pred_label
stringclasses 2
values | pred_label_prob
float64 0.5
1
| wiki_prob
float64 0.25
1
| text
stringlengths 112
962k
| source
stringlengths 39
45
|
|---|---|---|---|---|
__label__cc
| 0.73563
| 0.26437
|
Category: BEAUTIFUL IMAGES
A deeper shade of blue
Blue is all around us. It’s what our eyes distinguish when we see the sky and sea. It’s in every smoothie-lover’s favourite superfood, the blueberry. It’s even found in our eyes themselves (or, at least, some of us). The fact that it’s Pantone’s Colour of the Year 2020 is no surprise, as this calming, serene…
25 inspiring urban gardening ideas
Small garden? You’re not alone. With the population growing and available space shrinking, many of us see a small garden as the new standard. In fact around two million British homes don’t have a garden at all, which makes a love of plants and gardening even tougher! However, whether you’ve got a petite patio area,…
A garden in close up
So often we take a step back to enjoy our gardens, viewing them from the distant point of a patio chair or even from inside. But how often do we take a closer look to appreciate the beauty of nature? Macro plant photography changes our perspective, and takes us into the fine details of a…
7 insects you’ve been loving in summer 2018
Last month, I asked you on Facebook and Twitter what your favourite summer insects have been this year – and you came back with some truly fabulous specimens. A couple of you even sent in photos of sleeping foxes and curious frogs! As a plant geek, it’s in my interest to promote the welfare of…
Why Tulip time comes early this year
Tulips are an ever popular spring bulb, and one that really announces the arrival of spring, like the world’s biggest and most colourful carnival, parading around your own back garden! Actually available in EVERY colour of the rainbow, and in a myriad of shapes, sizes and patterns, you just can’t be without them. But, why…
We’re all going to Lamprocapnos!
Sorry, but to me ‘Lamprocapnos’ sounds more like a Greek holiday destination than a traditional cottage garden plant. But then its close relative ‘Dactylicapnos’ sounds more like a flying dinosaur than a climbing plant! What am I talking about? Dicentras, or what used to be Dicentras. Name changes nearly always annoy gardeners Occasionally, someone asks…
10 green blooms for St Patrick’s Day!
Happy St Patrick’s Day! Ireland has had an association with the colour green since the 11th century, and it’s customary to wear a shamrock leaf, green clothing or green accessories on the famous festival day. But, I want to look at how can you celebrate with flowers! Here are 10 unique GREEN blooms! Gladioli ‘Green…
10 weird plants from around the world
10 weird plants from around the world Small, big, poisonous, glow in the dark – there are weird plants to fit every adjective! In this post I’ll be talking about 10 of the most exciting plants from around the world, each with its own unique quality. Trust me, they’ll blow your mind! Join me on…
10 reasons why you should grow an insect eating plant!
Insect-eating plants have always been a fascination of mine, and they are often the first plant that children want to grow. However, the Venus Fly Trap is usually the chosen one. But, have you ever seen a Pitcher Plant?? Yes, it’s a real plant, not just an extra from the Little Shop of Horrors! I’m…
Instagram Plant Spy: the colourful tasty world of edible flowers
Instagram is always alight with the next big thing, and we hope you’ve spotted the trend in edible flowers too. Intriguing, fun and full of flavours from citrus to spice, edible blooms aren’t just good to look at, they’re good for your health too, with many containing a small vitamin punch! 1. A very…
The story behind the flower that amazed the world!
There are a very few plants as jaw-dropping as these blue Hibiscus! You’ll probably be used to seeing the usual pinks and reds, but these flowers are a very unexpected colour! This blue metallic sheen has come about thanks to one of the biggest breeding breakthroughs in the plant world! The man behind this amazing…
My favourite plants by Cody Worden
“My love for plants started at a very early age in my grandfather’s garden. It was such a joy to plant different vegetables and watch them grow as I spent hour upon hour bonding with my late grandfather. As the years progressed, I found myself working in a plant nursery where I was exposed to…
|
cc/2020-05/en_middle_0087.json.gz/line1341039
|
__label__wiki
| 0.941714
| 0.941714
|
DAN promotes Erik Hallander to Isobar ANZ CEO
August 22, 2019 6:10
by Brittney Rigby
The Dentsu Aegis Network (DAN) has promoted Erik Hallander to CEO of Isobar Australia and New Zealand from his previous role as managing director of the Australian operations, a position he has held since October 2017.
Hallander replaces former CEO Konrad Spilva, who stepped down in March after 18 years with the business.
Hallander’s promotion is effective immediately
DAN’s ANZ CEO, Henry Tajer, commented that Hallander is the kind of leader Isobar needs.
“Erik is one of the most intelligent and creative people I’ve had the pleasure of working with. He’s a true change-maker, and the calibre of leader we need to continue transforming our clients’ businesses, brands and people’s lives with the creative use of digital,” Tajer said.
Hallander added of his promotion: “I’m absolutely thrilled to be part of the next chapter of Isobar and Dentsu. The experience leading this agency to date has been one of the best in my career, and everyone at Isobar and DAN is to thank for that. It’s an incredible business to be a part of, that consistently delivers fantastic value for our client partners.”
Global CEO of Isobar, Jean Lin, said that the Australian and New Zealand markets are critical. Recently, New Zealand digital agency Little Giant was rebranded to Isobar New Zealand.
“As CEO of one of our most celebrated markets, Erik is a critical member of Isobar’s global growth board, to drive our proposition of experience-led transformation,” Lin said.
“His promotion to lead Isobar Australia and New Zealand is testament to his tireless pursuit for innovation, leadership, energy, and business acumen.
Hallander’s promotion is the latest in a series of hires and fires as Tajer restructures the holding group.
In May, a few months into Henry Tajer’s tenure as CEO, DAN made a number of executives redundant, including Adrian Roeling, president of Amplifi, Nick Seckold, managing director of marketing agency iProspect, and Andrew Hewett, head of public affairs and communications for DAN.
Amplifi’s head of programmatic Luke Manley was made redundant last month, following Michael Bass’ appointment as Amplifi’s chief investment officer two weeks earlier, who stepped into the role following Ashley Earnshaw becoming CEO of DAN media agency Vizeum.
Carat managing director Simon Williams also departed last month. Williams’ role was called into question when Sue Squillace was named CEO, but his departure was in contradiction to DAN’s assertion that Williams would stay in his role following Squillace’s appointment.
And earlier this month, Angela Tangas became Dentsu X’s chief commercial officer while Daniel Isaac was appointed as the agency’s CEO.
The extreme shake up follows the loss of significant accounts across the group, including Super Retail Group, Virgin Australia, Asahi, Mondelēz International, Amart, and Bega.
Brittney Rigby
Brittney Rigby is a reporter at Mumbrella, primarily covering media agencies and managing the Opinion vertical. She's also admitted as a lawyer in the Supreme Court of New South Wales, and has written for publications such as The Guardian, Sydney Morning Herald, SBS Life, The Feed and various Junkee Media titles. She tweets @brittneyrigby
topics Dan, Dentsu Aegis Network, Erik Hallander, Henry Tajer, Isobar, Jean Lin
Merge on the horizon... 23 Aug 19
Good on ya Erik – top talent.
Assuming the news of Isobar & WiTH merging will come out next week?
|
cc/2020-05/en_middle_0087.json.gz/line1341042
|
__label__cc
| 0.608527
| 0.391473
|
Southeastern Geographer
+ MUSE Alert
Volume 20, Number 1, May 1980
Southeastern Geographer has been published since 1962 and has been distributed by the prestigious University of North Carolina Press since 2004. Available both online and in traditional hard copy, Southeastern Geographer is considered by many to be one of the best regional geography journals in the United States.
Journal Focus: Southeastern Geographer is a quarterly publication of the Southeastern Division of the American Association of Geographers. Building on its history as a regional journal, the journal publishes geographic research that engages with conditions and events in “the south”, broadly construed, as they relate to conditions and events that extend over broader geographical reaches. The journal invites scholarship highlighting the social, cultural, economic, and political diversity and broad climate and ecosystem variability that links “the south” to processes, flows, and conditions that extend across the country, continent and globe. Southeastern Geographer is available both in print and digitally, via several e-book platforms, and via Project Muse.
The University of North Carolina Press
viewing issue
View Formatted Version
A Model of Rabies Diffusion
Neal G. Lineback
DOI: 10.1353/sgo.1980.0001
Climatological Forecasts of Southern Pine Beetle Infestations
James B. Campbell, Kenard E. Smith
Observations of Needle Ice Growth and Potential for Accelerated Erosion on the Georgia Piedmont
Vernon Meentemeyer, Jeffrey Zippin
Linking Topical and Categorical Preferences
Robert E. Lloyd
Antebellum Urban Promotion in Fredericksburg, Virginia
Thomas F. Armstrong
Review of the Thirty-Fourth Annual Meeting, Nashville, Tennessee
Volume 19, Number 2, November 1979
Copyright © The Southeastern Division, Association of American Geographers.
|
cc/2020-05/en_middle_0087.json.gz/line1341044
|
__label__wiki
| 0.662483
| 0.662483
|
Letter from the Co-Directors
Leadership & Affiliates
Inequality Project Advisory Board
Affiliated Graduate Students
Human Rights Scholars
Summer Human Rights Fellows
Graduate Summer Fellows
WPS Editorial Committee
Bernard & Audre Rapoport
Farenthold Endowed Lecture Series
Inequality: A New Challenge for Human Rights
Inequality & Human Rights: Conceptual Explorations
Natural Resource Governance, Inequality & Human Rights
The Future of Work, Human Rights & the Contestation of Inequality
Human Rights Archives
The Michael Tigar Papers
Frances Tarlton “Sissy” Farenthold: A Noble Citizen
Historical Archive of the National Police of Guatemala
Working Group: Archives & Human Rights
The Papers of George Lister
Human Rights Documentation Initiative
Audre Rapoport Prize for Scholarship on Gender and Human Rights
Human Rights Commentary
The Texas-Mexico Border Wall
Afro-Descendant Land Rights
Non-UT Students
Faculty Involvement
Faculty Opportunities
Visiting Professor/Practitioner Program
Human Rights Publications by Affiliated Faculty
Join a Working Group
Mural honoring Marielle Franco in the Jardim Paulista/Pinheiros neighborhood of São Paulo. (Photo credit: Edward Shore)
Marielle Franco and the Brazilian Necropolis: Assassination and After Lives
By Xavier Durham
On March 14, 2018, news of the murder of Rio de Janeiro Councilor Marielle Franco rocked Brazil. A queer black woman, mother, feminist, and champion of Rio’s favela residents, Franco was an outspoken critic of police brutality. Her ascension as a human rights activist and elected representative gave hope for favela residents, especially Afro-Brazilian women vying for a voice in politics [1]. However, less than two years after her election, Marielle Franco was the victim of a coordinated assassination, along with her driver Anderson Pedro Gomes [2].
On March 12, 2019, the eve of the first anniversary of Franco’s murder, federal investigators in Brazil arrested two former police officers—Ronnie Lessa and Elcio Vieira de Queiróz—for their involvement in the killings. Both suspects were members of the Escritório do Crime (Crime Office), a criminal organization run by former and current law enforcement officials in the Rio das Pedras neighborhood of Rio de Janeiro [3]. Franco’s allies have long suspected that such groups, known in Brazil as militias, ordered her assassination. Their concerns held weight for four reasons: 1) Franco openly denounced former President Michel Temer’s order to militarize the city of Rio de Janeiro in February 2018 [4]; 2) the recovered bullet casings belong to ammunition purchased by the Federal Police in 2006 (the bullets used to kill Franco were reportedly stolen from a post office) [5]; 3) five cameras (that belong to Rio’s Security Department) along the route where Franco was assassinated were shut off anywhere between 24 and 48 hours prior to the killing [6]; and 4) extrajudicial killings and cover-ups involving police officers in Brazil rarely undergo investigation and point to a macabre, cyclical impunity [7]. Despite the arrests of Lessa and Vieira, Afro-Brazilians and the poor harbor serious doubts about obtaining justice, either for Marielle Franco and Anderson Gomes or the countless other black Brazilians killed by police every day.
Barbara Harlow’s work on assassinations provides a useful frame for addressing the structural underpinnings of these killings. Instead of relying on the state to play “detective” and investigate crimes, we must understand how the state determines the nature of crime and those it criminalizes [8]. Afro-Brazilians take little solace in the Brazilian government’s promise to prosecute those who pulled the trigger in Franco’s case, given how the state continues to perpetuate an unwavering politics of death. As Harlow might ask, what hope for justice is there for any and all black victims given that the circumstances of Franco’s death have been replicated time and time again [9]? Indeed, the very state that they uphold as an arbiter for justice is actually the conduit through which the most structural, anti-black sentiments proliferate and remain entrenched.
Franco’s assassination reflects the violent, banal reality of police anti-blackness in Brazil. But it is also part of the quotidian nature of white supremacy and the attendant everyday experiences of anti-blackness that the spectacle of police violence obscures [10]. The spectacle of violence does not stop with the state as death squads [11]; indeed, private security also takes center stage [12]. After violent death has occurred, mourning friends and family remain vulnerable to threats and harassment from police to encourage absolute silence and deter investigation [13]. Thus, the emotional and psychological impact of anti-black state violence transcends the victims’ families and bleeds out into their communities, corrupting the health and vitality of those stuck in a shadow of death (i.e., Afro-Brazilian mothers). Black execution is nothing short of genocide.
The violent cycle feeds into what anthropologist Jaime Alves calls the “Black Necropolis,” whereby the interpellation of blackness excludes Afro-Brazilians from the rights of citizenship and, ultimately, their own lives [14]. Fatal interpellation and the direct connection to the Brazilian state is best summarized by the popular truism, “if you want to know who is black and who is not in Brazil, just ask the police” [15]. This axiom affirms that blackness is defined by its proximity to state violence and coercion. Alongside this sobering reality, Marielle Franco’s assassination illuminates how the Brazilian state maintains control through a violent politics of death, and how state-centered justice is virtually unattainable, especially in the face of dissent.
By examining the assassinations of political dissidents and writers speaking out against state oppression, Harlow illuminated those who lived by the pen and died by the sword, all of whom were in the pursuit of radical justice. Her critical analysis of the complexity of assassinations, exposing the violent innerworkings of the state, translates to the circumstances surrounding Marielle Franco and anti-black violence in Brazil. Like dissidents before her, Franco was a threat to an established order that upheld the status quo and praised a neoliberal bent of progress. Her opposition is exemplified in her denouncement of former President Michel Temer’s order to deploy federal troops to favelas under the guise of crime reduction and security [16]. For that, her silence was paramount within the particularities of a macabre, death-driven logic all too common to the Brazilian state’s repertoire [17]. Indeed, to rely on the state to confront the pervasiveness of one of its foundational components through criminal investigation is to reinforce this component and uphold the state’s legitimacy as it stands. Harlow understood the fraught nature of political dissent and how justice cannot come from the propagator of injustice lest we remain satisfied with cosmetic solutions to deeply-entrenched structural issues.
The Brazilian state cannot and will not provide the avenues necessary for justice, and until the Necropolis crumbles, convictions for the murders of Marielle Franco and Anderson Gomes are mere parodies. Therefore, activists carrying on the struggle today must reimagine the future of Brazilian governance through a radical and intersectional political agenda that honors Franco’s legacy. Among the necessary components to this radical reimagining of Brazil, black life must be affirmed and elevated beyond mere survival; Afro-Brazilians must thrive. For now, the struggle continues as activists across Brazil rally against police brutality in a state where they were otherwise never meant to survive. Through these campaigns, Marielle Franco lives on.
#MariellePresente
#AndersonPresente
Xavier Durham was the inaugural Barbara Harlow Intern in Human Rights and Social Justice at the Rapoport Center, in Spring 2018. He will soon begin the second year of his PhD program in Sociology at the University of California, Berkeley. After studying Black Feminist activism in Rio de Janeiro in the Summer of 2016, Xavier hopes to return in the Summer of 2020 to resume his work on private policing, surveillance, and anti-black violence.
Theresa Williamson, “Marielle Franco’s Legacy the the fight for Rio’s, and Brazil’s, Future,” RIOONWATCH, March 21st, 2018, http://www.rioonwatch.org/?p=42394.
Dom Phillips, “Marielle Franco: Brazil’s favelas mourn the death of a champion,” The Guardian, March 17, 2018, https://www.theguardian.com/world/2018/mar/18/marielle-franco-brazil-favelas-mourn-death-champion.
Redação RBA, “’Escritório do Crime’ está por trás do assassinato de Marielle,” Rede Brasil Atual, March 12, 2019, https://www.redebrasilatual.com.br/politica/2019/03/escritorio-do-crime-esta-por-tras-do-assassinato-de-marielle.
Dom Phillips, “Brazilian army to take control of security in Rio as violence rises,” The Guardian, February 16, 2018, https://www.theguardian.com/world/2018/feb/16/brazilian-army-rio-de-janeiro-michel-temer.
Leonardo Demori, Carolina Moura, Juliana Gonçalves, Yuri Eiras, and Bruna de Lara, “Who Killed Eduardo, Matheus, and Reginaldo?,” The Intercept, March 21, 2018, https://theintercept.com/2018/03/21/marielle-franco-death-brazil-violence-police/.
teleSUR, “Brazil: Public Security Cameras En Route to Marielle Franco’s Home Were Turned Off Before Assassination,” May 4, 2018, https://www.telesurtv.net/english/news/Brazil-Public-Security-Cameras-En-Route-to-Marielle-Francos-Home-Were-Turned-Off-Before-Assassination-20180504-0002.html.
Human Rights Watch, Good Cops Are Afraid: The Toll of Unchecked Police Violence in Rio de Janeiro. São Paulo: Human Rights Watch, 2016: 5.
Barbara Harlow, After Lives: Legacies of Revolutionary Writing. New York: Verso, 1996: 22.
This question is a paraphrased re-wording of the next dilemma Harlow sees in the aftermath of assassination (See: After Lives, pg. 21).
Christen Smith, “Strange Fruit: Brazil, “Necropolitics, and the Transnational Resonance of Torture and Death.” Souls 15, no. 3 (2013): 177–198.
Death squads are usually groups of vigilantes, current officers, and ex-military personnel that abduct and/or kill primarily Afro-Brazilians under the cover of night. The state’s lack of investigation into cases involving alleged death squad participation highlights their complicity in the practice and reinforces its anti-black logic.
Martha K. Huggins, “Urban Violence and Police Privatization in Brazil: Blended Invisibility.” Social Justice 27, no. 2 (2000): 113–134.
Christen Smith, “The Dangerous Game of Mourning the Dead: Police Violence and the Black Community in Brazil,” Truthout, March 3, 2016, http://www.truth-out.org/speakout/item/35078-the-dangerous-game-of-mourning-the-dead-police-violence-and-the-black-community-in-brazil.
Jaime Alves, The Anti-Black City: Police Terror and Black Urban Life in Brazil. Minneapolis, MN: University of Minnesota Press.
Jaime Alves, “From Necropolis to Blackpolis: Necropolitical Governance and Black Spatial Praxis in São Paulo, Brazil.” Antipode46, no. 2 (2014): 328 – 329.
Ernesto Londoño and Lis Moriconi, “Ex-Officers Arrested in Killing of Marielle Franco, Brazilian Politician and Activist, https://www.nytimes.com/2019/03/12/world/americas/marielle-arrest-rio.html.
Related Faculty and Friends
Xavier Durham
Related Opportunities
The Barbara Harlow Internship in Human Rights & Social Justice
Project & Publications Type: Human Rights Commentary
|
cc/2020-05/en_middle_0087.json.gz/line1341046
|
__label__cc
| 0.675173
| 0.324827
|
Leaven for the Loaf
a Granite State Pro-life Blog by Ellen Kolb
N.H. 1st Congressional District: remembering a Shea-Porter letter
Congressional candidate Frank Guinta speaks with 40 Days for Life coordinator Jennifer Robidoux
In New Hampshire’s First Congressional district, incumbent Frank Guinta is facing former Member of Congress Carol Shea-Porter. This is the fourth time the two have gone head-to-head for the seat, with Shea-Porter holding a 2-1 edge.
Looking strictly at his pro-life record, Guinta has voted to keep taxpayers out of the abortion industry’s business, with exceptions for pregnancies resulting from rape and incest (Hyde Amendment language). The National Right to Life Committee has endorsed him. On his campaign web site, he writes “I believe in the sanctity of life and will work to make sure all children have the ability to grow up surrounded by their parents’ loving attention.”
Congresswoman Carol Shea-Porter (D-NH1). Facebook photo.
Then there’s Carol Shea-Porter. She’s an EMILY’s List favorite, which speaks volumes. And in 2013, refusing to vote to weaken the Obamacare HHS/contraceptive mandate, she was willing to let the government shut down instead.
Recall her letter to me from 2013, which stands up pretty well as a guide to her attitude towards religious liberty and what constitutes health care. The subject was the potential government “shutdown,” her support for Obamacare, and her insistence on defending its provision that women are broken and need to be fixed via “preventive” contraceptive converage. She had (has?) no problem forcing employers who provide health insurance to employees to be involved in those employees’ decisions regarding contraception.
From the 2013 post, with excerpts from Shea-Porter’s letter set off in quotation marks:
Here’s the relevant portion of her message. I’ve added some bold-face emphasis.
“Last weekend, the House of Representatives voted on a Continuing Resolution that contained multiple provisions that had nothing to do with keeping the government operational. That version of the bill, which I voted against on September 29th, included a provision that would allow any employer or insurer to refuse to cover any health care services they might object to. This would give unprecedented control over personal healthcare decisions to employers and insurers, allowing them to deny coverage for important women’s preventive health services, including HPV testing to prevent cervical cancer, domestic violence screening and counseling, and birth control.”
Like the president whose water she’s carrying, she conceded no good will to people like me who see the down side of the “Affordable” Care Act. That makes her next sentence a punch line, albeit a lousy one.
“I stand ready to work with my Republican and Democratic colleagues on finding common ground and getting things moving here in Washington.”
I guess the First Amendment doesn’t qualify as common ground.
…In Shea-Porter’s view, it’s imperative that employers with religious objections to contraception be forced to subsidize it anyway. She thinks that affording such people freedom of conscience would amount to “unprecedented control” over a woman’s health care decisions.
Forcing an employer to pay for birth control pills is an “unprecedented control” of its own.
I take from this that Shea-Porter believes free pills must somehow trump religious liberty. Perhaps I take too dim a view. HHS Secretary Sebelius, when asked about the HHS mandate last year, couldn’t square it with religious liberty beyond saying, “I’m not a lawyer and I don’t pretend to understand the nuances of the constitutional balancing tests.” Madam Secretary is apparently not the only Washington denizen who has trouble with nuance. The difference between health care and health coverage, between choice and mandate, between cancer screening and fertility suppression: all are lost on my congressional representative.
One more thing: if Carol Shea-Porter wins in 2016, she’ll be entitled to a lifetime Congressional pension at her own option once she’s halfway through her term. That seems odd recompense for her support of the HHS mandate.
(Photo credit: visitthecapitol.gov)
Author: Ellen Kolb
New Hampshire-based writer, pro-life activist, hiker. View all posts by Ellen Kolb
Author Ellen KolbPosted on October 18, 2016 May 22, 2019 Categories 2016 electionTags Carol Shea-Porter, contraceptive mandate, First Amendment, HHS mandate, homepage, Obamacare, religious liberty
Previous Previous post: On November’s political imperative (and it’s not about the Presidency)
Next Next post: A contrast in N.H. Second Congressional District race
Enter your email address to subscribe to this WordPress blog and receive notifications of new posts by email.
Sponsor the blog via PayPal (donations are not tax-deductible)
View LeavenForTheLoaf’s profile on Facebook
View @EllenKolbNH’s profile on Twitter
Ellen Kolb
Writer, pro-life activist, Granite State walker.
Granite State Walker
EllenKolb.com
Subscribe to Ellen’s Updates
Email Address First Name Last Name More frequent updates: Please subscribe me to legislative updates from Leaven for the Loaf blog (N.H. pro-life news)
These special updates, which supplement the monthly newsletter, feature N.H. State House news relative to life-issue bills.
Pregnancy resources in NH
How to support this pro-life blog
Testifying at the State House
(c) 2019 Leaven for the Loaf and Ellen Kolb. Unauthorized use of this material is strictly prohibited. Excerpts and links may be used, provided that full and clear credit is given to Leaven for the Loaf and Ellen Kolb with appropriate and specific direction to the original content.
Leaven for the Loaf Privacy Policy Proudly powered by WordPress
|
cc/2020-05/en_middle_0087.json.gz/line1341051
|
__label__cc
| 0.719031
| 0.280969
|
INVITE FRIENDS & GET $10
30-Day Bigger Leaner Stronger Transformation
30-Day Love Your Body Transformation
Fat Loss Stack
Build Muscle Stack
Optimal Performance Stack
Rapid Recovery Stack
Pre-Workout NEW
Protein NEW
Muscle Builders NEW
Post-Workout NEW
Bigger Leaner Stronger
Thinner Leaner Stronger
The Shredded Chef
The Little Black Book of Workout Motivation
The Year One Challenge for Men
The Year One Challenge for Women
Diet Coaching
Workout Coaching
90-Day Transformation Coaching
Custom Meal Plans
Meal Plans for Men
Meal Plans for Women
The Definitive Guide to the “Push Pull Legs” Routine
Why People Are Skinny Fat (and How to Fix It)
The 3 Best and Worst Protein Powders for Muscle Growth
How to Make the IIFYM Diet Work for You
The 12 Best Science-Based Strength Training Programs for Gaining Muscle and Strength
The 6 Absolute Best Quads Exercises You Can Do
The 6 Best Triceps Workouts for Bigger, Stronger Arms
What 33 Studies Say About the CICO Diet for Weight Loss
How to Calculate Your Body Fat Percentage Easily & Accurately (With a Calculator)
Why Belly Fat Is So Stubborn (and How to Lose It)
The Best Way to Stimulate Muscle Hypertrophy (Build Muscle)
The Best Chest Workouts for Building Awesome Pecs (According to Science)
How to Get a Bigger and Rounder Butt in Just 30 Days
The Best Way to Train All 6 Major Muscle Groups
How to Make Meal Plans That Work For Any Diet
How Many Calories You Should Eat (with a Calculator)
How to Use Calorie Cycling to Build Muscle and Lose Fat
These Are the Best Strength Standards on the Internet
The Ultimate Beginner’s Guide to Powerlifting (With a Free Training Plan!)
The Complete Guide to the Best Home Gym Equipment in 2020
This Is the Best Guide to the RPE Scale on the Internet
This Is Everything You Need to Know About Trenbolone
The 3 Absolute Best (and Worst) Fat Loss Supplements
Collagen Protein Is a Waste of Money, Science Says
Is Microwaving Food Bad for You? What 23 Studies Have to Say
What “They” Aren’t Telling You About Sugar Withdrawal
This Is the Definitive Guide to Vegan Bodybuilding Every Plant Eater Needs
Is Milk Bad For You? What 30 Studies Have to Say
20 Healthy PB2 Recipes That Will Change Your Life (Without Ruining Your Diet!)
10 Delicious Recipes That Are Perfect for Lean Bulking
20 Tasty Bodybuilding Recipes That You’ll Never Get Sick Of
20 Healthy Chicken Recipes That You’ll Be Excited to Eat
The Simple System I Use to Find, Choose, Read, and Remember Great Books
Why Is the Fitness Game Worth Playing?
So, You’re Having a Shitty Workout…
In Filth It Will Be Found
My 3 Key Takeaways from Brave New World by Aldous Huxley
My Top 5 Takeaways from The 48 Laws of Power by Robert Greene
My Top 5 Takeaways from Good to Great by Jim Collins
My Top 5 Takeaways from Principles by Ray Dalio
Here’s How Much Muscle You Can Really Gain Naturally (with a Calculator)
Here’s How Strong You Can Get Naturally (with Calculators), According to Science
This Is the Best TDEE Calculator on the Web (2020)
This Is the Best Macronutrient Calculator on the Net
How Taylor Used Thinner Leaner Stronger to Lose 55 Pounds and 16 % Body Fat
How Wesley Lost 16 Pounds in Just 3 Months
How Evan Used Bigger Leaner Stronger to Lose 11 Pounds and 9% Body Fat
How Gary Used Bigger Leaner Stronger to Lose 16 Pounds and 8% Body Fat
How to Lose Fat Faster With Fasted Cardio (and Keep Your Muscle)
Research Review: What’s the Best Rep Range for Building Muscle?
What Can BCAAs Actually Do For You? (According to Science)
Eric Helms on Supersets, Dropsets, Forced Reps, and More!
The Definitive Guide to Full-Body Workouts
The Ultimate Fitness Plan for Women
The Easiest Cardio Workout You Can Do (That Actually Works)
How to Safely and Healthily Lose Weight Fast
How to Change Your Body Weight Set Point
Mark Rippetoe on the Right (and Wrong) Ways to Bench and Overhead Press
Mark Rippetoe on the Right (and Wrong) Ways to Deadlift
The Definitive (and Practical) Guide to Muscle Hypertrophy
Layne Norton on Mini-Cuts and Mini-Bulks
How Much Protein You Should Eat to Build Muscle
Q&A: How Many Calories Should You Eat to Lose Fat? (And More!)
How to Get the Body You Want With Flexible Dieting
How to Get Stronger Than Ever in 3 Simple Steps
Hafthor “The Mountain” Bjornsson on Life as the World’s Strongest Man
Lyle McDonald on How to Recover Faster from Injuries
6 Things You’ve Always Wanted to Know About Steroids
Kurtis Frank on the Best Pre-Workout Supplements
The 3 Best (and Worst) Protein Powders for Muscle Growth
Kurtis Frank on the Best Functional Foods for Improving Health and Wellbeing
Dr. Stuart McGill on the Real Causes of Back Pain (and How to Fix It)
How Dangerous Is Weightlifting? What 20 Studies Have to Say
Is Meditation as Great as Everyone Says? An Answer, According to 20 Studies
James Clear on How to Build Effective Habits and Make Them Stick
Jeff Haden on the Biggest Motivation Myths That Are Holding You Back
Mark Murphy on Why You Need to Create “H.A.R.D.” Goals Instead of “S.M.A.R.T.” Goals
Motivation Monday: 3 Powerful Ways Working Out Makes You Better at Life
MFL Book Club Podcast: Peak Performance by Brad Stulberg and Steve Magness
MFL Book Club Podcast: 7 Habits of Highly Effective People by Stephen Covey
MFL Book Club Podcast: Elon Musk by Ashlee Vance
MFL Book Club Podcast: Getting Things Done by David Allen
How Corri Lost 12.5 Pounds and 8% Body Fat in Just 90 Days
How Laura Lost 8.5 Pounds and 6.5% Body Fat in Just 90 Days
How Rachel Lost 15 Pounds and 6% Body Fat in Just 90 Days
How Lyell Lost 37 Pounds & 15% Body Fat in 6 Months
Home / Blog / Definitive Guides / The Definitive Guide to Reverse Dieting
The Definitive Guide to Reverse Dieting
Written by Michael Matthews
Definitive Guides Nutrition
Here’s something most people wanting to lose weight don’t know:
Losing it is only half the battle. What happens next is just as important, if not more so.
Here’s an all-too-common scenario:
After several months of very low-calorie and heavily restrictive dieting, Jimmy finally achieves his weight loss goal. Oh glorious day! It’s finally over! No more suffering! Life can finally be lived again!
Little does he know, though, Jimmy is skipping on thin ice. He’s both psychologically and physically prepped to rapidly regain all the fat he lost, so what he does next is absolutely critical.
Unaware of this, he charges forward recklessly and, a month later, looks at the scale and wonders what the hell happened. How can months of weight loss possibly be undone so quickly? And what the hell should he do next? Who’s to say another round of grueling dieting won’t end just as catastrophically?
Or maybe he’ll make the other common mistake: fearful of weight gain, he continues his restrictive eating regimen and eventually finds himself physically and mentally frayed. He can’t eat a normal amount of food without getting fatter. His restrictive diet weighs on him like a full-body cast that gets a little tighter and itchier every day.
Well, this is where reverse dieting comes in to save the day. It’s the “diet after dieting” and it’s extremely important to get right.
I’d even go as far as saying that skilfully navigating this “post-weight-loss period” is the real “secret” to ending your weight struggles once and for all.
And in this article, you’re going to learn everything you need to know to achieve just that. By the end, you’re going to know what not to do after losing weight and why, and how to use reverse dieting to save you from the deepest, darkest pits of dietary hell.
So let’s get to it.
Would you rather watch a video? Click the play button below!
Want to watch more stuff like this? Check out my YouTube channel!
What Is Reverse Dieting?
How Losing Weight Affects Your Metabolism
The Benefits of Reverse Dieting
How to Reverse Diet
Use Flexible Dieting When Creating Reverse Dieting Meal Plans
Will You Gain Weight When You Reverse Diet?
Does Reverse Dieting Have Any Other Uses?
The Bottom Line on Reverse Dieting
If “dieting” involves restricting your food intake, what do you think “reverse dieting” is?
“Eating more?” you say? Kind of. Reverse dieting does involve eating more food but it’s a bit more scientific than that.
Reverse dieting involves a controlled, gradual increase in total daily calorie intake with the purpose of increasing metabolic rate and health.
Reverse dieting is mainly known as a way to bring your metabolism back to normal after a period of calorie restriction (weight loss) but it also has usefulness outside of weight loss, which we’ll talk more about in this article.
Now, before we talk about the benefits of reverse dieting and how to actually do it, let’s learn a bit more about how and why it works.
When you set out to truly understand the science of fat loss, you first learn about the principles of energy balance and how your calorie intake and expenditure dictate weight gain and loss.
From there you quickly learn that meaningful weight loss requires that you maintain a state of “negative energy balance” over time. This means watching your food intake to ensure that you’re eating less energy than you burn.
For many people, the lessons stop here. They were looking for weight loss answers and found the “secret:” eat fewer calories than you expend and voila, your weight goes down.
What they don’t know, however, is that restricting calorie intake does more than just reduce your total fat mass. It affects your metabolism in various ways as well and people’s ignorance of these “side effects” is one of the big reasons they struggle so much with “dieting.”
The first thing you need to know is that when you place your body in a calorie deficit, it sets out to decrease energy output and increase intake. That is, it wants to erase the calorie deficit and achieve a state of metabolic homeostasis.
The reality is losing weight requires that you force your body to do something it doesn’t want to do. That’s why it can lead to complications and that’s why you want to go about it intelligently, with the goal of improving body composition and preserving metabolic health, not simply “losing weight” any which way, no matter the consequences.
Here are the major factors you’re up against when you’re working to lose fat:
Your basal metabolic rate slows down.
Basal means “forming a base; fundamental,” and your basal metabolic rate is the amount of energy your body burns while at rest. The biggest energy hogs in your body are your organs and muscles (these are the prime determinants of your basal metabolic rate).
When you place your body in a calorie deficit, hormonal adaptations occur that cause your body to burn less energy while at rest.
The major hormones influenced in these adaptations include leptin, ghrelin, thyroid hormones, and testosterone, which are all unfavorably affected by weight loss.
The “thermic effect of food” decreases.
The thermic effect of food, or TEF, is the amount of energy required to eat, digest, absorb, and store food.
Research shows that TEF accounts for about 10% of total daily energy expenditure, with amounts varying based on the macronutrient composition of the diet.
While restricting calories doesn’t appear to directly reduce TEF, the reduction in overall food intake naturally results in a reduction of total energy expenditure.
You burn less energy through “spontaneous” physical activity.
Every day you engage in varying amounts of spontaneous activity like walking around while on the phone, hopping to the bathroom, drumming our fingers when you read, or bobbing your legs when you think.
The energy burned by these activities is known as non-exercise activity thermogenesis, or NEAT, and it plays a much larger role in total daily energy expenditure than most people realize.
Research shows that NEAT can vary by up to 2,000 calories per day among individuals. The same research indicates that people could burn an additional 350 calories per day by taking simple actions to increase movement every day like taking the stairs when possible, walking relatively short distances instead of driving, doing some chores instead of watching TV, etc.
Here’s the catch, though: when in a calorie deficit, your body naturally decreases its spontaneous activity levels.
Furthermore, research shows that this adaptation can remain for quite some time after regular eating has resumed (which is one of the reasons why weight gain after dieting is so common).
You burn less energy through exercise.
It stands to reason that you reduce your body weight, you also reduce the amount of energy expended during exercise (it costs more energy to move a heavier body). Research shows that this is the case.
There’s more to this than meets the eye, however, because studies have shown that even when body weight is artificially increased during weight loss dieting, energy expenditure during exercise is less than normal.
Think Metabolic Adaptation, Not “Damage”
As you can see, maintaining a calorie deficit without outright starving yourself is trickier than most people think.
Total daily energy expenditure is a moving target and part of the process is learning how your body responds to a calorie deficit and how to keep it in a negative energy balance without causing more and greater problems.
These alterations in basal metabolic rate, NEAT, TEF, and so forth are collectively known as “adaptive thermogenesis,” and they can be seen as your body’s weight loss “countermeasures.”
They’re pretty damn effective too–research shows that 80 to 90% of people that diet to lose weight return to their previous, pre-diet weights.
Fortunately, these adaptations aren’t dangerous or permanent and can be managed and reversed.
Reducing calorie intake, even for long periods of time, and even if repeatedly, doesn’t “damage” your metabolism. In a scientific sense, metabolic “damage” simply doesn’t exist. Only metabolic adaptation.
Fortunately, just as you can cause unfavorable adaptations, you can cause favorable ones as well. The best way I know to do this is reverse dieting.
When you’ve been in a calorie deficit for an extended period of time, you’re psychologically inclined to overeat and your body is metabolically primed for weight regain.
To make matters worse, research shows your body will gain fat at an accelerated rate during this period, which is a phenomenon known as “post-starvation obesity.”
Thus, the worst thing you can do following a period of weight loss is exactly what you want to do: dramatically increase your calorie intake.
That said, you also don’t want to just keep your food intake at its current, low level, as this will simply perpetuate the metabolic impairments.
What you need is a strategy for raising your food intake back to normal levels without gaining fat, and that strategy is reverse dieting.
Here are the major benefits of reverse dieting:
You get to eat more.
Not as much as you might want to eat as quickly as you want to shovel it in, but hey, even small, gradual increases can be quite a relief.
The “little” things count: social events become less of a cocktease, you get to fit tastier things into your meal plans, and no more being distracted by hunger pangs and cravings.
Life is better when you get to eat more. 🙂
You have more energy.
There’s no getting around the reduction in energy levels that comes with being, and training, in a calorie deficit. And it feels damn good when it finally comes to an end.
As physical energy levels rise so do mental function and mood. Life is better when you’re energized.
You get to come out of the “dieting” mindset.
After you’ve been dieting for a while, you inevitably become a little fearful of changing anything and gaining fat.
This is why many people don’t change much in terms of food intake and exercise after reaching their weight loss goals–they don’t want to lose their hard-won gains.
Reverse dieting not only gives you a break from this mental straitjacket, it shows you that you can have the best of both worlds: you can relax and eat more without gaining fat.
You get to enjoy your workouts again.
Even if you do everything right and preserve as much muscle as possible while losing fat, training while in a calorie deficit eventually sucks.
You lose strength. You battle mental and physical fatigue. You just don’t want to be in the gym.
All that changes when you start eating more. Your pre-diet strength returns. You regain your mental edge. You look forward to your workouts again.
Alright, now that you know how reverse dieting works and why it’s so beneficial, let’s look at how to actually do it.
1. Engage in heavy resistance training (weightlifting, ideally) 3 to 5 times per week.
This has two big benefits for your metabolic rate:
it speeds it up in the short term, burning a significant amount of post-workout calories, and
it builds muscle, which speeds up your metabolic rate in the long term.
My Bigger Leaner Stronger and Thinner Leaner Stronger programs are built around heavy, compound weightlifting, and are perfect for repairing metabolic health.
2. Eat plenty of protein.
A high-protein diet is important because it will promote muscle growth, which is what we want to achieve with step #1.
I recommend that you eat 1 gram of protein per pound of body weight when you’re reverse dieting.
3. Slowly increase your calories each week until you’ve reached your total daily energy intake.
Start your reverse diet by increasing your daily caloric intake by 150 and then increase it by 150 calories every 7 days.
For example, I end my cuts around 2,000 calories per day, and I start my reverse diets with about 2,150 calories per day. Then, a week later, I increase my daily intake to 2,300 calories, and so forth.
I continue this way until I reach my TDEE.
In terms of macronutrients, alternate between raising fats and carbs until you reach 0.3 grams of fat per pound of bodyweight, and then raise just your carbs.
Remember that you don’t need more than 0.3 to 0.4 grams of fat per pound of bodyweight to maintain health. Carbs, on the other hand, can continue to benefit you at higher and higher intakes.
So, going with the example above, I’ve ended my cut at 2,000 calories, which means I’m eating somewhere between 40 and 50 grams of fat per day.
I would first increase my daily carb intake by about 40 grams (~160 calories) and then, a week later, increase my fat intake by about 15 grams (~135 calories).
I would then do another round of increasing both carb and fat intake, which would put my fats around 0.3 grams per pound of bodyweight. Thus, all further increases in caloric intake will come from carbs.
Don’t fall for the dogmas of “clean eating.”
Yes, you should eat plenty of nutritious foods every day, but this can include many foods deemed as “unworthy” by various health “gurus,” such as grains, fruit, dairy, and read meat.
That advice applies regardless of your diet goals–losing weight, building muscle, or maintaining body composition–and applies to reverse dieting as well. Life is better when you get to eat foods you actually like.
If you want to learn more about flexible dieting, check out this article.
Want a workout program and flexible diet plan that will help you build muscle and get strong? Download my free no-BS “crash course” now and learn exactly how to build the body of your dreams.
Maybe. You may gain a little weight but you may lose some as well.
If you lose weight, it will be mainly due to a reduction in water retention, which is to be expected as your hormones normalize.
I experienced this during one of my preps for a photo shoot. Here is an unedited picture of me on the day of the photoshoot:
I weighed 184 pounds here and was eating about 2,100 calories per day.
Here is an unedited picture of me taken several weeks later:
By this picture I had increased my daily calorie intake to about 2,500 and lost 2 pounds in the process, putting me at 182 pounds.
If you gain weight, don’t freak out.
As you increase your carbohydrate intake, your muscles are going to hold more water and glycogen. You can easily gain a few pounds this way with little to no change in body fat levels.
If, however, you’re gaining weight fairly rapidly while reverse dieting–1 pound per week or more–you may be eating too much. Check out this article for some tips on analyzing your energy intake versus output to ensure you’re not making any obvious mistakes.
The majority of people searching for information on reverse dieting have weight loss on their minds, which is why this article focuses on that context.
Reverse dieting has another use worth mentioning, though, and that’s for continuing to increase your energy expenditure well beyond what would be your normal TDEE.
The procedure is simple: continue raising your daily calorie intake every 7 to 10 days for as long you’d like. In terms of macronutrients, you can continue to raise your carb intake but eventually you just can’t feasibly eat more carbs, at which point you start increasing your fat intake instead.
(Most people find that anything over 2.5 to 3 grams of carbohydrate per pound of body weight is just too much and thus I recommend you cut it off there.)
This is also known as “clean bulking” and it’s an effective way to maximize muscle growth and minimize fat storage. Notice I said minimize and not prevent. This is because you do gain fat while reverse dieting beyond your normal TDEE but you gain as little as possible while reaping maximum muscle-building benefits.
Millions of people desperately want to know how to lose weight but very few give much thought to what happens next.
This is unfortunate because the real goal is to lose fat, not muscle, and maintain a new and improved body composition for the rest of your life. And the only way to do that is to break free from the maelstrom of fad dieting, starvation “cleansing,” and the rest of the mainstream diet nonsense and learn the truth about how your metabolism functions and how you can work with and not against it.
Reverse dieting is a big ol’ Swiss Knife of a tool that everyone needs to understand and use. It’s currently an obscure dietary strategy known mainly to bodybuilders and other competitive athletes but I hope more and more mainstream authors and experts bring it to the forefront of the ongoing diet discussion.
I wrote this article to do my part. If you found it helpful, share it around with friends and family to help spread the word and save them from the agonies of yo-yo dieting.
What’s your take on reverse dieting? Have anything else to share? Let me know in the comments below!
+ Scientific References
Skein M, Duffield R, Kelly BT, Marino FE. The effects of carbohydrate intake and muscle glycogen content on self-paced intermittent-sprint exercise despite no knowledge of carbohydrate manipulation. Eur J Appl Physiol. 2012;112(8):2859-2870. doi:10.1007/s00421-011-2253-0
Wang ZM, Heshka S, Zhang K, Boozer CN, Heymsfield SB. Resting energy expenditure: Systematic organization and critique of prediction methods. Obes Res. 2001;9(5):331-336. doi:10.1038/oby.2001.42
Fatouros IG, Chatzinikolaou A, Tournis S, et al. Intensity of resistance exercise determines adipokine and resting energy expenditure responses in overweight elderly individuals. Diabetes Care. 2009;32(12):2161-2167. doi:10.2337/dc08-1994
Leibel RL, Hirsch J. Diminished energy requirements in reduced-obese patients. Metabolism. 1984;33(2):164-170. doi:10.1016/0026-0495(84)90130-6
Weyer C, Walford RL, Harper IT, et al. Energy metabolism after 2 y of energy restriction: The Biosphere 2 experiment. Am J Clin Nutr. 2000;72(4):946-953. doi:10.1093/ajcn/72.4.946
Mason C, Foster-Schubert KE, Imayama I, et al. History of weight cycling does not impede future weight loss or metabolic improvements in postmenopausal women. Metabolism. 2013;62(1):127-136. doi:10.1016/j.metabol.2012.06.012
McGnire MT, Wing RR, Klein ML, Hill JO. Behavioral strategies of individuals who have maintained long-term weight losses. Obes Res. 1999;7(4):334-341. doi:10.1002/j.1550-8528.1999.tb00416.x
Rosenbaum M, Leibel RL. Adaptive thermogenesis in humans. Int J Obes. 2010;34:S47-S55. doi:10.1038/ijo.2010.184
Weigle DS, Brunzell JD. Assessment of energy expenditure in ambulatory reduced-obese subjects by the techniques of weight stabilization and exogenous weight replacement. In: International Journal of Obesity. Vol 14. ; 1990:69-77. https://www.ncbi.nlm.nih.gov/pubmed/2228420/. Accessed November 28, 2019.
Weigle DS. Contribution of decreased body mass to diminished thermic effect of exercise in reduced-obese men. Int J Obes. 1988;12(6):567-578. http://www.ncbi.nlm.nih.gov/pubmed/3235273. Accessed November 28, 2019.
Levine JA, Vander Weg MW, Hill JO, Klesges RC. Non-exercise activity thermogenesis: The crouching tiger hidden dragon of societal weight gain. Arterioscler Thromb Vasc Biol. 2006;26(4):729-736. doi:10.1161/01.ATV.0000205848.83210.73
Levine JA. Non-exercise activity thermogenesis (NEAT). Best Pract Res Clin Endocrinol Metab. 2002;16(4):679-702. doi:10.1053/beem.2002.0227
Miles CW, Wong NP, Rumpler W V., Conway J. Effect of circadian variation in energy expenditure, within-subject variation and weight reduction on thermic effect of food. Eur J Clin Nutr. 1993;47(4):274-284. https://www.ncbi.nlm.nih.gov/pubmed/8491165/. Accessed November 28, 2019.
Tappy L. Thermic effect of food and sympathetic nervous system activity in humans. In: Reproduction Nutrition Development. Vol 36. EDP Sciences; 1996:391-397. doi:10.1051/rnd:19960405
Mäestu J, Eliakim A, Jürimäe J, Valter I, Jürimäe T. Anabolic and catabolic hormones and energy balance of the male bodybuilders during the preparation for the competition. J Strength Cond Res. 2010;24(4):1074-1081. doi:10.1519/JSC.0b013e3181cb6fd3
Mäestu J, Jürimäe J, Valter I, Jürimäe T. Increases in ghrelin and decreases in leptin without altering adiponectin during extreme weight loss in male competitive bodybuilders. Metabolism. 2008;57(2):221-225. doi:10.1016/j.metabol.2007.09.004
MacLean PS, Bergouignan A, Cornier MA, Jackman MR. Biology’s response to dieting: The impetus for weight regain. Am J Physiol - Regul Integr Comp Physiol. 2011;301(3). doi:10.1152/ajpregu.00755.2010
Johnstone AM, Murison SD, Duncan JS, Rance KA, Speakman JR. Factors influencing variation in basal metabolic rate include fat-free mass, fat mass, age, and circulating thyroxine but not sex, circulating leptin, or triiodothyronine. Am J Clin Nutr. 2005;82(5):941-948. doi:10.1093/ajcn/82.5.941
Bosy-Westphal A, Braun W, Schautz B, Müller MJ. Issues in characterizing resting energy expenditure in obesity and after weight loss. Front Physiol. 2013;4 MAR. doi:10.3389/fphys.2013.00047
Trexler ET, Smith-Ryan AE, Norton LE. Metabolic adaptation to weight loss: Implications for the athlete. J Int Soc Sports Nutr. 2014;11(1). doi:10.1186/1550-2783-11-7
Hand GA, Shook RP, Paluch AE, et al. The energy balance study: The design and baseline results for a longitudinal study of energy balance. Res Q Exerc Sport. 2013;84(3):275-286. doi:10.1080/02701367.2013.816224
Sumithran P, Prendergast LA, Delbridge E, et al. Long-Term Persistence of Hormonal Adaptations to Weight Loss. N Engl J Med. 2011;365(17):1597-1604. doi:10.1056/NEJMoa1105816
Readers' Ratings
Mike Matthews is a bestselling fitness author of Bigger Leaner Stronger, Thinner Leaner Stronger, and The Shredded Chef, as well the founder of Legion Athletics.
His simple and science-based approach to building muscle, losing fat, and getting healthy has sold over a million books and helped thousands of people build their best bodies ever, and his work has been featured in many popular outlets including Esquire, Men’s Health, Elle, Women’s Health, Muscle & Strength, and more, as well as on FOX and ABC.
If you enjoyed this article, get weekly updates. It's free.
100% Privacy. We don't rent or share our email lists.
The Ultimate Shoulder Workout: The Best Shoulder Exercises…
The Ultimate Arms Workout: The Best Arm Exercises…
The Best Chest Workouts for Building Awesome Pecs…
Give Me One Week In Your Inbox…
…and I'll show you the best evidence-based ways to improve your body composition, develop your "inner game", and optimize your overall health and well-being.
Great! You're subscribed!
Looks like you're already subscribed!
Hey, I'm Mike Matthews. My books, articles, podcasts, and products help people build their best body ever. Will you be next?
Who is Mike?
The Best Training Frequency for Building Muscle (According to 20 Studies)
8 Ancient Laws for Creating a Simpler, Happier Life
How to Be More Physically Attractive to Women (According to Science)
How to Find the Best Workout Split for You
Use This Simple Mind Trick to Instantly Boost Your Motivation
4 Evidence-Based Ways to Stop Procrastinating Immediately
Body Fat Percentage
How to Deadlift
How to Squat
How to Bench Press
How to Military Press
Macronutrient Calculator
Strength Calculator
Muscle Gain Calculator
More from Legion
IT’S-ON-US MONEY-BACK GUARANTEE
Many companies offer a money-back guarantee because they know the majority of dissatisfied customers aren’t going to go through the hassle of actually returning the product to get their money back. We don’t play these games because we don’t have to, the quality of our products makes it unnecessary.
If you order any of our supplements for the first time and don’t like it, you can keep it. Just notify us and we’ll give you a full refund on the spot. No complicated forms and no return necessary.
To protect ourselves from fraud, the It’s-On-Us guarantee is only valid for first time purchases of a product, and redeemable up to three months after purchase. If you bought more than one bottle of a supplement on your first purchase and don’t like it, we would ask that you send the unopened bottles back to us for a refund because we can put them back into our sellable inventory.
Many companies use shipping and handling fees to increase their profit margins, but here at Legion, we hate profits so our shipping is 100% free!
Okay, we do dig on profits, but we also do offer 100% free shipping to everywhere in the world because it makes people you like happy, and that makes us happy.
So, if you live in the United States, your order ships free regardless of order size, and if you live anywhere else, your order ships free when it’s over $99.
Why the restriction on international orders?
Unfortunately shipping outside of the US is very expensive and if we didn't require a minimum order size, we'd lose a lot of money. That said, most customers spend about $100 with us each time they shop, so this setup is a win-win.
Our scientific review board of nutritionists, dietitians, molecular biologists, doctors, and other accredited experts is responsible for reviewing every article, podcast, and video we produce to ensure they’re evidence based, accurate, trustworthy, and current.
Thanks to their connections, credentials, and academic experience, this team of MDs, PhDs, and other professionals has access to a wealth of research published in the largest and most prestigious journals in the world.
This allows them to not only review individual studies but also analyze the overall weight of the evidence on any and all topics related to diet, exercise, supplementation, and more.
If you feel that any of our content is inaccurate, misleading, out-of-date, or anything less than factual, please let us know in the comments section of the article in question.
We follow a detailed, rigorous, multi-step process to create content that meets the highest standards of clarity, practicality, and scientific integrity.
First, our research associates provide our editorial team with accurate, up-to-date, proven scientific evidence.
Then, our editorial team uses this research to draft articles and outlines for podcasts and videos.
Finally, our scientific review board reviews the content to ensure all key information and claims are backed by high-quality scientific research and explained simply and precisely.
Enter your email address below to get instant access to your course!
Great! You're in! Check your email to get instant access to your free course.
Whoops, something went wrong. Please refresh the page and try again, or feel free to reach out to us via our support page.
It's-On-Us Satisfaction Guarantee
Scientific Review Board
Michael Matthews
Enter your email address below for exclusive discounts,
promotions, and notifications!
Connect with Us Twitter Facebook Instagram
Legion Athletics, Inc.
8045 Leesburg Pike #240
Copyright © 2020 Legion - All Rights Reserved Privacy | Terms
Copyright © 2020 Legion - All Rights Reserved
|
cc/2020-05/en_middle_0087.json.gz/line1341053
|
__label__wiki
| 0.647165
| 0.647165
|
Best Banks 2017-18
College Planner
Money 50: The Best Mutual Funds
Ultimate Retirement Guide
These Are the Best Banks for Service Members and Veterans
Many claim to offer perks, but only a few stand out.
This Is the Best Bank for Seniors Now
Plus two honorable mentions.
This Is the Best 12-Month CD Right Now
It pays about 1.5%—with no minimum.
How MONEY Chose the Best Banks in the U.S.
To choose this year's Best Banks, MONEY evaluated the largest 90 brick-and-...
To choose this year's Best Banks, MONEY evaluated the largest 90 brick-and-mortar banks, 50 credit unions, and 15 online banks, as identified by bank consultancy firm Novantas. Bankrate.com, MONEY’s project partner, collected data on fees,...
This Is the Best Online Bank
No branches? No problem.
Best Bank Accounts for When You're Broke
Avoid fees even when you're living paycheck to paycheck.
The Best Bank in Every U.S. State
Here are MONEY's picks from all across the U.S.
Sign up to receive the latest updates and smartest advice from the editors of MONEY
Best Auto Insurance
Best All-Inclusive Resorts
© Copyright 2020 Ad Practitioners, LLC. All Rights Reserved. Use of this site constitutes acceptance of our Terms of Use and Privacy Policy (Your California Privacy Rights).
MONEY is an independent, advertiser-supported website. MONEY may receive compensation for some links to products and services throughout this website.
Opinions expressed on this site are the author's alone, not those of a third-party entity, and have not been reviewed, approved, or otherwise endorsed. Offers may be subject to change without notice.
MONEY has partnered with CardRatings.com and ConsumersAdvocate.org, among other companies, for our coverage of credit card products. MONEY, CardRatings.com, and ConsumersAdvocate.org may receive a commission from card issuers.
Quotes delayed at least 15 minutes. Market data provided by Interactive Data. ETF and Mutual Fund data provided by Morningstar, Inc. Dow Jones Terms & Conditions.
S&P Index data is the property of Chicago Mercantile Exchange Inc. and its licensors. All rights reserved. Terms & Conditions. Powered and implemented by Interactive Data Managed Solutions. | Data Policy | EU Data Subject Requests
|
cc/2020-05/en_middle_0087.json.gz/line1341059
|
__label__wiki
| 0.892219
| 0.892219
|
A life history of louis armstrong the musician
Ap world history past exam essays
History and effects of tv ads
Home writing company history Table tennis history
Table tennis history
Popular appeal It is invaluable there are 40 million competitive critic tennis players and countless Table tennis history playing recreationally, making it the best with the most people worldwide.
You can learn how to make the game in one day, even become very best at it within a moment. Table tennis is the unauthentic name of the game. That bat, which had a speedy wooden handle, was only a variety parchment fitted on an oval frame.
The ouch began in the s, when lawn forgiveness players adapted their game to play anytime during the winter. Why not write over to our services of the previous indoor table tennis tables and grab a solid for your work.
As more and more ping fancy tournaments were now being organised, they also finite legal action against anybody who used their proprietary trademarked name of Course Pong without exemplifying the use of your equipment.
Rackets were lids from empty ground boxes, and a little so, parchment paper stretched around a college. If a game is important 15 minutes after it has revealed, the rest of that only and the remaining inconsistencies of the match scoop under the Expedite System. This gave the wooden a professional nuance and feel.
The name publication pong then came to be wary for the game attributed by the rather expensive Jaques journalism, with other manufacturers calling theirs table suspense. Significant presentations in the other of table tennis Since there have been many ways events which have taken place and many of these particular to changes to the rules of the educational.
Where was causation originated. But the story of the game had been said, establishing the fast attacking speed and classification style of the river game. Overly is table tennis originated from.
He dedicated a celluloid ball for the life. The two name are able interchangeably depending on the attention during play: Their team was led by the everyday Victor Barna, whose inspiration and random did so much to elevate the corresponding to sports singing.
Play is now restricted. In WithoutMajor Greg Clopton Wingfield devised a higher game for the citation of his guests at a garden entire on his relationship at Nantclwyd, Wales.
Water are the parts of a standard tennis table.
Table Tennis has an interesting history that took it from the living rooms of Britain to the Olympic stops of the Important. This was followed by E. The Sadly Mirror organized and sponsored a nationwide colon in which there were 40, companies. An excellent tell was adopted to get around this best.
Popular ribbon It is estimated there are 40 acquisition competitive table tennis players and only millions playing recreationally, upbringing it the sport with the most people worldwide.
by courtesy of the ITTF. The history of table tennis (also known as ping pong) has been the subject of extensive research, notably by Englishman Gerald Gurney and by American's Charles "Chuck" Hoey and Tim Boggan.
Table tennis: Table tennis, ball game similar in principle to lawn tennis and played using a lightweight hollow ball and paddles on a flat table divided into two equal courts by a net.
Popularly known by the trademarked name Ping-Pong, it is a common recreational activity as well as a competitive Olympic sport. History. Table tennis started as a genteel, after-dinner game, but is now a fast, high-tech sport.
It also has the most participants of any sport in the world. The history of table tennis (also known as ping pong) has been the subject of extensive research, notably by Englishman Gerald Gurney and by American's Charles "Chuck" Hoey and Tim Boggan.
But the research by Gerald Gurney - presented in "Table Tennis: The Early Years" - is considered to be the definitive guide to the history of the sport. History. Table tennis started as a genteel, after-dinner game, but is now a fast, high-tech sport.
It also has the most participants of any sport in the world. Table tennis, also known as ping-pong, is a sport in which two or four players hit a lightweight ball back and forth across a table using small bats. The game takes place on a hard table divided by a net. Except for the initial serve, the rules are generally as follows: players must allow a ball played toward them to bounce one time on their.
History of external auditing
History the mob boss
A history of slavery in the american civil war
A history of the bolshevik revolution
1954 history essay
How to write a complaint letter to a bus company
A history of pearl harbor as a military installation
A brief look at jewish history
A history of culture and mythology in the roman empire
History of the internet
Schindler s list history and memory
History of Table Tennis
|
cc/2020-05/en_middle_0087.json.gz/line1341064
|
__label__wiki
| 0.507851
| 0.507851
|
Mel's JAFF Stories
Enter the world of Jane Austen Fan Fiction
The Derbyshire Mystery Stone chapters 13 & 14
Date: February 9, 2019Author: melschertz 0 Comments
Georgiana was uncomfortable riding in the carriage with Elizabeth. From what the young lady had stated, Darcy had taken a liking to the Bennet daughter. But why would her brother find the dark-haired female to be so likeable? Was there something that Georgiana had not noticed?
“You have come to enjoy by sister’s company, Miss Elizabeth?”
The young lady nodded her head. “Indeed. She has been easy to speak with, and very knowledgeable on many subjects. You must be proud of her, learning more of the world than simply what is expected of young ladies. Many men frown on such, afraid of intelligent women.”
“And what subjects did you discuss?” Georgiana was curious. She had never thought of discussing matters that would be important to her brother, so it would be interesting to discover more about him through the lady before her.
“We spoke of medicine, treatments for different ailments and illnesses. And we discussed running an estate, crop rotations and such. I never expected to find another female who is as interested in such topics as myself.
Certainly, this is not a popular notion amongst society. And she has not even come out or taken her curtsey.”
“You would be amazed at how different my sister is, Miss Elizabeth.” Georgiana stated. She was unsure how they would explain the difference in her personality if they were successful in returning to their own bodies.
“Well, I am glad to know that you allow your sister to be herself, rather than conform to what society demands. My father has endured much teasing from his friends for allowing me the freedom to learn as if I were a son rather than a daughter.”
Georgiana looked out the window of which she was seated near. She had never thought about learning of crop rotation or any other aspects of running an estate. Her role models would be shocked to see such a young lady as Elizabeth Bennet. The thought of Lady Matlock learning how the farms are run or handling the books for the estate was ridiculous. But Georgiana Darcy was learning that netting a purse or playing the pianoforte were frivolous in comparison to what men were expected to do. Of course, many men of society have stewards to run the estate, rather than getting their hands soiled doing labor along with the tenants and staff. There was more she wished to know, to have a better understanding of the world in which she lived.
Elizabeth had been watching the expression of the gentleman before her. “If I have said anything inappropriate, Mr Darcy, please forgive me. I know most of the ton do not wish their ladies to know the details of estate management. Perhaps it is a subject you do not wish your sister to know.”
A thought came to Georgiana. “No, Miss Elizabeth, I was just considering that ladies are under appreciated. We expect you to set a proper table, entertain the men, and look pretty. But I have an aunt who was widowed many years ago, before my…my sister’s birth. The estate was not entailed, so my cousin Anne is to inherit. Until Anne takes up her inheritance, Lady Catherine sees to the estate being run.”
“Lady Catherine? It is she who gave my cousin the living at Hunsford Parish.”
Having met Mr Collins when she had last visited Rosings Park, Georgiana shuddered. “Indeed. My aunt prefers to surround herself with those who worship her benevolence. Mr Collins is…a unique person.”
“Your sister stated similar views of my cousin. I have yet to meet him, though I may be meeting your aunt soon.”
“Why would you meet my aunt? Are you to visit your cousin?”
It was Elizabeth’s turn to look out a window of the carriage. “I…I am supposed to marry my cousin.”
Shocked, Georgiana responded without thinking. “Your family would force you to wed such a vulgar man?”
“I have no brother, Mr Darcy. As such, with our estate entailed to Mr Collins, my parents felt it would protect my mother and sisters when my father’s time has come. It is my duty to do what I can to ensure my mother and sisters have a home and comfort.” Elizabeth could not look at the other occupants of the carriage.
“I pray there is another way to protect them, Miss Elizabeth.” Georgiana replied. “No one should have to suffer such a man for the security of her family.”
Bingley added his opinion. “Perhaps, if one of your sisters were to marry well, you would not be forced into such a union, Miss Elizabeth.”
“It is my prayer, Mr Bingley, though I will not count it as a possibility.”
The topic was quickly changed, turning to books. Georgiana was surprised at the variety of reading materials Elizabeth had read, making a note to learn more of the topics.
When the subject matter turned to geology, Elizabeth reached into her reticule, pulling out an object which instantly garnered Georgiana’s attention.
“I found this stone in the gardens this morning. It is not from Hertfordshire, I am certain, for I have never seen such before.”
In her hand, Elizabeth held the very stone that had triggered the change between the Darcy siblings.
Controlling her impulse to grab ahold of the stone, Georgiana shook her head. “It comes from Derbyshire. It is a form of fluorite.”
“It is beautiful. My father loves collecting stones from all over the world. As my mother’s brother owns an import company, he enjoys finding unique samples to gift my father. Just last year, my uncle acquired a beautiful specimen of tourmaline which was multicolored. Incredibly beautiful.”
“From what I have been told, the fluorite you hold is only found in the Peak District of Derbyshire. At Matlock House, in London, my aunt has a pair of candlesticks made from the stone. They are exquisite.”
Elizabeth returned the stone to her reticule, while Georgiana thought of ways to obtain the stone from the young lady. There had to be some way to gain possession of it.
~~ ** ~~
Wickham was not pleased with the lack of progress they were making. One of the horses had come up lame and had to be exchanged, then there was a problem with one of the wheels. They had only arrived in a small village in Bedfordshire in the nick of time, though the village had very little to assist them. The owner of the stables was ill and could not aid the carriage driver in exchanging the wheel. The inn was closed and appeared to have been closed for many days.
The driver went to the door of the parsonage, hoping to find someone who could rescue him from the ill temper that Wickham was experiencing. The parson came to the door. “How might I be of assistance?”
“Beggin your pardon, but our carriage has met with a mishap and we require a new wheel. Could you tell me where I can find someone who would be able to repair the wheel or find a replacement?”
“There is no one near. Closest would be in Luton, which is a two-hour ride on horseback.” The parson replied.
“How many are in your carriage?”
“Two ladies and a gent. He will be right angry over this.”
“Are they wealthy? Would they be able to pay if I offer them food and tea?” The parson’s cheeks turned red.
“I do not ask for myself. As you can see, our community is poor and in desperate need. A few coins would go a long way to helping those for which I tend.”
“The young miss looks to be from a fine family, but the other lady is her companion. And the gent, well, I have me doubts as to his wealth. Thinks more of himself than he is, if you know what I mean.”
“Well, the offer is there, if they wish. I will put the kettle on, just in case.”
The carriage driver nodded his head, then headed back towards the carriage. Wickham was pacing outside the carriage, furious over the delay. “Well, did you find anyone to come to our aid?”
Shaking his head, the driver explained the situation. “I will take one of the horses and ride to Luton. Hopefully I will return before dark.”
“That is not acceptable. We must be on our way immediately. These delays are costing us dearly.” Wickham stated as he attempted to rein in his temper. “We will have to ride the horses until we reach somewhere that has proper transportation for us.”
Darcy saw an opportunity to frustrate Wickham’s plans. Remembering how Georgiana had been injured from a fall from a horse, and her fear that grew from the incident, Darcy decided to use that to delay them.
“Mr Wickham, you cannot expect me to ride one of the horses. You remember when I was a child, when my father and I were riding, and an adder snake scared the horse. I was thrown to the ground, and the horse nearly trampled me. We must remain here, until the carriage can be repaired.”
“You can ride with me.” Wickham growled.
“The very thought of being on a horse brings me to tears. You cannot be so heartless as to torment me in such a manner. Please, do not try to force me on one of those beasts, I cannot abide the thought of torture.” Darcy feigned tears welling in his eyes. He despised when women used such tactics but realized that there were times when the supposed weaker sex was stronger than their male counterparts, and this was one of those times. As Wickham’s eyes saw Georgiana Darcy before him, he expected her to be weak and easy to manipulate to get what he wanted. It made Darcy realize there were times that he had been manipulated by some of the ladies in his own family, especially his two aunts. But that would require contemplation at a different time. Now he must use all the womanly charms he could to convince Wickham.
“You are behaving like a child, Georgiana. I insist you do as I say.” The scoundrel grasped Darcy by the upper arm, attempting to drag his captive towards the horses.
Darcy let out a cry, pretending to be hysterical. “No, please, do not make me get near the horses. Please, I am begging you.”
Mrs Younge took hold of the other arm of her charge. “Miss Darcy, you were not frightened of horses the other morning. You told me you wished to go riding.”
“You are lying…I would never say such a thing. When have you ever seen me near a horse? You are making up stories against me, all so you can be with Mr Wickham. I am frightened and cannot stand the thought of being near the horses, let alone ride on one.”
“George, I swear, she told me that she wished to go riding the other morning.” Mrs Younge demanded. “I told her that I did not pack her riding habit.”
“You must be mistaken, Mrs Younge. I remember when Georgiana had her accident and have never seen her near a horse since then.” Wickham said, angry with the situation. “We must leave here as soon as possible. I doubt that Darcy has learned of our disappearance, but we do not wish to be here when he discovers what has happened.”
“The parson says he can feed you if you have a coin or two. As poor as the neighborhood is, food must be at a high cost.” The driver suggested.
“No, we will remain with the carriage.” Wickham fumed. “Be off and return as quick as possible.”
~~~~~~~ ** ~~~~~~~
CHAPTER FOURTEEN
Mr Bennet dreaded the news of the arrival of his distant cousin. Mr Collins was not due to arrive for another week. The man’s decision to make the journey early was not appreciated, especially when there was no word of warning. Knowing Collins’ father, Mr Bennet was not anticipating the coming days.
Mrs Hill, the housekeeper of Longbourn, ushered the parson of Hunsford Parish into her master’s study. She inquired of Mr Bennet if he desired tea served, which was met with a slight nod.
“Mr Collins, I was not expecting you until next week. Why did you not write to inform me of the change?”
“My magnanimous benefactor, Lady Catherine de Bourgh was on her way to London to visit with her relations, including her brother, the Earl of Matlock. ‘Mr Collins, you should accompany me as far as London, then take a post carriage to your relations. It would cost you less by doing so, rather than having to hire a carriage to take you the entire way.’ Lady Catherine is superior in every way, and her wisdom is greatly appreciated. Why, she has even instructed on how my closets should be constructed, including shelves. Can you imagine, shelves in the closet? Such a wise lady.”
“And while you were saving yourself funds, you did not think to use some of those funds to send a message ahead to notify us of your early arrival?” Mr Bennet did not need longer to know that the son was much like the father had been.
“I was certain you would not require much time to prepare for me, as my father explained the size and worth of Longbourn. You must only have one spare room for guests, with so many daughters having rooms of their own.”
Mr Bennet was nearing the boiling point and his cousin had not been at Longbourn for even half an hour. “I beg to differ. Your father had not been here since he was a small boy, and even so, we have made improvements over the years. We added a separate wing to the east side of the manor house, which gave us a larger dining area to entertain company, and three additional bedchambers above. And a small conservatory was added, as my two eldest daughters have enjoyed learning more of plants.”
“Ah, your daughters. I believe the daughter you have decided on for me to marry is one of the eldest daughters.” Mr Collins was eager to set his eyes on the young ladies.
“My daughter, Elizabeth, is the one of which I wrote to you. She is my second born, with Jane being the eldest.”
Mr Collins frowned. “And why was your first born not offered to be my wife? Is there something wrong with the girl?”
“No, no, Jane is a delightful young lady, beautiful and sweet natured. But she has a young man courting her, and his attention to her came before your letter wishing to wed one of my daughters. Besides, Elizabeth is intelligent on matters of running the estate. She will be invaluable to you when I am gone.”
“A female who is knowledgeable on a man’s business? That is absurd. Your family is not of noble birth, so she could not possibly be as intelligent as someone such as Lady Catherine. She is a widow and has run Rosings Park quite on her own for many years, but she is the daughter of an earl, therefore her superior breeding has allowed her to understand the working of an estate.” Mr Collins sniffed the air as if there was something foul in the room.
“Well, my daughter may not be the daughter of nobility, but she is extremely intelligent and has been valuable in aiding me in caring for the estate.”
“Where is this daughter? I wish to meet her immediately, as it is my intention to be certain that she will make a proper parson’s wife. She will be required to see to the needs of those in my flock, and will need to show difference to our benefactor, as Lady Catherine deserves.”
Mr Bennet took some pleasure to announce that both Jane and Elizabeth were away from home. “Jane took ill while visiting our neighboring estate, and the family staying there would not hear of her returning to Longbourn until she was fully recovered. They even invited Elizabeth to stay with Jane, to comfort her as only a dear sister could.”
“Are your daughters prone to take ill while at someone’s home? I will not take a wife who is sickly.”
“Jane was caught in the rain and took a chill from the cold storm. Elizabeth has been extremely healthy all of her life.” Mr Bennet said with pride.
“Well, if you would show me to my rooms, I will refresh myself while you send for Cousin Elizabeth to return home.” Mr Collins demanded.
“My housekeeper will show you to your room, and you will meet Elizabeth when she returns home, after Jane is fully recovered.”
Not wishing to start an argument so soon after his arrival, Mr Collins waited for the housekeeper to return.
After Mrs Hill placed the tray containing the tea and biscuits on Mr Bennet’s desk, she motioned for the parson to follow her upstairs. Mr Collins’ disappointment of not being offered the refreshments that had arrived was obvious, but Mr Bennet ignored the foolish man, pouring tea for himself as his cousin followed Mrs Hill.
The door was closed after the parson left the study, leaving Mr Bennet to think of the man who was to be his son in law. “He does not stand a chance with Lizzy as his wife. The fool has not a sensible bone in his body, and Lizzy will put him in his place from the start. Perhaps it would be wise of me to warn Mr Collins that siding with one’s patroness over one’s wife is not a wise choice. But then again, it will be entertaining to watch Lizzy teach him that lesson.”
The master of Longbourn lifted his cup of tea to his lips, taking a sip. Once his cup was returned to the saucer, Mr Bennet returned to reading his book. All the while, he was thinking that perhaps he was wrong on having his cousin arrive so soon. Mr Bennet loved laughing at the foolishness of others, so watching his daughter put Collins in his place would be quite entertaining.
Mrs Bennet was all a twitter. Why had she allowed Elizabeth to go to Netherfield to tend Jane? Now that Mr Collins had arrived, she must insist on her least favorite daughter returning to give her attention to her betrothed. She waited until Mr Collins went upstairs with Hill before she entered her husband’s private domain.
“Mr Bennet, you must send a message to Netherfield. Lizzy must return immediately.”
“I will do no such thing. As Mr Collins failed to inform us of his change in plans, he will have to wait until our daughters return, and that is to be when Jane is fully recovered, and not a moment sooner.”
“Mr Bennet, how you vex me. Mary can be sent to tend Jane. Lizzy must be here with Mr Collins. He is her betrothed and might become irritated with her not being here.”
A chuckle escaped Mr Bennet. “Let him be irritated. I look forward to our daughter putting the fool in his place. No, he will have to wait for our girls to return, and that is that. Now, allow me some peace.”
Discouraged, Mrs Bennet turned and left the study. Then she had an idea. If her husband would not send a message insisting their second born return home, then Mrs Bennet would do so herself.
Going to her rarely used desk, Fanny Bennet pulled out a sheet of parchment and her writing supplies. After mending her pen, she scratched out a message.
Dear Lizzy,
Mr Collins has arrived earlier than expected. He is anxious to meet you, so that he can begin instructing you on what he expects from his wife. So, you must return immediately.
If Jane is unable to leave Netherfield, I will send Mary to tend her. But you must be at Longbourn. No other man would ever ask for your hand, so you must not waste this opportunity to wed. And it would bring comfort to your sisters and I to not have to leave our home when your father dies. It is your duty to our family, and to Longbourn. Without your guidance, Mr Collins will certainly be the ruination of the estate. For once, your learning is a blessing, for it will rescue our family from the hedge row.
I expect you to be at Longbourn within the hour. As I said, Mary can tend Jane if need be. Do as you are told, Elizabeth, our future happiness depends on you.
Your mother, FB
The letter was sanded and sealed, then Mrs Bennet went in search of the housekeeper. “Mrs Hill, this must be taken to Netherfield immediately. Will you see that one of the stable hands takes it to Lizzy?”
“Of course, Mrs Bennet.” Mrs Hill replied, accepting the message. “I will have Ted take it to Miss Lizzy.”
Mrs Bennet decided to take to her bed, as her nerves were in need of rest. As Mrs Hill went to find the stable boy, she was called upon to assist Longbourn’s cook, who had burned her arm. The housekeeper was so busy with the cook that it was several hours before she remembered the message, which she had placed in her apron pocket. When she pulled the folded parchment from her pocket, Mrs Hill discovered that the ink on it was smeared, as her apron had gotten wet while tending the burn on the cook’s arm.
What was she to do? Mrs Bennet would be furious that the missive had yet to be delivered, as she insisted it be done immediately. There was only one solution to the problem. Mrs Hill knocked on the door to Mr Bennet’s study. The master of Longbourn would know what to do about his wife.
Published by melschertz
Author of Pride and Prejudice fan fiction books. Retired crime lab/crime scene technician, I now spend my time with my family, making jewelry, and reading & writing P&P fanfiction. View all posts by melschertz
Previous Previous post: The Derbyshire Mystery Stone. Chapters 11 & 12
Next Next post: The Derbyshire Mystery Stone. Chapters 15 & 16
The Capture of Fitzwilliam Chapters 11 & 12
The Capture of Fitzwilliam chapters 9 & 10
The Derbyshire Mystery Stone. Chapters 17 & 18
Sarah P on The Capture of Fitzwilliam cha…
melschertz on The Trial of Elizabeth Bennet.…
melschertz on Pemberley Quaking. chapters 3…
melschertz on The Derbyshire Mystery Stone.…
Buturot on The Derbyshire Mystery Stone.…
Archives Select Month April 2019 February 2019 January 2019 December 2018 November 2018 September 2018 August 2018 July 2018 February 2018 January 2018 December 2017 November 2017 June 2017 May 2017 April 2017 January 2017 December 2016 November 2016 October 2016 September 2016 August 2016 July 2016 June 2016 May 2016 April 2016 March 2016 January 2016 December 2015 November 2015 October 2015 September 2015 August 2015 July 2015 June 2015 May 2015 April 2015 March 2015 February 2015 January 2015 December 2014 November 2014 October 2014 September 2014 August 2014 July 2014 June 2014 May 2014 April 2014
Categories Select Category Uncategorized (146)
Follow Mel's JAFF Stories on WordPress.com
© 2020 Mel's JAFF Stories
|
cc/2020-05/en_middle_0087.json.gz/line1341068
|
__label__cc
| 0.507565
| 0.492435
|
Small Molecule Therapeutics
The Protein Phosphatase 2A Inhibitor LB100 Sensitizes Ovarian Carcinoma Cells to Cisplatin-Mediated Cytotoxicity
Ki-Eun Chang, Bih-Rong Wei, James P. Madigan, Matthew D. Hall, R. Mark Simpson, Zhengping Zhuang and Michael M. Gottesman
Ki-Eun Chang
Laboratory of Cell Biology, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, Maryland.
Bih-Rong Wei
Laboratory of Cancer Biology and Genetics, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, Maryland.
James P. Madigan
Matthew D. Hall
R. Mark Simpson
Zhengping Zhuang
Surgical Neurology Branch, National Institute of Neurological Disorders and Stroke, NIH, Bethesda, Maryland.
Michael M. Gottesman
For correspondence: mgottesman@nih.gov
DOI: 10.1158/1535-7163.MCT-14-0496 Published January 2015
Despite early positive response to platinum-based chemotherapy, the majority of ovarian carcinomas develop resistance and progress to fatal disease. Protein phosphatase 2A (PP2A) is a ubiquitous phosphatase involved in the regulation of DNA-damage response (DDR) and cell-cycle checkpoint pathways. Recent studies have shown that LB100, a small-molecule inhibitor of PP2A, sensitizes cancer cells to radiation-mediated DNA damage. We hypothesized that LB100 could sensitize ovarian cancer cells to cisplatin treatment. We performed in vitro studies in SKOV-3, OVCAR-8, and PEO1, -4, and -6 ovarian cancer lines to assess cytotoxicity potentiation, cell-death mechanism(s), cell-cycle regulation, and DDR signaling. In vivo studies were conducted in an intraperitoneal metastatic mouse model using SKOV-3/f-Luc cells. LB100 sensitized ovarian carcinoma lines to cisplatin-mediated cell death. Sensitization via LB100 was mediated by abrogation of cell-cycle arrest induced by cisplatin. Loss of the cisplatin-induced checkpoint correlated with decreased Wee1 expression, increased cdc2 activation, and increased mitotic entry (p-histone H3). LB100 also induced constitutive hyperphosphorylation of DDR proteins (BRCA1, Chk2, and γH2AX), altered the chronology and persistence of JNK activation, and modulated the expression of 14-3-3 binding sites. In vivo, cisplatin sensitization via LB100 significantly enhanced tumor growth inhibition and prevented disease progression after treatment cessation. Our results suggest that LB100 sensitizes ovarian cancer cells to cisplatin in vitro and in vivo by modulation of the DDR pathway and cell-cycle checkpoint abrogation. Mol Cancer Ther; 14(1); 90–100. ©2014 AACR.
Ovarian cancer is the fifth leading cause of cancer-related death in women, taking the lives of over 14,000 patients in the United States in 2013 (1). Because of nonspecific early symptoms and unreliable screening measures, most patients present with late-stage disease and a poor (less than 20%) chance of long-term survival (2). Current standard treatment involves maximal debulking followed by combination chemotherapy consisting of a platinum-based compound and a taxane (3). Although patients may have an initial positive response, most eventually develop multidrug resistance and die of progressive cancer (4).
Cisplatin [cis-[PtCl2(NH3)2]] is a platinum-based drug that is commonly used in the treatment of ovarian cancer. Cisplatin acts by forming DNA cross-links that lead to double-strand break (DSB) formation as a consequence of innate repair mechanisms. The consequent DSB accumulation and stalled DNA fork progression result in apoptosis of sensitive cells (5). Despite its high potency, cisplatin is associated with potential toxicities, including nephrotoxicity, nausea/vomiting, neurotoxicity, and ototoxicity, limiting the effective dose that can be used (6). Cisplatin resistance in ovarian cancer is also common, and has been reported to involve an increase in tolerance and/or repair of DNA adducts as well as a failure of apoptotic pathway activation (7, 8). Importantly, greater than 90% of ovarian cancers harbor inactivating mutations of p53, and lack the ability to arrest the cell cycle at the G1–S phase junction (9, 10). Therefore, these cancers respond to DNA damage via S and G2–M phase arrests, allowing DNA-damage repair. Previous studies have shown that the disruption of the critical S and G2–M phase checkpoints can sensitize cells to cisplatin (11).
DNA-damage response (DDR) is facilitated by a highly integrated and complex series of phosphorylation and dephosphorylation events regulated by key kinases and phosphatases, respectively. It has been shown that constitutive phosphorylation of intermediates within the response signaling pathways is a barometer of the critical cellular processes that determine whether the cell will repair the damaged DNA or induce apoptotic cell death (12–15). The serine/threonine kinases ATM and ATR are the primary coordinators of cellular responses to DNA damage. These kinases are activated following DSB induction or a stalled DNA replication fork and are implicated in regulating DNA repair, cell-cycle checkpoints, and apoptotic signaling. ATM/ATR directly and indirectly exert these effects by controlling the phosphorylation of downstream target proteins such as BRCA1, H2AX, Chk1, and Chk2 (15). Furthermore, increased and constitutive phosphorylation of numerous other non-ATM/ATR pathway signaling proteins may be correlated with the extent of apoptotic induction. For example, sustained SAPK/JNK (stress-activated protein kinase/c-Jun N-terminal kinase) activation following cisplatin treatment plays a role in both extrinsic and mitochondrial apoptosis (16). Thus, inducing constitutive phosphorylation via targeted inhibition of phosphatases before the initiation of DNA-damaging therapy may enhance cytotoxic efficacy.
Protein phosphatase 2A (PP2A) is a ubiquitous serine/threonine phosphatase that regulates numerous proteins of both ATM/ATR–dependent and -independent response pathways (17). Pharmacologic inhibition of PP2A has previously been shown to sensitize cancer cells to radiation-mediated DNA damage via constitutive phosphorylation of various signaling proteins, such as p53, γH2AX, PLK1, and Akt, resulting in cell-cycle deregulation, inhibition of DNA repair, and apoptosis (18).
LB100 (Fig. 1A) is a small-molecule derivative of the natural product cantharadin with significantly less toxicity (19). Previous preclinical studies have shown that LB100 enhanced the cytotoxic effects of temozolomide, doxorubicin, and radiotherapy against glioblastoma (GBM), metastatic pheochromocytoma, and pancreatic cancer, respectively (18–20). Although the exact mechanism by which LB100 inhibits PP2A function has not yet been deduced, the overall potentiation of DNA-damage therapy seems to derive from abrogation of cell-cycle arrest despite DNA damage. LB100 is currently undergoing a phase I study in combination with docetaxel for the treatment of solid tumors (21). Given the importance of platinum agents for use in clinical treatment of ovarian cancer as well as the well-established literature implicating cisplatin as a potent DNA-damaging agent, we hypothesized that LB100 could enhance the effectiveness of cisplatin treatment in ovarian cancer model systems.
Inhibition of PP2A by LB100 sensitizes ovarian cancer cells to cisplatin cytotoxicity. A, structure of LB100, used as the racemate. B, dose-dependent inhibition of PP2A activity following 2-hour LB100 treatment in SKOV-3 cells. C and D, the MTT assay after 72-hour treatment showing increased cytotoxicity in SKOV-3 cells (C) and OVCAR-8 cells (D) for both IC25 and IC75 doses of cisplatin when cells were pretreated with LB100 compared with either drug alone. E, Western blot analyses following 48-hour treatment shows apoptosis via cleaved PARP and cleaved caspase-3. F, Western blot analysis following 72-hour treatment with cisplatin shows that pretreatment with LB100 enhances apoptosis induced with a sublethal dose (IC25) of cisplatin.
To test this hypothesis, in vitro studies were performed in various ovarian carcinoma cell lines. LB100-dependent effects on cellular PP2A activity, cytotoxic potentiation, cell-cycle modulation, apoptosis, and activation of DNA-damage signaling and repair pathways were investigated. In addition, possible additive or synergistic effects of LB100 on cisplatin treatment were determined. LB100-induced cisplatin sensitization was further determined in vivo in a metastatic ovarian cancer model.
Cell lines, cell culture, and drug solutions
Luciferase-expressing cells were generated by infecting SKOV-3 cells with pCLNCX-luciferase retrovirus (SKOV-3-Luc) as previously reported (22) and cultured in McCoy 5A medium (ATCC) supplemented with 10% fetal bovine serum and 100 U/mL penicillin G sodium, 100 μg/mL streptomycin sulfate, and 292 μg/mL l-glutamine (BioWhittaker). Human OVCAR-8 ovarian cancer cells were provided by the National Cancer Institute (Bethesda, MD; part of the NCI-60 collection). The PEO1, PEO4, and PEO6 ovarian cancer cell lines have previously been characterized (23) and were kindly provided by Dr. Ian Goldlust (National Center for Advancing Translational Sciences, Shady Grove, MD). All the PEO cells and OVCAR-8 cells were cultured in RPMI medium (Invitrogen) supplemented with 10% fetal bovine serum and 100 U/mL penicillin G sodium, 100 μg/mL streptomycin sulfate, and 292 μg/mL l-glutamine (BioWhittaker). Characterization and maintenance of HEK 293 human embryonic kidney cell lines overexpressing Pgp, MRP1, or ABCG2, and the parental human epidermoid carcinoma cell line, KB-3-1, and the cisplatin-resistant KB-CP.5 cells have been described previously (11, 24). All cell lines were thawed immediately before experimentation, and cell lines were characterized using short-tandem repeat profiling. Cisplatin was purchased from Sigma-Aldrich and prepared as a 3.32-mmol/L stock solution dissolved in sterile saline (0.9% sodium chloride; ref. 25). Solutions for injection were prepared immediately before administration. LB100, a water-soluble small-molecule inhibitor of PP2A, was provided by Lixte Biotechonology Holdings, Inc. ADD and was diluted in sterile PBS before administration.
PP2A phosphatase activity assay
Ovarian cancer cells were grown to 80% confluence in 100-mm dishes and treated with LB100 as indicated and prepared as described previously (18). Following treatment for 2 hours, cells were washed twice with cold PBS (pH 7.4) and lysed in lysis buffer (20 mmol/L imidazole–HCL, 2 mmol/L EDTA, and 2 mmol/L EGTA, pH 7.0) supplemented with protease inhibitors (Thermo Scientific) for 30 minutes on ice. Cell lysates were sonicated for 10 seconds then centrifuged at 2,000 × g for 5 minutes. Supernatants were assayed with the PP2A Phosphatase Assay Kit (Millipore) according to the manufacturer's instructions. Experiments were performed in triplicate, and the data are presented as a percentage mean of relative PP2A activity compared with control ± SD.
MTT assay
Cell survival was measured by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Invitrogen) assay. Cells were seeded at a density of 5,000 cells per well in 96-well plates and incubated at 37°C in humidified 5% CO2 for 24 hours. The 50% inhibitory concentration (IC50) values were defined as the drug concentrations required to reduce cell numbers to 50% of the untreated control. For IC50 determination, serially diluted LB100 or cisplatin was added to give the intended final concentrations. The MTT assays were carried out according to the manufacturer's instructions (Molecular Probes). Absorbance values were determined at 570 nmol/L on a SpectraMax 250 spectrophotometer (Molecular Devices). All the MTT assays were performed in triplicate. To determine whether LB100 could enhance the cytotoxic effect of cisplatin, cells were pretreated with LB100 for 1 hour before the addition of cisplatin. Cells were treated with both drugs for 72 hours. Cell viability was analyzed via the MTT assay as described above. Experiments were performed in triplicate, and the data are presented as a percentage mean ± SD.
Production of stable NT-shRNA– and PP2A-C-shRNA–expressing SKOV-3 and OVCAR-8 cells
To stably knockdown expression of the catalytic subunit of PP2A, PP2A-C, a pLKO.1-puro plasmid–based shRNA targeting the sequence: TGGAACTTGACGATACTCTAA (clone ID: TRCN0000002483; Sigma-Aldrich) was used (PP2A-C-shRNA). In addition, a nontargeting shRNA plasmid (NT-shRNA) that targets no known human sequence was used as a control. A primer containing the target sequence (CTGGTTACGAAGCGAATCCTT) along with a stem loop followed by the reverse target sequence was annealed to a complimentary primer and inserted into the EcoRI and AgeI sites of the pLKO.1-puro plasmid (Addgene; number 10878). Lentiviral particles were produced via Lipofectamine 2000 (Invitrogen)–mediated triple transfection of 293T cells with either the PP2A-C-shRNA or the NT-shRNA along with the lentiviral envelope plasmid (pMD2.G; Addgene; number 12259) and the lentiviral packaging plasmid (psPAX2; Addgene; number 12260). Target cells (SKOV-3 and OVCAR-8 human ovarian cancer cell lines) were transduced with either PP2A-C-shRNA or NT-shRNA containing lentiviral particles in the presence of polybrene (8 μg/mL) and stable cells were selected using puromycin (2 μg/mL).
Cell-cycle analysis
SK-OV-3 and OVCAR 8 cells were treated with LB100, cisplatin, or LB100 plus cisplatin at indicated concentrations for 24 and 48 hours. For cell-cycle analysis, cells were washed with PBS and fixed overnight in ice-cold 70% ethanol and stored at 4°C. Cells were then centrifuged and resuspended in 100 U RNAse (Sigma-Aldrich), and incubated at 37°C for 20 minutes. Propidium iodide solution (Invitrogen; 500 and 50 μg/mL in DPBS) was added to each tube and incubated in the dark at 4°C overnight. Flow cytometry analysis was performed with CellQuestPro and data analysis was completed with ModFit LT. All data are in triplicate and presented as a percentage mean ± SD.
Immunoblotting
Whole-cell and homogenized tumor tissues were lysed in NP-40 lysis buffer [50 mmol/L Tris–HCl, pH 7.4, 150 mmol/L NaCl, and 1% Nonidet P40, supplemented with Complete Protease Inhibitor Cocktail tablets and PhosStop phosphatase inhibitors (Roche)] and prepared as previously described (26). Total cellular proteins (40 μg) were separated on 12% or 15% SDS–PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes (Immobilon). The membrane was then blocked for 1 hour at room temperature in 5% (w/v) nonfat milk in TBS-Tween-20 and probed overnight with primary antibodies followed by anti-rabbit or anti-mouse IgG–horseradish peroxidase (HRP)–conjugated secondary antibodies (Cell Signaling Technology) in blocking buffer for 1 hour. Membranes were subsequently incubated in the Immobilon Western Blot Chemiluminescent HRP Substrate (Millipore) and developed on BioMax XAR film (Kodak). Primary antibodies were purchased from Cell Signaling Technology: γH2AX (Ser139), p-Wee1 (Ser 642), Wee1, p-cdc2 (Tyr15), p-BRCA1 (Ser1524), p-Chk1 (Ser345), p-Chk1 (Ser317), Chk-1, phospho-Chk2 (Thr68), PP2A-C, PP2A-A, cleaved caspase-3 (Asp175), cleaved PARP (Asp214), p-histone H3 (Ser10), p-ATR (Ser428), and p-(Ser) 14-3-3 binding motif.
In vivo intraperitoneal ovarian cancer model
Five- to 7-week-old female nude athymic mice (NCR nu/nu) were obtained from NCI (Frederick, MD), maintained in accredited animal facilities and used as stipulated by the U.S. Public Health Service Policy on Humane Care and Use of Laboratory Animals, in accordance with institutional reviews (http://oacu.od.nih.gov). SKOV-3/f-Luc cells (106) were suspended in 100-μL PBS and injected into the intraperitoneal (i.p.) cavity. After 4 days, the mice were randomized into four groups (4–5 animals/group): vehicle control (PBS), LB100 (1.5 mg/kg, i.p.), cisplatin (1.5 mg/kg, i.p.), and LB100 plus cisplatin (same doses as administered alone). Dose and treatment schedule were established on the basis of the activity of each agent reported in previous studies (18, 27). Following tumor inoculation, mice were dosed on days 4, 6, 8, 10, 12, and 14. For the combination group, LB100 was administered 1 hour before cisplatin. Tumor growth was measured twice a week via bioluminescence imaging (BLI) as previously described (28). d-Luciferin (3 mg/100; μL PBS) was administered via i.p. injection. Relative intensity of the BLI signal for each mouse was calculated by dividing the total luminescence for each session by the total luminescence measured on the first day of treatment. Mice were continuously observed until indicated euthanasia endpoints. Toxicity of the treatment regimens was assessed by the degree of weight loss and the overall health status was continuously monitored by a veterinarian on staff. For ex vivo Western blot analysis, 4 tumor-bearing mice were treated with either saline (control), LB100 (1.5 mg/kg), cisplatin (2.5 mg/kg), or LB100 (1.5 mg/kg) + cisplatin (2.5 mg/kg). After 4 hours, mice were euthanized and tumors were rapidly dissected from the i.p. cavity, snap-frozen in liquid nitrogen, and lysed as described above.
Statistical analysis was performed using the software GraphPad Prism 6 (GraphPad Software). Mean values are reported as mean ± SD, and a two-tailed unpaired t test was performed to assess statistical significance. Statistical significance was passed at two-sided P < 0.05.
Ovarian cancer cell line sensitivity to LB100 and cisplatin
To characterize the effects of LB100 and cisplatin on ovarian carcinoma cells in vitro, six ovarian cell lines were tested. SKOV-3 and OVCAR-8 cells have previously been described as p53-null and harboring an inactivating p53 mutation, respectively (29). Both cell lines have also been characterized as intrinsically resistant to cisplatin (30–32). The PEO cell lines (PEO-1s, PEO-1m, PEO-4, and PEO-6) were generated from the same patient before chemotherapy (PEO-1s and PEO-1m) and following the development of clinical cisplatin resistance (PEO-4 and PEO-6). The PEO-1 cell lines carry BRCA2 missense (m) and STOP (s) mutations (23).
The IC50 of each compound was determined using the MTT cytotoxicity assay (Table 1). Cell lines known to harbor intrinsic cisplatin resistance (SKOV-3 and OVCAR-8) or acquired resistance (PEO-4 and PEO-6) showed a 2- to 3-fold decreased sensitivity to cisplatin compared with PEO-1. SKOV-3 (IC50, 10.1 ± 1.8 μmol/L) was 2-fold less sensitive to LB100 compared with the other ovarian lines (average IC50, 5.7 μmol/L), which correlated with the level of PP2A protein expression (Supplementary Fig. S1), suggesting that cell line–specific sensitivity to PP2A inhibition depends, in part, on the overall protein level. Although ATP-binding cassette (ABC) efflux transporters have been shown to affect efficacy of candidate small-molecule therapeutics (33), no information exists on whether this is the case for LB100. When HEK 293 human embryonic kidney cell lines overexpressing Pgp, MRP1, or ABCG2 were treated with the same concentration of LB100, the IC50s of the transfected lines did not increase, and were similar to parental cells or in the presence of an inhibitor (tariquidar; Supplementary Fig. S2). In contrast, these cell lines were resistant to known substrates for these transporters, such as paclitaxel for ABCB1, etoposide for ABCC1, and mitoxantrone for ABCG2 (data not shown). Cisplatin-resistant KB-CP.5 cells demonstrated 2-fold increased resistance to LB100 (vs. 4.8-fold resistance to cisplatin) compared with parental KB-3-1 human adenocarcinoma cells, indicating minimal cross-resistance and potential therapeutic efficacy in cisplatin-resistant cell lines (Supplementary Fig. S3).
IC50s of cisplatin and LB100 on ovarian cancer cell lines
LB100 sensitizes ovarian cancer cells to the cytotoxic effects of cisplatin in vitro
To determine whether PP2A inhibition with LB100 could sensitize ovarian cancer cells to the cytotoxic effects of cisplatin, we first assessed the effect of LB100 on PP2A enzymatic activity. Consistent with previous findings in other types of cancer cells (18, 19), LB100 alone caused a concentration-dependent decrease in PP2A enzymatic function in SKOV-3 cells (Fig. 1B). Next, we performed cytotoxicity assays on ovarian cancer lines using either IC25 (5 μmol/L) or IC75 (15 μmol/L) doses of cisplatin in the presence of 2 μmol/L (<IC25) or 5 μmol/L of LB100. LB100 pretreatment (1 hour) resulted in a significant decrease in cell viability compared with either treatment alone. In SKOV-3 cells, 5 μmol/L (IC25) cisplatin alone resulted in 73% ± 2% viability compared with control, while the presence of 2 and 5 μmol/L LB100 significantly potentiated cisplatin toxicity (58% ± 2% and 25% ± 1% viability, respectively; Fig. 1C). This effect was observed for both low- and high-dose cisplatin concentrations in additional ovarian cell lines examined (Fig. 1D and Supplementary Fig. S4A–S4C). Immunoblot analysis of LB100 pretreatment in combination with cisplatin in SKOV-3 and OVCAR-8 showed increased levels of cleaved caspase-3 and cleaved PARP, indicating apoptosis as the mechanism of cell death (Fig. 1E). In SKOV-3 cells, LB100 sensitization greatly enhanced the expression of apoptotic factors in combination with an IC25 (5 μmol/L) dose of cisplatin 72 hours after treatment (Fig. 1F).
Because pharmacologic inhibition of PP2A via LB100 sensitized ovarian cancer cells to cisplatin, we investigated whether stable knockdown of expression of the catalytic subunit of PP2A (PP2A-C) might result in the same effect. Stable knockdown of PP2A-C was achieved in OVCAR-8 cells, with approximately 50% knockdown of PP2A-C expression compared with control, nonspecific shRNA (Fig. 2A). Cisplatin and LB100 sensitivity were determined for OVCAR-8 PP2A-C shRNA-expressing cells and compared with the same nonspecific shRNA control (Fig. 2B). Consistent with the pharmacologic sensitization induced by LB100, PP2A-C knockdown sensitized OVCAR-8 cells to cisplatin compared with nonspecific control. As expected, sensitivity to LB100 was greatly enhanced in the PP2A-C knockdown cells compared with control (LB100 OVCAR-8 NT shRNA IC50, 15.7 ± 1.3 μmol/L; LB100 OVCAR-8 PP2A-C shRNA IC50, 3.9 ± 0.9 μmol/L; Fig. 2B). Conversely, stable expression of PP2A-C-specific shRNA in SKOV-3 cells resulted in vastly decreased numbers of viable cells (data not shown), highlighting that a baseline expression of PP2A is essential for cellular viability (34).
Validation of PP2A-C as a mediator of cisplatin cytotoxicity. A, Western blot analysis showing stable knockdown of PP2A-C in OVCAR-8 cells. B, cell viability (MTT) assay demonstrating increased sensitivity to cisplatin and LB100 following PP2A-C knockdown. C and D, Western blot analysis showing hyperphosphorylation of Chk1 (S345) for up to 8 hours following cisplatin washout in PP2A-C knockdown (C) and LB100-treated (D) OVCAR-8 cells.
Inhibition of PP2A by LB100 induces hyperphosphorylation of Chk1
PP2A activity has been associated with dephosphorylation of γH2AX, Chk2, and BRCA1 (12, 35). Chk1 is a central mediator of the DDR and maintains the integrity of the genome by inducing S or G2–M cell-cycle arrest and promoting DNA repair. In addition, the functional integrity of Chk1 is maintained by continuous dephosphorylation of key serine residues such as S345, by PP2A (36). To assess whether inhibition of PP2A by LB100 could sensitize the DDR pathway by inducing hyperphosphorylation of Chk1 at S345, OVCAR-8 cells were treated with cisplatin for 1 hour with or without a 1 hour pretreatment with LB100, then incubated in media with or without LB100 for up to 8 hours. LB100 significantly increased the phosphorylation of Chk1 at S345 for each time point following cisplatin treatment compared with cells incubated in media alone (Fig. 2C). To confirm whether this differential phosphorylation was due to decreased PP2A function, we performed the same experiment in the stable PP2A-C knockdown OVCAR-8 cells (Fig. 2D). Consistent with the pharmacologic data, decreased expression of PP2A-C resulted in hyperphosphorylation of Chk1 following cisplatin, compared with OVCAR-8 cells stably expressing control, nontargeting shRNA.
LB100 induces constitutive phosphorylation of key mediators in the DDR pathway independent of ATR activation, allowing persistent DNA damage
Persistent expression of γH2AX is an indicator of inadequate DNA-damage repair (37), and its time-sensitive dephosphorylation is critical for maintaining the chronologic fidelity of repair initiation (13, 38). Furthermore, constitutive phosphorylation of BRCA1 and JNK has been shown to bias the cell toward apoptosis following induction of DNA damage (14, 16). To understand the potential mechanism by which LB100 pretreatment sensitizes ovarian cancer cells to the effect of cisplatin, we compared the phosphorylation state of these key intermediaries of the DDR pathway following treatment with of LB100 and cisplatin. Inhibition of PP2A enhanced the phosphorylation of γH2AX, Chk2, and BRCA1 at 24 hours, and JNK at 72 hours (Fig. 3A). These effects were independent of ATR activation (Fig. 3A, top). LB100 plus cisplatin (5 μmol/L) hyperphosphorylated γH2AX and BRCA1 at 24 and γH2AX, Chk2, and BRCA1 at 72 hours compared with cisplatin (5 μmol/L) alone. For the IC75 dose of cisplatin (15 μmol/L), LB100 pretreatment led to hyperphosphorylation of Chk2 and BRCA1, compared with cisplatin alone, while expression of γH2AX was similar for both groups. Phosphorylation levels of JNK were greater for 5 μmol/L cisplatin, compared with 5 μmol/L of both LB100 and cisplatin initially (24 hours), but at 72 hours, the combination treatments resulted in greater JNK phosphorylation compared with both doses of cisplatin alone.
Potential mechanisms of LB100-induced cisplatin sensitization in SKOV-3 cells. A, Western blot analysis showing LB100-mediated regulation of DDR proteins. B, Western blot analysis of cell lysates collected after 24-hour of treatment showing LB100-induced changes in the phosphorylation states of cell cycle–related proteins. C, Western blot analysis demonstrating differential generation of 14-3-3 p-Ser binding sites with LB100 alone or in combination with cisplatin. D, simplified scheme highlighting potential mechanisms involved in LB100-induced cisplatin sensitization.
Cisplatin-induced cell-cycle checkpoints are abrogated by LB100, which are mediated by changes in both Wee1 expression and cdc2 activation
Given the integral interactions between PP2A and numerous cell-cycle checkpoint proteins, we assessed whether LB100 could abrogate cisplatin-induced cell-cycle arrest. FACS analysis was performed on SKOV-3 and OVCAR-8 cells at both 24 and 48 hours following treatment with various concentrations of both cisplatin and LB100 (Table 2). LB100 treatment alone caused SKOV-3 cells to progress through the G1 stage, resulting in a significantly higher percentage of cells in the G2–M phase. This LB100-mediated event was concentration-dependent [cell fraction in G2–M (%): control (19.4 ± 0.9), LB100 (2 μmol/L; 25.1 ± 0.8), LB100 (10 μmol/L; 32.1 ± 1.6), LB100 (15μmol/L; 33.9 ±1.4)]. In agreement with previous reports (39), cisplatin induced either slow S-phase progression/arrest (SKOV-3) or G2–M phase arrest, which appeared over 48 hours (OVCAR-8). When each cell line was pretreated for 1 hour with IC25 concentrations of LB100 (5 μmol/L for SKOV-3; 2 μmol/L for OVCAR-8), cell-cycle arrest was abrogated at both 24 and 48 hours. In SKOV-3 cells, cisplatin alone resulted in 38% of cells in the S-phase while pretreatment with LB100 resulted in 25% of S-phase cells at 48 hours. In OVCAR-8 cells, cisplatin alone resulted in 79% of cells in the G2–M phase while pretreatment with LB100 resulted in 67% of S-phase cells at 48 hours.
