Split (1)

train · 379k rows

pred_label stringclasses 2 values	pred_label_prob float64 0.5 1	wiki_prob float64 0.25 1	text stringlengths 167 1M	source stringlengths 39 45
__label__cc	0.514873	0.485127	Comparing Loot Hauls And now, the highlight reel... Note: in the early years, Ellen and Amber would carry auxiliary candy buckets and hand them off as one got too heavy to hold. This time Olivia hauled the same bag the whole time. How Not to Perform a Tune Up (Of rotor, distributor cap, spark plug wires, and spark plugs.) 1. Completely ignore any shop manual of any sort. Since you already know how to change this stuff on a Spider, with a four cylinder motor designed some time before Noah picked up an axe, you can change them on a car twenty years newer with two more cylinders. Totally the same. 2. Come up with a really clever idea. Holding the old distributor cap, slowly attach new wires to new cap. 3. Completely ignore any key or notch on the distributor cap. YOU know much better which end is up than the factory ever did. 4. After three tries getting the order right, and a complete do-over because the cap is upside-down, forget there's a special spark plug tool in the trunk. It's much more fun to spend nearly an hour contorting hands, back, and knees while trying various combinations of "normal" tools that almost work. 5. Assume you have now, in spite of all contraindications, actually gotten it right the very first time and try starting the car just to see what happens. 6. Impress the entire neighborhood with an explosion so powerful it blows the plenum (a rectangular aluminum box about 12" x 6" x 2") almost completely off the top of the motor, violently disconnecting at least one fuel injector, snapping the plenum ground, breaking off a piece of the cam belt cover and blowing a cam sprocket cover completely off. 7. Unsuccessfully maintain complete composure as you greet the rest of the family as they arrive from errands exactly sixty seconds later. 8. Scare the wife into complete silence as she realizes it is in fact possible to die playing with cars. 9. Spend the rest of the evening angsting over the fact that you actually managed to blow the wife's car up. And the correct way is... 10. Wake up the next morning, download the proper page of the shop manual, write out a diagram with the correct firing order, use the spark plug tool in the trunk to remove and replace #5, which is otherwise inaccessible, and re-seat the three wires routed incorrectly by the moron who did the work the day before. Start the motor on the first crank. 11. Calmly trace and reconnect the fuel injector at the other end of the plenum which was causing it to, in the words of The Empress, "sound funny." Repair the ground wire and replace all other covers, clips, and clamps. I'm not a professional mechanic folks, it's more like I inflict myself on unsuspecting cars. 60 Minutes Does Top Gear Thank goodness for the internet, without which we would have completely missed 60 Minutes' profile of our favorite show, Top Gear. The, I don't know, six of you, left whom we have not completely converted into fans of this show may finally be able to understand What it's All About. The rest can have fun watching what in many ways is a very articulate (and enjoyable!) highlight reel, with some behind-the-scenes looks at just what makes the thing tick. Rainbow Spin Wall of Chalk The Cow Couch! By The Fountain Remember that "time traveler caught on silent film" segment? The one with the lady on the cellphone wandering around in a Chaplain film? Two words: hearing aid. Ah, well. It was fun to think about, that's for sure. BSG Update Looks like it's goodbye Caprica, hello Blood and Chrome. Caprica's premise, the origin of cylons and their relationship with the society that created them, started out well enough but in my opinion rapidly got bogged down in a bunch of navel-gazing and angsty soap-opera drama. Sometimes it was all too easy to forget the show was science fiction at all. In the end, I thought it was barely interesting enough to keep watching. Here's to hoping their next effort turns out better! Belly Bomb! Introducing the pumpple cake, a dessert that's literally two pies baked into a cake. One slice has 1800 calories and feeds four. Those of you wondering what to serve after your Thanksgiving turducken need wonder no more! Drunks Gotta Die, Bears Gotta Eat Of all the excuses not to visit a grave site, I think roving bears eating the corpses is one of the better ones. You'd think someone with an AK-47 and a desire for a trophy would take care of this problem relatively quickly. Pow Pow Pumpkin Mark gets a no-prize that must be pointed down range at all times for bringing us a very alternative way of carving a pumpkin. Seems kind of an expensive way to go about it, but hey, it's his gun, his ammo, and his pumpkin. Bonne Nuit Mon Chat De Noir Our "M" to the AMCGLTD passed away peacefully at 5:15 AM this morning after a several month struggle with lymphoma. Goodnight Magrat, we love you. 14 years went by too fast. Generics have cut into profit margins, so drug companies stop making things that allow people to live. This, and nothing else, is why it's so hard to apply markets to health care. If I can't afford the latest TV technology, I watch the one I have, or I read a book. If I don't have the drug I need, I frakking die. Until we manage to unlock immortality, this is where the market hits a brick wall. Progressives will then climb to the very tip of their bell tower's spire and rain righteous hellfire down on me, but they have a problem too. Immortality is going to be expensive, in ways nobody's really figured out. The only way it's going to happen, the only way, is if the medical industry is allowed to maximize its profits. Seeking social justice now, progressives will doom us all to the grave. There are no good answers, and anyone who thinks they have them is either insane, or selling something. ~ Puff, the Magic Helmet / Saved Me From the Tree ~ Finally, finally, we have a bike helmet even Suzanne might be willing to wear. I'll bet it works, but I'll also bet it's probably not cheap. Then again, neither is a high-end regular helmet (they're usually ~$250), and they're one-use items just like this thing. Certainly it makes ventilation a non-issue. I wonder how well it works with high-speed (25 mph+) impacts? Distant Relatives Scientists have announced the discovery of human remains which push back the date our ancestors were thought to have populated Asia by fifty thousand years. The find is, of course, controversial, but assuming all is well it poses interesting questions in the how and why of humanity's great eastward migration. That'll Buff Out. And that, friends, is why God invented roll cages. And helmets, and Hans devices, and, well, you get the picture. He walked away, sure, but I bet he was saying, "ow ow ow ow ow" while he did it. That's one seriously rung bell right there, yup. K'heystone Khopdullah So, are terrorists nasty and clever, or are they just, well, nasty? What I think is missing from the article is the concept that terrorists are dumb now because we've killed or captured the smart ones. And we need to keep doing that, otherwise they'll start getting bright again. Die, Drive, Die Ever wonder how long your flash/jump/thumb/whatever-you-call-it drive will last? It would seem the answer is, a lot longer than you probably think. The graphs are particularly interesting. Well, ok, the graphs are just about the only meaningful thing on there, for me anyway. Your Morning WTF. see more Poorly Dressed Trying To Get His Freak On... Bow...chick...a...wow........w...o...w.... Cell Phones? 1928? A time traveler, an alien or just someone with hearing trouble? Watch and decide for yourself. You have to watch the film. Hrmm... Food!? NOPE! Gray Hair! Monkey, our resident Parrotlet, decided that landing on Scott's head was pretty cool! So cool he did it to Olivia and me as well. So... Much... Win... I'm sorry, but I have a cat on a washing machine, therefore your argument is invalid. Hey, it's no worse than what Pelosi pulls out of her... ok, hang on, I really didn't want to go there, did I? Nature has done what millions of soccer fans around the world have been wishing they could do since the end of the World Cup. No, unfortunately it's not "a hurricane blowing those damned vuvuzelas up each and every one of their arses," it's the death of the world's greatest eight-armed sports prognosticator. I've always found it deeply puzzling that such a large, sophisticated creature has such a short life span. I guess that whole, "candle that burns twice as bright" thing may have something to it after all. Your Video for the Day Who knew The Sims analogs could be so entertaining? It's Called A Label Ok, I love hot sauce. I put it on nearly everything, but I'm smart enough to read the LABEL before dousing my food with it! Soon after ingesting the chili mixed with the substance provided by defendant John Doe, Timothy Caleb Gann began to suffer a severe physical reaction, including the flaring-up of hives on his skin, difficulty breathing and severe pain and inflammation of his digestive system including his mouth and throat," the complaint states. Some people are just stupid. Muscle Clown Car Therapy! Perineal therapy is as ubiquitous in France as free nursery schools, generous family allowances, tax deductions for each child, discounts for large families on high-speed trains, and the expectation that after a paid, four-month maternity leave mothers are back in shape — and back at work. Doesn't France have other issues more concerning than this to spend their ZERO budget on? For Amber Here is your single sock explanation! This Is Where You Go Find Another Church... One without the pastor with ED. Ms Ashby, a single mother, said she knew when she was filming the ad that it was in poor taste But she said she had taken the job because of the money. "My Visa was calling out for mercy," she said. "It was against my better judgment to it. I don't like to offend people." Ms Ashby, who didn't say which Christian church she attended, said the Bible spoke clearly about sex. Lady jut go take your ball and play at another playground. It's Called The IGNORE Button! I really am truly sorry for people that want kids of their own but cannot, but this takes it a bit to far. There's no shortage of people who feel pain while scrolling through Facebook: Chronically single people may envy friends' wedding pictures, for instance, and those who've lost a spouse can feel overwhelmed by friends' wedding anniversary announcements. Infertile couples say they protect themselves by hiding most, if not all, Facebook posts from pregnant friends who can't resist hitting the site's "Share" button to show off, say, the latest in maternity ware. Ignore button people...it's called the ignore button. Poor, Deluded Thing "So, when it comes to my comfort level as a conservative who happens to be gay, here's what I know: while many conservatives are people of faith and their religion promotes a very different point of view than mine on homosexuality (and a few other things!), I have found conservatives to be more tolerant, more curious and more understanding of those who are different to them than I ever did when ensconced in US liberal leadership." Now that I think about it, an absolute disdain for religious conservatives seems to, as I perceive it, underpin the beliefs of every left-leaning person I know. I even understand it, since such disdain informed my political views for a very long time. It took me, well, I hate to admit it, but I guess I must say "growing up," to realize that the people who led me to that disdain were either dumb teenagers, or the parents of same. Now that I'm older, in my opinion the adults who go to church, well, the churches I've been in at any rate, are just as frightened of this world as the rest of us are, and only want to find their own way, and, gently, try to help those they see as lost find theirs. I've always considered the symptoms of genuine intolerance to be belittling those who disagree with you, making jokes at their expense, and, if all else fails, throwing vile insults at or genuinely threatening them or the people they love or care about. With that definition, and especially when I review the comments to this particular post, I find it hard to deny that the real bigots are found among those who do not go to church. And heck, I'm a Buddhist. We don't even have churches. Via Instapundit Rrrm... About That... Ahem, "If you use your metal shop skills in an attempt to turn a Camaro into a Lamborghini, you might be a redneck." I'm pretty sure the photos are that close because getting any closer would be bad. I'd like it better if flames somehow shot out of those monster ducts in the rear. Clever! Backmarker F-1 team HRT have come up with a new way to get fined by releasing a car from the pits with a tire warmer still attached to it. Bah. These guys are brand-new. I can recall more than a few times when teams like Ferrari have released cars with things like fuel hoses still attached. I Guess Someone's Got to do It Scientists at Fermilab are building a "laser holometer" to find out if our 3-D universe really IS a 3-D universe. Boy, I bet you're going to feel sheepish about buying that 3-D TV if it turns out the whole dimension is a lie. Me, I'd blame Karl Rove. What an... Interesting... Collection If collecting more than 22 grams of belly-button lint doesn't qualify as, "too much time on your hands," I'm not sure what does. It only took him 26 years! What I think is even weirder is how it seems to have changed color over the years. Oyster Beer Shot NO, I did not chew it. YES, my chest was on fire from all the horseradish.(And I <3 horseradish!) NO, I will not do it again till next year. Outdoor Wood Slide He Was Fuzzy!! Yes, I Will Ask For Photos! I have no shame. Ren Fest 2010~ Zoom, Sip, Zoom Making the rounds: through a combination of various technologies, Mazda has created a gasoline-powered sedan that they claim gets 70 mpg. I got yer "mandate technology to achieve policy ends" refutation right there, bub. Don't Hold Back, Tell Us How You Really Feel P.J. O'Rourke: "This is not an election on November 2. This is a restraining order." No matter how great our hopes, it's looking more and more like the Democrats will be routed from the House but still hold on to a slim majority in the Senate. It will mean we'll be unable to repeal the core of their odious "cap and trade and tax and bail and obamacare for all!" agenda immediately, but it will also mean we'll be able to at least stop it from getting any worse. Considering the mess they managed to make up until now, I'll take what I can get. Trick or Treat at Udvar! Exit, Walkman After thirty years and some two hundred million units sold, Sony has officially ended production of its iconic Walkman cassette player line. They were too expensive for me when I was in high school, but around 1995 or so I picked one up that included an AM/FM radio. It was quite good! I Don't Think Those Words Mean What You Think They Mean Ok, tip to the wannabe journalist trying to break into the English language business: running your story through a Google translator results in sub-optimal results. Sub-optimal, but entertaining nonetheless: "A charge of abashed cartage acquired the baby aircraft to lose antithesis and tip over in mid-air during an centralized flight in the Democratic Republic of Congo. " Software Cook's Lament Robert H. gets a no-prize that'll fuss pedantically while the bacon starts to burn for bringing us a software engineer's rant on cooking. I like Alton Brown's stuff precisely because he not only tells you what to do, but why it works. The former gets you started, the latter helps guide you when things go wrong. Little wonder that the most successful recipes I've ever tried have been Alton's. Especially that stove-top mac & cheese. MMMM!!! Thesaurus Fail "The concept of being part of a team ... reaches its nadir in Halo: Reach. You will become emotionally invested in your Noble Team compadres..." (emphasis mine) Yes, folks, they used "nadir" to mean something they liked. Found in the print version of Best Buy's Gamer magazine. Unfortunately this juicy bit of failure is not available on their site (that I could find). Oh, don't worry, I didn't spend money on it. Dratted thing just showed up in my mailbox and, well... bathroom multitasking, people, bathroom multitasking. Now That's a Quote I Never Expected to Read "So dust, dildos, sex, high prices, unfinished grand stands, oily track and dodgy amenities are what the South Korean Grand Prix has brought prominently to the foremost portion of my mind." Dang. All I was expecting was for the cars to vacuum the asphalt into the sky. The rest is, well, I guess, gravy? The 2010 Halloween Costume Of course the snake is real. I Guess There Really Isn't Much to Do in Canada Young men, frozen in the Great White North, on a lake, with a gun. Let's spin some bullets! No, really! Far as I can tell, it's legit. Stupid, but legit. Alfodge? Dolfa? It's official: The first Alfa to hit our shores will be... wait for it... a Dodge. A lot will hinge on who's engine, suspension, and styling goes in it, as to what sort of car it will ultimately be. Still, it's nice to FINALLY see progress after all this time. Your Joke for the Day One day an old Jewish Pole, living in Warsaw, has his last light bulb burn out. To get a new one he’ll have to stand in line for two hours at the store (and they’ll probably be out by the time he gets there), so he goes up to his attic and starts rummaging around for an old oil lamp he vaguely remembers seeing. He finds the old brass lamp in the bottom of a trunk that has seen better days. He starts to polish it and (poof!) a genie appears in cloud of smoke. “Ho ho, Mortal!” says the genie, stretching and yawning, “For releasing me I will grant you three wishes.” The old man thinks for a moment, and says, “I want Genghis Khan resurrected. I want him to re-unite his Mongol hordes, march to the Polish border, and then decide he doesn’t want the place and march back home.” “No sooner said than done!” thunders the genie. “Your second wish?” “Ok. I want Genghis Khan resurrected. I want him to re-unite his Mongol hordes, march to the Polish border, and then decide he doesn’t want the place and march back home.” “Hmmm. Well, all right. Your third wish?” “I want Genghis Khan resurrected. I want him to re-unite his –” “Ok ok ok. Right. What’s this business about Genghis Khan marching to Poland and turning around again?” The old man smiles. “He has to pass through Russia six times.” I don't remember where I first heard it, but I got this version here. Cam Car! I've always wondered how Top Gear got such spectacular shots when filming their road tests. Now I know. I wonder how much practice it takes to get a $400,000 camera to skim an inch away from a car going 60+ mph? More than I have, I'm sure. You'd Think They'd at Least Know How to Steer A UK nuclear submarine has run aground. No injuries and no release of radiation, apparently, so that's a relief. It'll probably be a cold relief to the CO and who knows how many of the senior officers, though. Navies tend to view people who drive their expensive ships into the ground with something less than kindness. There's Gold in That Thar Moon Scientists who are part of the LCROSS mission, which involved NASA literally bombing the moon, have finally released their findings. Looks like there's more of, well, everything than they thought, although per usual media-created ideas of giant snow drifts hiding in the bottom of the crater did not pan out. Iz Nigh-Nigh Tyme! Nothing quite like watching Ellen trying to talk the 32oz bird out of the 8oz bird's cage so everyone can go to bed. "MAH BED TONIGHT! MAH BED! NOT HIZ!" Ah, binky ball to the rescue!!! And now, we get the butterfly net out to capture "HIZ" to put him in "HIZ" bed. Oh, Fabrujous Joy This, quite remarkably, sums up so many arguments I've been having with the left side of the peanut gallery lately. Via Cobb. Well, Of Course! It Wouldn't be Crunchy Otherwise! Nothing quite like finding a flash-frozen frog in your veggies to ruin the night's meal. With ribbity picture goodness! Damned critters'll get into the craziest places. Farting Garden Gnome? I have seen it all. I hate gnomes. About Darned Time The Car Lust guys have finally added another Alfa to their list of reviews, and you'll never guess the one they picked. I'm sure Ellen prefers Clarkson's "symphony of evil in black" than the author's "lady in red," but that's more personal preference and the color of the one we bought. I Can Haz Rekkerd? Meet Stewie, who, at 48.5 inches, is officially the longest domestic cat in the world. Maine Coons are impressively huge house cats, but this one's nearly as long as A Gramma is tall. I bet shedding season is spectacular. Beats the Sh- Out of a Hearse Yes, Virginia, Alfa did make quite industrial trucks, back in the day. And no, that's not just a Vanagon with a Giulietta grill wired on. That is a genuine "Romeo" truck. Not quite as slick as friend Chris's "yo-yo-YO" Escalade container ship, but at least I wouldn't have to blow the horn every time I entered the channel. Besides, a European truck from the early 70s? Yeah, I'd be worried people would steer off the road laughing at what the horn sounded like. Oh HELL Yeah Nothing like a full-scale replica of a Fallout 3 plasma rifle to end the middle of the week. I'm strictly a kit-based kind of model builder. Scratchbuilding stuff like this is way beyond me, but I sure do admire the skill it takes. You Spin it Left, I'll Spin it Right WSJ: "So look past the billionaires." Will we be a "government of the public employee, by the public employee and for the public employee"? Oh, don't worry, I already know your answer. I just want you to, well, not exactly "say it out loud," but I think you get my meaning. What is Wrong With This Picture Oh yeah, the Mom is the fat one, not the kid! How bout just purchasing healthy stuff to eat? Or rather how bout not eating your kid's portion of food. When Chimps Attack No, really, when chimps attack! Luckily nobody got hurt. You'd think that, after that whole, "chimp rips woman's face and hands off with his teeth" thing a few years ago, people would be smarter than this. Then again, when are people EVER smarter than this? No, No, It's not "Scrap Heap", It's "Dust Bin" Another year, another academic claiming science is, and should, destroying religion and taking its place. Because if the 20th century is nothing else, it is an abject lesson in what happens when science displaces religion and is given the powers of a state. Yeah, that all turned out real well, didn't it? Dang, Man, Ouch Remember when they tell you to keep your hands and feet inside the car at all times? Yeah, looks like we should've mentioned keeping your head in, too. Can you say, "closed casket?" I knew you could... Ignorance is as Ignorance Does They told me that even thinking the likes of Christine O'Donnell might do just as well as anyone else would mean a slew of ignorant candidates would come rushing out of the gate, and they were right! All due respect, your side thinks government sucks because the wrong people get put in charge. My side thinks government sucks because, well, government sucks, and the only way to make it better is to take the power away. Vote libertarian! We want to take over the government so it will leave you alone! Can Ellen and Amber Make a Sound So Loud it Shatters Windows in YOUR House? Let's Find Out Oh... Oh, Dear... The guy who created Glee has been tapped as the director of a Rocky Horror remake. That sound you heard was basically, well, all of my in-laws suddenly crying out in terror. And, now that you mention it, most of my friends, too. Me? Not quite twenty-five years ago I'd never seen it, and was nearly talked into dressing up as Frankfurter. I've been ambiguous about the flick ever since. Not that, you know, there's anything wrong with that. Never Let the Facts Get in the Way of a Crisis Yeah, it's a question I want to ask too: Hey, Al, what happened to all the damned hurricanes? Tell me climate change is a problem, and we're contributing, and I'm all ears. Tell me it's a mega-crisis that requires massive tax increases so the government can protect us... yeah, pull the other one, it's got bells on. Fun with Nukes I thought I was pretty well informed on the various nuclear screwups that have happened over the years, but I had only heard of two of these five incidents. History is replete with accounts of entire towns being flattened by various forms of conventional explosives when they first arrived on the scene in the 19th century. Considering the stakes, I'd say we've done a much better job than they did. Drunk Text, FTW! And in the, "why should we care at all" file, we have Johnn Cusack calling for "a satanic death center" to open at Fox News. I'd be more worried if I knew exactly what the heck that was. Ah, hang on, now I remember... when my side's loons spout incoherently about violence, it's a dangerous example of totalitarianism. When your side does it, it's simply an example of how far my side's pushed yours. "Heads I win, tails you lose," that sort of thing. Mah Pumpkin! As part of its centenary celebration, Alfa Romeo has commissioned the man who helped define the look of Avatar to take a crack at imaging iconic models of its range. Quick! Let the snark begin! Me, I think they're all pretty darned nifty, especially the next-to-last one. Unfortunately, since prices start at about $275, it doesn't look like I'll pick a copy up any time soon. But there is Christmas to think about, eh? Did the Angels Arc Across the Sky and I Missed It? I'm not even sure this can be defined as, "a sign of the apocalypse." You see, as far as I'm concerned, when what is usually a proud and reliable mouthpiece of the Democratic party starts running positive pieces about Sarah Palin, well, bub, that pretty much defines the end of the world, far as I'm concerned. From where I sit, Palin seems to make my center-left friends, especially the women, absolutely froth with rage. The folks who sit over on the left edge of the peanut gallery just explode impressively whenever her name comes up. It's really starting to eat into our cleaning budget, keeping up with that mess. I would have no problem voting for her, but I'm a card carrying member of The Vast Right-Wing Conspiracy. I'm capable of any evil as long as the end result is cutting taxes and shooting terrorists. Just ask the left side! So, anyway, I think she has a very long way to go to sway centrist voters, but she does have quite a bit of time to travel. Like the article notes, politicians with bigger problems have overcome them to win the prize. That said, I'd feel more comfortable if the Republicans in that bunch had a more consistent track record. Oh, I'm Definitely Detecting Nuttiness See! See! We are not even close to the only Alfa lunatics on the planet! And heck, she even owns a Milano just like ours, except with about 220,000 miles less on it. The comments are nearly as good, with the occasional, "wtf?!? Those suck!!!" only occasionally interrupting the sighs of longing or the "LEARN FROM ME, AND BEWARE! AND SELL ME YOURS!" notes from current owners. UK Military Reshuffle The UK's next defense review will be released this week, and if rumors are to be believed, the venerable Harrier is out, the venerable Tornado is in, Typhoon production stays open, and the Marines have something new to worry about with their F-35B. Assuming the -B works at all, I'll be completely surprised if the VTOL version of the Lightning II is ever canceled. The Marines managed to shepherd the V-22 through, what, some twenty years of development and darned if they don't actually have them. They'll get their F-35Bs. Ok, note to rich egomaniacs: don't tick off a well-funded news organization. Nothing good comes from it. I'd like to think a story like this would put paid to the left's argument that money and Republicans have ensured rich people can do bad things with impunity around here. Yeah, don't worry, I'm not holding my breath over it. Swing Time! She went to bed last night drugged to the gills after having spent the past three days with a fever. She literally danced down the stairs the next morning and demanded to go SOMEWHERE. We, naturally, had canceled all our original plans, and so Ellen on the spur of the moment chose Great Farms, a really nifty re-purposed farm-turned-cheap-theme-park. She had a good time. Oh The Things They Will Say Me:"Olivia, you want some tea? I'm making tea." Olivia: "Oh yes! The Teddy Bear Tea!" (aka-Sleepytime) "Mom...why does this tea say 'horrible?' Your tea says 'horrible.'" Me: Uh...no. That doesn't say "horrible", that says "herbal". Olivia, in a "must talk slowly and carefully" voice I'm sure I'll be hearing more of as the years go on: "But there is a dragon on your tea. It must be 'horrible.' Mom." Your Thought for the Day "Let me go on record that I regard communism as expressed by the U.S.S.R. and its friends here and elsewhere as a grisly horror, a tyranny maintained by force and terror, utterly subversive of human liberty, freedom of thought, and dignity. I regard it as Red fascism, distinguishable from black and brown fascism by differences of no importance to me nor to its victims." -- Robert Heinlein This is exactly how I feel about it, as well. Via Instapundit, who's highlighting yet another book pointing out just how horrible red, black, and brown really were. BMG? How Aboug BFG? Remember last week, when you guys were grousing that an AR-15 modified to shoot a .50 cal pistol round wouldn't be a patch on to one modified to shoot the big .50 rounds? Yeah, about that... This one probably shoots through ten schools. Not Your Grandad's Transport The DOD's Speed Agile program is wrapping up, and the aircraft studies it has produce are, well, definitely innovative. They've been trying to replace the C-130 for nearly as long as they've been building it, so I'm not expecting this to go anywhere, either. Still, a transport that looks like a B-2 has gotta be worth something. Fun with Shoes The things people can do nowadays with leather and plastic, well, you just wouldn't believe. It's Saturday, don't worry if it's SFW. That said, I looked at that first one nearly upside down, and I'm still not completely sure what's going on there. I'm sure it's naughty, I'm just not completely sure how. Oh, Yeah, Totally Comfortable with This Mike J. gets a no-prize strangely obsessed with the "Conner" section of the phone book for bringing us news that robots are now helping guard our nuclear stockpiles. Bah. Could be worse. Could be union employees doing the guarding. "Why is guarding important? Come, friend, strike with us for a 30 hour work week and mandated retirement with full salary at 55! No, nothing to worry about, a man in a turban took all the nasty nuclear things away..." Old that's New Two sections of the Colosseum have been re-opened to the public. Bonus: standard reporter gaffe, claiming gladiators fought in the dungeons. These people do have editors, right? Unfortunately, I Don't Think We've Seen the End of Petulance, Yet Victor Davis Hanson once again has a perceptive take on just where, and how, things went wrong for the Obama administration. Two things stood out, for me: A hard-core leftist base is petulant that Obama copied Bush’s anti-terrorism protocols and broke a lot of promises in the process; they will vote only if they happen to be driving by the polls on a Tuesday afternoon. This is exactly what I've been hearing from the people who sit so far to the left in the peanut gallery they're in danger of falling off that edge of the world. To which I can only say, "this isn't the election you're looking for. We can vote about our business. Move along..." And then there's... I think pundits have not appreciated the fact that this is not quite a red/blue, Republican versus Democratic race, but a historic election in which many of the Republican candidates are first-time politicians, beholden to no one, and not part of the Republican establishment. This is what I've been saying, for months now. The Republican establishment has reacted with such outrage precisely because of it. My side's great disillusionment came at the end of the Bush years, when we came to the realization that the only real difference between the two sides was the color of the tie tacks. We don't want to put the same set of people who sucked in '07 back in charge in '11. We want new faces, and it looks like we'll get them. Well, yes, they're gonna suck, too. But they'll suck in different ways, and before they really start to stink they may very well do some good. I Shall Call Them, "Spiderpillers" Scientists have announced the development of a silkworm that spins a kind of spider silk. The resulting fabric is much stronger than normal silk, but not as strong as pure spider silk. However, the group says it's only started experimenting, and are confident the much stronger pure spider silk is not far off. Yes, There is a Forum For Everything. I bring you Automatic Litterbox Central. Oh, the Things They'll Say So now we're on our second round through The Light in the Attic, a great collection of poems which Olivia likes because they're cool, and I like because it's just enough like singing to make me think I am, without, you know, all that bothersome pitch and tone. At any rate, Olivia's quite advanced now, which means she got to read The Toad and the Kangaroo all by herself. Which, at the end, she said: Dismissive COUGH "DAD! Why didn't they just name her CANDACE?" The sideways-think is strong with this one, Obi-Wan."' Lost Data? What Lost Data? So, I think the next time someone starts rattling a tin cup labeled, "For Want of a CD-ROM Drive, All Digital Media Is Unreachable" at me, looking for a grant, I'll pull out this story of a guy who managed to reconstruct the sounds created by a technique never meant to be played back in the first place. Created in the 1860s, no less. "Yes yes, " I can hear them sneer, "but that's analog! We're panicking over digital media!" Fear not, my 21st century chicken little. As long as the media survives, there will always be the ability to read it. It's Official, Fourth Sign of the Apocalypse When the second-most prominent mouthpiece of the Democratic party starts running pieces vaguely sympathetic to the tea party, well, that pretty much says all bets are off. I do, however, take comfort in the fact the article never once mentions a similar sort of sign survey for more recent left-ish rallies or, goodness me, any rally before 2008. They do have standards, you know. These Guys Sure do Get Around Looks like the second unit from the next Transformers movie spent a few days poking around LC 39. Having the space shuttle end up a transformer would be cool, although I'd think that, after 20+ years of taking them half apart and putting them back together again, someone over in the service bays would've noticed something. They're damned sneaky, those transformers... I See that SOMEONE Needs Some Busy-Work At Livermore California, scientists are trying to create stars. Even better, they're using frikkin lasers! Where large research grants go, cool science tech is sure to follow. On Pots, Kettles, and the Color Black They told me if I voted for John McCain government power would be used to silence political opposition, and they were right! I, personally, love George Soros, because he's so damned useful this election cycle when the folk on the left side of the peanut gallery start rattling their cages about giant campaign donations. You know, in this election cycle. Previous cycles? Oh, come on! They were fighting for justice then! Well Whaddya Know... They Are Useful for Something A famous (I guess) hip-hop artist helped talk a guy down off a roof yesterday. The timing couldn't be better, since said artist's probation hearing on a weapons violation happens this week. "The Old Testament has virtually no reference to the afterlife, to Heaven or Hell. There is a powerful sense of spirituality, but it’s all about this world, not the next world. It says that every single person has the ability and the obligation to get up in the morning and make the world better." -- David Hazony I'd Still Put My Money on the Stig Why yes, yes it does rather resemble a lap board. But that's ok, because those guys are heading toward a very important sort of finish line. Besides, if it could get them another point in the championship I'm sure Lewis and Sebastian would be right at the top of even that board. Modern Homebuilt And now, a car that looks like it was built in the 1950s made from materials undreamt of until the 21st century. A basic exotic so tough you can literally bounce rocks off it? Sign me the heck up, too! You Ate What??? Another year, another journalist on a voyage of weird food discovery. I'm quite honest about being a recovering picky eater, and I am under no illusions as to my ability to look at, let alone eat, anything even vaguely weird looking or smelling. I'm hoping to rely on my usefulness with computers and cars to convince others with stronger constitutions to keep me fed when the zombie apocalypse arrives. Well if it Was That Damned Easy, Why'd it Take So Long? A federal district judge has ruled the military's "don't ask, don't tell" policy unconstitutional, and will apparently be issuing a global ban on it soon. The complete lack of drama this time around is a striking contrast to the ruckus that was raised when the Democrats took a run at this in the early nineties, which resulted in the policy in the first place. I don't think the country, or the military, was quite ready for gays openly serving not quite twenty years ago. A generation later, well, I'd like to think they are. Doesn't seem like they'll have much of a choice. The blogroll's back. Blogrolling went belly-up about two months ago, and every other service I tried failed to work properly. Now it's a static series of links, and it damned well works properly now! So, apologies if you thought we'd de-linked you. Never ascribe to malice that which is adequately explained by, well, laziness. Candidate: 1, Maddow: 0 Just because they're new candidates, doesn't mean they can't run an unprepared talk show host straight into the ground. A more masterful leverage of a satellite delay I have yet to see. She's obviously much more comfortable browbeating people in her studio. Charisma, good looks, and the novelty of the TV studio experience doesn't work as well to intimidate people when they're remote, everyone knows that. I'll bet her producer was crapping bricks about what Maddow would do to him or her once the interview was done. Don't mess with old men from the northwest, they're tougher than they look. He Says that Like It's a Bad Thing Barney Frank: "Tea Partiers have tied me to the railroad tracks!" If anyone from my side had breathed even a word of it, there'd be a whole legion of moonbats twirling away from the tops of their towers, shrieking about the violence of the right. It's enough to make me wish I could play the piano like a silent movie pianist, and find someone with a mustache long enough to twirl the ends. Planet? What Planet? It seems that the potentially inhabitable planet announced a few weeks ago may not, in fact, exist. Remember, folks, science will always provide the definitive answer, until new data comes along, when it will provide a new definitive answer. That the new answer may flatly contradict the old is not science's problem. Necessary? Well, yes, of course. But it's also why most people get annoyed with science. The Perfect Alaskan Ride? Personally, I can think of no better fate for a 76 Mazda mini-truck than to be converted into a Radio Flyer wagon. In Alaska. You remember those people who said Alaskans were quirky? Yeah, well, there ya go. That's MISTER Super Car to You, Bub Not content with a car that makes, count them, 1001 horsepower, Bugatti has upped the ante with a "super sport" version of the Veyron. A four thousand pound car that can go zero to sixty in 2.3 seconds pretty much defines "f-ing sled" in my book. And, before you ask, even at 1/10th the price neither of us could afford one. But we can't afford a Saturn V either, and that doesn't make those any LESS cool, know'wha'ah'mean? Scientists have announced the discovery of the earliest known example of a hominid that had to have received help from others to survive. This all may seem screamingly obvious to everyone, but physical anthropology has been burned numerous times by "obvious" conclusions that were eventually overturned when someone looked at the evidence. Nowadays if they don't find direct, incontrovertible evidence, they won't make the call, and even if they do the guys on the other sideline throw about a dozen red flags down for another replay. It's sort of like really, really slow-motion football that way. Paging the Frisco Kid, White Courtesy Phone Please An ancient Torah that's spent its life avoiding one attempt to destroy it after another is being repaired for daily use at a US synagogue. Even a quick review of European history will make it clear it's a wonder anything that can burn ever survived at all. Kitteh Sez Wha? Scientists have for the first time observed real physical changes in the brain that would explain why people who lose one sense, like hearing, compensate by strengthening the others. I'd like to think the cats in this experiment were allowed to live a long, fulfilling life and weren't dissected when the grant ran out. Who knows? I may be right. The More You Know... Sometimes the old days could be good, as when a manual for, "farming with dynamite" was up at the front of the store, with the actual stuff somewhere in the back. Authored by DuPont, naturally. Yeah, take away all the deadly infectious diseases, the near-complete lack of appliances, and infant mortality and the turn of the last century could be pretty fun sometimes. The Wrong Sort of Ring Toss It's all fun and games until the boss's husband starts waving his winky about. Partying at the hotel is fun enough, I guess, but do you think the written questionnaire was really necessary? SFW. Goodnight Mr. B We love you Bud The Dog. I Can Haz Rescue? A 9 month-old kitten is your typical 9-month old kitten and gets his self stuck in a damned dangerous place. The result? a disassembled truck and a reporter with a softball to beat his deadline. Kitty is fine, too. Don't Tell Billy For the apocalypse-fearer on a budget, Costco will now sell one year's worth of dehydrated and freeze-dried food for just $799. As I recall, and I'm sure I'll be corrected if I'm wrong, my father-in-law became convinced that the Y2K (remember that?) bug would unleash Armageddon, and he stocked up accordingly. I think he burned the last of his stacked firewood last year, and I'm pretty sure there's still a few cases of oatmeal in the garage. Me? Oh hell, if I had a place to put it all I'd probably buy it just to say I did. That, and goof on super-campers Ron and Amber about how prepared I was. As if... The Snark is Strong with This One A private company completes a successful air-drop test of its spacecraft, and all The Guardian can do is snipe at it. "But the bitter truth we critics must face, is that in the grand scheme of things, the average piece of junk is probably more meaningful than our criticism designating it so." This is far, far from an average piece of junk. You Say That Like it's a Bad Thing Iran has publicly admitted they have an espionage problem at their nuclear facilities. I'd much rather screw up their ambitions with a well-placed wrench than I would to do it with a well-placed aerial bombardment. It'd also be nice to have a little more certainty about what needs blowing up, and what doesn't. Olivia the Comedian, October Issue Wherein I prove, conclusively, that I and my friends have a sense of humor not to exceed that of a seven year-old. Some Gypsies Have Wagons We travel in an Alfa Milano! Like all classics, it's timeless. Space Billiards Scientists have captured the first-ever images of an asteroid after a collision. Bah. It'll buff out. Speaking of Musical Animals... Tatterdemalian gets a no-prize with a big band and a bunch of very white singers for bringing us yet another take on 'ye olde trololololo". Or, you know, something like that. My grandmother Johnson was into Lawrence Welk, as I recall. I never really got the point. Not all that sure I was supposed to. Goofy Bird Cockatoos are known for this sort of thing. That's a pretty aggressive wing clip there, too. Whoaah...Neigh!!..Uh...awkward Everyone needs a Unicorn Fetus! Matrix Hydrochloride [[Texting]] Me: It’s not covered by insurance and it’s expensive. [[Texting]] Amber: What do you mean? It’s an OTC! They should have told you that! [[Phone does the cute blingidy bling ring]] A, on the phone: “It’s over the counter.” Me: “It is? Where?” A: “Look for it in the diarrhea aisle.” Me, {suddenly channeling ‘Mister Anderson’ scrabbling desperately, looking around for agents with wires in their ears,} “Ok…hang on…uh… Prilosec, Benedryl,…Dramamine?” A: “No. It’s called Meclizine.” {It’s hard to walk around bent over like this… where are my Ray-Bans???} Me: “Methyl what? So it’s not Dramamine.” A: “No. What milligram did you get scripted out for?” I can hear her do the angry pharmacy frustration dance. For her not able to reach her hand through my phone to snatch it off the shelf for me is killing her. Me, in a whisper: “Uh… I DON’T remember!” … {where are the agents? Where are the agents?!?} A: “Where is your script?” I can feel the fumes coming through the phone. Me: “The… the pharmacist has it.” I start to look around the aisle to make sure no one will witness the event that will happen over the phone. Then it happened: A: “You go take that box up to the pharmacy counter and ASK them to tell you if the drug you got scripted is OTC. They should have told you that your script you handed them was an OTC! AN OTC!! OTC!!! GAH!!” Desperation sets in as I’m trying to turn down the volume of my phone and not being successful at it. I’m getting stared at and it sounds like I have a very angry chicken on the other end of the phone. {Calm the hell down, Morpheus…} A, being a pharmacy tech for many years, well…. she sorta snapped during employment with an old people retirement facility. All those years of filling prescriptions for diuretics, heart medication, prescription strength Vagisil, and lots of Valtrex… A: “You go up there. And ask them. What the better. Deal. Is! They should have told you that drug was an OTC! You should not pay prescription price for an OTC drug!” Me:”…ok. I’ll call you back.” Me: I got it. The pharmacist was not very happy that I was not told that was not an OTC. She got upset with them. A: GOOD! She should! That is an OTC drug! Me: When will this work? [[Phone does the cute blingidy bling….]] {And the editor tries to throw more Matrix references in, right before Ellen grabs the @!R$@#%#@%#@} Awweee... Hey! Watch This! In spite of what the caption says, I'm pretty sure it's not the rotor that's letting go, it's the mounting bolts on the caliper that are shearing off. How we don't lose 80% of men aged 15-25 to "controlled flight into terrain" incidents like this, I never will understand. Oh Noes!!! Well, now I have to believe in Peak Oil. Why? Because there's now an official study that says it's here! It was put out by the Association for the Study of Peak Oil and Gas! They have to know what they're talking about! The video at the end makes a good point, but my bet is it won't ever be that apocalyptic. The only thing more ingenious than a human being is a human being who sees a pathway to becoming filthy, stinking rich, and there's an entire gigantic royal family of Saudis to prove just how rich someone who can make energy can get. Off the top of my head I can think of three or four alternatives to fossil fuels that just need more money to become viable. Put it this way... the world was surviving just fine when oil was, what, $140 a barrel, and the stories were coming fast and thick about how this guy or the other guy was beavering away at a replacement. It's not quite half that right now, so the incentives aren't as strong, but they're still there. Oil is not the most precious resource on the planet. We are. And we'll figure this out, just you wait. Daryl Who? You'd think that, with all these celebrities with really bad plastic surgery, other celebrities wouldn't take the risk. And then along comes another one. It's almost as if the genes which give beauty in youth make it impossible to extend its shelf life with surgery. Either that, or it just doesn't pay to screw around with your face. There Are Second Options One of three drugs used in California’s current lethal injection procedure. The drug became a major issue last month when the scheduled execution of Albert Greenwood Brown was called off. During the legal tangle leading up to the stayed execution, it came out that the state’s supply of the drug expired on Friday, October 1–about five hours after the execution was supposed to happen. I don't get why they just don't use Euthasol or Fatal-Plus that is used in animals, since technically they are. B-ch, I Own Fat! Scientists have determined the "black widow" pulsar is the most massive neutron star observed so far. It's also helping to change the theories which are used to explain how these objects come to exist, since it's quite a bit more massive than many popular models predict. Spitterdogen What better way to end a Thursday night than with a compilation of fly-bys by pilots who weren't worried about the FAA? The two lowest are both SEPECAT Jaguars, and those are only a few examples I've seen of that type just a few feet off the ground. Must've been something about their wing design that gave them a massive ground effect, which probably made it feel like flying against the wrong side of a magnet. Anyway, always remember, in the race for the lowest pass in an airplane, you want to come in SECOND. ~ Fly Me Out to Mars ~ Another year, another guy proposing an aerial probe to be sent to Mars. Rocket power is a novelty, I'll give him that, but I'd think the various ideas for balloons would be a better value. The guy behind X-plane used his program to simulate Mars. He used to have a nice summary of his findings somewhere, but I can't find it. At any rate, the challenges in getting an aircraft to fly on Mars are genuine and very strange. Well That's Just You All Over The line is funny when it's Dorothy and the rest of the crew picking up Scarecrow. When it's the Sheriff's office picking up some lady's husband across a few counties... yeah, not so much. Ellen has scoffed more than once at these amateurs. If you do it right, you're not supposed to find anything at all, she says. I Shall Call it, "Nerfsentry" There seems to be no end to the adaptations of everyone's favorite chain-fed nerf gun. Jeff's had one for ages. I think he might actually be a little disappointed it's possible to do something useful with it. That really wasn't the point. Dead Green Really, what is it with greens suddenly trying to kill kids? Just one incidence I can chalk up to one out-of-touch group. But two, so close together, and on opposite sides of the globe... well, folks, that sure seems like a trend to me. I always knew they were more interested in telling people what to do than in saving anything, but I didn't know the totalitarian streak would be so easy to bring to the surface. ~ There's a Killer in the Hive ~ It seems that, with the help of the Army, the cause of the well-publicized domestic honey bee collapse has finally been found. Turns out it's a combination of a virus and a fungus, neither of which has the ability to destroy a colony on its own. Just why this happens is still unclear, but now that the cause is known it's hoped a cure will be soon to follow. The Church on the Hill I've read more than my fair share of accounts of the Black Death. The ones specializing in England always liked to emphasize how, even to this day, there are deserted places with just a hollowed out church, where a village used to live. Which, in this "modren" age, I always asked, "well, where???" Ha... how about here. I'm sure everyone in the UK grew up living with this stuff. I'm fascinated by it, but in such a horribly sad way. A thousand year old church, with wind blowing through the hollow spaces, because all the parishioners died just two hundred years later. And now a farmer's combine grumbles past it, because it's easier than knocking the forgotten thing down. It echoes, like an old bruise... Must... Not... Use... For Evil... One day, hundreds of years from now, people will look back and say this, this was the time, when the first for-real Genesis Device started on the road to reality. A plot device in the next Die Hard movie? Hey, folks, you heard it here first. And that, friends, is why incentives will always trump design bureaus. Finally I Have a Reason to Like This Song Mythbusters is back this week, and what better way to promote it than to have that big Scottish lump Craig Ferguson drag the principals out to do Melt with You? Will they be able to top slicing a Honda in two with a rocket sled this year? Hey, you know they'll try! A Fantasy League, for the Rest of Us Introducing Fantasy UnSports, the game which lets you score points when your football players screw up off the field. Which is, of course, most of the time, so it's actually a pretty active game. I especially liked the point value for "Player claims that wildlife on the field during a game may be reincarnated former teammate." Shading the Macabre Actually, I know quite a few friends who likely would be very interested in a nonfiction book which follows a lamp shade made of human skin from garage sale to Buchenwald, including me. If the review is any indication, it's a monument to Mark Twain's quote on the difference between fiction and nonfiction. I think, though, that I'll wait for the trade paperback to come out. That dust cover sounds just that much too creepy. My Mom's Owl Family You're Gonna Love the Title of this Place Presenting Hidden Bush, wherein an intrepid reporter fulfills their monthly 3000 word article requirement. Did I mention Hidden Bush was a nudist camp? What a clever name! Again, article is SFW. I seem to remember reading a similar article twenty, maybe thirty years ago. Seems like nudists, at least, haven't changed all that much. That's a Real Buttinski Well of course you knew it was only a matter of time until someone teased out the anal sex stats from that new sex survey. Hey, man, consenting adults, not on my lawn, go knock yourself out. Or, you know, something to that effect. Article is SFW. Well... Good Luck With That... The Army has decided to start a competition to create a single rotary-winged platform that can, depending on what wears out first, replace the Kiowa fleet, or the Chinook fleet, with minimal modifications. For those of you not quite as nerdy about aviation, this is similar to someone saying they want something that can replace my Spider, or Ron's Xterra, just by fiddling with the form factor. Well, of course they can do it. And, hell, as long as the Chinese keep lending us money, why not let them try? It's the Obama administration, man. IF WE HAVE A CHECK BOOK, WE HAVE MONEY!!! That Will Do, Nicely An M4 rifle with a .50 cal... rrrm... "bit that shoots?" It's more likely than you think! Yeah, apologies to my gun nut buds, total term fail there. Having fired my brother's "deagle" a few times, yeah... seems like most of that ur-gun's impact comes from the round, because that video SURE brought back memories. No worries, I already know it's more than I can afford. Fun with Beige When Environmentalists Attack Well, not attack so much as engage in a fantasy that the rest of us would all just, you know, explode. The original, which is way too long even with all those special effects, is here. Visions of murdering people in spectacular ways because their disagreement with you endangers everything!!!! is only fun when you keep it on the inside. Then again, it's not like the left's ever ignored an opportunity to make everyone else obey. And it always turns out so well... Couldn't Happen to a Nicer Bunch of Guys If this story is to be believed, Iran's really got a nasty computer problem. Being a bunch of religious lunatics running a program to build a nuke will, after all, tend to attract the wrong sort of attention. Boneyardski While definitely neat, this collection of abandoned Soviet-era aircraft is hardly the stuff to keep someone awake at night. Well, except for those people who are looking to spend some serious cash on some serious aircraft. Soviet flight trainers were designed to operate from horrible airfields and be maintained by drunk teenage conscripts. They therefore usually make for incredibly good private aircraft. Oh HAI! Has A Muffin Won't You!? Got this pix outside my car window today! Sintel A long time ago, you needed a talented team and one helluva lot of cash to make a CGI movie. The talent, you still need that. The cash, though, not so much. I'm thinking that nifty little fantasy adventure short was helped along greatly by the music, but you'd expect a hi-fi nerd like me to say that. Recommended. Dig Em' Up! Amenhotep III, who lived until 1352 BC, was hardly a modest king. Hawass said there is an "overwhelming amount of statuary" depicting the ruler, who was the father of Amenhotep IV, better known as Akhenaten. There may be other statues of him at the site, according to the council's statement. Dug up in Luxor, Egypt...not Vegas. Radiation Hawks By using an "artificial event horizon," scientists seem to have found the first direct evidence for Hawking radiation. As with most really weird scientific experiments, the result is open to interpretation, not all of which confirm that black holes do in fact radiate energy. Fold 'em Up Just in time for, well, for the bike season to end, actually, we have this round-up of folding bicycles. One of my Learning Tree instructors used a folding bike when he was traveling to teach classes. He loved the thing. Glasses? We Don't Need No Glasses! Engineers at Toshiba have unveiled a 3D television which does not require glasses to work. Bonus: it also can transform "normal" broadcasts into 3D. New TV tech being what it is, prices start high... the equivalent of about $1500 in yen for a 12" screen. TV tech in general being what it is, I'd expect the price to drop steadily if it meets market success. Haikyo I would've thought Japan far too organized to allow anything to actually become ruins. Turns out not only do they have them, they're well organized and comparatively safe. You know, like the rest of the country. Keep an eye out for tentacles though, that's all I'll say. "You can't go around building a better world for people. Only people can build a better world for people. Otherwise it's just a cage." -- Terry Pratchett, Witches Abroad Via Talking to myself again... Restore, or Re-Work? Jeremy Clarkson is weighing in on the whole, "restore vs. resto-mod" debate. Me? I tend to value originality, and the market my cars play in does too. That said, I also think modifications which materially improve the car while also being true to its nature are also to be admired. Putting a Chevy 350 V-8 in a Jaguar XJS sedan I think is a pretty horrible thing to do, but putting a monster Alfa V6 in a tiny Alfa sports car (and, if you follow that thread, f-all else to it) is fine. Doing things to fix things that were actual mistakes in the original engineering, like the fixes on the E-type Jeremy mentions, are more than fine as well. But, ultimately, I've come around to the opinion that, "it's your car, do what you want to it." I admire any modification when it's done well, and I laugh uproariously at any that are done poorly. Take care of it, and don't half-ass anything. Wackos is as Wackos Does Ah, I see, when my side has a few right-wing loons show up at a massive rally, they get front page coverage. When the other side has wackos show up at a rally, you have to go digging for the evidence. I know, I know. we highlight the right-wing extremists because they are the truly dangerous ones. The left's record is so much cleaner! Goin' Retro As with most technologies, things like motion controllers and game boys have roots far deeper than you'd at first think. I remember the Microvision system very well, and I think either we or someone we knew had a Blip. The rest, not so much. Lambo Love There's show cars, and then there's show cars. 0-60 in 2.5 seconds is completely mad, and unfortunately it costs more than my house, so that plan goes out the window. Ah well, fun to look at! NO EssCahpay The Tub! Dr.Bronner's soap bath! Working With Smallish Bird Dope Science Ok, so it turns out Contador's failed drug test involved a substance that increases a person's metabolic rate, among other things. It's also just possible he really didn't take it intentionally. Me, I remember Floyd Landis was about as sincere as he could be professing his innocence, and look how that turned out. Regarding Lawns, and Getting Off Mine Another year, another forty-something bemoaning lazy, meddling kids. I'd take such things much more seriously, if I hadn't been reading them for the past, oh, thirty years or so. Likely there's a Linear A tablet somewhere complaining about how kids these days take bronze for granted and don't know how to properly tie a tunic. My Kind of Hybrid Meet the Jaguar C-X75, a technology demonstration car that's part electric, part jet. Yep, jet. Instead of the more common reciprocating engine, engineers have instead fitted a gas turbine to help extend the otherwise pitiable range of 68 miles to a much more comforting 500+. It's a show car, it doesn't have a price tag. Still, I can't imagine it'd be a particularly quiet car.	cc/2020-05/en_middle_0093.json.gz/line450
__label__wiki	0.690479	0.690479	Vinay Menon: Who cares if Billie Eilish has never heard of Van Halen? She’s 17! If you were outraged because Billie Eilish has never heard of Van Halen, I have some terrible breaking news: you are even older than you think. In a recent interview with Jimmy Kimmel, Eilish, the 17-year-old singing superstar, was quizzed about pop culture from 1984. Why? As Kimmel told his audience, that’s when he was 17, in what was “the greatest year in American history.” That’s debatable. When I imagine Kimmel in 1984, as a 17-year-old brat, I’m picturing a cherubic rascal who stole slices of pepperoni pizza and pranked senior citizens with whoopee cushions. I’m picturing a troublemaker who ran afoul of all authority figures, including the teachers inclined to give him a D- in algebra. But that was the greatest part of the ’80s: everyone was free to be who they were, even if they were not who they thought they were. Kimmel could ultimately emerge from the decade as a comedic genius despite, in other ways, being a total doofus. It didn’t matter. You liked what you liked and nobody judged you. You had room to become you. Even if there was no consensus on what was and what was not quote-unquote cool, all these years later, I can type out a list off the top of my head of ’80s brands and trends in the GTA — Beaver Canoe, Swatch, Fox, Indigo, paisley, yellow, flipped collars, 501s, army surplus backpacks, tapered legs, pastel blazers, Sony Walkman — that absolutely defined the era. Billie talks about living with her parents, being nominated for several Grammys, performing at the American Music Awards, being competitive with herself, why she’s looking forward to turning 18, dealing with fame, trying to be present, going on tour, her friendship with singer Jessie Reyez, and Jimmy proves how old he is with some questions for Billie from way back in 1984 – when he was 17. So I’m truly baffled as to why poor Billie Eilish is now getting savaged for confessing in this Kimmel interview that she’s never heard of Van Halen. My God, she is 17. Who cares? What does it matter? Why should she be familiar with Van Halen? Should Kimmel be drilling her on Procol Harum or CCR? Should she be well-versed in the Moody Blues or ELO? No, it doesn’t matter. Van Halen’s first album came out in 1978, or 23 years before Eilish was born. I mean, why should she be familiar with this hair metal band, anymore than she should be an expert on shoe cobblers or fallout shelters? In the last decade, has any child in the free world blasted “Panama,” “Jump,” “Hot for Teacher” or “Runnin’ With The Devil”? No. Whatever Van Halen was in the ’80s, in this millennium they are a distant memory. They have drifted far beyond her life experience. What’s hilarious about the angry Van Halen fans now chastising Eilish for being clueless about their sonic heroes is that, overall, in this Kimmel interview, she’s basically clueless about the decades that predated her birth. She also had a blank expression when Kimmel asked her about “The Cosby Show,” Mr. T, “Ghostbusters,” Cabbage Patch Kids and “Gremlins.” It was like he was speaking Swahili. It was like he was asking her to build Ikea bookcases with no pictograms. The irony of Eilish not knowing about Van Halen is that even some of its biggest fans should see the wisdom, all these years later, in her youthful ignorance. As a teenager, I once won tickets to a Van Halen concert by calling in to a local FM radio station that was running a contest. They’d play a song backwards and listeners had to guess what the song was. I remember hearing this particular reverse-garbled track and realizing, mostly by the distinctive percussion time signature, it was Led Zeppelin’s “D’yer Mak’er.” So I called up, got on the air and won the tickets. I promptly gave them to my younger brother. Go to a Van Halen concert? Please. So as one old man to the rest of you old men now attacking Eilish for not having a clue about one of the most overrated hair metal bands ever, here’s what I’d say: of all art forms, music is the most generational. We get attached to the tunes of our youth and use that as a benchmark for the rest of our lives. Then we tend to see everything new as bad. That’s ridiculous. We tend to demonize the up-and-comers as having no talent and no sense of history. And that’s even more ridiculous. Even if you appreciate the musicianship of Van Halen — Eddie Van Halen’s guitar playing is clearly Top 10 in rock history — can we at least acknowledge it’s totally fine for a gifted youngster such as Billie Eilish to have no idea about them? They had their time. This is her time. And music, by its very nature, has no long-term memory. Get more opinion in your inbox Get the latest from your favourite Star columnists with our Opinion email newsletter. We have suspended your account in accordance with our Code of Conduct. For more information please visit Code of Conduct Billie Eilish has never heard of Van Halen. Is that OK? Not OK? Share your thoughts Conversations are opinions of our readers and are subject to the Code of Conduct. The Star does not endorse these opinions. Vinay Menon: Tiny purses promise big rewards for h... Rob Lowe’s Bigfoot tale a step in the right direct... Vinay Menon: Julia Roberts headline flub gives ‘ho... Cameron Diaz: I may never act again To Vikings, Teddy Bridgewater looks ‘like he... Canada will never ‘be party to’ torture, defence m... Tags:Billie Cares Eilish Halen Heard. Menon never She’s Vinay ← How to Invest in Stocks: Investing in Stocks for Beginners South Korean actor Cha In-ha found dead in latest K-pop tragedy →	cc/2020-05/en_middle_0093.json.gz/line451
__label__wiki	0.502642	0.502642	Home > Places > Shops > Ashwell Stores > Christy's Shop - early 1940's - late 1940's > Christy's Shop - early 1940's - late 1940's Mr F Bowes of Kingsbury, London NW9 By Jackie Embury Evidence of an Agreement between Mrs Louisa Christy of Parade House, High Street, Ashwell (widow) and a Mr F Bowes of Deanscroft Avenue, Kingsbury, London NW9 dated 23rd October 1940 has come to light. It would appear that Louisa sold a lease to Mr Bowes in the sum of £600 + stock-in-trade in the sum of £424.16.10d., for the shop and Parade House. It also appears that Mr Bowes ran the shop for 7 years prior to Anna and Kit who rented the shop and Parade House from Louisa late 1940's - 1951. Acknowledgement: Nigel Robinson grandson of Fred Bowes Lease Agreement dated 23rd October 1940 Patricia Lewis Completion Statement - Oct 1940 - page 1 Parade House garden wall backing onto Wolverley House c 1940 Parade House and J H Christy & Son Ltd's shop c 1940 Parade House, J H Christy's shop and Dennis Butchers c 1940 J H Christy & Son Ltd shop display c 1940 Fred Bowes was my grandfather and from my understanding he took over the shop so that he could remove his family from London during the war. My mother (Fred's daughter) had been sent to Blackpool to work for the Civil Service but I believe came to Ashwell to help run the shop, including making deliveries. The family also lived in Letchworth where my mother met my father. After the war, my grandfather moved the family down to Brighton where I was born and remain. By Nigel Robinson Thank you Nigel for your comments it confirms my research. Do you have a photo of your grandfather and mother at that time, even better if you have them at the shop please, these could be added to complete the picture? Best wishes, Jackie Sorry it's taken me so long to reply. I don't think I have any photos of my grandparents at shop. I have three photos of the front and one which I think is in the rear garden - if it has a high wall as the picture is basically that with a shed to the right hand side. I couldn't work out how to paste photos into this comment. Dear Nigel, please send any pictures you have to enquiries@ashwellmuseum.org.uk and we will see that they get added to the site. By Peter Greener Thank you Nigel I am so pleased to receive your photos and will put them on the website as it helps to build the picture. It is interesting to see the sand bags, when we had the shop we thought that flooding had been a problem in the past but thankfully the drainage had been improved. You are correct about the wall it once had a greenhouse attached with heating it must have been quite impressive in the Victorian period. If you have photos of your grandparents from that time it would be good to include them. Best wishes, Jackie Ashwell Stores Ashwell Stores - 6 September 2015 - present John (Jack) Christy History of Ashwell Stores/Parade House in photos Christys Shop 1829 - 1940 Christys Shop - Late 1940s - 1951 (Ashwell Stores) S.G. Sackett 1951 - 1963 (Ashwell Stores)	cc/2020-05/en_middle_0093.json.gz/line455
__label__cc	0.546122	0.453878	The White Book shortlisted for Man Booker International Prize The Man Booker International Prize celebrates works of fiction from around the world, that have English translations published in the UK. The shortlist of six books in contention for the 2018 prize has just been announced. The GBP50,000 prize for the winning book will be divided equally between its author and translator. The list includes Han Kang, and Deborah Smith, who together won the prize in 2016 for The Vegetarian. Seoul-based Han Kang is one of South Korea's foremost novelists. Her writing has won the Yi Sang Literary Prize, the Today's Young Artist Award, and the Korean Literature Novel Award. The Vegetarian was her first novel to be translated into English. She is also the author of Human Acts. Deborah Smith translated both The Vegetarian and Human Acts into English. She has also translated two novels by Bae Suah, A Greater Music and Recitation. This time around the pair are in contention with The White Book, in which an unnamed narrator moves to a European city where she is haunted by the story of her older sister, who died a mere two hours after birth. As she contemplates the child's short life she focuses on whiteness and all it symbolises. The White Book is a meditation on colour beginning with a list of white things. It is a book about mourning, rebirth and the tenacity of the human spirit. It investigates the fragility, beauty and strangeness of life. The judges comment: “The White Book is a very delicate, very slight and measured piece of work. It’s a collection of white things; white is the colour of mourning and the colour of non-existence. It is a glimpsed story of an older sibling of Hang Kang’s who was born and very quickly died. It expresses respect and represents the guilt of being alive.” The full short list is: Virginie Despentes, for Vernon Subutex 1, translated from French by Frank Wynne Han Kang, for The White Book, translated from Korean by Deborah Smith László Krasznahorkai for The World Goes On, translated from Hungarian by John Batki, Ottilie Mulzet & George Szirtes Antonio Muñoz Molina for Like a Fading Shadow, translated from Spanish by Camilo A. Ramirez Ahmed Saadawi, for Frankenstein in Baghdad, transited from Arabic by Jonathan Wright Olga Tokarczuk, for Flights, translated from Polish by Jennifer Croft Lisa Appignanesi, chair of the 2018 Man Booker International Prize judging panel, comments:"This is a shortlist emblematic of the many adventures of fiction – its making and reading. We have mesmeric meditations, raucous, sexy, state-of-the-nation stories, haunting sparseness and sprawling tales; enigmatic cabinets of curiosity, and daring acts of imaginative projection – all this plus sparkling encounters with prose in translation. We were sorry to have shed so much of our longlist talent, but this is a shortlist to read and re-read." Posted by Rosie Milne at 08:40 Search Asian Books Blog Explore Asian Books Blog 500 words from (57) Indie spotlight (46) Lion City lit (36) Just quickly (27) Elaine Chiew contemporary voices (25) On translation (18) Backlist books (15) New book announcement (13) Student bookshelf (9) Lion City lit listings (8) Tsundoku (6) My working day (5) Q & A: Karien van Ditzhuijzen Backlist books: The Fugitive by Pramoedya Ananta T... Signal 8 Press by Marshall Moore Student bookshelf: The Tale of Genji Sight/Unseen drama conference Two nonagenarian authors and an outburst 500 words from Joyce Bergvelt The White Book shortlisted for Man Booker Internat... Asian Contemporary Voices: Interview with Kirstin ... Student bookshelf: exploring Mongolian folktales Interview with Singapore Unbound Founder Jee Leong... Follow Asian Books Blog by email Literary reviews and magazines in Asia Asian Review of Books Asia Literary Quarterly Publishers with strong Asia-focussed lists Backsmith Books Monsoon Books Ethos Books Camphor Press Singapore literary scene Singapore Writers' Group Singapore Writers Festival Swag Literary Journal Royal Asiatic Society Hong Kong Asia House Asia Society Royal Asiatic Society (London) © 2013 – 2019 Asian Books Blog. All rights reserved.	cc/2020-05/en_middle_0093.json.gz/line456
__label__cc	0.730977	0.269023	Why Did American Beer Tend to Blandness Prior to the Craft Era? August 7, 2015 August 7, 2015 by Gary I haven’t read the book which is the subject of this interesting Atlantic article, but would like to offer some thoughts. First, even post-Prohibition, American beers must have had plenty of taste. Look at A.L. Nugey’s table of beers circa-1936 I posted a few days ago. Those beers were hopped at .5 lb to upwards of 1 lb per (American) barrel, which is much, much more than the modern norm – I’m speaking here of the typical mass market beer, not the craft segment. It’s rather more than English bitters were achieving in the period leading up to the craft beer onset in the U.K. Even though most of those beers used some rice and corn adjunct (or sugars), they had to be far more impactful on the palate than the typical modern light beer or standard macro offering. This is due both to the much larger hop content than today but also the probable average lower percentage of adjunct used as compared with modern mass market beers. Sam Adams Boston Lager uses about 1 lb hops per U.S. barrel and is based on an 1800’s recipe of the founder’s ancestor: would anyone claim it is bland? Would anyone claim Pilsner Urquell, the “first” blonde lager and 4.4% abv as it was in the 1800’s, is bland? The American Budweiser in the 1800’s surely tasted much closer to both these beers than it now does… I don’t see that German immigration or lingering Volstead attitudes had much to do with the decline of beer flavour. The lowest alcohol level permitted in some states after 1933, 3.2 alcohol by weight, is about 4% by volume, fairly respectable. Foster’s lager, a large-selling brand in English pubs, is currently 4% abv. And many states post-Volstead had higher limits on beer abv or no limits. I believe the blandification of North American beer started mainly in the post-war era and gathered pace from the 1950’s in particular. This was for a variety of reasons: cost-savings under more sophisticated business strategies (use less or less costly materials = make more money), expanding the beer market to include more women and young people, and foremost, industry consolidation. Also, the U.S. and Canada had a corn crop, thus corn (or rice) became acceptable to use as an adjunct to barley, for which too there were technical brewing reasons at the outset, e.g., they promoted clarity. The UK has a lower-alcohol, inexpensive lager-based beer culture. So does France, Spain, many other countries. Well how did they get there then? No Prohibition, no huge German influx. I think the same factors explain the watery mass market taste as occurred in America after WW II. I do agree that a lot of lager was on the weaker side in the 1800’s, but this was so in Germany too at the time – the achievement of the circa-5% abv norm only occurred somewhat later both in the U.S. and Germany. This was probably connected, or in my view, to reduced multiple unit consumption vs. the later 1800’s, something which made sense both in light of greater health knowledge but also the increasing urbanization and mechanization of society. Of course this discussion is largely of a historical nature since the craft beer segment now ensures a range of very characterful beers (as the Atlantic piece noted), but still I thought it useful to indicate some thoughts in reaction to what I read. Categories General6 Comments August 5 2015 Recreation of Historic New York Beer Tasting (Image courtesy Rick Radell, Toronto) INTRODUCTORY REMARKS OF GARY GILLMAN AFTER JOHN MAXWELL INTRODUCED ME TO INVITEES AT AUGUST 5, 2015 RECREATION OF HISTORIC (1944) WALDORF ASTORIA, NYC “TASTING OF BEERS, ALES AND STOUTS WITH COMPLEMENTARY FOODS”. [Below is the printed version on which my speech was based, inevitably it wandered a bit from the strict text but not the spirit. It was a great evening]. Thanks to everyone for attending this event, very much, and to John Maxwell for believing in this project and making it happen “on the ground”. No one could do it better, due to John’s unquestioned status as one of Toronto’s premier restaurateurs. John, also, has been a long-time supporter of fine beer, and fine local wines, in Dora Keogh’s, and Allen’s next door, in our fair city. I am a full-time business lawyer in Toronto and research beer and brewing history as a pastime. I found the 1944 beer menu recently when perusing historical menus uploaded to the New York Public Library’s online menu archive. When I saw it, I realized we had to recreate that event as a time machine to enjoy some rare gastronomic history. As John observed to me recently, beer was always part of gastronomy and always appreciated as such. But until recently, appreciation at the level of investigation and reflection was restricted to a few privileged groups, mostly in London and New York (the same applied to wine, for that matter). In addition though, to organize any kind of epicurean event at the height of WW II took some doing. After all, wartime involved food shortages, rationing, and other privations both imposed and voluntary. Still, the organizers found a way to mount a very respectable tasting by any definition. Indeed, the same Society had organized a similar but even more lavish beer event in 1942, also at the Waldorf. That menu has twice the number of beers of the 1944 tasting and many more foods and taste notes. After two years and some of hard slogging in the war and countless sacrifices, I think the organizers of the 1944 event felt they should be more restrained. Still, the intricacy of their menu speaks for itself and once again, the mid-40’s was very early times for this. Many of the foods presented at the 40’s beer tastings of the Waldorf were regional American specialties. They included Virginia ham, Mohawk Valley, NY Limburger and Swiss-type cheese, NY sharp cheddar, “Nova” Salmon, Smoked Black Cod, various smoked lake fish, whole-grain breads, Saratoga and Devonsheer biscuits and crackers, and the rather modern-sounding shrimp chips. Many of these were from New York State or prepared there. While these were cold foods, it is notable that many distinctive American dishes were featured. In the 1930’s and earlier, cuisine more typically was an imitation of French or other European cooking. What of the beers (18) chosen for the 1944 tasting? Many were from the greater NY area, in particular Brooklyn, a brewing powerhouse until the 1970’s. Most were blonde lagers, but there was also dark lager, different types of ale, and two black stouts. Even the blonde lagers could be divided between the original Germanic, all-malt type and the Americanized, lighter version which used grain adjunct or sugars. The menu in its subject headings made an attempt at a logical style division but the actual listings didn’t follow it strictly, due probably to the haste with which the event was organized, or last minute changes to the selection. Well before the mid-1900’s, lager beer had become the dominant American style, acquired via German immigration in the 1800’s, and had displaced largely the ale and porter of the English colonists. Some beers at the tasting were sourced from Pennsylvania and Maryland, and one or two other states. Guinness Stout, almost certainly Foreign Extra Stout, was the only import. The strong focus on domestic beers and distinctively American foods may have resulted from sentimental or practical reasons, or both. Whatever the explanation, we can infer that, from these 40’s tastings, a new appreciation of “local” was gained. The “locavore” and food and wine scenes of today have their origins distantly in events such as the 1940’s Waldorf beer tastings and the other tastings (usually with wine) held by the pathbreaking Wine and Food Society, Inc. from the 1930’s through the 60’s. It was not alone of course but played a large role in the history, in my opinion. I’d like to close by saying, one of the first people I sent tonight’s Program to said to me, “Gary, you say in here the Wine and Food Society, Inc. of New York in 1944 was instrumental in the tasting of beer as a, quote, ‘aesthetic’. That may well be. But I’ll tell you one thing the Society was not instrumental in”. I said, “What’s that?” He said, “Tasting beer as an anaesthetic”. Have a great evening. Categories GeneralLeave a comment 1930s American Beer Styles at a Glance August 3, 2015 December 15, 2019 by Gary A few days ago I drew attention to A.L. Nugey’s important, 1937 book Brewing Formulas, and his hand-drawn “compositive table” for some 16 beers. It is actually more since he gave alternate versions for most of the styles. The document is above for further detail. Lager and Ale It occurs to me that a good subject for those monthly hosting sessions – where a blogger selects a topic for longer treatment by the Faculty – would be thusly: if you could choose on every outing to have the perfect beer experience, would you? Or would you rather negotiate the twists and turns of many bar sorties, i.e., where some or all of the beer inevitably is disappointing or middling? I think I’d opt for the former. When all goes right it induces a particular well-being rather beyond the efficacies of mere alcohol. On the other hand, there is a lot to be said for seeking the wilder shores of beerdom: the inevitable founderings, and dull destinations, are off-set by the El Dorados found. A pint of County Durham XXX on hand pump today at Bar Volo was as perfect as cask can be: limpid at the sight, low bubble but just enough, full-tasted with English tradition written all over it. Not a single fault (oxidation, over-age, etc.) to mar the experience. Durham, long-established as a quality ale purveyor at the city’s eastern edge, rarely disappoints, but this particular pint of XXX was surpassingly good. Later, in the Pilot a few blocks north, the new Mountain Lager from Side Launch Brewing Company in Collingwood, ON stunned by its rich clean malt qualities and complex, just-right Noble hop underpinning. The hops had a decided peppery note, not sure which sub-set of German hop mastery was employed here but the brew was like a fully-realized art work, in a word the apotheosis of the helles tradition. Amongst the many qualities, there was no hint of DMS, a taste traditional for some helles and other blonde lagers to be sure, but which does not enhance top quality, IMO. And so it was a two-run homer out there in the brewing fields. The fine Canuck rock song, Kim Mitchell’s Lager And Ale, was ringing in my mind as I departed down the aluminum stairs, my decisions this time gave the very best results. The metallic-theme decor of the Pilot reprises the look of the original location on Yonge Street, not far away. During the war it was a resort of RCAF and other fliers training in the area, hence the all-time-zones 40’s-style clocks which festoon the main room and other period touches. (Thanks to my buddy Rick Radell for his kind help to improve the first image above). Pilsner Urquell, a Towering Beer August 1, 2015 by Gary Urquell is on top of the city, Toronto in this case, which is not to suggest it is the best beer in the city, but it is amongst them, certainly. The rich, bitter-sweet taste, enhanced by a bare two months from packaging (per date code on base), is pretty much unique and also gastronomically very satisfying. There is a typical barley character to it, I recognize it in some other beers, that, matched with the Saaz herbal/flowery taste, is a unique stamp, one I recognize since starting to drink the beer in the 70’s. We have never gotten it here in better condition, in fact. In James Roberston’s “The Connoisseur’s Guide To Beer”, Caroline House Publishers, 1982, he described it thusly: “Deep yellow color, huge malty hop aroma [compared to AAL, he meant], heavy body, marvellous malt-hop flavor with an attractive sour dryness, excellent balance between hops and malt. A fine beer, worthy of its reputation”. True then, true now.	cc/2020-05/en_middle_0093.json.gz/line459
__label__cc	0.681459	0.318541	Overview of the Case-Law of the European Court of Human Rights 2016 (International) Criminal Law Caribbean law General Academic Human Rights & Humanitarian law International Public Law & politics Studyguides Technology & Law WLP catalogue About WLP Registry of ECHR Shipping Weight: 450 gram Published: 01-2018 Publisher: WLP Language: US ISBN (softcover) : 9789462403772 € 34.95 Verkrijgbaar via bol.com of uw lokale boekhandel Every year, the European Court of Human Rights delivers a large number of judgments and an even greater number of decisions, thus adding to its already formidable body of case-law. This can make it difficult for people outside the Court to know which cases break new ground or address new issues. An increasingly important aspect of the Court’s work has thus become to identify such cases and to disseminate them in a convenient and accessible format. The annual Overview series, available in English and French, seeks to respond to that need by focusing on the most important cases the Court deals with each year. All the cases are selected by the Court’s Jurisconsult’s Directorate on the basis of their jurisprudential interest. In addition to the cases chosen for publication in the Court’s Reports of Judgments and Decisions, they include a number of other cases that raise issues of general interest, establish new principles, or develop or clarify the case-law. The approach has been to draw attention to the salient points, allowing the reader to appreciate the jurisprudential significance of a particular case. What did other customers buy after viewing this item: webdesign by Robiz.nl Webdesign & Webhosting Oisterwijk	cc/2020-05/en_middle_0093.json.gz/line467
__label__wiki	0.845996	0.845996	Home \| Information wars 26.10.2011 \| Andrey Polevoy CRISIS AND TOLERANCE: Does Europe have enough money to pay immigrants their welfare? Recently a group of Swiss-residing Muslim lawyers demanded to...change the flag of a country they’d moved into. After a profound consideration of state symbols of a country that hosted them Turkish, Albanian and Bosnian migrants discovered an "unpleasant" detail. This is namely the cross displayed at the Swiss flag that "insults the memory of believers" and "reminds of the Crusades". Last winter the leaders of the most immigration-attractive European countries demonstrated a high degree of solidarity on an important political matter. Almost simultaneously Angela Merkel, Nicolas Sarkozy and David Cameron admitted that the so-called multiculturalism policy had failed completely. Achieving even a peaceful symbiosis of immigrants and natives seems to be utterly impossible. Despite the fact that one out five Germans is an immigrant or a child of immigrant these days, only one out of ten immigrants has found jobs during the last 10 years. The remaining 9 feel themselves just fine with the welfare, which every enlightened European state pays. That burdens the budget furthermore and aggravates the headache of the authorities. The immigration issues, though, are not confined with finances alone. The unwillingness of the new immigrants’ generation to adopt the common basis of European values — language, traditions and culture — inevitably builds up the tensions and the minority attempts dictate its will to the majority. At that, the examples of such dictatorship attempts turn all the more glaring. Recently a group of Swiss-residing Muslim lawyers demanded to...change the flag of a country they’d moved into. After a profound consideration of state symbols of a country that hosted them Turkish, Albanian and Bosnian migrants discovered an "unpleasant" detail. This is namely the cross displayed at the Swiss flag that "insults the memory of believers" and "reminds of the Crusades". Ivica Petrusevic, Vice President if the immigrants’ association Secondos Plus was the first man to offer removing the cross from the Swiss flag. "Cross doesn’t fit the contemporary multicultural Switzerland" — immigrant from the former Yugoslavia stated. There are plenty migrants in Switzerland — approximately 450 thousand of them, while the Swiss population makes up about 7.5 million people. Notwithstanding, even this ratio barely grants them the right, what fits Switzerland and what not. All the more, the offered alternative to the "unpleasant" flag (for immigrants) is quite equivocal. After a thorough research of Swiss history, applied symbols and signs, ardent lawyers concluded that the banner of the so-called Helvetic Republic will suit the multicultural Switzerland the best. At that, the Helvetic Republic itself emerged as pseudo-state under French protectorate, existed for 5 years (since 1798 until 1803) and got famous only for the sheer number of armed revolts against French occupants, "wandering" capitals, outrageous political instability and the amounts of money that have flown to France. During the age of the Helvetic Republic a caricature has become popular — it depicted Swiss dancing around a "Tree of Liberty", while French had been loading sacks with money onto the carts. Well, we may surely certain analogies to the nowadays situation. Freedom of press is aplenty in Europe these days, while the money keeps running low. So why have migrants liked the Helvetic Republic flag so much? Firstly, it contains nothing to insult the people, who honored Switzerland with moving there and secondly, it’ really pretty. That’s what the official statement of immigrants says: "We offer using the flag of the Helvetic Republic, painted in green, red and yellow, which looks alike with Ghana and Bolivian flags". At that, an inevitable question emerges — why haven’t the former Turkish and Albanian citizens chosen to live in Ghana and Bolivia instead? It also remains unclear, whether Christians, living in Turkey will be able to file lawsuits, demanding to change the Turkish national flag, depicting a crescent. Neither do we know what goal have lively Muslim lawyers pursued, although the reaction of the Swiss society was actually predefined. In the end of 2009 the resumes of the Swiss national referendum on the further construction of minarets has clearly demonstrated the lack of passion for multiculturalism. The "reformers" of state symbols have chosen the least appropriate moment for their demarche. Right in October the next parliament elections are to take place and according to the polls, the Swiss People’s Party (SPP), whose members initiated the minaret-related referendum, got an extra share of voters’ support. The punch-lines of the SPP election were the promise to evict all the foreign criminals, stop the mass immigration and resist the Swiss joining the EU by all means. Without waiting long for the elections to start, the SPP revived its bill, forbidding to cover faces in the public places except at the "festivities and holidays, stipulating the wearing of masks and other analogous accessories". Previously the second chamber of the Swiss parliament refused to restrict hijabs but the initiatives for changing the Swiss national flag may change the mind of Swiss law-makers. We can’t rule out the possibility of launching the Swiss-like mechanisms in Norway. Norwegian lawyers (just like Swiss ones) have stood up with a number of initiatives. They have particularly proposed legalizing the Shariah courts. Tor Landbach, leader of the Norwegian Court Alignment, and numerous human rights activist consider the de-facto operation of Shariah courts (and many "new Norwegian" obeying to them) to be a sufficient ground for that. Landbach believes that Shariah courts may be included into the system of Norwegian legal proceedings. He claims that if a faithful Muslim is offered swear an oath on Bible, has no reasons whatsoever for awing the procedure. Lawyers and human rights activists delicately omit the fact that it undermines both state security and the very foundations of the legal system. Clerical right has lost its grounds in Europe and the contemporary legislation is based upon the Roman right. Norwegian Minister of Justice Knut Storberget is unwilling to support these bold initiatives and has all the grounds for that. He claimed the idea of legalizing Shariah rule to be a dangerous one: "The legislation must remain utmost neutral from the religious point of view. If we legalize the Shariah rule even partially women will inevitably lose". Human rights activists reply that the "non-tolerant" standpoint of the Justice Minister is destined to fail: "This is like charging the windmills". Self-made banners "Shariah territory", stuck to the bus stops and store doors are all the more frequent in the immigrant districts of Norwegian cities. Lawyers and human rights activist states that quite a lot of "new Norwegian", Somali expatriates mostly, live in a religious marriage. Men often have up to six wives, including the under-aged ones, who reside in the flats, paid by the social services. It goes without saying that the absolute majority of Somali "Norwegians" is unwilling to assimilate in the classic Norwegian society. That’s the status quo and not only in Norway. As far back as in the middle of the summer, Islamic extremists have launched a pan-British campaign, sticking the banners to mark up the areas of Shariah law. Living districts were covered in the banners that said: "You enter the Shariah-controlled zone and have to obey the Islamic laws!" Radical priest Anjem Choudary assumed the responsibility for the action, exclaiming the plans to flood the Muslim and non-Muslim districts all over the Great Britain with them, stating that "in the long run this will sow the seeds for the ripening Islamic Emirate". While the activity of Swiss "reformers" causes merely aggravated discontent with immigrants and the imposition of protectionist cultural and religious steps, in Norway the situation is the opposite. Crusade of the terrorist Breivik has driven European right-wingers to an utmost inconvenient situation. Any attempt to protect the traditional set of Norwegian values is treated as a disguised approval of his actions. Breivik has in fact forced Norwegian authorities and their neighboring counterparts to make more — and rarely mutual — steps towards the immigrants, who don’t consider it necessary assimilating in the community and keeping up with the general rules of the land with its own history, traditions and values. Meanwhile, today’s changes of immigration policy are inevitable and conditioned by economic (along with cultural and political) reasons. Mind that it’d be financially impossible to maintain large unemployed masses forever, when the crisis comes. By Andrey Polevoy AMERICAN NMD AND THE "GREATER ROMANIA" PROJECT Oddities of the officially presented meaning of the U.S. NMD system may be discussed for a long time. So, the intercepting missiles, launched from Romania are to bring the hypothetical Iranian rockets down in over Turkey. In Turkey itself it is planned to station merely AWACS radar. According to the logic of the missile strikes, the latter one should be attack in the first place, because after that the attack at Europe and the USA can be waged with a much greater success. If we draw all the bases and radar of American NMD system as the points of a circle, it is the Russian Federation rather than Iran that happens to be in the center of it. "IRANIAN CONSPIRACY", THE USA AND THE GULF MONARCHIES Saudi Arabia and the Gulf monarchies are the strategic partners of the USA, the unsinkable battleships of it. Obama’s office is ready for more than just piling Al Qods, drug traffic and Los Zetas into a single heap for them. They can go as far as exclaiming the new terrorist plot against America and create the new "Iranian Al-Qaeda" for that sake. State Department microphones and White House paper can bear that much and more. EUROPEAN MULTICULTURALISM: Beyond the line of liberty Previously one could have hardly treated European multiculturalism seriously. This concept had all the chances to become the political framework of European integration process, although abuses of democracy and misinterpretations of human rights prevented new citizens of the major European countries from truly enjoying the fruits of the "free world". European relative multiculturalism ended up with a natural relative failure in a relatively tolerant European society. PEACE PRIZE OR PANDORA PRIZE? On the 7th of October Laureates of the Nobel Peace Prize will be announced in Oslo. It’s difficult to say whether Wael Ghonim will be awarded — he has tough rivals. Yet, if we start giving this award away to people, who provoked a chain reaction of coups, civil conflicts, full-scale civil wars and mass bombings, then the name "Pandora Prize" fits the Nobel Peace Prize more. RUSSIA AS THE GUARANTOR OF EASTERN MEDITERRANEAN SAFETY. Regional presence of Moscow will reduce the risk of conflict in the Turkey — Cyprus — Israel — Syria square The new power, designed to secure peace and stability in the Eastern Mediterranean, is to put itself forth with strength and energy. We have to say that Russia fits the role just fine. At that, Russia also has economic incentives to carry out active policy in that direction. It is well-known that Syria is going to develop trade relations with the Customs Union. FAKE CRYSTALL: REFLECTIONS ON US HUMAN RIGHTS CONCEPT Thousands of years old cultural taboos are reasonable and logical unlike US State Department statements. All deviations from family traditions impede the full performance of the most important natural function: to give birth and raise descendants, to transmit one’s genetic, intellectual and moral potential through them. By imposing its specific preferences to the whole humanity the US ruling strata not only undermines universal moral values, but, threatens the existence of the United States itself. AMERICAN INTERNET STRATEGY: THE WEST CAN DO WHAT OTHERS CAN’T WHAT LIES AHEAD OF THE AMERICAN REVOLT? Most likely the situation will develop in the following way: outstanding democrat Barack Obama will express his support of the participants albeit the police and the FBI will be slowly arresting the "revolt" leaders. Demanding total freedom and inviolability for the rebellious ringleaders abroad (especially in the countries stuck in geopolitical or economic discrepancies with the USA), America isn’t going to stick to the same rule inside the country. RUSSIA — UKRAINE — THE EU: Kiev suddenly understood the advantage of the Customs Union If Euro-bureaucrats haven’t dared to criticize Ukraine on their own, they should have been asked of that. Thanks to European remarks Ukrainian officials have finally started speaking the language that common Ukrainians understand. As if by a wave of a magic wand, the authorities became aware of the CU advantages and ghost-like benefit of the FTA, the difference of the actual economic pros and some make-believe bonuses. SENTENCE OF TYMOSHENKO. Russia and the EU are equally discontent with the situation The Ukrainian President has driven himself to a dead-end. Both Europe and Russia may reproach him for getting rid of a rival, while euro-integration becomes all the more distant. Even discharging Tymoshenko will give poor comfort. Releasing Yulia Volodymyrivna will instantly idolize her in the eyes of Yanukovych haters. BAHRAIN AND THE "DOCTORS’ PLOT": Why’s Bernard Kouchner keeping silence? Will the internationally-recognized Transitional National Council be created in Bahrain? Will the UN pass a resolution, condemning the "doctors’ genocide"? Will the members of Bahraini royal family considered persona non grata? Will the Bahraini foreign accounts be suspended? Surely, not. At least, not until there’s an American military base in this island state.	