policy • FLEX WordPress Theme by SNO • Log in
cc/2020-05/en_middle_0087.json.gz/line1338175
__label__cc
0.567808
0.432192
Home / Startup / Getting Your Office Ready / The Futuristic Trends That Will Transform Your Office Space Forever The Futuristic Trends That Will Transform Your Office Space Forever Oct 14, 2019 By Michael Benjamin As our approach to working life has continued to change over time, so too have the workplaces in which we spend so much of our lives. One of the most significant examples of this has been the rise of flexible working, which has gone a long way in expanding the potential of office spaces beyond traditional limitations. According to a report commissioned by design and architecture firm MoreySmith, sentient, hospitality and flat age work spaces are set to be the next major game changers in shaping the office spaces of tomorrow. Focused on providing attractive, technologically-advanced workspaces in which employees can thrive, these trends are well on their way towards revolutionizing office space as we know it. In this article, we’ll be taking a closer look at some of the most exciting office trends making an impact today—offering a glimpse of what your future office space might look like. Let’s get stuck in. Trend #1: Workplace Sentience While the concept of a ‘sentient workplace’ may initially sound like a challenging concept to grasp, its underlying principle is simple. The term ‘sentience’ refers to our capacity to experience the environment around us, and the idea that our work environment can have a significant impact on our productivity and wellbeing is far from new. Sentient workplaces are expected to take that principle to a whole new level. Focusing entirely on shaping a more human-oriented, intuitive environment, sentient workplaces will make use of sophisticated technologies capable of responding to workers’ needs. In practice, that could mean monitoring heart rates, hunger and air temperature—and reacting to them accordingly. The result? A work environment that is more actively connected to employee wellbeing, supporting them in becoming more healthy and productive. Although transforming an office from an indifferent concrete structure into a responsive environment conscious of its occupants’ needs may seem like a long way off, it is taking a step closer towards becoming a reality with each passing day. Productivity and wellbeing in the workplace will continue to play a central role in the years to come, and sentient workplaces are likely to be instrumental in driving them. Trend #2: Ultra Personalization The demise of the one-size-fits-all philosophy had already been partly ushered in with the rise of flexible office space, but the future focus on workplace personalization may well commit that approach to the history books forever. Every one of us approaches our work in a different way, and employers are beginning to recognize the benefits of taking account of this fact through the office spaces they provide. When it comes to personalizing our work environment, we’re not just talking about a well-placed desk plant or family portrait—although both of these can have a positive impact on workplace satisfaction. Instead, we’re talking about wearable technologies that provide personalized recommendations on health and productivity in the workplace, lighting that adjusts automatically to your comfort levels and much more. Achieving commercial results is all about getting the best out of every employee’s unique strengths, and technologies centered around the collection and analysis of data can give employers the tools they need to personalize their workplace in the best way possible. Trend #3: Age Agnosticism Future office spaces are likely to add further weight to the saying that age is just a number, blurring the lines between baby boomers, Generation Xers, millennials and Generation Zers. The workforce has always been made up of employees from different generations and backgrounds, but the immense importance of the diversity agenda means that offices are likely to consider intergenerational collaboration even more in the years to come. According to the MoreySmith report, the emergence of the 5G workforce—which sees five generations working together as one—will have a major impact on workplace collaboration. The so-called ‘flat age workspace’ is expected to level out the differing knowledge and requirements of each generation through providing improved facilities for knowledge sharing. If Mentor Pods, Diversity Incubators, VR Learning Labs and AI learning are anything to go on, then collaborative working is about to become much more exciting. Trend #4: The Hospitality Workspace One of the most exciting trends shaping the modern office is the ‘hospitality workspace,’ which is explicitly designed to bring work and play together under a single roof. Changing preferences have meant that in this day and age, many employees want more than just a place in which to work productively. Instead, they long to be part of an innovative and adaptable community that is fully adapted to their overall lifestyle. As one of the most innovative office spaces in London, the headquarters for global pharmaceutical company GSK has gone to extreme lengths to provide their employees with everything they need onsite. Costing over £300m, the new premises houses over 3,200 staff and includes it’s very own high street. Designed to provide a social space and an array of facilities, the street boasts an impressive selection of cafes, shops and even a beauty salon. Hospitality workspaces are ideally placed to meet this growing demand through turning the work environment into a multifaceted experience. Productive working is just the beginning here – employees could grab a meal at an office restaurant, sleep in a dedicated resting area, make use of fitness facilities or even get inspired by an on-site art gallery. Whatever the case, hospitality workspaces are all about catering to employees’ professional and personal lives simultaneously. The Evolution of Office Space The above are just a few examples of the way in which offices are continuing to evolve, and nobody really knows what the future of office space might have in store. What’s for certain, however, is that the office spaces of tomorrow will offer ample