Cell-cycle analysis of SKOV-3 and OVCAR8 cells
Transition into mitosis is critically dependent on the activation state of the cdc2/cyclin B complex (40). Cdc2 is negatively regulated by the Wee1 kinase through an inhibitory phosphorylation on Y15 and is positively regulated by the cdc25C phosphatase via dephosphorylation at this same residue. Wee1 is phosphorylated (p-Wee1 and Ser642) in an Akt/PKB-dependent fashion, such that when G2–M arrest occurs in cells p-Wee1 abundance increases (40). We assessed whether LB100-induced checkpoint abrogation and cell-cycle progression are due to alterations of checkpoint protein function and/or expression. SKOV-3 cells were treated for 24 hours with PBS (vehicle control), LB100 (5 μmol/L), and cisplatin (5 or 15 μmol/L) following 1-hour pretreatment with LB100 (5 μmol/L). LB100 (5 μmol/L) slightly increased the phosphorylation of Wee1 compared with control (Fig. 3B), and not observed at all when LB100 was added to either concentration of cisplatin or at lower LB100 concentrations (Supplementary Fig. S5A). Wee1 phosphorylation was nearly absent for the LB100 and cisplatin (15 μmol/L) combination. Total Wee1 protein levels were also decreased for this treatment group, suggesting that degradation or decreased expression resulted in the observed reduction in phosphorylation levels. Decreased Wee1 expression was correlated with a decrease in p-cdc2 (Y15) for both doses of cisplatin when pretreated with LB100 as well as LB100 alone, allowing cell-cycle progression into mitosis, indicated by the strong increased expression of p-Histone H3 (41). Because the DDR and cell-cycle checkpoint proteins are substrates for and regulated by the 14-3-3 family of chaperone proteins (42) and PP2A inhibition may increase available p-Ser binding domains, we next assessed whether LB100 enhances available p-Ser binding sites recognized by 14-3-3 proteins. In SKOV-3 cells, following 24-hour treatment with LB100 and cisplatin, LB100 alone or in combination with cisplatin (5 and 15 μmol/L) altered the generation of p-Ser binding sites compared with control and cisplatin alone, respectively (Fig. 3C).
LB100 sensitizes tumor cells to cisplatin in vivo
We next investigated the biologic efficacy of LB100-induced cisplatin sensitization in an in vivo mouse model of metastatic ovarian carcinoma. Tumors were established in female athymic nude mice via i.p. injection of SKOV-3 cells expressing firefly luciferase, recapitulating the peritoneal spread observed in the clinical setting (43). Mice were randomized into four groups [vehicle (PBS) control (n = 4), LB100 (1.5 mg/kg; n = 5), cisplatin (1.5 mg/kg; n = 5), and LB100 (given 1 hour before cisplatin) + cisplatin (n = 5)] and treated six times, with drugs administered every other day, starting from 4 days after tumor inoculation. Following the final treatment, mice were observed until predetermined health concerns necessitated euthanization. Dose and treatment schedules were determined from biologic profiles of each agent determined in previous studies (18, 19, 27) and disease progression was monitored by BLI.
There was no significant difference in mean body weight among the four treatment groups, indicating minimal toxicity of the compounds (Fig. 4A). LB100 alone did not alter tumor growth, as assessed by BLI (Fig. 4B and C). On the other hand, cisplatin (relative intensity 5.0 ± 1.6) and the combination of cisplatin and LB100 (4.1 ± 6.3) significantly delayed disease progression by day 25 compared with vehicle (22.4 ± 8.7) and LB100 alone (12.4 ± 6.7). By day 35, the combination treatment significantly delayed tumor progression compared with cisplatin alone (4.3 ± 4.7 vs. 19.8 ± 7.9; P = 0.03). By days 25 and 28, massive ascites developed in the LB100 and control group respectively, necessitating euthanasia. Ex vivo analysis confirmed that the BLI signals were originating from the tumors (Fig. 4D).
LB100 sensitizes SKOV-3 i.p. xenografts to the cytotoxic effects of cisplatin. Mice bearing SKOV-3 i.p. metastatic tumors were treated with PBS (vehicle control; n = 4), LB100 (1.5 mg/kg; n = 5), cisplatin (1.5 mg/kg; n = 5), or LB100 (1.5 mg/kg 1 hour pre-cisplatin) + cisplatin (1.5 mg/kg; n = 5) for six sessions given every other day. A, no significant difference in body weight indicates minimal toxicity. B, LB100+cisplatin combination treatment significantly slows tumor growth, as measured by bioluminescence signaling, compared with other treatment groups. Data are represented as mean ± SD of relative total photon flux compared with day 1 of treatment. C, representative imaging of each treatment group. An average (left) and best (right) responder in the combination group is shown by comparison. D, ex vivo imaging confirms that the signal obtained originates from tumor cells. E, Western blot analysis obtained from ex vivo tumor samples illustrates hyperphosphorylation of γH2AX, BRCA-1, and Chk-1.
Next, we assessed whether the same molecular mechanisms observed in vitro were involved in the LB100-induced sensitization of i.p. tumors to cisplatin. Consistent with the in vitro findings, LB100 alone induced hyperphosphorylation of BRCA1, Chk1, γH2AX, and p-histone H3 (Fig. 4E and Supplementary Fig. S5B). BRCA1 and Chk-1 phosphorylation was further enhanced with cisplatin and LB100 combination treatment compared with cisplatin alone. Combination treatment also resulted in hyperphosphorylation of histone H3 and caspase-3 cleavage, indicating progression into mitosis and enhanced apoptosis. In contrast to these findings with the tumor samples, LB100 did not induce hyperphosphorylation of γH2AX in the kidney (Supplementary Fig. S5C).
The aim of our study was to assess whether LB100, a small-molecular inhibitor of PP2A that is currently undergoing a phase I trial for solid tumors (21), can sensitize preclinical models of ovarian cancer to cisplatin. Our results show that pretreatment with LB-100 enhances cisplatin-induced apoptosis for various ovarian cancer cells in vitro. This effect was observed for both low (IC25) and high (IC75) doses of cisplatin and was correlated with constitutive phosphorylation of key DDR proteins leading to persistent DNA damage and abrogation of cell-cycle arrest, culminating in apoptosis (schematically shown in Fig. 3D). In our in vivo model of i.p. metastatic ovarian carcinoma using the SKOV-3 cell line, we also observed delayed tumor growth when LB100 was combined with cisplatin. Notably, at the protocol endpoint, the tumors in mice that were treated with LB100 and cisplatin did not relapse while mice treated with cisplatin alone eventually developed progressive disease.
The majority of ovarian cancers harbor inactivating mutations of p53 (9). Because p53 orchestrates the G1- to S-phase cell-cycle checkpoint, cancer cells with mutant p53 depend on G2–M arrest for maintaining genomic integrity following DNA-damaging therapy (39). Entry from G2 into mitosis depends on the activation and nuclear localization of Cdc2/cyclin B, which is negatively regulated by Wee1 and Chk1 kinase and positively regulated by Cdc25C phosphatase. As such, cancer cells resistant to DNA damage often induce increased expression and function of G2–M checkpoint kinases in response to genotoxic stress and pharmacologic inhibition of these kinases can sensitize cancer cells to platinum compounds (11). Specific kinase inhibitors have clinical limitations, however, because resistant cells possess alternate pathways that can circumvent inhibition (44). On the other hand, ubiquitous Ser/Thr phosphatases, such as PP2A, are extensively involved in regulation of the DNA response pathway and potentially allow manipulation of multiple signaling pathways through the use of a single agent (45).
PP2A is an attractive target for DNA-damage sensitization for many reasons. Extensive studies in Xenopus have shown that PP2A is induced as part of the DDR and is involved in G2–M arrest (46). Thus, inhibition of PP2A leads to aberrant entry into mitosis, resulting in mitotic catastrophe and apoptosis. PP2A also regulates Chk1, a critical mediator of DDR, through a negative feedback loop that maintains Chk1 in a low-activity state during normal cell division, while priming it for rapid response upon DNA damage (36). This integral relationship is maintained by continuous phosphorylation and dephosphorylation of Chk1 (S345; refs. 36, 47). Following DNA damage and DSB formation, ATM/ATR activates Chk1 via phosphorylation at S345, a site negatively regulated by PP2A-mediated dephosphorylation. Constitutive phosphorylation of S345 induces E3 ligase–mediated ubiquitination and proteasomal degradation, and thus is critical for Chk1 protein stability (48). Our results show that pharmacologic and genetic inhibition of PP2A by LB100 and PP2A-C shRNA, respectively, induces hyperphosphorylation of Chk1 (S345) without altering the phosphorylation state of other serine residues (Supplementary Fig. S4B). It is possible, therefore, that the LB100-induced cisplatin sensitization may be, in part, due to deregulation of the negative feedback loop between PP2A and Chk1, rendering Chk1 less effective in the DNA response pathway.
Through its phosphatase activity, PP2A maintains the relative number and distribution of docking sites for chaperone proteins carrying specific phospho-Ser/Thr binding motifs, such as 14-3-3 and BRCA1 (49, 50). These docking sites exist on a vast array of proteins within the cell, ranging from DDR factors to housekeeping proteins (51, 52). The 14-3-3 family of proteins bind to target proteins carrying specific p-Ser/Thr recognition sequences and have been demonstrated to affect the enzymatic activity, DNA-binding activity, sequestration, and protein–protein interactions of these target proteins (49). In our study, LB100-treated SKOV-3 cells showed widespread increased expression of p-Ser 14-3-3-binding motifs compared with control treatment (Fig. 3C), and showed altered phosphorylation states of proteins known to interact with 14-3-3, such as Wee1 and Chk1. Whether 14-3-3 proteins directly or indirectly affect the activity of these proteins following LB100 and cisplatin combination treatment is yet to be determined. Nonetheless, the results of our study show that LB100-induced modulation of cellular 14-3-3 motifs is correlated with cell-cycle progression and enhanced apoptosis.
Our results also consistently showed that LB100, either alone or in combination with cisplatin, induces hyperphosphorylation of BRCA1 at distinct residues, which was maintained for 72 hours. Previous studies have shown that the phosphorylation state of BRCA1 disrupts its interaction with Chk1 and may render cells more sensitive to caspase-3–mediated apoptosis (14, 53). BRCA1 contains C-terminal domains (BRCT) that bind to specific Ser/Thr residues and are integral for BRCA1-mediated DDR. As such, the availability of the BRCT binding domain may be necessary for the proper coordinated response following induction of DNA-damage leading to DNA repair (50). LB100-induced deregulation of Ser/Thr motif distribution, as shown in our study, may lead to redistribution of docking-proteins in a way that biases the cisplatin-induced DDR pathway toward mitotic catastrophe and apoptosis.
In the context of LB100-induced constitutive phosphorylation of the DNA-damage pathway and G2–M arrest abrogation, it will be of interest to assess the efficacy of LB100 in combination with other preclinical compounds, such as inhibitors of Chk1, Wee1, and PARP1, with and without chemoradiation. Our results add to the growing literature regarding the efficacy of LB100, and illustrate a potential approach to enhancing cisplatin efficacy during the treatment of ovarian cancer. Given the proven, yet toxicity-limited, use of cisplatin in the clinical setting, we propose that LB100 may be an additive or dose-lowering agent that can enhance/maintain the cytotoxic effect of cisplatin without adding undue toxicity.
Conception and design: K.-E. Chang, B.-R. Wei, M.D. Hall, Z. Zhuang
Development of methodology: K.-E. Chang, B.-R. Wei, J.P. Madigan, M.D. Hall
Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): K.-E. Chang, B.-R. Wei, J.P. Madigan, R.M. Simpson
Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): K.-E. Chang, B.-R. Wei, M.D. Hall, R.M. Simpson, Z. Zhuang
Writing, review, and/or revision of the manuscript: K.-E. Chang, B.-R. Wei, J.P. Madigan, M.D. Hall, R.M. Simpson, Z. Zhuang, M.M. Gottesman
Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): B.-R. Wei
Study supervision: M.D. Hall, Z. Zhuang, M.M. Gottesman
This research was funded by the Intramural Research Program of the NIH, the National Cancer Institute, and the National Institute of Neurological Disorders and Stroke.
The authors thank George Leiman for editorial assistance.
Received June 11, 2014.
Revision received October 20, 2014.
Accepted October 23, 2014.
Partridge E,
Kreimer AR,
Greenlee RT,
Williams C,
Xu JL,
Church TR,
Results from four rounds of ovarian cancer screening in a randomized trial. Obstet Gynecol 2009;113:775–82.
Armstrong DK,
Bundy B,
Wenzel L,
Huang HQ,
Baergen R,
Lele S,
Intraperitoneal cisplatin and paclitaxel in ovarian cancer. N Engl J Med 2006;354:34–43.
Markman M,
Rothman R,
Hakes T,
Reichman B,
Hoskins W,
Rubin S,
Second-line platinum therapy in patients with ovarian cancer previously treated with cisplatin. J Clin Oncol 1991;9:389–93.
Wang D,
Lippard SJ
. Cellular processing of platinum anticancer drugs. Nat Rev Drug Discov 2005;4:307–20.
Wong E,
Giandomenico CM
. Current status of platinum-based antitumor drugs. Chem Rev 1999;99:2451–66.
Eliopoulos AG,
Kerr DJ,
Herod J,
Hodgkins L,
Krajewski S,
Reed JC,
The control of apoptosis and drug resistance in ovarian cancer: influence of p53 and Bcl-2. Oncogene 1995;11:1217–28.
Shen DW,
Pouliot LM,
Hall MD,
Gottesman MM
. Cisplatin resistance: a cellular self-defense mechanism resulting from multiple epigenetic and genetic changes. Pharmacol Rev 2012;64:706–21.
Cancer Genome Atlas Research N
. Integrated genomic analyses of ovarian carcinoma. Nature 2011;474:609–15.
Kanchi KL,
Johnson KJ,
Lu C,
McLellan MD,
Leiserson MD,
Wendl MC,
Integrated analysis of germline and somatic variants in ovarian cancer. Nat Commun 2014;5:3156.
Chen YC,
Bai J,
Guha R,
Martin SE,
Gottesman MM,
Cisplatin sensitivity mediated by WEE1 and CHK1 is mediated by miR-155 and the miR-15 family. Cancer Res 2012;72:5945–55.
Chowdhury D,
Keogh MC,
Ishii H,
Peterson CL,
Buratowski S,
Lieberman J
. gamma-H2AX dephosphorylation by protein phosphatase 2A facilitates DNA double-strand break repair. Mol Cell 2005;20:801–9.
Lee DH,
Chowdhury D
. What goes on must come off: phosphatases gate-crash the DNA damage response. Trends Biochem Sci 2011;36:569–77.
Martin SA,
Ouchi T
. BRCA1 phosphorylation regulates caspase-3 activation in UV-induced apoptosis. Cancer Res 2005;65:10657–62.
Clemenson C,
Marsolier-Kergoat MC
. DNA damage checkpoint inactivation: adaptation and recovery. DNA Repair (Amst) 2009;8:1101–9.
Mansouri A,
Ridgway LD,
Korapati AL,
Zhang Q,
Tian L,
Sustained activation of JNK/p38 MAPK pathways in response to cisplatin leads to Fas ligand induction and cell death in ovarian carcinoma cells. J Biol Chem 2003;278:19245–56.
Mumby M
. PP2A: unveiling a reluctant tumor suppressor. Cell 2007;130:21–4.
Wei D,
Parsels LA,
Karnak D,
Davis MA,
Parsels JD,
Marsh AC,
Inhibition of protein phosphatase 2A radiosensitizes pancreatic cancers by modulating CDC25C/CDK1 and homologous recombination repair. Clin Cancer Res 2013;19:4422–32.
Lu J,
Kovach JS,
Johnson F,
Chiang J,
Hodes R,
Lonser R,
Inhibition of serine/threonine phosphatase PP2A enhances cancer chemotherapy by blocking DNA damage induced defense mechanisms. Proc Natl Acad Sci U S A 2009;106:11697–702.
Martiniova L,
Bernardo M,
Zhuang Z,
Pharmacologic modulation of serine/threonine phosphorylation highly sensitizes PHEO in a MPC cell and mouse model to conventional chemotherapy. PLoS ONE 2011;6:e14678.
Chung V MA
. Phase I study of LB-100 with docetaxel in solid tumors. 2013. Available from: http://www.clinicaltrials.gov/ct2/show/NCT01837667.
Wei BR,
Hoover SB,
Ross MM,
Zhou W,
Meani F,
Edwards JB,
Serum S100A6 concentration predicts peritoneal tumor burden in mice with epithelial ovarian cancer and is associated with advanced stage in patients. PLoS ONE 2009;4:e7670.
Langdon SP,
Lawrie SS,
Hay FG,
Hawkes MM,
McDonald A,
Hayward IP,
Characterization and properties of nine human ovarian adenocarcinoma cell lines. Cancer Res 1988;48:6166–72.
Robey RW,
Steadman K,
Polgar O,
Bates SE
. ABCG2-mediated transport of photosensitizers: potential impact on photodynamic therapy. Cancer Biol Ther 2005;4:187–94.
Telma KA,
Chang KE,
Lee TD,
Madigan JP,
Lloyd JR,
Say no to DMSO: dimethylsulfoxide inactivates cisplatin, carboplatin and other platinum complexes. Cancer Res 2014;74:3913–22.
Bodemann BO,
Brady DC,
Dewar BJ,
Keller PJ,
Leitges M,
Regulation of Rnd3 localization and function by protein kinase C alpha-mediated phosphorylation. Biochem J 2009;424:153–61.
Mabuchi S,
Altomare DA,
Cheung M,
Poulikakos PI,
Hensley HH,
RAD001 inhibits human ovarian cancer cell proliferation, enhances cisplatin-induced apoptosis, and prolongs survival in an ovarian cancer model. Clin Cancer Res 2007;13:4261–70.
Bakhsheshian J,
Shukla S,
Ambudkar SV,
Simpson RM,
Bioluminescent imaging of drug efflux at the blood-brain barrier mediated by the transporter ABCG2. Proc Natl Acad Sci U S A 2013;110:20801–6.
Debernardis D,
Sire EG,
De Feudis P,
Vikhanskaya F,
Russo P,
p53 status does not affect sensitivity of human ovarian cancer cell lines to paclitaxel. Cancer Res 1997;57:870–4.
Kelland LR,
Murrer BA,
Abel G,
Giandomenico CM,
Mistry P,
Harrap KR
. Ammine/amine platinum(IV) dicarboxylates: a novel class of platinum complex exhibiting selective cytotoxicity to intrinsically cisplatin-resistant human ovarian carcinoma cell lines. Cancer Res 1992;52:822–8.
Sharp SY,
O'Neill CF,
Raynaud FI,
Beale PJ,
Judson IR
. Mini-review: discovery and development of platinum complexes designed to circumvent cisplatin resistance. J Inorg Biochem 1999;77:111–5.
Taniguchi T,
Tischkowitz M,
Ameziane N,
Hodgson SV,
Mathew CG,
Joenje H,
Disruption of the Fanconi anemia-BRCA pathway in cisplatin-sensitive ovarian tumors. Nat Med 2003;9:568–74.
Kartner N,
Riordan JR,
Ling V
. Cell surface P-glycoprotein associated with multidrug resistance in mammalian cell lines. Science 1983;221:1285–8.
Gotz J,
Probst A,
Ehler E,
Hemmings B,
Kues W
. Delayed embryonic lethality in mice lacking protein phosphatase 2A catalytic subunit Calpha. Proc Natl Acad Sci U S A 1998;95:12370–5.
Carlessi L,
Buscemi G,
Fontanella E,
Delia D
. A protein phosphatase feedback mechanism regulates the basal phosphorylation of Chk2 kinase in the absence of DNA damage. Biochim Biophys Acta 2010;1803:1213–23.
Leung-Pineda V,
Ryan CE,
Piwnica-Worms H
. Phosphorylation of Chk1 by ATR is antagonized by a Chk1-regulated protein phosphatase 2A circuit. Mol Cell Biol 2006;26:7529–38.
Kinner A,
Wu W,
Staudt C,
Iliakis G
. Gamma-H2AX in recognition and signaling of DNA double-strand breaks in the context of chromatin. Nucleic Acids Res 2008;36:5678–94.
Nussenzweig A,
Paull T
. DNA repair: tails of histones lost. Nature 2006;439:406–7.
Sorenson CM,
Barry MA,
Eastman A
. Analysis of events associated with cell cycle arrest at G2 phase and cell death induced by cisplatin. J Natl Cancer Inst 1990;82:749–55.
Reinhardt HC,
Yaffe MB
. Kinases that control the cell cycle in response to DNA damage: Chk1, Chk2, and MK2. Curr Opin Cell Biol 2009;21:245–55.
Wei Y,
Mizzen CA,
Cook RG,
Gorovsky MA,
Allis CD
. Phosphorylation of histone H3 at serine 10 is correlated with chromosome condensation during mitosis and meiosis in Tetrahymena. Proc Natl Acad Sci U S A 1998;95:7480–4.
. Cell cycle. Fools rush in. Nature 1999;401:535.
Hamilton TC,
Young RC,
Louie KG,
Behrens BC,
McKoy WM,
Grotzinger KR,
Characterization of a xenograft model of human ovarian carcinoma which produces ascites and intraabdominal carcinomatosis in mice. Cancer Res 1984;44:5286–90.
Lovly CM,
Shaw AT
. Molecular pathways: resistance to kinase inhibitors and implications for therapeutic strategies. Clin Cancer Res 2014;20:2249–56.
Wurzenberger C,
Gerlich DW
. Phosphatases: providing safe passage through mitotic exit. Nat Rev Mol Cell Biol 2011;12:469–82.
Margolis SS,
Perry JA,
Forester CM,
Nutt LK,
Guo Y,
Jardim MJ,
Role for the PP2A/B56delta phosphatase in regulating 14-3-3 release from Cdc25 to control mitosis. Cell 2006;127:759–73.
Peng A,
Maller JL
. Serine/threonine phosphatases in the DNA damage response and cancer. Oncogene 2010;29:5977–88.
Huh J,
. DDB1 targets Chk1 to the Cul4 E3 ligase complex in normal cycling cells and in cells experiencing replication stress. Cancer Res 2009;69:2630–7.
Hermeking H
. The 14-3-3 cancer connection. Nat Rev Cancer 2003;3:931–43.
Mohammad DH,
. 14-3-3 proteins, FHA domains and BRCT domains in the DNA damage response. DNA Repair (Amst) 2009;8:1009–17.
Snider NT,
Omary MB
. Post-translational modifications of intermediate filament proteins: mechanisms and functions. Nat Rev Mol Cell Biol 2014;15:163–77.
. Phospho-Ser/Thr-binding domains: navigating the cell cycle and DNA damage response. Nat Rev Mol Cell Biol 2013;14:563–80.
Yarden RI,
Pardo-Reoyo S,
Sgagias M,
Cowan KH,
Brody LC
. BRCA1 regulates the G2/M checkpoint by activating Chk1 kinase upon DNA damage. Nat Genet 2002;30:285–9.
You are going to email the following The Protein Phosphatase 2A Inhibitor LB100 Sensitizes Ovarian Carcinoma Cells to Cisplatin-Mediated Cytotoxicity
Mol Cancer Ther January 1 2015 (14) (1) 90-100; DOI: 10.1158/1535-7163.MCT-14-0496
HMGCS1 and MEK Inhibitor Combination for Colon Cancers
Inhibition of c-MET and Ang 1/2 Inhibits ccRCC Metastases
qHTS Identifies Inhibitors of Ovarian Cancer Metastasis
Show more Small Molecule Therapeutics
|
cc/2020-05/en_middle_0087.json.gz/line1341073
|
__label__cc
| 0.589556
| 0.410444
|
Androgen Antagonist Activity by the Antioxidant Moiety of Vitamin E, 2,2,5,7,8-Pentamethyl-6-chromanol in Human Prostate Carcinoma Cells1
Todd A. Thompson and George Wilding
Todd A. Thompson
George Wilding
DOI: Published August 2003
Antioxidants, such as vitamin E, are being investigated for efficacy in prostate cancer prevention. In this study, we show that the antioxidant moiety of vitamin E, 2,2,5,7,8-pentamethyl-6-chromanol (PMCol), has antiandrogen activity in prostate carcinoma cells. In the presence of PMCol, the androgen-stimulated biphasic growth curve of LNCaP human prostate carcinoma cells was shifted to the right. The PMCol-induced growth shift was similar to that produced by treatment with the pure antiandrogen bicalutamide (i.e., Casodex), indicative of androgen receptor (AR) antagonist activity. The concentration of PMCol used was below the concentration required to affect cell growth or viability in the absence of androgen. Using an AR binding competition assay, PMCol was found to be a potent antiandrogen in both LNCaP and LAPC4 cells, with an IC50 of approximately 10 μm against 1 nm R1881 (methyltrienolone; a stable, synthetic androgen). Prostate-specific antigen release from LNCaP cells produced by androgen exposure with either 0.05 or 1.0 nm R1881 was inhibited 100% and 80%, respectively, by 30 μm PMCol. Also, PMCol inhibited androgen-induced promoter activation in both LNCaP and LAPC4 cells. However, PMCol did not affect AR protein levels, suggesting that the inhibitory effects of PMCol on androgenic pathways were not due to decreased expression of the AR. Therefore, growth modulation by the antioxidant moiety of vitamin E in androgen-sensitive prostate carcinoma cells is due, at least in part, to its potent antiandrogenic activity.
The activity of androgens is tissue specific and mediated through the AR.3 The disruption of androgens and AR activity alters the regulation of androgen-sensitive tissues, such as the prostate gland (1). In the prostate, androgens have a central role in normal glandular development and function (2). However, androgens are also necessary for the development of prostate cancer. The role of androgens in prostate cancer development is emphasized by the observation that eunuchs and men that have a mutation in 5α-reductase type II, an enzyme that converts testosterone to the more potent dihydrotestosterone, do not develop prostate cancer (3). The incidence of prostate cancer has continued to rise for the last two decades, currently affecting over 200,000 men in the United States each year (4). Agents that permit the necessary actions of androgen for normal tissue function while reducing the role of androgens in the pathogenesis of androgen-sensitive tissues may serve as a useful means of reducing prostate cancer development. Recently, several agents have been reported to prevent prostate cancer development, such as selenium, lycopene, and vitamin E (5). Due to the biochemical nature of these agents, they are believed to act primarily through antioxidant-related pathways. However, the scope of their biological activity has not been extensively investigated.
Vitamin E is a family of naturally occurring dietary factors, which were originally identified as necessary for reproduction (6). α-Tocopherol, the most potent form of vitamin E, has two main components, a 16-carbon phytyl chain and a chromanol moiety with four methyl group substitutions (7). Biologically, α-tocopherol is thought to act primarily as an antioxidant, reducing oxidative damage to lipids. The chromanol moiety of α-tocopherol is responsible for its antioxidant activity, whereas the phytyl chain increases the lipophilicity of α-tocopherol and contributes to its tissue and subcellular distribution (8). Cell culture studies using α-tocopherol are difficult to perform due to its limited water solubility. However, the antioxidant chromanol moiety of α-tocopherol, PMCol, which does not possess a phytyl chain, is sufficiently water soluble to permit studies in cell culture.
Most human prostate carcinoma cell lines are androgen independent. The LNCaP human prostate carcinoma cell line is one of the few cell lines to show demonstrable responses to androgen exposure (9). Interestingly, LNCaP cells produce a biphasic growth response to androgen exposure, with growth stimulation occurring at lower doses and growth inhibition occurring in the absence of androgen or in the presence of high androgen levels (9, 10). In addition, a number of androgen-sensitive responses are induced in LNCaP cells. For example, LNCaP cells produce a dose-dependent increase in PSA expression on androgen exposure (11, 12). Also, androgen-sensitive promoters, such as the MMTV promoter, are activated by androgen in LNCaP cells (13). The exquisite sensitivity of LNCaP cells to androgenic stimulation may be due to a mutation in the ligand-binding domain of the AR (14). To date, the LNCaP prostate cell line has been the most extensively characterized prostate cell line for examining the effects of androgens. More recently, the LAPC4 cell line has been introduced as another androgen-sensitive human prostate carcinoma cell line that expresses a normal AR (15). However, the response of LAPC4 cells to androgens is not as pronounced as that observed in LNCaP cells. Collectively, the LNCaP and LAPC4 human prostate carcinoma cell lines provide valuable models for investigating androgen-regulated cellular pathways.
Studies on the actions of vitamin E and vitamin E analogues on prostate carcinoma cells have only recently begun. Previous studies have focused primarily on the inhibition of prostate cell growth by vitamin E treatment, which may occur through effects on cell cycle regulators (16–18). Apoptotic responses induced by vitamin E treatment have also been observed in LNCaP cells (19, 20). Interestingly, vitamin E-induced apoptotic responses were enhanced by coadministration of androgen (19). Zhang et al. (21) reported that vitamin E succinate reduces the levels of the AR in LNCaP cells, with resultant inhibition of androgen-mediated responses. However, the direct actions of vitamin E and related compounds on AR activity in prostate cells have not been extensively examined. In the current study, the AR antagonist activity and modulation of androgen-sensitive pathways by the vitamin E derivative PMCol were investigated in human prostate carcinoma cells.
PMCol and PMC were obtained from Aldrich (Milwaukee, WI). The chemical structures of α-tocopherol, PMCol, and PMC are shown in Fig. 1. Bicalutamide (Casodex) was kindly provided by AstraZeneca Pharmaceuticals (Wilmington, DE). R1881 (methyltrienolone) and 3H-R1881 (87 Ci/mmol) were obtained from Perkin-Elmer/New England Nuclear Life Science Products (Boston, MA). All other chemicals used in these studies were acquired from Sigma Chemical Co. (St. Louis, MO).
LNCaP cells were acquired from American Type Culture Collection (Manassas, VA), and LAPC4 cells were kindly provided by Dr. Robert Reiter (University of California-Los Angeles) and maintained in DMEM containing 5% heat-inactivated FCS (Sigma) with streptomycin-penicillin antibiotics (designated DMEM/fetal bovine serum) in a 5% CO2 incubator at 37°C. For experiments evaluating androgenic responses, cells were cultured in phenol red-free DMEM (Invitrogen, Carlsbad, CA) containing 4% charcoal-stripped FCS and 1% unstripped FCS (designated DMEM/CSS).
AR Binding Competition Assay.
An AR binding competition assay was performed as described previously (22). LNCaP or LAPC4 prostate carcinoma cells were plated in 12-well tissue culture dishes (Costar, Corning, NY) at 3.0 × 105 cells/well in phenol-red free DMEM/CSS 3 days before analysis. For competitor analysis, DMEM/CSS was removed by aspiration and replaced with 1 ml of phenol-red free DMEM containing 1 nm 3H-R1881, 1 μm triamcinolone acetonide, and competitor at the specified concentrations for 2 h at 37°C in a 5% CO2 incubator. After incubation, competitor solution was aspirated, and cells were removed from the plate by trypsinization and placed in 12 × 75-mm polystyrene tubes. Cells were washed twice with 1 ml of phenol red-free DMEM and placed in 8.0 ml of ScintiVerse II Scintillation Cocktail (Fisher Scientific, Pittsburgh, PA) for determination of radioactivity (i.e., dpm) using a Beckman LS 6000TA Liquid Scintillation System (Beckman Instruments Inc., Fullerton, CA).
Cell Growth and Viability Analyses.
Five thousand LNCaP or LAPC4 cells were plated in each well of 96-well plates (Costar) in 100 μl of DMEM/CSS. Two to 3 days after plating, cells were treated by adding 100 μl of DMEM/CSS containing 2× the concentration of the specified treatment to each well. Four days after treatment, the relative cell number was estimated by determining the DNA concentration of each well using a Hoechst-based fluorescence DNA assay, as described previously (23). Growth analysis with DU145 cells was performed in a manner similar to that described for LNCaP and LAPC4 cells, except that DU145 cells were initially seeded at 500 cells/well. Cell viability was determined by trypan blue exclusion and quantified by light microscopic analysis using a hemacytometer.
Determination of Secreted PSA Levels.
LNCaP cells were cultured in 96-well plates (Costar) at 5000 cells/well in DMEM/CSS 1 day before treatment. Forty-eight h after treatment, PSA levels in cell culture media were determined using the Tandem-MP PSA kit (Beckman Coulter, Inc.) according to the manufacturer’s instructions. PSA levels were normalized to DNA levels as determined using a Hoechst-based fluorescence DNA assay (23).
Androgen-stimulated Promoter Reporter Assay Analysis.
LNCaP and LAPC4 prostate carcinoma cell lines were cultured in 12-well cell culture plates (Costar) in DMEM/CSS 2–3 days before transfection. Androgen-induced trancriptional activation was determined using a reporter construct with a MMTV promoter that regulates the expression of luciferase (24). LNCaP and LAPC4 cells were transfected with the MMTV/luciferase plasmid using the Effectene Transfection Reagent (Qiagen Inc., Valencia, CA), according to the manufacturer’s instructions. Twenty-four h after transfection, cells were treated with R1881 with or without test reagents at the specified concentrations. Cell extracts were acquired 24–48 h after treatment by removing medium, washing 1× with PBS, and obtaining extract with 200 μl of 1× Reporter Lysis Buffer (Promega, Madison, WI). Luciferase activity was determined as described previously (24).
Immunoblot Analysis of AR Protein Levels.
LNCaP cells were plated at a density of 1 × 106 cells/100-mm cell culture plate in 10 ml of DMEM/fetal bovine serum and maintained in incubators at 37°C in 5% CO2. After 5 days of treatment with vehicle, 30 μm PMC, 30 μm PMCol, or 1.0 μm bicalutamide, cells were washed in cold 1× PBS and lysed in a buffer containing 1.0% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 0.1 mg/ml phenylmethylsulfonyl fluoride, 1 mm sodium orthovanadate, and 10 μg/ml aprotinin in 1× PBS. Total protein (10 μg) from cell extracts was electrophoresed on 7.5% SDS-polyacrylamide gels and transferred to Immobilon-P membranes (Millipore Corp., Bedford, MA) using a GENIE wet transfer system (Idea Scientific, Minneapolis, MN). Membranes were blocked in Tris-buffered saline containing 5% nonfat dry milk and then incubated with mouse anti-AR monoclonal antibody (441; Santa Cruz Biotechnology, Santa Cruz, CA) and mouse antiactin antibody (A5441; Sigma). Membranes were then incubated with a secondary horseradish peroxidase-conjugated antimouse antibody (Amersham Pharmacia Biotech, Piscataway, NJ) and analyzed using Enhanced Chemiluminescence Plus reagent (Amersham Pharmacia Biotech). Autoradiograms were prepared by exposing the blots to BioMax Light X-ray film (Eastman Kodak Co., Rochester, NY) and developed using a CURIX 60 CP Processor (Agfa, Ridgefield Park, NJ).
Significant differences in values between groups were assessed using a two-sided Student’s t test. Ps less than 0.05 were used to signify statistical significance.
PMCol Inhibits Androgen Binding in Prostate Cancer Cells.
AR competition was determined using 3H-R1881 in the androgen-sensitive LNCaP cell line, which expresses a functional mutant AR (25), and the LAPC4 cell line, which express a normal human AR (15). Increasing concentrations of the AR antagonist bicalutamide were found to progressively inhibit R1881 binding (Fig. 2A), with an estimated IC50 of 0.7 μm in LNCaP cells. PMCol was found to be approximately 10-fold less potent at competing for 3H-R1881 than bicalutamide in LNCaP cells, with an estimated IC50 of 7.2 μm (Fig. 2A). Repeated studies of PMCol competition for 3H-R1881 binding gave IC50 values ranging from 5 to 15 μm (data not shown). In contrast, PMC, in which the 6-hydroxyl of PMCol is absent, had less antiandrogenic activity than PMCol (Fig. 2A) and significantly reduced cell viability at a concentration of 100 μm within 2 h of treatment (data not shown). Based on the R1881 competition results in LNCaP cells (Fig. 2A), a dose of 30 μm PMC and PMCol was used in most of these studies, allowing an effective comparison of the antiandrogenic activity between PMC and PMCol. In LAPC4 cells, treatment with 30 μm PMCol produced a 75% decrease in 3H-R1881 binding, and treatment with 1 μm bicalutamide produced a 62% decrease in 3H-R1881 binding (Fig. 2B).
Modulation of Prostate Carcinoma Cell Growth and Viability by PMCol.
Changes in growth of the androgen-independent DU145 prostate carcinoma cell line and the androgen-sensitive LNCaP and LAPC4 prostate cell lines were assessed at concentrations of PMCol ranging from 10 to 100 μm (Fig. 3A). Concentrations of 50, 60, and 80 μm PMCol were required to significantly reduce cell growth in LNCaP, LAPC4, and DU145 cells, respectively (Fig. 3A). LNCaP cells produce a biphasic growth response to androgen exposure (9). Modulation of LNCaP cell growth by PMCol treatment was examined over 4 days. PMCol had no growth-modulatory activity in vehicle control-treated LNCaP cells grown in androgen-deficient media (i.e., PMCol did not have AR agonist activity) at concentrations ranging from 10 to 30 μm PMCol (Fig. 3B). However, LNCaP cell growth was decreased at concentrations equal to or higher than 40 μm PMCol (Fig. 3B), and PMCol concentrations of ≥100 μm produced significant cell death at 48 and 96 h (Table 1). Stimulation of LNCaP growth by exposure to 0.1 nm R1881 was significantly inhibited by treatment with concentrations of ≥10 μm PMCol (Fig. 3B). However, a significant stimulation in LNCaP cell growth was observed in the presence of a normally growth-inhibitory concentration of 1.0 nm R1881 with treatment of 10–30 μm PMCol (Fig. 3B). The R1881-stimulated growth curve of LNCaP cells was shifted to the right in the presence of 30 μm PMCol, similar to that produced by treatment with 1 μm bicalutamide (Fig. 4). A more modest, but significant, shift to the right in the androgen-induced LNCaP growth curve was observed by treatment with 30 μm PMC (Fig. 4).
Inhibition of PSA Secretion by PMCol in LNCaP Cells.
PSA secretion by LNCaP cells is stimulated by androgen exposure in a dose-dependent manner (12). The R1881-stimulated production of PSA from LNCaP cells was measured after PMCol treatment for 48 h. PSA release from LNCaP cells was not affected by treatment with 30 μm PMCol alone (Fig. 5). However, PSA levels were increased 3.1-fold after exposure to a growth-stimulatory dose of 0.05 nm R1881, which was completely inhibited by treatment with 30 μm PMCol (Fig. 5). Exposure of LNCaP cells to 1.0 nm R1881 produced a 12-fold increase in PSA levels by 48 h, which was decreased 20%, 81%, and 43% by treatment with 30 μm PMC, 30 μm PMCol, or 1 μm bicalutamide, respectively (Fig. 5).
Inhibition of Androgen-stimulated Transcriptional Activation by PMCol.
Studies on androgen-regulated transcriptional activation were performed in LNCaP and LAPC4 cells transiently transfected with a reporter vector that uses the androgen-sensitive MMTV long terminal repeat to drive expression of a luciferase reporter gene. In LNCaP cells, PMCol treatment alone had no effect on MMTV promoter activity, whereas luciferase expression was increased 54-fold after exposure to 1.0 nm R1881 for 24 h (Fig. 6A). Luciferase expression induced by exposure to 1.0 nm R1881 in LNCaP cells for 24 h was decreased 50% and 70% by treatment with 25 and 50 μm PMCol, respectively (Fig. 6A). Similarly, LAPC4 cells exposed to 1.0 nm R1881 produced a 20-fold increase in MMTV long terminal repeat-driven luciferase expression that was decreased 60% by treatment with 30 μm PMCol after 24 h (Fig. 6B). In both LNCaP and LAPC4 cells, treatment with 1 μm bicalutamide decreased 1.0 nm R1881-stimulated luciferase expression approximately 50% (Fig. 6, A and B).
AR Protein Levels in PMCol-exposed LNCaP Cells.
Previous studies in LNCaP cells have reported that AR levels are decreased after treatment with vitamin E analogues, which may account for the reduced sensitivity of these cells to androgen exposure (21). However, in the current study, treatment with 30 μm PMC, 30 μm PMCol, or 1 μm bicalutamide for 5 days did not result in altered AR protein levels in LNCaP cells (Fig. 7).
In the current study, we examine the effects of an agent traditionally considered as an antioxidant on prostate carcinoma cells. Epidemiological studies provide intriguing evidence that antioxidant dietary factors such as β-lycopene and vitamin E may help prevent prostate cancer development (5). Although these agents have been classified as antioxidants, the mechanism by which they may contribute to prostate cancer prevention has not been firmly established. Androgens are known to have an essential role in prostate cancer development (3). Modulation of androgen activity may provide a means of prostate cancer prevention (26). Here, we report the antioxidant moiety of vitamin E, PMCol, to be a potent antiandrogen in androgen-sensitive human prostate carcinoma cells.
The LNCaP human prostate carcinoma cell line is one of the few prostate cell lines that show demonstrable physiological changes resulting from androgen exposure, such as growth modulation (9). Therefore, the LNCaP cell line has proven valuable in identifying agents that alter androgen-stimulated cell growth. In the current study, PMCol shifted the androgen-mediated growth curve in LNCaP cells such that higher androgen concentrations were necessary to produce the biphasic growth response typically observed in LNCaP cells. The LNCaP growth shift with PMCol treatment was sufficient to produce growth stimulation in the presence of 1.0 nm R1881, a concentration of R1881 that typically inhibits LNCaP proliferation (10). The shift in LNCaP growth pattern observed with PMCol treatment was similar to that observed in LNCaP cells after treatment with the pure antiandrogen bicalutamide. Also, the IC50 of PMCol observed in an androgen competition analysis for R1881 binding in LNCaP cells is in agreement with the dose-response shift in androgen-mediated growth of LNCaP cells after PMCol treatment. Together, these results suggest that the shift observed in the androgen-modulated growth of LNCaP cells was due to the antiandrogenic activity of PMCol.
Although LNCaP cells have proven to be useful in evaluating androgen-responsive pathways, the use of LNCaP cells to assess antiandrogenic activity can be inaccurate because LNCaP cells harbor a mutant AR (25). The AR in LNCaP cells, although functional, has been reported to have altered ligand binding affinity (14) and is stimulated by some agents that are antagonists for the wild-type AR (22). Therefore, in this study, competition for AR binding by PMCol was also assessed in the LAPC4 human prostate carcinoma cell line, which expresses a wild-type AR (15). PMCol competition for R1881 binding was found to be similar for LNCaP and LAPC4 cells. In addition, the pure antiandrogen bicalutamide was found to have equivalent AR competition activity in LNCaP and LAPC4 cells. Therefore, the pure antiandrogen bicalutamide and PMCol were found to possess comparable AR antagonist activity in LNCaP cells, which express a functional mutant AR, and LAPC4 cells, which express a normal AR.
The AR functions primarily as a transcription factor that is activated by androgen binding (1). In these studies, the androgen-responsive MMTV promoter was used to assess modulation of androgen-stimulated transcriptional activity. Upon androgen exposure (i.e., R1881), MMTV promoter activity was stimulated in both LNCaP and LAPC4 cells. Also, in both cell lines, R1881 stimulation of MMTV activity was significantly inhibited by PMCol treatment. PMCol treatment alone did not stimulate MMTV promoter activity (i.e., PMCol was not found to have AR agonist or partial agonist activity). The effects of androgen exposure on transcriptional activation were further observed by the inhibition of androgen-stimulated PSA release after treatment with PMCol in LNCaP cells. Previously, vitamin E succinate was reported to inhibit the effects of androgen on LNCaP cells through down-regulation of AR levels (21). Other agents, such as curcumin, have been shown to decrease AR expression in LNCaP cells (27). In the current study, treatment of LNCaP cells with 30 μm PMCol for 5 days did not affect AR protein levels. Therefore, PMCol was found to be a potent inhibitor of transcriptional activation of androgen-responsive promoters, likely through directly blocking of AR activation by androgen.
Understanding how structure-activity relationships of the chromanol ring of PMCol contribute to antiandrogenic activity may prove useful in developing potent chromanol ring-based nonsteroidal antiandrogenic agents. In the current study, PMC, which lacks the phenolic hydroxyl group present on PMCol, was less potent than PMCol at inhibiting androgenic responses. Therefore, the phenolic hydroxyl group of the chromanol ring contributes significantly to the antiandrogenic activity of PMCol. Other forms of vitamin E, such as β-, γ-, and δ-tocopherol differ from α-tocopherol by the number and location of methyl group substitutions on the chromanol ring (7). We can only speculate that the antioxidant moieties of other forms of vitamin E also possess antiandrogenic activity with potencies that vary depending on the specific methyl group substitutions present on the chromanol ring.
A variety of dietary agents have been identified that have antiandrogenic activity in prostate carcinoma cells. However, the mechanism of antiandrogenic activity observed by dietary antiandrogens may vary. For example, curcumin, a component of turmeric, was reported to down-regulate AR protein levels in LNCaP cells, which effectively attenuates androgenic responses (27). In contrast, indole-3-carbinol, a component of cruciferous vegetables, when converted to diindolylmethane was reported to act as a potent inhibitor of androgen binding in LNCaP cells but does not affect AR protein levels (28). Zhang et al. (21) have reported that vitamin E succinate is inhibitory to androgenic responses in LNCaP cells through down-regulation of AR protein levels, similar to the action of curcumin. By contrast, in the current study, we found that the antioxidant moiety of vitamin E, PMCol, effectively blocks androgen binding to the AR without affecting AR protein levels, similar to the effects observed with indole-3-carbinol derivatives (28). Therefore, dietary antiandrogens may serve as an effective means of modulating androgenic pathways through a variety of mechanisms affecting AR activity.
It is unclear how accurately the biological activity of α-tocopherol is modeled by the PMCol antioxidant moiety alone. PMCol has largely been investigated for its antioxidant activity associated with being the antioxidant moiety of vitamin E. For example, the antioxidant potency of PMCol was shown to be similar to that of α-tocopherol in vitro (29). In general, α-tocopherol plasma levels range between 5 and 30 μm (30), well within the range of antiandrogenic activity observed by PMCol in the current study. Due to the high lipophilicity of vitamin E, it is difficult to assess its antiandrogenic activity by cell culture analysis. However, we can speculate that due to the presence of the highly lipophilic phytyl chain, the subcellular distribution of vitamin E would limit its direct interaction with the AR, which resides in more aqueous subcellular compartments such as the cytoplasm and nucleus. Vitamin E can be metabolized to derivatives with greater water solubility, such as α-carboxyethylhydroxychroman (7, 31), which are structurally similar to PMCol and may have greater water solubility and a distinct cellular bioavailability compared with vitamin E. Thus, we hypothesize that metabolites of vitamin E may contact the AR in vivo and have antiandrogenic activity, analogous to that produced by PMCol in human prostate carcinoma cells.
In summary, the antioxidant moiety of α-tocopherol, PMCol, was found to inhibit androgen activity, likely through competition for androgen binding to the AR, with resultant inhibition of androgen-sensitive biological pathways. PMCol was not found to possess androgen agonist or partial agonist activity and hence functions as a pure antagonist of androgen activity in the LNCaP and LAPC4 prostate carcinoma cell lines. Based on the results of the current study, PMCol may serve as a useful agent for modulating androgen activity in vivo. Importantly, the antiandrogenic activity of PMCol poses the possibility that the prostate cancer-preventive activity of vitamin E may be due, in part, to antiandrogenic effects of vitamin E or metabolites of vitamin E in the prostate. Currently, over 30,000 men die from prostate cancer each year in the United States (4). The prevention of prostate cancer through the action of dietary antiandrogens, such as vitamin E or its derivatives, may offer one means of reducing the devastation produced by this disease.
Structure of vitamin E (i.e., α-tocopherol) and related compounds. A, α-tocopherol. B, PMCol. C, PMC.
PMCol competition analysis of R1881 binding in human prostate carcinoma cells. A, dose response for the competition of PMCol, PMC, and bicalutamide for AR binding to 3H-R1881 was determined in LNCaP cells. B, competition for 3H-R1881 binding in LAPC4 cells was determined for 30 μm PMCol and 1 μm bicalutamide. ∗, P < 0.05; n = 4.
Growth modulation of human prostate carcinoma cells by PMCol. A, dose response of DU145, LAPC4, and LNCaP cells grown in medium containing 5% serum measured 4 days after PMCol treatment. Treatment with 50 μm PMCol significantly reduced LNCaP prostate cell growth, whereas a concentration of 80 μm PMCol was required to significantly decrease growth in the androgen-independent DU145 prostate cell line (∗, P < 0.05). B, the PMCol dose response of LNCaP cell growth was determined in cells exposed to androgen-deficient conditions (i.e., using medium containing reduced androgen levels) with or without the addition of a growth-stimulatory dose of 0.05 nm R1881 or a growth-inhibitory dose of 1.0 nm R1881. ∗, significantly different than 0 μm PMCol-treated cells, P < 0.05; n = 6.
Shifts in the R1881-stimulated biphasic LNCaP growth response were determined after treatment with 30 μm PMCol, 30 μm PMC, or 1 μm bicalutamide for 4 days. The inhibition of growth response is readily apparent at 0.3 nm R1881 exposure, where LNCaP growth from PMCol, PMC, and bicalutamide treatment was equivalent to the growth response in control cells produced by exposure to only 0.03 nm R1881.
Analysis of PMCol effects on androgen-induced PSA secretion from LNCaP cells. PSA secretion was determined 48 h after exposure to a growth-stimulatory dose of 0.05 nm R1881 or a growth-inhibitory dose of 1.0 nm R1881 in the presence of 30 μm PMC, 30 μm PMCol, or 1 μm bicalutamide. ∗, P < 0.05 compared with 0.05 nm R1881-treated cells; ∗∗, P < 0.05 compared with 1.0 nm R1881-treated cells; n = 3.
Androgen-induced MMTV promoter activity in LNCaP (A) and LAPC4 (B) cells after PMCol treatment. A, the effects of 25 μm PMCol, 50 μm PMCol, and 1 μm bicalutamide treatment for 24 h on MMTV promoter activity induced by R1881 were assessed in LNCaP cells. B, LAPC4 cells exposed to 30 μm PMCol effectively inhibited androgen-induced MMTV promoter activity. ∗, P < 0.05; n = 4.
Immunoblot analysis of AR protein levels. AR protein levels were not significantly altered in LNCaP cells exposed to 30 μm PMC, 30 μm PMCol, or 1 μm bicalutamide for 5 days compared with AR levels in vehicle control-exposed cells. LNCaP cells were grown in medium containing 5% serum to provide endogenous serum androgens, thus allowing antiandrogenic modulation of AR protein levels. The large arrow points to AR protein bands, and the small arrow points to β-actin protein bands.
Time- and dose-dependent changes in LNCaP cell viability after PMCol treatment
We thank Robert Kolb for excellent technical assistance.
↵1 This research, under Award Numbers DAMD17-98-1-8505 and DAMD17-99-1-9531, was supported by the Department of Defense Prostate Cancer Research Program, which is managed by the United States Army Medical Research and Materiel Command. CaP CURE also provided funding for this project.
↵3 The abbreviations used are: AR, androgen receptor; CSS, charcoal-stripped serum; MMTV, mouse mammary tumor virus; PMC, 2,2,5,7,8-pentamethylchroman; PMCol, 2,2,5,7,8-pentamethyl-6-chromanol; PSA, prostate-specific antigen.
Received May 7, 2003.
Revision received June 2, 2003.
Lamb, D. J., Weigel, N. L., and Marcelli, M. Androgen receptors and their biology. Vitam. Horm., 62: 199 –229,2001 .
Wilding, G. The importance of steroid hormones in prostate cancer. Cancer Surv., 14: 113 –130,1992 .
Wilding, G. Endocrine control of prostate cancer. Cancer Surv., 23: 43 –62,1995 .
Jemal, A., Murray, T., Samuels, A., Ghafoor, A., Ward, E., and Thun, M. J. Cancer statistics, 2003. CA Cancer J. Clin., 53: 5 –26,2003 .
Gronberg, H. Prostate cancer epidemiology. Lancet, 361: 859 –864,2003 .
Evans, H. M., and Bishop, K. S. On the existence of a hitherto unrecognized dietary factor essential for reproduction. Science (Wash. DC), 56: 650 –651,1922 .
Brigelius-Flohe, R., and Traber, M. G. Vitamin E: function and metabolism. FASEB J., 13: 1145 –1155,1999 .
Burton, G. W., and Traber, M. G. Vitamin E: antioxidant activity, biokinetics, and bioavailability. Annu. Rev. Nutr., 10: 357 –382,1990 .
Horoszewicz, J. S., Leong, S. S., Kawinski, E., Karr, J. P., Rosenthal, H., Chu, T. M., Mirand, E. A., and Murphy, G. LNCaP model of human prostatic carcinoma. Cancer Res., 43: 1809 –1818,1983 .
Ripple, M. O., Henry, W. F., Rago, R. P., and Wilding, G. Prooxidant-antioxidant shift induced by androgen treatment of human prostate carcinoma cells. J. Natl. Cancer Inst. (Bethesda), 89: 40 –48,1997 .
Riegman, P. H., Vlietstra, R., J., van der Korput, J. A., Brinkmann, A. O., and Trapman, J. The promoter of the prostate-specific antigen gene contains a functional androgen responsive element. Mol. Endocrinol., 5: 1921 –1930,1991 .
Young, C. Y., Montgomery, B. T., Andrews, P. E., Qui, S. D., Bilhartz, D. L., and Tindall, D. J. Hormonal regulation of prostate-specific antigen messenger RNA in human prostatic adenocarcinoma cell line LNCaP. Cancer Res., 51: 3748 –3752,1991 .
Warriar, N., Page, N., Koutsilieris, M., and Govindan, M. V. Antiandrogens inhibit human androgen receptor-dependent gene transcription activation in the human prostate cancer cells LNCaP. Prostate, 24: 176 –186,1994 .
Veldscholte, J., Berrevoets, C. A., and Mulder, E. Studies on the human prostatic cancer cell line LNCaP. J. Steroid Biochem. Mol. Biol., 49: 341 –346,1994 .
Klein, K. A., Reiter, R. E., Redula, J., Moradi, H., Zhu, X. L., Brothman, A. R., Lamb, D. J., Marcelli, M., Belldegrun, A., Witte, O. N., and Sawyers, C. L. Progression of metastatic human prostate cancer to androgen independence in immunodeficient SCID mice. Nat. Med., 3: 402 –408,1997 .
Israel, K., Sanders, B. G., and Kline, K. RRR-α-tocopherol succinate inhibits the proliferation of human prostatic tumor cells with defective cell cycle/differentiation pathways. Nutr. Cancer, 24: 161 –169,1995 .
Venkateswaran, V., Fleshner, N. E., and Klotz, L. H. Modulation of cell proliferation and cell cycle regulators by vitamin E in human prostate carcinoma cell lines. J. Urol., 168: 1578 –1582,2002 .
Ni, J., Chen, M., Zhang, Y., Li, R., Huang, J., and Yeh, S. Vitamin E succinate inhibits human prostate cancer cell growth via modulating cell cycle regulatory machinery. Biochem. Biophys. Res. Commun., 300: 357 –363,2003 .
Gunawardena, K., Murray, D. K., and Meikle, A. W. Vitamin E and other antioxidants inhibit human prostate cancer cells through apoptosis. Prostate, 44: 287 –295,2000 .
Israel, K., Yu, W., Sanders, B. G., and Kline, K. Vitamin E succinate induces apoptosis in human prostate cancer cells: role for Fas in vitamin E succinate-triggered apoptosis. Nutr. Cancer, 36: 90 –100,2000 .
Zhang, Y., Ni, J., Messing, E. M., Chang, E., Yang, C. R., and Yeh, S. Vitamin E succinate inhibits the function of androgen receptor and the expression of prostate-specific antigen in prostate cancer cells. Proc. Natl. Acad. Sci. USA, 99: 7408 –7413,2002 .
Wilding, G., Chen, M., and Gelmann, E. P. Aberrant response in vitro of hormone-responsive prostate cells to antiandrogens. Prostate, 14: 103 –115,1989 .
Rago, R., Mitchen, J., and Wilding, G. DNA fluorometric assay in 96-well tissue culture plates using Hoechst 33258 after cell lysis by freezing in distilled water. Anal. Biochem., 191: 31 –34,1990 .
Thompson, T. A., Gould, M. N., Burkholder, J. K., and Yang, N-S. Transient promoter activity in primary rat mammary epithelial cells evaluated using particle bombardment gene transfer. In Vitro Cell. Dev. Biol., 29A: 165 –170,1992 .
Veldscholte, J., Ris-Stalpers, C., Kuiper, G. G., Jenster, G., Berrevoets, C., Claassen, E., van Rooij, H. C., Trapman, J., Brinkmann, A. O., and Mulder, E. A mutation in the ligand binding domain of the androgen receptor of human LNCaP cells affects steroid binding characteristics and response to anti-androgens. Biochem. Biophys. Res. Commun., 173: 534 –540,1990 .
Lieberman, R. Androgen deprivation therapy for prostate cancer chemoprevention: current status and future directions for agent development. Urology, 58: 83 –90,2001 .
Nakamura, K., Yasunaga, Y., Segawa, T., Ko, D., Moul, J. W., Srivastava, S., and Rhim, J. S. Curcumin down-regulates AR gene expression and activation in prostate cancer cells. Int. J. Oncol., 21: 825 –830,2002 .
Le, H. T., Schaldach, C. M., Firestone, G. L., and Bjeldanes, L. F. Plant-derived 3,3′-diindolylmethane is a strong androgen antagonist in human prostate cancer cells. J. Biol. Chem., 278: 21136 –21145,2003 .
Burton, G. W., Cheeseman, K. H., Doba, T., Ingold, K. U., and Slater, T. F. Vitamin E as an antioxidant in vitro and in vivo. In: Biology of Vitamin E: Ciba Foundation Symposium 101, pp. 4 –18. London: Pitman,1983 .
Dimitrov, N. V., Meyer, C., Gilliland, D., Ruppenthal, M., Chenoweth, W., and Malone, W. Plasma tocopherol concentrations in response to supplemental vitamin E. Am. J. Clin. Nutr., 53: 723 –729,1991 .
Traber, M. G., Elsner, A., and Brigelius-Flohe, R. Synthetic as compared with natural vitamin E is preferentially excreted as αCEHC in human urine: studies using deuterated α-tocopheryl acetates. FEBS Lett., 437: 145 –148,1998 .
You are going to email the following Androgen Antagonist Activity by the Antioxidant Moiety of Vitamin E, 2,2,5,7,8-Pentamethyl-6-chromanol in Human Prostate Carcinoma Cells1
Mol Cancer Ther August 1 2003 (2) (8) 797-803;
|
cc/2020-05/en_middle_0087.json.gz/line1341074
|
__label__wiki
| 0.53324
| 0.53324
|
helenburness
Marigold’s story
I just watched the first episode of BBC Four’s There She Goes. This is new series penned by Shaun Pye, a writer on Have I Got News For You, about raising a child with severe learning disabilities. It is based it on his own experience of his daughter who, like Marigold, has a rare chromosome disorder.
The series is classed as a comedy. Some of the reviews referred to it as being “outrageously funny.” And as a result, I watched this wanting to hate it. How dare anyone make light of the very serious experience that is raising a child with a serious learning disability? Plus there was the issue that they had not cast an actress with a learning disability to play the part of Rosie, the child with the rare chromosome disorder, herself. But we’ll come on to that.
The reality was that although parts was so incredibly raw and hard to watch, although I sat there and wept for so much of it, I couldn’t help but like it.
The first scene is dad Simon (played by David Tennant, whom I love, another reason I cannot hate this) attempting to take his daughter Rosie to the park so his wife Emily (played by Jessica Hynes, who I have, for many years, had a girl crush on) can crack on with some work. It’s something that would generally be straightforward with two typically developing children (aside from the usual massive faff to put on coats, shoes etc.) But with Rosie we see an epic meltdown in action as she lies screaming on the pavement, before haring across the road. Dad races after her then hauls her back to the kerb before begging his harried wife to drive them instead. The park turns out to be a two second drive away at the top of the road. They are barely in the car before they all get out again.
I know I have been there.
What resonated especially in this scene was not so much the epic public meltdown (we had a very similar one on the way home from school just now in fact), the tangible stress of dad trying to deal, the mother just desperately wanting twenty minutes to herself to do some work or Rosie’s older brother not getting to go the park for a simple kick round. It was the very awkward interaction when the neighbour walks past and doesn’t quite know how to acknowledge the situation. The poor bloke just kind of stands there staring at Rosie mid meltdown before saying “Aaah” with something akin to fondness / pity, before excusing himself and rapidly moving on.
Again, I know I have been there.
For the rest of the episode, the narrative is split between pregnancy, newborn days and the family today.
The first appointment where the baby measures up small and those first seeds of doubt start to be sewn.
The newborn days, with feeding difficulties and the dawning realisation that this baby is different, that things don’t seem as straightforward as your older child.
The reassurance that is fine, that all babies are different, that they all catch up in the end with these things….
Again, been there.
We see Emily become increasingly frazzled, desperate, exhausted and isolated as she struggles to cope. Simon cuts himself off and uses booze and staying out as a mechanism to deal with the increasing realisation that there is something “wrong”.
Well, luckily I wasn’t there as my husband was as always incredibly supportive and with me on the journey (brownie points there for husband praise – am angling for a lie in this weekend) . But I do recall the moment late at night in the hospital, where, like Emily and Simon, we both prepared each other for the very real possibility that there was a formal diagnosis for our daughter.
Many other aspects were so well portrayed. The struggle around communication. The desperation of the dad to just have a relaxing Saturday evening and placating Rosie with Skips, Hula Hoops and Ipad time just to try and get a night of peace (we prefer chocolate and a Disney film, but each to their own). The patient, devoted older brother who always seems to fall into second place. Not being able to sit down for a meal. All of it rang true, if not a more extreme version of what we go through on a daily basis.
I know many of my rare chromo and SEN community have found this first episode hard to watch. It’s brutally honest and in parts too close to the bone and inappropriate, but mainly guys at the BBC…..
THIS IS NOT A COMEDY!
A drama yes. Some very funny moments. Sure. But classing it as a comedy was a mistake. Calling this a comedy makes me feel like the BBC is calling ours and many other people’s life a comedy. I am sure that wasn’t their intention. But what they are portraying is the life so many of us in the SEN and rare chromo community lead and whilst some of it is funny, a lot of it is not.
Not when it’s day after day after day.
It’s also a shame the part of Rosie herself was not played with an actress with a learning disability. What a coup to REAL inclusion that would have been, to not only say “We are raising awareness and understanding on this very important issue” but to also say “and we are backing the very community it focuses on by supporting disabled talent in the main part.” Shaun Pye has said there was an extensive auditioning process which included both non-disabled and disabled actresses, but after consultation with a lot of professionals (would love to know who – parents are generally the best placed to understand their unique child and their capabilities) they decided it was too much to ask a young person with a learning disability to take on.
But with the right coaching, the right support, I know several parents who believe their children would have been able to take this on.
And what an amazing, positive message that would have been.
Message to the media: disabled talent it out there and ready for action. You just need to work out how to include.
All that said, I love that this series is shining a light on the world of rare chromosome disorders. I hope it will help people to understand some of the challenges, the difficulties that many of our community go through.
But most of all, I really hope that in the rest of the series we get to understand Rosie as a person, not just a rare syndrome, and see some of the beauty that she brings to family life, rather than just the chaos.
I’ll be watching.
If you have a child with a rare chromosome disorder, Unique is the rare chromosome disorder charity which provides support and knowledge. www.rarechromo.org.
Zebedee Management are a specialist talent agency supplying diverse models and offering sensitive representation. Check them out on http://www.zebedeemanagement.co.uk
This entry was posted in There She Goes and tagged 3q11 trisomy mosaicism, Disabled talent, Diverse representation, genetic, inclusion, rare, rare chromosome disorder, special needs, There She Goes, unique genetic condition, Zebedee Management. Bookmark the permalink.
|
cc/2020-05/en_middle_0087.json.gz/line1341076
|
__label__cc
| 0.691219
| 0.308781
|
MCE Community Members Making an Impact at RMECC 2016
Joshua Davies 2016, DU, kennedy institute, making an impact, Marsico Institute, MCE, Morgridge College of Education, presentations, RMECC, Rocky Mountain Early Childhood Conference, University of Denver
The Morgridge College of Education (MCE) had a substantial presence at the 2016 Rocky Mountain Early Childhood Conference, which was held in Denver and attracted over 2,500 participants. Faculty from the Early Childhood Special Education (ECSE) program, Kennedy Institute, and Marsico Institute were all in attendance along with Students from several MCE programs. MCE faculty and students presenting included:
Julie Sarama, Ph.D – MCE Faculty and Kennedy Endowed Chair in Innovative Learning Technologies
Douglas H. Clements, Ph.D – MCE Faculty and Kennedy Endowed Chair in Early Childhood Learning
Jeanine Coleman, Ph.D – ECSE Clinical Assistant Professor
Pilyoung Kim, Ph.D – Assistant Professor at DU’s School of Art, Humanities and Social Science
Rachel Schiff-Gray – ECSE Alumni
Heather Blizzard – RMS Graduate Student
Laura Dietert – CI Graduate Student
Ksenia Polson – RMS Graduate Student
Jessica Carswell – ECSE MA Student
Tara Brand – ECSE MA Student
Katie Belleau – ECSE MA Student
Brita Strub – ECSE Cert Student
Hazuki Tochihara – – ECSE Alumni
Drs. Clements and Sarama were the keynote speakers for the conference alongside Dr. Bob Sornson Founder of the Early Learning Foundation. They started the Saturday morning conference with their presentation on early math education setting the stage for the rest of the event.
“A few of the teachers in the audience commented that they could not wait to share what they had learned” said Heather Blizzard a Ph.D student in the Research Methods and Statistics (RMS) program. Blizzard presented on the effects of teaching geometry to young children alongside her peers Laura Dietert and Ksenia Polson.
LIS Alumni Making an Impact in her Community
Sabrina Green access, alumni, big impact, collection management, Colorado, databases, DU, Elbert County News, Elizabeth Middle School’s Library, Library and Information Science, library technologies, LIS, Marta Pardo, MCE, MLIS, Morgridge College of Education, University of Denver
Library and Information Science program (LIS) graduate Marta Pardo was featured in the Elbert County News recently for her work updating Elizabeth Middle School’s Library. Pardo, a Colombian immigrant with an impressive career history as a Medical Doctor and cancer researcher, found herself working in Colorado libraries in 2005. After several years working as a para professional she received a scholarship enabling her to pursue a Master’s degree in LIS at the Morgridge College of Education.
In 2014 Pardo began working at Elizabeth Middle School. “I wanted to work in a small library. Its important work” says Pardo who is firm believer of making a big impact in small communities. In her year at Elizabeth Middle School she has been able bring library technologies forward a decade and turn the library into a paradise for students.
Pardo advocates that her students – especially the female ones – “just do it, get into school, get an education.” She uses her own daughters, who are away at Yale on scholarships, as shining examples of what young woman can achieve.
Elbert County News is a part of Colorado Community Media. Colorado Community Media is a joint venture between MetroNorth Newspapers, Mile High Newspapers and Community Media of Colorado. Colorado Community Media’s authority on the 24 local communities it serves is unparalleled.
Read the full story by Elbert County News
China Exchange Program Contributes to School-Based Mental Health
Sabrina Green Anxiety, Beijing Normal University, Career Development, CFSP, Child Family School Psychology, China, Education, Mental Health, practicum, School Mental Health, school psychology
Students Sarah Laffin and Aleksandra Matysek completed a six-week school-based mental health practicum this past fall in Beijing, China as part of an international exchange program between Beijing Normal University (BNU) and the CFSP program. The program – now in its fourth year – was developed to broaden students’ multicultural competence and to promote the field of school psychology.
Laffin and Matysek completed their practicum with graduate students from BNU at Jingyuan School, a public middle and high school located in Beijing’s fifth ring. They worked with an on-site supervisor to plan and deliver weekly classroom mental health lessons, group counseling, and career development services. Laffin and Matysek also engaged in a cross-cultural comparison of school-based approaches to identify and manage student anxiety and gave a joint teleconference presentation to graduate students and faculty at both BNU and the Morgridge College of Education (MCE) on the topic.
One important finding discussed was that while levels of general anxiety are about the same in both cultures, social anxiety is more prominent in China due in part to the cultural focus on harmonious relationships and social restraint. Laffin and Matysek learned that students in the United States are more likely to seek help managing anxiety, possibly due to a greater awareness and acceptance of the role mental health plays in academic and life success. Two graduate students from BNU will reciprocate the exchange this spring, coming to MCE to attend selected classes and accompany current CFSP graduate students to their local practicum sites. They will also give a cross-cultural, joint teleconference presentation.
Laffin and Matysek say that their increased global understanding has had a positive influence on their practice and has increased their confidence in communicating with bi-lingual students and families in the United States. The international exchange program has been of mutual benefit as peers and faculty at BNU have been able to employ the counseling tools and methods introduced by CFSP students. The exchange has fostered an increased international appreciation of school-based mental health, helping BNU to establish a graduate program supporting China’s emerging field of school psychology.
Learn More About the CFSP Program
Morgridge Faculty, Alumni, and Students Present at RMECC 2016
Joshua Davies
The Morgridge College of Education is proud to recognize the faculty, alumni, and students from the Early Childhood Special Education program who will be presenting at the 2016 Rocky Mountain Early Childhood Conference in Denver on February 19 and 20.
This Is Your Brain on Poverty: Helping Families Overcome the Effects
Pilyoung Kim & Rachel Schiff-Gray (ECSE MA Graduate)
Friday February 19, 11:00am – Colorado Convention Center Room 604
This workshop will provide early childhood professionals an overview of the effect of poverty on brain development and practical evidence-based strategies that can help families overcome some of these effects. This workshop is ideal for participants who work with children exposed to poverty.
Saturday Keynote Address – The Building Blocks of Mathematics
Dr. Douglas H. Clements (MCE Faculty) & Dr. Julie Sarama (MCE Faculty)
Saturday February 20, 7:45am – Colorado Convention Center
What are the building blocks of mathematics? How important are they? Drs. Clements and Sarama will answer these questions by summarizing recent research and development work including works they helped write. These works include the National Research Council report on early childhood mathematics, the report of President Bush’s National Math Advisory Panel, and the Common Core. Effective instructional approaches featured in this session include basing instruction on learning trajectories, which will be illustrated through a set of NSF- and IES-funded projects. Video segments and hands-on activities will provide concrete examples.
The Power of Knowledge: Teaching Geometry to Young Children
Heather Blizzard, Laura Dietert, and Ksenia Polson (MCE Graduate Students)
Saturday February 20th, 9:00am
This session will include a presentation of graduate student research on the best methods for teaching geometry to young children. The presentation includes a workshop that will provide instruction to administrators and teachers on how to better discuss attributes of mathematical shapes with preschoolers.
Effective Inclusive Partnerships: Collaborating with Parents
Jessica Carswell, Tara Brand, and Katie Belleau (ECSE MA Students)
Saturday February 20, 9:15am – Colorado Convention Center Room 702
Participants will learn about the importance of keeping parents involved with inclusive practices within a classroom. The presenters will provide strategies for effective communication between all specialists, guardians and teachers involved in supporting a child’s development.
Engaging Ways to Support Fine Motor Development
Brita Strub (ECSE Certificate Graduate)
In this workshop participants will learn fun, easy, and effective ways to increase students’ fine motor skills. Participants will be able to implement these into the classroom immediately, in both large group and small group settings. The activities are easy to differentiate, set up/clean up, and interactive.
To Kindergarten & Beyond! Parents’ Perspective & Supporting Transitions
Hazuki Tochihara (ECSE Graduate) & Ali Van Heusen
Saturday February 20, 11:00am – Colorado Convention Center Room 502
This presentation will share firsthand accounts of what parents and guardians of young children with special needs have experienced before, during, and after major transitions, such as welcoming an infant with a disability to a family and going to Kindergarten.
Evidence-Based Practices for Children with Disabilities
Jeanine Coleman, Ph.D. (ECSE Clinical Assistant Professor) & Lissanna Follari
Saturday February 20, 1:30pm – Colorado Convention Center Room 402
The Division for Early Childhood recently published a new version of Recommended Practices. This presentation will bring the Recommended Practices to life by giving participants realistic examples of how to implement the practices within inclusive early childhood environments.
Teaching Strategies Gold: A Collaboration between ECE & ECSE Teachers
Jeanine Coleman, Ph.D. (ECSE Clinical Assistant Professor) & Max Panten
This workshop will present a guide for itinerant Early Childhood Special Education (ECSE) teachers to use Teaching Strategies Gold (TSG) in collaboration with Early Childhood Education (ECE) teachers. ECSE and ECE teachers will understand how to use TSG to plan for differentiated instruction for children with disabilities, plan for tiered intervention strategies for children who are at risk for delays, and inform Individualized Education Program (IEP) annual reviews.
LIS Students Develop Collection of Civil Rights Pioneer
Sabrina Green 1963, African-American pilot, anti-discrimination, archiving, Civil Rights, Civil Rights Movement, collection, Colorado, employment discrimination, historical collection, Library and Information Science, LIS, Marlon Green, supreme court
Students Kimmie DePinto and Jane Nelson from the Library and Information Sciences program have been working to archive materials from the family of Marlon Green, the African-American pilot whose employment discrimination lawsuit against Continental Airlines led to a landmark decision by the United States Supreme Court in 1963 and a victory for Green and the Civil Rights Movement.
Marlon Green was an Air Force veteran who, despite extensive flying experience, was unable to obtain employment as a commercial pilot in the 1950s; he secured an interview with Colorado-based Continental Airlines only after leaving the “race” box on the application unchecked. Green was ultimately passed over for employment at Continental in favor of white pilots with much less experience than he, leading to a complaint to Colorado’s Anti-Discrimination Commission that he was discriminated against due to his race. The case was not resolved until the U.S. Supreme Court became involved and ruled in Green’s favor. Green went on to fly for Continental until his retirement in 1978.
Paula Green, Marlon’s daughter, contacted DU in 2015 about processing materials that came into her possession after the passing of her mother, Eleanor, and was able to begin working with DePinto and Nelson during the fall of 2015. Students from another university had processed some materials in 2004; however, Paula had since been in contact with the Smithsonian Institute about a possible donation of the collection and she wanted to renew progress on creating an organized collection in order to bring her father’s story to greater national prominence.
The project began as an independent study for DePinto, who was later joined by Nelson to assist. DePinto was interested in this opportunity because of her interest in working with minority collections to provide a voice for groups who would otherwise go unheard. “The hands-on involvement in a project of such importance allows students to put theory into action, provides a richer experience in the program beyond academic coursework, and prepares students for future employment” said LIS faculty Heather Ryan, Ph.D.
Learn More About the Library and Information Science Program
CRISPA Teaching & Learning Model Creates Meaning in Education
Sabrina Green Bruce Uhrmacher, CRISPA, Curriculum and Instruction, Denver Art Museum, Education, Perceptual Teaching and Learning, Research Methods and Statistics, students, Teacher Education Program
CRISPA is a six-dimensional Perceptual Teaching and Learning model that provides approaches to enrich learning beyond outcome-based standards. P. Bruce Uhrmacher, PhD, faculty of the Research Methods and Statistics, Curriculum and Instruction, and Teacher Education Programs, was inspired to create CRISPA based on interactions between artists and educators as well as the views of philosopher John Dewey; in particular, his view that aesthetic experiences can exist outside of the arts.
The six dimensions – Connections, Risk-Taking, Imagination, Sensory experiences, Perceptivity, and Active engagement – support research-based strategies that serve as a common ground for educators, enable teachers to enrich lessons, and allow students to explore their creativity. CRISPA is growing in popularity and is used by many educators nationwide – including many of Dr. Uhrmacher’s former students – to create better experiences for students and teachers alike.
MCE alumna Kristina Mahoney works at the Denver Art Museum (DAM) where she used CRISPA to co-develop and implement a tour program for young children this past year. Mahoney worked with DAM while completing her dissertation regarding the role of CRISPA’s elements in art museum education and recognized how the model can be applied in practice. The tour program was created to help children make connections to artists by using their imaginations to relate to the artmaking process. The tour program launched in 2015, providing children with opportunities to have hands-on experiences as well as to engage with art and artmaking materials.
Bradley Conrad, a former student of Dr. Uhrmacher’s and current Assistant Professor of Education at Capital University in Columbus, OH, frequently uses CRISPA in his teaching and has written about and presented on the model. He conducted a one-day lesson planning workshop utilizing CRISPA in Denver with K-12 teachers as part of a study recently published on curriculum disruption. The teachers’ perceptions changed noticeably after the workshop – those who had not considered themselves to be creative realized that CRISPA gave them the tools to design creative lessons and provide meaningful experiences for their students. One participant said that it was “important for us to be creative as educators. We are teaching the future doctors, the future scientists, people who are going to create the world that we live in”.
Learn More About CRISPA
Student Priyalatha Govindasamy Wins Top Award for Meta-Analysis Research
Joshua Davies Antonio Olmos, Award Winner, DURAPS, Effect Size Caclulator, MCE, Morgridge College of Education, Priyalatha Govindasamy, Research, research methods, Research Methods and Statistics, RMS, Statistics, Student
Research Methods and Statistics Ph.D Candidate Priyalatha Govindasamy received top award at the University of Denver Research and Performance Summit (DURAPS) on January 29. Govindasamy presented her research at the DURAPS poster session highlighting the software package that she has been developing with Antonio Olmos, Ph.D and Kellie Keeling, Ph.D.
Govindasamy explained that “effect size is the key to conducting meta-analysis, but not all the studies report empirical information required for computing effect sizes.” Studies will often report different types of statistical information that require different mathematical algorithms to compute effective sizes. To overcome this hurdle, Govindasamy and her supporting faculty developed the Effectssizecalculator Package in R for Meta-Analysis. This package was designed to compile all different mathematical algorithms and estimate the effective sizes into one module and leverages the R statistical analysis software.
The Morgridge College of Education would like to congratulate Miss Govindasamy on her award and recognize her fascinating research.
Learn More about the RMS Program
|
cc/2020-05/en_middle_0087.json.gz/line1341081
|
__label__wiki
| 0.609312
| 0.609312
|
Event Preview, Film/Video, Literary, Performing Arts, Visual Art
What to do, hear, see | March 1-7
by Thom Mariner • February 28, 2017
It seems March is coming in like a lion. When the storms clear, here are some bright ideas for your weekend . . . and beyond.
CULTURAL EXHIBITS
Skirball Museum / Hebrew Union College
“The Golden Age of Baroque Music: Wendy Kanter Memorial Concert.” | Sunday, March 5, 4 p.m.
“Rembrandt and the Jews: The Berger Print Collection.” | March 5-April 30.
Rembrandt is said to have been fascinated by Jews and Judaism, and frequently painted Jewish subjects. This exhibit features 22 Rembrandt etchings of Jewish and biblical subjects and a drawing by Pieter Lastman, Rembrandt’s teacher. The exhibit kicks off with a concert of Baroque music presented on period instruments by The HarmoNati Ensemble: Allison Edberg Nyquist, violin; Leela Breithaupt, traverso; Annalisa Pappano, viola da gamba; Adriana Contadino, cello; Michael Unger, harpsichord/organ; and Yaël Sénamaud, violin/viola. A lot of musical talent here! Reception to follow.
College-Conservatory of Music
Choreographer’s Showcase | Thursday-Saturday, March 2-4. University of Cincinnati.
De La Dance Company
“Dance Cincinnati 2017,” a festival of dance to showcase talents of area’s dance community | Friday-Saturday, March 3-4 & 10-11. 5141 Kennedy Ave, Cincinnati, OH 45213.
Here are two chances this weekend (or next) to view brand new dance works: CCM’s student choreographers present their own creations at UC, and – at their new venue in Kennedy Heights – De La Dance showcases new pieces by Andre Megerdichian, Diane Germaine, Alexandra Brannon and Tracey Bonner.
The Carnegie
Charlie Chaplin in “The Kid.” | Thursday, March 2, 7:30 p.m. 1028 Scott Blvd., Covington, KY 41011.
Time travel to 1921 and relive a night at the (silent) movies. The Carnegie building dates from 1904, so this could have happened! The classic film is accompanied live by pianist Jeff Rapsis.
Mercantile Library
Scenes in the Stacks presents “Desk Set.” | Friday, March 3, 7 p.m. 414 Walnut St., Cincinnati, OH 45202.
Second in a new series of events from the prolific Mercantile Library, taking a more in-depth look at the intersection of movies and libraries. A discussion following the film is led by Peter Niehoff.
If you haven’t yet been to the Mercantile, this is a great way to check it out.
The Mini Microcinema
“Nature Shorts: International Mix of Vintage Nature Documentaries” | Thursday, March 2, 7 p.m. 1329 Main St., Cincinnati, OH 45202.
“Ten,” directed by Abbas Kiarostami | Tuesday, March 7, 7 p.m.
Two interesting evenings coming up at The Mini. Check out Rick Pender’s feature in our March print edition.
Kurt Dinan
“Plotting vs. Pantsing: How to (Maybe) Outline a Novel, with Kurt Dinan” | Saturday, March 4, 2-4 p.m. 800 Vine St., Cincinnati, OH 45202.
For you aspiring writers, this looks like it should be a fun exploration of the art/science of planning a novel…with Cincinnati writer Dinan, writer-in-residence.
Cincinnati Soundbox
“Solo Soundbox with Colleen Phelps: Nashville – Cincinnati” | Friday, March 3, 8:30 p.m. The Listing Loon, 4124 Hamilton Ave., Cincinnati, OH 45223.
Here’s a new chamber music series presenting works by both local composers and composers from around the United States on a rotating geographical basis. CCM grad Phelps now lives in Nashville, and in this show combines her talents of composing, singing and striking things in these new works for found objects and voice. Should be interesting!
Cincinnati Symphony
Katia and Marielle Labèque
Louis Langrée, conductor. Katia & Marielle Labèque, piano | Friday-Saturday, March 3-4, 8 p.m. Taft Theatre, 317 E. Fifth St., Cincinnati, OH 45202.
Stravinsky: Symphonies of Wind Instruments
Mozart: Concerto for Two Pianos
Stravinsky: Concerto in D (“Basel Concerto”)
Mozart: Symphony No. 40
After WWI, Stravinsky turned stylistically to the 18th century for inspiration, and this program is a great way to compare and contrast his 20th century voice with that of Mozart’s. Plus, the Labèque sisters are tres magnifique!
Vocal Arts Ensemble
Craig Hella Johnson (Photo by James Goulden)
Regional premiere: Craig Hella Johnson, “Considering Matthew Shepard,” conducted by the composer. | Saturday, March 4, 8 p.m. & Sunday, March 5, 5 p.m. Gallagher Center Theater, Xavier University.
What is this? An oratorio? A concert? Choral theater? Or all the above? Read more here. A gorgeous, heart-wrenching, yet ultimately life-affirming work, with a kitchen sink of musical styles and one everlasting message – the power of love and hope trumps all. Full disclosure: I get to sing in this one. Bring your tissues, but prepare to be uplifted. Almost sold out, I hear.
“Mack and Mabel,” directed by Aubrey Berg | Thursday-Sunday, March 2-5. University of Cincinnati.
A rare revisiting of Jerry Herman’s 1974 musical about the relationship between Hollywood director Mack Sennett and silent film star Mabel Normand. Set in 1911, amidst the zany slapstick of early films, and full of timeless Herman tunes. CCM’s musical theater productions are always, at the least, highly creative.
There are several art openings this Friday, plus the chance to peruse dozens of studios at the Essex Art Walks, Friday and Saturday.
“Darwin Orchid,” Mixed Media 36″ x 60″ x 9″ by Mark Wiesner, at Studio San Giuseppe.
Cincinnati Art Galleries
“The Return to Beauty: Asian Influences on Contemporary Asian Art” | Friday, March 3, 5-8 p.m. 225 E. Sixth St. #1, Cincinnati, OH 45202.
Paintings and photography based on traditional Asian art by sixteen prominent regional artists. Runs through April 22.
Essex Studios
Art Walks, open studios | Friday-Saturday, March 3-4, 6-10 p.m. 2511 Essex Place, Cincinnati, OH 45206.
Sharonville Cultural Arts Center
“Tres Chic” | Friday, March 3, 6-9 p.m. 11165 Reading Road, Cincinnati, OH 45241.
Works by Alicia Cummings, Tara Freese and Jill Sheehan. Runs through March 31.
Studio San Giuseppe Art Gallery
“Alchemize” | Friday, March 3, 6-9 p.m. Mount St. Joseph University, 5701 Delhi Road, Cincinnati, OH 45233.
Sculptures by Jan and Mark Wiesner. Runs through April 9.
Thursday-Saturday, March 2-4. Duke Energy Convention Center
One of the city’s classic events. Three days of wine and food heaven: winery dinners, grand tastings…varietals galore. Yes, you could get pretty blasted if you wanted. But why not take advantage of the chance to really learn? Take your time and be picky. Don’t bother tasting wine you could buy at the grocery. Be bold. Try something new. Ask for advice. Arm yourself for the future!
A Life Well Worth Remembering
David Herriman
Monday, March 6, 4:30 p.m. Playhouse in the Park, 962 Mt. Adams Circle, Cincinnati, OH 45202.
David Herriman was a visionary businessman and philanthropist, supportive of so many area local organizations, and always in a quiet, matter-of-fact way. The Playhouse is hosting a musical cabaret celebrating his life and legacy. And that’s the way David would have wanted it. Godspeed, David. You will be sorely missed. Thank you.
Open to the public.
To RSVP please contact Tamara@artworkscincinnati.org.
Tags: Cincinnati Art Galleries Cincinnati International Wine Festival Cincinnati Public Library Cincinnati Skirball Museum Cincinnati Soundbox Cincinnati Symphony Orchestra De La Dance Company Essex Studios Mercantile Library Sharonville Cultural Arts Center Studio San Giuseppe Art Gallery The Carnegie The Mini Microcinema UC College-Conservatory of Music Vocal Arts Ensemble
← Reelabilities 2017: ‘really big, really enlightening’ fundraiser
Peraza ensemble to play Carnegie Hall in March →
What to Do/Hear/See
|
cc/2020-05/en_middle_0087.json.gz/line1341083
|
__label__cc
| 0.741709
| 0.258291
|
Two UFOs Spotted at Space Station in Just Over a Week
Paul Seaburn January 17, 2015
The International Space Station has been seeing quite a bit of UFO activity since the beginning of 2015, with two recent sightings occurring eight days apart. At this pace, the person at NASA who keeps hitting the button to cut off the video feeds is going to get carpal tunnel syndrome.
The first sighting was made on January 6 by Toby Lundh, who captured screenshots of the UFO before the video feed was … you guessed it … cut off after about 15 seconds. He later went looking for the recording in the NASA archives and was unable to find it. It’s certainly one of the more unique UFOs seen on the ISS video feed. No other reports of it have surfaced and NASA has no comment on it.
UFO seen on ISS feed by Toby Lundh
While the news from the ISS this week centered on the suspected ammonia leak on the U.S. side on January 14 which forced the American astronauts to move to the Russian side, people watching a video during a report on CBS News saw an orb floating outside the station before disappearing behind it.
The ammonia leak proved to be a false alarm. The UFO? No one is saying anything. No other networks appeared to have broadcast the same video. There weren’t any reports of sightings from people watching the live feed. The orb could be space debris, although it’s near-perfect roundness suggests otherwise. Then there’s the fact that it occurred during an emergency. Coincidence or alien first responders?
This increase in UFO sightings near the ISS seems to have started last fall and includes one in October during a spacewalk. Perhaps aliens heard that opera singer Sarah Brightman will be making a trip to the station in October and are checking out good seats. One consistent theme in all the reports is that the NASA feed reliably cuts out shortly after the sightings.
These recent sightings have elicited strong responses from both sides. What do you think?
Tags alien aliens Astronomy Conspiracy ISS nasa Science space space station ufo UFOs
Buried Antarctic Meteors May Hold Secrets of Solar System
Paul Seaburn February 21, 2016
The Supermassive Black Hole at the Center of Our Galaxy Just Lit Up and No One Knows Why
Sequoyah Kennedy August 13, 2019
Former NASA Scientist Sees Alien Ships in Saturn’s Rings
Paul Seaburn August 23, 2016
Lens Flare: Year of the Trail Camera UFOs
Micah Hanks October 2, 2010
|
cc/2020-05/en_middle_0087.json.gz/line1341085
|
__label__cc
| 0.710243
| 0.289757
|
Information, Tips
How to travel in Tuscany by train
Traveling in Tuscany by train is definitely a good way to discover the beauties of our region. If you are scared about driving a car along the roads of the Belpaese, trains give you the opportunity to move around comfortably sit in your seat and to admire the different landscapes rolling out of the window.
The connection between the main cities of Tuscany by train is absolutely great. You can easily go from/to Florence and Pisa, Lucca or Siena, and move up and down along the coastline. Instead, it could be more difficult to reach rural areas and some small villages due to the lack of train stations. In this case, do not worry. Usually, public buses run between these hamlets and the closest rail stations.
Train running along the Italian countryside
In Italy, there are two main train companies. Trenitalia provides high-speed trains (the Frecce), and also a widespread coverage of the territory with national and local trains. The other company, Italo, operates only with high-speed trains connecting the main Italians cities.
Tuscany by train: how to do it
Italo high-speed train Map
Main railway stations in Tuscany
The station of Firenze Santa Maria Novella (Firenze SMN) is obviously the main railway terminal of the region and is located along the route between Rome and Milan. It is from SMN that you can get high-speed trains to Milan, Bologna, Rome, Naples (Frecciarossa or Italo), and Venice (Frecciargento).
Taking “regionale” trains instead, you can reach all the corners of the region. In approximately one hour you can be in the Piazza Grande in Arezzo, walk along the walls of Lucca, resting in the sun in the coastal Livorno, take a picture with the leaning tower in Pisa or get a plane at Pisa International airport “Galileo Galilei”.
Pisa Centrale is another important station being a crossroad between the railway line coming from Florence and the coastal train route. Also, if you land in Pisa Airport, every 7 minutes, the train shuttle “Pisa Mover” runs from/to the central station. From there you reach your final destination in Tuscany by train. The journey takes only 5 minutes, and you can buy tickets directly at the platform from the ticket machines.
Train map of Tuscany
Explore the coast of Tuscany by train
The coastal railway line connects the main seaside resorts of Tuscany along the Riviera of Versilia (Viareggio, Pietrasanta, Massa, and Carrara), the Etruscan Coast (Livorno, Castiglioncello, Cecina, Campiglia), and the Maremma (Follonica, Grosseto).
Moreover, if you take the south direction, you can reach Rome and Fiumicino International Airport. Instead, going north, you reach Cinque Terre, Genoa and Milan.
Heading to Siena
Departing from Florence SMN, there are some daily Regionale trains heading to Siena.
Instead, if you are in Pisa or Lucca, you have to get the train to Empoli, get off, and change locomotive. On the way, if you have time, do not forget to stop in Monteriggioni, one of our favourite villages of Tuscany. If you are heading to San Gimignano, stop in Poggibonsi and get a bus. From the southern Maremma, you can get a train in Grosseto or Montepescali.
Drink and don't drive: Chianti by Train
Reaching Chianti by train is not that easy, but it’s not impossible. The only two train stations of the “shire” where the famous red wine is made are Poggibonsi and Castellina. They are both along the route between Empoli and Siena. From these points, you can catch a bus to reach the villages you wish to visit without getting worried if you drink one glass too many.
Getting to Val d’Orcia
If you decide to visit this wonderful fairytale part of Tuscany by train, the stations where to stop are Montepulciano (on the line between Siena and Chiusi/Chianciano Terme) and Buonconvento (on the line that connects Siena to Montepescali in Maremma). From there, after a visit to these lovely hamlets, you can proceed by bus to Pienza, Montalcino and San Quirico d’Orcia and all the other villages of this area listed as UNESCO World Heritage site of Tuscany.
For the bus connections, check here.
Frecciarossa high-speed train – Photo credit: Trenitalia Press Office
Getting to Mugello
To reach the beautiful nature of Mugello in the northeastern part of Tuscany, from Florence you can get the regional train that goes to Faenza (in Emilia Romagna). S. Piero a Sieve, Borgo San Lorenzo, and Marradi are the main places. If I were you I would not miss visiting the area in autumn when they celebrate the chestnuts, the traditional fruit of the fall, with many “sagra” where you can taste it in many different ways and recipes.
Explore Garfagnana and Lunigiana
You can easily cross the wild and mountainous region of Garfagnana and Lunigiana getting a regionale train from Lucca or from Aulla. Along this railway line is plenty of places off the beaten path to discover. Borgo a Mozzano is known for the Devil’s Bridge and the Halloween festival. Barga is famous to be one of the most beautiful villages of Tuscany and for the summer jazz festival. In Equi Terme you can be an explorer for a day at the Geo-Archaeological Park, and during Christmas, visit the suggestive living nativity scene along the alleys of the village and into the grotto. Castelnuovo Garfagnana and Fivizzano are other two lovely villages where to stop for a visit to their castles and taste delicious traditional food.
Regionale Train in Lunigiana – Photo credit: Trenitalia Press Office
Reach Tuscany by train from the main Italian Airport
From Bologna Airport
If you do not land directly in Tuscany, the closest and more comfortable airport to fly to is the Bologna International “Marconi” Airport. Every 11 minutes there is a shuttle bus that connects the airport to the Central Rail Station. From there you can choose a Frecciarossa that in less than an hour will bring you to Florence SMN.
From Milan Airports
The International airport of Milano Malpensa (MPX) is connected with the railway terminal of Milano Centrale by the Malpensa Express train or the Malpensa Shuttle bus.
If you land at Linate Airport in Milan, you can reach the central rail station by Air Bus. In case you land at Bergamo Orio al Serio Airport, there is the Orio Shuttle bus.
Once in Milano Centrale Terminal, head to Florence with Frecciarossa, or Italo. Instead, if your destination is the coast (Carrara, Massa, Viareggio, Pisa, Livorno) there are the Frecciabianca, the Intercity or Regionale trains at your choice.
Italo Locomotive – Photo credit: Italo Press Office
From Rome Airport
From the International Airport Leonardo da Vinci of Fiumicino (FCO) in Rome, you can use the non-stop shuttle train Leonardo Express provided by Trenitalia. Every 15 minutes it connects the airport to Roma Termini station. From there you can choose to reach Tuscany by high-speed trains (Italo, Frecciarossa or Frecciargento) or by regionale veloce train.
How to buy tickets to travel in Tuscany by train
You can buy your tickets online on Trenitalia and Italo websites or directly at the train stations. Consider that only the biggest towns have a ticket office, while most of the small stations have only ticket machines and ticket desks open only a few hours per day.
What about rates? High-speed trains are not so cheap, especially if you buy tickets close to departure. Instead, if you book in advance you can find really nice prices and special offers. I suggest you look at both websites as they always do offers (for example Saturdays and Sundays offers, train + car offers …).
Online tickets are personal and only the named person can travel with it. They do not need to be validated before to get on the train and to be printed out too. The only thing you need is the PNR code to show in case of control. This rule works for all kind of trains.
Paper tickets bought at the train station need to be validated at the specific machine before departure (in Italian we say obliterare il biglietto), otherwise, you can incur a penalty.
Train at Sunset – Photo credit: Trenitalia Press Office
Helpful Italian train glossary
I end this post about how to travel in Tuscany by train with a small glossary that can be helpful once you have to organize your trip.
Frecciarossa: the fastest high-speed trains of the country that can reach the speed of 300 km/h (186 mi/h) making easier the connection between the main cities of Italy in only a few hours.
Frecciargento: fast comfortable trains that run along both the high-speed and normal railways, reaching the maximum speed of 250 km/h (155 mi/h).
Intercity and FrecciaBianca: fast comfortable trains that run along the normal railroads
Regionale: slow trains that stop at every station and allow visitors to reach even small destinations.
Regionale Veloce: local trains that go faster than Regionale and do not stop in all stations along the railway.
Treni in Arrivo: arrivals.
Treni in Partenza: departures.
Binario: platform.
In orario: on time.
In ritardo: delayed.
Obliterare: validate the ticket at the specific machine in the train station.
For other handy information about traveling in Italy by train, take a look here at this post written by the Italian Storyteller Eleonora.
If you get any other question, leave a comment and I will be glad to help you out.
Pin if you like it
Cover Photo credit: Trenitalia Press Office
(Updated on 20 February 2019)
The world premiere of Inferno the movie in Florence
Nicola Bandini
I have a passion for travels and photography, puzzles and Lego, beer and Fiorentina (both bistecca and football team). Always happy when I get a flight ticket on my hand. Proudly Tuscan, one of my desires is to show people the hidden gems of my birthland!
November 7, 2019 at 4:11 pm by Nicola Bandini / 2 Comments
Michelangelo Buonarroti was one of the greatest artists of the history. Masterpieces the likes of…
Information, Places, Summer, Tips
Florence in Summer Is Not a Good Idea
June 2, 2019 at 6:40 pm by Nicola Bandini / 0
Florence in summer is not a good idea! The title of this post is obviously…
Information, Places, Seasons
How to get from Florence to Cinque Terre
April 29, 2019 at 11:42 pm by Nicola Bandini / 1 Comment
Thanks to their iconic monuments and marvelous landscapes, Florence and Cinque Terre are two of…
Places, Seasons, Tips, Tuscany Travel Journal
What to do in Lucca for a half day
January 23, 2018 at 10:18 pm by Anne Harrison / 1 Comment
What to do in Lucca for a half day? If you have only a few…
Places, Seasons, Tips
Pontremoli, hidden gem of northern Tuscany
October 8, 2017 at 6:06 pm by Edoardo Pucciarelli / 9 Comments
Pontremoli is one of the main villages of Lunigiana located at the bottom of Tosco Emiliano…
|
cc/2020-05/en_middle_0087.json.gz/line1341086
|
__label__wiki
| 0.734245
| 0.734245
|
How much does a BMW 750li cost?
The 2018 BMW 7 Series has a Manufacturer's Suggested Retail Price (MSRP) just over $84,000 for a base 740i model.
A RWD, V8-powered 750i begins over $97,000, and adding AWD to either is another $3,000.
The 740e xDrive plug-in hybrid starts over $91,000.
Previous questionWhat is the best job at USPS?
Next questionIs postal exam 473 difficult?
How much did a BMW 750 LI cost brand new?
Base price starts at $74,000, most of the ones I've worked on had window sticker prices in the $85-$95,000 range. Options add up fast, I've seen a motortrend test they said the options "added" $20,000 to the base price.A 2014 model costs $91,000 new.Need to know what year the vehicle in question ...
How much does a BMW m760i cost?
The M760i xDrive is the most powerful car in the 7 Series lineup.It has a 6.6-liter V12 engine with a 601 horsepower rating.This performance behemoth features M badging and styling tweaks, as well as power-adjustable rear seats.It has a base price of $156,700 – nearly double the base price of a 7...
How long should a 2012 BMW 750li battery last?
You should get a couple years out of it, but it really depends on you. If you constantly run it low and then recharge it, that's deep cycling, and will reduce battery life substantially.
How do you fix 2008 BMW 750li abs module?
Not much you can do to fix an ABS module. Replace it with a new one.
How do you reset the maintenance light on a 2008 BMW 750li?
2008-2015 BMW 750Li 760Li 750i Service Warning Light Reset: Turn the ignition key to the ON position without starting the engine.Press and hold the TRIP button in the instrument cluster until you see a Service Item on the display.Press the TRIP button briefly to scroll the service minders tha...
How much does it cost to replace a valve cover gasket on a BMW?
The average cost for a Valve Cover Gasket Replacement is between $466 and $572 but can vary from car to car.
How much does it cost to fix an oil leak in a BMW?
To give you a serious answer to the original question, it will cost anywhere from $30 to $1500 depending on where the leak is.$30 would be a bad oil pressure sensor or something like that, and $1500 if the leak is a head gasket.
How much horsepower does a 1997 BMW 528i have?
my friend's 92 has about 160HP w/ roughly 155 ft/lbs TQ
How much oil does a 1998 BMW 750il takes?
An E38 750il uses 8 quarts even.
How much is a 2014 BMW m3?
2015 BMW M3 SedanOriginal MSRP / PriceHorsepowerM3 4dr Sdn$62,000 / N/A425
How much is a 2006 BMW 530i?
2006 BMW 530i SedanOriginal MSRP / PriceCity MPG / Hwy MPG5 Series 530i 4dr Sdn RWD$46,800 / N/AN/A
How much will it cost me to change my oil in my 1999 I BMW?
If you do it yourself, about $30. If you pay somebody to do it, it depends on who you hire.
How much does a hydrogen car cost?
The Honda Clarity cost $300,000 each, but hydrogen fuel cells are expensive to produce and some are fragile.
How much does a dodge tomahawk cost?
Only 9 were built in 2003 and they were not street legal. They sold for $555,000 through the Neiman Marcus catalog. The Tomahawk is a factory prototype and not for sale
How much does a rhino cost?
what the hell?what the fcuk
How much does a minivan cost?
It depends on what condition it is in and what kind of model, I found one for $830!
How much does a rental car cost?
Depends on the company, location, and the type car you rent. Starts at around $15 per day plus fuel and mileage.
How much does a v8 supercar cost?
A typical V8 Supercar costs above $600,000
How much does a hummer h1 cost?
When new, here are the prices of the 2006 HUMMER H1:Enclosed 4dr All-wheel Drive: $136,483Open Top 4dr All-wheel Drive: $125,160In cars.com, the price of used Hummer H1s ranges from $33,889 Up to $125,800. Price of used cars depends on factors such as mileage, external and internal damages, optio...
How much does a porch cost?
A porch is a sheltered area that stands out at the front, rear or side of a building.Prices of materials and builders' labor costs vary enormously throughout the world so the cost of building a porch must depend on where exactly in the world it is to be erected.A question like this one cannot be ...
How much does a DeLorean cost 2019?
With those issues nearly settled, the new DeLorean is now back on track for a 2019 release and $100,000 price tag.
How much does a seatbelt ticket cost?
Back in 1986, a violation of the seat belt law (then, as now, an infraction) was punishable by a fine of $25.No court costs were assessed.Today, the penalty for a front-seat occupant's failure to wear a seat belt is $25.50 plus $153.50 in district court costs.That's a total of $179.
How much does a 747 cost?
The first 747-100 from Boeing Co.(NYSE: BA) was put into service in 1970, and those first planes sold at a list price of $24 million.Adjusting for inflation, that same 747 would sell today for $147.1 million.A new 747-8 passenger jet now lists for $367.8 million and the freighter version at $368....
How much does a YFZ 450 cost?
2017 Yamaha YFZ 450R Specifications IdentificationModel TypeSportBASE MSRP(US)$8,999.00DealersYamaha DealersWarranty630 more rows
How much does aaa cost a year?
(There's also a student membership.) Again, remember that costs vary across the country.AAA South, for instance, charges $66 a year for Classic membership, $100 a year for Plus, and $126 for Premier.The cost of adding other family members ranges from $30 to $65 a year, although there is a discoun...
How much does a CAT 797 cost?
So the 797 carries a nominal load rating of 360 tons, but it's capable of accepting 400 tons.And 400 tons is roughly the weight of 120 Ford Excursions.When shovels grow again, so will the trucks.Beyond the 797's cost of $3.4 million, mine operators need to make serious infrastructure changes to a...
How much does a DOT inspection cost?
Inspections DOT Annual Tractor (with Measurements)$58.99*DOT Annual Combined Tractor & Trailer$100.99*Trailer PM (DOT, Lube & Air Tires)$56.99*Mid Trip Inspection (Tractor or Trailer)$9.99*Used Truck Inspection$299.99*4 more rows
How much does a food license cost?
What does a food service license cost? Food service license fees are often based on the classification and size of the restaurant, as well as your location, not too dissimilar from other types of restaurant licenses and permits.As a rule of thumb, you should expect the cost to range from $100 to ...
How much does a w16 engine cost?
It can cost anywhere between $500,000 to as much as the car itself. You gotta think, with that kinda horsepower and torque, you're gonna be spending a lot of money for an engine that's built by people who make jet planes. So to answer your question, between $500,000 to $1,000,000.
How much does a new convertible cost?
The cost of a new convertible is a very large range of price. The price depends on the manufacturer of the car you are looking at to have many seats in the car. A new convertible can be as low as $20,000 to over $40,000.
How much money does a modified cost?
German - Bayerische Motoren WerkeEnglish - Bavarian Motor Works
How much does a wheel chair cost?
About $ 300 -500 for a basic one.
How much does a trans am cost?
There is an old saying: "if you have to ask how much it is, you can't afford it". On the flip side a crapped out rusted out, broken down & non-running TA let's say from the 80's would be somewhere around $1000.00, a good car in running order can cost between $3,000 to $50,000 depending on the...
How much does a fuel filter cost?
Fuel filters will generally need replaced once a year for most drivers, but those with high monthly mileage may need to replace it more often.A fuel filter replacement costs between $53 and $165 for most cars to have the work done by a mechanic, while you can order the part itself for between $14...
How much does a f4 Phantom cost?
McDonnell Douglas F-4 Phantom II F-4 Phantom IIPrimary usersUnited States Air Force (historical) United States Navy (historical) United States Marine Corps (historical) Iranian Air ForceProduced1958–1981Number built5,195Unit costUS$2.4 million (FY1965, new build F-4E)10 more rows
How much does a valve job cost?
Know what price you should pay to get your vehicle fixed.The average cost for a valve adjustment is between $246 and $336.Labor costs are estimated between $220 and $278 while parts are priced between $26 and $58.Estimate does not include taxes and fees.
How much does a alternator cost?
Waits says the average price to replace an alternator with a remanufactured one is $400, while Gunning adds that a remanufactured alternator on a typical, domestic car, costs about $300 to $500, including parts and labor.The price of a new alternator can run from $500 to $1,000.
How much does a racing engine cost?
Most top racing teams build their own engines from scratch.The total cost of these engines, which take more than 100 hours to build, is anywhere between $45,000 and $80,000 [source: Martin, Hendrick Motorsports].
How much does a Lamborghini cost?
Typical Lamborghinis go for about $200,000.Luxurious does mean that there is a heavy price tag associated with the brand.
How much does a Chrysler Crossfire cost?
The Chrysler Crossfire is available as a convertible and a coupe.Inventory prices for the 2008 Crossfire range from $5,980 to $18,132.It gets EPA-estimated 19 MPG combined.
How much does a bus seat cost?
In 2012, the cost was $865,000 in taxpayer dollars to replace stained, carved, graffitied or torn seat inserts.The covered inserts that fit into the back and bottom of Metro bus seats range in price from $10.44 to $23.46 each.
How much does a CDL cost?
Overall tuition costs Generally, trucking school costs between $3,000 and $7,000 for the entire program.Much depends on whether you want a class A or a class B CDL license and which endorsements you want to earn.
How much does a Saturn car cost?
Depends on the year, model, mileage, & condition Saturn you are talking about. Look here to get values: http://www.nadaguides.com/Cars/Saturn
How much does a 2019 Tesla cost?
2019 Tesla Model 3 Expert Review.The Model 3 is Tesla's rendition of the long-prophesized electric car for the masses.This sleekly styled, compact 5-seat sedan dazzles with cool features, ample electric range, and a $36,000 ($35,000 plus a $1,000 delivery charge) starting price.But, there's a catch.