cc/2020-05/en_middle_0093.json.gz/line470
__label__cc	0.630257	0.369743	MP3 podcast Commercial Biz-Av Who Is ANN? Advertise On ANN! Airborne Unlimited -- Recent Daily Episodes Episode Date Airborne Unlimited- Airborne-Unmanned w/AUVSI- AMA Drone Report- Airborne On ANN Airborne Unlimited--01.13.20 Airborne UnManned-- AMA Drone Report--01.16.20 Airborne-YouTube Wed, Sep 11, 2019 Pair To Attempt Balloon Crossing Of The Atlantic Ocean In 2020 Flight Planned To Travel From New Brunswick In Canada To Landing In Europe In the summer of 2020, Deborah Day and Mike Scholes will take on the exciting and challenging record-breaking attempt adventure to fly across the Atlantic Ocean in a Cameron Balloons built, lighter-than-air, gas and hot-air combination balloon. The intrepid pilots plan to take off from New Brunswick, East Coast of Canada with the aim to land “where the winds take them” over Europe. The adventurous flight is expected to take between 5 to 7 days aloft and the couple also hope to break existing distance (the Atlantic Ocean is approximately 2,520 nautical miles), duration and altitude records for this size of aerostat. "We are very excited about the flight, it will be an adventure of a lifetime, challenging - of course but we are really looking forward to completing the flight successfully and raising awareness for Blind Veterans UK who have given Mike invaluable support and training, since his sight loss,” Day said. One of Day’s ambitions is to be the first female pilot to cross the Atlantic Ocean and Scholes aims to be the first registered blind person to make such an adventurous balloon-crossing as crew. This new Cameron Balloons designed and built balloon is the first of its kind. It can be adapted to fly with either hydrogen or helium and has been designed to reach altitudes in excess of 20,000 ft. “The Roziere balloon can be flown as a helium and hot-air combination or it can be used as a hydrogen only balloon.” explains, Pilot, Deborah Day. The Cameron Balloons specially designed balloon created a job for the UK Civil Aviation Authority too who had to invent a new classification type for this unique balloon, so now Deborah and Mike’s lighter-than-air craft, is the first of this new classification, the Roziere 77 Gas Balloon (R77GB) G-ZOZO (affectionately known as Golf-2020.) The pair has decided against a convention when flying over such a large expanse of sea, and despite advice to the contrary, they will use an open-weave basket rather than the more usual and highly-recommended capsule. Deborah and Mike are adamant that an “ordinary” basket will provide them with the flight experience they want and have planned their flight in the basket extremely thoroughly; to ensure the equipment to counteract the cold of altitude/night and the emergency systems are all in place despite being so open to the elements. For example; the basket will carry added insulation, as well as all supplies, equipment and communication systems the couple will need. Both Deborah and Mike are also undergoing specialized training to get them ready for their adventurous flight – including survival “dunk” training and general fitness training. During the flight one of the specialist pieces of equipment Mike will use is an audio app so that he can monitor the flight whilst Deborah sleeps. Mike clarifies “Even though I am registered blind I am bringing a wide range of experience to the challenge and my sight loss does not affect my ability to crew. I am really looking forward to the journey and having been to the test inflation and understood each step of the set-up, I have every confidence in the design and manufacture of the envelope.” The Couple also have the support of a very experienced ground support team who will work alongside them leading up to and throughout their flight; Kevin Stass, Flight Control Director, David Dehenau, Professor of Meteorology in Brussels, the team’s meteorologist and Bert Padelt, experienced Gas Balloon Launch Master, all of which have worked on previous record-breaking balloon flights or FAI (Fédération aéronautique internationale) approved competitions. (Image provided with Cameron Balloons news release) FMI: www.cameronballoons.co.uk Klyde Morris (01.20.20) Klyde's Friend Was Robbed... FMI: www.klydemorris.com>[...] Airborne 01.17.20: A/C Registration Warning, iFly GPS Update, Boeing's Net Loss Also: NBAA Updates Jet Resource, New Virgin Galactic COO, Heathrow Anti-Drone System, Gogo And Hispasat Deal EAA is warning the aviation community to regard any solicitation they m>[...] Airborne-Unmanned 01.14.20: 1st US EHang Flt, $6M For Kratos, Unlawful Drone Ops Also: Karma Firmware Update, Swift Tactical Systems, Drone-Based Home Security, Drone Swarms (Again) EHang conducted its first-ever US trial flight of its two-seater passenger-grad>[...] AMA Drone Report 01.16.20: Remote ID Opposition, DRL Tryouts, Karma Updated Also: Super Bowl LIV Regs, Drone-Based Home Security, Unlawful Drone Ops, Red Cat Acquisition With the recent announcement of a Model Aircraft Political Action Committee and dozens>[...] Headlines Only \| Headlines w/ Teasers \| View Everything Aero-TV: SyberJet Lives! - SyberJet’s SJ30 Program Gets Innovative Updates Subscribe to ANN newsletters Learn more about ANN © 2007 - 2020 Web Development & Design by Pauli Systems, LC	cc/2020-05/en_middle_0093.json.gz/line473
__label__cc	0.554169	0.445831	GA on AI ML Jobs AI Companies AI Meetup (SF) DataLabeling API AI:Mechanic AI Strategy, Machine Learning and Deep Learning d993: SpiNNaker: world’s largest neuromorphic supercomputer “SpiNNaker: world’s largest neuromorphic supercomputer switched on” – reddit discussion SpiNNaker: Spiking Neural Network Architecture It is designed to support spiking neural networks, which are much more similar than ANNs to biological neural networks. It is funded by the Human Brain Project. What do you guys think? Will this kind of architectures (neuromorphic computing) enable much progress in the Spiking Neural Network field? ‘Human brain’ supercomputer with 1 million processors – https://www.manchester.ac.uk/discover/news/human-brain-supercomputer-with-1million-processors-switched-on-for-first-time/ SpiNNaker Project – The SpiNNaker Chip. The basic building block of the SpiNNaker machine is the SpiNNaker multicore System-on-Chip. The chip is a Globally Asynchronous Locally Synchronous (GALS) system with 18 ARM968 processor nodes residing in synchronous islands, surrounded by a light-weight, packet-switched asynchronous communications infrastructure. The figure to the right shows that each SpiNNaker chip contains two silicon dies: the SpiNNaker die itself and a 128 MByte SDRAM (Synchronous Dynamic Random Access Memory) die, which is physically mounted on top of the SpiNNaker die and stitch-bonded to it. The micro-architecture assumes that processors are ‘free’: the real cost of computing is energy. This is why we use energy-efficient ARM9 embedded processors and Mobile DDR (Double Data Rate) SDRAM, in both cases sacrificing some performance for greatly enhanced power efficiency. SpiNNaker Chip The figure to the left shows a plot of the SpiNNaker die, with the 18 identical processing subsystems located in the periphery, and the Network-on-Chip and shared components in the centre. At start-up, following self-test, one of the cores is elected to a special role as Monitor Core and thereafter performs system management tasks. Normally, 16 cores are used to support the application and one is reserved as a spare for fault tolerance and manufacturing yield-enhancement purposes. Inter-processor communication is based on an efficient multicast infrastructure inspired by neurobiology. It uses a packet-switched network to emulate the very high connectivity of biological systems. The packets are source-routed, i.e., they only carry information about the issuer and the network infrastructure is responsible for delivering them to their destinations. The heart of the communications infrastructure is a bespoke multicast router that is able to replicate packets where necessary to implement the multicast function associated with sending the same packet to several different destinations. SpiNNaker chips have six bidirectional, inter-chip links that allow networks of various topologies. Inter-chip communication uses self-timed channels, which, although costly in wires, are significantly more power efficient than synchronous links of similar bandwidth. The SpiNNaker die area is 102 mm2 (10.386 mm × 9.786 mm). It was originally taped-out in December 2010. The first batch of fully-functional packaged chips was delivered on May 20th, 2011. https://arxiv.org/abs/1810.06835 – SpiNNTools: The Execution Engine for the SpiNNaker Platform SpiNNTools: The Execution Engine for the SpiNNaker Platform Andrew G. D. Rowley, Christian Brenninkmeijer, Simon Davidson, Donal Fellows, Andrew Gait, David R. Lester, Luis A. Plana, Oliver Rhodes, Alan B. Stokes, Steve B. Furber Distributed systems are becoming more common place, as computers typically contain multiple computation processors. The SpiNNaker architecture is such a distributed architecture, containing millions of cores connected with a unique communication network, making it one of the largest neuromorphic computing platforms in the world. Utilising these processors efficiently usually requires expert knowledge of the architecture to generate executable code. This work introduces a set of tools (SpiNNTools) that can map computational work described as a graph in to executable code that runs on this novel machine. The SpiNNaker architecture is highly scalable which in turn produces unique challenges in loading data, executing the mapped problem and the retrieval of data. In this paper we describe these challenges in detail and the solutions implemented. Previous Previous post: d992: HiddenLayer: Neural network graphs and training metrics for PyTorch and .. Next Next post: d994: Best AI news in October? AI Jobs Andrej Karpathy Andrew Ng Baidu Berkeley Books DARPA Dataset Deep Learning DeepMind Demis Hassabis Facebook FAIR Games Geoff Hinton Google Google Brain Greg Brockman Hardware Healthcare Hugo Larochelle Ian Goodfellow IBM Watson Ilya Sutskever Intel Keras Mark Zuckerberg Marvin Minsky Microsoft MIT NIPS NLP NVIDIA OpenAI PyTorch SDC Self-Driving Cars Stanford Stephen Wolfram TensorFlow Tesla Tutorial Uber Yann LeCun Yoshua Bengio d1026: Deep Learning for Classical Japanese Literature d1025: PyTorch v1.0 stable release d1024: Depth First Learning Fellowship: $4000 grants to build ML curricula d1023: Machine Learning for Combinatorial Optimization d1022: Can you tell if these faces are real or GAN-generated? d531: AI and Machine Learning Jobs July-August 2017 \| AI:Mechanic on d380: AI and Machine Learning Jobs California, February 2017 d531: AI and Machine Learning Jobs July-August 2017 \| AI:Mechanic on d501: AI and Machine Learning Jobs June-July 2017 d531: AI and Machine Learning Jobs July-August 2017 \| AI:Mechanic on d346: Machine Learning Jobs, January 2017 [San Francisco, Bay Area] d501: AI and Machine Learning Jobs June-July 2017 \| AI:Mechanic on d440: AI / Machine Learning Jobs April 2017 d501: AI and Machine Learning Jobs June-July 2017 \| AI:Mechanic on d412: Machine Learning and AI Jobs, March 2017 Proudly powered by WordPress \| Theme: Afterlight by WordPress.com.	cc/2020-05/en_middle_0093.json.gz/line476
__label__cc	0.514607	0.485393	Founding Director Bhagavd Gita 2019 Lectures and Seminars > Young Mind Speaks Workshops and Retreats > Science & Spirtuality Workshop Weekend Retreat to Melukote 10-11-2019 Consciousness Studies Students-Scholars Forum On the Shoulders of Giants Indian Heritage Winter School Glimpses Science-Spritual Retreats Past AISSQ Conferences Dr. T. D. Singh Gallery Melkote Melkote is a place of great spiritual significance. Many ancient events related to Lord and His devotees have taken place in Melkote. The two very ancient deities of Lord Vishnu as well as another ancient deity of Lord Narasimha can be found in Melkote. All these deities have come down to this planet Earth through the hands of the great devotees of Lord as well as different incarnations of Lord Vishnu Himself. As the hill of Melkote is closely associated with Lord Narayana, it was knows as Narayanadri in Satya Yuga. In Treta Yuga, this hill was known as Vedadri because Lord Dattatreya taught Vedic knowledge to his disciples in these mountains. Great personalities such as Medhatithi and Prahlada studied the Vedic scriptures here under the guidance of Dattatreya. In Dwapar Yuga, this hill was known as Yadugiri because Yadu family often came down here to worship Lord Narayana. In Kali Yuga, this hill is known as Yati Shaila because Shripad Ramanuja rebuilt and revived this place in the 11th century AD. As a number of great sages such as Narada, Vyasa, Bhrugu, Shandilya etc. came here to acquire knowledge, this place is also known as Dnyana Mantapa meaning "The house of knowledge". The spiritual significance of Melkote is described in different Vedic scriptures such as Naradiya Purana, Matsya Purana, Ishwara Samhita as well as Kashi Mahatmya. Therefore a serious spiritualist will be very curious to know more about the history of Melkote. In this article I will try to share the spiritual history of Melkote as far as my limited capacity permits. Arrival of Lord Tirunarayana: The temple of Lord Tirunarayana (Vishnu) is the main temple of Melkote town. This temple is situated at the base of Yadugiri hill. How the deity of Lord Tirunarayana came here is a very interesting fact. Lord Brahma, who is a secondary creator of the universe, wanted to have a deity of Lord Vishnu for worship. Lord Brahma performed austerities to obtain the deity of Lord Vishnu. When his austerities were successful, the deity of Lord Vishnu appeared before Lord Brahma in a beautiful celestial plane. This deity of Lord Vishnu is known as Lord Tirunarayana. Lord Brahma worshipped this self-manifested deity for a long time in Brahmaloka, which is one of the highest planetary systems in the universe. Later, Lord Brahma's son Sanatkumar requested his father to give him the deity of Lord Tirunarayana so that he could worship the Lord. Lord Brahma then gave the deity to Sanatkumar who brought it to this planet and installed it in Melkote for the benefit of masses. In this way Lord Tirunarayana came to Melkote and today He is present in His temple which is situated in the town. Arrival of Lord Ramapriya: There is another deity of Lord Vishnu which is known as Ramapriya. This deity is present in the temple of Lord Tirunarayana itself. This deity is a utsava murty, which is taken out of the temple for procession during the days of festivals. When Lord Brahma gave the deity of Lord Tirunarayana to his son Sanatkumar, he once again performed austerities to obtain another deity of Lord Vishnu for his daily worship. This time Lord Vishnu manifested a very beautiful deity from His heart along with the deities of Shridevi (mother Lakshmi) and Bhudevi (mother Earth). This deity is known by two names. The first name is Shri Cheluvaraya Swami and the second name is Ramapriya. In this article we will refer to this deity by its second name Ramapriya because it is easy to remember and pronounce. These deities were made of auspicious metals and they were worshipped by Lord Brahma in Brahmaloka. Later in the times of Ramayana, Lord Rama came back to Ayodhya after defeating daemon Ravana. At that time, a deity of Lord Ranganath was present in Ayodhya and it was being worshipped by Lord Rama and His family. Lord Rama made Vibhishana the king of the golden city of Lanka and instructed him to go to Lanka and rule there. Lord Rama gave Vibhishana the deity of Lord Ranganath so that he can take it to Lanka. But on the way to Lanka, the deity of Lord Ranganath decided to stay at Srirangam and it can still be found there. Because of these happenings, Lord Rama did not have any deity of Lord Vishnu for His daily worship. Seeing this situation, Lord Brahma gave the deity of Ramapriya along with Shridevi and Bhudevi to Lord Rama. Because these deities were very dear to Lord Rama, they are known as Ramapriya. Lord Rama worshipped these deities with great love and opulence. Later, Lord Rama's son Kusha worshipped these deities. Kusha's daughter Kanakamalini was married to Yadushekhara of Yadu dynasty and she took Ramapriya with her. In this way the deity of Ramapriya came from the Solar dynasty of Lord Rama into the Lunar dynasty in which Lord Krishna and Balarama appeared later. In the times of Mahabharata, Lord Krishna and Balarama used to worship Ramapriya in their house. Once Balarama came to south India on pilgrimage. When he visited Lord Tirunarayana in Melkote, He found that the deity of Lord Tirunarayana is strikingly similar to the deity of Lord Ramapriya in their house. When He came back home, He told Shri Krishna about this similarity. After this incidence, Krishna and Balarama brought the deity of Ramapriya to Melkote and installed it here. Today, this deity is also situated in the temple of Lord Tirunarayana. Lord Krishna and the members of Yadu family often visited Melkote to worship this deity. Therefore Melkote is also known as Yadugiri. In this way, the two ancient deities namely Lord Tirunarayana and Ramapriya are still present in the town of Melkote in the same temple. Melkote lost in the sands of time: After Lord Krishna left this planet and the age of Kali started, the spiritually vibrant atmosphere of Melkote was greatly affected by the forces opposing the religious principles. Melkote suffered attacks of foreign invaders who plundered the wealth of the temples. During these hard times, the temple of Lord Tirunarayana was lost and the area of the Melkote town was eventually covered by thick cover of forest. The deity of Lord Tirunarayana was covered under ground and the knowledge of its existence and whereabouts was lost to human kind. The deity of Ramapriya was taken by the foreign invaders as a loot from the temple and the knowledge about this deity was also lost. The spiritual significance of Melkote was hidden from the human society for a long time. In the 11th century AD, one of the great spiritual masters of India, Shripad Ramanujacharya, re-established the temple of Melkote. Now we will review a fascinating historical account of how Ramanujacharya found the lost deities and re-established a spiritual glory of Melkote. Ramanujacharya's archaeological discovery of Lord Tirunarayana: Ramanujacharya was one the greatest spiritual masters of India. He was mainly stationed in Srirangam but due the persecution of Lord's devotees started by the King of that region, Ramanuja had to leave Srirangam. After travelling to many places, he reached a place called Tondanur. The king named Bittideva used to rule that region. He was a follower of a Jain philosophy but after Ramanuja released the king's daughter from the control of evil spirits, the king became an ardent disciple of Ramanujacharya and changed his name to Vishnuvardhana. In the year 1090 AD, Ramanuja was running short of a white sand required by devotees to put a holy mark on their forehead. One night, Lord Tirunarayana came into the dream of Ramanuja and told him that He is very near in the town of Melkote. Lord instructed Ramanuja to go to Melkote and find the deity of Lord Tirunarayana as well as the white sand required by him. Ramanuja was extremely happy to have this revelation. He sent the message to Vishnuvardhana telling him about his arrival at Melkote as well as the divine revelation. Vishnuvardhana engaged many men to clear the forest around Melkote for the search of the deity. On the first day after Ramanuja reached Melkote, they were unsuccessful in finding the deity as well as the location of white sand. On that night, Lord Tirunarayana again appeared in Ramanuja's vision and gave him the specific directions for finding the deity. Lord told him that He was situated under a big ant-hill which was located between a Champaka tree and Vakula tree near the south-west corner of a water pond named Kalyani. Lord also told Ramanuja that the sacred white sand was located near the north-west corner of the same Kalyani pond. Ramanuja immediately followed the direction given by Lord and found the ant-hill. Ramanuja and his disciples removed the earth and found the deity of Lord Tirunarayana situated in its spiritual glory. Everyone present there was intoxicated with spiritual bliss after they found the Lord. Ramanuja then bathed the Lord with milk and made arrangements for the worship of the deity as well as the festivals that were to be observed. A temple was erected over the ant-hill and Lord Tirunarayana was thus reinstalled after the ages of oblivion. Ramanuja also found the sacred white sand near the north-west corner of the Kalyani pond. The Vedic scriptures explain that this Kalyani pond was formed by the drops of water which fell here when Lord Varaha was carrying mother Earth. Also the sacred white sand was brought here by Garuda from the planet named Shweta Dweepa where Lord Vishnu resides. Ramanuja's discovery of Ramapriya: After the revitalization of the town of Melkote, Ramanuja wanted to have an utsava murty in the temple of Lord Tirunarayana. Ramanuja was continuously thinking about how to accomplish this task. One day, Lord Tirunarayana appeared in the vision of Ramanuja and told him, "My utsava murty named Ramapriya is in Delhi inside the house of the Turkish king. Please go there and reclaim the deity of Ramapriya from the king." Following Lord's order, Ramanuja travelled all the way to Delhi on foot with some of his disciples. When Ramanuja visited king, he requested the king to return the deity of Ramapriya. King told Ramanuja that he had plundered thousands of deities from all over India and showed him his collection of these deities. Ramanuja wanted the deity of Ramapriya alone, but he could not identify the required deity. That night, when Ramanuja was anxiously thinking about how to find Ramapriya, Ramapriya Himself appeared in his vision and told him, "I am with the king's daughter. She plays with me treating me as her husband and I also reciprocate with her in that way. Please come and find me there." Next day, Ramanuja visited the king and told him about the vision. The king was very much impressed with this revelation and he also developed a respect and adoration for Ramanuja although the king was the follower of Islam. The king took Ramanuja to the inner chambers of his palace where no other man was allowed to enter. Ramanuja saw that king's daughter had placed Ramapriya on a couch. Ramanuja then called Ramapriya by his name and asked him to come towards him. The deity of Ramapriya then jumped down from the couch and walked towards Ramanuja and sat in his lap. The king also witnessed this most astonishing incident and honoured Ramanuja with many gifts. When king's daughter came to know that Ramapriya was about to be taken away from her, she could not bear the separation from Lord Ramapriya. She had developed a deep love for Ramapriya. She requested her father to allow her to go with Ramapriya to Melkote. King happily gave the permission and sent his daughter with Ramanuja along with untold amount of wealth and gifts. The king told Ramanuja, "Your Lord Ramapriya does not go alone but with a wife. Please take care of her." After reaching Melkote, Ramanuja arranged a wedding ceremony between Ramapriya and king's daughter. She served the Lord in Melkote till the end of her days. Today her temple can be found on the top of Yadugiri hill where she is known as Beebi Nachiyar. Personally I feel that Lord's marriage with king's daughter is one of the most astonishing event. From this event, we learn that Lord sees only the devotion and love of His devotee. He does not care whether the devotee is born in a family of Hindus or Muslims etc. The temple: The temple which houses Lord Tirunarayana as well as Lord Ramapriya is situated in the Melkote town. It also houses the deity of goddess Yadugiri Amma who is the consort of Lord Tirunarayana. She is situated at the feet of Lord Tirunarayana. The temple also houses the deity of goddess Shri Cheluvanayaki who is the consort of Lord Ramapriya. Goddesses Shridevi and Bhudevi sit on the two sides of Lord Ramapriya. All these deities are extremely beautiful and well decorated. The look on the faces of the deities is so compassionate that we will be very assured of the protection of devotees by Lord and His consorts. On the walkways inside the temple there are deities of Shri Sudarshana Alwar, Ramanujacharya and Anjaneya. The current temple was built in the time of Ramanuja (11th century AD). Kings of Mysore have contributed many later additions to the temple. The Yoga Narasimha temple: The temple of Lord Narasimha is situated on the top of the Yadugiri hill. As Lord Narasimha is sitting in a yogic posture, this deity is known as Yoga Narasimha. In the Satya Yuga, Prahlada, a great devotee of Lord, engaged in the meditation on Lord Narasimha on this hill. As a result he received this deity of Lord Narasimha which he installed here. Therefore this temple is also very ancient. The details about the life of Prahlada can be found in Bhagavat Purana as well as many other Vedic scriptures. The jewelled crown of Ramapriya: One of the most precious items present in the Melkote is a jewelled crown of Lord Ramapriya. The deity of Lord Ramapriya wears this crown only for a few days in the year. The story of this jewelled crown is also very interesting. Once Prahlada's demoniac son Virochana visited Lord Vishnu and saw that Lord Vishnu was in meditative trance. Virochana saw the opportunity and stole a jewelled crown which Lord Vishnu was wearing. He took this crown and went to the lower planetary systems of the universe. The devotees of Lord requested Garuda, who serves Lord Vishnu as his bird carrier, to go and retrieve the crown. Garuda then went to lower planetary systems and after fighting with Virochana, took possession of the crown. On the way back, He saw Krishna playing with his cowherd friends in Vrindavana. Garuda understood that Lord Krishna is non other than Lord Vishnu and surrendered the crown to Krishna. Krishna decorated the deity of Ramapriya with this crown and it came to Melkote when Krishna brought Ramapriya to Melkote. Other holy places of Melkote: Melkote is surrounded by many other holy places and holy water ponds. Many spiritually significant events took place at these places. These places are listed in Table 1 and Table 2 along with their brief description. Holy places in Melkote Paridhanashila Kshetra -- A place where Dattatreya taught Vedas to His students. Also Ramanuja gave up his white clothes and received safron robes here. Located on the banks of Veda Pushkarini pond. Yoga Narasimha Kshetra -- A place on the top of the hill where Prahlada received the deity of Lord Narasimha. Dnyana Ashwattha Kshetra -- A Peepal tree under which five great intellectuals named Shuka, Pundarika, Rukmangada, Ambarisha and Prahlada attained the spiritual realization. Located near the west bank of Kalyani pond. Taarkshya Kshetra -- A place located near Kalyani pond. Garuda brought sacred white sand from Shweta Dweepa and stored it here by the order of Lord Vishnu. This sand is still available. Nayana Kshetra -- Located in the row of hills near Yadugiri. The deity of Lord Keshava is present here. A Brahmin called Vishnuchitta performed austerities here. Varaha Kshetra -- Located on the east bank of Kalyani pond. At this place, Lord Varaha taught issence of Vedic knowledge to Bhudevi (mother Earth) who was sitting on Lord's lap. 7 Seeta Aranya Kshetra Located on the southern entrance of Kalyani pond where Lord Rama stayed along with mother Seeta and Lakshmana. Holy water ponds in Melkote Veda Pushkarini -- A place where Dattatreya taught Vedas to His students. Yadava Teertha River -- Yadavi flows by the side of this pond. A king named Yadavendra performed Yoga on its banks and attained liberation. Palasha Teertha -- A pond surrounded by many Palasha trees. Sons of sage Vasishtha were released from the curse they had got from sage Vishwamitra after bathing in this pond. Darbha Teertha -- Dattatreya used a Darbha grass grown on the banks of this pond. Shandilya lecured on Pancharatrika system of worhip at this place. Padma Teertha -- Sanatkumar used lotus flowers of this pond for worhipping Lord Tirunarayana. Maitreya Teertha -- Sage Parashara preached Vishnu Purana to sage Maitreya at this place. Also known as Parashara Teertha. Narayana Teerth -- a Located in Nayana Kshetra where Lord Narayana blessed a Brahmin called Vishnuchitta. Vaikuntha Ganga -- A pond foemed from the drop of Viraja river which flows in the spiritual world. Dhanushkoti -- A place where Lord Rama shot arrows into the rock to bring out the water for mother Seeta for bathing. Our Pilgrimage: We visited Melkote on 17 February 2013 along with 35 students from Indian Institute of Science as well as the senior members of Bhaktivedanta Institute Bangalore. After reaching Melkote we visited the temple of Lord Tirunarayana and paid obeisances to the deities. Then we climbed on the Yadugiri hill to visit the temple of Yoga Narasimha. While climbing the hill we sang the holy names of Lord accompanied by the musical instruments such as Mridanga and Kartal. After praying to Lord Narasimha, we performed Sankirtan on the top of the hill for some time. The view of Melkote town from the hill-top is very beautiful. The spiritual atmosphere was so vibrant that everybody was totally immersed in the bliss. After coming down from the hill, we visited Kalyani pond. Although due to timing constraints we could not visit all the holy places in Melkote, this spiritual trip was one of the most memorable trip of my life. From the histories of Lord Tirunarayana and Ramapriya, we understand that these deities are not different from Lord Vishnu Himself. Therefore we should not take these deities to me mere sculptures made of stone and metal. These deities have all the opulence and power of Lord Vishnu Himself. One has to possess a great fortune to have the faith in our ancient Vedic literature. A person who does not have such fortune is generally very quick to question the authority and accuracy of Vedic literature. But the places like Melkote are the witnesses to the ancient historical accounts mentioned in the Vedic literature. Today's historians may be entirely dependent on different stone markings and documents for knowing about the events that occurred few centuries ago. But Vedic literatures are our only reliable source if we wish to learn about the historical and spiritual events that happened millions of years ago, even the events that occurred just after our universe was created. I hope that the history of Melkote will help one to develop at least some amount of appreciation for our ancient books. Lastly I note that the large number of events that occurred in Melkote may cause a confusion in the mind of reader. It may not be possible to comprehend everything written in this essay in one reading. Therefore I request the readers to contact me if they have any queries about this article. I will be pleased to clarify their doubts as far as possible. I do not wish to call myself the author of this article as it may result in unnecessary pride. Such pride will be an additional obstacle in my spiritual journey because my mind is already filled with many filthy thoughts. I am totally dependent on the mercy of Lord Krishna and His devotees for protection of my spiritual progress. I request all the Vaishnavas to accept this essay as a humble offering at the feet of Lord although it is full of imperfections. 1. Melkote An Introduction, Haripriya, Samskriti Publications, 2011. 2. The life of Bhagavad Ramanujacharya, Alkondaville Govindacharya, Jeeyar Educational Trust, 2006. 3. Spiritual India Handbook, Stephen Knapp, Jaico publishing house, 2011. 4. Mystical Melkote, Swami B. V. Giri, Gaudiya Touchstone Issue 4, January 2013. I thank Bhaktivedanta Institute, Bangalore for organizing a wonderful trip to Melkote. I thank the scholars of IISc Bangalore for enthusiastically participating in this trip. I thank my friend Prof. Arulalan for gifting me a book mentioned in reference 1. I also thank my friend Tamilarasan who took wonderful pictures of Melkote. Finally I thank all the readers of this blog for constantly encouraging me through their kind words. Hrishikesh S Sonalikar, Dept of Instrumentation and Applied Physics, Indian Institute of Science, Bangalore 560 012, India. email: hrishikeshsonalikar@gmail.com http://historyancientindia.blogspot.in/ “Now (you have got this human form of life, therefore,) one should inquire into the nature of Brahman, the Absolute Truth, or God.” Copyright © 2019 Bhaktivedanta Institute, Bangalore 4th Floor, #11, 2nd Cross, 1st Main Rd, Subedarpalya, Yeshwanthpur, Bengaluru, Karnataka 560022. Email: bi.bangalore@binstitute.org	cc/2020-05/en_middle_0093.json.gz/line479
__label__cc	0.742604	0.257396	Make Art Not War Challenge About Monica Valentinelli Non-Fiction & Reference The Story Of The Titanic, A Corn Maze On Sunday, I got lost in a corn maze at the Creek Bed Country Farmacy. The miles of plowed rows were shaped into the form of the RMS Titanic. I was floored by the ingenuity of some people. Rather than tell you about this, I’d rather show you some pictures. If you want to see a larger image, you can click on it, and it’ll take to you a ginormous photo. That giant square pumpkin is a character named Spookley The Square Pumpkin. The owners had an outside theatre set up where you could watch videos. Yeah, I popped in for a bit. How could I not? Outdoor theatre? Turns out it’s okay to be square. Yay! In front of the maze, were two large haystacks and a life preserver. This is the entrance and exit to the maze. You can see that there’s a starboard and a port path. To get a sense of how huge this maze is, here’s a link to the map. Once inside, you could play a trivia game to get all ten stations punched. The right answer will lead you on the correct path. The wrong one will send you into a dead end. One of the things that I really enjoyed about the maze, was that there were a ton of really cool signs and set-ups like this one. So, it wasn’t just that you were meandering about sections of the ship. There were these teeny, tiny stories almost everywhere you looked. Afterward, we went on a hayride. You can see the stretch of corn maze from my viewpoint. And we saw BABY PUMPKINS! Sure, I mean I knew that baby pumpkins grew in a patch. . . But I’d never seen one of these before. When we sat down to have a snack, I encountered rows and rows of teeth. Pumpkin teeth. That glow-in-the-dark and can suck your blooooood. Then, I saw these oddly-shaped squash that reminded me of gnarled dragon talons. Of course, no corn maze would be complete without pets of varying size. A miniature donkey appropriately named “Eeyore.” And a giant Flemish rabbit named “Daisy” that, upon close inspection, could probably take on my black cat Rimmon — and win. Well, that was the end of my corny day at a farm. For ten bucks, I thought this was a lot of fun, and apparently it’s even spookier the closer you get to sunset. Imagine rushing through a corn maze with just a flashlight. . . In the dead of night. . . Many of the stalks were several feet higher than me. There’s a lot of ways to get lost and circle around in there. Good thing they had an emergency back up — a rescue if need be. Thankfully, I made it out all right and didn’t need a rescue. I suppose the promise of caramel apples DID help. 😀 Mood: WAKKA WAKKA Caffeinated Beverages Consumed: Enough that I’m hovering off my chair. Work-Out Minutes Logged Yesterday: I bent and twisted. In My Ears: Take A Bow by Muse Game Last Played: Tetris Movie Last Viewed: Harry Potter collection Latest Artistic Project: Miniatures Latest Release: “Fangs and Formaldehyde” from the New Hero anthology through Stone Skin Press corn maze, Halloween Blog, I Recommend... Monica Valentinelli is a writer, editor, and game developer. Her portfolio includes stories, games, comics, essays, and pop culture books. In addition to her own worlds, she has worked on a number of different properties including Firefly, Vampire: the Masquerade, Shadowrun, Hunter: the Vigil, Brandon Sanderson’s Mistborn, and Robert E. Howard’s Conan. Looking for Monica’s books and games that are still in print? Visit Monica Valentinelli on Amazon’s Author Central or a bookstore and game store near you. Want to Interview or Hire Me? Send Fan Mail? Would you like to hire me? Because my projects and manuscripts are in flux, I am always open to discussing new opportunities with publishers and studios. As a full-time writer, I spend a portion of my time seeking new gigs–so don’t be afraid to reach out. If you’re interested, please e-mail me via my Contact Page. I typically reply to work-related e-mails within one-to-two business days. Want an interview? If you’d like to interview me or request a guest blog post, please connect with me via the contact page, too. Due to time constraints and other communicative concerns, I typically don’t follow up on requests via social media. Keen on sending fan mail? I am also happy to engage with readers and fans. Please note that I am unable to reply satisfactorily to certain types of queries related to the companies I work for due to the agreements I typically sign. If you have a question about a TV show or a line of books, the best way to get your answer is to contact the studio or publisher directly. Gratitude Writing Exercise and a Casserole Recipe to Save Time Mark the Date for sub-Q Magazine’s February Issue! Join My Worldbuilding Panel at Midwinter! Critiquing The Witcher Season 1 My 2019 List of Publications Update on Make Art Not War Challenge and Future Plans [Upcoming Appearance] Writer Guest of Honor at RadCon! Join My ExtraLife Fundraiser and Help Sick Kids! My GameHole Con Guest and Streaming Schedule [New Release] Tales of Excellent Cats	cc/2020-05/en_middle_0093.json.gz/line485
__label__wiki	0.653326	0.653326	Boy of Summer Travis Nelson's Baseball Blog: Baseball Trade Rumors, News, Commentary, Trivia, Statistical Analysis, and Book Reviews from Major League & Fantasy Baseball Early Offseason Ramblings... It's a little early in the off-season to start complaining about the way the "market" is going, but there have been a few deals already, and already I'm confused. Lee Sinins sends out daily "Around The Majors" emails on the happenings of MLB, including signings, trades, notable game feats (when there are games), and even birthdays. Friday's list contained some curious entries... 1) The Cubs signed free agent P Scott Eyre to a 3 year, $11 million contract. There are incentives in the deal that could be worth an extra $2.4 million and the 3rd year is a player option. Is this what a decent lefty reliever is going for these days? Almost $4 million a year, and more if he meets incentives? Eyre's OK, I suppose, but he's got a 4.52 career ERA in 480+ innings spanning eight seasons. He set career highs with 86 appearances and 68 relief innings, and a career low with a 2.63 ERA, the first time in his career that it's been under 3.32. He'll be 34 years old in May, and isn't likely to get any better than he was last year. In fact, his numbers are likely to look notably worse in 2006 both because of normal regression from the career year he enjoyed in '05 and because of the difference between pitching in SBC Park (a moderate to severe pitcher's park) and Wrigley Field (a slight to moderate hitter's park). Eyre hasn't shown a particular left/right platoon split in the last two seasons, though there was a severe split before that, and he's still used as a LOOGY because of it, with 39 of those 86 appearances having been for two outs or fewer. Like I said, he's decent, "OK" as it were, but committing almost $12 million dollars for a guy who has exactly one season in his 8-year career you could objectively call "good" does not seem like an idea that's, well, good. But I'll tell you this much: When I have a son (no time soon, Mom, sorry) I'm going to duct-tape his right arm to his torso and make him do everything lefty. None of this "finding out naturally" what his disposition is. He's going to be a lefty, dammit, and he's going to throw 90mph if I have to stand behind him with a wind machine to make it happen. He's going to have 2-3 decent years in a major league bullpen, and then he, his mother and I, along with any other siblings he may have are going to take the contract the Cubs or Yankees give him and buy an island in the South Pacific on which to retire. So there. 2) The Pirates re-signed CF Jason Bay to a 4 year, $18.25 million contract. Sinin's RCAA (Runs Created Above Average) measure shows that Bay had marks of +18 and +59 in 2004 and 2005, respectively. His 2004 campaign (.282/26Hr/82RBI) earned him Rookie of the Year honors for the first time in Pirates history, and this year's numbers (.306/32/101, plus 44 doubles, 21 steals, 110 runs and 95 walks) made him one of the half-dozen or so best players in the National League, even if MVP voters didn't give him enough respect. At only 26 years old, Bay should be entering his prime as a hitter, and if the Pirates had anyone in the lineup around him at all, a guy like this could win an MVP award. Well, maybe if Albert Pujols got traded to an AL team. And for the rights to those four years, which in all likelihood will turn out to be the best of Bay's (hopefully) long, distinguished career, the Pittsburgh franchise has shelled out approximately what Jeff Bagwell made in 2004 alone. It would be amusing to write about how much smarter this deal is than, say, the ones that some team not too long ago gave to Pat Meares (5 years, $16 million) and Kevin Young (4 yrs, $24 million), for example. Good thing the Pirates aren't that stupid, right? Of course, it wouldn't be that instructive to do that, since those players were signed in the late 1990's, in a different economic climate and all that crap. Just amusing. Any way you slice it, this is a tremendous deal for the Pirates, who have a franchise player, a potentially perrenial MVP-candidate, signed for LAIM money. League-Average Innings Munchers like Mark Redman and Kris Benson made that kind of money last year, about $5 million, but those guys are rotation fodder. This one's a star. Also, those guys are pitchers, and this one's a left-fielder, so it makes sense to compare him to other left fielders signed in 2005, not shortstops in 1999 or pitchers in 2004, right? Well, lucky for us, we've got one of those: Hideki Matsui. Matsui, who plays left field for the Yankees rather than the Pirates, and who did not win a Rookie of the Year award in 2003, when he was one, was signed to a 4-year $53 million contract, just two days before the Jason Bay deal. Unfortunately for Bay, his agent apparently never reads the newspaper, or he would have known that he could get a hell of a lot more than $4.5 million a year for his client's services. Not that Bay is likely to ever need help from PaydayLoans, but still. Fire that agent quickly, I say. BAY AGE RCAA AVG OBA SLG OPS HR RBI SB 2004 25 18 .282 .358 .550 .907 26 82 4 2005 26 59 .306 .402 .559 .961 32 101 21 MATSUI AGE RCAA AVG OBA SLG OPS HR RBI SB 2003 29 5 .287 .353 .435 .788 16 106 2 2004 30 44 .298 .390 .522 .912 31 108 3 Matsui gets on base less often, hits for less power, doesn't steal bases, and is four years older than Bay. The two have been worth roughly the same number of runs above average for the last two years combined (79 to 72 RCAA, according to Sinins, 72 to 62 Batting RAA, according to Baseball Prospectus) but the trend is up for Bay, and down for Matsui. In addition, Jason racked up those runs in 40 fewer games than Matsui. They play the same defensive position, and Matsui is at best Bay's equal, probably a little worse with the leather, according to most objective fielding measures. And yet, for two reasons and two reasons only, Matsui will make almost three times Bay's salary for each of the next four years. 1) He played for nine years with the Yomiuri Giants in Japan, a league with a skill level somewhere between AA and AAA in the American minor leagues, but to which the American mass media gives far too much credit. B) He plays for the Yankees, who apparently can't find enough matches to set fire to all the money they want to spend next year. Don't get me wrong. Matsui's a good player, but he was probably as good as he'll ever be in the last two years, and the Yankees paid through the nose for the right to make sure he doesn't go to some rival team and end up beating them. 3) The Blue Jays have reportedly offered free agent P A.J. Burnett a 5 year, about $50 million contract, with another team also offering a 5 year contract and 2 others expected to do so within the week. Burnett strikes me as exactly the sort of pitcher who is bound to disappoint whichever team signs him, at least at that price. He's 28, with only two seasons in his 7-year career in which he's pitched 200 innings or more, and he's never pitched more than 210. His career adjusted ERA is only about 10% better than the league average, which isn't bad, but hardly seems like a good way to spend about $10 million dollars each year of the next half-decade. He's never won more than 12 games in a season, and has questionable control, walking about 3 batters per nine innings. Much of his "success" is owed to his home ballpark, Pro Player Stadium, which holds run scoring down by about 5% as compared to the rest of the NL. Burnett is 28-17 with a 3.20 ERA at home throughout his career, but only 21-33 with a 4.26 ERA elsewhere. Add to this the fact that he's only been healthy for two of the last four seasons, and you've got a $50 million recipe for disaster. 4) According to the Newark Star Ledger, Yankees P Carl Pavano wants to be traded. Speaking of disappointing ex-Marlin free agent pitchers... 6) According to the Newark Star Ledger, if the Yankees are able to trade Pavano or find a team that likes losing so much that they will take Jaret Wright, then they could be interested in free agent P Jarrod Washburn. Washburn has had the reverse of Burnett's problem, with an ERA between 1 and 2 whole runs higher on the road than at home for four of the last five seasons. Going to some other venue, especially one that's traditionally kind to lefties like Yankee Stadium, might do him good, but please, not for $10 million/year, OK? Of course this would require one of the Yankees' two stiffs getting traded, which isn't likely to happen. Their trade-values are probably as low as they ever will be, so it would behoove the Yankees to hold onto them for at least another year and hope they get helathy and bounce back a little. 7) According to the Atlanta Journal Constitution, Braves 3B Chipper Jones has agreed to a contract restructuring, contingent on him passing a physical. So let me get this straight: Chipper Jones is doing the Braves a favor by restructuring his contract, and the team is still requiring that he gets a physical to ratify the deal? His existing deal pays him something like $15 or $18 million for each of the next three years and doesn't require him to have any physical other than the one he had when he originally sined it, but now they've got to make sure he's healthy enough to lower his salary by $5 million? Not sure I get that, but then I'm not a baseball player. Posted by Travis M. Nelson at 11/21/2005 Yankees Chick said... re: matsui... dont forget the other reason that matsui is different than other similar players: he is japanese and brings in a HUGE contingent of fans and media - - and AD money - - - to the yankees organization. I'm sure they consider that when making deals... Subscribe To Boy of Summer Travis M. Nelson Bethlehem, Pennsylvania, United States Blogging the Yankees and whatever else occurs to me, usually way too infrequently, since 2002. General Baseball Blogs HardballTalk Royals, Alex Gordon close to contract agreement The Contact Adjustment It's About The Money The Top Job Recruitment Tips In Vegas For 2019 POLITICS/HISTORY: Our Two-Party System Isn't Going Anywhere If You Have An Amazon Prime Credit Card, You Can Get Up to 20% Back On Tech Purchases Twins Geek At Home Plate Yankees Blogs The Bronx View My Take: Yankees Acquire James Nelson for Stephen Tarpley NY Post: Yankees ‘overhauling’ plan to prevent another injury crisis Picked Off River Ave. Blues A Goodbye and a Thank You WasWatching.com Looking For Holiday Baseball Book Gift Ideas? Respect Jeter's Gangster Jeter Outlines Marlins Profitability Plan in 'Project Wolverine' Dossier Baseball and The Boogie Down &#?#! How to Renovate Your Basement to Build a Man Cave Go to our new site! LoHud Yankees Blog Heathcott hitting leadoff for second spring game Sliding Into Home Going To A Game This Weekend? Here's Where You Can Find Cheap Yankee Stadium Parking Confessions of a She-Fan Non-Yankees Baseball Blogs The Joy of Sox (Sawx) J.D. Martinez Is Confident Investigators Will Not Find Much Evidence Against 2018 Red Sox Mets Merized Online Mets Matters: It’s Been A Bizarre Offseason Bardball Scandal Roster 6-4-2 (Angels/Dodgers) Administrivia: Sidebar Cleanup U.S.S. Mariner Notes on a Lost Decade View From The Bleachers (Cubs) Federal Baseball (Nats) Washington Nationals’ lineup for 1st of 2 with Chicago White Sox in D.C. D-Rays Bay MLB draft 2019: Tampa Bay Rays draft Day 2 pick tracker Red Reporter 2019 MLB Draft Day 2 Open Thread Beaneball Where Things Stand Philliesflow.com Baseball players need long term care too are retirement AaronGleeman.com (Twins) Gleeman and The Geek #337: Wild Card Postgame Show The Detroit Tiger Weblog Game 2017.162: Tigers at Twins Newberg Report (Rangers) The Farm Report -- 9/9/2017 Kranepool Society (Mets) Things You Didn’t Know About The Mets El Lefty Malo (Giants) One Bad Month Only Baseball Matters (Giants) …. Get in line Elephants in Oakland ALL TOGETHER NOW - ROUND 1 'THE OLD SCOUT LOOK' - EiO Surviving Grady (Sawx) Al's Ramblings (Brewers) Baseball Resources Baseball Guru Posts That Somebody Actually Read Once Phillies: 2009 Phillies Preview in Iambic Pentameter 2008 Phillies Preview Yankees: Melky's Killing the Yankees Andy Pettitte and Sports Theology Meet the SWB Yankees!!! Yankees Winning a Team Effort Hall of Fame Debates: Jim Rice #1 #2 #3 LAIM: League Average Innings Muncher 25 Random Baseball Things Roy Halladay is Better than Cliff Lee More Picking on Cliff Lee Royals' Trade for 1B Mike Jacobs A Plan for the Expos Multi-Franchise Attendance Study Tommy Lee Attacks Tom Gamboa Book Review: Juiced, by Jose Canseco Travis Nelson, Boy of Summer Boy of Summer Main Page E-Mail Travis! [no spam] Addus aBaby (Ethiopian Adoption Blog) Boy of Summer's Book Reviews ArmchairGM.com Not (Yet) Panic Time in the Bronx B.J. Needs the Blue Jays More Than They Need Him Book Review: The Sports Junkie's Book of Trivia, T... PRESS RELEASE: The Sports Junkies Book of Trivia, ... Padres-Nats Trade Analysis: San Diego Will Soon Re...	cc/2020-05/en_middle_0093.json.gz/line486
__label__cc	0.612118	0.387882	Walk #661: Staveley to Windermere P20053295481 A stream in Staveley. P20053295485 A stream in Staveley. County Cumbria Start Location Staveley End Location Windermere Description This was a short walk, ending the Dales Way into Bowness and continuing on for the shot distance into Windermere. Pack Today I carried my 70-litre Craghoppers WildPlaces 70-litre rucksack, filled with full camping gear and food. Condition I feel better after this walk than I have after any long multi-day backpack - my body has no significant aches or pains and I feel as though I could easily have done double the distance. Weather Today was a nice, warm day, with thin, high cloud and large periods of sunshine. The wind, when I was exposed to it, was very chilly, but it was by far the warmest day of the walk so far. OS map Landranger number 97 (Kendal & Morecambe, Windermere & Lancaster) P20053295508 The path heading west from Outrun Nook. P20053295516 The path near Holme Farm. P20053295519 The view over Bowness towards Windermere. P20053295521 The last bench on the Dales Way. P20053295530 The view over Windermere. I awoke this morning after a wonderful nights sleep in a soft bed. It felt very strange to be able to stretch my body out in the bed rather than being constrained to the small area of my sleeping bag and tent. I woke up with me legs and arms outstretched, as if my body was savouring the space that surrounded it as I slept. As usual when sleeping in a bed during a long-distance walk the first thing I did when getting up was gingerly put the weight on my legs, to see if any problems had shown up over the night. Fortunately my legs did not protest, and I started to get ready for breakfast. It had been the latest night of the walk so far - I had not gone to bed until ten the previous evening due to chatting to the landlady. Breakfast was quickly dispatched, but as I had a short days walking ahead of me I was in hurry to leave, and so I chatted to the proprietors and the other guests. As a result by the time I had finished chatting and got all my kit together it was well after nine, and I headed off down through the village to regain the Dales Way where I had left it last night. Despite the strenuous and long walk of the previous day my legs felt fine as I started heading across fields away from Staveley. The A591 road was soon crossed, and after a short footpath the way joined a quite lane. To say that this lane was quiet is an understatement; no vehicles passed me as I walked along it, and I let my eyes wander over the stunning vista of the Lakeland Fells to my right. The road rose and fell and was not surprisingly strenuous, but the views more than made up for the tiring walking. The road was eventually left behind, and I started following the way as it crossed rocky grazing meadows, with the rocks sticking out of the ground complementing well the views of the fells in the distance. As I headed down towards the farm at Outrun Nook I came across a Yew that had just given birth - the lamb was standing, being licked by its mother, and the afterbirth was sill attached. I stood transfixed as I watched, and departed silently in order not to disturb them. From Hag End the path started to descend, and although it was muddy underfoot I managed to make good time as I�headed downhill, eventually joining an unsurfaced track with craggy hillside to both sides. This track soon doubled back on itself, heading south and becoming surfaced as it approached the B5284 road. For some strange reason I found it difficult to find the path that led northwestwards from the main road, and after heading down towards Low Cleabarrow I turned back and headed back towards the main road, before realising that I had been on the correct route after all and headed back towards the cottage. Quite what the two men behind me though of my actions I do not know! The last kilometre of the way was easy to follow - although muddy in places - as it headed westwards, and I soon came across the slate bench that marks the end of the Dales Way. I sat down on it, feeling justified in doing so at having completed the walk, and contemplated the last five days. I did not want to sit for too long, however, and after a couple of minutes I got up and started heading down the road into the village. At the first pub that I passed there was a sign stating that it was the first pub at the end of the Dale Way, so I nipped in and had a quick pint, a deserved celebration after the long walk. Whilst in there I chatted to some of the locals, and the main topic of conversation was the speed limit of 10 MPH placed on Windermere the previous night. This move by the National Park is highly controversial as it has put many speedboat companies out of business, but apparently the main aim of the law is to ban jet skis, who have been causing annoyance on the lake. Despite five year's notice the ban was still unpopular, and apparently just before midnight last night several speedboats had made one last journey up the lake. I did not want to spend too long chatting, particularly as it would mean having another pint, and so I picked up my rucksack ready to put it on. As I did so one of the locals asked me if he could feel the weight, and I felt strangely happy when he proclaimed that I must be insane for carrying that much weight on my back for 100miles! I left the pub and started on an indirect route towards the railway station; I planned to follow the road that skirts the eastern side of the lake before diverting inland to the centre of Windermere, as I was hoping to get some good views of the lake. Unfortunately this did not really turn out to be the case due to housing and the slightly inland route that the road took, and so I consoled myself with an ice cream from a roadside stall at one of the few viewpoints and merrily munched on this was I walked. I powered my way up the last hill and soon found myself at the railway station; I found myself to be slightly annoyed at having by-passed the centre of Windermere for the hope of getting good views of the lake. Just as I arrived at the station a train was arriving, and when I enquired at the ticket office the man behind the screen advised me to hop on that train. Thus I found myself in a little bit of a whirlwind - no sooner had I finished the walk than I was on a train. wheedling its way through the hills and onto the West Coast Main Line. As I had a return ticket for Leeds it was cheaper to go via Leeds, which meant quite a roundabout and long return journey. In the hurry I had no chance to buy a newspaper or magazine, and so I was forced to spend the journey looking out of the window - hardly a hardship, and I was surprised to get a glimpse of the sea to the south of Carnforth. So what are my immediate thoughts about the Dales Way? Well, it is a relatively easy walk when compared to (say) the Pennine Way - it is mainly a low-level walk, with the highest point being the climb over the watershed. Despite this, however, it was a superb walk, and I have many happy memories that photos will barely do justice of. It was one of the muddiest long-distance walks that I have ever done, but that was a result of the wet spring rather than any intrinsic feature of the walk. I also did rather long and strenuous days - it could be more enjoyable to spend and extra day or two and spend the nights in B&B's rather than carrying camping gear. It would be a very good warm-up walk for someone considering doing the Pennine Way or Coast to Coast walks. The majority of this walk follows the Dales Way; as this is a named trail I will not give directions. Instead I will refer you to the Ordnance Survey Recreational Path Guide for the path, which I used throughout my walk. This proved to be invaluable, and is bound to be kept more up to date than any directions I put on this site. The book also includes details of the Leeds extension to Ilkley, which adds twenty miles onto the Dales Way. Please click on the image below to go to the Amazon page for this book. The diversions from the Dales Way were at the start and the end of the day. Initially, I had to walk back from my B&B in the village towards the point where I had left the Dales Way the previous night at Stockbridge Farm. This was easy road walking, and was not complex. Then, when I had reached the end of the Dales Way in Bowness on Windermere, I continued walking downhill, past the Royal Oak pub until the main A592 road is reached. Turn right, to head north along the A592 as it parallels the eastern shore of Windermere northwards for a couple of kilometres until a roundabout with the A591 is reached. At the roundabout, turn hard-right and follow the A591 as it heads uphill southeastwards for about a kilometre to Windermere railway station, where this walk ends. this is a long route, and if you want to get to the railway station from the end of the Dales Way in Bowness-on-Windermere, then a more direct main road heads up to the railway station through the centre of the town. Staveley B&B Bowness on Solway 7.3 1017 1204 Bowness on Solway Windermere station 2.7 417 164 There are regular train services running from Windermere station to Manchester; there are also many bus services running from the railway station to many places in the Lake District. This walk was mentioned in the following routes: The Dales Way 660 Sedbergh to Staveley 21.1 unknown route './Trails/DalesWay' Notice: Undefined variable: route_title in /home/britishw/public_html/PHPTemplates/AdsPane.php on line 161 Notice: Undefined variable: home_page in /home/britishw/public_html/PHPTemplates/AdsPane.php on line 178 81.8 of 81.8	cc/2020-05/en_middle_0093.json.gz/line492
__label__wiki	0.529031	0.529031	Metallica’s Orion Fest is in Atlantic City this weekend; Kirk Hammett releasing horror memorabilia book By BrooklynVegan Staff June 22, 2012 12:49 PM As mentioned, Orion Music & More happens this weekend in Atlantic CIty’s Bader Field from June 23-24 and is being headlined by Metallica both nights, who play Ride the Lightning in full on Saturday (6/23) and The Black Album in full on Sunday (6/24). Other bands playing include Arctic Monkeys, Modest Mouse, Hot Snakes, Fucked Up, The Gaslight Anthem, Titus Andronicus, Best Coast, Liturgy, A Place to Bury Strangers, and more, plus a heavy stage with Suicidal Tendencies, Sepultura, Torche, Red Fang, Kyng, Landmine Marathon, Black Tusk, Thy Will Be Done and others. The heavy stage (aka “Damage, Inc.”) isn’t the only place you can catch heavy bands though. The festival also includes Baroness on the Orion stage, The Sword on the Fuel stage, Liturgy on the Frantic stage, and Ghost on the Orion stage. You can check out the full schedule of both days and all four stages HERE. Orion Music & More is the first NYC-area appearance for Hot Snakes since the reunited band played The Bell House and Maxwell’s in December. They’ll play another area show (also in NJ) at ATP I’ll Be Your Mirror in September. As mentioned, it’s the first time in a while that Modest Mouse will be in the NYC area. They play Orion on Saturday (6/23) before heading to Randall’s Island for Governors Ball, which also happens this weekend. There’s a ton of stuff going on at Orion other than live music too. You can pick up rock ‘n’ roll memorabilia at Ktulu’s Rock ‘N’ Roll Emporium, check out film screenings hand-picked by Lars Ulrich at Hit The Lights Films, skate the Motorbreath Mini Ramp, have a glimpse into Kirk Hammett’s creepy personal collection of horror film memorabilia at Kirk’s Crypt, surf, nerd out at the ESP Guitar Experience, check out the Metallica Museum, show your support for a variety of charities, or check out the car show. If you’re heading out to Atlantic City for the fest this weekend, head here for directions. If you’re driving, there’s no on-site parking at the field, but there are a number of parking areas nearby and free shuttles that run from the lots to Bader Field. If you’re taking the train, you can get there via the Amtrak or the NJ Transit Rail and there will be a free shuttle from the Atlantic City terminal to the festival. Once you’re there, this map should help you get around. We’re also told that it’s about a 20-30 minute walk from the boardwalk. Tickets for the festival are still available. In related news,” Kirk’s Crypt” isn’t the only place Mr. Hammett will be indulging in his love of all things creepy. He’ll be publishing a book titled Too Much Horror Business – The Kirk Hammett Collection this October via Abrams Image with photographs of his personal collection of horror memorabilia. The book also includes Kirk’s own handwritten captions for many of the photographs. He’ll be putting out limited edition toys, like the ones he’s been collecting his whole life, along with the book this October. You can pre-order the book at Kirk’s online toy store. He’ll be discussing the book at Kirk’s Crypt at 4 PM each day. Maybe his old friend Glenn Danzig will add it to his book collection… Filed Under: A Place to Bury Strangers \| Arctic Monkeys \| Atlantic City \| Avenged Sevenfold \| Bader Field \| Best Coast \| Black Tusk \| Cage the Elephant \| Eric Church \| Fucked Up \| Gary Clark Jr. \| horror \| Hot Snakes \| Kirk Hammett \| Kyng \| Landmine Marathon \| letlive. \| Liturgy \| Lucero \| Metallica \| Modest Mouse \| Orion Music and More \| Red Fang \| Roky Erickson \| Sepultura \| Soul Rebels \| Suicidal Tendencies \| The Black Angels \| The Gaslight Anthem \| The Jim Breuer Heavy Metal Comedy Tour \| The Sword \| Thy Will be Done \| Titus Andronicus \| Torche \| Wooden Shjips Category: books \| Heavy Metal News \| Music News \| tour dates	cc/2020-05/en_middle_0093.json.gz/line494
__label__wiki	0.50973	0.50973	Cinema Technology Magazine Online Articles / Features / Technology Direct view displays: Cinema LED Screens in the Real World August 8, 2018 August 3, 2018 - by Patrick von Sychowski Arguably the most significant innovation in cinema since digital projection, the use of LED screens to show first-run films has been a hot topic for over a year. Patrick von Sychowski examines the market entrants. Nobody seems sure what to call new cinema LED technology, whether it is direct view display (awkwardly abbreviated DvD), or active screens, video walls or something else. But nobody who has seen the demonstrations by Samsung and Sony could fail to be impressed by the brightness, clarity, definition, colours, blacks and contrast of the projector-less screens. If anything, cinema purists find them too perfect, much like digital projection is faulted for its lack of flicker, scratches, weaves and other photochemical film characteristics. Samsung Onyx Theatre Samsung became the early proponent of cinema LED when it held private demonstrations at CinemaCon in March 2017. The cinema industry was stunned by the speed with which the South Korean electronics major won DCI certification in May 2017 and installed the first unit with Lotte in Seoul last July. Eight sites have since been installed or announced, including in China, Europe and the US. The price tag of around $750,000 (including screen, audio and install) is still the biggest block to widescale adoption. The second is that the screen only comes in the size of 10.3m for the 4K version. Yet the promises of more than 100,000 hours’ lifespan means that, according to integrators, cinemas are seriously weighing it up as an alternative to laser projection. At its US launch, Samsung also announced plans for a 14m (45.9 ft) screen before the end of the year with wider pixel width (3.3mm instead of 2.5mm). The company also claims up to $25,000 savings for newly built cinemas by eliminating the need for a projection booth and the addition of three rows of seats. The installation of the first Samsung screen in a Hollywood post house (Roundabout in Santa Monica) should mean that feature films can now be mastered for the high brightness HDR screens, though Studios are not rushing to pay for yet another DCP versioning for a still-small installed base. Worries about damaged displays has led Samsung to issue assurances that defective modules can be replaced and recalibrated in just a few hours. While some high-profile directors such as Steven Spielberg and Christopher Nolan have expressed concerns about what they see as a ‘big television’ screen in cinemas, UNIC President Phil Clapp stated that he believes that they are in the majority. Moreover, despite these reservations, Spielberg’s “Ready Player One” was the first film screened at Samsung’s first US installation. Presently the Samsung Onyx Theatre situation is similar not only to the prototype DLP cinema deployment in 1999 in terms of installed base and cost but also in terms of industry buzz that it is generating. It remains to be seen whether it will similarly dominate cinemas in 15 years’ time. Samsung has an ambitious target of “10 percent of cinemas across the world by 2020.” But Samsung is not the only one advocating a bright future for projector-less cinema screens. Sony showed off its LED screen at CinemaCon 2017 in a public demo intended to gain feedback from the cinema industry, rather than announce entry into the field. The CLEDIS display was already in commercial use, but not DCI certified for cinemas. However, with Sony projectors having their own IMB, they would not need to look outside the company for an integrated cinema solution. In practice, the CLEDIS screen was considered ‘over-specced’ for cinema use, with a price tag to match. Feedback, though, was very positive. Sony is now on a path to launching a cinema LED screen, most likely before the end of 2018, with the new name of Crystal LED. Unlike Samsung, however, Sony has to be mindful of not undermining its existing projector line-up, including the recently launched blue-phosphor laser. Sony is also at pains to stress that its active screen solution is different from Samsung’s in that it uses micro LEDs. Sony’s Plans Oliver Pasch, Sony Digital Cinema Europe “Sony is committed to exhibition through its significant investment in developing Crystal LED, the future of the premium cinema experience with its true and verified contrast ratio of over 1,000,000 to 1! With infinite contrast and colour reproduction that can match what the filmmaker intended, Sony is taking every measure to ensure we deliver the right technology at the right time for the best picture in theatres. With the modular scalable design of our Crystal LED technology it caters for every size of screen —we’re excited to bring this to market for exhibition in the near future and are nearing the end of DCI approval. Our Crystal LED Active Screen solution is coming to market in its current generation, but we’ll continue to develop to the solution for future iterations, working with the Hollywood creative community and studios to develop a solution best fit for their needs, coupled with a realistic product for implementation by our exhibitor partners.” NEC, Barco and Christie At Cinemacon 2018 NEC hosted demos of a prototype LED display that showed stereoscopic 3D using passive glasses (Samsung uses more expensive active glasses). Resolution was low but 3D effects were impressive and without eye strain. NEC is confident it can get resolution up and offer a viable product in the near future. Both Barco and Christie have extensive experience in LED displays for indoor (including cinema lobbies) and outdoor use. A particularly impressive one greets visitors approaching Barco’s new HQ in Kortrijk, Belgium. Christie even formed a partnership with Wanda Film Holdings early this year for a joint Cinema Technology Centre of Excellence that among other things will look at cinema LED screens. As such both Barco and Christie have expressed confidence that they too can offer LED solutions for cinema, once there is significant market demand. Unlike Samsung, they clearly do not want such a display to siphon off attention from their current line up of projector-based solutions. LG… and China enter the fray Samsung’s biggest competitor in the LED TV and display panels is fellow Korean major LG. There are rumours the company will soon come out with a cinema LED product. This could lead to others, such as Sharp or Vizio also entering the field. Yet the biggest potential ‘threat’ to Samsung could come from China. Unlike DLP chips, which are strictly controlled and licensed by Texas Instruments, there is nothing inherently proprietary about LED technology. This means that a suitably good LED display with a DCI-approved IMB and FIPS could pass cinema compliance tests. While GDC Techonlogy is currently working with Samsung, there is nothing to stop it from sourcing LEDs from a manufacturer in China for its own solution in the future. China has long resented being dependent on ‘foreign’ projection technology and manufacturers, not least since becoming the world’s biggest cinema market by screen count. Cinema LED could give China the opportunity to source future screen technology from 100% domestic suppliers. And the audio issue? Because speakers cannot be placed behind LED screens, clever solutions have to be found to replicate regular 5.1, 7.1 and immersive sound. This challenge was addressed earlier by AMC for its Taurus curved screens and also in Finnkino’s AS2 solution used for its Scape PLF and over 100 other screens. This involves putting speakers in an array above and around the screen. Psych-acoustics mean people are generally able to distinguish better whether sound is coming from left or right but not up or down. Samsung has improved on this using speakers pointing at the screen, ‘bouncing’ them off it to the audience. “With support from JBL by Harman Professional’s sculpted surround sound system, Onyx Sound expands the audio sweet spot in a given theater,” Samsung explained at the launch of its first US screen, which, funnily enough, is less than 15mins drive from Harman’s US headquarters. Onyx LED: the numbers 10.2 x 5.4 meters – 96 panels @ 2.5 mm (4K) 5.1 x 2.7 meters – 24 panels @ 2.5 mm (2K) Q4 2018: 14 x 7.2 x meters – ?? panels @ 3.1 mm (4K) 1 module = 3,840 LED lights (16cm high x 15 cm wide) 1 cabinet = 24 modules (6 high x 4 wide) 4K screen = 96 cabinets (6 high x 16 wide) 146 ftL (foot-lambert) or 500 nit. 15-25 ftL is high-end for laser projection Samsung Onyx: USD $500,000-$800,000 (screen, audio and installation) Top RGB laser: USD USD $150,000-$300,000 (projector only) 3/7/17: Lotte Cinema World Tower (Seoul, South Korea)Lotte 20/7.17: Cinema in Centum City (Busan, South Korea) 4/2/18: Wanda Theater Wujiaochang (Shanghai, P.R. China) 20/3/18: Arena Cinemas (Zurich, Switzerland) 1/4/18: Paragon Cineplex (Bangkok, Thailand) 20/4/18: Pacific Theaters Winnetka 12 (Chatsworth, CA, USA) later in 2018: Golden Screen Cinemas (Kuala Lumpur, Malaysia) later in 2018: Cineplexx Cinemas (Vienna, Austria) Post-production – 20/4/18: Roundabout (Santa Monica, USA) 10 screens total open in May 2018 15 screens total open in June 2018 30 screens total open by end of 2018 EclairColor Samsung Onyx is the third digital cinema display device to be certified for EclairColor HDR-enabled pictures after Sony’s SRX-500 and Barco’s DP4K projectors. Patrick von Sychowski http://www.celluloidjunkie.com TaggedannouncedcinemasCLEDISfuture World’s First Four-Sided ScreenX Technology Revealed at CES 2020 \| 4DX Series 4 projection: The magic of mirrors QSC: Striving to deliver the networked cinema Previous Article What Can Cinemas Learn from Other Industries Next Article Subtitling in UK cinemas: a new way forward About Patrick von Sychowski View all posts by Patrick von Sychowski → Why not subscribe to our newsletter to know when the latest edition comes out and to stay upto date with the latest news? Just enter your details in the form below. We promise not to use them for anything else: Archives Select Month January 2020 (5) December 2019 (3) November 2019 (25) October 2019 (2) September 2019 (7) August 2019 (21) July 2019 (21) June 2019 (18) March 2019 (1) February 2019 (2) November 2018 (11) October 2018 (8) August 2018 (20) June 2018 (4) May 2018 (3) April 2018 (10) March 2018 (15) February 2018 (23) January 2018 (9) December 2017 (1) October 2017 (12) August 2017 (2) (C) 2018 Cinema Technology Magazine	cc/2020-05/en_middle_0093.json.gz/line513
__label__wiki	0.963433	0.963433	Posted at Jan 16, 2020 1:05 PM Democrats try to expand House battlefield by targeting six more districts With legislation stalled, campaign memo recommends blaming GOP and McConnell The DCCC has once again added Alaska Rep. Don Young, the longest-serving House Republican, to its target list. (Bill Clark/CQ Roll Call file photo) The Democratic Congressional Campaign Committee is adding six new targets to its 2020 battlefield, hoping to flip more Republican-held seats while protecting its House majority. Having made historic gains in the 2018 midterms, Democrats started the year on defense. Republicans need a net gain of 18 seats to retake the House, and their first targets will be the 30 districts President Donald Trump won in 2016 that are currently represented by Democrats. Pelosi endorses Christy Smith in race to replace Rep. Katie Hill Democrat has been racking up endorsements from the California delegation Speaker Nancy Pelosi, has endorsed Assemblywoman Christy Smith in the special election for California’s 25th District. (Tom Williams/CQ Roll Call) Speaker Nancy Pelosi is taking sides in the race to replace former Democratic Rep. Katie Hill in California, endorsing Assemblywoman Christy Smith over liberal talk show host Cenk Uygur. “I am proud to endorse Christy Smith because she will work to fight corruption, lower the cost of prescription drugs, fully fund public schools and build a strong middle-class economy that works for all Americans,” Pelosi said in a statement shared first with CQ Roll Call. Kamala Harris endorses Christy Smith in race to replace Katie Hill Smith is consolidating support among California Democratic leaders Sen. Kamala Harris, D-Calif., is endorsing Assemblywoman Christy Smith in the 25th District race. (Tom Williams/CQ Roll Call) California Democratic Sen. Kamala Harris has taken sides in the race to replace former California Democratic Rep. Katie Hill, endorsing Assemblywoman Christy Smith in the special election. “In the State Assembly, Christy has been an effective leader and a fearless voice for the people she represents,” Harris said in a statement shared first with CQ Roll Call. “I know Christy will do the same in Congress — working to enact tougher gun safety laws, combat the climate crisis, fully fund public schools, invest more in emergency response and public safety, lower the cost of prescription drug prices and build an economy that works for everyone.” Special California election to replace Katie Hill set for March 3 Vote on same day as presidential primary could hurt GOP effort to take back seat Rep. Katie Hill, D-Calif., resigned earlier this month. (Tom Williams/CQ Roll Call file photo) California Democratic Gov. Gavin Newsom has set the special election date to replace former Democratic Rep. Katie Hill, likely complicating the Republican effort to flip the 25th District. Newsom set the special election primary for March 3, the same date as the Golden State’s presidential and congressional primaries. Candidates from both parties run on the same ballot. For the special election, if one candidate garners more than 50 percent of the vote, he or she wins the race outright. If no one gets above 50 percent, the top two would advance to a May 12 election. Rep. Katie Hill says ‘double standard’ forced her out of office California Democrat is resigning after scandal involving explicit photos and affair allegations California Rep. Katie Hill arrives Thursday at the Capitol, where she voted for the impeachment resolution and made her final floor speech, a day before she leaves office. (Tom Williams/CQ Roll Call) California Democratic Rep. Katie Hill apologized for letting down her constituents, staff and loved ones as she made her final floor speech Thursday, but she also railed against a “double standard” and “misogynistic culture” that she said forced her out of office. “I’m leaving, but we have men who have been credibly accused of intentional acts of sexual violence and remain in boardrooms, on the Supreme Court, in this very body, and, worst of all, in the Oval Office,” she said on the House floor the day before she leaves office. Chris Cioffi George Papadopoulos just filed for a House run in Rep. Katie Hill’s district The former Trump campaign aide who served time in prison filed FEC paperwork to run for the California House seat George Papadopoulos visits "The Story With Martha MacCallum" at Fox News Studios on March 26, 2019. He filed paperwork to run for a House seat currently occupied by Rep. Katie Hill on Tuesday. (Noam Galai/Getty Images) A one-time campaign foreign policy adviser to President Donald Trump who served 12 days in jail for lying to the FBI has filed paperwork to run for the seat occupied by resigning California Democratic Rep. Katie Hill. George Papadopoulos, who confirmed he was considering a House run after being released from jail in December, filed a statement of candidacy with the Federal Elections Commission on Tuesday. The document lists his party affiliation as Republican. Katie Hill’s exit shakes up competitive race in Southern California Expensive special election in Los Angeles TV market would face both parties California Democratic Rep. Katie Hill has said she plans to resign. (Bill Clark/CQ Roll Call file photo) Democratic Rep. Katie Hill’s decision to resign amid allegations of an improper relationship with her staffer has upended the battle to control a competitive district in Southern California. Republicans believe they can win the 25th District back, especially now that they don’t have to face Hill and her sizable war chest, which was already at $1.5 million on Sept. 30. But Democrats contend that the district will stay in their hands, citing partisan dynamics and demographics of the district. Ratings update: No change for California seat Katie Hill is giving up Little indication the GOP can win a district that backed Hillary Clinton by 7 points California Rep. Katie Hill’s resignation sets up a competitive race for the 25th District. (Bill Clark/CQ Roll Call file photo) A Democratic House member resigns, but is it really at risk of a Republican takeover? Less than a year after getting elected to Congress, Rep. Katie Hill announced her resignation from California’s 25th District amid allegations of inappropriate relationships with staffers. On one hand, it’s easy to see why Republicans might be excited about the special election, considering they held the seat for a quarter of a century not that long ago. But there’s little indication that it’s currently a serious GOP opportunity. Rep. Katie Hill resigns amid allegations of improper relationships with staffers Ethics Committee last week said that it would investigate allegations The House Ethics Committee was investigating whether California Democratic Rep. Katie Hill had an improper relationship with a staffer. (Bill Clark/CQ Roll Call file photo) Mired in scandal over allegations she had an improper relationship with a congressional aide and revelations about another affair she and her now estranged husband had with a woman on her 2018 campaign staff, California Democratic Rep. Katie Hill announced Sunday that she is resigning. “It is with a broken heart that today I announce my resignation from Congress,” Hill said in a statement. “This is the hardest thing I have ever had to do, but I believe it is the best thing for my constituents, my community, and our country.” Democratic Rep. Katie Hill denies relationship with congressional staffer Conservative blog alleged California lawmaker had affair with man who is now her legislative director California Rep. Katie Hill, a member of House Democratic leadership, has denied allegations she had an improper relationship with her legislative director. (Caroline Brehman/CQ Roll Call file photo) Rep. Katie Hill on Tuesday denied allegations she had an improper relationship with the man who is her legislative director. The California Democrat said in a statement that her estranged husband is attempting to humiliate her and suggested there is a “coordinated effort” to destroy her. On Friday, conservative blog RedState published a story detailing Hill’s alleged relationships with 2018 campaign staffers. The first allegation involved a female campaign staffer who entered into a relationship with Hill and Hill’s husband. The second allegation is that Hill also had an extramarital affair with Graham Kelly, who worked for her campaign and is now her legislative director. A relationship with a current congressional staffer would be a violation of House rules.	cc/2020-05/en_middle_0093.json.gz/line517
__label__wiki	0.639375	0.639375	Rethinking Repetition in a Digital Age 12 June 2019, 12:00 - 19:00 Seminar Room SG2, First Floor, Alison Richard Building, 7 West Road, Cambridge, CB3 9DT Limited places. Online registration is now closed. Iteration as Persuasion Symposium: The internet and new digital media technologies are increasingly talked about as ‘dangerous’, ‘deadly’ even, in terms of their imagined or felt societal implications. These conversations have tended to limit our ability to talk about what developments in digital culture are actually doing, in their present moment, and what they could do for us in the future. This interdisciplinary symposium is an attempt to engage each other in more complex discussions about re-directing the potentials of the digital. How does our engagement with the digital space trigger emotions, nudge behaviours, (re-)form habits, construct identities, (re)perform traditions, (re)produce beliefs? Proceedings of the symposium will be published as a special issue of the AI and Society Journal. Join us for discussion panels on: Affordances of the Digital and the Rise of the Right Voice and Identity in a Digital Age Redirecting the Potentials of Digital Public Space Artists on the Difference Digital Makes Dr Ella McPherson (Senior Lecturer in the Sociology of New Media and Digital Technology, University of Cambridge) Geoff Stead (International thought leader on emerging technologies. Babbel, past senior Director of Mobile Learning at Qualcom, Head of Innovation at Tribal) Dr Hugo Leal (Methods Fellow, Cambridge Digital Humanities) Dr Clare Foster (CRASSH, University of Cambridge) With speakers from: Cambridge, Oxford, London School of Economics, King’s College London, London Goldsmiths, Anglia Ruskin University, University of Silesia, Kyiv-Mohyla Academy. For further information please contact the convenors: Ruichen Zhang or Francesca Root. Part of the ‘Iteration as Persuasion’ series at CRASSH. An event event organised by 'Re-' Interdisciplinary Network. Administrative assistance: networks@crassh.cam.ac.uk CRASSH is not responsible for the content of external websites and readings. All speakers' views are their own. Panel A: Affordances of the Digital & the Rise of the Right Introduction and Chair: Hugo Leal (Methods Fellow at Digital Humanities, University of Cambridge) Clemens Jarnach (DPhil in Sociology, University of Oxford) 'Investigating Online Media Consumption for Signs of Political Polarisation in the Context of Brexit' Rodolfo Leyva (Fellow in Media & Communications, London School of Economics) 'Testing the Effects of Fake News on Candidate Evaluations & Preferences' Anthony Kelly (PhD in Media & Communications, London School of Economics) 'Hybrid News Media, Networked Publics, and the Recontextualization of Right-Wing Outrage Online' ‘Discourses of Efficiency, Practices of Solidarity: Human Rights Witnessing in the Digital Age' Panel B: Voice & Identity in a Digital Age Ella McPherson (Senior Lecturer Department of Sociology, University of Cambridge) Cindy Ma (DPhil in Information, Communication and the Social Sciences, Oxford Internet Institute) 'Problematising White Invisibility in Digital Culture' Damian Guzek (Assistant Professor, University of Silesia in Katowice, Poland)) 'When a Minority Gets Access to the Digital Society: The Case of Radical Voices on Religious Diversity' Ruichen Zhang (PhD in Sociology, University of Cambridge) '"Socialism Elsewhere": A Discourse Analysis of Re-worked Political Ideology on Chinese Internet' Francesca Root (MPhil Sociology Alumna, University of Cambridge) 'Memorialising in the Digital Age: Analysing Affective Networks during the Public Display of Collective Loss' Panel C: Re-directing the Potentials of Digital Public Space Skype Interview Geoff Stead (Mobile app designer, ex-Qualcomm, Babbel, Berlin) Tom Hollanek (PhD in Film & Screen, University of Cambridge) 'Must My iPhone Be a Trojan Horse? On Artificiality, Blackboxing and Alternative Design' Ana Belén Martínez García (Visiting Research Fellow, King’s College London) 'Strategic Repetition in Activists’ Online Self-Presentation' Thomas Wadsworth (PhD in Visual Sociology, Goldsmiths, University of London) 'Self(ie)-Care and Mental Health' Orysia Hrudka (National University of Kyiv-Mohyla Academy, Ukraine) 'Favouring the Public? Ideologemes of Democracy and Political Economy of Facebook' Epilogue: Artists on the Difference Digital Makes Véronique Chance (Senior Lecturer in Fine Art, Anglia Ruskin University) Duncan Ganley (Senior Lecturer in Photography, Anglia Ruskin University) 'Re-presenting their Exhibition and Book re: print' David Wood (Centre of Latin American Studies, University of Cambridge) 'Mexican Media Artists Playing with Analogue Spaces and Technologies in a Digital Era' Closing remarks from all speakers and attendees. Dr Ella McPherson (Department of Sociology, University of Cambridge) Dr McPhearson is Senior Lecturer in the Sociology of New Media and Digital Technology as well as the Anthony L. Lyster Fellow in Sociology at Queens’ College. She is also Co-Director of the Centre of Governance and Human Rights, where she leads the research theme on human rights in the digital age. The Internet and the rise of digital media have dramatically changed the distribution and consumption of news and political information. Issues such as echo chambers, fake news, or large-scale political microtargeting lead to concerns about the use of online news with regards to politics. A common perception is that online news consumption is associated with selective exposure and is therefore limiting someone’s awareness of political arguments. Such concerns fuel arguments that digital news consumption leads to higher political polarisation levels. In an increasingly digital world where online news media is becoming the leading source for political information, the question arises of how digital news consumption influences the formation of public opinion, political polarisation, and electoral behaviour. Many studies have focused on social media platforms, such as Twitter or Facebook. Those studies often find that online social networks exhibit clear signs of political polarisation. Whereas most studies, relying on data from social media or self-report surveys, often find strong signs of political polarisation, my study contributes to the literature by investigating whether such strong polarisation structures can be also observed when taking the high-choice media environment into account. I address the question of whether digital news consumption was characterised by ideological segregation among citizens due to single-sided news exposure in the run-up to the Brexit referendum, by analysing a two-mode network of UK individuals and online news-websites. I analyse online news consumption behaviour of UK citizens by using clickstream data and social network analysis. The data and method used in this study provide improvements to the research design employed by previous studies. My first study results show that a majority of individuals had a diverse media diet and that news consumption patterns between Leave and Remain voters did not differ substantially. Dr Rodolfo Leyva (Fellow in Media & Communications, London School of Economics) There is growing worldwide concern over the potential for digital fake news (DFN) to detrimentally impact democratic elections. However, scientific studies have yet to directly examine if DFN can actually affect changes in political attitudes and electoral decisions. To help fill this empirical gap, the present priming experiment tested the effects of DFN exposure on voter support for the recent US Presidential candidates: Donald Trump and Hillary Clinton. Data were collected from a cross-sectional sample via a web-survey (N = 582). Results showed no direct main effects of attention to anti-Trump or anti-Clinton DFN on voter support for either candidate. Additional moderation analyses, however, showed that news believability negatively moderated the effects of exposure to anti-Clinton DFN on impressions and probability of voting for Clinton. This believability was, in turn, conditional on political ideology. Overall, the results suggest that DFN does not cause or induce conversions in candidate evaluations or preferences, but may reinforce the partisan predispositions and mildly increase the voting likelihood of mostly highly conservative Internet users. In this regard, these empirical findings support a growing consensus that susceptibility to online misinformation is predominantly a pathology of the far-right, and thus any electoral impact of DFN, though certainly concerning, is for now probably considerably narrower in scope than has been otherwise suggested by journalists and politicians. Other psychographic and news usage moderators that can help to mitigate susceptibility to DFN are also discussed. In a media market characterized by intensifying audience fragmentation (Webster and Ksiazek, 2012), emerging forms of hybrid media power (Chadwick 2013), and a growing prevalence of partisan media outlets (Levendusky, 2013), outrage-based political opinion media have become a potent force in contemporary American political life (Berry and Sobieraj, 2013). Outrage, as used here, is defined as a mode of political discourse that is marked by efforts to “provoke visceral responses” of fear, moral righteousness, anger, and indignation from audiences “through the use of overgeneralizations, sensationalism, misleading or patently inaccurate information, ad hominem attacks, and partial truths about opponents” (Sobieraj, Berry & Connors, 2013). At a time when news media are already adapting to the proliferation of networked technologies (Deuze, Bruns & Neuberger ,2007), the growth of outrage-based political opinion media has had a similarly transformative impact on the US news environment. Nevertheless, the effects are notably asymmetrical, with more prominent media on the right than on the left considered highly partisan (Benkler et al, 2017). News media provide an array of resources for citizens to express political agency, particularly through practices of recirculation in the everyday spaces of social media (Chadwick, Vaccari & O’Loughlin, 2018). However, by permitting audiences to perform alignments with outrage-based media content through techniques of news sharing and news commentary, online news media also present an opportunity for the recontextualization (Bauman & Briggs, 1990) of mass-mediated images of personhood (Agha, 2007) within networked publics (Varnelis, 2008). In the context of the partisan polarization that is increasingly seen to define contemporary American politics (Webster & Abramowitz, 2017), this paper explores this recontextualization of right-wing discourses of outrage in online political talk and asks what role such discursive practices play in the public negotiation and renegotiation of polarized political identities in the US. 'Problematizing White Invisibility in Digital Cultures' In her 1989 piece, “White privilege: Unpacking the invisible knapsack,” Peggy McIntosh catalogues the many advantages she has enjoyed in her life due to her race, advantages she and other white people take for granted but which are systematically denied to people of colour. Her list of privileges illustrates how whiteness had been rendered invisible in American society, how it forms the unmarked default category against which all others are compared but which seems to contain no substance of its own. This is the principle upon which a great deal of theorizing on whiteness, at least in communication studies, has been based. By extension, the work of critical theorists must be to make visible that which has been naturalized and, especially, to highlight how seemingly race-neutral policies, ways of speaking, and technologies in fact perpetuate the dominance of whiteness. But in examining the works of popular right-wing Internet personalities like Gavin McInnes and Steven Crowder, we see time and time again that, for them, whiteness is not an empty signifier but rather discursively tied to meaningful, albeit nebulous, concepts like “Western culture” and “Judeo-Christian values.” In my presentation, I will argue that much can be learned about the appeal of the “alt-right” and other pro-white movements if we begin to examine how white people perceive their own racialisation. Indeed, the internet abounds with proclamations that whiteness and maleness are now the most persecuted identities of all. In making these claims, leaders of the “alt-right” often deploy narratives of decline, even apocalypse, to illustrate the need for white racial consciousness, while adopting rhetorical strategies employed historically by people of colour seeking equality. My presentation aims to interrogate this discourse of white victimhood, drawing out and challenging its underlying logic. Dr Damian Guzek (Assistant Professor, University of Silesia in Katowice, Poland) In recent years, a number of radical voices have become visible due to digital platforms. Within this context, issues connected with religious diversity have not received any attention to date. Therefore, the primary goal of this paper is to analyze the way of articulating and repetition radical voices and discourses of opposition to religious diversity. The work focuses on the discursive strategies and practices of far-right leaders of opinions in political debates towards religious diversity in Poland. I describe the challenge of including radical right-wing arguments in social media platforms and how media users have responded. I conclude that the users in Poland who are in opposition to religious diversity are narrowing their Christian values to traditional Catholicism. Such a conclusion leads to an intricate understanding of Poland’s far-right movements as shaping their identities through religious norms and religious exclusivism. ‘Socialism Elsewhere’: A Discourse Analysis of Re-worked Political Ideology on Chinese Internet' Discourse of political ideology in China is normally attributed with one single meaning per word, which aims to guarantee that it belongs exclusively in the political field dominated by state authorities. However, in the digital age of vibrant entertainment and consumption with mass participation, ideological discourse is increasingly applied in alternative situations of utterances. This paper examines this phenomenon and asks two key questions: 1) How is ideological discourse re-worked? 2) Does it reduce the political power to persuade? Based on a grounded analysis of three discursive strategies to re-work socialist ideology, i.e. reframing, retelling, and re-signifying, this paper suggests a transformation of ideological discourse from monosemy to polysemy and argues that it implies a potential to break state monopoly on political discourse by opening up official narratives to tolerate alternative meanings and interpretations. The very iteration of ideology imposed by state authorities through language is starting to cause its own demise, bringing inevitable changes to its politically persuasive power. In this sense, digital polysemisation of ideological discourse may contribute to the liberalisation of public discourse in China as an authoritarian country. This project explores how cultural memory practice is effected by its continuation in the digital age. Through analysing popular objects and discourses formed in the aftermath of the November 2015 Paris Attacks, I show how mourning in digital spaces does significant social and personal “work”. Contra to techno-pessimistic discourses which argue that these practices are “meaningless” or “lazy” forms of solidarity, my analysis shows how public mourning in online spaces facilitates powerful border materialisations which organise bodies through connecting, contesting and affecting forms of public feeling about the event and its representational objects. I argue that if we acknowledge that issues with digital memorials stem from their restrictive frames of recognition, rather than some intrinsic flaw of the practice itself, we can begin to think about what a digital memorial should look like, thus redirecting our concerns about “the right way to mourn” loss in the digital age from a stagnated, pessimistic conversation, to a progressive and hopeful one. Surely, no likes to be deceived. And yet, even though in the age of ubiquitous computing we are surrounded by objects that incorporate AI solutions, we interact with different kinds of machine intelligence without realizing it – using online banking systems, searching for YouTube clips, or consuming news through social media – not really knowing how and when AI systems operate. In this paper, I revisit the idea of technology as a trap and the role of the designer as a trickster, to rethink our attitude towards technological imitation in the age of artificial intelligence. I draw on elements of media theory to locate the inquiry into AI explainability within the discourse on perception – to eventually ponder new ways of deconstructing the technological incarnation of the Trojan horse, that has pervaded our home and, more recently, surreptitiously taken over almost all aspects of our daily actions through global-scale computing, the cloud, and AI-enhanced personalization. I argue that culture has always been a form of ‘blackboxing’ – to speculate on alternative, self-conscious, anti-progressive design strategies that materialize critique and, in effect, raise awareness of the system as a whole. Dr Ana Belén Martínez García (Visiting Research Fellow, King’s College London) Activists make use of diverse means of communication, online and offline, to present themselves and create a persona with which many can potentially empathize. Building on my previous research on Twitter (Martínez García 2017) and TED talks as life writing (Martínez García 2018), this paper looks at the ways human rights activists deploy repetitive discursive techniques in narrating their struggle and, in so doing, re-frame both who they are and what they stand for. The potential of the web 2.0 and social media affordances has long been studied in the arena of social movements, advocacy and activism (see Gerbaudo 2012). However, much remains obscure in the domain of young women’s self-presentation practices in contemporary culture. Interestingly, most Global South young women who become activists tend to use English as a rights lingua franca, their discourse closely matching that of long-gone historical figures fighting for equality and freedom. Thus, these emerging key public figures employ a rhetorical style full of nuanced repetition which is quite emotionally charged (Martínez García 2018). The potential of strategic repetition is enhanced via technological affordances, such as the simultaneous deployment of various digital platforms, retweets and tagging (Papacharissi 2012). This contributes to a ubiquitous presence online that may influence policy-makers and actual implementation offline. The viral phenomenon of such activist young women as Malala Yousafzai, Yeonmi Park, Nujeen Mustafa or Bana Alabed, to name but a few, is a feature of global society that is yet understudied and deserves our attention. The affects awakened by these girls’ self-portrayal may effect much needed change not only locally, but crossing geopolitical borders, advocating for transnational solidarity. The role of the digital realm in amplifying their message, thanks to immediacy and reach, is of paramount importance and yet to be fully assessed. Self(ie)-Care and Mental Health Most media coverage surrounding mental health, online communities, and selfies portray the digital either as narcissistic and damaging, or in opposition as pro- instead of anti-social. What is missed in this binary is a discussion of what it means to be ‘social’, and an analysis of whether digital counter-cultures can (re)construct identities and spaces of self-care. Accusations of selfies being narcissistic place the photo-taker as self-obsessed and in need of (re)disciplining. The repetition of this claim creates a boundary of acceptable behaviour and what is considered ‘abnormal’. Building from discussions as part of my photo-voice methodology, this research places the narcissism of selfie-taking as an important tool for self-care. It allows people with mental illnesses to com-pose themselves and view the self in a manner otherwise denied. Beyond the individual selfie, these images are often posted to online communities. This formation of digital counter-cultures allows for a personalised celebration opposed to the dominant representation of mental health. The creation of these affective counter-publics can allow a freedom, however can become constraining themselves – for example (re)inforcing negative habits of surfacing and rendering visible often invisible disorders in order to ‘prove’ illness. Two different conceptualisations of self-care are important when considering these freedoms and constraints. While the act of continually creating oppositional spaces is necessary to reach for the better life, it is an anxious and tiring task. Often overlooked is the radical importance of being able to easily take a break from everyday life, without changing it, instead to allow for continued survival once returning. A feat the fixed but imperfect counter-publics partially achieve. To move towards harnessing the potential good of social media for people with mental health problems this research will consider how online self-care (re)constructs identity, and how different conceptualisations of care are tied up in these discussions. Democratic slogans are declared by the platforms of Web 2.0. In particular, Facebook positions its mission as ‘’connecting people’’. However, its design stimulates privately oriented topics. Private data can be sold to advertisers, and it’s the maximization of profit Facebook strives for. The paper explores how the implicit mechanisms of Facebook, implied in its business model and algorithms, refute the very democratic slogans Facebook proclaims. The research reveals 14 dialectical ideologemes (Jameson, 1982) of democracy, explaining why the declared inclusivity operates on Facebook as genuine exclusivity of people, equality as inequality, participation as passivity, privacy as surveillance, community as personification, networking as centralisation, horizontality as hierarchy, ‘’no matter who you are’’ as a primacy of status, knowledge abundance as ignorance, expertise as incompetence, choice as ‘’no alternative’’, communication as its renunciation, multiperspectivity as one-sidedness, public matters as private matters. The research applies ideas of neoliberal influences on media (Fuchs, 2014), the individualization of publicity (Sennett, 1992); reification (Honneth, 2005), represented by the platform’s design as ‘’likes’’, ‘’list of friends’’ (Bucher, 2018; Vaidhyanathan, 2018); commodification of social relations (Adorno, Horkheimer, 1972); mimetic production (Jameson, 1991); surveillance (Myhed, 2016); individual self-presentation; some-to-some-to-me communication (Castells, 2010; Dean 2009), end-to-end rhetoric (Gillespie, 2016). Neither technodeterministic approach, which presumes the predominance of digital context in defining users’ behaviour, nor behaviouristic one, which examines internet as a totally free space where users can realize everything they want, can fully explain the capacity of the internet to promote public matters. That’s why the political economy approach is useful. Whether digital platforms serve as liberating or not depends on their internal organisation. Not the advancement of public discussion but the augmentation of private issues is Facebook’s main goal. Designed differently, social media can refute individualisation, alienation and commodification, and encourage debate about commons. Ella McPherson Clare Foster Hugo Leal Re-printing: From the Paperback to Virago Modern Classics Re-Thinking the Book Anatomies of Re-printing: The Case of Rembrandt’s Dr Tulp CANCELLED: Dance and the Archive. Politics of a Re- Perspective Re-/Un-working Tragedy: Perspectives from the Global South RELOCATED Teach-Out. Passionate Affinities: Literature and Networks CANCELLED Re-Enacting Icons: Self-Portraiture and Selfies Tragedy and the Global South: A Conversation with Prof Martin Puchner Iconising the Classical: Pompeii in Silent Cinema Towards An-Iconology: Environmental Images Tacit Engagement in the Digital Age Repetition, Revival, Reconstruction: The Visual Culture of Architecture 1750-1900 The (Re)Shaping of Collective Memory The Psychology of Data Re-Mediating the Political: Digital Culture and Temporality Technologies of Reproduction and the Craft of Activism The Performer as Interpreter: an Embodied Double (Artist’s talk) Reimagining ‘The Classics’ Repetition as Claiming Space ‘Re- As an Embodied Practice (Workshop) The Repeating Work: Adaptation and Appropriation Replicas: Perspectives from the History of Art and Science The Concept of the ‘Original’: Japan, African and Indonesia Authenticities: Shakespeare’s Globe, Anatomical Drawings and Bach	cc/2020-05/en_middle_0093.json.gz/line519
__label__cc	0.70424	0.29576	History of Senior Class Isn’t it strange, that when we were Freshmen we thought that Commencement Day was the very loveliest of all the school year, and now when our graduation day is actually here, we’re really very sorry to leave P. H. S.? Of course, one couldn’t expect us to be wholly in tears and mourning, for there is always a happy side to everything, and graduation assuredly has its good points! How little we dreamed when we entered high school and the way seemed so difficult that it would be only too short. As “Freshies,” what manners we affected and what high hopes we had! We were now members of that great body called the “High School,’’ and some day hoped to be grave and reverend and dignified Seniors. But oh, how far away that all seemed! So we just had a good time then, trying not to show our ignor- ance of new systems too much. Almost before we knew it, we were Sophomores. Then, it seemed ages since our Freshman year, and just about as long before we would “finish school’’ as the phrase is. Gracious, what horrible studies confronted us! We had never seen any- thing like this before, and sincerely hoped never to meet with such terrors in the future. Then it was that we put in most of our studying, and, as a result, were so glad of any hard earned rest that we just decided to enjoy ourselves and not worry about dignity or establishing a precedent or anything. You know you never can be young but once, so why not have our fling now. But the next thing we knew (though usually we didn’t know much of anything) we hopped over into the Junior room, where we didn’t feel a bit at home, but which seemed to be the place where everyone expected us to be and was rather surprised if from force of habit we walked into the room where the Sopho- mores held sway. Surely, now with only two more years in school, we must begin to add to, or perhaps we should say to accumulate, our stock of dignity. But did we? Nay, not so. The evils of boning and cramming were over for the present, so why not have a little more enjoyment? Exams may come and exams may go, but fun goes on forever; that is, with apol- ogies to Lord Tennyson. Almost before we could realize it, however, we discovered by some subtle power of intuition that we were at last privileged to reside in the longed for and coveted, though somewhat chilly, Sanctum of the Seniors, just across the hall. For the second Senior napsljots -■m time in our scholastic lives we were overawed (the first time being when we entered the sacred portals and were dubbed Freshmen). Otherwise, we didn’t feel one bit different from what we had before. We were, evidently, not very responsive to environment. And would you believe it, we didn’t seem to care about anything much but having a good time, when we should have been obtaining our education and planning life careers and so on. From this one might judge that the class of ’23 did neither toil nor spin nor set the midnight oil to burn- ing. Though we fear we never quite equaled the lilies in glory, neither did we become old and wrinkled because of much study, which we read somewhere was a weariness to the flesh. We were only normal boys and girls who really studied quite a lot when it was absolutely urgent. It was during ’23 that the class started their famous picture gallery. During the previous year, we boasted only one very swell and obscure calendar, while in the second semester of the following year no less than twenty, and no more than twenty- five, calendars dotted the walls and various articles of furniture, such as desks, chairs, and blackboards; the only explanation is that it was a sudden and over-artistic fad. Hikes, parties and entertainments further added to the pleasure of the class, being “heartily enjoyed by all those pres- ent.” Through it all you may see that 1923 has been “out for a good time,” but don’t think that we are never serious and think no deeper than the “thrills” of class night or various forms of jollification. We truly realize how much dear Pulaski High School has done for us and how very, very much we owe her that we can never repay. We hate to leave you, P. H. S., now that the time for departure has come, but we trust that you will not completely forget the fun-loving and oftentimes thoughtless, but ever loyal, members of the class of ’23.	