opportunity for work and play in a way that is unlike anything we’ve ever seen before. Filed Under: Getting Your Office Ready Tagged With: Office, Trends Michael Benjamin Michael Benjamin is Chief Marketing Officer at Office Freedom. As European Marketing Manager at Rosetta Stone, the World’s largest online language-learning company, Michael spearheaded a marketing transformation and was voted MVP. Implementing an innovative strategy to diversify the marketing mix, managing a multimillion pound budget to establish the business as the No. 1 language learning company across key European territories. More recently Michael has enjoyed great success within the Property Industry serving as Head of Global Marketing at EasyRoommate the world’s no1 flatshare website. Managing TV, Outdoor and Digital channels across the UK, France, USA and Italy to double traffic for the business. In the position of Marketing Director at Upad Michael lead the PropTech business to accelerated growth. Now as the CMO at Office Freedom he has led the global re-brand from Search Office Space to Office Freedom and is responsible for global expansion. 2020 Franchising Trends 5 Essential Ways to Secure Your Office Building How to Make Sure Your Small Business Keeps Growing Why Starting Your Own Company is the New Retirement Nov 10, 2014 By Guest Contributor 9 Actionable Tips for Small Business Budgeting Jul 13, 2018 By Wagepoint 5 Online Marketing Strategies Your Business Needs to Know Apr 9, 2018 By Matthew Davies How to Run a Successful Used Car Dealership Aug 28, 2018 By Marina Lewis Effective Market Segmentation Dec 19, 2012 By Scott Miller
cc/2020-05/en_middle_0087.json.gz/line1338177
__label__wiki
0.50518
0.50518
Legislative Participation by John Wonderlich Aug 11, 2008 5:07 pm The next list I’d like to tackle is legislative participation. A number of innovative approaches have appeared in various legislative bodies, inviting public participation in what is arguably the most public of all processes: the creation of public policy. While these projects vary in scope and effect, they all have granted a new level of access and authenticity to public deliberation, recognizing the public as a capable partner in the process of legislating. These are all legislative projects operating with official government sponsorship. While there is a great deal of valuable work done tracking legislation and developing policy outside government, and also pioneering work developing in Congress for communicating with constituents, I’m focusing here on officially sponsored legislative participation. The Open House Project launched with Speaker Pelosi’s endorsement, developing a transparency reform agenda for Congress. The Irish House of Parliament, the Oirechtas, held an involved “e-consultation” project on their broadcasting bill. From their site: “The consulters, comprising of members of the Joint Committee of Communications, Marine and Natural Resources and the Office of the Houses of the Oireachtas e-Consultation Working Group, viewed the e-Consultation pilot as a significant departure from previous practice as it involved a dedicated website which allowed for the posting of submissions in a structured manner as well as a discussion forum and it constituted an attempt to communicate directly with the public on legislation and not just target traditional ‘stakeholders’.” Rep. Honda posted legislation and accepted public commentary on their proposed STEM Act. Rep. Kuhl launched a “Fix Washington” project, where citizens proposed legislative priorities. Senator Lieberman developed the first E-government Act of 2002 in conjunction with a public Web site that collected priorities and suggestions. From the accompanying report language: On May 18, 2000, Senators Lieberman and Thompson launched an on-line `experiment in interactive legislation’, a website that sought public comments on 44 topics related to possible measures that Congress could take to advance the cause of e-government. Topics were organized into categories, such as `centralized leadership’, `funding innovations’, and `digital democracy: citizen access and participation,’ and ranged from `centralized online portal’ to `interoperability standards’ to `G-Bay’: enhanced online distribution of federal government surplus property.’ For each of the topics, a short discussion described the status of current efforts and the `New Idea’, or ideas, being offered for consideration. Visitors to the website could then submit their comments on the subject, and read views that had been submitted by others. Nearly 1,000 comments were submitted, approximately one half of which were posted on the website after being reviewed by Committee staff.13 [Footnote] Comments were submitted by private citizens, academicians, federal employees, and even federal agencies. OMB also responded to the website by soliciting views from federal agencies; OMB officials then consolidated agencies’ responses and presented them to the Committee as a single document. Opinions, additional information, and alternative proposals submitted over the website proved helpful as Senator Lieberman formulated his electronic government legislation. [Footnote] 13Comments were reviewed primarily for appropriateness and relevance; Committee staff did not favor any particular viewpoint in deciding which submissions to post. The website was intended to educate the public about the potential of e-government, to solicit input and information on the many topics being considered for possible legislation, and to serve as both an experiment and an example of how the Internet could be used to make government processes more accessible to the public. Senator Dick Durbin held public discussions on Open Left and Redstate, asking the question: “What Should We Include in our National Broadband Strategy?” Politicopia is a public wiki, set up in conjunction with the Utah State Legislature’s Rules Committee. I’m looking for any other examples. Others that sort of fit: In a sense, the California initiative process involves citizen participation, although it bypasses more than it augments the legislative process. The Peer to Patent Project is probably the best designed example of substantive public involvement, although it isn’t legislative.
cc/2020-05/en_middle_0087.json.gz/line1338190