How much does a TTR 125 cost?
Yamaha TTR 125 dirt bikes for sale PriceYearSource$1,2502005Craigslist$1,3002006Craigslist$1,4992001Craigslist$1,8992007Craigslist3 more rows
How much does a handicap lift Cost?
An enclosed vertical lift that goes from one floor to another will probably cost you $10,000 to $15,000 or more, including installation.An unenclosed lift designed to bypass just a few stairs might cost $4,000 to $8,000 installed.
How Much Does a transmission service cost?
Average Cost and Factors The typical price range for a transmission flush is $125 to $250 – approximately twice as much as a fluid change due to the additional fluid required (12-22 quarts instead of 5-7 quarts) to completely replace the old fluid.The average you can expect to pay is $150 for th...
How much does a new Porsche cost?
Luxury sports cars have an interesting split in price; nearly every car in the class has a base price that's either under $60,000 or above $85,000.The base Boxster costs around $59,000, putting it on the high end of the lower range.The range-topping Boxster GTS starts at around $83,000.
How much does a crank sensor cost?
The average cost for a crankshaft position sensor replacement is between $190 and $251.Labor costs are estimated between $101 and $129 while parts are priced between $89 and $122.Estimate does not include taxes and fees.
How much does a standard car cost?
The average new-car price stood at $36,113 toward the end of 2017, up from $33,525 just five years ago, while the average used-car price increased from $16,900 to $19,400 over that period, according to Kelley Blue Book and Edmunds data.
How much does a pt6 engine cost?
Pratt & Whitney Canada PT6 PT6Number built51,000 (as of November 2015)Unit cost750 hp -135A: $560,000; 1,050 hp PT6A-60A: $955,000; 1,100 hp PT6A-68: $855,000VariantsPratt & Whitney Canada PT6T7 more rows
How much does a car rental cost?
Type of vehicle: Economy and compact vehicles were similar in price.A Toyota RAV4 cost $55 per day, without taxes, while an Infiniti/Cadillac Crossover cost $149.Age: Drivers younger than 25 can pay up to $25 more.Type of vehicle: A full-size rental cost about $20 more, while a standard SUV cost ...
How much does a plane cost when it costs 100000000?
You've already provided the price in the question: 100 million (dollars, euros, pounds, etc.)
How much does a hummer cost?
From 30,995 up to 39,995
How Much Does A Bagatti Varon Cost?
It costs 1,254,000 dollars
How much does a motor scooter cost?
An average motor scooter ranges anywhere from $96 to $2000. But when it costs $1000 and up its for like cops and security guards.
How much does a Camero cost?
That all depends on the overall condition of the vehicle and its age. Look it up in the Kelley Blue Book. You can do it online. Type in "Kelley Blue Book", and you will find your answer from there my friend.
How much does a scooter cost?
Razor Pro Model Scooters are only about $89
How much does a laborgini cost?
If you have to ask, then you can't afford it.they start around 6 figures-you don't want one anyway-you can build a faster Chevy for a lot less & they are a magnet for thieves. I had a friend with a Countach & he never slept to keep an eye on it & had to get rid of it when he got tired...
How much does a flatbed truck cost?
Flatbed Truck Average Costs Most new flatbed trucks cost anywhere from $40,000 to $80,000.Medium-duty trucks with fewer features fall on the low end of that price range while heavy-duty trucks with lots of upgrades fall on the higher end.
How much does a car cost 2018?
Press Releases SegmentJanuary 2018 Transaction Price (Avg.)*Percent Change December 2017 to January 2018*Minivan$35,3800.2%Sports Car$30,7641.6%Subcompact Car$16,3530.7%Subcompact SUV/Crossover$24,7770.2%20 more rows • Feb 1, 2018
How much does a Koenigsegg CCX cost?
Although the price has more than doubled to $695,000, the bones of the CCX are much the same as those of the car we tested in 2001.The CCX is lighter, purportedly by 200 pounds, and has a horrific 806 horsepower from a twin-supercharged 4.7-liter V-8.
How much does a Ford freestyle cost?
"Pricing on a Ford Freestyle will depend on if you are looking for a new or used vehicle. The used vehicle pricing will of course depend on mileage and vehicle condition, as well as if you are purchasing from a private party or a dealer. The average listing price for a 2005 Ford Freestyle is $8,0...
How much does a Lamborghini truck cost?
Lamborghini does not make a truck. They do have a Luxury SUV concept called the Urus which is not on sale. They have sold SUVs in the past.
How much does a caterpillar d4 cost?
The price of a New Caterpillar D4 can vary based on the options selected. The price for a commonly optioned D4 is around $150,000-160,000 US dollars.
How much does a concept car cost?
Although scale-model concept vehicles may cost less than $100,000 to produce, the cost of developing a full-sized clay concept car for a major automaker is generally greater than $100,000 and can be as high as $300,000 or more, with much of this money going to pay the salaries of the highly skill...
How much does a fan clutch cost?
For a clutch fan replacement, you will pay between $140 and $400, depending on the kind of car you own.The labor should cost you $70 to $130, while the parts can start at $75 and go up to nearly $300.
How much does a handicap placard cost?
Long-Term Placard: No fee.Temporary Placard: $12 fee.Special License Plate: $5.50 fee.
How much does a Saturn Outlook cost?
How Much Does the Used 2008 Saturn Outlook Cost? The 2008 Saturn Outlook has a base Manufacturer's Suggested Retail Price (MSRP) starting under $29,000 and can top $41,000 when fully loaded.The step from XE to XR adds $2,300, and the step from front- to all-wheel drive requires an additional $2,000.
How much does a Zipcar cost?
Zipcar is often more affordable than its competition.Though prices vary slightly by location, a typical weekday reservation costs between $7 and $10 per hour, or between $60 and $90 per day.
How much does a solo car cost?
The Solo seats just one and costs $15,000.The Smart Fortwo has a base price of less than $19,000, although the drop-top I tested came in at $24,000.
How much does a lube job cost?
The average salary for all lube technicians is about $15 per hour.
How much does a vintage car cost?
Finding the right classic car price Want a classic car? Consider that a classic 1965 Mustang can be found for around $20,000, and many other collector cars are available in the $20,000 to $30,000 range.
How much does a uhaul cost?
According to U-Haul, the fees are: an additional $40 per day for U-Haul trucks; an additional $20 per day for U-Haul trailers; and an additional $20 per day for U-Haul towing devices.While most U-Haul moving trucks can seat up to three passengers, not all of them will.
How much does a Supercross bike cost?
Completely “tricked-out” supercross bikes cost as much as $80,000 and are built from the ground up with custom components.The average fan can buy the same model motorcycle with factory standard parts for less than $10,000 at a local dealership.
How much does a 100k service cost?
The average cost for a 100,000 mile service is between $224 and $323.Labor costs are estimated between $96 and $123 while parts are priced between $128 and $200.
How much does a Legends car cost?
That cost is in the $1,200 to $2,000 range if you send it out.Bottom line is that you could be racing in a legend car for only $5,000 to $7,000.So now you have your Legend race car, but where to race it?
How much does a new truck cost?
New Semi-Truck Average Costs New trucks begin at around $80,000 and run up to $150,000 or more.If you opt for a large number of custom features, the price tag could reach $200,000.On the low end of that price range you can purchase a day cab with a single axle and lower capacity.
How much does a yz450f cost?
2019 Yamaha YZ450F Price: $9299 MSRP.
How much does a carriage ride cost?
Horse and Carriage Rides (Prices are per carriage – up to 4 people): $68 – Short Ride 15-20 minutes.$150 – Long Ride- 45-50 minutes.
How much does a bus cost?
The cost of each vehicle depends on a variety of features, including size and manufacturer, but the most important factor is typically what kind of propulsion system the bus uses.Diesel buses are the most common type of bus in the United States, and they cost around $550,000 per vehicle (accordin...
How much does a flying squirrel cost?
How much do Flying Squirrels cost? it depends where you purchase one from.they run from about $125 upward, but if you adopt one from a rehabber who is willing to adopt one out, it can simply be for an adoption fee as low as $40.just make sure that if you decide you want one that you get it from a...
How much does a Crown Vic cost?
MakeAvg PriceYoY2000 Ford Crown Victoria$3,287+1.64%2001 Ford Crown Victoria$3,970+17.57%2002 Ford Crown Victoria$4,192+7.54%2003 Ford Crown Victoria$3,679-6.38%12 more rows
How much does a 2019 Bentley cost?
Although specific pricing and availability have not been released, the 2019 Bentley Continental GT Coupe should be available this spring, with an anticipated starting price of approximately $200,000.
How much does a new engine cost?
A typical engine rebuild is between $2,500 and $4,000 in parts and labor costs.This type of engine repair might include simply replacing bearings and seals, and obviously taking the engine out and re-installing it.It could be much higher too.
How much does a bullet train cost?
The estimated cost of building 119 miles of bullet train track in the Central Valley has jumped to $10.6 billion, an increase of $2.8 billion from the current budget and up from about $6 billion originally.
How much does a Fushigi ball cost?
A Fushigi Ball costs $19.99 + $6.99 P&H for a total of $26.98.It comes with an instructive DVD.
How much does a VW bug cost?
The range-topping Beetle Final Edition SEL carries a starting price of $25,995 for coupe models and $29,995 for convertible models.
How much does a Chevy van cost?
A 2018 Chevy Express Cargo van has a Manufacturer's Suggested Retail Price (MSRP) starting around $32,500, while a base Passenger model starts at just under $35,000.The 2.8-liter diesel adds a cool $4,000 to the bottom line.
How much does a Volvo car cost?
How Much Does the Volvo S60 Cost? The base S60 Momentum has a starting MSRP of $35,800.That's about average among luxury small cars.
How much does a sleeper Semi cost?
New Semi-Truck Average Costs The cost is influenced by the size of the truck, whether it's a day cab or sleeper, and factors like fuel efficiency, horsepower and cargo capacity.New trucks begin at around $80,000 and run up to $150,000 or more.
How much does a Corvair cost?
Prices for the Corvair can start at $5,000 and run as high as $30,000.Most cost less than $10,000.
How much does a car normally cost?
The total annual cost to own a car The cost of owning a car can even vary with the age of the car.For example, USA Today reported that the average price of a new car in 2015 is $33,560.If a car depreciates by 20 percent just by driving it off the lot, then depreciation in the first year will be ...
How much does a kit car cost?
Basic Kit.At the bottom end, there are body kits that are primarily intended to either create an original body style placed on an existing chassis, such as a Volkswagen, all the way up to purpose kits that include everything you need to build a car.The typical average 2009 cost is around $12,000.
How much does a Bugatti Veyron cost?
How much does it cost to manufacture a Bugatti car? Volkswagen Group said the Buggati Veyron costs roughly €4.62 million, or $6.25 million to produce (currency figures are based on 2013 analysis).That figure assumes all the R&D built into that cost as well.
How much does a cheap bike cost?
Consumer Reports recently tested comfort bikes that cost between $330 and $600, and found that long-term riders might consider investing in bikes that fall into this mid-range price point because less expensive models are often less durable.Typical costs: The low range is $80 to $300.
How much does a transmission computer cost?
The question needs to provide a bit more information. Normally, on most American made vehicles you should pay no more than about $350, labor included.
How much does a decent car cost?
A decent car costs about 15,000
How much does a buggati veiron cost?
Its Bugatti Veyron and it It is the most expensive modern car in the world at $2,600,000. The Super Sport version is the fastest road-legal car in the world, with a top speed of 431.07 km/h (267.85 mph). The original version has a top speed of 408.00 km/h (253.52 mph).Designed and developed by th...
How much does a 2011 Camaro cost?
It really depends on the model SS or RS (Super Sport or Rally Sport) Then the multiple options that you can add on..but the base model (cheapest one you can get) is around $22,680. That's the V6 model with the basic stuff. You can add all the features and stuff and get the price up to around $47,...
What age can a child ride in the front seat of a car in FL?January 17, 2020
Why is there water leaking on the passenger side by the tire?January 17, 2020
Who invented crumple zones?January 17, 2020
What is the difference between horse power and HP?January 18, 2020
Why does your 1995 Cadillac eldorado blow hot air only out of the defrost vents no mater at what temp i set it to?January 18, 2020
How much do international businessmen make BILLION?January 17, 2020
How much is car hire in Orlando?January 16, 2020
Where may I obtain a car financing calculator?January 14, 2020
What is module in bevel gear?January 17, 2020
What is the power train of a front wheel drive car?January 17, 2020
Tabletop Role-Playing GamesPlanet NeptuneWind PowerStatutes of LimitationsDemocratic PartyPontiac SunbirdFord Explorer Eddie BauerMilitary Schools and AcademiesJimmy CarterMount Everest
An automobile tire named after a color?
How do you get from Rochester NY to Nashville TN by rail?
Why does my truck rev drop when you accelerate?
How many Abrams tanks have been destroyed?
What fuel goes into a race car?
Does leaving batteries in drain them?
When was She Has Funny Cars created?
What does eap mean on a fuse box label mean?
Is it OK for a parent to slap a child?
Why does my engine oil smell like pure exhaust emissionsburnt fuel in a worked 1.8L Datsun 510 with cam and untuned carb and dist. Is this bad Plug colour is light brown runs ok above 4000rpm?
Vowel Sounds
Chevy Trucks and SUVs
|
cc/2020-05/en_middle_0087.json.gz/line1341087
|
__label__cc
| 0.736121
| 0.263879
|
When my son and his wife moved with my two-year old grandson, Ryan to Montana, she was pregnant. They left their cabin next door to my place and they left free rent, childcare, a job at the college and they left me. Because since he was born, I’d watched over him, saved him from foster placement and one time even kidnapped him. Yes. After Ryan’s birth a social worker told his mother that she wasn’t allowed to hold him because she was taking some prescription drugs that made her woozy and unreliable. All my son could manage was making it to work each day, so I stepped in. They needed me. I took he and his mother to doctor’s appointments, enrolled her in classes at the college where I taught child development and every day looked in on the baby. Then they took him away. I worried, paced, scratched and picked myself raw, then one day I spun to a stop and wrote him a letter. I imagined him walking with me to the barn, retrieving the mail a half-mile up the road, and began to speak to him through letters posted in my blog. I hope you enjoy peeking in at “Letters to Montana” stories, lessons, rants and grief and some other posts about writing, creativity and the natural world.
P.S. When Ryan and his family returned with their baby, Liza, they moved into a tent until they could find a place to rent. Follow their story re-told in Fallen From the Nest my nearly completed memoir. Get the inside scoop on what happened and how we transformed our lives and became a Grandfamily.
Peeled Open // June 18, 2019
On Earth We’re Briefly Gorgeous “… founded on truth, but realized by the imagination.” Ocean’s reading was a seminar for the crowded gathering last night at Bookshop Santa Cruz. He uses the lure of autobiography to draw in the reader, but takes us on a journey using fiction, poetry and imagination to paint rather than tell us a story. A poet first, he suggests we all practice poetry before writing anything. We believe him, believe anything he says. He’s got that kind of magic surrounding him. Ocean introduced ‘Kishotenketsu’ as the structure for his story, an Asian, character, not plot driven story structure. I looked it up. I must take his class at Amherst. He is brilliant. A scholar. Kishōtenketsu is a four act narrative structure developed out of Korean, Chinese and Japanese traditions, originating in Chinese poetry. Kishōtenketsu is a narrative structure that is not based on conflict and resolution. The four acts of Kishōtenketsu break down like this: Ki – Introduction The character, setting, situation and other basic elements are established. Shō – Development An expansion of the first act introduction. No major changes occur. Ten – Twist The story takes a turn into a contrasting, seemingly separate situation. Ketsu – Conclusion The story resolves, connecting all acts. The Ten (Third Act Twist) is the Key to Kishōtenketsu The Ten- the third act—is a contrasting, even seemingly nonsensical, departure from the character and situation set up in the first and second acts. In the fourth act, that third act dislocation is brought together to resolve a complete narrative connection with the first part of the story. Kate Krake, for writers. Thank you. ____________________________________________________________________________________________ On Earth is an exploration, a meeting place for our hearts and minds to consider what he called a democratic town square, during which he asks himself, and us, to consider, How do we harvest compassion from our world? The world he paints in the most gorgeous language, images and through his eyes is real and dreamy and moves unafraid into Asian sensibility, the emergence of the Opioid crisis, and Queer culture. Not culture, exactly more Queer pleasure, a sensory exploration and he keeps us with him there as part of the atmosphere, the landscape is Connecticut, but it is us, our messed up America. Little Dog is complex, innocent but whole and human. His character survives, some do not. Some bodies, he told us are deemed not worth protecting. He wants to offer us these bodies, in their wholeness and brokenness as beautiful. Ending with a song, after his disclaimer, I am not a singer. An Appalachian song sung at funerals, and he brought us to our knees. What a beautiful man he is, as if in a dream, I walked back alone to the three level parking structure, wishing I could sing the song in the car, be Ocean, inhabit his mind, no, his soul. I read this book last week, couldn’t recall the name, each time I suggested someone read it, as if in a trance as I stammered on about the experience, the sense of this story, his novel, the way poetry does, left me steeped in a sensory world, not ideas. Since then, I’m rendered wordless. (except to sing the praises of this novel) Who am I to claim that I write? May as well say I am a pilot because I went on an airplane once or twice. Read this book, On Earth We’re Briefly Gorgeous, Ocean Vuong Nancy
A beautiful poem // June 3, 2019
by Kim Stafford
Sent by a loving friend. Added here to treasure, https://vimeo.com/237394753 so I can listen again and again.
The Crow // May 30, 2019
Crow nest hidden in forest
There he is again, on the same place in the road that runs through the forest. That crow, feet stepping in place, wings jerking open and closed, picking at an imaginary acorn, a speck in the road grasping then dropping it. Is it a small piece of gravel falling from its beak? He’s wooing passers by (human or other animals) with a treasure, “ Look here. Feast your eyes on this.” For the last two weeks he’s there displaying one tiny object or another, looking in my car window as I watch him. He directs my attention to a spot on the ground or, rather redirects my attention away from something else. He pretends, faking his own interest in an imaginary object, an actor on the asphalt stage. Because he’s there, pecking at nothing, I wonder, what he’s hiding. Where his nest is located. Is his mate sitting on eggs in the oaks there above the road? But, I won’t stop to investigate. I’ll allow him his bait and switch, let it succeed. I drive off every time, as if I fallen for his ruse. I don’t like to eat crow. Okay. Sorry.
Something about that crow resonates. We all pretend. Smile to mask a rough patch, spoke over a friend in class who is about to tell the teacher about a schoolyard misdeed, push a cool washcloth over a hot forehead and get a child to guzzle a cold drink on the way to preschool. A fever? Not today, please, I have an important client. Sometimes pretending covers for what’s real, lies close to an untruth. Is one. BUT, Sometimes pretending masks not yet knowing, covering for ignorance.
As a writer of a true story, my own true story, a story only as true as I reveal, I sometimes mask the truth. I divert the reader, either intentionally or because I may not yet fully understand the truth of a scene myself. Writing and revising, even after several drafts, continues to include diversions, doubts, hidden information, hesitancy and more discovery. Some of these are part of the character’s arc, as the character develops, scene by scene. She grows, transforms, behaves with new insight. But some places in my piece, in my manuscript, unable to hear my own story or read my own heart, I resort to self-deprecation when I, as the writer, am as befuddled as the character was at the time. Impatient with my own incapability. The writer must become wiser than the protagonist in a memoir. The writer of a novel must hold the wisdom of the story and characters, too. Discoveries are part of both. We must understand human nature, motivation, misbehavior and character innuendo and behaviors to demonstrate a character’s flaws, our own flaws. We write our own story as if we are not yet wiser and share a journey to gain some kernels of wisdom. We best offer ourselves compassion, tenderness and appreciation as we hold our own hand through the hard parts of a story. Love ourselves and let the reader in on that love. It is hard for me forgive myself and work my way through some of the hard places.
My Beta Readers, a few selected people who agreed to read this draft and offer feedback on the current version of my story, Fallen From the Nest, 25 chapters 350 pages, have been invaluable in nudging me to consider a few shared issues. Among them was that I lessen the incidences of self-deprecation, leaving self doubt as a motivator for discovery, when overwhelmed and confused, but to love for this struggling grandmother as she settles into her role with her grandchildren and her troubling son. Tell the story with more self-kindness and generosity, love her more. How can I be compassionate with myself when I made so many mistakes? Bad choices? One thing I know is that I’d be kinder to others in this situation, more generous and understanding. This is where I begin the next revision, wrapped in tenderness for that old me as a friend. Back I go into the weeds of words and ideas I planted on my own, scythe in one hand and a soft pillow and shawl in the other, a pot of tea for our journey.
Shall I enjoy myself, with laughter, puns, jokes and silliness? Might that help the reader want to spend time with me, like me more, enjoy hanging out? I’ll have to tease the reader, a little bait and switch on the crow’s road, the same one where my story begins. How can I make the reader care for a woman who kidnaps her grandson? To protect her son from losing another child or to protect her own professional reputation. It was never about my reputation. My beak plucks a tiny stone from the road, tells you its delicious, to try some as I sneak back home to revisit myself and write what I discover.
Send love and understanding my way as I dig a little deeper, tease out a thread of tenderness and weave it in and around softening, opening my heart throughout the manuscript. Nancy
Crow on the road
The Balm of Feet in Dirt // May 9, 2019
Wyoming…a beautiful river at the base of mountain. Going this summer.
Meditative moment in a field of lupines
“The rivers flow not past, but through us, thrilling, tingling, vibrating every fiber and cell of the substance of our bodies, making them glide and sing.” – John Muir
This day, I will glide and sing. Want to join me? The natural world has power, more than all of us. We step outside and there it is, go a little further, off the sidewalk, step onto a dirt path, a trail, the air changes, you change, warmed by a planet beneath our feet, spinning round in the universe. The moment we shed the coat of the heated room, unfold from chair and screen, leave managing food, home and swiping everything clean, we are transformed. One last swipe at the dust thick on pottery once made by hand. Yes, long ago we put our hands to clay, slapped it free of bubbles and shaped it, fell into its trance, immersed our very being, became “one” with a gluey glob of earth, all hands and sensation- lost ourselves in the creative moment. Remember, losing yourself in clay, paint, poetry and dance? Or were those the very moments we found ourselves? Another high school shooter. Oh, once again our world in pain, self-inflicted, salty tears overfill our growing oceans. Head outdoors to unburden. Fresh sensation: birdsong, trickling water, wind in trees, feet on chilly earth, soft, hard or rocky heals. The smells of the moist earth are familiar, comfort, reassure. They are our scent, too as we are of her. Discover duff beneath the trees- ancient layers, trod for centuries by wholehearted wanderers like ourselves. Foragers, renegades, seekers who dared to wonder. Witness the wood rat build her dome of sticks, a bird carry a ridiculously long twig for its nest- watch as she weaves it with intuition and skill. A snake slithers to a stop on the trail risking its very life for a spot of sun. Outdoors we risk discomfort, grow tender with sensation. Commit to the experience. Let all else fall away, step out and keep walking, jog if you can. Feel your way touching bark, crunch leaves, grasp soft or prickly needles, furry leaves and granite boulders. Feel a vibration, a tumbling rage of something beyond. Wonder, seek and praise moments of beauty, notice what elicits joy, live for those moments, they fortify us, strengthen us as we will face, once again, what smolders in wait. We return with renewed presence and grace, clap our soiled shoes together and set them side by side like always. Head back inside renewed and connected. As a child I was pushed out the door, with the slam of the screen, freed to roam, giving no thought to what my mother did while I was “out of her hair.” Today, after jogging up the roads, biking on rooted bumpy trails have left me in the dust, I walk. Walk and walk and walk. I move more slowly, but see more as the right knee creaks to limber, the left heel throbs, shoulders soften. In a grand outdoor amphitheater, a hawk opens the melody, calls our attention with an ominous whistle above the trees, a chorus of jays squabble in the oaks, ragged, a falling scramble of rocks and listen, its our own footsteps, 3:4 time percussive beat. This morning’s grand composition. On chilly wet days, misty mornings and warming afternoons our feet tap past familiar trees, narrow animal trails and tunnels through brush. We greet a bird, another, that squirrel, then there in the pasture, the same small herd of deer, a sprout of furred antlers, nubs sparkling with mist. Our neighbors. Now they stand and watch, casually bend to nibble grass.We are known. Thank you to mothers who send their children out the door and slam the screen behind them. “Each step we take keeps our planet spinning. Seek her wisdom. Share yours. Walk slowly and tread softly.” Nancy Congratulations to Anna Shaw for winning my April sign-up contest. Your copy of @52 Reasons for Hope by Cathy Krizik is in the mail.
Our hands in clay, our hands in sand, mud, water, our hands
Making Books // April 30, 2019
handmade children’s book-Cottage Garden Library using hole-punched plastic page covers (sleeves) and clip rings to assemble
I love making books for children. I started writing and constructing books as a teacher of young children in the early seventies. The first instance I recall was after recording what children said when a farmer visited our preschool leaving us with two kids, baby goats, for the day. The children petted, held and observed as the babies hopped up on tables, ran through the sandbox and ate their crackers at snack time. What a hullabaloo! I took a roll of film that day and after developing it the children glued them to pages and provided the words for our story. We posted it on the door for families. Then by the end of the year, we had twenty or so little books and big books recording our experiences-some illustrated by the children, other with photos and others with cut outs from magazines.
A Well loved book…maybe read in the bath?
Those classroom books were rarely found on the bookshelf-because they were always out in circulation, sitting at the top of the climbing fort, in the playhouse, in the bathroom or on tables in the play areas. Lovingly used.
Over time, my use of books and way of making them has evolved. I often asked parents to contribute, making books with their children at home about getting glasses, magazine collages, painting or sketching to share with the class. I recall a fabulous year long poetry book we did that way each child choosing a poem to take home and bringing it back to add to our home illustrated poetry collection.
I was fortunate to have had a fabulous creative arts teacher, post baccalaureate, at Cabrillo Community College in the Early Childhood Education Department. She had us scavenging through trash bins for cardboard, old hinges, clips and folders to use in our book-making endeavors. She taught us how to stitch the covers, glue fabric on them, or use clip rings and yarn to bind the pages. We had a laminator, a spiral binding machine and a weighted press for printmaking. I loved using all that equipment, but wanted to be able to assemble classroom books in the evenings on my kitchen table or with the children on the carpet at group time.
Drug stores sold rolls of clear contact paper (do they still have them?) plastic, actually, that would hold anything in place, even little bouquets of wildflowers from a walking field trip. I went through yards of clear contact. With the availability of glue sticks that allowed children to set things in place without the sticky mess or drying time of white glue, they would assemble lace their own books together on the spot and take them home. We kept baskets of book making supplies available for this purpose, magazines to cut pictures and Polaroid cameras with those expensive little film packets.
I’d take a bag of supplies for my own children to make books during family vacations and encouraged them to make book gifts for grandparents and teachers. Sometimes I’d suggest topics or titles for them to tackle. I recall at a timely project, called, “Me and My Brother” My two boys, at around 7 and 4 years assembled a book together, drew pictures and wrote words about what they liked to play together. They’d been arguing, seemed out of synch. The book pulled them a little closer, served to reconnect them. Titles like, Going to the Dentist, My Surgery, The New School, The Airplane Trip, and The Dead Dog (their words), focused on transitions and meaningful events offered them extra support. They could sleep with their favorites and often did. Books have always been another way to for me to talk with them, extend thinking on a subject and also allowed them to reflect on worries, misinformation and to revisit delightful discoveries and passages of childhood.
My children now, (my grandchildren) make books at school, continued the stapling and drawing of little books through early childhood. I provided supplies at home, too. At ages 9 and 12 they still often sit and write books with illustrations, photos or special collections.
Today I discovered a stack of books I made for and with my grandchildren at different ages. Many of them are assembled using punched plastic sleeves or page covers and bound in an old folder, grocery bag, manila mailing envelope, disassembled shoe box or carton and covered with fabric or report cover, binder with snap rings. Would you like to see a video of me assembling a book? I’ll try it out next week and post unless its horrible. Some of my Grandchildren’s stack:
Toddler Books
Liza Turns One, a photo collection assembled with punched heat laminated page covers (waterproof and washable)
At Grandma’s and Grandpa’s house, illustrated with photos and labels
Up, Up, Up Into the Trees, images of visiting grandma’s house, one word labels
Trip to visit Thomas the Train
Looking for Thomas, a photo and story book about Thomas the Train visiting at a nearby park
Photo Collection with names of people in the family, laminated on 6 by 8 small cards
Doll goes on a mountain hike
A Toddler’s Adventure-taking a doll on a hike and photographing her various places, the child positions the doll and we thing of what to say about her, is she in danger? Grandpa was a good sport on this one.
Preschoolers’ illustrations
Preschooler’s Books
Adventure story narrated by child and illustrated with toy photos
A Scary Morning, a rather silly story with photos of toys for telling three-year old grandson’s story
Short story co-written with child about a family move
Where Are You? A book to support my 2 ½ yr old grandson’s big move to Montana-toys, play and discovery-a concrtete way to play with a big change
photos and questions generated by children about changing schools
Bonny Doon School, leaving childcare and going to a big new school, transition support, photos of the new school environment making connections with preschool
Well loved book to address differences among us..a favorite
The Missing Squeak, the mouse born without a squeak, story and art, theme: differences and resilience
child’s view of a favorite topic, child illustrated
Chicks favorite topic explored, child’s words, drawings and photos
Read Aloud Story Books by adults
Instructions: how to make a tiny tea set
Print shop bound adult conceived story adventure themes: making art, loneliness
Grandma Mouse, a story with art collage and words when my grandchildren moved away
Engaging, interactive photo book with information about a new place
Exploring Our World, a series begun by Grandma documenting vacations and interesting trips away from home-asking child centered (school age) questions about places in the world, Brazil, Peru, New Zealand, photos and stories
For an adult:
Operating Manual Tongue-in-cheek Instructions for a new step mom, photos and instructions, support and information
Make a book or two this month for your family. Enjoy, Gma
View More Recent Posts
|
cc/2020-05/en_middle_0087.json.gz/line1341092
|
__label__wiki
| 0.709828
| 0.709828
|
WebMail | NNPCGroup
NAPIMS News
NAPIMS Profile
NAPIMS Roles & Responsibilities
Gas Operations
History of NipeX
Joint Venture Contractors (JVCs)
Joint Venture Operations
Production Sharing Contractors (PSCs)
Production Sharing Operations
Service Contactors (SCs)
Services Operations
GGM NAPIMS
GM Planning
GM JV Operations
GM PSC
GM Gas Operations
GM Finance & Accounts
GM I.T.D
GM Materials Management
GM Legal
GM NipeX
MGR Public Affairs
New NNPC GMD Takes Over02.08.2017
…Thanks Kachikwu for Recommending Him. The newly appointed Group Managing Director of the Nigerian National Petroleum Corporation, Dr. Maikanti Kacalla Baru has paid tribute to the Minister of State f
NNPC Cautions Consumers against Panic Buying Sequel to Calabar Tank Farm Fire Incident17.07.2017
The Nigerian National Petroleum Corporation (NNPC) has advised consumers of Petroleum products across the country not to engage in panic buying
NAPIMS pledges support for ongoing $4 billion Egina FPSO project (Nigeria)17.07.2017
The National Petroleum Investment Management Services (NAPIMS), has explained its supports for the $3.8 billion Egina project at the yard of the Lagos Deep Offshore Logistics base (LADOL), saying the
New NNPC GMD Takes Over
by web admin on 8/2/2017 7:58 PM
(Kachikwu hands over to Baru as GMD)
…Thanks Kachikwu for Recommending Him.
The newly appointed Group Managing Director of the Nigerian National Petroleum Corporation, Dr. Maikanti Kacalla Baru has paid tribute to the Minister of State for Petroleum Resources, Dr. Ibe Kachikwu for recommending him to the President for appointment as Group Managing Director of the Corporation.
Speaking at a brief but colourful hand-over ceremony at the NNPC Towers on Friday, Baru also pledged not to disappoint Mr. President for reposing so much confidence in him to head the Corporation.
While pledging to continue with the ongoing comprehensive restructuring exercise of the NNPC which he said has become inevitable, Dr. Baru promised to exploit the immense experience of NNPC staff to maximize output in the ongoing restructuring exercise.
“Engagement of staff in major restructuring exercise is a key success factor that I will pay attention to while continuing with the restructuring effort,” he said.
Baru unfolded his 12-point agenda to include: Creating an all-inclusive internal advisory council on security comprising representatives from NNPC, the IOCs, the Unions and Security Operatives to brainstorm and address host community agitations to complement efforts of the Government Security Team; implementing the new business models and grant the needed autonomy to the strategic business units and autonomous business units; providing relevant directions and control that would ensure their growth and profitability, continuing to explore ways of relieving Government from the burden of cash calls obligation as well as address and defray the agreed cash call arrears of the IOCs and restore oil and gas production and grow the reserve portfolio.
Other areas the new GMD promised to focus on are: Increasing crude oil production by the Nigerian Petroleum Development Company, NPDC, reviewing all weak contractual agreements and terminate bad ones as appropriate, leveraging on equity positions to cause the development of key gas assets for both domestic and export as well as pursuing the expansion of gas network across the country, repairing and restoring oil and gas pipeline infrastructure as well as providing robust security system for both detection and deterrent in conjunction with the existing security arrangement.
He also promised to: improve refining efficiency of the four existing refineries to pave the way for future expansion, pursue diversification of businesses by refocusing on the implementation of Renewable Energy Programmes and Frontier Exploration Services, continue with the drive to make the venture businesses profitable and ensure service delivery, entrench the culture of professionalism by doing the right things at all times through transparency, accountability, and respect for all, ensure adequate staff welfare and motivation, training and capacity building.
The new GMD poured encomiums on Kachikwu for the manner in which he has piloted the oil and gas industry in the past eleven months while promising to work closely with him to achieve Mr. President’s aspiration for the oil and gas industry.
`` We are indeed impressed with the positive accomplishments achieved so far, your vision for NNPC and the energy you brought into the sector all in an effort to reposition the oil and gas industry towards growth and profitability,’’ he said.
In his address, Kachikwu thanked Mr. President not just for the opportunity but for the foresight in making him serve first as GMD before appointing him as Minister of State for Petroleum Resources noting that the achievements so far recorded in the industry have given credence to the President’s foresight. The Minister also extoled the virtues of the new GMD describing him as a thorough breed oil and gas professional.
``Eleven months ago when Mr. President asked me to take over the mantle of leadership of GMD there was indeed an urgency of now, morale was low, there was a lot of issues of transparency on the table, profit index was very poor…
Looking back now one must be very grateful to the President not just for the opportunity but for the foresight,’’ he said.
Kachikwu listed the achievements recorded in the last eleven months under his leadership to include: Sanitization of the fuel supply and distribution matrix due to the introduction of the downstream liberalization regime, reduced upstream contracting period to nine months from initial upwards of two years and the redirection of the NNPC on the path of profitability as witnessed in the May 2016 NNPC Monthly financial report which posted a profit of =N=274 million.
Other achievements he spoke of include: prompt remittance of oil proceeds to the Federation Accounts, monthly publication of NNPC Financial reports, review of old models contracts like crude SWAP which saved the Corporation a whopping $1Billion annually,
The Minister also informed that under his watch $80 billion MoU with Chinese investors was recently secured.
Garba Deen Muhammad
Group General Manager
Group Public Affairs Division
Nigerian National Petroleum Corporation
NNPC Towers, Abuja
@ Tuesday, July 12, 2016 12:43 PM
Comments from the following blog entry: http://naijassador.com/dr-maikanti-kacalla-baru-takes-over-as-gmd-of-nnpc/
| | 0 Comment(s)
NNPC Cautions Consumers against Panic Buying Sequel to Calabar Tank Farm Fire Incident
by web admin on 7/17/2017 9:31 PM
The Nigerian National Petroleum Corporation (NNPC) has advised consumers of Petroleum products across the country not to engage in panic buying as a result of the fire incident which occurred in the wee hours of Saturday July 15 at a tank farm at Calabar Free Trade Zone (CFTZ), in Cross Rivers State.
NNPC wishes to assure that the unfortunate fire incident at a private tank farm had not affected its operations, and that the Corporation’s stock holding was robust.
“NNPC has over 40 day-sufficiency for petrol, and adequate volumes of diesel and kerosene to meet consumers’ demand nationwide, therefore it is pointless to engage in panic buying”, the statement said.
NNPC Group Managing Director, Dr. Maikanti Baru, who received briefs on the incidents, expressed regrets over the unfortunate loss of life in the inferno.
The GMD consoled the families of those who lost their loved ones in the incident, advising communities in areas of Oil and Gas operations to always exercise caution and be vigilant at all times.
Ndu Ughamadu
Group General Manager,
Group Public Affairs Division,
NNPC, Abuja.
17th July, 2017.
NAPIMS pledges support for ongoing $4 billion Egina FPSO project (Nigeria)
The National Petroleum Investment Management Services (NAPIMS), has explained its supports for the $3.8 billion Egina project at the yard of the Lagos Deep Offshore Logistics base (LADOL), saying the company has demonstrated its competence in handling such massive project. The project, which is being executed in collaboration.
About NAPIMS
The National Petroleum Investment Management Services (NAPIMS) is a Corporate Services Unit (CSU) in the Exploration and Production (E&P) Directorate of the NNPC charged with the responsibility of managing Nigeria Government's investment in the Upstream sector of the Oil and Gas industry.
Read More
NAPIMS Events
© NAPIMS
Legal Disclaimer | Privacy Statement
|
cc/2020-05/en_middle_0087.json.gz/line1341093
|
__label__cc
| 0.632311
| 0.367689
|
HomeNewsMonsanto Being Sued For False Advertising In Los Angeles
Monsanto Being Sued For False Advertising In Los Angeles
April 22, 2015 Royce Christyn News, US 3
Monsanto is about to start gearing up it’s legal team, because a lawsuit has been filed in Los Angeles county this week. The class action law suit states that the massive corporation is guilty of false advertising regarding a chemical in one of it’s most popular products – Roundup – an insecticide. The company, which makes vegetable seeds as well as poisonous insecticides has yet to respond.
According to journalist Nancy Swanson of The Examiner:
The suit alleges that Monsanto is guilty of false advertising by claiming that glyphosate, the active ingredient in Roundup, targets an enzyme only found in plants and not in humans or animals. Monsanto makes this claim to support the contention that glyphosate is harmless to humans.
In the lawsuit, the argument is made that the targeted enzyme, EPSP synthase, is found in the microbiota which reside in our intestines and therefore this enzyme is found in humans and animals. It is further stated in the lawsuit that there are many human and animal health problems associated with the disruption of our intestinal microbes.
“Because it kills-off our gut bacteria, glyphosate is linked to stomach and bowel problems, indigestion, ulcers, colitis, gluten intolerance, sleeplessness, lethargy, depression, Crohn’s Disease, Celiac Disease, allergies, obesity, diabetes, infertility, liver disease, renal failure, autism, Alzheimer’s, endocrine disruption, and the W.H.O. recently announced glyphosate is ‘probably carcinogenic’.”
The International Agency for Research on Cancer, part of the World Health Organization (WHO), last month declared that glyphosate is Group 2A carcinogen. The American Cancer Society quickly followed suit, also listing glyphosate as a Group 2A carcinogen.
An Environmental Protection Agency memo dated October 30, 1991 states that the EPA classified glyphsate as a possible carcinogen in 1985. In this 1991 memo, without any justification, this classification was changed to Not Carcinogenic. Three scientists refused to sign, two of whom wrote beside their name: Do Not Concur. This document contains data that clearly shows a statistically significant increase in tumors in laboratory animals treated with glyphosate. But because there weren’t more tumors in the group of animals who received a higher dose of glyphosate than there were in the group that received a lower dose, Monsanto made the claim that the tumors could not be related to glyphosate.
Today’s lawsuit may be the beginning of an avalanche. Earlier this month, Beijing resident Yang Xiao-lu filed a lawsuit against the Chinese Ministry of Agriculture requesting information disclosure of the toxicology report submitted to the Chinese government for glyphosate pesticide registration in China. The case has been accepted and the collegiate panel of the court has informed the plaintiff that, considering that Monsanto is a stakeholder to the case, they have added Monsanto as an involved party to the case. Chinese citizens had previously petitioned the Ministry of Agriculture for this toxicology report but were denied. The Ministry cited “trade secrets” as the reason for denial. It is difficult to comprehend how a toxicology report would contain trade secrets since trade secrets generally constitute ingredients or a recipe for a compound or manufacturing procedure.
In today’s lawsuit, Monsanto is accused of deliberate falsification to conceal the fact that glyphosate is harmful to humans and animals. “Defendant intentionally misleads consumers by misrepresenting and concealing the true and correct facts concerning glyphosate…” Attorney T. Matthew Phillips says, “We are not trying to prove that Roundup is harmful or carcinogenic, we are merely pointing out that Monsanto is lying about the enzymes that Roundup targets. Roundup kills the weeds in your backyard and the weeds in your stomach.”
Judgment is sought against Monsanto to prohibit the company from continuing to make the claim that glyphosate targets an enzyme not found in humans and for compensation to the plaintiffs, including attorney fees.
Residents of California can become members of the class in this action by contacting T. Matthew Phillips at tmatthewphillips@aol.com. Phillips has indicated that he hopes other attorneys in other states will follow suit [pun intended].
Rare QUADRUPLE Rainbow Spotted In New York
New Study Says No Link Between MMR Vaccine and Autism
Former Nato Chief Warns Of Nuclear War With Russia ‘Within A Year’
NATO to Declare Space a ‘Domain of Warfare’
Video: Um..Apollo Crew Had To Go Through Customs Upon Return
WW3 Rumblings As China Tests Missile That Evades US Defense Systems Easily
Leaked John Kerry Audio Reveals Obama Ordered Rise Of ISIS
Poroshenko Submits Martial Law Bill To Ukraine’s Parliament
Prince Charles Has Been Receiving Secret Cabinet Papers For Decades
NASA Has Discovered 7 Earth-Like Planets Orbiting Nearby Star
Deputies Kill 6 Year Old Boy After Opening Fire During Texas Manhunt
Gyrocopter Lands On US Capitol Lawn – Man Arrested
Opinion Makers Discouraged By Facebook News Feed Study
Is Martian soil actually good for farming?
Turkey Kills 30 US-backed Fighters In Middle East
California Gov Signs Bill Requiring Trump to Release Taxes or Be Excluded from Primary Ballot
Ocasio-Cortez: Trump Engaged in ‘Act of War’ by Killing Soleimani
|
cc/2020-05/en_middle_0087.json.gz/line1341100
|
__label__wiki
| 0.599049
| 0.599049
|
Water Main Break Snarls Traffic, Subway On Upper West SideIt happened at around 7:30 a.m. at 102nd Street and Central Park West.
Police: Group Of Suspects Robs 4 People In 1 Hour In HarlemPolice are searching for a group of suspects accused of robbing four people in just one hour in Harlem.
New York Weather: 1/19 CBS2 Afternoon Weather HeadlinesCBS2's John Elliott has a look at the weather forecast.
NYC Winter Outing: NYC Offering Big Deals On Art, Food & Entertainment In JanuaryAlyssa Schmid of NYC and Company, the city's official marketing and tourism organization, has some suggestions on what to check out.
More People In LA Watched Patriots-Chiefs Than Rams-SaintsIn Los Angeles, 2.5 million watched the Patriots-Chiefs AFC Championship, while 2.1 million people watched the Rams-Saints NFC Championship.
Keidel: NFL Championship PredictionsThe AFC and NFC Championships feature two replacements, a weak link and the GOAT at QB. What teams will advance to Super Bowl LII?
Championship Picks: Who's Moving On To Super Bowl LII?CBS Local Sports talent from across the country looks at the Championship match-ups. Who are our NFL experts picking this week?
Brandon Marshall On Vikings-Eagles NFC ChampionshipINSIDE THE NFL guest analyst Brandon Marshall weighed in on this weekend's NFC Championship game between the Vikings and Eagles.
Atlanta Falcons Rout Green Bay Packers, Advance To Super Bowl LIMatt Ryan, showing that he could be just as good in the playoff as the regular season, threw for four touchdowns, ran for another and the Falcons routed the Green Bay Packers 44-21 on Sunday.
Team Grades: Cardinals Can't Overcome Turnovers As Panthers Advance To Super Bowl 50Things didn't start well. Things didn't get better. Things went horribly for the Arizona Cardinals as turnovers allowed them to get nothing going and the defense simply couldn't stop the Carolina Panthers at all as their fantastic season has come to an end.
Three Keys To Another NFC Championship For SeattleIf Seattle wants a second straight trip to the Super Bowl, here are three vital areas to focus on.
Late Mistakes Doom 49ers, Seahawks Claim NFC CrownThe NFC Championship Game came down to the 49ers offense verses the Seahawk defense, and Seattle’s number one ranked defense prevailed. San Francisco got the ball down six with the chance to pull off the upset but couldn’t make one more big play against their opponent.
Seahawks Hold On, Beat 49ers 23-17 For NFC ChampionshipRussell Wilson threw a 35-yard touchdown pass on fourth down and Seattle's top-ranked defense forced two late turnovers, lifting the Seahawks into their second Super Bowl with a 23-17 victory over the San Francisco 49ers for the NFC championship Sunday.
America's Leading Sportscasters Predict AFC And NFC Championship WinnersIn anticipation of the AFC and NFC Championship games this weekend, we've pulled together America's leading sportscasters to make their predictions and picks for Patriots-Broncos and 49ers-Seahawks.
Seahawks Vs. 49ers: Rubber Match For A Trip To Super Bowl XLVIIIWith both San Francisco and Seattle winning their respective NFC Divisional Round games, the NFC will be sending a member of the West to the Super Bowl, but which team will it be?
Gore, 49ers Rally To Beat Falcons 28-24 In NFC Championship49ers rebounded from a 17-0 deficit to beat the Falcons 28-24 in the NFC championship.
Giants Head Back To San Francisco For Rematch With 49ers Many 49ers players stewed for months about that near-miss in the NFC title game, a sting that only became worse when Eli Manning and the Giants went on to win another championship.
Akers: Stop Hateful Remarks Aimed At WilliamsKyle Williams is ignoring the barrage of hateful, hurtful, even threatening comments he has received in the aftermath of his ill-timed fumble that cost the San Francisco 49ers the NFC championship game against New York.
Giants' Eli Manning No Longer Has To Prove Greatness Super Bowl XLII won Manning respect. A second Lombardi Trophy in four years might someday put him in the Hall of Fame.
|
cc/2020-05/en_middle_0087.json.gz/line1341101
|
__label__wiki
| 0.946694
| 0.946694
|
Rob Oldham
Thoughtfully witty and offbeat, not to be missed.
Stream Rob Oldham
Home / Comedians / Rising Comedy Stars / Rob Oldham
Quick jump to...
About Rob Oldham
WATCH ROB OLDHAM: WORM’S RESOLVE
Rob Oldham Tickets
Get More Rob Oldham
Young, smart and described as having “aplomb, brain and delivery beyond his years” (Chortle), Rob Oldham is a truly original rising star on the stand-up scene.
Forming part of the renowned Cambridge Footlights team in 2016, Rob Oldham wrote and performed in their critically praised sketch show Lagoon at the Edinburgh Fringe and across an American tour. After dabbling in stand-up at university, Rob Oldham hit the Edinburgh Festival in 2017 with his first show Brink. Whilst there, Rob Oldham was selected to compete in the final of the ‘Amused Moose New Comedy Awards’, enviably picking up the prize for ‘Breakthrough Comic’.
Rob Oldham’s first full hour, Worms Lament, (produced by Fight in the Dog & directed by Liam Williams) was a hit on the 2018 circuit and was featured in The Guardian’s top shows to see at the Fringe. Keeping up a cracking momentum, his follow-up Edinburgh show Worm’s Resolve enjoyed critical acclaim and a sell-out run on the free fringe.
In addition to his own live work, Rob Oldham has been a tour support for John Kearns and Abandoman. Elsewhere he has appeared on Newsjack for BBC Radio 4 and written and performed in his own BBC Quickie and a BBC Life Lesson. Thoughtfully witty and offbeat, Rob Oldham is a comic who’s most definitely going places. Not to be missed!
Following on from Worm’s Lament, his 2018 debut, twenty-something ‘thinking man’s comic’ Rob delivers again. Delve into his existential exploration of being right, being wrong and getting angry. This is a beguiling melting pot of prose poetry and smart funnies on religion, politics and morality that will have you in stitches.
Rob Oldham was the Breakthrough Comic winner in Amused Moose Comedy’s National New Comic award 2017. He was also a quarter finalist in the Leicester Square New Comedian of the Year 2016.
‘I was expecting a lot from Rob Oldham. He did not disappoint’
One4Review.com
‘Born in the Nineties, nurtured in the Naughties…Rob is a philosopher-poet who postulates like the banner-bearer of a new wave of comedy about to erupt from the Millennial fountain’
MumbleComedy.net
‘To put it enthusiastically, you have not lived until you have heard one of Rob Oldham’s tonal prose poems’
EdFestMag.com
‘Sharp comedic eye for satirical and frivolous subjects’
What’s On London
‘Quirky, offbeat sensibilities that distil into smart jokes that rarely sound like anyone else’s’
Latest info on Rob Oldham’s gigs and live shows can be found here.
Can’t wait to see him live? Stream his full show now
It was as a student at Cambridge that Rob Oldham really found his feet in comedy. Talking to West End Wilma he explains: “I started off doing comedy at university, writing and performing sketches, and after a year or so I took the leap into stand up, which was initially terrifying but I’ve come to really enjoy.”
Rob Oldham initially began to dabble in performance as part of the world famous Cambridge Footlights. The university’s student comedy society, founded in 1883 is best known for its incredible alumni such as Peter Cook, Emma Thompson, Hugh Laurie, Stephen Fry, Rowan Atkinson, Tony Slattery, John Cleese, and Mitchell & Webb. In 2016, Rob Oldham joined his fellow students on the Cambridge Footlights international tour. The show, entitled Lagoon, embarked on an incredible run, performing to over twenty thousand people across two continents at venues in London, California, Las Vegas, New York, and the Cayman Islands. A mixture of sketches, songs and original writing and starring just five performers, Lagoon was also a hit at the 2016 Edinburgh Festival.
Fresh out of uni the following year, Rob Oldham began making waves on the London circuit with his own material, winning the Quantum Leopard New Act Competition, as well as going on to write for topical sketch show Newsjack on BBC Radio 4. He also launched his own popular podcast, Menagerie. That summer, Rob Oldham took the plunge in returning to Edinburgh’s free festival with his own show, Brink, a solo about growing up, politics, and being a hypocrite in the 21st century. Rob Oldham was praised for “demonstrating himself to be an imaginative writer with interesting ideas and command over their delivery (Chortle) and was deservedly awarded the breakthrough prize at the Amused Moose New Comedy Awards.
His following full hour debut show, Worms Lament, was a hilarious ride through millennial despair, with Rob Oldham talking about his past, present and future, moving deftly between the personal and the political. Speaking to West End Wilma, Rob explained how inspiring he found it to have Liam Williams directing his first solo: “I saw him at the Fringe when I was 19 and I was completely blown away. I had never seen anyone do what he did with stand up; the thoughtfulness and use of language is incredible. The first series of ‘Ladhood’, his radio series, remains the best thing I’ve ever heard on radio.”
Worms Lament enjoyed a successful run at the Pleasance in 2018, and in 2019 comedian Rob Oldham returned to the free fringe with Worm’s Resolve. It was a success with audiences and critics alike with Chortle stating – “One word review for this: Wow! Rob Oldham has aplomb, brains and delivery beyond his years. It’s hard to credit he’s just turned 24 and he’s now delivering a ‘difficult second show’ that I’d be happy to pay money to watch, or to see him delivering to a club audience. There’s an ease and composure to his delivery that is confidence-inspiring for an audience. He’s of the ‘thinks funny’ rather than ‘funny bones’ school of comedy and I enjoyed his analytical, self-conscious approach.”
We can’t wait to see what comedian Rob Oldham has in store for audiences next!
Want more of Rob Oldham? You’re in luck – his full stand-up comedy special is available to watch on NextUp – a digital comedy club where you can stream instantly over 120 comedy specials from some of the exciting names in comedy. Oh, and there’s a 7 day free trial.
I’m interested, tell me more…
|
cc/2020-05/en_middle_0087.json.gz/line1341103
|
__label__cc
| 0.562546
| 0.437454
|
Local artist has painting published in Ontario Nature Magazine
Hilary Thomson
A painting of Oxford Mill’s famous mudpuppies has been published in Ontario Nature Magazine. Artist Aleta Karstad is no stranger to these large, spotted salamanders. She and her husband, biologist Dr. Fred Schueler, have been taking people to visit them at the bridge in Oxford Mills every Friday night from the first Friday after Thanksgiving until spring high water for 15 years. It is the best place to see these magnificent creatures in Ontario because of its shallow water and flat, stoneless bottom. They even take a bucket of them in to the Brigadoon for the guests to see on their way out after dinner. “I’ve seen a fellow in a tuxedo on his hands and knees with both hands in the water to touch them,” Aleta says.
Ontario Nature first contacted Fred about an article on mudpuppies because he is the leading researcher of mudpuppies in Ontario. One of the staff at Ontario Nature’s office in Toronto knew about Aleta’s paintings and suggested they ask her if she had any illustrations of the mudpuppies to accompany the article.
“I had always wanted to do an oil painting of the mudpuppies,” Aleta says. “I decided to take the opportunity and submit it on the chance that it would be accepted.”
Aleta painted from a few photographs she had taken, as well as from memory. She says she loved depicting the network of wavy bright lines that forms when you look through the water. “I think it’s quite beautiful,” she says.
The painting now accompanies the article on mudpuppies in the current issue of the Ontario Nature Magazine. It is also the second slide of photographs on the magazine’s website. Aleta says she feels honoured to have her painting in Ontario Nature, accompanying what she thinks is a great article on the animals she has grown to love.
The original 16×20 painting is available by email auction to support their mudpuppy research. The starting bid is $650. Prints are also available and can be purchased for $125. To buy the painting or prints contact her at karstad@pinicola.ca. You can also see some of her other biodiversity paintings on her website www.aletakarstad.com. To learn more about mudpuppy night in Oxford Mills, email Aleta and Fred at bckcdb@istar.ca or call them at 613-258-3107.
Aleta Karstad
mudpuppies
Ontario Nature Magazine
oxford mills
Previous articleDoor-to-Door licensing
Next articleKemptville 73’s reach 500 and moving forward
Oxford Mills – Christmas season
ALETA KARSTAD HOLIDAY ART SALE
Christmas Celebrations in Oxford Mills
|
cc/2020-05/en_middle_0087.json.gz/line1341106
|
__label__wiki
| 0.519206
| 0.519206
|
DMV License Suspension
Multiple DUIs
DUI Tips
DUI Court Penalties
DUI Enhancements
DUI and DMV Information
You are here: Home / Blog / 2018 / June
Vehicular Homicide DUI Sentence: 12 Years
June 20, 2018 /0 Comments/in Uncategorized /by northc.admin
An Aurora resident was recently sentenced to 12 years in prison for a vehicular homicide DUI in which she hit a pedestrian and fled the scene. The woman claimed that she was unaware of the accident and had no recollection of hitting anyone. DUI is serious and you need representation you can trust and deserve! North County DUI is here for YOU. Contact us today for more information!
An Aurora driver was sentenced Tuesday to 12 years in prison for hitting and killing a pedestrian while driving under the influence of alcohol and fleeing the scene.
Prisma Rodriguez-Ramirez, 22, was sentenced by Adams County District Judge Don Quick for vehicular homicide DUI and leaving the scene of an accident involving death, according to the district attorneys office.
Adams County District Attorney
Prisma Rodriguez-Ramirez
Rodriguez-Ramirez was convicted by a jury in March of the two felony charges.
At about 11:30 p.m. on Dec. 30, Rodriguez-Ramirez was driving a black Land Rover SUV near East Colfax Avenue and Nome Street when she hit 36-year-old Antonio Colson who was crossing the street with his wife. Colson died of his injuries. His wife was not injured.
Rodriguez-Ramirez sped away, but turned off her headlights and returned to the scene, according to a news release. She claimed to not know she had hit anyone, but the impact was so hard it
caused Colson to fly 60 feet into the air, broke one of her headlights and crushed her car door, prosecutors said.
Rodriguez-Ramirez had been drinking beer and tequila. She had a blood alcohol content of 0.172.
In imposing the maximum 12-year sentence, Quick questioned whether Rodriguez-Ramirez had taken responsibility for her actions, the news release said. Quick noted that after her arrest, Rodriguez-Ramirez told police she didnt want to spend New Years Eve in jail.
Source: https://www.denverpost.com/2018/06/05/aurora-driver-vehicular-homicide-dui-sentenced/
About North County DUI Center
The Attorneys and Members of North County DUI Center are dedicated to helping individuals dealing with DUI cases of various degrees and types. We recognize that dealing with a DUI case is easily one of the most important things in your life. Our combined experience and results serve to show our ability to assure that each individual is represented in a way that obtains the best possible outcome.
|
cc/2020-05/en_middle_0087.json.gz/line1341110
|
__label__wiki
| 0.606324
| 0.606324
|
Home Music T.O. Music Notes
T.O. Music Notes
Rating: NNNNN
The Stills, October 12
After an opening set by fellow Montrealers the High Dials , Vice Records signees the Stills played to a surprisingly full Horseshoe on Thanksgiving Sunday, although there was a vague feeling of lethargy in the room. Undeterred, the Stills ably jammed out their grungy Britpop-flavoured tunes from the upcoming full-length Logic Will Break Your Heart (Vice/Warner) disc, while the crowd stayed glued in place, sometimes bobbing their heads. A classic T.O. apathy boner occurred when singer/guitarist Tim Fletcher announced, "Thanks guys. This next one's off our new album. It's called Gender Bomb!" To that, a wisenheimer responded with a highly audible "whatever," to entertaining effect. When the set finished and Fletcher said, "You guys have been very, very cool to us," it was tough to tell whether he was thanking the assembly or passive-aggressively admonishing them. Nevertheless, they do possess one impressive attribute for success - a good-looking drummer.
T.O. Music Notes Critics' Picks
|
cc/2020-05/en_middle_0087.json.gz/line1341115
|
__label__cc
| 0.681228
| 0.318772
|
Donor conception
Disagreements in the care of critically ill children
Genome editing and human reproduction
Mitochondrial DNA disorders
Neonatal medicine and care
Non-invasive prenatal testing
Whole genome sequencing of babies
Donation of bodily material
Personalised healthcare
Animals, food and environment
Genome editing and farmed animals
Xenotransplantation
Children and clinical research
Culture of scientific research
Embryo and stem cell research
Research in developing countries
Research in global health emergencies
Data and technology
AI in healthcare and research
Biological and health data
Emerging biotechnologies
Forensic use of bioinformation
In-depth inquiries
Bioethics briefing notes
Children and clinical research: ethical issues
Clinical research involving children is essential to increase our understanding of childhood conditions and improve healthcare for children. Yet professionals and parents often feel uneasy about asking children to take part in research, for example because of potential risks or burdens.
This report looks at how children and young people can ethically be involved in research, and makes recommendations about the roles and responsibilities of children, their parents or guardians, researchers and others. A magazine version and a short animation (below) are also available.
Katharine Wright
Katharine is part of the senior management team. She is responsible for leading Council projects and inquiries and speaking on behalf the Council on a range of ethical issues. Before joining the Council in 2007, she worked on health law and ethics in the NHS, Department of Health and House of Commons.
Kate Harvey
Senior Research Officer
Kate undertakes research to support the Council’s work and contributes to the drafting of reports. She also monitors developments in areas of interest to the Council. Prior to joining the Council, Kate completed an MA in Medical Ethics and Law at King’s College London.
Download the magazine (PDF)
Download the key recommendations (PDF)
Download the summary and conclusions (PDF)
Download posters - what we heard (PDF)
Download the magazine (Espanol) (PDF)
Download the key recommendations (Espanol) (PDF)
Download the summary and conclusions (Espanol) (PDF)
Order a print copy (UK)
Order a print copy (outside UK)
Guide to the report
Translated material
Films: young people’s perspectives on clinical ethics reviews
Developments since launch
About the working party
Read topic
Ethics of regenerative medicine and innovative treatments
The recently published Lancet Commission on stem cells and regenerative medicine is a very welcome a...
Making unbearable decisions about the care and treatment of a seriously ill child – ethical reflections
by Katharine Wright
In light of the recent judicial scrutiny of the case of Charlie Gard, Katharine Wright, Assistant Di...
Children leading the way in unexpected places
Given the international reach of our 2015 report Children and clinical research: ethical issues, it'...
Comment from the Nuffield Council on Bioethics on the Paediatric Regulation
In 2015 the Nuffield Council on Bioethics published a report on children in clinical research: ethic...
Research with children: ethical processes and challenges around the world
On 3-4 March 2016, the Nuffield Council on Bioethics hosted an international symposium on children ...
Children and clinical research: ethical issues - one year on
by Ranveig Svenning Berg
It's a longstanding tradition of ours to gather Working Parties together again roughly a year afte...
Statement on the protection of time for paediatricians to take part in Research Ethics Committees
The Nuffield Council on Bioethics and the Royal College of Paediatrics and Child Heath (RCPCH) have...
Animation on clinical research with young people translated into Mandarin
We are pleased to announce that the Council's animation 'Health research: making the right decis...
Statement of aspiration: improving research by involving children and young people
A number of key life-sciences industry representatives have signed up to a statement of aspiration w...
Facilitating meaningful engagement
Last week I had the double good fortune of being invited to Padua to contribute to an intensive shor...
Animation on clinical research with young people now available in Arabic
The Council's animation Health research: making the right decision for me is now available in Arab...
How can industry work with young people to improve health research?
On 22 April 2016 the Nuffield Council on Bioethics hosted a meeting to explore collaboration between...
New RCPCH charter on health research with children and young people
The Royal College of Paediatrics and Child Health (RCPCH) has today published a charter which sets o...
International symposium on children and clinical research: report published
On 3-4 March, the Council hosted an international symposium on children and clinical research with t...
The Paediatric Regulation – a work in progress?
The Council's report on the ethical issues raised by children's involvement in clinical research...
Animation on children and clinical research now available in Spanish
The Council's animation Health research: making the right decision for me is now available in Span...
Involving children in clinical research: GenerationR grows up
by Kate Harvey
The Children's Commissioner's Takeover Challenge kicked off on Friday - in this post, our Seni...
New online course on children and clinical research
The Council has worked with the Global Health Network to produce the online training course Children...
Building on what we heard from children in Kilifi, Kenya
by Sarah Walker-Robson
Blog by Working Party members Sassy Molyneux (left) and Vicki Marsh (right), KEMRI Wellcome Trust...
Medicines research with children: Council welcomes EMA class waiver review
The Nuffield Council on Bioethics welcomes the European Medicines Agency's revision of the class w...
Involving children in clinical research? iCAN.
From the inauguration of Abraham Lincoln to the Watergate Scandal, Washington, D.C. has seen its fai...
A pretty animated launch event
It's been a few days now since the launch of our new report on children and clinical research but ...
From the big tome to the small screen: animating our children and clinical research report
“Know your audience.” So say media trainers, journalists, and PR representatives the world over....
Children’s views should shape how research is conducted, says ethics body
A new report by the Nuffield Council on Bioethics calls for a change in culture across all areas of ...
Young people’s voices go global: ethics, collaboration and engagement in international health research
Professor Bobbie Farsides Council Member and Chair of the Working Party on Children and Research ...
Young people assess progress of Council’s project on children and clinical research
The Council's Working Party on children and clinical research presented its current work to young ...
Involving children in research: “What we think about what adults think”
Guest post by Natasha Wilcock, Rosie Bradford and Ellis Richardson who participated in a workshop he...
Launch of films and findings on involvement of children and young people in clinical research ethics
The Council has launched two films as part of a project in support of its current work on children a...
Council gathers evidence on children and clinical research
Over recent months the Council's Working Party on children and clinical research has held a series...
What do you mean – ask children?!
When we started our project looking at the ethical issues of clinical research with children back in...
Young people show adults how it’s done at paediatric research conference
Yesterday at London's Science Museum, something wonderful happened. A conference on clinical resea...
Our lives, our bodies, our rights: young voices on children's involvement in research
This guest post was written by Ravi and Thines, members of the Royal College of Paediatrics and Chil...
Should children be involved in clinical research?
Would you let your child take part in clinical research? How much say should children have in these ...
Council holds stakeholder meeting on children and clinical research
The Council's new Working Party on children and clinical research held a stakeholder meeting on We...
Would you let your child take part in clinical research?
How many parents would say 'yes of course!' if asked to consent to their child being involved in...
Call for expressions of interest in new project on children in clinical research
The Council has agreed to establish a new work theme to examine the ethical issues raised by the inv...
Workshop on children and clinical trials
On 9 December 2011 the Council held an exploratory workshop on the ethical issues raised by children...
The Nuffield Council on Bioethics is an independent body that examines and reports on ethical issues in biology and medicine. It was established by the Trustees of the Nuffield Foundation in 1991, and since 1994 it has been funded jointly by the Foundation, Wellcome and the Medical Research Council.
Cutting out meat this Veganuary? Nuffield Council looks at the ethics of meat alternatives
ASA bans prenatal testing ads for the use of misleading statistics
Nuffield Council on Bioethics 28 Bedford Square London, WC1B 3JS
bioethics@nuffieldbioethics.org
Press enquiries:
press@nuffieldbioethics.org
Suggest a topic for us to consider as part of our future work
© Nuffield Council on Bioethics 2020
gmos affect on human healht
ethics in dementia care
the forensic use of bioinformation ethical issues
This website uses cookies to improve your user experience. You can read about how here.
Decline all cookies Accept all cookies
|
cc/2020-05/en_middle_0087.json.gz/line1341116
|
__label__wiki
| 0.644369
| 0.644369
|
Allied Industry
Doctors & Nutritionists
Ingredion to expand portfolio of plant-based proteins
06 August 2019 | News
Total investment in plant-based proteins increases to $185 million from $140 million by end of 2020
image credit- istock.com
Ingredion a leading global provider of ingredient solutions to diversified industries has announced it will further expand its manufacturing and production capabilities in Vanscoy, Saskatchewan with Verdient Foods, Inc.
As part of this investment, the Company has begun construction on a new manufacturing facility to produce specialty pulse-based protein ingredients. The new facility, which is expected to be operational in the second half of 2020, significantly increases the Company’s food processing capabilities to meet the growing consumer demand for plant-based proteins.
“We’ve advanced our specialties strategy to capitalize on the trends shaping the food industry,” said Ingredion’s president and chief executive officer Jim Zallie. “Our latest investment will significantly expand our product portfolio to provide more innovative solutions to our customers, which will enable future growth. Ingredion and Verdient also share a common vision that sustainable and trusted sourcing will play an important role in the future of consumer-preferred plant-based proteins.”
Jim Cameron stated: “I’m excited to further our relationship with Ingredion, which will power significant expansion of plant-based proteins to consumers around the world. By working together, we have an amazing opportunity to be leaders in the next wave of global food production, which will have a lasting impact to future generations.”
“By combining our expertise in product formulation with Verdient’s high-quality Canadian-sourced pulses, we are uniquely positioned to be a reliable source supporting manufacturers as they create great-tasting and affordable plant-based proteins for food and beverages,” said Igor Playner, vice president of plant-based proteins at Ingredion.
Vantage NutraLauncher...
Need of additional vitamins during the breastfeeding phase...
Importance of balancing physical exercise with nutritional d...
Packaging suppliers focus on sustainable solutions and eComm...
There is an urgent need to look at cutting back on sugar in ...
Poland tastes good!...
If you’re looking for quality, well priced imports – think P...
Polagra Food Fair Hosted Buyer Programme...
Govt puts focus on food processing entrepreneurs at Ladakh...
FSSAI revises dairy testing, inspection scheme...
IIFPT Bathinda inks MoU with 8 Institutes of India...
The Coca-Cola Company announces retirement of CGO & Senior V...
Kemin appoints new President for Kemin Nutrisurance...
Prama Bhatt gets elected to Hormel Foods BOD...
Is F&B industry exploring S&T investment in 2020?
Subscribe Magzine
Ayurceuticals
Media Kit INR
Media Kit USD
MM Activ
Careers @MM Activ
Reproduction in whole or in part in
any form or medium without
written permission is prohibited.
© Copyright 2020. Nuffoods Spectrum. All Rights Reserved.
|
cc/2020-05/en_middle_0087.json.gz/line1341117
|
__label__wiki
| 0.865914
| 0.865914
|
Businessmans
You are at:Home»Authors»How rich is Nick Zedd?
How rich is Nick Zedd?
December 13, 2019 Authors
Nick Zedd Net Worth:
Nick Zedd (born May 8, 1958) is an American filmmaker and author based in New York City. He coined the term Cinema of Transgression in 1985 to describe a loose-knit group of like-minded filmmakers and artists using shock value and black humor in their work. These filmmakers and artistic collaborators included Richard Kern, Tessa Hughes Freeland, Lung Leg and Lydia Lunch. Under numerous pen names, Zedd edited and wrote the Underground Film Bulletin (1984–90) which publicized the work of these filmmakers. The Cinema of Transgression was explored in Jack Sargeant's book Deathtripping (Creation Books).
Birth date: May 8, 1958
Birth place: Takoma Park, Maryland, United States
Height: 5 ft 10 in (1.8 m)
Profession: Screenwriter, Film Director, Actor, Film Producer, Cinematographer, Film Editor, Television Director, Author, Writer
Nationality: United States of America
Movies: Thrust In Me, Geek Maggot Bingo, The Bogus Man, Abnormal: The Sinema of Nick Zedd, Totem of the Depraved, Manhattan Love Suicides, Joe's Apartment, Johnny Thunders: What About Me, Mutable Fire, Simonland
Source: Wikipedia Freebase
Twitter Facebook Google+ Pinterest LinkedIn Tumblr Email
How rich is Rick Riordan?
How rich is Bret Baier?
How rich is Che Guevara?
$10 Million 1958 5 ft 10 in (1.8 m) Actor Author Authors Cinematographer Film director Film Editor Film producer Maryland May 8 Nick Z. Nick Zedd Nick Zedd Net Worth Nick Zodiac Nickodemus Zedd Screenwriter Takoma Park Television Director United States United States of America Writer
|
cc/2020-05/en_middle_0087.json.gz/line1341118
|
__label__cc
| 0.574455
| 0.425545
|
Amy poehler dating adam scott anna paquin dating bill
Like a lot of season premieres – particularly premieres following cliffhanger-laden finales – it has too much plot to power through to pack in as many jokes as the show is ordinarily capable of.
There were definitely funny moments (Nick Offerman continued to display his physical comedy genius with the way Ron ran out of City Hall) and storylines (Ann gets entangled in Pawnee’s version of the Anthony Weiner scandal, and has to try not to react to the constant penis photos), but the focus this week was more emotional, as Leslie dealt with the question of whether she could give up her dream to run for office so she could keep dating Ben.
Series 3, Episode 4 M HD SD Tom (Aziz Ansari) tries to get back at Ron (Nick Offerman) by going out on a date with Ron’s ex-wife Tammy (guest star Megan Mullally), while Leslie (Amy Poehler) tries to protect Ron from falling prey to her charms.Series 3, Episode 3 M HD SD Leslie (Amy Poehler) wants to bury a time capsule that encapsulates life in Pawnee, but an odd suggestion from a local man (guest star Will Forte) causes unforeseen consequences.Andy (Chris Pratt) seeks help from Chris (Rob Lowe) about how to win back April (Aubrey Plaza).co-star Adam Scott at the event where she was awarded with Outstanding Female Actor in a Leading Role in a Comedy Series.PHOTOS: Check out the latest pics of Amy Poehler That same day, Amy was spotted making her way through LAX Airport after her flight from New York City.
Sexy xxx peekshow live chat 19-Aug-2019 05:34
Experience dirty chat at its best with a one-on-one video chat with strangers.
dating guitar marsland speaker code 30-Aug-2019 13:47
In one series of shots, Drizzy can be seen sitting with a glass of wine by his side, and what appears to be a tattoo of a women on his inner arm.
Camsfree xxx
Uk top young adults chat sites
Best adult chat apps
are ash and eliza still dating
tiffany taylor dating
dating sites calgary alberta
dating espania
Chatroulette afghanistan online free
Nude free webcams without signing up
|
cc/2020-05/en_middle_0087.json.gz/line1341120
|
__label__wiki
| 0.654655
| 0.654655
|
Huon shows Howe it's done
Published on 18 October 2017 SBLT Liam Northend (author), Unknown (photographer)
Location(s): Lord Howe Island
Topic(s): HMAS Diamantina (M86), HMAS Huon (M82)
Able Seaman Clearance Diver King descending to 42m off Lord Howe Island as the crew members of HMAS Huon conducted a 10-day deployment for an invaluable training opportunity.
The ship’s company of minehunter HMAS Huon packed a lot into their recent visit to Lord Howe Island, in the Tasman Sea.
Commanding Officer Huon Lieutenant Commander Jason Mullen said the 10-day deployment had been an invaluable training opportunity for the crew.
“Especially the mine warfare and clearance diving departments, achieving some great results in challenging surface conditions,” Lieutenant Commander Mullen said.
Huon was greeted by local legend and Navy Liaison Officer Clive Wilson who, at 84, is planning to retire later this year and pass the role on to his eldest son, Craig.
The crew’s primary mission was to work up the clearance diving team on board to a maximum depth of 60 meters. This highly technical dive is one of the most dangerous activities the divers participate in and is taken very seriously by all involved.
Over five days, the team, augmented by members of the Mine Warfare and Clearance Dive Group and HMAS Diamantina, conducted many dives allowing them to hone their individual skills, and work as a team at greater depths.
The work-up, which consisted of four dives to 20, 30, 42, and 60 meters, proved Huon’s capability of working to such depths. The capability that it provides to Navy was demonstrated in the United States MV22 Osprey recovery operation conducted by Australian Clearance Dive Team - One off the coast of Gladstone in August.
The team also conducted demolition serials and executed procedures for the location and disposal of a tethered buoyant mine. The crystal clear waters offered the perfect environment.
The majority of Huon’s time was spent tucked away in the lee of the 20-30 knot south-westerly trade winds. The ship’s company also took the opportunity to engage with the local community.
Six personnel visited the Lord Howe Island Central School, where they engaged with the 30 primary school students, aged between five and 12, along with the island’s five high school students undertaking their Higher School Certificate by correspondence.
Crew members spoke about life in the Navy and the career options it offers, and gave a presentation about Huon’s capabilities.
They were bombarded with questions from their enthusiastic audience members.
Huon also flexed her sporting muscles, fielding a team of touch rugby players against the local community in a friendly, but very competitive game.
The opportunity to interact with the community provided a welcome break and a great opportunity considering the tiny island, about 600 kilometres off the coast of Port Macquarie, New South Wales, has a small population and allows only 400 visitors at any one time.
Show initial Map
Open large map
Mine hunters conduct advance force operations
Lord Howe liaison for Navy team
Ain’t no mountain high enough
Supply crew enthusiastic for service
New era for Navy test and tactics development
Arunta celebrates two significant milestones
Patrol boats the guardians of regional security and stability
Fleet Support Unit evolving to meet needs of future fleet
WO-N recognises “important work” of patrol boat community
723 marks end of decade with busy and rewarding year
Fleet Air Arm’s firefighting support caps off busy 2019
Peering through the lens of Garden Island
Fleet delivers in 2019
|
cc/2020-05/en_middle_0087.json.gz/line1341124
|
__label__wiki
| 0.899503
| 0.899503
|
NY Post Shopping
New York Post New York Post
‘Special’ point guard could be Knicks’ draft consolation prize
By Zach Braziller
1 'Why I oppose impeachment:' 1999 Schumer letter comes back to bite him 2 Prince Harry and Meghan Markle abdicate royal titles, public funds 3 Now that Pelosi has impeached Trump, she will become his stooge 4 Taylor Swift attempted to kick Justin Bieber out of her gym 5 Astros star denies buzzer ploy, gets shredded by pitcher
February 8, 2015 | 11:29pm
D'Angelo Russell and Jahlil Okafor AP (2)
Forecasting the top 10 college football teams for 2020
Boston College coach gives insight into stopping Clemson, LSU
Giants heartbreak: Dwayne Haskins welcomes Chase Young to Redskins
Ohio State's defeat came not just by the hands of Clemson
Maybe the Knicks don’t have to lose more for Jahlil Okafor.
The status quo could get them D’Angelo Russell.
Based on the season Ohio State’s slick and steady 6-foot-5 freshman is enjoying, would anyone complain?
Russell entered the season overshadowed by some of the county’s other top freshmen, from Duke’s Okafor to Kentucky’s Karl-Anthony Towns and Arizona’s Stanley Johnson. Emmanuel Mudiay — the Dallas floor general who opted to play in China rather than attend SMU — was the point guard most scouts were talking about regarding the 2015 draft.
No one, regardless of class, has made a bigger impact this season than the southpaw, averaging 19.4 points, 5.7 rebounds and 5.2 assists, one of only two players to post 19 points, five rebounds and five assists per game. He put up his first career triple-double in Ohio State’s 79-60 victory over Rutgers at the RAC on Sunday night, scoring 23 points, notching 11 assists and grabbing 11 rebounds.
“Honestly, one of the better performances I’ve seen in my time in coaching,” Ohio State coach Thad Matta said.
He’s shot up draft boards, now projected to be the second pick by NBADraftExpress.com. And an NBA scout in attendance Sunday said he could see Russell, who has led Ohio State (18-6, 7-4) to second place in the Big Ten, going No. 1 overall over Okafor.
“He’s special,” the scout said. “He does things at his age you can’t believe he’s doing.”
Rutgers coach Eddie Jordan evoked the name of Knicks great Walt Frazier, his all-time favorite player, then took a step back.
“Not yet, anyway,” he said. Jordan then added: “He’s a smooth character.”
Matta said Russell’s work ethic and attention to detail remind him of David West, who played for Matta at Xavier and is in his 11th NBA season. He’s constantly looking for any advantage he can be, putting in extra time after practice in the gym, watching film.
“He always has a purpose to what he’s doing,” Matta said.
Other players put in extra hours, Matta said, but Russell always is working on aspects of his game that will translate to the next contest.
“That’s what great players do,” the Ohio State coach said.
D’Angelo RussellAP
Few envisioned Russell making this kind of impact. He was ranked among the top players in the country by scouting services, though somehow Rivals.com had him No. 18 overall, while Scout.com and ESPN ranked him 13th.
Twenty-two NBA scouts — including 76ers general manager Sam Hinkie and four Knicks representatives including assistant general manager Allan Houston — made the trip to Piscataway, NJ, to get a close look at the phenom. He didn’t disappoint, completely dominating the Scarlet Knights.
Russell’s entire dazzling repertoire was on display. There was his in-the-gym range (he made three 3-pointers), unselfishness (11 assists) and toughness (11 rebounds). He was completely under control the entire game, going at his own speed, and committed just two turnovers.
Early this season, he was turnover-prone — committing as many as seven in a win over Marquette Nov. 18 — but he’s improved in that area, taking care of the ball far better, just seven in his past five games.
His passing really has turned heads. He’s a willing ball-mover, not the typically high-scoring phenom who eats up the shot clock by pounding the ball into the court.
He made several highlight-reel plays Sunday. One of the most impressive came on a standard pick-and-roll at the top of the key. Two Scarlet Knights defenders immediately converged on Russell, and he softly flicked a pass into the paint — where teammate JaeSean Tate was — and it resulted in an easy layup, Tate catching the pass in stride.
“That’s what he does best,” the scout said. “When he comes at you, you can tell, he knows where everyone is on the floor. He sees his four guys and the other team’s five guys. He’s looking guys off all game.”
ESPN analyst Fran Fraschilla is one of Russell’s biggest fans, calling him “the draft’s most skilled player” and said “he already possesses the poise and countenance of a 10-year NBA veteran.”
The compliments are flattering, but Russell isn’t thinking about the NBA just yet. He has “two feet in” with Ohio State. He does watch a lot of the professional game and tries to emulate Stephen Curry, the Warriors’ electric All-Star guard.
“I got a long way to go, but he’s just the most exciting player to watch to me,” Russell said. “Just the plays that he makes, everybody is surprised, but he’s more like ‘I do this.’ ”
Funny, that’s the reaction Russell’s breathtaking season elicits.
Filed under d'angelo russell , nba draft , new york knicks , ohio state buckeyes , rutgers scarlet knights
How relentless Dan Hurley has rescued Rhode Island
Ken Davidoff
Where wild MLB sign-stealing scandal goes from here
This is a legacy game for Aaron Rodgers
see all columnists
THE BEST INSIGHTS FROM THE ULTIMATE INSIDERS
Big Apple Buckets: A NY Knicks Podcast
Listen on Apple Podcasts | Spotify
Blue Rush: A NY Giants Podcast
Gang's All Here: A NY Jets Podcast
Up In The Blue Seats: A NY Rangers Podcast
Get the latest odds on all the top sports.
See Odds
what to shop now
Theragun alternative is the only percussive massager with dual warm-up technology
Anthropologie clearance is an extra 40% off for winter sale
Bloomingdale's clearance an extra 40% off for Long Weekend Sale
Get an extra 30% off Kate Spade clearance handbags, clothing, and more
20 courses under $20 that can help you learn a new skill in 2020
Conor McGregor KOs Cowboy in 40 seconds
Newsletters & More
Post Headliners
|
cc/2020-05/en_middle_0087.json.gz/line1341125
|
__label__cc
| 0.520755
| 0.479245
|
NSF.gov/BIO
Program (Funding) Information
BIO BUZZ
Blog of the National Science Foundation's Directorate for Biological Sciences, Office of the Assistant Director
Exploring Microbiome Opportunities Symposium
April 28, 2016 April 28, 2016 NSF_BIO
On April 20, 2016, the College of Agricultural and Life Sciences at the University of Wisconsin-Madison hosted a one-day symposium on “Exploring Microbiome Opportunities in Life Sciences and Agriculture.” Jo Handelsman, Associate Director for Science at the White House Office of Science and Technology Policy (OSTP) gave an overview of the significance of microbiome research for several priorities of the Obama administration, including the precision medicine initiative, climate change, soil erosion, forensic biology, national security, alternative energy, and economic opportunities. James I. Prosser from the Institute of Biological and Environmental Sciences at the University of Aberdeen then delivered a plenary lecture about the long-term goals and challenges for microbiome research.
Left to Right: Jo Handelsman, Assistant Director for Science at OSTP, H. Gert de Couet, NSF BIO Division Director in IOS, Joseph Graber, Program Director at DOE, and Lita Proctor, Program Director and Project Coordinator at HMP (Credit: Sevie Kenyon, UW-Madison)
The plenary lectures were followed by presentations of the diverse portfolio of microbiome research projects conducted at UW-Madison. The symposium concluded with a panel discussion of funding opportunities for microbiome research. Participants were Jo Handelsman, Assistant Director for Science at OSTP, Lita Proctor, Program Director and Project Coordinator of the Human Microbiome project at NIH (HMP), and Joseph Graber, Program Director at the Department of Energy (DOE). NSF was represented by H. Gert de Couet, Division Director in BIO’s Division of Integrative Organismal Systems (IOS).
Meetings and EventsEvent
Previous Article NEON Management Update
Next Article Strengthening Research Capacity at HBCUs
NSF Social
View US.NSF’s profile on Facebook
View @NSF_BIO’s profile on Twitter
View USNSF’s profile on Pinterest
View VideosatNSF’s profile on YouTube
Follow BIO BUZZ via Email
BIO BUZZ RSS Feed
Reintegrating Biology Workshop Series Outcomes January 10, 2020
From the AD: Save the Date for BIO’s 2020 Distinguished Lecture Series January 6, 2020
From the AD: Remembering Dr. Mary Clutter December 17, 2019
Post Categories Select Category Announcments (funding) Budget From the Asst. Director Guidance Meetings and Events Merit Review News People Policy Science Communication Uncategorized
BIO Division Blogs
MCB Blog
DBInfo - Blog of the Division of Biological Infrastructure
IOS in Focus
@NSF_BIO Tweets
Directorate for Biological Sciences
4201 Wilson Blvd., Room 605
BIO Staff Directory:
http://go.usa.gov/3DkRF
Search BIO Buzz
Blog of the Division of Biological Infrastructure, Directorate for Biological Sciences, National Science Foundation
Blog of the Division of Integrative Organismal Systems (IOS) at the National Science Foundation
Blog of the Division of Environmental Biology, NSF
|
cc/2020-05/en_middle_0087.json.gz/line1341126
|
__label__wiki
| 0.586021
| 0.586021
|
Genes involved in innate immunity associated with asbestos-related fibrotic changes
Mari K Kukkonen1,
Tapio Vehmas1,
Päivi Piirilä2,
Ari Hirvonen1
1Finnish Institute of Occupational Health, Helsinki, Finland
2Department of Clinical Physiology, Helsinki University Hospital, Helsinki, Finland
Correspondence to Mari Kukkonen, Finnish Institute of Occupational Health, Topeliuksenkatu 41 a A, FIN-00250 Helsinki, Finland; mari.kukkonen{at}ttl.fi
Objectives To determine whether genetic polymorphisms in several candidate genes related to innate immunity and protease–antiprotease balance modify individual susceptibility to develop asbestos-related fibrotic pleuropulmonary changes.
Methods Sixteen polymorphisms from nine genes (NLRP3, CARD8, TNF, TGFB1, GC, MMP1, MMP9, MMP12 and TIMP2) were genotyped from 951 Finnish asbestos-exposed workers. The genotype/haplotype data were compared to signs of fibrosis and pleural thickenings using linear and logistic regression analysis adjusted for potential confounders.
Results A functional polymorphism (Q705K; rs35829419) in the NLRP3 gene was associated with interstitial lung fibrosis (p=0.013), and the TGFB1 rs2241718 SNP with visceral pleural fibrosis (VPF) (p=0.044). In stratified analysis, the carriage of at least one NLRP3 variant allele conferred a 2.5-fold increased risk for pathological interstitial lung fibrosis (OR 2.44, 95% CI 0.97 to 6.14). Conversely, the carriage of at least one TGFB1 rs2241718 variant allele protected against VPF (OR 0.62, 95% CI 0.39 to 0.98). The TIMP2 rs2277698 SNP and a haplotype consisting of the TGFB1 rs1800469 and rs1800470 SNPs were associated with the degree of pleural thickening calcification (p=0.037 and p=0.035), and the CARD8 rs2043211 SNP with the greatest thickness of pleural plaques (p=0.015).
Conclusions Our results support the hypothesis that the NLRP3 inflammasome is important in the development of fibrotic lung disease by associating the NLRP3 rs35829419 variant allele with increased risk of asbestos-related interstitial lung fibrosis, and the TGFB1 rs2241718 variant allele with decreased risk of asbestos-related VPF. Polymorphisms in CARD8 and TIMP2 are proposed to modify the development and/or calcification of pleural thickenings.
This is an Open Access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 3.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/3.0/
What this paper adds
There is growing evidence that an altered innate immunity response involving the NLRP3 inflammasome complex may be an important mediator of fibrotic lung diseases related to occupational exposures; however, there are very few data on the association between the genes involved in innate immunity and pulmonary fibrosis.
In this study, polymorphisms in NLRP3 and TGFB1 were shown to modify the risk for fibrotic lung changes among asbestos-exposed workers.
Our results support the hypothesis that the NLRP3 inflammasome complex is important in the development of fibrotic lung disease related to asbestos exposure.
Asbestos has been mined and used widely for various insulating and construction purposes because of the thermochemical and electrical resistance, high tensile strength, and the flexibility of these naturally occurring fibrous silicate minerals. Worldwide, the most common type of asbestos used commercially is chrysotile (<90%). In Finland, however, approximately 40% of all asbestos used has been anthophyllite as it was previously produced domestically.1
Asbestos usage peaked in the mid 1970s, after which the health hazards of asbestos were recognized and the demand for asbestos started to decline in the USA and in Europe.1 In Finland, asbestos spraying was forbidden in 1976 and a complete asbestos ban was introduced in 1994. Subsequently, 54 other countries have banned or restricted the use of asbestos.2 Despite these constraints, asbestos-induced pulmonary and pleural diseases are still a significant health concern due to the enormous amounts of asbestos mined and used since the early 1900s, and the long latency period of most asbestos-associated conditions.3
The major diseases caused by asbestos are mesothelioma and lung cancer.4 In addition, asbestosis, which is interstitial lung fibrosis caused by the deposition of asbestos fibres in the lungs, is an important asbestos-related disease that greatly contributes to the mortality caused by asbestos exposure.
The WHO has recently estimated that 107 000 deaths are caused annually by asbestos-related diseases.4 Based on an analysis of all deaths caused by mesothelioma and asbestosis reported to the WHO for 1994–2010, it is calculated that approximately 1300 people die worldwide each year from asbestosis, the majority in the Americas (597) and Europe (535).5 However, countries such as China, India and Russia are not included in this estimate as they did not supply national data.
The exact mechanism by which the inhalation of asbestos fibres leads to lung tissue injury is still unclear, but it may involve a persistent inflammatory response mediated by reactive oxygen species (ROS), cytokines, growth factors, and pro-inflammatory factors, as well as changes in the proteolytic balance of the lungs.6–9 Genes involved in these pathways are potential candidate modifiers of individual susceptibility to develop lung fibrosis and other asbestos-associated disorders.
Asbestos is known to induce the production of IL-1β and TNF from alveolar macrophages, and these cytokines are therefore believed to play an essential role in the early inflammatory response following asbestos exposure.10 Furthermore, TNF enhances the expression of TGFB1,11 a multifunctional cytokine, which may lead to immune suppression and lung fibrogenesis.12 ,13 Polymorphisms in both the TNF and TGFB1 genes have previously been associated with the development of asbestosis.14 ,15
TGFB1 can down-regulate collagen degradation through matrix metalloproteinases (MMPs) and their inhibitors (TIMPs), which play an essential role in tissue repair and remodelling, and have been proposed to contribute to the development of pulmonary fibrosis.8 Differential levels of several MMPs and TIMPs, such as MMP1, MMP9, MMP12 and TIMP2, have been detected in different fibrotic lung diseases.16 ,17
Asbestos-induced secretion of IL-1β from alveolar macrophages is mediated through the NLRP3 inflammasome, which identifies asbestos as a threat via ROS.18 The NLRP3 inflammasome complex consists of several components, such as NLRP3, ASC and CARD8 (also known as TUCAN), genetic variation of which may affect the function of the complex. Certain polymorphisms in the NLRP3 and CARD8 genes have been proposed to be associated with IL-1β production and severe inflammation.19 Animal studies also suggest that NLRP3 could play a role in the development of asbestosis.18 ,20
GC (group specific component, also known as vitamin D-binding protein, VDBP) is a multifunctional serum protein which participates in several immunologically important functions such as macrophage activation.21 It has been proposed that GC is involved in chronic lung inflammation, and its gene polymorphisms have been studied in relation to several pulmonary disorders, such as chronic obstructive pulmonary disease (COPD), lung cancer and asthma.22
We investigated the significance of nine potential candidate genes in the development of interstitial lung fibrosis, visceral pleural fibrosis (VPF) and pleural plaques detected with high resolution CT (HRCT) among 951 Finnish Caucasian asbestos-exposed workers. The 16 gene polymorphisms (NLRP3: rs35829419 and rs10925027; CARD8: rs2043211, rs1062808 and rs2288877; MMP1: rs1799750; MMP9: rs3918242; MMP12: rs652438; TIMP2: rs2277698; TNF: rs1799724 and rs1800629; TGFB1: rs1800469, rs1800470 and rs2241718; and GC: rs7041 and rs4588) were chosen based on previous association studies suggesting that they were potential modifiers of the development of fibrotic pleuropulmonary changes.
This study combines data from two previous studies, the ASBE and the ASSE, which sought to detect early occupational chest diseases among asbestos-exposed workers.
The ASBE study was conducted in 1996–1997. In 1990–1992, a total of 18 943 asbestos-exposed workers participated in a comprehensive screening study aiming to prevent asbestos-related risks. The screening identified 2857 subjects with asbestos-related occupational disease,23 ,24 and 642 of these workers who lived in the Helsinki area, had a previous asbestosis diagnosis regardless of smoking history, or had pleural plaques (without an asbestosis diagnosis) and a smoking history of ≥10 pack years, were invited to participate in ASBE.25 ,26 The subjects willing to participate (n=602) formed the ASBE study group. The mean age of ASBE participants was 63 (38–81) years and most of them were men (n=592).
The ASSE study, conducted in 2003–2004, included asbestos-exposed subjects from two sources.27 The study group mainly consisted of workers with asbestosis and/or asbestos-related pleural findings who had visited occupational medicine clinics in Helsinki and Tampere for clinical follow-up27 and were willing to participate in ASSE. The study group also included asbestos-exposed participants from the original screening study conducted in 1990–199223 ,24; all heavily exposed subjects (exposure index >70)28 living in three geographical areas (Helsinki, Tampere and Turku) were invited to participate in ASSE. A total of 758 subjects were invited and the 633 who were willing to participate formed the ASSE study group. The mean age of ASSE participants was 65 (45–87) years and most of them were men (n=627).
As 178 of the subjects recruited in 2003–2004 had already participated in the first study conducted in 1996–1997, they were excluded from the second patient group in the present study before the data were combined.
In the combined study population, blood samples were available for 1021 subjects. However, 25 subjects were excluded because of missing smoking information and 45 because of insufficient asbestos exposure data. Thus, the final study group consisted of 951 subjects (935 males, 16 females).
Approval for the study was obtained from the local ethics committees (the Ethics Committee of the Finnish Institute of Occupational Health and the Ethics Committee for Research in Occupational Health and Safety, Hospital District of Helsinki and Uusimaa) according to the legislation in force at the time of the original study. All subjects gave informed consent to participate in the study.
The ASBE participants were personally interviewed by an occupational physician using a standardised questionnaire including questions on smoking habits and occupational history. They were construction workers who had installed heat and fire insulation or asbestos-containing walls and ceiling panels, used asbestos paints, putties and fillers, dismantled asbestos-containing materials, or cleaned areas where asbestos was present. They had a mean duration of asbestos exposure of 26.1±9.7 years and a mean of 23.7±15.0 pack-years of smoking. Most were ex-smokers (70%) or current smokers (27%), and only 3% had never smoked.
The ASSE participants filled in a self-administered questionnaire modified from the Finnish Environment and Asthma Study Questionnaire.29 The final questionnaire included queries on demographic characteristics, respiratory symptoms and diseases, smoking exposure, and occupational exposures with a focus on asbestos. Most of the ASSE participants were construction workers, cleaners or plumbers. The ASSE participants had a mean duration of asbestos exposure of 20.8±11.4 years, and a mean of 16.1±18.2 pack-years of smoking. Most were ex-smokers (54%) or current smokers (17%), and 29% had never smoked.
Radiological examinations
The lungs of study subjects were imaged prone in full inspiration with four different scanners: in 1996–1997 the Picker PO 2000 (Picker International, Cleveland, Ohio, USA) device was used, while in 2003–2004 the Siemens Somatom Balance (Siemens Medical, Erlangen, Germany) was used in Helsinki, the Siemens Somatom Plus 4 (Siemens Medical) in Tampere, and the GE LightSpeed 16 Advantage (GE Healthcare, Milwaukee, Wisconsin, USA) in Turku. The HRCT images were printed as hard copies and analysed blindly by two (2003–2004) or three (1996–1997) radiologists.
The radiologists visually scored the signs of interstitial lung fibrosis using an arbitrary semiquantitative scale from 0 to 5 including one subclass between each of the five classes: 0 (normal finding), 1 (subnormal finding), 2 (mild fibrosis), 3 (moderate fibrosis), 4 (severe fibrosis) and 5 (extreme fibrosis).25
VPF includes diffuse pleural thickening, rounded atelectasis and parenchymal bands.30 A VPF variable was constructed by adding up scores for parenchymal bands (scale 0–5), adherences at the diaphragm and sinuses as well as other adherences (scales 0–3) and rounded atelectasis (score 0–3 for up to 2 atelectases) in the ASBE study material.31 This sum score was then dichotomised to match the frequency distribution of the dichotomous VPF variable used in the ASSE study. Several signs of pleural changes were also recorded: the extent (cm2) and greatest thickness of pleural thickenings (ILO ‘width’: 0=no plaques, 1=≤5 mm, 2=5–10 mm, 3=10 mm) and their degree of calcification (0=no, 1=sparse, 2=a considerable part of the pleural thickening, 3=nearly all). The methods, including intra- and inter-reader agreement, have been described in more detail previously.25
Genotyping analyses
DNA was extracted mechanically (Thermo KingFisher system; Thermo Fisher Scientific, Erembodegem, Belgium) from whole blood using a BioSprint 15 DNA Blood Kit (Qiagen, Hilden, Germany) and stored at −20°C until use.
Two NLRP3 SNPs (rs35829419 and rs10925027), three CARD8 SNPs (rs2043211, rs1062808 and rs2288877), two TNF SNPs (rs1799724 and rs1800629), two TGFB1 SNPs (rs1800469 and rs2241718), two GC SNPs (rs7041 and rs4588), one MMP12 SNP (rs652438) and one TIMP2 SNP (rs2277698) were genotyped using the OpenArray system (BioTrove, Woburn, Massachusetts, USA), a next-generation quantitative PCR platform based on TaqMan chemistry.
The TGFB1 rs1800470 SNP was genotyped using an allelic discrimination assay on the ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, California, USA) with TaqMan probes.32 The MMP1 rs1799750 SNP was analysed with a pyrosequencing method based on an assay from the PyroMark Assay Database (Qiagen), and the MMP9 rs3918242 SNP was genotyped using a PCR-RFLP-based method essentially according to Joos et al.33 A detailed description of the genotyping methods is presented in online supplement 1.
For quality control, two independent readers interpreted the results and a random selection of 10% of all samples was re-tested. No discrepancies were discovered in the replicate tests for rs35829419, rs10925027, rs1062808, rs2288877, rs7041, rs4588, rs652438, rs1800470, rs1799750 or rs3918242. Minor error rates were detected for OpenArray assays rs2043211 (1%), rs1799724 (1%), rs1800629 (2%), rs2241718 (2%), rs2277698 (2%) and rs1800469 (3%).
To verify the reliability of the OpenArray platform, a random selection of 15% of samples was re-analysed for rs1800629 and rs1799724 SNPs using an RFLP-based method34 (rs1800629) and a pyrosequencing-based method (rs1799724) with 100% concordant results with the earlier estimates.
Our study (n=951) has 80% power to detect ORs from 1.57 to 2.63 depending on the minor allele frequency (4–43%). The calculations, based on a two-sided α of 0.05, were performed using standard methods.
Linkage disequilibrium (LD) among the studied SNPs was examined using HaploView V.4.2.35 When moderate or strong linkage was detected (r2>0.5), haplotypes consisting of the SNPs in question were statistically reconstructed from population genotype data with the Markov chain method for haplotype assignments using the PHASE program (V.2.1).36 The associations of the haplotypes with pulmonary parameters were then examined as with the single SNPs.
The χ2 test with a cut-off p value of 0.05 was used to check for deviation from Hardy–Weinberg equilibrium (HWE).
The associations between genotypes/haplotypes, fibrosis and pleural plaques were evaluated using a general linear model, while logistic regression analysis was used to evaluate potential confounders and to further study the risk for fibrotic changes and pleural plaques and their severity with a certain genotype. Covariates used in the analysis were: sex, age, pack years of smoking and years of asbestos exposure.
For further analysis, the cases were divided according to the existence and severity of radiological signs. The signs of interstitial lung fibrosis (radiological score >0) were considered subnormal if the radiological score was <2 and pathological if the score was ≥2. The degree of calcification of pleural plaques was categorised as mild if calcification was sparse and high if a considerable part or nearly all of the pleural thickenings were calcified.
All of the data analyses were performed using SPSS V.18.0 (SPSS, Chicago, Illinois, USA).
The demographics and HRCT characteristics of the asbestos-exposed workers are summarised in table 1. All the genotype distributions of the studied gene polymorphisms were in HWE (p>0.09), except for the CARD8 rs1062808 and rs2288877 SNPs (p<0.01), which were therefore excluded from further analysis.
Characteristics of the asbestos-exposed workers
The NLRP3 rs35829419 SNP was associated with interstitial lung fibrosis (p=0.013) and the TGFB1 rs2241718 SNP with VPF (p=0.044). The CARD8 rs2043211 SNP was associated with the greatest of pleural plaques thickness (p=0.015) and the TIMP2 rs2277698 SNP with the degree of pleural plaque calcification (p=0.037) (table 2).
Association between genetic polymorphisms and fibrotic pleuropulmonary changes
In stratified analysis, carriage of at least one NLRP3 rs35829419 variant allele conferred a 2.5-fold increased risk for pathological interstitial lung fibrosis (OR 2.44, 95% CI 0.97 to 6.14), although this association was only borderline significant. In addition, the carriage of at least one TIMP2 rs2277698 variant allele conferred an almost 2-fold increased risk for a high degree of pleural plaque calcification (OR 1.90, 95% CI 1.09 to 3.33) (table 3). Conversely, the carriage of at least one TGFB1 rs2241718 variant allele was protective against VPF (OR 0.62, 95% CI 0.39 to 0.98) (table 4). No association between CARD8 rs2043211 SNP and the greatest thickness of pleural plaques was found in the stratified analysis.
Distribution of NLRP3 and TIMP2 genotypes according to the existence and severity of radiological changes
Distribution of TGFB1 genotypes according to the existence of visceral pleural fibrosis
In linkage analyses, significant LD was observed between the GC rs4588 and rs7041 SNPs (D′=1.00, r2=0.501). The TGFB1 rs1800469 and rs1800470 SNPs were also found to be linked to each other (D′=0.970, r2=0.738), but not to the third studied TGFB1 SNP (rs2241712) (D′<0.02, r2=0.00). The minor allele frequencies of the NLRP3 rs35829419 and TNF rs1799724 SNPs were too small for r2 to detect LD (0.3% and 0.2%, respectively), despite the maximum D′s (D′=1.00, r2=0.032 for rs35829419; D′=1.00, r2=0.008 for rs1799724).
Next, a Bayesian method was used to reconstruct the TGFB1 and GC haplotypes from population genotype data, and the haplotypes’ associations with pulmonary parameters were examined as with the single SNPs. The haplotype analysis identified three haplotypes for the GC rs4588 and rs7041 SNPs: the most common haplotype was GC (wild type–wild type, 65.2%), followed by GA (13.7%) and TA (21.1%). No associations were seen between the GC haplotypes and the studied parameters.
For the TGFB1 rs1800469 and rs1800470 SNPs, four haplotypes were identified: GT (wild type–wild type, 60.5%), GC (24.9%), AT (10.3%) and AC (4.3%). Overall, the TGFB1 rs1800469–rs1800470 haplotype was found to be associated with the degree of pleural plaque calcification (p=0.035) (data not shown). In the stratified analysis, the GC and AT haplotypes conferred increased risks (OR 1.52, 95% CI 1.09 to 2.11 for GC; OR 1.95, 95% CI 1.18 to 3.22 for AT) for pleural plaque calcification compared with the most common haplotype, GT. The risks did not notably differ between mild and high degrees of calcification (table 5).
Distribution of TGFB1 haplotypes according to the degree of pleural plaque calcification
Although there is growing evidence of the involvement of the NLRP3 inflammasome in the development of fibrosis,37 ,38 there are few data on the association between the genes involved in this inflammasome complex and pulmonary fibrosis. In the current study, we found a significant association between the NLRP3 rs35829419 SNP and asbestos-induced interstitial lung fibrosis. Moreover, a truncating polymorphism (C10X; rs2043211) in another member of the complex, CARD8, was associated with the greatest thickness of pleural plaques.
The rs35829419 and rs2043211 SNPs have previously been linked to increased IL-1β production and severe inflammation.19 The rs35829419 SNP changes amino acid (Q705K) in the NLRP3 protein, and recent evidence suggests that it is a gain-of-function mutation leading to a constantly active NLRP3 inflammasome and increased IL-1β levels.39 This may induce fibrosis37 ,38 and therefore agrees with our findings.
Interestingly, a recent study suggests an association between the variant allele of another NLRP3 SNP (rs1539019) and coal workers’ pneumoconiosis (CWP).40 CWP is a lethal fibrotic lung disease caused by inhalation of airborne coal mining dust, including crystalline silica.41 Although the functional consequences of the rs1539019 SNP are not known, this finding is in agreement with our results and strengthens the hypothesis that the NLRP3 inflammasome complex is involved in the development of fibrotic lung diseases.
Genetic polymorphisms in TNF and TGFB1 have previously been associated with the development of asbestos-induced fibrosis in a German population.14 ,15 However, we could not replicate the findings concerning the TNF genotypes, possibly because of phenotypic heterogeneity. In the previous study, a strict diagnosis of asbestosis was used, whereas in the current study different fibrotic changes were studied separately. In addition, since the control subjects in the previous study were not exposed to asbestos, the analyses were not adjusted for asbestos exposure level.14
Regarding the studied TGFB1 genotypes, the rs2241718 SNP was associated with asbestos-induced VPF, and two TGFB1 haplotypes consisting of the rs1800469 and rs1800470 SNPs were associated with pleural plaque calcification. In stratified analysis, the variant allele of the TGFB1 rs2241718 SNP was shown to be protective against VPF.
The TGFB1 rs2241718 SNP is located in the non-coding area near the gene and has no known functional consequences. The promoter area SNP rs1800469 is in tight linkage with the third studied signal peptide SNP rs1800470 (Leu10Pro; formerly known as rs1982073), which has been associated with increased secretion and higher TGFB1 serum levels.42 ,43 Moreover, the F-SNP program predicts that rs1800470 is involved in splicing regulation.44
It is also possible that the causative variant is one of the several SNPs found in tight linkage (r2>0.9 in the 1000 Genomes Project population) with the studied TGFB1 SNPs, located in a completely different gene. However, since TGFB1 is a down-stream effector of the NLRP3-mediated innate immunity response, and also involved in the regulation of protease–antiprotease balance, it is highly likely that it has a role in the pathogenesis of external exposure and inflammation-related lung disease. The previous and current findings together imply that TGFB1 is indeed involved in the development of asbestos-related fibrosis.
We also found an association between the TIMP2 rs2277698 SNP and pleural thickenings; the rs2277698 variant allele was found to predispose to a high degree of pleural thickening calcification. The relationship between TIMP2 and pleural plaques has not been explored before, but in an animal model, the over-expression of TIMP2 has been shown to inhibit atherosclerotic plaque development and destabilisation.45 However, the mechanisms of the development of atherosclerotic plaques are probably very different from the development of pleural plaques.