cc/2020-05/en_middle_0093.json.gz/line523
__label__cc	0.615754	0.384246	P.O. Box 796, 1483 Route 6A, East Dennis, MA 02641 Antique Tools Antiques & Accessories Asian Art & Antiques Books, Postcards & Ephemera Fine & Decorative Art Glass at Auction Individual Estate Sales Marine and Oriental Export Art Paul Jacoulet Sporting & Military Items Sports & Other Collectibles Bid Live Request a Condition Report Leave an Absentee Bid Request a Phone Bid Paying for your Purchases Shipment of Purchases Catalog Subscriptions Request an Auction Estimate In Memory of Robert C. Eldred The Marine Sale at Auction Lot #1 DepartmentScrimshaw Sold For$320,000.00(hammer price) $384,000.00(price including buyer's premium) Last UpdatedNovember 4, 2019 POLYCHROME SCRIMSHAW WHALE'S TOOTH BY EDWARD BURDETT Circa 1830-1833 Inscribed on lower edge Engraved. by Edward Burdett. of Nantucket. onboard of The Ship Wm Tell." in script lettering. Obverse titled "Wm Thomson. Cutting. Boiling. And Fast. To A Whale." in serifed lettering. Depicts the American whaleship William Thomson flying a large and boldly rendered American flag off her stern. A whaleboat off her bow is in the process of capturing a surfaced sperm whale. Another American whaleship, identified as the Leonidus in script lettering, is depicted near the tip. Reverse titled "Pacific. Homeward Bound Full." in the same serifed lettering. Depicts the American whaleship Pacific flying a large American flag, an agent's red and blue "Pacific" flag off the foremast, a long and waving red and blue pennant off the midmast and a blue house flag off the stern mast. A coastal lighthouse and house is off the bow, and another hilly landmass is in the distance. The titles flank a cut-cornered rectangular cartouche inscribed "New Bedford Ships. S.N. Potter. Master." in the same serifed lettering as the titles. The tooth exhibits exceptional details throughout including a lookout in a mast, a rooster-form weather vane atop the lighthouse, smoke emanating from the house's chimney and the flurry of activity happening aboard the William Thomson. A red berry vine, typical of Burdett's work, wraps almost completely around the circumference of the base. Extensive use of red sealing wax in flags, whale and whale blubber. Ship hulls as well as the sperm whale, the whaleboat and assorted pennant and flags are carved in relief. Length 8". From the inscription, we know the tooth presented here was created while Edward Burdett was onboard the ship William Tell, which left New York in November 1829 and returned to port in February 1833. It is likely the William Tell encountered the ships William Thomson, Leonidus and Pacific while in the Pacific whaling grounds. The William Thomson sailed from New Bedford in October 1830 and returned August 1834, therefore this tooth likely dates from 1830 to 1833. We believe the tooth was engraved by Burdett and given to the ship captain, Stephen Potter. Edward Burdett was a pioneer of American scrimshaw, and in his short but prolific career he produced what are widely considered masterpieces of the genre. He was born on Nantucket in October 1805, the son of a merchant sea captain. His first whaling voyage was aboard the Foster from 1822 to 1824. In successive voyages he sailed aboard the William Tell and the Montano. In November 1833, while serving as first mate onboard the Montano, Burdett was entangled in line, dragged by a whale overboard, and drowned. This tooth is remarkably similar to another Edward Burdett tooth sold at Eldred's Marine Sale, July 20, 2017, Lot #1, for the world-record price of $456,000. That tooth bears the same maker's inscription and also depicted the whaleship William Thomson, though it was seen "Homeward Bound", not involved in active whaling as depicted on this example. Descended directly through the family of Captain Stephen Potter of the William Thompson. A letter from the family will accompany the tooth. In our opinion this lot provides an exceptional opportunity to own a scrimshaw whale's tooth with an important provenance and excellent patina engraved by one of the masters of the craft." Deep rich patina. Two old chips at base, one through the berry vine. Faint and unobtrusive age lines at tip and base. This item will not be shipped internationally without a CITES permit. Obtaining CITES and any other necessary permits is the obligation of the buyer. « Back a Page The description of the item above may not be the final version used in the catalog. The descriptions are as yet unedited and may contain mistakes. The description, estimates and photos could all be wrong. In rare cases they may not end up in this sale. Once the items have received their lot number the descriptions will have been changed if needed. Hours: April-November: Mon.-Fri. 8:30am until 4:30pm December-March: 8:30am until 4:00pm Visits: 71,582,883 Copyright © 2020 Robert C. Eldred Co., Inc MA Lic. 155 Hosting • Design • Development: Community Internet Cape Cod SEO	cc/2020-05/en_middle_0093.json.gz/line528
__label__wiki	0.56529	0.56529	← Joe Petruccio — Official Elvis Artist Touching AP Wire Stories after Elvis’ Death → Fun and Games on Elvis’ Movie Sets Posted on August 8, 2016 by Phil Arnold \| 2 Comments Three months ago I shared a few excerpts from the new book Elvis Humor by Bo Keeley. Bo had a unique concept for producing a successful book about Elvis. He went out and bought 43 other books on Elvis, and searched through them to find 290 anecdotes about his humor and love of fooling around and pulling stunts on others. Elvis Humor is organized into many categories like the three in the subtitle: Girls, Guns, and Guitars. Last time we looked at a few from the Graceland section, but this time the stories of fun and games take place in the Movies category. Bo Keeley precedes each story with a little background and follows with the original source information. Wet Shirt The Memphis Mafia was a mobile family that accompanied Elvis wherever he went, including onto Hollywood movie sets. Each had a specific duty such as bodyguard, valet, sport trainer, scheduling logistics, or playing in the bands. In Hollywood, the function of the group was to make sure Elvis had a good time. The boss always said that when making movies stopped being fun, he would stop making movies… I walked on the set of Clambake one morning. A bucket of water hit me from way up on one of the high catwalks. Elvis had a dressing room trailer that they pull from different locations. And I was there waiting for somebody to come out. Well, Red West had taken two buckets of water and crawled to the top of that studio. And I’m sitting there waiting. All of the sudden, a bucket of water hit me all over my head. And, when I looked up, the second one got me right in the face. Then I went to wardrobe and got a dry shirt. I hung my shirt up. And I went over there about 30 minutes later, it was still ringing wet. We broke for lunch, and when we came back, it was still wet. About an hour later, I came back, it’s still ringing wet. Well, this time I shot around the trailer, and I stopped and looked back where my shirt was hanging. And Elvis had one of those pumps, you know, that they use to keep the greenery looking good on the set. Every time I’d walk away, he’d go pump it and drown my shirt again. But that’s the type of thing we’d just for fun. (Attribution missing on this one) Wigged Out In Kissin’ Cousins An Army officer returns to the Smokey Mountains and tries to convince his kinfolk to allow th Army to build a missle site on their land. On Arriving, he discovers he has a lookalike cousin… Elvis played twins in the movie Kissin’ Cousins for MGM in 1963. Although he got a kick out of seeing two of himself on the screen, before filming started he became quite uncooperative with the director. He was required to wear a blond wig as one of the twins, and because he though the hairpiece made him look stupid, he refused to come out of his dressing room. The studio heads contacted Colonel Parker, who came down to the set to try to coax Elvis out. He told Elvis he was wasting the good money the studio was paying him, as well as hurting the other actors and prolonging everyone’s day. When Elvis finally emerged with the wig on his head, he was startled to see everyone on the set wearing blond wigs. Even the Colonel, with his ever-present cigar poking out of his mouth, was sporting a curly blond wig on top of his bald head. Elvis rolled over laughing. He forgot his nervousness and apologized to the cast and crew for his behavior. Jim Curtin, Elvis:Unknown Stories Behind the Legend, P.84 Frightening, Isn’t It? Elvis found out by watching movies that Tony Curtis wore mascara, so that on film and when they took photos, his eyes would be more defined. So, Elvis started doing it also when he performed. He was one of the very few men, with those Roman chiseled features, who could get away with it… Young Elvis wearing eyeliner. He was eagerly looking forward to one particular film, Harum Scarum (1965), seeing it as a chance to create a genuinely interesting character. He identified his role with Rudolph Valentino’s in The Sheik. At last, he thought, a part he could sink his teeth into. He saw a physical resemblance between himself and Valentino, especially in profile. During production, he came home darkened with makeup, dressed in white harem pants and a white turban. He looked extremely handsome, much more so than Valentino. Tilting his head down, with a piercing gaze, he asked rhetorically, “Frightening, isn’t it, how much I look like him? How does this get to ya?” He took me in his arms Valentino style and dipped me a la the famous poster of The Sheik. Night after night he kept his makeup and turban on all through dinner and up until bedtime. Priscilla Presley, Elvis and Me. P.211. Just Plain Ol’ Elvis Elvis blamed his fading popularity in the 60s on his humdrum movies, and yet the silver screen gave many of his fans around the world their only opportunity to view him. He stayed sane through the decade with pranks on the sets involving the Memphis Mafia, sports, and girls. In 1962, he played Walter Gulick, who is returning from his military service to his birthplace where he was orphaned as an infant, and grew up elsewhere, but always wanted to return to where he was from. Walter is happy to take any kind of work, but his devastating right hook send him down a different path as Kid Galahad… During the filming of Kid Galahad in the winter of 1961, Elvis’ friends ordered a custom-made director’s chair as a prank gift. The chair had “Mr. Presley” stamped on the back of it. They presented it to the star on the first day of filming in mid-November. Elvis turned to the crew, the director, and the producer and asked, “Mr. Presley? Why so formal?” Director Phil Karlson said, “Only the best for our star.” Elvis hated the formality of it. He wanted to be treated like one of the boys, and the chair destroyed the illusion. The next day a new chair replaced the formal one. The bright red canvas sported bold print that read “JUST PLAIN OL’ ELVIS.” Elvis laughed out loud and plopped into the chair. Jim Curtin, Elvis: Unknown Stories Behind the Legend, P.98 Memphis Mafia on Set Robert ‘red’ West was a close friend of Elvis and the first member of Presley’s inner circle, known as the Memphis Mafia. He first met Elvis in high school, where he was a year behind him, and defended Elvis in a bathroom brawl. After Elvis’ discharge from the Army in 1960, West was employed as one of Elvis’ bodyguards, and not only was quick to his boss’ defense, but strong on the practical jokes. West also became a movie stuntman appearing in 16 of Elvis’ films in the 60s, usually playing extras or bit and supporting parts… Red West remembers that there was so much playing around on Clambake [four of the stories in this post are from that movie]. We sure did cut up on Clambake, but I don’t think we held up production any. There were pie-throwing, firecracker fights, and water bombardments. “In one scene,” Red remembers, “Bill Bixby was before the cameras, which were rolling, and Elvis walked in and hit him with a cream pie.” “Up until that time, director Arthur Nadel hadn’t been hit. I thought he felt a little bit left out of it. So on the last day of shooting, he was dressed in a raincoat and rain hat, virtually inviting us to hit him. We didn’t. But that night as we had the end-of-movie party, he changed into a suit. After the party, he was going to a meeting. Well, we all made a little speech about how we love him and what a great guy he was to work with and what a great guy he was. Well, he gets choked up and begins to say thanks, and that’s when we hit him with a pie right in the face. At last he got the pie he wanted, but he was fully dressed.” Red West, Elvis: What Happened, P.273 Boom Truck After graduating from high school, Elvis took a full-time job driving a truck for Crown Electric Company. His pay was $1 an hour. Elvis enjoyed driving a truck for 14 months until the fall of 1954. His truck driving career was interrupted by a phone call from Sam Phillips inviting Elvis to record at Sun Studio. It was resumed in 1965 on a Hollywood set… Elvis was in a restless mood during the filming of Girl Happy. In order to get in Elvis’ good graces, as well as to lift his mood, one of the cameramen offered Elvis the chance to drive the camera boom truck around the studio lot. Excited at the prospect, Elvis ran over to the truck before the cameraman could change his mind. Elvis maneuvered the vehicle slowly at first, familiarizing himself with the gadgets. Within minutes, he was driving like an expert. Elvis began to get restless and drove the truck all over the lot much too fast. The cameraman ran after him, shouting at him to slow down, but Elvis would not listen. As he manipulated the large vehicle around the sets, he came within inches of knocking down permanent light fixtures and several backdrops. Panicking, the cameraman started to direct Elvis and prayed that the actor would listen. Elvis slowed the vehicle down and drove it around the lot at a reasonable speed. Fifteen minutes later, he parked the truck and shut off the engine. He thanked the cameraman for the opportunity. Relieved that nothing terrible happened, the cameraman had nonetheless learned his lesson. He never allowed the King to ride in the boom truck again. Jim Curtain, Elvis: Unknown Stories Behind the Legend, P.86 Sidecar Singers Elvis waterskied on McKeller Lake, Memphis as a teenager, so he was a natural in the 1967 musical Clambake. He is heir to an oil fortune who trades places with a waterski instructor at a Florida hotel to see if girls like him for himself, rather than for his father’s money… We were in Nashville cutting the soundtrack or Clambake with the Jordanaires, and Elvis told them, “Y’all sing on the chorus with me.” Well, the director of the picture was there, and he said, “Elvis, I don’t think you understand where the song’s going in the picture. In this particular scene, you’re riding down the highway on a motorcycle singing this song.” “The voices can’t sing along with you. Where would we put the singers?” Elvis thought for a second and said, “Put ‘em the same damn place you put the band.” That was the end of that. Rose Clayton, Elvis Up Close, P.226 Cricket Interlude Filming for the musical Follow That Dream began July 6, 1961 in the summer heat of Florida. Recording sessions had taken place at RCA studio in Nashville. Six songs were recorded for the movie, and a distressed Presley insisted the worst song “Sound Advice” be omitted from the soundtrack. However, to director Gordon Douglas, the worst recording of the film was the crickets on location… The film crew had a difficult time recording the soundtrack for Follow That Dream. Filming took place in Florida from July through August 1961, and the crickets caused major problems. The crickets seemed to have an uncanny instinct to congregate at the exact location of Elvis’ movie set. Every time Elvis’ voice was heard, the crickets began to sing; every time he stopped, silence filled the set. Director Gordon Douglas yelled at the crickets to shut up, which they did. He turned to Elvis and asked him why the crickets were making so much noise. Elvis smirked and blurted out, “Maybe they’re Pat Boone fans.” Elvis started to sing with the crickets and remarked that it even sounded like they were chirping a Pat Boone song. Everyone laughed. Douglas had to postpone that day’s filming. To make sure that the crickets would not cause further delays, he called an insect specialist. Firecracker Battle When Elvis lit a firecracker, it was to ease tension, make a point, or bring people together. When he lit dozens of them… In March 1967, Elvis was working on the movie Clambake. While he was having his make-up done by make-up man Dan Greenway, one of the crew members tossed a lit firecracker into the trailer. An all-out firecracker war was soon under way. Elvis lit a firecracker to toss under a crew member’s chair. He misjudged, however, and the cracker landed on top. As the crew member sat down, the firecracker blew a hole in his pants. Elvis laughed so hard he did not hear one of his bodyguards behind him until a larger cracker popped right under his own read end. He quickly ran to his dressing room and retrieved his own stash of fireworks. The firecracker fights continued for several days. The set looked and sounded like a war movie. Even director Arthur Nadel got involved in the action; he eventually appeared on set sporting a German war helmet. Rear ends were singed and fingers were burned, but by the time some action was finally caught on film, everyone was in a great mood and it showed. Jim Curtin, Elvis: Unknown Stories Behind the Legend, P.100 My thanks to Bo Keeley for agreeing to let me use excerpts from his book in this post. If you are interested in getting a copy of Elvis Humor – Girls, Guns & Guitars, click here. © 2016 Philip R Arnold, Original Elvis Blogmeister All Rights Reserved www.ElvisBlog.net Elvis, Elvis Presley, and Graceland are registered trademarks of Elvis Presley Enterprises, Inc. This entry was posted in Main Page, MOVIES and tagged and Guitars, Clambake, Elvis Humor: Girls, Elvis movies, Elvis Presley Fun, Elvis Presley Humor, Follow That Dream, Girl Happy, Guns, Harum Scarum, Kid Galahad. Bookmark the permalink. 2 responses to “Fun and Games on Elvis’ Movie Sets” Craig \| August 10, 2016 at 10:58 pm \| Reply Follow That Dream & Paradise Hawaiian Style were the only 2 movies where Elvis was fat in his younger days. Phil Arnold \| August 14, 2016 at 2:57 pm \| Reply Hi Craig: You are a source of some great Elvis trivia. Phil Arnold, Original Elvis Blogmeister	cc/2020-05/en_middle_0093.json.gz/line531
__label__cc	0.687352	0.312648	Betty's game repeated - 26/07 (originally 07/05) [ 95 posts ] Go to page 1, 2, 3, 4, 5 Next Big-Davey Posted: Fri Jul 25, 2008 10:03 pm Author: Big-Davey Post subject: Betty's game repeated - 26/07 (originally 07/05) Discuss in here which show you'd love to see repeated tomorrow. There is a Deal or No Deal on tomorrow which we can only assume like last summer during the weekend slot, is a Classic. But who would you rather see? Lifelong fan of Vicky, Siobhan and Lisa Resident divvy, keeps a nerdy eye on the UK Top 10, makes up the numbers in the forum Fantasy Football... ...and overseeing The 2010 Forum Wing Line-Up! Check it out in the Contestants section of the forum! Last edited by Big-Davey on Sat Jul 26, 2008 4:46 pm, edited 3 times in total. Posted: Fri Jul 25, 2008 10:07 pm Author: jonny Post subject: Re: Saturday's show 26/07 - obv. a repeat Well, I never saw Laura's game...but I'd be happy with any "classic", as long as it truly is a "classic". Jonny starred as...'audience member': 23rd, 24th and 25th of July 2008 (Adam, Helen, William) recorded 7th April 2008 18th, 19th and 20th May 2009 (Cath, Sean, Lynne) recorded 4th February 2009 10th, 11th and 13th December 2009 recorded 4th June 2009 Posted: Fri Jul 25, 2008 10:07 pm Author: KP Post subject: Re: Saturday's show 26/07 - obv. a repeat International Forums Moderator I'm sure most people will vote for Wakeyist games. So to cancel that out a fraction, I'd like to see Jeannie's game again! Champion of RTaB S6, creator of unorthodox DoND rulesets, and founder member of #teambat. Creator of the first DoND Live offer to be accepted. "Why regret what could not be?" (A Heart Full of Love, from Les Misérables) I introduced utility theory to the forums. Blame me. In your choices, beware of words leading you astray. Think in a balanced way about potential gains and losses. KP wrote: Richard's. Oooh, original Beryl's Posted: Fri Jul 25, 2008 10:08 pm Author: Lewis246 Post subject: Re: Saturday's show 26/07 - obv. a repeat Pat M's game, I've still never seen it! Posted: Fri Jul 25, 2008 10:09 pm Author: Big-Davey Post subject: Re: Saturday's show 26/07 - obv. a repeat Jonny actually bears a good point - albeit the following Saturday (13th January) and the More4 repeat, Laura's game has never been repeated! Posted: Fri Jul 25, 2008 10:18 pm Author: h2005 Post subject: Re: Saturday's show 26/07 - obv. a repeat Lewis246 wrote: I'd like her game to be shown too, as whilst she's my favourite ever contestant (yes she still is, even after all this time!) I can't find my recording of her game, and haven't seen it since it was first broadcast! By the way, are we sure there is going to be a show tomorrow? And that it's not just a cock-up in the schedules that have been printed as they assumed there would be a Saturday show as usual? I'm surprised the C4 announcer didn't mention it at the end of today's show, as people may get confused if they see an episode for tomorrow. But surely they'd have said so if there'd been an error and it wasn't on tomorrow. Anyway I'll guess we'll find out at... 4pm is it? And if it's finishing at 4:45 then that rules out several "classics" including Morris' and Laura's as they lasted more than 45 mins! Posted: Fri Jul 25, 2008 10:23 pm Author: Tom22 Post subject: Re: Saturday's show 26/07 - obv. a repeat I'd go with Pat M's game as well, I havent seen it since it was broadcast. Other than that Laura, Clive, Morris, Gaz, Mad Sarah and is it wrong of me to maybe want a christmas game with the decerations and stuff? EDIT - H2005 makes a good point there... http://www.channel4.com/listings/C4/ind ... artHour=11 Even says it's a repeat in the synopsis. Tom22 wrote: Third time today I've pipped you to the post. When was the last classic show anyway? Last summer? Just had a look at my today's show archive (here ) and I believe it was Di Please's which was repeated on 12/08/07... nearly a year ago. Hopefully it'll be a more recent classic like Clive's or an older one that hasn't been repeated - e.g. Pat M's, as all the usual suspects - £100k Gaz, £250k Laura, £75k Kirsty, Mad Sarah, Lance etc. have all been repeated already on C4! Posted: Fri Jul 25, 2008 10:34 pm Author: Billy Post subject: Re: Saturday's show 26/07 - obv. a repeat Di Please was indeed the last show, but there were two Classic Episode polls which got winners but were never shown...I think they were 10p Raj from three years ago, and also, somehow, £10,000 Sophie from late Season 2. I'd like to see Clive's game repeated as I don't have it, I'd already stopped taping them by then! "Welcome to PACK IT IN OR CARRY ON!" There is a good reason they've been repeated though! I wouldnt mind seeing any of them really with every possibility that it could be any old game tomorrow (although if it's one from the last month I think we should all agree to shut the forum down and never watch DOND again!). I'm just hoping it's a great funny show with a non-average win... There is a good reason they've been repeated though! Indeed, I'm not saying they shouldn't have been repeated... but I don't think they need repeating again when there are other classics which deserve a repeat and haven't had one yet. Endemol clearly still show signs of being pro-Wakeyist in some ways, and in light of recent games especially there is frustration. I predict a repeat for Betty. Kinda agree with KP - it'll be one of the big money winners. Infact, five Saturdays until the 25th August...let's wildly assume Maria, Chris and Betty be three of them...Clive another? CrazyChair Posted: Fri Jul 25, 2008 11:26 pm Author: CrazyChair Post subject: Re: Saturday's show 26/07 - obv. a repeat I know her game was ages ago and not in season 3, but I'd love to see Pat M's game, as I missed the last 10 minutes. From season 3, I'd like to see Maria's and Jean's again. I mean the Jean from October. Big-Davey wrote: Is there a repeat show every Saturday until the w/b 25/08? There isnt one next week. Michael DeVere Posted: Fri Jul 25, 2008 11:36 pm Author: Michael DeVere Post subject: Re: Saturday's show 26/07 - obv. a repeat Maybe they'll repeat the first very first show and instead of making any new episodes, and to save Endemol money, maybe they'll brainwash us tomorrow and make us forget DOND ever existed. Then they'll just continue to show the show from season one again when they return of their summer holidays and we'll be none the wiser. Anyway seriously, as they say it's an "amazing" game from season 3 they're planning to show, then i'm guessing if they want entertainment they'll go for Clive, or for a big money win someone like Betty, but as her show was quite recent i'd prefer one a little older. Maybe they'll show a 1p show, such as Matty's.	cc/2020-05/en_middle_0093.json.gz/line534
__label__cc	0.71273	0.28727	Costless Science Sleep Sci. 2012;5(1):iii Assessment of the impact of vertical dimension alterations on the quality of sleep in elderly patients wearing upper and lower full dentures Danilo Chucralla Chaccur; Lia Rita Azeredo Bittencourt; Ligia Lucchesi; Fernanda R. Almeida; Thiago Carôso Fróes; Ricardo Jun Furuyama; Maria Luiza Moreira Arantes Frigerio OBJECTIVES: The loss of vertical dimension of occlusion (VDO) is a problem that affects stomatognathic system performance, mainly in edentulous patients. Thus, diseases related to musculature failure such as obstructive sleep apnea syndrome (OSAS) are common in these patients. Consequently, efficient and low-cost therapeutic strategies such as intraoral devices (IOD) used to expand the upper airway (UA) are needed to improve the quality of sleep in these patients. The aim of this study was to assess both the subjective and objective effect of VDO increase on the quality of sleep in 19 elderly patients using bimaxillary total prostheses (TPs) before and after placement of new TPs and therapy with intraoral devices (IOD) especially designed to increase VDO without causing mandibular advancement. METHODS: For this purpose, questionnaires surveying quality of sleep (Epworth Sleepiness Scale, Pittsburgh Sleep Quality Index and sleep anamnestic questionnaire) and polysomnography tests (PSG) were performed at three different phases: baseline without TPs, with TPs and with IODs. CONCLUSIONS: It was concluded that the tested IODs may contribute to improvements in the quality of sleep for patients and their sleeping partners because they led to significant decreases in snoring. Most patients also expressed a preference for IOD use while sleeping. However, the use of IOD did not significantly improve polysomnography parameters compared to the baseline and thus cannot be indicated for the treatment of OSAS. Keywords: aging, equipment and supplies, obstructive, sleep apnea, vertical dimension. Validation of a new Brazilian version of the "Night Eating Questionnaire" Gleiciane Moreira Dantas; Thisciane Ferreira Pinto; Eanes Delgado Barros Pereira; Renan Montenegro Magalhães Júnior; Veralice Meireles Sales de Bruin; Pedro Felipe Carvalhedo de Bruin OBJECTIVES: The Night Eating questionnaire (NEQ) is regarded as an important tool for the assessment of the severity of the Night Eating Syndrome. The objective of this study was to validate a new Brazilian Portuguese version of the NEQ that could be easily applied to patients from the public health system. METHODS: In order to develop the Brazilian Portuguese version of the NEQ, we adopted the following steps: (a) translation, (b) back-translation, (c) comparison between translation and back-translation and (d) pretest. Subsequently, intra and inter-observer reproducibility were assessed in 37 patients from the Endocrinolgy Outpatient Clinic at the University Hospital of the Federal University of Ceará, Brazil. The reliability of the questionnaire was evaluated in 90 individuals from the same Institution. The construct validity of the NEQ was assessed by correlations with clinical variables. RESULTS: This new translated and culturally adapted version showed excellent internal consistency (alfa coefficient =0.87) and reproducibility both intra-observer and inter-observer (individual item coefficients ranging from 0.95 to 1.0 and 0.92 - 1.0, respectively). CONCLUSIONS: These results indicate that this Brazilian Portuguese version of the NEQ is a valid and reliable instrument for the assessment of patients with nocturnal eating problems and is equivalent to its original version. No major cultural adaptations were introduced to the questionnaire during the validation process, despite significant linguistic and cultural differences. Keywords: adaptation, circadian rhythm, eating disorders, obesity, questionnaires, sleep. Sleep abnormalities and memory alterations in obstructive sleep apnea Camila Andrade Mendes Medeiros; Pedro Felipe Carvalhedo de Bruin; Luciane Ponte e Silva; Wesley de Menezes Coutinho; Veralice Meireles Sales de Bruin OBJECTIVES: Obstructive sleep apnea (OSA) is associated with a variable spectrum of sleep abnormalities and has been connected with memory impairment. The aim of this study was to evaluate the associations between OSA, memory alterations and sleep structure abnormalities. METHODS: Polysomnography was performed in 20 consecutive patients (12 male, 57.9±5.8 years) with moderate/severe OSA (AHI 35.8±16.7). Daytime somnolence (Epworth Sleepiness Scale, ESS), state of alertness (Karolinska Sleepiness Scale), subjective sleep quality (Pittsburgh Sleep Quality Index, PSQI) and depressive symptoms (Beck Depression Inventory, BDI) were evaluated. Patients were tested before all night polysomnography and a retrieval test was performed in the following morning. Declarative memory was assessed by Verbal Paired Associates from the Wechsler Memory Scale, emotional memory by the exposure to emotional and non-emotional images and procedural memory by the maze test. RESULTS: Excessive daytime sleepiness (ESS>10, 55%) and impaired sleep (PSQI>5, 40%) were found. Patients with OSA presented greater neck circumference (p<0.005). Procedural memory, as evaluated by the maze test, showed worse retrieval in OSA patients and this was maintained after controlling for age, body mass index and BDI. In subjects with moderate/severe OSA, stage 3 sleep was correlated to the performance in the procedural memory test. CONCLUSION: We show that procedural memory is altered in OSA patients as compared to controls and this alteration is related to stage 3 of non-rapid eye movement sleep. We confirm that recall memory tests after one night sleep are efficacious to examine memory abnormalities in OSA patients. Keywords: memory, polysomnography, sleep, sleep apnea syndromes. Self-grooming, experimental anxiety and paradoxical sleep deprivation in rats Helga Caputo Nunes; Fernanda Augustini Pezzato; Katsumasa Hoshino OBJECTIVE: Paradoxical sleep deprivation increases grooming behaviors in rats. Discordant data on the change promoted by such deprivation on the experimentally defined anxiety levels have made difficult to assess if the deprivation induced grooming may be used as an experimental model of repetitive behaviors, observed in different psychiatric disorders, due increased anxiety levels. In such context, the present study aims to report data gathering grooming and anxiety in rats. METHODS: The degrees of tidiness displayed by female (n=26) and male (n=27) rats were evaluated after a period of maintenance in home-cages provided with wood shavings that have the property to dye animal's fur. In the second study, the tidiness degrees were evaluated after 96 h of sleep deprivation in anxious male rats (n=6) and compared to non-anxious controls (n=6). RESULTS: Females, that are believed to be more anxious than males, displayed higher tidiness (0% colored females x 96% colored males) in the first study. All anxious male rats (100%) that displayed wild running in response to intense acoustic stimulation showed better tidiness than their controls at the end of 96 h sleep deprivation. CONCLUSIONS: Our data suggest that self-grooming in rats is tightly related to anxiety and allows the interpretation that its increased occurrence in sleep deprivation results from its anxiolytic or tranquilizing property. Keywords: animal, anxiety, compulsive behavior, grooming, models, rats, sleep deprivation. Primary headaches and their relationship with sleep Fabiana Yagihara; Ligia Mendonça Lucchesi; Anna Karla Alves Smith; José Geraldo Speciali There is a clear association between primary headaches and sleep disorders, especially when these headaches occur at night or upon waking. The primary headaches most commonly related to sleep are: migraine, cluster headache, tension type, hypnic headache and chronic paroxysmal hemicrania. The objective of this review was to describe the relationship between these types of headaches and sleep and to address sleep apnea headaches. There are various types of demonstrated associations between sleep and headache disorders, and the mechanisms underlying these associations are complex, multi-factorial and poorly understood. Moreover, all sleep disorders may be related to headaches to some degree; therefore, the evaluation of patients with headaches should include a brief investigation on sleep patterns and related complaints. Patients with headache at night or upon waking who are resistent to the indicated treatment require formal polysomnographic evaluation to exclude a treatable sleep disorder. Keywords: headaches, migraine disorders, obstructive, pain, sleep apnea, sleep disorders. Mental health and sleep during basic combat training and beyond Shannon K. Crowley; Larrell L. Wilkinson; Stephanie T. Muraca; Lisa T. Wigfall; Tasha Louis-Nance; Alexandria M. Reynolds; Edith M. Williams; Saundra Glover; Matthew P. Herring; Shawn D. Youngstedt There are emerging links between disturbed sleep and mental illness. These associations may have particular relevance for military populations which are often faced with extremely stressful situations and profound sleep deprivation. Indeed, disturbed sleep has been predictive of mental illness following exposure to trauma, and, conversely, treatment of sleep problems has helped alleviate mental illness. There is a need for further investigation of sleep and mental health of soldiers participating in basic combat training (BCT), which is clearly also associated with sleep loss and stress. Keywords: depression, health status disparities, post-traumatic stress disorders, sleep. Future of sleep apnea therapy using a mechanistic approach Atul Malhotra Obstructive sleep apnea(OSA) has multiple underlying mechanisms which vary across patients. In afflicted patients, the degree of abnormality in pharyngeal anatomy, dilator muscle function, ventilatory control instability etc is highly variable. In patients with anatomical compromise at the velopharynx, robust responses to palatal surgery would be predicted, whereas other patients may have no major improvement if the primary abnormality were elsewhere. Similarly, measures to influence ventilatory control such as oxygen or acetazolamide may yield major improvements, but only for patients with unstable ventilatory control. Further research into treatment of OSA based on underlying mechanism is required. Keywords: apnea, future, lung, respiration, sleep, therapy.	cc/2020-05/en_middle_0093.json.gz/line536
__label__wiki	0.568282	0.568282	Oh Hae-young Again Episode 1 Episode 2 Episode 3 Episode 4 Episode 5 Episode 6 Episode 7 Episode 8 Episode 9 Episode 10 Episode 11 Episode 12 Episode 13 Episode 14 Episode 15 Episode 16 Episode 17 Episode 18 (Final) 272 May 11, 2016 May 24, 2016 Oh Hae-young Again: Episode 4 As Hae-young and Do-kyung settle into their new, tentative friendship, they’re slowly but surely opening up to each other a little more every day. What started as coincidence starts to become deliberate, and they begin to actually seek each other out purposely. But the reappearance of an old acquaintance could throw up a wall between them, or it could push them even closer towards each other. EPISODE 4 RECAP: “Let’s buy a humming tune and go home” Hae-young’s face falls when she calls out a “fighting!” to a jogger with the name “Oh Hae-young,” and sees that it’s her high school classmate, the “Pretty Hae-young” who she was always compared to. Do-kyung thinks about his latest premonition, the one where Hae-young tells him that “Pretty Hae-young” is back. He remembers his ex-fiancee, snuggling with him in bed and telling him that the sound of his heartbeat is the best sound in the world. The happy memories are tainted with the pain of her disappearance on their wedding day, when Do-kyung had found photos of her with another man. It’s no surprise to Hae-young when word gets out among her high school classmates that “Pretty Hae-young” is back in town. Their texting chat room is full of speculation on where she’s been and why she’s back. Hae-young takes herself to her “happy place,” determined not to let this affect her. She focuses on thinking only happy thoughts, and the first thing that comes to mind is how Do-kyung put his shoes in her entryway, to make it look like a man lives there. She remembers how he relented and agreed that they could both live there, and she’s all smiles again. Do-kyung admits to his therapist, Dr. Baek, that he still hasn’t told Hae-young that he’s the one who ruined her marriage, or the misunderstanding that led to his actions. Dr. Baek asks how he feels when he sees her in his visions, and he says thoughtfully, “Just… lonely. As if I’m remembering the old days right before I die of old age. I get a feeling that my life is going to end in tragedy.” He runs into Hae-young again at a restaurant, and sits at a different table with his back to her. It’s almost like he can feel her annoyed stare boring holes into the back of his head. He heaves a big sigh and joins her, and she just says, “I was about to punch you.” HAHA, I love these two. Hae-young chatters away while they eat, then suddenly reaches out and puts her hand on Do-kyung’s head. She says that she heard it takes a lot of energy to live in this area, and he’s lived here his whole life, so she’s taking some of his energy. She admits that she’s feeling down today, and repeats her words from his premonition: “She’s back. The Pretty Oh Hae-young.” Do-kyung freezes, but Hae-young doesn’t notice, and goes on about how she heard that the other Hae-young just suddenly left town one day. She’d felt relieved knowing she was gone, but she saw her yesterday running a marathon. As Do-kyung walks home later, he has another vision of Hae-young, a simple one where she just looks surprised. And right then she rounds the corner and looks at him with that exact same expression. He immediately has another one, where she’s discussing the nice weather, and she strolls past him and says how warm the night breeze is. Wow, these visions are really coming fast. They finally stop, and after a moment to collect himself, Do-kyung continues walking and Hae-young falls in beside him. She says that she feels better knowing that there’s someone who understands her pain of being jilted at the altar. She thought it happened to her because she was a lame person, but now she knows that it can happen to someone cool like him, too. Do-kyung stays silent, and Hae-young apologizes for finding comfort in his pain. When they get back to their house, Hae-young asks how they should handle the construction on the door, but now Do-kyung just wants to keep their furniture in front of it. He says that her apartment was his father’s workroom, and rationalizes that if she moves out, he’ll want that space for a workroom and will need the door. Riiight. As Hae-young bounces up the stairs, another vision hits Do-kyung — he sees her running down the stairs and leaping into his arms, and the image is so realistic that he actually staggers as if supporting her weight. Jin-sang’s staying at the Park siblings’ place for a while, hiding from a vindictive family member of the victim of one of his clients. Soo-kyung asks when he’s going to stop defending criminals, but Jin-sang argues that criminals deserve to be defended fairly, too. Says the guy with the bruised-up face. HAHA, the moment Soo-kyung leaves the room, we learn the real story — Jin-sang got the crap beat out of himself over a woman. He swears he asked if she had a boyfriend, he just forgot to ask about a husband. The guy came to his house with an ax, and now he’s in hiding. Mama Oh finally comes to see Hae-young and of course, the first thing she sees are Do-kyung’s shoes by the front door. She and Hae-young take up their old bickering right away — some things never change. Jin-sang follows Do-kyung up to his apartment to get a look at Hae-young himself, still suspecting she’s following Do-kyung because she knows what they did. Do-kyung tries to physically throw him out, and the two men hilariously grapple all the way across the room. Hae-young hears the commotion through the door, but Mama Oh is busy fussing at her about the number of liquor bottles in her trash. The guys hear the yelling and lean in to eavesdrop, and when Mama Oh finds the door between the apartments, they hold the cabinet on Do-kyung’s side in place so she won’t realize what’s on the other side. Dad is there too, installing a safer doorknob and lock on the front door. Hae-young argues that she can’t change things like this since she might move out, and hey, I saw that look of worry there, Do-kyung. Cranky now, Do-kyung heads off to work — today he goes to a horse racing track to record the sounds there. The movie director reminds him that they’re going to Jeju Island next month, and says they’ll have fun when Do-kyung doesn’t crack a smile. At dinner after work, Do-kyung asks his assistant if he’s hard to work with, and the assistant just says he’s learning a lot. Ouch. The big news at Hae-young’s work is that their brand is being renewed, and that a new team will be formed to do all the work. Soo-kyung calls Hae-young into the office to discuss the fact that she’s the only one not being promoted to be on the new team — her impression of Hae-young is that she’s been slacking off, that she planned to get married then quit. Now she’ll be doing a lot of the work, and will have to follow the orders of her former colleagues. Soo-kyung asks if Hae-young’s family is rich and, pride stung, Hae-young spits that they’re super rich. Soo-kyung mutters that she looks poor. Over drinks after work, her coworker Sung-jin swears that he didn’t know everyone was being promoted to the new team over Hae-young, and he listens sympathetically to Hae-young gripe about how Soo-kyung treats her. She wails that she doesn’t look poor like Soo-kyung said, but Sung-jin says she kinda does. “Well you look poor too!” Heh. Hae-young claims that she was trying not to be too good an employee and make everyone else feel inferior, but now she’ll show them all. Sung-jin isn’t happy about this either — they’ve recruited a new director for the team, and the unknown entity makes him nervous. On her way home Hae-young buys the last two bottles of her preferred liquor in the store, unaware that the crazy-haired lady next to her is her boss. Soo-kyung tries to take one of the bottles but Hae-young won’t hand it over, so Soo-kyung ties her hair back. When Hae-young realizes who she is, she gulps hard. It gets even more awkward when the two realize they’re heading home in the same direction, and Soo-kyung orders Hae-young inside: “Let’s drink it together.” Unable to refuse, Hae-young slumps into the house after Soo-kyung and obediently cracks open her two bottles. Soo-kyung wants to know if the village protectors have ever brought Hae-young home (the recurring gag is that they refuse to escort her, because she terrifies them), but Hae-young doesn’t even know who that is. When Soo-kyung asks where she lives, Hae-young just waves in a non-direction, but Soo-kyung isn’t too drunk to figure out that she’s being deliberately vague. She helps herself to Hae-young’s snacks and tries to condescend that she should have better taste in food, but this not being work, Hae-young lets herself say whatever she wants. She says that it’s childish to try to make yourself seem fancier using food, Soo-kyung laughs that Hae-young is “taste-blind,” saying that many people are looking for new and unique foods to get excited about. It’s one of the few pleasures in life that’s relatively cheap, and brings satisfaction and consolation. But Hae-young can think of something better: love. Soo-kyung is rendered speechless when Hae-young says that love is more fun than eating, and brings more happiness. She muses that people in love don’t need to seek happiness through food, because they’re already happy. Soo-kyung asks if that’s why Hae-young is always putting out plain rice when the other employees are fussing over signature dishes, calling her “rice girl” and entirely missing the point. Jin-sang gets to the house and notices that Hae-young’s lights aren’t on, still curious to see what she looks like. He’s surprised to see Soo-kyung drinking with someone, especially when she describes Hae-young as an inferior who calls her names at work, ha. Hae-young admits it, and that her nickname is “Isadora,” and Jin-sang immediately gets the play on words and confirms that Soo-kyung has a chronically upset stomach. Jin-sang and Hae-young adorably bond over teasing Soo-kyung’s messy hair, but his legs give out on him when she introduces herself. When he comments on her name, Hae-young tells him it’s so common there were two of them in her class at school, and that verifies for Jin-sang that this is the Oh Hae-young whose life he and Do-kyung ruined. Do-kyung arrives home and sees Jin-sang freaking out, but he’s more surprised to see Hae-young here drinking with his sister. She’s just as shocked to see him here, but it all makes sense when she learns that Soo-kyung is his noona. She pretends she’s just meeting Do-kyung for the first time, and makes a face at him, indicating for him to play along. When Soo-kyung suddenly notices her designer bag, Hae-young stammers that it was a wedding gift, but quickly corrects that she’s not married, she called off the wedding. Soo-kyung wants to know why, since Hae-young’s never talked about it, and Hae-young says that she just wasn’t sure she loved her fiance enough. Both guys know the truth, and just stand there looking awkward. Hae-young can’t seem to stop talking and just goes on and on, until finally Do-kyung gets fed up and walks away. Soo-kyung tasks Do-kyung with walking Hae-young home, and they’re forced to head down the street while she watches. Once alone, Hae-young breathes a sigh of relief and laughs at the insanity that his sister is her boss, telling him that she lied because Soo-kyung abuses her at work. Now knowing that they live in the same house, she thinks she really will have to move. They round the corner and run into An-na and Hoon, wildly making out in the bushes, HA. An-na is practically attacking Hoon’s face while he begs for air, and they’re not even shy when they see Do-kyung and Hae-young watching them. Do-kyung and Hae-young keep walking, and Hae-young finally screams her embarrassment for lying about being the dumper when Do-kyung knows she was the dumpee. She asks how long it’s been since his failed wedding day, and he says it’s been a year. She teases him for still being so broken up about it, but Do-kyung denies that he’s miserable. Hae-young says it’s all over him, in his expression and his posture and even his clothes. She kicks him and says he’s so pathetic she wants to hug him (amen to that), but he’s the only one who’s unaware of it. Do-kyung tells her to worry about herself, but Hae-young is perfectly aware of how miserable and pathetic she is. As Hae-young stomps away in a grand huff, Do-kyung watches her with the tiniest smile on his face. When Do-kyung gets home, Soo-kyung says without preamble that she’s been abusing Hae-young at work just because of her name. Jin-sang marvels that that’s the girl they confused with Do-kyung’s ex, but Do-kyung wanders off, uninterested in talking about it. Do-kyung’s mom is disappointed when CEO Jang gives her a designer bag and there’s no money inside, but when he notices, she says she was hoping for a letter. She shows up for a meeting with the nerdy scriptwriter, whining about getting nothing but a lousy purse and scaring the poor scriptwriter to death. She goes looking for Do-kyung, but he’s not in the office. Hae-young walks through the rain under her broken umbrella, tentative and shivering. A woman under a bright red umbrella strides confidently past her, and she admires the woman’s pretty clothes and fancy stockings. She follows her into her office buildin to ask about the stockings, but when the woman turns around, Hae-young freezes — it’s “Pretty” Oh Hae-young. In the office, everyone is buzzing abut the new special team leader, who is apparently quite talented and was scouted heavily for this job. They all agree to band together against her, and not let her bully them around. A flower arrangement arrives for Hae-young, or seems to, until she realizes it’s wishing her good luck on her first day. This happened once before in school, when Hae-young had gotten a love letter meant for “Pretty” Hae-young, and the author had ripped it away so hard he gave Hae-young a paper-cut on her face. She knows now that these flowers aren’t for her, and takes them back to the delivery person. They make their way to the right Hae-young’s desk, which is positively buried in flower arrangements. “Pretty” Hae-young recognizes Soo-kyung when she’s forced to welcome her to the company, and expresses happiness to be working together, as if she completely forgot that she dumped her brother on their wedding day without a word. Soo-kyung just gives her a Go to Hell glare, and keeps walking. Our Hae-young ducks under her desk when they walk through her office area, and it almost works, but “Pretty” Hae-young suddenly seems to realize who that was, and she rushes back to ask which school Hae-young went to. Our Hae-young tries to hide in her chair, but “Pretty” Hae-young is oblivious and acts like seeing her again is the OMG best thing ever!! Hae-young and Hee-ran dissect the reunion over drinks later, and Hae-young wonders if she should quit her job. She shamefully admits that she was actually glad when the other Hae-young recognized her, and Hee-ran yells at her for letting herself become so small whenever the other Hae-young is around. Do-kyung can hear everything Hae-young does in her apartment with his super-sensitive hearing, even the crunching as she eats snacks. She can hear him too and moves closer to the door, so it startles her when he bounces a tennis ball against the wall and calls out not to eavesdrop or make too much noise. Annoyed, she sits back down and turns the TV up. Do-kyung’s been avoiding his mother’s calls, so it’s no surprise that she turns up at his door, demanding to be let in. Hae-young can hear his doorbell and the fact that he’s not answering it, and calls out that there’s someone at his door. This is hilarious. He lets his mom in but insists on talking outside so Hae-young can’t hear, which just makes Mom more upset that he doesn’t want her in his house. She demands he lend her some money to hire a particular director for her movie, begging and pleading and trying to guilt him until he finally blows up at her transparent manipulations. Mom plants herself on Do-kyung’s couch, screeching that she’ll sell her organs if he doesn’t give her money. Hae-young can hear every word, and it works, because Do-kyung transfers his mother some money right away. Awww, Hae-young tries to make it sound like she’s been out at the store and just now came home, which is terribly sweet. Do-kyung calls through the door that he knows she’s lying and, embarrassed, stomps out of his own place with his sound equipment. Hae-young follows him to apologize, but Do-kyung snaps that what she did made him more embarrassed than knowing she heard everything. She follows him to his favorite spot overlooking the river and watches him set up his equipment, even shushing a couple who come near making a lot of noise. Do-kyung goes quiet when Hae-young asks if he works with his father, simply saying that he passed away. He nixes any further questions, but Hae-young smiles that she’s glad she followed him out here, because he’d look pitiful out here alone. She says that she’s been afraid of silence, scared that she’s just start cursing to fill the emptiness, but right now she feels peaceful. Do-kyung says there’s no reason to curse at a man who isn’t there, but Hae-young corrects him: A woman doesn’t curse at a man who’s left her, she curses at a man who’s acted shamefully towards her. She teases Do-kyung not to be shameful, and he looks at her thoughtfully. They stop at a pojangmacha to eat dinner, where Do-kyung watches Hae-young slurp her noodles. He says that she looks pretty when she’s eating, which makes her pause, and Do-kyung reminds her that she told him that Tae-jin complained about how she eats. He’s saying she looks fine. Shy now, Hae-young denies that his words touched her, and Do-kyung smiles a little. What’s funny is that she really is a messy, loud eater, and she eats even louder now that he mentioned it, embarrassed. She practically runs from the table, but once Do-kyung can’t see her face, Hae-young smiles to herself. The next morning Hae-young runs for the elevator as the door is closing, but when the men inside look entirely too excited to hold the door, she realizes that they’re not doing it for her… “Pretty” Hae-young is behind her. They both enter the elevator, but when the alarm sounds that it’s too full, the men actually shove our Hae-young out. Wow, not cool. All day our Hae-young attracts a lot of male attention, but they only want to ask her questions about “Pretty” Hae-young. Sung-jin saves her and chases the guys away, and our Hae-young goes to her happy place in her mind, which now includes Do-kyung telling her that she looks pretty when she eats. Soo-kyung witnesses Hoon and An-na joining up for a date, and she’s jealous at how An-na runs and leaps into Hoon’s arms. She imagines herself doing the same with a man, and embarrassingly, she’s caught making kissy faces by Jin-sang and Hae-young on their way home. Jin-sang says Soo-kyung looks jealous, and teases that she’s probably too heavy to run and have a man catch her that way. Trying to stay dignified, Soo-kyung says it’s more about athleticism than weight, and that Hae-young probably couldn’t do it either. Hae-young says she can, so Soo-kyung dares her to try it and directs Jin-sang to go catch her. Hae-young is about to decline, but right on cue, Do-kyung pulls up in front of the house and steps out of his car. Hae-young gets a mischievous glint in her eye, and winds up just as Do-kyung notices her. Despite the fact that he’s carrying all of his sound equipment, she starts to run towards him, grinning. As he watches her accelerating towards him, Do-kyung remembers his vision of this exact moment, and how he’d told his therapist about it. He’d said that she runs and embraces him, “But what if I don’t hold onto her at this moment? Would I be able to cut her out of my life?” As Hae-young runs, growing closer every second, Do-kyung’s grip on his equipment tightens as if to brace himself. She jumps and he sees her in slow motion, wondering if he could avoid her. “It feels like that woman keeps on unraveling me. It’s like she’s telling me, ‘Stop being miserable, and let’s be happy together.’” Do-kyung makes his decision in an instant, and drops his equipment. He catches Hae-young as she comes down out of the air, and holds her tightly. As they freeze there, Hae-young in Do-kyung’s arms, both of their eyes widen in realization of what this means. What a lovely ending scene, and so descriptive of Do-kyung and Hae-young’s relationship. She’s been running towards him, and though he’s not sure if he’s ready, his instinct is to catch her. It’s as if they already somehow know this is right, and they’re instinctively going through the motions of beginning a courtship while their heads catch up with their hearts. Somehow, this show just keeps getting better and better. Everything about it is so spot-on, from the acting and directing, to the way it blends humor and drama, the silly and the sad, in a perfect mixture that just gets under your skin and won’t let go. It’s probably one of the most beautiful dramas I’ve ever seen, but I don’t mean just visually (thought visually it’s lovely, too). Everything about it is so gorgeous, from the actors themselves to the cinematography, the way the scenes are framed and shot, the music, just everything. But the tone of the show is so melancholy and wistful, which should clash with the physical beauty, but doesn’t at all. The two tones compliment each other perfectly, the prettiness and the sadness, and somehow enhance each other in a really unique way. There are many dramas that are enjoyable to watch for many different reasons, but this one just makes you feel something special, no matter what’s actually happening on screen, and that’s just purely and simply brilliant directing. In fact, this show really thrives on highlighting the contrasts in life, particularly in the characters themselves. Do-kyung is quiet and sad, but he’s also caring and observant, and an excellent listener who speaks rarely, but when he does it’s amazingly insightful. Hae-young is insecure and vulnerable, but she’s so strong and outspoken and unafraid to say what she’s thinking, even if she thinks she may be ostracized for it. Even the secondary characters are a fun mix of contrasting features, like Soo-kyung, who can be mean but has a loyal heart and a protective streak a mile wide. Jin-sang may look like an idiot at first glance, but he’s an excellent friend and supportive to a fault. Even Mama Oh, for all her gruff tough love, cries for her daughter and would wrestle a raging bear to protect her. I love how all these variations never become confusing, but serve to magnify everything that’s admirable about these people. I’m starting to get really curious about Do-kyung’s visions. It’s interesting that they nearly always involve someone he’s close to, and often even just physically close to. They seem very random and unfocused, because there’s no real theme to them, they can be about anything. They aren’t necessarily important, though they can be — sometimes they’re about nothing, sometimes bring information, and sometimes they warn of a dangerous event about to happen. I do think that they were somehow triggered by Do-kyung’s acquaintance with Hae-young, because they started just before he met her, one of the first ones was about her, and they almost all involve her now. What is it about Hae-young that’s causing Do-kyung to have these premonitions? Did she somehow trigger them? And why are they nearly always about her? It’s so cute how Do-kyung, who so recently argued to get Hae-young kicked out of his house, is now going to such lengths so that she can stay. Letting her mother know abut the hidden door would have been a great way to get rid of Hae-young, yet he made sure she didn’t find out that the door went anywhere. I also love how aware he is of Hae-young and how he makes a point to do and say little things to bolster her, like telling her that she actually looks pretty when she eats, or how he played rain sounds when she said that sunny weather makes her sad lately. He’s definitely starting to have feelings for her, and I’m happy that he’s finally realizing it. I appreciate that the show didn’t make any attempt to paint “Pretty” Hae-young in a negative light before we met her, other than to state the facts, allowing us to form out own opinion of her now that we’ve finally met her. Our Hae-young never blamed her for the way she was treated in school — it was just an unfortunate coincidence about their names, and it wasn’t the other Hae-young’s fault she was treated like she was invisible. And Do-kyung hasn’t spoken badly about her either, we just know that she disappeared without notice on their wedding day, and that a picture of her standing next to a man showed up on social media (though I notice she doesn’t look very happy in that shot). So we know facts about her life, but nothing at all about the person she is, and we’re being allowed to get to know her on her own merits. So my first impression of “Pretty” Hae-young is this — I still don’t care for her. She seems shallow and unaware of others’ feelings, such as when she saw Soo-kyung and acted as if she didn’t break her brother’s heart. I don’t get any sense of malice from her, but she just feels… empty, is the word. She’s never had to be anything but pretty, and smart enough to get by, so that’s what she is, but that’s all she is. Our Hae-young may feel inferior to “Pretty” Hae-young, but nothing could be further from the truth. Pick a card, any card, for Oh Hae-young Again Eric meets Oh Hae-young and Oh Hae-young Again Jeon Hye-bin as the other Oh Hae-young in tvN’s mystery romance Eric, Seo Hyun-jin confirm mystery romance Oh Hae-young Again Seo Hyun-jin up to romance Eric in Oh Hae-young Again Tags: Episode 4, Eric, featured, Jeon Hye-bin, Oh Hae-young Again, Seo Hyun-jin 1 Angela I'm loving this drama so far. I don't know how I feel about the second Oh Hae Young yet. She's definitely using her looks to her advantage so she may be taking the mean girl route in the drama. I'm guessing she left DK because his mom bribed her or something to that effect since it was mentioned that his mom didn't like her. I don't think his mum has enough money to bribe her. =p But hopefully, there is a non-lame reason for the sudden calling off of the wedding. dramamama She didn't call off the wedding. She just didn't show up. Not a word. It has taken her a year to get back to Korea and contact DK again. What possible, rational reason could she have for doing that? Besides an accident with temporary amnesia that landed her in Europe I'm not sure what else. I also thought that when she approached Isadora (Soo-kyung) at work with a smile saying how happy she was to be working with her it was totally insensitive and clueless. Alessar As much as I'd like her to really be a mega-wench on this, it's so weird that I think there must have been some major misunderstanding. Like, someone was supposed to pass on a message about an emergency and they completely flaked. Hm, his mom is pretty flaky... maybe she's the actual culprit. I may be in the minority, but I actually really WANT to like No Hae-Young (lol, it seems like most are using this name for her). I love Jeon Hye-bin and I think she could do wonders with a popular character that is actually genuinely cool. But, the problem is that simply making her a nice character who didn't mean our heroine any harm isn't going to cut it. I would have liked to see her being more thoughtful towards the girl that was constantly put in her shadow. We still haven't been shown very much from her perspective though so I'm eager to see if that will change my feelings about her. Better than that, why doesn't Do Kyung's sister recognize the woman who left her little brother at the alter? So she abused the Ordinary Hae young just for her name but she doesn't even know what the Runaway Bride Hae young looks like? I guess it wouldn't be a Kdrama without a silly and huge plot hole that they'll cover up with some lame excuse. Oh well, you can't have it all I guess. She recognizes her brother's Oh Hae-young. She is just ignoring/treating her cooly right now. She lashed out at OHY1 because she shared the same name as OHY2 and also ended her wedding. It isn't that she actually thought OHY1 was OHY2. @ TJ - That's pretty derogatory. Yes, lots of kdramas aren't perfect. Actually, nothing is perfect. But I think saying that it wouldn't be a kdrama without a "a silly and huge plot hole that they'll cover up with some lame excuse" is unfair. I have seen many tightly plotted kdramas. I think that in every country bad dramas outweigh good dramas, but that is not why we keep watching ƪ(‾ε‾“)ʃ She does recognize her, but because of her status as a special company recruit Pretty Hae Young is spared open bullying. Our Hae Young is her direct subordinate and therefore an acceptable, easy target for verbal abuse. It seems she treats all her subordinates badly. Pretty Hae Young's company rank is equal or above Do Kyung's sister's. dramafan100 I almost feel we may be typecasting her too much. So far, there has not been any evidence that she is using her looks. She might be given advantages by society for her looks but that does not speak about her, rather speaks about the society no? Like it has not been shown yet that she ever behaved badly with main OHY. Clearly main OHY felt insecurity but it was not because of second OHY's behavior. Like what happened it that elevator right? It was the guys that discriminated - not the girl. So, I would not just blame the girl just because she is pretty. She might actually be a nice girl. And also, even if second OHY recognized that behavior - which I am sure she does - why should we expect her to be considerate or sympathetic to main OHY. That will make main OHY even more pathetic. So, I am kind of curious to find out if they are going to typecast OHY. Hopefully not. I want her to be a nice girl and that will create real conflict. zzmarie For me, this is what makes her more unlikable. She saw what the guys in the elevator did and realized what it meant. You can see it on her face in that one quick shot. She doesn't do anything about it, however. She just accepts it and moves on, like she has done her entire life. I will admit so far that she is not exactly painted as evil, but that doesn't necessarily make her a good person, either. atz I agree with you. Wait to see when she reaches older age. NO matter how pretty she is now, no boys would give that kind of services to her. Then what would she about that? yeah I dont blame other OHY for how our OHY is treated HOWEVER I do blame her for her just accepting it. I can forgive her teenage self, cuz she was a kid ok. and teens can be very self absorbed. but this is a grown woman now, in her 30's presumably, who is somehow acting so blithely to everyone as if she has no clue what is going on around her? like she saw what the elevator douches did. she should have either A) yelled at them B) jumped out of the elevator in protest/solidarity with our OHY or C) came to her privately later and apologized. Yes it wasnt OHY's fault that our OHY got thrown out like a sack of potatoes but how can she be ok with that? esp when it was done on her behalf? I dont hate other OHY. Rather I just feel so confused and unimpressed by her behavior. She seems nice but not /kind/ and thoughtful. Which doesnt mean she's the Devil but doesnt speak that well of her either. I hope we DO find out wtf is in that head of hers at some point tho. "She seems nice but not /kind/ and thoughtful." - Yeah, I was hoping they would make her a bit more...considerate? I know it isn't her job to come to Hae-young's rescue, but she knows that she has an influence and she could have easily used it to admonish people for using those nick-names growing up. I would feel really uncomfortable if people were blatantly comparing me to someone else, at that person's expense. Then again, we could be shone a different perspective of her later... I agree. Pretty OHY is opportunistic (mind that elevator event) and selfish -if selfish is defined as being ignorant towards other people's feelings (note when she says hi to DK's sister as if nothing happened, and note how many times she mentioned her name in front of the person who shares her name. Duh.). I dunno why she didnt show up at her wedding. Could it be because mom drugged her and sent her away to Paris unconscious with the money mom made by selling the house? Who knows. What we do know is that that girl didnt show up at her wedding, only to show up in social media, already in Paris. If she can post a picture, I know she should have been able to leave Fiancee Dearest a message -but she didn't. Not even afterwards. Now, what kind of behavior is that? @dramafan100 +1 Pretty much everything we've seen about her so far has been from OHY' or DK's perspective. I'll wait for her own thoughts to appear before making any conclusions about her character. Now I don't care where her character goes but I definitely don't like her teeth, this might be rude but I canot Just pass of it... I don't think she is evil. I don't think she intends to be mean. I'm getting the feeling that she is just clueless. It's like society has given her a free pass on everything she does, and she just takes it without thinking how her actions affect others. But now that she is back, she will quickly find out what chaos she caused when she left a year ago. @ sue Agree. She has everything and never faced rejection so perhaps she was just a happy go lucky girl. She does display a little bit of dejection at getting a cold greeting from SK. But no matter what, there's no excuse to leave a man at the altar with no explanation. So I think it's about time she learn to take responsibility for her decisions and actions. Overall I love the surreal pacing of the drama. And I love each character's quirks and strengths. windsun33 We still don't have a clue as to why she left though. May have been valid reasons for it. i agree- i don't think she's meant to be the usual bitchy, manipulative second lead. she's beautiful and oblivious, to some degree. like someone else said, it's hardly fair to blame her for describing oh hae young as being dull and colorless when she truly was very quiet during high school- largely due to her own influence, but she doesn't know that. the flashbacks of do-kyung and her together as a couple, and that brief bit where she strode past our hae young with that red umbrella made me understand why she's so attractive- she's so beautiful that even women stop to admire her, and she's got that glowy, magnetic charm to her that makes you feel special to be included, or in hae young's case, feel like you're wilting in her shadow. i've known someone like that, so i totally understood when hae young admitted that she was grateful that she was recognized by her. people like that are destructive, but they exist all the same and i'm interested in seeing how the show will develop her character. I agree with you that perhaps the "“Pretty” Hae-young" has some problems of her own, and it is far too early to typecast her as "living off of her looks". Not all women love being idolized for looks alone, she may have felt pushed into a corner because nobody could see that she also had a brain. What got me wondering was the last few seconds of the elevator pushout, where the "other" was the only one that tried to reach out for her. DramaDevourer 'Nobody seeing she had a brain' is definitely not No Hae Young's problem. Don't forget she was so hard to match and popular because she was a triple threat: beautiful, smart and rich. She went to Seoul U; no one was dismissing her intelligence. kyeong I am not sure what made her bail like that on her wedding but I have super crazy theory about the deja vu Dokyung has been having. WHAT IF: Dokyung is really having senile dementia like the chart that the doctor was previously doodling on the first time they met for consultation??? And the whole drama is actually him reliving his memories??? What he said this episode about feeling lonely and reminiscing and having a tragic end would make sense. Then the story would be sort of like The Notebook. I don't really like the pretty Hae Young so far there is nothing about her to like and we don't know enough about her to even develop any sort of attachment. I agree that her smiling and approach Dokyung sister at work was really low of her. The best friend is probably going to end up with the sister. I am guessing that much. But Dokyung mom is a piece of work. Really sucks for him. His whole family is really a family of oddballs. Similar to our Haeyoung except her family is infinitely warmer. I think what makes this show so incredibly relate-able for me is I totally get the comparison thingy. I think now with SNS, we compare ourselves more frequently to others, knowing how much better the lives of others seems (on the surface of course). Comparisons are so toxic and pointless since they set almost impossible standards on ourselves. As an outsider, I am rooting for the normal Oh Hae Young and I like her for her quirky character (which she seemed not to be aware of). In reality, I am living just like her: spending so much time comparing myself to others, feeling sorry for myself and forgetting to focus on my life presently. I find it so sad when her only recent happy moment is a douche (Dokyung) being nice to her. She is so much more than what she think of herself but she can't see that. WHAT WAS THE SONG AT THE END OF EPISODE FOUR? The one with the English lyrics? I've been searching for it for sooooo long and I can't seem to find it! Oh and I completely agree with everything you've said. I want to hurry up and watch how the show unravels but I don't want it to end. This show has overtaken my life hahaha :P Like a dream by Ben https://www.youtube.com/watch?v=mDf2SYMPWOI Enjoying this romantic comedy. That last scene was very nice. 3 Athirah i love this drama so far. I love how they're weaving bits of sound editing into the show. The music cues are making me crack up too, including the "heollll..." sound, ha! Soo-kyung is hilarious no matter what, but when she makes Do Kyung walk Hae Young home, she lingers in the background and at one point ROARS - the sound isn't overwhelming, but it's DEFINITELY her. And it's a sound we've heard before, I think off-screen but while she was drunk and in the vicinity. It's just so clever, establishing through sound exactly how insane she must seem to people like the village guardians. She's a ghost-looking woman who stinks of alcohol and roars in the distance! I really appreciate the effort they're putting into the sound layering, and it's mirrored by the effort that's been put into characterization. These weirdos really do feel like a family, even though individually there is absolutely no reason you would've connected them due to their totally different personalities. 4 Enz Just got back from a holiday and managed to catch up with all 4 episodes now. I can't believe I have a new drama to love so son after marriage contract. And loving it so much. Love the OHY and how she is played by Seo hyun jin. She is so expressive and really manages to capture the many varied moods and temperament of OHY. Love the way they tell the story as well. I feel captive in their world when watching and just can't wait for more. I feel like I've got happy juice in me watching it Thanks for the recaps lollypip. 5 ohyagain I don't dislike Soo Kyung (Isa Dora) but it was a really YIKES moment when she said to Do Kyung that she severely abused Oh Hae Young because of her name...like no matter how many other likeable oddball traits a character has, bullying someone is just not cool. I do think the show has it's flaws- like how some people are uncomfortable with dokyung/haeyoung because of how dokyung messed up taejin's business etc and soo kyung being a bully but overall I still can enjoy it despite some of my reservations. I think what triggered her was the cancellation of of our Oh Hae Young's wedding. It was too similar with the situation with her brother so she went psycho. But she'll come around. Sounds like she was punishing her before the (recent) cancellation of the wedding though too. the way she kept saying "you cancelled ur wedding" makes more sense now. and i do think that was the reason she became so vicious towards her. she might have been a bit cold before but like, it IS a common name. what's less common is the cancelled ur wedding at the last minute while also having that name. it was sstill unprofessional and shitty of her but at least i can see why she made those connections in her head (esp since she has no clue the real reasons behind it. cant wait to see her reaction when she finds out her brother is the REASON that girl had her wedding cancelled. gonna be a real laugh n a half lol) Right....She abused Ordinary Hae young because of her name and when Pretty Hae young comes along she does or says nothing. Why? Because in true Korean drama fashion she doesn't know her brother's girlfriend? The woman that left him at the alter? Huge and really stupid plot hole for me. I'm sure they'll have some ridiculous and lame excuse for why she can't recognize her own brother's former finance. It's not that she didn't recognize her (she was obviously frosty and unhappy at No HY's presence), but she does need to maintain some minimum standards of professionality in front of her bosses, esp. regarding the well-connected consultant they just head-hunted. I also think she's bidding her time. She's acting cold and disconnected right now, but I'm sure she's very angry and isn't going to let this go. YAI LOVER I think you missed DK's sister smirk when meeting No Hae Young at the office. Obviously there was a loathing smirk from her. 6 hawoojinruinedme This drama is gold, and Seo Hyun-jin is a blessing. 7 leleyleley Major squee for the last scene. The music is spot on. It's been a while since I feel this giddy watching drama, the last one was Marriage Not Dating. Eric and Seo Hyun Jin are winning in this. Now how can I survive the wait for next episode? fatraspberry Marriage Not Dating and this are directed by the same person :D No wonder it has same tone.... love the direction I love how he's using so many of the same instrumentals MnD. Not all of them thankfully (because I like a drama to have it's own special tracks too). Also, the script his mom threw on the table in frustration in episode 3! I'm pretty sure that was called Divorce Not Marriage so I was cracking up at that. Well that explains a lot. This show also reminds me a bit of Heart to Heart. It just feels more unfiltered and realistic, even though it's completely not realistic! Loved Marriage Not Dating. Love Han Groo. Adore Heo Jong min. No wonder they're using him again. He is adorable and oh so under utilized. miroufleur I know :D I watched the last scene many times. It's so beautiful how he decided to embrace her in his arms ❤ 8 Chandler That jump was the most glorious thing ever and his inner turmoil over whether or not to catch her just made it all that much more amazing when he did. I can't remember the last time I felt this giddy at episode 4. Just...ahhhh. The way they hold each other tighter instinctively. What am I supposed to do with myself until Monday... that beautiful hug at the end made the wait for Monday even more difficult ! Agree. Hae Young-Do Kyung's love story is so wonderful. Both deserve happiness. Hope they could get it soon. That jump was the most glorious thing ever.. Nice , much better than a wrist drag. Seo Hyun-jin , yay. I actually found myself tearing up at the ending during the part where Do Kyung was considering not catching her. I'm really surprised this kooky drama has managed to hit some of those deeper, more visceral emotional notes for me. I think I felt weepy because Our Hae Young has been dealt so many devastating blows recently, yet she's still brave enough to put herself out there and run toward the love that she wants. The thought of him turning away from her when she is expressing herself in such a raw and honest manner was unbearable, and when he dropped his equipment and caught her, my heart was so happy. It had me feeling weepy too. I happen to love when quirky, comedic dramas like this one manage to tap into those much deeper, human elements. Yeh Ji-won's Mixed-up Investigative Agency is another example of a drama like that (so happy to see her featured in a leading role again!). Hae-young suffered a setback in the office this episode with the other OHY coming back. But, where Do-kyung is concerned, she wears her heart on her sleeve and goes all out. It's almost as if her choice to run bravely towards him is her way of achieving catharsis from the self-doubt that's held her back all her life. I love it. It makes Do-kyung's dilemma all the more compelling: He knows he has no right to hold on to her or to become the person that makes her happy and yet he also can't bring himself to let her fall, not when she puts her trust in him so fully. That conflict just gets me. I am so invested in this story already. I'm already cringing when I think about how awful Our Hae-young is going to feel when she learns about: 1) Do-kyung's role in her break-up 2) No Hae-young & Do-kyung's relationship. PS - I want to thank you, because it was through clicking on your DB username that I found out about MyDramaList! This is the site I never even knew I needed! Kahmsahmnida, Chandler! ^_^ I know. It's like I'm in a constant state of dread/excitement with this one. Isn't it a wonderful site? I remember being so excited when I found it, "Finally! A site for people too lazy to blog!" I love that I have a place where I can keep track of all the dramas I've watched and rate them. I'm so happy I could help :) 9 ⭐ Sera The Ms Temper ⭐ Marathon this 4 episodes at once... and I really love this! Our Hae Young is pretty in and out. I love her interaction with her mom & her crazy-hair boss. They definitely have love hate relationship. Anyway, I wonder what will Jeon Hye Bin's character in this drama will be ( as a pretty OHY). I hope she is not just a bitchy type. Me too started at midnight finished by 5am.... I have important report to finish and now I have finished 3cups of coffee so I could stay awake ? 10 emily Again, I'm so ready to hate on Pretty Oh Hae Young. 11 nal I think he is given another chance to a happy life, that's why he sees those visions. It's more like if you don't move on you will regret these memories, and you will only remember them as a sad memory. He's living two lives at the same time, the one he lives it at the moment, and the future one. The future life comes to him as if he(the future him) remembers a memory he regrets. There is a sad tune with lingering feeling in those memories, like he should have discovered that she's the one who he loved the most yet at that moment he did not so that's why he remembers her with saddens. Or as a hint that he will not be with her if he didn't take the chance and so he opened his arms for her. "BUT there's something strange it's the first time he sees a memory yet it did not happened the same way he saw it but a different version of it with different place and circumstances" I also think that OHY2 is not a nasty girl, she's just oblivious to others pain since she's never experience them. She didn't face difficulties in her life nor did she has ever been rejected by someone. It was always easy for her, that's why she thinks everything will be Ok again with him and they can resume their relationships and she will be forgiven like always. I just hope our OHY will be happy, I don't want another repeat to what happened to her on her high school days. I want her to become strong and continue to love her self and I really really don't want her to depend on him as a solution to her problems. She will be devastated if she discovered the truth, she will think that he has been with her all this time because of what he did to her fiancee. out of pity. I love this drama, and I can't wait to watch what the fiancee will do when he comes out. They really did him wrong and they deserve punishment for that. What I love most in this drama is that all the characters are getting development even OHY manager is an interesting character. I love the family bonds and the friend that comes and goes of their house like he's one of them. Totally agree with you. What will happen when the fiancé comes out and the truth is out? That is the part I'm waiting for. Oh gosh, I love/hate that. It's like his brain is telling him "these are all the memories you'll have when she's gone." I love it too. Yes, I also dread it for what it may mean for the story. But I think we all know some separation is bound to happen with all the issues between them. I only wish that maybe the drama had held back on some of the other visions, like of Jin-sang and the doctor. Because I felt like those were thrown in to show what's happening to him, but they only serve to confuse me more when most of his important visions are of Hae-young. That said, I think I remember her being nearby when the visions first occurred with Jin-sang... It also seems like his visions are often influenced by sounds he hears and I like that touch, but, then again, that's not completely consistent. Luckily, visions of the future are one of those things I can easily accept as just being a fantastical happening. Even Do-kyung is still wondering why they're occurring so I don't think the show is just going to drop it. I definitely think his words about them feeling like sad, lonely memories mean something important. "BUT there’s something strange it’s the first time he sees a memory yet it did not happened the same way he saw it but a different version of it with different place and circumstances" - Okay. This had me wondering also. I even came up with a crazy idea, that I likely think won't actually happen, BUT hear me out anyway lol. What if...Do-kyung's 'visions' are memories from another timeline? Lol, maybe this is actually a time-travel drama in disguise where he will be given the chance to go back to that pivotal moment in the bar and rectify his mistake? And, by doing so, he'll be giving Hae-young a second chance with Tae-jin & giving up all the memories with her in this timeline etc. Then, perhaps, things won't actually go that differently in that timeline because Oh Hae-young and Han Tae-jin won't work out naturally. Perhaps most of the moments he sees are flashes of how their relationship would have happened without the burden of knowing the role he played in her heartbreak. This is, after all, a supernatural drama so anything could happen right? Lol, it's a stretch, but I kind of like the idea... All the visions he has of other people mess with this theory though :( Points for creative thinking :D :D Haha, thanks :) Dammit, autofill. It's finally happened. You've given away my full name... anabear my theory is that, in the future, Do-Kyung is in a near-death experience and that the entire series is based on how his life flashes back before his eyes. this probably explains the feeling of regret and sadness he feels when having such visions - that they almost feel like memories (something that already happened and not something about to exist). also, remember when he said that he feels his life will somehow end in tragedy? oh man, thinking about its possibility already gives me sad visions. 12 lolalarue I don't know if I'm just so biased towards our Oh Hae Young but I don't like No Hae Young. She seems really fake and superficial (and I realise that this is unfair because she hasn't actually really done anything to our Hae Young except be herself). She's used to being catered to, being complimented and being the centre of attention that even her remembering our Oh Hae Young seemed to be aimed at the audience (ie the other people in the office) to show how lovely, nice and magnanimous No Hae Young is. I've felt that Do Kyung and our Oh Hae Young have had some very steamy looks (good chemistry) between them even from the first 2 eps (when they thought they'd never see each other again) but am loving the new developments. I really love them together, I'm just a bit scared about what our Oh Hae Young will do once Do Kyung confesses his crimes. This is one of those occassions where I'm hoping she doesn't find out until long after they've fallen in love. I really hope that Oh Hae Young masters her urge to turtle herself in the presence of No Hae Young. Stand up for yourself, girl! Can't wait for next week. earthna lol No Hae Young DB should consider this instead of pretty oh hea young I think we should have Our Hae-young and No Hae-young! And yeah, I don't like calling No Hae-young "Pretty Oh Hae-young", for several reasons. First of all, I really really hate using someone's looks as their identifier. Second, I really hate comparing people based on their looks. And third of all, Our Hae-young is legitimately gorgeous, so I'm having a really hard time buying what this drama is trying to sell with regards to No Hae-young being soooooooooooooooooooooooo much prettier than Our Hae-young. kuromitsu Funny thing is, I buy that Our Hae Young is just plain Oh Hae Young. Seo Hyun Jin was that ability. In Let's Eat 2, she was supposed to be this chubby character when the actress herself is not, and she sold it pretty well. 13 dramafan100 I really want to talk about this drama. I am really liking it and I feel like talking. First of all, I like the main OHY actress. She is nailing the character and because of it, I love her so very much. I thought the drama will be simple enough where the hero tries to make up or something for making a mistake but having the second OHY come back as workplace boss was a bit much of a plot but still it adds that nice 'kdrama' to the mix. So, though I rolled my eyes at 'do you have to really do this?', I also was thinking 'please, this time, give it a positive & empowering tone'. I mean, we do not want her to go through her high school years do we? And how nice it could be if we find out that second OHY is actually a nice girl and perhaps had her own issues with main OHY? That will be such a fun thing to see. Also, I wish Eric Moon can emote better. I think the character is better written than his representation of it. He seems to have very limited expressions actually. So, I look forward to the day he feels one with the character.. I thought Eric did great job interpreted Park Do Kyung. His character supposed to be sad and gloomy without words. And I think he delivered it so well by his eyes and gestures. Do Kyung is my fav character. There is a sadness and loneliness in himself because the guy seems so introvert and like to spend his time by recording the sounds everywhere. It's totally opposite to Oh Hae Young which is full of spirit and bright. May be...I am left wanting quite a bit. I know he is sad, lonely, introvert etc but even when he sees future shots or remembers past moments, or he is just talking to her, I feel his expressions are a same all the time...Anyways, I am sure I will grow to like him. I liked him the moment he dropped his bags anyway... yoobitna I think Eric portrayal of Do Kyung is someone who is sad and always putting up poker face all the time, because he doesn't want people to figure out how he really feels. Like trying to hide his miserables feels. That's why he always had the same facade. But I guess he's opening up to Hae Young and he's gonna laugh more in the next episodeeeeeeee. Maybe we'll get a happy Do Kyung at the end of the drama. CANT WAIT TO SEE MY HAPPY DO KYUNGGGGGGG (SCREAMSSSS) but i don't want this to end.............. nop He did shouting all the time with his little brother and crews and act silly with his buddy Ji Sang lol..... So, i don't know exactly what you mean with the same expressions XD I like Eric as an actor. I follow him for several dramas. So, I know exactly how versatile this guy. if you still think he can't emote, try to see his previous work Que Sera Sera, Super Rookie or Discovery of Romance. So, you can sure that the way his presentation of Do Kyung already 100% based on the character itself. Totally agree with you!! Que Sera Sera..... Story is not for everyone but Eric is wonderful in it.... embarrassment after His mother left.... Awkwardness and guilt when hears all the story of hea young... I only saw him inexpressive after introducing park hoon... Who can blame him no one knows how to react in such situations... Hee! Another Andrea! Annyung! ^_^ It's funny, because this here Andrea has never been able to finish a drama with Eric Moon in it. I tried Que Sera, Sera and got bored/hated the main actress. I also tried Discovery of Romance and a) hated the main actress (I think it was the same actress as in QSS, actually) and b) hated Eric's character. This is the first Eric Moon drama that I haven't even thought about quitting. Here's hoping it stays this good! As a fan of Eric who has never thought of him as a perfect or flawless actor, I have to say I'm loving him more here than I ever have. He's playing such a different character, one that I think is actually pretty hard to portray without coming off as boring. But there is something subtly dynamic about his performance here. He conveys a quiet strength, while also giving the feeling that he's very world-weary. I think the vibe he gives off is actually what has be buying into Seo Hyun-jin's character gravitating towards him so quickly. He really feels like a listener by nature, not just quiet or introverted for the sake of it. I feel like Eric's performance has a lot to do with this so I'm personally very happy with him here. I didn't notice it until Haeyoung said it but everything about Dokyung makes him look unhappy and unsatisfied with his life. Eric is not perfect but so far, he looks and acts like a Dokyung so I'm all good. Right?? That was very perceptive of Hae Young Exactly what I'm thinking. He's one of the actor that can act without saying a word. I saw the same during Discovery of Romance. Totally disagree. Eric is the new thing I find in this drama. I love his eyes even when he talk nothing. We can see whether he's sad, lonely, desperate or happy. It's easy to show the actings through some moves or dialoques. But his actings are beyond words. Sometimes I think he's really flirty with Oh Hae Young (don't know it's Eric or Park Do Kyung) especially during he said she's pretty while eating:) When he smiles, my heart melts. Well, I don't think it's easy to act without sentences. And for me, Eric did very well even beyond my expectations (I always have some 'thing' in idol actor, but he proves me wrong. Like someone said, Eric has very expressive eyes. I'm sure after his sadness gone, we can see the real Park Do Kyung which is as crazy as his siblings lol. kirri Talking about idol actors, I just found out today that Kim Jisuk also debuted as an idol, although his group was short lived. That means 4 out of the 6 leads are of idol origin (except for Ye Jiwon and Lee Jaeyoon), although only Eric is still an idol. Should we start calling this drama an idol drama then? XD Really? I love all the actors in this drama. maybe they should promise if ratings hit 5% they would sing the OST all together. How fun it will be XD Seo Hyunjin mentioned in Eric's V-app before the drama's press conference that she'll be singing an OST, so at least there's that to look forward for! She was M.I.L.K's lead vocalist so she should be good, Jeon Hyebin asked her to sing a little part of it but she was so adorably shy about it XD Park Do Kyung is kinda new character in korean drama world. He's character more like beta male who usually we see as the second male lead. The calm, caring guy. It's so fresh to see something new like this and not typical snobby-bully-shouting-kinda male lead. Somehow, I think Eric did great job to play Park Do Kyung's character. He's like the very good listener for uri Hae Young, always helping and protecting her in silent but not hesitate to praise her which I think makes uri Hae Young think he's her 'happy thoughts'. He's so quiet compare to his crazy siblings. He likes to listen deeply and very introvert. And he's very passive. Even with pretty Oh Hae Young, the girl seems took the control over him. He's totally the opposite of uri Hae Young who is very extrovert and easy going. But there is a unique side of them. Hae Young seems strong outside but she's weak inside and Do Kyung is the place that she feels safe. On the other hand, Do Kyung seems weak outside but very strong inside. Both are hurting so deeply from the one that they loved the most. I sincerily hope that hae Young could open Do Kyung's heart and makes him smile again. This two opposite personality is interpreted nicely with Eric and Seo Hyun Jin. I love their romance is starting slow but sure. No rush. And when the time of the ex lovers come, their bond already strong for each other cause they got used to share one another. I like their past relationship. Both seems happy with their ex lovers. I think Do Kyung loves pretty Oh Hae Young is much more than Hae Young loves her ex fiance. So, not sure how the situations will be when pretty Oh Hae Young come out the next episodes. just a sudden thought, myb the writer decided his personality because he's a second child? because of his lil brother, he has to be sensible, and then there is his strong director sister who we never sees her ever talking to her mother. That's why I think he is kind of introvert and feels like everyone is his responsibilities. 14 Itenoria Wow, 'pretty' Oh Hae Young has a lot of nerve. First you dump him on his wedding day with an image of yourself in another country with another man and the annoying 'Wishing you happiness' phrase, then you start bugging him a year after, calling him and telling him you miss him. Then you start working at his sister's company (any one figure that she took that job only because she learnt that it was Soo Kyung's company and hoped that that would give her an in with Do Kyung?) and try to attach yourself by calling her 'unnie' and acting like everything is peachy. Then you run into our Oh Hae Young and act like you're the best of friends and 'you' were the one inconvenienced in high school because you shared the same name. Gah! I can't even... The world does not revolve around you 'pretty' Oh Hae Young. Get over yourself already. I am reserving judgement until we find out why she actually never showed up at the wedding. I am reserving judgement...somewhat. I may be ready to give her the benefit of the doubt to an extent, but I'll have a hard time accepting any reason she might have for the way she left him. Not even respecting him enough to break up with him in person or at all, only to end up in Paris with another guy while he is still searching hospitals for her in his tux? She will certainly have a hard time justifying that to me. And I say this as a someone who actually wants to like her. The kicker was the message accompanying that photo. 'From now on, ther will only be happy things'? Ouch. Thank you for telling me what that message said! It hasn't been translated in the recap or any of the episodes, even though the screen zooms into the words. Ugh, that makes it so much worse... Why doesn't "Unni" recognize her? Huge stupid kdrama plot hole for me that will undoubtedly be explained away with she was "abroad" or something the way they always do. Oh well. It's still Kdrama I guess. lolalarue She definitely does recognise No Hae Young. I think she's just biding her time to torture her. Oh, she definitely recognizes her. She actually gave No Hae-young the cut direct when No Hae-young called her "unnie". I was more than a little shocked that No Hae-young pulled out an "unnie", to be honest. 15 Kestrel 1. I love how petty and crazy Sister/Boss is. More French and Booze. Can't wait until she and OHY become besties. 2. "Pretty" OHY cannot truly be so oblivious to what she did in HS and now to "Just" OHY. That level of casual selfishness cannot be purely subconscious. 