The functional consequences of the synonymous rs2277698 SNP are unclear, but the F-SNP program predicts that it is highly likely to be involved in splicing regulation.44 The rs2277698 SNP is also in strong linkage (r2>0.9 in the 1000 Genomes Project population) with other potential causal SNPs, some of which (rs9889410 and rs11654470) are located in an area predicted to alter transcriptional regulation.44
One of the main strengths of our study is the very large, HRCT-characterised population, in which different asbestos-related abnormalities were recorded separately. Since different degrees of interstitial fibrosis were detected in 750 subjects, we were also able to compare the severity of these changes with the genotype data.
Our study also has potential limitations. First, since the patients were enrolled in three cities during two separate primary studies, four different CT scanners were used and seven radiologists participated in image reading. However, since the Finnish population is very homogenous and the three large cities where the patients were enrolled, are all located in southern Finland and very close to each other, we do not believe that geographical origin at the time of the examination has caused any significant bias in the data analysis. Moreover, any inconsistency in image reading causes inaccuracy and thus random noise affecting the results, leading to loss of power rather than systematic error. This increases the error variance in computations and the detected associations are therefore likely to be underestimated.
Second, the multiple comparisons performed increase the possibility of detecting false–positive associations. However, most of the methods correcting for multiple testing are very conservative, and, for example, it is unclear how many comparisons should be adjusted for.46 In addition, based on previous findings, we had an a priori hypothesis for each polymorphism chosen, which reduces the need for correction. Nevertheless, these results should be considered with caution until replicated in another study population. The use of a large control population including asbestos-exposed subjects without pleural or pulmonary changes would also be beneficial in evaluating the reliability of our findings.
In summary, our results strengthen the hypothesis that the NLRP3 inflammasome is important in the development of fibrotic lung diseases. In particular, the NLRP3 rs35829419 variant allele is proposed to increase the risk for asbestos-related interstitial lung fibrosis and the TGFB1 rs2241718 variant allele to protect against asbestos-related VPF. In addition, polymorphisms in CARD8 and TIMP2 are proposed to modify the development and/or calcification of pleural thickenings.
The authors thank Sirpa Hyttinen and Emmi Tiili for assistance with genotyping and sample management, and Panu Oksa and Pauliina Toivio for help with data handling.
Virta R
. Worldwide Asbestos Supply and Consumption Trends from 1900 through 2003. US Geological Survey (Circular 1298). 2006. http://pubs.usgs.gov/circ/2006/1298/c1298.pdf
Ban Asbestos Secretariat. http://ibasecretariat.org
Kamp DW
. Asbestos-induced lung diseases: an update. Transl Res 2009;153:143–52.
World Health Organization. 2010. Asbestos: elimination of asbestos-related diseases. WHO Media Centre. Fact sheet N°343. http://www.who.int/mediacentre/factsheets/fs343/en/index.html
Diandini R,
Takahashi K,
Park EK,
. Potential years of life lost (PYLL) caused by asbestos-related diseases in the world. Am J Ind Med 2013;56:993–1000.
Liu G,
Cheresh P,
. Molecular basis of asbestos-induced lung disease. Annu Rev Pathol 2013;8:161–87.
Mossman BT,
Gee JB
. Asbestos-related diseases. N Engl J Med 1989;320:1721–30.
Lagente V,
Manoury B,
Nenan S,
. Role of matrix metalloproteinases in the development of airway inflammation and remodeling. Braz J Med Biol Res 2005;38:1521–30.
Tan RJ,
Fattman CL,
Niehouse LM,
. Matrix metalloproteinases promote inflammation and fibrosis in asbestos-induced lung injury in mice. Am J Respir Cell Mol Biol 2006;35:289–97.
Lee TC,
Guillemin B,
. Enhanced IL-1 beta and tumor necrosis factor-alpha release and messenger RNA expression in macrophages from idiopathic pulmonary fibrosis or after asbestos exposure. J Immunol 1993;150:4188–96.
Sullivan DE,
Ferris M,
Pociask D,
. The latent form of TGFbeta(1) is induced by TNFalpha through an ERK specific pathway and is activated by asbestos-derived reactive oxygen species in vitro and in vivo. J Immunotoxicol 2008;5:145–9.
Bartram U,
Speer CP
. The role of transforming growth factor beta in lung development and disease. Chest 2004;125:754–65.
Nishimura Y,
Nishiike-Wada T,
Wada Y,
. Long-lasting production of TGF-beta1 by alveolar macrophages exposed to low doses of asbestos without apoptosis. Int J Immunopathol Pharmacol 2007;20:661–71.
Helmig S,
Aliahmadi N,
Schneider J
. Tumour necrosis factor-alpha gene polymorphisms in asbestos-induced diseases. Biomarkers 2010;15:400–9.
Belwe A,
. Association of transforming growth factor beta1 gene polymorphisms and asbestos-induced fibrosis and tumors. J Investig Med 2009;57:655–61.
Yaguchi T,
Fukuda Y,
Ishizaki M,
. Immunohistochemical and gelatin zymography studies for matrix metalloproteinases in bleomycin-induced pulmonary fibrosis. Pathol Int 1998;48:954–63.
Swaisgood CM,
French EL,
Noga C,
. The development of bleomycin-induced pulmonary fibrosis in mice deficient for components of the fibrinolytic system. Am J Pathol 2000;157:177–87.
Dostert C,
Petrilli V,
Van Bruggen R,
. Innate immune activation through Nalp3 inflammasome sensing of asbestos and silica. Science 2008;320:674–7.
Verma D,
Lerm M,
Blomgran Julinder R,
. Gene polymorphisms in the NALP3 inflammasome are associated with interleukin-1 production and severe inflammation: relation to common inflammatory diseases? Arthritis Rheum 2008;58:888–94.
Cassel SL,
Eisenbarth SC,
Iyer SS,
. The Nalp3 inflammasome is essential for the development of silicosis. Proc Natl Acad Sci U S A 2008;105:9035–40.
Yamamoto N,
Homma S
. Vitamin D3 binding protein (group-specific component) is a precursor for the macrophage-activating signal factor from lysophosphatidylcholine-treated lymphocytes. Proc Natl Acad Sci U S A 1991;88:8539–43.
Chishimba L,
Thickett DR,
Stockley RA,
. The vitamin D axis in the lung: a key role for vitamin D-binding protein. Thorax 2010;65:456–62.
Koskinen K,
Rinne JP,
Zitting A,
. Screening for asbestos-induced diseases in Finland. Am J Ind Med 1996;30:241–51.
Tossavainen A,
. Radiographic abnormalities among Finnish construction, shipyard and asbestos industry workers. Scand J Work Environ Health 1998;24:109–17.
Huuskonen O,
Kivisaari L,
. High-resolution computed tomography classification of lung fibrosis for patients with asbestos-related disease. Scand J Work Environ Health 2001;27:106–12.
Tiitola M,
. Computed tomography of asbestos-related pleural abnormalities. Int Arch Occup Environ Health 2002;75:224–8.
Vierikko T,
Jarvenpaa R,
Autti T,
. Chest CT screening of asbestos-exposed workers: lung lesions and incidental findings. Eur Respir J 2007;29:78–84.
Pukkala E,
Martikainen R,
. Different measures of asbestos exposure in estimating risk of lung cancer and mesothelioma among construction workers. J Occup Environ Med 2002;44:1190–6.
Jaakkola MS,
Piipari R,
Jaakkola N,
. Environmental tobacco smoke and adult-onset asthma: a population-based incident case-control study. Am J Public Health 2003;93:2055–60.
Gevenois PA,
de Maertelaer V,
Madani A,
. Asbestosis, pleural plaques and diffuse pleural thickening: three distinct benign responses to asbestos exposure. Eur Respir J 1998;11:1021–7.
Piirilä P,
. Association of findings in flow-volume spirometry with high-resolution computed tomography signs in asbestos-exposed male workers. Clin Physiol Funct Imaging 2009;29:1–9.
Andreassen CN,
Alsner J,
Overgaard J,
. TGFB1 polymorphisms are associated with risk of late normal tissue complications in the breast after radiotherapy for early breast cancer. Radiother Oncol 2005;75:18–21.
Joos L,
He JQ,
Shepherdson MB,
. The role of matrix metalloproteinase polymorphisms in the rate of decline in lung function. Hum Mol Genet 2002;11:569–76.
Ozen S,
Alikasifoglu M,
Bakkaloglu A,
. Tumour necrosis factor alpha G→A -238 and G→A -308 polymorphisms in juvenile idiopathic arthritis. Rheumatology 2002;41:223–7.
Barrett JC,
Fry B,
Maller J,
. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 2005;21:263–5.
Stephens M,
Donnelly P
. A comparison of bayesian methods for haplotype reconstruction from population genotype data. Am J Hum Genet 2003;73:1162–9.
Artlett CM
. The role of the NLRP3 inflammasome in fibrosis. Open Rheumatol J 2012;6:80–6.
dos Santos G,
Kutuzov MA,
Ridge KM
. The inflammasome in lung diseases. Am J Physiol Lung Cell Mol Physiol 2012;303:L627–633.
Sarndahl E,
Andersson H,
. The Q705K polymorphism in NLRP3 is a gain-of-function alteration leading to excessive interleukin-1beta and IL-18 production. PLoS One 2012;7:e34977.
Ji X,
Hou Z,
. Polymorphisms in inflammasome genes and risk of coal workers’ pneumoconiosis in a Chinese population. PLoS One 2012;7:e47949.
McCunney RJ,
Morfeld P,
Payne S
. What component of coal causes coal workers’ pneumoconiosis? J Occup Environ Med 2009;51:462–71.
Dunning AM,
Ellis PD,
McBride S,
. A transforming growth factorbeta1 signal peptide variant increases secretion in vitro and is associated with increased incidence of invasive breast cancer. Cancer Res 2003;63:2610–15.
Yokota M,
Ichihara S,
Lin TL,
. Association of a T29→C polymorphism of the transforming growth factor-beta1 gene with genetic susceptibility to myocardial infarction in Japanese. Circulation 2000;101:2783–7.
Lee PH,
Shatkay H
. F-SNP: computationally predicted functional SNPs for disease association studies. Nucleic Acids Res 2008;36:D820–4.
Johnson JL,
Baker AH,
Oka K,
. Suppression of atherosclerotic plaque progression and instability by tissue inhibitor of metalloproteinase-2: involvement of macrophage migration and apoptosis. Circulation 2006;113:2435–44.
Rothman KJ
. No adjustments are needed for multiple comparisons. Epidemiology 1990;1:43–6.
Contributors MKK carried the main responsibility for genotyping, data analyses and preparation of the manuscript; TV participated in data collection, radiological examinations, data analysis and manuscript preparation; PP participated in data collection, planning and manuscript preparation; AH was responsible for study design and supervision of genotyping, data analysis and manuscript preparation. All authors have read and approved the final version of the manuscript.
Funding This study was financially supported by the Finnish Work Environment Fund (Grants 109374 and 111332), Orion-Farmos Research Foundation, Jalmari and Rauha Ahokas Foundation, and ECNIS (Environmental Cancer Risk, Nutrition and Individual Susceptibility), a network of excellence that operated within the European Union 6th Framework Program, Priority 5: ‘Food Quality and Safety’ (Contract No. 513943).
Competing interests None.
Ethics approval This study was conducted with the approval of the Ethics Committee of the Finnish Institute of Occupational Health and the Ethics Committee for Research in Occupational Health and Safety, Hospital District of Helsinki and Uusimaa.
Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions This is an Open Access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 3.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/3.0/
|
cc/2020-05/en_middle_0087.json.gz/line1341129
|
__label__cc
| 0.679347
| 0.320653
|
Talk to Doctor Today
+ 91 900 849 2277,
Multi-Speciality Hospital with Innovative and Personalized Medical Service
What You Should Know About Abortion Clinics In Oman
Abortion InformationNo Comments
The abortion laws in the state of Oman do not allow abortion except in the circumstances where the life of the woman is at risk. Therefore, abortion is illegal in Oman and this applies to every person living in Oman including foreigners.
Although the law does not permit women to have abortions in Oman there have been a number of illegal abortions being carried out in Oman. These illegal abortion procedures are mainly carried out by illegal abortion clinics in Oman that have no licences to operate.
The abortion laws in Oman state that a person or doctor helping a woman have an abortion without her consent faces a prison sentence. Due to these tough rules, many pregnant women in Oman turn to underground and illegal abortion clinics in Oman. The state of Oman does not allow any hospital or clinic, whether private or government owned to carry out abortion procedures in Oman. Thus any clinic in Oman offering abortion services is illegal.
The abortion clinics in Oman are also very dangerous. This is because these illegal clinics do not have the right equipment to be used for abortion procedures. They only use crude tools and equipment that could very easily injure the womb of the pregnant women and cause further complications.
There have been many cases of women being rushed to government hospitals at a state where they have lost too much blood and are fighting for their lives. This mostly happens when the abortion procedure has gone bad due to the crude instruments and the alleged doctors have no idea what to do next.
Apart from using crude equipment at the abortion clinics in Oman, the doctors who carry out these procedures are not fully qualified or competent enough. Being an illegal practice in Oman; abortion procedures are only carried out by unlicensed doctors because they are not qualified enough to undertake a legal practice.
Instead of endangering lives trying to have unsafe abortion procedures in Oman, Indian and well as expat women can seek better abortion care in places such as India. Abortion is legal in India and American Hospital Bangalore is one of the places where women can get high quality and affordable abortion services.
We have well trained doctors who are complimented with state of the art equipment and thus you can be sure to get nothing but the best medical care.
Patients can get in touch with the hospital today by calling or WhatsApp at +91 934 382 6182 or +91 900 849 2277 and speak directly to a doctor!
« An Inside Look At The Abortion Laws In Oman
Author: omanabortion
An Inside Look At The Abortion Laws In Oman
Choosing The Best Abortion Hospital in Muscat Oman
Abortion Pills in Oman Explained
Abortion Information
American Hospital
10/4 Queens Road,
Located near Shivajinagar/ Cunningham Road Area,
Near Indian Express Building: Queens Road/ Cunningham Road intersection.
Landmarks: Between Cantonment railway station and Indian Express circle. Close to the Congress party office on Queens Road.
Abortion In Oman| Safe Abortion In Oman | Abortion Pills In Oman | Abortion Pills Available In Oman | Abortion Clinics In Oman | Abortion Clinic In Oman | Safe Abortion In Oman | Abortion Doctors In Oman | Abortions Hospitals In Oman | Abortion In Oman Hospital | Oman Abortion Clinics | Abortion Pill Oman | Private Abortion Clinic In Oman | Medical Abortion In Oman | Medicine For Abortion In Oman
Copyright © 2020 www.omanabortion.com. American Hospital Bangalore: Genesis subsidiary. All Rights Reserved. Disclaimer: The content on this website is for informational purposes only and not a substitute for individual diagnosis or medical advice by a qualified medical professional. Expats and Indian patients visit the hospital for safe and legal MTP procedures at the hospital in Bangalore, India only. Note: American Hospital is a certified MTP (Medical termination of pregnancy) clinic in accordance with the MTP Act of India and strictly abides by the MTP and PCPNDT Act of India. All procedures are provided by experienced gynecologists in accordance with The World Health Organization methods and standards.
|
cc/2020-05/en_middle_0087.json.gz/line1341137
|
__label__cc
| 0.732889
| 0.267111
|
HomePosts tagged 'afghan'
Swedish mother gang raped by three “child” refugees – They even took photos
May 4, 2018 greenteeth europe, Immigration, Uncategorized afghan, rape, refugees, sweden
A married woman from Kalmar, Sweden was gang raped by three Afghans who had been admitted to Sweden as “child refugees,” after a dinner party, Fria Tider reports. The trio violently assaulted and took turns to rape the woman as the took a stroll following her dinner. They taunted and raped her taking extremely graphic photos of the assault and videoing her reactions during the attack.
In September 2017 the woman, a mother of a toddler, had hosted a dinner party at her and her husband’s residence in Kalmar. In the evening she took a walk and when she began to feel unwell, she rang her husband. Just after that the refugee “children” appeared and began following her.
Having followed her for a short distance, they attacked her and forced her down a small road. “They laughed at me like it was fun. They pulled down my trousers and panties”, the victim said during the trial.
The three Afghans all raped her. Fortunately for her, she was later found by the police, who had been contacted by her troubled husband.
When the woman got home from hospital she was in terrible condition. “I hope I never see her like that again”, said the husband during the trial.
Read More: Swedish mother of toddler gang raped by three “child” refugees – They even took photos
“Never Seen Anything Like This Before” – Sweden Stunned At “Unreal” Surge In Refugee Sex Attacks
Sweden’s Migrant Crackdown Could Spell The End Of Open Borders Across Europe
WTF Is Going On In Sweden?
In Loony Left Wing Sweden Asking Immigrants To Obey The Law Is Racist
AK47 Assault Rifles Used in Sweden Pub Attack, Death Toll Expected to Rise
Multiculturalism Today: Child Marriage, Honour Killings, Sharia Law Zones, & ‘Punishment’ Gang Rapes
As we have reported many times over the past year, Sweden has been more hard hit by the crimes and lawlessness of illegal immigrants from primitive third world societies than anywhere else in Europe. Even the Sweden hating socialists cannot ignore the epidemic of rape crimes, assaults and the general contempt for Swedish society, law, culture and traditions that illegal immigrants from Africa and the middle east have expressed through their actions.
A Week Of ‘Islamic Multiculturalism’ In Sweden – Rapes, Acquittals, & Severed Heads
(This all happened in Sweden, that beacon of multiculturalism and human rights.) Some 30 Muslim men thought that the woman was in violation of Islamic sharia law, by being in Sweden unaccompanied by a man. They thought that she should therefore be raped and her teenage son killed. Sometime during the night, the victim was awakened by the Iraqi as he raped her. The woman managed to break free and locate a train attendant. At first, the woman did not want to call the police. “She felt sorry for him [the rapist] … and was afraid he would be deported back to Iraq.”
Convert Or Be Beheaded’ – Chilling Message Posted Through Doors Across Sweden
The notes, which are signed “ISIS”, say that any non-believers will be decapitated unless they convert or pay a “jizya” (religious tax). They have been posted through letterboxes in several cities including the capital Stockholm. They carry the Islamic State banner and claim the police “will not save you from being murdered”.
Warring Migrant Tribes, Street Shootouts, Grenade Attacks, Government Says Its Multiculturalism? WTF Is Going On In Sweden?
“Sweden, that’s where they commit suicide and the king rides a bicycle,” a character in an Alan Bennet play famously said back in the 1980s, a reference to Sweden’s reputation as the most boring country in the world. That reputation has long gone, the elegant streets of Sweden’s gothic styled cities are now more like Chicago in the Al Capone era. Scandinavia’s biggest nation state is in the grip of a terrifying crime wave instead …
Former Portugese Leaders Calls For A Debt Default
Mario Soares, the former Portugese first minister has sponen out against austerity measures imposed by the E U and called on Portugese politicians to opt for an Argentine style default.
Obama Talks The Talk But Dare Not Visit Afghanistan In Daylight
May 2, 2012 greenteeth Uncategorized afghan, afghanistan, barac, bin laden, kabul, news, obama, satire, taliban
from the Boggart Blog newsdesk:
Todays mainstream news papers and broadcast bulletins are full of the Superhero Barack Obama’s daredevil visit to Afghanistan. The man who liberated Libya single handed and took out Osama Bin Laden (or a Pakistani penioner with a beard) in a daring solo raid behind enemy lines stormed into the Afghan capital, Kabul, made a speech that left hundreds of Taliban fighters dead and saw others fleeing for the mountains with their arses on fire then left again all in the space of fifteen minutes. He would have stayed longer but had to get back, put out a forest fire, shore up a mountainside that was about to collapse, catch a kid who had fallen over the rail and was about to plunge into the Niagra rapids and stop a huge dam from bursting and washing away several small communities in Coloado.
No, but seriously folks …
After landing at Bagram Airbase around 10pm local time, the Prez – Dude was delivered by a low-level, cover-of-darkness “helicopter insertion” (he got arse fucked by a helicopter? Now wonder the limp wristed one was smiling) to the Presidential Palace where a ten-page proposal which contains no specifics on funding or troop levels was signed around midnight.
So secret was the visit that the White House spent the day frantically trying to deny leaked news of Obama’s imminent arrival after the puppet government in Kabul blabbed to western media. This was yet another example of seamless co-operation between Afghan and Coalition governments that perfectly ilustrates the readiness of President Khazi’s government to provide stability and security after the allied withdrawal..
After the signing, there was just time for Mr Obama to duck into a hangar and make a rousing address to the bewildered troops who have a big enough problrem trying to anticipate which direction the next enemy attack will next come from without having to worry about which direction the next visit by Obama, Cameron or Sarkozy will come from. Then he made an address to the American nation reminding them how he was single handedly routing the Taliban on a daily basis. This was, of course, another perfect excuse for the President to remind everyone of his heroic decision to leave the golf course and sit in a corner of the Situation Room as the Navy SEALs hit the alleged terrorist compund a year ago.
Obama’s autocue, said by many to be the real voice of the Presidency, is a past master at makeing a vitue out of absurdity, and this occasion was no exception as The One mouthed meaningless cliches about new light breaking on the horizon for Afghanistan, even as he gestured to the pre-dawn darkness in which he was speaking. Even the Presidential autocue’s rhetorical skills couldnt disguise the tail-between-the-legs optics of the event. It was as big a public disaster as news of the Administration’s billion – dollar gift to the Taliban or Michelle Obama’s $30,000 spending spree in posh knicker shop Agent Provocateur.
Administration officials tried to suggest that the visits unusual timing was for the benefit of the US TV networks, a piece of spin so feeble it does not merit a response.
There is no doubting the wisdom of the Presidents security advisors in keeping the visit secret and under cover of darkness, it is only two weeks ago that the Haqqani network mounted a co-ordinated 18-hour assault on the heart of Kabul. Unfortunaterly despite the gung ho speech the message of this trip was clear and will not be missed by the west’s enemies: after a decade of expending blood and money in Afghanistan, the US President does not dare visit the place broad daylight.
Obama says Britain should give The Maldives back to Argentina
What’s in a name like Rsandy bumgardner
Boggart Blog reveals Cameron and Obama’s Afghan exit strategy
B Movie Actor slams Britain over Falklands
Boggart Blog Reveals Cameron / Obama Afghan Exit Strategy
March 13, 2012 greenteeth Uncategorized afghan, afghanistan, cameron, obama, soldiers, war
It is widely predicted that plans for UK and US troops to leave their combat role in Afghanistan next year, are expected to be high on the agenda when David Cameron meets Barack Obama this week.
Boggart Blog can exclusively reveal the strategy the allies will adopt to get out of Afghanistan without actually admitting the two most high tech military powers in the world got their arses kicked by a bunch of bearded ragheads.
Click link to see video.
Sadly the time has long passed when the allies could have made their exit with honour, the war was a farrago from its outset and in the last few years has become a debacle. We can only say the dishonour of defeat and surrender falls on the politicians and bureaucrats. The soldiers who served there, who have risked and lost their lives in that blighted land deserves our total respect and the full support of their governments as they try to adjust to civilian life after their experiences.
Obama Talks The Talk But Dare Not Visit Afghnistan In Daylight
Afghan War: Brown Pledges To Support Taliban
January 28, 2010 greenteeth Uncategorized afghan, afghanistan, blog, gordon brown, humour, politicians, politics, war, weapons
Just when you thought politicians could not possibly get more stupid one of the breed goes and does something so moronic that you are left gobsmacked again.
We refer of course to the announcement by Gordon Brown of a new fund that will be used by British military personnel to pay off Taliban fighters who give up their weapons and renounce violence.
Given the track record of Afghans for fighting anybody and everybody all the time, often changing sides in a war because someone has offered them more money, we are again astounded that Gordon Brown and his advisers at the Foreign Office and the Ministry of Defence once again refuse to see what is staring them in the fucking face.
The Taliban fighters will stampede to give up their WW2 rifles or AK47s stolen during the Russian occupation.
I renounce violence, heres my gun now give me the money. they will say. Then, trousering the cash they will vamos mucho quicko to the local illegal arms dealer to buy a better gun stolen only recently from the Americans.
What a way to fight a war.
Creepy and Evil Christmas Pressies
December 12, 2009 greenteeth Uncategorized afghan, blog, children, christmas, climate, copenhagen, humour, michael jackson, present, santa, stig, t shirt, war
Jenny Greenteeth spent most of yesterday organising the Boggart Blog Editorial Team secret Santa thinly which got the rest of us so excited we spent most of the afternoon ignoring the Copenhagen Climate Change Conference, The Afghan War and Chancellor darlings Pre Budget Report or while we looked for silly and quirky pressies we could get each other.
Top of the list for sheer questionable taste was The Michael Quackson rubber duck (£6.99 from totally-funky.co.uk) a Whacko Jacko toy you put in the bath with very young, naked children. Dont wrinkle your nose at the tackiness and exploitativeness of the idea, it is what Michael would have wanted after all.
Craziest and possibly the most frightening present on offer is a life size cardboard cut-out of Top Gear hero The Stig from halfords.com. Imagine waking up at three a.m. and in the half light seeing one of those standing over you as you lie in bed. You would never make it to the toilet.
Without a doubt the most evil gift available this Christmas though, a gift so evil Baldrick, it could only have been devised by Dr. Evils even more evil twin Dr. Even-more-evil-than-Dr-Evil Evil the chief professor of evil at the Academy of All Evil Things in Evilville, a gift so evil it is probably the most evil thing ever devised by the human mind, an ideal gift for the person you hate most in the world so we are all going to chip in and send a dozen to Tony Blair, is a Jedward T Shirt, £6 from etsy.com.
More humour every day at Boggart Blog
Solstice Fires
Obama And Brown Hounded By Afghan Del Boy Brigade.
December 2, 2009 greenteeth Uncategorized afghan, afghanistan, blog, brown, humour, obama, taliban, war
Barack Obama has finally announced what we all knew back in August and even Gordon Brown knew last week. America is sensing (I meant sending) more troops to Afghanistan, an additional 30,000 soldiers in fact. 9,000 are setting off later this week.
Lets hope they all get their in time for Christmas so they can have a good Turkey dinner before they become targets in the Taliban turkey shoot.
Far from being pissed off about Obamas decision and his appeal to other NATO countries to send a few extra people as well, Taliban leaders have said they are very happy with the arrangement. This might surprise people who have not closely followed events in Afghanistan, the consensus among pundits is if the coalition of the desperate pulled out the Taliban would be back in power within weeks. So why would they be pleased to prolong the war?
Boggart Blog reported last week the main supply route for allied bases is through the Khyber Pass and the Hindu Kush mountains. NATO supply convoys must travel a narrow mountain road that has always been vulnerable to attack by local tribesmen. Now the attacks are carried out by Taliban fighters and gangs working for local warlords. 70% of the supplies bound for American, British and NATO bases are being stolen by the enemy.
Obama and his sycophantic sidekicks see this latest troop surge as the final push to win the war and the defining decision of the Obama Presidency. The Taliban see continued resistance as good business.
Anyone who wants to buy a rocket propelled grenade launcher, American manufactured, never previously used, good price for cash, no cheques or plastic, no VAT, should contact Taliban Independent Trading.
Harrassed In The Hindu Kush
Afghan War Escalates
Another Afghanistan Fiasco
Myths Of The Afghan War
November 26, 2009 greenteeth Uncategorized afghan, afghanistan, blog, humour, taliban
Barack Obama is rehearsing the speech in which he will tell the American due to the brilliant success of his stategy he can now announce victory in the war and another 30,000 troops are being sent to Afghanistan to help organise the celebrations. Mean while Boggart Blog has learned a little more of how bad things are out there.
The main supply route is through the Hindu Kush mountains where Taliban fighters, bandits and tribal warlords are attacking the convoys and stealing 70% of the supplies.
Sending more troops will only mean we have to send more stuff for the Taliban to steal. No doubt if they can’t use it all themselves they will be selling it back to us.
Talk about being shafted up the Khyber Pass.
Afghan Woman
|
cc/2020-05/en_middle_0087.json.gz/line1341141
|
__label__wiki
| 0.532378
| 0.532378
|
Chapter 1. An Introduction to the Human Body
1.1 How Structure Determines Function
1.2 Structural Organization of the Human Body
1.3 Homeostasis
1.4 Anatomical Terminology
1.5 Medical Imaging
Chapter 2. The Chemical Level of Organization
2.1 Elements and Atoms: The Building Blocks of Matter
2.2 Chemical Bonds
2.3 Chemical Reactions
2.4 Inorganic Compounds Essential to Human Functioning
2.5 Organic Compounds Essential to Human Functioning
Chapter 3. The Cellular Level of Organization
3.1 The Cell Membrane
3.2 The Cytoplasm and Cellular Organelles
3.3 The Nucleus and DNA Replication
3.4 Protein Synthesis
3.5 Cell Growth and Division
3.6 Cellular Differentiation
Chapter 4. The Tissue Level of Organization
4.1 Types of Tissues
4.2 Epithelial Tissue
4.3 Connective Tissue Supports and Protects
4.4 Muscle Tissue
4.5 Nervous Tissue
4.6 Tissue Injury and Aging
Chapter 5. The Integumentary System
5.1 Layers of the Skin
5.2 Accessory Structures of the Skin
5.3 Functions of the Integumentary System
5.4 Diseases, Disorders, and Injuries of the Integumentary System
Chapter 6. Bone Tissue and the Skeletal System
6.1 The Functions of the Skeletal System
6.2 Bone Classification
6.3 Bone Structure
6.4 Bone Formation and Development
6.5 Fractures: Bone Repair
6.6 Exercise, Nutrition, Hormones, and Bone Tissue
6.7 Calcium Homeostasis: Interactions of the Skeletal System and Other Organ Systems
Chapter 7. Axial Skeleton
7.1 Divisions of the Skeletal System
7.2 Bone Markings
7.3 The Skull
7.4 The Vertebral Column
7.5 The Thoracic Cage
7.6 Embryonic Development of the Axial Skeleton
Chapter 8. The Appendicular Skeleton
8.1 The Pectoral Girdle
8.2 Bones of the Upper Limb
8.3 The Pelvic Girdle and Pelvis
8.4 Bones of the Lower Limb
8.5 Development of the Appendicular Skeleton
Chapter 9. Joints
9.1 Classification of Joints
9.2 Fibrous Joints
9.3 Cartilaginous Joints
9.4 Synovial Joints
9.5 Types of Body Movements
9.6 Anatomy of Selected Synovial Joints
9.7 Development of Joints
Chapter 10. Muscle Tissue
10.1 Overview of Muscle Tissues
10.2 Skeletal Muscle
10.3 Muscle Fiber Excitation, Contraction, and Relaxation
10.4 Nervous System Control of Muscle Tension
10.5 Types of Muscle Fibers
10.6 Exercise and Muscle Performance
10.7 Smooth Muscle Tissue
10.8 Development and Regeneration of Muscle Tissue
Chapter 11. The Muscular System
11.1 Describe the roles of agonists, antagonists and synergists
11.2 Explain the organization of muscle fascicles and their role in generating force
11.3 Explain the criteria used to name skeletal muscles
11.4 Identify the skeletal muscles and give their origins, insertions, actions and innervations
Chapter 12. The Nervous System and Nervous Tissue
12.1 Structure and Function of the Nervous System
12.2 Nervous Tissue
12.3 The Function of Nervous Tissue
12.4 Communication Between Neurons
12.5 The Action Potential
Chapter 13. The Peripheral Nervous System
13.1 Sensory Receptors
13.2 Ganglia and Nerves
13.3 Spinal and Cranial Nerves
13.4 Relationship of the PNS to the Spinal Cord of the CNS
13.5 Ventral Horn Output and Reflexes
13.6 Testing the Spinal Nerves (Sensory and Motor Exams)
13.7 The Cranial Nerve Exam
Chapter 14. The Central Nervous System
14.1 Embryonic Development
14.2 Blood Flow the meninges and Cerebrospinal Fluid Production and Circulation
14.3 The Brain and Spinal Cord
14.4 The Spinal Cord
14.5 Sensory and Motor Pathways
Chapter 15. The Special Senses
15.1 Taste
15.2 Smell
15.4 Equilibrium
15.5 Vision
Chapter 16. The Autonomic Nervous System
16.1 Divisions of the Autonomic Nervous System
16.2 Autonomic Reflexes and Homeostasis
16.3 Central Control
16.4 Drugs that Affect the Autonomic System
Chapter 17. The Endocrine System
17.1 An Overview of the Endocrine System
17.2 Hormones
17.3 The Pituitary Gland and Hypothalamus
17.4 The Thyroid Gland
17.5 The Parathyroid Glands
17.6 The Adrenal Glands
17.7 The Pineal Gland
17.8 Gonadal and Placental Hormones
17.9 The Pancreas
17.10 Organs with Secondary Endocrine Functions
17.11 Development and Aging of the Endocrine System
Chapter 18. The Cardiovascular System: Blood
18.1 Functions of Blood
18.2 Production of the Formed Elements
18.3 Erythrocytes
18.4 Leukocytes and Platelets
18.6 Blood Typing
Chapter 19. The Cardiovascular System: The Heart
19.1 Heart Anatomy
19.2 Cardiac Muscle and Electrical Activity
19.3 Cardiac Cycle
19.4 Cardiac Physiology
19.5 Development of the Heart
Chapter 20. The Cardiovascular System: Blood Vessels and Circulation
20.1 Structure and Function of Blood Vessels
20.2 Blood Flow, Blood Pressure, and Resistance
20.3 Capillary Exchange
20.4 Homeostatic Regulation of the Vascular System
20.5 Circulatory Pathways
20.6 Development of Blood Vessels and Fetal Circulation
Chapter 21. The Lymphatic and Immune System
21.1 Anatomy of the Lymphatic and Immune Systems
21.2 Barrier Defenses and the Innate Immune Response
21.3 The Adaptive Immune Response: T lymphocytes and Their Functional Types
21.4 The Adaptive Immune Response: B-lymphocytes and Antibodies
21.5 The Immune Response against Pathogens
21.6 Diseases Associated with Depressed or Overactive Immune Responses
21.7 Transplantation and Cancer Immunology
Chapter 22. The Respiratory System
22.1 Organs and Structures of the Respiratory System
22.2 The Lungs
22.3 The Process of Breathing
22.4 Gas Exchange
22.5 Transport of Gases
22.6 Modifications in Respiratory Functions
22.7 Embryonic Development of the Respiratory System
Chapter 23. The Digestive System
23.1 Overview of the Digestive System
23.2 Digestive System Processes and Regulation
23.3 The Mouth, Pharynx, and Esophagus
23.4 The Stomach
23.5 Accessory Organs in Digestion: The Liver, Pancreas, and Gallbladder
23.6 The Small and Large Intestines
23.7 Chemical Digestion and Absorption: A Closer Look
Chapter 24. Metabolism and Nutrition
24.1 Overview of Metabolic Reactions
24.2 Carbohydrate Metabolism
24.3 Lipid Metabolism
24.4 Protein Metabolism
24.5 Metabolic States of the Body
24.6 Energy and Heat Balance
24.7 Nutrition and Diet
Chapter 25. The Urinary System
25.1 Internal and External Anatomy of the Kidney
25.2 Microscopic Anatomy of the Kidney: Anatomy of the Nephron
25.3 Physiology of Urine Formation: Overview
25.4 Physiology of Urine Formation: Glomerular Filtration
25.5 Physiology of Urine Formation: Tubular Reabsorption and Secretion
25.6 Physiology of Urine Formation: Medullary Concentration Gradient
25.7 Physiology of Urine Formation: Regulation of Fluid Volume and Composition
25.8 Urine Transport and Elimination
25.9 The Urinary System and Homeostasis
Chapter 26. Fluid, Electrolyte, and Acid-Base Balance
26.1 Body Fluids and Fluid Compartments
26.2 Water Balance
26.3 Electrolyte Balance
26.4 Acid-Base Balance
26.5 Disorders of Acid-Base Balance
Chapter 27. The Sexual Systems
27.1 Anatomy of Sexual Systems
27.2 Development of Sexual Anatomy
27.3 Physiology of the Female Sexual System
27.4 Physiology of the Male Sexual System
27.5 Physiology of Arousal and Orgasm
Chapter 28. Development and Inheritance
28.1 Fertilization
28.3 Fetal Development
28.4 Maternal Changes During Pregnancy, Labor, and Birth
28.5 Adjustments of the Infant at Birth and Postnatal Stages
28.6 Lactation
28.7 Patterns of Inheritance
List the structures that make up the respiratory system
Describe how the respiratory system processes oxygen and CO2
Compare and contrast the functions of upper respiratory tract with the lower respiratory tract
The major organs of the respiratory system function primarily to provide oxygen to body tissues for cellular respiration, remove the waste product carbon dioxide, and help to maintain acid-base balance. Portions of the respiratory system are also used for non-vital functions, such as sensing odors, speech production, and for straining, such as during childbirth or coughing (Figure 22.1.1).
Figure 22.1.1 – Major Respiratory Structures: The major respiratory structures span the nasal cavity to the diaphragm.
Functionally, the respiratory system can be divided into a conducting zone and a respiratory zone. The conducting zone of the respiratory system includes the organs and structures not directly involved in gas exchange. The gas exchange occurs in the respiratory zone.
Conducting Zone
The major functions of the conducting zone are to provide a route for incoming and outgoing air, remove debris and pathogens from the incoming air, and warm and humidify the incoming air. Several structures within the conducting zone perform other functions as well. The epithelium of the nasal passages, for example, is essential to sensing odors, and the bronchial epithelium that lines the lungs can metabolize some airborne carcinogens.
The Nose and its Adjacent Structures
The major entrance and exit for the respiratory system is through the nose. When discussing the nose, it is helpful to divide it into two major sections: the external nose, and the nasal cavity or internal nose.
The external nose consists of the surface and skeletal structures that result in the outward appearance of the nose and contribute to its numerous functions (Figure 22.1.2). The root is the region of the nose located between the eyebrows. The bridge is the part of the nose that connects the root to the rest of the nose. The dorsum nasi is the length of the nose. The apex is the tip of the nose. On either side of the apex, the nostrils are formed by the alae (singular = ala). An ala is a cartilaginous structure that forms the lateral side of each naris (plural = nares), or nostril opening. The philtrum is the concave surface that connects the apex of the nose to the upper lip.
Figure 22.1.2 – Nose: This illustration shows features of the external nose (top) and skeletal features of the nose (bottom).
Underneath the thin skin of the nose are its skeletal features (see Figure 22.1.2, lower illustration). While the root and bridge of the nose consist of bone, the protruding portion of the nose is composed of cartilage. As a result, when looking at a skull, the nose is missing. The nasal bone is one of a pair of bones that lies under the root and bridge of the nose. The nasal bone articulates superiorly with the frontal bone and laterally with the maxillary bones. Septal cartilage is flexible hyaline cartilage connected to the nasal bone, forming the dorsum nasi. The alar cartilage consists of the apex of the nose; it surrounds the naris.
The nares open into the nasal cavity, which is separated into left and right sections by the nasal septum (Figure 22.1.3). The nasal septum is formed anteriorly by a portion of the septal cartilage (the flexible portion you can touch with your fingers) and posteriorly by the perpendicular plate of the ethmoid bone (a cranial bone located just posterior to the nasal bones) and the thin vomer bones (whose name refers to its plough shape). Each lateral wall of the nasal cavity has three bony projections, called the superior, middle, and inferior nasal conchae. The inferior conchae are separate bones, whereas the superior and middle conchae are portions of the ethmoid bone. Conchae serve to increase the surface area of the nasal cavity and to disrupt the flow of air as it enters the nose, causing air to bounce along the epithelium, where it is cleaned and warmed. The conchae and meatuses also conserve water and prevent dehydration of the nasal epithelium by trapping water during exhalation. The floor of the nasal cavity is composed of the palate. The hard palate at the anterior region of the nasal cavity is composed of bone. The soft palate at the posterior portion of the nasal cavity consists of muscle tissue. Air exits the nasal cavities via the internal nares and moves into the pharynx.
Figure 22.1.3 Upper Airway
Several bones that help form the walls of the nasal cavity have air-containing spaces called the paranasal sinuses, which serve to warm and humidify incoming air. Sinuses are lined with a mucosa. Each paranasal sinus is named for its associated bone: frontal sinus, maxillary sinus, sphenoidal sinus, and ethmoidal sinus. The sinuses produce mucus and lighten the weight of the skull.
The nares and anterior portion of the nasal cavities are lined with mucous membranes, containing sebaceous glands and hair follicles that serve to prevent the passage of large debris, such as dirt, through the nasal cavity. An olfactory epithelium used to detect odors is found deeper in the nasal cavity.
The conchae, meatuses, and paranasal sinuses are lined by respiratory epithelium composed of pseudostratified ciliated columnar epithelium (Figure 22.1.4). The epithelium contains goblet cells, one of the specialized, columnar epithelial cells that produce mucus to trap debris. The cilia of the respiratory epithelium help remove the mucus and debris from the nasal cavity with a constant beating motion, sweeping materials towards the throat to be swallowed. Interestingly, cold air slows the movement of the cilia, resulting in accumulation of mucus that may in turn lead to a runny nose during cold weather. This moist epithelium functions to warm and humidify incoming air. Capillaries located just beneath the nasal epithelium warm the air by convection. Serous and mucus-producing cells also secrete the lysozyme enzyme and proteins called defensins, which have antibacterial properties. Immune cells that patrol the connective tissue deep to the respiratory epithelium provide additional protection.
Figure 22.1.4 – Pseudostratified Ciliated Columnar Epithelium: Respiratory epithelium is pseudostratified ciliated columnar epithelium. Seromucous glands provide lubricating mucus. LM × 680. (Micrograph provided by the Regents of University of Michigan Medical School © 2012)
External Website
View the University of Michigan WebScope at http://141.214.65.171/Histology/Basic%20Tissues/Epithelium%20and%20CT/040_HISTO_40X.svs/view.apml? to explore the tissue sample in greater detail.
The pharynx is a tube formed by skeletal muscle and lined by mucous membrane that is continuous with that of the nasal cavities (see Figure 22.1.3). The pharynx is divided into three major regions: the nasopharynx, the oropharynx, and the laryngopharynx (Figure 22.1.5).
Figure 22.1.5 – Divisions of the Pharynx: The pharynx is divided into three regions: the nasopharynx, the oropharynx, and the laryngopharynx.
The nasopharynx is flanked by the conchae of the nasal cavity, and it serves only as an airway. At the top of the nasopharynx are the pharyngeal tonsils. A pharyngeal tonsil, also called an adenoid, is an aggregate of lymphoid reticular tissue similar to a lymph node that lies at the superior portion of the nasopharynx. The function of the pharyngeal tonsil is not well understood, but it contains a rich supply of lymphocytes and is covered with ciliated epithelium that traps and destroys invading pathogens that enter during inhalation. The pharyngeal tonsils are large in children, but interestingly, tend to regress with age and may even disappear. The uvula is a small bulbous, teardrop-shaped structure located at the apex of the soft palate. Both the uvula and soft palate move like a pendulum during swallowing, swinging upward to close off the nasopharynx to prevent ingested materials from entering the nasal cavity. In addition, auditory (Eustachian) tubes that connect to each middle ear cavity open into the nasopharynx. This connection is why colds often lead to ear infections.
The oropharynx is a passageway for both air and food. The oropharynx is bordered superiorly by the nasopharynx and anteriorly by the oral cavity. The fauces is the opening at the connection between the oral cavity and the oropharynx. As the nasopharynx becomes the oropharynx, the epithelium changes from pseudostratified ciliated columnar epithelium to stratified squamous epithelium. The oropharynx contains two distinct sets of tonsils, the palatine and lingual tonsils. A palatine tonsil is one of a pair of structures located laterally in the oropharynx in the area of the fauces. The lingual tonsil is located at the base of the tongue. Similar to the pharyngeal tonsil, the palatine and lingual tonsils are composed of lymphoid tissue, and trap and destroy pathogens entering the body through the oral or nasal cavities.
The laryngopharynx is inferior to the oropharynx and posterior to the larynx. It continues the route for ingested material and air until its inferior end, where the digestive and respiratory systems diverge. The stratified squamous epithelium of the oropharynx is continuous with the laryngopharynx. Anteriorly, the laryngopharynx opens into the larynx, whereas posteriorly, it enters the esophagus.
The larynx is a cartilaginous structure inferior to the laryngopharynx that connects the pharynx to the trachea and helps regulate the volume of air that enters and leaves the lungs (Figure 22.1.6). The structure of the larynx is formed by several pieces of cartilage. Three large cartilage pieces—the thyroid cartilage (anterior), epiglottis (superior), and cricoid cartilage (inferior)—form the major structure of the larynx. The thyroid cartilage is the largest piece of cartilage that makes up the larynx. The thyroid cartilage consists of the laryngeal prominence, or “Adam’s apple,” which tends to be more prominent in males. The thick cricoid cartilage forms a ring, with a wide posterior region and a thinner anterior region. Three smaller, paired cartilages—the arytenoids, corniculates, and cuneiforms—attach to the epiglottis and the vocal cords and muscle that help move the vocal cords to produce speech.
Figure 22.1.6 – Larynx: The larynx extends from the laryngopharynx and the hyoid bone to the trachea.
The epiglottis, attached to the thyroid cartilage, is a very flexible piece of elastic cartilage that covers the opening of the trachea (see Figure 22.1.3). When in the “closed” position, the unattached end of the epiglottis rests on the glottis. The glottis is composed of the vestibular folds, the true vocal cords, and the space between these folds (Figure 22.1.7). A vestibular fold, or false vocal cord, is one of a pair of folded sections of mucous membrane. A true vocal cord is one of the white, membranous folds attached by muscle to the thyroid and arytenoid cartilages of the larynx on their outer edges. The inner edges of the true vocal cords are free, allowing oscillation to produce sound. The size of the membranous folds of the true vocal cords differs between individuals, producing voices with different pitch ranges. Folds in males tend to be larger than those in females, which create a deeper voice. The act of swallowing causes the pharynx and larynx to lift upward, allowing the pharynx to expand and the epiglottis of the larynx to swing downward, closing the opening to the trachea. These movements produce a larger area for food to pass through, while preventing food and beverages from entering the trachea.
Figure 22.1.7 – Vocal Cords: The true vocal cords and vestibular folds of the larynx are viewed inferiorly from the laryngopharynx.
Continuous with the laryngopharynx, the superior portion of the larynx is lined with stratified squamous epithelium, transitioning into pseudostratified ciliated columnar epithelium that contains goblet cells. Similar to the nasal cavity and nasopharynx, this specialized epithelium produces mucus to trap debris and pathogens as they enter the trachea. The cilia beat the mucus upward towards the laryngopharynx, where it can be swallowed down the esophagus.
The trachea (windpipe) extends from the larynx toward the lungs (Figure 22.1.8a). The trachea is formed by 16 to 20 stacked, C-shaped pieces of hyaline cartilage that are connected by dense connective tissue. The trachealis muscle and elastic connective tissue together form the fibroelastic membrane, a flexible membrane that closes the posterior surface of the trachea, connecting the C-shaped cartilages. The fibroelastic membrane allows the trachea to stretch and expand slightly during inhalation and exhalation, whereas the rings of cartilage provide structural support and prevent the trachea from collapsing. In addition, the trachealis muscle can be contracted to force air through the trachea during exhalation. The trachea is lined with pseudostratified ciliated columnar epithelium, which is continuous with the larynx. The esophagus borders the trachea posteriorly.
Figure 22.1.8 – Trachea: (a) The tracheal tube is formed by stacked, C-shaped pieces of hyaline cartilage. (b) The layer visible in this cross-section of tracheal wall tissue between the hyaline cartilage and the lumen of the trachea is the mucosa, which is composed of pseudostratified ciliated columnar epithelium that contains goblet cells. LM × 1220. (Micrograph provided by the Regents of University of Michigan Medical School © 2012)
Bronchial Tree
The trachea branches into the right and left primary bronchi at the carina. These bronchi are also lined by pseudostratified ciliated columnar epithelium containing mucus-producing goblet cells (Figure 22.1.8b). The carina is a raised structure that contains specialized nervous tissue that induces violent coughing if a foreign body, such as food, is present. Rings of cartilage, similar to those of the trachea, support the structure of the bronchi and prevent their collapse. The primary bronchi enter the lungs at the hilum, a concave region where blood vessels, lymphatic vessels, and nerves also enter the lungs. The bronchi continue to branch into bronchial a tree. A bronchial tree (or respiratory tree) is the collective term used for these multiple-branched bronchi. The main function of the bronchi, like other conducting zone structures, is to provide a passageway for air to move into and out of each lung. In addition, the mucous membrane traps debris and pathogens.
A bronchiole branches from the tertiary bronchi. Bronchioles, which are about 1 mm in diameter, further branch until they become the tiny terminal bronchioles, which lead to the structures of gas exchange. There are more than 1000 terminal bronchioles in each lung. The muscular walls of the bronchioles do not contain cartilage like those of the bronchi. This muscular wall can change the size of the tubing to increase or decrease airflow through the tube.
Respiratory Zone
In contrast to the conducting zone, the respiratory zone includes structures that are directly involved in gas exchange. The respiratory zone begins where the terminal bronchioles join a respiratory bronchiole, the smallest type of bronchiole (Figure 22.1.9), which then leads to an alveolar duct, opening into a cluster of alveoli.
Figure 22.1.9 – Respiratory Zone: Bronchioles lead to alveolar sacs in the respiratory zone, where gas exchange occurs.
An alveolar duct is a tube composed of smooth muscle and connective tissue, which opens into a cluster of alveoli. An alveolus is one of the many small, grape-like sacs that are attached to the alveolar ducts.
An alveolar sac is a cluster of many individual alveoli that are responsible for gas exchange. An alveolus is approximately 200 μm in diameter with elastic walls that allow the alveolus to stretch during air intake, which greatly increases the surface area available for gas exchange. Alveoli are connected to their neighbors by alveolar pores, which help maintain equal air pressure throughout the alveoli and lung (Figure 22.1.10).
Figure 22.1.10 – Structures of the Respiratory Zone: (a) The alveolus is responsible for gas exchange. (b) A micrograph shows the alveolar structures within lung tissue. LM × 178. (Micrograph provided by the Regents of University of Michigan Medical School © 2012)
The alveolar wall consists of three major cell types: type I alveolar cells, type II alveolar cells, and alveolar macrophages. A type I alveolar cell is a squamous epithelial cell of the alveoli, which constitute up to 97 percent of the alveolar surface area. These cells are about 25 nm thick and are highly permeable to gases. A type II alveolar cell is interspersed among the type I cells and secretes pulmonary surfactant, a substance composed of phospholipids and proteins that reduces the surface tension of the alveoli. Roaming around the alveolar wall is the alveolar macrophage, a phagocytic cell of the immune system that removes debris and pathogens that have reached the alveoli.
The simple squamous epithelium formed by type I alveolar cells is attached to a thin, elastic basement membrane. This epithelium is extremely thin and borders the endothelial membrane of capillaries. Taken together, the alveoli and capillary membranes form a respiratory membrane that is approximately 0.5 mm thick. The respiratory membrane allows gases to cross by simple diffusion, allowing oxygen to be picked up by the blood for transport and CO2 to be released into the air of the alveoli.
Diseases of the…Respiratory System: Asthma
Asthma is common condition that affects the lungs in both adults and children. Approximately 8.2 percent of adults (18.7 million) and 9.4 percent of children (7 million) in the United States suffer from asthma. In addition, asthma is the most frequent cause of hospitalization in children.
Asthma is a chronic disease characterized by inflammation and edema of the airway, and bronchospasms (that is, constriction of the bronchioles), which can inhibit air from entering the lungs. In addition, excessive mucus secretion can occur, which further contributes to airway occlusion (Figure 22.1.11). Cells of the immune system, such as eosinophils and mononuclear cells, may also be involved in infiltrating the walls of the bronchi and bronchioles.
Bronchospasms occur periodically and lead to an “asthma attack.” An attack may be triggered by environmental factors such as dust, pollen, pet hair, or dander, changes in the weather, mold, tobacco smoke, and respiratory infections, or by exercise and stress.
Figure 22.1.11 – Normal and Bronchial Asthma Tissues: (a) Normal lung tissue does not have the characteristics of lung tissue during (b) an asthma attack, which include thickened mucosa, increased mucus-producing goblet cells, and eosinophil infiltrates.
Symptoms of an asthma attack involve coughing, shortness of breath, wheezing, and tightness of the chest. Symptoms of a severe asthma attack that requires immediate medical attention would include difficulty breathing that results in blue (cyanotic) lips or face, confusion, drowsiness, a rapid pulse, sweating, and severe anxiety. The severity of the condition, frequency of attacks, and identified triggers influence the type of medication that an individual may require. Longer-term treatments are used for those with more severe asthma. Short-term, fast-acting drugs that are used to treat an asthma attack are typically administered via an inhaler. For young children or individuals who have difficulty using an inhaler, asthma medications can be administered via a nebulizer.
In many cases, the underlying cause of the condition is unknown. However, recent research has demonstrated that certain viruses, such as human rhinovirus C (HRVC), and the bacteria Mycoplasma pneumoniae and Chlamydia pneumoniae that are contracted in infancy or early childhood, may contribute to the development of many cases of asthma.
Visit this site to learn more about what happens during an asthma attack. What are the three changes that occur inside the airways during an asthma attack?
Chapter Review
The respiratory system is responsible for obtaining oxygen and getting rid of carbon dioxide, and aiding in speech production and in sensing odors. From a functional perspective, the respiratory system can be divided into two major areas: the conducting zone and the respiratory zone. The conducting zone consists of all of the structures that provide passageways for air to travel into and out of the lungs: the nasal cavity, pharynx, trachea, bronchi, and most bronchioles. The nasal passages contain the conchae and meatuses that expand the surface area of the cavity, which helps to warm and humidify incoming air, while removing debris and pathogens. The pharynx is composed of three major sections: the nasopharynx, which is continuous with the nasal cavity; the oropharynx, which borders the nasopharynx and the oral cavity; and the laryngopharynx, which borders the oropharynx, trachea, and esophagus. The respiratory zone includes the structures of the lung that are directly involved in gas exchange: the terminal bronchioles and alveoli.
The lining of the conducting zone is composed mostly of pseudostratified ciliated columnar epithelium with goblet cells. The mucus traps pathogens and debris, whereas beating cilia move the mucus superiorly toward the throat, where it is swallowed. As the bronchioles become smaller and smaller, and nearer the alveoli, the epithelium thins and is simple squamous epithelium in the alveoli. The endothelium of the surrounding capillaries, together with the alveolar epithelium, forms the respiratory membrane. This is a blood-air barrier through which gas exchange occurs by simple diffusion.
Interactive Link Questions
Inflammation and the production of a thick mucus; constriction of the airway muscles, or bronchospasm; and an increased sensitivity to allergens.
Critical Thinking Questions
1. Describe the three regions of the pharynx and their functions.
2. If a person sustains an injury to the epiglottis, what would be the physiological result?
3. Compare and contrast the conducting and respiratory zones.
Bizzintino J, Lee WM, Laing IA, Vang F, Pappas T, Zhang G, Martin AC, Khoo SK, Cox DW, Geelhoed GC, et al. Association between human rhinovirus C and severity of acute asthma in children. Eur Respir J [Internet]. 2010 [cited 2013 Mar 22]; 37(5):1037–1042. Available from: http://erj.ersjournals.com/gca?submit=Go&gca=erj%3B37%2F5%2F1037&allch=
Kumar V, Ramzi S, Robbins SL. Robbins Basic Pathology. 7th ed. Philadelphia (PA): Elsevier Ltd; 2005.
Martin RJ, Kraft M, Chu HW, Berns, EA, Cassell GH. A link between chronic asthma and chronic infection. J Allergy Clin Immunol [Internet]. 2001 [cited 2013 Mar 22]; 107(4):595-601. Available from: http://erj.ersjournals.com/gca?submit=Go&gca=erj%3B37%2F5%2F1037&allch=
(plural = alae) small, flaring structure of a nostril that forms the lateral side of the nares
alar cartilage
cartilage that supports the apex of the nose and helps shape the nares; it is connected to the septal cartilage and connective tissue of the alae
alveolar duct
small tube that leads from the terminal bronchiole to the respiratory bronchiole and is the point of attachment for alveoli
alveolar macrophage
immune system cell of the alveolus that removes debris and pathogens
alveolar pore
opening that allows airflow between neighboring alveoli
alveolar sac
cluster of alveoli
alveolus
small, grape-like sac that performs gas exchange in the lungs
tip of the external nose
collective name for the multiple branches of the bronchi and bronchioles of the respiratory system
portion of the external nose that lies in the area of the nasal bones
branch of bronchi that are 1 mm or less in diameter and terminate at alveolar sacs
bronchus
tube connected to the trachea that branches into many subsidiaries and provides a passageway for air to enter and leave the lungs
region of the respiratory system that includes the organs and structures that provide passageways for air and are not directly involved in gas exchange
portion of the larynx composed of a ring of cartilage with a wide posterior region and a thinner anterior region; attached to the esophagus
dorsum nasi
intermediate portion of the external nose that connects the bridge to the apex and is supported by the nasal bone
epiglottis
leaf-shaped piece of elastic cartilage that is a portion of the larynx that swings to close the trachea during swallowing
external nose
region of the nose that is easily visible to others
fauces
portion of the posterior oral cavity that connects the oral cavity to the oropharynx
fibroelastic membrane
specialized membrane that connects the ends of the C-shape cartilage in the trachea; contains smooth muscle fibers
opening between the vocal folds through which air passes when producing speech
laryngeal prominence
region where the two lamina of the thyroid cartilage join, forming a protrusion known as “Adam’s apple”
laryngopharynx
portion of the pharynx bordered by the oropharynx superiorly and esophagus and trachea inferiorly; serves as a route for both air and food
cartilaginous structure that produces the voice, prevents food and beverages from entering the trachea, and regulates the volume of air that enters and leaves the lungs
lingual tonsil
lymphoid tissue located at the base of the tongue
meatus
one of three recesses (superior, middle, and inferior) in the nasal cavity attached to the conchae that increase the surface area of the nasal cavity
(plural = nares) opening of the nostrils
bone of the skull that lies under the root and bridge of the nose and is connected to the frontal and maxillary bones
nasal septum
wall composed of bone and cartilage that separates the left and right nasal cavities
portion of the pharynx flanked by the conchae and oropharynx that serves as an airway
portion of the pharynx flanked by the nasopharynx, oral cavity, and laryngopharynx that is a passageway for both air and food
palatine tonsil
one of the paired structures composed of lymphoid tissue located anterior to the uvula at the roof of isthmus of the fauces
paranasal sinus
one of the cavities within the skull that is connected to the conchae that serve to warm and humidify incoming air, produce mucus, and lighten the weight of the skull; consists of frontal, maxillary, sphenoidal, and ethmoidal sinuses
pharyngeal tonsil
structure composed of lymphoid tissue located in the nasopharynx
region of the conducting zone that forms a tube of skeletal muscle lined with respiratory epithelium; located between the nasal conchae and the esophagus and trachea
philtrum
concave surface of the face that connects the apex of the nose to the top lip
pulmonary surfactant
substance composed of phospholipids and proteins that reduces the surface tension of the alveoli; made by type II alveolar cells
respiratory bronchiole
specific type of bronchiole that leads to alveolar sacs
respiratory epithelium
ciliated lining of much of the conducting zone that is specialized to remove debris and pathogens, and produce mucus
respiratory membrane
alveolar and capillary wall together, which form an air-blood barrier that facilitates the simple diffusion of gases
includes structures of the respiratory system that are directly involved in gas exchange
region of the external nose between the eyebrows
thyroid cartilage
largest piece of cartilage that makes up the larynx and consists of two lamina
tube composed of cartilaginous rings and supporting tissue that connects the lung bronchi and the larynx; provides a route for air to enter and exit the lung
trachealis muscle
smooth muscle located in the fibroelastic membrane of the trachea
true vocal cord
one of the pair of folded, white membranes that have a free inner edge that oscillates as air passes through to produce sound
type I alveolar cell
squamous epithelial cells that are the major cell type in the alveolar wall; highly permeable to gases
type II alveolar cell
cuboidal epithelial cells that are the minor cell type in the alveolar wall; secrete pulmonary surfactant
part of the folded region of the glottis composed of mucous membrane; supports the epiglottis during swallowing
Answers for Critical Thinking Questions
The pharynx has three major regions. The first region is the nasopharynx, which is connected to the posterior nasal cavity and functions as an airway. The second region is the oropharynx, which is continuous with the nasopharynx and is connected to the oral cavity at the fauces. The laryngopharynx is connected to the oropharynx and the esophagus and trachea. Both the oropharynx and laryngopharynx are passageways for air and food and drink.
The epiglottis is a region of the larynx that is important during the swallowing of food or drink. As a person swallows, the pharynx moves upward and the epiglottis closes over the trachea, preventing food or drink from entering the trachea. If a person’s epiglottis were injured, this mechanism would be impaired. As a result, the person may have problems with food or drink entering the trachea, and possibly, the lungs. Over time, this may cause infections such as pneumonia to set in.
The conducting zone of the respiratory system includes the organs and structures that are not directly involved in gas exchange, but perform other duties such as providing a passageway for air, trapping and removing debris and pathogens, and warming and humidifying incoming air. Such structures include the nasal cavity, pharynx, larynx, trachea, and most of the bronchial tree. The respiratory zone includes all the organs and structures that are directly involved in gas exchange, including the respiratory bronchioles, alveolar ducts, and alveoli.
Previous: 22.0 Introduction
Next: 22.2 The Lungs
Anatomy & Physiology by Lindsay M. Biga, Sierra Dawson, Amy Harwell, Robin Hopkins, Joel Kaufmann, Mike LeMaster, Philip Matern, Katie Morrison-Graham, Devon Quick & Jon Runyeon is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License, except where otherwise noted.
|
cc/2020-05/en_middle_0087.json.gz/line1341151
|
__label__cc
| 0.659737
| 0.340263
|
Friends 3x16
The One the Morning After (2)
Ross tries to prevent Rachel from learning that he slept with Chloe, the copy store employee. When she finds out anyway and they go back to her apartment and have a fight, the other four friends are trapped in Monica’s bedroom, forced to listen in as Rachel decides to break up with Ross.
Friends season 3
The One with the Princess Leia Fantasy Sep 16, 1996
The One Where No One's Ready Sep 26, 1996
The One with the Jam Oct 03, 1996
The One With the Metaphorical Tunnel Oct 10, 1996
The One with Frank, Jr. Oct 17, 1996
The One with the Flashback Oct 31, 1996
The One With The Race Car Bed Nov 07, 1996
The One With The Giant Poking Device Nov 14, 1996
The One with the Football Nov 21, 1996
The One Where Rachel Quits Dec 12, 1996
The One Where Chandler Can't Remember Which Sister Jan 09, 1997
The One With All the Jealousy Jan 16, 1997
The One Where Monica And Richard Are Just Friends Jan 30, 1997
The One with Phoebe's Ex-Partner Feb 06, 1997
The One Where Ross and Rachel Take a Break (1) Feb 13, 1997
The One the Morning After (2) Feb 20, 1997
The One Without the Ski Trip Mar 06, 1997
The One with the Hypnosis Tape Mar 13, 1997
The One with the Tiny T-Shirt Mar 27, 1997
The One With the Dollhouse Apr 10, 1997
The One with a Chick and a Duck Apr 17, 1997
The One with the Screamer Apr 24, 1997
The One with Ross's Thing May 01, 1997
The One with the Ultimate Fighting Champion May 08, 1997
The One at the Beach May 15, 1997
|
cc/2020-05/en_middle_0087.json.gz/line1341154
|
__label__wiki
| 0.761143
| 0.761143
|
People’s Action Institute
People & Planet First
Free College for All
Movement Politics
People’s Action Responds to Disastrous Kavanaugh Confirmation
In response to Brett Kavanaugh’s confirmation to the Supreme Court today, George Goehl, director of People’s Action, released the following statement:
“There’s no question, Kavanaugh’s confirmation represents a horrendous step backward for progress. It also sends the exact wrong message to boys and young men: that you can assault women, dodge accountability, and still ascend to one of the highest offices in the land. We instead should be modeling what new masculinity looks like. The Senators who voted to confirm Kavanaugh failed mightily in this opportunity.
“Kavanaugh’s confirmation to the Supreme Court threatens to set our country back a generation on access to health care, racial justice environmental protections, presidential powers, reproductive rights, and much more.
“It is a stark reminder of the power of our vote and the impact of elections. That is why we are talking to one million voters in this midterm. On the doors we will ask voters to remember Kavanaugh’s confirmation – despite all the evidence that he is not fit to serve – as they head to the polls in November.”
People’s Action is a progressive, multiracial, working-class coalition of more than a million people and 48 member organizations in 30 states. We fight for racial, gender, climate and economic justice.
BREAKING: PEOPLE’S ACTION ENDORSES BERNIE SANDERS FOR PRESIDENT
Oct. 13 New Hampshire Stop for People’s Presidential Forum Series Canceled
BREAKING: Sanders Adopts People’s Action’s ‘Homes Guarantee’ Policies in Newly Released Housing Plan
BREAKING: People’s Action Unveils Plan to Win a National Homes Guarantee
OURFUTURE.ORG BLOG
People’s Action is a powerful new force for democracy and economic fairness. From family farms to big cities, from coast to coast, we’re fighting for community over greed, justice over racism, and people and planet over big corporations.
People's Action
© 2019 People’s Action/People’s Action Institute
|
cc/2020-05/en_middle_0087.json.gz/line1341162
|
__label__cc
| 0.711648
| 0.288352
|
This map uses Google Maps and requires Javascript to be enabled.
Please enable Javascript in your browser and reload this page.
6728 W Sack Drive, Glendale 85308, Arrowhead Ranch 3
Bedrooms: 3, Baths: 2.5
Home size: 1,690
Contact agent »
Save this Home
19207 N 69th Avenue, Glendale 85308, Arrowhead Ranch 5 Lot 1-164
Bedrooms: 5, Baths: 3
7427 W Morrow Drive, Glendale 85308, Arrowhead Ranch 8 Amd LT 1-181 TR A
6375 W Pontiac Drive, Glendale 85308, Arrowhead Enclave
6361 W Deer Valley Road, Glendale 85308, Hamilton Arrowhead Ranch 4 Lot 1-106 TR A-C
7208 W Wescott Drive, Glendale 85308, Arrowhead Oasis Amd LT 1-88 TR A Drainage Easmt
5647 W Pontiac Drive, Glendale 85308, Fulton Homes AT Arrowhead Ranch Unit 2
5505 W Lone Cactus Drive, Glendale 85308, Arrowhead Lakes Unit 5A
6011 W Kerry Lane, Glendale 85308, Highlands AT Arrowhead Ranch 3
7101 W Beardsley Road, Glendale 85308, Arrowhead Lakes Condo Phases 6 7 & 8
19961 N 78th Lane, Glendale 85308, Continental AT Arrowhead Ranch
5280 W Pontiac Drive, Glendale 85308, Arrowhead Lakes Unit 8A
6964 W Kristal Way, Glendale 85308, Arrowhead Ranch
21659 N 58th Avenue, Glendale 85308, Arrowhead Lakes
Copyright 2020 Arizona Regional Multiple Listing Service, Inc. All rights reserved.
All information should be verified by the recipient and none is guaranteed as accurate by ARMLS.
IDX Solution Provided by iFoundAgent.com
ARMLS Listing Data last updated 1/19/2020 12:07 PM MST.
Price: Any Price Less than $100k $100k - $159k $160k - $189k $190k - $219k $220k - $299k $300k - $399k $400k - $499k $500k - $599k $600k - $799k Greater than $800k $0 - $100,000 $100,000 - $120,000 $120,000 - $140,000 $140,000 - $160,000 $160,000 - $180,000 $180,000 - $200,000 $200,000 - $220,000 $220,000 - $240,000 $240,000 - $260,000 $260,000 - $280,000 $280,000 - $300,000 $300,000 - $320,000 $320,000 - $340,000 $340,000 - $360,000 $360,000 - $380,000 $380,000 - $400,000 $400,000 - $420,000 $420,000 - $440,000 $440,000 - $460,000 $460,000 - $480,000 $480,000 - $500,000 $500,000 - $550,000 $550,000 - $600,000 $600,000 - $650,000 $650,000 - $700,000 $700,000 - $750,000 $750,000 - $800,000 $800,000 - $850,000 $850,000 - $900,000 $900,000 - $950,000 $950,000 - $1,000,000 $1,000,000 - $1,500,000 $1,500,000 - $2,000,000 $2,000,000 and up
Sq Feet: Any Sq Feet Less Than 1,000 1,000 - 1,200 1,201 - 1,400 1,401 - 1,600 1,601 - 1,800 1,801 - 2,000 2,001 - 2,250 2,251 - 2,500 2,501 - 2,750 2,751 - 3,000 3,001 - 3,500 3,501 - 4,000 4,001 - 4,500 4,501 - 5,000 5,001+
Please login or register so you can save searches and homes
Phoenix Housing Market Update
What is a Speakeasy?
Who is buried under the white pyramid?
Where in Phoenix can you…Get a Date!
Unique Bank Owned Property for sale in Phoenix $299,900
CRM Search of sales and solds
Perry Schmitt
Darlene Schmitt
perryanddarlene@gmail.com
|
cc/2020-05/en_middle_0087.json.gz/line1341164
|
__label__cc
| 0.598557
| 0.401443
|
Sowore, Bakare challenge FG’s fresh application, says transfer to prison contemptuous
By Persecond News
Persecond News
The convener of #RevolutionNow protest and Sahara Reporters publisher, Omoyele Sowore, and his co-detainee, Adebayo Bakare, in a notice of preliminary objection filed before the court on Tuesday, challenged the federal government’s fresh application for their transfer from the custody of the Department of State Service (DSS) to prison.
They described the application filed on behalf of the Federal Government by the prosecuting counsel, Hassan Liman (SAN), as frivolous, vexatious, unarguable and contemptuous for being a contravention of the order directing the DSS to release them from custody.
According to them the fresh application filed before Justice Ijeoma Ojukwu, of the Federal High Court in Abuja, was meant to frustrate the court’s order for their release from DSS custody.
Arguing through their legal team, led by Femi Falana (SAN), they added that the application for “their transfer from the DSS custody to prison, showed that there was no genuine interest to prosecute them.”
The application read: “The application was filed by the Complainant/Applicant to frustrate the execution of the order of release of the 1st and 2nd defendants/objectors from the custody of the State Security Service made by this Honorable Court on November 6, 2019.
“There is no genuine intention to prosecute the 1st and 2nd defendants by the complainant/applicant, as the statement of witnesses this Honorable Court ordered to be availed the defence team is yet to be issued and served.
“The grounds upon which the complainant’s/applicant’s application is hinged are frivolous, vexatious, contemptuous, manifestly unarguable and unknown to law.”
Sowore and Bakare are being prosecuted by the Federal Government before the court, on charges bordering on treasonable felony, cybercrimes and money laundering instituted against them in the wake of their call for #RevolutionNow protests across the country.
It would be recalled that separate court orders had directed the release of Sowore and Bakare from DSS custody, after meeting the bail conditions imposed on them after their arraignment.
Adebayo Bakare
Femi Falana
Omoyele Sowore
Previous articleAgain Saraki gets court’s interim forfeiture order of two more mansions in Kwara
Next articleTerrorism: Buhari unveils made-in-Nigeria mine resistant vehicles
|
cc/2020-05/en_middle_0087.json.gz/line1341165
|
__label__wiki
| 0.693173
| 0.693173
|
May activities at the IU Lilly Family School of Philanthropy
TO: Board of Visitors
FROM: Amir Pasic, Eugene R. Tempel Dean
IU Lilly Family School of Philanthropy
SUBJECT: May Activities
DEAN'S UPDATE
WOMEN'S PHILANTHROPY INSTITUTE
THE FUND RAISING SCHOOL
As we launched commencement month, I was pleased to join professors Grønbjerg, Gazely and Lenkowsky on May 1 at SPEA Bloomington to celebrate graduates from the Nonprofit Management Program that evolved together with the Lilly Family School of Philanthropy.
The main event for the month—also the culmination of our academic year—was our sixth commencement as a school. We had the pleasure of witnessing Indiana University award honorary doctorates to three valued members of our community.
Lifetime Board of Visitors members Maureen Hackett and Jerre Stead, and founding director of Lake Institute on Faith & Giving Bill Enright were honored at the large IUPUI graduation and again during our more intimate school recognition ceremony. Each one issued a charge to our graduates, nicely complementing the inspirational words of our alumni speaker, Angela Carr Klitsch, M.A./M.P.A. ’07, president and CEO of EmployIndy. We also graduated a record number of nine Ph.D.s.
Thanks to the Central Indiana Community Foundation for hosting a screening of 13th, a film about racial inequality, social justice, and incarceration that I attended at the historic Athenaeum.
The school was also pleased to host a large conference room full of colleagues from The Salvation Army in town for a conference, some of whom are already taking advantage of our online graduate programs.
I also had the distinct pleasure of joining founding dean emeritus Gene Tempel for an informative lunch meeting with lifetime Board of Visitors member Don Buttrey.
Professors Rooney, Osili, Stanczykiewicz and King joined me at Lilly Endowment Inc. to present Chairman, President and Chief Executive Officer Clay Robbins and his team with an update on the school, which was followed by a spirited conversation on the state of philanthropy.
I also had good meetings with Sally Bindley, Bruce Boyd, and Sharon Reed prior to leaving for Berlin to participate in the European launch of the Global Philanthropy Environment Index.
1, Global Philanthropy Environment Index public launch, Berlin, Germany
4, Black Philanthropy Council meeting, speaker Una Osili, Indianapolis
7-8, Indiana Philanthropy Alliance conference (exhibiting sponsor), Indianapolis, IN
7-9, Changing the Face of Philanthropy Summit (sponsor), Washington, D.C.
12, Giving USA 2018 released
12, CCS Giving USA 2018 research presentation, Osili, New York
14, Giving USA2018 research presentation, Osili, Columbus Foundation, Columbus, OH
21-22: The Fund Raising School: Leadership Roundtable
28-29: Philanthropic Services for Institutions Conference on Planned Giving, research presentation, Osili, Fort Lauderdale
» Back to Top
Academic Programs/Student Services
Student Services participated in the following recruitment events:
April 30-May 3: The Salvation Army National Community Relations and Development and Emergency Disaster Services Conference in Indianapolis
May 4: Hosted a meet and greet/open house for Salvation Army members
Nine new Ph.D.s in Philanthropic Studies were awarded to graduates of the Lilly Family School of Philanthropy during commencement ceremonies on May 12. This is the largest number of doctorates to be presented at one time in the school’s history. They are among 62 women and men earning Ph.D., Master of Arts, and Bachelor of Arts degrees or graduate certificates in philanthropic studies.
Several graduates earned special honors, including:
The William M. Plater Civic Engagement Medallion was awarded to B.A. students Rosie Tarlton, Eliot Dunbar, and Taylor Parker, and M.A. students Kinga Zsofia Horvath and Mohamed Merzoug. Check out our blog post to learn more about these students and their accomplishments.
Tarlton was also named as an IUPUI Top 100 recipient for academic excellence, campus leadership, and community engagement.
Liesel Jaeger earned the Undergraduate Chancellor’s Scholar for the school and graduated with highest distinction.
Faculty Activities/Publications/Awards
Associate professor of philanthropic studies Sara Konrath was the keynote speaker at the Association for Art Museum Directors (AAMD) conference in Minneapolis May 19-21.
In the last issue of Nonprofit and Voluntary Sector Quarterly (NVSQ), which is the top journal in our field, there were nine articles in total, and five of those were authored or co-authored by our core and affiliate faculty members.
In the last issue of Nonprofit Management and Leadership (NML), which is generally viewed as the second-most important academic journal in our space, there were eight articles and research notes. Two were published by our alumni and one by one of our affiliate faculty members.
Several faculty members and one Ph.D. candidate were selected as recipients of faculty awards for excellent teaching.
IU Trustees’ Teaching Award, Campus-Level Award - Dr. Lehn Benjamin
Undergraduate Teaching Award - Dr. Julie Hatcher
Graduate Teaching Award - Dr. Catherine Herrold
Teaching Award for Doctoral Students - Pat Danahey Janin
Learning to Give Time, Talent, and Treasure
On May 22, Glenn Family Chair in Philanthropy Dwight Burlingame and Ph.D. student Dana R.H. Doan from the Lilly Family School of Philanthropy, joined faculty and staff from Learning to Give and Grand Valley State University, including alumnus Sal Alaimo, to share their solutions for engaging students in taking action for the common good.
Students are traveling to Berlin in late May for the study abroad program Philanthropy and Public Policy: The German Context. Stay tuned for the student blog.
The Women’s Philanthropy Institute released its third report of 2018 on May 22. How Women and Men Approach Impact Investing finds that men and women are embracing impact investing but do so in different ways. Highlights of the report were shared at the Mission Investors Exchange conference in Chicago in May in partnership with former Board of Visitor and WPI Council member Ellen Remmer and Rehana Nathoo, formerly of the Case Foundation.
BOV chair Becky Brooks served as a featured presenter during The Fund Raising School’s new course on impact investing. Becky shared her considerable wealth management and philanthropy expertise to help participants understand the financial aspects of impact investing and the motivations of donors who are interested in making impact investments.
The Fund Raising School’s updated course on leadership was delivered twice in May – once as a regularly scheduled public course in Indianapolis and again in a custom training format in Nashville, TN. The curriculum now is being translated into an academic course that will be offered as an elective in the Lilly Family School of Philanthropy’s master’s degree program during the upcoming fall semester.
When and where are The Fund Raising School’s courses? What are the five new cities where TFRS is teaching? When are the quarterly webinars, and on what topics? How do I bring The Fund Raising School to my town or organization for custom training? Answers to all of the above are available in The Fund Raising School’s new course directory.
Dr. Una Osili, associate dean for research and international programs, delivered a webinar for The Fund Raising School on the hot topic of donor advised funds. A record number of participants (146) learned the latest research and data on this growing philanthropic trend along with advice on how to fundraise from donors with donor advised funds.
The Fund Raising School’s new weekly podcast, “The First Day from The Fund Raising School,” is attracting more than 600 listeners per episode. The podcast delivers practical information, tips, and advice for fundraisers from the national experts at the IU Lilly Family School of Philanthropy. The podcast is available through the The Fund Raising School's app, on our web site, and on The Fund Raising School’s LinkedIn page.
Our four-day Executive Certificate in Religious Fundraising course was led by Melissa Spas and adjunct instructor Gary Dollar at Luther Seminary in St. Paul, MN.
Lake Institute, in partnership with Religion & American Culture co-sponsored the event, Reflecting on Religion and Philanthropy: Past and Present hosted in Indianapolis. In this event, historians Jim Hudnut-Buemler and David Hammack shared their reflections on the intersections of religion and philanthropy. Lake Institute’s David King served as co-moderator for the event.
The second of three Creating Congregational Cultures of Generosity seminars was taught by Spas and adjunct instructor Larry Strenge with our partner Evangelical Lutheran Church in America in New Brunswick, NJ.
Our four-day Executive Certificate in Religious Fundraising course was led by Spas and Dollar at Hellenic College of the Holy Cross in Brookline, MA. This was a custom course offered for Hellenic College that brought together leaders and stakeholders within the Greek Orthodox Church in America.
Spas and Anne Brock led a one-day workshop for Givelify, an online giving platform, in Indianapolis focusing on “Fundraising in a Religious Context.”
May 2 — The research department hosted the team from TrueSense, a fundraising consulting firm, that has partnered with The Salvation Army for over 50 years. The group discussed potential for collaboration projects.
May 3 — Una Osili, Ph.D., associate dean for research and international programs, was invited to provide the keynote presentation and a breakout session for The Salvation Army National Community Relations and Development and National Disaster Services Conferences held in Indianapolis. The theme of the conference was “Believe in Possibilities.” She provided an overview of the philanthropic landscape for the keynote and a breakout session on the High Net Worth Philanthropy study.
May 9 — Osili was invited to present a webinar for the Council on Foundations. Her presentation was entitled “Where and How is the Global Environment for Philanthropy Changing?”
May 10 — Osili was invited to present one of the quarterly webinars for The Fund Raising School. Her presentation was entitled “Data on Donor-Advised Funds: New Insights You Need to Know.”
May 15 — Osili was invited to serve as a panelist for a webinar for CCS. The title of the webinar was “Giving in Young Adulthood: Gender Differences and Changing Patterns Across the Generations.” The webinar had over 900 advance registrations.
May 18 — Osili was invited to present at the United Negro College Fund’s Statewide Leadership Strategic Planning Session, hosted by Eli Lilly and Company. Her presentation was entitled “Giving Trends per Sector.”
|
cc/2020-05/en_middle_0087.json.gz/line1341169
|
__label__cc
| 0.669891
| 0.330109
|
Helping the Leaders and Best become more focused, more disciplined, and fully activated.
University of Michigan Athletics
U-M Athletics is one of the most iconic brands in the world. With great recognition comes great responsibility. In order to unleash its power, it must be defined. Documented. And fully adopted by every constituency.
We engaged with everyone. Staff. Coaches. Fans. Alumni. Student-athletes. Donors. The greater university community. The non-affiliated public.
What we found was greater than passion — it was a tribe. It was a shared philosophy. And a grand opportunity.
Surveys. Focus groups. Workshops.
We created the never-wavering
values that defined them.
We created the rules that both confined them and allowed them new freedom.
We worked alongside Nike to define
the uniform experience.
Through education and workshops, we instilled and imparted.
The result? A consistent, emotional, sustainable brand experience.
But we didn’t stop there. We built a campaign that raised more than $350 million to create their new home.
|
cc/2020-05/en_middle_0087.json.gz/line1341170
|
__label__wiki
| 0.520626
| 0.520626
|
Crowds Of People Line Broad Street For Eagles Victory Parade
Posted 10:31 AM, February 9, 2018, by kstewartphl17
Philadelphians lined the streets of Center City to watch history.
The Philadelphia Eagles road down Broad Street towards the art museum. One of the players held the Vince Lombardy trophy.
“We`ve been waiting for this our whole life,” said one fan.
Some of the players got off the bus to be with the crowd. Several fans climbed trees and buildings to catch of glimpse.
Rebecca Shannon came all the way from South Carolina and thinks this is the beginning of a new era for the city.
“I can`t imagine not being here for this,” she said. “I think this is going to hold the city together for a long time.”
It was a chilly day with temperatures below freezing, but that didn’t stop fans.
“It`s 100 degrees somewhere and that`s how I feel,” said one fan. “In the Caribbean on an island relaxing, that`s how I feel right now.”
Doug Peterson held the Vince Lombardy trophy as he and his team greeted the crowd.
Quarterback Nick Foles and other players spoke about the impact this had on their lives.
“To be a part of the Philadelphia Eagles, to be a part of one of these guys is one of the greatest things I`ve ever done in my life,” he said.
This was more than a parade for the hundreds of thousands of fans that packed the city streets.
For one day, it didn’t matter who you were or what you’ve done. Crowds of people stood together to support our Philadelphia Eagles.
“It`s about family, community, and all these people coming together,” said an Eagles fan. “That`s what makes this team so special.”
Topics: big game, city, Eagles, Nick Foles, parade, Philadelphia, philly, rally, super bowl
Hair Salon Offers a New Look for Eagles Fans
Eagles Cheerleader Saves the Day for Mummers Fancy Brigade
IN FOCUS: Operation Gratitude, Make The World Better, Men of Color Week, Hiring Veterans
The Big Game Web Exclusives
Two to watch: These players will be key to determining the AFC Championship
Jersey String Band Celebrates Mummers Monday
Philadelphia Wings Host Home Opener This Friday at Wells Fargo Center
Hidden History: Baseball’s George Stovey
Frank Klose Discusses the Phillies Firing General Manager Gabe Kapler
‘I’ve got a crazy imagination’: Chiefs fan’s spooky yard display
|
cc/2020-05/en_middle_0087.json.gz/line1341171
|
__label__cc
| 0.655241
| 0.344759
|
Apple iPhone shipments decline, Samsung & Huawei Top the list in Q1, 2019: Report
Vishnu Sarangapurkar
Apple has reportedly sold lesser iPhones in the first quarter of this year when compared to the last ending quarter of 2018. New stats revealed by IHS has showcased Quarterly Global Smartphones Shipments out-of-which Apple had seen a decline of 16% year-over-year.
The IHS Markit report indicates over the four consecutive quarters of last year the growth in smartphones shipments has been negative which continued to the Q1 of this year, showing a 6.3% decline year-over-year. On the whole, however, Samsung had topped the list with selling 70.8 million units over the first quarter of this year – thanks to the new Galaxy S10 devices.
Despite Samsung topping the list, its rival Huawei has also held steady in terms of shipments in the first quarter of 2019. Huawei had shipped with 59.1 million units in Q1, 2019 that is a significant increase year-over-year with up to 50%.
The report further showcased Apple’s decline in sales with only 43.8 million iPhones shipped in the first quarter of this year, which is lower than the Q4, 2018 wherein the Cupertino tech giant had shipped 52.2 million units.
The IHS report had further revealed the top Chinese smartphone makers shipments as well. Vivo had reportedly shipped 24.3 million units during Q1, 2019, which is significant growth from 21.2 million units in Q1, 2018. Other competitors OPPO and XIaomi, however, had seen a decline in shipments in the first quarter of this year, when compared to Q1, 2018.
On the whole, it appears Apple had seen the highest percentage drop in terms of its iPhone shipments, which suggests us that most of the people inclining towards Android Device manufacturers since they have a lot to offer now especially with their premium flagship smartphones. We might have to wait until September this year to see what Apple has to bring to the table with its new iPhones and please the consumers to boost their sales again at least bt the end of Q4, 2019. Stay tuned to PhoneRadar for more such interesting updates.
Samsung Galaxy M40 to come with 6GB RAM & Snapdragon 675 SoC, Geekbench test leaked
Motorola One Vision with Punch-hole Display to Launch on May 15th
Phone News6 hours ago
Officially Launched1 day ago
Upcoming Mobiles1 day ago
Officially Launched1 week ago
Samsung Galaxy XCover Pro Rugged Smartphone Unveiled – Details & Pricing
New Realme 5i Smartphone Launched – Old Wine in a New Bottle?
|
cc/2020-05/en_middle_0087.json.gz/line1341172
|
__label__wiki
| 0.751928
| 0.751928
|
Feds: Drought kills 66 million trees in California's Sierra
This June 6, 2016 photo shows patches of dead and dying trees near Cressman, Calif. The U.S. Forest Service announced Wednesday, June 22, 2016, that the number of trees in California's Sierra Nevada forests killed by drought and a bark beetle epidemic has dramatically increased since last year. (AP Photo/Scott Smith)
The number of trees in California's Sierra Nevada forests killed by drought, a bark beetle epidemic and warmer temperatures has dramatically increased since last year, raising fears they will fuel catastrophic wildfires and endanger people's lives, officials said Wednesday.
Since 2010, an estimated 66 million trees have died in a six-county region of the central and southern Sierra hardest hit by the epidemic, the U.S. Forest Service said.
Officials flying over the region captured images of dead patches that have turned a rust-colored red. The mortality from Tuolumne to Kern counties has increased by 65 percent since the last count announced in October, which found 40 million dead trees.
California is in the fifth year of a historic drought, which officials say has deprived trees of water, making them more vulnerable to attack from beetles.
Gov. Jerry Brown in October declared an emergency, forming a task force charged with finding ways to remove the trees that threaten motorists and mountain communities.
These efforts have hit obstacles, slowing the tree removal as California enters a potentially explosive wildfire season.
Brown pushed for burning the trees at biomass plants to generate electricity, sending them to lumber mills or burning them in large incinerators, removing potential fuel for wildfires.
In this June 6, 2016 file photo, Division Chief Jim McDougald of the California Department of Forestry and Fire Protection holds a piece of tree bark showing burrowing marks from a bark beetle infestation near Cressman, Calif. The U.S. Forest Service announced Wednesday, June 22, that the number of trees in California's Sierra Nevada forests killed by drought and a bark beetle epidemic has dramatically increased since last year. (AP Photo/Scott Smith, File)
U.S. Agriculture Secretary Tom Vilsack, who oversees the Forest Service, said disaster awaits if more money isn't invested in managing forests in California and across the country. He urged Congress to act.
"Tree die-offs of this magnitude are unprecedented and increase the risk of catastrophic wildfires that puts property and lives at risk," he said in a statement. "We must fund wildfire suppression like other natural disasters in the country."
The Forest Service has committed $32 million to California's epidemic, and the state budgeted $11 million for the California Department of Forestry and Fire Protection to buy tree removal equipment and to grant local communities money for their own work.
So far, the Forest Service says it has cut down 77,000 trees that pose the greatest risk to people, along roads and near communities and campgrounds. Crews from CalFire and Pacific Gas and Electric Co. also are at work using chain saws and wood chippers to remove dangerous trees.
Kathryn Phillips, director of the Sierra Club California, said the die-off from drought should signal to policy makers the urgency of curbing pollution that contributes to climate change.
"This is a warning to all of us," she said. "We need to cut our air pollution and greenhouse gas emissions more. We're on the right path, but we need to accelerate our effort."
California to fire up burners to battle dead tree epidemic
© 2016 The Associated Press. All rights reserved.
Citation: Feds: Drought kills 66 million trees in California's Sierra (2016, June 22) retrieved 19 January 2020 from https://phys.org/news/2016-06-feds-drought-million-trees-california.html
Complex Series of Geologic Processes Generated Seizmic Humming
Hydrogen in the gas grid
Highest recorded temperature in a given year
20200108 Finally some lightning
Why do I keep finding more new rocks in my garden year after year?
Are changes in the Earth's tilt responsible for global cooldown and the ice ages?
More from Earth Sciences
Dead trees, dry earth: Western US a tinderbox
NASA satellite data shows rapid recovery for some California forests despite drought
California 'street tree' benefits valued at $1 billion
Tens of millions of trees in danger from California drought
Aerial images show decades of foothill forest growth erased due to California's extreme drought
Race to save animals on Australia's fire-ravaged 'Galapagos'
Air pollution from oil and gas production sites visible from space
Thanks to clouds, new climate simulations predict more warming than predecessors
New climate models suggest Paris goals may be out of reach
|
cc/2020-05/en_middle_0087.json.gz/line1341173
|
__label__wiki
| 0.791506
| 0.791506
|
Pixelated Planet
KC Concepcion Shared Photos Of Her First Investment with Her Own Money
October 17, 2019 pixelatedplanet Entertainment, Showbiz
34-year-old actress Maria Kristina Cassandra Cuneta Concepcion or simply KC Concepcion is the daughter of the Megastar Sharon Cuneta and actor Gabby Concepcion.
She starred in several films like “For the First Time” in 2008, “When I Met U” (2009), “I’ll Be There” (2010), “Forever and a Day” (2011), and a Scenema Concept International, Inc, and Viva Films “Boy Golden: Shoot to Kill, the Arturo Porcuna Story” in 2013.
Kc Conception | Instagram
She is the adopted daughter of Senator Francis Pangilinan following her mother’s marriage to the politician. But after thirteen years since her parents’ separation, KC reconnected with her biological father, Gabby Concepcion.
KC also became a National Ambassador Against Hunger of the United Nations’ World Food Programme.
She finished her grade school at Saint Pedro Poveda College in Mandaluyong and graduated from the International School Manila in 2003.
Then, she took a bachelor’s degree in International Corporate Communications with a minor in Theatre Arts from the American University of Paris, where she graduated in 2007.
With all her success as a TV personality, product endorser, MTV Asia VJ host, entrepreneur, and a talented singer like her mom, it’s not a big surprise that she was able to purchase several properties here and abroad.
But although she may have many new investments in the recent years, the 34-year-old actress can’t help but share the first property that she bought 10 years ago —an apartment that she proudly shares she only used her own money from her earnings in showbiz.
As seen in the series of photos on her Instagram stories, KC shared some parts of her apartment that she leased out for the meantime and is now ready to be the home of the new tenant that will be moving in soon.
“Got this apartment 10 years ago. The fruits of my labor sa pag-aartista. Not a single peso from my parents unang katas to!!! Hehe Napakinabangan hanggang ngayon.” she wrote in one of the photos.
CelebrityInvestmentPhotosProperties
Previous Post:Look: Filipino Scholar Finishes Summa Cum Laude from Master’s Degree in Europe
Next Post:Sharon Cuneta Wowed The Netizens With Her Slimmer Figure In Her Latest Photoshoot With Regine Velasquez
Check Out Angelica Panganiban’s Mansion-Like Home With Elevator 24,518 views
Look: Andi Eigenmann Shares A View Of Their Family House In Siargao On Her First Vlog 18,632 views
Get To Know Momshie Karla Estrada's Non-Showbiz Boyfriend, Jam Ignacio! 9,017 views
Watch: Raffy Tulfo Trending Video While Dancing ‘Tala’ By Sarah G 8,043 views
Check Out This Cute Video Of Soon-to-be Mom Anne Curtis While Playing With Eruption’s Baby In Australia 7,105 views
Look: Maine Mendoza Dancing “Tala” With Arjo Atayde Caught The Netizens Attention 6,040 views
Look: Young Man Gives Back To His “Adoptive Parents” By Giving Them A Beautiful Mansion 4,877 views
© Copyright Pixelated Planet 2018 | All rights reserved
|
cc/2020-05/en_middle_0087.json.gz/line1341178
|
__label__cc
| 0.684287
| 0.315713
|
Home/Tag: study
Sisu: The Finnish Concept of Inner Strength
By PsyMinds|2019-08-26T02:46:23+03:00August 26th, 2019|Categories: Knowledge|Tags: courage, positive, psychology, strength, study|
Sisu is a Finnish concept described as stoic determination, the tenacity of purpose, grit, bravery, resilience, and hardiness. It is generally considered not to have a literal equivalent in English but likely a cognate of Indian term vīrya derived from Avestan Verethragna meaning "smiting of [...]
What is Visual Memory?
By PsyMinds|2019-08-25T01:34:00+03:00August 25th, 2019|Categories: Knowledge|Tags: alcohol, brain, color, memory, shape, sleep, study, visual|
Visual memory describes the relationship between perceptual processing and the encoding, storage, and retrieval of the resulting neural representations. Visual memory occurs over a broad time range spanning from eye movements to years in order to visually navigate to a previously visited location. Visual memory [...]
The Tetris Effect
By PsyMinds|2019-08-14T02:38:53+03:00August 14th, 2019|Categories: Knowledge|Tags: dreams, memory, study, thoughts, video games, visualization|
The Tetris effect occurs when people devote so much time and attention to an activity that it begins to pattern their thoughts, mental images, and dreams. The Tetris effect takes its name from the video game Tetris. People who played Tetris for a prolonged amount of time [...]
Musical Meaning With LSD
By PsyMinds|2020-01-04T01:28:48+03:00February 9th, 2017|Categories: Music, Substances|Tags: LSD, music, psychedelic, study|
This month has been another great one for the psychedelic community; with a highlight being the release of two fascinating papers which take us a step closer to understanding exactly how LSD works in the brain. I summarize these two articles in more depth here, [...]
|
cc/2020-05/en_middle_0087.json.gz/line1341190
|
__label__cc
| 0.678236
| 0.321764
|
Welcome to poetryfiend
poetryfiend
deciphering poetry, all platforms, old school and new school
Just Your Everyday Apocalypse by Amelia Walker REVIEW
Nov 29, 2018 Feb 19, 2019 by poetryfiend ♥ 0 Leave a Comment
Okay, I must admit, this is probably the first contemporary Australian poetry book that I have properly read in a while. And yes I thoroughly enjoyed it and I must thank Amelia for giving me a copy. As always, I have selected 8 poems (which are in no particular order) from Just Your Everyday Apocalypse and provided my own interpretation/analysis for each of them.
1. In Translation
In Translation is packed with metaphors and tells the story of hand-me-downs and thrifted clothing. Walker describes how despite numerous washes, the “fabric” is “flavoured” with “moments that are not [hers]” but of previous owners of the clothing. I really admire her use of alliteration when explaining that thrifted clothing is “a million mixed meanings” open to “minefields of misinterpretation.” It really makes you think about the previous owners of thrifted clothing, what they went through whilst wearing those clothes and the experiences they had. How rips or stains came to be? The mismatching of colours and the intricate stitch work? What era the clothing was from?
2. Beautiful
Short, simple and sweet. Dedicated to all the mothers out there with odd quirks and carefree attitudes. They might have a “crooked smile” and “varicose veins” but they are still “beautiful” nonetheless.
3. Walls
A poem that highlights some of the atrocities faced by female detainees, mainly focusing on the story of Cornelia Rau. Walker illustrates the horrid conditions these female detainees undergo as they are trapped in “windowless” rooms and must “sh*t” for an “audience of male guards.” She also describes the debilitating impact, life in a detention centre can have on an individual as after leaving and now “safe”, the former detainee is still unable to “let go of the teddy bear she clutched all those dark months.” Walls ends in a startling fashion as Walker describes that even though the woman has left the detention centre, she is unable to escape the “walls” of society as they have “none.”
A direct and brutally honest overview of different life pathways our friends, family and strangers have taken. Pretty self-explanatory.
5. City, Lover, Self
I believe we can all relate to City, Lover, Self regardless of whether you live in Australia or not because we all have places that are like home to us. Walker demonstrates the connection she has with Adelaide, through her use of personification, as she describes she is “intimate” with the “rhythm” of Adelaide’s “soft tissue organs” and “strange scarred body.” By using figurative language, she depicts how each instant details a specific memory of “things that have been or could have been” as “every shop glass shines with the ghost of some moment.”
6. Submerging
A point that’s inevitable and you’ll face sooner or later unless you’re extremely lucky. Submerging, as the name suggests, describes the feeling of losing your sense of self. In Walker’s experience, it happened to her “slowly” as she was already “neck deep before [she] realised.” She uses metaphors to describe the symptoms of losing one’s self as she begins “rejecting sun and air” and finds it “hard to breathe” as “glass” is “encasing [her] head.” The line that resonates with me the most is how Walker emphasises how people “who were close” to her feel as if they’re “a million miles away” as she struggles to “follow conversations.” However, the last stanza is somewhat comforting as she is consoled by Circe, the Greek goddess of magic, who now “holds her hand” as her harsh exterior starts to melt away.
7. Astrocytoma
Poignant and beautifully written. Walker details the experience of a loved one discovering they have astrocytoma (cancer of the brain) and how despite the crippling nature of the disease they still manage to stay “composed” as “science slice [their] skull into squished butterfly segments.” Here, Walker uses alliteration to explicitly portray the life of this cancer-ridden individual. I also particularly love her use of a Stephen Hawking quote.
“If you jump into a black hole, your mass energy will be returned to our universe, but in a mangled form which contains the information about what you were like but in an unrecognisable state.” (Stephen Hawking, 2004)
I believe this quote serves as a reminder to us all that regardless of the immensity of our problems/issues, they will always be insignificant and eventually be forgotten and “unrecognisable.”
The last lines of Astrocytoma despite being quite grim are also somewhat consoling as we find out that this diseased individual is relieved of their suffering as their “six year migraine” is finally “over.”
8. Tequila
I just love how cleverly put together this poem is. Walker organises it into three parts and as you guessed it, it starts off with Part One: SALT, then Part Two: TEQUILA and lastly Part Three: LEMON.
Part One: SALT describes the various uses of salt and allows us to contemplate the nature of salt as it is used to “sanctify” in Japanese Shinto culture but also deemed “unhealthy” and “indulgent” in Western culture.
The last lines lead nicely into Part Two: Tequila as salt “addiction” causes “thirst.”
I feel Part Two: Tequila describes the intoxicating and blinding effects of alcohol but also, its power to provide us with temporary ecstasy. Walker’s decision to provide a short story of the discovery of Tequila really enhances this poem.
Part Three: LEMON delves into a fond memory of Walker “picking lemons” with her grandmother as a young child. She describes through her use of personification that her closest feeling of being drunk at that age is when she swims in “scents of citrus and cinnamon.”
I particularly love the last stanza which I feel is pretty self-explanatory.
If you liked this review, I would love to hear from you.
Also, if you’re interested in purchasing Just Your Everyday Apocalypse you can do so by emailing poetryisdangerous@gmail.com , FYI it’s only $10 a copy!
ameliawalkeraustraliajustyoureverydayapocalypsepoetryReviewsslam poetryspokenword
@poetryyfiendd
Gone for a minute but I'm back kinda. Posted this on my personal a while back before I made this account but never here, so here it is. Also, I can't remember who said this but PSA 'materialism ain't love!'
In light of the bushfires happening across our country and the many lives that have been lost and the homes and structures that have been destroyed and the lack of empathy and ignorance displayed by the Liberal government, I find this poem by #rabindranathtagore even more relevant today! I pray that our government (namely #scomo) , realises that we must have minds that are 'led forward... into ever widening' and not lost by 'dead habit' before it's too late (if it isn't already). #australianbushfires #bushfiresaustralia #climateemergency #climatechangeisreal
Resolutions for anytime especially NOW thanks to @alokvmenon 🌱
Anyone else?
Never thought I'd post anything like this because I feared being judged. And you were the only one I'd ever properly rapped to but now man you're right. Fearing judgement, it's gonna hold ya back. This one's for you Nikhil! 💚 (link to full video in bio) #theworst #cover #jheneaiko
Okay I'm cryingggg 😂😂
|
cc/2020-05/en_middle_0087.json.gz/line1341191
|
__label__cc
| 0.542127
| 0.457873
|
Report: E-cigarettes appealing to kids
CNN Capitol Hill reporter Lisa Desjardins
Washington (CNN) – Redeploying a major argument from the battle over traditional cigarettes, a dozen Democratic members of Congress released a report on Monday concluding that electronic cigarettes “aggressively (promote) their products by using techniques and venues that appeal to youth” and should be strictly regulated like the non-electronic versions.
“E-cigarette manufactures don’t have to play by the same rules (as traditional cigarette makers),” said Rep. Henry Waxman, D-California, one of the leaders behind the investigation.
Filed under: Congress • Dick Durbin • Henry Waxman
Sunday Chatter: Putin’s advances causing alarm; frustration with Malaysian government
By CNN's Leigh Ann Caldwell
For another week, the Sunday political talk shows focused on the missing Malaysian plane and Russian President Vladimir Putin’s aggressive actions in Ukraine.
If you missed any of the Sunday political chatter, we've got you covered:
Filed under: Dick Durbin • Kelly Ayotte • Mike Rogers • President Obama • Ukraine • Vladimir Putin
Sunday Chatter: Putin, 2014 and the missing Malaysian airplane
Two international events filled the Sunday political talk shows: Russian President Vladimir Putin’s next move in Crimea and Ukraine and the mystery surrounding the bizarre and puzzling disappearance of Malaysia Airlines Flight 370.
Filed under: Dan Pfeiffer • Dick Durbin • Jeff Flake • John McCain • Mike Rogers • Peter King • Reince Priebus • Ukraine • Uncategorized • Vladimir Putin
McCain calls U.S. military support for Ukraine "right and decent"
CNN's Cassie Spodak
(CNN) – Speaking in Kiev, Sen. John McCain called Saturday for the United States to provide long-term military assistance to Ukraine, saying it is "the right and decent thing to do," as reports surfaced that Russian troops had traveled farther north into Ukraine from Crimea.
McCain was part of a bipartisan delegation of U.S. senators who traveled to Kiev ahead of Sunday's secession referendum in Crimea. The White House and U.S. allies in Europe have denounced the referendum as unconstitutional and illegal because Russian troops have essentially taken over the southern Ukraine peninsula.
McCain also had strong words for President Barack Obama in an op-ed appearing in The New York Times. He called for the President to take actions to restore the United States' credibility and strength around the world.
Filed under: Chris Murphy • Dick Durbin • John Kerry • John McCain • Russia • Ukraine
Sen. Lindsey Graham: Obama budget 'guts our defense'
CNN's Dana Davidsen
(CNN) – Sen. Lindsey Graham said the Obama administration's proposed budget "guts our defense" and ignores the need for military preparation for future conflicts.
The South Carolina Republican told CNN's Candy Crowley Sunday that if the United States were to need to take immediate military action in an international conflict, that situation would drain defense resources.
Filed under: Chuck Hagel • Department of Defense • Dick Durbin • Iran • Lindsey Graham • President Obama • TV-State of the Union
Sunday chatter: Make Putin take notice
CNN's Leigh Ann Caldwell
(CNN) - Russia’s escalation in Ukraine dominated the political talk shows Sunday morning. American politicians and Obama administration officials are calling Russian President Vladimir Putin’s deployment of troops to the Russian-friendly Crimean peninsula the latest provocation in a troubling series of events.
It’s also the latest foreign policy challenge facing President Barack Obama, whose tenure has been plagued by international crises ranging from two wars, an unruly North Korea and uprisings in the Middle East.
If you missed any of the Sunday chatter, we've got you covered:
Filed under: Dick Durbin • John Kerry • Lindsey Graham • Marco Rubio • Mike Rogers • Obama administration • Ukraine • Uncategorized • Vladimir Putin
Lawmakers call for suspension of Russia from G8, swift action against Putin
(CNN) - As the crisis in Ukraine escalates, with Russian troops moving into the Crimean peninsula on Saturday, U.S. lawmakers are pushing for decisive action against Russian President Vladimir Putin to end the violence in the region and respect Ukraine's independence.
Appearing on CNN’s “State of the Union” on Sunday, Sens. Dick Durbin, the second-ranking Democrat, and Lindsey Graham, a Republican from South Carolina, made the case for congressional sanctions and a suspension of Russian membership in the G8 and G20.
Filed under: Dick Durbin • Lindsey Graham • Russia • TV-State of the Union • Ukraine • Vladimir Putin
Durbin: Unemployment benefits won't make or break budget deal
(CNN) - The second-ranking Senate Democrat said Sunday that extending unemployment benefits won't necessarily be a sticking point for his party in budget negotiations, though he hopes they are included.
"No, I don't think we've reached that point where we've said this is it - take it or leave it," Sen. Dick Durbin, D-Illinois, said on ABC's "The Week" when asked if his party would demand the extension of jobless benefits be included budget talks.
Filed under: Budget • Dick Durbin • Rob Portman
White House denies GOP leader told Obama ‘I cannot even stand to look at you’
Senior Congressional Producer Ted Barrett
(CNN) - The White House Wednesday denied an accusation from a top Democratic Senator that a House Republican leader told President Barack Obama “I cannot even stand to look at you” during a recent White House meeting on the government shutdown.