3. Why do younger bro/jailbait GF exist? 4. I cannot be the only one who actually wanted him to step aside and let her splat right? RIGHT? (I know, I'm evil.) 4. I almost expected that because he expected her to jump. I thought it would be fun too. But his choice was much more endearing. 1. I am loving the sister too. She definitely feels crazy. I am almost certain she wants her brother do something something with main OHY. 3. This has been my question since the beginning. 3. I hated Hoon in Marriage Not Dating, at least his prescence and similarity to his MND character are somewhat eclipsed by the Convenience Store GF (who I actually like). Convenience Store GF is such a nicer name than my Jailbait GF, but hey, they did actually check her DOB in the show! :P 3. Lol, I don't know what all of you are talking about. The end of this episode explained their existence to me perfectly ;) For real tho, I actually like his brother. I just think his romance feels out of place (until it became a useful influence at the end there). herkawaiidramas lol at # 3&4 3. This tbh! Like the only scenes I skip are An na's and the brother's. Sort of unnecessary and I don't really find their scenes amusing. 4. I was actually yelling at the screen telling him to run! Run as far away as he can! Heh. 3. The actress is/was an idol and they need some way to give her screentime? Idk, I find them irrelevant to the story but they're both good at comedy, so they're too amusing for me to be bothered by them, lol. I absolutely love Crazy French Drunk. I also absolutely love that she and Hae Young have entire conversations that have nothing to do with men or relationships. True, they're about work or alcohol or fighting or village guardians or generally abusive, but it's nice to have two women talking normally without some jealous man-grab thing happening. And the entire scene of the family gathered round trying to translate the Drunk French was priceless and fit everyone's personalities perfectly. They all seemed so HAPPY, and Hae Young would have fit in perfectly, probably doing a drunk flamenco dance to join in. I even like Anna, who is insane but stagily so and is giving the brother a run for his money. Awesome. 3. I think they exist to show us their uncensored way of "just being together because..." thing. They show that there's nothing holding them back when they are together. They enjoy being happy together w/out any thought of being hurt etc. Whereas both our mains are reserved because of their past. Its a contrast that I think gives the people around them food for thought w/out even knowing it. 16 meowingme Really wanted to jump into the wagon of this show, but dreading the angst when Hae Young finally found out the truth about Do Kyung, auh! Also, have hopes that the Pretty one has good reason to leave (like Polar Bear from Witch's Romance maybe? Totally stupid reason, but definitely not malicious), coz this show is too good to be messed up by a cliched second lead. Omg, now I remember Polar Bear ugh. That was indeed stupid. I love the show, but am constantly plagued by angst over Hae Young's ex's potential revenge plus Have Young finding out. Now because "Pretty" Hae Young is played so sickeningly nice I am worried about Polar Bear syndrome. AHHHHH!!!!!! meowingme ~ coz this show is too good to be messed up by a cliched second lead. I know. Crossing fingers, hoping the plot doesn't go with the 1st Love /Ex/2nd Lead Hell Bitch role for Pretty OHY. 17 earthna Eric can really do cheesy well. I died a million times. I agree about Pretty Haeyoung being empty. Well, it's still early since we've only seen her for a bit but so far, I don't like her. When she acted all chummy with Sookyung, I wanted to hack her. It's annoying how oblivious she is and she could have done something so that our Haeyoung wouldn't have suffered that much. From what we saw of their past, she seemed to even enjoy being the "superior" one between the two of them. And yeah, Dokyung's visions need to be explained. Otherwise, I'd just think of them as an excuse to fill the episode with replays. The ending was well played though. Thanks for the recaps! Gosh... Eric is the guy that can deliver cheesy lines without permission and that makes me swooonnnn.... I love when he tease uri Hae Young. And I can understand why Hae Young refers him as a HAPPY SPACE XD Remember his "Do you smell something burning? My heart is burning."? /dead cupkate Hahahaha I've only seen him in Discovery of Romance so this must be a different drama? It's from an old one called Phoenix/Firebird. Here's a clip: https://www.youtube.com/watch?v=-4ooa_PVXco He also parodied himself in SNL and it was hella funny. Yeap. It's from his first drama Phoenix (Bulsae) way back in 2004. It's so cheesy, he has never lived that line down XD They built a whole skit around it when Shinhwa hosted SNL Korea in May 2015. It was cheesily hilarious. Pwahahaha omg no Eric no. That was hilarious! But yeah..I'm slayed. Purva Huilgol Eric should have a dialogue in this drama telling Hoon to insert the sound of a heart burning, lol. seriously, if they include that dialogue, that'll be so epic... Pfffft omg please. I need this to happen. loveblossom🌸 Hahaha that cheesy line! xD Thanks for sharing the video. Dramaholic That remark followed him to Discovery of Romance. In a scene at at Jung Yumi's workshop, she and Eric were having a conversation when he suddenly interrupted her and said "do you smell something burning?" She had been making herself some ramen for lunch before he showed up and had forgotten about it. actually it was Jung Yumi asking him if he smells something burning, then Eric gave a deadpan face "are you kidding me?!" HAHAHAH it was soooo funny I wonder if Do Kyung's vision are related in some way to his father's death. He shut that conversation down pretty quickly - maybe there's more to it than him being an introvert. I don't think we have seen enough of Pretty HY to really make any judgements. 18 Lala haven't had this much anxiety waiting for Monday like this in a really really REALLY long time. Seo Hyunjin is so charismatic as our favorite Oh Hae Young, it is almost too perfect to be true. Eric, ô Eric, I've missed you so much! I don't want to jinx but last time I waited for Monday Tuesday was for CITT.... Which was also from Tvn... It was a disaster.. lolabeans This is what has me scared. I've enjoyed the first four episodes soooo much and I'm loving all of the characters (not even that bothered by Do Kyung's gold digging mother), but this could easily end in disaster again so I'm keeping my love in check. 19 onion I'm getting a sense of doom from Do Kyung's memories, from whatever happens between him and Oh Hae Young. A bit of grab onto something fleeting while he can( do I sense a Kdrama separation?) And let's not forget how "pretty" Oh Hae Young described main Oh Hae Young said to Do Kyung' about (Not very nice), but she could be just oblivious or a simply mean girl, I think the show's doing a good job of teasing the viewer with the possibilities. Ohh, about about that end hug, Oh Hae Young came down like a Kung Fu warrior. I wonder if she's going to fall in the next episode or maybe not? To be fair to Pretty Oh Hae Young, Our Hae Young does seem dull in the flashbacks. We know her as she is now, but back then insecurity made her a lot smaller and I don't think POHY can be blamed for seeing her in an unflattering light. At least not yet. I just hope Our Hae Young doesn't fall back into her past behavior now that POHY is back. I think (and I hope) that when she said that she too had problems having the same name, she was being honest. I sense that behind all the bubbliness there's also a resentment and I hope it will make her more likable. Here's a thought I had: We haven't been told much about Pretty Hae-young's life at all. She has it all when you look on the surface, but maybe she had her own things she was lacking growing up? She says in this episode that she thought of Hae-young's mom sometimes. Maybe she has issues with her mom and whenever Oh Hae-young's mom would call her name growing up, Pretty Hae-young would be envious of that? Pfft. And maybe this is the reason she didn't want to marry Eric? Because she wanted a better mother-in-law, lol. His mom is really the only reason I can think of for someone not to want to marry Eric... Oh, that would be nice, but I admit that I definitely didn't think she was being honest when she said it also caused problems for her. The pause and her expression made it seem like she tacked it on to her original sentence to maybe mollify Our Hae Young or something. I don't know. It was awkward though. It seemed like Pretty realized she was implying that Just Hae Young was the lacking one (through comparison) so quickly tacked herself on so it would be balanced. And her slightly-dorky overexcitement about seeing Just Hae Young again didn't feel manufactured. From what we've seen so far, Pretty doesn't seem actively mean, just self-centered and oblivious. She's had a charmed life where people just want to make things easier for her, and she might have no idea how much she's benefited from that. Though based on her phone call with Do Kyung and the entire "Unni" thing, she also may never have had to actually deal with fallout from her actions - with SK in particular she seems to think she's going to be able to brazen through this with a couple of "unni"s and being charming. And I do not think SK is going to roll with that (though it might take her a while to get her bearings, and also I'm now worried SK is a serious alcoholic who drinks soju like water). 20 gadis Gosh, this drama... Look at all those stolen glances and half-smiles. And that epic "You look pretty when you eat" comment with all the embarrassing reactions afterward. And how all those little and mundane memories with Do-kyung became the happy place Hae-young's mind unconsciously sought whenever she felt down. Ah, I fall in love completely with this show. Someone help meeee.. Sorry, but I keep seeing this popping up in recaps for this drama. The word "alter", as used in this recap, should be spelled "altar". 22 Purva Huilgol Thank you for the recap, Lollypip!! Amazing analysis over how the visual part of the drama plays an important role. Just like this is the 1st time i have paid particular attention to the sounds I hear in a drama and movie and how much they enhance the experience of watching it. I love, love, love this show!! The chemistry between Our Hae-young and Do-kyung is so awesome. I can just feel it in my gut that they are perfect for each other. I like Do-kyung's gruffness so much different from the bad boy types we see in kdramas. And Seo Hyun-jin as Our Hae-young is a delight to watch. Love all the side characters too- so far, nobody has been completely negative in their character I still need to know about the Other Hae-young and I agree with everybody here that she does seems completely oblivious. However, she can't have been so successful in her career if she hadn't realized that her looks were to her advantage. She doesn't seem to be the type to be intentionally hurtful, though that might change when Do-kyung is concerned. That being said, I didn't like the way she said to Our Hae-young that she suffered a lot in high school because of their names. I thought I was the only one! I've been so sensitive to sounds since watching this drama. And here I am thinking that they can capture all sounds while filming. me too,.. now, whenever i watch a movie/tv series, i start to analyze the sound... Not alone I picked pleanty of sound faults from entertainer after watching this... Unintentionally I focus more on sounds its weird... That's bad,,.. You know why?? because it means after Oh Hae Young ended, there are so many sound directors graduated from dramaland hahahah Also, was I the only one who thought that the premonition which Do-kyung had of Our Hae-young jumping into his arms was different than what actually happened? In episode 3, they showed us that Do-kyung noticed in detail what was about to happen by noticing her pink dress and heart-shaped jewellery. However, this time- in his vision, she was climbing down the stairs in their house and then jumping into his arms. What actually happened was that she ran to him on the street and even her clothes were different from the vision. I don't know if it was just a mistake by the team or if that has some significance. It was a different scene in his premonition. I guess it will be significant later. Aah, thank you! I thought I was seeing too much into these things. Yup. And I've been racking my brain, trying to figure it out.	cc/2020-05/en_middle_0093.json.gz/line537
__label__cc	0.5923	0.4077	Weather Stations Near DW0553 Call distance direction age temp speed gust direction rain* rain 24h rain midnight humidity barometer DW0553 0.0 00:00:03:02 60 0 1 179 0 0 0 62 1017.8 EW1565 2.8 W 00:00:08:41 60 2 7 117 0 0 0 82 1018.7 EW4246 3.4 NE 00:00:09:33 60 0 1 55 0 0 0 58 1017.4 EW2249 4.0 SE 00:00:04:24 57 0 1 0 0 0 80 EW7328 4.1 NW 00:00:00:55 60 0 4 186 0 0.01 0.01 80 1017.8 ORA422 4.7 NW 00:00:17:57 60 0 5 213 0 0 0 77 1018.2 EW3141 4.7 SW 00:00:07:34 59 5 9 112 0 0 0 71 1018.0 DW3439 5.0 NE 00:00:02:37 61 1 6 184 0 0 0 54 1018.6 KB6FW 5.2 SW 00:00:09:32 60 2 8 103 0 0 0 90 1017.6 FW0058 5.3 NW 00:00:08:52 60 0 6 184 0 0 0 76 1018.2 EW3225 6.1 SE 00:00:09:05 58 0 4 265 0 0 0 68 1018.1 FW0107 7.7 SE 00:00:04:36 60 1 3 143 0 0 0 89 1018.5 AJ6B 8.5 SE 00:00:01:58 59 0 2 246 0 0 0 64 CW1521 8.5 W 00:00:09:10 58 0 0 211 0 0 0 88 1011.2 N6NJ 8.8 NW 00:00:01:16 60 0 6 196 0 0 0 78 1015.4 DW9182 8.8 SE 00:00:05:07 0 0 0 0 0 0 0 1 1016.6 dw7047 8.9 SE 00:00:08:31 58 0 3 295 0 0 0 73 1019.1 CW5283 10.5 E 00:00:06:34 60 2 2 234 0 0 0 48 1015.0 rain*: This column is either rain in last hour or cumulative rainfall. Greyed out stations have not reported their conditions in the last hour. Click on the callsign to see station's weather history.	cc/2020-05/en_middle_0093.json.gz/line541
__label__cc	0.749136	0.250864	The State of Goaltending in Canada We're on the eve of destruction. No, some radical church hasn't pronounced tomorrow the day of the rapture. Tomorrow is the start of NHL free agency, usually a time when general mangers forget their plans for spending money wisely and istead go money drunk. Because the salary cap took a huge jump and this year's crop of free agents is terribly weak (think, Ville Leino might be the second best UFA forward if we don't count Teemu Selanne), some teams are going to drop huge cash on 10 goal scorers. What's most frightening is that the Rangers have over $20 million in cap space. Glen Sather shall pronounce "$7 million contracts for all!" To keep you occupied until tomorrow at noon, you can read my latest post over at The Good Point. This week's article focuses on the state of goaltending in Canada. It's a dark time for Canadian goaltenders. Carey Price might just be the best Canadian goaltender and he was being routinely booed last season. That's not reassuring. Written by Unknown at 10:26 AM 0 comments Links to this post Tags: Canada, Carey Price, goalies, goaltending, Martin Brodeur, Roberto Luongo, The Good Point The Darryl Sutter Era Lives The 2011 NHL Entry Draft weekend was totally overshadowed by two mega-deals pulled off by the Philadelphia Flyers. Out are Mike Richards and Jeff Carter – two players who both thought they would stay in Philadelphia for their entire careers; in are a handful of highly touted prospects. The deals allowed the Flyers to finally acquire a legitimate goalie, one who is a Vezina Trophy finalist. Other deals rose more than a few eyebrows: Brian Campbell, once thought definitively untradeable, found himself dumped in Florida for a former prospect turned big league bust; and Calgary jettisoned both Robyn Regehr and Ales Kotalik for a couple of spare parts in Buffalo. The Brian Campbell deal is easy to understand: the Florida Panthers needed to reach the cap floor and still have about $20 million to go, even with Campbell’s $7 million cap hit. They could hypothetically offer Brad Richards a max contract and require further money wasting. Alternatively, the Robyn Regehr deal represents everything wrong in Calgary. Written by Unknown at 11:01 PM 0 comments Links to this post Tags: Alex Tanguay, Buffalo Sabres, Calgary Flames, Darryl Sutter, Jay Feaster, JFJ is alive and well, Robyn Regehr Brad Richards: Saviour or False Prophet The pursuit of a number one centre will be Brian Burke’s top priority this summer. Of course you already know this because Brian Burke isn’t shy with his opinions and the Toronto media loves to run wild with any piece of informational nugget that Burke throws them. There are a few options for the Leafs, each with their own positives and negatives. Written by Unknown at 2:45 PM 3 comments Links to this post Tags: 2011 UFAs, Brad Richards, Brian Burke, hypothetical trade, Jeff Carter, number 1 centre, Paul Stastny, Stephen Weiss, Toronto Maple Leafs, UFA madness The NHL's Top UFAs and RFAs With the conclusion of the Stanley Cup Final, it means that it's back to rumour and speculation season. I know I shouldn't like to hear all the outlandish rumours that get thrown around, but there's something very satisfying about hearing them. This week's aritcle at The Good Point checks out the top UFAs and RFAs that will be in line for a new contract this summer and where they could possibly land. Tags: 2011 UFAs, Brad Richards, Detroit Red Wings, RFAs, Shea Weber, The Good Point, Zach Parise Breaking Down the Bruins' Cup Win The Bruins dug themselves an early hole against the Canucks after dropping two heart-breaking games in Vancouver. I thought it was over, as did many. However, the Bruins stormed back and eventually won in seven games. How did this happen? How did the Bruins complete the comeback after losing the first two games against the President’s Trophy winners? What went right for the Bruins and, maybe more importantly, what went wrong for the Canucks? Written by Unknown at 9:00 AM 0 comments Links to this post Tags: 2011 Stanley Cup champions, 2011 Stanley Cup Final, Boston Bruins, Vancouver Canucks 2011 5MFF Playoff Awards On Wednesday night the world saw an ugly side of Vancouver. After losing to the Bruins, a couple hundred people, who the police are now describing as organized anarchists masquerading as Canuck fans, started rioting in the streets of downtown Vancouver. It wasn’t a very good representation of Vancouver, which is a beautiful city. The next day the citizens of Vancouver took to the streets to help the clean-up effort. Those are the real people of Vancouver. Amidst all the mayhem, there was a celebration occurring in the Bruins’ locker room after their impressive series clinching victory. The shots of Kaberle dousing his teammates in champagne made my heart feel good. The cars on fire outside? Not so much. Not many people (myself included) gave the Bruins a shot after they fell 2-0 to the Canucks, but they rallied back like they did all post-season and became the only team in Stanley Cup history to win three game 7s. Well, that’s the season. It was fun. I hope you enjoyed it. I guess we’ll all be on our merry way… But wait, there’s the important matter of handing out some hardware for the deserving few who excelled (and a few that didn’t) during the playoffs. Without further ado, here’s the second annual Five Minutes For Fighting Playoff Awards. Tags: 2011 playoffs, awards, Boston Bruins, Joe Thornton, MVP, playoff awards, Ryan Kesler, Tim Thomas, Vancouver Canucks Congratulations, Old Friend Tags: 2011 Stanley Cup champions, 2011 Stanley Cup Final, Boston Bruins, Tomas Kaberle Champions' Plight: Repeating in the Stanley Cup Finals I have a new article posted at The Good Point that you should all check out. Today I'm discussing how difficult it is to repeat as Stanley Cup champions, especially in the cap era. Specifically, I'm looking at how likely it will be that for either Boston or Vancouver to make it back to the Stanley Cup Final next season. Here is the link to the article. It should kill some time during the day while you wait patiently for tonight's (hopefully) exciting game 7. There isn't anything better in all of sports than a game 7 in the Stanley Cup Final. I can't wait. Tags: 2011 Stanley Cup Final, Boston Bruins, repeating, The Good Point, Vancouver Canucks The Other Centre The Leafs’ desperate need for a true number one centre isn’t a secret. Tyler Bozak was incapable of handling such a role, which isn’t surprising considering he was entering his first full season as an NHLer. Only in Toronto would the media ask whether Tyler Bozak was a true number one centre. Of course he wasn’t! He was the Leafs' only option in what was still a re-building season. With Brad Richards all but gone from Dallas, there is a true number one centre with star quality available come July 1st. The Leafs have ample cap space and Brian Burke is known to covet star players. Richards seems like a perfect fit in Toronto, but the Leafs won’t be the only team vying for the former Conn Smythe winner’s services. Both the New York Rangers and LA Kings have plenty of cap space and a need for a number one centre as well. Look for the price tag to sky-rocket if these three teams start trying to out-bid each other. If the Leafs do indeed sign Brad Richards, Tyler Bozak will receive third line duties. His ugly -29 rating doesn’t really scream third line centre and his advanced metrics (from Behind the Net) don’t really disprove that notion. Bozak did score 27 points in 37 games during his rookie season before struggling for long stretches this past season, so there is hope that he can rebound with a strong 2011. However, Bozak is already 25-years-old and maybe his offensive game won’t develop much further. Is he going to fall into the dreaded void in between the second and third line where he’s not offensive enough to play in the top-six, but not defensive enough to play in the bottom-six? If the Leafs decide they aren’t prepared to experiment with Bozak on the third line there is another centreman available that could fill in nicely. Tags: 2011 UFAs, Brooks Laich, summer, Toronto Maple Leafs, two-way player, Washington Capitals The Worst Moves of the Glen Sather Era Remember, if you want to keep up with Five Minutes for Fighting you can do so on both Twitter and Facebook. Yesterday’s report that the Rangers intend to buy out the final year of Chris Drury’s contract signals the end of yet another Glen Sather mistake – something that is becoming a regular occurrence in New York. For the past decade, Glen Sather has essentially dug a hole in the ground and thrown millions and millions of dollars into it. If there was an aging superstar entering free agency you could be sure that Sather was the most persistent suitor for their service. Even if there wasn't a superstar available, Sather would pay someone as if they were a superstar. Now the hot rumour is that the Rangers are going to fall over themselves trying to sign Brad Richards to a lucrative contract. It almost seems unfair that a team can give someone a $7 million contract seemingly every season and wiggle out of these commitments when it becomes apparent they made a terrible mistake. (Note: my faux-outrage really stems from my yearning for the Leafs to sign Brad Richards). What’s confusing is that aside from spending money, Glen Sather is an adept GM. Sather has shown an ability to acquire superstars for close to nothing. He brought in Pavel Bure for two prospects and three draft picks that accumulated a mere 33 games in the NHL; Eric Lindros for Kim Johnsson and spare parts; and Jaromir Jagr for Anson Carter. Injuries curtailed Bure's time in New York, but he scored 50 points in 51 games. Lindros suffered a similar fate, but still gave the Rangers a 70+ point season and a 50+ point one. Jagr was the true steal, scoring 123 points his first season (the 3rd best total of his career), 96 in his second, and 71 in his third. In total, Sather brought in close to 500 points for a bag of rocks. Sather has also finally started building a solid young core of players that includes Brandon Dubinsky, Ryan Callahan, Marc Staal, Derek Stepan, and others. Plus, he seems to find takers for some pretty unattractive contracts (which we’ll discuss in more detail later). This is also a man inducted into the Hockey Hall of Fame. He’s clearly great when given all-world talent to work with. He won four Stanley Cups with the Oilers in the 1980s and played a major role in building team Canada for the 1984 Canada Cup, 1994 World Hockey Championship, and the 1996 World Cup of Hockey. However, his Hall of Fame induction was in 1997, three years before he became this free spending maniac GM. Enough with the pleasantries; you’re reading this for a juicy trash session. Here are the (current) worst moves of the Glen Sather Era. Remember, as long as Sather has money to spend as the Rangers’ GM, this list is a work in progress. Tags: bad contracts, Glen Sather, GMs stupidity, New York Rangers, stupid, UFA madness The Stanley Cup's Alternate Ending I love history. I love thinking that one little thing could have dramatically changed everything that followed it. Maybe that's one of the reasons I love the concept of time travel as well. And because we're talking about time travel we may as well talk about the greatest time travel movie of all-time - Back to the Future. Where is all this going? Really I just wanted to put a picture of Back to the Future up, so the preamble really only serves that purpose. But my latest post at The Good Point was published today and I examined what a Stanley Cup Final between the Sharks and the Lightning would have looked like. Alternate history. Dig it. Tags: Alternate History, San Jose Sharks, Tampa Bay Lightning, The Good Point 2011 Wendel Clark All-Stars The playoffs are drawing to an exciting conclusion and that means not only will a Stanley Cup winner be crowned, but that there are beards growing out of control on players' faces. One may be more important than the other. Regardless, the beauty of the beard needs appreciation. That means it's time for the second annual Wendel Clark All-Stars! The best beards of the playoffs are extensively scouted and each position is awarded a beard All-Star. The rules are simple: No player could have started growing a beard before the playoffs began. That means players like Shea Weber and Ryan Malone are disqualified. It's tough, but if you have a beard before the playoffs you're cheating. It's not a playoff beard in January; it's just a beard. If you grew a moustache before the playoffs began I'll make an exemption. Regular season moustaches: In; regular season beards: Out. This is serious business. Before I get to the all-beard team, let's break down some awards first. Think of these like the Grammy awards they give out before the taped broadcast. Tags: beards, best beards, best playoff beards, playoff beards, The Wendel Clark All-Stars 2011 NHL Playoffs: Stanley Cup Final Breakdown Following an almost unbearable break after the Conference Finals, the Stanley Cup will finally begin tonight. I hope at this point you trust my predictions. I nailed both Conference Finals, which matches my performance last season. I'm 11-3 on the season and 22-7 over the past two. However, I refuse to accept responsibility if you lose your kid’s college fund gambling. Tags: 2011 playoffs, 2011 Stanley Cup Final, Boston Bruins, breakdown, Stanley Cup, Vancouver Canucks Champions' Plight: Repeating in the Stanley Cup Fi...	cc/2020-05/en_middle_0093.json.gz/line543
__label__cc	0.739709	0.260291	About Fortuna Media » Press Releases » Fortuna Entertainment Group accepted bets of EUR 797.0 million up 163.7% in the first quarter of 2018 Fortuna Entertainment Group accepted bets of EUR 797.0 million up 163.7% in the first quarter of 2018 Fortuna Entertainment Group N.V., the leading Central Eastern European regulated fixed-odds betting and gaming operator, has announced its unaudited consolidated results for the first quarter of 2018. · Total Amounts Staked in Q1 2018 increased by 163.7% to EUR 797.0 million · Total Gross Win in Q1 2018 increased by 157.6% to EUR 110.0 million · Total EBITDA in Q1 2018 amounted to EUR 22.7 million up 665.5% yoy · Net profit in Q1 2018 increased by 923.6% to EUR 14.0 million „The strong reported financial results for the first quarter of 2018 reflect our growth strategy with investments into operational excellence, new platforms and regional expansion. Thanks to that, we recorded a substantial growth in all reported key indicators, this driven both by strong organic growth as well as M&A. Our Amounts Staked increased by 163.7% yoy to EUR 797.0 million, Gross Win amounted to EUR 110.0 million and EBITDA reached EUR 22.7 million a yoy increase of 157.6% and 665.5% respectively. If we adjust for one-off costs related to Integration, the EBITDA increased 723.9% yoy. We also would like to confirm our guidance for the rest of 2018.” said Per Widerström, CEO and Chairman of the Management Board of Fortuna Entertainment Group. FEG, the leading Central Eastern European regulated fixed-odds sports betting and gaming operator present in the markets of Poland, the Czech Republic, Slovakia, Romania and Croatia recorded in Q1 2018 total Amounts Staked figure of EUR 797.0 million, 163.7%more than in Q1 2017. This increase was driven primarily by organic growth in online, particularly in fixed-odds betting in all original countries, and by online gaming in the Czech Republic. The year-on-year growth was also driven by the new acquisitions of Hattrick Sports Group (“Hattrick”) and Fortbet Romanian entities (“Fortuna Romania”) which were acquired after the first quarter of 2017. In Q1 2018, total Gross Win reached EUR 110.0 million, an increase of 157.6% compared with Q1 2017. The Gross Win increase was driven by Amounts Staked growth as well as by the continuous strong performance of underlying key indicators. Total consolidated EBITDA recorded in Q1 2018 was EUR 22.7 million, up 665.5% yoy, resulting from higher betting volumes, online gaming addition and consolidation of Hattrick Sports Group and Fortuna Romania. Total EBITDA in the first quarter of 2018, if adjusted by one-offs related to integration, was EUR 22.8 million, up 723.9% yoy. Total Net profit of the Company for the first quarter of 2018 amounted to EUR 14.0 million, an increase of 923.6% yoy, driven primarily by higher EBITDA. Total Net profit of the Company in the first quarter of 2018, if adjusted by one-offs related to M&A and integration costs, was EUR 14.2 million, up 1,113.4% yoy. Petr Šrain PR manager, Spokesperson E-mail: srain.petr@ifortuna.cz These contacts are primarily for journalists. Therefore, unfortunately, we can not guarantee that we will be able to react to non-media enquiries within the desired deadline. If you are a Fortuna customer, you can also send your question to helpdesk@ifortuna.cz or connect with us some other way. Thank you for your understanding. Fortuna Entertainment Group Site map	cc/2020-05/en_middle_0093.json.gz/line546
__label__wiki	0.7613	0.7613	macrohistory.com (AFRICAN EMPIRES, SLAVERY and EUROPEANS – continued) home \| 16-17th centuries index AFRICAN EMPIRES, SLAVERY and EUROPEANS (4 of 7) The Kingdoms of Oyo, Dahomey and Asante From the 1640s, four inland states near the Gulf of Guinea were growing in wealth and power from the slave trade. The kingdom of Oyo, around 300 kilometers (190 miles) inland, was the most successful of these kingdoms. It benefited from terrain sufficiently unforested and free of the tsetse fly and other disease-carrying insects to allow for the breeding of horses. The Oyo kingdom used cavalry effectively in expanding southward where savanna split coastal forest. Oyo forced the coastal kingdom of Allada to pay it tribute, and it gained direct access to trade with Europeans. Oyo was a slave state, and its king used slave labor on his vast farmlands. In wars, Oyo took more slaves than it needed for the royal farms, and it traded them to the Europeans for guns, cloth, metal goods and cowry shells. It traded also with Africans to its north for horses and for more captives for the slave trade. And the kingdom acquired wealth by taxing trade that crossed its territory to and from Hausaland. Another power in the region was the kingdom of Abomey, which was founded in the early 1600s by the brother of the king of Allada, a coastal kingdom that had grown wealthy from the slave trade. The brother, Do-Aklin, cut off village chiefs from having any say in selecting his successor. Rule in Abomey passed to his grandson, Wegbaja, who consolidated his power – while both Allada and Abomey were paying tribute to the more powerful kingdom of Oyo. In Abomey, human sacrifices were used to honor the king's ancestors – the sacrifices usually captives from warfare. West of Abomey were the Ashanti (Asanti), who were dominated by the Denkera to their southwest, to whom the Ashanti paid tribute. The primary political unit among the Ashanti had been the village, governed by clan elders. In the 1660s, an Ashanti warrior named Osei Tutu grouped clan chiefs around him and formed an alliance with the leading Ashanti religious figure, Anokye. They created a golden stool, representing power and spiritual unity, on which the ruler of the Ashanti was to sit, and they sanctified the golden stool with sacrifices. Osei Tutu and Anokye extended their power across Ashanti chiefdoms, unifying the Ashanti. And with the power that accrued from this unity, the Ashanti defeated the Denkera and absorbed some of their subject states. These victories gave the Ashanti contact with the Europeans, to whom they sold slaves. And the Ashanti began an expansion inland for more slaves and for gold. Meanwhile, Oyo cavalry invaded the Abomey four times, but Abomey retained enough power to expand against Allada on the coast. The king of Abomey, Agaja, was interested in buying arms from the Europeans. Conquering Allada in the 1720s gave him access to European trading. The enlarged rule of Agaja became known as Dahomey, and it began to prosper from the sale of slaves to the Europeans. previous \| next (5 of 7) to the top \| home \| 16-17th centuries index	cc/2020-05/en_middle_0093.json.gz/line547
__label__wiki	0.869567	0.869567	home \| timeline index \| timeline 1944 \| timeline 1946 Jan 5 In the liberated city of Lublin, Polish Communists have created a provisional government. The Soviet Union announces recognition of that government. Stalin is hostile to the London Poles and wants a friendly government in Poland. Churchill cables Stalin and complains. Jan 11 The Soviet Army enters Warsaw. Jan 12 The Soviet Army resumes its offensive – 180 divisions against 75 German divisions. Hitler has 28 other divisions defending his front in Hungary. Hitler orders sixteen divisions in the West to the East. Jan 12 In a conversation at a private party a 27-year-old nurse, Gertrude Seele, expressed dislike for Hitler's regime. Someone reported her, and it was been learned that she had helped some Jews. She was imprisoned, and, on this day, she is executed. Jan 18 With the Red Army approaching, a German order is given to evacuate slave laborers and inmates in the Auschwitz area to points farther west. Marching on foot in freezing weather, anyone who does not keep up is shot. Jan 20 Soviet troops are pushing into East Prussia. More than 2 million Germans from East Prussia are fleeing westward. Jan 26 Soviet troops enter Auschwitz. Jan 30 In a raid behind Japanese lines on the Island of Luzon, 100 US soldiers and more than 400 Filipino guerrillas rescue 531 American prisoners of war. One US soldier and 26 guerrillas die. Feb 2 Ecuador announces that it is at war with Japan. Feb 3 The US Army is converging on Manila from three directions and has pushed into the northern outskirts of the city. The battle for Manila begins. Feb 3-11 Stalin, Churchill and Roosevelt meet at Yalta and firm up agreements, including a coalition government for Poland. Stalin speaks of continuing good relations but warns that after the war will come a difficult time when they will be divided by "diverse interests." Feb 7 Paraguay declares war on Germany and Japan. Feb 12 Peru announces it is at war with Germany and Japan. Feb 13 The Soviet army drives German forces from Budapest. Feb 13 British bombers make two raids against railway yards at Dresden. A firestorm results that burns eleven squared miles of the city. The city has been filled with people fleeing from the advancing Soviet forces. Feb 14 Chile, Ecuador, Paraguay and Peru join the United Nations. Feb 15 Dresden is still burning. The US Airforce joins in bombing the city, believing that more havoc will be created by hitting the city when firefighting equipment is in the streets. Dresden is to burn for five more days. The identifiable dead number 39,773. The unidentifiable are 20,000 or more. Feb 15 Venezuela and Uruguay declare war on Germany and Japan. Feb 17 In Manila, Japanese troops are holding 5,000 Filipinos hostage. Japanese troops release their frustration and anger against civilians. A young Japanese soldier writes in his diary of the killing of "several thousand ... young and old, men and women." Feb 19 Two divisions of U.S Marines land at Iwo Jima, a small island with an airfield closer to Japan than Tinian Island. Feb 23 On Iwo Jima's Mount Suribachi, Marines and a Navy Corpsman raise the US flag. Feb 24 The Prime Minister of Egypt, Ahmed Pasha, announces that Egypt has declared war on Germany and Japan. Later on this day he is assassinated. Feb 26 Egypt's parliament approves the declarations of war. Feb A Russian artillery officer at the front in eastern Germany, Captain Alexander Solzhenitsyn, has been arrested for a deprecatory remark about Stalin in a letter to a friend. Mar 1 Iran and Saudi Arabia declare war on Japan. Mar 3 The battle for Manila ends. There, approximately 100,000 Filipinos have died. The US Army has lost 1,010 dead, the Japanese about 16,000. Mar 3 Finland declares war on Germany retroactive to Sept 15, 1944. Mar 6 King Michael of Romania gives power to a coalition government dominated by the National Democratic Front and Romanian Communists. Mar 7 Romania declares war on Japan. Mar 8 In Yugoslavia, Josip Tito creates a federal republic. He is premier. Mar 9 The dropping of tons of incendiary bombs on Tokyo begins. A firestorm consumes oxygen and suffocates thousands. Liquid glass rolls down streets. As many 120,000 die. Perhaps as many as 200,000. Mar 16 The last of the Japanese resistance on Iwo Jima ends. Of the 22,000 Japanese fighting men on the Island only 1,083 survive. The US Marines have lost 6,891. Mar 23 US, British and Canadian forces have crossed the Rhine River. Mar 28 Churchill sends a memorandum to Air Marshall Arthur Harris saying that "It seems to me that the moment has come when the question of bombing of German cities simply for the sake of increasing the terror, though under other pretexts, should be reviewed." Apr 1 The US Army and Navy land 50,000 troops on an eight-mile beachhead at Okinawa – a part of Japanese homeland – against about 100,000 Japanese troops. Apr 4 A provisional government for Czechoslovakia is established in the eastern Slovak town of Kosice, cleared of Germans by the Soviet Army. Eduard Benes, a liberal, is the provisional government's president. A leader of the Czech Social Democrats is prime minister. Communists dominate the Ministry of Interior Affairs. Apr 5 The Soviet Union ends its neutrality pact with Japan. Apr 11 Hitler's Gestapo telephones the Buchenwald concentration camp and says that it is coming to blow up the camp and its inmates. Camp administrators have already fled. An inmate answers the phone and, pretending to be an administrator, says not to bother, that it has already been done. The Gestapo does not arrive. A few hours later the US 3rd Army arrives. Apr 11 Chile declares war on Japan. Apr 12 President Roosevelt dies of a cerebral hemorage. Apr 13 The Soviet army takes Vienna. Apr 15 British troops liberate Bergen-Belsen concentration camp. They are shocked by what they find. Apr 15 Since early February the Allies have bombed Berlin eighty-three times. Berliners are living without water and electricity and with little food. The bombs are accomplishing little strategically but making rubble bounce, killing more civilians and killing Allied airmen. In Berlin people joke about Hitler having promised that under his administration they would eventually not recognize their city. Apr 25 US and Soviet troops meet at the Elbe River. Apr 28 Benito Mussolini has been fleeing northward toward Germany and is caught by Italian partisans. Mussolini is reported to have said he is sorry just before he is shot. At an Esso gas station In Milan, the bodies of Mussolini, his mistress and some other leading fascists are hung by their heels, on display as executed criminals. Apr 30 Hitler has written his will and testament. He names the head of his armed forces, Admiral Donitz, chief of state and apologizes for nothing. All failure he sees as the work of others. He commits suicide. May 1 Joseph Goebbel's commits suicide, taking with him his wife Magda, six children and dogs. May 2 In Berlin, soldiers place the Soviet flag over the parliament building. The Soviet Union announces the fall of Berlin. May 8 Germany surrenders unconditionally to the Allied forces. The Soviet army enters Prague. May 9 In Prague the usual civility of the Czech people has broken down. A public announcement calls for "Death to Germans." A week of revenge begins. A former mistress to a German officer is murdered in the street. German-speaking civilians, male and female, are brutalized and some others killed. Taking advantage of the rampage, some engage in rape and thievery. May 23 In western Germany, Heinrich Himmler has been found by the British. While in custody he commits suicide with a hidden vial of cyanide. May 29 In Damascus, French troops have fired upon people demonstrating against their presence, and this creates more anger and demonstrations. Jun 4 Amid famine in northern Vietnam, Ho Chi Minh's Viet Minh establishes a provisional government in a region free of Japanese in northern Vietnam. It abolishes the "corvee" (forced labor) and begins distribution of French owned lands to peasants. It begins literacy programs and the training of local militia. Jun 21 After three months and 21 days, the fighting on Okinawa ends. US Army, Navy and Marines dead or missing are 18,900. At least 150,000 Japanese civilians have died – about one-third of the population – many by suicide. About 100,000 Japanese soldiers have died, many by suicide. 7,000 were taken alive. Jun 22 Emperor Hirohito tells his ministers that he desires concrete plans to end the war. Jun 26 At San Francisco, 50 nations sign the United Nations charter. Jul 16 In New Mexico, the first atomic bomb is successfully exploded. Jul 17 Stalin has just reaffirmed his commitment to have the Soviet Union enter the war against Japan on August 15. Truman writes in his diary: "Fini Japs when that comes about." Jul 21 Since July 17, Stalin, Churchill and President Truman have been attending the Potsdam Conference, not far from Berlin. Truman approves use of the atomic bomb against Jul 25 The Japanese have been talking to Soviet officials regarding an end to the war. The United States has been intercepting messages between Tokyo and Japan's representatives in Moscow, and US leaders are aware that Japan realizes that the war for them is lost. The Japanese consider the "formality of unconditional surrender" an unacceptable dishonor. Jul 26 Britain's Labour Party has won elections in a landslide, Clement Attlee replaces Winston Churchill as Prime Minister. Jul 27 From Potsdam, Truman cables the Japanese and warns of "utter devastation of the Japanese homeland" unless Japan surrenders unconditionally. Aug 6 The Japanese have not accepted Truman's demand for unconditional surrender, and rather than wait patiently for the Japanese to change their mind, the US military has been waiting for good weather. The military has participated in choosing Hiroshima as the target, and there the United States drops its atomic bomb. Aug 8 The Soviet Union declares war on Japan. Aug 9 The United States drops its second demonstration bomb, on Nagasaki. Aug 15 Japan surrenders. Emperor Hirohito breaks the news of surrender to the Japanese people. Aug 15 Japan's governor, General Abe, transfers power to a Korean Committee for the Preparation of Korean Independence. Koreans are jubilant, believing that Korea is an independent nation again. Aug 17 Sukarno reads his declaration of independence for Indonesia. Aug 22 Stalin announces his treaty with the government of Chiang Kai-shek. He orders Mao to dissolve his army and work for Chiang Kai-shek. Aug 22 Near Tokyo, a revolt by diehard soldiers has been quelled. Japan's military high command, following the will of Emperor Hirohito, has established calm and order. Aug 24 The Soviet forces have entered Pyongyang in northern Korea, in agreement with the Allies at the Potsdam Conference. They are rounding up Japanese forces, some of whom are coming south from Manchuria. Aug 25 Saigon comes under the control of the Communist Viet Minh. Vietnam's Emperor Bao Dai follows Ho Chi Minh's advice and abdicates. Aug 28 In agreement with the Japanese, an advance party of 150 US experts and engineers and 38 combat troops arrive at Atsugi airbase near Tokyo. Aug 30 The US 11th Airborne arrives at Atsugi airbase on transport planes. General MacArthur arrives in the afternoon. The 11th Airborne band plays "Ruffles and Flourishes." A motorcade takes him to his temporary headquarters. Japanese soldiers line the route, their backs facing the motorcade – a gesture of respect and also a security measure. Sep 2 Ho Chi Minh declares Vietnam's Independence. Bao Dai has agreed to be "supreme advisor" to the new Communist government in Hanoi. Sep 2 On board the USS Missouri, in Tokyo Bay, the Japanese sign the instrument of surrender. Sep 3 Japanese authorities learn of US plans to put Japan under military governance – contrary to the Potsdam agreement, which declared the right of Japan's government to continue to exist. Japanese authorities fear losing credibility with the Japanese people. MacArthur listens and agrees to rescind rule by military governance. He agrees to keep Japan's paramount social and political institutions in place. The occupation is to be seen as background and secondary. In the US, authorities are to see MacArthur's authority in Japan as "indirect governance." Sep 7 General MacArthur assumes power over the southern half of the Korean peninisula. He delegates that authority of US Lieutenant General John R. Hodge. Sep 8 The US military is welcomed at the Port of Inchon, near Seoul, by a delegation of Japan's military. Sep 8 British troops parachute into Jakarta's Kemayoran Airport. Japan's military begins surrendering to Australian forces. Sep 9 In Seoul the US military accepts the surrender of the Japanese. It frees English and Australians prisoners of war. It establishes a US military government south of the 38th parallel. Koreans are hostile and frequently violent toward those among them who had collaborated with the Japanese, but the US general in charge, John R. Hodge, includes those who had collaborated with the Japanese in his Korean administration and police. Many Koreans see the Americans as occupiers. Sep 13 British forces arrive in Saigon for the expressed purpose of disarming the Japanese there. Sep15 The freeing of Dutch prisoners in Indonesia begins. Sep 22 In Saigon 1,400 French soldiers and some of the 20,000 or so French civilians there, attack the Viet Minh and kill civilians, including children. A French struggle for control of Vietnam begins. Oct 9 The British arrange for the transport of additional French troops to Indochina, including Vietnam, and agree to turn over responsibilities there to the French. Oct 15 Poland becomes the 51st member of the United Nations. Oct 24 In Norway, Quisling has been convicted of treason and is hanged. Nov 10 The government of Enver Hoxha in Albania is recognized by Western Powers. Nov 11 Yugoslavia's population has more than a 90 percent voter turn-out, and it gives overwhelming support to the popular front government of Josip Tito. Nov 20 In Nuremberg Germany, war crimes trials begin. Dec 4 US Senator James O. Eastland joins others in helping alarm the Russians about opinion in the United States. He speaks of "Mongolian hordes stalking the streets of Western civilization as conquerors." He adds that the American people "must realize that Russia is a predatory, aggressor nation, and that today she follows the same fateful road of conquest and aggression with which Adolf Hitler set the world on fire." Dec 29 The US and the Soviet Union have agreed to the formation of a provisional government for a united and independent Korea. With Britain they have agreed to "trusteeship" for Korea not to exceed five years. In Korea news of the trusteeship is greeting with disappointment, anger and violence. Dec 1-31 Australians are turning over areas in Indonesia to Dutch forces. to 1935 \| to 1946	cc/2020-05/en_middle_0093.json.gz/line548
__label__wiki	0.545664	0.545664	1726: Edward Burnworth and his gang, London Lives Add comment April 12th, 2019 Headsman Edward Burnworth and his gang — a group of villains who “seem to have risen to notoriety on the downfall of [Jonathan] Wild” by the estimation of the Newgate Calendar — were executed on this date in 1726, and thereafter hung in chains. We endorse a bio of this coterie of thieves turned murderers on LondonLives.org. This wonderful site “makes available, in a fully digitised and searchable form, a wide range of primary sources about eighteenth-century London, with a particular focus on plebeian Londoners”; it’s in the spirit as the oft-cited-by-Executed Today site Old Bailey Online site, and involves some of the very same principal authors.* Their zoom-in on Burnworth et al finds the gang slaying one Thomas Hall, a gin shop owner who was attempting to set up as a thief-taker in the vacuum created by the hanging of the aforementioned Jonathan Wild — previously London’s preeminent thief-taker and (simultaneously) crime lord. Burnworth, William Blewitt, Thomas Berry, John Legee, John Higgs, and Emanuel Dickenson all suffered together and were gibbeted in chains thereafter, two apiece at St. George’s Fields, Putney Common and Kennington Common, although the last of these was given over to his friends for burial after just one day of exposure in consideration of his father’s honorable military service. (Burnworth unsuccessfully attempted to exonerate of theft a man bound for the gallows a month before him, by confessing to the crime.) * Tim Hitchcock, a historian now at the University of Sussex and a director instrumental to both sites, has previously provided some commentary directly to Executed Today as well, weighing in for example on the controversial identity of “Smugglerius” as well as OldBaileyOnline.org digitization practices. There are several other related “history from below” sites in his orbit: Locating London’s Past, Connected Histories, and The Digital Panopticon: The Global Impact of London Punishments, 1780-1925. 1715: Jeremiah Meacham, "mightily distressed" - 2018 1635: Sawney Cunningham, an abandoned Villain - 2017 1895: Richard Burleson, Crab Shack controversy - 2016 1969: Alexandre Banza, Central African Republic politician - 2015 1776: James Langar, Smuggerlius? - 2014 1749: Richard Coleman, solemnly declaring - 2013 1652: Joan Peterson, the Witch of Wapping - 2012 1967: Aaron Mitchell, Ronald Reagan's first and only execution - 2011 1782: Captain Joshua Huddy - 2010 1814: Six slaves in Guyana - 2009 1966: Christiaan Soumokil, South Moluccan President - 2008 1748: William Whurrier, War of Austrian Succession veteran 1718: John “Jack Ketch” Price, former hangman 1755: Mark and Phillis, a landmark 1726: William “Vulcan” Gates, Black Act casualty 1792: William Winter, Elsdon Moor gibbet habitue 1743: John Breads, Rye killer 1737: Five Johns Entry Filed under: 18th Century,Capital Punishment,Common Criminals,Crime,Death Penalty,England,Execution,Gibbeted,Hanged,Mass Executions,Murder,Public Executions Tags: 1720s, 1726, april 12, edward burnworth, emanuel dickenson, john higgs, john legee, london, thomas berry, william blewitt 1726: Margaret Millar, infanticide Add comment February 10th, 2019 Headsman This broadside hails from the National Library of Scotland’s wonderful archive of such documents, and the curator notes that as a “coal-bearer” — the backbreaking work of toting mined coal from the business end of the mine up and out the shaft — it’s unlikely that Millar was as educated as implied by the prose style that publishers put to her name. The last Speech and dying Words of Margaret Millar, Coal-bearer at Coldencleugh who was execute [sic] 10. February I726 at the Gibbet of Dalkeith, for Murdering her own Child. The present Age is so degenerate into Vice and Immorality, That they have the Ascendant over Godliness and Vertue; whereas Religion and Piety are run down by manifest Profanity, Dissimulation and Hypocrisy: So the Sin of unnatural Murder (while one Relation barbarously embrues their cruel Hands in the innocent Blood of another)[.] The Parents theirs in the Blood of their tender Children, the Children theirs in that of their dutiful and affectionate Parents: And in short, That of the Inhuman and cruel Servants (for the love of Money) barbarously butchering their kind and obliging Masters and Mistresses[.] That all these horrid Actions and abominable Sins, are the ready Means to bring down the heavy and just Judgments of GOD upon a People, or Person, who avowedly do commit the same, and whatever Secrefy may be gone about, in the Perpetration of any of these, yet the all-seeing Eye of the Almighty will bring the hidden Things of Darkness to Light, That the guilty Offenders may by the Hand of Justice be brought to condign Punishment, for a Terror and Example to others, who shall or may be guilty of the like Crimes. Dear People, since I am by the just Sentence of the Law, condemned to suffer this Day a shameful and cursed Death, for that unnatural and cruel Fact, it will be expected by you all, to hear something from me, as to the course of my frail Life, which is now near to a Period. The place of my Birth was at Dysert in Fife. My Father John Millar was a Salter under my Lord Sinclar there, and I being in my Nonage left to the Care of an Uncle, who put me to the Fostering, and after being wean’d from the Breast, was turn’d from Hand to Hand amongst other Relations, when my Friends being wearied and neglecting me, I was obliged to engage with my Lord Sinclar’s Coalliers to be a Bearer in his Lordships Coalheughs: So being unaccustomed with that Yoke of Bondage, I endeavoured to make my Escape from such a World of Slavery, expecting to have made some better thereof: But in place of that I fell into a greater Snare; which was in a Millers House near unto Lithgow, where my Masters Son and I fell into that Sin of Uncleanness, and I brought forth a Child unto him; which Child was fostered, and lived until it was three or four Years of Age, and died in the small Pox. After which Time, I came from the foresaid Service into this Place, where I engaged in the Coalcheugh of Coldencleugh, under the Service of Christian Lumsden, which I most solemonly regrate this Day, and which was my Misfortune, she reduced me to great Extremities, by not paying up of my Wages, so duely as I was needful of it, to buy me Cloaths to go to the House of GOD upon his Day, which made me to ran into an Hurry of Dispar, my Land-Lady and others in the Coalheugh suspecting I had an Ear with George Lauder Coal-grieve there, began to make Reflections upon me, which prompted me to greater Vice, as most unhappily hath now fallen out: Which Vice hath brought me to this unhappy and untimely End; he having had that Opportunity of inducing me into that horrid Sin of Adultry, and after which Time I came to be with Child to him, I acquainted him thereof, and when the Time of Birth came, I finding no Subsistance from him, I did most unnaturally imbrue my Hands in the innocent Blood of the Fruit of my Womb. I must own, that even in my younger Years I was addicted to all Vice, such as neglecting Duty towards GOD, Breach of his Sabbath, and neglecting of his Ordinances: Now I desire that all Persons take a warning of me this Day who am but an Ignorant, or a Castaway, That they be not Breakers of the Sabbath, Despisers of his Ordinances left that their End be such an untimely one as mine. F I N I S 1938: Vladimir Antonov-Ovseyenko, Winter Palace stormer - 2018 1956: Elifasi Msomi, witch doctor - 2017 1854: John Tapner, the last hanged on Guernsey - 2016 1945: Anacleto Diaz, Philippines Supreme Court Justice - 2015 1973: Tom Masaba, Sebastino Namirundu, and 10 other Uganda Fronsana rebels - 2014 1892: Four anarchists in Jerez - 2013 1794: Jacques Roux, the Red Priest, cheats the guillotine - 2012 2011: Rashid al Rashidi, Mousa mosque murderer - 2011 1952: Liu Qingshan and Zhang Zishan, the first corruption executions in Red China - 2010 1956: Wilbert Coffin - 2009 1905: Samuel McCue, mayor of Charlottesville, Virginia - 2008 1724: Half-Hangit Maggie Dickson 1723: Margaret Fleck, with a fresh dempster 1721: Janet Hutchie, repentant infanticide 1739: Seven of nine Williamsburg malefactors 1721: Christiana Bell 1752: Helen Torrence and Jean Waldie 1784: Anne Castledine, infanticide Entry Filed under: 18th Century,Abortion and Infanticide,Capital Punishment,Common Criminals,Crime,Death Penalty,Execution,Hanged,Murder,Public Executions,Scotland,Women Tags: 1720s, 1726, dalkeith, february 10, margaret millar 1726: Thomas Craven and William Anderson, reluctant autobiographers Add comment January 29th, 2019 Headsman For this date’s post we return to one of our favorite sources, James Kelly’s Gallows Speeches: From Eighteenth-Century Ireland. We have noticed via Kelly the unscrupulous competition between broadside publishers for any claim on privileged access to a doomed criminal, to the extent that they would pass off fake “last speeches” from men who had never spoken to them. Posterity has reason to appreciate this vulturous commerce as we see from today’s entries, whose short autobiographies they profess to have composed simply to preempt the circulation of fabulisms. THE LAST SPEECH AND DYEING WORDS OF THOMAS CRAVEN AND WILLIAM ANDERSON who is to be Executed this present Saturday being the 29th of the Instant January 1725-6, near Kilmainham. Good Christians, I had no thought at first to make any Speech, but being told if I would not, that Some Printers would, and I thereby made more blacker than I am, and the Publick impos’d on by a parcel of Lyes and Nonsence; in order to prevent the same, I have sent to the Printer hereof, to whom I related the whole truth of my past Life and Conversation, which is as follows, viz. I drew my first Breath at a place call’d Ballgee, in the County of Meath, of very honest Endeavouring Parents, but so Poor, that they could not give me either Learning or Trade, but growing up to Years and Strength, I went to live with one Mr. Boylan a Miller, living at a place call’d Moorehead in the said County, with whom I liv’d for the Space of five or six Years, during which time I behaved my self true and honest, as many in them parts can tell, but leaving him about some few Months ago, took upon me to go to Dublin, but unfortunatly [sic] meeting with Mr. Elisha Charles at a place called Swords, and he having three Cows that he bought, desired me to drive them to his House, and I being one that always bore a good and honest Name, took no thought of me, but left me to my self, thinking that I would leave them at home, but he no sooner left me, but I turn’d the Cows and drove them to Dublin, and thought to have sold them the next Day; but Mr. Charles thinking I stay’d too long, he made an Enquiry about me, and being inform’d that I went to Dublin with the Cows, he took Horse and rid after me, and got me selling the Cows in Smithfield, for which he had me Apprehended and committed to Kilmainham Goal, and now must justly Dye for the same, and now as I am a dying Man this is the first fact that ever I Committed. Haveing no more to say but beg the Prayers of all good Christians, I dye a Roman Catholick and in the 36th Year of my Age, and the Lord have Mercy on my poor Soul, Amen. The Speech of William Anderson Good people, I Seeing my Fellow Sufferer giving his Speech to be Printed, I thought it would be proper, since we are to dye together, that I should do the same which I did, and is as follows, viz. I was Born in the County of Cavin, of very honest Parents, who brought me up very tenderly till I was able to go to a Trade, and then they bound me to a Courier, to whom I serv’d seven Years true and honest, being out of my Time, I wrought at my Trade, and by it got good honest Bread, but my time being so short, that I shall not trouble the reader with any long stories, but tell you the cause of my Death. I being acquainted in the House of Mr. Tyerer in St. Patrick Street, went there when I thought they were all a sleep, and went to the Window and took down the Glass and so got in, but got nothing for my pains but a small silver Cup, but indeed I thought to get a good parcel of Mony, but cou’d not, by reason they paid it away. Having no more to Say, but begs the Prayers of all good Christians, I dye a Roman Catholick, and in the 27th Year of my Age, and as this is my first Fact, I hobe [sic] my God will forgive me my Sins, and receive my Soul in the Hour of my Death, and I hope all good Christians will say Amen. Printed at the Rein Deer in Montrath Street, 1725-6. 1696: Thomas Randal, obstinate - 2018 2015: Robert Ladd, "let's ride" - 2017 1802: Joseph Wall - 2016 1745: Eve, her smoke visible throughout the country - 2015 1879: John Achey and William Merrick, the first hanged in Indianapolis - 2015 1253: P. Morret, poor guesser - 2014 1913: Edward Hopwood, clumsy suicide - 2013 Daily Double: Century-Old English Legal Novelties - 2013 1912: Albert Wolter, white slaver - 2012 1869: Chauncey W. Millard, candy man - 2011 1810: Pedro Domingo Murillo, for Bolivian independence - 2010 2006: A female spy by al Qaeda - 2009 1547: Not Thomas Howard, because Henry VIII died first - 2008 Themed Set: The English Reformation - 2008 1725: John Coamber 1787: Margaret Savage, repeat offender 1792: John Philips, a wretch robbed of life for so trivial a robbery 1725: James Casady, aged beggar 1718: A horse thief and two travelers, “the worst rideing that ever I rid” 1731: Captain Daniel McGuire, griller 1730: Cathrine M’Canna, mother’s daughter Entry Filed under: 18th Century,Capital Punishment,Common Criminals,Crime,Death Penalty,Execution,Hanged,Ireland,Public Executions,Theft Tags: 1720s, 1726, january 29, thomas craven, william anderson 1726: Franz Laubler, Hermann Joachim Hahn’s murderer Add comment July 18th, 2018 Headsman Franz Laubler was broken on the wheel in Dresden on this date for assassinating Protestant deacon Hermann Joachim Hahn. Hahn was a well-connected pastor who had been plying his trade in the Lutheran Kreuzkirche for nigh 20 years. That trade consisted heavily in the evangelization of Catholics in a confessionally split city;* indeed, his murderer, a Catholic-reared butcher and mercenary, had himself once upon a time been converted by Deacon Hahn. Said Franz Laubler had in time returned his soul to the Roman fold but the unsettled mind suggested by his sectarian vacillation is supported by Laubler’s strange conviction that a communion wafer taken in 1720 had lodged permanently in his gullet. “Schlaget mir den Kopt ab, und ihr werdet noch die Hostie in meinem Halse finden!” he exclaimed: “Cut off my head, and you’ll still find the Host in my throat!” Not to be confused with the Ghost to the Post. On May 21 of that same year of our Lord 1726, the Host-throatened Laubler presented himself at the divine’s residence under the guise of seeking spiritual counsel, but instead sent Hahn straight to his maker with a hidden blade.** He’d thrown down Dresden’s Lucifer, he explained to the gendarmes who took him into custody — and made his heavy heart light. The murder triggered a massive Protestant pogrom against Catholics which required several days to quell. There’s a public domain volume from 1826 about these events available free here, as well as a 2009 book Die Hostie im Hals. (The Host in the Throat \| here’s a review) Both titles are in German. Hahn’s Wikipedia page itemizes a number of other German pamphlets about his murder dating to the 1720s. Hahn’s tomb can be found in the Trinitatiskirche Cemetery, where it was transferred in the mid-19th century from the old Johanniskirchof. * Dresden, and Saxony in general, were predominantly Protestant. However, Catholics enjoyed a broad grant of tolerance thanks in part to the Elector of Saxony, Augustus the Strong, who converted to Catholicism in 1697 in order to become King of the Polish-Lithuanian Commonwealth. ** Okay, it wasn’t straight to his maker: Laubler started by trying to strangle Hahn with a rope, and resorted to the knife as his victim resisted him. 1743: The Black Watch mutineers - 2019 1888: Two in New Jersey, by father and son hangmen - 2017 1741: Othello, Doctor Harry, and five other New York slaves - 2016 1707: John Whittingham - 2015 1801: Chloe - 2014 2003: Lehlohonolo Bernard Kobedi - 2013 1936: Virgilio Leret, the first shot in the Spanish Civil War - 2012 1300: Gerard Segarelli, Apostolic Brethren founder - 2011 1943: Eight from the Krasnodar Trials - 2010 1865: Chief Ahan of the Tsilhqot’in - 2009 2007: Not Sina Paymard, saved by a flute - 2008 1726: The Gypsy outlaws of Hesse-Darmstadt 1762: Jean Calas, intolerably 1476: Israel, the last execution of the Trent blood libel trial 1573: Lippold ben Chluchim, scapegoat 1586: Anthony Babington and fellow plotters, Walsingham’d 1714: Various rebel slaves in the Cape Colony 1705: The Camisards Catinat and Ravanel Entry Filed under: 18th Century,Assassins,Broken on the Wheel,Capital Punishment,Death Penalty,Diminished Capacity,Disfavored Minorities,Execution,Germany,God,Gruesome Methods,History,Holy Roman Empire,Murder,Notable for their Victims,Public Executions Tags: 1720s, 1726, augustus the strong, catholics, christianity, dresden, franz laubler, hermann hahn, july 18, mental illness, mentally ill 1726: Joseph Quasson Add comment June 29th, 2016 Headsman Hanged on this date in 1726, Joseph Quasson enjoys a minor distinction in the annals of the gallows press: according to friend of the blog Anthony Vaver, Samuel Moody’s account of Quasson’s long* jailhouse sojourn was the first published in the colonies as a standalone conversion narrative, without cover of an attached ministerial sermon. And here it is: * Quasson fatally shot a fellow enlistee serving during Father Rale’s War. There was no question about his guilt, but when the murder took place the next sitting of the court was nine months away so the man just got to cool his heels. 1955: Gerhard Benkowitz and Hans-Dietrich Kogel, of the KgU - 2018 1996: The Abu Salim prison massacre - 2017 1900: Benjamin Snell, electricity in his head - 2015 1612: Robert Crichton, Lord Sanquhar and mediocre swordsman - 2014 1944: A day in mass executions in Axis Europe - 2013 1799: Admiral Francesco Caracciolo, Neapolitan - 2012 1925: Sheikh Said Piran, Kurdish rebel - 2011 1541: Thomas Fiennes, 9th Baron Dacre - 2010 Feast Day of Saint Peter and Saint Paul - 2009 2000: Two kidnappers, televised by Guatemala - 2008 1738: Katherine Garret, Pequot infanticide 1721: Joseph Hanno, “miserable African” 1715: Margaret Gaulacher, Cotton Mather ignorer 1732: Pompey, poisoner of James Madison’s grandfather 1794: Edmund Fortis, in the hands of God 1756: Owen Syllavan Entry Filed under: 18th Century,Capital Punishment,Common Criminals,Crime,Death Penalty,Disfavored Minorities,England,Execution,Hanged,History,Maine,Murder,Occupation and Colonialism,Public Executions,Racial and Ethnic Minorities,Soldiers,USA Tags: 1720s, 1726, father rale's war, first peoples, indigenous, joseph quasson, june 29 1726: James Stephens and Patrick Barnel, broadsided Add comment May 25th, 2016 Headsman On this date in 1726, two men hanged on Dublin’s St. Stephen’s Green. We meet these men, as we often do in this period, through the cheap hang-day publications that were hurried to press to sell for the occasion, and since in this instance we have two such brochures for the same event, it is a handy occasion to turn our gaze upon these ubiquitous ephemera. Then as now, publishing was a perilous hustle forever beckoning its practitioners to shady expedients further to enhancing narrow margins. Public executions — especially those of particularly notorious offenders — were pretty much the clickbait of broadside printers, and this one weird trick they could resort to was hawking rival pages each purporting to be the “last words and confession” of the poor sap on the gallows. Competition for access to a condemned fellow was intense, and where there could be the least question as to authenticity (for formulaic plausibilities could easily be hung around the handful of publicly discoverable facts) printers made free to use these solemn partings to take astonishingly vituperative shots at their commercial rivals* — a sure irreverence entirely in keeping with the carnivalesque orgies for which public hangings became infamous. Here a huckster whose main purpose is to use a dying man’s last passion to retaliate a rival scribbler’s previous libel, there a future gallows-bird relieving a gawker’s pocket of the penny he meant to waste on the tabloid. Well might we latter-day ghouls thank these unprincipled pushers: their scandalous documents, be they ever so compromised and artless, constitute a rare and precious glimpse into the criminal class of the early modern world. We are indebted in this instance to James Kelly’s fascinating Gallows Speeches From Eighteenth-Century Ireland, a book we have previously cited, for the two rival, contradictory, and mutually recriminatory broadsides recounting this execution. As Kelly’s own introduction notes, the mere existence of multiple competing reports — which we here humbly present for the reader’s discretion — does underscore “that public demand could sustain this volume of publication in individual instances.” And that fact alone would surely make the list of 26 secrets to make it as a printer in the the 18th century. The True Last Speech, Confession, and Dying Words of Mr. James Stevens and Account of Patrick Barnwell who are to be executed at St. Stephen’s Green, on Wednesday the 25th Inst. May, 1726, being condemn’d for feloniously taking from Mr. Philip Kennersly of Dame-street, a Glas-case, Value 50l. If it were not usual for Men of every Degree, in my unfortunate Circumstances to make a Kind of Declaration at their Death of their past Behaviour, I shou’d not, as at this Day, nor even should the above mention’d Considerations move me to make this, my Only and Last, were I not sensible of the many Villanous [sic] Falsities, which might be publish’d concerning my unhappy Fate, by Persons of the vilest Characters themselves; such as one Hoy in Pembroke-Court, who publish’d a scandalous and wicked Paper on the last poor Wretches that suffer’d, under the name of G.F. or George Faulkner, a Person known to have no Being in this Kingdom, this long Time past, altho’ make his Tool and Screen for scandalizing the Chiefest of our Just and Good Governours, as vilely as the poor undone Wretches: Beside him, there is another as notorious for the like Villainy, living at the Rein Deer in Montrath-Street, unworthy, and noted for the above named wicked Practice. On these Considerations only, then I say, I the unhappy and unfortunate James Stephens, have thought fit to tender to Richard Dickson of Dame Street, Printer, THIS, for Publication, as he thinks proper. FIRST, Then, since I see it is the Will of the most High God, whose Name be for ever Blessed, That in this World I should be brought from my Former happy, to this Wretched state, I submit, beseching [sic] humbly for his most Gracious mercy and Forgiveness for my manifold Transgressions in the Follies of my youth, and misspent Time, which began in the City of London, where I first Drew my Breath, being an entire Stranger here, of Creditable and Honest Parents, who Bred me Tenderly and well, till I was able to go Apprentice, which Time I serv’d to an Image-maker, after I had done with him, I Work’d for my self, and growing worth money, after I had spent some of my untainted Youth, in the Service abroad, belonging to the Ordnance, I set up to keep Hire-Horses, for the Court, in Nature of the great Mr. Blount, in the Parish of St. James, having Licenc’d coaches, and dealing for upwards of 500l, a year, till many Misfortunes comming [sic] on me, I was oblidg’d to leave my Native Country, and on a Woful [sic] Day, I came for Ireland with some small matter of Money, about a year since, where I follow’d making Images, till I came acquainted with the vile Woman Eleanour Fenly, who to save her Life at Tryal falsly [sic] said she was my Wife, Poverty forceing me to keep first with her, she pretending to have Friends who would make my Fortune, which alas! they have, it being her Brother, Fernando Fenly, and his Accomplice who swore my Life away, in declaring That about the 25th of March, last I have a Box of Goods, which were Mr. Kennersly’s, afterwards found in his Custody, and that I paid him 2 Shillings for carryage from the Sun Inn, in Francis Street, to Ross, which I vow all False, nor was I e’er Guilty of what was sworn, tho’ for it I must dye, having no Friend to appear for me, yet with the Constancy of a Christian who can accuse himself, of no great Crimes I go to meet my Fate, Dying in Charity with the World. But this I further for my Innocency declare, I ne’er had Intention to rob Mr. Kennersly, nor e’er sold any of his Goods, but going into the Country with the Aforemention’d Eleanor Fenly to her Brother’s in Loghreagh, where he lives well; she came in Company with one Byrn, a Fellow [I] did not like and who resolv’d I suppose to do us an Injury, upon which I quarrel’d, and happening to be damag’d by some People in Caterlogh. I resolv’d to get Justice of which, being by ’em suspected, they got me apprehended on Suspicion of an idle Person, and Nell Fenly getting some Toys to sell there, she was discover’d at that time, on which her Brother made the Examination aforesaid, against me, which caused me to be transmitted and tryed upon it, to save his own Life; she as I before said, escaping by alledging she was my Wife &c. I may likewise add, that had not my Fellow Sufferer hop’d to have sav’d his Life, he cou’d have clear’d me, for which I pray God forgive him, And now Dear Christians, I have nought to say, but heartily beg that some of you, who shall see me dye, out of mere Pity to my unhappy State, (an entire and poor Stranger) will cover me with Earth, an Hindrance to those Men whose Business it is, to keep forlorn Wretches from their Graves, for private Practice o’er their mangled Bodies. I now conclude begging your Prayers to God for my Forgiveness, being about 37 Years of Age, A Protestant Member of the Church of England. James Stephens. PATRICK BARNEL Who is to dye with Mr. Stephens, on the Persuasion of some Friends has declin’d making further Confession, than to his Ghostly Father, which he desires so might be forth, lest any imprudent Person should pretend he had made any Speech, giving no further Account of himself, than that he was pritty [sic] well educated, and when young, that he serv’d Major Arthur, to whom he owns great obligation, that after he left him, he went to serve a Weaver, whose Business he after, follow’d, dating his Misfortunes to begin in being concern’d in Mr. Kenerslys Robbery; to whom he afterwards gave up several Things in hopes to save his Life. He Dies a Roman Catholick, begging the Prayers of All good Christians. Mr. Gray having by Gracious Mercy, obtained a Reprieve, ’tis hop’d no notice will be taken of the absurd Pieces, design’d and publish’d, by the said Hoy in Pembroke Court, or under any feign’d Name whatever, which is notoriously known to be intended by Hoy, who surely will cheat the Publick with some scandalous and lying Paper, intitled a Speech to the abovenamed unfortunate Men, in prejudice and defamation to the Printer hereof, who unwittingly gall’d hiim, in saying th’other Day, He look’d like Death, when a Person affirm’d to his Face, in the open street, he said he was a MOLLY, (term well known for Sodomite) a charge so bold, that it might be wished, before he strives to taint another’s, he’d clear his own Character, from that Aspersion, if so it may be term’d. Printed by Richard Dickson, and Gwyn Needham in Dames-Street. The Last Speech, Confession and Dying Words, of Patrick Barnel, and James Stephens who are to be executed at St. Stephens Green, this present Wednesday, the 25th of this Inst. May, 1726. For the Robbery of Mr. Kinnersly in Dames-Street. The Speech of James Stephens. I James Stephens, was born at Cheswick, about five Miles from London: my Parents put me to a free School to learn to write, where I had the Character of an unlucky Boy. At 14 Years of Age, I was entertained by the celebrated Jonathan Wilde, under whom I arrived to such Dexterity in Picking Pockets and Impudence in bare-fac’d Robberies, that I robb’d on a Play Night in Drury Lane Edward Martin, Esq, of 75 Guineas and a Gold Watch. My honest Master for the sake of a Reward of ten Pounds for the Discovery of the Persons who committed the Robbery, made Oath that I was the Person. But I having Timely notice of it, fled to France, where I with some others Rob’d and Murder’d Mr. Lock, and the English Gentlemen in his Company, then I took Shipping at Calais, and landed at Cork, where Information in a little Time was given against Me, for several Robberies; this obliged me to come to Dublin, where I most impudently perform’d that unparalleled Roguery of Stealing a Glass Case with Rings, Silver Spoons, Snuff-Boxes, &c. to the Value of Seventy Pounds from Mr. Kinnersly Goldsmith in Dame Street. I heartily and sincerely repent of my horrid Crimes, and desire the Prayers of all my Fellow Christians. I dye an unworthy Member of the Church of England. The Speech of PATRICK BARNWELL Good Cristians, [sic] I Patrick Barnel was born in the County of Dublin of Poor, but Honest Parents; their mean Circumstances was in a great Measure, the Cause of my Present Misfortune, for they could not give me any Education, and I was often obliged to take away from the little Children of the same Town their Victuals to satisfie my Hunger, when I was a Boy, I stole several little Things, and escaped without Punishment. I was induced to commit great Rogueries; I became acquainted with a Gang of Tories who kept their Rendevouz [sic] in the County of Kerry with whom I committed such Cruel and Barbarous Actions, that we were all Obliged to disperse and shift every one for himself, it was my Fate to come to this City where I had not been above Six Months, before I introduced into the Company of my ellow-Sufferer, who was the Head of a Gang of about a Dozen, having no Manner of Subsisting myself. I committed several petty Thefts with him and others, and at last that most notorious one for which I now die, I cannot deny that I am guilty, but having a true sence of my Crimes, I repent of them, and I desire your Prayers for my soul, I die a Member of the Church of Rome in which I was bred, and the Lord have mercy on my poor Soul. N.B. On Sunday last, one Dickson a Printer who publishes Papers under the Name of G Needham, came to us in Newgate, and we not thinking him a proper Person to make any thing publick from us. We desire the publick be aware buying any Speech of ours from him, for whatever is printed by him is an Imposition of the Town, and can only be excused by his saying, He is a poor Boy, and must endeavour to better his miserable Circumstances, and maintain himself and his little Family. He had already advertised, that he has the Speech of one who is not to die. Dublin: Printed by G.F. in Castle Street. * The emoluments available for intermediating the sentiments of the hanged become quite obvious through the lucrative quasi-monopoly the Ordinary of Newgate was able to establish around his privileged access to London’s condemned. 1798: The Carnew executions - 2019 1425: Murdoch Stewart, Duke of Albany - 2018 1940: Julien Vervaecke, Tour de France cyclist - 2017 1987: Pawel Tuchlin, the Scorpion - 2015 1849: Washington Goode - 2014 1721: Joseph Hanno, "miserable African" - 2013 1872: Communards Serizier, Boin and Boudin - 2012 1911: Laura and Lawrence Nelson lynched - 2011 1946: Marcel Petiot, Vichy serial killer - 2010 1948: Witold Pilecki, Auschwitz infiltrator - 2009 1979: John Spenkelink, the harbinger - 2008 1784: Richard Barrick, Massachusetts highwayman 1702: Dick Bauf, executioner of his parents 1722: Cartouche’s brother, hanged by the armpits 1707: John Whittingham 1789: Not Mary Wade, 11-year-old thief 1781: Diego Corrientes Mateos, Spanish social bandit Entry Filed under: 18th Century,Capital Punishment,Common Criminals,Crime,Death Penalty,Execution,Hanged,History,Ireland,Public Executions,Theft Tags: 1720s, 1726, broadsheets, dublin, james stephens, literature, may 25, patrick barnel, print, publishing 1726: Three molly-house sodomites 5 comments May 9th, 2015 Headsman Nine men and one notorious women died at Tyburn on this date in 1726 at a more than usually raucous execution-day. “At the Place of Execution, Map got himself loose, threw himself out of the Halter, and jump’d 3 or 4 Yards from the Cart, upon the Heads of the numerous Crowd of People, but the Officers following after him, wounded him with their Pikes, and the Executioner and some others soon brought him back again,” the Ordinary’s account remarked. “Vigous got himself free of the Halter also, which was immediately observ’d: Gillingham was the more desirous of Prayers, having the Night before taken Poyson, and conscious of his Guilt.” And that’s just what was happening under the nooses. Out in the audience, Just before the Execution, a Scaffold that had been built near Tyburn, and had about 150 People upon it, fell down. A Snuff Box Maker in Castle-Street, and a Gentleman then not known, were, as ’tis believed, mortally Wounded; and about 12 other Men and Women, Maimed and Wounded in a most cruel Manner: Some having their Legs, others their Arms, &c. broke. Some part of the Scaffold being left standing, the Mob gathered upon it again in Numbers; and in about Half an Hour more, that also fell down, and several were hurt. Soon after another Scaffold broke down, with about 100 Persons upon it; but the People that were damaged by it, being immediately carried off on Mens Backs, and in Coaches, we must defer the Particulars of that Mischief … (Daily Journal, May 10, 1726) We will leave for a future May 9th the notorious fate of the woman, Catherine Hayes, and focus for this post on the fate of the notorious men: sodomites Gabriel Lawrence, William Griffin, and Thomas Wright. A mere three months before, this trio had been among dozens of men rounded up in a raid on London’s thriving “molly house”. These establishments catered to what we might anachronistically call the gay scene of Georgian London — or the molly scene, if you like, from the slang term for effeminate, cross-dressing, or homosexual men encompassing a panoply of alternate sexual identities and preferences. What these behaviors “among Christians not to be named” had in common, of course, was the opprobrium of the surrounding world. Rictor Norton, who keeps the voluminous Homosexuality in Eighteenth-Century Enland site and wrote a book about Mother Clap’s Molly House, records a 1726 letter to the editor demanding an exemplary punishment to check the misuse of genitalia. It being too notorious, that there are vile Clubs of Miscreants in and about this City, who meet to Practise and Propagate the detestable Sin of Sodomy, a Crime which drew down the flaming Vengeance of God upon the City of Sodom, in a Day when they had not that Light which we are bless’d with now, ’tis humbly propos’d that the following Method may not only destroy the Practice, but blot out the Names of the monstrous Wretches from under Heaven, viz. when any are Detected, Prosecuted and Convicted, that after Sentence Pronounc’d, the Common Hangman tie him Hand and Foot before the Judge’s Face in open Court, that a Skilful Surgeon be provided immediately to take out his Testicles, and that then the Hangman sear up his Scrotum with an hot Iron, as in Cases of burning in the Hand. Old Blighty was never favored with courtroom scrotum-searings, but connoisseurs of same-sex love “must risque our necks for” it well into the next century. But what pleasures welcomed the man who was ready to wager his life! An informant reported from that same Mother Clap’s that he found between 40 and 50 Men making Love to one another, as they call’d it. Sometimes they would sit on one another’s Laps, kissing in a lewd Manner, and using their Hands indecently. Then they would get up, Dance and make Curtsies, and mimick the voices of Women. O, Fie, Sir! – Pray, Sir. – Dear Sir. Lord, how can you serve me so? – I swear I’ll cry out. – You’re a wicked Devil. – And you’re a bold Face. – Eh ye little dear Toad! Come, buss! – Then they’d hug, and play, and toy, and go out by Couples into another Room on the same Floor, to be marry’d, as they call’d it. Several such informers were stalking the city’s molly-houses in the 1720s, goaded (or forced) by both police and private bluenoses. One of the resulting court records notes that “[t]he discovering of the Molly Houses, was chiefly owing to a Quarrel betwixt Mark Partridge and – Harrington: For upon this Quarrel Partridge to be revenged on Harrington, had blab’d something of the Secret, and afterwards gave a large Information of a great many others.” Many lives hung on this lover’s spat. Mother Clap’s was raided in February 1726, but it was just the most famous of a whole series that forced into public awareness “a new, distinct molly ‘sodomite’ identity.” The saving grace for the twoscore arrestees at Mother Clap’s was that even in Bloody Code England, a fairly high bar was required to execute for same-sex sodomy: “penetratio, that is res in re“ (“thing in thing”)* — often quite difficult to prove.** As nobody had actually been caught in flagrante delicto, most of those initially arrested were simply released un-charged. But the informants raise their scaly heads once more here: as they were themselves habitues of the molly circuit, they could provide firsthand eyewitness testimony about the acts of buggery several men had committed with them. Five men were put on trial for their lives in April on the strength of accusations made by informants Mark Partridge, Thomas Newton, and Edward Courtney. The cases are described in some detail at Norton’s site: Gabriel Lawrence and William Griffin, both 43-year-old married men, were Mother Clap regulars who implausibly claimed to have no idea it was a molly house. (The place was a coffee shop/tavern.) Griffin actually lived there. Both these men were easily condemned but refused to the end to admit their proclivities to the Newgate Ordinary, and insisted that they had been framed. Thomas Wright, seller of ale, had gone so far to set up his own molly house where he both slept with Newton, and procured Newton for his other customers. Wright, who “inclin’d to the Anabaptist-Way,” also said that Newton had perjured himself; nevertheless, he “could not deny his following this abominable Courses, only he refus’d to make particular Confessions.” A third informant keyed two additional capital trials that didn’t end at Tyburn. George Kedger (Keger) and George Whittle (Whytle) both mounted much stronger defenses casting much greater doubt on the circumstances of their entrapment. Charged with taking Courtney into his bed, Kedger contended that he had in fact resisted Courtney’s advances until the latter threatened to “swear my Life away”. Kedger was condemned, but pardoned. Whittle did still better by forcing his accuser to admit that he was a convict three times over and insinuating that rumors about his buggery were started by a disgruntled lodger. With a parade of character witnesses at his back, Whittle was acquitted outright. * This was also the standard for same-sex rape; we’ve seen in these pages a man’s life hang on a question of just the tip. ** Attempted buggery — a charge which could result from making a sexual advance on another man that he rejected, or as a judicial punt when same-sex activity was afoot but no penetration could be proven — might land one a fine and a trip to the pillory. This was no mean sentence; the pillory could be quite a dangerous (sometimes lethal) ordeal for homosexuals or for anyone else. Mother Clap herself, whose molly house we have referred to throughout this post, was also pilloried, not executed. Her eventual fate is not known; a marker in Holborn notes the former site of her famous establishment. 2010: Four Kurdish political prisoners - 2019 1916: Thomas Kent - 2018 1887: Charles Smith - 2017 1800: Three Canadian pirates in Philadelphia - 2016 1961: Alvin Table Jr. and Billy Wayne Sees, Bahamas pirates - 2014 1979: Rahim Ali Khorram and Habib Elghanian, millionaire businessmen - 2013 1474: Peter von Hagenbach, war crimes milestone - 2012 1766: Thomas Arthur de Lally-Tollendal, undiplomatic - 2011 1794: Four members of the Targowica Confederation - 2010 1947: Willie Francis, this time successfully - 2009 1628: Johan Bernhard Reichardt, a nine-year-old witch - 2008 1835: John Smith and James Pratt, the last hanged for sodomy in Great Britain 1814: Six slaves in Guyana 1673: Mary Carleton, “German princess” 1677: Seven at Tyburn 1761: John Perrott, bankrupt debtor 1816: Four sodomite sailors of the Africaine Entry Filed under: 18th Century,Capital Punishment,Crime,Death Penalty,Disfavored Minorities,England,Execution,Hanged,History,Homosexuals,Mass Executions,Public Executions,Sex Tags: 1720s, 1726, catherine hayes, gabriel lawrence, london, margaret clap, may 9, molly houses, sodomy, thomas wright, Tyburn, william griffin Add comment March 14th, 2013 Headsman March 14, 1726, was the hanging date of five men* at the gallows of Tyburn. We’ll come to the other four of them presently, but our featured case among the group is one Bill Gates — not the Microsoft billionaire, obviously; this fellow was, rather, a victim of the plutocracy. William Gates was a blacksmith by trade, presumably the source of his outstanding nickname or alias “Vulcan”. But he also liked to hunt, and that’s how he ended up having his neck pinched. It was only logical in the early 18th century for hunters like Vulcan to take quarry from the common lands. But these longtime traditional rights were under long-term attack; just a few years before, the “Black Act” dramatically escalated penalties and enforcement mechanisms for “poaching”. Among other things, the Black Act permitted a suspect to be accused by reading out charges “on two Market Days, and in two Market Towns in the County, where the Offence is committed.” If the named party failed to turn himself in within 40 days, he stood convicted — no trial necessary. This was Vulcan’s situation exactly. He’d been accused of “being one of the Men that entered Enfield Chace, killed two Deer,” and took some potshots at the gamekeepers. Having not given himself up, the entirety of the short proceeding once Gates was taken was to establish his identity. (A potentially tricky affair in those days, but not in this instance.) Frequent death-blog litterateur Charles Dickens glossed this story for the literary magazine he founded, All the Year Round, quoting in Vol. 18 the account of the Ordinary of Newgate when Gates and the four who were doomed to die with him “took it into their foolish heads that they would not be hanged.” (I’ve added line breaks to the Dickensian version, for readability.) The day on which they were executed, when I [the Ordinary] came to Newgate to give them their last exhortations and prayers, they would not allow any person to come near them, having got an iron crow into the prison, with which they had forced out stones of a prodigious bigness, and had made the breach two feet deep in the wall. They had built up the stones at the back of the door of the condemned hold, so that nobody could get at them. The keepers spoke to them through the door, but they were inflexible, and would by no entreaties yield. I spoke to them also, representing to them how that such foolish and impracticable projects interrupted their repentance, and the special care they should have taken in improving those few moments to the best advantage; but they seemed inexorable. I said that I hoped they had no quarrel with me. They answered, ‘No, sir, God bless you; for you have been very careful of us.’ Bailey said, that they would not surrender till they either killed or were killed. It was twelve at night before they began this enterprise; and, to conceal their purpose from the keepers, while part of them were working, the rest sung psalms, that the noise might not be heard. Sir Jeremiah Morden, one of the present sheriffs of London and Middlesex, came with proper attendance, and, desiring them to open the door, they refused it; upon which they [not the prisoners, but the sheriff and his men] were obliged to go up to the room over the hold, where there is a little place that opens, which is made in case of such disturbances. This shutter they opened, but the prisoners continuing obstinate, they [the sheriff’s assistants] fired fifteen pistols with small shot among them, not to kill, but to wound and disable them. They retired to the remotest part of the room where the shot could not reach them, yet Barton and Gates, the deer-stealer, were slightly wounded in the arm. At last Sir Jeremiah Morden spoke seriously to them through the little hole above, desiring them to surrender. Barton asked, ‘Who are you?’ Sir Jeremiah answered, ‘I am one of the principal sheriffs.’ ‘Show me your chain,’ says Barton. Sir Jeremiah was so good as to show him his gold chain through the little hole, upon which they consulted, and agreed to surrender. After this they removed the stones for the back [of the] door, and, the keepers entering, Barton snapped a steel tobacco–box in the face of one of them, which made a little noise like the snapping of a pocket-pistol, and then gave him the box” [saying ‘D-me, you was afraid.’ -Dickens omits this taunting clincher (ed.)] After this the unctuous Ordinary tried to dog the intended escapees out of any parting sacrament on the grounds that their souls were not adequately prepared, to which the mutineers justly replied that they “been busied otherwise; they said it was only out of a desire of self Preservation … upon which account they desired to be excused.” The Ordinary is vague on whether he excused them so far as to grant a last absolution. They were never to be excused from the rope. While we’ve mentioned the singular case of Vulcan Gates, the other four were a more prosaic bunch of convicted burglars. Three of the four denied their guilt to the last. And while it’s nigh-impossible to judge credibility from the few second-hand words of an interlocutor religiously convinced of their culpability, it’s quite an affecting testimony to the scant circumstances needed to doom a fellow under the Bloody Code. More than likely we’re a little skeptical of Benjamin Jones, who said that he chanced to stumble upon some silver plate in the darkness when stumbling out drunk from his tavern to pick up a whore. Was it just a bit of mutual aid among thieves that Jones accused a different prisoner, one Frazier, who was sick on his deathbed? The Ordinary said that he “ask’d Frazier, if this account was true? who said that it was, and that he had written the full Narrative thereof to Persons of the highest Quality.” Francis Baily was doomed by the detailed testimony of a fellow-inmate in his same boarding house. He did admit to being a professional robber whose real crimes were quite enough to stretch his neck, but that his particular condemnation was thanks to the perjury of “one of the most infamous, wicked Women in the World who had sworn away his life, as she had the Life of some others, besides several there whom she had got transported and whipp’d &c. Baily pointed the finger at the absconded landlord of the house, the aptly named Matthew Wildman, who was his frequent burglarious partner. The saddest of the self-proclaimed innocents was William Swift. He was accused along with another man, Lawrence Simpson, of having been part of a gang of highway robbers who committed a couple of muggings one evening. Although it was dark, one woman claimed to have been able to recognize Swift’s face by the light of “a Lamp about 6 Yards off,” and this was enough to seal his fate. Simpson hadn’t been glimpsed so clearly, so he was acquitted. As for the last fellow at Tyburn that March 14, John Barton didn’t claim any species of innocence at all. Instead, he announced at the scaffold, “I am the Man, who in Company with two or three others, whom he named, particularly one Capel [Bob Cable], who committed the Robbery for which Swift dies.” (Barton had been set to testify at the Swift-Simpson trial, but was disallowed on account of his own pending burglary charges.) * Seven were originally condemned to die this date; two petty thieves received the crown’s mercy. 1953: Abel Danos, le mammouth - 2019 1964: Jack Ruby condemned - 2018 1824: John Smith - 2017 1808: Thomas Simmons - 2016 1610: Henry Paine, shipwrecked mutineer - 2015 1908: Massillon Coicou and the Firminists - 2014 1719: Mary Hamilton, lady in waiting - 2012 2009: Four Iranians - 2011 1757: Admiral John Byng - 2010 1551: Alice Arden, husband killer - 2009 1957: Evagoras Pallikarides, teenage guerrilla poet - 2008 1741: Jenny Diver, a Bobby Darin lyric? 1739: Dick Turpin, outlaw legend 1730: James Dalton, Hogarth allusion 1723: The first London executions under the Waltham Black Act 1691: Eleven at Tyburn 1711: Phebe Ward, Thomas Pritchet and John Matthews Entry Filed under: 18th Century,Capital Punishment,Common Criminals,Crime,Death Penalty,England,Execution,Hanged,History,Mass Executions,Murder,Notable Jurisprudence,Public Executions,Theft,Wrongful Executions Tags: 1720s, 1726, black act, charles dickens, london, march 14, names, newgate prison, Tyburn, vulcan gates, william gates Add comment November 14th, 2009 Headsman On November 14 and 15, 1726, more than 20 Gypsy outlaws of Hesse-Darmstadt were executed en masse. Detail view (click for full image) of the execution of the Gypsies at Giessen. Gypsies in Europe still suffer ample discrimination today, so it’s little surprise to find early modern Europe thick with anti-Gypsy legislation. No surprise, Angus Fraser writes in The Gypsies, this sort of thing did in the end produce enormous changes in the life of the Gypsies in Europe. To survive, they had to adapt; they also had to make the most of the loopholes in a system which expressly sought, by denying them food and shelter, to make honest living impossible. Some found a degree of security in inaccessible waste-lands and forests. Some exploited differences in jurisdiction and the spasmodic nature of the authorities’ activity, by making a home in frontier regions … Many broke up into small groups when it was necessary to avoid attention; conversely, others gathered into larger bands to facilitate self-protection … sometimes resorting to violence. Certain Gypsy brigands gained notoriety in eighteenth-century Germany, large tracts of which were overrun with robber companies of mixed and varying origins. Some of these had a strong Gypsy element: numbering perhaps 50 or 100, armed and defiant, they stole for their sustenance and skirmished with the soldier-police sent to confine them. “The poor Gypsies,” one poor Gypsy lamented to a contemporary German author,* “also want to have the right to live.” Like the Gypsies’ other necessities, that right went as far as they themselves could secure it … and when secured by brigandage, it eventually brought down an overwhelming response. The German author in question, J.B. Weissenbruch, relates the tale of a particularly notorious pack of Gypsy outlaws under the leadership of rough characters names of Antoine la Grave, aka “der Grosse Galantho” or “the Great Gallant”, and Johannes la Fortun, aka “Hemperla”. These were no romantic Johnny Depp-esque Gypsies, at least according to Weissenbruch. Besides “their disposition to wandering, to idleness, to theft, to polygamy, or rather promiscuous license” — well, okay, sort of romantic — these went toe to toe with soldiery dispatched to corral them and had the chops to “take military possession” of a village for the purpose of exacting some corporal revenge. We know where this ends up. Though the Great Gallant escaped punishment,† Hemperla and 20-plus of his band (different sources quote slightly different figures) enjoyed the pleasures of the thumbscrew and the Spanish boot to secure confessions necessary to license their sentences. Some were hanged, others (including women) beheaded, and Hemperla and a few comrades were broken on the wheel. * Cited here; regrettably, I have not been able to locate a browsable original of the Weissenbruch text. ** Same story in yet another Google books freebie. † This German book says his rank got him off the hook, but he lost his head just the same in 1733. 1989: Solomon Ngobeni, the last hanged in South Africa - 2019 2018: The Sultan of Coins - 2018 1879: Charles Drews and Frank Stichler, graveyard insurance - 2017 1738: False Tsarevich Alexei - 2016 Daily Double: Georgia - 2015 1996: Larry Lonchar, bad gambler - 2015 1864: Franz Muller, "Ich habe es getan" - 2014 1888: William Showers, "pathetic soul" - 2013 1930: Yang Kaihui, Mao Zedong's wife - 2012 1960: Phineas Tshitaundzi, the panga man - 2011 1963: Four Cubans as CIA spies - 2010 1817: Policarpa Salavarrieta, Colombian independence heroine - 2008 1226: Frederick of Isenberg - 2007 1763: Hannah Dagoe, violently 1943: 186 prisoners at Plotzensee Prison 1599: Beatrice Cenci and her family, for parricide 1781: Tupac Amaru II, Incan insurgent 1600: The Pappenheimer Family Entry Filed under: 18th Century,Beheaded,Broken on the Wheel,Capital Punishment,Common Criminals,Crime,Cycle of Violence,Death Penalty,Disfavored Minorities,Execution,Germany,Gruesome Methods,Hanged,History,Holy Roman Empire,Mass Executions,Outlaws,Public Executions,Racial and Ethnic Minorities,Theft,Torture,Women Tags: 1720s, 1726, antoine la grave, der grosse galantho, giessen, gypsies, hemperla, hesse-darmstadt, j.b. weissenbruch, johannes la fortun, november 14, november 15, racism, the great gallant 1726: Mary Standford, shunning convict transportation 2 comments August 3rd, 2009 Anthony Vaver (Thanks to Anthony Vaver of Early American Crime for the guest entry, reposted from a fascinating entry in his series on convict transportation. Vaver is the author of Bound With An Iron Chain: The Untold Story of How the British Transported 50,000 Convicts to Colonial America. -ed.) Mary Standford was convicted of privately stealing a shagreen pocket book, a silk handkerchief, and 4 guineas from William Smith on July 11, 1726. After her conviction, she strongly rejected transportation to the American colonies as an alternative to execution. Standford was raised just outside of London by good parents who sent her to school and educated her in the principles of Christian values. Standford, however, showed more interest in the “Company of Young Men,” so she was sent to London to become a servant, where she lost several positions due to her behavior. In her last position she was seduced by a footman, which subsequently forced her into prostitution. Standford quickly fell in company with Mary Rawlins, “a Woman of notorious ill fame,” and the two of them walked the streets between Temple Bar and Ludgate-Hill looking to empty the pockets, one way or another, of gullible men. Later, they had considerable success targeting sailors who, after returning from their voyages, had money to spend for their favors. Standford eventually married a man with the last name of Herbert, but after a year and a half she left him or, by her account, he abandoned her. Soon afterward, she had a child out of wedlock from another man, who was a servant. Standford’s Arrest With two mouths to feed, Standford set out to practice prostitution on her own, and it was then that she was arrested for theft. William Smith, who brought her to trial and was surprisingly frank in his testimony, related that he was walking along Shoe Lane after one o’clock in the morning when he was approached by Standford, who offered him to “take a Lodging with her.” He spent 2 or 3 three hours with her, all the while ordering drinks to be brought up from downstairs. He soon realized that he was missing money, and when he confronted Standford about it, she bolted from the room. A constable caught Standford running away from Smith in the street. He picked up one of Smith’s guineas after Standford had dropped it, and he found another in her hand and two in her mouth. He also discovered Smith’s handkerchief and pocket book on her. In his testimony, the constable called Smith a “Country Man” and described him as very drunk at the time. Standford’s version of the event was quite different. She claimed that Smith was drunk when she met him, and that he forced himself up to her room. There, he placed the four guineas one by one in her bosom and then threw her onto the bed. In the struggle, she speculated that his pocket book must have fallen out of his pocket, and when she discovered it after he left, she ran after him to return it. Not believing her story, the jury found her guilty, and she was sentenced to death. A Rejection and a Defense of Transportation After receiving her sentence, Standford’s friends pleaded with her to ask for a pardon in exchange for transportation. Standford refused, “declaring that she had rather die, not only the most Ignominious, but the most cruel Death that could be invented at home, rather than be sent Abroad to slave for her Living.” The author of the Lives of the Most Remarkable Criminals was baffled by Standford’s position and presents a lengthy defense of the institution of convict transportation: such strange Apprehensions enter into the Heads of these unhappy Creatures, and hinder them from taking the Advantage of the only possibility they have left of tasting Happiness on this side the Grave, and as this Aversion to the Plantations has so bad Effects, especially in making the Convicts desirous of escaping from the Vessel, or of flying out of the Country whither they were sent, almost before they have seen it. I am surpriz’d that no Care has been taken to print a particular and authentick Account, of the Manner in which they are treated in those Places; I know it may be suggested that the Terrour of such Usage as they are represented to meet with there, has often a good Effect in diverting them from such Facts as they know must bring them to Transportation, yet . . . if instead of magnifying the Miseries of their pretended Slavery, or rather of inventing Stories that make a very easy service, pass on these unhappy Creatures for the severest Bondage. The Convicts were to be told the true state of the Case, and were put in Mind that instead of suffering Death, the Lenity of our Constitution, permitted them to be removed into another Climate, no way inferiour to that in which they were born, where they were to perform no harder tasks, than those who work honestly for their Bread in England do, and this not under Persons of another Nation, who might treat them with less Humanity upon that Account, but to their Countrymen, who are no less English for their living in the New, than if they dwelt in Old England, People famous for their Humanity, Justice and Piety, and amongst whom they are sure of meeting with no variation of Manners, Customs, &c. unless in respect of the Progress of their Vices which are at present, and may they long remain so, far less numerous there than in their Mother-Land. I say if Pains were taken to instill into these unhappy Persons such Notions . . ., they might probably conceive justly of that Clemency which is extended towards them, and instead of shunning Transportation, flying from the Countries where they are landed, as soon as they have set their Foot in them, or neglecting Opportunities they might have on their first coming there, be brought to serve their Masters faithfully, to endure the Time of their Service chearfully, and settle afterwards in the best Manner they are able, so as to pass the Close of their Life in an honest, easy, and reputable Manner; whereas now it too often happens, that their last End is worse than their first, because those who return from Transportation being sure of Death if apprehended, are led thereby to behave themselves worse and more cruelly than any Malefactors whatsoever (Vol. III, pp. 287-289). The author’s cheery account of life as an indentured servant in the American colonies certainly makes transportation sound like a compelling alternative to execution. The reality of life overseas under such conditions, though, does not match this picture, and some criminals valued their liberty over enforced servitude, even if it meant their own death. In his account of her execution, James Guthrie, the minister at Newgate Prison, described Standford as “grosly Ignorant of any thing that is good.” He went on to say that “she was neither ingenious nor full in her Confessions, but appeared obstinate and self-conceited.” Standford continued to maintain her innocence in the affair with Smith, and she appeared indifferent about the fate of her child, expressing to Guthrie the hope that the parish would take care of it. Guthrie claimed, however, that “she acknowledg’d herself among the chief of Sinners.” Mary Standford was executed on Wednesday, August 3, 1726 at Tyburn. She was 36 years old. Executed alongside her were 3 other criminals. Thomas Smith and Edward Reynolds were both sentenced to die for highway robbery. John Claxton, alias Johnson, was put death for returning twice from transportation before his 7-year sentence had run out. Resources for this article: Lives of the Most Remarkable Criminals. 3 vols. London: John Osborn, 1735. Old Bailey Proceedings Online (www.oldbaileyonline.org, 26 January 2009), July 1726, trial of Mary Stanford (t17260711-51). Old Bailey Proceedings (www.oldbaileyonline.org, 26 January 2009), Ordinary of Newgate’s Account, 3 August 1726 (OA17260803). 1151: Konrad von Freistritz, ruined - 2019 1599: Elisabeth Strupp, Gelnhausen witch - 2018 1829: John Stacey, in Portsmouth town - 2017 1546: Etienne Dolet, no longer anything at all - 2016 1795: Jerry Avershaw, contemptuously - 2015 1530: Francesco Ferruccio, victim of Maramaldo - 2014 1949: Jacob Bokai, the first Israeli spy executed - 2013 1788: Not Jean Louschart, rescued by the crowd - 2012 1573: William Kirkcaldy of Grange, former king's man - 2011 1976: Valery Sablin, Hunt for Red October inspiration - 2010 1916: Sir Roger Casement - 2008 1747: Mary Allen and Henry Simms, Gallows Lovers 1786: Hannah Ocuish, age 12 1789: Catherine Murphy, Britain’s last burning at the stake 1719: Nicholas Horner, a minister’s son Entry Filed under: 18th Century,Capital Punishment,Common Criminals,Crime,Death Penalty,England,Execution,Guest Writers,Hanged,History,Other Voices,Public Executions,Theft,Volunteers,Women Tags: 1720s, 1726, august 3, convict transportation, mary standford, Tyburn	cc/2020-05/en_middle_0093.json.gz/line556
__label__cc	0.745079	0.254921	Once Upon a Time, Season 7, Episode 20: Is This Henry Mills? Gothel is casting her apocalypse spell and things are looking ominous. Lucy is quick to fill in Regina including that Henry and Jacinda kissed and the curse didn’t break and Henry doesn’t have his memories. Gothel also drops in to basically say how evil she is and how all humanity will die. Y’know just in case we missed that this spell was a bad thing Regina’s not having this, of course: but Gothel also happily lays out why the curse didn’t break. It seems Henry’s belief isn’t strong enough because he’s suffered too much pain: he beliefs his wife and child are dead. He’s an adult now without the faith he has as a child This is where we also have a lot of recaps of young Henry and Regina. There’s a lot of Regina both trying to hang on to her boy but also accepting she needs to let go and he needs to be able to live his own life - even if that’s outside of Storybrooke. Even if that’s in California. While Henry has his own conflicts - he doesn’t want to stay in Storybrooke not just because he wants to move on and see the world but because he’s the only person in Storybrooke who didn’t have a cursed identity. He is of this world more than any of them and he wants to be part of it At the same time when applying for college he realised everything he’s writing is a lie - and he’s not entirely of this world either. The magic and wonder of Storybrooke is equally part of him and not something he can ever live or experience in the outside world - which is also complicated And I want to know where Granny learned how to fix cars. Back in Hyperion Heights, Regina continues to struggle to find some way to stop Gothel - and Rumple arrives offering help. Regina is not amused to see him given his betrayal - but Rumple has a peace offering - a memory potion which may work on Henry. He has been doing some thinking - he’s beginning to accept he may new reunite with Belle. In which case he needs to do the best he can with the family he already has. Which is nice to have him back on side, at least for a little while until Rumple has yet another of his many many changes of hearts. Unfortunately when Regina goes to Henry with this potion it doesn’t work. More, despite all this theorising last episode, Henry has gone back to completely disbelieving in magic; that he can’t be Lucy’s father, that there is no special magic or woo-woo at all. Every doubt he has he rationalionises… like an adult. Everything Regina says, Henry has a reasonable explanation for. Because he’s not a wide eyed child, not the Truest Believer (which has always struck me as a bizarre title - like “I’m the man with the least connection to humanity!”), he’s a man who has suffered losses and faced brutal, bitter reality. And, also, saying “I’m your mother, here’s the adoption papers” isn’t exactly an easy sell. And Regina realises that his pain is based on solid reality - because those his wife and child didn’t die, he did lose them and he wasn’t able to protect them. Even the Storybook which she and Lucy dig up from Victoria’s grave doesn’t break the curse. Of course part of why it’s so unbelievable is not just fairy tales - but time travel. This curse, to succeed, didn’t just curse them and drop them on Earth, but also moved them back in time. This was necessary, per the show, to stop people like Snow White and Emma from intervening once Henry, Regina et al fell off the map. Which sounds like a decent way to explain where these people went, I guess. All those flashbacks aren’t actually flashbacks - young Henry debating going to college with Regina is happening now - but on the other side of America. They’re in Storybrook (New England) along with Emma, Snow, et al which is why none of them are riding to the rescue Yes it’s going to get confusing Henry walks out on Regina because this is all so ridiculous to him (on account of being, well, objectively ridiculous) but he’s still faced with Lucy’s fury. And Regina has dropped the adoption file she dug up on him… so he calls the number And gets hold of Henry. His younger self. I’m sure we’re all supposed to scream paradox or something here. It doesn’t break the space time continuum but it does shatter the curse entirely, leaving him with all his memories. And the ability to give himself a creepy pep talk about home being family and since his family is always going to be with him he shouldn’t worry about leaving Storybrooke because they’ll always be there like a magical Deus Ex Machinae. Before the curse breaks we have a minor storyline - Sabine and Jacinda go looking for Naveen and end up kidnapped by Facilier And Killian tries to stop Tilly from casting the human genocide spell. Especially since as the spell progresses the coven members turn into trees - which is kind of ascension since all humans are going to die and they get to live on as magical foliage. Yay… I guess? Tilly won’t listen to Killian (she’s now entranced by Gothel) especially since proximity seems to be triggering the whole heart poison thing - and he runs to Rumple. Who gives him a quick guide - yes magic is real, fairy tales etc etc. And Killian is more inclined to agree than Henry because he just saw someone get turned into a tree. Which is convincing. Rumple also calls him Captain which rather hugely amuses me They follow Rumple’s plan, grab Margot at the bar and run back to the cave to have Margot reach out to Tilly. True love is, of course, a staple of this series And, yes I do love that one of the most powerful, world saving forces of this episode is the love of two women. I love that their relationship is presented as that powerful, that meaningful and that important and equal. However I can’t help but point out this is the seventh season and there are only 2 episodes left, so let’s not go all praiseworthy when a firm “it’s about time” may be more appropriate. Especially since their relationship could have done with a little more development here to make it feel more pivotal. But I’ll take it, I’ll cling to this one Tilly continues to use magic against them - shrinking them. Regina goes to confront Gothel alone, with nothing but a stick. It goes exactly as badly as you’d expect. Regina is unconscious and Henry arrives, late, to be all tearful and heartbroken that he didn’t believe sooner. And he loves her - and kisses his mother Yup, that would be True Love’s Kiss. And I have to love how Once Upon a Time has continually upheld the power and importance of True Love’s Kiss but rarely held it forth as being a romantic kiss. Family has been upheld as something immensely more powerful to the story and magic. The curse is broken, everyone has their magic and memories back And in the Cavern, Margot - now Robin - manages to bring Tilly - now Alice - back from the circle of magic and Gothel’s control. And there’s a lovely romantic kiss from Alice and Robin which is all joyful as we move into the final confrontation. Regina stands up with all magic to confront Gothel - but her magic alone is not enough Now in my head cannon, we then get Rumple, Zelena, Regina (hey throw in Facilier) standing together and nuking Gothel down to ash with so much magic that that ash still glows. Because I’m 5 and I still like big explosions and awesome arsekicking Instead we get Alice, bolstered by the love of her girlfriend and father, adamantly rejecting her mother. Insisting she isn’t alone, an orphan or abandoned, she is loved and has a family that has her back: she choses love not bitterness (look, it’s fairy tale land, it’s allowed to be twee). She’s also duly pitying to Gothel; sorry that life has turned her so and has been so cruel to her, remembering that Gothel is a victim and turning her into a tree. Which is probably not a fate Gothel would entirely object to Until someone needs to build a new shopping centre there, anyway. And she even has flowers grow around her base in a nice gesture of hope, forgiveness, understanding and genuine tweeness. Young Henry even starts up in a nice shiny affirming monologue but I’m rapidly reaching the end of my tweeness tolerance here. And besides I’m not entirely sure if “choose love not hate” is a message I’m all keen on. I mean, don’t get me wrong, I’m not behind human genocide. But Gothel was a woman with legitimate grievance beyond mere hate. And love isn’t going to grow her grove back Oh remember Tiana and Cinderella (they have their memories back, they’re not Sabine and Jacinda any more) who were literally locked in Facilier’s cupboard to keep them out of all the action and not even pretend they’re relevant characters any more? Well, they escape with all their memories back and attack Facilier with sticks… and he runs away Why since he now has all his magic, I have no idea But we’re not finished - Facilier goes to Rumple’s house to steal his… photo album? I have no idea why. Rumple follows up furious that Facilier has messed with his personal possessions and memories of Belle. Especially since he’s finally acknowledging that he may never get back to her. But despite some beginning magical strangling (because the Dark One has his powers as well) he stops because he really is trying to be a better person Facilier mocks him - he must be the worst possible version of himself. After which he is stabbed in the back with the Dark One dagger By Rumpelstiltskin - a second Rumplestiltskin, all golden skinned and Dark-Oney. This is the Wish Realm Rumpelstiltskin and totally bad and evil and the big bad we’re actually going to face… ..apparently? I mean some foreshadowing would have been nice. And there’s only 2 episodes left. That’s a bad time to derail everything to try and introduce a new storyline. It feels almost like they finished the season and then turned round and yelled “shit we got two more episodes to fill?! How did we not see this”? Or they are trying to set up the big villain for season 8 only season 8 isn’t actually going to happen.. Are you going to end on a cliffhanger, Once Upon a Time? Posted by Sparky at 12:00 PM Labels: 3.5 Fangs, AMC, fairy takes, magic, Once Upon A Time, television The Devil's Revolver (The Devil's Revolver, #1) by... Supernatural, Season 13, Episode 22: Exodus Shadowhunters, Season 3, Episode 8: A Heart of Dar... Westworld, Season Two, Episode Three: Virtù e Fort... iZombie, Season 4, Episode 10: Yipee Ki Brain, Mot... Lucifer, Season 3, Episode 23: Quintessential Deck... The Handmaid's Tale, Season Two, Episode Three: Ba... Once Upon a Time, Season 7, Episode 20: Is This He... Into the Badlands, Season 3, Episode 3: Chapter XI... Fear the Walking Dead, Season 4, Episode 3: Good O... The Originals, Season 5, Episode 3: Ne Me Quitte P... The Handmaid's Tale, Season Two, Episode Two: Unwo... Supernatural, Season 13, Episode 21: Beat the Devi... Westworld, Season Two, Episode Two: Reunion	cc/2020-05/en_middle_0093.json.gz/line561
__label__wiki	0.553092	0.553092	Leah's Little Blog of Gaming HEY, LISTEN! PLEASE READ THIS HEY, welcome back to GP! You should probably check this thread out here if this is your first time back on the forum since our upgrade. Suffice it to say, some things have changed! CLICK HERE to read more about it, including some new functionality. A blog by Leah Entries in this blog Top 5 Embarrassing Games to Play in Front of People Games do an excellent job at telling stories and making us laugh or cry and making us happy or sad. However, sometimes video games aren“t always great to play in front of others. While it may be awesome to play something like a Zelda or Mario game in front of your family (I know my own dad enjoys watching my siblings and I play those two series) and have them enjoy it just as much as a movie, games like the ones I“ll be discussing here may not be. Whether it“s something extremely sexual or just plain awkward, you might want to think twice before letting grandpa watch you play any of these games. Though perhaps you're masochistic and would enjoy the embarrassment. Nonetheless, read on and find out exactly what will get your face redder than a tomato. Nintendogs While the Nintendogs series may not be something that suits the tastes of many gamers out there, I“ve still found the games highly enjoyable. Plus, let“s face it: who can resist such adorable puppies and kitties? It“s not as difficult to clean up after them or give them baths, either. There is something that these little critters possess that is just as infuriating as their real-life counterparts, howeverâ€¦ and that“s the inability to understand commands 100% of the time. To get to the point, what“s embarrassing about this game is that your family and friends are going to start thinking you“ve lost a couple of your marbles when they start hearing you shout â€œPUMPKIN, SIT DOWN!â€ over and over since your darling puppy can“t seem to differentiate between that and rolling over. Final Fantasy X Final Fantasy X is one of the best games I“ve ever played. It features incredibly beautiful music, environments, characters, and a great story. However, like any other game, it can have its bad moments. One of which is the infamous laughing scene between the main characters, Tidus and Yuna. While the laughing is meant to be forced and not serious, those around you watching probably don“t know that and you“ll soon find yourself slinking down into your chair until the cutscene is over. No More Heroes Let me tell you something. If I had known what I was getting into that Christmas day when I popped my new copy of No More Heroes into my Wii and started playing in front of my siblings, I wouldn“t have done it then. As soon as the game began, I was greeted with bloodshed and colorful obscenities that made my face turn a brilliant red as my siblings watched on. It didn“t stop there, either. I soon found that in order to recharge my weapon, the beam katana, Travis had to thrust it up and down in front of him in a way that mimicked masturbation. Because of this, I needed to find a save point, and quickly, before anybody saw any more of what was going on. The cherry on top: saving by means of using the toilet. I didn“t play the game for a long time after that, but when I did, I blasted right through and enjoyed it immensely (and played without anyone else in the room, of course). Bayonetta Bayonetta is an odd game and maybe it“s not quite a shock that it“s on this list. It is well known that the game presents an abundance of sexual themes that may cause for awkwardness amongst you and those watching (poses, crotch shots, and the appearance of some enemies). However, there“s some other unusual moments that will leave non-gamers (and maybe even you) scratching their head. The most discussed is the fact that Bayonetta attacks with her hair, and not just that, but that her whole outfit is composed of her hair. It may not be obvious at first, but it“s soon realized when you use her climax attack and witness her hair-clothes coming off her body and spiraling around her. Try explaining that to your folks. Shin Megami Tensei: Persona 4 Persona 4 is another one of my favorite games that made its way on this list. However, it“s not absent of any risquÃ© and uncomfortable moments. It retains the same demons (or personas as they“re known in this game) as the rest of the series, such as the ever-popular Mara, that may get some questioning looks from your family. This game is a bit different from the other entries in the series, though, with how it treads through the lives of everyday teenagers. Thus, it brings typical teenage shenanigans and problems (such as questioning sexuality) to the table more often and makes that present in the game“s characters, bosses, and dungeons. It makes up for it with some hilarious moments everyone can relate to, though. Honorable Mentions Eternal Sonata – â€œWhy is Chopin fighting monsters?â€ Metal Gear Solid 2: Sons of Liberty – naked Raiden doing cartwheels Enchanted Arms – overly flamboyant main character and incredibly bad voice acting Tales of Symphonia: Dawn of the New World – the two main characters will make anyone cringe (and you even more so with others watching) and â€œCourage is the magic that turns dreams into reality!â€ What are some embarrassing games that you have played? Why Grand Theft Auto Needs a Female Protagonist The Grand Theft Auto series is undoubtedly a very popular one. In the many different installments developed, players have been hijacking cars and causing havoc for years, especially with the popularity of Grand Theft Auto III, Grand Theft Auto: Vice City, and Grand Theft Auto: San Andreas. Now, we“re getting a brand new entry added to this awesome series from Rockstar. With the recent announcement of Grand Theft Auto V, many fans are speculating over the various possibilities the game could present. One of the big areas of discussion is who the protagonist of this game might be. Rockstar has done a fabulous job already representing different races, ethnicities, and nationalities. Furthermore, while it's mostly talk of someone that has already appeared in previous Grand Theft Auto installments, those who do offer their own ideas of someone that is new to the series rarely suggest a female protagonist over a male one. Look at all those handsome menâ€¦ Butâ€¦ where are the ladies? Getting to the point, what the Grand Theft Auto series desperately needs is a female protagonist. After over ten years of the series, I believe we are exceedingly overdue for a woman to take the reins. Not just an over-sexualized gal who barely wears anything, either, but someone who“s strong and kicks an extreme amount of butt. We see men as the main characters in games such as Grand Theft Auto all the time (not to mention movies, television, and books). A woman“s impact and view into the crime world of the Grand Theft Auto series could present something fresh for players. The dramatic change from a male to female protagonist could be great if necessary and deep thought is put into place. It's even difficult to find female protagonists in any game that exude these qualities. While Lara Croft and Bayonetta are big name ladies and do get the job done well, they obviously put out as much fanservice as possible. While the way they are presented isn't necessarily wrong, it's less than ideal. Moreover, let“s face it: do we really want another typical woman like that to play as? Samus from the Metroid series, on the other hand, is an excellent way of having a woman being portrayed in video games (well, maybe not in Metroid: Other M, but that's a topic for another day). Other women that I picture in mind include Jade from Beyond Good & Evil and Lightning from Final Fantasy XIII. These ladies know how to get stuff done. Now getting back to the topic at handâ€¦ Gamers may be scared to even try out a game that has only a female protagonist. It“s happened before with games in the past such as Final Fantasy X-2 and Wet. Not to mention the way our society is driven: growing up with stories about men rescuing the damsel-in-distress and therefore saving the day. Developers like Rockstar realize this and it“s probably why they haven“t tried it yet. However, if they play their cards right and put careful thought into how this could all work out, gamers will put aside the fact that the character that they are playing as is female and appreciate that she is just as strong and adamant as the characters Rockstar has created before. With Grand Theft Auto being a big-name series, it could possibly even lead the game industry in a new and different direction with how female protagonists are handled and trying to insert them as lead characters more often. Not to mention possibly bringing some more female gamers into trying out the Grand Theft Auto series. While this is a fake screenshot, at least someone else out there desires a female protagonist enough to make it in the first place. While I would love for it to happen in the upcoming release of Grand Theft Auto V, it most likely won“t happen (and if it does, I will most certainly be much more excited and more apt to pick the game up!). It may be a while before Rockstar does put a lady as the main character of a Grand Theft Auto game, unfortunately. Hopefully, fans of the series share my thoughts and will become vocal and noticeable enough to catch Rockstar“s attention so that this may be a plausible future. Images courtesy of: gta.wikia.com en.wikipedia.org Harvest Moon: The Tale of Two Towns Review Publisher: Natsume Developer: Marvelous Interactive Platform: DS, 3DS Release Date: Out now ESRB: E for Everyone This review is based on the 3DS version of the game. Being a fan of Harvest Moon since Save the Homeland on the PS2, it made me excited to see the series get its first installment on the 3DS. This time, it boasts a thrilling new feature: being able to live in one of two towns (hence the title of the game). Does the game present itself well enough with all its new additions? Will it all warrant a playthrough over other Harvest Moon games you might“ve been skipping out on? Before the actual game even starts, you are greeted by a cheery, upbeat FMV opening sequence. Something like this is not usually seen in a Harvest Moon game, so it“s a bit impressive. The story, like one for any other Harvest Moon game, is incredibly simple. You crash your horse cart and are found by the mayors of two neighboring rival towns. They give you the option of living in Bluebell (a European-centric town that focuses on livestock) or in Konohana (an Asian-centric town that focuses on crops). Regardless of your choice, you can raise livestock and crops and interact with the villagers in both towns, as well as the ability to change residencies between either town (at a cost). It is soon that you realize that the goal of the game is to get the mayors to befriend each other and reunite the two towns. In The Tale of Two Towns, your main objective is farming, of course. Along with cows, chickens, and sheep, new animals to add to your barn are brought into this installation, such as alpacas. Raising crops is pretty much the same as in any other Harvest Moon title: dig a hole, plant your seeds, and water until they“re ready to harvest. There are new bonuses in this game, however, such as creating trenches to ease your amount of watering and being able to water twice a day to reduce the amount of time needed for a crop to mature. Other features new to the Harvest Moon series that are present in The Tale of Two Towns include a request system, hand fishing, and bug/creature catching. All of these make the game much more pleasurable and apt to keep your attention longer, as well as put more money in your pocket and make the townsfolk appreciate you more. Of course, you have the option of taking a bachelor or bachelorette“s hand in marriage, of which there is a wide variety to choose. It“s almost hard to choose just one, though! Another new addition to The Tale of Two Towns is being able to take your potential husband or wife on dates, which helps increase their relationship with you. When you two lovebirds do get married, you“ll also be able to have a baby. Throughout the game, you“ll get to experience the game“s beautiful mountain environment, as well as the unique architecture for both towns from which they derive their culture. The music is equally as fun and wonderful and I often find myself having it stuck in my head long after playing. The game looks and sounds splendid, but because the 3DS version is basically a port of the DS version, it does not take full advantage of the system“s graphical prowess. Speaking of which, it“s important to denote the differences between the DS and 3DS versions. The 3DS version does have enhanced graphics that will pop out slightly when the 3D is turned on, however, it quickly loses its charm and there“s no real point in keeping the 3D turned on (not to mention NPCs“ portraits will look slightly blurry). The 3DS“s wider top screen proves advantageous over the smaller DS screen. Other 3DS-specific features include a special animal petting minigame and Street Pass. The Tale of Two Towns is not without its faults, however, of which there are quite a few. For some reason, the game will be restrictive on what you name your character/animals/etc. Even seemingly harmless names will sometimes be blocked. The off-putting saving system, which only allows you to save before going to bed and ending the day, will sometimes become infuriating for those who are prone to wanting to save often and does not bode well with the 3DS version“s tendency to freeze. The 3DS version also unfortunately suffers from some slowdown issues. With these thoughts in mind, it is more worth it to pick up the DS version of The Tale of Two Towns over the 3DS version, especially with its lower price tag. Despite some shortcomings, you will enjoy either version of this fresh and innovating installment of the Harvest Moon series (especially when there“s alpacas involved!). Pros: + Freedom to embrace game“s challenging portions, or simply keep things basic and easy + New features keep things fresh + Cute graphics/art style and fun music Cons: - Freezing and slowdown issues in the 3DS version paired with restrictive saving system will frustrate many - Loses luster after marrying and completing â€œstorylineâ€ - Restrictions on naming characters/animals/etc. Overall Score: 7 (out of 10) Good Fans of the farming simulation genre should definitely have a place for this on their shelf. Shinobi Review Publisher: Sega Developer: Griptonite Games Platform: Nintendo 3DS Release Date: Out now ESRB: T for Teen Like a ninja from out of seemingly nowhere, the Shinobi series sees its first release in over seven years on the Nintendo 3DS. It also returns to its roots by favoring side-scrolling over the 3D worlds of the last two entries. Despite being a well-received series, I have never picked up a Shinobi title before this one. My avoidance towards it is mostly because the games can be notoriously difficult. Is this game right for newcomers to the series, or is it too hard and should be left for the old fans? In Shinobi, you take the role of the ninja Jiro Musashi (the father of Joe, the famous ninja of previous Shinobi games). What little story there is doesn“t really matter (and to be frank, it“s confusing anyway) – you“re going to be playing for the frantic platforming action. You have an array of ninja equipment and moves at your disposal and you“re going to be wanting to use every last thing such as your trusty katana, kunai, magic, and parrying. Even during the beginning stages, you“re going to be wanting to have some fast reflexes, knowledge of your attacks and defense, and be expectant of whatever may be lurking at the sides and top of your screen. In later stages, enemies will start to become especially overwhelming with their shurikens and whatnot pretty much filling up the whole screen. This game is hard. Even on beginner and normal modes, you're going to have a tough time getting through certain spots and bosses. Thankfully, beginner mode does offer infinite lives to help those new to games like Shinobi. Included is also a very hard mode that boasts that nobody will be able to complete it unless they are a real ninja. In this mode, you're only granted 1 extra life, 3 continues, no auto-saving, and even more challenges spread throughout the game. If you're able to beat the game on this mode, you are a god amongst men. Unfortunately, multitudes of spastic enemies aren“t just what makes this game difficult. The controls do feel a bit stiff and in this kind of game, it makes a major difference. With complicated wall-jumping and such over bottomless pits, these controls could mean many irritating deaths. The graphics for Shinobi are okay, but like the story, they aren“t going to be the focus. Level design takes priority anyway and you“ll have the pleasure of going through awesome renditions of feudal Japan and a future of mechanical machinery. The 3D effects are sparse and minimal with some objects popping out slightly. Even though there are some problems with double images when the 3D is turned on, it“s still pleasant to look at. There are also cutscenes in Shinobi with simplistic and minimal animation, but they“re beautiful and work out perfectly. The only voicing done is from a narrator reading some inspiring (and sometimes cheesy) quotes that will pop up from time to time during these scenes. The only negativity about these cutscenes is that they are unskippable and may be forced to watch them repeatedly with how often you“re going to be dying. The music for Shinobi is great and fits the game perfectly. The main theme that plays on the main menu is simply awe-inspiring and gets you pumped and ready to begin your adventure. A neat little note about the music is that Norihiko Hibino of Metal Gear Solid fame composes it. Some cool little extra features put into the game include unlockable concept art, music, cheats and more. There are even achievements like those for PS3 and Xbox 360 games in Shinobi for those who are fans of that. With the extras this game provides, you“ll be pouring even more time into it and get your money“s worth. Shinobi is really a game made for fans of the series, although it seems to be a good entry point to those new to it and seeking to get into some ninja action. Despite the game kicking your butt nonstop, there's nothing like the feeling of overcoming the intense obstacles in it. Pros: + Pure and intense side-scrolling, platforming action + Fun extras like achievements and unlockables Cons: - Stiff controls can lead to many infuriating deaths - Unnecessarily and mercilessly hard at some points Overall Score: 7.0 (out of 10) Good Fans of Shinobi and other similar series should consider picking this up, but be somewhat wary if you“re not used to fast-paced, butt-kicking action. Review: Theatrhythm Final Fantasy Developer: indieszero Publisher: Square Enix Platform: Nintendo 3DS Release Date: July 3, 2012 (out now) ESRB: E10+ for Everyone 10 and older The Final Fantasy series has not only graced us with memorable characters and stories, but also breathtakingly beautiful music. Terra“s Theme, To Zanarkand, Aerith“s Theme, and The Man with the Machine Gun are just few of many. So, why not make a Final Fantasy rhythm game? And that“s just what Square-Enix did when they brought out Theatrhythm Final Fantasy. It doesn“t disappoint at all, either. Right off the bat, Theatrhythm asserts itself as a creative and unique sort of rhythm game. Not only will you be tapping and sliding your stylus to Final Fantasy tunes, but you“ll also be leveling up characters, honing their stats and abilities, and collecting items and collectables. In a broad sense, it“s an RPG/rhythm-game hybrid. There are three modes for you to play in: series, challenge, and Chaos Shrine. Series mode allows you to play five songs from a Final Fantasy title in a row. Challenge mode lets you choose a single song to play through. Both series and challenge modes have three difficulty settings: basic, expert, and ultimate. Basic is pretty, wellâ€¦ basic. Those familiar with rhythm games will have absolutely no problem perfecting all the songs in this mode. Expert is a lot more challenging than basic, but ultimate is where the real fun is. It“s so fast-paced and will get your adrenaline pumping. You have to be a real rhythm game master in order to 100% all the songs on ultimate – or get all critical on each song, if you want to push it up a notch. The only annoying thing is that expert and ultimate modes are not available from the start. The third mode, Chaos Shrine, is where you“ll be spending a lot of your time if you“re interested in farming for rare items and shards (which are needed to unlock new characters). With Chaos Shrine, you receive â€œDark Notesâ€, which consist of two songs. Every single Dark Note is randomly generated, so the amount of possible combinations for songs, scores, difficulty, bosses, and items is practically endless. The main problem I have with Chaos Shrine, however, is that there are only 20 songs (out of 70 or so that Theatrhythm has) that it uses. So, I hope you like hearing Fight with Seymour, Eternal Wind, and Mambo de Chocobo over and over again. Regardless, the random generation within Dark Notes still makes Chaos Shrine fun. The selection of songs chosen to be included in the base game of Theatrhythm is pretty nice. Most of the classics you know and love are in there ready to be played countless times. Of course, some of your favorites are probably missing and were made into DLC instead. Each song is only a dollar, but if you wanted all the ones currently availableâ€¦ it would be a little over $40 altogether. It“s a pretty steep price, but diehard Final Fantasy fans have had no trouble paying the money for all those songs. I“ve not bought any yet myself, but if I did have 40 bucks magically appear in my wallet right now, there might be a small chance I would put that towards some eShop cards to buy some sweet Theatrhythm tracks. And hey, with how much I“ve fallen in love with the game, it would be totally worth it. I also really enjoyed the wide variety of characters that are available to use. Not only are there 13 at your disposal right at the very beginning, but there“s another 13+ to unlock as you gather more shards throughout your playthrough. And they“re all so cute in Theatrhythm“s art style! Though I won“t spoil who you can get, I am somewhat disappointed Fran, Balthier, or Rikku weren“t implemented as playable characters. And as much as I dislike paid DLC, I would totally buy more characters to use in the game. I briefly mentioned that Theatrhythm has collectables. The main one is an album to collect cards in (called CollectaCards). There are 81 unique CollectaCards, however, if you want a 100% complete album, you“ll need 10 of each. When you collect four of one card, it will turn into a holofoil. And with seven of one card, it will turn into a super shiny platinum. Thankfully, you get plenty of CollectaCards throughout the game whenever you finish a song (especially in Chaos Shrine), so the feat of completing your album isn“t as difficult as it sounds. There are also unlockable videos to watch in theatre mode and songs to listen to in the music player. That“s self-explanatory, though. The last mode in the museum is records. Records includes your total play time, total number of chains, character usage, and so on. There are also trophies for you to achieve. There are 64 total trophies, and some are quite difficult, so those are sure to keep any completionist busy for a while. There“s so much to keep you occupied and entertained in Theatrhythm that you“ll be playing for hours on end. The replayability is sky-high! Not to mention it“s perfect for playing in short bursts. Theatrhythm was one of the most delightful gaming experiences of the year for me, and still is, since I“m aiming to unlock and achieve as much as I can. The game has also helped me rekindle a love for Final Fantasy. Now I want to go and play the games I haven“t touched or finished, like Final Fantasy IX and Final Fantasy VI (oh, if only I had the time!). I“m sure I“ve made my point now about how much I love Theatrhythm. It“s a 100% must buy for any other Final Fantasy fans out there. And even if you don“t enjoy playing the main games in the series, but adore the music and you“re a fan of rhythm games, get it anyway! You“ll love it, I promise. Pros: + Mash-up of rhythm game and RPG aspects is unique, refreshing, and extraordinarily fun + More than 70 classic Final Fantasy songs to play, with over 40 to buy as DLC + Over 13 Final Fantasy characters to unlock, as well as other collectables + The chibi art style is adorable Cons: - Expert and ultimate modes for songs not available from the start - Chaos Shrine only uses 20 of Theatrhythm“s playable songs Overall: 9.5/10 Fantastic Theatrhythm Final Fantasy is a dream come true for Final Fantasy fans and rhythm game enthusiasts. If you“re either or both, there“s absolutely no reason not to pick this game up. Press related gp.press[at]gamepodunk[dot]com contact[at]gamepodunk[dot]com Game Podunk Game Podunk is your destination for video game news, reviews, and features! We also have a great community that fosters a positive and friendly, familiar spirit similar to that of a small town, or "podunk" if you will. If you love video games, you'll feel right at home here, so join us and become a part of the community today!	cc/2020-05/en_middle_0093.json.gz/line564
__label__wiki	0.609732	0.609732	Jack White American vocalist and guitarist The Jack White birth date is 9 July 1975.He is an American artist. He is musician, songwriter and record manufacturer. He is multi-instrumentalist and periodic acting professional. He was famous as the vocalist, guitarist and piano player of The White The White Stripes in Feb 2011, as well as a artist and artist for The Raconteurs and the percussionist of The Deceased Weather. White launched his first appearance single record Blunderbuss on Apr 24, 2012.He started enjoying an device, a drum, at the age of six years old. White was already enjoying the doldrums and Sixties rock. He performed percussion, well I think I'll play guitar then. White established The White in 1997.The group started its career as aspect of the Michigan garage rock underground music scope. The White were finalized to Tuscany Records. The record gradually actually peaked at No. 38 in Billboard's Separate Collections graph when the group had established their popularity. The White made history by enjoying the quickest show ever only enjoying one note, in St John's, Newfoundland in This sseason 2007. 0 Responses to “Jack White American vocalist and guitarist” Jenna Jameson worlds first performer Jenna Jameson worlds first performer The Jenna Jameson was calved April 9, 1974.Her Birth name was Jenna Marie Massoli. She is a Unit... Kobe Bryant professional basketball Performer Bio Kobe Bryant professional basketball Performer Bio Kobe Bean Bryant birth date is Aug 23, 1978. His nicknamed is the Black Mamba. He is... Miguel American musician Bar Refaeli Israeli Model and businesswomen Person... Ray Rice Football Performer Paul Harvey ABC Radio Networks broadcaster Alicia Keys Singer And Best Performer Michael Oher American football offensive tackle OJ Brigance National Football League Best Player Beyonce Giselle American singer Star Joe Biden Vice President of the United States Lupe Fiasco American Performer Martin Luther King Jr Biography Richard Blanco United State Teacher Tony Gonzalez United State Football Player	cc/2020-05/en_middle_0093.json.gz/line567
__label__wiki	0.745623	0.745623	The road back to Bonneville... Thanks to Rob Ida! October, 1970: The remains of the Gyronaut's canopy, tail and bodywork get inventoried to assess the extent of the crash damage. Still with an eye on reclaiming the world record now held by Denis Manning and his Harley-Davidson streamliner, they decided to mildly repair the body in order to create a new Gyronaut by taking molds off the body pieces with the hopes of lengthening the chassis to fit two Triumph Trident engines. The plans fell through, however, when Leppan needed to focus on running his dealership rather than running for the record. Fast forward 43 years to the night before its departure to be restored. At this point, Bob Leppan had the chassis restored by Jim Lamb and Tony Kulka at Jefferson Motor Service, but the engines and body remained untouched since the early 1970's. Both the canopy and the engine cover were gone and needed to be completely fabricated. All loaded up and secured in the Horseless Carriage trailer, the Gyronaut is about to embark on a cross-country trek from California to New Jersey to Detroit and finally to the Bonneville Salt Flats where it is planning to be run again for an historic exhibition to celebrate its return home. The Gyronaut never had it so good during its competition days. Now it gets to relax in the comfort of an enclosed trailer for its journey back in time. Typically towed on an open trailer exposed to wind, rain and road grit, the Gyronaut has earned its retirement from competition and deserves its travel protected from the elements. Upon arrival at Rob Ida's, the Gyronaut is immediately greeted by its proposed Bonneville tow vehicle, a 1948 Tucker recreation built by Rob Ida Concepts for the upcoming movie, Sin City II. With little time before Speed Week 2013, there's no time to waste admiring the view. The old fiberglass and missing pieces need the full attention of the crew tasked with turning the clock back almost half a century. If you're not familiar with some of the cars to come out of the shop at Rob Ida Concepts, then you've been missing some of the coolest rides ever created. Here's just a few samples of the top quality work that goes on every day at the shop. It's not work, it's passion... The distinctive profile of the Gyronaut starts to take shape with Sean Tucker shaping the foam into the contours of the Gyronaut's missing pieces. The entire process took place under the protective cover of the next twin-turbo'd Tucker being created. It was absolutely appropriate to have these two beautiful creations over and under during both of their simultaneous builds. Sean, his brother Mike and Dad John Tucker, Jr. are also keeping the legend of Preston Tucker and his car alive over at Preston Tucker, LLC. Check them out when you get the chance... The lengthy process of accurately recreating the missing parts is begun by building the foam profile of the Gyronaut from original drawings, blueprints and vintage photographs. Sean Tucker, one of Preston Tucker's great-grandsons, traveled long distances to help with the project. The complex curves of the Gyronaut's profile really is now taking shape. The Circle of Life: 67 years ago, Alex Tremulis helped Preston Tucker realize his dream car by styling the most radical car of the time. Here, Preston Tucker's great-grandson, Sean Tucker, helps shape the missing canopy for Alex Tremulis' Gyronaut, now owned by Alex Tremulis' nephew, Steve Tremulis. Add in another of Preston Tucker's great-grandsons (and Sean's twin), Mike, and you've got a story that will be told for generations to come. And where else would all of this take place? None other than under the guidance of Rob Ida at Rob Ida Concepts where his Granddad, Joe, and brothers Frank and Dominic signed up to be a Tucker dealer in Yonkers. That love for all-things-Tucker has carried on through the generations for all three families who now find themselves intertwined in the dreams their forefathers created and in the process making new stories for future generations, young and old, to enjoy time and again. Goosebumps!!! With the fresh fiberglass laid up and curing, at last the Gyronaut is starting to look more like it did in the middle of the last century. But there's still plenty of work to be done to bring the body back to its former glory. Endless sanding, shaping and fitting is required to obtain a perfect fit for both the old and new body panels. The engine's air intakes are recreated on the sides of the engine cover. These provide a cool 200MPH breeze over the air-cooled twin-Triumph Bonneville engines that lie beneath. The canopy gets fitted with the plexiglass windshield that used extremely complex curves to fight wind resistance. One can only imagine the difficulty of wrapping the windshield to fit the various contours of the original flowing design. For the first time in 43 years, the Gyronaut has its canopy back over the driver's seat. After countless hours of prepping the vintage fiberglass to accept a new coat of Titian Red, Rob Ida suits up to spray the first coats onto the once-bare body parts. Rob Ida mixing up a quick batch of Sebring Silver to add finishing touches to preserve the rear access panel that still bears the Gyronaut's original pinstriper's signature, "Wild Bill" of Detroit. All the body pieces now wear the colors of the record-breaking runs of 1966 when the Gyronaut captured the title as "World's Fastest Motorcycle". While the Gyronaut chassis awaits its reconditioned body parts, what better company to hang out with than a Porsche 550? Bob Ida, Rob's Dad, looks on as Rob prepares the bellypan for another coat of paint. The teamwork of the father and son is evident in their attention to detail that most builders often miss. John meticulously works on the edges of the engine cover to ensure a precise fit with both old and new fiberglass. Every piece of the Gyronaut's body received the same attention to detail in making the parts fit to both the chassis and the adjacent body panels. Ryan fitting the nosecone to the bulkhead. Both the nosecone and the canopy share just a two inch landing on the front bulkhead to conteract the force of a 250 MPH wind. It's the Gyronaut's low coefficient of drag that keeps those forces to a minimum in order to achieve the highest speeds possible. Arty buffing out the freshly laid paint. Hour upon hour of sanding out the finish with finer and finer sandpaper and then to several buffings brings out the most beautiful colors within the metallic Titian Red and Sebring Silver. By the end, Arty knew every square inch of the Gyronaut's paint and had each one shined to perfection. Rob sanding the nosecone while ensuring that every bit of the Gyronaut's skin is consistently smooth and blemish free. In the early 1970's the Gyronaut was entirely stripped of its 1970 colors and stored for the next 40 years. The only paint that was original was the signature that Bill Betz had hand-lettered on the rear access panel. That signature by "Wild Bill" was preserved by Rob Ida using the Sebring Silver to frame Wild Bill's handiwork. Wild Bill is still at it, and he will once again recreate his pinstriping and lettering exactly as he had done it just before the Gyronaut set the record 47 years ago! Ryan, John and Arty assembling the Gyronaut for the umpteenth time while the Ida Tucker keeps an eye (or three) on their progress... The Tucker and the Gyronaut side-by-side for some quick photos before more polishing and fitting. Rob's 356A and Triumph Bonneville complete a scene overflowing with awesomeness... As they will appear on the salt, except with a bit more distance between the two, both Alex Tremulis designs look as timeless today as when they were first created. It's hard to believe that just 17 years separates these two advanced concepts... The Idas taking a moment to admire the view of their Tucker accompanying the Gyronaut for a quick photo op. No one could take their eyes off the pairing. Perfect from every angle... John, Rob, Arty, Bob and Ryan stand proud with their masterpiece. Inside, Rob's Triumph Bonneville and two Tuckers wait their turn for a photo op with the streamliner. Bonnevilles everywhere you look. Rob's Triumph Bonneville alongside the twin-engine streamliner powered by none other than two of the early Triumph Bonneville powerplants. The Gyronaut would be last and fastest in Triumph's reign as World's Fastest Motorcycle, starting in 1956 with the Devil's Arrow/Texas Ceegar, and ending in 1970 with the Gyronaut. On a side note: Land speed racing history again being attempted by Triumph? The latest attempt as a factory effort to set some speed records at Bonneville, this Castrol/Triumph streamliner may capture the glory as being the World's Fastest once again as the team from Triumph get ready for an assault in 2014. Just imagine old and new together again with the Gyronaut's original sponsors, Castrol and Triumph, behind both efforts. History repeats? Best of luck to Triumph rider, Jason DiSalvo... Ryan applying the finishing touches just moments before being loaded into the trailer for a road trip to its next destination: Bob Leppan's, where he hasn't seen the Gyronaut wear these colors or have a roof over the rider's head since 1970! But that'll have to wait for the next entry! So now we've got the Ida's, Tucker's and Tremulis' all striving to share these fantastic stories of family history and the cars and people that created their passions. They're making history as they're saving it. And it will be these future generations who will be carrying the torches so that everyone can see, hear and feel exactly why these dream cars have such a huge impact on the soul. To quote Bogart: I think this is the start of a beautiful friendship. Stay tuned for the latest info on FaceBook and follow our progress by "LIKING" the page... Jack Kiely The workmanship is an amazing accomplishment . The detail certainly is a mark of the quality put into your cars and the Gyronaut. Best of luck at the Flats. Car sales licence link Positive site, where did u come up with the information on this posting? I have read a few of the articles on your website now, and I really like your style. I liked this blog man. This information is very important. I will suggest you to my other friend. mightystudents link all trying to talk about these amazing encounters of ancestry and the automobiles and people that developed their passions. They're developing history as they're protecting it.	cc/2020-05/en_middle_0093.json.gz/line572
__label__cc	0.717191	0.282809	Home - Sports Category - Philosophy Of Sport (Books) 1. A History and Philosophy of Sport 2. Practical Philosophy of Sport 3. Philosophy of Sport: Critical 4. Running and Philosophy: A Marathon 5. Sports and Athletics: Philosophy 6. Philosophy of Sport (Paragon Issues 7. Coaching the Mental Game: Leadership 8. Football and Philosophy: Going 9. The Red Sox and Philosophy (Popular 10. Soccer and Philosophy: Beautiful 11. Cycling - Philosophy for Everyone: 12. Sport Ethics: Concepts and Cases 13. The Philosophy of Aikido 14. Understanding Sports Coaching: 15. Philosophy, Risk and Adventure 16. Fair Play in Sport: A Moral Norm 17. Sport, Rules and Values: Philosophical 18. Sport, Play, and Ethical Reflection 19. Bodily Democracy: Towards a Philosophy 20. Sport Technology, Volume 21: History, 1. A History and Philosophy of Sport and Physical Education: From Ancient Civilizations to the Modern World by Robert Mechikoff This engaging and informative text will hold the attention of students and scholars as they take a journey through time to understand the role that history and philosophy have played in shaping the course of sport and physical education in Western and selected non-Western civilizations. From Mesoamerica and Ancient Greece to the 2008 Olympic Games, the book touches on religion, politics, social movements, and individuals as they contributed to the development of sport and physical education. An extensive array of pedagogical tools--including timelines, comprehensive lists of chapter objectives, suggested websites, and discussion questions--aids the learning experience. ... Read more The description for this item was very accurate adn honest. There was minor wear on the corners, but still very useable. Well worth it. Fine book with a notable exception As an overview of the philosophy of sport from Egypt and Ancient Greece to the present time, this is a fine volume. But it is breathtaking that in a review of the 1972 Olympic Games in Munich the author saw fit to recall "Notable" performances in track and field events, gymnastics, swimming and more and yet managed to leave out the most notable and historic contest of all: the gold medal basketball game between Russia and the United States. This was the United States' first "loss," since basketball's inclusion in 1936, though they were swindled out of their gold after officials put time back on the clock on three consecutive occasions. In a spirit of solidarity and righteous indignation the American team refused to accept their silver medals. How can this episode--which is arguably the greatest instance of official bias in sports history--not be recognized in an objective history of this sort? Ken Shouler ... Read more 2. Practical Philosophy of Sport and Physical Activity - 2nd Edition by R. Scott Kretchmar Philosophy is a crucial, yet often overlooked, part of kinesiology students’ education. Practical Philosophy of Sport and Physical Activity, Second Edition, provides students with a thorough, clear, and practical introduction to the philosophy of physical activity and sport, and in doing so, prepares them for the ethical questions they will face as professionals. This second edition has been significantly revised, and it has been enhanced to include the following features:·Expanded instruction on practical ethics in physical activity, guiding students in how to rank values and turn those values into actions·New material that emphasizes physical activity as well as sport, and provides specific holistic techniques for the practitioner in the workplace·In-depth case studies, one on running up the score and the other on performance-enhancing substances, from previously published articles that have been reprinted in their entirety in the appendix·Discussion questions based on the case studies that can be used to teach students how to follow a philosophical argument and come to their own conclusions Practical Philosophy of Sport and Physical Activity, Second Edition, helps students examine key moral questions in sport. Its approach to the content helps students follow and dissect ethical arguments, think through philosophic issues, and apply theory to practice. Each chapter includes objectives, philosophical exercises, reviews, and study questions to reinforce understanding. Kretchmar’s engaging writing style accentuates important topics of discussion, focusing the readers’ attention on the philosophy behind the practice or strategy. As a result, students develop their philosophical skills, refine their personal philosophy concerning physical activity and sport, and learn that philosophy can be clear, practical, and holistic, rather than obscure, overly theoretical, and dualistic. The text is arranged in four parts. Part I introduces students to the nature and methods of philosophy. Part II focuses on issues relating to the nature of the athlete or client and includes analyses of dualism, scientific materialism, and holism. Part III delves into kinesiology issues, including the nature of play, games, and competition, and Part IV provides expanded material on ethics, value choices, and active lifestyles. This text provides students with the practical tools and specific techniques they need to think ethically and systematically, as they become skilled practitioners in the field of physical activity and sport. In doing so, it demystifies philosophy and reveals it as the guiding element in our understanding of, and approach to, activity, games, and competitions. ... Read more 3. Philosophy of Sport: Critical Readings, Crucial Issues by M. Andrew Holowchak This user-friendly collection of essays on topical issues in philosophy of sport draws principally from philosophy, but contains some writings from sociological and psychological literature that has a philosophical slant. The anthology contains 44 essays on diverse and contemporary issues in sport from different perspectives. Each article addresses critical and topical issues such as “What is Sport?”“Are female athletes of the same rank as men?”“Is sport a species of art?”and each invites critical discussion. The essays address the following issues: the nature of the sport; aesthetics and sport; ethics and sport; sportspersonship; cheating; winning; violence; performance-enhancing drugs; epistemological issues in sport; sport and society; heroism; gender; race; pedagogy; and sport in society. For athletes and sports fans interested in the philosophy of sport. Review for Philosophy of Sport Textbook The textbook I received was acceptable.The book does contain marks like underlining and highlights.The textbook was being sold as acceptable condition, so the markings did not surprise me. ... Read more 4. Running and Philosophy: A Marathon for the Mind (Philosophy for Everyone) A unique anthology of essays exploring the philosophical wisdom runners contemplate when out for a run. It features writings from some of America’s leading philosophers, including Martha Nussbaum, Charles Taliaferro, and J.P. Moreland. A first-of-its-kind collection of essays exploring those gems of philosophical wisdom runners contemplate when out for a run Topics considered include running and the philosophy of friendship; the freedom of the long distance runner; running as aesthetic experience, and “Could a Zombie Run a Marathon?” Contributing essayists include philosophers with athletic experience at the collegiate level, philosophers whose pasttime is running, and one philosopher who began running to test the ideas in his essay Great book Very inspiring and thought provoking. Not only gets your foot out the door but your mind is no longer lazy either! Must read for all thinker/runners. Two different activities that complement each other greatly! Though I have read very few pop culture & philosophy books all the way through, this is one of the best ones I have read. Not only do many of the essays connect to well known philosophers and ideas, but many other essays seem very original in their thesis and their conclusions. The best part about this book, though, is that nearly all of essays are easily relatable as anyone who has ever done even a short mile or 5K race can instantly understand what the author is talking about when they mention something about running. It doesn't hurt that many of the best authors seem to be runners themselves and imbue their essays with their own personal experiences. However, at times the book suffers from what many pop culture & philosophy books suffer from: essays and ideas that are not explained very well and go way over the heads of the readers. One essay in particular started talking about "zombies" without explaining what he was talking about. It took me half of the essay to figure out what he meant. Overall, while this book won't make you a better runner or be as necessary as a good pair of running shoes, but the topics discussed will keep you thinking on those long runs. Philosophy is the key word in the title. I'm not a philosophic guy generally speaking. The book is made up of many different philosophical view points and then they are equated to running. I think it would be an outstanding resource if I find myself taking Philosophy 101 and have to show how philosophy can effect my daily life. That being said, I did find many of the essays thought provoking, and I was able to really think about them on my runs. Some of the subject matter and tag lines even became part of my blog posts about running. It you are looking for something deeper to think about while you are running, or need something to help your motivation, it is an excellent choice. Thought provoking, time well spent I picked up this book at the perfect time and that is why I am giving it 5 stars.I originally got into running like a lot of people in high school as part of the cross country team.I only ran cross country as a way to get in shape for basketball season.After high school I stopped running and did not pick up the sport again until after my Step-father was diagnosed with cancer.He was a big time runner and had a 10 year streak of competing in a local 13.1 mile race.So I stepped in to run in his place to keep the streak alive.After his passing, I ran my first marathon in his memory and in the process found out a lot about myself.I have been running ever since, taking on 5K, 5 milers, halfs and marathons, all the while becoming more engrossed in the sport of running as well as the psychology behind it.As a child running is as natural as breathing, then at some point it became a chore and now it gives me the time and space I need to think in our modern world.This book simply shares the thoughts of others who have found similar insights from running.Happy trails. Fun, Challenging, Motivating This is one of the best books in the whole philosophy and pop culture genre. For philosophers, the essays feel like they come very naturally out of the topic. They are wide-ranging but all grounded in running--no stretches to get the philosophy in. It's as effortless as a comfortable pace can be. For runners, there is an informative development of ideas that you've probably started to have in your own running, but haven't seen through this far. Fun, challenging, motivating. ... Read more 5. Sports and Athletics: Philosophy in Action (Littlefield, Adams quality paperback) by Joseph C. Mihalich 6. Philosophy of Sport (Paragon Issues on Philosophy Series) by Drew Hyland 7. Coaching the Mental Game: Leadership Philosophies and Strategies for Peak Performance in Sports and Everyday Life by H.A. Dorfman Coaching the Mental Game is a bible for coaches who strive to make their athletes the most complete performers possible. Not only a wonderful asset to athletic coaches, this book is a motivational resource for workers in all industries as well as in the game of life. ... Read more Could not put it down I purchased this book for two male friends who are high level athletic coaches.They both stated that they could not put it down.They also recommended the book to their wives to read.The wives loved it also.I just ordered one for myself. Best book on this topic For amateur "weekend warrior" coaches such as myself this is a topic that is far to often barely touched on if talked about at all. Telling kids to concentrate, focus and be mentally tough without teaching it like any other skill is like giving them a bat with no instruction and telling them to hit. Some will pick it up better than others due to their own make-up but all can get much better with a coach teaching them. The mental game can be taught as a skill the same as any physical skill we teach them. This book is one that has the authentic "been-there-done-that" feel to it. It's well organized with great real world examples and has multiple lists at the end of each topic on how to make our athletes aware of the mental game and how to practice getting better at it. This is a book you will read and re-read if you're truly interested in being the best coach you can be.It's one of those books where you can just open to any page and pick up a great idea or tip. This is the 4th time I bought this book. I have given three away and the last one is worn out. Trying to make the most out of a player's ability is not complete until the mental aspect is addressed and this book helps with that approach. If you coach baseball, you need to have a copy. Best book on the mental game, period The most useful book you will find on the mental game, and was very easy to ready. Great organization. A must read for any coach. Graetest Coaching Book in Existance. 361 Pages Hardcover ExerptPage 70 Coaching is teaching. The best coaches have something else. They have the good sense to instruct, then get out of the way. They are pedagogues not demagogues. Section 1 The Coach as leader, Communicator, Teacher 1. Leadership & Power(s) 2. Leadership style 3. You, the leader-the coach 4. The substance of leadership 5. The coach communicates, one way or another 6. Communication: Considering the process Itself 7. Communication: The when, where, how, why-and who! 8. Coaching is teaching. 9. Learners: the Coach and athlete Section 2 The mental game alphabet: Impact terms for the coach. Section 3 The mental Game, A to Z: Athletes' impact terms. Appendix A Leaders list Appendix B "The guy in the glass" Appendix C we learn what we've lived Appendix D A winning way Appendix E The final word on the mental game ... Read more 8. Football and Philosophy: Going Deep (The Philosophy of Popular Culture) Over the past forty years, football has surpassed baseball as America's favorite game. The game has become an institution of our national culture: the Super Bowl is regarded as an unofficial national holiday, and our annual Thanksgiving Day celebrations would be incomplete without it. The sport brings in massive amounts of revenue to high schools and both public and private universities as spectators enjoy a unique and celebratory social scene. Professional football teams across the country cultivate and foster a sense of community in urban areas. Surely a game this influential, with its hallowed traditions, treasured festivities, and clearly defined cultural presence, resonates far beyond recreational importance. Football and Philosophy: Going Deep, edited by Michael W. Austin, reveals how a sport followed by millions reflects our deeper values, beliefs, and priorities. Austin and other contributing writers bring unique perspectives to this thought-provoking collection of essays. Divided into "four quarters" of reflective writing, the book covers many topics frequently debated by football fans. Sharon Ryan asks "What's So Bad about Performance Enhancing Drugs?", while the book's editor argues for a playoff system in college football. Daniel Collins-Cavanaugh ponders whether the salary cap makes the NFL a fairer league, and Joshua Smith offers his own review of the instant replay. Football and Philosophy also forays into some time honored issues as it considers the philosophy of winning in light of the NFL's most legendary coach, Vince Lombardi, and contemplates the concepts of sportsmanship, virtue, friendship, and failure. While the book is unafraid to tackle serious topics, touching on ethics, religion, and the nature of reality itself, the collection is designed to be accessible for any interested reader and was written, first and foremost, for fans of the game. As Austin notes, football fans and philosophers definitely have one quality in common: they both love to argue. Football and Philosophy engages in the debates of both groups, illuminating how the fields are intertwined. So whether they love or hate the college bowl system or disagree on whether the NFL has an ego problem, readers of this book will undoubtedly find much to ponder about America's favorite game. Not enough good essays There were two terrific essays in this book: one about the college playoff system and one about the effect of the NFL salary cap on competition.The rest of the essays were nothing special. ... Read more 9. The Red Sox and Philosophy (Popular Culture and Philosophy) This volume in the Popular Culture and Philosophy series delves into the tragic and redemptive history of the Boston Red Sox baseball franchise. Drawing on philosophers from Aristotle to Sartre, chapters range from issues of faith and spirituality to tragedy, irony, existentialism, Sabermetrics, and the infamous "curse of the Bambino." With an emphasis on "Red Sox Nation" the community of Red Sox fans across the globe the book connects important philosophical ideas with one of the most storied teams in the history of Major League Baseball. The chapters make complex philosophical arguments easy to understand while providing an insider’s knowledge of the hometown team. All but one of the authors in this volume are all Red Sox fans who comment on their team philosophically. There's even a Yankee fan’s perspective! With a foreword by Dick Bresciani, vice president and official historian of the Boston Red Sox, this book provides a unique philosophical experience for the die-hard Red Sox fan. The fun guide links philosophy to popular culture Philosophy and sports collections alike will appreciate the messages in The Red Sox and Philosophy: Green Monster Meditations. It brings together a team of some thirty of America's leading thinkers to reveal the Red Sox mysteries, from proof that the Sox are the greatest sports team to moral heroes and Red Sox hats and fans. The fun guide links philosophy to popular culture. 10. Soccer and Philosophy: Beautiful Thoughts on the Beautiful Game (Popular Culture and Philosophy) This collection of incisive articles gives a leading team of international philosophers a free kick toward exploring the complex and often hidden contours of the world of soccer. What does it really mean to be a fan (and why should we count Aristotle as one)? Why do great players such as Cristiano Ronaldo count as great artists (up there alongside Picasso, one author argues)? From the ethics of refereeing to the metaphysics of bent (like Beckham) space-time, this book shows soccer fans and philosophy buffs alike new ways to appreciate and understand the world's favorite sport. Deserves a dual location on philosophy and sports shelves Soccer and Philosophy provides an unusual pairing: soccer notes by philosophers - and offers insights on ethics, metaphysics, and issues of beauty and form in the soccer environment. By blending philosophical principles and inquiry with soccer specifics, this will reach an audience not ordinarily attracted to philosophy books, and deserves a dual location on philosophy and sports shelves alike. Wonderful, Whimsical and Cogent First, ignore the comments on the back cover. They are banal clichés (See Chapter 3: The Boy Done Good? Football's Clichés). I doubt the comments were written by people who actually finished the book. Second, although this is a book about soccer, the analysis and conclusions may be applied to all sports. (See Chapter 8: What's Luck Got to do with it?). Third, think about how sports overlap with life and demand the attendance of prominent politicians - to toss the first ball, etc. (See Chapter 24: When a Soccer Club Becomes a Mirror). Fourth, think about how the officials on the field, in the ring or on the court influence the outcome of the game. (See Chapter 28: The Loneliness of the Referee). Fifth, Consider whether prayer before, during or after the game influences its outcome. (Chapter 29: God is not a Referee) This enumeration of thoughts about soccer could to go on without end, just like a 0 to 0 soccer game, requiring a shoot out (see Chapter 27: It's a Lottery!: Penalties and the Meaning of Winning). Oh, did I tell you about the wonderful creative writing in Chapter 26: Kierkegaard at the Penalty Spot? This is a wonderful, whimsical and cogent book for soccer fans and soccer players, particularly those who enjoyed their philosophy courses in college. The book has multiple authors with uneven writing, but the good writers more than make up for the others. Soccer in Football Country (Florida) A great book with a different bent. An easy read even if you don't know a lot about either soccer or philosopy. I recommend it highly. What a great collection! What a great book!A collection of different philosophical treatments of the beautiful game from the sublime to the humorous.And just in time for the World Cup too! ... Read more 11. Cycling - Philosophy for Everyone: A Philosophical Tour de Force Covering interesting and varied philosophical terrain, Cycling - Philosophy for Everyone explores in a fun but critical way the rich philosophical, cultural, and existential experiences that arise when two wheels are propelled by human energy. Incorporates or reflects the views of high-profile and notable past-professional cyclists and insiders such as Lennard Zinn, Scott Tinley, and Lance Armstrong Features contributions from the areas of cultural studies, kinesiology, literature, and political science as well as from philosophers Includes enlightening essays on the varieties of the cycling experience, ranging from the ethical issues of success, women and cycling, environmental issues of commuting and the transformative potential of cycling for personal growth Shows how bicycling and philosophy create the perfect tandem Includes a foreword by Lennard Zinn, author and owner of Zinn Cycles Inc. Michael W. Austin really knows his stuff.He continues to amaze and enthrall me with the breadth of his knowledge about all things philosophy and sports.My only hope is that he will continue to produce at this astounding rate.Anyone who is a cyclist, is interested in cycling or has thought about riding a bike should buy this book immediately. ... Read more 12. Sport Ethics: Concepts and Cases in Sport and Recreation by David Cruise Malloy, Saul Ross, Dwight H. Zakus Sport has always presented participants, administrators and observers with a wide and often bizarre array of ethical dilemmas. They take on a special edge, perhaps because the sport personalities are usually well known as are result of the extensive media coverage of sporting events. We look in astonishment and horror at such things as the judging debacle in the pairs figure-skating event at the 2002 Olympic Winter Games, the not-too-distant future possibility of genetically modified athletes, the bribe taking by members of the IOC, the widespread steroid use by athletes, the child sex-abuse cases in hockey, the acceptance of physical assault and violence, the hooligans among British soccer fans, and the drug abusers at the Tour de France. This revised and expanded edition is designed to provide an analytical framework to enable readers to explore and understand many of the ethical issues and controversies in sport today. Included for discussion purposes are topical case studies drawn from the world of sport and recreation. ... Read more by John Stevens At last, a clear and insightful look at the system of beliefs that is the basis for the practice of Aikido. The Philosophy of Aikido is an invaluable guide for practitioners--whether beginning or advanced--wishing to know more about the context in which Aikido was developed and Aikido's implications for the world today. Intended as a companion volume to Kisshomaru Ueshiba's classic The Spirit of Aikido, the book is authored by John Stevens, the foremost non-Japanese expert in the field. It is written from an international perspective that considers how Aikido is related to the emerging global culture. Some of the ideas discussed are: * the relation of Aikido to such Asian traditions as Shinto, Shingon Buddhism, Omoto-kyo esotericism, Taoist mysticism and Tantra * points of correspondence between Aikido and Western philosophical and religious systems--Greek philosophy, Christianity, Kabbalah, alchemy and modern scientific theories links between Aikido and art ways that Aikido thinking can be used to advance the causes of such urgent issues as health and healing, conflict resolution and environmental responsibility The Philosophy of Aikido will be of vital interest to all those who are drawn to a dynamic philosophy centered on harmony, peace and spiritual strength. The book includes 70 black-and-white illustrations of woodblock prints, calligraphy and photographs from the author's extensive collection. ... Read more Excellent, eloquent, thought-provoking book I was extraordinarily impressed by this book.Author Stevens has provided a succinct overview of the philosphy of Aikido.What is at least as impressive is how he ties in religious and philosophical threads from many other traditions, eastern and western, ancient and modern, in a way which sets Aikido's spirituality in a wonderfully broad and rich context.He does this in a way which is not at all forced or contrived, but truly sensible and resonant.A work of this philosophical and religious depth is a real find at any price. Personally, I found this book very moving and thought-provoking, and a great help in my spiritual search.I strongly recommend it for all Aikido practitioners, as well as all those generally interested in eastern philosophy and comparative religions. OK, not great. Some interesting thoughts on aikido, but very thin for expensive price. Last half of book is nothing but photos. Save yourself some money. Buy it used or wait for the paperback. ... Read more 14. Understanding Sports Coaching: The Social, Cultural and Pedagogical Foundations of Coaching Practice by Tania G. Cassidy, Robyn L. Jones, Paul Potrac Successful sports coaching is as dependent on utilising good teaching and social practices as it is about expertise in sport skills and tactics. Understanding Sports Coaching offers an innovative introduction to the theory and practice of sports coaching, highlighting the social, cultural and pedagogical concepts underpinning good coaching practice. Now in a fully revised and updated second edition, the book explores the complex interplay between coach, athlete, coaching programme and social context, and encourages coaches to develop an open and reflective approach to their own coaching practice. It addresses key issues such as: power and the coach-athlete relationship viewing the athlete as a learner instructional methods and reflection how our view of ability informs assessment coaching philosophy and ethics. Understanding Sports Coaching also includes a full range of practical exercises and case studies designed to encourage coaches to reflect critically upon their own coaching strategies, their interpersonal skills and upon important issues in contemporary sports coaching. This book is essential reading for all students of sports coaching and for any professional coach looking to develop their coaching expertise. 15. Philosophy, Risk and Adventure Sports With interest and participation in extreme and adventure sports growing year on year, the time is ripe for a thoughtful and analytical assessment of this phenomenon from a rigorous philosophical perspective. This collection of essays is the first single-source treatment of adventure sports from an exclusively philosophical standpoint. The text offers students a uniquely focused reader of this burgeoning area of interest and provides scholars with a source book for further studies in this area. Featuring contributions from well-respected writers in the field who each also have personal familiarity of participation in adventure and extreme sports, this is set to become a classic analysis of the intersections between philosophy and extreme experiences, encompassing essential related concepts of elation, danger, death, wilderness and authenticity. 16. Fair Play in Sport: A Moral Norm System (Ethics and Sport) (Volume 0) Fair Play in Sport presents a critical re-working of the classic ideal of fair play and explores its practical consequences for competitive sport. By linking general moral principles and practical cases, the book develops a contemporary theory of fair play. The book examines many of the key issues in the ethics of sport, including: * fairness and justice in sport * moral and immoral interpretation of 'athletic performance' * what makes a 'good competition' * the key values of competitive sport. The notion of fair play is integral to sport as we know and experience it, and is commonly seen as a necessary ethos if competitive sport is to survive and flourish. Fair Play in Sport provides an invaluable guide to the subject for all those with an interest in ethics and the philosophy of sport. ... Read more 17. Sport, Rules and Values: Philosophical Investigations into the Nature of Sport (Ethics and Sport) by Graham McFee Sport, Rules and Values presents a philosophical perspective on some issues concerning the character of sport. ... Read more by Randolph Feezell In paperback for the first time, Randolph Feezell's "Sport, Play, and Ethical Reflection" immediately tackles two big questions about sport: "What is it?" and "Why does it attract so many people?" He argues that sports participation is best described as a form of human play, and the attraction for participants and viewers alike derives from both its aesthetic richness and narrative structure. He then claims that the way in which sports encourage serious competition in trivial pursuits is fundamentally absurd, and therefore participation requires a state of irony in the participants, where seriousness and playfulness are combined. Feezell builds on these conclusions, addressing important ethical issues, arguing that sportsmanship should be seen as a kind of Aristotelian mean between the extremes of over and under investment in sport. Chapters on cheating, running up the score, and character-building stress sport as a rule-governed, tradition-bound practice with standards of excellence and goods internal to the practice. With clear writing and numerous illuminating examples, Feezell demonstrates deep insight into both of his subjects. ... Read more 19. Bodily Democracy: Towards a Philosophy of Sport for All (Ethics and Sport) by Henning Eichberg Sport has gained increasing importance for welfare society. In this process, however, the term of ‘sport’ has become less and less clear. Larger parts of what nowadays is called ‘Sport for all’ are non-competitive and derived from traditions of gymnastics, dance, festivity, games, outdoor activities, and physical training rather than from classical modern elite sports. This requires new philosophical approaches, as the philosophy of sport, so far, has been dominated by topics of elite sports. Based on Scandinavian experiences, the book presents studies about festivities of sport, outdoor activities, song and movement, and play and game. The engagement of elderly people challenges sports. Games get political significance in international cooperation, for peace culture and as means against poverty (in Africa). The empirical studies result in philosophical analyses on the recognition of folk practice in education and on relations between identity and recognition. The study of ‘Sport for all’ opens up for new ways of phenomenological knowledge, moving bottom-up from sport to the philosophy of "the individual", of event, of nature, and of human energy. Popular sports give inspiration to a philosophy of practice as well as to a phenomenological understanding of ‘the people’, of civil society and the ‘demos’ of democracy – as folk in movement. This book was published as a special issue in Sport, Ethics and Philosophy. 20. Sport Technology, Volume 21: History, Philosophy and Policy (Research in Philosophy and Technology) Sport Technology: History, Philosophy and Technology arrives at a crucial time for the ethical consideration of elite sport. With new innovations in sports equipment, doping methods and human engineering on the horizon, the ethical issues raised by such technology have become noticeably acute. The problematisation of technology in sport has gone largely unnoticed in historical, philosophical and policy studies of sport, until the publication of this volume. Tracing the origins, present contexts and future of sport technology, this volume speaks to a multi-disciplinary audience, developing theory of technology and sport. Sport Technology: History, Philosophy and Technology provides a foundation for theorising technological issues in sport, building upon themes in cultural studies of the cyborg, otherness and gender. The book begins with an initial contextualising of sport technology, tracing the historical roots of key mome ... Read more	cc/2020-05/en_middle_0093.json.gz/line574
__label__cc	0.572112	0.427888	Getbig Bodybuilding, Figure and Fitness Forums > Getbig Main Boards > Politics and Political Issues Board (Moderators: Ron, Dos Equis, OzmO, polychronopolous) > Obama: "I fully back Israels' right to self defense" Author Topic: Obama: "I fully back Israels' right to self defense" (Read 1112 times) Soul Crusher Doesnt lie about lifting. Obama: "I fully back Israels' right to self defense" http://www.huffingtonpost.com/2012/11/18/obama-israel-gaza_n_2154008.html mogulgangi fitness celebrity Re: Obama: "I fully back Israels' right to self defense" Quote from: 333386 on November 19, 2012, 07:38:59 AM Hilarious...smoking mirrors..what he's really trying to say is " I don't give a fuck and will not help them, but for the sake of it, I agree that they self defend"... whork Quote from: mogulgangi on November 19, 2012, 08:11:59 AM You disagree with this? Quote from: whork on November 19, 2012, 08:46:21 AM Come on..ru that stupid...do you need anymore proof he's a Muslim..he dosent care what happens with Israel... Do you care what happens with Israel? Israel is the precursor to world war 3...hope this helps What is your solution? If I was obama, I would start talks and threats of sanctions against the Gaza strip, allow the UN to intervene using their own military to make this not a western alliance "thing"..make the people of the country throw of the Hamas and Muslim brotherhood out...call both countries to stop the non sense, not just say "they are allowed to defend themselves"..give Israel the upper hand due to the insignificane of the Hamas and Muslim brotherhood.. No, obama rather be in Thailand so you would involve the US in another war like situation? ok got it. What about just staying the fuck out of the conflict. Turkish Prime Minister: ‘Israel Is A Terrorist State’ Israeli artillery shells attack a target in the Gaza Strip on Nov. 19, 2012 on Israel’s border with the Gaza Strip. (credit: Christopher Furlong/Getty Images) WASHINGTON (CBSDC/AP) — A top Turkish official has claimed that Israel is committing acts of terrorism by bombing Hamas targets in Gaza. Turkish Prime Minister Tayyip Erdogan told the Eurasian Islamic Council conference in Istanbul that the Jewish state is systematically mass-killing Muslims. “Those who associate Islam with terrorism close their eyes in the face of mass killing of Muslims, turn their heads from the massacre of children in Gaza,” Erdogan said, according to Reuters. “For this reason, I say that Israel is a terrorist state, and its acts are terrorist acts.” The conflict between Israel and Hamas escalated last Wednesday after an Israeli airstrike killed the terror group’s military commander, Ahmed Jabari. CBS News reports 87 Palestinians, 50 of them civilians, have been killed in the six-day conflict so far. Hamas is demanding Israel stop its five-year blockade of the Gaza Strip in order to get a cease-fire deal done. The White House says Israeli Prime Minister Benjamin Netanyahu called President Barack Obama Friday to provide an update on the situation. Netanyahu expressed appreciation to Obama and the American people for U.S. investment in the Iron Dome rocket and mortar defense system, which has been used to defend Israel against rocket attacks from Gaza, saving many Israeli lives, the White House said. Obama reiterated U.S. support for Israel’s right to self-defense and discussed possible ways to scale back the conflict, the White House said. It did not offer specifics. Separately, Obama called Egyptian President Mohammed Morsi on Friday and praised Egypt’s efforts to ease tensions in the region, the White House said. Obama expressed hope that Egypt’s efforts would be successful, officials said. In both calls, Obama expressed regret for the loss of Israeli and Palestinian civilian lives and underscored the importance of resolving the situation as quickly as possible. Obama also spoke with the Israeli and Egyptian leaders last Wednesday. Israeli Defense Minister Ehud Barak called Defense Secretary Leon Panetta on Friday during Panetta’s flight from Bangkok to San Francisco as he returned to the U.S. from an Asia-Pacific tour, a senior Pentagon official said. In their second phone conversation this week, Barak briefed Panetta on the situation with Gaza and the prospects for de-escalation of the violence. Militant groups have staged rocket attacks against Israel, which has responded by assassinating the military chief of the ruling Hamas militant group and conducting dozens of airstrikes on suspected rocket-launching sites and other Hamas targets in Gaza. (TM and © Copyright 2012 CBS Radio Inc. and its relevant subsidiaries. CBS RADIO and EYE Logo TM and Copyright 2012 CBS Broadcasting Inc. Used under license. All Rights Reserved. This material may not be published, broadcast, rewritten, or redistributed. The Associated Press contributed to this report.) Quote from: Necrosis on November 19, 2012, 11:35:36 AM Hamas and the Muslim brotherhood get funded by Iran and all the other sand ni@@er countries..Hamas has no chance against Israel..if Israel invades all Arab countries will intervive to help Hamas...thus starting world war 3... staying out of will do nuthing than put us in a defensive stance when the sand ni@@ers attack and most portantly russiam....we need to be in the ofensive and defensive..true war is won playing both sides...this is were democrats and repub differ in war..one will wait until something starts and inevitably then help or the other plays the bully role and let's it be know he won't be messesd around with So you would invade palestine? tu_holmes Quote from: whork on November 19, 2012, 03:01:54 PM Where is this country? It's not any map I've seen. Quote from: tu_holmes on November 19, 2012, 03:09:17 PM Trust me its there. of coiurse he cares...but you're right..he's not going to help them..why should he???...we don't need to be pulled into another war right now its in the minds of the Palestinians...thats good enough....thats why they are willing to die for it agreed...as I said...the Palestinains know its there Quote from: andreisdaman on November 19, 2012, 08:53:16 PM Did you cry at the pic of O-94er at the seder? Quote from: 333386 on November 19, 2012, 08:57:44 PM you are hilarious...I'm sure you did	cc/2020-05/en_middle_0093.json.gz/line575
__label__wiki	0.567391	0.567391	Walkthroughs and Cheats for Online Physics Games Mr Strange And The Core Game Walkthrough level 1 to 20 Video Length: 00:09:08 Mr Strange And The Core Game video solution for all the 20 levels help you to complete the fun adventure game, enjoy! Machines Planet Game Walkthrough - How to Build Machines Planet is a physics game similar to Fantastic Contraption. Walkthrough for the game now is avaliable here, it will help you to complete the game. Catch the Candy Game Walkthrough level 1 to 15 Catch the Candy is a cool game popular on iphone. Here is the video solution for all the 15 levels of the game, enjoy! Space Ivan Game Walkthrough level 1 to 30 Space Ivan is a fun puzzle game, if you stuck some where please refer to this video solution for all the 30 levels of the game, enjoy! Bubble Go Game Walkthrough level 1 to 20 Bubble Go is a fun physics game, here is the video solution for all the levels of the game, enjoy! Physics Melon Level Pack Game Walkhthrough level 1 to 9 Physics Melon level pack is a 9 levels physics game. Here is the video solution for all the 9 level of the game, enjoy! Its Like Gravity 2 Game Walkthrough level 1 to 24 Its Like Gravity 2 is a physics-based puzzle game, here is the video solution for all the 24 levels of the game, enjoy! Death House Game Walkthrough level 1 to 30 Kill all the funny little puppets living in a Death House, here is the walkthrough for all the 30 levels of the game, enjoy! Magic Muffin Frog Game Walkthrough level 1 to 30 Magic Muffin Frog is a cool puzzle game, this is the video solution for all the 30 levels of the game, enjoy! Tire Shop Game Walkthrough level 1 to 24 Tire Shop is a hard puzzle game, if you stuck some where please refer to this video solution for all the 24 levels of the game, enjoy! 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54	cc/2020-05/en_middle_0093.json.gz/line576
__label__cc	0.704187	0.295813	Homeschooling in Alaska Home Getting Started How To Homeschool How Do I Teach... Beyond the Basics Support Why Homeschool? Where to Begin Legal/Homeschool Laws History of Homeschooling Getting Started Homeschooling in Alaska There is so much information about homeschooling that it can seem overwhelming. We've gathered information to help you make your homeschooling decision and to inform you about laws and other legal issues. Here you'll find research and statistics that support the notion that homeschooling provides specific advantages to children and families. And we'll help you take the first steps on the road of your own homeschooling adventure. The first step to homeschooling is making your decision to home educate your child. It is important to become informed and knowledgeable about some of the main concerns you may have. Explore these areas of our website to learn more about the initial decision to homeschool. You've decided to homeschool your child! But what comes first? For many parents, knowing where to begin in the homeschooling process can be confusing. Although there seems to be so much information available, it may be hard to get your questions answered. We've put together some resources to start you on your journey, giving you the information and motivation you need to successfully begin to homeschool in Alaska. Legal/Homeschool Laws Laws that regulate home education vary from state to state. It is important to understand the legal requirements in your state and to be aware of legislative and other legal issues that affect homeschoolers in your community. We've compiled resources that will help you become informed. Although homeschooling is legal in all 50 states, and the vast majority of homeschoolers face no problems, you may find that you need legal assistance at some point in your homeschooling career. We've compiled a list of resources to help you find the support you need. And if you'd like to become more involved in working towards homeschooling freedoms, we discuss some of the issues facing homeschoolers that we hope you find compelling. History of Homeschooling in America How did homeschooling start? When did it become legal? Who were the key players in making homeschooling the social movement it is today? The story of the history of homeschooling in the United States is a compelling tale of dedication, innovative ideas, and personal conviction and sacrifice. We have put together a history of this educational and social phenomenon, hoping it will inspire you to learn from the early and more recent pioneers of home education in America. Featured Articles & Links Back to Top Dr. Ben J. Mettes This article was written by Drs. Ben J. Mettes, who has degrees in psychology and communications, and looks at the way in which school enforces a specific psychological mindset onto children. The article looks critically at the education system, including University, and argues that it does not prepare for future jobs. School destroys intelligence, by focusing on the left hemisphere and silencing the right hemisphere of the brain. Socialization is a Bunch of Malarkey Most folks who ask about socialization mean well. They are not plotting against us, but they are uninformed. But modern socialization in schools is not natural or desired. The S-Word: Socialization for Homeschoolers Why do homeschoolers hear socialization questions more than any others? In fact, very few of them are home long enough to be unsocialized! Homeschooling: A Growing Option in American Education Dan Lips and Evan Feinberg Families cite common reasons for choosing to homeschool their children, such as concern about the environment at other schools, dissatisfaction with the academic instruction at other schools, and a preference for providing religious and moral instruction not provided in traditional schools. The decentralized nature of the homeschooling population limits researchers' ability to draw conclusions about the specific effect of homeschooling on various outcome measures such as academic achievement. However, evaluations of homeschooled students have reported that homeschool students perform well in that academic environment. Moreover, a survey of adults who were homeschooled suggests that home schooling leads to positive life outcomes, such as higher college attendance and enrollment. Pacific Justice Institute (PJI) Pacific Justice Institute is a non-profit legal defense organization specializing in the defense of religious freedom, parental rights, and other civil liberties. PJI provides free representation to parents who are unlawfully denied the right to homeschool their children. PJI also provides legal counsel to those parents wishing to homeschool, but do not know their legal options or obligations. Looking for homeschooling information for another state? More States... Contact Us \| Submit a Link \| Privacy Statement Copyright 2003-2014 HomeschoolinginAmerica.com	cc/2020-05/en_middle_0093.json.gz/line584
__label__cc	0.628537	0.371463	Your Los Angeles Pro Sports Source Home & LA News Los Angeles FC • Soccer FANS, FANS, FANS – They make the sport go around DECINES-CHARPIEU, FRANCE – JULY 07: USA Fans prior to the 2019 FIFA Women’s World Cup France Final match between Netherlands and the United States at Groupama Stadium on July 07, 2019 in Decines-Charpieu, France. CHICAGO – What is fan? Someone who supports their team through thick and thin. The fan remains loyal despite the teams winning or losing. The fans in Lyon, who are currently watching the US team warm-up for their match against The Netherlands, are loyal on many levels. They love the game of soccer, they are supportive of the women, who are not accepted equally as their male counterparts, and they support their national teams. DECINES-CHARPIEU, FRANCE – JULY 07: Dutch Fans prior to the 2019 FIFA Women’s World Cup France Final match between Netherlands and the United States at Groupama Stadium on July 07, 2019 in Decines-Charpieu, France. Even Uncle Sam travelled to Paris to support the team. Probably sitting next to the American Outlaws, Uncle Sam Wants You to Support the team – now and forever. Can the US Men’s Team follow in the US Women’s footsteps to win their tournament? Southern California Player, Alex Morgan, keeps scoring in the 2019 World Cup Los Angeles Galaxy • Soccer Los Angeles Galaxy will host the inaugural eMLS season... Former LA Galaxy star, Gyazi Zardes, wins MVP and... LA Galaxy pushes past Orlando City, 4-3 Los Angeles FC • Los Angeles Galaxy • Soccer LAFC fail to hold off LA Galaxy, 2-2 LA Galaxy rallies over Philadelphia, 3-1 Minnesota dominates LAFC, 5-1 Can the US Men’s Team follow in the US... FANS, FANS, FANS – They make the sport go... Southern California Player, Alex Morgan, keeps... Los Angeles Rams beat Kansas City Chiefs 54 –... Baseball Post Four (BB and Dodgers) video LAFC signs Roberts Los Angeles Lakers lose another one on the road as... Benfica club president named suspect in corruption... Copyright © 2017. IMSports.media and created by Meks. Powered by WordPress.	