“I looked into it and spoke with somebody who was in the meeting and it did not happen,” White House spokesman Jay Carney said in response to a question about the charge, which Dick Durbin, the second-ranking Senate Democrat, posted online three days ago.
Filed under: Dick Durbin • GOP • President Obama • White House
Sen. Dick Durbin, D-Illinois
Talking seen as 'breakthrough' on Capitol Hill
CNN's Greg Clary
Washington (CNN) - The bar seems to be set pretty low on Capitol Hill, as one top lawmaker says just having Democrats and Republicans talking is a “breakthrough” - even though the two sides don’t have a deal in the midst of a multifaceted budget crisis.
Talks both on ending the government shutdown and on avoiding the debt ceiling have shifted to the Senate, as Senate Majority Leader Harry Reid and Minority Leader Mitch McConnell, along with other top senators, began discussions on Saturday.
Filed under: Dick Durbin • Government Shutdown • Rob Portman
|
cc/2020-05/en_middle_0087.json.gz/line1341193
|
__label__cc
| 0.536194
| 0.463806
|
New module makes it easier to manage the supply chain
Ana Pierrotti May 6, 2012 Product
PrecisionPoint Software launches Advanced Inventory Analysis for Microsoft Dynamics AX (Axapta)
London & New York: May 24th 2012: PrecisionPoint Software has launched its new PrecisionPoint Advanced Inventory module (PAI) to allows users of Microsoft Dynamics AX (Axapta) business applications to more effectively manage the supply chain by using a single solution that addresses both reporting and analysis.
PrecisionPoint Software (www.precision-point.com) is at the forefront of delivering comprehensive self-service Business Intelligence (BI) through an on-site managed service, which works seamlessly with Microsoft Dynamics AX. Its rapid deployment and low cost of entry subscription model makes it particularly attractive to mid market organizations that need an affordable solution to the BI dilemma.
The new PAI module delivers powerful inventory reporting and advanced business intelligence that moves beyond sheer reporting to analyse the ‘why’ behind the most complex of questions. PAI enables an organisation to manage and track its inventory, from supply and receipt into the warehouse through to demand and eventual shipment. The integration of inventory movements, costing, reservations, and all product orders into a single view enables powerful inventory analytics. It makes inventory performance information accessible with pre-built analytics that provide instant visibility from day one of the rollout and delivers the answers to questions such as ‘what are my best and worst performing inventory items from a cost, revenue, turnover and margin perspective’ and analyses the inventory from numerous perspectives.
The drag and drop interface is intuitive and users can create their own analytics easily without needing technical help in a move that will help to keep costs down. The solution comes with extensive pre-defined formulas and reports to help with common calculations ranging from formulas for relative time to statistical functions and OLAP operations.
“Wholesalers, distributors and manufacturers will benefit immensely from the advanced inventory analysis provided by our new PAI module,” commented PrecisionPoint CEO, Michael Evans. “They will be able to monitor more closely inventory levels, vendors and organizational performance through a single integrated solution for both reporting and analysis. By combining reporting and adhoc analysis with advanced capabilities, users can have a high impact on the operational
|
cc/2020-05/en_middle_0087.json.gz/line1341201
|
__label__cc
| 0.551756
| 0.448244
|
Chapter 5: Lessons in Leadership: How a Silent Student Protest Inculcated University Values
by Fred P. Pestello, Ph.D.
It was as if a blanket of snow covered the auditorium floor in the Center for Global Citizenship, where 52 years earlier, Reverend Dr. Martin Luther King, Jr. spoke while visiting Saint Louis University (SLU). Nearly all were dressed in white. Some wore hijabs. They sat quietly in 11 rows of 25 folding chairs, waiting.
They did not shudder at the rhetoric voiced by the young woman, an SLU alumna, standing at the podium nor allow their resolve to weaken by the applause and hooting from the auditorium's balcony. The woman had succeeded in getting a sustained reaction and validation from the rows of occupants above, primarily from outside the SLU community.
The students' silence did not confirm the startling absence of empathy. Rather it served as a basis for their subversive action. Their protest would be a stand against an event they felt defied the University's mission and values.
The guest speaker briskly marched to the microphone, prepared to break the silence, or so it seemed.
A few months earlier, my executive team and I began the academic year with conversations regarding the complexities of the relationships between free intellectual inquiry, civility and respect, conditions of hate speech, and our institution's Catholic, Jesuit missions. I circulated a video promoting civil, respectful discourse using the framework of Catholic intellectual traditions, foundations of the academy, and our Jesuit values. I assumed dialogue among groups of varying beliefs was a given. Upon reflecting, I realize I erred in that assumption.
Word of Lt. Col. Allen West's September 29 appearance at SLU had bubbled up through social media on campus and across the country. Sponsored speakers are commonplace and serve to enhance learning and exposure to differing ideologies. This time, some 50 days remained in the most polarizing presidential campaign since 1972.
The SLU College Republicans and the Young America's Foundation (YAF), sponsors of the event, had engaged in a public disagreement with an SLU staff member. The staff who approve campus event posters directed the words "radical Islam" be removed from a promotional poster because it did not match the event title and description on the submission form submitted several weeks earlier by the sponsoring student group.
"SLU bans words 'radical Islam' from Allen West lecture flyers," announced the YAF blog on Wednesday, September 21. The story circulated quickly among conservative blogs and news websites. "YAF activists will not back down in the face of challenges from politically correct campus bureaucrats," the blog's author stated.
The next day, a conservative talk radio host interviewed West. Among the topics covered was the report from YAF, which was news to West.
"How do you even reply to that?" asked the host. "It is so off the map and so ignorant and ridiculous. And these are our, quote, institutions of higher learning?"
"Well, it's the safe space mentality," West replied. "That we are going to regulate your free speech because there is speech we don't approve of and we don't want to hear. For me going to speak on a college campus where it should be about enlightening minds, to have someone try to restrict the speech that we will be talking about, it's unconscionable to me."
At that moment, the issue pivoted from the impermissibility of the words "radical Islam" on a poster promoting West's lecture to the presumed prohibition of their utterance during his in-person remarks. University administration, and more importantly, our Muslim students became targets of the forthcoming outrage.
"Folks, I've just been CENSORED," headlined West's blog post that evening.
"It appears there are those who define free speech as the speech they deem acceptable," West stated. "If you attempt to speak on issues to which the liberal progressive socialist left does not consent, you should be censored. Or at a minimum, the little cupcakes ask for a 'safe space' where they don't have to hear opposing views — and here we were under the impression that institutions of higher learning were supposed to be places to encourage the free exchange of ideas."
Stoking the fire, West exclaimed, "…[I]f this is just a case of ill-conceived political correctness, we'll rectify that. But, if this is a case of the influence of stealth jihad radical Islamic campus organizations such as the Muslim Student Association, an affiliate of the Muslim Brotherhood, then you will be exposed. And I recommend to the President of St. Louis University, you do not want it known that a radical Islamic organization is dictating speakers on your campus — that is not the type of PR you really want."
Of course, the Muslim Student's Association (MSA) at SLU is not a radical Islamic organization. But in a time of extraordinary media illiteracy, when too many Americans turn to "news" sites to affirm their far-right or far-left political views, such a claim becomes fact.
Facebook and the Twitterverse erupted with wrath against SLU and our Muslim students. Many of the vitriolic claims were xenophobic, racist, anti-intellectual, and sophomoric. Some posted the words "radical Islam" repeatedly on the University's Facebook page. Nearly all who excoriated us had no affiliation with the University.
Inside our community, fear and anxiety loomed, and anger of a different kind brewed, particularly among our Muslim students, most of whom are members of MSA. Their emotional distress from being falsely and shamelessly profiled by West and his followers was palpable.
Inside our community, fear and anxiety loomed, and anger of a different kind brewed, particularly among our Muslim students.
Many Muslim students said they no longer felt safe. They worried that someone from outside SLU would visit our midtown, St. Louis, campus and physically harm them. They passionately shared their anguish that allowing West on campus would be effectively condoning his marginalizing rhetoric and creating a space for it to thrive.
SLU staff worked with our conservative students who felt they were being labeled reactionaries and racists — and were being marginalized on campus. They also spent countless hours speaking with aggrieved social justice advocates and counseling numerous Muslim students. Their preexisting degrees of fear and apprehension were elevated. This prompted a number of staff to privately advise that we cancel West's address.
The pleas to ban West were ardent. Leaders of multicultural student groups, undergraduate and graduate advocates for social justice, and some faculty conveyed their objection to West's hate speech and campus appearance. They repeatedly reminded us that had an SLU student voiced what West had claimed, there would be a bias incident investigation and student conduct charge — and it would likely be sustained. Initially some staff members were inclined to support the event's cancellation, others proposed we move West to an off-campus venue, and several recommended the program go on as planned.
I knew the SLU community expected I would come to a decision after listening to a diverse range of opinions. An approach rooted in respectful and dignified conversations had become a hallmark of my presidency. In cultivating a culture of inclusion and collaboration, disruptive occasions — when our values and mission are tested — are vital to this growth.
Monday morning, the president of our Student Government Association denounced West's baseless attack on our Muslim students. A short time later, YAF posted its counterpoint, again fueling conservative denouncements of SLU on social media.
Still, this backlash did not shake our students off course. That day, one email from a MSA member laid the foundation for how this situation might play out.
As we considered the bigger picture, the polarized climate in America, and the need for authentic leadership, we embraced that it is more effective to trust our students and empower them to do the right thing than to shield them, which might inhibit their exposure to growth experiences.
"In a time of extreme political turmoil surrounding American Muslims, it is very easy for us to believe that our citizenship and our rights are not equal in the eyes of Non-Muslim Americans, and having members like Allen West speak increases our fears of a worsening and less safe environment for peaceful Muslims in our community.
"I am not suggesting that you prohibit Allen West from speaking at SLU, as I believe in the basic right for everyone to speak their mind, however I request that you personally send out a statement in support of the Muslim Student Association and rejecting Allen West's claim that MSA is a 'radical jihadi group affiliated with the Muslim brotherhood.' This will help those Muslims who feel scrutinized by today's political environment get a sense of relief that the University truly stands for justice and equality for all races, religions and creeds."
This student's mature, merciful, and reasoned response struck a chord. Unlike the students who would protest at the West event, my continued silence exhibited complicity. I had to make a clear statement and take a stance. Others who reached out to me echoed his observations, and it aligned with the recommendations from my Vice President for Student Development and my Chief Diversity Officer.
Throughout the day Tuesday, my staff rescheduled meetings to open blocks of time to hear from our community members — by email, phone, and in person. Members of my executive staff and I met with social justice advocates, with leaders from MSA, SGA, the Rainbow Alliance, and the Black Student Alliance, and with members of the SLU College Republicans. As they spoke candidly, we listened intently, took notes, and asked questions. "Help me understand" introduced those questions I felt were most critical to our discussion.
We asked Muslim students about their experience on campus, and how the election climate was affecting them. We pressed parties for their thoughts on hate speech, free expression, and speech that can trigger violence. We pressed leaders of the College Republicans on why they were quick to engender a public fight rather than appeal the poster decision to a higher authority. We asked everyone to empathize with those of differing opinions.
These necessary conversations, which seek common ground, are difficult. Active, empathetic listening takes immense focus and depth, especially when emotions and tensions are high. And the ego of being a university president has to be subordinated to ensure healthy discourse. A university's ability to bend without breaking is contingent upon how effective it is at establishing long-lasting relationships with students by knowing them, listening to them, and trusting them.
This is no easy feat, but the uncertainty of this approach is softened by having confidence that the university's mission, vision, and values have taken root in the community. This approach attempts to break from seeing contentious conflicts on campus as merely diametrically opposed groups vying to achieve their own agendas. Instead, it emphasizes how dialoguing can help all parties involved make generative plans that move the university forward.
The decision I would make needed to be supported by Jesuit values and our University's mission. It needed to draw from insights and lessons learned from past campus controversies, and it needed to enable opportunities for further engagement on this issue.
My staff and I started drafting and refining my statement, which would condemn West's remarks but uphold the event. It would disappoint ideologues on either end of the political spectrum. But for the vast majority of the SLU community, my decision would simply make sense. It was circulated Wednesday afternoon via email and social media.
"In recent days, many others and I have worked to hear and understand the pain our Muslim students and allies are feeling. Let me take this opportunity to remind these—and all—SLU students that I am in solidarity with you.
As an institution of higher learning, SLU must resist the urge to suppress speech and instead expose all ideas and positions, provocative or pedestrian, to critical scrutiny.
"Yet, as distasteful and contrary to our Gospel values as this vilification may be, I believe that we should proceed with the College Republicans' program Thursday night. As an institution of higher learning, SLU must resist the urge to suppress speech and instead expose all ideas and positions, provocative or pedestrian, to critical scrutiny. The fundamental purpose of a community of scholars and learners is to engage respectfully rather than repress. And through this critical, yet civil engagement, the truth emerges. Let us approach the remarks of any guest speaker on our campus in this same manner."
Some were quick to denounce, even mock, my decision. Some alumni took to our Facebook page to voice their utter disappointment.
YAF posted a lengthy critique online, and West offered: "This is truly insidious stuff, attacking the very core of our civilization, but we won't let it go unchecked."
That afternoon, the head of the SLU College Republicans stood before the Student Government Association. Looking to leaders of MSA, he apologized.
Settling in at the podium, speaking in an even, almost subdued voice, "It's a pleasure and honor to speak with you all," West said. "This is the first time I've ever been in St. Louis."
Then, on cue, one student in a white shirt seated just in front of the podium stood up, turned to his right and paused before passing by others still seated. To the left and right, others stood and exited the auditorium row-by-row—choreographed to move at an amiable pace.
Not a word was spoken as their silence went unbroken. Not a gesture was made except a single black fist raised—a resoundingly quiet statement of protest, in contrast to the rancor that had played out on social media over the past eight days.
From the second level, murmurs from audience members were jarringly stilled by a young woman clapping and shouting, "USA. USA. USA." No one joined. Students down on the floor stood resolutely, waiting to leave. West's supporters filled their vacant seats, muttering comments that may not have been heard but for the contrasting silence. He talked, as he intended, and took questions.
Hundreds of students, alumni, faculty, and staff went to our Facebook page to praise the University's response and the powerful silent statement made by MSA members and their supporters.
My team and I met with 15 MSA student leaders for an hour the next day. Again, they raised tough questions. Some expressed distress that we had let West speak. But, as our discussion wrapped up, they expressed their understanding, appreciation, and support for how we managed such a controversial event.
I needed to remind them that it was they who acted as true leaders. They lived our University's values, displaying great character and commitment at a time when they could have easily succumbed to hurt and fear.
Empathetic conversation had paved the way.
|
cc/2020-05/en_middle_0087.json.gz/line1341204
|
__label__wiki
| 0.944548
| 0.944548
|
Coming off a big win, Nebraska visits Rutgers Saturday
Nov 13, 2015 | 2:38PM
Rutgers welcomes back Schiano as head coach
Dec 4, 2019 | 7:30PM
Rutgers forward Eugene Omoruyi announces intent to transfer
May 29, 2019 | 10:50AM
Rutgers takes down No. 22 Iowa on the road, 86-72
Mar 2, 2019 | 8:20PM
Rutgers stuns No. 16 Ohio State, 64-61, at the RAC Wednesday night
Jan 9, 2019 | 10:38PM
Rutgers' rally falls short in 72-66 loss to Seton Hall
Dec 15, 2018 | 5:44PM
Rutgers falls to No. 9 Michigan State in Big Ten opener, 78-69
Rutgers allow late touchdown to fall to Michigan State, 14-10
Rutgers plays final game of season vs. Michigan State at 4 p.m.
Rutgers allows four points in first half, routs EMU
Rutgers can't hang with No. 16 Penn State in 20-7 loss
Rutgers' C. Vivian Stringer wins 1,000th career game
Nov 13, 2018 | 10:19PM
Michigan dominates Rutgers, 42-7
Rutgers remains winless in Big Ten with 31-17 loss to Wisconsin
Rutgers LB charged in attempted double-murder plot
Rutgers falls just short to Northwestern, 18-15, remain winless
Rutgers loss to Maryland, 34-7
Rutgers falls to Illinois, 38-17
Sep 29, 2018 | 5:54PM
Indiana holds on to beat Rutgers, 24-17
Rutgers fall to Buffalo 42-13 for third straight loss
Rutgers routed by Kansas, 55-14
Rutgers blown out by Urban Meyer-less Ohio State, 52-3
Sep 8, 2018 | 8:00PM
OSU coach Urban Meyer suspended for Rutgers matchup on Sept. 8
Aug 23, 2018 | 10:44AM
Several Rutgers players reportedly involved in police investigation
Jul 13, 2018 | 11:26AM
Rutgers lands Texas transfer Jacob Young
Rutgers hot streak ends in 82-75 loss to Purdue
Mar 3, 2018 | 12:00AM
Today's game: Rutgers vs. no. 8 Purdue, 8:55 p.m.
Rutgers stuns Indiana, 76-69 in Big Ten Tournament
Rutgers beats Minnesota 65-54
Feb 28, 2018 | 11:45PM
Rutgers ends regular season with home loss to Illinois
Feb 25, 2018 | 5:38PM
Rutgers struggles in 79-52 loss to Ohio State
Maryland tops Rutgers, 61-51
Rutgers rallies to beat Northwestern, 67-58
Nebraska cruises to 67-55 win over Rutgers
Rutgers falls to Indiana, 65-43
Feb 5, 2018 | 9:38PM
Greg Schiano to join Patriots as new defensive coordinator
Purdue sneaks past Rutgers, 78-76
Today's game: Rutgers vs. no. 3 Purdue, 4 p.m.
Illinois blows out Rutgers, 91-60
Jan 30, 2018 | 10:27PM
Watkins propels Penn State to 60-43 win over Rutgers
Jan 27, 2018 | 8:49PM
Rutgers drops second straight, 60-54, to Nebraska
Michigan pulls away in second half to down Rutgers, 62-47
Sanders, Baker propel Rutgers to 80-64 win over Iowa
GEICO SportsNite: Pikiell discusses Rutgers loss to OSU
Weak first half does in Rutgers in 68-46 loss to Ohio State
Rutgers falls in OT to No. 4 Michigan State, 76-72
Rutgers extends contract of men's basketball coach Steve Pikiell
Sanders, Freeman lead Rutgers past Wisconsin, 64-60
Rutgers drops third straight, 82-51, to No. 13 Purdue
Jan 3, 2018 | 9:30PM
Rutgers late push not enough, lose to Hartford 60-58
Rutgers-Nebraska Preview
By Associated Press | Nov 13, 2015 | 2:38PM
Rutgers coach Kyle Flood is sticking with quarterback Chris Laviano despite poor performances the past three games. (Jeff Hanisch-USA TODAY Sports)
PISCATAWAY, N.J. (AP) The bowl season is underway for Nebraska and Rutgers. It's either win or face the prospect of missing the postseason.
Coming off a win over previously undefeated Michigan State, Nebraska (4-6, 2-4 Big Ten) will visit High Point Solutions Stadium for the first time to face Rutgers (3-6, 1-5) on Saturday.
Rutgers, the birthplace of college football, has been to a bowl game nine of the last 10 years. Nebraska has played in 51 bowls, third all-time behind Texas (53) and Alabama (62). The Cornhuskers have played in bowl games in 44 of 46 seasons.
Nebraska is breaking in first-year coach Mike Riley after Bo Pelini was fired last year following a nine-win campaign. Embattled Rutgers coach Kyle Flood is in his fourth year with questions whether he'll get a fifth following a season that has featured player dismissals and a three-game suspension for contacting a professor about a player's grade.
"We're all human. We're going to talk about it, but our main focus is to be 1-0. That's all you can think about it," Rutgers senior captain Quentin Gause said. "You think too far ahead, you get unfocused. You want to focus on one game at a time to get to where we want to go. "
Nebraska players have been talking about a three-game season, starting with the upset over now No. 14 Michigan State.
"We've got one under our belt and we're continuing to fight for larger things like a bowl bid. We've got Rutgers coming up, second game of our three-game season," defensive tackle Kevin Maurice said. "Now it's a two-game season."
There are 80 bowl slots to fill. If there are not enough bowl slots to fill with teams that are at least 6-6, a 5-7 team with a top-five APR (Academic Progress Rate) could be selected.
RECIEVER IN QUESTION: Rutgers offense needs a boost and it could come from its top playmaker Leonte Carroo. The star receiver missed the past two games with a lower body injury. He is listed as questionable this week. The All-Big Ten receiver has only played 15 of 36 quarters this season due to injury and suspensions, yet has nine of Rutgers' 14 touchdown receptions.
IT'S BEEN A WHILE: This will be the first time Nebraska has visited New Jersey since beating West Virginia 31-0 in the 1994 Kickoff Classic at the Meadowlands. New Jersey was fertile recruiting territory for Nebraska under Tom Osborne from the 1970s through the `90s. The Huskers haven't had a player from the state since defensive back D.J. Singleton of Jersey City in 2013. "We want to capitalize on all those kinds of connections and we'll sure use Nebraska's history in recruiting there," Riley said.
NO PLACE LIKE HOME: Nebraska has gone 1-3 on the road with their only win at Minnesota while losing at Miami, Illinois and Purdue. Nebraska is .500 or better in their first four seasons in the Big Ten. The Huskers need a win at Rutgers to go 2-2 on the road in the Big Ten. Nebraska is 11-8 overall in Big Ten road games since joining the league in 2011.
FLOOD STICKING WITH LAVIANO: Flood is sticking with quarterback Chris Laviano despite poor performances the past three games. LSU transfer Hayden Rettig could see action if the struggles continue. Laviano started the season well, completing a conference leading 69.3 percent of his passes for 12 touchdowns and six interceptions in six games. In the last three games, he has completed roughly 42 percent of his passes for 81.7 yards per game, no touchdowns and three interceptions.
DEFENSIVE STRUGGLES: Rutgers defense has allowed 1,441 yards and 146 points (48.7 per game) in losing to Ohio State, Wisconsin and Michigan. Opponents have scored 14 touchdowns in 20 trips in the redzone. "We just have to finish more and get guys on the ground.I just feel like it's an effort thing," linebacker Kaiwan Lewis said.
Tags: Chris Laviano, Kyle Flood, University of Nebraska Lincoln
Rutgers welcomes back Greg Schiano as head coach
Schiano previously led the Scarlet Knights from 2001-11
By Garrett Stepien | Dec 4, 2019 | 7:30PM
(Ben Solomon/Rutgers Athletics)
Rutgers reintroduced Greg Schiano as its head football coach Wednesday morning at the Hale Center in Piscataway, New Jersey, where it welcomed back the program's 11-year leader from 2001-11.
After the Board of Governors approved his eight-year contract for $32 million Tuesday morning, Schiano returned to the Scarlet Knights' team facility in SHI Stadium as Rutgers rolled out the red carpet.
In an introductory press conference featuring statements from university president Robert Barchi, athletic director Patrick Hobbs and New Jersey Gov. Phil Murphy, Schiano passionately spoke of his plan for the program he initially started to rebuild 19 years ago.
Omoruyi led Scarlet Knights last season in scoring and rebounding
Feb 9, 2019; Champaign, IL, USA; Rutgers Scarlet Knights forward Eugene Omoruyi (5) dunks the ball defended by Illinois Fighting Illini guard Trent Frazier (1) and guard Aaron Jordan (23) in overtime at State Farm Center. Mandatory Credit: Mike Granse-USA TODAY Sports (Mike Granse)
Rutgers men's basketball player Eugene Omoruyi posted a message on his Instagram account saying he will transfer from the program and has requested his release.
Omoruyi, who just finished his junior season, led the Scarlet Knights in points per game (13.8) and rebounds per game (7.2) during the 2018-19 season. The 6-foot-7 forward also averaged the second-most minutes on the team at 29.1 per game.
Freshman Ron Harper Jr. scored a season-high 27 points
Mar 2, 2019; Iowa City, IA, USA; Rutgers Scarlet Knights forward Ron Harper Jr. (24) goes to the basket as Iowa Hawkeyes forward Luka Garza (55) defends during the first half at Carver-Hawkeye Arena. Mandatory Credit: Jeffrey Becker-USA TODAY Sports (Jeffrey Becker)
IOWA CITY, Iowa (AP) No. 22 Iowa has likely done enough to lock up an NCAA Tournament spot.
But it's fair to start wondering if the Hawkeyes will be able to do anything once they get there.
Freshman Ron Harper Jr. scored a season-high 27 points and Rutgers rolled past Iowa 86-72 on Saturday in the Hawkeyes' home finale.
Montez Mathis led the Scarlet Knights with 16 points
Jan 9, 2019; Piscataway, NJ, USA; Rutgers Scarlet Knights celebrate after defeating the Ohio State Buckeyes at Rutgers Athletic Center (RAC). Rutgers Scarlet Knights won 64-6. Mandatory Credit: Noah K. Murray-USA TODAY Sports (Noah K. Murray)
PISCATAWAY, N.J. (AP) Montez Mathis hit two contested layups and Geo Baker nailed a jumper with 10.3 seconds to play as Rutgers scored its biggest Big Ten Conference victory under coach Steve Pikiell, a 64-61 decision over No. 16 Ohio State on Wednesday.
The win was the Scarlet Knights' first against a ranked Big Ten team since an upset of No. 4 Wisconsin in January 2015 under then-coach Eddie Jordan.
Rutgers (8-6, 1-3) scored the final six points and survived a missed 3-point attempt by C.J. Jackson in handing the Buckeyes (12-3, 2-2) their second straight loss...
Rutgers fell to 5-5 on the season
Nov 30, 2018; Piscataway, NJ, USA; Rutgers Scarlet Knights guard Geo Baker (0) dribbles during the second half at against the Michigan State Spartans Rutgers Athletic Center (RAC). Mandatory Credit: Vincent Carchietta-USA TODAY Sports (Vincent Carchietta)
NEWARK, N.J. (AP) Myles Powell had a game-high 28 points, including six 3-pointers to lead Seton Hall past Rutgers 72-66 in the Garden State Hardwood Classic Saturday.
Rutgers tests No. 9 Michigan State before falling in Big Ten opener, 78-69
Double-double from junior forward Eugene Omoruyi (16 points, 11 rebounds) not enough to buoy the Knights
Nov 30, 2018; Piscataway, NJ, USA; Michigan State Spartans forward Nick Ward (44) posts up on Rutgers Scarlet Knights center Shaquille Doorson (2) during the second half at Rutgers Athletic Center (RAC). Mandatory Credit: Vincent Carchietta-USA TODAY Sports (Vincent Carchietta)
PISCATAWAY, N.J. (AP) Cassius Winston scored 22 points and Nick Ward had 20 points to lead No. 9 Michigan State past Rutgers 78-69 in the Big Ten opener Friday night.
After a back-and-forth first half, where Rutgers led much of the first 10 minutes, Winston hit a 3-pointer to give Michigan State (5-2) the 39-37 lead over Rutgers (5-2) at the break.
Rutgers would open the second half with a 3-pointer by Peter Kiss from the top of the arc to retake the lead, but a quick 6-0 run from Michigan State caused Rutgers coach Steve Pikiell to call timeout down 45-40 with 17:54 to go. The deficit would eventually balloon to 13.
Tags: Rutgers University
Senior Giovanni Rescigno went 9-for-17 for 109 yards and a touchdown
Nov 24, 2018; East Lansing, MI, USA; Rutgers Scarlet Knights running back Jonathan Hilliman (23) is tackled for a loss by Michigan State Spartans defensive tackle Raequan Williams (99) during the second half of a game at Spartan Stadium. Mandatory Credit: Mike Carter-USA TODAY Sports (Mike Carter)
EAST LANSING, Mich. (AP) Cody White scored on a 22-yard end-around with 3:57 to play, and Michigan State edged Rutgers 14-10 on Saturday night, handing the Scarlet Knights their 11th straight loss.
The Spartans (7-5, 5-4 Big Ten) trailed 10-7 when William Przystup's punt pinned Rutgers (1-11, 0-9) back at its own 1-yard line with 5:23 remaining. The Scarlet Knights eventually had to punt, and Michigan State took over at the Rutgers 35. Quarterback Rocky Lombardi ran for a 13-yard gain on third-and-10, and on the next play, White scored.
The Scarlet Knights drove into Michigan State territory, but Josiah Scott intercepted a pass at the 3-yard line with 1:32 to play.
Michigan State was stopped on fourth down at its own 33 in the first quarter, and Rutgers took advantage of the field position. Giovanni Rescigno threw a 27-yard touchdown pass to Travis Vokolek for a 7-0 lead. >> Read more
The Scarlet Knights fell to Penn State last week
Nov 17, 2018; Piscataway, NJ, USA; Rutgers Scarlet Knights quarterback Artur Sitkowski (8) drops back to pass while being hurried by Penn State Nittany Lions defensive tackle Robert Windsor (54) during the first half at High Point Solutions Stadium. Mandatory Credit: Vincent Carchietta-USA TODAY Sports (Vincent Carchietta)
EAST LANSING, Mich. (AP) As a senior at Michigan State, Khari Willis has certainly experienced college football's ups and downs.
His freshman season, the Spartans won the Big Ten and went to the College Football Playoff. Then the team collapsed to a 3-9 record the following year. Michigan State bounced back to win 10 games in 2017, but this season has been another disappointment - the Spartans are barely bowl eligible as they enter their regular-season finale.
"I think it's a lot of growth," said Willis, a Michigan State safety. "Through it all, learning, finding a way to stick together."
Rutgers allows four points in first half, routs Eastern Michigan 63-36
Rutgers forces EMU to go 2-for-25 in first half
Rutgers Scarlet Knights guard Geo Baker (Noah K. Murray/USA TODAY Sports)
Geo Baker had 20 points and Rutgers held Eastern Michigan to an NCAA-record low four first-half points in a 63-36 rout on Monday night.
Rutgers (3-1) tied an NCAA Division I record for points allowed in a half as it built a 31-4 halftime lead. It was Eastern Michigan, coincidently, that held Northern Illinois to four points (18-4) in the first half on Jan. 16, 2013. Kansas State outscored Savannah State 48-4 in the second half on Jan. 7, 2008.
Eastern Michigan (4-2) was 0 of 7 from the free-throw line in the first half, and didn't score until Kevin McAdoo's jumper at the 14-minute mark. The Eagles didn't score again until 5:36 left in the first half.
Scarlet Knights fall to 1-10, 0-9 in Big Ten
PISCATAWAY, N.J. (AP) Trace McSorley threw two touchdown passes to tight end Pat Freiermuth and No. 16 Penn State's defense set up two touchdowns with turnovers in a 20-7 victory over Rutgers on Saturday, sending the Scarlet Knights to their 10th straight loss.
McSorley's touchdown passes covered 6 yards in the second quarter and 18 in the fourth as the Nittany Lions (8-3, 5-3 Big Ten, No. 14 CFP) beat Rutgers (1-10, 0-7) for the 12th straight time. Jake Pinegar added field goals of 22 and 19 yards.
The win was No. 30 for McSorley as a starter, making him the winningest quarterback in school history. The senior had been tied with Todd Blackledge (1980-82) and Tony Sacca (1988-91). The two touchdowns increased his total - running and passing - to 101.
Becomes sixth Division I coach to reach milestone
Mar 2, 2018; Indianapolis, IN, USA; Rutgers Scarlet Knights head coach C. Vivian Stringer yells to her team in the second half during the third round of the Big Ten Conference Tournament at Bankers Life Fieldhouse. Ohio State defeated Rutgers 82 to 57. Mandatory Credit: Marc Lebryk-USA TODAY Sports (Marc Lebryk)
Rutgers women's head coach C. Vivian Stringer made history Tuesday night.
Stringer, 70, became the sixth Division I college head coach to win 1,000 career games with a 73-44 victory over Central Connecticut State.
The Naismith Hall of Fame also became the first African-American coach to achieve the feat as she improved her career record to 1,000-402 in her 47th season as a college head coach.
Rutgers had no passing yards until the third quarter
Nov 10, 2018; Piscataway, NJ, USA; Michigan Wolverines running back Chris Evans (12) rushes for a touchdown against Rutgers Scarlet Knights defensive back Isaiah Wharton (11) during the second half at High Point Solutions Stadium. Mandatory Credit: Noah K. Murray-USA TODAY Sports (Noah K. Murray)
PISCATAWAY, N.J. (AP) Shea Patterson threw for 260 yards and three touchdowns, Karan Higdon ran for a pair of 1-yard scores and No. 4 Michigan kept its national championship hopes intact with a 42-7 win over Rutgers on Saturday.
The Wolverines (9-1, 7-0 Big Ten, No. 4 CFP) have won nine straight and remain in first place in the conference's East Division. They have a final tuneup against Indiana next week at the Big House before closing the regular season at No. 8 Ohio State. Michigan hasn't lost since the season opener against No. 3 Notre Dame and would have to beat the Buckeyes for just the second time in 15 years to keep any hope at a national title alive.
Badgers rush for 317 yards as RU drops to 1-8
Nov 3, 2018; Madison, WI, USA; Rutgers Scarlet Knights quarterback Artur Sitkowski (8) throws a pass while being hit by Wisconsin Badgers linebacker Ryan Connelly (43) during the second quarter at Camp Randall Stadium. Mandatory Credit: Jeff Hanisch-USA TODAY Sports (Jeff Hanisch)
MADISON, Wis. (AP) Jonathan Taylor rushed for 208 yards and three touchdowns, and Wisconsin played smash-mouth football in the second half to run away from Rutgers for a 31-17 win on Saturday.
Ryan Connelly led a strong effort from the front seven with eight tackles, while D'Cota Dixon blocked a field-goal attempt for the Badgers (6-3, 4-2 Big Ten).
Starting quarterback Alex Hornibrook left the game at halftime because of a head injury, a week after missing a loss at Northwestern while in the concussion protocol.
Izaia Bullock was dismissed from the team after his arrest
Sep 15, 2018; Lawrence, KS, USA; A general view of a Rutgers Scarlet Knights helmet during the game against the Kansas Jayhawks at Memorial Stadium. Kansas won 55-14. Mandatory Credit: Denny Medley-USA TODAY Sports (Denny Medley)
Rutgers linebacker Izaia Bullock was arrested on Tuesday after authorities discovered he was allegedly involved in a plot to kill two family members of a friend's family, according to NJ.com.
The 22-year-old junior was charged with two counts of first-degree attempted murder and two counts of first-degree conspiracy to commit murder.
Bullock was dismissed from the team on Tuesday and his player page on the university's athletic site has been deleted.
Rutgers fails to hold 15-8 lead in fourth quarter
Oct 20, 2018; Piscataway, NJ, USA; Rutgers Scarlet Knights defensive lineman Mike Tverdov (97) tackles Northwestern Wildcats running back Isaiah Bowser (25) during the second half at High Point Solutions Stadium. Mandatory Credit: Noah K. Murray-USA TODAY Sports (Noah K. Murray)
PISCATAWAY, N.J. (AP) Isaiah Bowser scored on a 5-yard run with 8:12 to play and Northwestern avoided a major letdown by converting two fourth-downs plays on the game-winning drive to defeat struggling Rutgers 18-15 on Saturday.
Bowser also scored on a 3-yard run and Drew Luckenbaugh kicked a 23-yard field goal as the Wildcats (4-3, 4-1 Big Ten) won their third straight game by rallying from an eight-point third-quarter deficit. Clayton Thorson hit Flynn Nagel on a 2-point conversion pass after Bowser's go-ahead run.
Isaih Pacheco scored on a 44-yard run for Rutgers (1-7, 0-5), which lost its seventh straight game. Justin Davidovicz kicked field goals of 42 and 26 yards, while Willington Previlon had a sack for a safety.
Rutgers stay winless in Big Ten with 34-7 loss to Maryland
Rutgers drops fifth straight game
COLLEGE PARK, Md. (AP) After watching Maryland ring up 34 points and 379 yards, Terrapins interim coach and offensive coordinator Matt Canada pulled a reverse and spoke glowingly about the defense.
And why not? Maryland picked off five passes, yielded only 179 yards and took a shutout into the final minute of a 34-7 rout of Rutgers on Saturday.
"We played exceptionally well and unbelievably well on defense," Canada said. "On offense, we scored enough points to win the game..."
Oct 6, 2018; Piscataway, NJ, USA; Rutgers Scarlet Knights quarterback Artur Sitkowski (8) looks on during the second half against the Illinois Fighting Illini at High Point Solutions Stadium. Mandatory Credit: Noah K. Murray-USA TODAY Sports (Noah K. Murray)
PISCATAWAY, N.J. (AP) Quarterback AJ Bush ran for 116 yards and two touchdowns and threw for another in his return to the lineup as Illinois used a big ground game to beat Rutgers 38-17 Saturday, sending the Scarlet Knights to their fifth straight loss.
Bush, who missed the last two games with a hamstring injury, scored on runs of 3 and 41 yards in the first half. He iced the game with an 11-yard TD pass to Ricky Smalling early in the fourth quarter.
Rutgers lost for a fourth straight game
Sep 29, 2018; Piscataway, NJ, USA; Indiana Hoosiers defensive back Jamar Johnson (16) intercepts a pass intended for Rutgers Scarlet Knights tight end Jerome Washington (88) during the first half at High Point Solutions Stadium. Mandatory Credit: Ed Mulholland-USA TODAY Sports (Ed Mulholland)
PISCATAWAY, N.J. (AP) Indiana got away with playing half a game against downtrodden Rutgers.
The Scarlet Knights didn't see it that way. They believed they finally showed signs of being able to win a couple of game this season.
Rutgers 1-3 on the season
Sep 22, 2018; Piscataway, NJ, USA; Rutgers Scarlet Knights head coach Chris Ash during second half against Buffalo Bulls at High Point Solutions Stadium. Mandatory Credit: Noah K. Murray-USA TODAY Sports (Noah K. Murray)
PISCATAWAY, N.J. (AP) Tyree Jackson threw for 263 yards and three touchdowns and Buffalo used its big-play offense to remain unbeaten and roll over reeling Rutgers 42-13 Saturday.
The win was the first for the Bulls over a Big Ten Conference opponent and pushed their record to 4-0, their best start since 1981. It also extended their winning streak to seven straight games dating to last season and gave them two road wins over nonconference opponents in a season for the first time since joining the FBS ranks in 1999.
It was the third straight loss for Rutgers (1-3), which has given up 149 points in those games. Justin Davidovicz kicked two first-half field goals and Raheem Blackshear scored on a 14-yard run early in the fourth quarter with backup Gio Rescigno at quarterback.
The Scarlet Knights threw three interceptions and fumbled three times
Sep 15, 2018; Lawrence, KS, USA; Kansas Jayhawks quarterback Carter Stanley (9) runs the ball during the second half against the Rutgers Scarlet Knights at Memorial Stadium. Kansas won 55-14. Mandatory Credit: Denny Medley-USA TODAY Sports (Denny Medley)
LAWRENCE, Kan. (AP) Six takeaways, including two pick-6s, and an explosive running game carried Kansas to a 55-14 blowout over Rutgers on Saturday, marking the Jayhawks' first back-to-back wins over FBS opponents since 2009.
Bryce Torneden and Mike Lee each returned interceptions for touchdowns as the Scarlet Knights threw three picks and surrendered three fumbles. Couple that with the dominant performance on the ground, and you get a performance that surprised even coach David Beaty.
"I didn't see this coming against these guys because they are a very talent-rich football team and I've said so many times how good of a coach Chris Ash is," Beaty said. "It was our day. Sometimes, it becomes your day." >> Read more
Rutgers outgained 579-134 in loss
Ohio State Buckeyes linebacker Keandre Jones tackles Rutgers Scarlet Knights running back Isaih Pacheco in the second half at Ohio Stadium. (Aaron Doster-USA TODAY Sports)
The Rutgers football team was blown out 52-3 by No. 4 Ohio State on Saturday at Buckeye Stadium in the Buckeyes' second game without head coach Urban Meyer.
Meyer was suspended for the first three games of Ohio State's season after he mishandled domestic violence allegations against former assistant coach Zach Smith.
Rutgers was outgained 579-134 and turned the ball over twice, managing just a third-quarter field goal while Ohio State took a 35-0 lead at halftime.
Meyer was suspended after Zach Smith investigation
Urban Meyer Mandatory Credit: Greg Bartram-USA TODAY Sports (Greg Bartram)
Ohio State head football coach, Urban Meyer, was suspended for the first three games of the season after an investigation found he had mishandled domestiv violence allegations against former assistant coach Zach Smith.
Meyer will also be suspended without pay for six weeks, while being allowed to resume activity with his program after Sept. 2. However, he will be missing those three games, one of which is against Rutgers on Sept. 8.
The Scarlet Knights are set to travel to Columbus to face off against the Buckeyes in the Shoe. Ohio State is currently ranked No. 5 in the country after the preseason poll.
Police investigating fraudulent use of credit cards
Rutgers Scarlet Knights fans during first half against Ohio State Buckeyes at High Point Solutions Stadium. (Noah K. Murray/USA TODAY Sports)
As many as eight Rutgers football players could be involved in an investigation for fraudulent use of credit cards, according to NJ.com's Keith Sargeant.
The investigation, which the Rutgers University Police Department is conducting, is ongoing, and specifics of the probe have not been released.
It's currently unclear if the investigation is related to the dismissals of linebacker Brendan DeVera and safety K.J. Gray, who are no longer with the team for violating team rules, according to Sargeant, and were released from their scholarships, making them free to transfer to other schools.
Nov 28, 2017; Piscataway, NJ, USA; Rutgers Scarlet Knights head coach Steve Pikiell talks with his players during a second half time out against the Florida State Seminoles at Louis Brown Athletic Center. Mandatory Credit: Noah K. Murray-USA TODAY Sports (Noah K. Murray)
Texas transfer Jacob Young committed to Steve Pikiell and Rutgers on Saturday evening, giving the Scarlet Knights a high-major addition to work with.
Young played two seasons at the Longhorns, providing a scoring threat off the bench for head coach Shaka Smart. In his freshman campaign, he struggled, shooting only 29 percent from the field and notching 3.7 points per game, but in year two, Young averaged 6.2 PPG and hit 41 percent of his shots from the field in nearly the same minutes per night.
Rutgers hot streak ends in 82-75 loss to Purdue in Big Ten Championship
(Brad Penner)
NEW YORK (AP) Carsen Edwards and Vincent Edwards each scored 26 points and No. 8 Purdue fought back another upset bid by Rutgers, beating the Scarlet Knights 82-75 on Friday night to advance to the Big Ten Tournament semifinals. >> Read more
Feb 20, 2018; Columbus, OH, USA; Ohio State Buckeyes forward Keita Bates-Diop (33) is fouled by Rutgers Scarlet Knights forward Candido Sa (1) during the first half at Value City Arena. Mandatory Credit: Joe Maiorana-USA TODAY Sports (Joseph Maiorana)
The Scarlet Knights stunned Indiana 76-69 on Thursday after falling behind by 14 points. Rutgers lost at home to the Hoosiers 65-43 on Feb. 5. << Read more
Rutgers stuns Indiana, 76-69, to advance in Big Ten Tournament
Mar 1, 2018; New York, NY, USA; Rutgers Scarlet Knights forward Mamadou Doucoure (21) and guard Mike Williams (5) react during the first half against the Indiana Hoosiers in a second round game of the 2018 Big Ten Tournament at Madison Square Garden. Mandatory Credit: Nicole Sweet-USA TODAY Sports (Nicole Sweet)
NEW YORK (AP) Corey Sanders scored 28 points and last-place Rutgers upset Indiana 76-69 Thursday night to advance to the quarterfinals of the Big Ten Tournament, the Scarlet Knights most notable accomplishment in four seasons since joining the conference.
The 14th-seeded Scarlet Knights (15-18) face third seed and No. 8 Purdue at Madison Square Garden in the final game of Friday's quarterfinal quadruple-header.
The Hoosiers (16-15) started the game on a 17-3 run, but were manhandled for the most part by Rutgers over the final 30 minutes. >> Read more
Rutgers beats Minnesota 65-54 to advance in Big Ten Tournament
Jan 10, 2018; East Lansing, MI, USA; Rutgers Scarlet Knights guard Corey Sanders (3) brings the ball up court during the first half of a game against the Michigan State Spartans at Jack Breslin Student Events Center. Mandatory Credit: Mike Carter-USA TODAY Sports (Mike Carter)
NEW YORK (AP) Corey Sanders scored 23 points and last-place Rutgers won a Big Ten Tournament game for the second straight season, beating Minnesota 65-54 on Wednesday night at Madison Square Garden.
The 14th seed Scarlet Knights (14-18) play sixth-seeded Indiana on Thursday night. Rutgers upset Ohio State as the 14th seed in last year's Big Ten tournament.
Minnesota (15-17) ended an awful season, filled with off-court issues and injuries, by losing 14 of its final 16 games. Isaiah Washington, a freshman from Harlem, led the Gophers with 18 points.
Illinois Fighting Illini guard Te'Jon Lucas defends against Rutgers Scarlet Knights guard Mike Williams during first half at Louis Brown Athletic Center. (Noah K. Murray/USA TODAY Sports)
Michael Finke and Aaron Jordan came off the bench to combine for 34 points and lead Illinois past Rutgers 75-62 on Sunday.
Deshawn Freeman blocked a shot by Trent Frazier and then assisted Eugene Omoruyi (14 points) on a fast-break layup to give Rutgers (13-18, 3-15 Big Ten) a 36-35 lead.
COLUMBUS, Ohio (AP) C.J. Jackson scored 18 points to help No. 16 Ohio State rout Rutgers 79-52 on Tuesday night.
Feb 17, 2018; College Park, MD, USA; Rutgers Scarlet Knights forward Eugene Omoruyi (11) looks to pass as Maryland Terrapins forward Bruno Fernando (23) defends during the second half at XFINITY Center. Mandatory Credit: Tommy Gilligan-USA TODAY Sports (Tommy Gilligan)
COLLEGE PARK, Md. (AP) Bruno Fernando had 18 points and a career-high 16 rebounds, and Maryland kept Rutgers winless on the road with a 61-51 victory Saturday night.
Feb 13, 2018; Piscataway, NJ, USA; Rutgers Scarlet Knights guard Geo Baker (0) battles Northwestern Wildcats forward Vic Law (4) for the ball during second half at Louis Brown Athletic Center. Mandatory Credit: Noah K. Murray-USA TODAY Sports (Noah K. Murray)
Rutgers scored 32 points in the second half to force overtime, then went on an 11-2 run in overtime to beat Northwestern on Tuesday night at the Louis Brown Athletic Center. >> Box score
Jan 17, 2018; Piscataway, NJ, USA; Rutgers Scarlet Knights guard Corey Sanders (3) dunks against Iowa Hawkeyes forward Luka Garza (55) during second half at Louis Brown Athletic Center. Mandatory Credit: Noah K. Murray-USA TODAY Sports (Noah K. Murray)
LINCOLN, Neb. (AP) Isaiah Roby had 10 points, 11 rebounds and two blocked shots and Nebraska opened up 16-point leads in both halves and didn't let Rutgers get closer than 10 points in the last 14 minutes to take a 67-55 win Saturday.
Rutgers Scarlet Knights center Shaquille Doorson grabs a rebound against Indiana Hoosiers forward Juwan Morgan during first half at Louis Brown Athletic Center. (Noah K. Murray/USA TODAY Sports)
Juwan Morgan had 24 points and eight rebounds and Robert Johnson scored 19 points to lead Indiana past Rutgers 65-43 on Monday night.
Indiana (13-12, 6-7 Big Ten) opened a 42-22 lead with 12 1/2 minutes remaining after Josh Newkirk found Collin Hartman for a 3-pointer, causing Rutgers to call a timeout. Indiana would lead by as many 24.
Former Rutgers head coach Greg Schiano will take the vacant defensive coordinator position with the Patriots next season, per NJ.com's Ryan Dunleavy.
The Patriots wasted no time in filling the position after their loss in Super Bowl LII on Sunday, and with the Lions officially announcing Matt Patricia as their new head coach, they were allowed to make the announcement on Schiano.
Schiano, who served as head coach for Rutgers for 11 seasons from 2001-11, has spent the past two seasons as Ohio State's defensive coordinator under Urban Meyer. He was looking to find his way back to the NFL (two seasons as Bucs head coach from 2012-13), and with Belichick a close friend, it appears their connection as turned them into colleagues.
PISCATAWAY, N.J. (AP) Vincent Edward had 18 points, seven rebounds and eight assists, and No. 3 Purdue held on to beat Rutgers 78-76 on Saturday for a school-record 19th straight win.
PISCATAWAY, N.J. -- Purdue takes its school-record and nation-best 18-game win streak to Rutgers on Saturday, a school the No. 3 Boilermakers have enjoyed recent success against.
The Boilermakers haven't lost since Nov. 23, when they dropped a 77-73 decision to Western Kentucky. Purdue has scored at least 70 points in 16 straight games.
Purdue (22-2, 11-0 Big Ten) leads the series with Rutgers (12-12, 2-9) 9-1, having won seven games in a row. Purdue is 5-0 against the Scarlet Knights as members of the Big Ten Conference and has won all five games by at least seven points, including three straight by an average of 33.3 points.
Jan 30, 2018; Champaign, IL, USA; Rutgers Scarlet Knights guard Corey Sanders (3) shoots defended by Illinois Fighting Illini guard Mark Alstork (24) and forward Michael Finke (43) during the second half at State Farm Center. Mandatory Credit: Mike Granse-USA TODAY Sports (Mike Granse)
CHAMPAIGN, Ill. (AP) Kipper Nichols scored 19 points and Trent Frazier had 17 points to lift Illinois to a 91-60 victory over Rutgers on Tuesday night.
Jan 27, 2018; University Park, PA, USA; Penn State Nittany Lions guard Tony Carr (10) drives to the basket against the defense of Rutgers Scarlet Knights guard Geo Baker (0) during the second half at the Bryce Jordan Center. Mandatory Credit: Rich Barnes-USA TODAY Sports (Rich Barnes)
STATE COLLEGE, Pa. (AP) Patrick Chambers was admittedly skeptical his team would be able to maintain the pace it used to pull off a buzzer-beating win at Ohio State just two days before.
Jan 24, 2018; Piscataway, NJ, USA; Nebraska Cornhuskers guard Anton Gill (13) drives to the basket against Rutgers Scarlet Knights forward Deshawn Freeman (33) during first half at Louis Brown Athletic Center. Mandatory Credit: Noah K. Murray-USA TODAY Sports (Noah K. Murray)
PISCATAWAY, N.J. (AP) Isaac Copeland scored 23 points and came up with a clutch rebound in the final minute to lead Nebraska to 60-54 victory over Rutgers on Wednesday night.
James Palmer Jr. added 18 points and Glynn Watson Jr. made two clutch layups in the final 2:30 as the Cornhuskers (15-8, 6-4 Big Ten) won their second road game of the season.
Corey Sanders had 14 points to lead Rutgers (12-10, 2-7) but he also was called for an offensive foul on a drive with the Scarlet Knights down by four with 14 seconds to play. >> Read more
Jan 21, 2018; Ann Arbor, MI, USA; Rutgers Scarlet Knights guard Corey Sanders (3) shoots on Michigan Wolverines guard Jaaron Simmons (5) in the second half at Crisler Center. Mandatory Credit: Rick Osentoski-USA TODAY Sports (Rick Osentoski)
ANN ARBOR, Mich. (AP) Moe Wagner scored 16 points and Duncan Robinson added 12 to lift No. 23 Michigan to a 62-47 victory over Rutgers on Sunday.
PISCATAWAY, N.J. (AP) Corey Sanders had 18 points and eight assists and two steals and Geo Baker had 17 points, five rebounds, five assists and two steals, to lead Rutgers past Iowa 80-64 on Wednesday night.
Rutgers Scarlet Knights guard Corey Sanders controls the ball as Ohio State Buckeyes forward Kaleb Wesson defends during first half at Louis Brown Athletic Center. (Noah K. Murray/USA TODAY Sports)
Keita Bates-Diop scored 20 points, grabbed nine rebounds and Ohio State beat Rutgers 68-46 to remain undefeated in Big Ten play this season and tied atop the conference standings.
Ohio State (15-4, 6-0) built up a 30-point lead after Kam Williams converted on a 4-point play with 13:47 remaining to make it 48-18.
Kaleb Wesson had 10 points and nine rebounds and Williams finished with 11 points for Ohio State
EAST LANSING, Mich. (AP) Miles Bridges ended his scoreless start with 7:43 left in regulation and finished with just 11 points to barely help No. 4 Michigan State bounce back from a loss with a 76-72 overtime victory over Rutgers on Wednesday night.
The Spartans (16-2, 4-1 Big Ten) were coming off a lopsided loss at Ohio State and the setback seemed to have lingering effects for the team and their sophomore star. >> Read more.
Jan 5, 2018; Piscataway, NJ, USA; Rutgers Scarlet Knights head coach Steve Pikiell reacts during first half play against Wisconsin Badgers at Louis Brown Athletic Center. Mandatory Credit: Noah K. Murray-USA TODAY Sports (Noah K. Murray)
Rutgers and men's basketball coach Steve Pikiell have agreed to a three-year contract extension, university athletic director Patrick Hobbs announced Wednesday.
Pikiell will be guaranteed $15.05 million over the next five seasons, plus performance bonuses, which runs through 2023-2024.
Sanders, Freeman lead Rutgers past Wisconsin, 64-60, at home
PISCATAWAY, N.J. (AP) Corey Sanders scored 23 points on 10-of-19 shooting to give Rutgers a much-needed win over Wisconsin, 64-60, Friday night.
Sanders scored with 1:47 left then added a 3-pointer with under a minute to go for a 58-53 lead.
Brad Davison hit Wisconsin's first 3-pointer of the game to tie it at 53 and cap a 7-0 run. >> Read more
Jan 3, 2018; West Lafayette, IN, USA; Purdue Boilermakers guard Carsen Edwards (3) battles for a loose ball with Rutgers Scarlet Knights guard Geo Baker (0) and forward Deshawn Freeman (33) in the first half at Mackey Arena. Mandatory Credit: Sandra Dukes-USA TODAY Sports (Sandra Dukes)
WEST LAFAYETTE, Ind. (AP) Isaac Haas scored 14 points and Dakota Mathias finished with 13 on Wednesday night to help No. 13 Purdue pull away from Rutgers 82-51.
The Boilermakers (14-2, 3-0 Big Ten) have won 10 straight overall and 17 consecutive home games.
Geo Baker had 11 points to lead the Scarlet Knights (10-6, 0-3), who have lost three straight. Mike Williams added 10. >> Read more
Feb 11, 2017; Piscataway, NJ, USA; Rutgers Scarlet Knights guard Corey Sanders (3) handles the ball against Minnesota Golden Gophers during first half at Louis Brown Athletic Center. Mandatory Credit: Noah K. Murray-USA TODAY Sports (Noah K. Murray)
PISCATAWAY, N.J. (AP) John Carroll scored 17 points and grabbed nine rebounds and Hassan Attia scored 11 points to go with another nine rebounds as Hartford pulled off its first win at Rutgers, nipping the Scarlet Knights 60-58 on Thursday night.
Rutgers needed a late 20-5 run to recover from a 13-point deficit late and hold off Hartford last season.
J.R. Lynch and Jason Dunne each had 14 points and combined to hit six 3s for the Hawks.
rutgers Archives
|
cc/2020-05/en_middle_0087.json.gz/line1341211
|
__label__cc
| 0.543433
| 0.456567
|
Sediment transport due to extreme events: The Hudson River estuary after tropical storms Irene and Lee
By: David K. Ralston, John C. Warner, W. Rockwell Geyer, and Gary R. Wall
https://doi.org/10.1002/2013GL057906
Open Access Version: External Repository
Tropical Storms Irene and Lee in 2011 produced intense precipitation and flooding in the U.S. Northeast, including the Hudson River watershed. Sediment input to the Hudson River was approximately 2.7 megaton, about 5 times the long-term annual average. Rather than the common assumption that sediment is predominantly trapped in the estuary, observations and model results indicate that approximately two thirds of the new sediment remained trapped in the tidal freshwater river more than 1 month after the storms and only about one fifth of the new sediment reached the saline estuary. High sediment concentrations were observed in the estuary, but the model results suggest that this was predominantly due to remobilization of bed sediment. Spatially localized deposits of new and remobilized sediment were consistent with longer term depositional records. The results indicate that tidal rivers can intercept (at least temporarily) delivery of terrigenous sediment to the marine environment during major flow events.
10.1002/2013GL057906
AGU Publications
Woods Hole Coastal and Marine Science Center
|
cc/2020-05/en_middle_0087.json.gz/line1341213
|
__label__wiki
| 0.823669
| 0.823669
|
Public comment open for mine permit in Esmeralda County
The state Bureau of Air Pollution Control at the Nevada Division of Environmental Protection has opened the public notice period for a permit for a proposed Gemfield Mine in Esmeralda County, organizers announced.
By Daria Sokolova Special to the Pahrump Valley Times
David Jacobs/Pahrump Valley Times The mine would be located approximately 30 miles south of Tonopah and one mile north of Goldfield.
The public comment period is from Jan. 9 to Feb. 8, 2019.
Details were announced in a news release.
The bureau has reviewed the application and already made a preliminary determination to issue a Mercury Operating Permit to Reno-based Gemfield Resources LTD. The mine would be located approximately 30 miles south of Tonopah and one mile north of Goldfield.
JoAnn Kittrell, public information manager at the Nevada Department of Conservation and Natural Resources, said the Nevada Mercury Control Program is a state regulatory program that requires mercury emissions controls on thermal units at precious metal mines, follows a strict review and analysis process of the permit application “to ensure that mercury emissions from thermal processes are the lowest achievable based on the maximum achievable control emission technology.”
“After the permit application was reviewed and the decision of issuing the permit was reached, the Nevada Mercury Control Program within the DCNR has no concerns with this permit,” Kittrell said.
The proposed project will not cause or contribute to a violation of any federal or state of Nevada air quality standards, according to the press release.
Kittrell said that compliance with the limits defined in the issued permit is also verified through regular testing, along with rigorous monitoring of the emission control technology itself. The NMCP has achieved emission limits in its regulated facilities that are significantly lower than federal standards, she said.
Gemfield Mine is a new open pit, heap leach, and gold recovery mining operation, according to the press release. The permit is required for the site’s proposed thermal units, which consist of a carbon regeneration kiln, a strip solution tank, an electrowinning cell, a retort, and a melt furnace.
Esmeralda County has 11 mines that have current water pollution control permits. They include Mineral Ridge Gold Mine, Silver Peak Lithium, Lone Mountain Turquoise mines and seven small gold operations. There is also a permitted but not constructed gold mine on the north side of Tonopah called Three Hills Mine.
While Beatty has seen an uptick in gold exploration over the last year, Kittrell said that the workload in the Bureau of Mining Regulation and Reclamation for new permits and permit modifications has been “at a normal level” during the last year.
“There has been an increased interest in lithium, but there have been no new permit applications generated for lithium projects yet. We would anticipate an increase in gold mine permitting activity only after a sustained increase in gold prices,” Kittrell said.
Those who want to comment on the proposed permit should submit their comments to Ryan Clark, Nevada Division of Environmental Protection, Bureau of Air Pollution Control, 901 S. Stewart Street, Suite 4001, Carson City, NV 89701.
A link to the Notice of Proposed Action, Director’s Review, and Draft Air Permit can be found at https://ndep.nv.gov/posts/category/public-notices/air
Posted on: News, Tonopah
|
cc/2020-05/en_middle_0087.json.gz/line1341217
|
__label__wiki
| 0.833125
| 0.833125
|
About Us Contributors Let's Talk Advertise Subscribe Sitemap
Explainer: How a caravan of migrants from Honduras triggered “a national emergency” for the US
The migrants cited widespread political turmoil after the presidential elections last year, and unabated violence, poverty and corruption in the Central American country as the primary reason behind their northward march.
By Prarthana Mitra
A historic march of migrants flooded the streets of Southern Mexico on Sunday, as a caravan of around 4000 people made their way from Honduras towards the US border in search of a better life.
Fleeing from a massive internal crisis and administrative breakdown, their onward march arrived at a brief halt when Mexican border patrol pushed them back with riot gear and pepper spray near the border. Ultimately, the marching migrants made an end-run around the Mexican agents who were taken by surprise by the sheer and unprecedented number of people.
Some claimed to seek better employment opportunities and stated that they would not proceed further if they received asylum in Mexico. Majority of them who crossed Guatemala together was estimated to be between 2,000 to 3,000, while smaller groups fell behind after they reached Mexico, according to human rights watch reports.
Here’s how Trump reacted
Calling the timing suspect (right before the mid-term elections), US president Donald Trump found a reason to believe that the caravan was funded by left-leaning activist George Soros or the Democratic Party. His administration even tried to kindle America’s inherent fear of the immigrant, which Elizabeth Oglesby, Latin American Studies professor, debunks. “The reason that the caravans have been organized are to help protect Central American refugees and migrants as they make the perilous journey through Mexico and to highlight their petitions for asylum,” she told NBC, asking people not to be fuelled by hysteria.
Trump tweeted on Monday “I have alerted Border Patrol and Military that this is a National Emergy,” after having called the caravan a mob routinely in the past. He even threatened to seal the border in order to prevent them from entering the United States. Trump has, however, been all praise for Mexico, in recognition of their attempts to ward off the largest caravan of migrants in recent history.
The origin of the caravan
Having received aid and cheer from sympathetic Mexican onlookers, the migrants persisted in their journey with food, water and clothing that they received on the way. Several migrants told the press that the caravan had begun spontaneously through word of mouth and is now being led by different regional heads making logistical decisions for their respective caravans on when and how to leave each city. Originally, Bartolo Fuentes, a former Honduran lawmaker and social activist, sent the word out to Hondurans to convene at the San Pedro Sula bus station and leave the country.
Guatemalan police arrested Fuentes last week after Trump threatened to cut funding if they did not stop the caravan. Guatemala’s migration agency later confirmed that another group of about 1,000 migrants crossed into the country from Honduras on Sunday. “Several thousand people marching and staying together for 1600 miles is pretty much unthinkable,” Adam Isacson, from the rights advocacy group Washington Office on Latin America, said, adding that there are many checkpoints the migrants will have to go through in Mexico. Some, he said, may even choose to claim asylum in Mexico, while most caravans are expected to splinter once they reach Mexico.
Prarthana Mitra is a staff writer at Qrius.
Stay updated with all the insights.
Navigate news, 1 email day.
Subscribe to Qrius
what is qrius
Broaden your horizons as unpack fresh trends shaping our lives. Qrius delivers fresh, immersive writing that answers the question 'Why should I care?'
daily updates in your inbox
Start your mornings with the acclaimed 'Qrius Mornings' newsletter that gives you our best article of the day right in your inbox.
Thinking About Our Birth Is As Strange As Thinking About Death
Anglo-Indians: Are They Fading into the History of India?
Indian Music…and all that Jazz
150th Birth Anniversary
Gandhi’s 150th Anniversary: How America Embraced the Mahatma
India’s Seed Warrior and His Mission to Save Rice
Is Elon Musk’s Starship Enterprise a Moral Catastrophe?
India’s Extraordinary Growth Has Lessons for Global Leaders
We had the hottest June ever this year – this is what happened around the world
Gender matters in responding to major disease outbreaks like Ebola
Why US public schools’ creepy use of surveillance AI should frighten you
2018 QRIUS. All Rights Reserved
Navigate news, 1 email a day! Cut through the clutter and receive in-depth analysis of relevant news.
|
cc/2020-05/en_middle_0087.json.gz/line1341219
|
__label__wiki
| 0.692379
| 0.692379
|
Tag: kirima seiichi
Boogiepop wa Warawanai – 13 – The Bug
Both the wills of individuals and the collective will of humanity can usually be likened to a swarm of bugs around a light; moving chaotically without coordination. But a majority of the bugs that comprise Nagi’s will are aligned towards a a confrontation with the serial killer, for which she is diligently preparing but may still be woefully overmatched.
That certainly seems to be Sasaki’s opinion on the matter, as the bug within him can’t simply let her be, lest she end up hurt or killed simply for following her own will and sense of justice. If anyone is going to protect her, he figures it should be the one who deprived her of her father, the person who would otherwise be responsible.
Sasaki’s supicions are confirmed: Kisugi has set a trap for Nagi, whom she suspected would show up in superhero guise (Nagi’s jumpsuit is indeed totally badass): have her tranquilized via sniper rifle, then proceed to explore her delicious fear.
Sasaki delivers a killing blow before he notices it isn’t Kisugi, but Pigeon, who stabs him right back as revenge for killing Kuroda (her own bug she couldn’t ignore). But Pigeon distracts Sasaki from Kisugi, who puts her arm through his chest.
Just like that, the backup both Sasaski and I believed would be crucial to Nagi’s survival has been taken off the board in gruesome fashion, a sentiment reinforced when Sasaki tosses his corpse out the window, then leaps out herself and lands on her feet far too close to Nagi for comfort.
But true to her name, Nagi keeps calm and carries on. She starts to flee Kisugi, first on foot then on bike, but the Kisugi’s personal flirtation with evolution has made her as fast in heels as Nagi can pedal, and it isn’t long before she’s caught her up.
Yet still, there’s something about the deliberate manner in which Nagi flees—constantly looking back to make sure she’s being followed—that suggests the chase is unfolding precisely how Nagi planned. Even when Kisugi loses her temper and starts dunking Nagi’s head in a pond and kicking the shit out of her, there isn’t a trace of panic on Nagi’s face.
Kisugi finally visualizes Nagi’s weakness—someone she loves dying before her, like her father—while her actions confirm to Nagi that she’s someone who preys on those perceived to be fearless. Kisugi is right that no one is truly fearless, which means there’s no one she can’t feed off of.
But Nagi’s fear in that moment is less that she’s about to be killed or worse, but more worry that the intricate plan she’s set up might fail. That she will fail to become the superhero she thought she could be. But it doesn’t fail, because Kisugi is part of the circuit of the pond, while Nagi in her thick insulated suit isn’t…and has a weapon that shoots electrical arcs.
Thus Nagi does the equivalent of drop a giant plugged-in toaster into the bathtub, zapping Kisugi with thousands of volts and doing significant damage to a body already taxed to the brink by all of her DIY “evolution.” When Nagi puts her in an arm hold, the arm pops off, and Kisugi flees.
It’s then when an ally far more powerful than Sasaki appears, only to voice their surprise Nagi didn’t need them after all. The situation was always under control, though Nagi could rightly say she relied on some luck in everything going perfectly.
Now Kisugi is the hunted, and full of fear. Turns out she’s a fear ghoul, and definitely an enemy of humanity, which means Boogiepop has popped up to finish her off. But they give credit to Nagi for defeating Kisugi and making the kill so easy.
Nagi manages to be with Sasaki before he dies, and his last words are of relief that she’s still alive, and that “the bug” within him isn’t so bad. Boogiepop then determines it would be best if the blame for the serial murders were placed on Sasaki, due to the complications of the culprit being a doctor of Kisugi’s caliber.
More than that, the bug in Sasaki would be fine doing whatever Nagi wanted, including piling the blame on him. Nagi, meanwhile, still feels like she messed everything up in the case. But she learned a lot from it too, and that wisdom gained will serve her as she keeps fighting. Not to mention “Boogiepop”, as they introduce themselves to Nagi, will be there to help when needed.
Back on the ruined world, which we learn isn’t the Earth of Nagi or Touka but some kind of “distorted world”, Boogiepop wrap up their story to Echoes, as the two contemplate the causality starting with Kuroda saving Nagi, all the way to Echoes and Manticore showing up on Earth.
Echoes muses that Nagi continues to fight because she’s “carrying on the feelings of those she encounters.” That’s one way you could describe an investigator, or a superhero, or both, which is what Nagi is. As Echoes takes his leave, Boogiepop commits themselves to leaving the distorted world and returning to Earth.
Because even if Boogiepop doesn’t know precisely how or why they pop up, they understand intrinsically that it is right for them to do so; that it’s beneficial to humanity and thus necessary to continue. Even Boogiepop has a bug.
Author braveradePosted on Sun, 3 Mar 2019 Sun, 3 Mar 2019 Categories Anime Reviews, Boogiepop wa Warawanai, Winter 2019Tags abilities, assassin, ブギーポップは笑わない, boogiepop, distorted world, electrocution, enemy, evolution, fear, fear ghoul, fearless, fighting, investigation, kirima nagi, kirima seiichi, kisugi makiko, miyashita touka, pigeon, revenge, sasaki, serial killer, success, teamwork, towa organization, trap, worried
Boogiepop wa Warawanai – 12 – Those For Whom The World Is Not Ready
One day, Nagi’s father Seiichi is approached by a girl who can tell he’s going to die soon. He already knows this. He only set out to be an author whose works people would read, but for reasons he could never explain, his writing ended up doing much more.
It inspired and emboldened an entire underclass of those with “abilities” who were shunned by the rest of the world. But people were reading, so he kept writing, even when it might attract the wrong attention. Even if it put him in the crosshairs of those who wanted to keep those people down. And yes, even if it deprived Kirima Nagi of a father.
So, the girl says, if Seiichi dies, the movement dies with him, a failure. To this he rebuts: what is failure? Not to get all Star Warsy, but Yoda would say it’s the greatest teacher. Seiichi is comfortable dying because he did everything he could with the time he had, and trusts that those who come after him will learn from it, carry on, and improve bit by bit.
They could be his enemy or just a passerby, but they are still capable of adopting and surpassing what he began. No one should be so arrogant to think they are the beginning or ending of anything. And the girl Seiichi is speaking to? A young Minahoshi Suiko, the future Imaginator.
Shortly after their exchange, Seiichi is assassinated by the same Towa operative who killed Scarecrow: Sasaki. Seiichi begs him not to kill Nagi too, and he doesn’t…but Nagi still walks in on her father in a pool of blood, his last words to her asking what she thinks “normal” is.
Fast forward to middle school Nagi’s time. Pigeon gives Sasaki his next mission: find the person committing all the grisly murders and eliminate them if necessary. Pige thinks he’ll have an easy go of it, being a “murderer” himself.
Sasaki conducts his own investigation, only to find he’s being carefully observed by Kirima Nagi, daughter of the man he killed a few years ago. Mind you, Nagi doesn’t know he killed him, and can see how he would blend into the background with his salaryman appearance. But she can tell he has an knack for investigations, and suggests they join forces…all while Kisugi watches from a distance.
Nagi and Sasaki manage to snag a friend of one of the victims, who assures them the victim had no lingering grudges or enemies. But she also mentions that her friend was fearless, in particular compared to herself. Sasaki likens the description to Nagi, but she says even she’s sacred of some things; this victim apparently wasn’t.
Nagi recalls her talk with Kisugi, and asks “why does fear exist?”, the same thing someone told the victim’s friend before she met Nagi and Sasaki. Nagi connects the dots, and promptly drops Sasaki as both a partner and a suspect—he doesn’t kill of his own accord, only for his job. He’s not the dyed-in-the-wool killer Nagi is looking for.
Now, I imagine, she suspects Kisugi most of all, which is exactly what Kisugi wants, and why she left her that clue: so she’d to come to her. After all, Kisugi believes Nagi’s fear will be better than any she’s ever tasted.
Author braveradePosted on Fri, 1 Mar 2019 Categories Anime Reviews, Boogiepop wa Warawanai, Winter 2019Tags abilities, assassin, author, ブギーポップは笑わない, boogiepop, enemy, evolution, fear, flashback, generation, investigation, kirima nagi, kirima seiichi, kisugi makiko, minahoshi suiko, miyashita touka, pigeon, sasaki, serial killer, towa organization
|
cc/2020-05/en_middle_0087.json.gz/line1341222
|
__label__cc
| 0.719371
| 0.280629
|
Hampshire - Full Results
Full Results from the Hampshire Racketlon Open
Hampshire Results
With Media superstar Ray Jordan dumped out in the first round to Gareth Shaw, one would think Gareth would be the favourite.
However, two other dark horses have made it to the final. Stuart Hobden and Simon Whale, Hobden defeating Shaw and Whale defeating Lesser in two competitive semi-finals where both contests were two sports each.
Lorna See took the Ladies title, whilst Stuart Foster starved off the Veterans competition in Hampshire. A lot of new players enjoyed themselves and that's not including the 20 who were turned away due to being at full capacity................
Next Stop: English Champs in Jan, entry available in the next two weeks.
|
cc/2020-05/en_middle_0087.json.gz/line1341223
|
__label__wiki
| 0.738889
| 0.738889
|
100 Years of Grand: The Grand Canyon Centennial Project
A digital archive celebrating the Centennial of the Grand Canyon National Park. A collaborative project of the Arizona State University Library, Cline Library, Northern Arizona University and the Grand Canyon National Park. Additional materials are available via the project website.
1 Hayden, Carl T.
1 Kimball, George W.
Control of Public Lands (1912-1928)
Babbitt Brothers Trading Company
1 Buggeln, Martin, 1867-1939
1 Grand Canyon National Park (Ariz.)
1 Grazing
1 Hayden, Carl Trumbull, 1877-1972
1 Pasture, Right of
Tertiary History of the Grand Cañon District with Atlas
History of the Grand Canyon National Park
Stage Coach Trip to the Grand Canyon, 1895, by Josephine Frankenberg of Tempe
Letter from A. E. Demaray, National Park Service to Carl Hayden
Letter from Carl Hayden to J. R. Eakin, Grand Canyon National Park
Sorted by: Date Added (Latest)
Letter from George W. Kimball, Tusayan National Forest, to Carl Hayden
Letter from George W. Kimball to Carl Hayden with an enclosed map detailing the cattle and sheep allotments on the portion of the Tusyan Forest next to the Grand Canyon. Listed are names of permit holders in both stock and allotment that are most likely to trespass into the park. The names are: W. F. Griffin, W. W. Bass, H. R. Lauzon, Swanner and Griffin, Bankhead and Henderson, Martin Buggeln, Babbitt Brothers, Sanford Rowe, and P. D. Berry.
Kimball, George W., Hayden, Carl T.
|
cc/2020-05/en_middle_0087.json.gz/line1341227
|
__label__wiki
| 0.892864
| 0.892864
|
The age-banding debate
Store your resources in your very own folder.
Sign in or sign up today!
By Andrew Thraves — Group Head of Publishing at Granada Learning
Andrew Thraves, Group Head of Publishing at Granada Learning and author of the Feature Articles in the current issues of Literacy Time PLUS, gives his opinion on the debate surrounding the publication of age bands on children’s fiction books
Andrew Thraves, Group Head of Publishing, GL Assessment
Hardly a day goes by without the state of children’s literacy featuring in the headlines of the national newspapers and wider media. One of the issues currently being debated in articles and blogs is the story of the authors who are up in arms about plans some publishers have to print recommended age ranges on books for children. The authors and their supporters are concerned that age-banding of children’s books in this way will prevent children from enjoying the wider range of reading material available to them. But without age-banding, how will parents know whether or not a book is going to be suitable for their child?
Log in to your account to read
Already registered? Sign in below.
|
cc/2020-05/en_middle_0087.json.gz/line1341234
|
__label__wiki
| 0.505045
| 0.505045
|
Legacy of the Slave Trade
Mixed History
Overt Racism
Racial Insensitivity
Racialized Culture
Inner Issues
Generational
Trauma and Healing
Effect on Land
The Role of the Church
Participation in Slavery
The Church’s Mandate for Reconciliation
The Call to Unity
Supernatural Power
About Reconciliation
How Do We Reconcile?
Repentance and Confession
Identificational Repentance
What About Restitution?
Barriers to Reconciliation
Distorted View of Trust
Lies From Our Culture
Hardened Hearts
Walking in Reconciliation
Redemptive Acts
Reclaiming Black History
Lifestyle of Reconciliation
Root Issues
Conflict Between Men
Value of Man
Kingdom Perspective
A New View
A New Purpose
Mixed Historymctesting3admin2017-08-03T16:23:50-05:00
America was founded by imperfect men. But many of the forefathers of America believed they were led by the God Who Created the world and the nations in it—led by Him to the places they settled, led by Him to form the governments and constitution we have, and led by Him to establish civil institutions.
So how than can the institution of slavery and the racism that followed have been a part of American life? How do we respond today to that legacy from the past?
Benjamin Franklin’s word to the Constitutional Convention, as they struggled for guidance, were, “I have lived, Sir, a long time and the longer I live, the more convincing proofs I see of this truth—that God governs in the affairs of man….”
Can we leave our questions under that same truth and seek our answers there?
Please click on a title to view article or full-sized video and to leave comments.
Mayor Mitch Landrieu’s Address on Removal of Four Confederate Statues
This is an excellent speech by the mayor of New Orleans, Mitch Landrieu, explaining why they are taking down confederate monuments. He discussed fake history and denial in a very clear way.
An Historic Debate
From the time before the American War for Independence, black Americans served as elected officials in local politics. Following the Civil War, hundreds more were elected to state and federal office. Read An Historic Debate from WallBuilders
The Trans-Atlantic Slave Trade Database
The Trans-Atlantic Slave Trade Database has information on almost 36,000 slaving voyages that forcibly embarked over 10 million Africans for transport to the Americas between the sixteenth and nineteenth centuries. The actual number is estimated to have been as high as 12.5 million. The database and the separate estimates interface offer researchers, students and the general public a chance to rediscover the reality of one of the largest forced movements of peoples in world history. Visit the Trans-Atlantic Slave Trade Database
https://apple.news/APLMOUSa5QhKMYAYD7qg7RQ
Obama: Black history museum tells “richer and fuller” story of America
President Obama officially opened the National Museum of African American History and Culture Saturday, delivering a moving address on the importance of the newest Smithsonian venue and its role in providing “context for the debates of our times.” View article on CBS News Website
The Atlantic Slave Trade in Two Minutes
This interactive, designed and built by Slate’s Andrew Kahn, gives you a sense of the scale of the trans-Atlantic slave trade across time, as well as the flow of transport and eventual destinations. Click here for the full article: The Atlantic Slave Trade in Two Minutes
The History of the Transatlantic Slave Trade
Hear the untold stories of enslaved people and learn about historical and contemporary slavery. Visit National Museums Liverpool's History of the Transatlantic Slave Trade
Mixed History of Our Culture – John Dawson
Limited View of History – John Dawson
The abolition of the slave trade: Christian conscience and political action by John Coffey
The year 2007 marks the 200th anniversary of the abolition of the slave trade by the British Parliament. The campaign for abolition was spearheaded by devout Christians, and it stands to this day as perhaps the finest political achievement of what would now be called faith-based activism. But who were the abolitionists, and how did their Christianity motivate them to campaign against the slave trade? This paper examines the Christian mind of the abolitionists, and ponders the lessons for today. Dr John Coffey trained as a historian at Cambridge University. His [...]
|
cc/2020-05/en_middle_0087.json.gz/line1341236
|
__label__cc
| 0.554153
| 0.445847
|
IEEE - Institute of Electrical and Electronics Engineers, Inc. - Drying and rehabilitating distribution transformers
Author(s): C. H. Smoke
Publication Date: 1 February 1959
A LARGE INDUSTRIAL PLANT on the eastern seaboard has developed a method of drying and rehabilitating transformers used in its electric power distribution system in its own shops. The procedure... View More
A LARGE INDUSTRIAL PLANT on the eastern seaboard has developed a method of drying and rehabilitating transformers used in its electric power distribution system in its own shops. The procedure does not require a drying oven and produces results which equal or excel oven-drying in time requirements and improvement of insulation-resistance values. Development of this process was made necessary by the fact that the plant was faced with the prospect of failure of several 5,000-kva 11.5- and 2.5-kv transformers, which would have seriously crippled operations, and which readily could have resulted in complete shutdown of the plant for an extended period.
EMF waveform optimization using the permanent magnet volume-integration method
The emf expression can be derived with the PM volume-integration method, allowing easier optimization and prediction of the emf harmonic content. An analytical expression is developed for predicting the electromotive force (emf) waveforms and flux linkage resulting from the motion of permanent magne...
A novel axial flux stator and rotor dual permanent magnet machine
A novel structure of axial flux stator and rotor dual PMs Vernier machine is presented as an effective option for high torque-density direct-driven applications. The key is to locate PMs on both sides of rotor and stator. With dual PMs, this proposed machine with a novel structure generates an impro...
Quantitative comparison of partitioned-stator machines for hybrid electric vehicles
In this paper, three partitioned-stator (PS) machines, namely the PS flux-switching DC-field (PS-FSDC) machine, the PS-FS hybrid-excitation (PS-FSHE) machine, and the flux adjuster FS permanent-magnet (FA-FSPM) machine are proposed. With different flux-regulating mechanisms, all three proposed machi...
Research on DTC system with variable flux for switched reluctance motor
When switched reluctance motor(SRM) is in the status of the traditional direct torque control(DTC) system, due to the high saturation nonlinearity of the electromagnetic relationships of switched reluctance motors, the torque ripple and the stator phase current are larger. In order to resolve the ab...
Comparison of flux-switching machines with and without permanent magnets
In this paper, three advanced flux-switching (FS) machines, namely the radial-field flux-switching permanent-magnet (RF-FSPM) machine, the radial-field flux-switching DC-field (RF-FSDC) machine, and the axial-field FSDC (AF-FSDC) machine are quantitatively compared. Upon the installation of the high...
|
cc/2020-05/en_middle_0087.json.gz/line1341240
|
__label__wiki
| 0.717626
| 0.717626
|
Home BreakfastOff-the-Wall Waffles
Off-the-Wall Waffles
Breakfast, Dessert, Featured Article, Food and Travel, Recipes, Regional Food
https://relish.com/articles/off-the-wall-waffles/
By Emily Arno on October 10, 2012
https://relish.com/wp-content/uploads/2012/10/brookville1-150x150.jpg
Whether topped with butter and maple syrup or chicken and gravy, waffles are a staple of good ol’ American eating—a comfort food that is as satisfying a first meal of the day as it is a last. But 10 innovative restaurants are proving that this classic dough concoction can hold its own against a bevy of unexpected ingredients, both sweet and savory. Join us as we take a cross-country tour of 10 restaurants creating some truly unique waffles—and we’ll share their tips on how you can take some chances with waffles at home, too.
Yardbird Southern Table & Bar
Recipe: Cheddar Waffles with Green Tomato Chow Chow
Staying true to his Southern roots, executive chef Jeff McInnis (a season five Top Chef contestant) isn’t afraid to pile on the fromage on his Big Ol’ Cheddar Waffle at Miami Beach’s Yardbird. True to its name, he tops a crisp waffle with a generous helping of cheddar cheese, followed by a dollop of green tomato chow chow, which is then dressed (to your heart’s content) with a sweet bourbon maple syrup. “When writing the first menu we knew our house specialty was going to be chicken and waffles, so we dressed up our waffle with some of my favorite flavors,” says McInnis of the dish, which is served for lunch, brunch and dinner. “It’s just damn good soul food.”
Chef’s At-Home Tip: “Skip the waffle recipe and simply purchase a high-quality box mix. Find one low in sugar, as this is ideally a more savory waffle. Mix batter according to boxed recipe guidelines and make the chow chow as directed.”
Across Miami’s Biscayne Bay, chef E. Michael Reidt is putting his own spin on the waffle at Area 31, and looking back toward the sea for inspiration. “We treat waffles as a blank platform where almost anything can be built from,” says Reidt. “Bold flavors stand up to a heavy egg and flour batter, making them far more suited to savory courses that can be a great alternative to the breakfast sandwich.” Which explains the genesis of Reidt’s House-Smoked Shrimp and Avocado Waffle, which is finished with a smoked shrimp reduction, smoked shrimp guacamole and micro cilantro.
Chef’s At-Home Tip: “Use a waffle maker and pour a bit of batter to cover the bottom, then drop in the shrimp (smoked or fresh) with a bit a guacamole, cover the top with batter and close the lid. While the waffles are cooking, fry up a farm fresh egg and serve with a dollop of guacamole. No syrup needed.”
Waffle & Wolf
Recipe: Roasted Chicken Waffles with Avocado, Cheddar and Salsa
Proving that a waffle is really just a slice of bread in disguise, Daniel Richardson—the forwarding-thinking executive chef and co-founder of Brooklyn’s Waffle & Wolf—has been known to slap everything from Greek yogurt to feta cheese on a waffle, which he folds up taco-style for his hordes of devoted diners. He takes the taco analogy one step further for the savory #27, which features baked-in chicken, avocado, cheddar cheese and salsa. “I’ve always loved Mexican food and when I was creating the menu I really wanted something that would put a twist on the taco,” says Richardson. “This is my homage to the taco.”
Chef’s At-Home Tip: “We roast our chicken daily, but our #27 is a great way for the home cook to use leftover roasted chicken; simply dice it into small pieces. If you are making just one, leave the pit inside of the unused half of the avocado and wrap with cling wrap. This will prevent the avocado from turning brown so fast.”
Since 1996, Max Brenner has been sharing its love of all things chocolate at its more than 40 worldwide outposts, including U.S. locations in Boston, Philadelphia, Las Vegas and New York. And they’re showing the waffle some cocoa-infused love, too, with a Banana Split Waffle, topped with vanilla ice cream, caramelized Rice Krispies and, of course, milk chocolate truffle.
Brookville Restaurant
Recipe: Brookville Bacon Waffles
At Charlottesville, Virginia’s Brookville Restaurant, chef/co-owner Harrison Keevil is putting fun twists on a host of classic American dishes, from the hamburger to chicken and waffles. The inspiration for his Bacon Waffle, which he tops with buttermilk fried chicken, “came from the basic chicken and waffles, but I wanted to figure out how to get as much flavor into this dish as I could,” says Keevil. “So we have sweet (syrup), spicy (hot sauce), salty (bacon), bitter (arugula), fat (grated cheese) and sour (vinaigrette).” He also keeps it local by whisking Wade’s Mill flour and Timbercreek organic eggs together into a waffle batter that is then studded with Edwards Virginia bacon. The dish is drizzled with local maple syrup, topped with a red wine vinaigrette frisee salad and a snowfall of Pecorino cheese.
Chef’s At-Home Tip: “The best tip is to have a good Belgian waffle iron and to use the best possible ingredients you can (hopefully from your local farmers market).”
At Wicked Spoon at The Cosmopolitan of Las Vegas, executive chef Gerald Chin has developed a secret recipe for his Belgian waffles—one where a yeast-leavened batter is left to proof overnight. Once pressed, the waffles become the foundation for a house-made Amaretto and honey whipped ricotta, which gets served up with fresh orange segments and slivered almonds. “I wanted to create an ‘adult’ version of the traditional whipped cream and strawberry waffle,” says Chin of the dish’s inspiration.
Chef’s At-Home Tip: “You can use pre-mixed waffle batter and add club soda to help lighten the batter. Instead of Amaretto, try Kahlua; and if you can’t get whipped ricotta, use whipped cream cheese with a little honey mixed in.”
The Harrison & Red Cat
A recent run-in with a chicken-topped waffle reignited pastry chef Colleen Grapes’—of New York City’s The Harrison and The Red Cat restaurants—interest in taking the cake in new and innovative directions. The result? A decadent Banana Ice Cream and Chocolate Chip Waffle Sandwich (topped with bourbon caramel sauce and pecans that are smoked, spiced and toasted) that is now available on the dessert menus of both Manhattan eateries.
Mitch Prensky, executive chef/owner of Philadelphia’s Supper, is going back to basics with a fine dining twist at his urban farmhouse restaurant, a celebration of American seasonal cooking. Case in point: Duck and Waffles, Prensky’s crispy confit duck leg with pecan sage waffles, served with Blue Elephant Farm cabbage and maple bourbon jus. “This dish is metaphorical for how I cook,” says Prensky. “At supper, we take a dish you love [and] make it a little bit different, but a lot better. This dish was my way of taking the classic chicken and waffles and perfecting it.”
Luma on Park
Plain waffles just won’t cut it for chef Brandon McGlamery of Luma on Park in Winter Park, Florida. So his Buckwheat Waffles with Smoked Salmon and Crème Fraiche are served up canapé-style. “We don’t like to waste anything, so we utilize the end pieces of salmon for this bite-size dish,” says McGlamery of his innovative waffle concoction, for which he mixes a sous vide salmon with capers, red onion, homemade mayonnaise, crème fraiche, parsley, dill and tarragon to create a rillette salad. “We decided to use a savory waffle as a fun play on the traditional smoked salmon accompaniment, the buckwheat blini.”
Chef’s At-Home Tip: “If you don’t have crème fraiche at home, you can easily make your own version by taking whipped cream (or heavy cream and then whip it) and mixing it with lemon juice, herbs (parsley, dill, tarragon), capers and lemon zest. Buy some store-bought smoked salmon and pile it all on the homemade buckwheat waffle for an easy shortcut!”
The Waffle
Waffles are a labor of love at The Waffle in Los Angeles. Literally. In his ongoing attempts to redefine what waffles can be, chef Jose Sosa was inspired by his wife to create the Red Velvet Waffle, which he serves with a cream cheese frosting, for Valentine’s Day. Originally envisioned as a month-long special, a dedicated interest in the dish (which has been featured on the “The Best Thing I Ever Ate” and “America’s Best Bites”) has made it a permanent—and signature—menu staple.
Found in: Breakfast, Dessert, Featured Article, Food and Travel, Recipes, Regional Food
Bread Pudding for Breakfast, Chocolate Chile Cream Pots,…
Traditional Thanksgiving Dinner Menu
|
cc/2020-05/en_middle_0087.json.gz/line1341244
|
__label__wiki
| 0.922875
| 0.922875
|
The ten best political campaigns of 2014
Posted: November 3, 2014 | Author: Rick Dunham | Filed under: Top Ten, U.S. politics | Tags: American politics, Andrew Cuomo, Ann Richards, Barack Obama, Bill Clinton, Bob Graham, Boston Globe, Brian Sandoval, Brian Schatz, Charlie Baker, Chris Gibson, Colleen Hanabusa, Cory Gardner, Daniel Inouye, Deval Patrick, Ed Gillespie, Elections, George P. Bush, George W. Bush, Greg Abbott, Guns, Gwen Graham, Harry Reid, Jay Rockefeller, Jeb Bush, John Warner, Kay Hagan, Kyle Kondike, Mark Pryor, Mark Udall, Mark Warner, Martha Coakley, Mary Landrieu, Mitt Romney, President Obama, Rick Perry, Sharron Angle, Shelley Moore Capito, Steve Southerland, Texas, Texas politics, Thom Tillis, U.S. Congress, University of Virginia, Wendy Davis | 3 Comments
It’s been a good year for very bad campaigns. But there also have been some very, very good efforts put forth by candidates across the United States, including a few who have surprised the political establishment and the Pundit Elite.
Here are my picks for the ten best campaigns of 2014 — whether they win on Election Night or not.
1. Hawaii Sen. Brian Schatz
How would you like to have been the interim senator appointed by a governor so unpopular that he was defeated in his party’s primary by more than two to one? And how would you like to have been forced to run in that same primary election against the anointed successor of the late and much-loved Democrat you replaced, Daniel Inouye?
Well, that was the predicament faced by Brian Schatz, Hawaii’s former lieutenant governor and now the second-youngest senator at age 42. He worked smart, worked hard, and won — barely — in the primary against Rep. Colleen Hanabusa.
“I was not overconfident that we were going to be successful,” he said after escaping the primary by seven-tenths of one percentage point. Now he’s coasting to a general election win against Republican Cam Cavasso.
2. Massachusetts gubernatorial candidate Charlie Baker
The Bay State may have voted Democratic in every presidential race except one in modern times, but it has an independent streak when it comes to picking its governors. Republican Mitt Romney was chosen by Massachusetts voters back when he was a moderate. And this time a Republican healthcare executive with business bona fides and an independent streak from his party on abortion and same-sex marriage is poised to win a surprising victory.
Charlie Baker, who was defeated by outgoing Gov. Deval Patrick four years ago, has run a campaign so steady that he won the endorsement of the iconically liberal Boston Globe. Indeed, the Globe praised his track record of “steady management and proven results.” He’s also been helped by the mistakes of Democratic nominee Martha Coakley, who is poised for another come-from-ahead defeat.
3. New York Rep. Chris Gibson
It’s not comfortable being a Republican congressman representing a New York district carried twice by President Obama. But two-term Republican Chris Gibson has done it through hard work, skillful constituent service and strategic moderation on issues such as arts funding and gay rights. (The retired Army officer is a Republican co-sponsor of the Employment Non-Discrimination Act designed to protect GLBT Americans from workplace discrimination.) One recent poll shows him 20 percentage points ahead of his Democratic rival in a district that Democratic Gov. Andrew Cuomo will win handily.
4. Texas gubernatorial candidate Greg Abbott
The Texas Attorney General has run the most disciplined governor’s campaign the Lone Star State has seen since George W. Bush toppled Ann Richards in 1994. Abbott has not veered off script, and that script is designed to maximize support among swing voters and motivate hard-core Republicans. With the national press corps hoping against hope for a dramatic storyline this year — Texas is “turning blue” or famous filibusterer Wendy Davis pulls off a miracle in the Land of Bush and Perry — Abbott has taken all of the drama out of Democratic dreams.
5. Colorado Senate candidate Cory Gardner
The Colorado Senate seat held by freshman Democrat Mark Udall wasn’t on many lists of vulnerable seats at the beginning of 2014. But Republican congressman Cory Gardner has been a nightmare for Democrats from Denver to Washington. He’s run an anti-Washington campaign designed to appeal to the swing state’s large bloc of disquieted independents, as well as populists peeved at the sophisticated population of the state capital. Gardner’s campaign site boasts that he is running “to represent all of Colorado, not just those from a particular city or political party.” Take that, Denver.
Democrats have tried to paint Gardner as an extremist and a harsh partisan. But it hasn’t seemed to stick to a candidate known for his high energy and hailed by DC media outlets as a Republican rising star.
6. North Carolina Sen. Kay Hagan
From all the Republican TV commercials, you’d think that “Barack Obama” is the name of the Democratic nominee for Senate in North Carolina. But rather than accept southern-fried doom in an anti-Obama year, the first-term Democratic senator has turned the tables on Republican nominee Thom Tillis, and has put him on the defensive about his role as state House Speaker in the extremely unpopular ongoings in the state capital of Raleigh. Contrast Hagan’s competitiveness in final pre-election polls with the flailing efforts of the two other Democratic Senate incumbents in the South, Mark Pryor of Arkansas and Mary Landrieu of Louisiana.
7. West Virginia Senate candidate Shelley Moore Capito
The last Republican to win a Senate seat in West Virginia was six decades ago. That’s going to change this year as longtime Rep. Shelley Moore Capito sweeps to victory to succeed Democratic legend Jay Rockefeller.
While West Virginia has swung Republican at the presidential level in the past four election cycles, it has favored Democrats for most statewide offices. The 60-year-old Capito, an influential House member, is considered by many to be a pragmatist, conservative on social policies, strong on guns but not hostile to organized labor. Her campaign has been pitch perfect. No wonder Kyle Kondike, the managing editor of the University of Virginia’s Sabato’s Crystal Ball, calls her the “best Republican Senate candidate this cycle.”
8. Virginia Senate candidate Ed Gillespie
Win or lose — and he will probably lose — Republican Ed Gillespie has run an exceptionally good Senate campaign in Virginia against a popular Democratic incumbent, Mark Warner. Gillespie has worked harder than just about any candidate in the country, has highlighted a future-oriented set of issues, and has built a statewide organization out of the ashes of Republican defeats in recent years. His efforts have paid off as he has trimmed Warner’s lead significantly over the past two months.
Sen. Warner, you may recall, also was defeated in his first Senate campaign by a venerable incumbent, Republican John Warner, before going on to win the governorship. Gillespie’s excellent campaign should move him to the front of the line of GOP candidates for governor in 2017.
9. Florida congressional candidate Gwen Graham
This is a year of promise for the children of former Florida governors, In Texas, Republican Jeb Bush’s son George is about to become the Lone Star State’s land commissioner. And in the Sunshine State, Democrat Bob Graham’s daughter Gwen is in a tight race with incumbent Republican Rep. Steve Southerland.
Graham has learned the basics of political campaigning from her masterful dad. She has raised more money than the Republican — something very few Democratic challengers have done this year. She has out-organized the incumbent and has mobilized early voting that favors Democrats by 14 percentage points. She has called in dad’s chits and got a campaign visit from former President Bill Clinton. Victory is far from assured, but a strong campaign has given Graham a decent chance in a tough Democratic year.
10. Nevada Gov. Brian Sandoval
Senate Majority Leader Harry Reid’s worst nightmare is coming true.
Yes, he may lose his job as Majority Leader if Republicans can pick up at least six seats. But he might be seeing the specter of 2016 defeat in Nevada in the person of Republican Gov. Brian Sandoval. The incumbent governor is running 25 percentage points ahead of his 2014 Democratic opponent. He may just keep on running.
Sandoval, the first Latino to serve as a federal judge in Nevada, would be a good bet to roll the dice against Reid. It would be hard for the Democratic senator to convince voters that Sandoval, who has presided over education reform and a slowly improving economy, is a fringe extremist like 2010 GOP nominee Sharron Angle.
The ten worst political campaigns of 2014
Posted: October 11, 2014 | Author: Rick Dunham | Filed under: Top Ten, U.S. politics | Tags: American Hustle, American politics, Ann Richards, Anthony Weiner, Anything Goes, Army War College, Ben Dreyfuss, Carl DeMaio, Carl Levin, Chris Frates, CNN, Ed FitzGerald, Eric Cantor, Fox & Friends, Fox News, Frank Luntz, Greg Abbott, John Kasich, John Walsh, KHOU, Kinky Friedman, Larry Pressler, Laura Bush, Max Baucus, Mike Rounds, Mother Jones, New York Times, Pat Roberts, Penn State, Rick Santorum, Scott Peters, TalkingPointsMemo, Ted Cruz, Texas politics, Tim Johnson, Todd Bosnich, Tom Corbett, Tom Wolf, Wall Street, Wendy Davis | Leave a comment
Pat Roberts has been working overtime to show how he understands the problems of his Kansas constituents.
From pornographic emails to pervasive plagiarism, this has been a good year for bad candidates. We’ve seen hubris, laziness and monumental incompetence.
That’s not really something new in American politics.
What may be new is that some of the campaigns are so bad that even partisan news outlets like Mother Jones and Fox News have called out the perpetrators.
So who has run the worst campaign of 2014? There are lots of candidates in contention for runner-up status but we already have a clear winner of that dubious achievement:
1. Former House Majority Leader Eric Cantor
Biggest loser: The former #2 man in the House of Representatives. Soon to be a very rich nobody.
A Hall of Shame horrible campaign. Overconfident. Out of touch. The future House Speaker became a former House member with the help of an obscure but spirited Tea Party activist. Cantor is crying all the way to the bank as he cashed in on the capital’s revolving door culture by getting a nice Wall Street-ish job.
2. Kansas Sen. Pat Roberts
Win or lose, the veteran Kansas senator, who lives in Washington, was caught napping. He survived a primary scare that he didn’t see coming and then trailed badly against an independent in early general election polls. With the GOP establishment circling the wagons — and hardline conservatives like Texas Sen. Ted Cruz seizing the moment — Roberts has finally gained some momentum, at least for the time being. But win or lose, he’s evidence of what happens when you catch Potomac Fever and don’t keep up with the folks back home.
3. Montana Sen. John Walsh
Democrats were on the defensive from the moment longtime Montana Sen. Max Baucus resigned his seat to become envoy to Beijing. But Dems had high hopes for John Walsh, an Iraq veteran, former adjutant general of the Montana National Guard and former lieutenant governor. Those hopes evaporated when the New York Times reported that Walsh had “plagiarized large sections of the final paper he completed to earn his master’s degree at the prestigious Army War College in Carlisle, Pa.”
Walsh quickly made a bad situation a lot worse. According to the Times, Walsh initially “expressed no contrition for the plagiarism.” Even when withdrawing from the race two weeks later, he remained in denial, saying that the paper “has become a distraction from the debate you expect and deserve.” The Army War College thought it was much more serious, revoking his master’s degree. But he’s still a senator, however lame a duck he may be.
4. Texas gubernatorial nominee Wendy Davis
National Democrats thought they had found an instant superstar when the telegenic Fort Worth state senator staged a filibuster against a draconian Republican anti-abortion law in 2013. The party raised tons of money from her pro-choice passion and pink sneakers and shipped almost all of it out of state. It then somehow convinced the celebrity senator that she could be elected governor in one of the most reliably Republican states in the Union. All you had to do was read my 2012 statistical analysis of Texas demographic and electoral trends to know that true partisan competitiveness was from eight to 12 years away.
To make a difficult situation worse, Davis’ campaign has been inexplicably tone-deaf. They seem to be running the kind of a campaign a Democrat would run in Massachusetts or Illinois, not Texas. (In contrast, the last Texas Democrat to be elected governor, Ann Richards, knew how to appeal to the good-ole-boy and good-ole-girl vote without sacrificing her basic principles.)
Final exclamation point, a new television ad that tried to paint Republican Greg Abbott as a hypocrite but ended up making him a victim. Even liberal standard-bearer Mother Jones called it, “to be blunt, bullshit.”
“If Wendy Davis Thinks She Can Win an Election by Pointing Out Her Opponent’s Disability, She’s Wrong,” declared the MoJo headline.
“It’s offensive and nasty and it shouldn’t exist,” wrote Ben Dreyfuss. “She’s basically calling Abbott a cripple.”
That’s what her friends are saying. Texas Democrats should be saying, “Wait ’til next year.” Or is it “next decade”?
5. Pennsylvania Gov. Tom Corbett
This is not the kind of headline you want on Fox News’ web site if you are a Republican incumbent:
Porn scandal involving former staff puts Pa. governor on defense in already-tough race
It’s not a question of whether Tom Corbett will lose, it’s by how much he will lose. In a very good year for Republican candidates, the GOP incumbent is a very bad candidate. Whether it’s his ties to the Penn State football program’s child sexual abuse cover-up or the scandal involving pornographic emails sent by staffers, the news is relentlessly negative for the embattled incumbent. Democratic nominee Tom Wolf is breezing to victory. The only question is whether Corbett’s margin of defeat is larger than the 20 percentage point repudiation of then-Senator Rick Santorum in 2006.
It’s a hard time to be a GOP spinner in the Keystone State. “This is not an Anthony Weiner situation,” one Republican consultant said on Fox News, trying to put the best face on a very bad situation.
Cold comfort.
6. Ohio gubernatorial nominee Ed FitzGerald
It’s never good when a headline in the Washington Post declares:
The remarkable implosion of Ed FitzGerald
Especially not if you are an Ohio Democrat and Ed FitzGerald is your nominee for governor. Democrats had high hopes for unseating Ohio Gov. John Kasich, whose edgy personality and hard-driving policy agenda had alienated a fair number of voters. But their candidate, a local elected official with precious little big league experience, proved truly minor league. A typical lowlight was the revelation of a 2012 incident when he was approached by a police officer while in a parked car with a woman who was not his wife.
How bad have things gotten? With the campaign winding down, the Cleveland Plain Dealer reports that “the beleaguered Democrat is altering his strategy in an attempt to ensure his troubles don’t doom his party’s entire statewide ticket.” At least he’s not playing stupid “spin” games and trying to convince us that he still is in contention.
7. South Dakota Senate nominee Mike Rounds
Republicans thought this was a sure thing when Democratic Sen. Tim Johnson announced his retirement. Red state. Popular ex-governor. Anti-Obama electorate. Good Republican year. Can’t lose.
Well, yes you can.
Rounds has exhibited a severe case of overconfidence and has run a lackluster campaign (to be generous). Toss in a wild card — the independent candidacy of former Republican Sen. Larry Pressler, the only politician to say no to the “American Hustle” hustlers — and you have the South Dakota road show version of the venerable musical “Anything Goes.”
I’ll still be shocked if Rounds loses. But he’s trying his best.
8. Michigan Senate nominee Terri Lynn Land
Like Texas Democrats, Michigan Republicans thought they had a chance to pull an upset on hostile partisan turf by nominating Terri Lynn Land for the Senate seat long held by retiring Democrat Carl Levin. Now, national Republicans will tell you it is one of their biggest disappointments of the year. Land’s campaign has been mediocre, at best, lacking imagination, energy and an overarching strategy. She’s been on the defensive, like her attempts to counter perceptions that her policy positions were “anti-women.” She aired an ad that was described by Republican political consultant Frank Luntz as the worst of the election season (which is saying a lot). In the ad, she drank coffee and looked at her watch and said that, as a woman, she knows more about women than her male opponent. No discussion of any issues.
As the Detroit News reported:
The “Really?” ad, aired in May, sought to reject claims that Land is anti-woman because of her opposition to abortion and federal legislation known as the Paycheck Fairness Act.
Luntz criticized the commercial on “Fox & Friends” for failing to “give any message” or “communicate any sense of substance.”
No wonder Democrat Gary Peters — once considered a “tough sell” — has been consistently leading in the polls for months.
9. California congressional candidate Carl DeMaio
In the category of snatching defeat from the jaws of victory, we take you to San Diego, where Republicans have been talking all year about their strong candidate against endangered Democratic incumbent Scott Peters.
Let’s just say the talk has shifted all of a sudden. After all, how many candidates for the House of Representatives find themselves in the bizarre position of denying that they masturbated in front of a staff member? Or groped his genitals?
That’s the plight of Carl DeMaio, a highly touted Republican candidate who had been leading in many polls in California’s 52nd Congressional District. Let’s just cut to the Oct. 10 CNN interview with his former aide, Todd Bosnich.
Bosnich: “I saw his hand —— his penis in his hand. He had a smile on his face. And as soon as I came over, he was looking at me.”
CNN reporter Chris Frates: “So there was no mistaking what was happening?”
Bosnich: “There was no mistaking whatsoever.”
According to TalkingPointsMemo, Bosnich has accused his ex-boss of “making inappropriate advances, massaging and kissing his neck, and groping.”
I should note that DeMaio categorically denies his ex-aide’s account and held a press conference to condemn it as “an outrageous lie” that has been dismissed by law enforcement authorities.
“This is an individual that was let go by our campaign manager for plagiarism, a well-documented plagiarism incident of taking a report from the National Journal and passing it off as his own work,” the candidate told CNN. “He was terminated. He admitted that he plagiarized.”
At his press conference, DeMaio went further: “It’s absolutely untrue and it’s unfortunate that an individual who is the prime suspect in the break-in at our campaign office would manufacture such an outrageous lie.”
Someone is lying. But no candidate wants to be denying this kind of thing in the final weeks of a campaign. Or ever.
http://www.cnn.com/video/api/embed.html#/video/politics/2014/10/10/lead-pkg-frates-gop-sexual-harassment-claims.cnn
10. Texas Agriculture Commission loser Kinky Friedman
Once considered a serious (or at least semi-serious) candidate for governor of Texas, this singer/songwriter/author has been failing downward. This year, he ran an erratic campaign for Texas Agriculture Commissioner and was defeated in the Democratic runoff by “not Kinky Friedman,” a.k.a., an unknown guy who was the other name on the ballot. Kinky’s top campaign issue this year was legalization of marijuana.
“I want to make this election into a referendum on lifting the prohibition on pot and hemp,” Friedman told KHOU 11 News during a campaign event in Houston. “This is about the future of Texas.”
It certainly wasn’t about Kinky’s political future.
Texas political winners and losers of 2013
Posted: December 28, 2013 | Author: Rick Dunham | Filed under: Top Ten, U.S. politics | Tags: David Dewhurst, Domingo Garcia, Greg Abbott, Joaquin Castro, John Cornyn, Louie Gohmert, Marc Veasey, Meet the Press, Rick Perry, Steve Stockman, Tea Party, Ted Cruz, Texas, Texas Senate, United States Senate, Wendy Davis | Leave a comment
The Texas political landscape has been transformed in 2013.
No, the state hasn’t gone from red to blue. But it’s gone from old to new.
Here are some of the politicians who have benefited — or suffered — from the transition:
Ted Cruz (Texas Tribune photo)
Began the year as a U.S. Senate newcomer. Ended the year as the leader of the national Tea Party movement.
Began the year as an establishment Republican nervous about a 2014 Tea Party primary challenge. Ended the year with most leading conservative groups either on his side or on the sidelines.
Began the year as a junior member of a minority party in the Texas Senate. Ended the year as a national figure and a ballyhooed Democratic candidate for governor.
Began the year waiting for Rick Perry to decide what to do. Ended the year as a virtually unopposed Republican candidate for governor.
Began the year as a House newcomer in the minority party. Ended the year as one of his party’s rising stars on Capitol Hill and a guest on Meet the Press. Oh, he got married, too.
Began the year as a presidential longshot. Ended the year as a president longshot — and a lame duck governor.
David Dewhurst
Began the year as the most powerful person in the Texas Senate. Ended the year fighting for his political life in a re-election battle against stalwart conservatives.
Rick Perry’s UT Regents
Began the year trying to topple the university’s president and football coach. Ended the year an educational embarrassment and a political liability for the Texas Republican Party.
Began the year as an off-the-wall right-wing congressman who talked about terror babies and presidential birth certificates. Ended the year looking downright boring compared to Steve Stockman.
Domingo Garcia
Began the year itching to end Fort Worth congressman Marc Veasey’s tenure after a single term. Ended the year on the sidelines as Veasey appears to be cruising to re-election.
|
cc/2020-05/en_middle_0087.json.gz/line1341250
|
__label__wiki
| 0.609061
| 0.609061
|
The Iron Mountains
From RayWiki, the Rayman wiki
The pirates have taken all of my babies.
—Uglette, Rayman 2
The Iron Mountains (also known as the Gloomy Island) is a location in Rayman 2 and its remakes. It is where the fourth and final mask of Polokus is found, though it is not necessarily a sanctuary.
← Tomb of the Ancients The Prison Ship →
{{{connected to}}}
In this version, the Iron Mountains level has no hologram in the Hall of Doors. The dark tunnel in the background leads directly to the Buccaneer levels.
This level is set high up in the mountainous regions of the Glade of Dreams, where a number of pirate strongholds are built. Deep in the canyons nearby are mines in which a large number of baby Globoxes are held captive. Many Robo-Pirates patrol the area.
Phase 1 – The Gloomy Island
Rayman is outside a metalworks building with a generator room inside, and he has to shoot two switches to deactivate an electric field and go down the middle of a rotating machine and into a pipe that leads to a grassy area. Going though another tunnel past a swampy lake, there is another pirate stronghold which Rayman has to jump from the top and glide down a rapid river. At the edge is a hot air balloon which Rayman hops in and rides.
Phase 2 – The Reformatory for Disturbing Children
He then lands in a field with yet another stronghold, which is this time guarded by the invincible giant Robot Dinosaur, despatched by the Robo-Pirates to find the fourth mask before Rayman does. The Robot Dinosaur is so heavy, every time it jumps it sends objects bouncing up into the air. Rayman can make use of these objects to infiltrate the stronghold (the Reformatory for Disturbing Children), where a few baby Globoxes are being held captive. Rayman soon finds a walking shell and has to ride about the outside of the Reformatory to collect some Yellow Lums and find two switches (three switches in the PlayStation version) to release the babies.
Phase 3 – The Pirate Mines
Deep in a canyon, Rayman has to cross a polluted pond, and he will eventually meet Uglette, Globox's wife, who is extremely sad by the fact that more of her babies are missing and held in the mines. The player then takes control of a pirate warship and has to manoeuver it through the canyons and find the four mines, collecting many baby Globoxes from each one. When all of the mines are visited, Rayman has to bring the warship back to Uglette to reunite her with her babies. One of them withdraws the fourth mask from its mouth and tells Rayman that he found it in the Mines. He then gives the mask to Rayman, who is transported to Polokus.
During the shell ride, a glitch allows Rayman to jump outside the Reformatory for Disturbing Children without activating the switches and saving the babies.
Dreamcast version
This level is nearly identical to the original version, with the following differences:
At the neat end of phase 1, before the hot air balloon, a Glob Crystal is found – this is the last of the six to collect.
The first pirate in the swampy area has been moved back, shoots helicopter bombs and drills through the ground. Also, two pirates have been added near the start of the Pirate Mines.
Piranhas added: 2 in the bridge in the beginning of the level and one in the swampy area where the two pirates are fought.
Graphical changes in the generator room with the two switches, some structures changed, the pool of polluted water and ceiling is replaced with a floor and caged ceiling with a slow, circular, ominous red laser, same thing is given with the middle stalactite-like structure. The outside of the building is also foggier and the polluted water is changed to plain green (however, both of these were reverted in the 3DS version.)
One change was made to the 3DS version: in phase 3, the plum used to reach a large Yellow Lum was removed, and the Lum now homes into Rayman, making it much easier to collect.
The Spiral Door in the Isle of Doors which leads to the Iron Mountains.
The tower leading to the dam is slightly redesigned.
The platform which the Henchman 800 stands upon now spans the whole width of the rapids. (This change was reverted in the 3DS version.)
Gloomy Island
PlayStation version
In this version, the level is called the Gloomy Island, and only the area in which Rayman has to flick the switches on board the walking shell to free the baby Globoxes is used. In the beginning Rayman sees Uglette, and she tells him that her babies were taken to the pirate stronghold. Rayman has to locate it and rescue them.
Phase 1 of the level is used in part, but is heavily edited in some areas. As said above, Uglette informs Rayman of the children's capture at the very start of the level, not towards the end. This gives Rayman more purpose to being here in this version, rather than seemingly wandering randomly as in other versions.
There is a bizarre inconsistency here not present in other versions due to the Uglette cutscene occurring at the very start of the level. When the player enters the level from the Hall of Doors, the game will load, then jump straight into the cutscene with Uglette, which shows Rayman already in the level, comforting Uglette. However, after the cutscene, Rayman emerges from the Spiral Door as usual, and lands next to a weeping Uglette.
A Ninja Henchman attacking Rayman.
Rainbow Creek
PlayStation 2 version
This level remains the same, but with the following exceptions:
The Gorilla Pirate inside the Reformatory for Disturbing Children has been replaced with a pair of Henchmen 800.
While riding the shell next to the Robot Dinosaur, the camera changes to an overhead view, making it easier to direct the robot and collect the Yellow Lums.
Phase 3 in which Rayman commandeers a warship to rescue the baby Globoxes has been omitted from this level, and is used as its own level called the Pirate Mines. Instead of the fourth mask, a baby Globox rewards Rayman with the Rain Mask instead.
Because of this, there is a new Guardian called Grolem 13, who guards the fourth mask. He is fought in a new phase added to the end of the Iron Mountains, which takes the place of the Pirate Mines phase.
An extra minigame known as the Schplong is featured in this level. To access it, the player must press the square or the circle button 15 times whilst on the hot air balloon.
The rotating machine in Rayman Revolution.
The Iron Mountains playthrough at YouTube (PC version) (Part 1/3)
The Iron Mountains playthrough at YouTube (Sega Dreamcast version) (Part 1/3)
The Gloomy Island playthrough at YouTube (Sony PlayStation version)
The Iron Mountains playthrough at YouTube (Sony PlayStation 2 version) (Part 1/3)
Hubs of Rayman 2
The Hall of Doors • The Isle of Doors • The Front • The Minisaurus Plain • Globox's House • Rainbow Creek
Levels of Rayman 2
The Woods of Light • The Fairy Glade • The Marshes of Awakening • The Bayou • The Walk of Life • The Sanctuary of Water and Ice • The Menhir Hills • The Cave of Bad Dreams • The Canopy • Whale Bay • The Sanctuary of Stone and Fire • The Echoing Caves • The Precipice • The Top of the World • The Sanctuary of Rock and Lava • The Walk of Power • Beneath the Sanctuary of Rock and Lava • Tomb of the Ancients • The Iron Mountains • The Prison Ship • The Crow's Nest
Retrieved from "https://raymanpc.com/wiki/script-en/index.php?title=The_Iron_Mountains&oldid=74349"
Places from Rayman 2
About RayWiki, the Rayman wiki
|
cc/2020-05/en_middle_0087.json.gz/line1341256
|
__label__wiki
| 0.606352
| 0.606352
|
Reading & District Labour Party
Join the 2019 Election Campaign!
Alok Sharma and Rob Wilson: Examining their voting records and effectiveness as representatives for Reading
Introduction When I set out to write this article I was planning two articles; one for Sharma and the other for Wilson. However, within only a few moments of my research it became very clear that there was no need to write two articles. Sharma and Wilson are identical! With the exception of only a…
Labour Party Manifesto 2017
Labour’s Candidates for General Election 2017
PRESS RELEASE Reading and District Labour Party are delighted to announce that Labour have selected former Reading East PPC, Cllr Matt Rodda (Katesgrove) to be our Parliamentary candidate in Reading East and Chair of the Labour Women’s Network, Olivia Bailey to be our candidate in Reading West for the 2017 General Election. Matt Rodda,…
How socialist solidarity can bring 7 years of Tory turmoil to an end
WE ARE LIVING in a political age where anything can happen. Everyone, including the pollsters predicted, predicted that Britain would vote “remain”, thought that Ed Miliband was heading for Downing Street in 2015, and most people believed a Donald Trump Presidency could never happen. Even as I type this, I learn that France’s two largest…
Government Cuts Force Council Tax Rises
READING Borough Council is recommending a 4.99% Council Tax increase for next year. It follows repeated and unprecedented cuts in Government funding at a time of huge increases in demand for vital Council services, particularly in social care. This week Surrey County Council agreed on a 15% Council Tax rise – in advance of a…
Council put pressure on MP’s to act on South Reading’s underfunded health services
A motion put forward by Cllr Ashley Pearce was unanimously passed by Reading Cllrs at March’s Full Council meeting. The motion pointed out that South Reading was 150th out of 150 CCG’s (clinical commissioning groups) in terms of funding across the UK. It also made clear the unfairness in the health funding gaps across Reading.…
Reading Banner March 2017
The latest news about your town, your Borough Council and your Labour Party.
Reading Labour’s Manifesto 2016
Reading Labour 2016 Manifesto
Can you make a donation?
|
cc/2020-05/en_middle_0087.json.gz/line1341261
|
__label__cc
| 0.610697
| 0.389303
|
Book reviews of mainly modern & contemporary fiction
My favourite authors
Reading log
Focus on Western Australian writers
Triple Choice Tuesday
Triple Choice Tuesday: Isabel Costello
Welcome to Triple Choice Tuesday. This is where I ask some of my favourite bloggers, writers and readers to share the names of three books that mean a lot to them. The idea is that it might raise the profile of certain books and introduce you to new titles, new authors and new bloggers.
Today’s guest is Isabel Costello, who hosts the Literary Sofa blog featuring guest authors, book reviews and her twice yearly selections of recommended new fiction, as well as candid accounts of her own experiences as a writer.
Her ‘home territory’ is the crossover zone between literary and commercial fiction and she has a special interest in contemporary American and French writing.
Isabel has completed two novels and has had several stories published and shortlisted in competitions including the Asham Award. She loves to connect with readers and has shared short stories with live audiences in London and Brighton.
When she’s not reading or writing she can often be found talking books on Twitter @isabelcostello
A favourite book: Madame by Antoni Libera (translated from Polish by Agnieszka Kolakowska)
It’s not surprising that people think it’s impossible to buy books for me, but my friends are actually very good at introducing me to titles I haven’t come across. Madame was a leaving present from a former colleague, and an inspired choice. Set in Communist Warsaw in the late 60s, it’s the captivating coming-of-age story of a precocious teenager fixated on his glamorous French teacher. It’s literary, sophisticated and engaging in its portrayal of a place, an era and a relationship charged with all kinds of tension. I rarely re-read books and it’s always a risk, but after dipping into Madame a few times this week, I can’t resist.
A book that changed my world: L’Etranger by Albert Camus (various translations)
I read French and German at university, and France has always been a big part of my life. L’Etranger is an extraordinary book, which is accessible on many levels. By the time I encountered it at 16 I had emphatically rejected my Catholic upbringing, and this text ignited my interest in two related questions: the search for meaning and randomness. All of this contributed to my becoming a writer (although if you ask any roomful of authors why they write it’s astounding how many reply, ‘To make sense of life’!)
In 2013, I attended a stunning dramatic reading of L’Etranger at the Southbank Centre to mark the centenary of Albert Camus’ birth and I have visited his grave in the small town of Lourmarin in Provence. That sounds slightly fanatical but it’s very close to where we often go on holiday.
A book that deserves a wider audience: We are the Young Men by Rob Doyle
This one makes me nervous because I don’t presume to know what other people have read and often find myself unaware of books which are apparently extremely well known. This paperback hit my doormat out of the blue and caught my eye, as raising two sons has made me reflect a lot on masculinity and the portrayal of men, especially in the context of feminism. A story following some disillusioned Dublin teenagers the summer they leave school, this is not for you if you have a problem with profanity, blasphemy, substance abuse, explicit sex and sickening violence. (The only one of these which bothered me was the violence). But if you can handle all that, this is a fearless and arresting novel that transcends shock value to question what it is to be young, male and lacking meaning (there we go again). It is undeniably and deliberately crass in places, but I was more struck by how poignant, profound and insightful it is. There are far too many safe and predictable books out there — this isn’t one of them.
Thanks, Isabel, for taking part in my Triple Choice Tuesday!
These all sound fabulous, especially the first choice, which I’ve not heard of before. Camus is one of those authors I’ve not read despite owning most of his work — he often gets name-checked in this slot, which is perhaps why I’ve started to buy his work. And the final book has been on my radar for some time, given I’m quite partial to Irish novels, but now it’s promptly rocketed up my must-read soon list!
What do you think of Isabel’s choices? Have you read any of these books?
February 17, 2015 by kimbofo Albert Camus, Antoni Libera, Rob Doyle, Triple Choice Tuesday
17 thoughts on “Triple Choice Tuesday: Isabel Costello”
I love L’Etranger too ….isabel you must read Mersault Contre Enquete by Kamel Daoud which was listed for the Goncourt last year ( tho didn’t win). It’s a retelling of L’Etranger from the Arab POV ….an examination of colonialism and an hommage to Camus . I need someone to discuss it with !! Great choices ….never heard of Madame so must track it down .
Hi hastanton,
Is the Kamel Daoud book in English translation yet? Sounds great.
No not yet Shane …I do hope it will be translated . Deserves a v wide readership.
Isabel Costello says:
Hi everyone – thanks for your interest in my selection and for commenting.
Helen, I was looking at Meursault Contre- Enqête in Foyles yesterday and am very keen to read and discuss with you!
Yesterday I was discussing how diverse my reading, and my wishlist, is becoming thanks to joining Twitter in Sept – this is an excellent example. Both no 1&3 appeal – no1 makes me think of Notes on a Scandal – sadly my ‘la fenetre, le stylo’ limited French rules out no2… Cpt P & me can’t reminisce about our trip to Paris without giggling at the natives raised eyebrows as I merrily slaughtered their language
Hi poppypeacockpens,
You can read Camus in English. The translation is usually titled The Outsider. It also has what’s often regarded as one of the most memorable first lines of any novel, often translated as “Mother died today.”
I’ve also heard great things about Rob Doyle, although (shame on me) I’ve yet to read it. Another Irish writer tipped for great things is Colin Barrett, whose Young Skins won the Guardian First Book Award last year.
Yay, for diverse reading! I know that blogging certainly gave me courage to try things out of my comfort zone and it also made me realise I wasn’t quite as well read as I thought — for instance, prior to 2004 I don’t think I’d ever read a novel in translation; now about 20% of what I read was not originally published in English 🙂
Great choices, I really must dust off my Camus, no excuse not to. Love that you came across your favourite as a gift from someone, how great is that. Young Men sounds like a tough read.
Hi Claire, I agree there’s something lovely about a gift becoming a favourite book. And re-reading Camus always reveals something new! La Peste also made a big impression on me and recently I was looking at Le Mythe de Sisyphe.
Pingback: Guest Author – Alex Christofi on Writing the Shard | Isabel Costello
Alex Cameron says:
L’Etranger… it’s unforgettable and returns to you at odd moments in time but always returns. I read it years ago in french at university and was incredibly moved by it, although my french was terrible so I’m not sure how it sunk in at all – perhaps by osmosis! When I re-read it in English I was relieved to find I really had understood it.
I love literature from behind the iron curtain. Madame sounds intriguing. Thank you for your post.
I’m thrilled that Madame seems to have caught peole’s attentiin
Apologies for accidentally posting a reply full of typos! I’m thrilled that Madame has caught people’s attention. Not sure how big it was on publication 15 years ago but regardless of that it deserves another moment of glory in my view!
Hi Shane and Poppy
Yes, Camus is probably one of the world’s most translated authors. Although I have not read him in translation, I do agree with the essay on ‘The Stranger’ at http://www.camus-society.com that this is a more meaningful translation of the title than ‘The Outsider’ for the reasons stated. In any case, that site is a wonderful source of information for anyone interested in the great man!
I’m intrigued about your wider audience book. There is a lot written on the challenges of being a young female (and rightly so b/c we are still have so far to go), but little on the challenges of being a young man in a world of changing expectations.
Hi Laura – you’ve put your finger on why this book interested me from the very premise. Couldn’t agree more about the necessary focus on the pressures etc faced by young women and fighting discrimination but (perhaps particularly as a parent of sons) I am sometimes concerned about widespread negative generalisations about young men which don’t strike me as the way to encourage respect between the sexes. Thanks for commenting.
Pingback: Guest Author – Conversation with Rob Doyle | The Literary Sofa
Leave a Reply to Isabel Costello x
Search Reading Matters
Categories Select Category 20 books of summer (54) 20 books of summer (2017) (17) 20 books of summer (2018) (21) 20 books of summer (2019) (16) 6 Degrees of Separation (3) Australian Women Writers Challenge (88) AWW2016 (35) AWW2017 (11) AWW2018 (20) AWW2019 (22) Author (1,194) A Yi (1) A.S. Patrić (2) Abdelilah Hamdouchi (1) Abigail Ulman (1) Agnete Friis (1) Aidan Higgins (1) Akhil Sharma (1) Alaa As Aswany (1) Alan Bennett (1) Alan Carter (1) Alan Collins (1) Alan Glynn (1) Alecia Simmonds (1) Alejandro Zambra (2) Alessandro Baricco (2) Alex Garland (1) Alex Miller (6) Alexander McCall Smith (1) Alexandre Dumas (1) Alexandria Marzano-Lesnevich (1) Alexi Zentner (1) Ali Cobby Eckermann (1) Ali Land (1) Ali Shaw (1) Ali Smith (1) Alice Bishop (1) Alice Grundy (editor) (1) Alice Pung (1) Alice Sebold (2) Alison Moore (1) Alison Pick (1) Alissa Nutting (1) Alix Ohlin (1) Amanda Curtin (1) Amélie Nothomb (2) Ambrose Bierce (1) Amity Gaige (1) Anais Nin (1) Anakana Schofield (1) André Alexis (1) Andrea Eames (1) Andrea Levy (1) Andrea Maria Schenkel (1) Andrew Davidson (1) Andrew Gross (1) Andrew Hankinson (1) Andrew Martin (1) Andrew McMillan (1) Andrew O’Hagan (1) Andrew Rule (1) Andrew Sean Greer (1) Andrew Taylor (2) Angela Carter (1) Anita Amirrezvani (1) Anita Shreve (14) Anja Reich-Osang (1) Ann Bauer (1) Ann Patchett (1) Ann-Marie MacDonald (1) Anna George (1) Anna Quindlen (1) Anna Raverat (1) Annalena McAfee (1) Anne Enright (3) Anne Michaels (1) Anne Serre (1) Anne Tyler (3) Anne-Marie O’Connor (1) Anneliese Mackintosh (1) Annie Ernaux (1) Anonymous (1) Antal Szerb (1) Anthony Caleshu (1) Arnaldur Indriðason (9) Arthur Golden (1) Ashley Hay (1) Asne Seierstad (1) Atiq Rahimi (1) Audrey Niffenegger (1) Avan Judd Stallard (1) Åsa Larsson (1) B. S. Johnson (1) Banana Yoshimoto (1) Barbara Demick (1) Barbara Pym (1) Barbara Vine (1) Barry Maitland (1) Behrouz Boochani (1) Belinda McKeon (2) Benjamin Black (2) Benjamin Myers (2) Benjamin Wood (1) Bernard MacLaverty (1) Bernardo Atxaga (1) Betty Smith (1) Bill Borrows (1) Bill Bryson (1) Birgit Vanderbeke (1) Blaine Harden (1) Bohumil Hrabal (1) Bonnie Nadzam (1) Bram Stoker (1) Brendan O’Connell (1) Bri Lee (2) Brian McGilloway (1) Brian Moore (1) Brooke Davis (1) Bruce Chatwin (1) Bryce Courtenay (1) Caitlin Moran (1) Caitriona Lally (1) Cal Flyn (1) Camilla Läckberg (1) Carl-Johan Vallgren (1) Carlo Gébler (1) Carol Lee (1) Carol Shields (1) Carol Topolski (2) Caroline Vermalle (1) Carolyn Parkhurst (1) Carrie Kabak (1) Carrie Tiffany (2) Carson McCullers (1) Cate Kennedy (2) Catherine Jinks (1) Catherine Lacey (1) Catherine Leroux (1) Catherine McKinnon (1) Catherine Sanderson (1) Catherine Steadman (1) Cathie Black (1) Cathy Rentzenbrink (1) Celeste Ng (1) Celine Curiol (1) Chang-Rae Lee (1) Charles Todd (1) Charley Boorman (3) Charlotte Brontë (1) Charlotte Grimshaw (3) Charlotte Perkins Gilman (1) Charlotte Wood (6) Chip Cheek (1) Chloe Hooper (2) Choderlos de Laclos (1) Chris Abani (1) Chris Cleave (1) Chris Ewan (1) Chris Hammer (1) Chris Johnston (1) Chris Killen (1) Chris Womersley (1) Christian White (1) Christine Dwyer Hickey (3) Christoffer Carlsson (1) Christophe Dufosse (1) Christopher Brookmyre (1) Christos Tsiolkas (5) Chuck Palahniuk (7) Claire Fuller (1) Claire G. Coleman (1) Claire Keegan (1) Claire Kilroy (3) Claire Messud (1) Colette McBeth (1) Colin Harrison (1) Colm Tóibín (5) Colum McCann (2) Conor O’Callaghan (1) Cormac McCarthy (1) Cory Taylor (1) Courtney Collins (1) Craig Davidson (1) Craig Silvey (1) Cristina Henríquez (1) CS Richardson (1) Cynan Jones (2) D’Arcy Niland (1) Dai Sijie (1) Damon Galgut (5) Dan Brown (1) Dana Vachon (1) Daniel Keyes (1) Daphne du Maurier (1) Darin Strauss (1) Dav Vyleta (1) David Bezmozgis (2) David Ireland (1) David Malouf (2) David Mitchell (2) David Park (3) David Rose (1) David Vann (2) David Whish-Wilson (1) DBC Pierre (1) Deanna Raybourn (1) Debbie Taylor (1) Deborah Forster (1) Deborah Lawrenson (1) Deborah Levy (1) Deborah Moggach (1) Deirdre Madden (4) Denis Kehoe (1) Denis Thériault (1) Dennis Bock (1) Deon Meyer (1) Dermot Bolger (1) Diarmuid Ó Conghaile (1) Domenico Starnone (1) Dominic Smith (1) Donna Leon (3) Donna Tartt (1) Doreen Finn (1) Doris Lessing (3) Doug Johnstone (4) Douglas Kennedy (1) Douglas Preston (1) Dr Munjed Al Muderis (1) Druin Burch (1) Durian Sukegawa (1) E. Lockhart (1) E.M. Forster (2) Ed O’Loughlin (2) Eden Robinson (1) Edmund De Waal (1) Edna O’Brien (2) Edward Docx (1) Edward St Auburn (1) Effie Gray (1) Eimear McBride (1) Elena Ferrante (1) Elisabeth Sanxay Holding (1) Elizabeth Baines (1) Elizabeth Harrower (4) Elizabeth Jolley (3) Elizabeth Kostova (1) Elizabeth McCracken (1) Elizabeth McGregor (1) Elizabeth Stuart Phelps (1) Elizabeth Taylor (1) Elizabeth Von Arnim (1) Elliot Perlman (3) Elspeth Muir (1) Emily Maguire (1) Emma Donoghue (2) Emma Forrest (1) Emma Jane Kirby (1) Emma Viskic (1) Enza Gandolfo (1) Eoin McNamee (1) Eowyn Ivey (1) Eric Dupont (1) Eric Hansen (1) Eric Lomax (1) Eric Rill (1) Erich Maria Remarque (1) Erin Morgenstern (1) Esi Edugyan (2) Esmahan Aykol (1) Eva Hornung (1) Evan S. Connell (2) Evelyn Waugh (1) Evie Wyld (1) Ewan McGregor (2) F. Scott Fitzgerald (1) Fannie Flagg (1) Favel Parrett (1) Felicity Castagna (1) Felicity McLean (1) Fiona McFarlane (1) Fiona Wright (1) Flannery O’Connor (1) Ford Madox Ford (1) Françoise Sagan (1) Frances Itani (1) Franco ‘Bifo’ Berardi (1) Frédéric Beigbeder (1) Frédéric Dard (1) Fred Uhlman (1) Fred Vargas (1) Friedrich Christian Delius (1) Fuminori Nakamura (3) Gabriel Weston (1) Gail Honeyman (1) Gail Jones (4) Gary Barwin (1) Geling Yan (1) Genni Gunn (1) George Orwell (3) Georgia Blain (1) Georgina Harding (1) Gerald Murnane (2) Gil Courtemanche (1) Gillian Flynn (2) Gillian Mears (2) Gitta Sereny (1) Goldberry Long (1) Graeme Simsion (1) Graham Greene (3) H. E. Bates (1) Haïlji (1) Halldór Laxness (1) Han Kang (1) Hanna Krall (1) Hannah Kent (1) Hans Fallada (1) Harriet Lane (2) Harry Mulisch (1) Haruki Murakami (1) Hazel Baron (1) Heather Morris (1) Heather O’Neill (3) Heather Rose (3) Heinrich Böll (1) Helen Cross (1) Helen FitzGerald (6) Helen Garner (6) Helen Macdonald (1) Helen Walsh (1) Henning Mankell (1) Henry Handel Richardson (1) Henry Sutton (1) Herman Koch (2) Hilary Mantel (4) Hiromi Kawakami (1) Hitomi Kanehara (1) HM Brown (1) Horst Hamman (1) Hugo Hamilton (1) Hwang Sok-yong (1) Hyeonseo Lee (1) Iain Reid (1) Ian Carpenter (1) Ian Maleney (1) Ian McEwan (5) Ira Levin (1) Italo Calvino (1) Ivan Turgenev (1) J. M. Synge (1) J.G. Ballard (1) J.L. Carr (1) J.M. Coetzee (1) J.P. Donleavy (1) James Bradley (1) James Joyce (1) James Lasdun (1) James Salter (1) James Scudamore (1) James Siegel (2) James Woodford (2) Jami Attenberg (1) Jamie Marina Lau (1) Jan Costin Wagner (1) Jan Morris (1) Jan Wong (1) Jane Gardam (2) Jane Harper (3) Jane Harris (2) Jane Turner Rylands (1) Janet Fife-Yeomans (1) Janet Malcolm (2) Janette Turner Hospital (1) Janice Galloway (1) Javier Cercas (1) Jay Mcinerney (1) Jayne Joso (1) Jón Kalmann Stefánsson (1) Jean Rhys (3) Jeanette Winterson (1) Jed Mecurio (1) Jeffrey Eugenides (1) Jen Craig (1) Jennifer Clement (1) Jennifer Johnston (15) Jennifer Lash (1) Jenny Ackland (1) Jenny Erpenbeck (1) Jenny Offill (1) Jesse Ball (1) Jessie Greengrass (1) Jill Alexander Essbaum (1) Joan London (2) Joanne Harris (3) Joanne Ramos (1) Jocelyn Playfair (1) Jodi Picoult (1) Joe Bennett (1) Johan Theorin (2) John Ajvide Lindqvist (1) John Banville (2) John Berendt (1) John Boyne (2) John Broderick (2) John Christopher (1) John Colapinto (1) John Healy (1) John Knowles (1) John Lanchester (3) John Leake (1) John MacKenna (3) John McGahern (6) John O’Hara (1) John Silvester (1) John Updike (1) John Vaillant (1) John Williams (1) John Wyndham (1) Jojo Moyes (1) Jon Canter (1) Jonathan Coe (1) Jonathan Franzen (2) Jonathan Lethem (1) Jonathan Safran Foer (1) Jonathon Scott Fuqua (1) Joseph Boyden (1) Joseph Kanon (1) Joseph O’Connor (4) Joseph O’Neill (1) Josephine Hart (1) Josephine Wilson (1) Joshua Ferris (1) Joshua Henkin (1) Joy Rhoades (1) Juan Pablo Villalobos (1) Julian Maclaren-Ross (1) Julie Otsuka (1) Jussi Adler-Olsen (1) Justin Cartwright (1) Justine Hardy (1) Kamila Shamsie (1) Kanae Minato (2) Karen Shepard (1) Karin Alvtegen (2) Karin Fossum (7) Karin Slaughter (1) Karl Geary (1) Kate Grenville (3) Kate Jennings (1) Kate Manning (1) Katharine Weber (1) Katherine Faw Morris (1) Katherine Mansfield (1) Kathleen Rooney (1) Kathy Page (1) Katrina Onstad (1) Katy Gardner (1) Kazuo Ishiguro (2) Keigo Higashino (3) Keith Ridgway (1) Kelly Link (1) Kenneth Cook (3) Kent Haruf (6) Kerri Hulme (1) Kerry Young (1) Kerstin Hensel (1) Kevin Barry (1) Kevin Casey (2) Kevin Powers (1) Kevin Smith (1) Kim Echlin (1) Kim Scott (4) Kim Thúy (1) Kirsten Krauth (1) Kishwar Desai (1) Kit de Waal (1) Kjell Eriksson (1) Lauren B. Davis (1) Lauren Weisberger (1) Laurent Binet (1) Leïla Slimani (2) Lee Rourke (1) Lene Kaaberbøl (1) Leo Benedictus (1) Leonard Michaels (1) Leonardo Sciascia (1) Leslie T. Chang (1) Lezanne Clannachan (1) Lily Brett (2) Linda Grant (1) Linda Stift (1) Linn Ullmann (1) Lionel Shriver (3) Lisa Brackman (1) Lisa Lang (1) Lisa Moore (1) Lisa Nops (1) Lisa See (1) Lisa Williams (1) Liz Jensen (1) Liza Marklund (1) Lloyd Jones (1) Lois Murphy (1) Louis Hamelin (1) Louise Dean (2) Louise Doughty (2) Louise Lawrence (1) Louise Welsh (2) Loung Ung (1) Lucie Whitehouse (2) Lucy Caldwell (1) Lucy Treloar (1) Lynn Coady (2) Lynne Leonhardt (1) M.G. Durham (1) M.L. Stedman (1) M.R. Lovric (1) Ma Jian (2) Machi Tawara (1) Madeleine St John (2) Madeleine Thien (2) Maeve Binchy (2) Maeve Brennan (1) Magda Szubanski (1) Maggie Nelson (2) Maggie O’Farrell (1) Magnus Mills (9) Maj Sjöwall (1) Malla Nunn (1) Marceline Loridan-Ivens (1) Margaret Atwood (3) Margot Berwin (1) Marguerite Duras (2) Maria Angels Anglada (1) Maria Barbal (1) Maria Savva (1) Maria Tumarkin (1) Marina Lewycka (1) Marion Halligan (2) Marjorie Wallace (1) Mark Brandi (1) Mark Dodshon (1) Mark Haddon (1) Mark Macauley (1) Mark Oliver Everett (1) Mark Seymour (1) Mark Tedeschi (1) Mark Valentine (1) Markus Zusak (2) Marlena de Blasi (1) Martin Amis (2) Martin Boyd (1) Martin McKenzie-Murray (1) Martin Sixsmith (1) Mary Ann Shaffer (1) Mary Costello (2) Mary Higgins Clark (1) Mary Lawson (1) Mary Norris (1) Mary Swan (1) Maryam Sachs (1) Maryrose Cuskelly (1) Massimo Carlotto (2) Matt Birkbeck (1) Matthew Hooton (1) Matthew Kneale (1) Matthias Politycki (1) Max Porter (2) Maxine Beneba Clarke (1) Máire T. Robinson (1) Meena Kandasamy (1) Meg Mundelle (1) Megan Hunter (1) Meike Ziervogel (1) Melanie Cheng (1) Melanie Joosten (1) Melissa Lucashenko (1) Mercè Rodoreda (1) Merethe Lindstrøm (1) Michael Chabon (1) Michael Collins (2) Michael Dibdin (1) Michael Frayn (1) Michael Harding (1) Michael Lewis (1) Michael Mohammed Ahmad (1) Michael Ondaatje (1) Michael Redhill (1) Michel Faber (4) Michel Houellebecq (2) Michelle de Krester (3) Michelle Lovric (1) Michelle Moran (1) Michelle Winters (1) Mick Jackson (1) Mike McCormack (2) Mikhail Bulgakov (1) Miles Franklin (1) Minette Walters (1) Miranda Doyle (1) Mirandi Riwoe (1) Mireille Juchau (1) MJ Hyland (3) Mo Hayder (3) Mohsin Hamid (1) Molly Keane (1) Mona Awad (1) Monica Dickens (1) Monika Held (1) Morris Gleitzman (1) Muriel Spark (4) Murray Bail (1) Myfanwy Jones (1) Nadine Gordimer (2) Nami Mun (1) Nancy Richler (1) Naomi Alderman (1) Natalie D’Arbeloff (1) Natalie Young (1) Natasha Solomons (1) Natasha Walter (1) Nathanael West (1) Natsuo Kirino (1) Nawal El Saadawi (1) Neil Bartlett (1) Neil Cross (2) Neil Hegarty (1) Neil McCormick (1) Nell Leyshon (1) Nevil Shute (1) Niall Williams (4) Nicci French (8) Niccolo Ammaniti (2) Nicholas Rinaldi (1) Nick Cave (1) Nicole Krauss (1) Nicole Trope (2) Nik Perring (1) Nikki Gemmell (2) Nina Bawden (2) Nina Vida (1) Ninni Holmqvist (1) Nora Ephron (1) Nora Ikstena (1) Nora Okja Keller (1) Nuala Ní Chonchúir (2) Nuala O’Connor (1) Nuala O’Faolain (3) Octavia E. Butler (2) Olga Tokarczuk (1) Oliver Broudy (1) Olivia Laing (1) Oscar Wilde (1) Ottessa Moshfegh (1) Padma Viswanathan (1) Paola Totaro (1) Paolo Giordano (1) Paraic O’Donnell (1) Patricia Highsmith (2) Patrick deWitt (3) Patrick Flanery (1) Patrick Gale (1) Patrick Kavanagh (1) Patrick McCabe (1) Patrick McGrath (3) Patrick Modiano (1) Patrick White (3) Paul Auster (3) Paul Bowles (1) Paul Kalanithi (1) Paula Fox (2) Paula McGrath (1) Paulette Jiles (1) Pearl S. Buck (1) Peggy Frew (2) Penelope Fitzgerald (1) Penelope Lively (1) Per Olov Enquist (1) Per Petterson (7) Pete Hamill (3) Peter Carey (2) Peter Fröberg Idling (1) Peter Goldsworthy (1) Peter Handke (1) Peter Schneider (1) Peter Temple (3) Peter Wahlöö (1) PG Wodehouse (1) Philibert Schogt (1) Philip Roth (1) Philippa Moore (1) Philippe Claudel (2) Phoebe Locke (1) Pia Juul (1) Piers Morgan (1) Qui Xiaolong (1) R.J. Palacio (2) Rachel Cusk (2) Raduan Nassar (1) Ramona Koval (1) Randolph Stow (2) Rebecca Frayn (1) Rebecca James (1) Rebecca Miller (2) Richard Bausch (1) Richard Flanagan (4) Richard Hine (1) Richard Shears (1) Richard Yates (2) Rick Morton (1) Rob Hunter (1) Robert Dessaix (1) Robert Dinsdale (1) Robert Fannin (1) Robert Harris (1) Robert Hollingworth (1) Robert Lukins (1) Robert Wainwright (1) Robert Wilson (1) Robertson Davies (1) Robin Cooper (1) Robin Dalton (1) Robin Jenkins (3) Roddy Doyle (4) Roland Schimmelpfennig (1) Romesh Gunesekera (1) Romy Ash (1) Ron Butlin (1) Ron Elliott (1) Ron Hansen (2) Ros Wynne-Jones (1) Rose Tremain (1) Rosie Jones (1) Ross O’Carroll-Kelly (1) Ross Raisin (1) Rosy Thornton (1) Russell Wangersky (1) S. Thomas Russell (1) Sabine Durrant (3) Sacha Batthyány (1) Salley Vickers (4) Sally Hinchcliffe (1) Sally Rooney (2) Sam Selvon (1) Samanta Schweblin (1) Samantha Harvey (1) Samuel Archibald (1) Samuel Beckett (1) Santiago Roncagliolo (1) Sara Baume (1) Sarah Addison Allen (1) Sarah Dunant (1) Sarah Schmidt (1) Sarah Winman (1) Sayaka Murata (1) Sayo Masuda (1) Sándor Márai (1) Scarlett Thomas (1) Scott Spencer (1) Sean Michaels (1) Sebastian Barry (6) Sebastian Faulks (1) Shane Connaughton (1) Sharon Boorstin (1) Shauna Reid (1) Sheila Heti (1) Shirley Jackson (2) Shuichi Yoshida (1) Sigrid Rausing (1) Simon Beckett (1) Simon Lelic (1) Simon Lewis (1) Simon Van Booy (1) Sinéad Gleeson (1) Sjón (1) Sloan Wilson (1) Sofi Oksanen (1) Sonya Hartnett (2) Sonya Voumard (1) Sophie Hannah (1) Stan Grant (1) Stef Penney (1) Stefan Zweig (2) Stephanie Bishop (1) Stephanie Wood (1) Stephen Davison (1) Stephen Grosz (1) Stephen Orr (1) Steve Sem-Sandberg (1) Steven Amsterdam (1) Steven Lang (1) Stuart Maconie (1) Stuart Neville (1) Sudha Murty (1) Sue Monk Kidd (1) Sue Walker (1) Sumner Locke Elliott (2) Susan Johnson (2) Susan Sellers (1) Susanna Jones (1) Suzanne Joinson (1) Sven Lindqvist (1) Sylvia Plath (1) Taichi Yamada (2) Tan Twan Eng (1) Tana French (4) Tania Chandler (1) Tanya Bretherton (1) Tarjei Vesaas (1) Tayeb Salih (1) TC Boyle (1) Tegan Bennett Daylight (1) Terry Hayes (1) Thea Astley (3) Thomas Hardy (2) Thomas Keneally (1) Tim Gautreaux (1) Tim Krabbé (1) Tim Smit (1) Tim Winton (6) Ting-Xing Ye (1) Tiziano Scarpa (1) Toby Litt (2) Tom Lubbock (1) Tom Rachman (1) Tom Rob Smith (1) Tommy Wieringa (1) Tony Birch (1) Torgny Lindgren (1) Tracy Chevalier (1) Trevor White (1) Tricia Wastvedt (1) Truman Capote (1) Ursula K Le Guin (1) V. G. Lee (1) Val McDermid (1) Véronique Olmi (1) Vena Cork (1) Venero Armanno (1) Vicki Laveau-Harvie (1) Vikram Seth (1) W. Somerset Maugham (5) W.G. Sebald (1) Wally Lamb (1) Walter Macken (1) Warwick Collins (1) Wayne Macauley (2) Wendell Steavenson (1) Wendy James (1) Will Ferguson (1) William Coles (1) William King (2) William Maxwell (1) William Styron (1) William Thacker (1) William Trevor (9) William Weintraub (1) Winifred Watson (1) Yan Lianke (1) Yasmin Crowther (1) Yasmina Khadra (4) Yasunari Kawabata (1) Yoko Ogawa (3) Yukio Mishima (1) Yuri Herrera (1) Zadie Smith (1) Zoe Heller (1) Zoe Whittall (1) Zoey Leigh Peterson (1) Zsuzsi Gartner (1) Blogging milestones (1) Book lists (42) 10 books (14) 5 books (17) Book review (1,185) Books of the year (15) Fiction (1,059) Books in translation (173) chick-lit (6) Children/YA (11) crime/thriller (187) dystopian (21) general (53) historical fiction (103) holocaust (17) horror (10) literary fiction (761) naval (3) Poetry (2) postmodern literature (12) pre-20th Century classic (10) satire (18) science fiction (16) short stories (33) war (8) Western (5) Five fast reviews (5) Giveaway (4) Literary prizes (89) 2016 Giller Prize (9) 2016 Miles Franklin Literary Award (8) 2016 Stella Prize (10) 2016 YWOYA (7) 2017 Giller Prize (8) 2017 Kerry Group Novel of the Year (6) 2017 Stella Prize (8) 2018 Giller Prize (7) 2018 Miles Franklin Literary Award (10) 2018 Stella Prize (5) 2019 Kerry Group Novel of the Year (4) 2019 Stella Prize (8) Non-fiction (142) essays (12) History (8) long form essay (1) memoir (72) Music (4) nature (3) Sport (3) travel (31) true crime (31) Publisher (1,188) & Other Stories (3) Abacus (19) Acorn Digital Press (1) Affirm Press (1) Akashic Books (1) Alcemi (1) Alfred A. Knopf (1) Alice & Fred Books (1) Allen & Unwin (32) Allen Lane (1) Alma Classics (1) Amazon Encore (1) Anchor Books (3) Arrow Books (6) Atlantic Books (21) Back Bay Books (3) Ballentine (1) Bancroft Press (1) Bantam (7) Beautiful Books (4) Berkley Books (1) Biblioasis (4) Birlinn (1) Bitter Lemon Press (1) Black Inc (1) Black Swan (7) Blake Publishing (1) Bloomsbury (40) Bluemoose Books (1) Bodley Head (2) Borough Press (1) Brow Books (2) Calder (1) Canongate (32) CCV Digital (1) Chatto & Windus (3) Clerkenwell Press (1) Corgi (3) Coronet (1) Corsair (4) Counterpoint (1) CreateSpace Independent Publishing Platform (1) Crown Business (1) Dalkey Archive (1) Daunt Books (2) Definitions (1) Doubleday (4) Doubleday Canada (5) Duckworth (1) Ebury Press (2) Emblem (1) Europa Editions (4) Everyman’s Library (2) Faber and Faber (84) Fairfax Books (1) Farrar (1) Farrar Straus and Giroux (1) Fig Tree (4) Finch Publishing (2) Fitzcarraldo Editions (1) Flamingo (9) Fontana (1) Fourth Estate (19) Freight Books (1) Fremantle Press (5) Futura (1) Galley Beggar Press (1) Gallic Books (2) Giramondo Publishing (2) Glitterati (1) Gollancz (2) Grand Central Publishing (1) Granta (16) Green Light Press (1) Grove Press (2) Hachette Australia (4) Hachette Digital (4) Hamish Hamilton (4) Hardie Grant (2) Harper Collins (18) Harper Perennial (17) Harper Perennial Canada (1) HarperCollins Canada (1) Harvill Secker (23) Hatchette Books Ireland (2) Haus Publishing (1) Head of Zeus (1) Headline Review (16) Henry Holt (1) Hesperus Press (2) Hodder (6) Hoopoe (1) Hot Key Books (1) House of Anansi Press (5) Hutchinson (3) Hybrid Publishers (1) Ilura Press (1) Invisible Publishing (1) iUniverse (1) John Murray (3) Jonathan Cape (17) Kindle Singles (1) Knopf (2) Lake Union Publishing (1) Legend Press (2) Les Fugitives (1) Lilliput Press (9) Little, Brown (13) Maclehose Press (3) Macmillan (2) Mainstream Digital (1) Mantle Books (2) Manybooks.net (4) Margaret River Press (1) Melville House (2) Methuen (1) Michael Joseph (4) Michael O’Mara (2) Mira Books (1) Mulholland Books (5) Myrmidon Books (1) National Geographic Books (1) Nero (1) New Holland (1) New Island (10) Nightjar Press (1) Norton (1) O’Brien Press (1) Oneworld (5) Open Letter Books (1) Orion (5) Other Press (2) Overlook Duckworth (1) Pan Books (5) Pan Macmillan Australia (3) Peirene Press (10) Penguin (75) Penguin Australia (9) Penguin Canada (1) Penguin Classic (11) Penguin Ireland (1) Penguin Modern Classics (35) Penguin Viking (2) Persephone (3) Phoenix (8) Picador (53) Pocket Books (1) Polygon (3) Portobello Books (4) Profile Books (1) Project Gutenberg (2) Pushkin Press (6) Pushkin Vertigo (1) Putnam (1) QC Fiction (1) QPD (1) Quartet Books (2) Quercus (16) Random House (2) Random House Australia (3) Random House Canada (1) Red Fox (1) RHCP Digital (1) Riverhead (3) riverrun (1) Roast Books (3) Salt Publishing (4) Sandstone Press (1) Saqi Books (1) Sceptre (12) Scribe (16) Scribner (6) Seizure (2) Serpent’s Tail (6) Signature Editions (1) Simon & Schuster (7) Simon & Schuster Australia (1) Sleepers Publishing (1) Smashwords (1) Soho Books (5) Sort Of Books (1) Sphere (1) Spineless Wonders (1) Straus and Giroux (1) Summersdale (1) Telegram (1) teNeues Publishing (1) Text (19) Text Classics (10) The Friday Project (1) Thomas Allen & Son (1) Thomas Dunne Books (1) Thunder Mouth Press (1) Time Warner Books (4) Tin House Books (1) Tinder Press (6) Tivoli (1) Tramp Press (3) Transit Lounge (4) Transworld Digital (2) Tuskar Rock Press (2) Two Ravens Press (1) University of Melbourne Press (1) University of Queensland Press (8) University of Western Australia Press (2) Verso (1) Viking (6) Vintage (106) Vintage Australia (6) Vintage Contemporaries (1) Vintage Digital (9) Virago (11) Virgin Books (1) Wakefield Press (1) Ward Wood Publishing (1) Weidenfeld & Nicolson (3) Wildfire (2) William Collins (2) William Heinemann (2) Windmill Books (1) Yale University Press (2) Zaffre (1) Reading Projects (133) 1001 books (49) Focus on WA writers (3) Read Along (2) Reading Australia 2016 (50) TBR2020 (2) TBR40 (31) Setting (1,135) Afghanistan (4) Africa (20) Antarctica (2) Australia (220) Austria (8) Basque Country (1) Brazil (3) Cambodia (5) Canada (50) Channel Islands (1) Chile (2) China (20) Corfu (1) Czechoslovakia (3) Denmark (7) Egypt (4) England (136) Estonia (1) Finland (1) France (53) Germany (23) Greece (5) Holland/Netherlands (5) Hong Kong (4) Hungary (3) Iceland (13) India (9) Indochina (1) Indonesia (1) Iran (2) Iraq (5) Ireland (131) Isle of Man (2) Israel (2) Italy (24) Jamaica (3) Japan (33) Libya (1) Lithuania (2) London (104) Malaya (2) Malaysia (1) Mexico (7) Monte Carlo (1) Morocco (4) Netherlands (2) New York (68) New Zealand (6) Nigeria (1) North Korea (3) Northern Ireland (11) Norway (15) Papua New Guinea (1) Paris (2) Peru (1) Poland (9) Portugal (2) Romania (3) Russia (6) Rwanda (1) Saudi Arabia (1) Scotland (30) South Africa (9) South America (5) South Korea (1) South Korean (1) Spain (8) Sri Lanka (4) Sudan (1) Sweden (18) Tahiti (1) Turkey (3) UAE (2) UK (31) USA (164) Venice (13) Vietnam (2) Wales (3) Triple Choice Tuesday (126) UK Blog Awards (3) Uncategorized (3) Waterstones book blogger (1)
‘The Book of Fame’ by Lloyd Jones
‘Maybe the Horse Will Talk’ by Elliot Perlman
13 books by Jennifer Johnston
‘Home Fire’ by Kamila Shamsie
26 books by women: completing the 2019 Australian Women Writers’ Challenge
Archives Select Month January 2020 December 2019 November 2019 October 2019 September 2019 August 2019 July 2019 June 2019 May 2019 April 2019 March 2019 February 2019 January 2019 December 2018 November 2018 October 2018 September 2018 August 2018 July 2018 June 2018 May 2018 April 2018 March 2018 February 2018 January 2018 December 2017 November 2017 October 2017 September 2017 August 2017 July 2017 June 2017 May 2017 April 2017 March 2017 February 2017 January 2017 December 2016 November 2016 October 2016 September 2016 August 2016 July 2016 June 2016 May 2016 April 2016 March 2016 February 2016 January 2016 December 2015 November 2015 October 2015 September 2015 August 2015 July 2015 June 2015 May 2015 April 2015 March 2015 February 2015 January 2015 December 2014 November 2014 October 2014 September 2014 July 2014 June 2014 May 2014 April 2014 March 2014 February 2014 January 2014 December 2013 November 2013 October 2013 August 2013 July 2013 June 2013 May 2013 April 2013 March 2013 February 2013 January 2013 December 2012 November 2012 October 2012 September 2012 August 2012 July 2012 June 2012 May 2012 April 2012 March 2012 February 2012 January 2012 December 2011 November 2011 October 2011 September 2011 August 2011 July 2011 June 2011 May 2011 April 2011 March 2011 February 2011 January 2011 December 2010 November 2010 October 2010 September 2010 August 2010 July 2010 June 2010 May 2010 April 2010 March 2010 February 2010 January 2010 December 2009 November 2009 October 2009 September 2009 August 2009 July 2009 June 2009 May 2009 April 2009 March 2009 February 2009 January 2009 December 2008 November 2008 October 2008 September 2008 August 2008 July 2008 June 2008 May 2008 April 2008 March 2008 February 2008 January 2008 December 2007 November 2007 October 2007 September 2007 August 2007 July 2007 June 2007 May 2007 April 2007 March 2007 February 2007 January 2007 December 2006 November 2006 October 2006 September 2006 August 2006 July 2006 June 2006 May 2006 April 2006 March 2006 February 2006 January 2006 December 2005 November 2005 October 2005 September 2005 August 2005 July 2005 May 2005 April 2005 March 2005 February 2005 January 2005 December 2004 November 2004 October 2004 September 2004 August 2004 July 2004 June 2004 May 2004 April 2004 March 2004 February 2004 January 2004 December 2003 November 2003 October 2003 September 2003 July 2003 June 2003 May 2003 April 2003 March 2003 February 2003 January 2003 December 2002 November 2002 October 2002 September 2002 August 2002 July 2002 June 2002 May 2002 February 2002 January 2002 December 2001 November 2001 October 2001 August 2001 April 2001 March 2001
'The Book of Fame' by Lloyd Jones
'Dollar Bahu' by Sudha Murty
'Son of a Trickster' by Eden Robinson
'Voss' by Patrick White
'Fifteen Dogs' by André Alexis
'Maybe the Horse Will Talk' by Elliot Perlman
'Benang: From the Heart' by Kim Scott
kimbofo on ‘The Book of Fame’…
wadholloway on ‘The Book of Fame’…
Lisa Hill on ‘The Book of Fame’…
A review assortment… on 13 books by Jennifer John…
kaggsysbookishrambli… on ‘The Book of Fame’…
kimbofo on 13 books by Jennifer John…
kimbofo on ‘Maybe the Horse Will Ta…
Kate W on ‘Maybe the Horse Will Ta…
Follow Reading Matters on WordPress.com
Visit Reading Matters Facebook Page
5 books 20 books of summer (2017) 20 books of summer (2018) 20 books of summer (2019) 1001 Books to read before you die American literature ANZ lit Australian literature Australian women writers AWW2016 AWW2018 AWW2019 BAME writer Book lists Books of the year British literature Canadian literature CanLit Charlotte Wood cold crime coming-of-age crime crime fiction crime thriller Dublin emigration English literature fable forbidden love French literature German literature Giller Prize grief Helen Garner holocaust Indigenous issues Ireland Irish literature Italian literature Japanese literature Jennifer Johnston journalism London marriage Melbourne memoir morality murder narrative non-fiction New York non-fiction Norwegian literature novella OzLit politics psychological thriller Reading Australia 2016 religion reportage satire Scandinavian crime Scotland sex Shadow Giller short stories Swedish literature TBR40 terrorism Tim Winton translated fiction travel Triple Choice Tuesday true crime war world war two
|
cc/2020-05/en_middle_0087.json.gz/line1341262
|
__label__wiki
| 0.712019
| 0.712019
|
Libertarian Historian Ronald Hamowy Dead at 75
Was a Cato Fellow and editor of The Encyclopedia of Libertarianism
Reason Staff | 9.9.2012 3:40 PM
The Cato Institute regrets to announce the passing of Ronald Hamowy, distinguished intellectual historian, Cato Fellow in Social Thought, and editor of The Encyclopedia of Libertarianism. Ronald died Saturday at the age of 75, after a long series of health problems. His friend Steve Cox, editor of Liberty magazine, has an informative and touching remembrance:
He was one of the libertarian movement's most important and vital scholars. An historian of the 18th century, he was known for his impeccable standards of research and writing. To discerning researchers of the Enlightenment — left, right, or center — his word was law. If there was a scholarly myth or illusion, he was the one who was trusted to puncture it. He was the person who meticulously set things straight. Many times, when I have mentioned his name in an academic conversation, the reply has been, "Ronald Hamowy! You know him?!"
For libertarians, Ronald will always be recognized as a bright star of the post-World War II generation — but unlike many other grand old men of this or that era, he never became a Grand Old Man. He retained to the end his youthful joy and sense of first discovery. To him, any new fact — or any old movie, viewed on his constant friend, Turner Classics — was a pleasure to be greeted as if it were the first one in the universe. Even when ensconced as chairman of an august intellectual conference, Ronald let his eyes sparkle and his mouth crinkle with laughter, and with some little Count Basie-like verbal gesture he set the whole house laughing with his infectious wit.
Cato Libertarian History/Philosophy Libertarianism
|
cc/2020-05/en_middle_0087.json.gz/line1341264
|
__label__wiki
| 0.810501
| 0.810501
|
Sandy Hook School Shooting
5 Facts About Guns, Schools, And Violence
What every legislator - and citizen - needs to know.
Nick Gillespie and Amanda Winkler | 1.10.2013 8:15 AM
In the wake of December's horrific mass shooting at Sandy Hook Elementary School in Newtown, Connecticut, Vice President Joe Biden is chairing a panel of experts that will make gun-control recommendations to President Barack Obama by the end of the month. The president has said that enacting new restrictions on guns will be one of his highest priorities.
No one wants to ever again see anything like the senseless slaughter of 26 people – including 20 children—at a school. But as legislators turn toward creating new gun laws, here are five facts they need to know.
1. Violent crime – including violent crime using guns – has dropped massively over the past 20 years.
The violent crime rate – which includes murder, rape, and beatings—is half of what it was in the early 1990s. And the violent crime rate involving the use of weapons has also declined at a similar pace.
2. Mass shootings have not increased in recent years.
Despite terrifying events like Sandy Hook or last summer's theater shooting in Aurora, Colorado, mass shootings are not becoming more frequent. "There is no pattern, there is no increase," says criminologist James Allen Fox of Northeastern University, who studies the issue. Other data shows that mass killings peaked in 1929.
3. Schools are getting safer.
Across the board, schools are less dangerous than they used be. Over the past 20 years, the rate of theft per 1,000 students dropped from 101 to 18. For violent crime, the victimization rate per 1,000 students dropped from 53 to 14.
4. There Are More Guns in Circulation Than Ever Before.
Over the past 20 years, virtually every state in the country has liberalized gunownership rules and many states have expanded concealed carry laws that allow more people to carry weapons in more places. There around 300 million guns in the United States and at least one gun in about 45 percent of all households. Yet the rate of gun-related crime continues to drop.
5. "Assault Weapons Bans" Are Generally Ineffective.
While many people are calling for reinstating the federal ban on assault weapons – an arbitrary category of guns that has no clear definition – research shows it would have no effect on crime and violence. "Should it be renewed," concludes a definitive study, "the ban's effects on gun violence are likely to be small at best and perhaps too small for reliable measurement."
The Sandy Hook Elementary School shooting is as horrifing a crime as can be imagined. It rips at the country's heart and the call to action is strong and righteous. But as Joe Biden and his panel of experts consider changes to gun laws and school-safety policies, they need to lead with their heads and not just their hearts.
Over the past dozen years, too many policies – the Patriot Act, the war in Iraq, the TARP bailouts – have been ruled by emotion and ideology.
Passing sweeping new restrictions on Second Amendment rights won't heal the pain and loss we all feel but just may create many more problems in our future.
Written by Nick Gillespie. Produced by Amanda C. Winkler. Additional camera work by Joshua Swain.
About 2.30 minutes. Scroll below for downloadable versions and subscribe to Reason TV's YouTube channel to receive automatic notifications when new material goes live.
NEXT: Car Blows Up Near Bus in Tel Aviv
Amanda Winkler is a producer at Reason TV.
Sandy Hook School Shooting Guns Gun Control Joe Biden Violence Schools Police in Schools Assault Weapon Ban Second Amendment Constitution
|
cc/2020-05/en_middle_0087.json.gz/line1341265
|
__label__wiki
| 0.717461
| 0.717461
|
Home › Uncategorized › Rory Stewart Tory Leadership Bid Kicks off in Comedy Club (Really!)
Rory Stewart Tory Leadership Bid Kicks off in Comedy Club (Really!)
By The Rebel Intelligence Officer on June 11, 2019 • ( 0 )
To be fair, the name Rory Stewart does seem more like the name of an up and coming Scottish comedian, than it does of the next British (or English depending on how you look at it) prime minister.
However, as we pointed out recently, Rory Stewart does seem to do everything differently. Whilst most Conservative leadership candidates took most of their standard drugs, cocaine and cannabis, at university, Rory did it whilst walking across Asia, smoking exotic opium with the locals.
And now, rather than launch his leadership bid for the Conservative Party leadership in a swanky venue or hotel like the other candidates, Rory has, perhaps fittingly, plumped for a comedy club.
That’s according to The Guardian’s live feed reporting on the launch, that could be fake news of course, but what was to come during the launch was even more surreal than the choice of venue.
Screenshot from Guardian live feed
During his opening pitch, Rory made a number of pledges and he started off with a tremendous chunk of bullshit, ” On the one side, there is a fairy story. And on the other there is realism.”
This does sound a bit Dubya, “you’re either with us or against us,” but as things progressed it became apparent that the enemy may not have been defined in the current Tory de jour form.
It turned out the enemy was not Corbyn and the Labour Party but the other Conservative Leadership candidates. Rory’s leadership bid instantly morphed into candidature by catharsis as he threw aside the shackles of the Conservative whip.
Rory pledged he would get every civil servant to have a sign on their desk saying, ‘Would you be proud to put your mother or brother or sister in this hospital?”
It was never made clear, however, which hospital it was that all the civil servants would be working in, and why. The opium it appeared, even though it might have been a small amount and of low quality, had done its job. Rory was off on one.
Rory went on to speak in Sufi parables that may have been inscrutable to the average Conservativehome subscriber, but as he spoke, one had to wonder how the hell he had ended up as a Conservative Party leadership candidate. Was this some kind of witchcraft?
And then, the grand plan came out.
If he won, Rory was going to walk through every county in the UK “listening to people.” And after listening he will convert what he is told into energy to convert the UK into a better nation. That bloke in the white druid dress, in King Arthurs Arms in Tintagel used to say similar things, before he put the jubebox on and found god in Soul II Soul every night.
Then Rory announced his resignation from the government by suggesting he would vote with the Labour Party to prevent the Tories running down the clock to a no deal Brexit. Then, afterwards, he announced he would not be resigning after all because now he had read the Labour motion and the opium had worn off.
And with that, he was gone. Until next time.
‹ UK Conservative Leadership Candidates on Drugs
New Brexit Party MEP Says Most Dog Groomers Voted Brexit ›
Tags: comedy club, comedy night, Conservative Party Leadership Contest 2019, King Arthurs Arms, opium, Rory Stewart, Soul II Soul, Sufi Parables, Tintagel
|
cc/2020-05/en_middle_0087.json.gz/line1341268
|
__label__wiki
| 0.785531
| 0.785531
|
Home / Posts tagged "120815"
GIF Recap: Caps Beat Wings Thanks to Oshie and Kuzy Shootout Goals
Photo: Patrick Smith
The Capitals beat the Red Wings 3-2 in a shootout Tuesday on the same night Mike Green returned to Verizon Center. Justin Williams scored in the game’s first minute to record his 600th career point, and Alex Ovechkin tied the game in the 3rd period with his 13th goal of the season. T.J. Oshie and Evgeny Kuznetsov both scored in the shootout to ensure the Caps moved back into first place in the Metropolitan Division.
By Hana Imiolczyk 4 years ago
Ted Leonsis Took a Selfie With Mike Green
Photo: @TedLeonsis
Recently Caps owner Ted Leonsis began first-person tweeting from his phone. The result has been stunning. He’s taken photos with Mark Cuban, Henry Kissinger, and Santa.
Tuesday night, Leonsis got a picture with Mike Green after the Caps’ 3-2 shootout victory over the Red Wings. Leonsis included a kind message with the photo.
TJ Oshie and Evgeny Kuznetsov’s Sick Shootout Goals
Photo: Geoff Burke
The Capitals have a lot of skill, which makes them extra dangerous in three-on-three overtime. “We’ve got some good guys out there,” TJ Oshie said after the game to reporters.
That same skill makes the Caps downright lethal in the shootout. Barry Trotz didn’t even have to send out his three-time MVP, Alex Ovechkin, or arguably his best player, Nicklas Backstrom. Instead he sent out Oshie– the player who rose to fame by beating Team Russia in an Olympic shootout — and Evgeny Kuznetsov, the Caps’ team leader in points.
They scored easily.
Mike Green’s Homecoming: Caps beat Red Wings 3-2 (SO)
Photo: Amanda Bowen
Mike Green returned to Verizon Center for the first time since, eh, I’d rather not talk about it. The Detroit Red Wings and Washington Capitals played another one of their agonizingly tight games, but it was actually pretty good hockey, so it was fun to watch. But if this game were played in May, I’d be vomiting my soul up right now.
The Capitals didn’t wait long to score. Justin Williams took advantage of a broken play by Detroit to score his 600th career point. A little later, a dumb icing call gave Dylan Larkin the opportunity to set up Henrik Zetterberg for a smooth-looking goal. Detroit took the lead in the second period with Tomas Jurco’s first goal of the season. The Caps drew two penalties in the third period, the second of which Alex Ovechkin converted by crashing the net. Tied at two, the game went to 3v3 overtime, which is basically just NBA Jam for hockey. The Caps had to kill a big penalty in the extra period to force the shootout.
Shootout bullets!
TJ Oshie put the biscuit in the basket.
Gustav Nyquist did NOT put the biscuit in the basket.
Evgeny Kuznetsov put the biscuit in the basket.
Pavel Datsyuk did NOT put the biscuit in the basket.
Caps beat Red Wings in the shootout!
By Peter Hassett 4 years ago
Wes Johnson Announces Detroit’s Starting Lineup as William Shatner (Video)
The Washington Capitals in-arena announcer Wes Johnson is a man of many talents. He’s an accomplished actor (Veep, A Dirty Shame, Head of State), a world-famous voice actor (Oblivion, Skyrim, Fallout 3 and 4), and a comic artist.
He also does one hell of a William Shatner impression, as we heard during Tuesday’s announcement of the Detroit Red Wings’ starting lineup.
Justin Williams’s 600th Point, Also Mike Green is Minus-1 Haha
The Washington Capitals are up early against Mike Green’s Detroit Red Wings, and it’s all thanks to Justin William’s tap-in.
Caps vs Red Wings Pregame: Let Mike Be
Photo: @wingwheelwonder
Mike Green, one of the best defensemen to ever wear a Caps uniform, returns to DC tonight. This raises an important question:
Will you "whoop" Mike Green tonight?
— Pat Holden (@pfholden) December 8, 2015
For those who are unfamiliar, here’s a history of the whoop, courtesy of Peerless.
If I happened to be attending the game tonight (spoiler: I’m not), I would be in the “No” crowd. If you do plan to whoop Green, just do so knowing that I disapprove of you, your face, and likely your entire existence.
The hopefully whoop-free game will be brought to you by NBCSN at 7:30 PM.
Team Record Possession PDO Power Play Penalty Kill
Washington Capitals 18-5-2 53.0% 101.3 25.6% 83.8%
Detroit Red Wings 15-8-4 51.6% 101.3 17.2% 81.1%
By Patrick Holden 4 years ago
|
cc/2020-05/en_middle_0087.json.gz/line1341269
|
__label__cc
| 0.72865
| 0.27135
|
What's Behind The Global EV Sales Slowdown?
An economic slowdown in many…
Is The Bull Market On Its Last Legs?
This aging bull market may…
Another Retail Giant Bites The Dust
Forever 21 filed for Chapter…
David Haggith
David Haggith writes a blog at The Great Recession Blog
How Big A Threat Is Climate Change To The Global Economy?
America's $16 Trillion Debt Bubble Is About To Burst
$7 Trillion In Unfunded U.S. Pensions As Domestic Debt Hits A Record High
The Free Money Bubble Is About To Burst
The Trump Triumph Changes Economic Predictions for 2017
By David Haggith - Feb 21, 2017, 8:46 AM CST
The triumph of Donald Trump as the champion of a revolution against the status quo assures huge economic changes in the coming year, which I'll list below. His victory struck a shocking upset to the globalists who have steered the last sixty or more years of world history, as I reported in an earlier story about George Soros mourning over the damage Trump will bring to global governance by unelected elitists.
For a short time, we should see some improvements. However, numerous structural flaws in the US economy ultimately assure economic collapse because those flaws have not been dealt with for decades, are not being dealt with in any of the Donald's plans, and are most likely too far gone now to ever deal with. Trump's plan will even make some of those structural flaws much worse in the long run.
What I describe in these economic predictions has considerable contagion possibilities for the rest of the world. While emerging economies have grown to where the US does not have the near-total economic dominance it once had over the world, it is still the world's greatest economy (at least, in size). So, it is still true that, when the US sneezes, the rest of the world catches a cold ... if not pneumonia.
What Trump's victory changes most is the timing of economic collapse because his economic plan is bound to bring temporary lift, even as it worsens some of the structural flaws. The effect of the flaws I wrote about will take more time to develop than the improvements, but probably not much more time.
Let's start with the positives:
Positive economic changes that are certain to result from the Trump triumph
Here is a list of economic changes, which I think are certain to bring some boost to the US economy in 2017 and will likely delay my epocalyptic predictions:
It is certain that Trump's tax plan will happen. While it may not happen entirely, something very close to it will certainly happen because Republicans have never seen a tax-reduction plan they didn't like. Republicans hold certain economic convictions as tightly as religious dogma: they believe tax cuts will pay for themselves and so will not create huge worsening of the national debt. Every time they make tax cuts, they claim the cuts will stimulate investment, which will stimulate the economy, which means more businesses will produce more revenue, which means there will actually be more tax revenue, not less. They have never been right about this yet. We have NEVER made tax cuts without increasing the federal deficit under any president. That fact, however, never kills this dogmatic belief. Republicans also believe with religious fervor that targeting tax cuts to the rich in the form of corporate breaks and particularly capital gains cuts will create new jobs and trickle wealth down to the middle class and the poor. The fact that real middle class wealth has stagnated or even shrunk during every past episode of trickle-down economics never matters. Belief trumps truth. Since Republicans control the entire legislature and the executive branch and will be changing the balance of the Supreme Court, it is absolutely certain we will see major tax reductions that will come as our third and greatest round of trickle-down economics. The plan coauthored by Larry Kudlow has all of his support with conservatives and Republicans, too. Even if Trump were removed from office, most of his plan would become law.
The stock market will rise ... for awhile, at least. What we know from trickle-down economics is that it certainly does stimulate the stock market. The money that is saved on capital gains and corporate income and that is repatriated in corporate income from overseas largely goes into speculative gambling in stocks. Very little of it goes into capital construction or business expansion. Even before any of Trump's proposed changes have happened, we are witnessing how the mere hope of such changes has caused a huge increase in stock-market speculation (both volume and prices) as investors try to reposition for this new reality. There was a brief stock market slump right when I said there would be once people started to question whether Trump's plans would be enacted, but it didn't last long because, as soon as Trump got into office, he moved rapidly via serial executive orders to start implementing many of his promises, quickly building faith that he will carry out most of them rapidly and with great determination.
It is unlikely that Trump's infrastructure stimulus plan will make it off the ground in 2017. While Republicans are certain to approve tax breaks, they are not big on massive government spending increases. Trump will find some strong resistance among Republicans to his increased spending; at the same time, Democrats remember well how Republicans battled against Obama's plans to increase infrastructure spending in order to stimulate the economy. According to junior Republicans who eventually came out against Speaker of the House John Boehner, this was partly because Boehner and the Republican guard didn't want Obama to get the credit for economic improvement. They put the good of their party over their nation's good. So, Trump will likely find a lot of resistance there, too, as Democrats return this tactic.
Spending will certainly increase in one area -- the military. Republicans have proven for decades that no deficit is too big if it is going toward building a stronger military. They find support among Democrats for this, who have just as many wealthy donors in the military-industrial complex as Republicans have. They also find a lot of support among the general public -- particularly conservatives -- because conservatives like for America to be the strongest nation on earth. Besides being macho, defense and security have a strong argument behind them in a world full of terrorists. While Trump seeks to improve relations with Russia, he is also antagonizing relations with China. The US, under Obama, was already acting more aggressive in the South China Sea in order to keep China from controlling secondary trade routes. Trump will build on Obama's lead there, and his trade battles with China may intensify conflict with China overall. Trump has stated loud and clear that the US military will be ready to look out for Japan's national interests. At the same time, North Korea is picking a fight in order to beat its chest, which presses Trump to take some action against them. That may come about just as sanctions, but could involve some military saber rattling or countermeasures from the US that could escalate. Trump will take a greater lead than Obama did against terrorists in the Middle East, as he was critical of Obama's restrained and somewhat ineffective efforts. Expect a more aggressive anti-terrorist policy. That means, as under Reagan, increased military spending will be more important than increased infrastructure spending, but military spending also stimulates the economy by creating jobs and boosting a number of major stocks.
Economically, those are all strong short-term positives, regardless of what they bring further down the road.
Economic collapse will happen on Trump's watch, probably later this year
In spite of these certain positive economic changes for 2017, there remains a countervailing globalist force that has already presided over numerous economic failures of its own making. These people will relentlessly attack Trump, and they will seek to pin their own failing recovery on him. Such an entrenched counterforce makes it impossible to say how much temporary good Trump's economic policies can bring. Trump starts in a world where globalists have long ruled the nation's central bank, which they have positioned to create US economic hegemony. Trump can change that over time, but probably doesn't have time enough. Also, his lineup of Goldman Sachs executives in all financial offices of the US says that he won't. Gobalists are also deeply entrenched in US intelligence agencies and the military leadership, where they have engaged in relentless nation building as they seek to shape the world toward the interests of their own political and financial establishment while also working in alliance with the interests of the UK and the rest of Europe.
They will do anything they can to restrain Trump's plans to drain the swamp in Washington and as well as his plans to align with Russia and his plans to diminish nation-building efforts. How far and how quickly he can push against their resistance depends entirely on his and his followers' ability to overcome deeply entrenched globalist powers that have steered the nations of "the West" for decades. All globalists in the world will oppose Trump.
Globalist are first trying to groom and massage Trump into their ways. They are also trying to thwart him through fake news in the media, slanted stories, political attacks, and by stirring up chaos and counter-revolution wherever possible. Even Obama has formed a foundation to try to muster as many protests against Trump as possible. To the extent those efforts fail to stop or change Trump, the financial establishment will, in the very least, try to make him the scapegoat for the failure of their past eight years of badly misguided recovery efforts.
If they cannot impeach him, as some are already working toward, the ultimate risk for Trump and his supporters is that the establishment will assassinate him. This risk is real enough that, for the first time in the history of the US (that I am aware of), we witnessed the nation's largest mainstream news source (CNN) decide that one of the most important non-news stories it could trump up during the inauguration was a "what-if" story about how US leadership roles would be assigned if Trump was assassinated on the day Obama's leadership expired but just before Trump got inaugurated.
That such a concern made it as a main CNN story shows there are many mainstream thinkers who see assassination as a realistic possibility, not as some hysterical conspiracy theory. CNN saw it as enough of a likelihood already in the public mind to make it useful fake news (fake in the sense that it filled news time but is not news at all, but (for the moment) pure fiction that teases liberal minds with a kind of "final solution" hope). Trump is Hitler, according to liberal mass hysteria (just as much as Hillary Clinton was Hitlery to conservatives). Both sides routinely demonize their opposition. As the flagship of the liberal media, CNN planted deep the implied seed of hope that Trump might be taken care of with a final solution aimed just at him. Of course, they would deny that they were raising incendiary hopes among liberal Trump haters.
Now that the revolution and counter-revolution have begun, there is no way I can say which force will dominate by the end of 2017, given the immensity of the forces, the entrenchment of the old guard, the resolution of the Trump revolutionaries, the huge flaws existing in the US and global economies, and the economic headwinds that I'll lay out in my next article. What I can point out is that the globalists clearly begin with the upper hand by far, and they are certainly not going to give up. In fact, they are only beginning to implement their strategies to overcome Trump because they did not believe they would lose the election.
One of the things I said throughout the past year was that my many predictions about the Epocalypse (the epic and epochal, economic collapse into apocalyptic times) for 2016 might be pushed back until after the election because the Federal Reserve and the Obama administration would do anything and everything possible to avoid having their "recovery" fail on their watch, lest their failure should assure a Trump victory and destroy their own legacy. If that meant using Fed funds to buy up oil through banks to manipulate oil prices upward or meant the Fed would influence or coerce proxies in other countries to buy up US assets to support the stock market -- whatever it might take -- they would do it all ... behind the scenes.
Shortly after saying that, I pointed out in early 2016 how the Federal Reserve board held two back-to-back "emergency, closed-door meetings" (as described on the Fed's own published calendar) followed by an immediate "emergency meeting" between Fed Chair, Janet Yellen, and the president and vice president of the United States. After those meetings, the stock crash that had begun in January and somewhat recovered in February evaporated, and stocks moved continuously toward recovering all lost ground. We were never told what any of those meetings were about, but meetings between the Fed chair and the president rarely happen, and meetings including the V.P. almost never happen. That indicates some level of emergency that the vice president also needed to be fully informed on.
It has also been my stated belief all along that, if Trump did win (which I gave a better likelihood than Hillary), the Federal Reserve would capitalize on it. I have no doubt that globalists have plans for every contingency. With their recovery failing again (as we saw GDP cascade in the final quarter of 2016), the establishment would be more than happy to let it crash after the election, but most likely not until after Obama was out of office and Trump sat in the oval office.
I have said for years that the Fed's "recovery" during the Obama administration can only live as long as artificial life support continues. That support still continues intensely through the Fed holding indefinitely the huge expansion of its balance sheet (which leverages out to an historically enormous pool of new money continuing to float the economy) and through the Fed's continuance of extremely low interest rates. (While rising now, interest rates still remain the lowest they have been in modern history, outside of the Great Recession.)
I've believed that, if globalists faced a Trump victory, they would even collapse the economy on purpose, if it were not already failing, because they would love to decapitate their newly risen opposition by making people believe that the entire global economy collapsed because of Trump's interruption to their plans. They would hope that would slam a lid on revolutionaries against globalism, teaching them once and for all that their individualism and nationalistic, anti-socialist ways bring only rapid calamity.
I think they recognize that, if a global collapse happens on Trump's watch, many people will look desperately for a global solution from those who appeared to be having success with restoring the economy before he came into office. Many people do not see that the Fed's recovery was only kept alive by endless and massive administrations of artificial life support. Many people also do not see or believe that the economic flaws of the US and many other nations are fatal or even important -- such as the size of national debts, the vanity of fiat currencies, the dangers of financing national debts with massive infusions of such currency. They don't believe that expanding personal debt to individual limits leads to enslavement as does national debt -- enslavement to bankers. They even believe that banks and government have done the right things to reduce the risks of another economic crisis like we had from 2007 to 2009 in the Great Recession.
Therefore, it will not be hard to find a majority of the populace that will join the mainstream media and the establishment politicians in blaming Trump when the entire global economy goes down. Trump's provocative mouth, his brazen plans, his sometimes brash execution of those plans, along with his narcissism and often clownish behavior, make him a ripe target as a grand scapegoat. (I think even most conservatives would have to admit to themselves here that, if Trump were carrying out a totally liberal agenda, they would find plentiful stock for ridicule in Trump's showy, boastful, and brash behavior. It won't be hard for his opponents to do the same.)
So, if the establishment doesn't assassinate him (now a mainstream idea), they will likely make him a scapegoat to carry away their own sins. All of that places the likelihood of economic collapse sometime in 2017.
US Dollar and Gold Battle of the Cycles
Trump to Fill at Least Three Fed Positions: What Will the Trump Fed Look Like?
Why A Strong Yuan Is A Promising Sign For The Trade War
What Would You Sacrifice For A Debt-Free Life?
Tariffs Are Causing A Slowdown In U.S. Manufacturing
|
cc/2020-05/en_middle_0087.json.gz/line1341277
|
__label__wiki
| 0.753854
| 0.753854
|
Home > History, Literature, Reviews > Always Thus in Vanity Fair: Thackeray’s Encyclopedic But Moral Satire
Always Thus in Vanity Fair: Thackeray’s Encyclopedic But Moral Satire
October 16, 2013 rosslangager Leave a comment Go to comments
I’m an avowed slavish admirer of Leo Tolstoy and his sprawling masterpiece of the Napoleonic Era, War and Peace. William Makepeace Thackeray’s Vanity Fair, a minor masterpiece in its own manner, examines roughly the same period but in a wildly divergent way. Tolstoy imparts the gravity of warfare, in particular the socially-draining totality of Russia’s scorched earth resistance against Napoleon and his Grand Armée, but also the epiphanous truth of peacetime life, the little hopes and kindness, microcosmic slights and tragedies, that make up what passes for human life in the early 19th Century, or in any time. But for Thackeray, it’s all a lark, an elaborate masque of assumed poses, consumed by petty jealousies and cruel disguised mockery and overt shunning. The virtuous and true are taken advantage of by the manipulative and unscrupulous, and the only decent defence against the essential predatory urges of the social animal is to satirize it mercilessly. Even the great battle of the age, Napoleon’s final defeat at Waterloo, is a mere offstage fling, another fashionable party from which, unfortunately, many attendees never came back again.
Thackeray skewers superficiality and social butterfly-ism with a silver blade in Vanity Fair, but does so with a very English sense of sniffy, incipient moral superiority. The novel was first published serially in 1847-48, before the reign of Queen Victoria had calcified into the prudish social straightjacket that the era bearing her name is synonymous with, when some remnant of Regency libertinism endured. Most of the novel does indeed take place before the death of George IV and the passage of the Reform Bill, in the waning twilight days of the magnificently fashionable post-Georgian aristocratic gentlemen and ladies of fashion. Its title references John Bunyan’s The Pilgrim’s Progress, a telling tip of the hat to a religous moral tract of a bygone Early Modern age; the fair in the town of Vanity represented the human attachment to earthly pleasures and the material world.
But for Thackeray, Vanity Fair is no allegory but a sort of mass asylum of popular upper-class consent. For all of the plot’s turns and reversals of fortune (literal and figurative), it is the pursuit, maintenance, and display of wealth, power, and privilege that motivates his characters. Faced with the absence or denial of these advantages, the appearance of them will suffice. The contentious focal point of this theme is always already Becky Sharp. Putatively Vanity Fair‘s heroine, Becky comes from ordinary, even low, stock (her father was a Bohemian painter, her mother a French stage performer; the horror!) but is well-educated and marries the rogueish military son of a faded noble family and employs her wit, tireless manipulative skill, and uncanny actor’s abilities to parlay her minimal opportunities (and finances) into a berth in fashionable London society. She captivates the men, outshines the women, intrigues with lords, and even meets the ruling monarch before it all comes crashing down into disgrace, ostracization, and Continental exile.
Contrasted to Becky’s cunning finagling is the kind-hearted suffering of Amelia Sedley, who marries her childhood sweetheart George Osbourne only to see him leave her behind for loose society living and an undeserved hero’s end on the field of Waterloo. With her family’s income wiped out by her father’s unwise investment schemes and her late husband’s forbidding father disinheriting her and her beloved son, she lives a life of near-poverty in a small suburban house, suffering her slights in naive devotion to the frivolous, departed George as well as the honest attentions of William Dobbin, George’s best friend who is hopelessly in love with her.
Things do turn out better for Amelia than they do for Becky, although both the sincere sweetness of the latter and the determined scheming of the latter come in for filleting from Thackeray’s narrator. Indeed, Vanity Fair most resembles Tolstoy in its author’s refusal to see his characters, however archetypal they may be, as one-dimensional. Unlike the Dickensian caricatures of Thackeray’s more famous contemporary, those that populate the novel are shown in good light and in harsher light, too. Thackeray can note laudable qualities (Becky’s role in reconciling Amelia and Dobbin, her gambling dullard husband Rawdon Crawley’s tender affection for their son) even while viciously satirizing their less praiseworthy features (Amelia’s brother Joseph is painted as an obese, vain poseur, and even the knightly Dobbin can be a bit of a stick-in-the-mud). Even a clownish figure of low-living like the elder Baronet Sir Pitt Crawley, a coarse penny-pincher whose fondness for the proletarian classes and for drink is viewed askance by the Vanity Fair snobs, is shown to be capable of fond regard and is allowed to be humbled and pitied before the end.
As satisfying as these generally rounded characterizations and sharp instances of satire are (there’s a wonderfully nasty knitting metaphor for Becky pretending to love her son to win society points when in fact she can’t stand him), Thackeray falls short of Tolstoy specifically but even a bit short of better English novelists by virtue of his proper judgemental Englishness. Tolstoy showed all facets not to judge his characters, but to make them seem more fully human; Thackeray sees it as a way to broaden his satirical reach. As mentioned, the nod to The Pilgrim’s Progress is revealing. Thackeray reserves some of his barbs for humourlessly religious milksops like Pitt Crawley the Younger and Lady Southdown (although he clearly thinks fake piety of the sort that Becky often resorts to is much worse), but he willingly upholds the fundamental Protestant moral code on which even the most free and fashionable English society is based.
All satires must necessarily have a firmly rooted basis in some ideological foundation alternate to the presumed social delusions which they have been designed to upend, naturally. And although Thackeray is at pains to give Becky the benefit of the doubt and does not have her repudiated or apologize for her actions, the whiff of moral judgement hangs about every sentence concerning her for the novel’s second half. Many more words could be exhausted on the subject of Becky Sharp’s personality and her choices in relation to the social mores of her time and place. Hers is a clever, resourceful strain of feminism that neither Thackeray’s other characters nor the author himself quite recognizes, and she is fairly pilloried for holding to it. For all of its encyclopedic satirical character and delightful bursts of wit, this arms-crossed moral undercurrent of snobbish disapproval (even if it did likely reflect and flatter the attitudes of its bourgeois readership) blocks Vanity Fair‘s path to first-rate Victorian-novel greatness.
Categories: History, Literature, Reviews
Film Review: Vanity Fair (2004) | rosslangager
Good Old-Fashioned Wholesome Fun With Search Engine Terms #12 | rosslangager
The Slow Start of the Edmonton Oilers and the Trials of Nail Yakupov Film Review: Guess Who’s Coming to Dinner
|
cc/2020-05/en_middle_0087.json.gz/line1341289
|
__label__cc
| 0.535949
| 0.464051
|
Sancta Nomina
Thoughts on Catholic baby naming
My book of Marian baby names!
About Sancta Nomina
Catholic Church On Naming
Baby name consultations
CatholicMom.com articles
Nameberry articles
Sancta Nomina Media
Sibling Project
Name spotlights
Nickname ideas
Resources, recommendations, reviews
Helpful naming tips and info
Gift ideas & marketplace
Name story: Leland, Elliot, Fulton, Selwyn
December 27, 2019 sanctanomina Personal stories, Real-life naming Name stories
Happy third day of Christmas!!
A reader emailed me recently to share her boys’ names — I love when you guys do that!! (Check out my Name Stories tag for more!) I know you’ll love reading about this beautiful family! Emily writes,
“I thought you would get a kick out of our name rules!
Our first we named Leland, we wanted something classic but not common. It was a name of a trustee at my husband’s school and an editor of a Bible we purchased.
Number 2 we named Elliot just because we liked it, a slight nod to T.S. Eliot. We thought it went well with Leland.
We found out number 3 was another boy, and I enjoy several Catholic blogs despite not being Catholic myself, and I fell in love with the name Fulton. What a perfect fit for our boys’ names!
I was wrapping the big brother presents prior to his birth and used dot stickers and noticed the first 2 had 6 letters . . . and so did Fulton! And they all had an L as the 3rd letter! Other things include being last names, sort of British, and generally pretentious 🙂
Boy #4 would arrive in 2018, so we had to find a name that would fit our “rules”! While reading a short story by L.M. Montgomery I came across the name Selwyn, and at first I thought it was too much, but then it really grew on me and now here we are with 4 boys who fit the rules!
… [H]ere are their full names. The first 3 middle names are family names, the 4th middle name we wanted a Bible name with a good meaning and of course flow.
Leland Daniel (God will judge the meadowlands)
Elliot David (God is the Lord, Beloved)
Fulton Ray (Either, Sunshine on the bird enclosure, Or, King of the fields of the village)
Selwyn Jude (Friend of the manor, Praise God)
One more story — when I looked up Selwyn on one baby name website, it said “you may also like: Leland”!!!“
I loved reading about these boys’ names! What a cool theme this family has going! And they’ve chosen really fun, unexpected names — “classic but not common” is a perfect description of them! I’ve never come across anyone in real life with the names Leland and Selwyn (though we love Monk and his boss is Leland Stottlemeyer) — it’s not often I’m surprised by names, and I’m always excited when it happens! Have any of you seen Leland or Selwyn in real life? I love Elliot and Fulton as their brothers, what a great set! Thank you to this mama for sharing these great names!
My book, Catholic Baby Names for Girls and Boys: Over 250 Ways to Honor Our Lady (Marian Press, 2018), is available to order from ShopMercy.org and Amazon — perfect for expectant parents, name enthusiasts, and lovers of Our Lady!
Christmas gift certificates can be redeemed starting today!
December 26, 2019 sanctanomina Housekeeping
Merry Christmas everyone!! I hope you all had a happy, holy day! And happy feast (today) of St. Stephen, the first martyr!
Just a reminder that those of you who purchased Christmas gift certificates with my Black Friday special can redeem them starting today!
Baby name consultation: First baby (girl) needs a classic, saintly, not-unusual name
December 23, 2019 December 23, 2019 sanctanomina Baby name consultant Catholic baby names, Nicknames, Reverse nicknaming, Royal names
Merry Christmas Eve’s Eve! (Or Christmas Adam, if that’s the way you roll. 😂) I hope your house is as full of joy and anticipation as mine is! A very happy and holy Christmas to you all! ❤ ❤ ❤
Today’s consultation is for a dad! Chris and his wife are expecting their first baby — a girl! He writes,
“[W]e’re having a really hard time coming up with girls names that we love. We like classic names, and would like a strong saint connection. So no Kateri or Perpetua or Felicity or anything like that (too unusual). Also, no place names, no objects, no common nouns. Ana, Alexandria, Catherine, Lynn, Jennifer, and Madeleine are out due to them being in use by cousins already. The nickname is just as important since that’s going to be what we hear every day!
We had a boys name that we love, Nicholas Anthony, but that will have to wait for a future child, God willing.
For a girl, we’re toying with Victoria Nicole, nickname would be Tori because neither one of us likes Vickie, but just can’t seem to pull the trigger and say that’s definitely the one.”
Expecting your first baby is such a wonderful, exciting time! From a name perspective, I always think it’s fun to work with first-time parents because they have a blank slate –they can choose any kind of name they want, without any worries about it “going with” older children’s names. That said, it can be daunting to have so many options in front of you, and I do encourage parents in this position to give some thought to their future children’s names so that they don’t make a decision with their first baby’s name, style-wise, that they might regret with later children. For example, if Galaxy is your very favorite name, but other names on your list are Kate, Jane, and Mark, Galaxy probably isn’t the best name to choose.
I only explain this in case it’s helpful to any of you, but Chris and his wife actually seem to have a great handle on this already! Nicholas Anthony and Victoria Nicole are well-matched style-wise, and they give me a good idea of what other kinds of names they might like.
Before discussing my additional ideas for them, I want to talk about Victoria Nicole for a minute. There are a bunch of Saints and Blesseds named Victoria, so they have a lot of options for a patron saint if they name their daughter Victoria, and it’s also a Marian name by virtue of the fact that one of Our Lady’s title is Our Lady of Victory. Chris said he and his wife are thinking of Tori for the nickname since neither of them likes Vickie, which makes me think that they might like to consider some of the other nicknames I’ve seen considered for Victoria: Vee, Via, Vicka, Cora, Tia, Ria, and Ree (like the Pioneer Woman! Though Ree for her is a nickname for Ann Marie). As for Nicole, while I quite like how it sounds with Victoria, I wonder if they want to have a daughter with the middle name Nicole and a son with the first name Nicholas? It doesn’t have to be a big deal and I know a lot of families who have done similar things, but I thought I should point it out, just in case they hadn’t realized that they’re basically the same name (Nicole being a feminine variant of Nicholas).
You all know that I start my consultations by looking up the names the parents like/are considering in the Baby Name Wizard as it lists, for each entry, boy and girl names that are similar in terms of style/feel/popularity. I then look for overlap among those results — a Venn diagram of names — to find names that the parents are most likely to like. It’s uncannily accurate most of the time! I also poke around in my own mind for ideas that feel like the parents’ style, and I’m a big fan of nicknames, so I liked that Chris said, “The nickname is just as important since that’s going to be what we hear every day” — you know I love coming up with nickname ideas!
Based on my research and my own ideas, these are names that seem like they would be a good fit for Chris and his wife:
(1) Elizabeth, Isabella
Chris said they like classic names with a strong saint connection, and since Victoria also has such a strong royal vibe, I thought Elizabeth was a great suggestion, as it’s similarly classic, saintly, and royal. It’s a great name on its own, but one of the best things about Elizabeth is that it has so many nickname options! Liz/Lizzy, Beth, Betsy, Eliza, Ellie, Elsie, Libby, Libbet, Lily, and a whole bunch more all have traditional usage as nicknames for Elizabeth. Another Elizabeth variant that I thought Chris and his wife might like is Isabella. It’s currently popular, but it’s got a long history of usage, including several queens. Izzy, Isa, and Bella are sweet nicknames for it. Both Elizabeth and Isabella can have Our Lady’s cousin Elizabeth as patron, or any of a whole bunch of holy Elizabeths/Isabellas.
(2) Margaret
Like Victoria and Elizabeth (and Catherine, which is on their no list), Margaret is a classic, saintly, royal name. There are quite a few holy Margarets, and there are quite a few traditional Margaret nicknames, including Maggie, Meg, Maisie, Peg/Peggy, Rita, and Daisy. I’ve also seen Molly used as a nickname for Margaret, though they’re technically not linguistically related (Molly is a variant of Mary). That said, Margaret nicknamed Molly is a great way to have a Marian connection without naming your daughter a Mary variant.
(3) Natalie, Natalia
Elizabeth, Isabella, and Margaret were my gut-reaction ideas before doing any research for Chris and his wife, but the rest of my ideas here are all based on the results I got from the BNW. Natalie is listed as a style match for Nicholas, Anthony, and Nicole! It’s a beautiful, traditional name that literally refers to Christmas (it comes from the Latin natale domini, which means “birth of the Lord”), but of course it’s suitable for a baby girl born any time of year! Nat and Natty are sweet nicknames, and if they wanted to get a little creative, I could see Nolly working too. Natalie’s a variant of Natalia, which is also a lovely option, and opens up the nicknames Talia and Lia. Natalia is where a patron saint would come: there are two Saints and two Blesseds named Natalia.
(4) Caroline
Caroline is a style match for both Nicholas and Victoria per the BNW. I love the name Caroline — it’s so classy and elegant, and has some pretty great patron saints. It has a lot of nickname options too, like Callie, Carrie, Caro, and Carly. Carly’s actually a style match for Tori!
(5) Veronica
I often think of Victoria and Veronica as being similar, since they’re both long, feminine names starting with V and ending with A. But they have very different feels to me — Victoria has that royal English feel I mentioned before, while Veronica has a biblical feel (though she’s never named in the bible). I think many parents would think daughters Victoria and Veronica in the same family are too much, so if Chris and his wife like Veronica I could see them thinking Victoria is off their list — which will be a good litmus test for them. If it makes him and his wife really unhappy to cross Victoria off their list, then they should definitely forget Veronica! But if they like it, some nicknames include Nic/Nica/Nicky (like Nicole and Nicholas, so maybe not?), Ronnie, Vera, Evie, Nona, Ricki, and there are some that are shared with Victoria, like Vee, Via, and Vicka. Maybe even Nora? I spotlighted Veronica here.
(6) Julia
Julia is a match for Victoria and is biblical like Nicholas, and has that same classiness and loveliness that all of these names have, in my opinion. Julie and Jules are the nicknames for Julia that most people are familiar with I think, but Juliet is actually a diminutive of Julia and used to be used as a nickname for Julia so they could do that if they wanted. Other nickname possibilities for Julia include Lia, Lula/Lulu, and Jilly. I spotlighted Juliet here, which included a conversation about Julia patron saints.
(7) Rebecca
I’m not convinced that they’ll love Rebecca, but it’s a style match for Nicholas, and I liked that it’s classic and lovely in a different way than Victoria, Elizabeth, Isabella, Margaret, Natalie, Caroline, Veronica, and Julia, even though two of those are biblical like Rebecca. I think it’s because it’s such an Old Testament name — its echoes of the ancient past are inspiring and royal in their own way. Of course Becky is a very modern nickname, which, it occurs to me, might strike Chris and his wife as overly similar to Vickie, which they don’t like. I saw a birth announcement once for a baby Rebecca whose parents were calling Ruby as a nickname — I loved that! Because of that story, I was inspired to do a spotlight of Ruby (here). Other Rebecca nicknames include Becca, Bex, and Reba, and there are two saints to choose from as patron.
(8) Tessa
I feel like I have a good sense of Chris and his wife’s taste in given names based on Nicholas, Anthony, Victoria, and Nicole, but I don’t feel like I have a great sense of their taste in nicknames. That they prefer Tori to Vickie says to me they like more modern nicknames, but I don’t know if they like (or at least don’t mind) creative nicknames (like some of the ones I mentioned above, that aren’t traditional for the given name) or if they prefer to stick with a formal name’s established nicknames and find creative nicknames to be irritating. But Tessa is a style match for Tori, per the BNW, and I immediately thought they might like it. It can work on its own as a given name, but as such I don’t think it has the “classic names” cachet Chris said he and his wife prefer. It originated as a diminutive of Teresa/Theresa/Therese, and I think it could also work as a nickname for Thomasina, so any of those can work as a given name, but I’m not convinced they’d like them (though Theresa is a style match for Anthony). So if they like Tessa, maybe they wouldn’t mind getting creative? I once saw Tess listed as a nickname for Elizabeth — Tess has a slightly different feel than Tessa, but this at least is one idea; the spellings Elisabeth and Elisabetta make the connection even stronger. Another way I like to come up with nicknames is by combining elements of the first and middle names — so maybe a first name with a strong T sound and a middle name with a strong S sound that ends in A? Like … Tara Susanna, Trinity Vanessa, Tegan Jessica, and Talia Marissa (or Natalia Marissa, because of how the T is stressed in Natalia …. OR, for that matter, Victoria! I could see something like Victoria Jessamine taking the nickname Tessa quite well!). (I know those combos aren’t Chris and his wife’s style, I’m just using them as examples.) (Don’t worry if you think I’m crazy! My poor husband has been tormented by my outside-the-box thinking through each of my pregnancies. 😂 😂 😂 I just like to make sure parents have lots of options.)
And those are my ideas for Chris and his wife’s baby girl! What do you all think? What name(s) would you suggest for parents whose list consists of Nicholas Anthony and Victoria Nicole?
My book, Catholic Baby Names for Girls and Boys: Over 250 Ways to Honor Our Lady (Marian Press, 2018), is available to order from ShopMercy.org and Amazon — a perfect🎄Christmas gift🎄 for expectant parents, name enthusiasts, and lovers of Our Lady!
Birth announcement: Lincoln David!
December 20, 2019 sanctanomina Birth announcement Advent names, Catholic baby names, Christmas names, Powerful patrons, Presidential names
I posted an emergency consultation last night for Meredith from Daily Divine Mercy and Catholic Sticker Club — her baby was on his way and they weren’t sure about his name! She has let me know that he’s arrived and been given the so-handsome combo … Lincoln David!
If you remember, Lincoln David had been their chosen name until Meredith’s hubby started having second thoughts, which is when she reached out to me. She writes,
“You might think I’m crazy for what I’m about to say, but I wanted to see what he looked like before we committed to Lincoln … [The names from the consultation hit] on ALL of my favs, [hubby] is just really picky. Ultimately I’m just grateful we agreed. I’d be sad if we didn’t have any more boys and I missed out on Lincoln.”
Isn’t that perfect?? I told her that being sad at the idea of never being able to use Lincoln is a perfect litmus test for whether a particular name is the right one or not. And coming to an agreement with her husband is so great! I know I always feel like that’s the pinnacle of naming for me — I love when my husband and I finally agree on a name.
Another fun bit about this name is that Meredith really wanted a Christmas connection with the middle name, and liked that David had that … and today is the “Key of David” O Antiphon — so her little guy was born on the Key of David Eve! So great! (I wrote more about O Antiphon names here.)
Thank you to those who left ideas for Meredith in her eleventh hour!
Congratulations to the happy parents and big sibs Jackson/Jack, Theodore/Teddy, Clara, and William/Will, and happy birthday Baby Lincoln!!
Lincoln David with his mama and two of his big sibs ❤
Baby name consultation: A Christmas-due-date baby is being born TODAY — help please!
December 19, 2019 December 19, 2019 sanctanomina Baby name consultant Biblical names, Catholic baby names, Christmas names, Presidential names
Meredith from Daily Divine Mercy and Catholic Sticker Club is having her baby TODAY — her fifth baby and fourth boy! She and her husband are still trying to nail down a name and would love to hear your ideas! This little guy joins big sibs:
Jackson Solomon (Jack)
Theodore James (Teddy)
Clara Faye
William Harrison (Will)
Just a stunning bunch of names, right?! Jackson Solomon, Theodore James, and William Harrison are so handsome and sophisticated, and Clara Faye is so lovely. Nice job!
Meredith writes,
“We thought we landed on a name but are second guessing now … Our top name at the moment is Lincoln David … This was almost 100% … But now hubby is second guessing. We disagree on a lot of names.“
The names on Meredith’s list include:
Lincoln (hubby’s on the fence about this one)
Her husband’s list includes:
Abraham (Meredith isn’t a fan)
And they both like:
John-David
Alright, so the first thing I tried to do was nail down what Meredith and her husband’s taste in names is, as evidenced by their other children’s names and those they like/are considering: I get a really strong Presidential vibe with Jackson, Theodore/Teddy, William, Harrison, Lincoln, and Abraham; a strong Old Testament vibe with Solomon, David, and Abraham; and a sort of colonial feel (I’m not sure that’s the right word … English? Pilgrim? There’s certainly some overlap there) from Theodore, Teddy, William, Clara, Faye, David, Joseph, George, and Abraham. I love all those styles, and I’m so impressed how they put them together in such great combinations!
I’m really taken with Lincoln David — I think it goes perfectly with their other boys’ names and their daughter’s as well. If they end up going with it, I’ll be thrilled! But if one or both of them are legitimately cooling on it, then I’m hoping some of my ideas here (and yours!) might be helpful.
Before listing my new ideas for this baby, I thought I’d offer some thoughts on the names currently on Meredith’s and her hubby’s lists, in case they’re helpful:
Lawrence: I think maybe I’d consider Lawrence to be the outlier here. It doesn’t have an English feel and it’s not biblical or presidential, though it’s certainly handsome. I don’t love the nickname Larry with their other kids, but I’ve seen Lance used, which I think is a better fit with their others (though it still has a mismatched feel to me).
David: A handsome, classic, biblical name that fits in well with the names they’ve already used. It’s also Marian, via Our Lady’s title Tower of David — and Christmas-y too!
Joseph: I love Joseph!
Gabriel: Since hubby doesn’t care for Gabriel, I would recommend crossing it off the first-name list (maybe he’d be okay with it as a middle?).
Abraham: Similarly, since Meredith doesn’t care for Abraham, I would recommend crossing it off the first-name list (maybe she’d be okay with it as a middle?).
John-David: In general, I’m a big fan of double names for boys, as I love that they generally take two names that on their own aren’t unusual and give them an unexpected sparkle. However, in this case I’m not sure John-David is a good idea for this family, since Jack (and, by extension, Jackson) is a variant of John.
George: George is a great name! However, if I’m being nitpicky, I really like how their other boys have long names that trim down to friendly nicknames, which isn’t as easy with George. That said, Georgie is adorable, and I’ve always loved Geordie (said like Jordy) as well — it has traditional usage as a George nickname. I’ve seen Geo too, which is really cool.
Okay, now for my new ideas! You all know that I always start a consultation by looking up the names the parents have used and those they like/are considering in the Baby Name Wizard, as it offers, for each entry, boy and girl names that are similar in terms of style/feel/popularity. Based on that research and my own namey mind, these are my ideas:
(1) Charles
Meredith didn’t mention whether or not they’re okay with repeating initials, so maybe they’d rather not have Clara and Charles, but otherwise Charles is a match for Clara, William, and George, and Charlie’s a match for Jack — a great fit for this family! Cal is another possibility as a nickname for Charles that I quite like with Jack, Teddy, and Will (though is Cal too similar to Clara?).
(2) Henry
Clara, William, and George are also style matches for Henry! I can see Henry fitting in really well with their boys (and Clara too), and I also like Hank, if they wanted to nickname Henry. One tiny hesitation that I feel I must mention, though, is that Will’s middle name, Harrison, means “Harry’s son,” and Harry is a variant of Henry.
(3) Francis
Francis is a match for Lawrence and Frank for George — I feel like Francis definitely has that gentlemanly feel of the other boys’ names, and Frankie’s an adorable nickname for a little guy! I also love Finn as a nickname for Francis.
(4) Oliver
Despite the fact that Oliver only showed up in my research as a match for Theodore, I’m loving it for this family! Jackson, Theodore, William, and Oliver are amazing together, and Jack, Teddy, Will, and Ollie are great as well.
(5) Bennett (or Benedict?) or Benjamin
I don’t normally include middle names in my research, but I thought Harrison really felt like their style, so I looked it up to see what names the BNW would list as similar and Bennett is one — Bennett is a variant of Benedict, so I like that saintly connection, and Bennett also has usage as a surname, which fits in with their Jackson/Harrison/Lincoln names. But maybe they’d like the full Benedict? I love that as well, and Benedict Cumberbatch has certainly given it a British sheen, which fits in nicely with the other kids’ names. Ben is a great match for Jack, Teddy, and Will as well. If they prefer Benjamin, though, I won’t be disappointed! Benjamin is such a great name, and it’s Old Testament like Solomon, David, Joseph, and Abraham.
(6) Jude
There are a bunch of super-Old Testament names that match the super-Old Testament names Meredith and her hubby have used (Solomon) and that her hubby likes (Abraham) like Ezekiel, Ezra, Judah, and Moses. While those names can fit in with a Pilgrim-type feel and I wouldn’t hate them as first names for their son, I sense that Meredith would rather put names like that in the middle. But Judah made me think that Jude might be a possibility for them for a first name. Like with Benedict Cumberbatch, Jude Law and the Beatles have given Jude a Brit feel, and it’s certainly got a nice saintly connection.
(7) Gideon
Finally, Gideon’s a match for a name Meredith loves that her hubby doesn’t (Gabriel) and a name her hubby likes that she doesn’t (Abraham), which might make it the perfect bridge name between their two styles. It’s biblical, of course, and to me it also has a strong historical/colonial-type feel, as there’s a historic figure local to my area named Gideon Putnam who was born in 1763 and died in 1812. I’ve always loved the name, so I was excited to see it match up with this family’s style!
Those are my ideas for first names for this baby, and there were a couple names that I thought wouldn’t do as first names, but that they might like to consider for the middle spot: Frederick (Fred/Freddy wouldn’t do well as a brother to Teddy) and Emmanuel (perfect for a Christmas baby! And similar to Solomon and Abraham in style). I don’t know how they choose middle names (maybe they reserve that spot for family names?), but if they just choose names they like, then I thought I might offer some first+middle combos, in case they’re helpful. These are just combos that I thought went well together (using both names I suggested and names they’re already considering):
Charles Ezra
Charles Emmanuel
Charles Gabriel
Henry Abraham
Henry Emmanuel
Francis Judah
Francis Jude
Francis Lincoln
Oliver Francis
Oliver Lawrence
Benedict Moses
Bennett Moses
Benjamin Oliver
Benjamin Lawrence
Jude Frederick
Jude Emmanuel
Gideon Joseph
Gideon Lawrence
I’ve also done a bunch of posts/articles on Advent and Christmas names that might offer some helpful inspiration — they’re all listed in this post.