cc/2020-05/en_middle_0093.json.gz/line588
__label__wiki	0.800403	0.800403	Tag Archives: Di Cunningham Bisexual, Gay, Human Rights, Russia Protests continue at Chechnya Homophobia, Gay-Bisexual Torture & Killing 14th April 2017 Katy Leave a comment Chechen Gay ‘Concentration Camps’ The Chechen Republic is a Russian autonomous region that is around 95% Muslim. Reports over the last week or so have continued to come in that around 100 men suspected of homosexuality have been sent to a detention facility in Argun, and that allegedly 3 have been killed. Calling them ‘concentration camps‘ may be a reach, but as we don’t know what is going on there it may be appropriate. Thank you for joining the #ChechnyaProtest. Let’s make the world aware of what’s happening to gay men in #Chechnya. https://t.co/sOJvUBwTAm — Pride in London (@LondonLGBTPride) April 13, 2017 Clive Lewis MP speaking at Norwich LGBT Chechnya protest The last few nights have seen protests in London at the Russian Embassy and around the country because of the 100 detainees. Norwich held its protest with around 50-60 attendees last night on the City Hall steps. The supporters were addressed by Norwich Pride’s Nick O’Brien, Labour MP Clive Lewis, Green’s Lesley Grahame, Katy Jon Went, Julie Bremner, Andy Futter, and Di Cunningham. (Gallery here) The fine people of Norwich showing #solidarity #LGBT #Chechnya #humanrights @LondonLGBTPride @EDP24 @WipeHomophobia pic.twitter.com/QQWQHxDmOI — Norwich Pride (@NorwichPride) April 13, 2017 Decriminalisation of homosexuality Norwich City Hall LGBT Chechnya protest We can keep the victims in the media eye, gain diplomatic and human rights traction by our voices, standing up for those who’ve lost their liberty because of their sexuality. This is poignant coming, as it does, on the 50th anniversary of the decriminalisation of homosexuality in the UK. Sadly, over 70 nations worldwide still criminalise homosexuality and male on male sex which includes bisexuality, so let’s not forget that those imprisoned and beaten, even killed, may include gay and bi men, and trans – anyone who is an affront to the macho traditional image of Mother Russia and the two major religions in its regions, the Russian Orthodox Church and Islam. Chechnya: Men detained for being perceived to be gay must be immediately released & their abuse/persecution ended https://t.co/DbbnIVQbSf — UN Human Rights (@UNHumanRights) April 13, 2017 What is happening in Chechnya? One victim described how Interior Ministry SOBR police officers: “stripped me naked. One filmed me on his telephone. Three of them beat me. They kicked me, broke my jaw. They said that this is a gay and that there shouldn’t be defects like this in Chechnya.” Rounding up the “defects”, the “abnormal”, speaks of sexuality eugenics and group genocide. These are not just rumours, the Guardian spoke to two victims who were “subjected to torture on a daily basis” and activists report this is happening in multiple towns across the region. Helplines have been set up to help LGBT people leave the country and journalists who have reported on it are also fearing for their lives after threats and considering that the rare independent voice of Novaya Gazeta has had several of its staff murdered. We have no Gays! Denial that is happening is part and parcel of how this kind of abuse works. Spokesman, Alvi Karimov, for Chechnya’s leader, Ramzan Kadyrov described the Novaya Gazeta report as “absolute lies and disinformation”, saying also that there were no gay people in Chechnya: “You cannot detain and persecute people who simply do not exist in the republic. If there were such people in Chechnya, the law-enforcement organs wouldn’t need to have anything to do with them because their relatives would send them somewhere from which there is no returning.” According to the Guardian, Chechen television is reporting that thousands gathered at Grozny’s central mosque to pass a resolution against the “lies and libel” in the Novaya Gazeta stories – “chiefly for suggesting there are gay men in Chechnya”! “The centuries-old traditions of Chechen society, the dignity of Chechen men, and our faith have all been insulted, and we promise that those behind it will face reprisals, whoever they are and wherever they are.” – Chechen Resolution This is similar to during the Sochi Winter Olympics, when “The mayor of Sochi, said there are no gay people in the city.” Why ban what allegedly doesn’t exist? Famous Gay or Bi Russians Why forget and erase the history of your own great LGBT+ persons? From Tchaikovsky and Mussorgsky, probably Stravinsky, the son of Rimsky Korsakov, Gogol, numerous artists, dancers like Nijinsky and Nureyev, to Ivan the Terrible with 7 straight marriages but a preference for cross-dressed men. Not to mention dozens of counts and princes of Russia’s past who were bisexual, open or closeted gay Russians. Legal Prohibition of Homosexuality Apart from religious condemnation of homosexuality in orthodox Christianity and Islam, I’ve encountered a secular Russian traditionalism that also condemns being LGBT on the basis that it destroys the family, the national image, and is just plain “abnormal”. In June 2013, Russia brought in a law banning the “propaganda of homosexuality among minors”, not unlike the UK’s Section 28, but given the street-based homophobia much more dangerous. Section 28 of the 1988 Local Government Act stated that councils should not “intentionally promote homosexuality or publish material with the intention of promoting homosexuality”. Homosexuality “in private” was decriminalised in Russia in 1993, but plenty of discrimination and prejudice remains. Actually, it was decriminalised in 1917 but re-criminalised in 1933. That’s a stark reminder that equality rights won can be lost again, just look at India and Uganda too. Russia is at least 25 years behind the UK on LGBT rights. The law banning spreading “non-traditional” sexual propaganda to minors is so loosely worded that almost anything could be seen as illegal. Locals say they fear even holding hands or kissing in public for the risk of attracting a £100 fine or worse. Prides in Moscow (2006-2011) have been beset by homophobic violence and since 2012 banned for 100 years by Moscow courts. Russia’s second-largest and hitherto most open city, St Petersburg, has seen a deterioration with city council members since 2012 pushing Putin to harder lines on LGBT freedoms. Marked homophobia and transphobia worsened in 2016 with LGBT persons and their supporters being hounded out of their jobs, attacked in the street, and denied civil freedoms. Vladimir Putin, himself, has linked homosexuality to paedophilia and stated strongly that Russia needs to “cleanse” itself of gays if it wants to increase its birth rate. The tagging of population growth on the end of that statement in no way minimises the echoes of a homosexual holocaust that was part of Hitler’s ‘Final Solution’ in “cleansing” 1930s Nazi Germany of Jews, homosexuals, the disabled, and non-conformists, alike. Chechen Laws and Attitudes Chechnya, in 1997, implemented Article 148 of the Criminal Code punishing “anal sexual intercourse between a man and a woman or a man and a man”. The punishment was caning but upon a third conviction, the death penalty by shooting, stoning or beheading. Since 1996 and repeatedly reaffirmed, Russia under pressure from the Council of Europe has had a moratorium on the death penalty despite a persistent majority of the population wanting its reinstatement. The death penalty thus remains on the books but not enacted since 1996. In 2011, the Chechen president, Ramzan Kadyrov, is quoted as saying: “I have the right to criticise my wife. She doesn’t. With us [in Chechen society], a wife is a housewife. A woman should know her place. A woman should give her love to us [men]… She would be [man’s] property. And the man is the owner. Here, if a woman does not behave properly, her husband, father, and brother are responsible. According to our tradition, if a woman fools around, her family members kill her… That’s how it happens, a brother kills his sister or a husband kills his wife… As a president, I cannot allow for them to kill. So, let women not wear shorts…” With these kinds of archaic gender stereotype attitudes is it any wonder that LGBT people are ostracised, given up, locked up, with little internal national complaint? Freedom House included Chechnya in the “Worst of the Worst” list (2009) of most repressive societies in the world, together with Burma, North Korea, Tibet. Toxic intolerance of Homosexuality From the Russian Orthodox Church to Conservative Islam and extremist Islamism, religion, tradition and ideology are involved in the toxic intolerance of homosexuality in Russia and Chechnya. We must support open-minded inclusive faith and practice, but not the closed-minded homophobia of secular and religious pronouncements and laws. Keep Chechnya in the public eye, and don’t forget everywhere else we turn a blind eye to, like Saudi Arabia, Brunei, Uganda and the other 70+ nations that deny human rights to LGBTI people. LGBT Concentration Camps Chechnya protes Andy FutterBisexualChechenChechen LawsChechnyaClive LewisConcentration CampsCriminalisation of HomosexualityDeath PenaltyDecriminalisation of HomosexualityDi CunninghamFamous Gay RussiansGayGogolGreen PartyHomophobiaHomosexualityHRCIslamIslamismIvan the TerribleJulie BremnerKaty Jon WentLabour MPLesley GrahameLGBTILGBTIQMoscow PrideMussorgskyNick O'BrienNijinskyNorwichNorwich PrideNovaya GazetaPink NewsRamzan KadyrovRimsky KorsakovRudolf NureyevRussiaRussianRussian Orthodox ChurchSt PetersburgStravinskyTchaikovskyTortureUnited NationsVladimir Putin	cc/2020-05/en_middle_0093.json.gz/line591
__label__wiki	0.504634	0.504634	Designer Weebly Themes weebly review wix review squarespace review jimdo review UNLV EMERGENCY MEDICINE RESIDENCY Curriculae > Applicants/Students > Interview Info Active Duty Military Applicants Recent Research & Publications Research Assistant Program Ultrasound > Ultrasound Resources Where We Live > Pediatric Emergency Medicine Fellowship UMC Adult ED UMC Pediatric ED UMC Trauma ED Residents > Alumni (Click for Map) > Resident Life Event Medicine FOAM Blog Departmental Intranet > Rotating Residents F.O.A.M. BLOG Las Vegas FOAM Blog is dedicated to sharing cutting edge learning with anyone, anywhere, anytime. We hope to inspire discussion, challenge dogma, and keep readers up to date on the latest in emergency medicine. This site is managed by the residents of Las Vegas’ Emergency Medicine Residency program and we are committed to promoting the FOAMed movement. The New Sepsis By Aaron Heckelman MD PGY-3 Why did we need a new sepsis definition? It has been recognized, in one form or another, since ancient Greece, that some patients will get symptoms of an infection and over a few days get better, while some will get symptoms of an infection, then over a few days get multi-organ system failure and die. In the 2000 years since, it has proven surprisingly hard to predict which patients are going to fall into that later category, in other words which patients are going to develop, or are already in the early stages of, “sepsis.”1 Broadly speaking, we can define “sepsis” as a severe infection associated with organ dysfunction.2 But getting any more specific than that has proven problematic. The upshot is that, as of 2016, we still have no “gold standard” test or set of criteria by which to define sepsis.3 The first attempt at a universal definition and set of clinical criteria for sepsis came in 1991, when a panel of experts from the American College of Chest Physicians and Society of Critical Care Medicine convened in Chicago to put their heads together and produce an “expert consensus.”4 Prior to that, there was no universally accepted definition of “sepsis,” which led to great heterogeneity in the methods and findings of different research groups, as well as consternation among clinicians trying to care for patients. In the years since 1991, specifically through repeat conventions in 2001 and 2012, that expert-consensus definition has been refined and revised into the form my generation learned in medical school, outlined below. Whether or not it was the intention of those conventioneers back in 1991, their core definition, and its underlying assumption that SIRS in the setting of infection progresses to “severe sepsis,” which progresses to “septic shock,” which progresses to “multisystem organ dysfunction,” has become dogma in medical education.5 And that presents a problem, because as all of us working in the ED know, the current sepsis definition is not great. The 1991 consensus definition, and all its iterations since, were meant not just to aid researchers, but to serve as part of an effort to raise awareness and promote early recognition of sepsis; this eventually became the groundwork for the Surviving Sepsis Campaign. To that end, the definitions were designed to be broad and highly sensitive.3 And that they are (albeit maybe not as sensitive as we once thought6) but at the expense of specificity. A tremendous proportion of ICU patients meet SIRS criteria, with or without infection.7 As ED residents, we all see multiple patients every shift that meet SIRS criteria, be it from dehydration, a common cold, anxiety, the flu, meth…. The question becomes do they also have a “suspected infection,” and therefore need broad-spectrum antibiotics and admission? It’s often extremely hard to say, and ends up being a subjective and provider-dependent decision. How many times have you admitted a patient from the ED with a vague diagnosis of “rule out sepsis,” because you knew they were nonspecifically sick enough to need observation, and knew you could use the SIRS criteria as ammunition in negotiating with the hospitalist? How many times have you admitted a patient to the ICU with shock but no obvious infection only to find out their diagnosis became “septic shock” because the chest x-ray showed a questionable pneumonia, or the urinalysis had some bacteria in it? The legal and reimbursement systems in the United States force us to assign discrete, billable diagnoses to patients, and “sepsis,” “severe sepsis,” and “septic shock,” have become some of our most useful catch-alls, albeit to the likely detriment of accuracy and antibiotic stewardship. Sepsis 3 is an attempt to improve this situation. It redefines “sepsis,” using an ICU-oriented clinical tool called the SOFA (Sequential Organ Failure Assessment) score, eliminates the concepts of “SIRS” and “severe sepsis,” and in homage to our current understanding of the disease’s complex pathophysiology, generally tries to move away from the idea of sepsis as a disease with a predictable, linear progression.8-10 Does the specific definition really matter that much? For doing and interpreting studies (in other words figuring out what treatments work), yes it matters tremendously. Does a 6-year-old dying of meningococcemia really have the same disease as a 50-year-old with a pulse of 95, WBC 12.5 and negative blood cultures but a little chest x-ray haziness? It all depends on how you define the disease, and, for better or worse, according to our current definition the answer to that question is, “yes.” Without an accurate, useful definition, you can’t even research sepsis well. How do you know the patients in that “CVP-guided fluid management in sepsis“ study you did really belonged in the experimental group? How do you know the mice in the research lab on which you’re testing novel drugs really have sepsis, or are in the same stage of their sepsis? And as clinicians, how can we trust that the results of any of these studies translate to our patient populations? What’s the new sepsis definition? SIRS: >or = 2 of : T>38 or <36, P>90, RR>20 or PaCO2<32, WBC>12 or >10% bands Sepsis=SIRS + suspected infection Severe sepsis=Sepsis + >or= 1 of SBP<90 or MAP<65 or lactate >2 after fluid challenge, INR >1.5, Plt <100, Tbili >2, PaO2/FiO2<250, SpO2<90%, UOP <0.5ml/kg/h for 2 hrs, Cr>2 MODS: Evidence of dysfunction in >or= 2 organ systems. A change of >or=2 in the SOFA score above the patient's baseline score, with suspected presence of infection Sepsis = A change of >2 in the SOFA Score above the patient’s baseline score, with suspected presence of infection Septic shock = Sepsis with vasopressors required to keep MAP>65 AND lactate>2 after adequate fluid resuscitation. To identify patients at particularly high risk of mortality or a long ICU stay, bedside providers should look for any of the qSOFA criteria: qsofa: R> 22, altered mental status, SBP< or = 100 So is this new definition going to help the situation? There is an argument to be made that, until we have some sort of new biomarker specific to sepsis, or some fundamental shift in our understanding of the disease that makes a new biomarker unnecessary, any attempt to define sepsis by rearranging physical exam findings, vital signs and current lab tests is going to be like rearranging the three primary colors in a futile attempt to produce a novel color. It won’t work – the current tools are too limited. Imagine trying to define DKA without the concept of insulin. But that argument aside, the answer to this question from an ED perspective is…probably not. This new sepsis definition is remarkably out-of-synch with how we work up sepsis at UMC: you cannot calculate a SOFA score without an arterial blood gas (we practically never get those on non-intubated patients), and the score is based on the notion that dopamine is everyone’s first choice of pressor in septic shock (I have yet to use dopamine in two years of residency). These are going to be real problems if national quality-measures and reimbursement end up linked to having “properly documented a SOFA score.” Meanwhile, the qSOFA score, the suggested tool for frontline providers like us, seems doomed to be proven non-inferior to clinical gestalt. What we need in the ED is a tool to help us make clinical decisions on intermediate-risk patients for early sepsis; Sepsis 3 seems geared towards identifying only the sickest patients that need ICU care right this minute. A boon for researchers, but probably not for us. On a super practical note, this new definition takes away our aforementioned SIRS criteria ace-in-the-hole when negotiating a gestalt-based admission with a reluctant hospitalist. As for whether or not this turns out to be a good thing in the long run for costs and patient safety, time will tell. On the upside, for those of us loath to administer broad-spectrum antibiotics to patients who almost certainly don’t need them, but who technically meet SIRS criteria, we now have ammunition for an argument not to do so. What’s the initial reaction to this in the rest of the medical community? Mixed.10-13 There were 31 medical societies involved in the creation of the new sepsis definition, but only a small handful from the United States, and only one emergency medicine society (the European Society of Emergency Medicine). As of today, it has not been endorsed by ACEP, SAEM, or any other American emergency medicine society. Chest, the official journal of the American College of Chest Physicians (co-creators of the original 1991 consensus definition), has published a pretty critical editorial.11 Initial response in the FOAM world has been skeptical at best.7,14-16 When I go into my next ED shift, do I need to do something differently because this new sepsis definition now exists? No you don’t. It’s probably a good idea to let this hash itself out in the literature and administrative worlds first. Keep following your hospital or group’s established sepsis protocols, and keep using the same lab tests and road-tested gestalt you’ve been using to pick the sickest needles out of the haystack. Vincent J et al. “Sepsis: older and newer concepts.” Lancet Resp Med. 2016. 4: 237-240. Cohen J et al. “Sepsis: a roadmap for future research.” Lancet Infect Dis. 2015. 15: 581-614. Shankar-Hair, M. “Do we need a new definition of sepsis?” Int Care Med. Feb 2015. 41(5). Bone R et al. “Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis.” Chest. 1992. 101(6): 1644-1655. Lynn. “The diagnosis of sepsis revisited: a challenge for young medical scientists in the 21st century.” Patient Safety in Surgery. 2014. 8(1). Kaukonen, K et al. “Systemic Inflammatory Response Syndrome Criteria in Defining Severe Sepsis.” NEJM. 2015. 372: 1629-1638. Nickson, C. “Sepsis definitions and diagnosis.” Lifeinthefastlane.com. Posted Feb 24, 2016. Accessed April 21, 2016. Singer M et al. “The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3).” JAMA Feb 2016; 315(8): 801–810. Abraham, E. “New definitions for sepsis and septic shock: continuing evolution but with much still to be done.” JAMA. Feb 2016. 315(8): 757-759. Surviving Sepsis Campaign. “Surviving sepsis campaign responds to sepsis-3.” March 1, 2016. Simpson, S. “New sepsis criteria: a change we should not make.” Chest. 2016. Not yet published but available online. Antoline-Wang, D. “Sepsis and septic shock get new international consensus definitions.” ACEPNow. Mar 10, 2016. Machado F et al. “Why LASI did not endorse the new definitions of sepsis published today in JAMA.” Available online at http://ilas.org.br/upfiles/arquivos/statement-en.pdf. Accessed Apr 20, 2016. Farkas, J. “Top ten problems with the new sepsis definition.” Emcrit.org. Posted Feb 29, 2016. Accessed Apr 20, 2016. Long, B. “Ready for the new sepsis 3.0?” Emdocs.net. Posted Mar 17, 2016. Accesseed Apr 20, 2016. Morgenstern, J. “Sepsis 3.0 – no thank you.” First10em.com. Posted Feb 25, 2016. Accessed Apr 20, 2016. Infectious Disease "Zebras" to Watch for in armed forces servicemembers By Dr. Aaron Heckleman, PGY-3 UMC Emergency Medicine Residents rotate yearly at Nellis Air Force Base ED, where we frequently see servicemembers recently returned from deployment in the Middle East. While most of their complaints are run-of-the-mill, occasionally we see returning troops with complaints that warrant consideration of infectious diseases they may have been exposed to while in theater, particularly in the Middle East. To that end, here is a review of the “Zebra” infectious diseases reported in deployed and recently returned US servicemembers over the past few years. Infectious Gastroenteritis This is by far the most common medical ailment that affects troops in theater, with more than half of them getting it at some point. A 2004 study of affected soldiers’ stool found that the majority of cases were caused by the same gastroenteritis-causing pathogens as in the USA (enterotoxic E. coli, norovirus, Shigella, etc). A few, however, had Entamoeba histolytica, Giardia, and Cryptosporidium.1 Other studies of returning troops have also found scattered cases of Giardia.2 Note that unless sensitivity studies say otherwise, none of these pathogens should need antibiotics beyond ciprofloxacin+Flagyl for 5-10 days. If you are going to treat empirically, probably starting with ciprofloxacin and adding Flagyl if there is no response, consider sending a stool O+P and stool culture first. In a patient who has already been treated and continues to have chronic diarrhea, consider post-infectious irritable bowel syndrome, a very common complication of bacterial gastroenteritis.3 A small number of troops have been reported to contract hepatitis E16, and anecdotally from the Nellis attendings hepatitis A has also occurred – as a result some attendings order liver panels on these returning troops with persistent GI symptoms. There have been no reports of any tapeworms, roundworms or flatworms in any returning troops. It is known, however, that the roundworm Strongyloides is endemic in Iraq, and there have been reported cases of acute eosinophilic pneumonia which is sometimes associated with Strongyloides exposure, so consider sending a stool O&P or Strongyloides serology study on patients with unexplained eosinophilia – yours could be the first case report.4 Malaria, caused by Plasmodium parasites invading the red blood cells, has been reported in several soldiers returning from Afghanistan, though none from Iraq.2 The diagnosis tends to not get made until weeks-months after infection, meaning this is one you could potentially see in a stateside ED like Nellis.5 Anecdotally from several Nellis attendings, it is in fact THE oddball infectious disease you are most likely to see at Nellis (with TB a close second). Soldiers are supposed to take malaria prophylaxis while in theater, but not all do. The malaria coming from Afghanistan is primarily P. vivax (not as fulminant or prone to causing cerebral malaria as the more dangerous P. falciparum), but various resistance patterns have been reported so treatment would best be started in consultation with the ID department that will be following the patient long-term. Symptoms of malaria include fever, malaise, general myalgias, nausea and vomiting; labs should show anemia and/or thrombocytopenia. Do not let the lack of a classic relapsing-remitting pattern (like we all learned in med school) make you miss this diagnosis: that finding is not sensitive for malaria.6 If you suspect possible malaria, thick and thin blood smears are the gold standard lab tests.18 During the first Gulf War, 2.5% of US soldiers converted from a negative to a positive PPD test.1 No data are publically available on currently returning soldiers, but it is likely the number is similar. Have TB on your differential for patients with chronic infectious symptoms, especially respiratory. Cutaneous Leishmaniasis (Baghdad Boil) A surprisingly common infection among troops in Iraq and sometimes also in Afghanistan2,7,8 , cutaneous leishmaniasis is almost always caused by the intracellular protozoan parasite Leishmania major, which is transmitted by the bite of an infected sandfly. Suspect this in a patient with a chronic, painless, non-healing, ulcerative skin lesion or lesions. Don’t let this disease’s exotic nature scare you – it is usually self-limited, rarely spreads to other body systems, and often responds to cryotherapy just like a wart.8 These patients should be referred to dermatology on a nonurgent basis for further testing and treatment; in the meantime they can be given a trial of a topical –azole which may have some efficacy.7 There are no tests you need to send from the ED – dermatology will do a biopsy. The type of Leishmania found in Iraq does not cause mucocutaneous leishmaniasis, which is a feature of South American strains.8 Because of rare cases of Leishmania major being incompletely treated and having a more chronic course, and out of an abundance of caution regarding the more dangerous Leishmania species detailed below, the military bars anybody who has ever been diagnosed with any type of leishmaniasis from donating blood.2 Visceral Leishmaniasis (Kala Azar) This is a much more rare, but much more serious disease usually caused by two other Leishmania species: L. infantum-donovani and L. tropica. They are also intracellular protozoan parasites, are also transmitted by the bite of an infected sandfly, and are also endemic throughout the Middle East. A handful of cases have been reported in returned US troops. 9-11 The course of visceral leishmaniasis is prolonged; the incubation period can range from several months to more than a year after return from deployment. When symptoms do occur, they include chronic fever, night sweats, cachexia, pancytopenia and progressive hepatosplenomegaly.10 These patients are sick, and will likely require admission for IV amphotericin B or other antiparastics. If you suspect the disease, there is a Leishmania serology test, or the inpatient team can arrange for various organ biopsies that the pathologists can examine under the microscope to look for the parasite. Caused by the bacterium Coxiella burnetii, which is endemic in livestock throughout the Middle East. Transmission occurs not from eating contaminated meat, but from inhaling aerosolized bacteria from the animals’ manure, straw, bedding etc. Transmission has also been reported from tick bites and ingestion of raw milk, both of which still involve proximity to livestock. After a 2-3 week intubation period, infection usually causes a self-limited flu-like illness with pancytopenia and a viral-pneumonia appearance on chest x-ray. It can have a fulminant course with severe pneumonia and hepatitis, and the most feared complication is endocarditis.2,13 Several cases of Q fever have been reported in troops in Iraq and Afghanistan.12-14 Consider this diagnosis in a recently returned soldier with a flulike febrile illness who has been around livestock, especially if there is pancytopenia. The test for Q fever is a Coxiella serology, and the treatment is doxycycline. Q fever is not generally transmissible between humans, except for a few case reports of possible sexual transmission.15 There have only been a few reported cases of brucellosis in US troops, but it is endemic to the entire Middle East.2 Brucella bacteria can be ingested, inhaled or percutaneously inoculated, and the disease occurs in patients in contact with infected livestock, especially sheep. After an incubation period of up to a few months, symptoms include relapsing-remitting fever, night sweats (with a strong, peculiar, moldy or wet-hay odor) and migratory arthralgia’s/myalgias.4 After the acute flulike phase, the disease enters an indolent chronic phase in which most any organ system in the body can become involved and all signs/symptoms are very nonspecific. There are no characteristic laboratory findings except for positive Brucella serology, and other than the odd-smelling sweat and proximity to livestock, nothing else unique on history and physical. Treatment is with doxycycline plus streptomycin or doxycycline plus rifampin. Except for rarely reported sexual transmission, brucellosis is not transmissible person to person.16 Something else to be aware of: During Operation Iraqi Freedom/Operation Enduring Freedom, many patients returning from theater with burns and traumatic war wounds ended up with multi-drug resistant bacterial soft tissue infections, especially from the previously little-known Acinetobacter baumanii.17 Much was made of this in the US media at the time, where it was labeled an “Iraqi superbug.” Know that this was mostly a problem restricted to the surgical wards and ICU’s of the military’s major medical centers.2 Recently deployed troops who present ambulatory to the ED with soft tissue infections are unlikely to have this bacterium, and you needn’t alter your initial antibiotic choice out of concern for it. Aronson, N et al. “In harm’s way: infections in deployed American military forces.” Clin Infect Dis. 2006. 43(8): 1045-1051. Malone, J et al. “Parasitic infections in troops returning from operation desert storm.” NEJM. 1991. 325: 1448-1449. Ericsson, C et al. “Postinfectious irritable bowel syndrome.” Clin Inf Dis. 2008. 46(4): 594-599. Sessums, L et al. “Care of returning military personnel.” Ann Int Med. Jul 2013. 159(1). Borchardt, S et al. “Accurate and timely diagnosis of infectious diseases in veterans returning from Iraq and Afghatnistan.” Vet Rural Heal Res Center-Central Reg. Issue brief #1. Fall 2012. Kotwal RS et al. “An outbreak of malaria in US army rangers returning from Afghanistan.” JAMA. Jan 2005. 293(2): 212-216. Pehoushek JF et al. “Cutaneous leishmaniasis in soldiers returning from deployment to Iraq.” J Am Acad Dermat. Nov 2004. 51(5): 197-200. Willard RJ et al. “Cutaneous leishmaniasis in soldiers from Fort Campbell, Kentucky returning from Operation Iraqi Freedom highlights diagnostic and therapeutic options.” J Am Acad Dermatol. Jun 2005. 52(6): 977-987. Woodrow JP et al. “Cutaneous and presumed visceral leishmaniasis in a soldier deployed to Afghanistan.” MedGenMed. Nov 2006. 8(4): 43. Myles, O et al. “Visceral leishmaniasis: clinical observations in 4 US army soldiers deployed to Afghanistan or Iraq, 2002-2004.” JAMA Int Med. Sep 2007. 167(17): 99-1901. Halsey ES. “Visceral leishmaniasis in a soldier returning from Operation Enduring Freedom.” Mil Med. Sep 2004. 169(9): 699-701. Leung-Shea, C. “Q fever in members of the United States armed forces returning from Iraq.” Clin Infect Dis. Oct 2006. 43(8): 77-82. Gleeson TD. “Q fever in US military returning from Iraq.” Am J med. Sep 2007. 120(9): 11-12. White, B et al. “Q fever in military and paramilitary personnel in conflict zones: case report and review.” Travel Med Infect Dis. 2013. 11(2): 134-137. Miceli MH et al. “A case of person-to-person transmission of Q fever from an active duty serviceman to his spouse.” Vector Borne Zoonotic Dis. Jun 2010. 10(5): 539-541. Franco, M et al. “Human brucellosis.” Lancet Inf Dis. Dec 2007. 7(12): 775-786. Calhoun, J et al. “Multi-drug resistant organisms in military wounds from Iraq and Afghanistan.” Clin Orthop Relat Res. 2008. 466(6): 1356–1362. White, N et al. “Malaria.” Lancet. 2014. 383(9918): 723-735. Eick, A et al. “Hepatitis E seroprevalence and seroconversion among US military service members deployed to Afghanistan.” J Infect Dis. 2010. 202 (9): 1302-1308. Las Vegas EM A FREE AND OPEN-ACCESS MEDICAL EDUCATION BLOG BY THE RESIDENTS AND FACULTY OF LasVegasEM. The information contained in this blog is for educational puposes only and is not intended to advocate specific medical practices. All opinions are our own and do not imply endorsement by our hospital or school of medicine. Any reference to patients has been redacted or intentionally altered to make identification impossible. READ FULL LEGAL DISCLAIMERS Free LVEM Lecture Videos #vegasfoamblog UNIVERSITY OF NEVADA LAS VEGAS DEPT. OF EMERGENCY MEDICINE 901 RANCHO LANE, STE 135 EMERGENCYMEDICINELV@GMAIL.COM F.O.A.M. WWW.LASVEGASEMR.COM LasVegasEMR.com is neither owned nor operated by the University of Nevada Las Vegas School of Medicine (UNLVSOM). It is financed and managed independently by a group of emergency physicians. This website is not supported financially, technically, or otherwise by UNLVSOM nor by any other governmental entity. The affiliation with UNLVSOM and the UNLVSOM logo does not imply endorsement or approval of the content contained on these pages. ©LasVegasEMR physicians READ FULL LEGAL DISCLAIMERS Design by DivTag Weebly Templates	cc/2020-05/en_middle_0093.json.gz/line611
__label__cc	0.610041	0.389959	HOME> - HANCOCK COUNTY>STATION 11 Shirley Volunteer Fire Department Shirley is located just between SR-234 and SR-109 & I- 70 in northeast Hancock County and Western Henry County. Main Street is literally the county line. Established in 1890, Shirley VFD provides Fire, Rescue, and BLS protection for the Town of Shirley and parts of Brown Township and Greensboro Townships. SVFD is staffed with 25 trained and professional volunteers who protect approximately 1,000 residents and 40 square miles from their single station. Fire Station 11 - Downtown Shirley The Town was incorporated in 1890, and nearly destroyed by fire in 1908. The fire claimed at least two lives and burned downmost of the downtown businesses. The Town built a water system in 1910 and a hose cart was bought to supplement the hydrantsthat were installed. The first fire truck was a homemade chemical truck constructed in 1925. The first pumper was built by Howe Fire of Anderson in 1927 and is now owned privately by an Indianapolis businessman. The current trucks are white, dating back to the department's third pumper from 1956 (shown on the retired rigs page). The lime green engines here were purchased used and did not require rennovation and therefore, were not repainted. Covering two counties adds two separate 911 centers and radio systems to make communications and mutual aid challenging. Engine 11-1 - 2008 Sutphen S-1 Shield Series Pumper - 1500gpm/1000gal Engine 11-1 is the first out apparatus for all Fire and Extrication calls. Engine 411 - 2008 Sutphen S-1 Shield Series Pumper - 1500gpm/1000gal Engine 412 - 1991 E-One Cyclone Pumper (#9010) - 1250gpm/1000gal This apparatus was purchased from Danville, WV in 2014. It was already white, but had blue stripes prior to a change to the SVFD color scheme. Engine 413: 1978 Ford/Grumman-Howe Pumper - 1000gpm/500gal Engine 413 is the second-out rural engine and reserve truck in the event the other engines are out of service. This truck was purchased in 2005 from the Greenfield Fire Department where it had a previous life in lime green. This rig was renovated in-house with volunteer labor. Engine 413 - 1978 Ford/Grumman-Howe Pumper - 1000gpm/500gal Tanker 415 - 1999 GMC/S&S - 750gpm/2100gal Tanker 415 responds on all out of town fires and is equipped for first attack fire suppression if manpower is an issue during the day. Ambulance 411 - 2014 Ford E-450/2015 PL Custom - Type III The Wilkinson and Shirley Town Councils entered into a joint venture to provide BLS transportation to this district after the local private service went out of business. The truck housed in Shirley is manned by on-call personnel and covers all of Brown Township and Northern Jackson Township in Hancock County, and Western Greensboro Township in Henry County. A second unit (Ambulance 98) is kept as backup at nearby Wilkinson VFD. BLS Ambulance 418 (x11-8) - 2006 Ford E-450/MedTec Ambulance 418 was purchased in December 2006 and served as the first-due ambulance until a new rig was purchased in 2014. It is now the reserve ambulance and is often kept at the Wilkinson Station. Special Thanks to Andrew Ebbert for helping arrange for these pictures and for providing SVFD history and background.	cc/2020-05/en_middle_0093.json.gz/line614
__label__wiki	0.663033	0.663033	Home \| About us \| Current Issue \| Archives \| Ahead of Print \| Submission \| Instructions \| Subscribe \| Advertise \| Contact \| Reader Login Most popular articles (Since April 15, 2007) Archives Most popular articles Most cited articles Abstracts of 59th Annual National Conference of Indian Psychiatric Society Indian Psychiatric Society January-March 2007, 49(5):1-60 [FULL TEXT] [PDF] 55,902 6,522 - Suicide and its prevention: The urgent need in India Lakshmi Vijaykumar DOI:10.4103/0019-5545.33252 PMID:20711387 [FULL TEXT] [PDF] [CITATIONS] [PubMed] 33,823 3,033 14 Vajikarana: Treatment of sexual dysfunctions based on Indian concepts PK Dalal, Adarsh Tripathi, SK Gupta January 2013, 55(6):273-276 DOI:10.4103/0019-5545.105550 PMID:23858267 Vajikarana or Vrishya chikitsa is a one of eight major specialty of the Ashtanga Ayurveda. This subject is concerned with aphrodisiacs, virility and improving health of progeny. As per Charak Samhita, by proper use of these formulations, one becomes endowed with good physique, potency, strength, and complexion and sexually exhilarated and sexually potent. This in turn is helpful in many common sexual dysfunctions, including Infertility, Premature Ejaculation and Erectile dysfunction. The therapy is preceded by living in strict compliance with the directions mentioned in Ayurvedic classics, various methods of body cleansing and other non-medicinal strategies like sexual health promoting conduct, behavior and diet. Certain individualized herbal and herbo-mineral combinations are administered as per the nature of a person according to the Ayurveda. Many limitations need to be considered before considering the use of theses therapy like lack of scientific studies, possibilities of adulteration in the herbal and herbo-mineral combinations available in market and possibilities of unexpected side-effects etc., The article calls upon initiating research in this area so that claims of ancient Ayurvedic texts could be substantiated and vajikaran therapy may be utilized by modern medicine. [ABSTRACT] [FULL TEXT] [PDF] [Mobile Full text] [EPub] [CITATIONS] [PubMed] 35,103 1,011 1 Farmers' suicide in Vidarbha region of Maharashtra state: A myth or reality? PB Behere, AP Behere April-June 2008, 50(2):124-127 Incidence of farmers ending their lives in Vidarbha region had hit epidemic proportions recently. We adopted the psychological autopsy approach to offer some insight into the reason why these individuals resorted to such a drastic step. Suicide in farmers is public health problem and we suggested some immediate and serious interventions to prevent suicide. [ABSTRACT] [FULL TEXT] [PDF] [CITATIONS] [PubMed] HISTORY AND PSYCHIATRY Institute of mental health and hospital, Agra: Evolution in 150 years Sudhir Kumar, Rakesh Kumar October-December 2008, 50(4):308-312 [FULL TEXT] [PDF] [PubMed] 29,524 646 - The limbic system V RajMohan, E Mohandas GUEST EDITORIALS Indian marriage laws and mental disorders: Is it necessary to amend the legal provisions? Choudhary Laxmi Narayan, Mridula Narayan, Deep Shikha, Shivendra Shekhar [FULL TEXT] [PDF] [Mobile Full text] [EPub] [PubMed] Understanding nutrition, depression and mental illnesses TS Sathyanarayana Rao, MR Asha, BN Ramesh, KS Jagannatha Rao National mental health survey of India 2015–2016 R Srinivasa Murthy January-March 2017, 59(1):21-26 DOI:10.4103/psychiatry.IndianJPsychiatry_102_17 PMID:28529357 Substance dependence: Decades apart in a teaching hospital J Venkatesan, Stelina S.D Suresh Aim: The present study was done to understand the changing trends in substance dependence across decades. Settings and Design: It is a retrospective study done in Department of Psychiatry in a Teaching Hospital setting. The data of patients who attended the OPD for substance dependence during the months January to December in the years 1985 & 1986, 1995 & 1996 and 2005 & 2006 were collected and analysed. Materials and Methods: A total of 839 new patients with substance dependence identified according to International Classification of Diseases (ICD) (n = 839) was analysed in the present report. Study variables taken into account are alcohol dependence, polysubstance dependence which also includes alcohol, age, sex, age of initiation of substance use, duration of use, and comorbidity. Statistical Analysis: Z -test, Chi-square test, mean, percentages, standard deviation. Results: Substance dependence constituted 5.32% in 1985 and 1986, 5.02% in 1995 and 1996, and 4.05% in 2005 and 2006 of the newly registered total psychiatric patients. The variation in incidence figures across the years is statistically not significant ( P > 0.05). Among the substance dependents 2% in 1985 & 1986, 1% in 1995 & 1996 and 1% in 2005 & 2006 were females. Majority of the patients were alcohol dependent (87.2% in 1985 and 1986, 89.4% in 1995 and 1996, and 79.6% in 2005 and 2006). Polysubstance dependence showed an increasing trend and it was statistically significant. Comparison of the years 1985 and 1986 with 2005 and 2006 gives Z = 2.4, P < 0.05 (statistically significant). Comparison of the years 1995 and 1996 with 2005 and 2006 gives Z = 3, P < 0.01 (significant statistically). Number of people getting initiated to substance use in early age ( viz . 10-19 years) showed an increasing trend. People with positive family history of substance dependence started using substances early in life. (Chi-square value: 164.7, P < 0.0001, significant statistically). In polysubstance dependence comorbidity was more ( Z = 4.1, P < 0.001, significant statistically). Conclusions: Incidence of substance dependence remained the same across the two decades. But incidence of polysubstance dependence is increasing over the years. People start using substances earlier and are becoming dependent earlier in their lives in the present decade. Polysubstance dependence is correlated with greater comorbidity. Early recognition of comorbidity and its management is essential for better prognosis. Substance dependence is exclusively a male diagnosis in our population. How to write a good abstract for a scientific paper or conference presentation Chittaranjan Andrade Abstracts of scientific papers are sometimes poorly written, often lack important information, and occasionally convey a biased picture. This paper provides detailed suggestions, with examples, for writing the background, methods, results, and conclusions sections of a good abstract. The primary target of this paper is the young researcher; however, authors with all levels of experience may find useful ideas in the paper. Moving towards ICD-11 and DSM-V: Concept and evolution of psychiatric classification PK Dalal, T Sivakumar A classification is as good as its theory. As the etiology of psychiatric disorders is still not clearly known, we still define them categorically by their clinical syndrome. There are doubts if they are valid discrete disease entities and if dimensional models are better to study them. We have come a long way till ICD-10 and DSM-IV, but there are shortcomings. With advances in genetics and neurobiology in the future, classification of psychiatric disorders should improve further. The concept, evolution, current status and challenges facing psychiatric classification are discussed in this review. Stressful life events among adolescents: The development of a new measure Shilpa Aggarwal, H.R.A Prabhu, Aalok Anand, Atul Kotwal April-June 2007, 49(2):96-102 Background: Adolescence can be a stressful time for children, parents and adults who work with teens. We believe that a scale measuring the events perceived as stressful by an average Indian adolescent is necessary due to the presence of irrelevant items and absence of items related to our culture on foreign scales. Aim: This study was done to adapt and test the validity of a scale measuring stress caused due to life events in an Indian adolescent; to assess clinical value of the instrument in exploring causal relationships between stressful events and behavioral problems; and to compare the degree of overlap in stress-causing events between adolescents and their parents during the same timeframe. Materials and Methods: An adolescent life event stress scale (ALESS) containing 41 items was administered to 156 adolescents for formulation and 102 adolescents for validation. A third set of 112 adolescents was used to compare ALESS scores with child behavior checklist (CBCL) scores and parental stress scores due to life events. Results: The comparison showed a strong positive correlation with CBCL scores with a model fit (r 2 = 0.32) and a weak positive correlation with parental stress (Pearson's coefficient = 0.011) due to life events. Conclusion: Thus, a life event scale for adolescents was especially adapted to the Indian conditions. An overview of Indian research in depression Sandeep Grover, Alakananda Dutt, Ajit Avasthi September 2010, 52(7):178-188 Depression as a disorder has always been a focus of attention of researchers in India. Over the last 50-60 years, large number of studies has been published from India addressing various aspects of this commonly prevalent disorder. The various aspects studied included epidemiology, demographic and psychosocial risk factor, neurobiology, symptomatology, comorbidity, assessment and diagnosis, impact of depression, treatment related issues and prevention of depression in addition to the efficacy and tolerability of various antidepressants. Here, we review data on various aspects of depression, originating from India. Substance use and addiction research in India Pratima Murthy, N Manjunatha, BN Subodh, Prabhat Kumar Chand, Vivek Benegal Substance use patterns are notorious for their ability to change over time. Both licit and illicit substance use cause serious public health problems and evidence for the same is now available in our country. National level prevalence has been calculated for many substances of abuse, but regional variations are quite evident. Rapid assessment surveys have facilitated the understanding of changing patterns of use. Substance use among women and children are increasing causes of concern. Preliminary neurobiological research has focused on identifying individuals at high risk for alcohol dependence. Clinical research in the area has focused primarily on alcohol and substance related comorbidity. There is disappointingly little research on pharmacological and psychosocial interventions. Course and outcome studies emphasize the need for better follow-up in this group. While lack of a comprehensive policy has been repeatedly highlighted and various suggestions made to address the range of problems caused by substance use, much remains to be done on the ground to prevent and address these problems. It is anticipated that substance related research publications in the Indian Journal of Psychiatry will increase following the journal having acquired an 'indexed' status. Creativity and mental health: A profile of writers and musicians KS Pavitra, CR Chandrashekar, Partha Choudhury Creativity and its link with mental health have always been much speculated about. However there have been a handful of methodologically sound studies to clearly establish the relationship between creativity and mental health. The objective of the study therefore was to examine the psychiatric morbidity stress profile, coping skills and personality profile in creative versus non-creative populations. Forty writers, 40 musicians and 40 controls chosen after randomization, who met the inclusion and exclusion criteria constituted the sample of the study. All the subjects were administered GHQ-28; SCAN for all GHQ positives (and 10% of GHQ-ves), Perceived stress scale and coping check list and NEO-FFI. Statistical analysis was done using SPSS 11.0 version. Pearson's correlation, Chi-square and ANOVA one-way tests were used. The present study corroborated the findings of earlier studies in 70's and 80's that there was no difference between creative and non-creative groups in terms of mental illness and stress profile. The writers differed significantly from the other two groups on religious and faith domain of coping skills. The two creative groups had similar personality characteristics and scored significantly high on all dimensions compared to the non-creative group. A study on the prevalence of internet addiction and its association with psychopathology in Indian adolescents Deepak Goel, Alka Subramanyam, Ravindra Kamath Background: There has been an explosive growth of internet use not only in India but also worldwide in the last decade. There is a growing concern about whether this is excessive and, if so, whether it amounts to an addiction. Aim: To study the prevalence of internet addiction and associated existing psychopathology in adolescent age group. Materials and Methods: A cross-sectional study sample comprising of 987 students of various faculties across the city of Mumbai was conducted after obtaining Institutional Ethics Committee approval and permission from the concerned colleges. Students were assessed with a specially constructed semi-structured proforma and The Internet Addiction Test (IAT; Young, 1998) which was self-administered by the students after giving them brief instructions. Dukes Health Profile was used to study physical and psychosocial quality of life of students. Subjects were classified into moderate users, possible addicts, and addicts for comparison. Results: Of the 987 adolescents who took part in the study, 681 (68.9%) were female and 306 (31.1%) were males. The mean age of adolescents was 16.82 years. Of the total, about 74.5% were moderate (average) users. Using Young's original criteria, 0.7% were found to be addicts. Those with excessive use internet had high scores on anxiety, depression, and anxiety depression. Conclusions: In the emerging era of internet use, we must learn to differentiate excessive internet use from addiction and be vigilant about psychopathology. Episodic confusional state: Due to insulinoma Jagadheesan Venkatesan, Sophie Dina Suresh Stelina July-September 2008, 50(3):197-199 This case report deals with 45-year-old male who came for consultation in the psychiatry department for the persisting symptoms, after consulting various departments with no relief. He had episodes of confusion with disorganized behavior, restlessness, and symptoms like talking irrelevantly once a week lasting up to 10-30 min in the preceding six months. Investigations like computerized tomography scan, electroencephalogram were not contributory. While under observation in our ward for evaluation and diagnosis, one such episode with intense sweating and clouding of consciousness was witnessed and helped in clinching the diagnosis of insulinoma. The case is reported for its rarity and as one of the causes of episodic confusional state. Prevalence of alcohol and drug dependence in rural and slum population of Chandigarh: A community survey BS Chavan, Priti Arun, Rachna Bhargava, Gurvinder Pal Singh The present epidemiological survey was conducted by the department of psychiatry, Govt. Medical College and Hospital, Chandigarh to estimate the pattern of alcohol and other substance dependence in rural and slum dwellers population of Chandigarh. In this survey 6.88% individuals of the total population surveyed (2992) fulfilled dependence criteria of ICD-10. Alcohol was the primary substance of dependence for majority of urban slum substance users and rural areas users. Age at first drug use was 20.89 ± 5.31 years (mean ± S.D) among rural population and 19.75 ± 5.4 years (mean ± SD) in urban slums. Majority of them reported having health related complications (85.71%) followed by family problems (77.31%) due to drug dependence. This survey reflects the need to intensify efforts at the community level to reach the unreached. The Rights of Persons with Disabilities Act, 2016: Does it address the needs of the persons with mental illness and their families Choudhary Laxmi Narayan, Thomas John DOI:10.4103/psychiatry.IndianJPsychiatry_75_17 PMID:28529356 AWARD PAPERS Acute and transient psychosis: A paradigmatic approach Savita Malhotra Cellular and molecular mechanisms of drug dependence: An overview and update Swapnil Gupta, Parmananda Kulhara Drug dependence is a major cause of morbidity and loss of productivity. Various theories ranging from economic to psychological have been invoked in an attempt to explain this condition. With the advent of research at the cellular and subcellular levels, perspectives on the etiology of drug dependence have also changed. Perhaps the greatest advance has been in the identification of specific receptors for each of the drugs, their target neurotransmitter systems and the intracellular changes produced by them. These receptors also provide potential targets for treatment strategies of drug dependence. This overview attempts to present the mechanisms in the development of dependence and the newer treatment strategies for the major drugs of abuse like alcohol, opioids, cannabis, nicotine and cocaine. The MMR vaccine and autism: Sensation, refutation, retraction, and fraud TS Sathyanarayana Rao, Chittaranjan Andrade [FULL TEXT] [PDF] [Mobile Full text] [EPub] [CITATIONS] [PubMed] Prevalence of attention deficit hyperactivity disorder in primary school children Jyothsna Akam Venkata, Anuja S Panicker Context: There is a lacuna of studies on Attention Deficit Hyperactivity Disorder (ADHD) in the Indian context. Aims: (i) To identify the prevalence of ADHD in primary school children, (ii) To identify the gender difference in the prevalence of ADHD, (iii) To compare the distribution of ADHD among different socioeconomic status, (iv) To identify the presence of any co-morbid factors associated with ADHD. Settings and Design: This is a cross sectional study of school aged children selected from four different schools in Coimbatore district. Materials and Methods: Seven hundred seventy children aged between 6 and 11 years were selected from four schools in Coimbatore district after obtaining informed consent from their parents. The presence of ADHD was assessed by using Conner's Abbreviated Rating Scale (CARS) given to parents and teachers. The children identified as having ADHD were assessed for the presence of any co-morbid factors by administering Children's Behavioural Questionnaire (CBQ) to the teachers and Personal Information Questionnaire to the parents. Statistical Analysis: Statistical Product and Service Solutions (SPSS) 10 software, Mean and Standard Deviation, and student's t test were used for statistical analysis. Results: The prevalence of ADHD among primary school children was found to be 11.32%. Prevalence was found to be higher among the males (66.7%) as compared to that of females (33.3%). The prevalence among lower socio-economic group was found to be 16.33% and that among middle socio-economic group was 6.84%. The prevalence was highest in the age group 9 and 10 years. Conclusion: The present study shows a high prevalence of ADHD among primary school children with a higher prevalence among the males than the females. Sitemap \| Feedback \| Copyright and Disclaimer © 2006 - Indian Journal Psychiatry \| Published by Wolters Kluwer - Medknow Online since 15th April, 2007	cc/2020-05/en_middle_0093.json.gz/line615
__label__cc	0.633216	0.366784	The New Monday Quiz Celebrates π Day Hey, it's March 14! And, I've been doing a bunch of arguably grown-up things in the physical world, so I need a super-straightforward topic if there's going to be a Monday Quiz. Therefore, today's topic is: 1. What is π, anyway? Not the numbers, but their significance. 2. What's 2πr? 3. What's πr2? 4. What's 4/3 πr3? 5. If all you had was the 2πr formula, you could reason out pretty quickly that π was going to be between two and four. How? 6. If all you had was the πr2 formula, you could do the same thing. How would that work? 7. True or False: Although it had long been established that π must be between 3 and 3.25, it could not be calculated with precision until the advent of modern computers. 8. True or False: Because each successive digit of π requires an order of magnitude of computer power to calculate, an accurate figure to 1000 decimal places reached in 1970 has, as of 2015, only been extended to 1200 decimal places known with absolute certainty. 9. True or False: When a British scientist exclaimed "How I want a drink, alcoholic of course, after the heavy lectures involving quantum mechanics," what did that have to do with this quiz? 10. A fellow named Rajveer Meena holds the world record for memorizing and reciting π to the greatest number of decimal places. About how far out do you suppose he got? Oh, go on, guess. It's only the Monday Quiz. Labels: Holiday Cheer, The New Monday Quiz UnwiseOwl said... Grown-up things? Ugh! 1. The proportion of a the circumference of a circle relative to its diameter. 2. Wait, did you just ask me the same thing again? 3. The area of the circle. 4. The volume of a sphere? 5. Hrmm...maths proofs, ugh. Well...Since the circumference of half a circle 2πr/2 (πr) is obviously longer than the diameter 2r, π > 2. And...the 'circumference' of a square of sides 2r (which would be the smallest square that the circle could fit inside) would be 8r. The circle must have a lesser circumference than that, so 2 < 8 and thus πr <4. 6. I dunno, man. Area of that big square is 4r² (2rx2r), and the area of the circle is less than the square too, therefore π < 4. The >2 bit has me baffled. 7. Depending on your definition of precision, false. Greeks were pretty smart. 8. Ummm...very false. 9. That's a well known piem. 10. 7000? Guy had skills, probably. DrSchnell said... 1. It's a constant that you can use to compute the circumference or the area of a circle given its radius. Or, given question 3, the area of a sphere..... 2. circumference of a circle, given the radius (r) 3. area of a circle, given the radius (r) 4. volume of a sphere given radius r? 5. mmmmmm . . . pie! 6. probably something involving cutting out squares and trying to fit them inside the circle. 7. I guess that would depend upon your definition of precise, no? But that begs the question - how are they computing it? Given that there's no fraction that you can create that equals pi, and therefore, no exact measurements of a circle that you could measure even with the most precise measuring instrument that would give it to you, where are they getting it from? What numbers are they placing into their supercomputer and saying, "go to town, HAL" with? 8. false-a-roonie! 9. mmmmmmmm.. . ... pie! 10. 1000 places? 1. It's a greek letter. The lower-case "pi" also represents the circumference of a circle divided by its diameter. It can also represent, for example, a function representing the density of the primes. There are fewer letters than there are mathematical concepts that we'd like to represent succinctly, as it turns out. 2. That's the circumference of a circle, if "r" is the radius of the circle. 3. That's the area of a circle, again with "r" being the radius. 4. That's the volume of a circle. 5. A value of 2 would be good for measuring the length of the diameter twice, as if we were marching around the outside. A value of 4 would be good for measuring the perimeter of a square. Since a circle is bounded horizontally the same as both of these shapes, extends further vertically than the line, but is more confined vertically than the square, we can conclude that pi is somewhere between 2 and 4 (this is not a rigorous proof by any means). 6. We can draw a square completely inside of a circle with area pi2^2 (put the corners on the circle) and a square completely containing a circle with area pi4^2 (put the center of each of the lines on the circle). 7. False. It's a straightforward mathematical procedure. We did it in my high school geometry class. 8. False. It's pretty easy to increase precision. 9. I'm not really sure how that's a "True or False". 10. I'd guess on the order of magnitude of 100,000, but it could very possibly be much higher. The Infinite Art Tournament, Left Bracket Second R... Element of the Month: Erbium! The Infinite Art Tournament, Round Two: Prud'hon v... The Songs of the Fifty States: Missouri revisited The Infinite Art Tournament, Round One: Ribera v. ... The Infinite Art Tournament, Round 3: Patenier v. ... The Infinite Art Tournament, Round Two: Popova v. ... The Infinite Art Tournament, Round One: Renoir v. ... The Infinite Art Tournament, Left Bracket Third Ro... The Infinite Art Tournament, Round One: Rembrandt ... The Infinite Art Tournament, Round Two: Polke v. P... Through History with The New Monday Quiz: the 1230... The Semi-Finals: Chardin v. Cassatt! At the Movies: Ugly The Songs of the Fifty States: Arizona The Infinite Art Tournament, Round Two: Pisanello ...	cc/2020-05/en_middle_0093.json.gz/line616
__label__cc	0.690866	0.309134	Meet the Youngest Prof in the World - She's 18 0 0 AKA4ESP Monday, 12 February 2018 Edit this post Alia Sabur is her name; she was three days short of her nineteenth birthday when she turned into a full-time workforce Profess... Alia Sabur is her name; she was three days short of her nineteenth birthday when she turned into a full-time workforce Professor at Konkuk University in Seoul, South Korea. The past record was held by an understudy of physicist Isaac Newton, Colin Maclaurin, who set the check in 1717. She began talking and perusing at 8 months old. She completed her primary school at age 5, She made a long bounce to school at age 10, she played the clarinet with the Rockland Symphony Orchestra at 11 and by age 14 she earned a four year education in science degree in connected arithmetic from Stony Brook University She later earned a Master's degree and a PhD in material science and designing from the Drexel University. Academic Academics achievement Career advise Education Youngest Professor INSIDEFUTO BLOG: Meet the Youngest Prof in the World - She's 18 https://1.bp.blogspot.com/-lhvITyOg2kE/WoIwMEbFjgI/AAAAAAAAAW0/V1gFsJl0CgQrMUx2U9iSl-IGbf3RbzSCgCLcBGAs/s640/young%2Bprof%2B1.jpg https://1.bp.blogspot.com/-lhvITyOg2kE/WoIwMEbFjgI/AAAAAAAAAW0/V1gFsJl0CgQrMUx2U9iSl-IGbf3RbzSCgCLcBGAs/s72-c/young%2Bprof%2B1.jpg http://www.insidefutoblog.com.ng/2018/02/meet-youngest-prof-in-world-shes-18.html	cc/2020-05/en_middle_0093.json.gz/line618
__label__cc	0.628555	0.371445	Iraq Dinar - Iraqi Dinar - Iraq Stock Exchange - Dinar Revaluation and Speculation - Investors Iraq > Iraq News > Iraqi General News > Ahrar bloc calls demonstrators to avoid sectarian slogans View Full Version : Ahrar bloc calls demonstrators to avoid sectarian slogans Sunday, 06 January 2013 20:38 \| http://www.alliraqnews.com/cache/multithumb_thumbs/b_280_189_16777215_0___images_idoblog_upload_1861_ alahrar-12-12-2012-bbb.jpg Baghdad (AIN) –Ahrar bloc called the demonstrators in Anbar and other provinces to avoid sectarian slogans and not to be driven by foreign agenda. The head of the bloc, Baha al-Araji, stated in a press conference held at the parliament building on Sunday "The demonstrations are constitutional but we call the demonstrators to condemn the recent statements launched by the Deputy President of the former regime, Izzat al-Dori." "Ahrar bloc was the first to call for endorsing the General Amnesty Law but we are against canceling the Justice and Accountability Law," he concluded. Anbar, Nineveh and Salah-il-Din provinces witness demonstrations since days in protest of arresting the guards of the Finance Minister, Rafi al-Esawi, and calling to release the detainees in addition to getting the IA forces from the cities. http://www.alliraqnews.com/en/index.php?option=com_content&view=article&id=26152:ahrar-bloc-calls-demonstrators-to-avoid-sectarian-slogans-&catid=35:political&Itemid=2	cc/2020-05/en_middle_0093.json.gz/line623
__label__wiki	0.958064	0.958064	Court hears of 'errors' in attempts to access McIntyre Boston College tapes Belfast Project researcher Anthony McIntyre has taken legal action over attempts to gain access to his own Boston College interviews. Picture from BBC Jean McConville killing: Evidence against Ivor Bell was unlawfully obtained from US Anthony McIntyre seeks to prevent PSNI getting access to his Boston College tapes Winston Rea released on bail after being charged with murder of two Catholic workmen Boston College holds the Belfast Project tapes A FORMER IRA man interviewed for Boston College's 'Belfast Project' claims he was the victim of a bomb attack for which he is now under investigation, the High Court has heard. Anthony McIntyre also alleges he was acquitted on a charge of membership of a proscribed organisation that forms part of a police attempt to gain access to his tapes from the US university. Senior judges in Belfast have now ordered the PSNI and Public Prosecution Service to clarify the situation and explain how an International Letter of Request (ILOR) for the material wrongly included an erroneous conviction for armed robbery. McIntyre's legal bid to stop detectives listening to the tapes has been put on hold until explanations are provided and shared with American authorities. With the case adjourned until September, PSNI officers due to travel to Boston tomorrow as part of a separate inquiry will not yet be able to take possession of his recordings. McIntyre, who is from Belfast but now lives in the Republic, was one of the main researchers in the major project to compile an oral history of the Troubles. Dozens of loyalists and republicans provided testimonies to Boston College on the understanding their account would only be made public after they died. But those assurances were dealt a blow when legal battles resulted in police securing transcripts and tapes of interviews given by former IRA woman Dolours Price and high-profile loyalist Winston 'Winkie' Rea. Rea (65), from Groomsport, Co Down, appeared before a court earlier this month charged with the murders of two Catholic workmen in Belfast more than 25 years ago. Now the authorities want access to McIntyre's recorded recollection of his own IRA activities. A subpoena seeking copies of his interviews has been served on Boston College by the British government. The move involves an ILOR setting out alleged offences being investigated. McIntyre's lawyers have issued judicial review proceedings against the PSNI and PPS for issuing the request letter. In court it emerged that the alleged offences being investigated include a bomb explosion at Rugby Avenue in Belfast in 1976, and an imitation or toy pistol discovered inside a prison where he served time. Ronan Lavery QC, for McIntyre, claimed: "The ILOR is replete with errors, and that's putting it mildly." Disputing any suggestion that his client was behind the bombing, he added: "In relation to the explosion on Rugby Avenue Mr McIntyre (says he) was the victim." It was also contended that the former IRA man was acquitted more than 30 years ago of a membership charge that features in the international letter. Counsel for the respondents were unable to confirm the claim, insisting archives would have to be checked. Lord Justice Weatherup, sitting with Lord Justice Weir, described the situation as unsatisfactory. "It's incredible; you have sent a letter to America... and you don't know whether it was in respect of an offence for which he's already been acquitted," he said. During the hearing it was accepted that an armed robbery incident for which McIntyre was never convicted was erroneously included in the ILOR. But judges were told the mistake was brought to the attention of the US court before any decision was taken on releasing the tapes. Tony McGleenan QC, for the Chief Constable, contended that McIntyre was raising speculative points that may prove to be groundless. He suggested PSNI officers who will be in Boston on Saturday to collect other materials could also bring back the McIntyre recordings and deposit them, still sealed, with the court. However, Lord Justice Weatherup instead directed the PSNI and PPS to first file a statement explaining the issues raised. Anthony McIntyre belfast project 23 June, 2016 19:43 Northern Ireland news	cc/2020-05/en_middle_0093.json.gz/line624
__label__wiki	0.642744	0.642744	Political Parties, Elections and Referendums Act 2000 2000 c. 41 Show Explanatory Notes for Sections Open Act without Schedules Correction Slip - 31/07/2013 This is the original version (as it was originally enacted). 2The Commission may do anything (except borrow money) which is calculated to facilitate, or is incidental or conducive to, the carrying out of any of their functions. PrintThe Whole Schedule PDF The Whole Schedule Web page The Whole Schedule You have chosen to open The Whole Act The Whole Act you have selected contains over 200 provisions and might take some time to download. You may also experience some issues with your browser, such as an alert box that a script is taking a long time to run. You have chosen to open The Whole Act as a PDF The Whole Act you have selected contains over 200 provisions and might take some time to download. Show Explanatory Notes for Sections: Displays relevant parts of the explanatory notes interweaved within the legislation content. Text created by the government department responsible for the subject matter of the Act to explain what the Act sets out to achieve and to make the Act accessible to readers who are not legally qualified. Explanatory Notes were introduced in 1999 and accompany all Public Acts except Appropriation, Consolidated Fund, Finance and Consolidation Acts.	cc/2020-05/en_middle_0093.json.gz/line627
__label__wiki	0.856106	0.856106	AIRPLANE VIDEOS PILOT TRAINING & DOCUMENTARY FILMS WARBIRDS FORUM North American FJ-1 Fury Airplane Videos and Airplane Pictures - Page 2 RQ-170 Sentinel A-10 Thunderbolt II "Warthog" Bell P-59 Airacomet Fictional Military Aircraft Spitfire Ace Great Planes: B-57 Canberra Dogfights: Desert Storm Advanced German Weapons WARBIRD DVDS O! for a horse with wings! - William Shakespeare, Cymbeline Quote LivingWarbirds.com Suggestions/Comments Share Your Videos Help Veterans Honor Flight Network KID'S DVDS North American FJ-1 Fury Video - Picture More North American FJ-1 Fury Videos 1 2 North American FJ-1 Fury Aircraft Information Picture: An FJ-1 Fury in 1947 Role - Fighter aircraft National origin - United States Manufacturer - North American Aviation First flight - 11 September 1946 Introduced - October 1947 Primary users - United States Navy Number built - 31 (including prototype) The North American FJ-1 Fury was the first operational jet aircraft in United States Navy service, and was developed by North American Aviation as the NA-135.[1] The FJ-1 was an early transitional jet of limited success which carried over similar tail surfaces, wing and canopy derived from the piston-engined P-51 Mustang. The evolution of the design to incorporate swept wings would become the basis for the land-based XP-86 prototype of the United States Air Force's enormously influential F-86 Sabre, which itself formed the basis for the Navy's carrier-based FJ-2/-3 Fury. Ordered in late 1944 as the XFJ-1 in competition with proposals from Douglas and Vought, the Fury began as a straight-wing, tricycle gear fighter with a single turbojet passing through the fuselage. The wing, empennage and canopy strongly resembled that of the piston-engined P-51 Mustang, North American Aviation's highly successful World War II fighter. The first flight of the prototype XFJ-1 took place on 11 September 1946, with the first of thirty deliveries beginning in October 1947. The Fury's first landing on an aircraft carrier was made 10 March 1948 aboard USS Boxer. Flown operationally by Navy squadron VF-5, the FJ-1 pioneered jet-powered carrier operations and underscored the need for catapult-equipped carriers. The Fury was capable of launching without catapult assistance, but on a crowded flight deck the capability was of small practicality. In reality, taking off without a catapult launch, pitched the FJ-1 into a perilous, slow climb that was considered too risky for normal operations.[2] As straight wings were seen at the time as the only way to ensure the low speed and stability needed for carrier landings, the FJ-1 used a straight wing. No provision for wing-folding had been made as dive brakes mounted in the wings made that option unfeasible. In order to conserve carrier deck space, a unique "kneeling" nose undercarriage along with a swivelling "jockey wheel" allowed the FJ-1 to be stacked tail-high, close to another FJ-1.[3] Although ordered into production, the initial order for 100 units was trimmed to only 30 aircraft which were mainly used in testing at NAS North Island, with VF-5A, later redesignated VF-51, operated the type in operational service beginning in August 1948. Although VF-51 went to sea on Boxer by May 1949, the FJ-1s were phased out in favor of the new F9F-3 Panther.[4] Ending its service career in US Naval Reserve units, the FJ-1 eventually was retired in 1953. The one highlight in its short service life was VF-51's win in the Bendix Trophy Race for jets in September 1948. The unit entered seven FJ-1s, flying from Long Beach, California to Cleveland, Ohio, with VF-51 aircraft taking the first four places, ahead of two California ANG F-80 Shooting Stars.[1] Picture: A U.S. Navy FJ-1 Fury of the Oakland Naval Air Reserve flies over Oakland, California in 1950. Picture: FJ-1 and FJ-2 in 1952 XFJ-1 Prototype aircraft, powered by a 3,820 lbf (17 kN) General Electric J35-GE-2 turbojet engine, three built. FJ-1 Fury Single-seat fighter aircraft, powered by a 4,000 lbf (17.8 kN) Allison J35-A-2 turbojet engine, armed with six 0.50 in (12.7 mm) machine guns, 30 built. Specifications (FJ-1) Length: 34 ft 5 in (10.48 m) Wingspan: 38 ft 2 in (11.63 m) Height: 14 ft 10 in (4.52 m) Wing area: 221 ft² (20.5 m²) Empty weight: 8,843 lb (4,010 kg) Loaded weight: 15,118 lb (6,854 kg) Powerplant: 1× Allison J35-A-2 turbojet, 4,000 lbf (17.8 kN) 805 gal (3018 l) Fuel provisions Internal fuel load: 465 gal (1,743 l), Wing Tip Tanks: 2 × 170 gal (644 l) JP-4 fuel Performance Maximum speed: 547 mph at 9,000 ft (880 km/h at 2,743 m) 1,496 mi (with external tanks). (2,407 km) Range: 1,496 mi, (2,407 km) Service ceiling: 32,000 ft. (9,753 m) Rate of climb: 3,300 ft/min at sea level (1,005 m/min) Thrust/weight: 0.38 Stalling speed (power off): 121 mph (106 kn, 194 km/h) Guns: 6 × 0.50 in (12.7 mm) M2 Browning machine guns (1,500 rounds in total) Related development FJ-2/-3 Fury Comparable aircraft Dassault Mystère FH Phantom F-84 Thunderjet Saab Tunnan Supermarine Attacker 1. a b "The FJ-1 Fury." Retrieved: 29 April 2008. 2. "North American FJ-1 Fury – carrier-borne fighter." aviastar.org. Retrieved: 29 April 2008. 3. "FJ Fury." boeing.com. Retrieved: 29 April 2008. 4. "FJ Fury." globalsecurity.org. Retrieved: 29 April 2008. Taylor, John, W.R., ed. Jane's All the World's Aircraft 1965-1966. London: Jane's All the World's Aircraft, 1967. ISBN 0-71061-377-6. Wagner, Ray. The North American Sabre. London: Macdonald, 1963. No ISBN. Winchester, Jim, ed. Military Aircraft of the Cold War (The Aviation Factfile). London: Grange Books plc, 2006. ISBN 1-84013-929-3. Living Warbirds: The best warbirds DVD series. This site is the best for: everything about airplanes, warbirds aircraft, war bird, plane film, airplane film, war birds, airplanes videos, aeroplane videos, and aviation history. A list of all aircraft video. Copyright � A Wrench in the Works Entertainment Inc.. All rights reserved.	cc/2020-05/en_middle_0093.json.gz/line637
__label__cc	0.583557	0.416443	Home Camera Panasonic Review Panasonic GH4 to Become the Most Expensive MFT Camera Panasonic GH4 to Become the Most Expensive MFT Camera 3/11/2014 Camera, Panasonic, Review It's been just over a month since Panasonic made the original announcement for GH4, and the official pricing for both the GH4 and the interface unit is availability now. The GH4 camera body will be available at the beginning of May, at a retail price of US-$ 1,699.99, making it the most expensive Micro Four Thirds camera so far–but also the most capable. The interface unit for the GH4 can be purchased separately for US-$ 1,999.99, or in kit with the camera for a grand total of a little under US-$ 3,300. Panasonic GH4 is clearly aimed at the professional videographer look for an affordable 4K Ultra_HD solution. For some folks, the high price of GH4 is justifiable for sure. But for others who just need a good compact interchangeable lens camera with HD video capability, it's a bit too pricey, especially when you can have an outstanding all around camera such as Olympus OM-D E-M1 for $1,399. You can also check out the OM-D E-M1 video review to see if that suits your needs even though it's not in the same league as 4K Ultra HD found in GH4. Panasonic also made available a full-fledged accessory interface unit that you won't find in any other Micro Four Thirds camera. Tech Highlight Brand new 16.05 Micro Four Thirds sensor DCI 4K 4096x2160 at 24p UHD 4K 3840x2160 at 30p/24p 4:2:0 to the SD card, 4:2:2 otherwise NFC, Wifi capabilities 1/8000 shutter speed 2,359K-Dot OLED Live View Finder Splash and dust proof with a magnesium alloy body Venus 9 engine High-Speed 49-Point Autofocus 4:2:2 8-Bit or 10-Bit HDMI Output 3 inch LCD screen with 1040K Dots Bulb mode of up to 60 mins FHD 60P readout Panasonic GH4 to Become the Most Expensive MFT Camera Reviewed by Brandon on 3/11/2014 Rating: 5 Camera Panasonic Review	cc/2020-05/en_middle_0093.json.gz/line646
__label__wiki	0.924707	0.924707	Secretary General welcomes Prime Minister Zaev to NATO Headquarters Photo credit: NATO Secretary General Jens Stoltenberg welcomed Prime Minister Zoran Zaev to NATO headquarters on Monday (12 June 2017) for talks on the partnership between the Alliance and the former Yugoslav Republic of Macedonia. The Secretary General congratulated Prime Minister Zaev on his appointment and welcomed the formation of a new government. Mr. Stoltenberg encouraged all political parties to focus on necessary reforms, including on good governance and the rule of law. He noted that these reforms will benefit all citizens of the former Yugoslav Republic of Macedonia, and will further advance the country’s Euro-Atlantic aspirations. “We want to see your country as part of a stable, democratic and prosperous region,” he added. Calling Skopje “an important partner” for NATO, the Secretary General also thanked Prime Minister Zaev for his country’s contribution to NATO’s Resolute Support Mission in Afghanistan. He noted that the Alliance will continue to support Skopje’s path towards Euro-Atlantic integration, including NATO membership. Source: NATO Media/News Center Keep up to date with the latest news and developments that impact Greece's national security and Balkan regional stability. Επίσης Διαβάστε Τα άρθρα του Μάρκου Α. Τέμπλαρ στα Ελληνικά εδω. FYROM Watch Marcus A. Templar Please Visit & Support Highlighted Articles Ilinden: A Story of the Web and the Harpoon - The “People’s Republic of Krushevo” -- by Marcus A. Templar Fallacies and Facts on the Macedonian Issue A Synopsis of the FYROM Name Issue -- by Marcus A. Templar The Treaty of Bucharest: Borders of the Balkan countries as of 10 August 1913 III Communist International, Fifth Congress - June 17-July 8, 1924 "Resolution on National Question in Central Europe and the Balkans" The Balkans: Macedonian and Thracian Questions -- Comintern Journal #7 An Introduction to and Remarks on the Comintern Resolution of 11 January 1934 Eliminating Opposition One Way or Another: The Case of the Expelled Swabian Germans and the Kidnapping of Greek Children (c) 2014-2019 The Macedonian League	cc/2020-05/en_middle_0093.json.gz/line648
__label__wiki	0.758501	0.758501	Izumo Class - Machtres Fighters Telephone List SU Comparative Table B52-stratofortress B2-Spirit Pampa Serie II Pampa Serie III Yak-130 N. Korean arsenal Iranian arsenal Russian KAB Borisoglebsk 2 Russian KAB1 China weapons Develops of Argentina SBX Radar a-400M Xian Y-20 b797-x48b X projects QF-16 yal-1a wedgetail emb145 G550-CAEW E3-C Sentry Wings of Malvinas Space Chaco pulqui 1 France Mistral Class China: Next generation Japan Hyuga Class Japan Izumo Class sacb saocom ArSat 1-2-3 Tronador II VEX1 Aleph Constellation CubeBug-1 BugSat-1 gradicom pcx/pcx2 Hyperspectral Sensors Tracking stations Izumo Class The Ministry of Defense (MOD) first announced plans for the new class on November 23, 2009. This ship's primary mission is anti-submarine warfare but peacekeeping and disaster relief operations are also being considered. The ship will be able to carry up to 14 helicopters, however only 7 ASW helicopters and 2 SAR helicopters are planned for the initial aircraft complement. For other operations, 400 troops and 50 3.5t trucks (or equivalent equipment) can also be carried. The flight deck has 5 helicopter landing spots that allow simultaneous landings or take-offs. The ship is equipped with 2 Phalanx CIWS and 2 SeaRAM for its defense. The destroyers of this class were initially intended to replace the two ships of the Shirane class, which were originally scheduled to begin decommissioning in FY2014. Forecast International has reported that some of the design changes with respect to the previous class are intended to support the Bell-Boeing V-22 Osprey and Lockheed Martin F-35 Lightning II aircraft,[5] although neither the MOD or the JMSDF have ever mentioned the possibility of introducing fixed-wing aircraft. The construction of the first ship of the class began in 2011 at an IHI Marine United shipyard in Yokohama. with funding totaling 113.9 billion yen ($1.5 billion) being set aside in the fiscal 2010 budget for this purpose. Commissioning of the first of class is currently scheduled for 2015. Ships in the class In September 2011, The Asahi Shinbunreported that the Ministry of Defence is to proceed with a budget request calling for funds for the construction of the planned second unit in the class, but finally, the budget was approved and construction contract was awarded to IHI Corporation in October 2012. This will come under the Defense Ministry's Mid-Term Defense Program FY2011-2015. The first ship in the class, the Izumo was launched on 6 August 2013. On August 6, 2013 the Izumo (DDH-183) was unveiled in Yokohama, south of Tokyo, Japan. The Washington Post noted that this ship, the biggest warship in Japan's fleet since World War II, "has raised eyebrows in China and elsewhere because it bears a strong resemblance to a conventional aircraft carrier" and has been described by the Chinese, as an “aircraft-carrier in disguise”. Though technically a destroyer, some experts believe the new Japanese ship could potentially be used in the future to launch fighter jets or other fixed wing aircraft. Japanese officials say it will be used in national defense. Specifically, they cited anti-submarine warfare and border-area surveillance missions. Additionally, it is intended to bolster the nation’s ability to transport personnel and supplies in response to large-scale disasters. This unveiling occurred at a time of heightened tensions over several small disputed islands called the Senkaku in Japan and the Diaoyutai in China. The islands are located between southern Japan and Taiwan. Name: Izumo-class helicopter destroyer Builders: IHI Marine United Preceded by: Hyuga class helicopter destroyer Cost: 113.9 billion yen ($1.2 billion for construction of first unit to date) Planned: 2 19,500 tonnes empty 27,000 tons full load Length: 248.0 m Beam: 38.0 m Draft: 7.5 m Depth: 23.5 m Installed power: 112,000 hp (84,000 kW) Propulsion: COGAG, two shafts 4 × GE/IHI LM2500IEC gas turbine Speed: 30 knots (56 km/h) Complement: 970 including crew and troops Sensors and processing systems: OYQ-12 combat direction system OPS-50 AESA radar OPS-28 surface-search radar OQQ-23 bow sonar Electronic warfare & decoys: NOLQ-3D-1 EW suite Mark 36 SRBOC Anti-torpedo mobile decoy (MOD) Floating acoustic jammer (FAJ) Armament: 2 × Phalanx CIWS 2 × SeaRAM CIWS Aircraft carried: 7 ASW helicopters and 2 SAR helicopters 14 aircrafts maximum index \| Air Services \| Planes \| History \| Aircraft Carriers \| Space \| General Site Map	cc/2020-05/en_middle_0093.json.gz/line649
__label__cc	0.630002	0.369998	Maggie Allen Candy Email: maggieallencandy@yahoo.com Holiday Brittle Old Tyme...Southern Style..Delicious...With Love From Our Heart To Your Taste Buds! Maggie Allen Candy gives you 5-Star Award Winning Peanut Brittle with a delicious sweet buttery flavor and crunchy texture that literally melts in your mouth! Guaranteed Fresh. The History of Peanut Brittle According to the history of peanut brittle candy, brittle was probably the first candy ever made. Peanut brittle made with corn syrups and nuts began appearing in cookbooks around the 19th century. Peanut Brittle History and Folklore Because we find peanut brittle recipes most commonly in American cookbooks, it is generally recognized as an American recipe, but it's safe to assume that brittles, like pralines, have been made in all countries-or any country where sweet liquids such as molasses, honey, sugar or a variety of other sweets were available-for hundreds of years. Soft and hard nougat candies also would have arrived in the cookbooks somewhere along the same time. As for the peanuts, peanuts became more popular in America during the Civil War. According to the National Peanut Board, soldiers who were fighting survived off peanuts. Once George Washington Carver began to reveal how many ways peanuts could be used in 1903, their popularity exploded, especially in the American South. Perhaps due to the Southern connection, the history of peanut brittle is tied to Tony Beaver, a lumberjack folk hero. In the story, Tony Beaver creates peanut brittle when he stops a flood using peanuts and molasses. Not only does he save a town, but he also gives them a terrific snack.	cc/2020-05/en_middle_0093.json.gz/line651
__label__wiki	0.805613	0.805613	7 Labels / Record Deals 4 Sync Licensing: Advertising 4 Sync Licensing: TV / Movies / Video Games 3 Publishing Deal 1 Management Deals 1 Artist Development 2 Not Available 3 $501 - $1,000 3 $1,001 - $1,500 1 $3,001 - $5,000 new Tommy Boy Seeks New Music for Potential Signings Tommy Boy Seeks New Music for Potential Signings Legendary Hip Hop & Electronic label founded in NYC in 1981 seeks new talent to add the roster. We are looking for artists that bring originality and undeniable vibes to the table. Please submit your best tracks for consideration. Tommy Boy is credited with launching the careers of notable Hip Hop legends Afrika Bambaataa, Coolio, Queen Latifah, House of Pain, De La Soul, and Naughty By Nature. - Brian Delaney - A&R - Tommy Boy Entertainment Teen Music Acts Wanted for Genuine Music Group Looking for 13-18 year old teen pop based vocalists or bands for development and shopping for deals. Please submit your best track(s) for consideration. Genuine Music Group's producer/songwriter clients have been featured on sales of more than 140 million records. Over 70 RIAA Gold and Platinum awards have been earned by the company for it’s work on numerous contemporary artists including Eminem, Christina Aguilera, Jay Z, Usher, Justin Timberlake, Dr Dre, Robin Thicke, 50 Cent, Lil Wayne, Jennifer Lopez, Faith Hill, LeAnn Rimes, Trey Songz and more… - Michael "Mav" Mavrolas / Genuine Music Group Deal Type: Label/Management Signing Decision Maker: We are the final decision maker Similar Sounding Artists: Justin Bieber, Ariana Grande, Taylor Swift, Shawn Mendes, etc Publisher seeking uptempo pop songs a la Katy Perry, Maroon 5 and Lady Gaga Successful publisher seeking uptempo pop songs a la Katy Perry, Maroon 5 and Lady Gaga for film, TV and advertising placements. If your song is selected you will be offered an exclusive publishing agreement. High quality masters only. No demos. Expressive Artists is a music publishing company with an emphasis on film and television placement. In the past year we've placed more than 50 songs submitted by Music Xray artists (including theatrically released feature films and documentaries). Pop-Up Music Needs Pop Music Pop-Up Music needs 'Pop' Music to add to their roster. We are after all genres of Pop music past and present from 1960's(USA Bubble-gum-Pop would be so cool), 1970's{some original Disco or Glam Rock would be amazing), 1980's(bring on some New Romantic) up-to present Pop - Indie Pop, Electro Pop, Indie Folk, Electro Swing, Dubstep. This opportunity is for an exclusive contract with a term - all submissions must be 100% owned by the writer/writers. We look forward to your Pop submissions Record Label Looking for Ambient, Minimal, Piano Recordings to Release Bad Architect Records is currently looking for new, unreleased, recordings in the style of Nils Frahm, Olafur Arnalds, Max Richter, and other artists in the minimal, Neo-classical genre to release on record label! - Judson Hurd - CEO - Bad Architect Records We're currently looking for Slide Guitar, 'Muddy Waters', Down Home, Blues style songs for worldwide placements We're currently looking for Slide Guitar,'Muddy Waters', Down Home, Blues style songs for worldwide placements We're currently looking for Slide Guitar, 'Muddy Waters', Down Home, Blues style songs for worldwide placements in film, tv, advertising, and sub-publishing opportunities. IMPORTANT: High Quality submissions only. No demos will be accepted for this listing If selected, you will be offered an exclusive licensing contract. - Music Of The Sea Inc. Loudmouth Music - looking for Artists Loudmouth music is looking for artists Loudmouth is the brand new venture by Phonogenic owners Andrew Frampton & Paul Lisberg Loudmouth is actively seeking emerging artists to sign & develop. If you have what it takes please submit your very best work Phonogenic previous successes include The Script, Hurts & Natasha Bedingfield.	cc/2020-05/en_middle_0093.json.gz/line652
__label__wiki	0.872625	0.872625	Video: I’d love to settle in Ghana after retirement- Tim Godfrey Source: Ghana\| Myjoyonline.com \| Gloria Akpene Nyarku Tim Godfrey Nigerian gospel musician, Tim Godfrey, has revealed he would love to settle in Ghana after his retirement. Tim Godfrey’s pronouncement is based on his perception of the attitude Ghanaians have towards God with regard to worship. According to Tim, who was a guest artiste at the ‘Move Concert’ organised by fellow Nigerian Preye Odede here in Ghana, Ghanaians are “Amazing Worshippers”. “Ghana, you guys are the best. I always said that if I’m going to retire, probably, come to Ghana and settle down because you people have a beautiful spirit, your Jollof is nice too,” Tim said on ‘The Gist with MzGee’. Preceding his retirement, which is obviously not soon, Tim also disclosed he will be back in Ghana for a live recording session. He stated some international artistes will join him in Ghana for the sessions. Tim also explained he wants to create a Ghanaian album, “I love the culture, I love the language. I feel led to record a Ghanaian album, from here we are going to bring out songs that will become an anthem for the whole world”. “I think the world needs to know what Ghana is like. I feel like I’m part of Ghana; I am family. Ghana feels like I’m home,” he added. Watch video: London Underground to get full 4G coverage Desperate pet owner offers his home to whoever finds his lost dog	cc/2020-05/en_middle_0093.json.gz/line655
__label__wiki	0.844375	0.844375	Tag Archives: Sal Yates Review of Ghost Mountain’s 2010 album Art Without Audience April 20, 2010 Publicity jobsBryson Mulholland, Christian Pyle, Eben McCRimmon, emo, Ghost Mountain, Johnny Cash, Nick Edin, Sal YatesMick Daley Being a musician is about considerably more than playing an instrument. It’s about a life moved by artistic vision and emotion – a fraught word in the modern era. Like that other, highly nuanced casualty of the lexicon, ‘gay’, it’s been forced into an entirely other set of pants. Emotion in its truncated, graffitoed form has been circumscribed to those youth who feel that shanghiing the Goth credo is not enough, that as sole inheritors of genuine sorrow the emos need to annex it for their own private kingdom. But Ghost Mountain ain’t letting go of it. This band’s lives are a subterranean mine of emotion, roiling and tectonically shifting beneath the amaranthine hills of the Byron hinterland. And where it breaks the surface, that’s where you’ll find Art Without Audience. Engineered, produced and finessed in his usual inimitable style by co-founding member Christian Pyle (CP), this record is then broken down by Sal Yates, the other half of the equation. Sal’s voice, enormous, vulnerable, glorying in power and range, is as laden with the E word as was Johnny Cash’s in another realm entirely, so tightly woven with tantalising promise, searing passion and aching despair that every phrase sounds like a psalm from the Old Testament. Arm that voice with CP’s masterful, deft and unrestrained knowledge of an electric guitars possibilities, and you indeed have high art, albeit aloof and oblique, grounded in high misty hills and constant, tropical rain. It’s my contention in fact that the mountain is question is music itself, and the ghost is the ephemeral, shifting emotion that haunts it. Drummer Nick Edin and bassist Eben McCrimmon are adept interpreters of the raging and temperamental songs on this, the second album from the band. Two years in the making, it’s a potent mix of their signal slant on rock and roll with a determined and steady artistic vision. Envenomed at turns with Bryson Mulholland’s coruscating keys and CP’s own bristling voice, the result is a glittering treasury of blazing ardour and wilful collapse. From the stately timbre of Government Arms to the Crazy Horse guitar tirade of I’m Gonna Face You, there’s a ruthless spectrum of styles lurching through the eleven songs. Delving into electro-pop with Everythings OK, the Mountaineers also tackle brooding alt-rock in Started a Fire, while Capsized Moon is as lilting and yearnful as Don’t Make Me Wait is majestic. Easy Does It is a standout, not because I have an undeserved credit, but because of its simple melody and poised, sanguine lyric. The lover who sings ‘You swine, I’m coming to get you’, is the same who on Animal declares, “I’m not your animal, you’re not worth dying for”, and hexes exes when In Spite of Me shudders in full spate with “I’m getting over the game … taking time to write the lies that you breathe …”. She’s also the temptress who promises “If you really wanted this could be your song”, in Capsized Moon. Like Ghost Mountain’s previous work, this album is more about subtle and dark than user-friendly. There’s few concessions to idiocy and the banal will slope away, unmoved. But if you like to tap into raw emotion and the elliptical truth of unfettered art, you’ll find closer The Whole compelling and its hot-tempered jealousy a door slamming on a volatile, irresistible album. Like a spurned lover, you’ll be hanging at the back windows, peering into that murky light.	cc/2020-05/en_middle_0093.json.gz/line659
__label__wiki	0.602219	0.602219	My pictures of Ireland This picture was taken at Lansdowne Road, in front of the famous stadium there. Lansdowne Road was a stadium in Dublin owned by the Irish Rugby Football Union that has been the location of a number of sports stadiums. It was used rugby and football matches as well as some music concerts. Me on a bridge over the River Liffey. I actually find this place fascinating. This is known as a passage tomb. To be exact, the Fourknocks Passage tomb. These passage graves are decorated with abstract art and bear the first depiction of a human face found in prehistoric art in Ireland. Three earthen mounds were excavated by the National Museum in 1950-1952. One covered a passage grave to crucification plan, with decoted uprights and lintels resembling the Newgrance designs. The contents of this tomb were intact and so the results were of immense importance and value to students of the megalithic period in Ireland and the world. The contents found were of great importance with fragmentary human remains representing dozens of bodies of all ages and sexes. These were accompanied by grave offerings (stone beads and miniature hammer pendants, bone pins etc.) in the three side chambers. Four Knocks is a Passage Chamber Tomb built about 5000 years ago. It is located 10 miles southeast of Newgrange between Ardcath in County Meath and the Naul in County Dublin. The name Fourknocks may be from the Irish Fuair Cnocs meaning Cold Hills. This is the beautiful Cliffs of Moher. Soaring over 700 feet above a wild 5-mile stretch of County Clare between Liscannor and north of Doolin where the Irish coastline meets the Atlantic, the Cliffs of Moher are one of the most impressive places to see in Ireland. Many say the finest view of the Cliffs is from O'Brien's Tower which was built by local Cornelius O'Brien of Dromoland Castle in the 1830's, and is evidence that the site's popularity as one of Ireland's top tourist attractions has a long standing. On a clear day, visitors can see the Aran Islands, and even the Twelve Bens of Connemara come into view https://www.cliffsofmoher.ie This is taken at Glendalough, one of the sites where the filming of Braveheart took place too.. Glendalough, from the Irish “Gleann da locha", meaning the Glen of two Lakes, is one of my favorite places. It combines extensive monastic ruins with a stunning natural setting in the Wicklow Mountains. The beauty and tranquility of the lakes and glacial-carved valley no doubt appealed to St Kevin, a hermit monk, who founded the monastic site near the Lower Lake in the 6th Century. Most of the buildings that survive today date from the 10th through 12th centuries. Despite attacks by Vikings over the years, Glendalough thrived as one of Irelands great ecclesiastical foundations and schools of learning until the Normans destroyed the monastery in 1214 and the dioceses of Glendalough and Dublin were united. The settlement was destroyed by English forces in 1398. A reconstruction program was started in 1878 and today the valley boasts a visitor centre, wooded trails, walkways and rock climbing. www.glendalough.ie/ Me boarding a boat to the Aran Islands... I don't think there is any significance in this huge rock which was somewhere in Co Galway., but I took a pic with it anyway. Help please... I am in stocks at a carnival. I think this was somewhere in Kilkenny. This is taken at Slane Abbey. In the year 433 St. Patrick, during his mission to convert Ireland to Christianity, lit the first Paschal or Easter fire in Ireland on the summit of the Hill of Slane so that it could be seen at the seat of the High King at Tara 16km to the south-west. Following this an Early Medeival monastery was founded on the site by St. Erc who died in 514. That early monastery was replaced by another set of buildings in the Medeival period. In 1175 Richard le Fleming, first Baron of Slane, built a Motte and Bailey castle on the western side of the hill. The standing remains on the site are of the Franciscan Friary and College founded by Christopher Flemyng, Baron of Slane, in 1512. The Friary was dissolved in 1540 during the reformation but a monastery of Capuchin monks was briefly refounded by the Flemings on the site in 1631. The surviving structures are an undivided nave and chancel church with a later side chapel and west tower situated within a walled graveyard. North of the church is the College for priests, lay-brothers and choristers, founded by Christopher Flemyng. It is a quadrangular structure surrounding a courtyard, with priest’s residence at north and a defended tower house and remains of the refrectory on the southern side. The Motte and Bailey castle is also visible on the western part of the hill. The Hill has good views over eastern and south-eastern Meath This one at the Monaisterboice. I love historical sites like this and am always so happy and at peace in such areas. Monasterboice (Mainistir Bhuithe) is an interesting monastic site near Drogheda in County Louth. The impressive ruins include a large cemetery, two churches, one of the tallest round towers in Ireland and two of the tallest and best high crosses. Monasterboice is said to have been founded by St. Buithe (d. 520), a follower of St. Patrick, in the late 5th century AD. (There is evidence that the site had pre-Christian sacred significance as well.) It is from St. Buithe that the Boyne River gets its name. According to legend, the saint ascended directly into heaven via a ladder lowered from above. The settlement was captured by invading Vikings in 968 AD, who were then comprehensively expelled by Donal, the Irish high king of Tara. St. Buithe's Monastery was an important center of spirituality and scholarship until the Cistercians arrived at nearby Mellifont Abbey in 1142, after which Monasterboice declined. Cliffs of Moher, Dubling, Fourknocks PassageTomb, Ireland, Kilkenny, Monasterboice, Slane Abbey, travel Leave a Comment Stop the blame game and support Malaysia Teenage Mutant Ninja Turtles at the Curve Arts and craft for Anne Fruits Ninja Final at eCurve 30 days challenge- day 18 Two gorgeous weddings in March.. 30 days challenge- Day 16 and 17 30 days challenge - day 12 10 biggest conspiracy theories The day a well known news network company went stu... Food review: Uncle Jack Fried Chicken Program Destini Anak Bangsa utk lepasan SPM yang t... Kenapa Wanita Istimewa The Best Time A scary car ride.. All in a day of events... Fragrance review - Jimmy Choo's Exotic ALCATEL ONETOUCH to showcase the IDOL ALPHA XOX Berhad enters Joint Venture with e-horizon Pray for MH370... from Pavilion KL Faber Castell event @One Utama Pray for MH 370 Actifry by Tefal Biasiswa lepasan SPM / SPM scholarships offered Dedicated to my son Adam Danial Funny pics... 30 days challenge- day 9 Caring for the Marine life.. 30 days challenge - day 6 and 7 Hair make over at Secolo Giving your mobile photos more drama and life... Keropok Lekor Ganu Pulau Perhentian, keseronokan tanpa henti 30 days challenge... day 4 and 5 Tragedy at Pulau Perhentian. The 30 day challenge... day 2 & 3 Trip Bengkel Penulisan, Pelaporan Media dan Fotogr... Pusat Konservasi Gajah Kebangsaan Kuala Gandah Persediaan untuk percutian di pulau/ tepi pantai Simple stir fried noodles for lunch Mystery shrouds the fate of Malaysia Airlines Flig... 30 days challenge... just for fun.. Flashback USA trip- Mc Call, Idaho The possibilities of why Malaysia Airlines jet mig... Malaysian plane presumed crashed MH370 goes missing from KL-Beijing and crashes in ... Khasiat Bawang How to make your own DIY mosquito trap The week's most popular and hottest selfie Oscar's best supporting actor nominee is dead brok... Hit and run accident Breakfast at Garden Terrace, Lost World of Tambun Funny signboards you see sometimes... Hell explained (by a chemistry student) 18 sx My trip to Tambun (teaser)	cc/2020-05/en_middle_0093.json.gz/line660
__label__cc	0.71829	0.28171	Prince Bisi Olatilo’s Low-key 60th Birthday Celebration There is no perfect timing to merry regardless of the motive behind the merrymaking. We are therefore at liberty to celebrate landmark achievements- birthdays, marriages and events- that add value to our existence. In this case, there is no questioning why veteran broadcaster and Chief Executive Officer of Biscon Communications, Prince Bisi Olatilo settled for a low-key 60th birthday celebration. Prince Olatilo, a native of Igbajo, Osun State, has an acute lingual disposition and mastery of the three major languages in Nigeria namely; Igbo, Yoruba and Hausa. A rare ability that sets this highflier far-off his peers. With over 30 years of experience in broadcasting, Prince Olatilo is without contest a national and an international brand to reckon with. As a pointer to his hard work in radio broadcasting, Prince Olatilo was rewarded with several awards and a back-to-back honour of the prestigious Nigerian Media Merit Awards-Broadcaster of the year in 1993 and 1994. His ingenuity and creativity stretches beyond the corridors of broadcasting as he boasts of a healthy career in printing. He is also a renowned Master of Ceremonies, with a long list of major events for dignitaries and top corporate organizations. And so, no one could blame him for staging a birthday ceremony that brought the high and mighty in the society in a cool and serene atmosphere. Events • Society	cc/2020-05/en_middle_0093.json.gz/line670
__label__cc	0.705788	0.294212	Places people want With funding from the Academy for Sustainable Communities (now the Skills and Knowledge team of the Housing and Communities Agency), Angus Willson was leader of a GA Living Geography project with teachers looking at aspects of settlement. This project has now been completed (2006-2008). For the project site see www.geography.org.uk/projects/buildingsustainablecommunities [opens in a new window] It also produced a chapter in the book Living Geography. Read more > The project was also run in collaboration with local architecture centres which are members of the Architecture Network. Living Geography: building sustainable communities In July 2006 the Geographical Association project started based on the recommendations of a critical review: Knowledge, understanding and skills for building sustainable communities: a critical review of geography in secondary schools Angus Willson, Geographical Association The study of settlements, living space, population distribution and service provision are found in the mainstream of the geography curriculum in secondary schools and colleges. There is some evidence that this knowledge-base at its reduced level has become static or in a delayed response to recent trends. However, there are positive signs in pilot exam specifications and recent projects that this can be rectified. Meanwhile other aspects of the classroom learning context, such as thinking skills and use of geographic information, has been very creative. Upon this basis of educational change, teachers and young people are faced with keeping up with the current geographical dilemmas such as large-scale housing demand in the south-east of England and refurbishment of housing in cities. Building knowledge and understanding is sound preparation for present and future engagement with and in sustainable communities. There is also recognition that the geography classroom and fieldwork provides the context for the development of both generic and specific skills as identified by the Egan Review and ASC. The issues and solutions explored in geography are multi-sectoral, perhaps the subject is alone in representing the work of such a diverse range of professions. Also schools now place more emphasis on student participation in the school and the wider community. Two dynamic contexts are under the remit of this review and the main purpose is to clarify the areas of convergence and departure. It seeks to understand the mutuality between the two contexts of ASC and school geography and to explore how further collaboration can be beneficial. The literature review will embrace the school constraints and opportunities as presented by the national curriculum, examination specifications, reports and guidance from the Quality and Curriculum Authority (QCA) and OfSTED, and textbooks and other learning resources. A critical review will be derived from interviews with a select number of teachers and a focus group meeting (with email follow up) including geography academics, geography educators and practitioners in planning, the building industry and architecture. This will include reference to research and journals beyond the usual scope of geography teachers in schools. The Review will be written by the principal consultant in liaison with the chief executive of the GA. It will form a substantive piece of work in its own right, leading to publication in professional journals. Hopefully, it will also act as a spring board and platform for subsequent work that will have significant national impact. For example, the focus group could be retained and reconvened to feed forward ‘recommendations’ for, and subsequently guide, a longer-term project which will actively engage teachers and pupils in a process of profession-led action research, leading to curriculum development. This model has proved successful in combining a progressive curriculum agenda with teachers’ professional development. A second phase of this project would concentrate on imaginative dissemination. It became called ‘Places People Want‘ and consisted of : * action research conducted by teachers in four working-groups; * CPD sessions in four locations; * workshop sessions at the GA Annual Conference; * a photo-CD and cut-out figures; * an online CPD unit; * a chapter in Living Geography; * A DVD called “Sustainable Communities: Places People Want?” Available from the GA shop > [opens in a new window] For further details see the GA website at www.geography.org.uk/projects/buildingsustainablecommunities [opens in a new window] Update 2018: These project pages are being archived somewhere on the GA site. 1 reply on “Communities” CPD – continuing professional developmentsays: […] Communities […]	cc/2020-05/en_middle_0093.json.gz/line673
__label__cc	0.535904	0.464096	Pod Apps Back Us Poll: how should United approach the summer transfer market? May 3, 2012 by Ed Articles Poll, Premier League In the aftermath of defeat to Manchester City on Monday night, Manchester United could end the season trophyless for the first time since 2004. That is unless Papiss Cisse and his Newcastle United colleagues do the Reds a favour this coming weekend, while the Reds emerge victorious from games against Swansea City and Sunderland. But in a season where Sir Alex Ferguson’s side has lost 11 times, and exited early from four competitions, questions will be asked about United’s quality whatever the conclusion to the Premier League title race. Critics point to a degradation in squad quality over six years of ownership by the Glazer family, with the club having spent more than £500 million on interest, debt repayment and associated fees over the period. At the same time rivals such as City, Chelsea, Real Madrid and Barcelona have invested heavily in the market, on both transfer fees and wages. Indeed, net transfer spend since the Glazer takeover is approximately £7.50 million per season – significantly less that United’s rivals at home and abroad, save for Arsenal. Meanwhile, United has slipped to 12 in the global sports pay scale, behind the aforementioned quartet of rivals, accoring to industry analysts Sporting Intelligence. There is mitigation. Some fans will point to the £38 million net spent last summer on Ashley Young, David de Gea and Phil Jones as proof of United’s investment in youth. While others point to United’s extensive injury list in the current season, or the ‘potential’ of many younger players within the squad during a ‘season of transition’. The question is where does Ferguson go from here? Spend big in order to compete with the very best at home and abroad, or trust in the current squad and transfer strategy to regain former glories? [poll id=”79″] 60 thoughts on “Poll: how should United approach the summer transfer market?” VishKaush says: We have a capable squad, bar a good midfielder who takes up the creative responsibilities. So that Carrick can lay back and do what he does best. Oh, and sack our assistants. Bring back Queiroz. Zi Indefatigable says: I wanna see every bit of dead wood leave the club and get replaced by young players not on loan. Then I wanna see 2007-08 Summer Transfer window shit go down. Anderson, Nani, Hargreaves, Tevez. Gotze, Hazard, M’Villa and Heskey. I realise this will not happen. We need to dig deep and get spending. It’s ok relying on youth but most of our youth team is off out on loan next year. Only cleverley and maybe Macheda and pogba (contract dependant) will be here next year. Scholes, Giggs and Rio are getting no younger. Giggs and Park have been poor lately. Fletcher may or may not return. Berbatov and maybe Owen will be heading for the exit doors, Fabio is also going on loan. We need to replace and strengthen the squad. RB and a LB, CM and ST at least, maybe even 2 CM and ST’s depending who moves on. Sagar says: I believe our current youth strategy is the best for the club specially considering long term future. That’s how a team is built and that is who we are. I won’t mind an established player in mid though to take burden off Carrick and Scholes. If Fletcher comes back, its good or we need some hassler in there. We have Cleverley, Petrucci, Larnell Cole and others who have the capacity to become starters in recent future. BELIEVE!! dan o'd says: Can we buy a centre mid with more than 2 gears please? Scholes, Carrick, Giggs are too easily got form me. Ando doesn’t look like he will fulfill his potential and Cleverley has spent two seasons injured. Ander Herrera from Bilbao please. Then can we have a playmaker, forward (Papiss Cisse?), and one or two decent full-backs? If we can also have the pre-2012 Phil Jones back next season that wouuld also be great. Domestically we have a competitive squad, but Europe this season has been agony to watch. He needs a play-maker that can drift in front of Carrick, who alongside Scholes is able to totally dictate play with a short passing game. United’s problem is in the final third; they need to be able to link their swift defensive turnover into something more tangible. Carrick’s had an immense season at Man U, the unsung hero, and I whole-heartedly believe he should be an England regular. If you compare Carrick’s statistics to Parker’s from whoscored.com – possession, passes per game, pass completion, dispossession etc. – then it becomes clear that Carrick’s composed presence in United’s midfield begins a significant number of their attacks. Compared to Parker, he intriguingly makes far fewer clearances and is dispossessed less, suggesting he is a more useful player in retaining the ball and converting defending into attacking. Based on Hodgson’s preference for defensive solidity it is highly likely a defensive midfielder will be used, and his philosophy on the role of the midfielder, as he highlights in interviews, supports this theory. I actually wrote an article on this topic if anyone is interested, at http://alex-keble.blogspot.co.uk/2012/05/why-michael-carricks-possession.html Ian B says: Fergie will not be able to get cisse, he will concentrate on the midfield, with rooney, wellbeck, chicharito and i think he’ll bring through some of the youngsters. In midfield he’ll possibly look at cabaye from newcastle…but never gonna happen at the figures the long contacts up there will cost…theyre all on 5-6 year deals Tourettes at the KOB says: No one has mentioned Ben Arfa from Newcastle, would certainly add to the midfield. dave kelly says: we need to spend big…my wish list; 1. Hazard 2. Pique 3. Bale 4. Cisse Alfonso Bedoya says: Look… I know some of you would trust Ferguson, pissed on turps, to shave your Johnson with a carpet knife… but ffs… some of us are sick to back teeth of some the turgid shite served up in an attempt to grind out results we don’t fuckin deserve. I wouldn’t swap Ferguson for any manager in the game… but I want the old cunt to have a proper United squad to take another run at one more Champs league title before he’s gone… And that will take a lot… A LOT… more than just a decent midfielder. A left back… Evra can’t do it alone any more… £10 mill. At least 1, TOP QUALITY central midfielder… I’d prefer 2… Scholes, Giggs, Anderson, Park – OUT!!!… Carrick and Cleverly to compete to start… £25/30 mill each… A top class… proper left footed winger… Valencia, and Nani can fight over the right… and Young can be a utility player… £25/30 mill… And a top class front man to get the best out of Rooney!… Hernandez and Welbeck can scrap it out for 3rd… £25/30 mill… It’s not going to happen… but to fill out my wish list “PROPERLY” would cost £100/150 million… I can hear some of you spitting your Horlicks all over your keyboards… tough shit… those figures are NOT outrageous. Now Perhaps Ferguson can find a couple diamonds, like he did with Vidic/Evra, and fill out that list a bit cheaper… but the very simple truth is any of the top 10 players that will go on the market this summer… all coveted by the top clubs… will cost £25/30 million easy… some a LOT more… and there will be heavy competition for their signatures… Chelsea will rebuild… City will spend, just because they can… Real and Barca never stand still… And the Italians are trying to claw back their status as a top league… I will be impressed if spend even £50 million… and that will probably keep us top 2/3 in the PL, and probably last 8 in Europe… For some… that will be enough… not for me… and especially if we’re not even that exciting to watch any more. “Badges, to god-damned hell with badges! We have no badges. In fact, we don’t need badges. I don’t have to show you any stinking badges, you god-damned cabrón and ching’ tu madre! Come out from that shit-hole of yours. I have to speak to you.” brianofnazareth says: Alfonso Bedoya said: My feeling exactly! Depressing seeing such crap football… I am spoilt and not used to it! danniitronix says: fergie will say there is no value those we want will not come to the UK or be released to come to united there is so much overrated shit out there, i’d be surprised if we get anyone truly world class It def comes down to what we think is needed and what will actually happen. A spend of 100 mill would solve most of the problems, however that is fantasy football. realistically we could spend 50 mill pre glazers, but in the glazer era a net spend of 25 mill is likely. Most likely to happen: Gaitan 25 mill Clyne 2.5 mill comp Hoilett 2.5 comp or random foreign forward 5 mill Berbatov 7.5 mill Kuzsacak De Laet Fletcher (retired) Fergie will look at the 83 points currently on the board and think there is no need to spunk a shitload of cash on new players. There is a gulf in quality between our 11 and City’s 11. It would be nice to address that, but you don’t need the best 11 to win the league because it’s a squad game. We can lose/draw to City and win the league by beating the rest. A couple of midfielders, a striker (if Owen & Berba go) and a left back would be ideal. Other than a top midfielder (which we won’t sign) there is no massive signing there. bman says: A very substantial investment is needed to put United back among the best in the world, where it deserves to be. Two or three seasons ago we desperately needed a top quality creative/attacking midfielder, but the situation has only deteriorated since then. To be fair to Fergie, some of it is bad luck — Fletcher’s condition, Hargo being a crock, Cleverly and Anderson being too crocked to really have a chance to show what they’ve got (ok not bad luck, you can blame the medical staff, but it’s not Fergie’s fault). But we now have only one single proven, good quality central midfielder – Carrick. Yeah we have Scholes, but he should only be used as Carrick’s back-up now, since he’s evolved to play the same way as Carrick, or else occasionally they can be used together against softer opposition. How fucking outrageous is that for a top club to have only one reliable midfielder? And at 31 or 32, Carrick is also not far from the point where he’ll be getting past it. How many quality midfielders do Real, Barca, Juve, Bayern etc. have? How do we not have a single decent box-to-box battler aside from Fletcher, or a single creative attacking midfielder in the old Scholes style? I have to laugh about people complaining about Fletcher and Carrick a couple of seasons ago. These days, we’d be delighted to see that combo in a big game like the one against City, instead of fogey Scholes, crocked Park, and fogey Giggs helping out leaving Evra to cover nearly a third of the entire pitch all by himself. And don’t get me started about Evra — we play about 4 matches all season in all competitions that the poor fucker doesn’t start and finish. If we got him a decent understudy and game him a few days off, we might see the old Evra again before he gets too old. We don’t even have a proper left-sided player in front of him, our tactical strategy is basically “right Patrice, you’ve got 30% of the pitch to yourself — make sure to get plenty of crosses in and defend like a terrier”. We need a minimum of three real quality players: a midfield boss and a midfield attacker for sure, and also at least one of either a true left-sided attacker or a forward (in an ideal world obviously we’d just get all four). I think you can get away with just three if the midfield attacker and left-sided player is the same person, i.e. someone like Hazard or Kagawa that you could shift into either position, and if your new midfield options provided serious amounts of goals. Then getting decent understudies for left back and maybe right back would be important too, but much less expensive. Squad for next season: Full backs Centre backs Central Midfielders Gaitan Hoilett Macheda Loanees: Fabio, Keane W, King, Tunnicliffe, Norwood What the fuck is that, Bill shauno says: I was just thinking the same! It’s a pain in the arse to try to decipher all those initials. But I can tell if our summer business consists solely of Gaitan and fucking Hollett, then i’m going to stop watching football until the Glazers are gone. What do u think it is? I haven’t got time to write out full names, especially on an iPad! NC = Clyne The three amigos every summer since 2009, that is how it goes, would be surprised if that changed. If SAF cuts out rotation in the cl we will get to the last 8, and finish second to 2nd. Prob acceptable to Malcolm. We might sneak a cup. Only solace is the comedy show that is KKK. uncleknobheadforfucksake says: five years since we signed a midfielder we will again start the season weaker than we ended the last If one of Fletcher Giggs or Scholes retires and Pogba leaves we will get one. I couldnt really care less if Pogba went, he’s unproven at the highest level yet he seems to think he deserves the same treatment as a seasoned international, or it could be bad advice from his agent, I’d rather have Ryan Tunnicliffe come through and given more a chance. uncleknobheadforfucksake said: That’s not true, we just signed Paul Scholes in the January window. Yep!! So retiree plus Pogba leaving means we get a new midfielder in the summer. I think Giggs and scholes will give it one more season and fletcher miight try preseason and then make a decision. I see Javi Martinez got in a bit of a fight with Ronaldo in the Real-Bilbao match. Maybe there’s a bit of the Keano about him, let’s be ‘avin ‘im then. ed, I think bman and bill are the same person Nope, definitely different! I still think we should be in for most of the Bilbao midfield and transplant them direct into the starting 11 in a 4-3-3. I don’t even know the fucking names I just remember them sweeping up and down the pitch playing like Barca but with pace and an end product. DamnedUnited says: I’d feel bad for Bilbao if that happens. I want them to retain their squad and see how they do. They’ve got potential. Why can’t United find players like those? We’ve been trying but looking at the kind that are brought in (Diouf, Bebe, Anderson etc) the srategy seems completely disjointed. Of course, you also need a coherent strategy to be able to use these players. Why do you think we’re the same person? I don’t even agree with Bill that often (no offence bill). Bill said: You wanna get yourself a proper computer n all madmax says: Ideally we should be spending big.An attacking midfielder, a defensive midfielder, a left winger, left back and a striker. But we all know its not going to happen.Fergie will definitely get a left back and probably a Young like signing in midfield. That’s the best we can hope for. Apart from needing a lot of players, we definitely need a new assistant manager. Don’t know how much of a role Phelan plays, but our tactics and results have been dire. Queiroz would not have let Fergie squander a 2 goal lead against Everton. We need some one like him. I think this is as important as getting a midfielder. But then…I guess there will be no value for an assistant coach as well. Got one plus an iPad thx! And as Madmax says nobody can be impressed with Phelan, he’s just a company man who won’t leave or rock the boat. SAF is stung after mclaren and left so just wants someone who will never leave. DeadRevel says: Ideally we would get a left back, 2 midfielders and a striker. All of finished product / first team quality. But I would be satisfied with one top midfielder if I knew that Cleverley would stay fit next season… Our problems are in midfield, which needs strengthening for better attacking AND defensive options. Left back is a problem which I don’t understand… Fabio seems the perfect back up for Evra. I wonder if we’re buying a another left back who will be first choice when Evra retires / leaves. Dinkinflicker says: Commenter said: I have a very reliable contact at Everton who tells me that we’ve been speaking to them for several weeks about Leighton Baines. Reckons a deal is likely to happen. It would be very funny to find out we were considering bringing back Darron “G-bomb” Gibson. just for the level of outrage in this comment page. As for Baines, that seems reasonable. But how much would we pay? We seem to get bent over a barrel at the best of times, for English players you pay 30% more than they’re worth. Unless we’ve done a deal with Moyes in light of all the United players heading to Everton to sweeten the deal. Maybe more this summer? 19 and counting says: Baines only makes sense if Evra is leaving which I doubt will happen. Cissokho was another mentioned but I think Fergie has more pressing issues in MF. I thought that, but I didn’t realise Baines was in his late 20s – Evra is surely nearing his end as a United player, Fabio is still only 20/21 and inexperienced. So maybe in 2 years we could see Baines / Fabio fighting it out for the LB spot. Who knows, but considering we bought Young, Smalling and Jones recently going for a reasonably talented & priced English player wouldn’t surprise me. And more pressing issues he may have, but if we only have one recognised, error-prone left back next season, surely it IS a pressing issue. We can’t have this team getting worse for fucks sake. Denton Davey says: Bman @ 4:35: “To be fair to Fergie, some of it is bad luck — Fletcher’s condition, Hargo being a crock, Cleverly and Anderson being too crocked to really have a chance to show what they’ve got (ok not bad luck, you can blame the medical staff, but it’s not Fergie’s fault). But we now have only one single proven, good quality central midfielder – Carrick.” It seems that Shinji Kagawa, from Borussia Dortmund, is pretty-much signed and sealed and will be delivered in the summer. He’s a very, very good “playmaker” – better than Gaitan or Eriksen but not in the same quality-range as his team-mate Mario Goetze. If the reports are true then this would be a start to addressing the “bad luck” issues highlighted above. BUT what’s needed even more than someone who can be regarded as a “replacement” for TheGingerNinja” is a player who can add drive, steel, and energy to the midfield. Javi Martinez of Athletic Bilbao is a great pal of David De Gea and that might influence him but, of course, “money talks and bullshit walks” and Martinez would be a very expensive addition. But, really, why not blow the whole wad on an identikit player for an specified need rather than just buying more and more raw talent. Sometimes – and this seems like the time – a hole in the dyke needs to be filled and DarrenFletcherinho ain’t likely to come back to his “football genius” mode. We do need a ready made player or two. Hopefully Kagawa fits the bill. Javi Martinez sounds interesting and gave a good interview before the Bilbao-United game which suggests he might be open to a move. Not convinced he will move this summer though. Pogba would be perfect if he was a couple of years older, but he isn’t. Football is about fine margins and United don’t seem to have had much luck recently. So many injuries, lots of young talent who aren’t quite ready to step up, and legends who have past their peak. The timing has been slightly off. How much of this is down to the Glazers / Ferguson / misfortune is open to debate. You don’t think Kagawa, if we actually did get him, would be the replacement for Scholes’ old attacking creative midfield role? He seems to be doing that very well at Dortmund — he’s been key to them winning the German league two seasons in a row, racking up great goal and assist stats. Still a young guy too. I’d be very happy with getting him. We do desperately need someone to boss the midfield though, in a Keane, Schweinsteiger kind of way. No such thing as a direct replacement when it comes to midfielders, especially Scholes. I think would be a great addition though and crucially be a first team starter most games, as opposed to another sign-and-hope transfer. Not sure we need a ‘bastard CM’ like Keane anymore. Wouldn’t say no to Tiote or similar at a cut price but only as a squad player. It’s too easy to see Carrick, Giggs and Scholes and think ‘we need the opposite to that’ – strength, aggression etc but it’s a simplistic way of looking at it IMO. bman @ 5:39: “We do desperately need someone to boss the midfield though, in a Keane, Schweinsteiger kind of way.” “The Tragedy of DarrenFletcherinho (“FootballGenius”)”. A follow-up to “The Unfortunate Knees of Owen Hargreaves”. It’s impossible to “blame” SAF for these two consecutive bad luck stories these guys have really, really been missed in the big games for the last three years. I’ve always wondered how well Barcelona – “the best team on the planet” – would have fared if UTD were able to play those two ManchesterTerriers. of course, we’ll never know the answer to that hypothetical but their absences have been crucial to UTD’s “under-performances” in those big matches. Like I wrote above, why not get one guy who can provide that steel, energy, and drive – ready-made and not just potential-with-talent. The absence of such a player in the first eleven makes it penny-wise/pound-foolish to scour the bottom of the market. The cost of NOT doing that would have been amply re-paid by seeing TheLads progress in the CL and other cup competitions this year. What about next year ? UTD won’t be any more of a threat in the big matches without getting that kind of player. Of course, it’s not just a matter of “strength, aggression etc” but those fighting qualities seem to missing from the current set of midfielders. Well the success that teams like Inter and Chelsea have had against Barca suggests that we might have done alright against them if we’d had Fletcher and Hargreaves fit and available. Or even one of those players would have helped, because even if they’re not the greatest players in the world, a decent defensive midfielder is a massive improvement over none at all. Especially in the first final: Hargo Fletch and Carrick in the middle would definitely have cramped Barca’s style, and then we’d have had a good chance of Rooney, Ronaldo, and Tevez making something happen. United usually play around 55-60 games a season, so if United are to keep on playing either 4-4-1-1 or 4-5-1 they will def need another midfielder. That means we will need at about 120 games worth of appearances in central midfield. Carrick 40 Scholes 25 Cleverley 15 (injures) Anderson 15 (injures). That leaves 25 games to be filled by another player. At the moment that would be Jones, Park and Giggs!!! Also surely Fergie can’t think that Anderson, Cleverley and Dad’s army will remain fit or even Fletcher will recover?! Pogba if he stays and Tunnicliffe are too inexperienced. http://www.manutd.com/en/News-And-Features/Football-News/2012/May/pre-season-aim-for-darren-fletcher.aspx Fletch is the new Hargo If he gets close to fitness then we won’t be buying a CM, especially if Pogba signs too. Oh god, oh jesus christ Bri, you got our hopes up You know the same old excuses will be coming soon. No value too costly blah blah blah. We all want a big signing who will fit in at united. I don’t care about the price as long as he is class but looking at who is available I’d say we should make hazard a priority. chocolatteballs says: 3 centre midfielders Fergie 2 world class. Scholes and giggs could retire with dignity. Keep Cleverly and ship the rest out. Quite like the Martinez bloke from Bilbao but in fairness we have had 5 years to earmark midfielders and not just wait to make a failed pretend attempt to sign whoever emerges from the Euros. Our squad with Anderson Carrick Cleverly will always be good enough to Challenge for the league such is the actual standard of the Premier league. As for Europe…. forget about it already. Stock up on quality central world class midfielders, forget the strikers, leftbacks and goalkeepers. Will we do this? Will we fuck. Twisted Blood says: Fergie’s now saying 2 or 3 in the summer. Kagawa is one and Clyne or Baines the other. That leaves one spot for a creative CM or a destroyer. Please let it be Hazard but if not, I am still haunted by visions of Yaya rampaging through our midfield. If we have to do it cheap, Tiote would do. As for out, I don’t care about fees for anyone other than Berba but getting Park and Giggs off the wage bill will help. Twisted – nah it’ll be another young kid. Somebody with “value” – a word Ferguson used again yesterday. In fact I wouldn’t be surprised if Fergie’s been outbid on Hazard by City and that’s prompted the rant. If only the old fool actually stood up to the Glazers perhaps he’d have some moral right to moan. Ed: I’m not sure where I come out on the big buy philosophy and might favor a bit of value buying. Should we have got Nasri at 24-25 million quid last summer? Yes. Should we be paying him City’s crazy 173-200K per week? No way even despite his mazy runs last Monday night. If that means we lose Hazard, it will hurt but so be it. No way given Eden’s limited resume at Lille and Belgium is he worth those wages. One would hope the boy has an advisor who can show him Nasri languishing on the bench at City for most of year and ask him whether wages are more importnt than playing. Naive I know. the sad thing is we may never see the best of Hazard if he goes to City. I guess whatever City will pay is what the market will bear but when we get to this point, the “na value in the market” argument acrually rings true to me. I’ve heard your argument that United should be in the big boy pool when it comes to wages and that is a measure of a big club moreso than transfer fees paid. However, regardless of United’s fiancial state, Nasri is nowhere close to worth that much. Turns out Ozil, the one that got away the year before was worth the wages but he was only ever going to one club. I’ve seen too many big money flops (Torres, Carrol) or big wage underperformers loaned out by City to want to see United waste what funds they have. Berba, our biggest buy of late, is no flop but in retrospect he did not fit in or Fergie did not adjust the team to suit him. Therefore the 30 mill would have been better spent elsewhere. Transfers are not an exact science so instead of flinging all our cash on one star, I’m not opposed to the shotgun approach of buying a Kagawa, Eriksen, Barkly and seeing who comes good. Got to be a Little Pea among that bunch eh? sheesh says: Ed said: I wonder what Newcastle United’s net spend has been for the last few years. The lack of value didn’t stop them signing cabaye, ba, cisse, tiote or ben arfa. Of course the Glazers have fucked us over but we made duff signings with whatever money we had. Or signed potentially decent players and mucked around with them. We seem to be hell bent in turning jones into the next O’Shea. The Glazers are of course right at the top of the tree in the blame game but there is a lot of blame to go round and fergie himself is not an innocent bystander. Look at the money wasted signing players we didn’t need like Ashley Young. Now this summer, when we really need to spend on 5 or 6 top players we don’t have the money. I wholeheartedly apologise! Kagawa says he’s coming to United. That may mean Park is going to be sold too. we have no pot to piss in , we’ll be lucky to get in the top 6 next season , keep going though and keep showing your support for the gimps redmyst says: Two genuine needs — holding midfielder and a striker. De Gea is already a sensational keeper. And Anders is no slouch either. We’re actually in pretty good shape on the back line, if Fabio and Rafael can stay healthy for 3-4 months at a time. Cleverley and Pogba have huge upside potential, while our wingers are second to none in the prem. We’ve got three decent forwards, but I would like to find another Welbeck if Macheda can’t make the cut. With all due respect to Fletcher, we could really use a mid like Javi Martinez. Not that he’d necessarily be an automatic starter on Day One, but I could see him lapping Carrick fairly quickly. A little more protection for the back line is what the doctor orders. No panic buys and no clear outs. I wouldn’t mind selling Park, however. If we can find a buyer for him and bring in Kagawa, all the better. Leave a Reply to madmax Cancel Reply 2004-2019 © No Question About That	cc/2020-05/en_middle_0093.json.gz/line679
__label__cc	0.635429	0.364571	PubTracker The Ideal Internship New Author Announcement PHP welcomes second generation author Sarah Maggiore Sarah Maggiore is the daughter of PHP's most prolific writer, Dr. Jack Maggiore, and PHP's new series author. Sarah Maggiore will graduate Cum Laude with her degree in nursing from St. Ambrose University in 2012. A prolific writer and researcher, Sarah has received accolades from her faculty and peers as a gifted professional who is able to dissect difficult medical topics and present them in a comprehensible and engaging manner. Healthcare is in Sarah’s bloodline. As the daughter of two medical technologists, dinnertime conversations centered around interesting and puzzling cases led to her pursuit of a career in nursing. Sarah’s mission is to be a patient educator and advocate. During her clinical rotations, Sarah recognized that far too often patients and their families are left with more questions than answers in a healthcare system that tends to overwhelm us with data, yet deprive us of explanation. As a lifelong migraine sufferer, Sarah provides insight from both a patient and nurse’s perspective on the triggers and treatments of these debilitating headaches. Readers will learn the keys to prevention and limiting the frequency and severity of migraines. Upcoming Books by Sarah Maggiore What If It's...™ Migraines (Series Book) Title: Migraines Author: Sarah Maggiore BSN, RN Formats: Paperback, eBook, Mobile App What If It’s… Migraines explores the meaning of migraine, provides help to those who suffer from these debilitating headaches, and enables readers to differentiate between types of headaches. The book provides insight to migraine triggers as well as efficient ways to get relief from the pain. What If It’s… Migraines also teaches the reader about the disturbances in normal bodily processes that contributes to the pain from a migraine, in order to avoid an onset or decrease in the intensity and frequency of occurrences. With more than 3.2 million migraine sufferers in the US, guidance is needed from a healthcare professional who can relate to readers as both a patient and a nurse. Sarah Maggiore takes the role of a nurse advocate and educator in helping readers to understand the complexity of this ailment, and provides a comprehensive and unbiased review of available therapies and remedies. Migraine Treatments and Remedies Series Book (Skinny Book™) Title: Migraine Treatments and Remedies Buy Now on Amazon! Watch the Book Trailer The dull pain starts behind your eye, like it always does when you are stressed and overtired. You know that a migraine is developing, and start to wonder how you will manage this one. Grandma always told you to turn off the lights and apply hot compresses to your forehead. Your co-worker swears by her megadoses of Vitamin B Complex. You love the convenience of over-the-counter combination analgesics with caffeine. You have heard of prescription nasal sprays, pain killers classified as controlled substances, and even something about injectable bacterial toxins. There are as many choices for treating migraines as there are triggers for these debilitating headaches. What worked one time for you does not work every time. Some medications take the edge off the pain, but cause other problems with nausea or tiredness. Some medications have lingering side effects or could be causing more serious problems later in life. What If It’s…™ Migraine Treatments and Remedies provides an in depth review of the available treatments, from home remedies to prescription drugs to sprays and injections. © 2010-2020 Portrait Health Publishing, Inc. All rights reserved. Powered by Portrait Health Technologies	cc/2020-05/en_middle_0093.json.gz/line683
__label__wiki	0.712121	0.712121	Preview Papers Focus Collections Upcoming Focus Issues Editorial Board and Staff Plant Direct The Arabidopsis Book Plant Cell Teaching Tools ASPB Follow plantphysiol on Twitter Visit plantphysiol on Facebook Visit Plantae Research ArticleRESEARCH ARTICLES - FOCUS ISSUE DEAD-Box RNA Helicase 42 Plays a Critical Role in Pre-mRNA Splicing under Cold Stress Chung-An Lu, Chun-Kai Huang, Wen-Shan Huang, Tian-Sheng Huang, Hsin-Yi Liu, Yu-Fu Chen Chung-An Lu Department of Life Sciences, National Central University, Jhongli City, Taoyuan County 320, Taiwan, Republic of China ORCID record for Chung-An Lu For correspondence: chungan@cc.ncu.edu.tw Chun-Kai Huang Wen-Shan Huang Tian-Sheng Huang Hsin-Yi Liu Yu-Fu Chen Published January 2020. DOI: https://doi.org/10.1104/pp.19.00832 © 2020 American Society of Plant Biologists. All Rights Reserved. Low temperature is an important environmental stress that adversely affects rice (Oryza sativa) growth and productivity. Splicing of pre-mRNA is a crucial posttranscriptional regulatory step in gene expression in plants and is sensitive to temperature. DEAD-box RNA helicases belong to an RNA helicase family involved in the rearrangement of ribonucleoprotein complexes and the modification of RNA structure and are therefore involved in all aspects of RNA metabolism. In this study, we demonstrate that the rate of pre-mRNA splicing is reduced in rice at low temperatures and that the DEAD-box RNA Helicase42 (OsRH42) is necessary to support effective splicing of pre-mRNA during mRNA maturation at low temperatures. OsRH42 expression is tightly coupled to temperature fluctuation, and OsRH42 is localized in the splicing speckles and interacts directly with U2 small nuclear RNA. Retarded pre-mRNA splicing and plant growth defects were exhibited by OsRH42-knockdown transgenic lines at low temperatures, thus indicating that OsRH42 performs an essential role in ensuring accurate pre-mRNA splicing and normal plant growth under low ambient temperature. Unexpectedly, our results show that OsRH42 overexpression significantly disrupts the pre-mRNA splicing pathway, causing retarded plant growth and reducing plant cold tolerance. Combined, these results indicate that accurate control of OsRH42 homeostasis is essential for rice plants to respond to changes in ambient temperature. In addition, our study presents the molecular mechanism of DEAD-box RNA helicase function in pre-mRNA splicing, which is required for adaptation to cold stress in rice. Rice (Oryza sativa) is among the most important crops in the world and is the main staple food for almost 50% of the world’s population (Fairhurst and Dobermann, 2002; Gross and Zhao, 2014). As a tropical and subtropical crop plant, rice is sensitive to cold stress (Lee et al., 1995). Low temperature impairs rice development at the vegetative and reproductive stages, affecting germination, seedling growth, plant height, photosynthesis, heading days, and fertility (Suh et al., 2010). Therefore, cold stress is a major limiting factor for rice growth and production (Jena et al., 2012; Xie et al., 2012; Zhang et al., 2014). Cold response in plants, including rice, involves a complex network of pathways. Complex mechanisms underlying the molecular and physiological changes that enable adaptive response to cold stress in plants have been detected (Hashimoto and Komatsu, 2007). Previous studies of rice response to cold stress have mostly focused on the cold-induced transcriptional response, and many cold-related transcription factors, such as CBF/DREBs, MYB4, MYB3R-2, MYBS3, OsNAC5, OsbZIP52, and OsbZIP73, have been identified in rice (Vannini et al., 2004; Ito et al., 2006; Dai et al., 2007; Su et al., 2010; Takasaki et al., 2010; Liu et al., 2012, 2018). Overexpression of certain cold-related transcription factors can enhance the tolerance of rice to cold stress (Ito et al., 2006; Wang et al., 2008; Ma et al., 2009; Su et al., 2010; Takasaki et al., 2010). In addition to basic transcriptional regulation, posttranscriptional regulatory mechanisms, such as splicing, capping, polyadenylation, mRNA transport, mRNA stability, and translation of the functional mRNA, also influence the cold stress-response regulatory network in many different plants (Gong et al., 2005; Nishimura et al., 2005; Lee et al., 2006; Narsai et al., 2007; Adamo et al., 2008; Chinnusamy et al., 2008; Kim et al., 2017; Shi et al., 2019). RNA molecules, including mRNA, rRNA, and tRNA, perform a specific function based on their well-defined structure during gene expression (de la Cruz et al., 1999; Rajkowitsch et al., 2007). Low temperature causes overstabilization of incorrectly folded RNA and therefore leads to RNA molecular inactivation (Sosnick and Pan, 2002; Melencion et al., 2017). RNA chaperones and RNA helicases function to ensure the formation of mature RNAs of the correct structure by means of their RNA-unwinding and RNA-unfolding activities (Rajkowitsch et al., 2007). RNA helicases are enzymes that can rearrange ribonucleoprotein (RNP) complexes and modify RNA structures and are therefore involved in all aspects of RNA metabolism (Linder, 2006; Hubstenberger et al., 2013; Russell et al., 2013). DEAD-box helicases, which constitute the largest family of RNA helicases, exhibit variable protein sizes and compositions of N- and C-terminal extension sequences. These extension sequences have been proposed to provide substrate-binding specificity, signals for subcellular localization, or interaction domains with accessory compartments (Korolev et al., 1998; Cordin et al., 2006; Byrd and Raney, 2012). DEAD-box helicases are present in most prokaryotes and all eukaryotes, including plants (Okanami et al., 1998; Aubourg et al., 1999; Rocak and Linder, 2004; Owttrim, 2006, 2013; Umate et al., 2010; Xu et al., 2013). Certain DEAD-box RNA helicases in plants are associated with a variety of cellular functions, developmental regulation (Stonebloom et al., 2009; Huang et al., 2010a, 2010b; Liu et al., 2010; Nishimura et al., 2010; Burch-Smith et al., 2011; Asakura et al., 2012; Kanai et al., 2013; Hsu et al., 2014), and response to biotic and abiotic stresses (Gong et al., 2005; Kant et al., 2007; Huang et al., 2010c; Xu et al., 2011; Khan et al., 2014). Expression of five DEAD-box RNA helicases, namely AtRH7 (Huang et al., 2016a), AtRH9/PMH1 (Kim et al., 2008), AtRH22 (Tripurani et al., 2011), AtRH25/STRS2 (Kant et al., 2007), and AtRH53/PMH2 (Kim et al., 2008), is induced by cold stress. Overexpression of AtRH25 confers tolerance to cold stress in Arabidopsis (Arabidopsis thaliana; Kim et al., 2008). AtRH38/LOS4 (Gong et al., 2005) and AtRH42/RCF1 (Guan et al., 2013) perform crucial roles in the export of RNA molecules from the nucleus to the cytoplasm and in pre-mRNA splicing, respectively, and both proteins have an impact on the cold-stress response mechanism. The protein AtRH7 participates in rRNA biogenesis and is also involved in the cold-response mechanism in Arabidopsis (Huang et al., 2016a). Thus, expression of these DEAD-box RNA helicases is essential and may promote plant adaptation to cold stress. To date, the majority of plant DEAD-box RNA helicases shown to function in the cold-response mechanism have been characterized in Arabidopsis. Although the physiological roles of a limited number of DEAD-box RNA helicases, such as OsABP (Macovei et al., 2012), OsRH53 (Nawaz et al., 2018), TOGR1 (Wang et al., 2016), and OsRH58 (Nawaz and Kang, 2019), have been reported in response to abiotic stresses in rice, most rice DEAD-box RNA helicases remain uncharacterized. In this study, we identified and characterized the cold-induced expression of the DEAD-box RNA helicase OsRH42. OsRH42 interacted directly with U2 small nuclear RNA (snRNA). Gain- and loss-of-function analyses revealed that both OsRH42 overexpression and knockdown in transgenic rice seedlings confer hypersensitivity to cold stress. RNA sequencing (RNA-seq) analysis indicated that cold-induced pre-mRNA splicing is disrupted in both OsRH42-overexpressing and -knockdown transgenic lines. Combined, these results demonstrate the pivotal role of OsRH42 in the accurate regulation of cold-induced pre-mRNA splicing and cold-stress tolerance in rice. Cold and Heat Stresses Induce the Expression of OsRH42 To identify DEAD-box RNA helicases involved in the rice response to cold stress, we first identified relevant low temperature-induced expression targets. A rice DEAD-box RNA helicase, namely OsRH42 (Os08g0159900/LOC_Os08g06344), was revealed to be a putative cold-induced gene following a search of a public gene expression profiling database (Genevestigator) in rice (Supplemental Fig. S1A). The cold-induced expression pattern of OsRH42 was verified in rice suspension-cultured cells by reverse transcription PCR (RT-PCR) analysis (Supplemental Fig. S1B) and in 2-week-old rice seedlings by reverse transcription quantitative PCR (RT-qPCR) analysis (Supplemental Fig. S1C) with gene-specific primers (Supplemental Table S1). Expression of OsRH42 under treatment with salt (150 mm NaCl), drought (10 min of air drying), polyethylene glycol (PEG; 20%, w/v), heat (42°C for 3 h), or cold (4°C for 48 h) was analyzed in 2-week-old rice seedlings. The OsRH42 mRNA abundance increased by about 10-fold in cold-stressed seedlings and about 7-fold in heat-stressed seedlings compared with control mock seedlings (Fig. 1A). The abundance of OsRH42 mRNA increased slightly, by a factor of 4, in drought-stressed seedlings (Fig. 1A). These results indicate that OsRH42 expression was highly responsive to cold and heat stresses and that OsRH42 may participate in the response mechanism to these stresses in rice. Expression patterns of OsRH42. A, RT-qPCR analysis of OsRH42 expression under various stress treatments. Two-week-old seedlings were treated with salt (S48; 150 mm NaCl for 48 h), drought (D3; air dried for 3 h), osmotic (P48; 40% [w/v] PEG for 48 h), cold (C48; 4°C for 48 h), and heat (H48; 37°C for 48 h) stress. C0 indicates seedlings at pretreatment; N48 indicates that seedlings were transferred to the new culture medium for 48 h. The rice ACT1 gene was used as a control to normalize RNA signals. B, RT-qPCR analysis of OsRH42 gene expression in various tissues and organs of rice. Total RNA was isolated from seedlings (Sd), roots (Rt), stems (St), leaves (L), sheaths (Sh), flag leaves (Fl), booting panicles (Pi), heading panicles (Ph), flowering panicles (Pf), and pollinated panicles (Pp). The rice ACT1 gene was used as an internal control. Error bars indicate se of three replicate experiments. The expression patterns of OsRH42 in various tissues and organs of rice were determined by RT-qPCR analysis. The OsRH42 transcripts were detected in all selected tissues and organs, including the root, stem, leaf, sheath, panicle, and seedling, and relatively high amounts of OsRH42 mRNAs were detected in vegetative leaves and flag leaves (Fig. 1B). Thus, OsRH42 expression was ubiquitous for all the plant developmental stages examined and was predominant in leaves. The temporal and spatial expression patterns of OsRH42 were further examined in three independent transgenic plants that harbored an OsRH42 promoter-driven GUS chimeric gene (Supplemental Fig. S2A). The GUS activity was weak and only detected in leaf tips of the seedling (Supplemental Fig. S2B). We also examined the mRNA accumulation pattern of OsRH42 mRNA in the leaf blade. Three samples of leaf blade, leaf apices, leaf midribs, and leaf bases were collected from 2-week-old, 1-month-old, and 3-month-old rice plants and their total RNAs were subjected to RT-qPCR analyses. Accumulation of OsRH42 mRNA in all three parts of the leaf blade was maintained at similar levels (Supplemental Fig. S2C). The studies described here suggest that although the expression of OsRH42 in rice is ubiquitous and occurs predominantly in leaves, OsRH42 expression may be regulated not only at the transcriptional level. Expression Knockdown and Overexpression of OsRH42 Cause Defective Plant Development Loss- and gain-of-function approaches were applied to explore the biological and cellular functions of OsRH42 in rice. The RNA interference (RNAi) target region comprised 290 bp of the OsRH42 cDNA 3ʹ untranslated region sequence, which was used as a query to search rice mRNA databases of the National Center of Biotechnology Information. No RNA region had an identical sequence of 16 or more nucleotides. In addition, a public web-based computational tool developed for the identification of potential off-targets, siRNA Design Software (Naito and Ui-Tei, 2012), was used to search rice mRNA databases. No potential off-target effects based on use of the RNAi target region were detected. Several independent transgenic plants that harbored the OsRH42 RNAi construct, which is controlled by a maize (Zea mays) ubiquitin gene (Ubi) promoter (Supplemental Fig. S3A), were generated, and OsRH42 mRNA abundance was determined by RT-qPCR analysis. The residual levels of OsRH42 mRNA detected in three independent T1 transgenic lines, RNAi-4, RNAi-17, and RNAi-20, were about 25% of those of wild-type lines (Supplemental Fig. S3B) and were therefore selected for further investigation. In addition, OsRH42-overexpression transgenic rice lines were generated using OsRH42 cDNA fused downstream of the maize Ubi promoter (Supplemental Fig. S3A). Three independent homozygous lines that showed high abundances of OsRH42 mRNA were obtained: OX-6, OX-17, and OX-18 (Supplemental Fig. S3C). OsRH42-overexpression and -knockdown transgenic lines were generated up to the T3 to T5 generations, and these showed a number of morphological defects at vegetative and reproductive stages. The OsRH42-overexpression transgenic lines were more severely impacted than the OsRH42-knockdown lines. Reduced seedling growth was observed in the OsRH42-knockdown and -overexpression transgenic lines compared with the growth of wild-type seedlings; the height of 2-week-old transgenic seedlings was 12% and 20% shorter, respectively, than those of wild-type seedlings of identical age (Fig. 2, A and B). At the reproductive stage, the plant height of OsRH42-knockdown and -overexpression transgenic lines was less than that of wild-type plants (Table 1; Fig. 2, C and D). The culm and internode lengths of the transgenic lines were reduced compared with those of wild-type plants (Supplemental Fig. S4). The OsRH42-knockdown and -overexpression transgenic lines showed a 13% to 46% reduction in terms of the number of panicles compared with the wild-type plants (Table 1). After pollination, the OsRH42-knockdown and -overexpression transgenic lines exhibited a decrease in tiller number, panicle number, and panicle length, and produced fewer and lighter seeds, compared with wild-type plants (Table 1; Fig. 2E). Phenotypes of OsRH42-knockdown and -overexpression T5 transgenic rice. A, Wild-type (WT), three independent OsRH2 knockdown line (RNAi), and three independent overexpression line (OX) seedlings were grown on one-half-strength Murashige and Skoog agar medium for 10 d and transferred to hydroponic culture for 7 d. The image has been digitally extracted for comparison. Bar = 5 cm. B, Quantification of plant height at the seedling stage. The plant height of 17-d-old seedlings was measured. Error bars indicate se of 10 individual plants for each line. Significantly different from the wild-type plants (Student’s t test, P < 0.05). C, Comparison of plant height between wild-type, RNAi-4, and OX-6 125-d-old plants. The image has been digitally extracted for comparison. Bar = 20 cm. D, Quantification of plant height at reproductive stages. The plant height of 140-d-old seedlings was measured. Error bars indicate sd of 10 individual plants for each line. Significantly different from the wild-type plants (Student’s t test, P < 0.05). E, Spikelet phenotypes of three independent OsRH42-knockdown lines and three independent OsRH42-overexpression lines. The image has been digitally extracted for comparison. Bar = 5 cm. Table 1. Comparison of agronomic traits in field-grown wild-type, OsRH42 knockdown (RNAi), and OsRH42 overexpression (OX) lines Twenty plants were grown from February to July 2017. Error (±) indicates sd; n = 30. OsRH42 Is Essential for Tolerance to Prolonged Cold Stress in Rice To investigate the response of rice ‘Tainung 67’ to cold stress, 2-week-old wild-type seedlings were incubated in growth chambers at 4°C for various periods and then transferred to 28°C for 7 d. Survival percentage declined from 100% to 70% after 6 d of cold stress and then decreased progressively until almost no seedlings remained alive after 9 d (Fig. 3A). A 6-d cold treatment of seedlings was used to assess whether OsRH42 plays a role in cold-stress response. Under prolonged cold stress, the leaves of all examined rice seedlings showed dramatic rolling. After cold treatment, the three independent OsRH42-knockdown lines, RNAi-4, RNAi-17, and RNAi-20, did not grow and exhibited withered, dried leaves before eventually dying (Fig. 3B), whereas the wild-type seedlings continued to grow and showed a relatively green and healthy appearance (Fig. 3B). Survival percentages of the RNAi-4, RNAi-17, and RNAi-20 lines ranged from 26% to 42%, which were lower compared with 85% for the wild type (Fig. 3C). Unexpectedly, continued growth of seedlings of the OsRH42-overexpression lines was inhibited by cold treatment (Fig. 3B). Three OsRH42-overexpression lines, OX-6, OX-17, and OX-18, showed survival percentages of 3.6%, 4.2%, and 4.6%, respectively (Fig. 3C). Electrolyte leakage was measured in seedlings grown under 4°C for 6 d to assess the degree of cold stress-induced membrane injury. Electrolyte leakage during cold treatment was higher in both OsRH42-knockdown and -overexpression lines than in the wild-type seedlings (Fig. 3D). These results indicate that OsRH42 plays an essential role in the rice response to cold stress, and ectopic constitutive overexpression of OsRH42 is unable to improve rice tolerance to cold stress. Examination of the seedling cold-tolerant phenotype in the wild type (WT), three independent OsRH42-knockdown lines (RNAi-4, RNAi-17, and RNAi-20), and three independent OsRH42-overexpression lines (OX-6, OX-17, and OX-18). A, Survival (%) of wild-type seedlings under cold stress. The seedlings were grown at 28°C for 14 d, then subjected to cold stress (4°C) for various time periods and recovery at 28°C for 10 d. B, Comparison of the vegetative morphology of wild-type, RNAi, and OX seedlings under cold stress for 6 d and recovery at 28°C for 10 d. The image has been digitally extracted for comparison. C and D, Quantification of survival (C) and electrolyte leakage (D) of the wild type, RNAi lines, and OX lines under cold stress for 6 d. Error bars indicate se of 10 individual plants for each line. Significantly different from the wild-type seedlings (Student’s t test, *P < 0.05). To investigate the mechanism by which OsRH42 acts in the response of rice to cold stress, OsDREB1A (DRE-binding protein 1A/CBF3) and OsDREB1B expression patterns were examined in wild-type, RNAi-4, and OX-6 seedlings treated at 4°C for 12 and 18 h. The wild-type seedlings exhibited increased OsDREB1A and OsDREB1B expression levels under cold stress for 12 and 18 h (Supplemental Fig. S5). Consistently, the expression levels of OsDREB1A and OsDREB1B induced by cold stress in the RNAi-4 and OX-6 seedlings were similar to those of the wild type (Supplemental Fig. S5). This result indicates that the function of OsRH42 in the response to cold stress is independent of the CBF-mediated system. OsRH42 Is a Prp5-Homologous RNA Helicase That Interacts Directly with U2 snRNA The OsRH42 gene was located on rice chromosome 8 and included two exons. The deduced amino acid sequence of OsRH42 cDNA consisted of nine conserved RNA helicase domains and the characteristic amino acid residues D-E-A-D in motif II (Fig. 4A). Comparison of the amino acid sequences and analysis of the phylogenetic relationships among plant, yeast, and mammalian OsRH42-like proteins showed that OsRH42 is closely related to Arabidopsis RCF1, yeast Prp5, and human DDX46 (Fig. 4A; Supplemental Fig. S6). All homologs contained a conserved motif, EXDPLPY/FM, unique to the family. Moreover, N-terminal external regions of all homologs, except in the case of Saccharomyces cerevisiae, included RD/RS dipeptide repeats (Fig. 4A). Subcellular localization of OsRH42. A, Domain structure of the OsRH42 protein. The conserved motifs are highlighted by gray and black boxes and include the RD/RS domain, DPLP motif, and helicase motifs Q, I, Ia, Ib, II, III, IV, V, and VI. aa, Amino acids. B, An OsRH42 fluorescence fusion protein was localized in the splicing speckles. Rice protoplasts were cotransformed with 35S::OsRH42-GFP and 35S::RNPS1-RFP (splicing speckle marker). Bars = 100 μm. Both Prp5 and DDX46 are involved in branch-point site selection of pre-mRNA splicing (Hozumi et al., 2012; Liu and Cheng, 2015; Tang et al., 2016) and are therefore located in splicing speckles. To determine the subcellular localization of OsRH42, an OsRH42-GFP fusion gene under the control of the cauliflower mosaic virus 35S promoter was generated and introduced into rice protoplasts. OsRH42-GFP-derived fluorescent signals were detected in the nucleus with specific foci, whereas the GFP control signals were observed in the nucleus and cytoplasm (Supplemental Fig. S7). In addition, rice protoplast cells were coexpressed with the fusion proteins OsRH42-GFP and RNPS1-mCherry, a splicing speckle marker. Both GFP and mCherry signals were detected in specific nuclear foci (Fig. 4B), which indicates that OsRH42 is localized in splicing speckles in rice. In both yeast and humans, Prp5 has been demonstrated to bind directly to U2 snRNA (Xu et al., 2004; Liang and Cheng, 2015). Moreover, Prp5 comes into contact with U2 snRNA regions on and near the branch-point-interacting stem loop (Liang and Cheng, 2015). In addition, Prp5 also can interact with U1 snRNA in fission yeast Schizosaccharomyces pombe and humans, but the interaction was not found in S. cerevisiae (Xu et al., 2004). Therefore, an RNA immunoprecipitation (RIP) assay of OsRH42-GFP rice transgenic calli was performed to detect whether OsRH42 binds directly to U2 snRNA in vivo. Two transgenic lines independent of OsRH42-GFP, namely 42-GFP-1 and 42-GFP-2, were obtained and their expression of OsRH42-GFP was verified by RT-PCR and immunoblot analysis (Fig. 5A). The transgenic calli were subjected to RIP analysis using an anti-GFP antibody. Immunoprecipitated RNAs were examined by RT-PCR with primers specific to the U1, U2, U4, and U6 snRNAs (Supplemental Table S1). High amounts of U2 snRNA and low amounts of U1, but no U4 or U6, snRNA were detected (Fig. 5B). By contrast, the RIP assay showed no binding signal in the GFP control transgenic callus (Fig. 5B). This result indicates that OsRH42 binds strongly to U2 but only weakly to U1 snRNA. Our result is consistent that of S. pombe and humans, in that Prp5 interacts with U1 and U2 small nuclear ribonucleoproteins (snRNPs) to bridge between the two snRNPs in the formation of the prespliceosome (Xu et al., 2004). RNA immunoprecipitation analysis for OsRH42. A, RT-PCR and immunoblot analyses for OsRH42-GFP transgenic calli. Total RNA and total soluble proteins were isolated from two independent OsRH42-GFP transgenic lines (42-GFP-1 and 42-GFP-2) and a GFP transgenic line (GFP) and then analyzed via RT-PCR with specific primers for GFP and ACT1 genes and via immunoblotting (WB) with GFP antibody, respectively. B, OsRH42-associated snRNA analysis. Total RNAs and immunoprecipitated (IP) RNAs were subjected to RT-PCR analysis with specific primers for U1, U2, U4, and U6 snRNAs. Pre-mRNA splicing defect analysis of AtSK12, AtPRR5, AtEBF2, and AtPUB45 was carried out in the Arabidopsis rcf1 (an OsRH42 homolog) mutant (Guan et al., 2013). Rice homologs of these genes were identified and their pre-mRNA splicing was examined in OsRH42-knockdown rice. Two-week-old wild-type and RNAi-4 seedlings were cultured under nonstress conditions (28°C) and then treated with cold stress (4°C) for various periods. Total RNA was isolated from the seedlings and subjected to RT-PCR to evaluate the abundance of tested mRNA precursors using gene-specific primers (Fig. 6; Supplemental Table S1). The unspliced mRNAs of SHAGGY-LIKE KINASE12 (OsSK12; Os01g0252100), PSEUDO-RESPONSE REGULATOR59 (OsPRR5; Os09g0532400), EIN3-BINDING F-BOX PROTEIN2 (OsEBF2; Os02g0200900), and PLANT U-BOX PROTEIN45 (OsPUB45; Os01g0901000) were detected after cold-stress treatment (Fig. 6), which indicates that pre-mRNA splicing for these genes was affected in rice seedlings under cold stress. The relative abundance of unspliced mRNA fragments in cold-stressed seedlings was higher in the RNAi-4 seedlings than in the wild-type plants (Fig. 6), which indicates that OsRH42 participates in rice pre-mRNA splicing under cold stress. Examination of OsRH42 function in pre-mRNA splicing. Schematic illustrations of the various gene structures are shown on the left, and the positions of primers used for RT-PCR analysis are indicated by arrows. Total RNA was isolated from 2-week-old seedlings grown at 4°C for various periods and then subjected to RT-PCR with gene-specific primer sets for OsSK12, OsPRR5, OsPUB45, and OsEBF1. The rice ACT1 gene was used as an internal control. Unspliced mRNA is indicated by asterisks. WT, Wild type. Accurate Expression of OsRH42 Is Important for Genome-Wide RNA Splicing in Rice under Cold Stress To determine the role of OsRH42 in genome-wide pre-mRNA splicing under cold stress, we performed RNA-seq analyses of seedlings of the wild type, an OsRH42-knockdown line (RNAi-4), and an OsRH42-overexpression line (OX-6) under nonstress and cold-stress conditions. Approximately 62.4, 70.75, 49.34, 60.81, 53.79, and 48.48 million paired-end sequence reads, with a read length of 150 bp, from wild type, RNAi-4, and OE-6 under nonstress and cold-stress conditions, respectively, were generated (Supplemental Table S2). More than 83% of the reads were perfectly aligned to the rice IRGSP-1 reference genome sequence (Supplemental Table S2). Comparison of mapping frequency in individual samples showed a similar distribution of nonsplice reads and splice reads (Supplemental Table S2), which indicates that the RNA-seq data were of high consistency. Thus, alternative splicing (AS) of pre-mRNA, including intron retention (IR), exon skipping (ES), and alternative 5′ or 3′ splice site (AltDA) events, was analyzed for these RNA samples. Aberrant IR, ES, and AltDA in 268 (255 genes), five (five genes), and 71 (48 genes) events, respectively, were detected in the OsRH42-knockdown seedlings under nonstress conditions compared with the wild-type seedlings (Table 2; Supplemental Data Set S1). Interestingly, a large number of aberrant IR, ES, and AltDA events, specifically 3,822 (2,747 genes), 30 (30 genes), and 301 (239 genes), respectively, were detected in the OsRH42-knockdown seedlings under cold-stress conditions (Table 2; Supplemental Data Set S1). Comparison of aberrant IR, ES, and AltDA genes in the RNAi-4 seedlings, which were detected in 98, one, and 20 genes, respectively, overlapped in the nonstressed and cold-stressed seedlings (Supplemental Fig. S8). These results indicate that expression of OsRH42 is required for accurate splicing of pre-mRNAs in rice in response to cold stress. In the OsRH42-overexpression seedlings, aberrant AS, including IR, ES, and AltDA events, also accumulated under cold-stress conditions, but with reduced abundance, with 1,247 (1,048 genes), 24 (24 genes), and 69 (59 genes) detected, respectively, compared with those in the OsRH42-knockdown seedlings (Table 2; Supplemental Data Set S2). However, more than 1,200 aberrant AS events, especially IR events (1,194), were detected in the OX-6 seedlings under nonstress conditions (Table 2; Supplemental Data Set S2). Among aberrant IR genes, 225 genes were detected under both nonstress and cold-stress conditions (Supplemental Fig. S8). These results suggest that overexpression of OsRH42 causes pre-mRNA splicing defects of certain genes in rice seedlings, regardless of cold stress. Table 2. Differential AS (DAS) events and genes in the OsRH42-knockdown (RNAi-4) and OsRH42-overexpression (OX-6) seedlings under nonstress and cold-stress conditions OsRH42 Affects AS of a Subset of Cold-Induced Transcripts Differentially expressed gene (DEG) analysis between nonstress and cold-stress conditions revealed that 1,059 and 894 genes showed increased and reduced expression in response to cold stress, respectively (Supplemental Data Set S3). Among the genes up-regulated by cold treatment, 396 and 175 genes showed aberrant IR events in the RNAi-4 and OX-6 seedlings, respectively (Fig. 7A). Of these genes, aberrant IR events were induced for 134 genes by knockdown expression as well as by overexpression of OsRH42 (Fig. 7A). Two up-regulated genes that encode MULTIDRUG RESISTANCE7 (MR7) and CALMODULIN BINDING PROTEIN-LIKE (CBP-LIKE), which have been shown previously to be up-regulated by cold treatment (Su et al., 2010), were selected to assess representative IR splicing events by RT-PCR analysis with gene-specific primer sets (Fig. 7; Supplemental Table S1). The accumulation of various intron-containing mRNA isoforms of these two genes was highly increased in the RNAi-4 seedlings, and slightly increased in the OX-6 seedlings, incubated at 4°C for 18 h (Fig. 7, C and D). For an additional two cold-induced genes, which encode an initiator-binding protein (TRF-LIKE2) and a haloacid dehalogenase-like hydrolase (HAD-LIKE), we verified that IR was enhanced only in the RNAi-4 seedlings in our RNA-seq data (Fig. 7, E and F). The levels of intron-containing mRNA isoforms of these two genes were higher in the RNAi-4 seedlings but slightly reduced in the OX-6 seedlings (Fig. 7, E and F). In addition, some genes up-regulated by cold treatment showed aberrant IR and/or ES and/or AltDA events in the current RNA-seq data (Fig. 8). Two up-regulated genes, encoding ALKALINE INVERTASE6 (INV6) and DST COACTIVATOR1 (DST1), were analyzed using RT-PCR with gene-specific primers (Fig. 8; Supplemental Table S1). For INV6, cold-induced In4 retention mRNAs were enhanced in the RNAi-4 and OX-6 seedlings, but cold-induced In1 retention mRNAs were only enhanced in the RNAi-4 seedlings (Fig. 8A). An alternative 5′ splicing site at In4 of INV6 was detected in all cold-treated seedlings and was enhanced by expression knockdown or overexpression of OsRH42 (Fig. 8A). However, INV6 mRNA with an alternative 3′ splicing site was only detected in OX-6 seedlings. For DST1, IR at the third intron, alternative 5′ splicing site at the fourth intron, and ES at the fourth exon mRNAs were detected at increased frequencies in cold-treated RNAi-4 and OX-6 seedlings compared with wild-type seedlings (Fig. 8B). Two alternative 3′ splicing sites at the 10th intron were only enhanced by knockdown expression of OsRH42 (Fig. 8B). These results indicate that OsRH42 plays a critical role in the regulation of mRNA splicing of cold stress-responsive genes under cold stress. Effect of OsRH42 on IR events in cold-responsive genes. A, Venn diagram of cold up-regulated genes, aberrant IR genes in OsRH42 knockdown (RNAi-4) seedlings under cold-stress conditions, and aberrant IR genes in OsRH42 overexpression (OX-6) seedlings under cold-stress conditions. B to F, Representative AS events visualized by the IGV browser and validation of AS by RT-PCR analysis among wild-type (WT), OsRH42-knockdown (RNAi-4), and OsRH42-overexpression (OX-6) seedlings under nonstress and cold-stress conditions. In the IGV schemes, the exon-intron structure of each gene is displayed at the bottom. The positions of primers used for RT-PCR analysis are indicated by arrows. The sizes of PCR products and different mRNA isoforms are shown on the right of each gel. Effect of OsRH42 on ES, 5′ alternative site, and 3′ alternative site events in two cold-responsive genes. Representative AS events in the cold-responsive genes INV6 (A) and DST1 (B) are visualized by the IGV browser, and validation of AS by RT-PCR analysis among wild-type (WT), OsRH42-knockdown (RNAi-4), and OsRH42-overexpression (OX-6) seedlings under nonstress and cold-stress conditions is shown. In the IGV schemes, the exon-intron structure of each gene is displayed at the bottom. The arcs generated by the IGV browser indicate the splice junction. The positions of primers used for RT-PCR analysis are indicated by arrows. The sizes of PCR products and IR, ES, 5′ alternative sites (5SS), and 3′ alternative sites (3SS) are shown. Regulation of Cold-Induced AS Is Affected by Abnormal Expression of OsRH42 Cold stress induces pre-mRNA AS events in Arabidopsis (Calixto et al., 2018). Rapid and dynamic AS have impacts on Arabidopsis response to cold stress (Calixto et al., 2018). In this study, several DAS, including 9,720 differential IR (DIR), 719 differential ES (DES), and 571 differential AltDA (DAltDA) events, were detected in wild-type seedlings after cold stress for 18 h (Table 3; Supplemental Data Set S4). Among these DAS events, DIR represented the majority, which occurred in 6,000 rice genes (Table 3). Cold-induced DES and DAltDA events were less abundant, with transcripts of 628 and 138 genes, respectively (Table 3). Compared with cold-induced DEGs, 863 cold-responsive genes showed cold-induced DAS events, including DIR, DES, and DAltDA events (Supplemental Fig. S9). These results suggest that AS for a number of genes, including cold-induced DEGs, were regulated in the rice response to cold stress. Table 3. Cold-induced DAS events and genes in wild-type, OsRH42 knockdown (RNAi-4), and OsRH42 overexpression (OX-6) seedlings Cold-induced DAS events were dramatically increased in cold-treated RNAi-4 seedlings, especially DIR, with 16,775 events in 8,371 genes detected in the RNAi-4 seedlings (Table 3; Supplemental Data Set S5). The number of cold-induced DES and DAltDA events was also increased in the RNAi-4 seedlings, but to a much lesser degree than cold-induced DIR events (Table 3; Supplemental Data Set S5). Comparison of cold-induced DAS genes between the RNAi-4 and wild-type seedlings reveals that almost 87% (5,216 of 6,000 genes) of genes showing DIR events in the wild type were observed in the RNAi-4 seedlings (Fig. 9A; Supplemental Data Set S6), and 3,153 unique cold-induced DIR genes were detected in the RNAi-4 seedlings (Fig. 9A; Supplemental Data Set S6). In addition, 77% (481 of 628 genes) of DES genes and 59% (267 of 450 genes) of DAltDA genes in the wild type were also detected in the RNAi-4 seedlings under cold stress (Fig. 9A; Supplemental Data Sets S7 and S8). These results suggest that expression knockdown of OsRH42 increased the number of cold-induced DAS events and genes. By contrast, overexpression of OsRH42 slightly reduced cold-induced DIR, DES, and DAltDA events and genes, respectively (Table 3; Supplemental Data Set S6). Only 68% (4,073 of 6,000 genes), 55% (344 of 628 genes), and 44% (199 of 450 genes) of cold-induced DIR, DES, and DAltDA genes, respectively, in the wild type were shared with those in the OX-6 seedlings (Fig. 9A; Supplemental Data Sets S7–S9). These results suggest that overexpression of OsRH42 reduced the frequency of cold-induced DIR, DES, and DAltDA transcripts observed in the wild type but led to the accumulation of an additional subset of abnormal AS transcripts. Effects of OsRH42 on the regulation of cold-induced DAS. A, Venn diagram of DAS between cold-stress and nonstress conditions, including IR genes (left), ES (middle), and AltDA (right) in wild-type (WT), OsRH42-knockdown (RNAi-4), and OsRH42-overexpression (OX-6) seedlings. Information can be found in Supplemental Data Sets S7 to S9. B, Structure of each analyzed gene. The positions of primers used for IR-containing pre-mRNAs by RT-qPCR analysis are indicated by arrows. C to E, RT-qPCR analysis of IR-containing pre-mRNA of three cold up-regulated genes (MR7, CBP-LIKE, and INV6) in the wild type, RNAi-4, and OX-6 under cold-stress treatments and recovery for various periods. Two-week-old seedlings were cultured at 28° and then transferred to 4°C for 6, 12, 18, and 24 h. The seedlings were then transferred to 28° for 2, 6, and 12 h. The rice ACT1 gene was used as a control to normalize RNA signals. Error bars indicate se of three replicate experiments. Three cold-induced DIR events detected in three genes up-regulated by cold treatment, namely MR7, CBP-LIKE, and INV6, were selected to assess the effects of OsRH42 on the regulation of cold-induced DAS. Two-week-old seedlings of the wild type, RNAi-4, and OX-6 were incubated under cold stress for various periods. The accumulation of intron-containing mRNAs of MR7 was detected in RNAi-4 and OX-6 following 6 h of cold stress, whereas accumulation in the wild type was detected after 12 h of cold stress (Fig. 9C). Increased abundance of MR7 IR mRNAs in RNAi-4 and OX-6 seedlings was detected after 6 to 24 h of cold stress, respectively, compared with the wild type, which was detected from 12 to 24 h (Fig. 9C). Similar expression patterns were observed for CBP-LIKE (Fig. 9D) and INV6 (Fig. 9E); IR-containing pre-mRNAs of these two genes were detected earlier and showed greater abundance in RNAi-4 and OX-6 seedlings in comparison with the wild type. In addition, rice seedlings were incubated under cold stress for 24 h and then transferred to the recovery (nonstress) condition (28°C) for various periods. Accumulation of MR7 IR mRNAs was rapidly reduced in the wild type, RNAi-4, and OX-6 when the seedlings were moved to the nonstress condition for recovery after 2 h (Fig. 9C). The CBP-LIKE and INV6 IR mRNAs also rapidly decreased in abundance in the recovery phase in wild-type seedlings (Fig. 9, D and E). However, continued high abundance of CBP-LIKE and INV6 IR mRNAs was detected in RNAi-4 and OX-6 seedlings after 6 to 12 h of recovery. Taken together, these results indicate that abnormal expression of OsRH42 impairs the rapid regulation of certain genes involved in AS in the response of rice to cold stress. Investigation of rice adaptation to a variety of abiotic stresses, together with the improvement of yield and quality, are the focus of current research to address the problem of climate change exacerbated by soil degradation. Low temperature is a major environmental stress, which adversely affects rice growth and productivity. Splicing of pre-mRNA is a crucial posttranscriptional regulatory stage in gene expression in plants and is closely connected to environmental changes (Dubrovina et al., 2013; Reddy et al., 2013). Pre-mRNA splicing is mediated by the spliceosome, which is composed of five uridine-rich snRNPs, namely U1, U2, U4, U5, and U6. These snRNPs function to interact with unspliced pre-mRNAs with the correct sequence at the 5′ splicing site, the 3′ splicing site, and a branch-point region to process intron removal and exon joining. A number of DEAD-box RNA helicases facilitate RNA folding and rearrange the snRNPs at various specific steps during the pre-mRNA splicing process (Liu and Cheng, 2015). Given that the RNA conformation is temperature sensitive (Hofinger and Zerbetto, 2010; Bevilacqua et al., 2016), DEAD-box RNA helicases are of increasing importance to maintain the efficiency of pre-mRNA splicing under a low-temperature environment (Urushiyama et al., 1997; Schaffert et al., 2004; Lee et al., 2006; Du et al., 2015; Kim et al., 2017). In this study, we demonstrate that a nuclear DEAD-box RNA helicase, OsRH42, plays a critical role in pre-mRNA splicing in rice exposed to cold stress and is essential for the cold-stress tolerance of rice growth. OsRH42 has a similar structure in its RNA helicase domain, DPLD motif, and RD/RS domain to Arabidopsis RCF1. However, it is uncertain whether these two proteins perform similar or different biological functions. Here, our evidence shows that although OsRH42 and RCF1 are very similar proteins, and both are required in cold-induced pre-mRNA splicing pathways in rice and Arabidopsis, respectively, the precise involvement of OsRH42 in the pre-mRNA splicing mechanism in rice may differ from that of RCF1 in Arabidopsis. There are five important points to make, as follows. (1) The cold-induced expression pattern of OsRH42 was similar to that of RCF1. The expression of OsRH42 in rice is ubiquitous and is seen predominantly in leaves and may be regulated not only at the transcriptional level (Fig. 1A; Supplemental Fig. S2C). However, the equivalent findings for RCF1 are as yet unclear. (2) The OsRH42-GFP protein is localized to the splicing speckles (Fig. 4B). However, the RCF-GFP fusion protein was detected only in the nucleus (Guan et al., 2013). (3) Three rice OsRH42-knockdown transgenic lines showed hypersensitivity to cold stress (Fig. 3) as did the rcf1 mutants of Arabidopsis (Guan et al., 2013). However, RCF1 has a negative role in regulating CBF gene expression in Arabidopsis (Guan et al., 2013), and the function of OsRH42 in the response of rice to low temperature is independent for the CBF-mediated cold-response system (Supplemental Fig. S5). (4) Both OsRH42 and RCF1 were involved in pre-mRNA splicing in rice (Figs. 6–9; Tables 2 and 3) and Arabidopsis (Guan et al., 2013), respectively, but only for OsRH42 was there a direct interaction with U2 and U1 snRNA in vivo (Fig. 5). (5) Overexpression of OsRH42 in transgenic rice had a negative effect on rice plant growth at the vegetative and reproduction stages (Fig. 2). Moreover, the OsRH42-overexpression lines showed disruption in terms of pre-mRNA splicing and hypersensitivity to low temperatures (Figs. 6 9; Tables 2 and 3). By contrast, constitutive overexpression of RCF1 increased the tolerance of Arabidopsis to cold stress (Guan et al., 2013). Both OsRH42-knockout and -overexpression transgenic rice lines exhibited defects in plant growth and development (Fig. 2; Table 1), and their pre-mRNA splicing was affected under normal growth conditions (Table 2). These results suggest that disorder in pre-mRNA splicing causes defects in plant growth and development, as reported previously in Arabidopsis (Syed et al., 2012; Loraine et al., 2013; Staiger and Brown, 2013). However, the OsRH42-overexpression lines showed a more severe phenotypic defect than the OsRH42-knockdown lines (Fig. 2; Table 1). Accumulation of aberrant pre-mRNA splicing genes in the OsRH42-overexpression lines, compared with the OsRH42-knockdown lines, under normal growth conditions (Table 2) is a reasonable explanation for this. More severe phenotypes were also observed in OsRH42-overexpression transgenic seedlings under cold-stress conditions. Survival rates of the OsRH42-overexpression transgenic seedlings were lower than those of the OsRH42-knockdown seedlings (Fig. 3). In this study, survival rates were determined 10 d after recovery from cold stress. It is possible that, in the recovery stage of plants, OsRH42-overexpression transgenic seedlings have more aberrant pre-mRNAs than OsRH42-knockdown lines, thus explaining their lower survival rates compared with the OsRH42-knockdown lines. However, our findings do not rule out the possibility that overexpression of OsRH42 has a particular effect on rice plant development and response to cold stress, which might not be related to its function in pre-mRNA splicing. Rice OsRH42 is a Prp5-homologous RNA helicase. In yeast, Prp5 binds directly to U2 snRNA to function in the conformational change of U2 snRNP in the recognition of the branch-point region of pre-mRNA (O’Day et al., 1996; Liang and Cheng, 2015). After U2 snRNP binds to the branch-point site, Prp5 is released from the complex, which is essential for tri-snRNP (U2, U4, and U5) to be recruited into the spliceosome; the spliceosome then proceeds following the steps of the splicing pathway (Liang and Cheng, 2015). In consideration of the expression pattern, the subcellular localization, the snRNA-binding abilities of OsRH42, the pre-mRNA splicing phenomena in the OsRH42-knockdown and -overexpression transgenic lines, and the yeast pre-mRNA splicing mechanism, a hypothesis is proposed here to address the biological relevance of observations with pre-mRNA splicing in rice in this study. Under normal temperature conditions, the abundance and function of OsRH42 are irrelevant possibly due to the existence of other RNA helicases (Fig. 1); the U2 snRNP has a functional structure that can participate in pre-mRNA splicing and generate mature mRNAs for rice growth. By contrast, increased OsRH42 under low temperatures (Fig. 1) is important to process pre-mRNA splicing, and this ensures a sufficient quantity of mature mRNAs for adaptation to cold stress in rice. OsRH42 was shown to bind directly to U2 snRNA (Fig. 5). The OsRH42-knockdown transgenic lines have reduced amounts of OsRH42 to bind U2 snRNP in the splicing speckles, leading to less U2 snRNP to associate with the spliceosome in cold-stressed rice plants, and thus their seedlings exhibited the phenotype of cold-stress hypersensitivity (Fig. 3). Increased OsRH42 abundance caused a reduction in the number of aberrant pre-mRNA splicing genes in the transgenic rice seedlings under cold-stress conditions (Table 3). However, a high amount of OsRH42 may also increase the likelihood that OsRH42 still binds to U2 snRNP after U2 snRNA binds to the branch-point site. As speculation from the pre-mRNA splicing mechanism in yeast (Liang and Cheng, 2015), tri-snRNP cannot be recruited into the spliceosome without the release of OsRH42 from U2 snRNA. Thus, rice transgenic lines overexpressing OsRH42 showed disruption of the pre-mRNA splicing pathway (Figs. 7–9; Tables 2 and 3), growth retardation (Fig. 2), as well as intolerance of cold stress (Fig. 3). Taken together, rice plants need accurate control of OsRH42 homeostasis in order to respond to ambient temperatures. Forward genetic studies have shown that several spliceosome-related proteins are important for pre-mRNA splicing and stress response in Arabidopsis (Filichkin et al., 2010; Staiger and Brown, 2013; Ding et al., 2014). For example, SAD1/LSM5 may be involved in stabilization of the U6 snRNP during pre-mRNA splicing. A mutation in the homolog of the LSM5 protein, SAD1/LSM5, leads to increased sensitivity to drought and abscisic acid (Xiong et al., 2001; Cui et al., 2014). RDM16, a component of the U4/U6 snRNP, is involved in pre-mRNA splicing and plant response to salt stress and abscisic acid (Huang et al., 2013). The spliceosomal protein U1A is involved in 5′ splicing site recognition and salt-stress tolerance (Gu et al., 2018). In addition, STABILIZED1, a Prp1p and Prp6p homolog, and PRPF31, which regulates the formation of the tri-snRNP, are required for the response to cold stress in Arabidopsis (Urushiyama et al., 1997; Schaffert et al., 2004; Lee et al., 2006; Du et al., 2015; Kim et al., 2017). Our results here suggest that OsRH42 facilitates pre-mRNA splicing mediated by U2 snRNP function at the branch-point site (Fig. 5). Indeed, RCF1, an OsRH42 homolog, performs an essential role in pre-mRNA splicing and is involved in cold tolerance in Arabidopsis, as reported previously (Guan et al., 2013). These studies suggest that the pre-mRNA splicing mechanism is generally conserved in eukaryotes (Lorković et al., 2000). However, different spliceosome-related proteins are indicated to be connected to a unique stress response in the plant. The branch-point site recognition and tri-snRNP formation may be cold stress-targeted steps in the pre-mRNA splicing pathway. A recent report indicated that the expression of U2B″-LIKE is required for cold acclimation and freezing tolerance in Arabidopsis (Calixto et al., 2018), which provides further support for this hypothesis. AS involves different splicing events from the same pre-mRNA, leading to a variety of mature mRNAs that may code for different functional proteins. In many different plants, AS has been shown to contribute in the response to different stresses (Mastrangelo et al., 2012; Leviatan et al., 2013; Staiger and Brown, 2013; Hartmann et al., 2016; Klepikova et al., 2016; Laloum et al., 2018). In Arabidopsis, cold-induced rapid and dynamic AS has an effect on the cold response transcriptome, which in turn affects plant growth at low temperatures (Calixto et al., 2018). In our genome-wide study, we demonstrate that AS is also detectable in rice seedlings after 18 h of cold stress. Furthermore, analysis of three selected genes reveals that cold-induced AS was detectable at earlier time points. Accumulated IR-containing mRNAs were detected after 6 h of cold stress (Fig. 9). When cold-stressed rice seedlings were transferred to nonstress growth conditions for 2 h, the pre-mRNA splicing mechanism rapidly returned to normal. Accumulated IR-containing mRNA was undetectable in rice seedlings after 2 h under nonstress conditions (Fig. 9). Thus, cold-induced AS is an additional strategy in rice for adaptation to cold stress. Moreover, our results indicate that OsRH42 plays a role in the regulation of cold-induced AS. OsRH42 expression knockdown leads to the acceleration of cold-induced AS in cold-stressed rice and delays normal-type AS in the recovery phase (Fig. 9). An increasing body of evidence indicates that overexpression of a certain spliceosome or other splicing factors can increase plant tolerance to various environmental stresses (Guan et al., 2013; Cui et al., 2014; Cui and Xiong, 2015; Gu et al., 2018). Thus, manipulation of the AS of specific genes may be an effective approach for plants to cope with abiotic stress. However, overexpression of these proteins has not yet been investigated in crop plants. Given that constitutive overexpression of OsRH42 in rice cannot protect seedlings from chilling injury and that such transgenic plants show severe stunting of growth in rice fields under normal growth conditions, accurate control of OsRH42 homeostasis is important for rice adaptation to cold stress. Use of stress-inducible promoters for the expression of OsRH42 may minimize its negative effects on rice plant growth in future applications. Plant Materials and Growth Conditions Rice (Oryza sativa) ‘Tainung 67’ was used in this study. Transgenic rice plants were cultivated at the Agricultural Experiment Station, National Chung-Hsing University (Taichung, Taiwan). Sterilized seeds were placed on one-half-strength Murashige and Skoog agar medium supplemented with 3% (w/v) Suc and cultivated at 28°C under constant light for 10 d. Seedlings were then transferred to a hydroponic culture medium (Kimura B solution) for 4 d before being used in experiments. Stress treatments were as follows: salt, seedlings were transferred to a culture solution containing 150 mm NaCl for 2 d; drought, seedlings were air dried for 3 h; osmotic, seedlings were transferred to a culture solution containing 40% (w/v) PEG for 48 h; heat, seedlings were transferred to 42°C for 2 d; cold, seedlings were transferred to 4°C for 2 to 9 d. The nucleotide sequences of all primers used for plasmid construction, PCR, RT-PCR, and RT-qPCR analyses are listed in Supplemental Table S1. Plasmid pMDC43 (Curtis and Grossniklaus, 2003) was used for fusion of the OsRH42-GFP chimeric protein. The pCAMBIA vectors were obtained from CAMBIA. The OsRH42 coding regions were amplified with specific primers (Supplemental Table S1) using Phusion High-Fidelity DNA Polymerase (New England Biolabs) using the cDNA of seedlings at the three-leaf stage as templates. The PCR products were cloned into the yT&A cloning vector (Yeastern) to generate pOsRH42. For subcellular localization of OsRH42, full-length cDNA fragments were excised from pOsRH42 with AscI and NotI and then ligated into the corresponding sites of the pENTR-TOPO vector to generate the pOsRH42-ENTR vector. Using LR Clonase (Invitrogen), the OsRH42 DNA fragments were transferred from the entry vector to the destination vector, pMDC85, by recombination to generate the OsRH42-GFP plasmid. To generate a construct for ectopic expression of OsRH42, pOsRH42 was digested with BamHI, and the full length of the OsRH42 cDNA fragment was isolated and then introduced into the pAHC18 vector between the maize (Zea mays) Ubi promoter and the Nos terminator to generate pUbi-OsRH42. The pUbi-OsRH42 construct was further digested with SspI and introduced into the pCAMBIA1301 binary vector to generate p1301OsRH42. For the construction of the OsRH42 RNAi vector, a 290-bp DNA fragment located at the 3′ untranslated region of OsRH42 was amplified using specific primers (Supplemental Table S1). This DNA fragment was cloned into the yT&A cloning vector, generating pRH42Ri. The GFP cDNA was amplified by PCR using a forward primer and a reverse primer (Supplemental Table S1) and was then subcloned into the yT&A cloning vector to generate pGFPRI. The OsRH42 RNAi DNA fragment was isolated from pRH42Ri by digestion with EcoRI and BamHI, the GFP DNA fragment was isolated from pGFPRI by digestion with EcoRI, and these two fragments were ligated into the BamHI site of the pAHC18 expression vector, generating pAHC18-OsRH42-Ri. This RNA-silencing construct was linearized by digestion with HindIII and inserted into the HindIII site of the pCAMBIA1301 binary vector for Agrobacterium tumefaciens-mediated gene transformation. RT-PCR and RT-qPCR Analyses Total RNA was isolated from whole seedlings as previously described (Huang et al., 2016b). First-strand cDNA was synthesized using ReverTra Ace reverse transcriptase (Toyobo) with oligo(dT) primers. A 20-fold dilution of the resultant first-strand cDNA was subjected to PCR (22–35 reaction cycles) with gene-specific primers (Supplemental Table S1). For RT-qPCR, a 20-fold dilution of the first-strand cDNA was subjected to qPCR using a PikoReal Real-Time PCR System (Thermo Fisher), in accordance with the manufacturer’s instructions. The PCR procedure was repeated independently at least three times. The relative gene expression levels are expressed as ratios of the abundance of the target gene’s mRNA to that of Act1 mRNA. Data were analyzed using the PikoReal software provided by the manufacturer. The gene-specific primers used for RT-qPCR are listed in Supplemental Table S1. Plant Transformation Rice embryonic calli were induced from germinated seeds on N6 solid medium with 9 μm 2,4-dichlorophenoxy. A. tumefaciens strain EHA105 was used to perform rice transformation as previously described (Huang et al., 2010b). Transformed calli were selected on N6 medium containing 50 mg L−1 hygromycin B. Subcellular Localization Analysis A protoplast transient expression system was used as previously described (Chou et al., 2017). Rice protoplasts were isolated from the sheaths of 10-d-old seedlings and then incubated with expression vectors and PEG for 20 min. After the PEG had been washed away, the rice protoplasts were incubated in WI solution for 6 h and observed using an Olympus IX71 (Olympus) inverted fluorescence microscope. Electrolyte Leakage Assay Examination of electrolyte leakage was performed as described by Yoon et al. (2016) with a slight modification. Briefly, 2-week-old seedlings were treated with 4°C for 6 d. Leaf samples were cut into 1-cm slices from the fourth leaf of seedlings and subjected to electrolyte leakage measurement. The cold-induced electrolyte leakage (%) was calculated as electrolyte leakage (cold)/electrolyte leakage total × 100. RNA Immunoprecipitation Assays RNA immunoprecipitation assays were performed using an RIP-Assay Kit (MBLI). Fresh calli were ground in liquid N2 and then resuspended in a lysis buffer with protease inhibitor cocktail (Roche) and RNase inhibitor (Toyobo). The lysed supernatant was incubated with anti-GFP antibody (Abcam) coupled with Mag Sepharose-Protein G (GE Healthcare). After the preparation had been washed four times, the RNA was extracted from GFP antibody-immobilized protein G Sepharose beads-RNA-protein complex. First-strand cDNA was synthesized with random primers, and RT-PCR was performed with specific primers. RNA-Seq Analysis Total RNA was isolated from three biological replicates of wild-type, RNAi-4, and OX-6 seedlings under 4°C for 0 and 18 h using TRIzol Reagent (Thermo Fisher). The RNA quality was examined using a NanoPhotometer spectrophotometer (IMPLEN). Three biological replicates of RNAs were pooled, polyadenylated RNAs were isolated, and RNA-seq libraries were constructed using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs). Having assessed the library quality, the library preparations were sequenced on the NovaSeq 6000 system with 150-bp paired-end reads. Sequence reads were mapped to the rice IRGSP-1 reference genome sequence using TopHat v2.0.12. HTSeq v0.6.1 was used to count the read numbers mapped to each gene. The fragments per kilobase of transcript per million mapped reads were used for estimation of gene expression levels (Trapnell et al., 2010). The read counts were adjusted using the edgeR program package through one scaling-normalized factor before performing differential gene expression analysis. Differential expression analysis of two conditions was performed using the DEGSeq R package (1.20.0). The corrected P value (false discovery rate) of 0.005 and log2 (fold change) of 1 were set as the threshold for significantly differential expression. DAS events of two conditions were analyzed using the RACKJ (http://rackj.sourceforge.net/) package as previously described (Chang et al., 2014; Kanno et al., 2017). All genes, the average depths of all exons and all introns, and read counts for all splicing junctions of read counts were computed by the RACKJ. In this study, events containing nonannotated splicing junctions or nonspliced sequences spanning annotated splicing junctions in representative gene models were considered AS events. For the preference of IR, a χ2 for goodness of fit (Sasaki et al., 2015) was used, where read depths of an intron in two samples were compared with the background of read depths of neighboring exons. The null hypothesis was assumed that the probabilities of IR were the same in the two samples, and a significant false discovery rate (less than 0.001) indicates that the chance of IR was altered in one of the two samples. Using similar methods as for the IR events, the χ2 test was applied for goodness of fit to measure the preference of ES events and AltDA events, in which those with a skipped exon and other junctions of the same intron were compared. The data presented here were statistically analyzed by Student’s t test, P < 0.05 as significant difference. Statistical analysis was performed with the Excel program. Sequence data from this article can be found in the GenBank/EMBL data libraries under the following accession numbers: Os08g0159900 (OsRH42), Os09g0522200 (OsDREB1A), Os09g0522000 (OsDREB1B), Os01g0252100 (OsSK12), Os09g0532400 (OsPRR5), Os02g0200900 (OsEBF2), Os01g0901000 (OsPUB45), Os03g0718100 (ACT1), Os01g0695800 (MR7), Os01g0134700 ) CBP-LIKE), Os03g0274300 (TRF-LIKE2), Os03g0273800 (HAD-LIKE), Os11g0175400 (INV6), and Os10g0456800 (DST1). The following supplemental materials are available. Supplemental Figure S1. Screening for rice cold-induced DEAD-box RNA helicase gene. Supplemental Figure S2. Expression pattern of the OsRH42p::GUS chimeric gene. Supplemental Figure S3. Characterization of OsRH42-knockdown and -overexpression transgenic lines. Supplemental Figure S4. Comparison of internode distance of 4-month-old rice plants among the wild type, RNAi-2, RNAi-17, RNAi-20, OX-6, and OX-17. Supplemental Figure S5. Comparison of OsDREB1A and OsDREB1B expression in wild-type, RNAi-4, and OX-6 seedlings. Supplemental Figure S6. Phylogenetic relationships of RH42 family members. Supplemental Figure S7. Subcellular localization of the OsRH42-GFP fusion protein. Supplemental Figure S8. Venn diagram of aberrant AS in RNAi-4 and OX-6 seedlings under nonstress and cold-stress conditions. Supplemental Figure S9. Venn diagram of cold-induced DAS genes and DEGs in wild-type, RNAi-4, and OX-6 seedlings. Supplemental Table S1. List of primers used in this study. Supplemental Table S2. Mapping statistics of RNA-seq. Supplemental Data Set S1. DAS genes between RNAi-4 and wild-type seedlings. Supplemental Data Set S2. DAS genes between OX-6 and wild-type seedlings. Supplemental Data Set S3.Cold-induced DEGs in wild-type seedlings. Supplemental Data Set S4. Cold-induced DAS genes in wild-type seedlings. Supplemental Data Set S5.Cold-induced DAS genes in RNAi-4 seedlings. Supplemental Data Set S6.Venn diagram of cold-induced DIR genes in wild-type, RNAi-4, and OX-6 seedlings. Supplemental Data Set S7.Venn diagram of cold-induced DES genes in wild-type, RNAi-4, and OX-6 seedlings. Supplemental Data Set S8.Venn diagram of cold-induced DAltDA genes in wild-type, RNAi-4, and OX-6 seedlings. Supplemental Data Set S9.Cold-induced DAS genes in OX-6 seedlings. We thank the Agricultural Experiment Station, National Chung-Hsing University, for providing space to plant transgenic rice. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Chung-An Lu (chungan{at}cc.ncu.edu.tw). www.plantphysiol.org/cgi/doi/10.1104/pp.19.00832 C.-A.L. designed the experiments; C.-A.L., C.-K.H., W.-S.H., T.-S.H., H.-Y.L., and Y.-F.C. performed the experiments; C.-K.H. and C.