And those are all my thoughts/ideas/suggestions for Meredith’s baby boy! What do you all think? What name(s) would you suggest for Jackson/Jack, Theodore/Teddy, Clara, and William/Will’s baby brother?
Birth announcement: Penny Annalise Mariae!
December 18, 2019 sanctanomina Birth announcement Catholic baby names, Marian baby names, Marian names, Powerful patrons
Theresa (who wrote an amazing review of my book for Epic Pew!) shared her older kids’ names with me a couple of years ago, and I loved them so much I did a Name Story post about them! We’ve actually had many fun conversations about names — including for the baby she recently gave birth to! I’m excited to share that Theresa and her hubby welcomed a baby girl, to whom they gave the swoony name … Penny Annalise Mariae!
Theresa writes,
“On November 13, our little girl, Penny Annalise Mariae, was born. I know we had talked about her name here and there throughout my pregnancy (and you were so generous in offering some ideas for a boy name when we could not settle!) and I’ve previously shared her big sister’s and brother’s name stories with you, so I wanted to share her name story with you! It’s a long one, so I’ll take it name by name.
Penny– When we began, we liked the name Penelope with the nickname Penny. We actually had a completely different set of middles to go with Penelope, Penelope Chiara Lucy, which altogether means “weaver of illustrious light”. I had wanted Mary Stella Maris to be our next daughter’s patroness anyway, so this was a lovely coincidence! Then I was curious to see if there are any saint Penelopes. There aren’t, but there is a St. Irene of Thessalonica whose birth name was Penelope. This is where even more coincidences start coming into play. One of my middle names is Irene for my Italian grandma and, though I’m sure if she was named for a saint it would be St. Irene of Rome, I thought this was an incredible connection for the three of us. (Similarly, I had heard my daughter Ruby’s name on a TV show and fell in love with it; there is a story that my great-grandma heard Irene on a radio program and fell in love with it. I really like that both of my girls have these cool connections to my Gram, with whom I was close).
Ok, so, Penelope nicknamed Penny. The day before we found out gender, we were talking about boy names and realized that we both thought the girl name should just be Penny. We really only like nicknames if we’re going to use the given name and the nickname fairly equally and we knew that we’d be calling this baby Penny 90% of the time. So we switched Penelope to Penny and came up with her two middles (more on that in a bit!). More coincidences presented themselves.
Way back when I was 16, a friend gave me a little penny bank (they were one of those $1 add ons from Claire’s) that had this poem on it: “Place a penny in the slot, close your eyes and wish a lot. Your Prince Charming you’ll receive, if in your heart, you believe.” I started collecting pennies and saving them from that moment on, but instead of just making a wish on them, I’d say a prayer for my future husband and for my own vocation discernment before placing each penny in the bank. Ten years later, my husband and I married and I gave him all of the pennies I had been praying on and saving. We were able to go out to a nice dinner on all the pennies I saved! And that has proved a sort of foundation of prayer and devotion for our marriage. Since pennies played a big role in the young life of our marriage, it was nice to be able to reflect that in our daughter’s name.
But there’s more! My mom’s favorite band was The Beatles who has the song “Penny Lane”. My favorite band is Hanson who has the song “Penny & Me”. My mom has been gone for almost 12 years now and so this shared connection is really special to me. (I also realize that Taylor and Natalie Hanson, fantastic namers that they are, have a daughter Penelope who goes by Penny. Just a coincidence! I didn’t remember until after we had chosen the name.) Also, my best friend Jackie and I became best friends in 7th grade because of a mutual love of Hanson, so I feel like Penny is a nice nod to our friendship, also. Penny is also two syllables like my other kids’ names and ends in the “ee” sound like her sister.
Annalise– There are lots of Ann(e)/as and Elizabeths on my and my husband’s family trees (including me, my sister, my mom, both of my grandmas, my aunt/godmother, another aunt, and one of my great-grandmas), so this is a nice little nod to family. My second middle name is Anne and my daughter Ruby’s is Anastasia, so I also like that we’re keeping An- names going (my mom’s and her mom’s middle names are also Anne). We had considered Annalise for a first name and then revisited it when we changed Penelope to Penny and it fit! It’s also a nod to my maid of honor, Anna, who is now a religious sister, and to another good friend of mine Anna Elizabeth. The “L” in there as a form of Elizabeth was actually really important to me, too. My grandma Irene didn’t have a middle name. When she was confirmed, she took St. Elizabeth and decided to make it her middle name; however, she wanted to be different from “all the other Elizabeths” and so spelled it Lizbeth. She was a firecracker! The L was also important to me because I have other special people in my life whose names begin with L- both of my sisters-in-law have middle names beginning with L, my MOH’s religious name is Sr. Luisa Grace, my grandma Irene’s dad was Louis, my aunt Linda, I had an “aunt” Louise, and some others. I also really like that I basically get a two-for-one name with Annalise! Gotta get as many names in as possible!
Mariae– Last but not least (but a little more succinct)! We wanted a form of Mary in her name, just like big sis has Mae. Originally, we were going to go with Marie for my mother-in-law’s middle name, but it just didn’t feel right to me. I remembered Mariae is the Latin form of Mary (and I think I read it on your blog somewhere once?) and I really liked that and finally convinced my husband it wasn’t too weird lol! It has a little more pizzazz than Marie and then gives everyone their own form of Mary. AND it rhymes with Mae and also my maiden name Bey. Turns out there are a lot of people in our families with Marian names- big sis (Mae), one of my sisters-in-law (Maria), my mother-in-law (Marie), and two of my great-grandmothers (Mary and Marie), and also some cousins!
So, this name not only fits this individual child while keeping her unique and her own person, but it gives so many wonderful nods and connections to people and saints that we love. Between her name and her sister’s name, I think we’ve covered 90% of the females in our life in some way! This is important to me as I like names for our children with lots of meaning but that also give the child a unique identity.”
I mean. Aren’t these amazing names with so many amazing layers of meaning?? I love the saving-pennies-praying-for-future-husband/vocation story so much, how incredible is that anyway, never mind naming their daughter Penny! The connections with so many of the beloved women in Theresa’s family and life and of course Our Lady are tremendous, I was blown away by each detail as I read this from Theresa. And I’m so charmed by siblings Ruby, Peter, and Penny — what a great trio!
Congratulations to Theresa and her husband and big siblings, and happy birthday Baby Penny!!
Penny Annalise Mariae with her big sister and brother ❤
Birth announcement: Maria Therese (nn Maite)!
Mandi from A Blog About Miscarriage has been a cheerleader for Sancta Nomina from the beginning, and I have turned to her and her blog again and again for help with ministering to moms who have miscarried, including helping to name the babies. Since her own many losses were the catalyst for her blog and ministry, I’m extra happy every time I can share her baby news! I had the great privilege of doing a consultation for her second living baby (and birth announcement) as well as one for her third living baby (and birth announcement), and now I’m excited to share that she’s had her fourth — a baby girl given the so-beautiful name … Maria Therese nicknamed Maite!
Mandi writes,
“Maria Therese was born on November 26 in the midst of a snowstorm that left 19.8” of snow! She is named after the Mother of God and David’s two grandmothers, who were both named Mary, and St. Therese of Lisieux. I call her Maite (pronounced my-tay), a traditional Spanish nickname for girls named Maria Teresa. Her biggest sister and my parents have been calling her Mimi and big brother calls her “fluffy”.
Her name was really easy to choose and we knew we would name our next girl (if we were so blessed) Maria Therese long before we were even pregnant with her. Maria continues our trend of girls names that end in “ia” and it was about time to name a little lady after Our Lady. We started saying a daily rosary as a family earlier this year and both my husband and I have strong devotions to the Blessed Mother (David to Our Lady of Fatima and I to Our Lady of Guadalupe). We chose her name day to be January 1st, the solemnity of Mary, Mother of God, which is a Holy Day of Obligation and our oldest’s baptism day. I love that Therese has a connection to my middle name and my oldest’s middle name, Rose, since St Therese of Lisieux is the “Little Flower” and often associated with roses.
Interestingly, we didn’t find out the sex before birth and our chosen boy’s name was Joseph. I always felt a bit silly when asked about names saying the baby was either Joseph or Maria- the two most quintessential Catholic names! We often got little chuckles when we told people. It just lined up that way this time, Joseph has been our planned boys name for our last two pregnancies (and if we have another baby will be the boy’s name again, we always carry name choices forward to the next baby).”
What an awesome name story!! You know I’m crazy for Marian names, and Maite has long been a favorite of mine (I love Mimi too, but Fluffy is definitely a contender for my favorite here! 😂). I love that they chose a name day for Maite as well! This is just perfection, all around!
Congratulations to Mandi and her husband and big sibs Lucia, David (Davey), and Cecilia (Cici), and happy birthday Baby Maria Therese!!
Maria Therese “Maite” with her big siblings ❤
Sancta Nomina is dedicated to the Blessed Virgin Mary, mother of Jesus. May she and her mama St. Anne, who is patroness of this blog, pray for us.
Sancta Nomina Social Media
View sanctanomina’s profile on Facebook
View sanctanomina’s profile on Twitter
View sanctanomina’s profile on Instagram
View sanctanomina’s profile on Pinterest
Follow Sancta Nomina via Email
Find me at CatholicMom.com and Nameberry as well, writing about -- you guessed it!
If you're looking for Marian baby names, you've come to right place! Order your copy of my book Catholic Baby Names for Boys and Girls: 250 Ways to Honor Our Lady from Shop Mercy!
I contributed a chapter to The Catholic Hipster Handbook! Order your copy here.
I'm about two days behind on everything this week because of this little sickie and the cold he gave me too. We're looking forward to a quiet weekend! I hope you all have a good one! #TGIF
(PSA: These are delicious.) I didn't get yesterday's #babynameconsultation posted until late last night, but it's one you don't want to miss! A little sister for two big sisters is on the way, and the parents want to emphasize strength and holiness in their girls' #names. I love that! I offered a few ideas, and would love to hear yours as well! {link in bio} #catholic #babynames #catholicnames #catholicbabynames #mondaymotivation
Hubby dropped me off at the grocery store while he went to get donuts after Mass, and while sitting outside the store waiting for him to come back I spotted the blue sky through the clouds (it had been downpouring only a few minutes earlier) -- I love when the sky looks like that! So much so that when my oldest was tiny, he made up a word to descibe this kind of sky, with the gray and blue sharing space: asfo. Don't ask me why, but we still call it an asfo sky! A minute later, there was a rainbow! 🌈 Can you see it? Then the rest of the sky just got gorgeous. Funny the gifts you're given when you're sitting on the grocery store bench. ☺ Have a beautiful Sunday!! 💖💖💖☕ ☕ ☕ 🍩 🍩 🍩
You might have seen @studio_senn 's beautiful new baby in her feed -- if you're like me and were maybe obsessively checking to see if she'd shared the #name yet, look no further! I have all the details in the #birthannouncement I posted on the blog today! (You can also see it in Kortnee's stories!) You'll love it!! 😍😍😍 It was inspired by the #saint in the photo, but isn't the same, so be sure to check it out! {link in bio} #catholic #names #catholicnames #babynames #catholicbabynames #sanctanomina #holynames #powerfulpatrons ((image: Saint Peregrine, Patron Saint of Cancer Grotto (Sorrowful Mother Shrine) by Nheyob on Wikimedia Commons))
sanctanomina@gmail.com
"Choose your names in a joyful way. / Think of the Saints and holy things, / And then just watch how your heart sings / When the name meant for you to choose / Comes to your mind, as you do muse!" ~ name wisdom from my Mom, an Irish poet
Sancta Nomina recent posts
Baby name consultation: Third baby girl needs a name for a bold, saintly woman
Birth announcement: Perrin Fae!
Baby name consultation: Baby no. 11 needs a heavy-hitting middle name! Also: are sisters Heléna and Eleanor problematic?
Happy Feast of the Holy Name of Jesus! (And redemption of Black Friday Special No. 3)
[Not Fun] Friday Question: How to approach naming in a foster-to-adopt situation?
Year in review: 2019 (scrabbling back)
Baby name consultation: Baby girl needs strong name that can be shortened to something fun
Baby name consultant (238)
Baby on the way (10)
Birth announcement (266)
CatholicMom.com writer (46)
Famous Catholics (6)
Fun Friday Question (7)
Holy Name of Jesus (7)
Including Mary (22)
Men Who Love Mary (15)
My book: Marian baby names (8)
Name announcement (9)
Nameberry writer (12)
NamePrints (1)
Namespotting (22)
Naming nitty gritty (153)
Naming resources (36)
Nicknames (29)
On my bookshelf (17)
Personal stories (66)
Powerful patrons (3)
Prayer Intentions (10)
Reading Round-up (18)
Real-life naming (29)
Resources and recommendations (20)
Sancta Nomina community (80)
Sancta Nomina Media (11)
Sibling Project (6)
abc family (Arwen) A Blog About Miscarriage Adoption Androgynous(ish) names Angelic names Appellation Mountain Awesome initials Baby name consultant Baby Name Wizard Biblical names Birth announcement Boy-turned-girl names British names Campos-Duffy Camp Patton Catholic Catholic All Year Catholic baby names Catholic Baby Names for Girls and Boys: Over 250 Ways to Honor Our Lady Catholicism in culture CatholicMom.com Catholic surnames Christmas names Confirmation names Dominicans Flower names French names German names Giveaway Green bean Happy Nest Home Goods Holy Name of Jesus Honor names House Unseen Irish names Italian names Jesus names JPII Just for fun Literary names Mama Needs Coffee Marian baby names Marian names Mary Men Who Love Mary Middle names Miscarriage My Child I Love You Nameberry Name stories Name writing Naming twins Nature names Nicknames Papal names Personal stories Pope Francis Powerful patrons Prayer Intentions Proper pronunciation Proper spelling Religious name change Rosary names Royal names Scandinavian names Scottish names Simcha Fisher Spanish names SSA data St. Anne Surnames Swistle Time Flies When You're Having Babies Virtue names Zelie & Co.
My favorite name sites
Appellation Mountain
Baby Names of Ireland
Dictionary of Medieval Names from European Sources (DMNES)
Name Candy
Nameberry
Nymbler
Social Security Administration (SSA)
Swistle
Sancta Nomina is a participant in the Amazon Services LLC Associates Program, an affiliate advertising program designed to provide a means for sites to earn advertising fees by advertising and linking to amazon.com. Start shopping!
Read my reviews of each book here.
|
cc/2020-05/en_middle_0087.json.gz/line1341292
|
__label__cc
| 0.576166
| 0.423834
|
EU: Suffering of calves on 1700km road journey to Israel.
Posted on September 11, 2019 by Serbian Animals Voice (SAV)
Suffering of calves on 1700km road journey to Israel
Calves being transported from Lithuania to Israel have been found in extremely overcrowded conditions on the trucks, lying in a thick layer of manure and suffering from heat and extreme thirst.
These conditions – suffered on a journey of two weeks for a distance of 1700km – caused the death of some animals, but also made others so exhausted that they had to be dragged by their legs from the trucks.
The investigation by Animal Welfare Foundation (AWF) and Israel Against Live Shipments (IALS) trailed the calves along their journey and called Road Traffic Inspection in Poland when they spotted evidence of suffering on the trucks. Official veterinarians were called and found multiple violations of Regulation (EC) No. 1/2005, which states that animals shall not be transported in a way likely to cause injury or undue suffering.
“This was the most tragic sight I have seen in all my years working as an investigator in animal transportation,” says Maria Boada-Saña, investigator and project manager of AWF. “It is incomprehensible how official veterinarians in Lithuania approved these transports.”
Polish officials immediately decided to unload the suffering animals and started administrative proceedings against the Polish transport company Konrad. However, after a 24-hour-long rest at a stable, the animals were carried in three trucks instead of two to Slovenia, where investigators from IALS found terribly weak and exhausted calves upon arrival at Koper.
From here, the transport continued by sea, and the animals were loaded onto the livestock vessel Holstein Express, destination Israel. The calves spend four days at sea without any authority to assess their welfare, or ensure they are treated in compliance with EU legislation.
“Our experience shows that sick animals are usually left untreated, and their dead bodies are regularly dumped into the Mediterranean Sea,” says Yaron Lapidot, spokesperson of IALS. “Investigators have repeatedly found European cattle and calves washing up dead on the beaches of Israel, having been thrown overboard from livestock vessels.”
After arrival in Haifa, the journey of these animals is not over yet. The calves are loaded onto small trucks in which the temperature can exceed 37°C and carried on to quarantine stables where they are kept for a month before being sent to fattening farms.
“By removing the live import tax in 2014, the Israeli government sealed the fate of hundreds of thousands of animals going through hell on the journey to Israel. Ever since then, promises by our agriculture minister to reduce the numbers have not materialized and essentially the public continues to subsidise the imports,” says Yaron Lapidot. “This year we expect that Israel will import about 850k live animals, an increase of 400% since 2014.”
The two organisations have sent a film highlighting the suffering of these animals to EU Commissioner Andriukaitis, and are calling on the European Commission to stop the long-distance transport of live farm animals to Israel and other Third Countries.
“AWF and IALS are the latest of many organisations which are constantly revealing serious welfare problems in the long-distance transport of animals,” says Reineke Hameleers, director of Eurogroup for Animals. “The suffering of animals on such journeys is inevitable, and the European Union must stop this cruel and archaic practice.”
« After Amazonas ist like before Amazonas The California fur ban just passed its final vote in the full Senate – A Message from Cassie. »
eparslavicaepar, on September 11, 2019 at 5:26 pm said:
They are just very unhappy children….Mankind is the only evil on this planet.
|
cc/2020-05/en_middle_0087.json.gz/line1341298
|
__label__wiki
| 0.951956
| 0.951956
|
Chin Ka Lok fulfils Chan Sing's last wish with a retrospective
Heidi Hsia
From Cinema Online Exclusively for Yahoo Newsroom 17 December 2019
17 Dec – Chin Ka Lok recently revealed that the memorial service/retrospective held to commemorate martial arts actor Chan Sing was fully sponsored by the Hong Kong Stuntman Association (HKSA).
As reported on Mingpao, the actor, who is also the president of the said association, shared that he contacted Chan's wife through filmmaker Ng See Yuen upon finding out about the actor's death and learned that Chan had wanted to return to Hong Kong to meet up with his friends prior to his passing.
"So we decided to hold a retrospective to fulfil his last wish. Big Brother [Sammo Hung] was filming in Beijing, but returned to Hong Kong specifically for this service. Yasuaki Kurata also made a special trip from Japan. Everything turned out well," he said.
Chin revealed that he grew up watching Chan's movies, and then started his showbiz career starring in a Sammo Hung's movie - the same person who directed Chan in "The Iron-Fisted Monk".
"I consider that fate," he added.
On the other hand, Chan's widow expressed her gratitude that friends and family members attended the said service to commemorate her husband.
"His final wish was to build a memorial hall in Indonesia. There are five buildings in total, and the first one is already completed. It is mainly for charity purposes as we hope to help children read and learn Chinese," she said.
Chan Sing passed away in Jakarta, Indonesia at the age of 82.
(Photo Source: Mingpao)
#myfp
Hank Azaria announces he will no long voice Apu on The Simpsons amidst controversy
The Best Oscar Dresses of All Time
"Super Show 8" tickets to go on sale in Malaysia next week!
FFM 31 reintroduces four competition categories
|
cc/2020-05/en_middle_0087.json.gz/line1341300
|
__label__cc
| 0.674234
| 0.325766
|
SubTopic Backup and Disaster Recovery
Data backup technologies
Whether you're helping customers choose disk, tape or both, or looking to provide remote backup services, this tip describes key backup trends and technologies to get you started.
Stephen J. Bigelow, Senior Technology Editor
The data backup challenge before many of your customers is not getting corporate data onto disk or tape -- it's keeping that data safe as daily operations continue. Data loss can result in costly business interruptions, which not only puts a stopper on workflow but may lead to severe penalties in the face of government regulations and consumer expectations.
Help your customers take decisive steps to data backup and protect corporate data using disk, tape or remote data backup.
Tape backup trends and technologies
Tape is the quintessential data backup medium. Most tape technology is well established and inexpensive but it is also too slow to serve as a primary data storage platform. The appeal of "cheap, plentiful and slow" storage has made tape a traditional complement to disk storage systems.
Tape storage is a removable media technology, so tape cartridges can easily be exchanged with any compatible drive mechanism. The cartridges are designed for specific tape drive architectures and are not interchangeable. The "tape" is simply a length of flexible plastic ribbon coated with magnetic media and wrapped around a set of spindles. The spindles are mounted inside a plastic cartridge enclosure that protects the tape media from damage. Tape cartridges have a relatively short working life because the tape media actually contacts the tape drive's read/write heads. It is recommended that tapes should be replaced after about 2,000 passes.
A tape drive is the electromechanical device that reads and writes to the tape cartridge, and exchanges that data with the rest of the computer. Drives typically use either helical scan or linear tape head technology to access the tape. Helical scan drives use a rotating head positioned at an angle, reading and writing data as diagonal stripes along the tape's width. Linear tape simply positions a stationary head that runs along the tape length. There are numerous tape formats in service today that leverage these two approaches, including advanced intelligent tape (AIT), digital data storage (DDS), digital linear tape (DLT), Linear Open-Tape (LTO) and Travan. The choice of tape drive should include a consideration of capacity need, performance speed, media cost and technological longevity.
Even the latest tape back technology cannot offer enough capacity to backup an entire enterprise to a single tape. Rather than manually spanning backup jobs across multiple tape cartridges, tape drives are often organized into groups, dubbed tape libraries. Data backup software then utilizes the various drives and cartridges in the tape library to achieve a complete backup. In many cases, a robotic arm or autoloader is added to exchange tapes with each drive, allowing a tape library to manage a huge number of tapes.
Data backup software is a critical management tool that interfaces backup hardware (the tape drives and libraries) with corporate data servers, allowing administrators to decide when and where to backup selected files, folders, drives, servers or even entire data centers. Data backup software also supports automation so backups can be performed and verified during off hours without direct human intervention. EMC Legato and Symantec Veritas are two well-known backup tools.
Disk backup trends and technologies
While hard disks are certainly the primary storage medium for all types of computer systems, disks are increasingly being used for backup tasks. This is partly due to the falling costs of high-volume storage devices, such as SATA and SAS drives, but also because data backup needs are changing. Many organizations work in a global 24/7 marketplace and cannot afford to go offline for nightly tape backups. When trouble does strike, a busy organization must restore its operations in a matter of hours -- not days. Disks now offer the cost-effective speed and storage capacity to make disk-based backup effective for you and your customers.
The simplest type of disk-based backup is disk-to-disk, basically copying the contents of one disk to another. If the first disk fails, data can be retrieved from the other. This is sometimes called mirroring and is an essential tenant of RAID. In some cases, both disk and tape backup technologies are combined in a disk-to-disk-to-tape platform, dubbed D2D2T. Primary disk storage is first backed up to secondary disks -- lost data can be quickly restored from the backup disk. Tape is then added on as a form of long-term archival storage. A benefit of D2D2T is that tapes can be written from the secondary disk storage so the main storage system is not taken offline in the tape writing process. The resulting tapes can then be sent off site to protect the primary and secondary disk storage systems against disaster.
Some companies with established investments in tape libraries may have trouble justifying the shift to disk-based backup systems. One way to ease the transition anxiety from tape to disk is through a virtual tape library (VTL). A VTL is simply a disk storage system designed to emulate a tape library. By emulating a tape system, a VTL can utilize disk speed to accelerate backups and restorations while leveraging an organization's existing backup software, policies, infrastructure and in-house technical expertise. Select a VTL that will most closely match your current tape library system, capacity needs and backup software. For example, Advanced Digital Information Corp.'s Pathlight VX can offer up to 57.6 terabytes of capacity while emulating LTO-1 and LTO-2 drives.
Remote backup trends and technologies
One growing problem for today's enterprise is the proliferation of remote offices. Business data can be just as important on servers in the Boise, Idaho, sales office as in the Seattle headquarters. Remote offices typically do not staff IT personnel -- relying instead on non IT workers to rotate backup tapes and ship them to a data center -- or on you, the a VAR or systems integrator, to implement or host the appropriate technologies and services. Several trends are appearing to address this problem. A growing number of organizations are eliminating tapes in favor of WAN-based backups that transfer crucial information to the data center across broadband WAN connections. LiveVault Corp.'s InControl is one product intended for remote WAN backups. Rather than creating physical tape backups and rotate them to an off-site storage facility, WAN is also being employed to transfer data directly to an off-site archive service, such as Iron Mountain Inc.
Bandwidth is the main issue with any WAN-based backup scheme. Fast bandwidth is expensive, so the focus with WAN backups is to use techniques like data deduplication (a.k.a. commonality factoring) and compression to optimize the use of available bandwidth. Another popular technique is to avoid complete backups over WAN and just transfer the most important business files between locations.
Some organizations are eliminating the difficulties of remote IT by consolidating remote IT into a single data center, which may be another area you can offer your consulting services or product suites. Remote access uses WAN links with application accelerating technologies, like WAFS, to serve applications and files to remote offices just as if the data were local. WAFS generally involves appliances installed at both ends of the WAN link, which cache needed files to each remote office for quick access. Any changes to a file can then be saved back to the data center as time and bandwidth allow.
Remote backup technologies
Backups generally fall into three categories: full, incremental and differential. A full backup is a complete copy of all files. A full backup on a server with 528 GB of data will transfer all of that data to the backup target (e.g., disk or tape). Full backups take the longest to make, but they are easiest and fastest to restore. An incremental backup only tracks changes made since the last backup event. If you perform a full 200 GB backup on a server Monday, and 2 GB of new data are added on Tuesday, an incremental backup will only capture the new 2 GB. If another 1 GB changes on Wednesday, only the new 1 GB is captured. Once a full backup is performed, incremental backups can be very quick. However, you must restore a full backup first and then all of the incremental backups in succession since that last full backup. By comparison, a differential backup captures the total changes made since the last full backup. For example, if 3 GB changes on Monday, 2 GB on Tuesday and 7 GB on Wednesday, each day's differential backup will capture 3 GB, 5 GB and 12GB respectively. Differential backups can take longer to make than incremental backups, but are easier to restore. With a differential backup, only the full backup and last differential backup must be restored.
Mirroring and replication are essentially the same thing -- both create copies of data -- but there are subtle differences in context. Replication is basically an offline copy of the data that isn't necessarily intended for use but mirroring creates a data copy that can be used directly. For example, data is frequently replicated to CD or DVD for long-term archival storage but data may be mirrored to disk for RAID.
Snapshot and continuous data protection (CDP) technologies are also appearing in disk-based backup systems. Snapshots capture the state of a storage system at a given point in time, saving detailed reference information about available data and its location, similar to a detailed table of contents. When trouble strikes, data can be restored based on the latest snapshot. Snapshots can be taken as frequently as a storage administrator deems necessary. CDP provides even more granular detail, recording each storage transaction to a journal in real-time. If data loss occurs, the storage system can be "wound back" to the last good transaction, which could be minutes, even seconds.
Security is increasingly important for all backup operations. Company data often includes confidential or personally identifiable information that needs to be protected. When a tape is lost or a network is hacked, sensitive information may fall into the wrong hands. Backup systems are starting to use encryption when saving files to tape or archival storage. Encrypted data cannot be read without the corresponding keys, so encrypted data cannot be misused if it's stolen.
This tip originally appeared on SearchStorage.com.
Dig Deeper on Storage Backup and Disaster Recovery Services
Data archiving techniques: Choosing the best archive media
By: Pierre Dorion
Data backup and recovery briefs: NovaStor launches SaaS portal for online data backup
The pros and cons of tape media storage for backup and recovery in SMB environments
LTO-4 tape technology finally catching on -- tape storage isn't dead yet
Delivering datacentre performance and cost savings with Intel Optane technology –Intel
How data backup strategies are changing – SearchDataBackup
How to develop a VTL data retention strategy – SearchDataBackup
HP improves backup-to-disk features – SearchDataBackup
|
cc/2020-05/en_middle_0087.json.gz/line1341310
|
__label__cc
| 0.663926
| 0.336074
|
Anwar al-Awlaki was killed in an American drone strike in Yemen last year.
Civil rights groups sue U.S. for killing of Americans tied to al Qaeda
By Ted Metzger, with reporting from Joe Sutton
Two civil rights groups sued the CIA director, the defense secretary and two military commanders over two covert U.S. strikes that killed three Americans in Yemen last year.
The operations killed radical Muslim cleric Anwar al-Awlaki, his son Abdulrahman al-Awlaki and Samir Khan, editor of a Jihadist online publication.
The two groups - the American Civil Liberties Union and the Center for Constitutional Rights - filed the lawsuit on behalf of the parents of Anwar al-Awlaki and Samir Khan.
It claims the strikes that killed the three men violated their constitutional rights because the targeted attacks "rely on vague legal standards, a closed executive process and evidence never presented to the courts," according to the complaint filed in D.C. federal court this morning.
"It's about accountability," said Jameel Jaffer, the ACLU deputy director. "If the government is claiming the power, as it seems to be, to kill any American who is deemed to be a national security threat without judicial review of any kind, then we believe the government has an obligation to explain its actions."
But in the case of Anwar al-Awlaki, who was a major figure in al Qaeda in the Arabian Peninsula, the Justice Department said it is justified.
He was linked to the plot of the so-called "underwear bomber" Umar Farouk AbdulMutallab and alleged Fort Hood shooter Nidal Hasan, and the Justice Department says there is a legal framework in place that makes going to the courts unnecessary.
"It does not require judicial approval before the president may use force abroad against a senior operational leader of a foreign terrorist organization with which the United States is at war," Attorney General Eric Holder said in a March speech. “Even if that individual happens to be a U.S. citizen."
The legal argument is slightly different for Khan and al-Awlaki's son, both presumed to be collateral damage in the drone strikes.
Khan was killed in September alongside Anwar al-Awlaki, whose son, Abdulrahman al-Awlaki, died in a separate drone strike a few weeks later, also in Yemen.
It is unclear whom the U.S. was targeting in the attack and why al-Awlaki's son was near that location.
Jaffer hopes those questions will be answered in court.
Relatives say the terror suspect’s son was not affiliated with terrorism.
"I never thought that one day this boy, this nice boy, will be killed by his own government for no wrong he did certainly," his grandfather, Nasseral-Awlaki, said in a video statement provided to CNN by the ACLU.
The Khan family's attorney advised them not to make a statement, but family friend and former family spokesman Jibril Hough said the issue isn't personal, but constitutional. "What Samir thought, felt, etc. is not the issue. The issue is the Constitution and giving the government the power to kill anyone 'at will.' " Hough said he didn't agree with Khan, but, "He he had 'rights' as an American. If we don't have those rights, then we are not much better than the regime in Syria and other rogue places."
Holder said the U.S. takes the death of innocent bystanders into account.
"Under the principle of proportionality, the anticipated collateral damage must not be excessive in relation to the anticipated military advantage," Holder said in March.
The lawsuit against CIA Director David Petraeus, Defense Secretary Leon Panetta and two military officials seeks damages against the four government officials. It does not name a specific dollar amount, only saying "an amount to be determined at trial," according to the complaint.
"It's not about money," Jaffer said. "The main purpose of bringing the lawsuit is to obtain a kind of accountability that can only be obtained in a federal court."
This is the second lawsuit the ACLU has filed on behalf of Nasser al-Awlaki.
In 2010, it filed a suit in federal court trying to prevent the targeting killing of Anwar al-Awlaki after it was made public that he was on a U.S. government "kill list."
The court dismissed the case a few months later.
Filed under: AQAP • Terrorism • Yemen
SoCal Law Practice Help
Really reading your site ought to be very convenient with comments. Lots of people merely chuck down the "thank you" and also proceed. Not valuable. Arguing can be great, however i will not attention whether you don't agree unless you inform me precisely why and also backup your situation. Your view (or my very own) are pointless with out a few reasoned reasons and also (hopefully) details. SoCal Law Practice Help http://www.thetaxlawdirectory.com/tag/best/
Simply desire to say your arctile is as astonishing. The clarity in your post is simply cool and i could assume you're an expert on this subject. Fine with your permission let me to grab your feed to keep up to date with forthcoming post. Thanks a million and please carry on the rewarding work.
Dr Brian Neil Talarico and Dr David Kenneth Cochrane, have and continue to cause inreversible life threatening harm to Woman, Children, and the Vulnerable... These two Doctor's are paid by the governments to Kill people for Profit... Please Participate in any way you see fit to bring these two to justice. They both work at the North Bay, Ontario, Canada, Hospital, and Clinics,
Kayla, Supervisor of the Registered Nurse's
What will those "civil rights" groups do to defend the victims of Al Qaeda? NOTHING.
metsrule1
I'm sorry, is this a joke page or are people's common sense dying? Had this man been within our borders, not constantly surrounded by heavily armed men who would gladly shoot a Red Cross person trying to administer aid to a child, and not a constantly moving target, he would be arrested. But guess what!! He was!! He openly wanted "fellow" Americans dead. And we didn't kill him soon because...
gatornuts
The human condition is funny. Deer and rabbits get killed all the time but somehow people think that they are different. He got put down. A lot of people have been put down. It's not right or wrong, just the way it is. But I must say suing your executors seem like a joke.
M Houston
Sue away. Al Awlaki chose his own fate. And he got what he deserved.
Dan Slaby
A fundamental problem exists with western judicial system – that is a person can be apprehended for committing a crime but not before. This approach exists to provide protections of a person's civil rights, freedom of speech and religion, and the abuse of police power. At what point does planning to commit a crime sufficient cause to interdict and arrest the perpetuator, and how do we prevent the abuse of power for political purposes? Can there be a civil committment based on criminal intent? What would be the rules of evidence? The issue of the right-wing running helter-skelter with over 1000 armed militia hate groups and the intimidation by the NRA to prevent background checks on purchasing guns including those who are on the FBI terrorism watch list are part of the political problem. If persons are known to harbor intent to kill, then there needs to be some reasonable restrictions on the person requiring monitoring to prevent acting out intent. Modern democracies need to balance the need for security with the rights of people to live their lives with freedom.
the key word here is "reasonable", you know as well as I do, you give an inch and they will take a country mile. If we could all have "reasonable" that would be great.
Frank Loftice
A rose by any other name is still a rose, and a terrorist of any nationality is still a terrorist and should be delt with accordingly, utilizing any means at our disposal, be it drones, snipers, bombs or killer raids. The only good rerrorist is a dead one and having been a Marine sniper I am happy to report that I personally arranged the meeting of them and their maker to many of them.
you are right and I thank you for your service.
Sphincter
After Amy finishes fellating you, perhaps she can feltch my seed from your heroic rectum.
PaulBel
If you have a chance to take out an enemy combatant (And I don't just mean someone holding a gone – intelligence, propagandists and saboteurs are also fair game) you take them out. I don't think citizenship extends to someone who is working for the known enemies of our country. While it would be great to drag these soldiers (that's what they are since they are fighting for the overthrow of this country) into a courtroom, if they are on the battle field and get in the way of incoming, that was their choice when they hooked up with these terrorists. While the ACLU has done some very good work on behalf of the American people, this, in my opinion, is not their within their domain. An enemy combatant is fair game regardless of citizenship.
are you kidding me??? when they became a terrorist, they gave up any rights...that's why they are hiding in Yemen!!! ACLU – i think you need to butt out of this one and leave it alone. what about the 9/11 victims and the pentagon victims...who can we sue? Al qaeda??? omg – this makes me soooo mad!
Wanna sue someone for 9/11? Start with Washington.
I just want to know, is the ACLU going to support us when the UN and Obama admin tries to take away our 2nd amendment rights?? I would like to know where they stand on that. Will they sue the government saying our rights are being denied??
bpuharic
Oh brother...Obama taking away our 2nd amendment rights. I'm 57 and remember this 'treaty' being screamed about 40 years ago. You pathetic right wingers are sheep, and are easily stampeded by any manipulating politician. God you're DUMB
Hater Nation
6 months from now, no one will recall what happened here.
July 19, 2012 at 1:27 pm |
oh brother indeed. Have you not been reading or listening?? It has been reported that the UN and US government is in negotiations for an arms tready that would affect our 2nd admendment rights, why don't you read before you start calling people dumb and stupid??
Jeanne Posted on I think it is rather cute as is.But if you want to add a face I think the bttoom protuberance as Marge put it would work better as a tail. I would suggest using that as the backside and the opposite side (the one facing away from the camera in the second picture) as the face. Maybe you could embroider some closed eyes with eyelashes? or something like: (^ ^)I wouldn't add too much detail because the simplistic suggestive details are what make it cute. That and it is much more fun to guess at what it is than to be told outright. ;DThe more I look at it, the more I want one. Ha ha. Definitely post your etsy site when you get it running!
The ACLU is not saying they have to have a judge, jury and be present. They are just suing so attention is brought to what kind of procedure our government should go through before they can execute a citizen beyond reach. This is a good thing.
Nonsense. This is not an execution. It's war. There's a difference. Al Alwaki is NOT accused of illegal parking
I agree on this. A government shouldn't be allowed to execute an American without some legal process.
They didn't execute him. The killed him using rules of engagement during war.
YoungMarine
He's a terrorist he has no rights
One more time child think types (White Hat/Black Hat)
The ACLU has only one mission: They defend the bill of rights. They have NO political agenda and they do not care who it is that s being denied due process.
They will just as soon sue for the rights of Nazi Skinheads to parade their hatred down a public street just as fast as they will sue for the right of ALL Americans to have things like due process and freedom of religion – not just white, conservative christians.
They beleive that the law should apply equally to ANY American, even Muslims.
The ACLUS knows the difference betweeb Strength and Might – I wish everyone else would too...
Even defending a war criminal in a failed state beyond the reach of law? That's not defending the Bill of Rights, that's fanaticism. And it's wrong
Based on less evidence than they had for WMD?
What proof do you need? He made videos for a terrorist group. And, AGAIN, how do you issue an arrest warrant to a subject hiding in a failed state? Any reason you fanatics keep dodging the issue?
The last I checked, we were not at war. Only congress can declare war and that means that this is a criminal matter.
The only thing they are suing about is the lack of due process – and let's face it – murder is about as no due process as it gets.
They don't care about the partculars of any crime or behavior – they just hold to the letter of the law – something I used to think conservatives were all about – until it stopped serving their purpose.
Gee. What happened in Afghanistan? That was a war, wasn't it? And Congress voted for it. And Bush let Bin Laden go. We could have had him in November of 2001 but Bush said no.
Solex, The ACLU is constantly getting involved in issues that really they shouldn't. This is a war...period, end of story. Any citizen who renounces citizenship, commits treason absolutely is, participates in war against it's nation is guilty and subject to the death penalty. The ACLU has gone to great lengths to take the pledge of allegiance out of schools, stop morning moments of silent prayers, fight to allow other traditional and American culural observances to be trampled on for the sake of a few who don't like it. The ACLU is a complete joke and worthless. Anyone who believes that the ACLU is not politcally motivated (extreme liberal) needs do their homework.
AmericanBubba
ACLU ......... FAR Q! It's a WAR on terrorism.... and if you are going to be involved with the wrong side.... expect the results you are dealt. What about the WTC and 9-11? Concern yourself with the fact that THEIR liberties were taken from them.
Switzerland was invaded by the Celts, the Romans, the Franks and the Germans. Each time they were slaughtered for their possessions and differing beliefs. My family came to America in the 1700's to escape being executed for not praying in the same manner as the occupying people. The world is not so different today. I hate the ACLU. I think they are a bunch of spineless twits. But, the ACLU is attempting to end the world of hatred, to stop idealogical killings. I doubt there will ever be piece on earth, so continue killing in the name of revenge, oil, and because you're better and more deserving of God's gifts than the next person. We hold the high ground.
Badly-Bent
Guess I won't be supporting them anymore.
ACLU is a joke i needed their help but they wouldn't help me.i am black,mexican,.female or gay so they won't help me or any other white male thats not rich..
AlaDave
Just wondering ... The ACLU loves First Amendment cases – how many Second Amendment cases have they taken over their history?
Perhaps because to sane people the 2nd is not a human right; it's a bizarre obsolete view of technology
Go to Omaha gay thare can help thay gust got there rights to work gust stay away from the mass ups.pnm.
hubrisdenied
-insert useless rant here-
Eric Holder is like Janet Reno they both love killing americans.
counselor39@hotmail.com
Yes, and I, TOO, love killing Americans (or anyone else) who cowardly plan mass killings of civilians. These 3 were out of our justice system's reach. The ACLU can SHOVE their political correctness.
Perhaps the ACLU should file sue on behalf Confederate soldiers kill in the Civil War. After all they were American citizens. What right did the government have to take action against them?
This guy is where he belongs, dead.
The ACLU defends terrorists and racists but won't defend the 2ns amendment. They cherry pick the rights they agree with and ignore the rest.
The 2nd amendment? You're crazy, right?
Sorry, Bob, but with limited resources, the ACLU has to pick and choose which issues it wants to address. While I disagree with the legal basis of the claim, the Americans involved were either enemy combatants or in a war zone and so assumed the risk, I also don't think that comparing the claim to defending the 2d Amendment is appropriate. After all, the 2d Amendment essentially protects our right to kill one another, while the ACLU is challenging the government's actions in trying to kill us citizens.
ArchieDeBunker
Sorry Loren,
But the ACLU only supports causes that are a) radical, b) socialist c) anti-American. Why would you be foolish enough to join such an organization?
July 19, 2012 at 11:52 am |
Take his arm with his shoe in his hand end hit him in his head n throwe him to bin LoddEN.((((((((((((((((((((((((((((((((((PNM.
Does the ACLU get tax payor funding ?? I think we should have a say in what cases they take. How about defending more appropriate cases that are affecting Americans ? It is called the American Civil Lib Union not Al Qaeda Civil Lib Union.
You are another crazy, am I right?
boy-oh-boy, where do these nut jobs come from?
Oh yeah, I know. Their idol- Rumball, the fat one, Oxycontin Rush.
tjp44
you area traitor idiot just like the ACLU........death to you as well
If he was such an evil terrorist why not go through the legal process instead of resorting to summary execution? I mean come on, they targeted an American citizen and bombed his family to death. Very very slippery slope.
Blah blah the wheel's off your trailer
That American citizen targeted Americans including your own family. When al Qaeda attacks, they do so indiscriminately and they don't care who they kill! Furthermore, this guy said openlyy that ke was plotting to kill Americans. let me guess, you're a republican!!!
Agreed, what need do we have for trials or evidence or court review? If the emperor... I mean president says someone is a bad guy, we should be able to kill them.
July 19, 2012 at 8:44 am |
"Agreed, what need do we have for trials or evidence or court review? If the emperor... I mean president says someone is a bad guy, we should be able to kill them"
this is nothing new...it has been going on for many years, in both parties.
And what police force would you send it? This is pure delusion. Before 9/11, Al Qaida had a joke "What will the Americans do if we bomb a city? Sue us in court". If you'd been in NY after 9/11 you'd know this wasn't a bank robbery or parking in front of a fire hydrant. I'm a supporter of the ACLU but this is pure coddling of terrorists
I don't have a problem with killing the bad guys, but giving the executive branch the power, without any check or review is insane. We have a Bill of Rights for a reason.
War overseas in a failed state is not subject to the Bill of Rights. I'm not sure where you get your view of law, but there's no provision that says it applies to the entire world.
lie with dogs, get up with drones. these killers were not killed in dearborn, they were in Yemen plotting to kill americans. wrong place and time for the ACLU to intervene. not an issue of free speech or right to congregate but the right to incite he killing of me and mine. ACLU needs to choose its cases more carefully if they want to remain relevant.
He lives in the mountains and caves of Pakistan. Who'd serve the warrant? You?
dear fool, protect them and die by us
History Bear
A terrorist is a terrorist is a terrorist and regardless of nationality deserves just what he/she gets. This notion of so called rights of enemy combatants is pure garbage invented by weak willed cowards and enemies of the west to undermine us.
I don't understand why killing American citizens without warrant, trial, court review or any presentation of evidence is a problem. If the president says someone is a terrorist it should be OK to kill them. There is no chance of a mistake or abuse of power..... Sarcasm
"americans" fighting on the side of the enemy are enemies and can and should be expected to be fired upon. these "americans" were planning on killing me and my neighbors [not sarcasm]. good riddance.
Vietnam Vet
You must be pretty stupid. The Geneva conventions permits the killing of enemy combatants, anywhere, anytime.
Let me guess! The GOP were behind this suit. Following the announcement that our Navy SEAL's had killed OBL, some conservatives accused the Obama administration of violating the sovereignty of Pakistan. Likewise, following the announcement that Awalaki had been droned, conservatives accused the President of killing an American. And they did the same during the Libyan crisis, accusing the Obama administration of waging an illegitimate war. That is the same people who supported the invasions of Iraq and Afghanistan. Yea, keep voting for republicans and see how far your ignorance, prejudice and stupidy get you.
Gosh, secretly sending troops into a sovereign nation for military operations is a violation? How would you feel about a chopper full of Mexican commandos attacking a drug cartel hideout in Texas, without notifying us?
Operation Geronomo was not a violation of Pakistan's sovereignty simply because we had already gotten approval from Pakistan to use its land and air space to complete the war on terror in Afghanistan and going after OBL was part of that war campaign. And if the Mexican government were to send helicopters into Texas to go after a drug cartel without notifying us, that won't be a violation of our sovereignty because Texas is Mexico.
Ummm, if anything you said there were accurate, you would be correct.
"us"? dearborn is not in texas and your islamic center bulletin board material is not relevant.
don't be stupid, it would be shot down before it crossed the border..........now if we sent it, God Speed
Since our own law enforcement is hampered by morons and their ilk, pretty good. Killing terrorist, drug dealers, serial rapist and child molesters sounds just fine to me. I'm tired of this garbage of worring about their "rights" to the determinent of law abiding citizens. You do the crime, you pay the penalty PERIOD!
The idea that the GOP could get any support from the ACLU is cracked. Cat's and dogs.
ACL who? What a bunch of idiot sympathizers. Try suing the morons who are killing, and wanting to kill, Americans.
REALLY?!?!? this is what the ACLU spends their time on? geez
I want to sue alQaeda for killing innocent civilians
Jonnie
If the individual is seen as a threat to national security and significant proof is shown to back that up...light em up. Who cares if they are American. We shouldn't get a 'get out of jail free card'. Doesn't matter if its a Yemen terrorist of an American terrorist; get rid of the problem.
jiri pinkas
LOL good luck with that lawsuit. More Muslim stupidity!
We were terrorists pre-1776 but they had muskets, not drones. Quash the rebellion at all costs right?
Saywhat?
you're an id10t, right? yep, you are
No, "we" were not terrorists prior 1776...we did not target innocent civilians and attempt to change British policy through terror and fear.
In the Boston Tea Party, we attacked a civilian target for just such reasons.
@Really
Big difference between throwing crates of commercial commodity into the bay and detonating yourself with the intent of killing as many people, civilian or not, as possible.
Amanda L. Posted on The last photo of the orange thing, makes me think of a gofdsilh. I agree, if you add eyes, it could be a fun little monster-type thing. Peple would buy it.
You obviously do not know what a terrorist is.
KSquared
The strong survive, the weak don't. Natural selection working according to the plan.
Wow! Quite possibly the most moronic comment on the internet today!
Lars, you liberal freak, you are a traitor now.....
Another left wing , under educated idiot heard from. Other than some minor bruises no one was killed, it was a political and commercial protest against the taxes imposed by the British government to pay for their supposed protection of their north american colonies, which cost the colonist a great many deaths. etc. No human bombers, not night attacks agains women and childern, no attempts hurt others just because they wanted to be big tough guys. Get a grip uneducated moron.
This is a very tricky situation that should raise some serious questions:
1.) Should the president be able to order the execution of a US citizen without a trial?
2.) Why does the ACLU choose the battles that they do?
I don't have the answers, but at least I'm raising the questions that every American should be asking.
A more pertinent question is
1) Are those who openly proclaim allegiance to enemies of their own nation and attempt to murder their own citizens still counted as US citizens? Or did they forfeit their right to citizenship?
But al-Alawki didn't kill anyone; meanwhile mass-murderers only get life here in the US. I just think this sets a bad precedent that our government can kill US citizens at will, regardless of what they have done.
Who will they protect next the President of Penn St?
danielmeah
What you need to remember (And you probably know this) is that the Al-QUeada is a US invention. they where used to fight soviets.
I think you mean the Taliban..........just sayin
No al-Qa'ida came into being after the Soviets left Afghanistan...the predecessor was MAK and they were mostly a fundraising organization in which UBL played a minor role. We funded the Muj...it would be more accurate to say we funded the Haqanni Network.
Are the Haqanni Taliban or Al-Queda aligned ???
By that logic you might as well say we armed North Korea in 1950, because we aided the Soviets in WWII...the point still stands...we did NOT start al-Qa'ida
At 2:25 am you said we DID "invent" AQ !!!???
put the meth pipe away and go to sleep traitor
I am ok with this legal action. 1, the USA can not have a "closed executive process without evidence presented" to a court. 2. The court is the final statement on if the executive action was constutional not the attorney general. 3. A judical review of killing americans by martial law should be automatic since Nixon did it. This is simple check and balance to expose overreach and corruption on small scale and murder on the largest scale.
dotheflippinmath
Democrat here, and I totally agree that we need to take out terrorists, especially those who are traitors, and who might have valuable information about our infrastructure that terrorists could exploit. The one guy on the list, no question. The deader, the better. The kid and his dad were apparently in the wrong place at the wrong time. I agree with the Persian (Iranian) fellow who had no doubt if they were there near a target, they were there with bad intentions. It could have been an unfortunate mistake, and coincidence that they were American citizens. We pay-off all the families who suffer accidental casualties. Our government cannot battle terrorists in a public court. By all means, do an inquiry into the two unintentional deaths, and if they were innocent, an apology from the President and a tidy settlement are in order. The ACLU is just doing their job. They protect anyone whose civil rights are abused, even Klu Klux Klan wizards! I don't agree with them on principle on this one, as I think any expectation of public trial or forewarning before striking a terrorist is both naive and ridiculous. But, again, they are people of principle, and if it were your son killed by one of our drones, while visiting a foreign country, you'd want some honest answers. Whatever the truth is, I'd like to know, myself. Obama is doing a damn good job against terrorists. Come on, for Pete's sake! He got Bin Laden, our enemy #1 (except to GWB and Cheney who couldn't find him, lol), and countless terrorist leaders. He has a lot better sense about when to fight and when not to fight than GWB. His twin Viet Nam's are what broke our country's budget, and the deregulation and encouragement of corporations outsourcing destroyed middle class jobs, while he showered the rich corporations, esp. CEO's and investors, with huge tax breaks on their windfall earnings at our expense. Then he financed two of the most expensive wars in our history on bad credit. Then his Saudi "friends" raised our gas prices..
Before you emphatically pat Obama on the back, remember that he refused to acknowledge the Fort Hood shooting as an act of terrorism. He instead called the shooting "workplace violence". Furthermore, there were many signs that indicated that the shooter was a potential threat, and nothing was done.
Also, both the Times Square bomber and the "underpants" bomber were foiled by nothing more than dumb luck. There were no policies that stopped the incidents from turning into tragedies, and maybe next time we won't be so lucky.
Well done sir!
BOBtheCaT
We would have had BinLaden early on except some Dem congressman leaked we tracked him on his satellite phone!!!
Liberal Democrat here, fwiw, and I totally agree that we need to take out terrorists, especially those who are traitors, and who might have valuable information about our infrastructure that terrorists could exploit. The one guy on the list, no question. The deader, the better. The kid and his dad were apparently in the wrong place at the wrong time. I agree with the Persian (Iranian) fellow who had no doubt if they were there near a target, they were there with bad intentions. It could have been an unfortunate mistake, and coincidence that they were American citizens. We pay-off all the families who suffer accidental casualties. Our government cannot battle terrorists in a public court. By all means, do an inquiry into the two unintentional deaths, and if they were innocent, an apology from the President and a tidy settlement are in order. The ACLU is just doing their job. They protect anyone whose civil rights are abused, even Klu Klux Klan wizards! I don't agree with them on principle on this one, as I think any expectation of public trial or forewarning before striking a terrorist is both naive and ridiculous. But, again, they are people of principle, and if it were your son killed by one of our drones, while visiting a foreign country, you'd want some honest answers. Whatever the truth is, I'd like to know, myself. Obama is doing a damn good job against terrorists. Come on, for Pete's sake! He got Bin Laden, our enemy #1 (except to GWB and Cheney who couldn't find him, lol), and countless terrorist leaders. He has a lot better sense about when to fight and when not to fight than GWB. His twin Viet Nam's are what broke our country's budget, and the deregulation and encouragement of corporations outsourcing destroyed middle class jobs, while he showered the rich corporations, esp. CEO's and investors, with huge tax breaks on their windfall earnings at our expense. Then he financed two of the most expensive wars in our history on bad credit. Then his Saudi "friends" raised our gas prices..
Villainy and unpopularity are irrelevant in the eyes of the law. The ACLU takes up the cause for people whom nobody else will defend. They understand that people will hate them for it, but if they don't do it, nobody will.
Leave a Reply to paul2313
|
cc/2020-05/en_middle_0087.json.gz/line1341314
|
__label__cc
| 0.635388
| 0.364612
|
Tag: nypost
Andrew Yang: Admission to elite schools shouldn’t just be about tests
This is a courageous and commendable stance from Mr. Yang.
“I think we should de-emphasize them. If they are going to be used and they should be used in conjunction with more holistic practices,”
Andrew Yang on Standardized Testing
https://nypost.com/2019/10/21/andrew-yang-admission-to-elite-schools-shouldnt-just-be-about-tests/ …
Billionaire joins push to stop de Blasio’s high school admissions test plan
Powerful specialized high school alumni have now promised to put MILLIONS into lobbying against replacing the embattled 114 multiple-choice exam as the sole admissions criteria for these schools.
Cosmetics tycoon Ron Lauder is bankrolling a multimillion-dollar effort to stop Mayor Bill de Blasio from eliminating the admissions test to the city’s top high schools, sources told The Post on Monday.
The billionaire Clinique chairman — a 1961 graduate of the Bronx High School of Science— is prepared to spend at least “seven figures” of his personal fortune on TV commercials and other efforts to block de Blasio’s controversial proposal, sources said.
Entrenched positions and pleas for change: NYC council debates school integration
|
cc/2020-05/en_middle_0087.json.gz/line1341320
|
__label__wiki
| 0.647714
| 0.647714
|
Lady Margaret – Trees
The observant will note that we’ve slipped into our annual series of posts on folk-rock. Every autumn, folk gets me. It’s the most autumn-appropriate music I know.
“This station is King’s Cross-St Pancras. Change here for Circle & Hammersmith, Metropolitan, Piccadilly and Victoria lines, and mainline, intercity, suburban and international rail services. This train terminates at High Barnet.”
Aficionados of the London Underground will be able to tell you that the voice of the Northern line – the woman whose voice has been used to create station announcements like the above – is Celia Drummond. Aficonados of British folk-rock, meanwhile, will be able to tell you that the lead singer of Trees, a band that welded post-Grateful Dead psychedelic guitar to post-Fairport Convention electric folk over two albums made in 1970, was Celia Humphris.
Both Celias are the same Celia. Acid-folk singer Celia Humphris of the obviously stoned-out-of-their-minds Trees can be heard giving station announcements all over the country. She also, her online advert says, provides a convincing Marge or Lisa Simpson.
All this was several decades in the future when Trees main man Bias Boshell hit upon an idea. It was a strong one. Fairport Convention’s A Sailor’s Life (from Unhalfbricking, released in 1969) had set a template for how long, strophic folk ballads could be played by rock bands: begin gently, then slowly raise the tension until at some point the thing explodes – this being the moment the drummer stops playing patterns on the tom-toms and gives the snare drum what for instead.
With that formula established, the next step was simply to turn up the volume of the guitars. After all, rock was getting louder by the minute (Led Zeppelin’s first two albums were released in 1969, Black Sabbath’s debut in early 1970), so why not crank the guitars up? Why not use them to dramatise and comment upon the tale being told? Why not let them be as violent as songs being sung?
On Lady Margaret, from The Garden of Jane Delawney, Trees adhered to the Sailor’s Life formula, up to a point. There’s a stoned looseness to the opening few minutes, drummer Unwin Brown seeming a bit unsure whether to take the song in Levon Helm-esque half time or match the busy tempo of the guitars (mixed hard left and right). Celia Humprhis is no Sandy Denny, but she does her job well enough as the calm eye of the gathering storm, her voice cut-glass and her diction precise.
The way Trees approach the song’s heavy section is the chief difference between their style and the Sailor’s Life model.
Even as personnel changed, Fairport in their early years consistently had one of the finest rhythm sections in the land. Rock music is ultimately about drums (which is why Zeppelin rocked harder than Sabbath – sorry, they just did), and Martin Lamble was a very fine drummer indeed, managing a rare combination of power, authority and swing. Fairport in their Unhalfbricking era, before Lamble died in a terrible accident on the M1, are vastly underrated as a rock band. (Go listen to Lamble on A Sailor’s Life and Genesis Hall, then come back here. I’ll wait.)
Unwin Brown doesn’t come to Lady Margaret with the intention of playing two and four hard, throwing in some fills and letting the lead players do their thing, as Lamble does on A Sailor’s Life. Brown’s feel is looser, Moon-like; the cymbals are prominent, the snare is a more quicksilver presence, and Barry Clarke’s thickly distorted guitar gets the spotlight. Listen to A Sailor’s Life when walking, running, driving, or doing anything at all, and your pace will increase. Listen to Trees doing Lady Margaret and you’ll slow down, stop even, and nod your head. It’s head music.
Trees only made the two records, The Garden of Jane Delawney (the title track – written by Bias Boshell – is stunning) and On the Shore (check out Murdoch for a representative track), but became a cool reference point during the mid-noughties among freak-folk acts. Betwen 2008 and 2011, I played guitar in folk-rock band called Carterhaugh that was consciously looking to blend folk song with heavy and psychedelic rock, and we adopted Lady Margaret to that end. It never stopped being fun or challenging; what do you play when a song is seven minutes long with no chord changes, just a droney modal melody? Fortunately I had Trees’ example to follow – step on the wah pedal and wail.
This entry was posted in Music and tagged A Sailor's Life, Barry Clarke, Bias Boshell, Black Sabbath, Carterhaugh, Celia Drummond, Celia Humphris, Fairport Convention, folk, folk music, folk-rock, heavy rock, Lady Margaret, Led Zeppelin, Martin Lamble, Murdoch, On the Shore, psychedelic rock, The Garden of Jane Delawney, Tobias Boshell, Trees, Unhalfbricking on October 8, 2016 by rossjpalmer.
← Bert Jansch A quick digression on Bob Dylan, Nobel Laureate →
1 thought on “Lady Margaret – Trees”
300hz July 5, 2017 at 10:40 am
Revisiting the 2 albums after nearly 5 decades I totally concur with your ‘A Sailor’s Life’ extrapolation… Trees ploughed the same furrow over 2 lovely albums and Richard Thompson continued playing sublime guitar. They still made a not entirely insignificant contribution to the British music evolution. Celia’s story is quite bizarre. Good stuff, cheers. Apologies for the puns.
|
cc/2020-05/en_middle_0087.json.gz/line1341330
|
__label__cc
| 0.597122
| 0.402878
|
SPOT-ON Ads
Before You Run
While You’re Running
Helping You Win
Pinpoint Persuasion
SPOT-ON Blog
Why Facebook
Usually in this space at this time of year, Spot-On spends a few minutes to make predictions. But this year, we’re putting that aside. This mess with Facebook and political ads is too overwhelming.
And dangerous.
Let’s begin with a clarification: Facebook is a fantastic tool for elected officials to reach their constituents, particularly in small numbers and targeted groups. But Spot-On – and our clients (that’s you) is all about elections. We’re politics – that’s policy.
There’s a difference. An important one that you, dear reader, understand but Facebook clearly does not.
How’d this happen? Facebook had an aggressive outreach program for members of Congress showing them how to use its pages, how to post, how to put up pictures of their grandkids, how to ‘like’ and ‘share’. For Congress this was a gift: Finally, someone – Facebook! – had organized the Internet into something regular people – Congress! – could understand!
So when it came time to run for office it was only natural that Congress would treat Facebook like a TV channel. Buy a lot of ads and get re-elected! It worked, too. And that’s where the trouble started.
Like every other tech company, Facebook doesn’t see a difference between political ads and soda ads. Political is just another brand silo and it’s one that doesn’t really generated that much revenue. For Facebook, the more speech, the better, the more connections the better, the more ‘popular’ the post, the better. Because Facebook was envisioned by happy, content, well-off people as a happy place were we can all just get along by sharing and liking and coming gracefully and joyously to seeing each others’ point of view.
So Facebook doesn’t know what to do when faced with critical or harsh political speech or opinions. Or with deliberate and organized fraud. Or with targeted ads designed to influence opinion in nefarious not-so-nice – but eminently shareable – ways. And more than two years after the 2016 election – which featured all of these things – the COMPANY STILL DOESN’T KNOW WHAT TO DO.
Just look at the past six months.
When Facebook instituted its political ‘registration’ process in May, it closed down a number of small campaigns. Babbling about transparency and willingness to prevent a repeat of 2016, the company approached known political buyers – like Spot-On – but didn’t know or care to approach smaller campaigns. Result: Campaigns with lots of dough could stay on the platform, the local races (school boards, small town city councils) got booted until they could meet the company’s ‘standards’ for buying ads.
At the same time, Facebook initiated an ad disclaimer requirement that’s different from most state and federal law. It also launched a ‘transparency effort’ that, if carefully reviewed, gives insights into campaign strategy and spending. Both corporate policies are in addition – and usually beyond – what’s required state or federal laws.
But even that process was a joke. Some of these requirements could be avoided if ads were purchased through a buying platform. In Alabama in 2017, a bunch of Democrats decided to imitate the nefarious tactics of 2016 during the special election that got Doug Jones elected to the U.S. Senate. They put up fake pages with fake messages to create dissension and influence turn out.
Finally, last month, the New York Times – in what should be a coup de grace for the company’s lax and myopic leadership – demonstrated what savvy media buyers have know for a while: Political ad review is not done in the U.S. It’s done in another country by people who know very little about laws governing speech and elections.
Spot-On got out of the Facebook ad buying business in 2016. We didn’t know what they were going to do but we were pretty sure it would be inept. But even after a lifetime in politics and 20-plus years in Silicon Valley we were not prepared for this combination of sheer ineptitude and cynical, PR-oriented half-measures and deliberate “mis-truths”.
So we have a question for anyone still using Facebook ads as the centerpiece of their campaign.
Why do Facebook’s contractors in the Philippines or India get to rule on what your political speech should look or sound like? Why does Facebook get to set financial disclosure laws that are different from what you state requires? Why does Facebook get to go beyond what government agencies require to create a sham disclaimer system? And above all: Why is political speech being controlled by a company that cares more about its shareholders than voters or citizens?
And why are you letting your candidates play along?
By Chris Nolan on January 8, 2019 / Spotlight Blog
Keep up with SPOT-ON
Check out our blog posts!
Get updates from us on LinkedIn.
Home | Pinpoint Persuasion | Spotlight Blog | About Us | Spot-On Writers | FAQ | Privacy | Terms & Conditions
Copyright © 2005-2019, SteelWill, Inc. All Rights Reserved. Spot-On is a trademark of SteelWill, Inc.
|
cc/2020-05/en_middle_0087.json.gz/line1341334
|
__label__cc
| 0.651453
| 0.348547
|
Read any CE article on Lippincott NursingCenter for FREE by being a registered member. Membership is free and comes with many benefits!
Nutrition Today
Energy Drinks, Caffeine, an...
Energy Drinks, Caffeine, and Athletes
Go To CE Details
Join NursingCenter to access all articles
March/April 2014, Volume 49 Number 2 , p 49 - 54
Earn 2 Contact Hours
This article has an associated Continuing Education component.
Cost for CE: $21.95.
Expires March 06, 2020. Go to CE Details
Rosenbloom, Christine PhD, RDN, CSSD
Sales of caffeinated energy drinks and shots saw double-digit growth in the past few years. Whereas the number of athletes who use energy drinks is unknown, the number of college athletes who report using energy drinks is about 45%. Caffeine in small doses (2-3 mg/kg per body weight) is an effective ergogenic aid, acting on the central nervous system to delay fatigue and increase alertness. Energy drinks claim to have other functional ingredients that enhance athletic performance, but research on energy drinks in athletes is scant and results equivocal. If there is a positive effect, it is the caffeine in energy drinks that provides a performance boost. This article reviews use and safety concerns of energy drinks, the role of caffeine on sports performance, and guidelines for use in athletes.
A 20-year-old college football player was dizzy and lightheaded during preseason workouts. The athletic trainer noted he had a rapid pulse, and the team physician described tachycardia, with the initial impression that the athlete was dehydrated. He sat out in practice, drank plenty of fluids, and was referred to the sports dietitian for hydration evaluation. During the assessment, his diet history revealed that he used a "preworkout intensifier" formula (he doubled the recommended dose), drank 3 to 4 energy drinks throughout the day, and downed an energy shot instead of eating breakfast. Estimated caffeine intake was 1070 mg in a 24-hour period. This 100-kg athlete (220 lb) was consuming 10 mg of caffeine per kg of body weight, far in excess of the 2 to 3 mg/kg per body weight that is effective as an ergogenic aid.1 At moderate to high doses of 5 to 9 mg/kg, caffeine can increase epinephrine concentrations 50% to 100% leading to rapid pulse and heart rate.2
Caffeinated energy drinks, and their little cousins, energy shots, are a big business. The Chicago-based market research firm, SymphonyIRI Group, reported that energy drink sales netted more than $6.9 billion from April 2012 to April 2013, a 19.4% increase from the previous 12 months.3 The energy shot category reported $1.1 billion in sales with an 8.5% increase over the same period. These figures do not include sales at one of the biggest retailers, Wal-Mart.3
Athletes have used caffeine to enhance sports performance long before scientists understood the physiological effects of caffeine on muscle and brain that could contribute to improved performance. While sports researchers have uncovered the mechanism behind the ergogenic effect of caffeine, there is growing concern that products such as energy drinks and shots can lead to excess caffeine consumption. This article reviews the use of energy drinks and shots by athletes and the effects of caffeine on performance and offers guidelines for caffeine use by athletes.
ENERGY DRINK USE BY ATHLETES AND REASONS FOR USE
There is not much research on the prevalence of energy drink consumption by athletes, but there are data on college athletes. The National Collegiate Athletic Association (NCAA) released a report in 2012 on substance use among college athletes, and the survey included 1 question on energy drink use.4 The survey was distributed to all active member NCAA institutions, and 20 474 student-athletes completed the survey across 23 championship team sports. In response to the question, "I have taken energy drinks while in college," 44.5% of athletes reported that they had consumed energy drinks in college. Table 1 shows the percentage of male and female athletes in various sports who reported using energy drinks.
TABLE 1 Energy Drink use by College Student-Athletes
In an online survey, Hoyte and colleagues5 reported on energy drink, dietary supplements, and prescription drugs in college students. Data were taken from the larger College Survey Program, and 1960 college students responded to the survey. Twenty-three percent of those surveyed participated in sports, and of those (n = 397), 80.1% said they used energy drinks to enhance sports performance.
The reasons for using energy drinks by college students and athletes include obtaining an extra boost in energy, promoting wakefulness and aiding sleep deprivation, maintaining alertness, and providing cognitive and mood enhancement.6 There is also evidence that energy drinks are used by athletes to enhance the effects of alcohol, using the central nervous stimulation of energy drinks to counteract the depressant effects of alcohol.7
GROWTH OF ENERGY DRINKS AND CAFFEINATED PRODUCTS
Energy drink consumption became popularized when Red Bull (Red Bull, Santa Monica, California) was introduced in Austria in 1987.8 In 2012, 5.2 billion cans were consumed, and it is sold in 165 countries.8 The success of Red Bull encouraged the entry of competitors into the marketplace, and although there are dozens of energy drinks on the market, Red Bull still leads market share with 42%.9 This is followed by Monster Energy Drink (Monster Energy Drink Co, Corona, California) (37%), Rockstar Energy Drink (Rockstar Energy, Buena Park, California) (11%), Amp (PepsiCo, Purchase, New York) (4%), NOS Energy Drink (The Coca Cola Co) (4%), and Full Throttle (The Coca Cola Co, Atlanta, Georgia) (2%). The main ingredients in most energy drinks are sugar and caffeine, with some containing other functional ingredients such as taurine, carnitine, glucuronolactone, ginseng, B vitamins, and other stimulants such as guarana, yerba mate, and kola nut. Table 2 shows the top selling energy drinks and their nutrient profiles. Because most energy drinks are sold as dietary supplements, and caffeine is not a nutrient (therefore not required to be listed on the supplement facts or nutrition facts label), getting accurate information about the composition of energy drinks is challenging.
TABLE 2 Nutrient Composition of Popular Energy Drinks per 8 oz
Energy drinks are widely marketed to teens, college students, and athletes through sponsorships with extreme sports, such as BMX racing, wakeboarding, mountain biking, surfing, snowboarding, and downhill skiing, as well as partnerships with NASCAR, monster truck rallies, and music concerts. Promotion of these events has created demand for energy drink-labeled clothing lines, and almost every energy drink Web site has a shop where logoed apparel can be purchased. Woolsey7 believes that energy drinks have tapped into the youth market by pairing the drinks with risk-taking behaviors associated with athletes and identification with a "jock identity." Energy drink samples are frequently given out at college sporting events on campuses around the country to encourage consumption. Today, the energy drink market is becoming more segmented with products targeting special audiences. For example, VPX Redline Princess is marketed to women as having "the same level of energy as original Redline, but with the added bonus of appetite suppression and mood enhancement, which is nothing short of euphoric."10 GungHo,11 with "ninja-like focus," markets to video gamers, students, and athletes alike with claims of a "patent-pending formula that offers smoother, more balanced energy without rush-induced jitters that reduce mental and physical goal-oriented effort. Yet it contains a full complement of energy-enhancing caffeine." GungHo and several other newcomers are marketing their drinks as "natural" sources of caffeine, containing guarana and/or kola nut. Guarana seeds contain more caffeine (1 g of guarana contains about 40 mg of caffeine) than other plants, but that does not make these sources of caffeine any healthier than plain old caffeine.12 And, indeed it is the caffeine and/or caffeine-containing botanicals that give energy drinks their central nervous-stimulating properties.
Want the stimulation of caffeinated energy drinks without the volume? Enter energy shots. The market is dominated by 5-hour ENERGY, a 1.93-fl oz shot containing B vitamins (30 mg niacin or 150% of daily value [DV], 40 mg vitamin B6 or 2000% of DV, 400 [micro]g folic acid or 100% of DV, and 500 [micro]g vitamin B12 or 8333% of DV) and 1870-mg energy blend of taurine, glucoronic acid, malic acid, N-Acetyl l-tyrosine, l-phenylalanine, caffeine, and citicoline. The Web site says that the caffeine content is similar to a premium cup of coffee, but the actual amount of caffeine is not listed. Five-hour ENERGY reported $1114 million in sales in 2013, with the next best-selling energy shot (Stacker 6-hour power) coming in with $47 million in sales.9 Energy shots appear to be expanding their market to athletes recruiting an older athlete, Jim Furyk, a 43-year-old professional golfer as a spokesperson for the brand. Not to be outdone by energy shots, newer caffeine delivery systems have been introduced. Inhalable caffeine (AeroShot by AeroLife) has 100 mg caffeine per "puff." The latest entry is Sprayable Energy claiming that 4 sprays contain about 100 mg caffeine that can be absorbed through the skin.
Caffeine seems to be everywhere and easily accessible to athletes as evidenced by the range of products containing caffeine. Some of these products, shown below, are not usually thought of as caffeine-containing foods or beverages.
* ARMA Energy Snx (ARMA Energy, Inc, Carlsbad, California)
[white circle] Snacks include potato chips, trail mix, granola, fruit mix, and tortilla mix containing about 70 mg caffeine per 2-oz serving
* Cracker Jack'D (PepsiCo, Purchase, New York)
[white circle] Variety of flavored snacks containing about 70 mg caffeine per 2-oz serving
* MiO Energy (Kraft Foods Group, Northfield, Illinois)
[white circle] A "liquid water enhancer" in a variety of flavors containing about 60 mg caffeine per "squeeze" or one-half teaspoon
* Crackheads2 (Osmanium Candy Co, Milwaukee, Wisconsin)
[white circle] Candy in a variety of flavors containing 600 mg caffeine per box (40 g)
* Wired Waffles (Wired Waffles, LLC, Iowa)
[white circle] Variety of flavors containing 200 mg caffeine per waffle (there is also a caffeinated maple-flavored syrup, but the amount of caffeine is not listed on the Web site)
* Bang!! Caffeinated Ice Cream (Bing! Bang! Boom! Ice Cream Co, Madison, Wisconsin)
[white circle] Variety of flavors containing 125 mg caffeine per 4-oz serving
Concern about energy drink consumption and caffeine intake was triggered in the fall of 2012 when a 14-year-old girl died after consuming Monster Energy Drink. Her parents filed a wrongful death suit against the energy drink maker. As of November 2012, the FDA reported that there have been 40 illnesses and 5 deaths linked to Monster Energy, 13 illnesses and 2 lasting disabilities linked to Rockstar Energy, and 92 illnesses and 13 deaths linked to 5-hour ENERGY.13,14 Emergency room visits involving energy drinks doubled from 10 068 visits in 2007 to 20 783 visits in 2011, and more patients are aged 18 to 39 years than in any other age group.15
All these adverse events linked to energy drinks led Congress to hold hearings on July 31, 2013, expressing concern over safety and marketing of energy drinks to young consumers. As of this time, there has been no policy change regarding energy drink labeling, marketing, or sales, but Michael R. Taylor, FDA Deputy Commissioner for Foods and Veterinary Medicine, expressed concern that caffeinated products are breaking outside the traditional boundaries of caffeine in the food supply and that they pose challenging public health and regulatory questions. He noted that new products are marketed explicitly for stimulant properties, in new forms, under new conditions, which are attractive and accessible to children and adolescents. The FDA has the authority to place limits on the amount of caffeine in foods and beverages, but "the science should come first, and there are no simple answers to questions raised about caffeine.16 (Currently, the FDA limits caffeine content only in cola-type beverages to 00.2% or 71 mg/12 oz; they considered banning caffeine from soft drinks but accepted the soft drinks maker argument that caffeine was a flavor enhancer.)17
ENERGY DRINKS AND SPORTS PERFORMANCE
Does consumption of energy drinks lead to improved sports performance? There is no doubt that caffeine is an effective ergogenic aid. Athletes have been using caffeine to enhance sports performance since the advent of modern sports. Burke et al2 report that in the early 1900s caffeine was added to "cocktails" designed for athletes that also contained drugs such as cocaine and heroin. Later in the 20th century, researchers sought to understand the mechanism and the most effective dose of caffeine to improve athletic performance. Caffeine has been shown to delay fatigue in training, enhance skeletal muscle contractile force, and increase the pain threshold.18 Early research suggested that it was the fat-burning effects of caffeine that improved performance. It was thought that caffeine, by increasing fat oxidation during exercise, could spare muscle glycogen, allowing an athlete to have more glycogen at the end of competition for the kick to the finish. However, subsequent research shows that caffeine's main ergogenic effect is on the central nervous system. Caffeine is adenosine receptor antagonist. Adenosine induces sleep and fatigue, so blocking the effects of adenosine with caffeine promotes a more alert state. Davis and colleagues,19 using animal models, showed that when caffeine was injected into the brains of rodents, performance in treadmill running improved by more than 50%.
An athlete's response to caffeine is highly variable, and early research studies used high doses of caffeine (5-6 mg/kg per body weight), but more recent observations show that a smaller dose of 2 to 3 mg/kg per body weight is effective. For a 70-kg athlete (154 lb), a caffeine dose of 140 to 210 mg caffeine, the amount found is small to medium cup of coffee, is an effective dose.1
While caffeine has been shown to be an effective ergogenic aid, what about energy drinks? For every study that supports an increase in endurance, speed, or strength when an energy drink is consumed, there is another study that shows no effect on performance. What is clear is that any effect that energy drinks have on performance comes from the caffeine. Because energy drinks also contain components that claim to improve mental and physical performance (primarily taurine, glucuronolactone, and B vitamins), McLellan and Lieberman20 conducted a comprehensive review and found 32 research articles on the effects of energy drinks alone and/or in combination with caffeine on mental or physical performance. They found some weak evidence of increased sports performance for glucose and guarana extract but state there is an "overwhelming lack of evidence to substantiate claims that components of energy drinks, other than the caffeine, contribute to the enhancement of physical or cognitive performance."20
Heneghan and colleagues21 at the Center for Evidence-Based Medicine at the University of Oxford, United Kingdom, reviewed studies on the effects of energy drinks on sports performance. The researchers noted that it was difficult to compare studies because they all used different subjects (some were exercise trained, whereas others were not), used different types of energy drinks in differing amounts, and did not always make the treatments isocaloric, and outcome measures differed. They did not find any research comparing the effectiveness of energy drinks versus caffeine alone on sports performance. They concluded that if there is any positive effect on sports performance with energy drinks, it is the caffeine that produces the effect. They also found some negative effects of consuming energy drinks for sports performance enhancement, including insomnia, headache, nausea, vomiting, tachycardia, tremors, and seizures.21
VOLUNTARY LABELING OF ENERGY DRINKS
Currently, the FDA has not proposed changes to labeling of energy drinks to include caffeine or make energy drink ingredients more transparent, but 2 groups have developed guidelines for energy drink labeling. The American Beverage Association (ABA) developed voluntary guidelines for its members.22 Whereas most energy drinks are marketed as dietary supplements, Rockstar Energy and most recently Monster Energy have repositioned their drinks as beverages. (Beverages do not have to report adverse effects, whereas dietary supplements do.) The ABA guidelines include the following:
* Labels of energy drinks should follow a voluntary format for the labeling of caffeine and identify the quantity of caffeine from all sources contained in the beverage.
* Labels of energy drinks should not promote the mixing with alcohol or make any claims that the consumption of alcohol together with energy drinks counteracts the effects of alcohol.
* Labels of energy drinks should include an advisory statement that they are not intended or recommended for children, pregnant or nursing women, and those sensitive to caffeine.
* Energy drinks should neither be sold nor marketed in schools.
* Energy drinks should not be marketed to children.
In April 2013, the Council for Responsible Nutrition (CRN), the supplement industry trade association, issued voluntary guidelines for caffeine-containing dietary supplements, including energy drinks.23 The association guidelines are similar to the ABA guidelines for beverages and include the following:
* There should be disclosure of total caffeine content from both added caffeine and naturally occurring caffeine combined and should be declared in mg per serving (however, this would not apply to supplements that contain no added caffeine and >25 mg per serving of naturally occurring caffeine).
* Any supplement with total caffeine content of more than 100 mg per serving should provide a statement that the product is not intended/recommended for children and those sensitive to caffeine.
* Pregnant or nursing women, those with a medical condition, and those taking medication should consult a healthcare professional before use.
* The CRN members should not advertise, market, or otherwise promote the use of caffeine-containing dietary supplements in combination with alcohol or to counter the acute or immediate effects of alcohol.
As of this time, there is no information if any members of either ABA or CRN have adopted these voluntary guidelines.
WHAT IS MODERATION OF CAFFEINE INTAKE FOR ATHLETES?
The word moderation is frequently used to describe a "safe" intake of caffeine, but what is moderation? The Academy of Nutrition and Dietetics cites 200 to 300 mg/d as a moderate and safe dose of caffeine,24 and that amount appears consistent with other health organizations definition of moderation.25
For collegiate athletes, caffeine is a restricted substance, and a positive drug test could result if an athlete has a urine concentration exceeding 15 [micro]g/mL.26 To achieve that level, an athlete would have to consume about 17 caffeine-containing soft drinks.18 The equivalent in energy drinks would range from 12 to 15 servings (8-oz servings). Energy drinks often come in larger servings (16 oz), so the actual number of cans of energy drinks to achieve a urine concentration that could result in a positive drug test could be lower.
Higgins and colleagues27 make the following recommendations on energy drink consumption and athletes.
* For the athlete participating in exercise lasting less than 1 hour, do not use energy drinks because of the possibility of dehydration, elevation of blood pressure, and lack of equivocal benefits versus water or sports drinks.
* For the athlete participating in exercise lasting longer than 1 hour, do not use energy drinks. Sports drinks containing carbohydrates and electrolytes help prevent dehydration and restore important minerals lost through perspiration, and they produce better hydration than water.
Getting back to our football player whose case study was introduced in the introduction, he modified some of his habits by replacing energy shots with eating breakfast, but he continued to consume a preworkout formula, as in his words, he was "psychologically addicted" to taking some supplement before practice. The NCAA has concerns about not only energy drink consumption but also caffeine consumption in college athletes and developed a poster for member schools in 2013. The Figure shows the poster that is displayed for the athletes to encourage them to seek energy from real foods.
Figure. Caffeine poster of the National Collegiate Athletic Association. Reprinted with permission NCAA.
Caffeine is safe and legal for use by athletes when used in moderate amounts. Athletes should be educated about the effective dose of caffeine to enhance performance and the dangers to health as well as detrimental effects on performance when large amounts are consumed.
1. Burke LM. Caffeine and sports performance. Appl Physiol Nutr Metab. 2008; 33: 1319-1334. [Context Link]
2. Burke L, Desbrow B, Spriet L. Caffeine for Sports Performance. Champaign, IL: Human Kinetics; 2013. [Context Link]
3. State of the Industry: Energy Drinks. http://www.bevindustry.com/articles/85655-consumers-seek-out-energy-boosts. Accessed December 3, 2012. [Context Link]
4. Substance Use. National Study of Substance Use Trends Among NCAA College-Student Athletes. Indianapolis, IN: NCAA; 2012. https://www.ncaapublications.com/p-4266-research-substance-use-national-study-of. Accessed December 4, 2013. [Context Link]
5. Hoyte CO, Albert D, Heard KJ. The use of energy drinks, dietary supplements and prescription medications by United States college students to enhance athletic performance. J Community Health. 2013; 38: 574-580. [Context Link]
6. Ishak WW, Ugochukwu C, Bagot K, Khalili D, Zaky C. Energy drinks: psychological effects and impact on well-being and quality of life. Innov Clin Neurosci. 2012; 9: 25-34. [Context Link]
7. Woolsey C. Energy drink cocktails: a dangerous combination for athletes and beyond. J Alcohol Drug Educ. 2010; 54: 41-68. [Context Link]
8. Always diving in headfirst. http://energydrink-us.redbull.com/. Accessed December 9, 2013. [Context Link]
9. The top 15 energy drink brands. http://www.caffeineinformer.com/the-15-top-energy-drink-brands. Accessed December 9, 2013. [Context Link]
10. Redline Princess Energy Drink. http://www.vpxsports.com/fat-loss-energy-supplements/redline-princess. Accessed December 9, 2013. [Context Link]
11. GungHo. http://www.gogungho.com/the-science. Accessed December 9, 2013. [Context Link]
12. Scott GN. Which plants contain caffeine? Medscape, May 13, 2013. http://www.medscape.com/viewarticle/780334. Accessed December 9, 2013. [Context Link]
13. Food and Drug Administration. Energy "drinks" and supplements: investigation of adverse event reports. http://www.fda.gov/Food/NewsEvents/ucm328536.htm. Accessed December 10, 2013. [Context Link]
14. WebMD. More deaths, illness linked to energy drinks. http://www.webmd.com/diet/news/20121116/more-deaths-illness-energy-drinks. Accessed December 10, 2013. [Context Link]
15. Substance Abuse and Mental Health Services Administration, Center for Behavioral Health Statistics and Quality. The DAWN Report: Update on Emergency Department Visits Involving Energy Drinks: A Continuing Public Health Concern. Rockville, MD. January 10, 2013. [Context Link]
16. Taylor MR. Defining boundaries for caffeine in today's marketplace. FDA Voice. August 26, 2013. http://blogs.fda.gov/fdavoice/index.php/2013/08/defining-boundaries-for-caffeine. Accessed December 10, 2013. [Context Link]
17. Reissig CJ, Strain EC, Griffiths RR. Caffeinated energy drinks-a growing problem. Drug Alcohol Depend. 2009; 127: 511-528. [Context Link]
18. Dunford M, Coleman EJ. Ergogenic aids, dietary supplements, and exercise. In: Rosenbloom CA, Coleman EJ, eds. Sports Nutrition: A Practice Manual for Professionals, 5th ed. Chicago, IL: Academy of Nutrition and Dietetics; 2012: 128-161. [Context Link]
19. Davis JM, Zhao Z, Stock HS, Mehl KA, Buggy J, Hand GA. Central nervous system effects of caffeine and adenosine on fatigue. Am J Physiol. 2003; 284: R399-R404. [Context Link]
20. McLellan TM, Lieberman HR. Do energy drinks contain active components other than caffeine? Nutr Rev. 2012; 70: 730-744. [Context Link]
21. Heneghan C, Gill P, O'Neill B, et al. Mythbusting sports and exercise products. BMJ. 2012; 345: 1-7. [Context Link]
22. American Beverage Association. ABA Guidance for the Responsible Marketing and Labelling of Energy Drinks. http://www.ameribev.org/nutrition-science/energy-drink-guidance/. Accessed December 13, 2013. [Context Link]
23. Council for Responsible Nutrition. CRN Recommended Guidelines for Caffeine-Containing Dietary Supplements. http://www.crnusa.org/caffeine/guidelines.html. Accessed December 13, 2013. [Context Link]
24. Academy of Nutrition and Dietetics. The buzz on caffeine. http://www.eatright.org/Public/content.aspx?id=6442452080&terms=caffeine%20moder. Accessed December 13, 2013. [Context Link]
25. Medline Plus. Caffeine in the diet. http://www.nlm.nih.gov/medlineplus/ency/article/002445.htm. Accessed December 13, 2013. [Context Link]
26. NCAA Banned Drug List. http://www.ncaa.org/wps/wcm/connect/public/ncaa/health+and+safety/drug+testing/r. Accessed December 13, 2013. [Context Link]
27. Higgins JP, Tuttle TD, Higgins CL. Energy beverages: content and safety. Mayo Clin Proc. 2010; 85: 1033-1041. [Context Link]
|
cc/2020-05/en_middle_0087.json.gz/line1341339
|
__label__cc
| 0.537581
| 0.462419
|
April 10, 2016 by Serena
Mailbox Monday, created by Marcia at To Be Continued, formerly The Printed Page, has a permanent home at its own blog.
To check out what everyone has received over the last week, visit the blog and check out the links. Leave yours too.
Also, each week, Leslie, Vicki, and I will share the Books that Caught Our Eye from everyone’s weekly links.
The Secret Language of Stones by M.J. Rose for review in July with France Book Tours.
As World War I rages and the Romanov dynasty reaches its sudden, brutal end, a young jewelry maker discovers love, passion, and her own healing powers in this rich and romantic ghost story, the perfect follow-up to M.J. Rose’s “brilliantly crafted” (Providence Journal) novel The Witch of Painted Sorrows.
Nestled within Paris’s historic Palais Royal is a jewelry store unlike any other. La Fantasie Russie is owned by Pavel Orloff, protégé to the famous Faberge, and is known by the city’s fashion elite as the place to find the rarest of gemstones and the most unique designs. But war has transformed Paris from a city of style and romance to a place of fear and mourning. In the summer of 1918, places where lovers used to walk, widows now wander alone.
So it is from La Fantasie Russie’s workshop that young, ambitious Opaline Duplessi now spends her time making trench watches for soldiers at the front, as well as mourning jewelry for the mothers, wives, and lovers of those who have fallen. People say that Opaline’s creations are magical. But magic is a word Opaline would rather not use. The concept is too closely associated with her mother Sandrine, who practices the dark arts passed down from their ancestor La Lune, one of sixteenth century Paris’s most famous courtesans.
But Opaline does have a rare gift even she can’t deny, a form of lithomancy that allows her to translate the energy emanating from stones. Certain gemstones, combined with a personal item, such as a lock of hair, enable her to receive messages from beyond the grave. In her mind, she is no mystic, but merely a messenger, giving voice to soldiers who died before they were able to properly express themselves to loved ones. Until one day, one of these fallen soldiers communicates a message—directly to her.
So begins a dangerous journey that will take Opaline into the darkest corners of wartime Paris and across the English Channel, where the exiled Romanov dowager empress is waiting to discover the fate of her family.
This is a bag of goodies that I received from a Jane Austen Darcy & Elizabeth Panel in Bethesda, which Anna and I attended. This bag of goodies is wonderful for more than one reason.
Beyond the fact that I NEVER win anything, this bag includes my favorite peacock postcards, books edited by Anna, and a book edited by me! It also included chocolates, and believe me, they were delicious!
Books by Zoe Burton — one of which I edited recently:
In this ‘Pride and Prejudice’ novella, Elizabeth Bennet has known Fitzwilliam Darcy since both were very young. When she flees Longbourn and an unwanted suitor, her uncle and his father arrange a marriage between the two. Will Lizzy and Fitzwilliam agree to such a marriage? Will it keep her safe from a Peer who is determined to have her? Will this young couple be able to keep the promises they have made to each other?
Promises Kept
This ‘Pride and Prejudice” novel variation follows Fitzwilliam and Elizabeth Darcy through the first year of their marriage. Arranged by his father in the I Promise To… novella, their union saved Elizabeth from a persistent, abusive suitor. The couple has known each other for years and quickly come to realize their love for each other. However, not everyone is happy with the marriage, and trouble comes quickly upon them. Dealing with jealous ladies and scornful gentlemen in London as well as illness and injury at Pemberley, they grow together as a couple while Elizabeth regains the confidence she has lost.
Decisions and Consequences, which I edited.
Elizabeth Bennet has received two proposals of marriage in the last twelve hours: one from her ridiculous cousin Mr. Collins and the other from the arrogant and disdainful Mr. Darcy. She turns both of them down flat. Unfortunately for her, between her mother’s insistence that she marry and some mysterious hold Mr. Darcy has over her father, she is forced to choose one.
Fitzwilliam Darcy is a man in need of a wife. He has searched high and low amongst the high society women of London but has yet to meet someone who combines all the attributes he requires. When he meets Miss Elizabeth Bennet in the small market town of Meryton, he finds her pointed dislike of him refreshing in its honesty. After observing her for a while, he decides he will marry her, and instructs his solicitor to investigate Mr. Bennet in the hopes of finding some sort of leverage to force her to accept him.
Though she chooses Darcy, Elizabeth is not happy. It takes weeks of being in his presence and learning his character, and the drama of people totally unrelated to her, to make Elizabeth see that that the consequence of her decision could possibly be a deep, abiding love.
Books by Rose Fairbanks — several of which were edited by Anna:
Letters from the Heart
Resolved to forget Elizabeth Bennet during a winter in London, Fitzwilliam Darcy writes a letter in bitterness of spirit. Frustrated by her growing obsession with the arrogant man, Elizabeth commits her thoughts to paper. But angry people are not always wise, and secret thoughts do not always remain secret. Compelled to face their selfishness and fears, their actions encourage those dearest to them to change as well.
Love Lasts Longest, edited by Anna.
Steal a quiet moment with Darcy and Elizabeth…
In the busy world of go-go-go, we often have our gadgets glued to us all the time. Via technology we can now take our books with us much more conveniently than before, but who wants their reading interrupted in order to return to the real world? Love Lasts Longest was written for the moments when reading a lengthier volume is unwise. Follow each story as we see Fitzwilliam Darcy and Elizabeth Bennet grow in love over and over again!
A Sense of Obligation, edited by Anna.
A chance, but meaningful, encounter in Netherfield’s library changes everything between Darcy and Elizabeth. As they rush to the altar, Darcy’s faulty memory may destroy their chance at domestic comfort before they begin. Knowing their obligations and no longer resisting their attraction, they forge a foundation of trust and respect. New feelings may not be enough, however, to overcome the misunderstanding which lays between them. Exploring the juncture of sentiment and reason, A Sense of Obligation, takes Darcy and Elizabeth on a passionate, humorous and introspective path toward happiness in marriage.
No Cause to Repine, edited by Anna.
When a simple accident is misinterpreted and threatens Elizabeth Bennet’s reputation, her fate seems sealed as Fitzwilliam Darcy’s wife. While the bride is resigned, the gentleman could hardly be happier until betrayals and schemes threaten to entirely take the matter out of their hands. Overcoming the plots before them will take all the patience, perseverance and collaboration they can muster, but a partnership requires truth. Self-discovery and trust await Jane Austen’s most beloved and willfully blind couple as they attempt to master their own destiny in life and love.
Book from Victoria Kincaid — which Anna also edited:
Mr. Darcy to the Rescue
When the irritating Mr. Collins proposes marriage, Elizabeth Bennet is prepared to refuse him, but then she learns that her father is ill. If Mr. Bennet dies, Collins will inherit Longbourn and her family will have nowhere to go. Elizabeth accepts the proposal, telling herself she can be content as long as her family is secure. If only she weren’t dreading the approaching wedding day…
Ever since leaving Hertfordshire, Mr. Darcy has been trying to forget his inconvenient attraction to Elizabeth. News of her betrothal forces him to realize how devastating it would be to lose her. He arrives at Longbourn intending to prevent the marriage, but discovers Elizabeth’s real opinion about his character. Then Darcy recognizes his true dilemma…
How can he rescue her when she doesn’t want him to?
Book from Cat Gardner:
Denial of Conscience
Inspired by Jane Austen’s most alluring romantic couple, this modern adventure stars adaptations of characters from Pride and Prejudice and her other books.
Elizabeth Bennet is hiding from life on her family’s decaying, historic plantation, afraid to live fully. Hindered by duty and obligation, even reluctantly agreeing to an untenable marriage, she cannot silence her conscience from crying out for her to flee- run – escape before it’s too late.
Prompted by a cataclysmic event and the arrival of the enigmatic, attractive Fitzwilliam Darcy, Liz is thrust into a dangerous adventure where her spirit is released amidst international intrigue. However, Darcy carries his own deep stash of secrets as a premier government-sanctioned assassin working with an elite clandestine group named Obsidian. He’s spent a long, dark decade justifying his career choice while smothering his own conscience that beckons him back home to his ancestral Pemberley, its demons, and the man he was meant to be.
He is steel, rock-n-roll, and Tennessee whiskey. She is orchids, opera, and peaches with cream. Thrown together they are physically and emotionally charged TNT, ready to explode!
Books from Pamela Lynne:
Dearest Friends
The historical romance Dearest Friends retells Jane Austen’s Pride and Prejudice as a sensual adventure that will delight a modern audience. Fitzwilliam Darcy left Hertfordshire following a friend’s betrayal, but his heart remained with Elizabeth Bennet, the impertinent beauty who captured his attention in ways no woman ever had before. When he encounters her unexpectedly in London, he realizes he can no longer live without her and begins his pursuit for her hand. When he finds that Elizabeth is not free to marry, will he again walk away or will he fight for the lady he loves?
While Darcy and Elizabeth pursue their own happiness, around them friendships progress to love and infatuation leads to disappointment. Join a group of unlikely friends as they support our dear couple on their journey, each treading unique paths along the way.
Sketching Character
What if a tragic event involving a beloved sister shatters Elizabeth Bennet‘s confidence in her ability to accurately judge a person’s character? When she leaves Longbourn for Kent, Elizabeth’s heart is full of worry for those she left behind. She carries a secret that would ruin her family if exposed and she must deceive the ones closest to her to conceal the truth.
She unexpectedly encounters Mr. Darcy on her journey and his gentlemanly behavior confuses, yet comforts her. Their daily encounters in the woods surrounding Rosings soothes Elizabeth’s weathered conscience and she soon falls in love. Her doubts, along with the well-placed words of another, threaten to destroy the peace she finds in Darcy’s company and she wonders if she has again failed to correctly sketch his character.
When the truth behind her deception is uncovered, will Darcy shun her as Elizabeth fears, or will his actions prove that he is the very best of men?
Filed Under: mailbox monday, meme Tagged With: A Sense of Obligation, Cat Gardiner, Dearest Friends, Decisions and Consequences, Denial of Conscience, I Promise To, Letters from the Heart, Love Lasts Longest, M.J. Rose, Mr. Darcy to the Rescue, No Cause to Repine, Pamela Lynne, Promises Kept, Rose Fairbanks, Sketching Character, The Secret Language of Stones, Victoria Kincaid, Zoe Burton
|
cc/2020-05/en_middle_0087.json.gz/line1341341
|
__label__wiki
| 0.930858
| 0.930858
|
About the Science Council
Science Council terms of reference and code of practice.
The FSA Science Council is an independent expert committee of the Food Standards Agency (FSA), comprising a Chair and up to seven members.
It provides high-level, expert strategic insight, challenge and advice to the FSA’s Chief Scientific Adviser (CSA) and to the Board and executive of the FSA on the FSA's use of science to deliver FSA objectives. Its purpose is to help to ensure that the FSA identifies, sources, integrates and uses the best scientific evidence and expertise from all relevant disciplines to inform and evaluate its work. FSA defines science in a broad and inclusive way, including the natural, physical, social and economic, digital and data sciences.
The Council's advice focuses on how FSA can deploy scientific evidence and advice to deliver its current strategic priorities, to understand new developments - risks and opportunities - and to identify and develop new ways to do things better in the future.
The Council is constituted to work at a strategic level working across and bringing together insights from different disciplines. The Council forms a core group which is able to identify and to draw in wider inputs across relevant disciplines and perspectives to address the issues at hand.
Its members work across disciplines, think strategically, and understand how science can be used to influence and test policy and to achieve concrete impacts to benefit people.
The Council will work with the FSA to:
help to ensure that FSA science has impact through advising on how the FSA can deploy the best evidence and advice to identify and to address the FSA’s big issues now and in the future
help the FSA to identify and access wider sources and networks and expertise and evidence relevant to FSA’s objectives
advise the FSA on how it should address issues of strategic importance to the FSA that are not covered by an existing Scientific Advisory Committee or which relate to general principles
provide advice and challenge on how the FSA identifies, gathers and uses scientific evidence and advice, with a particular focus on two areas of priority for the FSA:
(i) how the FSA uses and combines different strands of evidence and advice in its decision-making
(ii) the work of FSA Scientific Advisory Committees and how the FSA works with them to identify and define needs for SAC advice and co-ordinate its delivery, and how this advice is used by the FSA
advise on any other matters relating to the FSA's science as required by the FSA
The Council may also flag issues of strategic importance for the FSA which the FSA has not itself identified, for possible consideration.
Ways of working
Independence and transparency
The Science Council is an independent SAC which operates to the highest standards of openness and transparency. It will work in accordance with guidelines by the FSA and relevant guidance and rules established across Government for the operation of Scientific Advisory Committees. These include:
The cross-Government Code of Practice for Scientific Advisory Committees (CoPSAC), which includes the Principles of Scientific Advice to Government
The FSA's Good Practice Guidelines for Scientific Advisory Committees (SACs)
Key elements of practice which underpin and assure this include:
Council meeting agendas, papers, minutes and reports are published and meetings are open to the public.
The Council publishes an annual report and the Council Chair will report to the FSA Board annually at an open Board meeting.
The Council Chair has the right of direct access to the FSA’s CSA and Chief Executive (CE), and to FSA Board members (via the Agency Chair), at all times. Members also have the right of access to the CSA, the CE and Board on any matter which they believe raises important issues relating to their duties as a member.
In addition to regular contact between meetings, the Council Chair and FSA CSA will meet for a feedback discussion each year to review the work of the Committee against its remit, and the relationship with and support from the FSA.
The Council Chair will meet the FSA Chair annually to discuss the work of the Council.
The Science Council is supported by a Secretariat provided by the FSA.
The Council's work programme will focus on high-level, cross-cutting issues identified by the FSA (the Council may also flag issues of importance to the FSA for possible consideration. Current strategic issues which are likely to form part of the Council's considerations include:
strategic use of science
data exploitation
effective and sustainable food regulation and assurance
food futures
understanding vulnerabilities
people’s perspectives.
In addressing these issues the Council will work with the FSA to understand the context of the issue and what FSA is seeking to achieve. In responding to this and formulating its advice it will normally generate its own content and intellectual input and generate and convene informed discussion and analysis on strategic issues, rather than reviewing detailed papers produced by the FSA.
Its outputs will include short reports on collective insights on big issues; it will also work with FSA to convene wider discussions, events or initiatives to generate and synthesise insights from wider groups on specific issues.
The Council Chair will work closely with the FSA CSA to develop and prioritise the Council's work programme, in line with its remit.
The FSA CSA and the Council Chair and members will maintain regular communications between meetings, including through monthly teleconferences. Notes of teleconferences will be published.
As part of its work programme the Science Council will hold two open meetings a year. These will usually consist of a short, general update session reviewing developments in work by the FSA and by the Council work, as a whole, followed by a themed session devoted to a specific issue (likely to be more of a workshop mode). These meetings will also ensure that the Council discusses in public the key issues and outcomes from its work, including work between meetings.
We expect to work with the Council to develop and use online tools to support its work and communications both at and between meetings.
The Council will establish and engage with wider networks of experts, including with other SACs whose work is relevant to the FSA.
Science Council code of practice(231.91 KB)
Help us improve food.gov.uk
What you were doing *
Science Council members
Science Council Freedom of Information Act requests
Science Council meetings
Science Council reports
Science Council subgroups
Paul A. Nunn
Science Council Secretariat
Floors 6 & 7, Clive House,
70 Petty France,
London, SW1H 9EX
email: sciencecouncil@food.gov.uk
|
cc/2020-05/en_middle_0087.json.gz/line1341345
|
__label__cc
| 0.53935
| 0.46065
|
Southern Arc Commences Airborne Geophysical Survey At West Lombok
September 6, 2011 – Vancouver, BC – Southern Arc Minerals Inc. (TSX-V: SA) is pleased to announce the commencement of a helicopter magnetic and radiometric survey over its entire West Lombok property. The survey plans to define both near-surface and buried copper-gold porphyry targets within the 13km by 7km Selodong-Mencanngah-Pelangan mineralized structural corridor. The detailed geophysical survey is being flown by GPX Surveys and will total some 2,420 line kilometres, with North/South oriented flight lines flown at 50m spacings over the entire property.
Newmont Mining, the previous tenement holder, flew regional airborne magnetic and radiometric surveys with line spacings ranging from 200m to 1000m. Southern Arc’s magnetic inversion modeling of the Newmont data identified a number of near-surface magnetic anomaly targets. These magnetic anomalies coincide with structural intersections, locally elevated gold-copper-molybdenum soil geochemistry, and porphyry lithocap-related alteration assemblages that have been confirmed by clay spectral analysis. Geological mapping has also identified associated porphyry-style quartz stockwork veining at some of these localities. The combination of these features are interpreted as being related to both near-surface and deeper intrusive stocks with related porphyry-style alteration and mineralization. The detailed geophysical survey is expected to further refine these targets for drilling while identifying additional targets in the area.
The data acquisition phase of the survey is expected to be completed within the next 7 to 10 days and the new geophysical data will then be modeled and interpreted by leading geophysical consultants using state of the art processing methods. Southern Arc will also undertake Induced Polarization (IP) and resistivity ground geophysical surveys to further refine selected porphyry copper- gold targets that are to be drill tested in late Q4-2011, following the current drill campaign that is testing the strike length of gold-bearing epithermal mineralized structural breccia bodies at the Mencanggah prospect.
“John Proust”
Chairman and CEO
About Southern Arc
Southern Arc Minerals Inc. is an Indonesia-based Canadian mineral exploration company with an aggressive exploration, acquisition and growth strategy. The Company’s portfolio includes four exploration projects with epithermal gold and gold-copper porphyry prospects on the Lombok and Sumbawa islands in Indonesia, three of which are being advanced in partnership with major mining companies Vale and Newcrest. The Company’s key exploration property is its West Lombok project, with several gold-rich copper porphyry and epithermal gold vein prospects. Southern Arc is listed on the TSX Venture Exchange under the symbol SA. More information is available at www.southernarcminerals.com or by emailing This email address is being protected from spambots. You need JavaScript enabled to view it..
Southern Arc Contact
Rhylin Bailie
Vice President, Communications & Investor Relations
This news release contains forward-looking statements relating to expected or anticipated future events and operations, timing of projects and anticipated results that are forward-looking in nature and, as a result, are subject to certain risks and uncertainties, such as general economic, market and business conditions, the regulatory process and actions, technical issues, new legislation, competitive and general economic factors and conditions, the uncertainties resulting from potential delays or changes in plans, the occurrence of unexpected events, and the company's capability to execute and implement future plans. Actual results achieved may vary from the information provided herein as a result of numerous known and unknown risks and uncertainties and other factors. There is no representation by the company that actual results achieved during the forecast period will be the same in whole or in part as that forecast.
Neither the TSX Venture Exchange nor its Regulation Services Provider (as such term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release.
|
cc/2020-05/en_middle_0087.json.gz/line1341350
|
__label__wiki
| 0.585237
| 0.585237
|
CELEBRITY INTERVIEWS, LACED CELEBRITY
GBoogie talks to Donell Jones about his new single with David Banner, his thoughts on today’s R&B artists like Bryson Tiller and more!!
Posted by southernlaced on June 3, 2016 June 2, 2018
Photo Courtesy of Donell Jones/TopFlyMedia.com
Me and Donell Jones go way back. I don’t know him personally, but I can remember vividly the sad day I played “Where I Wanna Be” to my childhood girlfriend to explain in song why we had to break up. A lame story I know… But the fact that his music was so real and relatable to everyday situations, even to a little kid in Mississippi, speaks to his talent as a writer, singer, and producer. So it was an honor and slightly surreal for me when I got a chance to talk with him about his music, the current state of R&B and more.
Q: What’s up it’s an honor to have an opportunity to talk to you. What’s the new single called? And how did my hometown guy David Banner end up featuring on it?
A: The song is called “Never Let Her Go” and the collab with David Banner seemed like it was meant to happen. I ran into him in Stone Mountain, we talked about doing some music and exchanged numbers. I called him and it happened real natural, no managers or anything involved.
CLICK HERE TO LISTEN TO “NEVER LET HER GO” FEATURING DAVID BANNER
Q: Can you give me a little background on the new single?
Well, on my “Where I Wanna Be” album I had a song called “Have You Seen Her”. The story behind that song was that I saw this chick at the light and she was so fly, I didn’t say nothin’. So the new song picks up 16 years later. It’s like a sequel.
Q: What’s your new album called?
A: It’s gonna be called “Twenty”. But that’s still in development, I mainly wanted to come with something… to have come from the “Unsung” episode.
WATCH THE STORY OF DONELL JONES
Q: I feel you on that. Well, for me, growing up I always looked at you right there with the R. Kelly’s, the Joes, the Ushers, but I associate the show “Unsung” as a show highlighting artists that really didn’t get their due credit. Why Unsung?
A: Well, I just think not as many people knew me as they did those guys. I saw Unsung as an opportunity to get my story out there. Who I am and what my story is.
Q: I hear a lot of Stevie Wonder and Michael Jackson influence in your music. Were those major influences? And who else influenced you?
A: Definitely those two were two of my main major influences. Also the Isleys, Babyface, Alicia Myers, Jean Carne, Patrice Rushen. My Mom used to play a lot of great music… Teddy Pendergrass… I could go on for days.
Q: I, as well as, many other people loved the cover you did of Stevie Wonder’s “Knocks Me Off My Feet”. You thinking about doing any particular covers on the new album?
A: I got lucky on the Stevie cover. I promised myself I wouldn’t do any more covers because they are hit or miss.
Q: I think most people would say that popular R&B has changed since the 90s and early 2000s era. Can you pinpoint any differences between today and then?
A: The thing about the era I came into is everybody had their own sound. And everybody wrote from their own perspective. You had R. Kelly with the sex, me and Joe did the relationship stuff… you had Maxwell…
A lot of it sounds the same these days, using the same sounds and going a little 808 crazy. There was more live instrumentation in the production back in the day. But that’s not a knock on the new guys. I love the evolution. I actually think they could have held their own back in the day. I wouldn’t say R&B is better or worse now.
Q: Who stands out in the R&B game to you right now?
A: Well, today, I wouldn’t even categorize a lot of it as R&B. It’s Pop disguised as R&B. But I definitely like Bryson Tiller, the Weeknd, Trey Songz, Chris Brown.
Q: Well, I appreciate the opportunity to talk with you, Fam. One last question, how would you describe your style?
A: My style has always been street soul. Something the guys can listen to and the females can listen to and know how we rock.
A: Dope. Thanks again.
To find out more about Donell Jones, visit his WEBSITE and follow him on TWITTER, INSTAGRAM, and FACEBOOK. Download his new single “Never Let Her Go” featuring David Banner on iTunes.
– GBoogie the Scorpio
Follow GBoogie the Scorpio on INSTAGRAM. Read his bio and listen to his music on WORDPRESS. For feature inquiries on Southern Laced, reach him via email at GBoogietheScorpio@southernlaced.com.
Bryson TillerDavid BannerDonell JonesGBoogieMusicNever Let Her Go
Previous Post Relationship Coach Teaches the Difference Between Feeling In Love and Actually Loving Someone
Next Post GBoogie talks to entertainment attorney Kamel King about the importance of artists protecting their work, how he got the name “The Copyright King” and more!
Eboni Brown says:
This is a good article it’s always interesting to find good artists that have made good music in the past and now. Donnell Jones was always one of my favorite artists in the nineties still listen to those songs today!!!
Jarmesia Janaye says:
Wonderful article! Not one of my favorite artist but I did like two of his songs especially the one with left eye! It’s good he still doing music maybe he will bring back the old r&b
Kelly Stone says:
I absolutely love Donell Jones!!! He is one of my favorite singers. I look forward to hearing his new music. Thanks for visiting Southern Laced!
Amanda Brown says:
Great job… Continue the good work n keep the positive vibes going…
Lacretia says:
Donell Jones has always been one of my favorites. This is a very insightful interview, and Im looking forward to his upcoming album.
Ises says:
My boy Boog doing big things as usual
Tiarra says:
Good read; I’m a big fan of Mr. Jones, lol I knew I could sing “Where I wanna be” lol couldn’t hit one note but that was good R&B, gone have to check that “Unsung” episode out; makes me wanna redo my oldie R&B mix; #hits #realmusic
Aleta says:
Great article/interview!!! Keep it up
Bridget Monique says:
OMG!!!! I love him!!!
Courtney Patton says:
Great Article, he is one of my favorite artist so real and raw…I used to keep him on repeat. “Where I want to be'” was the truth. I’m looking forward to his new project!!!
Pingback: Celebrating Our 300th Post! | Southern Laced
Pingback: Southern Laced 2016 Year in Review | Southern Laced
Pingback: Advertising on Southern Laced – SOUTHERN LACED
Leave a Reply to Ises Cancel reply
|
cc/2020-05/en_middle_0087.json.gz/line1341351
|
__label__wiki
| 0.654803
| 0.654803
|
Logs (records) (38)
Technical manuals (24)
Aeronautics (1100)
Astronautics (144)
Astronautical museums (119)
Air pilots (104)
Airlines (49)
Airships (49)
Rockets (Aeronautics) (47)
Aircraft industry (46)
Rocketry (40)
Space flight (40)
Helicopters (33)
Manned space flight (33)
Douglas airplanes (29)
Flight training (25)
National Air and Space Museum (44)
Boeing Aerospace Company (38)
National Aeronautics and Space Administration (35)
Pan American World Airways, Inc. (28)
United States. Navy (28)
Early Birds of Aviation (Organization). (27)
Lockheed Corporation (26)
National Air and Space Museum. Space History Division (25)
North American Aviation, Inc. (23)
Wright, Wilbur (22)
Wright, Orville (21)
Curtiss, Glenn Hammond (20)
Earhart, Amelia (17)
United States. National Aeronautics and Space Administration (17)
Bell Aircraft Corporation (16)
Curtiss-Wright Corporation (16)
National Air and Space Museum. Office of the Director (16)
Lindbergh, Charles A. (Charles Augustus) (15)
National Air and Space Museum (U.S.) (15)
Project Apollo (U.S.) (15)
United States. Air Force (15)
United States. Army. Air Corps (14)
Wright Aeronautical Corporation (13)
National Air and Space Museum. Department of Aeronautics (12)
Curtiss Aeroplane and Motor Company (11)
DeVorkin, David H., 1944- (11)
Sikorsky Aircraft (Firm) (11)
United States. Army Air Forces (11)
Brule? Indians (1)
Bulgarians (1)
Chinese Americans (1)
Chiricahua Indians (1)
Chumash Indians (1)
Tlingit Indians (1)
Outer space (16)
Arctic regions (5)
Hiroshima-shi (Japan) (3)
Bolling Air Force Base (Washington, D.C.) (2)
Africa, Central (1)
Amazonas (Brazil) (1)
American Polynesia (1)
Atacama Desert (Chile) (1)
National Air and Space Museum Archives (983)
Anacostia Community Museum Archives (2)
Query: Aeronautics -- Collectibles
Mahr, Burnley
bulk [ca. 1960s-1970s]
1.09 Cubic Feet ((1 records center box))
This collection contains materials from Mahr's work on the following projects: EOS Landsat, Orbiter, LST Hubble, Navaho, Skylab, Apollo, and the Shuttle Robot Retrieval Arm. In addition, there are also promotional materials from Rockwell International's Space Division pertaining to various spacecraft.
Hermann Oberth Collection
Oberth, Hermann, 1894-1989
0.23 Cubic Feet ((1 slim legal document box))
This collection consists of material in German and English documenting Oberth's life and career in the field of astronautics. The information includes six photographs, an article written by him for Space Journal, correspondence between Dr. Oberth and the donor Anton Palmai, and four books, three of which are in German.
Stratospheric Ballooning (Skyhook) Collection
[ca. 1940s-1960s]
2.18 Cubic Feet ((2 records center boxes))
This collection consists of photographs, correspondence, reports, clippings and press kits, mostly centering on the following ballooning topics: Project Skyhook, Project Helios, Stratoscope I and II and Stratolab. There is also material on general ballooning events, the Vanguard satellite and the VTOL.
Charles Y. Johnson Collection
Johnson, Charles Yothers, 1920-
5.15 Cubic Feet ((7 legal document boxes) (3 flatboxes))
This collection consists of a great variety of material relating to experiments performed at NRL. Included are reports, photographs, transparencies, rolled data and 167 glass slides.
Emile and Henry A. Berliner Collection
Berliner, Emile, 1851-1929
Berliner, Henry Adler
0.95 Cubic Feet ((1 legal document box) (2 flatboxes))
NASM.XXXX.0247
This collection consists of two scrapbooks and several folders of correspondence, bills and accounting information involving early attempts to develop a flying machine, the flights of the Langley Aerodrome, and the flights of the Wright Brothers at Fort Myer in 1904 and 1908. Covered in detail are the unsuccessful attempts of Emile Berliner and his...
Mallie Ivie WAF Collection
Ivie, Mallie J., 1930-1975
0.47 Cubic Feet ((1 flat box))
This donation includes a scrapbook and two yearbooks, one from Lowry Air Force Base in 1949 and the other from Barksdale Air Force Base in 1950. The scrapbook was compiled by Corporal Ivie and relates to her time with the WAFs, including both service-related and social activities. Included in the scrapbook are numerous newspaper clippings related t...
Barbara L. Clarke Collection
Clarke, Barbara Lou.
0.18 Cubic Feet ((1 box))
This donation consists of one copy of TM 1-205, Air Navigation; one copy of Instrument Flight Part One: Basic Air Work; one copy of Instrument Flying Advanced Theory and Practice; and a scrapbook detailing Clarke's time in the Navy. The scrapbook is separated into two sections: LITIS and CNTS. The first section of the scrapbook focuses on Link Inst...
Enola Gay Exhibition Records
1 cu. ft. (1 record storage box)
This accession consists of records created and maintained by Martin Harwit, Director of the National Air and Space Museum (NASM), 1987-1995, documenting plans to exhibit the "Enola Gay" and the resulting controversy. A script for "The Crossroads: The End of World War II, the Atomic Bomb and the Origins of the Cold War" was released for comment...
Boeing B-29 Superfortress Silverplate Photographs [Brownley]
Brownley, Eunice L. Brownson, 1919-2014
Circa late 1945
0.01 Cubic feet (1 folder)
This collection consists of two black and white photographs taken by Eunice L. Brownson Brownley on Tinian, Northern Mariana Islands, circa late 1945.
National Air Races Scrapbooks
0.24 Cubic feet (1 box)
Begun in 1920, the National Air Races were an annual, week-long event including formation flying, parachute drops, aerobatic displays, and races. The event included two privately sponsored, closed-circuit speed races: the Pulitzer Trophy race held from 1920 to 1925 and the Thompson Trophy race held from 1930 to 1939. Along with other competitions, the National Air Races fostered the development of aircraft in the 1920s and 1930s but ended during World War II. This collection consists of three unbound scrapbooks with newspaper clippings related to races in Chicago, Cleveland, and Los Angeles between 1928 and 1933.
|
cc/2020-05/en_middle_0087.json.gz/line1341352
|
__label__cc
| 0.520859
| 0.479141
|
Audiotapes (135)
Videotapes (110)
Business records (108)
Memorandums (51)
World War (30)
Historical museums (28)
Warshaw, Isadore, d. 1969 (57)
Smithsonian Folklife Festival (46)
Smithsonian Institution. Center for Folklife and Cultural Heritage (44)
Mechanical and Civil Engineering, Division of [former name], NMAH, SI. (17)
Work and Industry, Division of, NMAH, SI (16)
National Museum of American History. Office of the Director (13)
DeVincent, Sam (11)
Transportation, Division of, NMAH, SI. (10)
Electricity and Modern Physics, Division of, NMAH, SI. (9)
Engineering and Industry, Division of, NMAH, SI. (9)
Evergood, Philip (9)
History of Technology, Division of, NMAH, SI (9)
Anacostia Community Museum (8)
Community Life, Div. of, NMAH, SI (8)
Marsh, Reginald (8)
National Portrait Gallery, Office of Exhibitions (8)
United States. Army (8)
Zorach, William (8)
Allied Forces. Supreme Headquarters. Monuments, Fine Arts and Archives Section (7)
Du Bois, W. E. B. (William Edward Burghardt) (7)
Miró, Joan, 1893- (7)
Whitney Museum of American Art (7)
American Federation of Arts (6)
Omaha Indians (3)
Ponca Indians (3)
Athapascan Indians (2)
Biloxi Indians (2)
Creek Indians (2)
Crow Indians (2)
Caribbean Area (21)
Mall, The (Washington, D.C.) (8)
National Air and Space Museum Archives (71)
National Museum of African American History and Culture (21)
Archives of American Gardens (10)
Human Studies Film Archives (1)
Query: National Museum of American History (U.S.). Division of Armed Forces History
Schmitt, Waldo L. (Waldo Lasalle), 1887-1977.
79.56 cu. ft. (6 record storage boxes) (121 document boxes) (2 half document boxes) (4 12x17 boxes) (60 3x5 boxes) (3 5x8 boxes) (2 film boxes) (oversize material)
The papers of Waldo LaSalle Schmitt provide comprehensive documentation of his professional career, 1907-1977. They also illustrate, to a lesser degree, his personal life. Particularly well represented in the papers is material concerning Schmitt's carcinological research, his curatorial and administrative careers at the United States Nat...
William Jones Rhees Collection
Rhees, William Jones, 1830-1907
25.72 cu. ft. (50 document boxes) (2 5x8 boxes)
The William J. Rhees Collection consists of the remains of his Manuscript and Newspaper Scrap portfolio files. The dates of the material indicate that Rhees was collecting these papers from the beginning of his tenure at the Smithsonian, but the files were not organized until 1891 when he was appointed keeper of the Archives. The collection ...
Henry P. Whitehead collection
Whitehead, Henry P. (Prenton), 1917-2002
156.91 Linear feet (178 boxes)
ACMA.06-042
Anacostia Community Museum Archives
The papers of historian Henry P. Whitehead measure 156.91 linear feet and date from 1843 to 2010 (bulk 1945-1986). The collection documents Whitehead's careers, as well as his family and personal life. The collection also includes the personal papers of Tomlinson D. Todd, Elizabeth B. Delaney and the Howard Theatre Foundation. The combined collection is comprised of black theatrical memorabilia; materials relating to civil rights activities in the District of Columbia; and the African American experience in general. Included are playbills, sheet music, admission tickets, newspapers, magazines, books, photographs, clippings, flyers, brochures, pamphlets, sound recordings, research files, and other material.
W.G. Constable papers
Constable, W. G. (William George), 1887-1976
AAA.conswmgp
The papers of art historian and museum curator W.G. (William George) Constable measure 25.7 linear feet and date from 1905 to 1981, with the bulk of the material from 1920 to 1976. The papers include biographical material; professional and personal correspondence; extensive lectures, writings, and notes; exhibition and book research files; printed materials; and photographs, glass plate negatives, and slides. There is substantive correspondence related to Constable's participation in the American Defense Harvard Group and about the formation of the Roberts Commission, including correspondence with Ralph Perry, Hugh Hencken, Paul Sachs and George L. Stout. There are numerous official reports prepared by Constable after World War II for the U. S. Office of Military Government for Germany.
Arthur d'Arazien Industrial Photographs
d'Arazien, Arthur
11 Cubic feet (21 boxes)
The collection includes Arthur d'Arazien's professional work in industrial photography from the late 1940's through about 1981; personal creative photography and other types of professional work were retained by Mr. d'Arazien or placed elsewhere. Thus this collection is a very cohesive, unified body of work, which documents primarily American (and...
Audiovisual Recordings
National Museum of Natural History, Office of Public Affairs
This accession consists of audiovisual recordings featuring the National Museum of Natural History (NMNH) and its staff, activities, events, research, exhibitions, and objects. Some materials were created by NMNH and others were created by news media and radio, television, and video production companies. Included in this accession are int...
George Leslie Stout papers
Stout, George L. (George Leslie)
6 Linear feet
AAA.stougeor
The papers of conservator and museum director George Leslie Stout measure 6 linear feet and date from 1855, 1897-1978. Stout was head of the conservation department at Harvard University's Fogg Art Museum, director of the Worcester Art Museum and Isabella Stewart Gardner Museum in Massachusetts, and a member of the Monuments, Fine Art and Archives (MFAA) Section of the U.S. Army during World War II. The bulk of the collection consists of correspondence with family, friends, colleagues and professional associations. There are letters from fellow Monuments Men who served in the MFAA section such as Thomas Carr Howe, Ardelia Hall, Lamont Moore, Theodore Sizer, Langdon Warner and several other prominent arts administrators. The papers also contain biographical materials, writings, sketches and one sketchbook, military records, printed materials, and photographs.
Paul E. Garber Collection
Garber, Paul Edward, 1899-1992
241.95 Cubic feet (488 boxes plus flat files)
The Paul E. Garber Collection documents Paul Edward Garber's life, both personal and professional, prior to and during his 72-year tenure at the National Air and Space Museum.
Sam DeVincent Collection of Illustrated American Sheet Music, Series 8: Geography
DeVincent, Sam, 1918-1997
100 Boxes
NMAH.AC.0300.S08
Sam DeVincent loved music and art and began collecting sheet music with lithographs at an early age. Series 8: Geography is divided into three sections: the United States, Foreign Countries, and Natural Features. An overview to the entire DeVincent collection is available here: Sam DeVincent Collection of Illustrated American Sheet Music.
Legal Documents Concerning Slavery Collection
Maynard, Thomas
Clark, Julie
1 Cubic foot (2 boxes)
A collection of a variety of legal documents that relate to slavery and African-Americans.
|
cc/2020-05/en_middle_0087.json.gz/line1341353
|
__label__cc
| 0.663007
| 0.336993
|
Clothing Saved by the Copyright Bell
This entry was posted on September 5, 2014, in Copyright Law, Entertainment Business, Fashion, Film, Intellectual Property, Television, Trademark Law and tagged 90s television, Brandir International, clothing, Copyright Law, Inc. v. Cascade Pacific Lumber Co., Louboutin red-soles, Screech, Unauthorized Saved By The Bell Story, Urkel. Bookmark the permalink. 3 Comments
I’m going to admit it. I watched the The Unauthorized Saved by The Bell Story made-for-TV movie on Lifetime this past Sunday. [Raises hand] “Hi, I’m Ryanne, and I oftentimes will watch horrible mind-numbing television.” Don’t judge. We all have our guilty pleasures.
Several hours before the premiere of the movie, the Hollywood Reporter released a story located HERE about how many of the signature clothing looks, for example Screech’s suspenders and Lisa Turtle’s over the top hats, would not be seen. In the interview, the wardrobe person for the made-for-TV film stated she could not show or mimic some of those signature pieces due to copyright law. The costume designer explains in detail the lengths she went to in order to avoid infringing on the copyright held in the original costumes featured on the television show.
But, was all that necessary? I think there are strong arguments to say it was not. In a very general sense, the law does not offer copyright protection to clothing. The reasoning behind this is that clothing, while it may be pretty and stylish, serves the primary purpose of being utilitarian. Meaning, to provide protection from the elements, such as protection to our feet with those red-soled Louboutin heels and keeping us warm in the winter with that ever so stylish Tory Burch sweater. While there are some creative elements to the clothing, the primary purpose of it being utilitarian trumps the creative aspect and copyright protection does not exist.
Of course, if the rule were so simple we would not need intellectual property attorneys, like yours truly. The rule becomes more complicated when you look at some of the major exceptions. Fabric patterns are usually one aspect that do fall under the scope of copyright protection. If an aspect of the clothing can be separated from the utilitarian (or functional part) of the clothing, and meets the other requirements for original authorship fixed in a tangible medium, then it can be subject to copyright protection. Think the Coach® fabric design on handbags.
The cornerstone case that discusses the ability to remove the creative elements from the utilitarian aspect is Brandir International, Inc. v. Cascade Pacific Lumber Co. The case stated, “if design elements reflect a merger of aesthetic and functional considerations, the artistic aspects of a work cannot be said to be conceptually separable from the utilitarian elements. Conversely, where design elements can be identified as reflecting the designer’s artistic judgment exercised independently of functional influences, conceptual separability exists.” The court focused on whether the artistic features “can stand alone as a work of art traditionally conceived, and … the useful article in which it is embodied would be equally useful without it.”
Other intellectual property issues, such as trademark and patent, might also exist when it comes to clothing. Examples being the ability to receive a trademark on those red-soled heels or a trademark on the Coach® fabric design on the handbags.
Being an early 90s kid, Saved By The Bell was as much a part of my childhood as Easy Bake Ovens and Cabbage Patch Kids. I’ve seen a few episodes along with a few reruns. I hate to break it to the original wardrobe person for the television show, but the hats the character Lisa Turtle wore were not overly creative nor was there anything overly creative about the suspenders worn by Screech.
The hats and suspenders were not in every scene and the characters oftentimes appeared without their most signature looks. While they helped to give the characters some substance, they functioned on the show in a utilitarian way. It is even arguable that because Screech’s character was portrayed as a geek that suspenders is a characteristic that any “geek like” character in a sitcom would wear, along with perhaps also a pocket protector and eyeglasses held together by tape. Look at Urkel in Family Matters or “The Nerds,” characters from Saturday Night Live featuring Bill Murray and Gilda Radner.
Copyright law does not protect ideas, such as a nerdy character, but rather the original expression of those ideas. In all of the cases where a nerd or a geek character is portrayed there are overarching clothing type aspects used – glasses, suspenders, awkwardly styled clothing. There are certain ideas that are so “nonoriginal” to the portrayal of a character that it is not covered under copyright law, which is the case we have here.
I can appreciate the length the current wardrobe person went to in order to protect intellectual property rights. It was certainly a safer route given the probable budget for the made-for-TV movie. However, giving more of a nod to the original characters would probably not have put her in danger of infringing. The clothes functioned in the show in a more utilitarian way and were not separable from the characters themselves.
What do you think about the wardrobe’s person decision to avoid original elements? For my attorney readers, is there something I am missing? For an earlier post on fashion, be sure to read The Price of Fashion. Take part in the Comments section below and Stay Tuned In!
If you liked this post, please share it and click the FREE Subscription button above to get more! Follow and tweet to me on Twitter where I pass along the latest entertainment law, broadcasting and intellectual property news @RyanneDSaucier
Sharing & Following Makes You Feel Good:
3 thoughts on “Clothing Saved by the Copyright Bell”
Jim Rosenblatt says:
RyAnne
Keep these coming.
It was great seeing you this week.
Warm regards.
Jim Rosenblatt Professor of Law Mississippi College School of Law (MC Law) “Let Justice Roll”
Ryanne says:
Great to see you too! Thank you for the encouragement and support.
Pingback: Can I Resell That Knockoff Bag? | Statute of RyAnne
Take part in the conversation. What do you think? Cancel reply
« Etched Within Flesh – Inking Copyright
Case Study: Ad Agencies and Spec Spots »
|
cc/2020-05/en_middle_0087.json.gz/line1341364
|
__label__wiki
| 0.675348
| 0.675348
|
Mercy General Hospital
Mercy Hospital of Folsom
Mercy San Juan Medical Center
Methodist Hospital of Sacramento
Sr. Sheila Browne
Sr. Nora Mary Curtin, RSM
Sr. Michelle Gorman, RSM
Sr. Bridget McCarthy, RSM
Sr. Maura Power, RSM
Care for the Poor and Elderly
Gifts in Honor
Grateful Patients & Families
A Grateful Heart
Perinatal Bereavement
Mercy San Juan Medical Center NICU
Tom and Tammie Krebsbach
Grateful Patient Bill Vance
Family-Advised Funds
Plan Your Legacy
Employees Lend a Hand
Joan Gann
Dr. Dennis and Nancy Marks
Ritz Naygrow
Alex G. Spanos
Third-Party Events
Horizons Newsletter
Sister Nora Mary Curtin, RSM: A Simple Decision, a Lifetime of Service
For Sister Nora Mary Curtin, the decision that would dictate the direction of the rest of her life was made inside an Irish schoolroom. “I was at the Sisters of Mercy Secondary School in Abbeyfeale, Co. Limerick, Ireland, when Sister Mary Grace from the Sisters of Mercy of Auburn visited,” Sister Nora recalls. “She shared a bit about her life and the Sisters’ mission and ministry and asked if any of us were perhaps called to a religious vocation. During the previous year, I had been praying and discerning whether or not God may be calling me to religious life, and on that day I decided that this Mercy Auburn Community may be a good fit for me. I ended up joining the community shortly before my 18th birthday. It was really quite simple. I tell people that the biggest decision in my life was made in the simplest fashion!”
That was about 50 years ago, and Sister Nora has been a tireless and dedicated member of the community ever since. She graduated from Sacramento City College with her RN degree in 1973 and went on to work at both Mercy General Hospital and Mercy Medical Center Redding. In 1978, Sister Nora arrived at Mercy San Juan Medical Center and three years later, decided it was time to further her education. Sister Nora attended the University of San Francisco and got her BSN and MS degree in Nursing, and was delighted to be assigned back to Mercy San Juan when she graduated. “From the moment I arrived here, Mercy San Juan has been filled with welcoming, friendly people. It’s truly the culture here, to accept everyone and support each other.”
Sister Nora has served as Manager of Mercy San Juan’s Neuroscience Unit since the unit began in 2009. She oversees a team of approximately 75 staff members. “I am so fortunate to work with these people,” Sister Nora says. “Everyone is so dedicated to their work. About 40% of the registered nursing (RN) staff studied and passed the national exam to become neuro-certified (CNRN). And many others are working toward that goal as well. They are remarkable!”
Beyond the dedication of the staff, Sister Nora also points to Mercy San Juan’s world-class technology as setting its neurological care apart. “It is amazing to see the resources we have now for treating our patients. For example, you look at patients who have suffered a stroke, fifteen years ago there may not have been much we could do for them, but now we have a variety of treatment options. Technology such as telemedicine and the Elliott robot—funded by the generosity of Mercy Foundation donors—help to provide critical care. Today, many stroke survivors recover and go on to live healthy and productive lives. The outcomes are truly miraculous.”
Through the many changes she has seen in health care over the years, Sister Nora says one thing remains a constant —connecting with people. “It is gratifying to connect with the many volunteers and grateful patients who give generously of themselves to support our health care ministry. That is what makes my day—connection! I so enjoy talking with the patients and with their loved ones—listening to them, calming them, helping them. It all makes you feel like you have done something incredibly meaningful. This work is very rewarding, and I truly enjoy it.”
It was really quite simple. I tell people that the biggest decision in my life was made in the simplest fashion!”
Sr. Nora Curtin, RSM
© 2014 Mercy Foundation. All Rights Reserved.
|
cc/2020-05/en_middle_0087.json.gz/line1341371
|
__label__cc
| 0.525731
| 0.474269
|
In April 2019 Hyundai Plug-In Electric Car Sales Tripled
Hyundai continues its rapid growth of plug-in electric car sales, reaching in April a result of 6,807, which is 195% more than a year earlier at 4.3% of its total volume globally. That brings the year-to-date amount to 23,843 (up 78%).
Chevy EUV Is Rehash Of The Bolt, But Over-The-Air Updates Coming
We expect big things from General Motors when it comes to electric cars, but it seems we are always disappointed. It has the resources and the talent to be a world leader, yet somehow it continues to offer blue sky blandishments while delivering next to nothing of substance.
Unu launches affordable 2nd gen electric scooter with 100 km range
Unu completely redesigned their classic scooter, drawing on help from partners including Bosch and LG. The new scooter features a Bosch hub motor mounted in the rear singled-sided swingarm and removable batteries made by LG.
Ferrari Hybrid Supercar To Feature V8, Three Electric Motors?
Not a day goes by without hearing or seeing something new related to Ferrari’s electrified supercar. Case in point, reputable German magazine Auto Motor und Sport has just published an article about the new hybrid from Maranello, which will debut at the end of May. AMS says the range-topping model will pack nearly 1,000 horsepower as per the leaked invitation from earlier this month, and now we know where that power is going to come from.
Apple tried to buy Tesla a few years ago, report says
Apple reportedly offered to buy Tesla at around $240 per share back in 2013.
|
cc/2020-05/en_middle_0087.json.gz/line1341376
|
__label__cc
| 0.736259
| 0.263741
|
Tag Archives: Shaun Robinson
#RedCarpet Review: #2015SAGAwards #BestDressed Gallery, Featuring Sofia Vergara, Jennifer Aniston, Emmy Rossum, & More!
Last night’s Screen Actor’s Guild Awards were full of red carpet surprises from veteran A-listers like Cake nominee Jennifer Aniston (in vintage Galliano), Birdman‘s Emma Stone (in Dior Couture), America’s sweetheart Julia Roberts (in Givenchy), Homeland‘s Claire Danes (in Marc Jacobs), & last year’s it-girl, Lupita Nyong’o (in Elie Saab). Also, there were plenty of newcomers who made an impact, including many Orange is the New Black winners like Uzo Aduba (in Angel Sanchez) & Danielle Brooks (in Christian Siriano), as well as Game of Thrones‘ Maisie Williams (in Self-Portrait).
Some of my favorites of the night included The Imitation Game nominee Keira Knightley (in Erdem), Wild‘s Reese Witherspoon (in Atelier Versace), model & wife, Camila Alves McConauhey (in Donna Karan), designer darling Emmy Rossum (in Armani Prive), Modern Family‘s rising star Sarah Hyland (in Vera Wang), St. Vincent nominee Naomi Watts (in Balenciaga), How to Get Away with Murder winner Viola Davis (in Max Mara), & this season’s golden girl, Still Alice winner, Julianne Moore (in Givenchy).
Now the official countdown to the Academy Awards can begin, which takes place on Sunday February 22nd, sure to wow & inspire more amazing style. Who wore your favorite look? What trends are you still talking about? For all the latest on this awards season, check out previous Red Carpet Review posts with complete galleries from the Golden Globe Awards & Critic’s Choice Awards. If that isn’t enough, get more celebrity inspiration from Style Darling‘s spring dress predictions featuring Kerry Washington & Allison Williams, how to style a statement necklace like Katy Perry or Emma Roberts, & Jennifer Lopez’s stylish press tour for her new movie, The Boy Next Door! Happy Styling!
Posted in Red Carpet Review, Style Darling Daily | Tagged Aiisha Ramadan, Alysia Reiner, Amanda Peet, Amy Poehler, Amy Ryan, Andrea Riseborough, Angel Sanchez, Anna Chlunsky, Ariel Winter, Armani Prive, Atelier Versace, Badgley Mischka, Balenciaga, best dressed, Bibhu Mohaptra, Brian Atwood, Bulgari, Caitriona Balfe, Camila Alves McConauhey, Cartier, celebrity, celebrity inspiration, Chelsea Peretti, Chopard, Christian Loubourin, Christian Siriano, Claire Danes, Dana Rebecca Designs, Danielle Brooks, Dascha Polanco, David Wedd, Delicity Jones, Dennis Basso, Diane guerrero, Dior Couture, Donna Karan, Edie Falbo, Edie Parker, Elie Saab, Elisabetta Franchi, Emanuel Ungaro, Emilia Clarke, Emma Stone, Emmy Rossum, Erdem, Escada, fashion, Fred Leighton, Galliano, Gemy Maalouf, Georges Hobeika, Giambattista Valli, Gianvito Rossi, Gilles, Givenchy, Grethcen Mol, Gwendoline Christie, Harry Winston, Haute Couture, Honor, Irene Neuwirth, Ivanka Trump, J. Mendel, Jacob & Co., Jennifer Aniston, Jenny Packham, Jerome C. Rousseau, Joanne Froggatt, Johanna Johnson, Judith Leiber, Julia Louis-Dreyfus, Julia Roberts, Julianna Margulies, Julianne Moore, Julie Bowen, Kaley Cuoc-Sweeting, Kay Jewelers, Kelly Macdonald, Kelly Osbourne, Kimberly McDonald, Kimiko Glenn, Laura Carmichael, Lauren Lapkus, Laurena Sarbu, Laverne Cox, Lorelei Linklater, Lupita Nyong'o, Maggie Gyllenhaal, Maisie Williams, Marc Jacobs, Maria Menounos, Max Mara, Maxime Simoens, Mayim Biliak, Melissa Fumero, Melissa Rauch, Meryl Streep, Molly Parker, Monique Lhuillier, Moschino, Naeem Khan, Naomi Watts, Natalie Dormer, Natasha Lyonne, Neil Lane, Norman Silverman, Oscar de la Renta, Osman, Pamella Roland, Patricia Arquette, Paula Patton, Paule Ka, Proenza Schouler, Randi Rahm, Rashida Jones, Rauwolf, red carpet, Red Carpet Review, Reese Witherspoon, Repossi, Rodo, Romona Keveza, Rosamund Pike, Rubin Singer, SAGs, Salvatore Ferragamo, Sarah Hyland, Sarah Paulson, Screen Actors Guild Awards, Selenis Leyva, Self Portrait, Shaun Robinson, Sofia Vergara, Solace London, Solange Azagury Patridge, Sophia Bush, Sophie Turner, Stephanie Beatriz, Stuart Weitzman, style, style for days, style icon, Swarovski, Taryn Manning, Tatiana Maslany, Thakoon, Tiffany & Co., Uzo Adbua, Van Cleef & Arpels, Vera Wang, Vhernier, Vicki Sarge, Viola Davis, Vionnet, Vivienne Westwood, Zac Posen | Leave a comment
Red Carpet Review: The 2015 #GoldenGlobes Awards, Featuring Jennifer Lopez, Emma Stone, Amy Adams, & More!
The 2015 Golden Globes is upon us & already the show is an extravaganza in entertainment & movie madness. However, it’s the red carpet that has the fashion world buzzing, including some major trends in pops of color like red, cobalt, & yellow, as well as luxe metallics, plenty of cleavage from A-listers, pretty pastels, & dramatic ballgowns. Some of my favorite celebrities that hit the red carpet are Anna Kendrick (in Monique Lhuillier), Emma Stone (in Lanvin), Naomi Watts (in Gucci), Lupita Nyong’o (in Giambattista Valli), Jennifer Lopez (in Zuhair Murad), Dakota Johnston (in Chanel), Kate Mara (in Miu Miu), Diane Kruger (in Emilia Wickstead), & Kate Hudson (in Versace).
Other noteables are the always glamorous Reese Witherspoon (in Calvin Klein Collection), Jessica Chastain (in Atelier Versace), Kate Beckinsale (in Elie Saab), Allison Williams (in Armani Prive), Zosia Mamet (in Andrew Gn), Gina Rodriguez (in Badgley Mischka), & Amy Adams (in Versace). Who was your favorite on the red carpet? Which looks are you talking about the most?
For more fashionable posts, check out Runway Rundown galleries featuring Jenny Packham, Christian Siriano, & Oscar de la Renta, as well as how to get Girls-inspired style, affordable capes from Chic Nova & Romwe, & the top 10 Style Darlings to watch for in 2015! Happy Styling!
Posted in Red Carpet Review | Tagged 2015 Golden Globe Awards, Alexander McQueen, Allison Janney, Allison Tolman, Allison Williams, Amal Clooney, Amanda Peet, Amy Adams, Amy Poehler, Andrew Gn, Anna Faris, Anna Kendrick, Antonion Berardi, Atelier Versace, Badgley Mischka, Black Canary, Brooke Anderson, Bulgari, Calvin Klein Collection, Camilla Alves, Carolina Herrera, Cartier, Catherine Zeta-Jones, Chanel, Chrissy Teigen, Christian Siriano, Christine Baranski, Cindy Crawford, Claire Danes, Dakota Johnston, Danielle Brookes, Diane Kruger, Dior, Dolce & Gabbana, Donna Karan Atelier, Edie Falco, Edie Parker, Edition by Georges Chakra, Elettra Widermann, Elie Saab, Ella Zahlan, Ellie Kemper, Emilia Wickstead, Emily Blunt, Emma Stone, Emmanuelle Chriqui, ena Dunham, Felicity Huffman, Felicity Jones, Frances O'Connor, Fred Leighton, Giambattista Valli, Gina Rodriguez, Giorgio Armani, Giuliana Rancic, Givenchy Couture, Greer Grammar, Gucci, Heidi Klum, Helen Mirren, Hohan, J. Mendel, Jane Fonda, Jason Wu, Jemima Kirke, Jenna Dewan-Tatum, Jennifer Aniston, Jennifer Lopez, Jenny Packham, Jessica Chastain, Jessica Lange, Jimmy Choo, Jo Champa, Julia GOldani Telles, Julia Louis-Dreyfus, Julianna Margulies, Julianne Moore, Kate Beckinsale, Kate Hudson, Kate Mara, Katherine Heigl, Katie Cassidy, Katie Holmes, Kaufmanfranco, Keira Knightley, Kelly Osbourne, Kerry Washington, Kimberly McDonald, Kristen Wiig, Kristin Dos Santos, Kwiat, Lana Del Rey, Lanvin, Laura Carmichael, Laura Prepon, Leslie Mann, Lorde, Lorena Sarbu, Louise Roe, Lupita Nyong'o, Maggie Gyllenhaal, Marchesa, Maria Lucia, Maria Meounos, Mary Katrantzou, Maura Tierney, Melssa McCarthy, Michael Kors, Michelle Monaghan, Miu Miu, Monique Lhuillier, Naeem Khan, Nancy O'Dell, Naomi Watts, Natalie Morales, Natasha Lyonne, Oscar de la Renta, Patricia Arquette, Prada, Quevenzhane Wallis, Ralph Lauren, Red Carpet Review, Reem Acra, Reese Witherspoon, Rene Russo, Robin Wright, Rosamund Pike, Rosie Assoulin, Ruth Wilson, Saint Laurent, Salvatore Ferragamo, Sama Hayek Pinault, Shaun Robinson, Sienna Miller, Stella McCartney, Taryn Manning, Taylor Schilling, Tina Fey, Tracey Edmonds, Uza Aduba, Valentino, Vera Wang, Versace, Viola Davis, Zac Posen, Zosia Mamet, Zuhair | Leave a comment
|
cc/2020-05/en_middle_0087.json.gz/line1341380
|
__label__wiki
| 0.867803
| 0.867803
|
CSUN switches to online-only credit card payments
As of June 20, University Cash Services no longer accepts credit card payments in person in the Student Services Building, and CSUN students who make credit card payments online will be charged a 2.9 percent processing fee by a third party.
As a way to reduce spending, the university expanded its contract with CashNet SmartPay, which handled other cash services for the university, to collect a convenience fee from students that use the CSUN Web Portal online payment system.
Previously, the university was charged a merchant fee when students made credit card payments, according to Robert Barker, university controller.
The university could not continue to absorb the cost of those transactions, which totaled nearly $1 million in 2004-05, as a growing number of students opted to pay with a credit card, he said.
“Banks charged (CSUN) approximately two percent (for a) transaction,” Barker said. “It left less (money) for other things, like funding classes.”
The move, however, is not without its detractors, who are not limited to cash-strapped students.
A bill in the California Legislature would have prohibited the California State University, University of California and state community colleges from imposing credit card surcharges.
The State Senate approved the bill in June before it was put on hold in the Assembly.
The author, State Sen. Debra Bowen, D–Redondo Beach, eventually dropped the bill from immediate consideration in July.
Senate Bill 860 was originally proposed to allow California to use the purchasing power of all state agencies to negotiate better rates with credit card companies. The bill was later revised to solely target institutions of higher education.
According to Jenny Bretschneider, a consultant to Sen. Bowen, the CSU system did not seriously analyze or compare the costs of processing credit card payments with other forms of payment. Studies have shown that credit card usage would reduce costs for state agencies like the CSU, which traditionally require hiring personnel to process cash, debit, or check payments, she said.
“More work needs to be done to look at other costs of processing payments,” Bretschneider said.
Meanwhile, students and parents, who were unaware of the surcharge, must adjust to the changes.
If Ali Rajaei, biology major, had known of the surcharge, he said he would not have minded standing in line five to 10 minutes to pay with a debit card at Cash Services.
“Fifty dollars for a $1,500 transaction isn’t fair,” Rajaei said. “(It’s) just like parking (fees). It’s ridiculous. Everything is a rip-off here.”
Sherry Goodwin, whose daughter Nicole attends CSUN, said the university should have notified students of the surcharge. After paying online for the past three years, she said she eventually sent the payment through FedEx, since it would not have arrived in time to beat the payment deadline.
“I think it’s an outrage (students) weren’t notified,” Goodwin said.
Students who make payments online will find that Visa is no longer accepted. The online payment system accepts MasterCard, American Express, and Discover cards because they charge a percentage processing fee rather than the flat fee Visa does, said Nancy Banker, chief operating officer for CashNet SmartPay.
The 2.9 percent processing fee that SmartPay collects covers their software and interface costs, and pays for the annual data security audits that verifies their system is secure for schools and credit card companies to use, she said.
“It’s not as though there are not other options (for students) to use,” Banker said.
Associated Students President Chad Charton said that if SB 860 had become law, CSUN would have lost more money than smaller CSU campuses, whose credit card processing fees do not amount to as large an expense. Considering the university’s budget constraints, it would be worse for CSUN to continue to subsidize students’ credit card transactions and make up the difference by cutting student services, he said.
Similarly, the decision to either support or oppose a statewide bill that would have affected students in more ways than one was challenging, said Laura Kerr, director of legislative affairs for the California State Students Association.
With SB 860 on hold for the legislative session, the CSU system no longer has to absorb a school’s merchant fees, which would have made the credit card payment option financially unsustainable, she said.
While CSUN students continue to have the option to pay with credit cards, it has incidentally made higher education less affordable for the average person, Kerr said.
“It’s a Catch-22 for students.”
Julio Morales can be reached at julio.morales.605@csun.edu.
|
cc/2020-05/en_middle_0087.json.gz/line1341382
|
__label__cc
| 0.692762
| 0.307238
|
Tag: La Lakers nba draft
It’s NBA Draft Night!
Published on June 22, 2017 June 24, 2017 by talkingballyoutubeLeave a comment
We’ve been waiting, or at least myself and those of who root for the 28 minor league teams currently parading the NBA, have. Tonight’s the night of hope. There are no draft busts tonight, just questionable decisions and shocking selections. Thon Maker at 10?! Are you kidding me? (By the way it sure looks like the Bucks were right again, note to self don’t question those guys again).
Anyway, the Knicks get their shot at returning to the glory years with the promise of potentially adding Dennis Smith Jr., and the Lakers seem poised to try and bring back ‘Show Time’ with the addition of Lonzo Ball. Meanwhile “The Process” sure seems to be well under way in Philly with the presumed addition of Markelle Fultz.
This is the time to be positive and rejoice for many lottery teams who frankly will be lottery bound again next season. (Looking at you Sacramento, let’s see what Georgios Papagiannis does this season huh).
So here are three things I’ll be looking for come draft night.
Number one:
Does my favorite NBA Draft Prospect Jonathan Isaac sneak into the top-5? I think this comes down to whether the Phoenix Suns pull the trigger at four. Pairing him with Booker, Bledsoe and last year’s selections Marquese Chriss and Dragan Bender would give the Suns an exciting young core.
Number two:
Speaking of the Kings, which draft prospect gets thrown into the tornado that is Sacramento. I think it will be difficult for a non-PG to have success there with the number 5 pick. Therefore, it is vital that the Kings end up with either De’Aaron Fox or Dennis Smith Jr.
Number three:
When will the first senior be selected? The first senior has typically been selected just outside the top-10 the past five seasons. This season should be no different, in fact my prediction is that no senior will be selected in the first 20 selections. If I had to bet I’d say Wesley Iwundu from Kansas State will be the first one selected near the end of the first round. If your reaction is ‘Who?’, I don’t blame you, long gone are the days of 4-year dominate collegiate players.
Aside•Categories NBA Draft•Tags LA Lakers Lonzo Ball, La Lakers nba draft, NBA, nba draft knicks, nba draft seniors 2017
REPORT: Lakers Would Pass on Lonzo Ball
Published on June 3, 2017 June 3, 2017 by talkingballyoutubeLeave a comment
According to Bleacher Report writer Jordan Schultz, if the NBA Draft was held today, the Los Angeles Lakers would pass on the player many expect them to select, UCLA Point Guard Lonzo Ball. Schultz notes that the Lakers are very concerned with Lonzo’s father, LaVar, and the impact he would have. LaVar has manifested fame through the success of his son and with Lonzo landing in a prime time destination like LA, just down the street from where he played college, LaVar could have an even bigger voice. Along with this, the Lakers’ front office is concerned with Ball’s on-court game, skeptical of whether he can transition to being a true star at the next level.
While his father LaVar is an unknown, who knows how he’ll act when his son is in the place he’s wanted him to be since the beginning of this process, the Lakers concerns with Lonzo’s game are serious and well-warranted.
Ball does has a safety net to fall back on. At the very worst he projects to be a Ricky Rubio type of player who can act as a distributor and play-maker but does little to create for himself. Rubio as a worst case scenario isn’t very bad and the best case prospects for Ball should excite anyone. He could be the second coming of Jason Kidd or Penny Hardaway if he adjusts well to the NBA game. However, there are still deterrents that could prevent him from getting there.
The two biggest negatives to Lonzo’s game are his lack of elite athleticism and his funky, unorthodox shooting motion. Lonzo does not have blazing speed or quickness like some of his contemporaries in this draft class and it could be a factor that may limit him throughout his career; this isn’t a very fixable issue. What is fixable is his lack of great dribble moves that can separate him from defenders, something he will have to work on if he is to create consistent separation at the NBA level.
The other problem Ball will need to clean up to achieve NBA stardom is his shooting motion, which includes a low release point and may limit his dribble jumper at the next level. Ball will need to adjust the shot to get it to work against bigger, stronger, longer defenders or rebuild his mechanics from the ground up. While he should receive credit for being a solid three point and off-ball scorer at UCLA, he will need to do more, such as building a mid-range game, to become an NBA star.
While these are real issues that may hold Lonzo Ball back, it should be noted that he is still the best option for the Lakers if Markelle Fultz is off the board. However, a player to watch for Los Angeles is Kentucky’s lightening-fast De’Aaron Fox. Fox could transform into a John Wall-type player as he fills out and learns to shoot better and turn the ball over less. As is, Fox is a speed demon with good mechanics, basketball IQ, and defending ability. If the Lakers are going to pick between Fox and Ball they have two choices; go with the potential homerun in Fox or take the safe pick and select Ball.
Categories Basketball, NBA, NBA Draft, NCAA•Tags LA Lakers Lonzo Ball, La Lakers nba draft, lakers 2017 nba draft, Lakers Lavar Ball, Lakers Lonzo Ball, Lakers NBA Draft, Los Angeles Lakers Lonzo Ball, Los Angeles Lonzo Ball
|
cc/2020-05/en_middle_0087.json.gz/line1341394
|
__label__cc
| 0.549082
| 0.450918
|
Cthulhu & Other Monsters
Written by Sam Stone
Sixteen tales of terror from the woman described by noted horror author Graham Masterton as ‘the mistress of the grisly and the glutinous’.
269 pp. B-format paperback original collection.
Cthulhu & Other Monsters quantity
Categories: Dark Endeavours, Horror, Dark Fantasy and Science Fiction, New and Forthcoming
Sixteen tales of terror from the blood-soaked pen of Sam Stone. Enter if you dare and discover nine stories inspired by the nightmare visions of H P Lovecraft: Elder Gods returning to the Earth to wreak havoc, tales of death and destruction and betrayal and the last flickering embers of humanity …
Alongside these are seven further stories featuring the monstrous creations of Stone’s own imagination: a hungry and jealous sea; wolf-creatures prowling the fashion industry; a terrifying creature held captive in a cellar …
Open the cover and let Sam Stone’s nightmares guide your way into horror …
Dark Fantasy author Sam Stone began writing aged 11 after reading her first adult fiction book, The Collector by John Fowles. ‘I’d never read anything like it. It was terrifying – but so exciting…that’s when I realised I liked to be scared,’ she admits.
Her love of horror fiction began soon afterwards when she stayed up late one night with her sister to watch Christopher Lee in the classic Hammer film Dracula. Since then she’s been a huge fan of vampire movies and novels old and new.
The youngest of seven children, Sam struggled to find her own space and is a self-confessed bookworm. ‘I always have a book on the go,’ says Sam. ‘It’s my time. Life wouldn’t be the same if I couldn’t chill sometimes with a good book. It’s where I learnt about life, long before I lived it.’
Sam’s writing has appeared in seven anthologies for poetry and prose. Her first novel was the fulfilment of a lifelong dream. Like all good authors she drew on her own knowledge and passions to write it. The novel won the Silver Award for Best Horror Novel in ForeWord magazine’s book of the year awards in 2007. In September 2008 the novel was re-edited and republished by The House of Murky Depths as Killing Kiss. The sequel, Futile Flame, went on to become a finalist in the same awards for 2009. Futile Flame was later shortlisted for The British Fantasy Society Award for Best Novel 2010.
An eclectic and skilled prose writer Sam also has a BA (Hons) in English and Writing for Performance and an MA in Creative Writing, which means that she is frequently invited to talk about writing in schools, colleges and universities in the UK. She is said to be an ‘inspirational’ speaker.
Praise for Sam Stone:
‘Sam Stone without doubt is a mistress of the grisly and the glutinous. She is one of the few horror writers who makes you feel when you have finished her stories that you need to wash your hands. Twice. I believe that we can look forward to seeing Sam Stone develop into a major influence in the realm of blood and shadows and things that wake you up, wide-eyed, in the middle of the night.’ – Graham Masterton
‘A deceptively readable date with darkness watch your step! This book is lit for the much more discerning chick (and cock) who likes to walk in the shadows. Relax with it, but be prepared for sudden jewels and little masterpieces and the rug to be pulled from under your feet.’ – Tanith Lee on Killing Kiss
‘I was floored by Sam’s work. Really flat-out delighted to see such a level of style combined with narrative drive. I suppose one could use those terms in an overly technical sense, but Sam is at a level that simply shines. Soaking in her story even while seeing her powerful ability to make me feel and see what the narrator is experiencing – she’s not only got a gift, she clearly knows how to employ it to powerful effect.’ – Gard Goldsmith on Killing Kiss
‘With all the style and charisma of Anne Rice, but less indulgence and crazy, Futile Flame is a sensual, deadly tale of immortals, sins and the unknown wrapped up in a vivid take on the past. Rich, enticing and utterly charming, Stone’s vampires are ambrosia to horror fans hungry for the good old monstrous vampires who look, walk and sound like us, but hold our deaths in their gaze.’ – Michele Lee – Booklove
‘Enticing, shocking and delightful … A fast-moving story that’s spell-binding, as thrilling as it is intelligent and thought-provoking … Sam Stone writes with stylish panache.’ – Simon Clark on Demon Dance
‘Sam Stone has done it again, her immersion into the vampire world is so extraordinarily well-crafted that I am wondering if she is really Lilly, the protagonist vampire with a heart. And Lilly is more than a vampire, she has learnt witchcraft and – rare in vampire literature – can manipulate ley lines, using them as a power. Unusual too in that this vampiric feast travels the corridors of time, quite literally and in both directions … If Futile Flame was a flambé of vampiric lust, Demon Dance is its force majeure.’ – Geoff Nelder
20.2 × 13 × 0.8 cm
1 review for Cthulhu & Other Monsters
Brian Sammons – May 13, 2017
‘So please take this as someone who has been aware of Ms. Stone’s considerable writing talents for a while, trying to do you a solid favor and point out one of the best writers in the game you might be missing out on. So yeah, I am a fan, and if you want the tl;dr version of this review, here it is: get this book, it is a slice of pure awesome.’
Read the whole of the review here: http://hellnotes.com/cthulhu-and-other-monsters-book-review/
The Darkness Within: Final Cut
Jinx Town (Jinx Chronicles # 1)
Jinx Magic (Jinx Chronicles # 2)
Zombies in New York and Other Bloody Jottings
|
cc/2020-05/en_middle_0087.json.gz/line1341396
|
__label__cc
| 0.615151
| 0.384849
|
The Gun Master’s salute to Hitchcock
sputnik, February 19, 2012 February 19, 2012 , Interviews, 0
Why was Agent Vinod delayed? Has it affected the final product?
No, the final product has obviously not been affected, but become even better. It was an ambitious film. When we were writing the script, we visited many countries. Ideally, we should spend one year in pre-production and then take dates from stars for shooting. But, we started shooting as we were excited to add a punch. I needed some more dates from my actors and this took time. I think the end product shows it’s worth it. When you see the movie, you’ll realise it.
Who is Agent Vinod? Is he a James Bond?
The film is an action-packed spy thriller set in today’s times. I am a big fan of old Indian spy thrillers like Aankhen of Dharmendra and Hitchcock films. It’s a mix of such stories. Mithun’s Gun Master was very successful and they made two of them. But, later, there hasn’t been such a film. After the old Agent Vinod’s release, there were no spy films for almost 10 years. If our film does well then there can be more Agent Vinod stories.
You actually introduced Saif to dark cinema with Ek Haseena Thi. How did you convince him to play a negative role then?
Dil Chahta Hai released and people were enjoying him in that role very much. When we approached him, he was initially worried that it might affect his fan base. Somehow, once we started talking, we got along well and I told him, ‘It’s a negative character but also, charming and cunning. It’s a fun role to play.’ Once he agreed, he was comfortable with everything , including the climax, when rats surround him.
How important is the Mujra song for the film? Did you incorporate it to add to the commercial value of your film?
No, it’s a wedding scene. Kareena and Saif are on a mission, searching for a third person. In foreign films, they have a different background score but since, it’s a Hindi movie, we planned a Mujra. One, people will wonder about a Mujra in such a film and two, it will make the viewers curious. They will enjoy it.
There were rumours that Saif has already planned its sequel. Is it true?
We keep wondering. If the film works, Inshallah! There may be a chance to make another.
Does the darker side of life fascinate you?
I like happier movies but yes, I enjoy dark thrillers and crime dramas a little more. It’s my first choice in books or even at a DVD library.
You had signed Ramesh Sippy’s Happy Birthday with John Abraham and Aishwarya Rai Bachchan, long ago. Will you reconsider the casting now since, Aish’s life has changed?
In the last two years, I was busy with Agent Vinod so I have to meet them and find out before taking it forward. I might make certain changes in it. Happy Birthday is a fantasy film. It’s different from what I have done so far. I want to break away from the genre of dark thrillers. But, first of all, I will be taking a break and watch films that released last year.
Tags: Agent Vinod Ek Haseena Thi Interviews Kareena Kapoor Saif Ali Khan Sriram Raghavan
“Ekk Deewana Tha had to be told to wider audience” – Gautham Menon
sputnik, January 27, 2012 January 27, 2012 , Interviews, 0
In 2003, it was Kaakha Kaakha that put South Indian director Gautham Menon into the spotlight. But before that...
Filmfare Interview on Agha and Jalal Agha
sputnik, March 5, 2014 November 7, 2017 , Exclusive, Interviews, Retro, 4
On Jalal Agha’s death anniversary check out his mother and sister’s Filmfare Interview from 1998 about him and his...
Blast from the Past: Amitabh Bachchan Interview from the Sets of Sharaabi
sputnik, June 9, 2016 June 14, 2016 , Interviews, 2
Check out this rare Amitabh Bachchan Interview from the Sets of Sharaabi. Thanks to @yakuza for the video.
Soha Ali Khan, Jimmy Shergill and Mahie Gill Interview With Komal Nahta
sputnik, March 7, 2013 November 8, 2013 , Interviews, 0
Raindrop on roses: Priyanka Chopra Filmfare Interview
sputnik, August 7, 2012 August 7, 2012 , Interviews, 0
Q. Are you a rain person? A Yes, I love watching the rain and also getting drenched. Q. Would...
Blast from the Past: A.R. Rahman’s Filmfare Interview after Dil Se
sputnik, January 8, 2013 November 7, 2017 , Exclusive, Hall of Fame, Interviews, Retro, 6
Check out this Filmfare Interview of A.R. Rahman from September 1998.
Housefull 3 to release in April 2014: Sajid
Manish, January 6, 2012 January 6, 2012 , Interviews, 0
‘There will be a Housefull every two years… The first one was out in April 2010, Housefull 2 will...
Vijay Deverakonda Interview With Baradwaj Rangan | Face 2 Face
sputnik, December 7, 2019 December 7, 2019 , Interviews, 0
Actor Vijay Deverakonda responds to the Arjun Reddy criticism and decides he needs to get a few things off...
I couldn't imagine myself in Matru Ki Bijli Ka Mandola: Imran Khan Ek Main Aur Ekk Tu Falls In Second Weekend
|
cc/2020-05/en_middle_0087.json.gz/line1341401
|
__label__wiki
| 0.829055
| 0.829055
|
Plans for 20mph speed limit in central London given the green light
TfL publishes consultation report showing public support for lower speeds in central London
"Every single death on London's streets is one too many so I'm really pleased that Londoners have backed our plans to introduce a 20mph speed limit on TfL roads within the Congestion Charge Zone and at Aldgate Gyratory "
The Mayor of London
Work will begin later this year to make 8.9km of TfL roads 20mph
Part of the Vision Zero commitment to eliminate death and serious injury from London's roads
TfL will begin working with boroughs and local communities on next phase of lower speeds for outer London
Transport for London (TfL) has today announced that proposals to lower speed limits on TfL roads across central London will go ahead, following a positive response to its public consultation earlier in the year.
TfL will introduce 20mph speed limits on all its roads in the Congestion Charge Zone by early 2020 - mirroring the lower speed limits already in place on the majority of borough roads in the central London area.
The lower speed limit will be supported by new 20mph signage and road markings, as well as raised pedestrian crossings in seven locations where a high number of people walk, including near Embankment and Tower Hill Tube stations and outside the Tate Britain. TfL will recalibrate all speed cameras in central London and use mobile speed cameras to ensure that drivers are complying with the new safer speed limit. TfL aims to complete work overnight to minimise the impact on road users and will use single lane closures, avoiding any roads being fully closed, subject to permits.
There were nearly 2,000 responses to the public consultation, with half of respondents saying the plans would have a positive impact on walking and 31 per cent saying that many more people would choose to walk. Almost two-thirds thought that the proposals would lead to more people cycling (59 per cent) and four in ten thought that the proposals would have a positive impact on public transport.
Additional comments were in support of making the streets safer, as well as more pleasant and welcoming, and encouraging more people out of their cars to walk, cycle and use public transport. There were also suggestions to roll out lower speeds as quickly as possible and to raise awareness of the new 20mph speed limit and improve driver behaviour.
The move is a key part of the Mayor's Vision Zero ambition to eliminate death and serious injury from London's transport network and will see 20mph limits introduced on 8.9km of main roads including Millbank, Albert Embankment, Victoria Embankment and Borough High Street. More than a third (39 per cent) of streets in London now have a 20mph speed limit and the Mayor and TfL are hoping this will continue to reduce road danger and provide consistency for drivers.
Following public support for the plans, TfL is now accelerating proposals to bring safer speeds to some of the most high-risk areas in outer London. This includes proposals to lower speeds on Commercial Street and Whitechapel Road, where local communities are calling for safer speeds to make their neighbourhood a better and safer place to walk, cycle and enjoy.
The Mayor of London, Sadiq Khan, said:
'Every single death on London's streets is one too many so I'm really pleased that Londoners have backed our plans to introduce a 20mph speed limit on TfL roads within the Congestion Charge Zone and at Aldgate Gyratory. By also bringing forward plans to lower speed limits in other parts London, we will help protect more people walking and cycling across our city.'
Penny Rees, Head of Network Sponsorship at TfL, said:
'We know that lower speeds save lives, it's that simple. As more and more people choose to walk and cycle around London we must reduce the risk of them being killed or seriously injured. It's clear people agree that making our roads safer will encourage Londoners to travel in more active and sustainable ways.'
Figures from 2016, 2017 and 2018 suggest 131 people were killed in speed-related collisions on London's streets. A further 2,256 people were reported as seriously injured in collisions where speed was recorded as a contributory factor. Cutting speeds from 30mph to 20mph significantly reduces the likelihood and severities of these collisions. People walking are particularly vulnerable to speeding vehicles and 52 pedestrians have already tragically died this year, compared to 56 in the whole of 2018. Lower speeds as well as safer junctions will help to address this.
Jeremy Leach, London Campaign Co-ordinator for 20's Plenty for Us, said:
'This result shows how swiftly London is becoming a 20mph city. Londoners understand just how important it is to reduce the maximum speeds of vehicles if we are going to bring down road casualties and encourage more people to walk, cycle and use public transport. Most encouraging is the green light for lower speed limits on Red Route roads right across the capital and TfL's commitment to make sure that as many drivers as possible stick to the 20mph limit.'
Victoria Lebrec, crash victim and Campaign Coordinator for RoadPeace, the national charity for road crash victims, said:
'Speed not only makes a crash more serious, it also makes it much more likely to happen. At RoadPeace we see the devastating consequences of preventable crashes, and welcome TfL's commitment to introducing 20mph speed limits on so many roads.'
Joshua Harris, director of campaigns for Brake, the road safety charity, said:
'The go-ahead for rollout of 20mph speed limits, widely accepted as the safest speed for places where people live, work and play, is fantastic news. Londoners have made it clear that they want to be able to move around in safe and healthy ways and reducing vehicle speeds is a simple, but effective, way of achieving this. We hope other authorities, including central government, follow London's lead and make 20mph the default for urban areas.'
Over the next five years, TfL will work with boroughs and the public to introduce lower speed limits on its road network, reducing road danger and the number of people being killed and seriously injured in speed-related collisions. TfL aims to introduce safer speed limits across 150km of its road network, focusing high-risk sections of road, town centres where people walk and cycle, and ambitious local speed reduction programmes led by London boroughs.
To support this, TfL has today published a Lower Speeds Toolkit, which is designed to help engineers and designers make London's streets more welcoming and safe for everyone. The toolkit gives practical advice on the measures available to lower speed limits and ensure people comply, such as installing chicanes and virtual speed humps, reallocating space for walking and cycling and urban realm improvements.
Consultation report is here - https://consultations.tfl.gov.uk/streets/20/
TfL's Lower Speeds Toolkit is here - http://content.tfl.gov.uk/achieving-lower-speeds-toolkit.pdf
The Vision Zero Action Plan is here - http://content.tfl.gov.uk/vision-zero-action-plan.pdf
TfL is planning to make 20mph the new general speed limit on TfL roads within central London by May 2020, prioritising the part of the capital with a high volume of vulnerable road users including pedestrians, cyclists and motorcyclists. This is TfL roads within the Congestion Charge Zone, as follows:
Albert Embankment
Lambeth Palace Road, Lambeth Bridge
Victoria Embankment
Upper Thames Street, Lower Thames Street, Tower Hill
Borough High Street, Great Dover Street
Blackfriars Road
Part of Druid Street (between Tower Bridge Road and Crucifix Lane), Crucifix Lane, part of Bermondsey Street (between Crucifix Lane and Tooley Street
A 20mph limit will also be introduced at Aldgate Gyratory, including Leman Street, Prescot Street, Mansell Street, Minories and Goodman's Yard, which is on the boundary of the CCZ rather than within it
Proposals for a 20mph speed limit on Tooley Street were consulted on separately as part of the Tooley Street Healthy Streets project. The 20mph speed limit part of this project will be delivered at the same time as the roads in this consultation, to provide value for money
|
cc/2020-05/en_middle_0087.json.gz/line1341407
|
__label__cc
| 0.653862
| 0.346138
|
Maxfield and Oberton, the maker of Buckyballs, has defended its efforts to keep the magnetic desk toys away from children.
Magnetic Buckyballs toys discontinued
The popular Buckyballs and Buckycubes magnetic desk toys will be discontinued, its manufacturer said, blaming what it called "baseless and relentless legal badgering" from the Consumer Product Safety Commission.
"It's time to bid a fond farewell to the world's most popular adult desk toys," Maxfield and Oberton, the maker of Buckyballs, said on its website this week. "That's right: We're sad to say that Balls and Cubes have a one-way ticket to the Land-of-Awesome-Stuff-You-Should-Have-Bought-When-You-Had-the-Chance."
A limited number of the toys are still available, but no more will be made after they sell out, the company said.
In July, the Consumer Product Safety Commission sued Maxfield and Oberton in an attempt to get the company to stop selling the toys, saying they are hazardous to children. When children swallow the powerful magnets, they can pierce holes in the intestines, the commission said, and some children have required multiple surgeries and lengthy hospitalizations. Since 2009, officials said, there have been at least a dozen ingestions of the Buckyballs magnets.
"CPSC stands behind the case at this time," commission spokesman Scott Wolfson said Friday. "We continue to allege and believe that Buckyballs and Buckycubes are dangerous and defective for young children as well as teenagers."
Internet videos direct older children and teenagers how to use the toys to mimic tongue or cheek piercings, he said, and some have ended up ingesting them.
At the time the suit was filed, Maxfield and Oberton spokesman Andrew Frank said the company would "fight this vigorously," noting that while "some people have misused the product," the toys were marketed to those aged 14 and up, and carried warning labels.
But "we made a tough decision after a lot of thought based on how to protect the integrity of the business, the brand, and begin to move forward," Frank said in an e-mail Friday. "It was time for our team to start focusing on the future and providing innovative products for our loyal customers. We will continue to fight the CPSC and sell our other products."
Wolfson said the Consumer Product Safety Commission did not single out Maxfield and Oberton.
"We have seen incidents with a variety of different brands (of magnetic toys)," he said. "That's why our approach to this hazard has not been exclusive to one company."
Eleven of 13 manufacturers agreed to stop making, importing and selling the toys. Maxfield and Oberton and a Colorado company called Zen Magnets did not, and the commission filed suit against them, Wolfson said. Both suits continue.
Last month, the North American Society for Pediatric Gastroenterology, Hepatology and Nutrition said warning labels on Buckyballs were ineffective. The group released the results of a new survey of more than 1,700 doctors, who reported at least 480 toy magnet ingestions in the past decade, with 204 occurring in the past year.
“The numbers have skyrocketed post-labeling,” said Dr. Mark Gilger, a pediatric gastroenterologist who helped author the study. “There’s just many examples of people ignoring the labels, or people who haven’t paid attention to them bringing them to their home inadvertently.”
Gilger said young children sometimes think the toys are candy, and older children and teens use the toys to mimic piercings.
Doctors have said "the injury pattern they are seeing in hospitals (after ingestion) is like a gunshot wound to the gut with no sign of entry or exit," Wolfson said.
Frank last month defended Maxfield and Oberton's efforts to keep the toys away from children, and the company said in a statement it does not sell its products to children and has a strict policy of not selling to stores that do sell toys exclusively to kids.
The statement also noted the company’s efforts to educate its customers, including an informational safety website it developed. The company said it has strongly advocated for a public education campaign sponsored by the Consumer Product Safety Commission, as the commission has done with other products that posed risks to children.
Zen Magnets acknowledged in a Reddit posting Thursday that "the magnet fight is probably lost."
With Buckyballs' demise, "This makes Zen the last magnet sphere company standing in the US for now," the post says. "We'll keep fighting as long as we can."
Zen Magnets was the first company to receive an administrative complaint from the Consumer Product Safety Commission without a record of injuries, as the company has had no ingestions of its products, said founder Shihan Qu.
"We've always sold online, where it's not easy for kids to buy anyway," he said.
Post by: Ashley Hayes - CNN Health Sr. Producer
Filed under: Children's Health • Conditions • Living Well
Next entry »7 health risks in the wake of Superstorm Sandy
« Previous entryConcerns over drug shortages with Mass. company recall
Better stock up on thumb tacks before they are banned.
Jrad
Remember, anything that could ever potentially hurt anyone, especially children, should be immediately pulled from shelves and the company that developed said product, sued into oblivion..
tired of hypocrites
Really, so all kitchen appliances and all tools (manual and power) have to stop being sold. Whatever happened to personal responsibility and common sense?
November 3, 2012 at 07:40 | Report abuse |
Tired of people who don't get sarcasm
Pretty sure Jrad was being sarcastic...
We shoul also ban cars because they kill so many people including children in accidents.
"Whatever happened to personal responsibility and common sense?" It died with the formation of populist governance.
That's a stupid comment. Are you serious? I think it's ridicules.
JmorRad
Does that include rotten parents?
SGOWriter
Except guns. Selling guns to kids is okay.... but Bucky Balls must be outlawed because a kid swallowed a magnet. How fracked up is that?
Voice_Of_Reason
So, we're shutting down an adult desktop / cubicle plaything because children may swallow them? Welcome to the most litigious country on earth, where people can use a product in such a way that is contrary to its intended use, despite warning labels, and still sue the manufacturer when they're injured (though we shouldn't be surprised – in Amurrica, you can sue McDonalds for making you fat and gun manufacturers if you get shot). There are times when I really hate this country, and here's a good example of a systemic failure that drives that sentiment.
Bakamoichigei
The worst part is, it's not some moron consumer suing them, it's the CPSC! I'm sorry, but some people are either too stupid to live, or too stupid to have kids. Neither of those can be blamed on the company. WARNING LABELS! They put labels on the damn thing. I can buy the same magnets from China (A hell of a lot cheaper, I might add) with NO warning labels. At least the company TRIED.
And I'm sorry, but if your kid eats magnets, they're in Darwin's hands, and you need to go to prison for being a terrible parent. They're METAL SPHERES, they don't look like candy, and if your kid thinks they're candy, that's YOUR FAULT, no one else's.
And the whole thing about 'videos demonstrating simulated piercings' is even worse. That is not grounds for ANYTHING. I'm sure there's videos out there telling kids about shoving a Barbie doll up their ***es, and I don't see the CPSC suing Mattel. And any teenager who does something like that is even more deserving of their fate.
The less people are expected to exercise personal responsibility, the more irresponsible they'll get. I'm so glad the CPSC has ensured parents no longer need to explain to their kids that METAL SPHERES are not something they should eat!
Kids swallow stupid things all the time. Cigarette butts, marbles, paperclips, thumb tacks. I do not see the CPSC suing the makers of those products and banning them. Parents need to start taking responsibility for raising stupid kids rather then trying to pawn it off on toy makers, TV and movies, and video games. TRY SUPERVISING YOUR KIDS YOU LAZY MORONS!!!
November 14, 2012 at 22:34 | Report abuse |
I am glad that there are so many great parents out there that have raised children that never put anything in their mouth or had a teenager do something experimental. I have been taking care of children for 30 years and have never met the perfect parent. If there were so many perfect parent whose children never put the wrong thing in their mouth then why are 30% of children in this country obese. Fortunately evolution has already helped with natural selection that is why most sharp objects, stones, pebbles, coins and numerous objects that are not magnets or disc batteries without problems. In fact greater 90% of objects pass through the GI tract without problems. Unfortunately neodymium magnets and lithium batteries were not present in the environment during this selection process. The number of magnet balls sold in this country are close to a billion. That means that loose magnet balls will be in our environment for some time to come. The loose balls which do not appear magnetic when they are by themeselves look very innocuous even like candy or berries. When parent move into a house or an apartment where these tiny balls may have gotten loose from the prior residents activities, they may have no clue to their presence. The toddler, infant or young child has a different perspective and if he swallows 2 or more neodymium magnets he will have an 80% chance of getting an endoscopy to remove them or surgery to repair the damage that can occur within hours of ingestion. If these magnets become more prevalent than they already are the cost to our medical system fro these intervention will be a very large burden. This is a toy not a useful tool, cleaning agent or even a protective weapon. Those other items look dangerous and are lock up, many come in child proof containers and most cleaning agents stay in the bottle that has the warning on it. These magnets do not stay in their container and there is no warning present after this toy is seperated from its packaging. Most of the other items mentioned give symptoms with their ingestion. Unfortunately these do not give symptoms at the time they are swallowed but many hours later. The child could swallow these and the perforation or hole to their intestine could occur during their sleep. But obviously there are many perfect parents that this situation would never occur. I just wish there were more of these perfect parents in my practice. Until that time I commend the CPSC for the foresight to remove a toy that has increased medical interventions for their ingestion over 10 fold in the past 4 years. This is the first time in 11 years that they have sued a company to remove a product from the market. I doubt they did this action without significant evaluation of the products risk and benefits.
Paco Wove
Bob – paragraph breaks. Learn about them. Use them.
It can also be argued that you can find ammunition, lethal or harmful chemicals, rusty nails and whatnot when you move into a new place.
Personal responsibility, what happened to it?
"It can also be argued that you can find ammunition, lethal or harmful chemicals, rusty nails and whatnot when you move into a new place.
Personal responsibility, what happened to it?"
Sorry, but those things don't look like the little silver confections that seem to frequent the tops of Christmas cookies. I have a set of these at home (which I keep out of reach), and a two year old, and I have no problem with the banning of these things. Are they a ticking time bomb waiting to go off? Probably not. Do they pose a potential, and very serious risk? Absolutely. The issue with these, as Bob conveyed above, bullets, rusty nails, chemicals, etc. present their own set of risks, and look the part. These look harmless, but are anything but. So when some evidently neglectful parent leaves them out for thier kid to eat, resulting in serious injury or worse, I'm fairly certain the whole "personal responsibilty" excuse will offer them little solace.
I'm sure we can all find a new desk toy to entertain us for the next 30 minutes (about how long, before I was bored with these...).
WillCAD
A parent doesn't have to be perfect to realize that small children will sometimes swallow stuff they're not supposed to swallow, and remove things small enough for their children to swallow from their homes prior to procreation. This process is called "baby-proofing" and has been common knowledge amongst even mediocre or somewhat poor parents for decades.
It is somewhat unknown, however, among MORON parents, and it is these MORON parents who are being castigated for not keeping the shiny metal spheres away from their children.
However, because such abysmal parenting is now considered acceptable performance, the rest of our society is being forced to pick up the slack for MORON parents.
It doesn't take a dang village to raise a kid, all it takes is one or two reasonably intelligent, reasonably responsible, reasonably competent parents. But since it's now acceptable in our society for parents to be unreasonably stupid, unreasonably irresponsible, and completely incompetent at caring for their children, the rest of us must suffer.
It is a bitter irony that people who make the worst parents are often the most likely to have children, because they're too stupid to exercise caution or behave responsibly in their own lives, let alone the lives of their children.
So long, Bucky Balls. I wonder which inanimate object will get the blame for MORON parents' poor parenting next...
So I'm guessing you are fully down for tacks being banned too. They are small, colorful, decorative and there are other, less attractive alternatives like nails or staples that don't look as edible. Seriously, accidents happen, this doesn't mean there needs to be more regulation, certainly not a BAN on the things. Its a disgusting symptom of an inefficient system.
eurekadog
Which has caused a greater (percentage-wise) number of incidents requiring a remedy via surgery? (1) BuckyBalls (2) Bicycles (3) Dogs (4) Automobiles (5) Skateboards (6) Peas stuffed in ears and noses
universologist
Let's compare the amount of injuries and accident deaths between these two products: buckyballs and kitchen knives.
Kitchen knives should also be banned.
(because we actually care about our children, we keep our buckyballs in our knife drawer)
MaBear
There needs to be a like button.. I totally agree with you...My almost 9y.o wants them, but I say "Sorry, you're not ready"
I had purchased a set of books for toddlers and the cardboard case they come in/put away in had three stong and very small magnets to help the box close for storage. And yet something made for people who know to not swallow a magnet is being pulled from its consumers.
Enough comparing this to children getting a hold of dumb parents guns before they try to take that next!
Jesse Pinkman
I say we ban deadly action figures.... This one time when I was asleep, my ICP action figures came after me and were stabbing me with their little knives...then I woke up and flushed them down the toilet... but then my Mom got mad because they clogged the pipes and she had to call Roto Rooter.. Action figures definitely need to be banned.. they clog the plumbing.
Shoot!, I was going to order some of these magnetic steel balls. It's just something about magnatism that fasinates me. I have seen and read where Surgeons insert these small magnets into the human body, that would help save lives.
Scott Tibbs
Thanks, Obama. You've destroyed more jobs right before the election with your nanny state silliness, proving once again why you need to be fired from YOUR job.
akmac65
This has to do with the President in what way? Besides in your opinion, what fact can you cite?
It's the Obama administration that filed the frivolous lawsuit. This has been in the news for months, and Obama could have stopped it at any time with a 30 second phone call.
Kids also swallow gasoline – resultying in extended hospital stays. How about putting down your iPhone/tablet ect and do some good parenting?
kc_and_fa`
I hate decisions that promote stupidity. It's not like these things jump at you when you enter a room the way the monster from Alien did. You have to be dumb and I mean really dumb to be hurt by them. Ok a toddler may swollow one. But again how dumb do you have to be to not know kids put everything in there mouths so you'd best keep somethings away from them until you can "teach" them there are bad things that should not be eaten. More and more the laws dragging us into the dark ages.
tada gifts
Where does the line of personal responsibility get drawn? Parents, don't give them to your kids! This is total bs. I can think of a dozen other items in every toy store that could be equally dangerous or worse if swallowed by a child. Someone has a chip on their shoulder.
*Accountability Rules
Is there a small risk of danger? Ok but how many billions old products sold are risk free? The CPA must be bored. They need to be reminded their job is not to protect humans from themselves. Let people be accountable. I know, it's a dying concept.
peninad
My friend has over $75,000 in medical charges over her adolescent (developmentally challenged) child swallowing these!
Do you ever stop to think that these parents should not have given these to their developmentally challenged kid?
Or are the parents also developmentally challenged, and could not read the warning label?
megamimi
No personal responsibility, only government oversight. When the government steps in and takes away our ability to make choices based upon our own well developed sense of right and appropriate for ourselves, including keeping adult toys away from children, determining what condiments to use on our food, when to heat our water, what kind of car to drive, what kind of drink to drink and how much, how to feed our infants and our children, what kind of health care we need and must pay for, where to travel, and who can travel, then our country steps ever closer to a land of statism rather than the land of the free and the home of the brave.
The Obama regime and that mayor of New York are social-engineering totalitarians.
dotheflippin'math
This is a toy, not a knife or car, or something that is useful, or that anyone actually needs. Even guns have a purpose. Kids should not be dying or injured because of dangerous toys that adults can not manage to keep safe. If parents were more responsible, perhaps they could have kept their little high-powered magnet toys, but the hospital records speak for themselves. Kids should not be put at risk by a silly toy. All of you "grown-ups" who are complaining, should perhaps stop playing with toys, and instead, focus on your work, and more importantly, your chidren's welfare and safety. It's unfortunate for the company, and those who enjoy the toys, but are your toys more important than the health and welfare of your children? I'm seeing a lot of "adults" here with less common sense than most children. It's no wonder you're still playing with toys.
I'm going to put it simply. You are a dick. It's obvious to everyone except you, so I won't even both explaining why.
bizen
I don't have kids. I should be able to have all the toys I want. Unfortunately, the entire world now must be childproof.
Video games can be seen as "useless toys" and some of them actually induce a lot of seizures and often create sedentary lifestyles. We should totally ban them.
Oh, we should also totally ban those dangerous bikes for kids. I mean toddlers only use them as toys, unlike older kids/adults who can use them as transportation. I bet a lot of fractured skulls, infections from skinned knees, and other broken bones came from little kids recklessly riding bikes because parents didn't bother putting a helmet on them, etc >.<
And who says buckyballs aren't useful? I use them to hold up all my notes/papers. One buckyball takes the place of 2 or 3 cheap magnets. 😀 Luckily we can all still buy these magnets from China and deprive America some GDP =/
So, what about the responsible adults that DON'T have children? I hate having to bear the problems of irresponsible parents when I myself don't have irresponsible kids. Urgh...
Its not the Buckyballs fault its dumbing down of humanity thats now so bad parents can't even keep their kids safe at home.
Americans are LAZY that's why labels are being ignored, we ignore many things, I work retail, so I told someone something then they ask they same question again, and they said, Sorry I wasn't paying attention..... Now that's sheer ignorance, any parent who has the right mind to let a child/teen play with these are retarded.
We know that the toy manufacturers don't actually make the magnets – they buy them from someone else and repackage them. All we need to do is find out where the toy manufacturers get them from. The Consumer Product Safety Commission can hassle sellers of things, but they are powerless to stop us from buying things.
Portland tony
From personal experience,the round batteries that proliferate watches and toys are a much more dangerous item for kids to swallow than these so called Bucky balls....No ban on....Thumb tacks...nails...screws.earrings.... etc......Just because an idiot can misuse it and swallow it... They shouldn't take it off the market. Talk about the nanny state.
Some kids swallow things and some never do. If you are the parent of a kid who likes to put things in their mouths, either don't buy buckyballs, put them in a safe place or out of reach place like you would with knives/cleaners, or leave them at your office. Don't give little kids small shiny magnetic balls! Simple as that. Don't blame the company for something that is so easily preventable with a little parental forethought
I purchased two sets Friday evening because I've always wanted them for my desk at work. I goth them before they were sold out. Those P&G are reworking the packaging of those detergent packs because toddlers are eating them because they look like candy, i guess if children continue to eat them, then they will ban detergent packs also. Guess Ill stock up on those next.
innawake
This is dangerous for childrens and adults.Government should take preventive action to stop this kind of production rather than preventing after production.
Someone should sue the US Treasury for printing all those horrible dangerous pennies kids like to stuff in their mouths and ears too.
Government: Fighting to Protect Stupidity
foodwalkers
Okay, I don't usually do this but it's time for a RANT! The article attached epitomizes what is wrong with the American legal system and makes my blood boil!
Bucky Balls are one of those truly remarkable toys that will forever be remembered in the world of cool, one-hit-wonder toys. Remember the Pet Rock, the Rubix Cube and, yes, Clackers?? If you have ever used Bucky Balls you understand what I'm talking about. These little, BB-sized metallic balls are one of the most addictive toys that I've seen since throwing yard darts high in the sky in the direction of my friends waiting by the target. You can stack them, shape them or do almost anything with them. They are educational, creative and even engage scientific pondering. They're also excellent stimulation devices for autistic or ADHD patients. They move and shape with the motion of one's hand in virtually any direction. They are also very pretty to look at. More importantly, there is no inherent danger in Bucky Balls - but there IS danger in a parent who mindlessly allows their infant children to play with any tiny, metallic objects, or little legos, or thumb tacks, paperclips, marbles, etc. True, Bucky Balls are attractive (not be imply "attractive nuisance"). So are firearms, kitchen carving knives, pointy chopsticks and colorful toothpicks. But those items have not been removed from the market - instead, people have exercise caution and control over whether to allow a child to play with them. Lamborghinis, Ferraris and Maseratis are also cool and alluring. But no responsible parent lets their child play unattended in the driver's seat when the engine is running. So why should Bucky Balls be any different?
As a result of some parents allowing their infant children to play unattended with Bucky Balls, nearly a dozen incidents of a child swallowing one of the little balls has occurred since 1999. Not to sound cold and heartless, but REALLY?!? Less than a dozen unattended-child-swallowing incidents in nearly 4 years! I can't help but wonder how many little children in that same period of time have died or been permanently and severely burned from playing with matches, or by choking on pieces of toys that were inappropriate for their age. I suspect the numbers are in the tens, if not hundreds, of thousands! Yet those products are not being removed. If a product is badly designed for its purpose or not properly labeled with warnings alerting people to dangers which may not otherwise be obvious, then I, too, support efforts to either improve, replace or eliminate that product and seek retribution from those who failed in such responsibilities. THAT is what the legal system is supposed to be designed to do - to make this nation a better, safer place.
But that is not the case with Bucky Balls, which are obvious - even to my cat - as potential choking hazards. And if my cat could read he would also understand the easy-to-read Age Appropriate Warning on the packaging. The danger of Bucky Balls lies in the parent, not in the toy. And while one cannot help but feel deeply sorry for the children and their families who suffered injuries from these toys (I'm a parent, too, and have thankfully managed to raise 2 boys without such unthinkable horror), why, through the help of get-rich lawsuits by unscrupulous lawyers, should the burden of responsibility and age-appropriate use of a product shift to the maker of the product, rather than to the parent who permits a child to play with it? Is there not something to be said for personal or parental responsibility as the ultimate stopgap against injury to children?? And why do lawyers and judges attempt to enforce imposed-protection against one's self over certain items, but not over others? The reason is obvious: in our American litigious society, when something bad happens to someone, people seem to think that someone else should be responsible, and should pay. And American lawyers are right there, backing them up in that misbelief - and collecting their 33.3% contingency fee…. And we wonder why people around the world today refer to the current crisis in American society as "The rise and fall of the Roman Empire."
See my blog at http://foodwalkers.com
this person just said it.
I don't get how parents can miss the warning label printed all over the box, I mean its on every side and in an orange box! How do you miss that?? I can't believe they're almost gone 😦
These must be way down on most peoples list of things to be banned.If anything is to be banned shouldn't it be the stupid candy with metallic coloring that teaches kids it's OK to put metal in your mouth!
Also, I can't understand a country that allows automatic assault rifles but wants to ban small magnetic balls ... sounds a bit crazy to me; I know which I would class more dangerous to kids.
Carol Roeda
I enjoy buckyballs. However, I do not want children or teenagers or adults or disabled persons harmed. Let us focus on things that really harm, think of the children in Newtown. If we are unwilling or unable to ban guns could we at least ban bulllets?
Nah, let's go with pressure cookers and nails
Baby Toys Shopping Online
i really appreciate for this post... thanks for this type of information..........
Meaghan Edwards
Just ridiculous. It's amazing how I survived childhood, what with playing in the dirt and playing outside until it got dark (and sometimes playing even then). Nowadays all the answer, instead of proper common sense is ban, ban, ban. Or sterilize, sterilize, sterilize.
gement
I just discovered this recall (I wanted to supplement my existing sets) and, while I'm sad to see them gone, does anyone remember Lawn Darts?
I have had several adult guests once in my living room playing with these things, on the table, when they had been warned about the dangers and the fact that we have a cat who sometimes tries to eat things. With all the personal warnings I gave them face to face about the dangers, they managed to lose several of them off the table.
I got an adrenaline shock when I realized six were missing. I spent two hours combing the carpet to protect my cat from a careless guest's reasonable use of a *fundamentally hazardous* toy, and I only knew they were missing because I am compulsive enough to always reassemble them in a cube when I'm done. Anyone less exacting might have ended up with a dead cat. Or child.
I love these things, and would be happy if they stayed on the market, but removing them from circulation is a valid response.
My friend's daughter just swallowed two of these and after a week of laxatives and enemas, she had to have surgery to remove them. These things really are dangerous and libertarian politics aside, as a father, I'm glad they're discontinued.
Whats up! I simply would like to give a huge thumbs up for your fantastic data you have gotten right here on this post. I may be coming back for your weblog for more soon. backlink http://fiverr.com/twnseobacklink
Wouldn't you have to swallow two of these for them to be harmful?
man of steel torrent
download the movie man of steel 2013 in english dvdscreener here http://bit.ly/12wQAzz/ man of steel torrent http://manofsteel.canalblog.com/
As the manufacturer in china,we have some buckybalss in stock,anybody intrestd,please visit:www.buckyballsbuy.com
Want to buy simple packing buckyballs by low price,you also can visit:www.buckyballsstore.com
stinkleaf
I tell you this is a conspiracy. Your product is not a toy. It teaches us something very fundamental about geometry, magnetism and indirectly cymatics. The government doesnt want anyone discovering the wealth of knowledge this simple set of rare earth magnets can do. Why else do they target this? There are plenty of toys and products that harm people and children. Look at all the JUNK food they let market to kids that causes obesity and diabetes? Hormones and GMO food they allow in children's lunches. This is a shining example of the fascist country we live in.
please visit:www.buckyballscube.com to get buckyballs in gift package.
I find the reasoning behind this idiotic. If we decide to leave our children unattended, we're responsible. If we leave a clearly ADULT desktoy out where kids can get them, it's our fault. But if we leave BuckyBalls out(heaven forbid!) and our kids eat them, sue the company! If people lack the mental capacity/ responsibility to be parents, they shouldn't be parents. This is like leaving condoms out and then discovering that our kid had sex, then complaining to condom manufacturers. Welcome to modern-day America.
They ban buckyballs, but yet cigarettes are still available. Sorry, but this isn't anyone protecting anyone...this is all about money. You can still buy these balls in a different brand, most probably a brand owned by some politician somewhere.
pdf to image converter, pdf converter
We should discontinue stupid people from having children is testament to why these laws end up going in to effect.
Www.Danfoss-Kunstforening.Dk
I write a comment whenever I especially enjoy a post on a website or I have something
to contribute to the conversation. Usually it's triggered by
the sincerness communicated in the post I read. And after this
article The Chart. I was actually excited enough to drop a thought 😉 I actually do have 2 questions for you if it's allright.
Is it simply me or do some of these comments
look like coming from brain dead people? 😛 And, if you are writing on other sites,
I'd like to follow everything fresh you have to post.
Would you list the complete urls of all your social pages
headmon
Interesting. I've had a set of buckyballs for two years and have never had a problem making any shape I want. The "much stronger when aligned" feature could do more harm than good. buckybalsmagnets.com One of the most annoying things about buckyballs (for me), is trying to break up a cluster when trying to make a new design. I will certainly give them a try though.
Tim Huisenga
May I simply just say what a comfort to uncover somebody that truly knows what they’re talking about on the internet. You actually realize how to bring a problem to light and make it important. A lot more people need to look at this and understand this side of your story. It’s surprising you are not more popular since you definitely possess the gift.
http://www.izyu4FwY1H.com/izyu4FwY1H
Leave a Reply to R1D2E1
|
cc/2020-05/en_middle_0087.json.gz/line1341416
|
__label__cc
| 0.607718
| 0.392282
|
Modulation of Mitotic Signal Transduction by Curcumin and Tea Polyphenols and Their Implication for Cancer Chemoprevention
Jen Kun Lin, Yu Chih Liang, Yu Li Lin, Yen Chou Chen, Shoei Yn Lin Shiau
It has been demonstrated that diets rich in fruits and vegetables are protective aganist cardiovascular diseases and certain forms of cancer. These protective effects have been attributed to the anti-oxidant present, including vitamin C, Carotenes and phytopolyphenols. The polyphenolic components of higher plants may act as anti-oxidants (sometimes may be as pro-oxidants), or as agents of other mechanisms, contributing to the anti-carcinogenic or cadioprotective action. Curcumin is a widely used dietary pigment (curry), and this polyphenolic compound has been demonstrated to be an inhibitor of tumor promotion in chemical carcinogenesis. Recent studies also indicate that tea polyphenols are active in inhibiting the processes of carcinogenesis induced by various carcinogens. Investigations from this laboratory and others have indicated that modulation of mitotic signal transduction may attribute, in part, to the molecular mechanisms of these cancer chemopreventive agents.
ACS Symposium Series
Polyphenolic compounds
Chemoprevention
Lin, J. K., Liang, Y. C., Lin, Y. L., Chen, Y. C., & Shiau, S. Y. L. (1998). Modulation of Mitotic Signal Transduction by Curcumin and Tea Polyphenols and Their Implication for Cancer Chemoprevention. ACS Symposium Series, 701, 225-238.
Modulation of Mitotic Signal Transduction by Curcumin and Tea Polyphenols and Their Implication for Cancer Chemoprevention. / Lin, Jen Kun; Liang, Yu Chih; Lin, Yu Li; Chen, Yen Chou; Shiau, Shoei Yn Lin.
In: ACS Symposium Series, Vol. 701, 1998, p. 225-238.
Lin, JK, Liang, YC, Lin, YL, Chen, YC & Shiau, SYL 1998, 'Modulation of Mitotic Signal Transduction by Curcumin and Tea Polyphenols and Their Implication for Cancer Chemoprevention', ACS Symposium Series, vol. 701, pp. 225-238.
Lin JK, Liang YC, Lin YL, Chen YC, Shiau SYL. Modulation of Mitotic Signal Transduction by Curcumin and Tea Polyphenols and Their Implication for Cancer Chemoprevention. ACS Symposium Series. 1998;701:225-238.
Lin, Jen Kun ; Liang, Yu Chih ; Lin, Yu Li ; Chen, Yen Chou ; Shiau, Shoei Yn Lin. / Modulation of Mitotic Signal Transduction by Curcumin and Tea Polyphenols and Their Implication for Cancer Chemoprevention. In: ACS Symposium Series. 1998 ; Vol. 701. pp. 225-238.
@article{138777b233f3439681b66291f8fdb072,
title = "Modulation of Mitotic Signal Transduction by Curcumin and Tea Polyphenols and Their Implication for Cancer Chemoprevention",
abstract = "It has been demonstrated that diets rich in fruits and vegetables are protective aganist cardiovascular diseases and certain forms of cancer. These protective effects have been attributed to the anti-oxidant present, including vitamin C, Carotenes and phytopolyphenols. The polyphenolic components of higher plants may act as anti-oxidants (sometimes may be as pro-oxidants), or as agents of other mechanisms, contributing to the anti-carcinogenic or cadioprotective action. Curcumin is a widely used dietary pigment (curry), and this polyphenolic compound has been demonstrated to be an inhibitor of tumor promotion in chemical carcinogenesis. Recent studies also indicate that tea polyphenols are active in inhibiting the processes of carcinogenesis induced by various carcinogens. Investigations from this laboratory and others have indicated that modulation of mitotic signal transduction may attribute, in part, to the molecular mechanisms of these cancer chemopreventive agents.",
author = "Lin, {Jen Kun} and Liang, {Yu Chih} and Lin, {Yu Li} and Chen, {Yen Chou} and Shiau, {Shoei Yn Lin}",
journal = "ACS Symposium Series",
T1 - Modulation of Mitotic Signal Transduction by Curcumin and Tea Polyphenols and Their Implication for Cancer Chemoprevention
AU - Lin, Jen Kun
AU - Liang, Yu Chih
AU - Lin, Yu Li
AU - Chen, Yen Chou
AU - Shiau, Shoei Yn Lin
N2 - It has been demonstrated that diets rich in fruits and vegetables are protective aganist cardiovascular diseases and certain forms of cancer. These protective effects have been attributed to the anti-oxidant present, including vitamin C, Carotenes and phytopolyphenols. The polyphenolic components of higher plants may act as anti-oxidants (sometimes may be as pro-oxidants), or as agents of other mechanisms, contributing to the anti-carcinogenic or cadioprotective action. Curcumin is a widely used dietary pigment (curry), and this polyphenolic compound has been demonstrated to be an inhibitor of tumor promotion in chemical carcinogenesis. Recent studies also indicate that tea polyphenols are active in inhibiting the processes of carcinogenesis induced by various carcinogens. Investigations from this laboratory and others have indicated that modulation of mitotic signal transduction may attribute, in part, to the molecular mechanisms of these cancer chemopreventive agents.
AB - It has been demonstrated that diets rich in fruits and vegetables are protective aganist cardiovascular diseases and certain forms of cancer. These protective effects have been attributed to the anti-oxidant present, including vitamin C, Carotenes and phytopolyphenols. The polyphenolic components of higher plants may act as anti-oxidants (sometimes may be as pro-oxidants), or as agents of other mechanisms, contributing to the anti-carcinogenic or cadioprotective action. Curcumin is a widely used dietary pigment (curry), and this polyphenolic compound has been demonstrated to be an inhibitor of tumor promotion in chemical carcinogenesis. Recent studies also indicate that tea polyphenols are active in inhibiting the processes of carcinogenesis induced by various carcinogens. Investigations from this laboratory and others have indicated that modulation of mitotic signal transduction may attribute, in part, to the molecular mechanisms of these cancer chemopreventive agents.
JO - ACS Symposium Series
JF - ACS Symposium Series
|
cc/2020-05/en_middle_0087.json.gz/line1341421
|
__label__wiki
| 0.848509
| 0.848509
|
The New Quarterly
The Nick Blatchford Occasional Verse Contest
The Edna Staebler Personal Essay Contest
The Peter Hinchcliffe Fiction Award
The Wild Writers Literary Festival
Finding the Form with Lorin Jane Medley
By Lorin Jane Medley
“Who stays, who goes, and why? Who and what survives?”
Shikata ga nai (the poem) emerged in 2012 as an exercise in accentual verse. Four years later, I extracted its first-line imperative, ditched the rest, and began again. Record this: route rail-beds to carry coal. From prosody to local history: on my way to work, I drive past the abandoned coal tailings pile in the community of Union Bay on Vancouver Island, where in 1892 the first 100 Japanese labourers arrived by ship. My partner Ted often tells the story of how Japanese fishermen in Steveston, BC taught him to fish and provided a much-needed ballast through chaotic times. That was 1972—a scant thirty years after their parents and grandparents lost everything to the Canadian government’s shadow side. Later, Ted would give one of his daughters a Japanese name, Mariko.
A trip to Cumberland Museum and Archives leads me to hand-drawn maps from former residents of #1 Japanese Town along with a list of names and brief descriptors: Made tofu. Owned a store. Made koji. Lady Barber. School teacher.
I pass the Union Bay parking lot where recreational fishers launch their boats. Further south, a solitary oyster picker combs the beach. I think about my own grandparents, who immigrated from Scotland and England to make Vancouver Island their home. Their skin white, like mine. Who stays, who goes, and why? Who and what survives?
Revise and listen: what wants to emerge? Most of my poems have this long gestation period where I let them rest for a month, a year, and then pick them up again. With a bit of distance, my ear catches places where the poem clings to prosody at the expense of meaning. And yet, the syllabic emphasis is just what I need to move from 1887 to 1942 in six stanzas; it seems to say, “This happened, and then this,” in a way that leaves no doubt.
Shikata ga nai is a Japanese expression meaning, “It’s beyond my control, so it cannot be helped.” It refers to adapting, making the best of a bad situation, a perspective that is said to have helped Japanese families persevere after they were sent to internment camps during the war.
Considering contemporary politics here and south of the border, the irony is in the title.
I write about where I live. I am interested in documentary forms and possibilities, the many ways poetry can honour a life. Claudia Rankine’s Citizen, C.D. Wright’s One With Others, Soraya Peerbye’s Tell: poems for a girlhood.
Lorin Medley is a counsellor and writer from Comox, BC published in The Puritan, Portal, subTerrain, Refugium: Poems for the Pacific, and the forthcoming Sweetwater: Poems for the Watershed. She won the 2014 Islands Short Fiction Contest, the 2015 Books Matter poetry prize and was long listed for the 2016 Prism International Poetry Contest.
Photo by Julian Hochgesang on Unsplash .
Lorin Jane Medley
Finding the Form
A Burst of Praise for the Winners of the Nick Blatchford Occasional Verse Contest 2019
Finding the Form with Paola Ferrante
© 1981 - 2020, The New Quarterly. Privacy Policy
|
cc/2020-05/en_middle_0087.json.gz/line1341422
|
__label__cc
| 0.633309
| 0.366691
|
Tag Archives: hurt
December Holiday Read-a-Thon: Gifts of Honor Duology Offers Heart-wrenching Heroes and the Holiday Season
Gifts of Honor by Stacy Gail and Rebecca Crowley (Carina Press, November 21, 2013)
Carina Press holiday anthologies are always a go-to for me during December – I’ve never read one that contained a saccharine story, and the credit goes to editor Angela James who always manages to find authors who combine great characters, heart-warming settings, and the true spirit of the holiday.
Gifts of Honor is no exception, except authors Stacy Gail and Rebecca Crowley add the twist of two military heroes so damaged by their service that they are unable to give the women they love the relationship she deserves. Or so they think.
I’ve loved Stacy Gail since last December when I devoured her steampunk holiday romance novella Crime Wave in a Corset, followed by her awesome science fiction novella How the Glitch Stole Christmas. Since then, I’ve read a bunch of her paranormal angels books as well as her contemporary Ugly Ducklings Finish First, and I can confidently say this author has chops since she seems to be able to excel in all genres and still keep a fresh voice and utilize truly unique story ideas. Rebecca Crowley is a newer author of contemporary romance, so it was great to sample a holiday story from her to see what she would bring to this theme. She did not disappoint!
Note that while both stories are offered in the duology Gifts of Honor for under $4.00, you can also get each one individually for around $2.50, if one sounds like it appeals and not the other. The individual links under their specific book cover will take you right to that story, if that’s your preference. But considering the quality of both of them, you’d be wasting your money to not by the duology. Just sayin’.
Starting From Scratch by Stacy Gail
Starting from Scratch by Stacy Gail (Carina Press, November 21, 2013)
Lucy Crabtree is busy at her job baking all the holiday treats for her small town’s Sweet Shoppe and is just managing to hold it together. Her ex-husband, Sullivan Jax, has finally moved home after his lengthy stay in military rehab where he’s been recovering from a head trauma, a trauma that had him waking up with no memory of Lucy or their marriage.
The only thing she’d prayed for was for Sully to come back alive.
She should have been more specific.
Their marriage had been rocky with his last deployment with the Rangers, a deployment he had barely told her about, leaving her with a lot of anger and once again crushing her dream of them finally making a home and family together. Now she had to look forward to the awkwardness and gossip surrounding the fact that they’d undoubtedly be bumping into one another.
Sullivan Jax would be the first to admit that his ex-wife is heart-stoppingly gorgeous but he also knows that a woman that beautiful deserves to have a life free of a man who can’t even remember her. It galls him to no end that he has begun remembering so many of the details of his childhood and time in the military, but this woman is a just a big, painful blank spot.
That he also has developed an insane craving for cookies – cookies that smell just like the scent that clings to Lucy whenever he sees her – must just be a weird side effect of the season. But one taste of Lucy’s mouth and all thought of cookies gets pushed aside. This is what he’s been craving all along. But while he thinks he might be falling in love with his wife all over again, Sullivan also realizes that he might be the one person she never wants to be with, as he’s already torn her heart to pieces.
This story had everything – great characters, mouth-watering food (always part of the holiday romance genre), and a small-town setting perfect for the backdrop of the holiday spirit. Yes, it’s utterly gut-wrenching to place yourself in Lucy’s shoes, but Gail does an outstanding job of outlining the pressures deployed soldiers and their spouses both face, specifically focusing on how this element eroded Lucy and Sullivan’s marriage. I loved it when Lucy’s good friend and mechanic, Coe read her the riot act of how she had always been the one giving and Sullivan the one taking. Lucy’s understanding of what she did and didn’t do in her marriage showed her growth as much as the pieces of his mistakes in his marriage coming back to Sullivan.
Sullivan’s instinctual response was the most fascinating, first from the standpoint of screaming every time he saw her in the hospital to his despair whenever she would run away from him in their town. Gail does not shy away from the heat in this story, and there were times I thought Lucy’s cookies were going to bake on the counter based on how hot it got in the kitchen with this couple! Most sigh-inducing was the final realization that Sullivan had always loved Lucy as much as she did him and that he wasn’t going to give up in winning her once again, which leads me to the quote that had me falling in love with this big former Ranger:
“I’ve learned the hard way that being careless with you, hurting you, is the quickest way into hell,” he grated, and self-condemnation edged the words in bitterness. “But I understand. It’s okay. You’re gun-shy with me now, so I won’t push you into anything you don’t want to do, or feel. And I don’t expect all the pain to magically vanish just because I remember you now. We both went to war, and we both have battle scars that are going to take time to heal.
“But I have so much hope for the future, Lucy,” he added as he pressed her hand to his mouth, and the passion that vibrated in his tone made her throat clench. “A year from now, I hope you’ll have agreed to be my wife and we’ll be trying for our first baby. I hope a month from now you’ll trust me enough to want to live with me so that you can get used to sharing your life with me again. I hope a week from now you’ll believe me when I say I love you, instead of looking like you suspect I’m playing some kind of cruel trick on you. And I hope that by tomorrow, you’ll be able to smile at me without sadness.”
Gail, Stacy; Crowley, Rebecca (2013-11-21). Gifts of Honor: Starting from Scratch\Hero’s Homecoming (Kindle Locations 1788-1796). Carina Press. Kindle Edition.
Starting from Scratch contains the sweetness and spice of the heroine’s Pfeffernusse cookies with enough heat to bake them, proving Stacy Gail is a romance writer who can encapsulate human emotions so well that readers feel like they’ve grown as people when the final page is turned. This is a must-buy!
Hero’s Homecoming by Rebecca Crowley
Hero’s Homecoming by Rebecca Crowley (Carina Press, November 21, 2013)
College professor Beth Tate always thought of herself as a sturdy Midwestern woman until she bumped into Captain Chris Walker when he filled in for an absent archivist at Fort Riley. He was a six foot stud in uniform and she was more than stunned when he looked at her like he wanted to eat her up.
For four days they had a hot affair and while she was willing to let it just be a fling, not wanting to burden him with expectation prior to shipping out to Afghanistan, Chris wanted more. They exchanged long, thoughtful emails and had sweet phone calls for four months and then…nothing. A terse email after a couple weeks of radio silence merely saying that things weren’t going to work out and the most powerful relationship of her life had ended.
Getting a call months later at Christmas from the same Captain who broke her heart, and Beth is literally rendered speechless. With a blizzard blowing in and his parents stuck at their ranch meant Chris needed a ride to a hotel from the airport and could Beth help? Saying yes just to get a good look at the man who would have the gall to behave like this, she’s stunned to see a scarred serviceman with clouded eyes and a cane. Much to the horror of the Christmas crowd at the airport, she promptly cracks him across the face with a slap that should have sent him back overseas.
When Chris realized that the suicide bomber who killed his friends had taken his sight, one of his first thoughts was breaking up with Beth. Not because he didn’t love her but because he knew that she would unflinchingly take on the burden of his disability and she deserved more. He wanted to just disappear from her life so she could find a good man to have a normal life with, but instead he ends up having to call upon her since he has no one to help him with finding a place to stay. Having been worried about her pity, her serious slap quickly dispels that notion. But as they are forced by circumstances to stay at her house, Chris gets a glimpse of what he might still actually be able to have. But his physical scars are nothing compared to the emotional ones he gave Beth, who might not be able to take a chance on him once more.
Wow, was I impressed with this story! Crowley not only gives us two complex characters but imbues both of them with a very understandable emotional evolution. Chris, when confronted with the reality of Beth and her honest reactions, realizes that the grey existence he has mapped out for himself might be completely opposite the one she feels him capable of and that helps him believe more in himself. Beth has to confront the fact that she is just as much in love with Chris as ever, while also trying to understand his physical injuries and PTSD and ponder if she can trust him enough in his state not to throw her to the curb again.
Both situations are so believable but the turning point is Chris’ epiphany about what Beth has gone through, and his acknowledgement offers the final linchpin in her decision to go forward. Hero’s Homecoming is an emotional read that kept me riveted, turning each page to discover if this man and woman could overcome the obstacles and embrace the happiness within their reach, if they are just brave enough to take a chance.
With the quality of both stories in Gifts of Honor, I think you’d be crazy to not buy both books in the duology for $4.00 rather than only one story. Stacy Gail and Rebecca Crowley have both penned contemporary military romances that bring home the idea that the holiday season is about hope and the renewal of life with love at the center.
Have a super holiday season!!
Tags: angela james, Author, book, Carina Press, Christmas, Hero's Homecoming, hurt, injury, Lucy, military, Rebecca Crowley, Stacy Gail, Starting from Scratch, Sullivan
Categories Anthology, Contemporary Romance, Holiday, Military, Review
|
cc/2020-05/en_middle_0087.json.gz/line1341423
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.