-A.L. analyzed the data and wrote the article. ↵1 This work was supported by grants 106-2311-B-008-001-MY3 and 106-2313-B-008-001-MY3 from the Ministry of Science and Technology, Taiwan (MOST). ↵3 Senior author. ↵[OPEN] Articles can be viewed without a subscription. Received July 10, 2019. Published November 21, 2019. Adamo A, Pinney JW, Kunova A, Westhead DR, Meyer P (2008) Heat stress enhances the accumulation of polyadenylated mitochondrial transcripts in Arabidopsis thaliana. PLoS ONE 3: e2889 Asakura Y, Galarneau E, Watkins KP, Barkan A, van Wijk KJ (2012) Chloroplast RH3 DEAD box RNA helicases in maize and Arabidopsis function in splicing of specific group II introns and affect chloroplast ribosome biogenesis. Plant Physiol 159: 961–974 Aubourg S, Kreis M, Lecharny A (1999) The DEAD box RNA helicase family in Arabidopsis thaliana. Nucleic Acids Res 27: 628–636 Bevilacqua PC, Ritchey LE, Su Z, Assmann SM (2016) Genome-wide analysis of RNA secondary structure. Annu Rev Genet 50: 235–266 Burch-Smith TM, Brunkard JO, Choi YG, Zambryski PC (2011) Organelle-nucleus cross-talk regulates plant intercellular communication via plasmodesmata. Proc Natl Acad Sci USA 108: E1451–E1460 Byrd AK, Raney KD (2012) Superfamily 2 helicases. Front Biosci 17: 2070–2088 Calixto CPG, Guo W, James AB, Tzioutziou NA, Entizne JC, Panter PE, Knight H, Nimmo HG, Zhang R, Brown JWS (2018) Rapid and dynamic alternative splicing impacts the Arabidopsis cold response transcriptome. Plant Cell 30: 1424–1444 Chang CY, Lin WD, Tu SL (2014) Genome-wide analysis of heat-sensitive alternative splicing in Physcomitrella patens. Plant Physiol 165: 826–840 Chinnusamy V, Gong Z, Zhu JK (2008) Nuclear RNA export and its importance in abiotic stress responses of plants. Curr Top Microbiol Immunol 326: 235–255 Chou WL, Chung YL, Fang JC, Lu CA (2017) Novel interaction between CCR4 and CAF1 in rice CCR4-NOT deadenylase complex. Plant Mol Biol 93: 79–96 Cordin O, Banroques J, Tanner NK, Linder P (2006) The DEAD-box protein family of RNA helicases. Gene 367: 17–37 Cui P, Xiong L (2015) Environmental stress and pre-mRNA splicing. Mol Plant 8: 1302–1303 Zhang S, Ding F, Ali S, (2014) Dynamic regulation of genome-wide pre-mRNA splicing and stress tolerance by the Sm-like protein LSm5 in Arabidopsis. Genome Biol 15: R1 Curtis MD, Grossniklaus U (2003) A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol 133: 462–469 Dai X, Xu Y, Ma Q, Xu W, Wang T, Xue Y, Chong K (2007) Overexpression of an R1R2R3 MYB gene, OsMYB3R-2, increases tolerance to freezing, drought, and salt stress in transgenic Arabidopsis. Plant Physiol 143: 1739–1751 de la Cruz J, Kressler D, (1999) Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem Sci 24: 192–198 (2014) Genome-wide analysis of alternative splicing of pre-mRNA under salt stress in Arabidopsis. BMC Genomics 15: 431 Du JL, Zhang SW, Huang HW, Cai T, Chen S, He XJ (2015) The splicing factor prp31 is involved in transcriptional gene silencing and stress response in Arabidopsis. Mol Plant 8: 1053–1068 Dubrovina AS, Kiselev KV, Zhuravlev YN (2013) The role of canonical and noncanonical pre-mRNA splicing in plant stress responses. BioMed Res Int 2013: 264314 Fairhurst T, Dobermann A (2002) Rice in the global food supply. Better Crops International 16(Suppl): 3–6 Filichkin SA, Priest HD, Givan SA, Shen R, Bryant DW, Fox SE, Wong WK, Mockler TC (2010) Genome-wide mapping of alternative splicing in Arabidopsis thaliana. Genome Res 20: 45–58 Dong CH, Lee H, Zhu J, Xiong L, Gong D, Stevenson B, (2005) A DEAD box RNA helicase is essential for mRNA export and important for development and stress responses in Arabidopsis. Plant Cell 17: 256–267 Gross BL, Zhao Z (2014) Archaeological and genetic insights into the origins of domesticated rice. Proc Natl Acad Sci USA 111: 6190–6197 Gu J, Xia Z, Luo Y, Jiang X, Qian B, Xie H, Zhu JK, Wang ZY (2018) Spliceosomal protein U1A is involved in alternative splicing and salt stress tolerance in Arabidopsis thaliana. Nucleic Acids Res 46: 1777–1792 Guan Q, Wu J, Liu R, Chai C, Zhu J (2013) A DEAD box RNA helicase is critical for pre-mRNA splicing, cold-responsive gene regulation, and cold tolerance in Arabidopsis. Plant Cell 25: 342–356 Hartmann L, Drewe-Boß P, Wießner T, Wagner G, Geue S, Lee HC, Obermüller DM, Kahles A, Behr J, Sinz FH, et al. (2016) Alternative splicing substantially diversifies the transcriptome during early photomorphogenesis and correlates with the energy availability in Arabidopsis. Plant Cell 28: 2715–2734 Hashimoto M, Komatsu S (2007) Proteomic analysis of rice seedlings during cold stress. Proteomics 7: 1293–1302 Hofinger S, Zerbetto F (2010) A RNA-based nanodevice recording temperature over time. Chem Phys 369: 91–95 Hozumi S, Hirabayashi R, Yoshizawa A, Ogata M, Ishitani T, Tsutsumi M, Kuroiwa A, Itoh M, Kikuchi Y (2012) DEAD-box protein Ddx46 is required for the development of the digestive organs and brain in zebrafish. PLoS ONE 7: e33675 Hsu YF, Chen YC, Hsiao YC, Wang BJ, Lin SY, Cheng WH, Jauh GY, Harada JJ, Wang CS (2014) AtRH57, a DEAD-box RNA helicase, is involved in feedback inhibition of glucose-mediated abscisic acid accumulation during seedling development and additively affects pre-ribosomal RNA processing with high glucose. Plant J 77: 119–135 Huang CF, Miki D, Tang K, Zhou HR, Zheng Z, Chen W, Ma ZY, Yang L, Zhang H, Liu R, et al. (2013) A pre-mRNA-splicing factor is required for RNA-directed DNA methylation in Arabidopsis. PLoS Genet 9: e1003779 Huang CK, Huang LF, Huang JJ, Wu SJ, Yeh CH, (2010a) A DEAD-box protein, AtRH36, is essential for female gametophyte development and is involved in rRNA biogenesis in Arabidopsis. Plant Cell Physiol 51: 694–706 Shen YL, (2016a) The DEAD-box RNA helicase AtRH7/PRH75 participates in pre-rRNA processing, plant development and cold tolerance in Arabidopsis. Plant Cell Physiol 57: 174–191 Sie YS, Chen YF, Huang TS, (2016b) Two highly similar DEAD box proteins, OsRH2 and OsRH34, homologous to eukaryotic initiation factor 4AIII, play roles of the exon junction complex in regulating growth and development in rice. BMC Plant Biol 16: 84 Yu SM, (2010b) A rice DEAD-box protein, OsRH36, can complement an Arabidopsis atrh36 mutant, but cannot functionally replace its yeast homolog Dbp8p. Plant Mol Biol 74: 119–128 Wei T, Laliberté JF, Wang A (2010c) A host RNA helicase-like protein, AtRH8, interacts with the potyviral genome-linked protein, VPg, associates with the virus accumulation complex, and is essential for infection. Plant Physiol 152: 255–266 Hubstenberger A, Noble SL, Cameron C, Evans TC (2013) Translation repressors, an RNA helicase, and developmental cues control RNP phase transitions during early development. Dev Cell 27: 161–173 Ito Y, Katsura K, Maruyama K, Taji T, Kobayashi M, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2006) Functional analysis of rice DREB1/CBF-type transcription factors involved in cold-responsive gene expression in transgenic rice. Plant Cell Physiol 47: 141–153 Jena KK, Kim SM, Suh JP, Yang CI, Kim YG (2012) Identification of cold-tolerant breeding lines by quantitative trait loci associated with cold tolerance in rice. Crop Sci 52: 517–523 Kanai M, Hayashi M, Kondo M, Nishimura M (2013) The plastidic DEAD-box RNA helicase 22, HS3, is essential for plastid functions both in seed development and in seedling growth. Plant Cell Physiol 54: 1431–1440 Kanno T, Fu JL, Matzke AJM, Matzke M (2017) A genetic screen implicates a CWC16/Yju2/CCDC130 protein and SMU1 in alternative splicing in Arabidopsis thaliana. RNA 23: 1068–1079 Kant P, Kant S, Gordon M, Shaked R, (2007) STRESS RESPONSE SUPPRESSOR1 and STRESS RESPONSE SUPPRESSOR2, two DEAD-box RNA helicases that attenuate Arabidopsis responses to multiple abiotic stresses. Plant Physiol 145: 814–830 Khan A, Garbelli A, Grossi S, Florentin A, Batelli G, Acuna T, Zolla G, Kaye Y, Paul LK, Zhu JK, et al. (2014) The Arabidopsis STRESS RESPONSE SUPPRESSOR DEAD-box RNA helicases are nucleolar- and chromocenter-localized proteins that undergo stress-mediated relocalization and are involved in epigenetic gene silencing. Plant J 79: 28–43 Kim GD, Cho YH, Lee BH, Yoo SD (2017) STABILIZED1 modulates pre-mRNA splicing for thermotolerance. Plant Physiol 173: 2370–2382 Kim JS, Kim KA, Oh TR, Park CM, Kang H (2008) Functional characterization of DEAD-box RNA helicases in Arabidopsis thaliana under abiotic stress conditions. Plant Cell Physiol 49: 1563–1571 Klepikova AV, Kasianov AS, Gerasimov ES, Logacheva MD, Penin AA (2016) A high resolution map of the Arabidopsis thaliana developmental transcriptome based on RNA-seq profiling. Plant J 88: 1058–1070 Korolev S, Yao N, Lohman TM, Weber PC, Waksman G (1998) Comparisons between the structures of HCV and Rep helicases reveal structural similarities between SF1 and SF2 super-families of helicases. Protein Sci 7: 605–610 Laloum T, Martín G, Duque P (2018) Alternative splicing control of abiotic stress responses. Trends Plant Sci 23: 140–150 Kapoor A, (2006) STABILIZED1, a stress-upregulated nuclear protein, is required for pre-mRNA splicing, mRNA turnover, and stress tolerance in Arabidopsis. Plant Cell 18: 1736–1749 Lee TM, Lur HS, Chu C (1995) Abscisic-acid and putrescine accumulation in chilling-tolerant rice cultivars. Crop Sci 35: 502–508 Leviatan N, Alkan N, Leshkowitz D, Fluhr R (2013) Genome-wide survey of cold stress regulated alternative splicing in Arabidopsis thaliana with tiling microarray. PLoS ONE 8: e66511 Liang WW, Cheng SC (2015) A novel mechanism for Prp5 function in prespliceosome formation and proofreading the branch site sequence. Genes Dev 29: 81–93 (2006) Dead-box proteins: A family affair—active and passive players in RNP-remodeling. Nucleic Acids Res 34: 4168–4180 Liu C, Ou S, Mao B, Tang J, Wang W, Wang H, Cao S, Schläppi MR, Zhao B, Xiao G, et al. (2018) Early selection of bZIP73 facilitated adaptation of japonica rice to cold climates. Nat Commun 17: 3302 Liu CT, Wu YB, Wang XP (2012) bZIP transcription factor OsbZIP52/RISBZ5: A potential negative regulator of cold and drought stress response in rice. Planta 235: 1157–1169 Liu M, Shi DQ, Yuan L, Liu J, Yang WC (2010) SLOW WALKER3, encoding a putative DEAD-box RNA helicase, is essential for female gametogenesis in Arabidopsis. J Integr Plant Biol 52: 817–828 Liu YC, (2015) Functional roles of DExD/H-box RNA helicases in pre-mRNA splicing. J Biomed Sci 22: 54 Loraine AE, McCormick S, Estrada A, Patel K, Qin P (2013) RNA-seq of Arabidopsis pollen uncovers novel transcription and alternative splicing. Plant Physiol 162: 1092–1109 Lorković ZJ, Wieczorek Kirk DA, Lambermon MHL, Filipowicz W (2000) Pre-mRNA splicing in higher plants. Trends Plant Sci 5: 160–167 Guo J, Liu Y, Chen N, Xiao J, Zhang D, Xu Z, Zhang X, et al. (2009) Enhanced tolerance to chilling stress in OsMYB3R-2 transgenic rice is mediated by alteration in cell cycle and ectopic expression of stress genes. Plant Physiol 150: 244–256 Macovei A, Vaid N, Tula S, Tuteja N (2012) A new DEAD-box helicase ATP-binding protein (OsABP) from rice is responsive to abiotic stress. Plant Signal Behav 7: 1138–1143 Mastrangelo AM, Marone D, Laidò G, De Leonardis AM, De Vita P (2012) Alternative splicing: Enhancing ability to cope with stress via transcriptome plasticity. Plant Sci 185–186: 40–49 Melencion SMB, Chi YH, Pham TT, Paeng SK, Wi SD, Lee C, Ryu SW, Koo SS, Lee SY (2017) RNA chaperone function of a universal stress protein in Arabidopsis confers enhanced cold stress tolerance in plants. Int J Mol Sci 18: E2546 Naito Y, Ui-Tei K (2012) siRNA design software for a target gene-specific RNA interference. Front Genet 3: 102 Narsai R, Howell KA, Millar AH, O’Toole N, Small I, Whelan J (2007) Genome-wide analysis of mRNA decay rates and their determinants in Arabidopsis thaliana. Plant Cell 19: 3418–3436 Nawaz G, (2019) Rice OsRH58, a chloroplast DEAD-box RNA helicase, improves salt or drought stress tolerance in Arabidopsis by affecting chloroplast translation. BMC Plant Biol 19: 17 Zaw Tun Sai T, Lee K, Kim YO, (2018) Rice DEAD-box RNA helicase OsRH53 has negative impact on Arabidopsis response to abiotic stresses. Plant Growth Regul 85: 153–163 Nishimura K, Ashida H, Ogawa T, Yokota A (2010) A DEAD box protein is required for formation of a hidden break in Arabidopsis chloroplast 23S rRNA. Plant J 63: 766–777 Nishimura N, Kitahata N, Narusaka Y, Narusaka M, Kuromori T, Asami T, Hirayama T (2005) Analysis of ABA hypersensitive germination2 revealed the pivotal functions of PARN in stress response in Arabidopsis. Plant J 44: 972–984 O’Day CL, Dalbadie-McFarland G, Abelson J (1996) The Saccharomyces cerevisiae Prp5 protein has RNA-dependent ATPase activity with specificity for U2 small nuclear RNA. J Biol Chem 271: 33261–33267 Okanami M, Meshi T, Iwabuchi M (1998) Characterization of a DEAD box ATPase/RNA helicase protein of Arabidopsis thaliana. Nucleic Acids Res 26: 2638–2643 Owttrim GW (2006) RNA helicases and abiotic stress. Nucleic Acids Res 34: 3220–3230 (2013) RNA helicases: Diverse roles in prokaryotic response to abiotic stress. RNA Biol 10: 96–110 Rajkowitsch L, Chen D, Stampfl S, Semrad K, Waldsich C, Mayer O, Jantsch MF, Konrat R, Bläsi U, Schroeder R (2007) RNA chaperones, RNA annealers and RNA helicases. RNA Biol 4: 118–130 Reddy ASN, Marquez Y, Kalyna M, Barta A (2013) Complexity of the alternative splicing landscape in plants. Plant Cell 25: 3657–3683 Rocak S, (2004) DEAD-box proteins: The driving forces behind RNA metabolism. Nat Rev Mol Cell Biol 5: 232–241 Russell R, Jarmoskaite I, Lambowitz AM (2013) Toward a molecular understanding of RNA remodeling by DEAD-box proteins. RNA Biol 10: 44–55 Sasaki T, Liang SC, Chen PY, Liao WW, Matzke AJ, (2015) An Rtf2 domain-containing protein influences pre-mRNA splicing and is essential for embryonic development in Arabidopsis thaliana. Genetics 200: 523–535 Schaffert N, Hossbach M, Heintzmann R, Achsel T, Lührmann R (2004) RNAi knockdown of hPrp31 leads to an accumulation of U4/U6 di-snRNPs in Cajal bodies. EMBO J 23: 3000–3009 Shi H, He S, He X, Lu S, Guo Z (2019) An eukaryotic elongation factor 2 from Medicago falcata (MfEF2) confers cold tolerance. BMC Plant Biol 19: 218 Sosnick TR, Pan T (2002) Getting hotter with RNA. Nat Struct Biol 9: 795–796 Staiger D, (2013) Alternative splicing at the intersection of biological timing, development, and stress responses. Plant Cell 25: 3640–3656 Stonebloom S, Burch-Smith T, Kim I, Meinke D, Mindrinos M, Zambryski P (2009) Loss of the plant DEAD-box protein ISE1 leads to defective mitochondria and increased cell-to-cell transport via plasmodesmata. Proc Natl Acad Sci USA 106: 17229–17234 Su CF, Wang YC, Hsieh TH, Lu CA, Tseng TH, Yu SM (2010) A novel MYBS3-dependent pathway confers cold tolerance in rice. Plant Physiol 153: 145–158 Jeung JU, Lee JI, Choi YH, Yea JD, Virk PS, Mackill DJ, Jena KK (2010) Identification and analysis of QTLs controlling cold tolerance at the reproductive stage and validation of effective QTLs in cold-tolerant genotypes of rice (Oryza sativa L.). Theor Appl Genet 120: 985–995 Syed NH, Barta A, (2012) Alternative splicing in plants: Coming of age. Trends Plant Sci 17: 616–623 Takasaki H, Kidokoro S, Fujita Y, Yamaguchi-Shinozaki K, Nakashima K (2010) The abiotic stress-responsive NAC-type transcription factor OsNAC5 regulates stress-inducible genes and stress tolerance in rice. Mol Genet Genomics 284: 173–183 Tang Q, Rodriguez-Santiago S, Pu J, Yuste A, Gupta V, Moldón A, Xu YZ, Query CC (2016) SF3B1/Hsh155 HEAT motif mutations affect interaction with the spliceosomal ATPase Prp5, resulting in altered branch site selectivity in pre-mRNA splicing. Genes Dev 30: 2710–2723 Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, Salzberg SL, Wold BJ, Pachter L (2010) Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28: 511–515 Tripurani SK, Nakaminami K, Thompson KB, Crowell SV, Guy CL, Karlson DT (2011) Spatial and temporal expression of cold-responsive DEAD-box RNA helicases reveals their functional roles during embryogenesis in Arabidopsis thaliana. Plant Mol Biol Rep 29: 761–768 Umate P, Tuteja R, (2010) Genome-wide analysis of helicase gene family from rice and Arabidopsis: A comparison with yeast and human. Plant Mol Biol 73: 449–465 Urushiyama S, Tani T, Ohshima Y (1997) The prp1+ gene required for pre-mRNA splicing in Schizosaccharomyces pombe encodes a protein that contains TPR motifs and is similar to Prp6p of budding yeast. Genetics 147: 101–115 Vannini C, Locatelli F, Bracale M, Magnani E, Marsoni M, Osnato M, Mattana M, Baldoni E, Coraggio I (2004) Overexpression of the rice Osmyb4 gene increases chilling and freezing tolerance of Arabidopsis thaliana plants. Plant J 37: 115–127 Wang D, Qin B, Li X, Tang D, Cheng Z, Xue Y (2016) Nucleolar DEAD-box RNA helicase togr1 regulates thermotolerant growth as a pre-rRNA chaperone in rice. PLoS Genet 12: e1005844 Wang QY, Guan YC, Wu YR, Chen HL, Chen F, Chu CC (2008) Overexpression of a rice OsDREB1F gene increases salt, drought, and low temperature tolerance in both Arabidopsis and rice. Plant Mol Biol 67: 589–602 Xie G, Kato H, Imai R (2012) Biochemical identification of the OsMKK6-OsMPK3 signalling pathway for chilling stress tolerance in rice. Biochem J 443: 95–102 Rock CD, Subramanian S, Galbraith D, (2001) Modulation of abscisic acid signal transduction and biosynthesis by an Sm-like protein in Arabidopsis. Dev Cell 1: 771–781 Xu R, Huang J, Zheng C (2013) Genome-wide comparative in silico analysis of the RNA helicase gene family in Zea mays and Glycine max: A comparison with Arabidopsis and Oryza sativa. PLoS ONE 8: e78982 Xu RR, Qi SD, Lu LT, Chen CT, Wu CA, Zheng CC (2011) A DExD/H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana. FEBS J 278: 2296–2306 Newnham CM, Kameoka S, Huang T, Konarska MM, (2004) Prp5 bridges U1 and U2 snRNPs and enables stable U2 snRNP association with intron RNA. EMBO J 23: 376–385 Yoon DH, Lee SS, Park HJ, Lyu JI, Chong WS, Liu JR, Kim BG, Ahn JC, Cho HS (2016) Overexpression of OsCYP19-4 increases tolerance to cold stress and enhances grain yield in rice (Oryza sativa). J Exp Bot 67: 69–82 Zhang Q, Chen Q, Hong Y, Wang Z (2014) Rice and cold stress: Methods for its evaluation and summary of cold tolerance-related quantitative trait loci. Rice (N Y) 7: 24 Thank you for your interest in spreading the word on Plant Physiology. You are going to email the following DEAD-Box RNA Helicase 42 Plays a Critical Role in Pre-mRNA Splicing under Cold Stress Message Subject (Your Name) has sent you a message from Plant Physiology Message Body (Your Name) thought you would like to see the Plant Physiology web site. Plant Physiology Jan 2020, 182 (1) 255-271; DOI: 10.1104/pp.19.00832 Vol. 182, Issue 1 Genome-wide Target Mapping Shows Histone Deacetylase Complex1 Regulates Cell Proliferation in Cucumber Fruit Evolution of the RNA N6-Methyladenosine Methylome Mediated by Genomic Duplication Variation and Inheritance of Small RNAs in Maize Inbreds and F1 Hybrids Show more RESEARCH ARTICLES - FOCUS ISSUE Plant Physiology Preview Recognizing our Authors Journal Miles Advertise in our journals Copyright © 2020 by The American Society of Plant Biologists	cc/2020-05/en_middle_0093.json.gz/line690
__label__wiki	0.748222	0.748222	Home > Vol 8, No 70 > Zhang Functional characterization of a unique cytochrome P450 in Toxoplasma gondii Xiao Zhang, Taotao Zhang, Jing Liu, Muzi Li, Yong Fu, Jianhai Xu and Qun Liu _ Xiao Zhang1,2, Taotao Zhang1,2, Jing Liu1,2, Muzi Li1,2, Yong Fu1,2, Jianhai Xu1,2 and Qun Liu1,2 1Key Laboratory of Animal Epidemiology and Zoonosis, Ministry of Agriculture, College of Veterinary Medicine, China Agricultural University, Beijing, China 2National Animal Protozoa Laboratory, College of Veterinary Medicine, China Agricultural University, Beijing, China Qun Liu, email: qunliu@cau.edu.cn Keywords: T. gondii; P450; biotransformation enzymes; drug resistance Received: October 09, 2017 Accepted: November 15, 2017 Published: December 06, 2017 The basic metabolic cytochrome P450 (CYP) proteins are essential for the biotransformation of sterols and xenobiotics. By contrast, the Toxoplasma gondii genome contains only one CYP gene, and the role of this enzyme in the physiology and biochemistry of apicomplexan parasites is unknown. Because it is a potential resistance gene, identifying the functionality of P450 in T. gondii is particularly important. Knocking out Tg-P450 had no significant effect on T. gondii survival, but mice infected with parasites overexpressing Tg-P450 exhibited significantly enhanced pathogenicity. Enzyme activity analyses demonstrated that this protein has mammalian CYP2B and CYP3A enzymatic activity. In addition, T. gondii lacking the P450 gene exhibited reduced resistance to quinine, mefloquine and clarithromycin compared with parasites overexpressing Tg-P450. These results suggest that P450 functions in T. gondii metabolism and detoxification is involved in vitally important processes in parasitic organisms, making this enzyme a potential drug target. Functional characterization of a unique cytochrome P450 in Toxoplasma gondii \| Zhang \| Oncotarget T. gondii is a globally ubiquitous pathogen that infects approximately 30% of the world population. This obligate intracellular parasite is found in virtually all warm-blooded vertebrates, with feline species serving as the definitive host [1]. As a major opportunistic infection protozoan parasite, toxoplasmosis is usually reported in low-immunity populations, such as developing countries wherein HIV/AIDS is rampant, and it commonly causes focal brain lesions, coma and death [2]. The absence of an effective vaccine against T. gondii infection and its growing drug resistance makes it more important to understand the physiology of T. gondii and explore new drug targets. Importantly, T. gondii can resist the killing effects of many drugs that have previously proven to be effective against Plasmodium falciparum, also an apicomplexan [3]. We hypothesize that some drug resistance genes exist in T. gondii that are associated with this phenomenon. Heme-containing cytochrome P450 enzymes (CYPs, also known as CYP450s) are widely distributed in living organisms, ranging from microorganisms to mammals. Their ubiquity may reflect their ancient origin and physiological importance. CYPs mainly catalyze monooxygenase reactions, metabolizing a wide variety of endogenous substances, such as steroids and fatty acids [4, 5] and detoxifying exogenous substrates. Thus, elevated CYP activity accelerates drug metabolism and is often a reason for drug resistance. While the human genome encodes 57 CYPs, one enzyme, CYP3A4, catalyzes more than 50% of these reactions [6, 7]. Despite their presence in all phyla of living organisms, some parasites are long thought to lose both CYPs and their ability to oxidize xenobiotics [8]. Nonetheless, CYP-like activity was later identified in some apicomplexan parasites (Plasmodium falciparum [9] and Trypanosoma cruzi [10]), and the role of this activity in parasite drug-resistance was demonstrated [8, 11] by proving the existence of the CYP system. However, no data on the composition of the P450 system or the structure and expression of these proteins in T. gondii are available. The aims of this study were (i) to determine the significance of P450 for T. gondii survival and pathogenicity, (ii) assess the role of P450 in drug resistance, (iii) and reveal an essential xenobiotic biotransformation mechanism for the survival of T. gondii lacking Tg-P450. Detection of only one CYP450 protein in T. gondii Only one P450 gene (TGGT1_315770) was found among all the T. gondii genome sequences annotated in the ToxoDB database. Analysis of the Tg-P450 coding region sequence and a search for conserved domains using the National Center for Biotechnology Information (NCBI) conserved domain database revealed the presence of a functional domain (E-value = 3.85e-31) belonging to CypX, a member of the cl12078 superfamily (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) that plays roles in catabolism and defense. Therefore, we believe that Tg-P450 may have a vital effect on metabolic exogenous drugs. The Tg-P450 C-terminal region contains a heme-binding loop with a characteristic P450 consensus motif (Phe-X-X-Gly-X-Arg-X-Cys-X-Gly), with this specific motif comprising Phe492-Gly-Phe-Gly-Thr-Arg-Lys-Cys-Leu-Gly501 (Figure 1A), which helps position the iron atom in the heme [12, 13]. Another conserved region is the Glu-X-X-Arg motif in helix K, which usually helps stabilize the protein core. Other conserved structural regions also exist in Tg-P450, such as the PERF motif Pro476-Asp-Arg-Phe479 and the helix I motif Lys441-Ser-Val-Asp-Phe-Ser446. Figure 1: Comparison of the Tg-P450 protein with CYP450 proteins from other species. (A) Protein sequence-based schematic representation of conserved CYP450 motifs in the Tg-P450 sequence. (B) Phylogenetic analysis of Tg-450 with Neospora caninum, Hammondia hammondi, Sarcocystis neurona and multiple T. gondii strains annotated in the ToxoDB database generated using the Neighbor-Joining method. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentages of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. Sequence analysis was performed using P450 protein sequences from Neospora, Hammondia and Sarcocystis, which are similar to T. gondii. Tg-P450 shares 96% sequence identity with the Hammondia protein, 79% sequence identity with the Neospora protein and 56% sequence identity with the Sarcocystis protein. Phylogenetic analysis showed P450 to be relatively conserved in the different strains of T. gondii (Figure 1B). These results indicate that P450 may have similar functions in T. gondii. Tg-P450 is unnecessary for the survival of T. gondii tachyzoites In other organisms, P450 proteins have been shown to be vital for survival. After treatment with ketoconazole (KCZ, an inhibitor of CYP3A4) at final concentrations of 0.2 mol/L, 0.2×10-2 mol/L, and 0.2×10-4 mol/L, the proliferative capacities of the parasites were significantly decreased. As the KCZ concentration increased, the inhibitory effect on the proliferation of T. gondii became stronger (Figure 2A). Therefore, we believe that Tg-P450 is essential for T. gondii growth. To further verify the function of Tg-P450, we used CRISPR-Cas9 gene deletion techniques to create Toxoplasma tachyzoite lines with Tg-P450 knocked out. The knockouts were confirmed by Western blot analysis with anti-P450 antisera (Prepared by our laboratory) (Supplementary Figure 1D). To assess the survivability of the Tg-P450 knockout parasite line, an integrative plaque assay was performed to assess a multi-step process involving invasion, several rounds of replication and egress. When parasites were cultured for 7 days, no plaque difference was observed between the KO-Tg-450 strain and the parent GT1 strain (Figure 2B). Proliferation experiments also showed no significant difference between the KO-Tg-P450 strain and the GT1 strain within 24 hours of culture (Figure 2C). Thus, these results revealed that P450 is unnecessary for T. gondii tachyzoite survival, at least under normal culture conditions. Subsequent mouse survival experiments showed that KO-Tg-P450 slightly reduced the pathogenicity of T. gondii in mice, but the reduction was not statistically obvious (Figure 2D). Figure 2: Knocking out Tg-P450 has no effect on T. gondii proliferation. (A) Proliferation of tachyzoites per 100 host cells in cultures treated with KCZ at concentrations of 0.2 mol/L, 0.2 × 10-2 mol/L, and 0.2 × 10-4 mol/L. The number of tachyzoites per cell was assessed by IFA. Statistical information is in Supplementary Table 1. Note: Comparisons were made with the control group (GT1). (B) Plaque assay comparing the viabilities of the KO-Tg-P450 and GT1 strains. (C) Proliferation of KO-Tg-P450 tachyzoites per 100 host cells compared with that of GT1 tachyzoites in 24 h. (D) Mouse death curve. Pathogenicity in mice infected with KO-Tg-P450 strain tachyzoites compared with that of mice infected with GT1 strain tachyzoites; 100 tachyzoites/mice. Six mice were assigned to each group, and the statistical results are shown above. Tg-P450 overexpression increases susceptibility to T. gondii infection in mice To further verify the function of Tg-P450, we also constructed a Tg-P450 overexpression strain (Tg-P450 OE), which was electroporated with modified pDMG-TgMCA into GT1, which is a type I strain. After several rounds of selection by pyrimethamine, a transgenic GT1 strain stably expressing Tg-P450 fused with a hemagglutinin (HA) tag was isolated and confirmed by Western blot (Figure 3B). An IFA showed that the Tg-P450 protein was expressed in the T. gondii cytoplasm (Figure 3A). The pathogenicity of the Tg-P450 OE strain was measured in BLAC/c mice. All mice infected with the Tg-P450 OE strain died within 7 days, but GT1 tachyzoite-infected mice survived three days longer (Figure 3C). Tg-P450 OE Pru, a type II strain, was also constructed and used to verify the pathogenicity variation. Virulence lethality in mice inoculated with 2000 and 300 Tg-P450 OE Pru tachyzoites, while a lower pathogenicity was found in mice inoculated with the Pru parent (Figure 3D). These results suggest that Tg-P450 may play special roles in helping T. gondii resist factors that are not suitable for survival. Figure 3: Overexpressing Tg-P450 enhances the pathogenicity of T. gondii. (A) IFA showing Tg-P450-HA expression levels. Green indicates Tg-P450 detected with an anti-HA antibody (Sigma, H3663, USA), and blue indicates cell nuclei. TgGAP45 was stained red to observe the shape of the parasites. Note: A1, cultured for 12 hours; A2, cultured for 48 hours. (B) Western blot analysis of Tg-P450-HA expression levels. The hemagglutinin (HA) label protein was fused with the target protein, and expression was detected. (C) Mouse death curve. Pathogenicity in mice infected with Tg-P450 OE (GT1) strain tachyzoites compared with that of mice infected with GT1 and KO-Tg-P450 strain tachyzoites; 100 tachyzoites/mice. Six mice were assigned to each group, and the statistical analyses are shown above. (D) Mouse death curve. Pathogenicity in mice infected with Tg-P450 OE (Pru) strain tachyzoites compared with mice infected with Pru strain tachyzoites; 300 or 2000 tachyzoites/mice. Six mice were assigned to each group, and the statistical analyses are shown above. T. gondii has CYP enzyme activities PR and BR are fluorogenic substrates of cytochrome P450, and a fluorescent product (resorufin) is produced upon enzymatic cleavage of the alkyl group [14]. If T. gondii does in fact possess monooxygenase ability, the parasites will produce a fluorescent product observable under a rhodamine filter. After incubation with PR and BR for 24 h, a weak specific fluorescence signal was visible in the Tg-P450 OE strain (Figure 4A1, A2, B1, B2) but not in the host cells (HepG2). After treating the P450 knockout parasites with PR and BR, no fluorescence was observed (Figure 4A3, B3). Therefore, T. gondii can metabolize substrates specific to monooxygenases of the mammalian CYP2B and CYP3A families (PR and BR, respectively) [15]. Unfortunately, we did not clearly observe the location of metabolism because of the weak fluorescence, which also indicated that the CYP enzymatic activity in T. gondii is extremely weak. Figure 4: T. gondii CYP activities in situ. Fluorescence micrographs of T. gondii tachyzoites exposed with several substances for 24 h. (A) Intracellular tachyzoites were treated with benzoxyresorufin (BR) and pentoxyresorufin (PR). Note: A1-A2, GT1 strain; A3, KO-Tg-P450 strain. (B) Extracellular tachyzoites were treated with benzoxyresorufin and penzoxyresorufin (rhodamine). Monochrome images were acquired using a rhodamine filter. Note: B1-B2, GT1 strain; B3, KO-Tg-P450 strain. T. gondii CYP activity is derived from Tg-P450 To confirm that the T. gondii CYP activities were derived from Tg-P450, we examined the effects of Tg-P450 activity in hepatic-derived HepG2 cells, which lack most CYP enzymatic activities [16]. We transfected Tg-P450 into HepG2 cells (Figure 5A) and used P450-Glo™ Assay kits (per the operating manual’s instructions) to determine the enzymatic activity of Tg-P450. The enzymatic activities of P450s in the transfected cells were obviously higher than those in control cells. Tg-P450 was demonstrated to have activity of the mammalian enzymes CYP3A4 and CYP2B. We also examined the activity of CYP1A, which is also responsible for exogenous drug metabolism, revealing that Tg-P450 does not possess this enzyme activity (Figure 5B). Next, we treated transfected cells with the recommended CYP3A inducible agent rifampicin, which increased the activity of CYP3A but not of CYP2B and CYP1A (Figure 5C). The genes CYP2B and CYP3A encode monooxygenases, which catalyze most reactions involved in drug metabolism. Thus, Tg-P450 provides T. gondii the ability to resist environments unsuitable for survival. Figure 5: Tg-P450 CYP enzymatic activities in HepG2 cells. (A) Tg-P450 successfully expressed in HepG2 cells. (B) Enzymatic activities of CYP1A, CYP2B and CYP3A in cells transfected with Tg-P450 for 24 h. Note: Comparisons were made with mock cells transfected with the control vector; P < 0.05, P < 0.01. (C) Enzymatic activities of CYP1A, CYP2B and CYP3A in cells transfected with Tg-P450 and induced with rifampicin (manual recommends a CYP3A inducer) for 24 h. Note: comparisons were made with mock cells transfected with the control vector (also induced with rifampicin); P < 0.05, **P < 0.01. Parasites overexpressing Tg-P450 have stronger survival ability than Tg-P450 knockout parasites under drug pressure Plaque assays are often used to assess a multi-step process involving invasion, several rounds of replication and egress. A larger plaque area indicates that Toxoplasma is more viable in this environment. To further verify whether Tg-P450 in parasites has anti-drug effects in vitro, 500 tachyzoites of the Tg-P450 OE (GT1), KO-Tg-P450 (GT1), and GT1 strains were evaluated in the plaque assay. As shown in Figure 6A, after treatment with miconazole, the Tg-P450 OE strain formed larger plaques and had a stronger vitality than the GT1 strain. Meanwhile, the proliferation of KO-Tg-P450 was the weakest due to lacking the Tg-P450 protein. This trend was maintained even when the miconazole concentration was altered. Subsequently, the same results were obtained when repeating the test with quinine and clarithromycin (Figure 6B–6C), and repeated experiments are shown in Supplementary Figure 1A–1C. Figure 6: Tg-P450 can render T. gondii resistant to exogenous substances. (A) Effects of miconazole on the intracellular replication of T. gondii KO-Tg-P450, Tg-P450 OE and GT1 strain tachyzoites. A1 and A2 were treated with miconazole at concentrations of 10-2 μM and 10-3 μM for six days. The red arrows point to plaques formed by Toxoplasma proliferation (Giemsa staining). (B) Effects of quinine on the proliferation of the three strains. B1 and B2 were treated with quinine at concentrations of 6 μM and 0.6 μM. (C) Effects of clarithromycin on the proliferation of the three strains. C1 and C2 were treated with clarithromycin at concentrations of 2 × 10-2 μM and 2 × 10-3 μM. Elucidating the functions of Tg-P450 in this study showed this protein is unnecessary for the survival of T. gondii tachyzoites, while P450 overexpression enhanced the pathogenicity of T. gondii in mice. Because these results were confusing, we next evaluated whether Tg-P450 confers drug resistance like other organisms, revealing that it possesses CYP3A and CYP2B enzymatic activities but not CYP1A. These enzymatic activities resulted in Tg-P450 OE parasites having high resistance to quinine, mefloquine and clarithromycin. The Tg-P450 gene exists as only a single copy in the T. gondii genome, which is extremely different from humans that have 57 P450 genes. Alternative splicing and genetic variations of human P450 can lead to the production of many more distinct protein species [17], and even in parasites, such as Haemonchus contortus (a ruminant nematode), seventy-three partial CYP sequences in 61 supercontig genome assembly databases were identified [18]. The loss or down-regulated expression of CYP family members makes infections with Schistosoma mansoni or the fluke Opisthorchis felineus lethal [19, 20]. Theoretically, Tg-P450 is essential for parasite survival, as only one CYP450 gene was retained in T. gondii. However, the parasites survived even after knocking out the Tg-450 gene. In Schistosoma mansoni, a single P450 protein exists, which is differentially expressed during parasite development in mammalian hosts [19]. Most CYPs were expressed at the highest levels in H. contortus in one or more of the four larval stages, but a small number showed higher expression in the egg or in the adult [18]. We performed our studies on only tachyzoite stages, and different developmental stages may require different CYP450 metabolites and/or experience different immunological stresses. Therefore, we cannot absolutely conclude that Tg-P450 is unnecessary for T. gondii survival. KCZ is currently recognized as a strong inhibitor of CYP3A, CYP2C and CYP2D, and it is used in many studies [21]. KCZ inhibited the proliferation of T. gondii in our study. Nevertheless, knockout of P450 did not affect the survival of parasites. Therefore, the inhibition of Toxoplasma survival by KCZ must be due to unknown factors. Among the drugs tested in this study, miconazole (inhibitor of CYP2B6, CYP2C9, CYP2C19, CYP3A4, CYP2A6, and CYP2D6) and clarithromycin (inhibitor of CYP3A4) have the broadest spectrum of inhibitory activity against CYPs [22, 23], and these two drugs have previously exhibited good killing effects on parasites [24, 25]. In our experiments, these two drugs exhibited a perfect killing effect on all of the gene-edited strains, including the Tg-P450 OE strain. In fact, Tg-P450 OE parasites maintained a resistance relatively stronger than that of the GT1 parent strain with a lower drug concentration, but the KO-Tg-P450 parasites effectively lost their resistance. Quinine is a cinchona alkaloid used in the treatment of severe forms of malaria. Formation of 3-hydroxyquinine is catalyzed by CYP3A4 [26]. The concentrations of quinine tested in our study were intended to be approximately equal to the levels required for an inhibitory effect on malaria parasites, but no obvious anti-toxoplasmosis effects were observed, which was similar to previous reports [27]. However, when we knocked out P450 in T. gondii, an apparent killing effect was observed. While Plasmodium and T. gondii, both apicomplexan parasites, have a similar evolutionary relationship, their resistance to quinine differs. Previous reports indicated that malaria parasite resistance may be related to P450 [27], but these claims were eventually denied [28]. Whether the variant functions of P450 in T. gondii and P. falciparum underlie their differences in resistance needs to be further evaluated. CYP450s function in electron transport chains wherein electrons are passed from NADPH through a flavoenzyme either directly to the CYP450 heme or indirectly through cytochrome b5 or ferredoxin. In the endoplasmic reticulum, NADPH CYP450 reductase serves as the flavoenzyme [29]. Additional partners of CYP450s in the endoplasmic reticulum include cytochrome b5 and cytochrome b5 reductase [30]. The T. gondii genome contains one P450 protein, four cytochrome b5s (TGGT1_276110, TGGT1_240770, TGGT1_313580, TGGT1_276990), one cytochrome b5 reductase (TGGT1_262910), and one ferredoxin reductase (TGGT1_215070). As we did not study the metabolic process of the Tg-P450 protein, we have no evidence of Tg-P450 in concert with these proteins. To reveal the function and metabolic process of Tg-P450, a more complex and in-depth study is needed. Toxoplasmosis remains a challenging disease for people living in endemic areas, and despite many years of drug use, the prevalence of infection remains high. New protein targets for anti-Toxoplasma must be identified, and our discoveries described herein may be a new strategy for treatment of this disease. T. gondii is typically used as a model protozoon organism because of its easy cultivability and facilitation of gene editing operations, and our results may thus provide evidence for the prevention and control of other protozoon parasites. The experiments performed herein were in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the Ministry of Science and Technology of China. All experimental procedures were approved by the Institutional Animal Care and Use Committee of China Agricultural University (under the certificate of Beijing Laboratory Animal employee ID: CAU20161210-2). All efforts were made to minimize the pain and suffering of mice during the procedures. Parasites and cell culture Human foreskin fibroblast (HFF), liver hepatocellular carcinoma (HepG2) and African green monkey kidney (Vero) cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China), and cultured in complete Dulbecco’s Modified Eagle’s Medium (DMEM, Macgene, China) as described in previous reports [31]. T. gondii tachyzoites (GT1, Pru strains were obtained from Professor Xingquan Zhu, Chinese Academy of Agricultural Sciences) were maintained in vitro by serial passage on confluent Vero monolayers in DMEM containing 25 mM glucose and 4 mM glutamine supplemented with 10% fetal bovine serum (FBS, Gibco, USA) and incubated at 37°C with 5% CO2 in a humidified incubator. The medium was changed 6 hours after inoculation. Mice and experimental infections Six-week-old BALB/c mice (Peking University Health Science Center, China) were raised with sufficient water and feed, and the light–dark cycle was set at 14 h light:10 h dark. T. gondii tachyzoites used to infect mice in all the experiments were suspended in phosphate buffered saline (PBS) and injected intraperitoneally using a 0.25-gauge needle. Plaque assay Plaque assays were performed on HFF cells in 6-well tissue culture plates (Corning Costar, USA). Briefly, 500 tachyzoites per well were seeded onto confluent monolayers, and infected cells were maintained in fresh serum-free medium and incubated without disturbance at 37°C in 5% CO2 for 7 days. To stain the monolayers, media was aspirated, and disassociated parasites were removed using PBS. The cell monolayers were then fixed for 10 minutes in PBS containing 4% formaldehyde, stained with crystal violet solution (12.5 g of crystal violet was dissolved in 125 mL of ethanol and mixed with 500 mL of 1% ammonium oxalate in water) at room temperature for 10 minutes. They were then washed with deionized water, air-dried, and visualized by microscopy using image acquisition and plaque area measurements as previously reports described [32]. Invasion assay Approximately 1 × 104 tachyzoites were inoculated onto confluent HFF cells in 12-well plates. Invasion was allowed to take place for 30 min at 37°C before replacement of the inoculation medium with fresh medium, and cells were incubated for the following 24 hours. Thereafter, cells were fixed in PBS with 4% formaldehyde, and an indirect immunofluorescence assay (IFA) was performed using a rabbit anti-GAP45 polyclonal antibody (prepared by our laboratory) for staining. In each of three wells, five random fields were captured, yielding 15 total images for each condition. This was repeated for three separate experiments, totaling 45 images analyzed for each condition. Using ImagePro Plus 6.0 software, for each image, the ratio of cells that had been invaded by T. gondii (green, FITC labeled) to non-invaded cells was calculated. Generation of Tg-P450 knockout and overexpression strains To generate clean knockouts of specific genes, we used a previously described double sgRNA strategy to create separate double strand breaks at the 5′ and 3′ ends of P450. A CRISPR/CAS9-P450 specific sgRNA sequence (GACGCAAGAGAGAATTGAAG) was designed (E-CRISP, http://www.e-crisp.org/E-CRISP) and used for targeted disruption of the Tg-P450 gene. P450-specific sgRNA was cloned into the CRISPR/CAS9 backbone plasmid for T. gondii (kindly offered by Bang Shen [33]). In addition, to generate a plasmid for inserting DHFR (pyrimethamine resistance gene) into the Tg-P450 gene, upstream (800 bp) and downstream (750 bp) regions outside the Tg-P450 coding region were used to surround the DHFR (primers are listed in Supplementary Table 2).These two plasmids were co-transfected into GT1, and parasites were selected using pyrimethamine. The complete coding sequence of Tg-P450 was amplified and inserted into a modified pDMG plasmid in which GFP was replaced with HA, and the vector pDMG- Tg-P450-HA was electroporated into GT1 and Pru for Tg-P450 overexpression. The transgenic parasites were selected with pyrimethamine pressure. Intracellular parasite replication assay First, 500 freshly isolated parasites were inoculated on HFF cells in 12-well plates (Corning Costar, USA). After 30 min, the extracellular parasites were removed by washing 3-5 times with PBS. After incubation for 24 h, the infected cells were fixed with 4% formaldehyde, and an IFA was performed using a rabbit anti-GAP45 polyclonal antibody for staining. For these experiments, 100 parasites per vacuole were evaluated, and the results are shown as the mean ± standard deviation. Virulence assay in mice The virulence assay was performed as described previously [34]. For this assay, GT1 (Type I strain) or Pru (Type II strain) tachyzoites were intraperitoneally injected into each mouse, and all infected mice were monitored every 12 h for clinical signs and survival. We terminated the statistics when there were no survivors (type I strain) or after 40 days (type II strain). Cloning the Tg-P450 gene and transfection into HepG2 cells Based on the T. gondii protein-coding gene sequence (ToxoDB, TGGT1_315770, TGME49_315770), the primers 5′-ATGTCGGAACTTAGTACGCCTTCGG-3′ forward and 5′-CGCCCGAGGTTTGAAACGAAGCAT-3′ reverse were designed to amplify the full-length Tg-P450 coding sequence. Briefly, total RNA from T. gondii tachyzoites was extracted using TRIzol® Reagent (Invitrogen, USA), and first-strand cDNA was synthesized using the above primers with a SuperScript® One-Step RT-PCR System and Platinum® Taq DNA Polymerase (Invitrogen, USA). The PCR fragment containing the Tg-P450 coding sequence was inserted into the pcDNA3.1(+) expression vector to produce the plasmid Tg-P450-pcDNA3.1(+). CYP activity test To measure enzymatic activity, HepG2 cells were transfected with Tg-P450-pcDNA3.1 using Lipofectamine Plus Reagent (Invitrogen, USA); control (mock) cells were also transfected with the empty vector. Transfected cells were incubated at 37°C for 24 h at 5% CO2. The CYP1A, CYP2B6, and CYP3A4 enzymatic activities were measured using P450-Glo Assays (Promega, USA) following the manufacturer’s instructions, and reconstitution buffer was added to the Luciferin Detection Reagent. In situ visualization assay Briefly, normal culture medium was replaced with medium containing 1 μM pentoxyresorufin (PR, Anaspect, USA) and benzoxyresorufin (BR, Anaspect, USA). HepG2 cells infected with tachyzoites overexpressing the P450 gene were incubated in 24-well plates at 37°C and 5% CO2 for 24 h. Next, samples were washed gently three times with PBS, fixed with 4% formaldehyde (Sigma-Aldrich, USA) for 30 min and mounted on a microscope slide for examination. Tachyzoites in which the P450 gene was knocked out served as the negative control. Statistical significance between groups was evaluated by two-tailed unpaired Student’s t-tests using GraphPad Prism 5 (San Diego, CA, USA). Statistical data are presented as the mean value ± standard error of the mean (SEM). P < 0.05 and P < 0.01 were considered statistically significant and very significant, respectively. X.Z., J.L., and Q.L. conceived and designed the experiments. X.Z. and T.T.Z. performed the experiments. X.Z., M.Z.L., J.H.X., and Y.F. analyzed the data. Q.L. contributed reagents, materials, and analysis tools. X.Z. and Q.L. wrote the manuscript. This study was supported by the National Natural Science Foundation of China (31730096 and 31372424). The authors declare no competing financial interests. 1. Sibley LD. (2009). Toxoplasma Gondii: Wiley-VCH Verlag GmbH & Co. KGaA. 2. Anuradha B. Toxoplasmosis in HIV infection: An overview. Trop Parasitol. 2016; 6:129–35. 3. Holfels E, Mcauley J, Mack D, Milhous WK, Mcleod R. In vitro effects of artemisinin ether, cycloguanil hydrochloride (alone and in combination with sulfadiazine), quinine sulfate, mefloquine, primaquine phosphate, trifluoperazine hydrochloride, and verapamil on Toxoplasma gondii. Antimicrob Agents Ch. 1994; 38:1392–6. 4. Anzenbacher P, Anzenbacherova E. Cytochromes P450 and metabolism of xenobiotics. Cell Mol Life Sci. 2001; 58:737–47. 5. Nebert DW, Dieter MZ. The evolution of drug metabolism. Pharmacology. 2000; 61:124–35. 6. Fujita K. Food-drug interactions via human cytochrome P450 3A (CYP3A). Drug Metab Pers Ther. 2004; 20:195. 7. Smith DA, Jones BC. Speculations on the substrate structure-activity relationship (SSAR) of cytochrome P450 enzymes. Biochem Pharmacol. 1992; 44:2089–98. 8. Cvilink V, Lamka J, Skalova L. Xenobiotic metabolizing enzymes and metabolism of anthelminthics in helminths. Drug Metab Rev. 2009; 41:8. 9. Na-Bangchang K, Bray PG, Ward SA. Study on the biochemical basis of mefloquine resistant Plasmodium falciparum. Exp Parasitol. 2007; 117:141–8. 10. De Vas MG, Portal P, Alonso GD, Schlesinger M, Flawia MM, Torres HN, Fernandez VS, Paveto C. The NADPH-cytochrome P450 reductase family in Trypanosoma cruzi is involved in the sterol biosynthesis pathway. Int J Parasitol. 2011; 41:99–108. 11. Devine C. Inhibition of cytochrome P450-mediated metabolism enhances ex vivo susceptibility of Fasciola hepatica to triclabendazole. Parasitology. 2010; 137:871–80. 12. Nelson DR. Cytochrome P450: Structure, Mechanism, and Biochemistry, 3rd ed. J Am Chem Soc. 2005; 127:12147–8. 13. Werckreichhart D, Feyereisen R. Cytochromes P450: a success story. Genome Biol. 2000; 1:1–9. 14. Burke MD, Thompson S, Weaver RJ, Wolf CR, Mayer RT. Cytochrome P450 specificities of alkoxyresorufin O-dealkylation in human and rat liver. Biochem Pharmacol. 1994; 48:923–36. 15. Hagemeyer CE, Burck C, Schwab R, Knoth R, Meyer RP. 7-Benzyloxyresorufin-O-dealkylase activity as a marker for measuring cytochrome P450 CYP3A induction in mouse liver. Anal Biochem. 2010; 398:104. 16. Westerink WM, Schoonen WG. Cytochrome P450 enzyme levels in HepG2 cells and cryopreserved primary human hepatocytes and their induction in HepG2 cells. Toxicol In Vitro. 2007; 21:1581. 17. Turman CM, Hatley JM, Ryder DJ, Ravindranath V, Strobel HW. Alternative splicing within the human cytochrome P450 superfamily with an emphasis on the brain: The convolution continues. Expert Opin Drug Metab Toxicol. 2006; 2:399–418. 18. Laing R, Bartley DJ, Morrison AA, Rezansoff A, Martinelli A, Laing ST, Gilleard JS. The cytochrome P450 family in the parasitic nematode Haemonchus contortus. Int J Parasitol. 2015; 45:243–51. 19. Ziniel PD, Karumudi B, Barnard AH, Fisher EM, Thatcher GR, Podust LM, Williams DL. Correction: The Schistosoma mansoni Cytochrome P450 (CYP3050A1) Is Essential for Worm Survival and Egg Development. PLoS Negl Trop Dis. 2016; 10:e0004439. 20. Pakharukova MY, Ershov NI, Vorontsova EV, Katokhin AV, Merkulova TI, Mordvinov VA. Cytochrome P450 in fluke Opisthorchis felineus: identification and characterization. Mol Biochem Parasitol. 2012; 181:190. 21. Agarwal SK, Salem AH, Danilov AV, Hu B, Puvvada S, Gutierrez M, Chien D, Lewis LD, Wong SL. Effect of Ketoconazole, a Strong CYP3A Inhibitor, on the Pharmacokinetics of Venetoclax, a BCL-2 Inhibitor, in Patients with Non-Hodgkin Lymphoma. Brit J Clin Pharmaco. 2017; 83:846. 22. Ke AB, Zamek-Gliszczynski MJ, Higgins JW, Hall SD. Itraconazole and Clarithromycin as Ketoconazole Alternatives for Clinical CYP3A Inhibition Studies. Clin Pharmacol Ther. 2014; 95:473–6. 23. Mordvinov VA, Shilov AG, Pakharukova MY. Anthelmintic activity of cytochrome p450 inhibitors miconazole and clotrimazole: in-vitro effect on the liver fluke opisthorchis felineus. Int J Antimicrob Agents. 2017. 24. Olliaro P, Gorini G, Jabes D, Regazzetti A, Rossi R, Marchetti A, Tinelli C, Della BC. In-vitro and in-vivo activity of rifabutin against Toxoplasma gondii. J Antimicrob Chemoth. 1994; 34:649. 25. Huy NT, Kamei K, Kondo Y, Serada S, Eanaori K, Takano R, Tajima K, Hara S. Effect of Antifungal Azoles on the Heme Detoxification System of Malarial Parasite. J Biochem. 2002; 131:437–44. 26. Mirghani RA, Ericsson OG, Gustafsson LL, Bertilsson L. Quinine 3-hydroxylation as a biomarker reaction for the activity of CYP3A4 in man. Eur J Clin Pharmacol. 2003; 59:23–8. 27. Ndifor AM, Ward SA, Howells RE. Cytochrome P450 activity in malarial parasites and its possible relationship to chloroquine resistance. Mol Biochem Parasitol. 1990; 41:251. 28. Barrett J. Cytochrome P450 in parasitic protozoa and helminths. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol. 1998; 121:181–3. 29. Hlavica P. On the function of cytochrome b5 in the cytochrome P450-dependent oxygenase system. Arch Biochem Biophys. 1984; 228:600–8. 30. Hanukoglu I. Electron Transfer Proteins of Cytochrome P450 Systems. Adv Atom Mol Opt Phy. 1996; 14:29–56. 31. Gaskell EA, Smith JE, Pinney JW, Westhead DR, McConkey GA. A unique dual activity amino acid hydroxylase in Toxoplasma gondii. PloS one. 2009; 4:e4801. 32. Roos DS, Donald RG, Morrissette NS, Moulton ALC. Molecular tools for genetic dissection of the protozoan parasite Toxoplasma gondii. Method Cell Biol. 1995; 45:27–63. 33. Shen B, Brown KM, Lee TD, Sibley LD. Efficient gene disruption in diverse strains of Toxoplasma gondii using CRISPR/CAS9. Mbio. 2014; 5:01114–14. 34. Wang H, Lei T, Liu J, Li M, Nan H, Liu Q. A Nuclear Factor of High Mobility Group Box Protein in Toxoplasma gondii. PloS one. 2014; 9:e111993.	cc/2020-05/en_middle_0093.json.gz/line694
__label__cc	0.592456	0.407544	Polarimeter Calibration Standards Quartz control plates with traceable UKAS Certificates of Calibration WITH UKAS ACCREDITED CERTIFICATES OF CALIBRATION FOR POLARIMETER STANDARDISATION A quartz plate consists of one (or two) thin discs of optically worked crystalline quartz mounted in a tube, forming a 'standard' sample for a polarimeter. These are the ideal standards for quality control laboratories, as the quartz plate comes with a Certificate of Calibration accredited by UKAS, the United Kingdom Accreditation Service. The UKAS mark on the certificate of Calibration is your assurance that the laboratory (in this case Optical Activity Ltd) issuing the certificate has been stringently assessed by independent experts and that the measurements are traceable to National and International Standards. Optical Properties of Quartz Crystalline Quartz resembles an ordinary uniaxial crystal. When a beam of light passes through such a crystal, the light is split into two beams polarised at right angles. In the special case of uniaxial crystal cut perpendicular to its optic axis, the state of polarisation for a beam passing through the crystal remains unchanged. Quartz however is Optically Active. This phenomenon of optical activity was discovered in 1811 by Arago, who observed that with quartz, unlike an ordinary uniaxial crystal, the plane of polarisation is also rotated with respect to the incident beam. A number of crystals, both uniaxial and biaxial, are optically active; quartz being the best known example. Quartz exists in two forms; one form, called Dextro-Rotary quartz, rotates polarised light in a clockwise direction. Laevo-Rotary quartz rotates in an anti-clockwise direction. The specific rotation of quartz (ie the rotation of a 1mm thick plate) at a 20°C for light of wavelength 589.4400nm (sodium yellow) is 21.7 degrees. Variations with both temperature and wavelength are well known for quartz. Optical Activity Quartz Control Plates All Optical Activity quartz control plates are manufactured to the specifications laid down by I.C.U.M.S.A. (The International Commission for Uniform Methods of Sugar Analysis) and are available with or without the facility for temperature control of the plates. The quartz disc or discs are mounted in a central cell, which provides the best protection from dirt or careless handling. In the temperature controllable version, the central cell is thermally insulated from the supporting sections and can be connected to a thermocirculator to control the temperature by flowing fluid. Optical Activity quartz plates are supplied in a fitted wooden box for safe storage. Optical Activity quartz plates can be used in most polarimeters which accept the standard 30mm diameter end collars. Optionally, plates can be supplied adapted to fit polarimeters which require larger support collar diameters. Standard Rotation Values Available (normally ex-stock) are nominally:- Angular degrees +34°, +17° or + 8.5° International Sugar Scale +99°Z, +50°Z or +25°Z Other rotations, either positive or negative, can be made to special order. If a plate of rotation less than 8.5° (less than 25°Z) is required, this must be made as a double plate, because the minimum thickness of any quartz plate meeting the I.C.U.M.S.A. specification is 0.4mm. Smaller rotation standards are made by using one dextro and one laevo-rotary quartz disc, the difference in rotation giving the required positive or negative rotation. Any rotation up to 90° can be provided for general use in checking and calibrating polarimeters, however, only plates up to a maximum thickness of 1.6mm giving a rotation of ±34° (100°Z) come within the I.C.U.M.S.A. specification. Optical Activity is a UKAS accredited calibration laboratory for the calibration of polarimeters and quartz control plates. All Optical Activity quartz control plates are supplied with a UKAS accredited Calibration Certificate. The metal mount is engraved with a serial number for unique identification along with the optical rotation value at a temperature of 20°C and at the wavelength 589.4400nm (unless otherwise requested). A temperature calibration table is also supplied for each plate. Quartz Plate Rotation (all values are nominal) Non-temperature controllable plates with UKAS certificate:- 99°Z (International Sugar Scale) 34 angular degrees 8.5 angular degrees Special single plate, rotation to choice between 8.5 and 90 angular degrees (25 and 100°Z) positive or negative Special double plate, rotation to choice between 0.5 and 8.5 angular degrees (1.5 and 25°Z) positive or negative Dimensions Non-temperature controllable Temperature Controllable Length 120mm 172mm Support Collar Diameter 30mm* 30mm* Maximum height above optical centre 15mm 45mm Weight (approx) 255g 400g Size (l x d x h) 160mm x 62mm x 52mm 233mm x 78mm x 53mm *Larger diameters available	cc/2020-05/en_middle_0093.json.gz/line697
__label__wiki	0.736841	0.736841	Suffle Quotes Editors Collection Author : A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 12,865,547 quotes searched till now British, Businessman Total Quotes : 26 Rome Seventies Entertain From the early Seventies to the mid-Eighties, I approached Rome at a snail's pace. Having concluded that God existed, I could not seriously entertain the thought of not trying to be in contact with Him. - Conrad Black American Side Least At least 80 percent of American prisoners are grossly over-sentenced. The Supreme Court knows this, but shows scant concern for this human side of criminal justice. Think Immigration Figure I'm not a xenophobe - I think immigration is a good thing for most countries - but they transmute the foibles of their native tongues into English in a way that's difficult to figure out. World Been Terms For decades, I have been a militant anti-declinist in terms of America's place in the world. I Am Citizen Am I am a passport-carrying citizen of the E.U. Shame Any I don't have any shame. Punishment Rehabilitation All emphasis in American prisons is on punishment, retribution, and disparagement, and almost none is on rehabilitation. Over Patriotic Took The United States is a proud, determined, hard-working, talented, patriotic nation and people, and it is not over-extended in the manner of empires of the past that took over the lands of others and eventually collapsed under the weight of the over-ambitious hegemon. Mind Rather Could I do not at all have the mind of a bully... in my mind bullies are intolerant of contrary opinion, domineering and rather cowardly. I would hope that none of those terms could be fairly used in describing me. Trying Go Up I don't go around trying to stir up foreign wars. Loyalty Agreeable Mr Although his personality is generally quite agreeable, Mr Murdoch has no loyalty to anyone or anything except his company. I Am Proud Surviving I am proud of being in a U.S. federal prison and surviving it. Sympathy Never Ask I never ask for mercy and seek no one's sympathy. Service Everyone Republic The U.S. prosecution service is eating at the soul of the American republic. It is an absolute danger to everyone. World Persecution Perhaps Perhaps the gravest under-publicized atrocity in the world is the persecution of Christians. Increasingly Penalties Private-sector firms are increasingly active in the prison industry and they and the militantly unionized correctional officers, almost all unskilled labor, constantly lead public demands for more criminal statutes and more draconian penalties. Argument Mob Socialists The argument of socialists, that people really want to share, beyond a reasonable level of charity, is rubbish, though it is espoused by a lot of rich, pious hypocrites who want to share only enough to avoid widespread starvation, mob violence, and government seizure of more of their incomes. News Curious Energetic Walter Cronkite was a personally decent and convivial man, who literally couldn't kill a fly, was kind to his children, generally helpful to juniors, authentically curious about the news, and, in his time, an energetic reporter. Country Which Largest Nixon's full term was one of the most successful in U.S. history, which is why he was re-elected by the largest plurality in the country's history. Always My Own Otherwise I always keep a firewall between my own travails and my perception of public-policy issues; otherwise I would retain no credibility as a commentator. Showing: 1 out of 2 Pages Sign in with Facebook Sign in with Twitter Sign in with Linkedin Sign in with Google Sign in with Tumblr Sign in with Pinterest Subscribe to our weekly Newsletter and stay tuned. © 2018 QuotesChannel.com	cc/2020-05/en_middle_0093.json.gz/line701
__label__cc	0.745744	0.254256	Tag: oil A really ‘refined’ solution: Rand-Air Durban supplies Class-0 oil-free air to oil refinery shutdowns Aug 7, 2019 samanufacturing While Durban is one of South Africa’s major industrial hubs, it is also home to some of South Africa’s major oil refineries. The fuel and oil from these refineries keep much of South Africa and its economy on the move and flowing smoothly every day. A refinery is a very large and highly complex operation which has been designed to run most of the time with a minimum of supervision. However, usually every two years, oil refineries need to be shut down for a period of intensive maintenance, replacement or… LATEST NEWS, OIL AND GAS, OIL AND LUBRICANTSAssistance, oil, Rand Air, shutdown, south african manufacturingLeave a comment Oil resumes drop as demand fears overshadow Iran tanker seizure Oil has resumed its decline as a sharp drop in the Chinese yuan compounded fears that a deepening trade war will depress demand, countering concerns crude flows may be disrupted following Iran’s seizure of another ship. Futures lost as much as 1.5% in New York. The yuan weakened beyond 7 a dollar for the first time in more than a decade after President Donald Trump said Friday he can raise tariffs on China to a “much higher number.” That followed his threat the day before to increase levies, which spurred… LATEST NEWS, OIL AND GASdrop. fears, Iran, oil, south african manufacturing, tank seizureLeave a comment China launches world’s first intelligent mega tanker An Oil carrier with a capacity of 308,000 tons, amounting to approximately 2.275 million oil barrels is the world’s first intelligent mega tanker, a VLCC, which has been installed with an intelligent operating system and is the first smart carrier in the world. China currently stands as the fourth-largest oil producer in the world, and with the petroleum industry rapidly increasing, it’s easy to see why China has invested in upgrades of marine technology, as demand to supply oil to foreign countries has risen quickly. The new VLCC carrier,… LATEST NEWS, OIL AND GASchina, first intelligent mega tanker, launches, oil, south african manufacturingLeave a comment Angola looks to benefit from surge in oil prices Apr 24, 2019 samanufacturing INTERNATIONAL – Angola plans to auction nine blocks this year and is seeking to build new refineries as Africa’s second-biggest oil producer looks to benefit from a surge in crude prices that could boost companies’ appetite for investments.The tenders for the offshore areas are part of efforts to lure back global explorers that cut spending after crude crashed in 2014, driving down output in the oil-dependent nation. The nine blocks are located in the Namibe basin, Angolan Oil Minister Diamantino Azevedo said, and are part of 55 that local newspaper… LATEST NEWS, OIL AND LUBRICANTSAngola, benefit, oil, sa manufacturingLeave a comment OPINION: Rumblings in the belly off the waters of Port Shepstone Feb 26, 2019 samanufacturing CAPE TOWN – Here is an express announcement detailing plans and intent to drill for crude oil on the waters off the coast of Richard Bay all the way down to Port Shepstone in KwaZulu Natal. It arrives at a time when South Africa is gripped in a svengali hold of ever rising fuel prices. And before I get ahead of myself, let’s pay attention to the enormity of the announcement and the implication of what ENI of Italy and Sasol Oil intend to do. Besides, until we resolve the… OIL AND GASgas, oil, POLITICSLeave a comment Oil, gas exploration expected to boost economy Feb 4, 2019 samanufacturing Minister of Mineral Resources Gwede Mantashe says the Total Exploration and Production Southern Africa’s deep sea stavenger rig operations in the Western Cape should boost investor confidence and contribute positively to the oceans economy. “If we can discover oil and gas here, that will be a game changer for the country in terms of the economy. We hope that we will discover oil so that we can reduce our dependence on imported crude oil,” Mantashe said. On Saturday, the Minister led a delegation from the Department of Mineral Resources on… LATEST NEWS, OIL AND GASboost economy, gas, oilLeave a comment Yokogawa Wins Control System Order for Water Source Facilities in Northwestern China’s Dushanzi District Jan 19, 2018 Feb 9, 2018 samanufacturing Yokogawa Electric Corporation (TOKYO: 6841) announces that its subsidiary, Yokogawa China, has received an order from the Dushanzi Petrochemical Company, a subsidiary of PetroChina Company Limited, to deliver a control system for its water source facilities. This system will monitor and control various water source facilities managed by the Dushanzi Petrochemical Company in the Dushanzi District of Karamay, a city in China’s Xinjiang Uyghur Autonomous Region. The Dushanzi Petrochemical Company manages four sources that annually produce approximately 650 million m3 of water for use by its world-class Dushanzi petrochemical complex… AUTOMATION AND CONTROL, INNOVATION, LATEST NEWSand food, chemicals, iron and steel, natural gas, oil, pharmaceuticals, power, pulp and paper, Yokogawa China, Yokogawa Electric Corporation (TOKYO: 6841), Yokogawa Wins Control System Order for Water Source Facilities in Northwestern China’s Dushanzi DistrictLeave a comment Working together to keep oil away from the environment There has been a fair amount of news about recycling in automotive-related industries. Most of it has been about the demise of Redisa, the tyre recycling agency. But what about waste oil? Those who generate more than 20kg of hazardous waste a day are required to register on the National Waste Information System and to report on the volumes generated and taken away for recycling. Those who fail to comply with the regulations set out by legislation face penalties such as fines or even jail time. It is the legal… HEALTH AND SAFETY, OIL AND GAS, RECYCLING AND WASTE MANAGEMENThazardous, oil1 Comment Yokogawa to Release ProSafe®-RS SIL2 Wireless Gas Detection System Jul 25, 2017 Jul 25, 2017 samanufacturing Offering of a total system solution, including consulting and engineering– Yokogawa Electric Corporation announces that it will release the ProSafe-RS® SIL21 wireless gas detection system in September. The ProSafe-RS SIL2 wireless gas detection system will consist of a newly enhanced version of the Yokogawa ProSafe-RS SIL3 safety instrumented system (R4.03.10), Yokogawa field wireless network devices, annunciator panels, and GasSecure2 GS01 or GS01-EA*3 wireless gas detectors. For this system, Yokogawa will establish a total solution that will include both consulting and engineering. In energy and basic materials… AUTOMATION AND CONTROL, CHEMICALS, LATEST NEWS, NEW PRODUCTS, OIL AND GASa safety instrumented system, and chemicals, gas, oil, petrochemicals, YokogawaLeave a comment	cc/2020-05/en_middle_0093.json.gz/line702
__label__wiki	0.816904	0.816904	Home » Suppliers ipDatatel and Resolution Products announce merger and new chairman HOUSTON and HUDSON, Wis.—ipDatatel and Resolution Products announced yesterday a merger of the two companies. As part of the transaction, veteran technology industry executive, Robin Pederson, will become chairman of the combined company. Financial terms of the deal were not disclosed. "Both of these companies were founded by technology leaders that have advanced the home automation and security industries for decades," Pederson said in the announcement. "I am excited to help them join forces to continue to introduce new products and services for the tens of thousands of independent security dealers and home entertainment and technology integrators making secure smart homes and intelligent, efficient workplaces a reality." When combined, the complementary companies will do more for customers in less time and at a lower cost, the press release read, offering dealers and installers higher, long-term recurring revenue, noting: “The combined organization helps dealers by focusing on reducing account creation costs, increasing recurring revenue and reducing attrition rates. Together, the products and services provide security dealers, alarm installers and home technology experts a platform to service and retain accounts and, takeover existing products and services in a unified, secure communications environment. Since there is virtually no overlap between the offerings of ipDatatel and Resolution Products, the two companies will mostly be unchanged.” Brian Seemann, CEO, Resolution Products, said in the announcement the combination of the two companies “will create a comprehensive, vertically-integrated solution for independent home and commercial installers of security, technology, entertainment and automation. Working together, we'll be able to move more quickly to serve more of the market." Today, the companies jointly sell a complete security, alarm, access control and automation solution for smart homes and commercial installations using the Resolution Products' Helix Alarm Panel and ipDatatel's Universal Alarm Communicators and cloud services. The companies also provide innovative Universal Translator modules, allowing dealers to take-over accounts without replacing sensors, and deliver an innovative line of wireless sensors compatible with virtually any professionally installed security system. "Nowadays, consumers are filling their homes with the latest DIY home automation technology such as the Amazon Echo with Alexa and Nest smart thermostats/cameras," Russell Vail, CEO of ipDatatel, said in the announcement. "The merger of Resolution Products and ipDatatel will bring these homeowners or renters a suite of solutions that connect legacy alarm systems, new installations and DIY automation in a simpler, more intuitive way. Additionally, the technology will be less expensive and faster for the installer to both set up and maintain." Imperial Capital LLC served as the financial advisor to the two companies on the transaction. ipDatatel, Resolution Products	cc/2020-05/en_middle_0093.json.gz/line712
__label__wiki	0.986373	0.986373	Minnesota gubernatorial election, 1908 Title: Minnesota gubernatorial election, 1908 Subject: Minneapolis municipal election, 2009, United States House of Representatives elections in Minnesota, 2008, United States House of Representatives elections in Minnesota, 2012, United States House of Representatives elections in Minnesota, 2014, Minnesota gubernatorial election, 1956 John Albert Johnson Jacob F. Jacobson Governor before election John Albert Johnson Elected Governor Elections in Minnesota Federal elections House of Representatives elections State executive elections Gubernatorial elections Secretary of State elections State Auditor elections Attorney General elections State legislative elections Mayoral elections Board of Estimate and Taxation elections Park and Recreation Board elections The 1908 Minnesota gubernatorial election took place on November 3, 1908. Democratic Party of Minnesota candidate John Albert Johnson defeated Republican Party of Minnesota challenger Jacob F. Jacobson. 1908 Gubernatorial Election, Minnesota Democratic John Albert Johnson 175,136 51.93% -9.00% Republican Jacob F. Jacobson 147,997 43.88% +9.10% Prohibition George D. Haggard 7,024 2.08% -0.53% Public Ownership Beecher Moore 6,516 1.93% +0.25% Independent William W. Allen 593 0.18% n/a Majority 27,139 8.05% Turnout 337,266 Democratic hold Swing List of Minnesota gubernatorial elections http://www.sos.state.mn.us/home/index.asp?page=653 Executive elections Legislative elections United States gubernatorial elections, 1908 Minnesota elections, 1908 Minnesota gubernatorial elections Duluth, Minnesota, Anishinaabe, Science, Rochester, Minnesota, University of Minnesota Democratic Party (United States), Republican Party (United States), United States, United States House of Representatives, United States Congress Minnesota, United States, Adolph Olson Eberhart, Samuel Rinnah Van Sant, Rochester, Minnesota Minneapolis municipal election, 2009 United States Senate, Minnesota elections, 2006, Minnesota elections, 2008, Minnesota elections, 2010, Minnesota elections, 2012 United States House of Representatives elections in Minnesota, 2008 Republican Party (United States), Minnesota, Democratic Party (United States), Incumbent, Independence Party of Minnesota Republican Party (United States), Minnesota Democratic–Farmer–Labor Party, Minnesota House of Representatives, Carver County, Minnesota, Minnesota Minnesota Democratic–Farmer–Labor Party, Minnesota, Republican Party of Minnesota, Barack Obama, Mitt Romney Minnesota, United States Senate, Orville Freeman, Minnesota Democratic-Farmer-Labor Party, Minnesota elections, 2006	cc/2020-05/en_middle_0093.json.gz/line713
__label__wiki	0.614317	0.614317	Tour Archive 2018 Tour Diaries Overkill / Seven Witches / After All Tour (11/2003) Anthrax / Prong / After All Tour (06/2003) Anthrax / After All Tour (03/2003) Metal Grand SlamTour (03-05/2001) Waves Of Annihilation (2016) Dawn Of The Enforcer (2012) Cult Of Sin (2009) This Violent Decline (2006) The Vermin Breed (2005) Mercury Rising (2002) Dead Loss (2000) Transcendent (1997) EP's & Singles Restore To Sanity (2017) Rejection Overruled (2015) Becoming The Martyr (2011) Betrayed By The Gods (2010) The Devil's Pathway (2006) Armageddon Come (2001) The Bereaved EP (2001) No Recollection (2000) Ultraje Sampler 2016 Metal Hammer Sampler (2016) Rock Hard Sampler (2016) Rock Tribune Sampler (2016) Metal Or Death (2010) Rock Hard Dynamit Vol. 66 (2009) Terrorizer Fear Candy 69 (2009) Face Your Underground (2009) BAP Midem (2000) Rookies I (1999) Greenbellies Vol. 2 (1997) Restore To Sanity The Unusual Sin Rejection Overruled To Breach And Grieve Digital War Parasite Within After All Shop Past / Sold Out Merch After All Live @ RGMC 2017 Bert Guillemont (Drums) Christophe Depree (Guitars) Dries Van Damme (Guitars) Frederik Vanmassenhove (Bass) Mike Slembrouck (Vocals) After All Metal! THANKS FOR YOUR SUPPORT IN 2012! The year 2012 may be on its way out, but After All isn't! We'd like to say thanks to all you metalheads out there for making 2012 such a successful year for After All. Highlights include the release of our 8th studio album 'Dawn Of The Enforcer', our very first arena show opening for Judas Priest, a short tour of Germany and Switzerland with Sacred Reich, and a ton of cool shows throughout Belgium and Holland. Thanks to Roadrunner Records/CNR (Benelux) and Ván Records (anywhere else), the promoters we worked with in 2012, and you of course, for your continued support! Some say 2012 will be difficult to top, but we are convinced that the best is yet to come. We will return to the stage in the spring of 2013. Until then, we are in full writing mode for what is to become the next After All album. So stay tuned... To start 2013 in style, we present the brand new, official video for 'To Breach And Grieve' on January 1st. Make sure to check the official After All YouTube channel: www.youtube.com/afterallmetal. Happy newyear! AFTER ALL PRESENT OFFICIAL VIDEO FOR "DIGITAL WAR" Pounding metal! After All have chosen 'Digital War' as the second official video from the 'Dawn Of The Enforcer' album. The video was shot earlier this year, during After All's set as special guest for Angel Witch in Opwijk, Belgium. Many thanks to Henri van Dommelen, Paul Steen and crew! AFTER ALL INTERVIEWED BY ROCK HARD As announced earlier on these pages, German leading metal magazine Rock Hard recently published an interview with After All guitarist Drieze. Thanks again to Götz, Frank and staff for their continued support! AFTER ALL'S KEVIN STRUBBE SCHEDULES DRUM CLINIC Always wanted to know how Kevin pulls off those crazy drum beats in After All's music? Here's your chance to find out... RAVE REVIEW IN ROCK HARD MAGAZINE The new After All album 'Dawn Of The Enforcer' keeps piling up rave reviews... The staff of leading German metal magazine Rock Hard selected the album for the top 10 of best albums in its August edition, adding an awesome review as well. Nice! Be sure to check out Rock Hard in September, as it will feature an interview with the band. DIGIPACK CD, LIMITED VINYL AND NEW SHIRTS ARE AVAILABLE NOW Earlier this summer, Ván Records released 'Dawn Of The Enforcer' both as deluxe digipack cd and super-deluxe limited vinyl. Both editions of the album are now available directly from the band. The digipack includes a 12-page booklet. The LP - limited to 300 copies on heavy 180g vinyl - comes with a printed inner sleeve and contains a giant double sided poster. Also finally in: new After All t-shirts featuring Ed Repka's stunning cover design of the 'Dawn Of The Enforcer' album, as well as old school patches and buttons. Don't let these get away and order now! To order: check the webshop or just send your name and address to This email address is being protected from spambots. You need JavaScript enabled to view it.. The After All shop keeper will get back to you with details. PayPal accepted. AFTER ALL DRUMMER KEVIN LANDS ENDORSEMENT DEAL WITH DIXON "Dixon hooked me up with a brand new rack system", commented After All drummer Kevin Strubbe. "Not only does it make my kit look badass, the rack is really easy to mount and it's also very versatile." Learn more about Dixon here: www.playdixon.com. 'DUSK' EP: TWENTIETH ANNIVERSARY In the summer of 1992, After All released their first EP 'Dusk'. "It seems hard to believe", said After All guitarist Drieze. "Twenty years have passed since that first EP, and what a trip it's been!" Since 1992, After All released six more EPs and eight full albums - 91 original songs. The band toured all over Europe with bands such as Judas Priest, Anthrax, King Diamond, Fear Factory, Testament, Overkill, Stone Sour, and many more. We'd like to give a big shout out to our loyal crew and our fans, both old and new, for sticking with us for all these years. No retreat! No surrender! "We achieved far more than we could ever imagine when 'Dusk' came out twenty years ago..." After All re-recorded the track 'Blind Euphoria' - originally released on the 'Dusk' EP - for their 2006 album 'This Violent Decline'. "It's always nice to revisit that old stuff", added Drieze. "It helps to put everything in perspective. So yeah, let's rock on for some twenty more years!" THANKS FOR YOUR SUPPORT DURING THE SACRED REICH TOUR Better late than never... We'd like to say thanks to all the metal maniacs that came out to support us during the Sacred Reich tour, earlier this summer. These tour dates definitely were the best way to present the new album in Germany and Switzerland! Good times were had... Thanks again and see you soon! 'DAWN OF THE ENFORCER' TO BE RELEASED IN GAS COUNTRIES Following the successful release of 'Dawn Of The Enforcer' trough Roadrunner Records/CNR in Belgium and Holland, After All are proud to announce that the new album will hit stores in Germany, Austria and Switzerland through Ván Records/Soulfood. The release is scheduled for June 8, just in time for the tour with Sacred Reich. "Ván Records is the home of some personal favourites, such as The Devil's Blood, Year Of The Goat and Necros Christos", commented After All guitarist Dries Van Damme. "We feel truly privileged to be part of the Ván roster." Ván Records will release 'Dawn Of The Enforcer' both as digipack cd and limited black 180 g vinyl. Both can be ordered directly from the shop section of this site. JUDAS PRIEST RULES! Just a quick note to thank all of the headbangers that came out to see the Judas Priest / Saxon / After All show at the Lotto Arena in Antwerp. We were told there were about 6,000 of you. And yes, you were loud! Of course, a big thank you to Judas Priest for making us feel welcome. It was awesome! For pics and videos of After All supporting Priest, please go to www.facebook.com/afterallmetal. AFTER ALL TO OPEN FOR JUDAS PRIEST! Holy f*ck! After All have been invited to open for Judas Priest on the Belgian date of the current 'Epitaph' tour. How cool is that? Needless to say we are super stoked for this show. Sharing the stage with the mighty Priest is definitely a dream come true... JUDAS PRIEST + SAXON + AFTER ALL Lotto Arena - Antwerp (B) - May 23 doors: 6 PM - show: 6.45 PM MASSIVE JÄGERMEISTER GIVEAWAY After All teams up with Jägermeister to celebrate the arrival of the new album 'Dawn Of The Enforcer'. Here's your chance to win all sorts of free Jägermeister goodies: from bottles of the actual booze, to shirts and caps... All you need to do is log on to Facebook and share the video for 'Parasite Within', the opening track of the new After All album. Share the video here: www.facebook.com/afterallmetal. (Competition runs until Sunday May 13th, 11.58 PM) NOTHING BUT RAVE REVIEWS ... The new After All album 'Dawn Of The Enforcer' is set to hit record stores in Belgium and Holland on May 4th. Meanwhile, the album receives nothing but rave reviews: Rock Tribune (Belgium): 92/100 + 3 page interview “This will surprise both friends and enemies of the band!” Aardschok (Holland): 82/100 + 2 page interview “A true must-have for every thrash metal fan.” Hellspawn (Belgium): 92/100 + album of the month “The best songs After All ever came up with.” - review Metal To Infinity (Belgium): 93/100 “A fantastic masterpiece!” - review Face Your Underground/Deathmetal.be (Belgium): 92/100 "Sheer class!" - review Lordsofmetal.nl (Holland): 89/100 "This new album is top-notch." - review AFTER ALL PRMIER NEW TRACK FROM UPCOMING ALBUM Last Sunday, After All guitarist Drieze premiered 'Parasite Within', a new track from the upcoming After All album 'Dawn Of The Enforcer' during his weekly metal show on Studio Brussel. 'Dawn Of The Enforcer' is scheduled for a late April release through Roadrunner Records/CNR in Belgium, Holland and Luxembourg. A broader European release is scheduled for early June 2012. The video for 'Parasite Within' was officially released today. 'Parasite Within' is also featured on the compilation album that comes with the April issue of Rock Tribune magazine. The Rock Tribune compilation album features the artwork Ed Repka designed for the new After All album. Rock Tribune subscribers receive the magazine today. It will be available in stores throughout Belgium and Holland as of April 10. PRE-ORDER YOUR COPY OF THE NEW ALBUM NOW! Make sure you order your copy of the new After All album 'Dawn Of The Enforcer'. We are currently taking pre-orders, adding some nice extras as well... For a limited time only! Don't miss out... TO ORDER: just send your name and address to This email address is being protected from spambots. You need JavaScript enabled to view it.. The After All shop keeper will get back to you with details. PayPal accepted. AFTER ALL ANNOUNCE COLLABORATION WITH DAN SWÄNO AND ED REPKA Belgian thrashers After All have tapped Swedish producer Dan Swanö to mix and master the upcoming new album, set for release late April through Roadrunner Records in the Benelux. Dan Swanö also worked on After All’s latest album ‘Cult Of Sin’ (2009) and the band’s two EP releases ‘Betrayed By The Gods’ (2010) and ‘Becoming The Martyr’ (2011). Dan Swanö will mix and master the new After All album at the infamous Unisound Studios in Örebro, Sweden. In related news, legendary illustrator Ed Repka is currently finishing the artwork for After All’s forthcoming album. “Ed is a metal legend”, said Dries Van Damme. “His artwork is what added extra greatness to our favourite releases of bands such as Megadeth, Evil Dead, Toxik, Nuclear Assault, Death, and many others from the 1980s thrash scene. We’re absolutely psyched to work with Ed on the concept and the design of the artwork.” After All’s new album is set for release on March 23. The as yet untitled record will be the band’s eighth full studio album. After All described the new songs as both the heaviest and the most versatile of their long-running career. AFTER ALL ANNOUNCE TOURDATES WITH SACRED REICH! Belgian thrashers After All will be touring as direct support to Sacred Reich. The legendary thrash band from Phoenix, Arizona is celebrating its 25th anniversary with a run of European shows starting in June. After All are direct support to Sacred Reich on the following dates: June 10 – Hamburg (D) – Markthalle June 12 – Berlin (D) – C-Club June 13 – Bochum (D) – Zeche June 14 – Nürnberg (D) – Hirsch June 15 – Pratteln (CH) – Galery After All are currently recording and mixing new songs. Copyright © AFTER ALL 1997 - 2019, All Rights Reserved Designed by DuderDesign.	cc/2020-05/en_middle_0093.json.gz/line715
__label__wiki	0.792819	0.792819	Mobb Deep :: Free Agents – The Murda Mixtape Steve 'Flash' Juon April 22, 2003 MixtapeReview For hardcore rap fans, the word “infamous” automatically brings Mobb Deep to mind. The connotation is far from negative; in fact their rise to ill fame comes on the backs of legendary songs from “Drop a Gem On ‘Em” to “Quiet Storm” to “Shook Ones Pt. II.” Anyone that saw “8 Mile” will know the latter even if they never heard the record; because Eminem freestyles to Havoc’s beat during a battle at The Shelter. When Eminem uses the Mobb Deep hook “ain’t no such thing as halfway crooks” the whole crowd picks up on it and immediately shouts along with him. That’s not acting, and that’s not because they rehearsed the scene multiple times – that’s EXACTLY how a hardcore set of rap fans would react in the same situation. To top it all off, be sure to thank the Infamous for rap slang like “Dunn” and “kiko.” They are to rap linguistics from Queensbridge what E-40 is to verbals from Vallejo. Beloved and legendary as they are, no group survives solely on the strength of their reputation alone. “The Infamous” was a hip-hop classic in 1995, and “Hell on Earth” was a very strong follow-up a year later, but afterwards the group seemed to be struggling for direction and lost amidst a new era of pop rap that didn’t include their grimy sound. 1999’s “Murda Muzik” was underwhelming, although they briefly recaptured some momentum with Prodigy’s solo record “H.N.I.C.” in 2000. Unfortunately they sorely dissapointed their fans with the mediocre “Infamy” in 2001. Havoc was as always still out there producing tracks for other MC’s while Prodigy was heard doing occasional cameos, but nothing significant from both had been heard for over two years until this “Murda Mixtape” hit in 2003. The fans have to be wondering if the Mobb is still Infamous, or if Havoc and Prodigy are just plain famous now without the “shock and awe” their new records once had on unsuspecting listeners. Mobb Deep are using this “Mixtape” as the opportunity to re-establish themselves, both with the long hungry fanbase and a new generation of rap fans that don’t know their steelo. They also take the time along the way to pay tribute to those who inspired them, Eric B. & Rakim, with “Paid in Full.” Many have heard the countless cover versions of this song by now that use the same beat, but for this one Havoc crafted a whole new gem that gives both him and P freedom to reference the old without being hidebound to reference every single line of the original. It’s a refreshing approach, and Prodigy’s lyrics prove that it pays off: “Have patience, we can’t though, we need paper Like thirty-five million’ll straighten us up It’s nuttin for us to make these songs that bump Shit that out, then tour for like six months but.. This can’t be life, this can’t be all there is for us We need more cream to splurge Thinkin back, how we used to pick herbs Me and Hav’ in Manhattan, stickin up cowards for they wallets and Starter hats For anything worth somethin, we beat ’em out of that But fuck all that, we grown men, we need Porsches We need Porsche endorsements and more shit Yeah Dunn, that sound righteous I feel stressed though — so I just hop in my truck for a drive Bring my nine, cause that’s how I stay alive” This album is full of such treats. Havoc and Prodigy light up “What Can I Do?” – a song that many will either recognize from it’s old school sample or it’s use in the hip-hop classic “Deeper” by Bo$$. “It’s Over” is equally classic, a swinging groove that’ll put a smile on your face if Prodigy lines like “See the God, big ol’ chains, but can’t stick him; cause they know I shoot niggaz like Slick Rick and them” don’t. On the Alchemist produced “The Illest” though, Havoc gets just as much shine and shows his wisdom over a slow deep pounding bass and symphonically constructed backdrop: “Made it out the projects, against all odds Went from, ridin these trains to coppin expensive cars And even so, all this shit don’t make me better than y’all It only means that I work harder than the average nigga Never sat around for handouts, I watched and observed Then quickly rubbed my eyes, if my vision got blurred I coulda sold drugs (yea yea) ’til I got bagged and jailed Out of sight, out of mind, niggaz locked feel me like braille (Feel me) While everybody was chillin I was broke like a motherfucker, loyal to my vision Knowin that I’d be on top or somewhere close to it Nigga, my livin quarters’ll be the thing to prove it! And vowed once I got there to never ever lose it Let my, head get big and slack off on my music” Clearly this is the kind of shit that the Mobb’s mob have been waiting for. Songs like “Narcotic” are aptly named – the scratchy sample, ominous backdrop, and brutal lyrics are deeply addictive. Some might take issue with just how vicious the song is, but the always eloquent Ice-T explains it well in the intro “This is Not Supposed to Be Positive” with these words: “This music is negative because the streets ARE negative, y’know? So, in the record, you’re gonna hear violence, you’re gonna hear aggressive behavior […] y’know, that’s like telling somebody like Stephen King ‘Well make a horror movie with a happy ending’ they don’t HAVE happy endings, it’s a horror movie it’s supposed to end horrible!” While Ice’s point is well taken, he also misses out on an important fact – gangsta rap IS positive if it directs negative energy into more healthy forms of expression like music; even more so if it brings joy to the listener through the beats and rhymes. Songs like “Clap First,” the S.C. produced “Double Shots” featuring Big Noyd (the closest thing to a “party song” any Mobb Deep track may ever come) and “Let’s Pop” featuring Dog (of ACD), or Havoc re-interpretations of classic beats like “Came Up” the album is bound to make you smile again and again. By the time you reach “Don’t Call Tasha” at track 16 both hip-hop and Mobb Deep fans will be well satisfied with their new set of material. Oh yeah, it ain’t over motherfucker. Just when you though the Dunns were done, Mobb Deep has a special bonus selection of “classic freestyles” as mixed by the New York street tape impresario DJ WhooKid. You may not have known the names of these tracks before now, but they’ve all been named here: the illy dark “Cradle to the Grave,” a “Tough Love” rap sampling from a banging Mobb beat, the aptly named “Can’t Fuck With Us” and freestyles set to the beats from their classics “Right Back at You” and “Shook Ones.” What could have been more appropriate than to end the album on that note? It brings Mobb full circle, with Havoc’s track and his braggadocious rap attacking lesser MC’s that just aren’t as Infamous: “As I look to the sky and ask God why he put me here I know why, to have you cowards shook, runnin with fear See that glare in my eyes and my focus clear I’m that head coach, benchin you rookies and fake players Only spit, collector’s edition shit So in a few years it’ll be ten times what you spent” Prodigy’s not to be outdone though, with a rap that’s a humerous and unofficial “Dreams of an R&B Chick” part deux: “I’d rather, beat my dick than go the R. Kelly way I’d take Felice for nine and a half weeks Fill it back, pourin Henny on her ass cheeks I fucked Missy in that Lamborghini Give Foxy the ecstasy without the pill, see me I give Alicia Keys quickie while she on tour Nuttin’ but +Gangsta Love+, then I take a flight home” The funny part is, after fifty-five minutes of all this, the shit STILL ain’t over. Don’t forget to reach inside the jacket of this CD, because inside you’ll find “Free Agents: The Bonus Disc.” You’ll find tracks such as “Burn Something” which was on a recent WhooKid retail CD, a “Get Back Remix” with Big Noyd, and SEVENTEEN MORE SONGS. Naturally the focus is on up and coming Mobb affiliated artists like 1st Infantry, Noyd, and the Infamous Mobb; but as a special treat several other songs featuring Mobb Deep members are included for your listening pleasure. Among others, this includes underground smash hits like Cormega’s “Thun & Kicko” (there’s a million ways to spell the Mobb-istics), Kool G. Rap’s “Where You At?” and even an unreleased version of his “Thug Chronicles.” Don’t forget to 1st Infantry’s all-star “Fourth of July” though, produced by Alchemist featuring Evidence and Prodigy. There’s an amazing plethora of material on these two discs, and most stores are offering it at the unbelievable price of $9.99. It’s easily worth twice as much. Rap values like this don’t come along that often, and neither do rapper slash producers like Havoc who excel at both or deep voiced grimy MC’s like Prodigy who tell street narratives but entertain and show wit and intelligence at the same time. The two have been an outstanding duo for over a decade, and by leaving Loud Records and inking a new distribution deal with LandSpeed these “Free Agents” prove that time off only got their game back to fine form. It’s like Jordan’s return, only better. Mobb Deep :: Free Agents - The Murda Mixtape Music8.5 Lyrics8.5 HavocKoch RecordsLandspeedMobb DeepProdigy Previous ArticleB.G. :: Living Legend Next ArticleSolseekers :: Halfway There KRS-One :: Maximum Strength 2008 Inspectah Deck :: The Movement Steve 'Flash' Juon June 17, 2003 Kool G Rap :: The Giancana Story Steve 'Flash' Juon December 3, 2002 Various Artists :: Bleu DaVinci Presents the World Is BMF’s Matt Tomer October 17, 2006 Foxy Brown :: Brooklyn’s Don Diva Steve 'Flash' Juon May 13, 2008 QB Finest :: Queensbridge: The Album Steve 'Flash' Juon January 2, 2001	cc/2020-05/en_middle_0093.json.gz/line720
__label__cc	0.690849	0.309151	SR! Store \| Subscribe Free \| Hot Deal Bikes \| Used Bikes \| News Bytes \| Show \| SAFE ADVERTISING Eating your way around the Hood Canal You might know the old standbys, but have you checked out what’s new? Who doesn’t like a ride around the Hood Canal? For myself and many others, it’s an annual ride. But a rider has to eat – right? If I think back to my first ride around Hood Canal, here’s what I recall. Torrential rainfall, using an air hand dryer on the Bremerton ferry to attempt to dry out my jacket interior on the way and the search for food mid-way through the ride that resulted in, not the best fried baskets of chicken and onion rings. Well, a lot has changed since that ride two decades ago. Today I know my way around a lot better, some places have truly amped up their offerings, but during a recent ride it was clear to me that there are some new kids on the block everyone might want to know about. Sure, there's the old stand-bys like Fat Smitty's and the Geoduck. But if you're ready for something new, here’s a clockwise look at the worthy places along a loop ride of the canal that would start outside of Seabeck, work its way through Tahuya, across to Union and up the West canal along the Olympic Peninsula, ending in Kingston. You need our exclusive GPS route? Drop an email to sreditor@soundrider.com with your request. Sorry to say, the food offerings in Seabeck are restricted to the local grocery store, and a mediocre restaurant behind it that has seasonal hours only. But for many it’s a regular Ice Cream stopover and the water view is beautiful. But we must continue on for a real meal. Camp Union Formerly the Camp House Grill, a BBQ joint and a number of others things, the Camp Union Saloon is a favorite with locals and riders on the go. Burgers, sandwiches and the usual deck out a short menu. If that’s not gonna do it for ya, keep on riding. There used to be a pretty good pizza place here. Now it’s a hair salon. There used to be a good bar-b-que joint, but they moved on. Keep riding… Now we’re getting somewhere. The Alderbrook Resort has some exceptional offerings morning, noon and night every day of the week. It’s a favorite with the high-tech set since it’s used for a number of off-campus retreats. Not only is the food good, but for those with a health-conscious appetite, it solves the problem of locating food with higher standards until now. But there are other options as well. We’ve always liked the Robin Hood Restaurant and Pub, just around the corner from Alderbrook. Hours have varied here over the years, but it looks like this summer they’ll be open for dinner 7 days a week. Looking for Mexican Food? You’ll find it at the 2 Margaritas location situated right on the water on the west end of town. Nothing fancy here, but it’s a nice view off the patio on a sunny day. Grass fed burgers anyone? Heck ya! Since 1963, Kelsey’s, just south of HP, has been serving up burgers and other assorted seemingly fast food. But the fact today they claim to be natural (which has no clear definition in the real food world) and that they do offer 100% organic grass-fed burger is a breath of fresh air in an area that’s short of wholesome food options. Newly remodeled, the redo on the parking area makes it easier than ever to park the bike here. When the Black Bear diner here burned to the ground, nobody cried. But they were stuck with the Geoduck Restaurant as about the only other choice. Some like it, some don't care for it. Fortunately, the Pleasant Harbor Marina has just completed a major upgrade and added The Galley and Pub to its list of offerings. A roof-top patio and a locally inspired menu makes this a perfect stop to soak up some sunshine mid-way through your adventure. The Olympic Timber House has seen its days of ups and downs, but right now it’s riding high being well taken care of by its owners. Hours vary throughout the year so check them out before you go. This is just the kind of steakhouse that sets the standard for such cuisine within a 25-mile radius. Prime Rib on Friday or Saturday nights means you might have to make it a two-day loop. No one leaves here hungry. If the meetup is early morning, which is standard for many dual sport rides that initiate here on weekends, the Loggers Landing is the house of choice. Typical pancakes and eggs type menu will get you started. For some, it's a pilgrimage to ride up to Fat Smitty's for their famous burgers. There, we said it. Chimicum Another great breakfast meetup joint is more than just a joint. Farm’s Reach Café is serving up breakfast and lunch primarily sourcing their ingredients locally and that means you’ll launch your day a healthier way. Naturally nested eggs, fresh greens, 3 egg omelets and sandwiches you can get to go, means you can picnic somewhere scenic at lunch. Both casual and fine dining are waiting for you in Port Ludlow. Take your pick between the upscale Port Ludlow Resort (breakfast, lunch and dinner) or the more casual Cucina Pizza (lunch, dinner), just around the corner from the local gas stop. Either way, you can’t go wrong. Anyone who’s ever walked into the store in Port Gamble has either spied or dined in the restaurant, that used to be in the back. Now it’s moved to the north and sports a nice patio and an amped up selection of offerings. But the newest member of the PG family is Butcher and Baker provisions that took over the old Mike’s BBQ that was in the historic gas station. B&B offers light plates and you can mix and match up a small or large meal depending on where you want to go on the menu. Stop in for breakfast, lunch or an early dinner. If it’s been a while since you rode around the canal, now, more than ever here’s a few reasons to book your passage now. TM/May 16 We've worked hard to upgrade this site. Click here to notify us of any problems we need to correct. ADVERTISING WE CONTROL, NOT A ROBOT Subscription has its privileges - Each month Sound RIDER! publishes new features on rides, clubs, dealers and events. Don't miss out on these informative stories. Sign up today for your FREE subscription and you'll get notification each month when the new issue comes on line. You'll also be the first to find out about special Sound RIDER! events. From time to time, we also provide valuable coupons that can save you hundreds of dollars on motorcycle services. What are you waiting for? Click here to sign up now! USEFUL ADVERTISING INFORMATIVE ADVERTISING TRENDING WITH READERS RFID Blocking - What every rider needs to know Helmet Care and Cleaning - Turn that bio-disaster into something you feel good about putting on your head Tips & Tricks for riders - Making the most of your ride Takeaways from the demise of Noble Rush - Feeling left out in the cold, many riders aren't sure where to turn. The Sound RIDER! show - Hear the latest episode LOCAL BUSINESSES ADVERTISE HERE EZ GAUGE DLX - The inline air gauge, modified for a solid seal - EVERYTIME! Pacific Northwest Motorcycle Safety - Beginner to advanced rider courses available Your First Ride - A first-time rider primer, free to everyone ADVERTISING WORTH VEIWING Pacific Northwest Touring Books - Leave the main roads behind Have you met my sister? - check out www.seattledining.com The Rally in the Gorge - 5 days, 4 nights and TOO MUCH FUN! ADVERTISING IS WHAT MAKES SR! FREE TO YOU USEFUL DIRECTORIES Pacific Northwest Dealers - Find dealers for all current brands sold Pacific Northwest Service Providers - Independent service, custom seats and more SR! Editorial Archive - Select from hundreds of article. Sortable by topic. Pacific Northwest Clubs - Whatever your passion is, connect with others here Pacific Northwest Calendar of Moto Events - Get in touch with what's going on, then go for a ride there. Report a problem with the site Copyright ©1999-2019 Mixed MEDIA Privacy Statement	cc/2020-05/en_middle_0093.json.gz/line722
__label__wiki	0.6147	0.6147	Events for Travellers + Guides & Stories Travel Stories » South Korea Dirty Foreigners Brought Swine Flu to South Korea Posted November 12, 2009 by David Wills. Xenophobic hysteria just got a whole lot worse on the Korean peninsula. South Korea has an unfortunate history of mass hysteria and severe paranoia, a result of gross national contempt for the world beyond its borders. Perhaps this is understandable for a nation so frequently abused by others and troubled by the outside world. In spite of their attempts at ‘globalization’ and the ‘openness’ that has helped lift South Korea from the third world to the first, many Koreans still maintain a fear and loathing of anything non-Korean. It says foreigners are unqualified and dangerous to let into your home Image from Wandering Seoul In recent years we’ve seen mass protests and violence any time a foreign country is perceived to have interfered in Korea’s business. Anti-American and anti-Japanese sentiments run high and even the most trivial of sparks can cause a humiliating explosion of popular racism. National pride and outright xenophobia run together to create a frighteningly – and dangerously – paranoid country. So when Swine Flu broken out in Mexico back at the start of 2009, Korea reacted in unsurprising fashion – first by labeling it Mexican Flu, and then by denying it could be contracted by Korean people. This is an old pattern here. Koreans like to believe their perceived racial superiority insulates them from the diseases and problems of the outside world. They believe their mighty national dish – kimchi – protects them from SARS, AIDS, and even homosexuality… So naturally Swine Flu was perceived as something merely in the domain of the nasty outside world, and not to be worried about. However, a certain level of logic and reason prevailed quickly enough and soon people became aware that Swine Flu could be passed onto Koreans. But they didn’t worry too much. The government recommended people eat more kimchi and not travel to dirty foreign countries, or associate with expats. Suddenly Koreans were aware of Swine Flu and they knew it was in their country. But they weren’t too scared… Somehow everyone had the same idea – the only people in Korea who had the virus were foreigners. It’s important to remember that this is a nation that has yet to implement any law prohibiting racism or any form of discrimination against non-Korean nationals. It is a nation frequently chastised by the United Nations and Amnesty International for its vicious treatment of anyone who doesn’t look Korean. Dirty Foreigners Infecting Koreans With Swine Flu So when it was decided that only foreigners had Swine Flu and that they were the ones who could pass it onto Koreans, certain measures had to be taken. Soon non-Koreans were quarantined and subjected to “laws” that didn’t exist, and no one outside of Korea was meant to know. In fact, very few people inside Korea were meant to know. The whole thing was a big secret, perpetrated mostly by business owners. But the trouble with oppression, racism and intimidation in this generation of Twitter, Blogger and Facebook is that keeping secrets is tough. I heard rumours online about foreigners being locked up and subjected to travel bans against their will. Later these rumours were confirmed by half the people I knew working around Korea. Their schools were implementing ‘secret’ policies to appease the parents, whom had become obsessed with the notion that foreigners would infect their children. Schools began installing heat sensors and demanding their foreigners be checked daily for the Swine Flu. They were made to scrub their classrooms, wear masks in class and told that by no means could they associate with other non-Korean people. It should be noted that no Korean teachers at these schools were ever required to jump through the same hoops as the foreigners, just as they aren’t required to submit HIV tests or criminal history checks. Only a handful of foreign teachers contracted Swine Flu, and in doing so they broke their contracts and earned themselves unemployment and, consequently, deportation. How paranoid can you get? From Wandering Seoul Taking a look around any hagwon-heavy area of a Korean city would have at one stage given a Korean-speaking non-Korean person a good laugh… Almost every school had a big sign outside, proclaiming: OUR FOREIGNERS ARE FLU–FREE! Of course, that didn’t stop subway trains full of people emptying when a foreigner set foot inside, or people from shouting Swine Flu! Swine Flu! on the street, whilst pointing at the only foreigner in sight. And it didn’t stop Samsung from making an advert that depicts all white people as pigs, running around a city as the mighty Koreans strut about without a care in the world… But then reality dawned and Korea woke up to the fact that Koreans, just like the rest of us, are human beings, and as such are susceptible to viruses. And, in turn, that awareness didn’t stop the country from going into a panic meltdown. As soon as it became evident that Koreans were in danger of dying from this no-longer-foreign virus, South Korea all but shutdown. The government instructed people to avoid gathering in groups, and banned all festivals and celebrations involving more than one thousand people. Schools have been shut down periodically, due to low attendance and caution by the government. Parents are too afraid to send the children outside, and the education industry is suffering badly. Consequently, many schools hide Swine Flu cases, gagging parents of inflicted children to keep attendance steady, and causing the virus to spread faster. But it’s not all bad. Sales of soap and hand sanitizer went through the roof in a country where washing your hands is really something that just doesn’t happen. Foreigners have rejoiced in the availability of soap in bathrooms around the country, whereas previous they had to simply rinse or go Korean. Many foreign bloggers even thank Swine Flu for making Korea a cleaner place to live. Public campaigns have gained momentum in attacking other disease-spreading habits that have disgusted visitors to Korea for a long time – including spitting indoors and coughing directly into the face of another person. In the past week the number Swine Flu cases in Korea has almost doubled and the government is talking about shutting down all schools for a short period. Foreign teachers are beginning to wonder whether they will keep their jobs or be cast out of the country en masse. The education industry is worth billions, but many schools simply can’t afford to close their doors. Another concern is whether matters will improve for immigrants in Korea when the Swine Flu pandemic eventually blows away… Foreigners in Korea, like so many other parts of the world, are perfect scapegoats. Will they be forgiven for the treasonous offense of bringing Swine Flu to Korea? David Wills David Wills is the editor of Beatdom magazine, literary journal devoted to the Beat Generation. Religion and Soul » India Naked Naga Babas Naked, penniless and stoned, the Nagas are as happy as mud. handtomouthtoindia » Hungary From Vienna to Budapest – Hand to Mouth to India Chapter 3 Drunken antics win Tom a romantic week in Budapest as he continues to hitchhike to India. New! The Road Junky Travel Stories Podcast Road Junky Travel Stories is a new podcast that will feature crazy stories from travellers who walk the edge..and those… Travel Guides Argentina Travel Guide Australia Travel Guide Bangkok Travel Guide Bolivia Travel Guide Brazil Travel Guide UK Travel Guide California Travel Guide Cambodia Travel Guide Colombia Travel Guide Dublin Travel Guide Ecuador Travel Guide Georgia Travel Guide Germany Travel Guide Guantanamo Bay Holiday Camp Guide, Cuba Guatemala Travel Guide Kazakhstan Travel Guide Himalayas Travel Guide Holland Travel Guide Hong Kong Travel Guide Hungary Travel Guide India Travel Guide Iran Travel Guide Israel Travel Guide Italy Travel Guide Japan Travel Guide Jordan Travel Guide Mexico Travel Guide Morocco Travel Guide New Zealand Travel Guide Nicaragua Travel Guide Pakistan Travel Guide Peru Travel Guide Philippines Travel Guide - 7017 Islands Photo Guide to Curacao - Part One Poland Travel Guide Rio De Janeiro Travel Guide Online Beijing Guide Online Romania Travel Guide Russia Travel Guide South Korea Travel Guide Tel Aviv Travel Guide Thailand Travel Guide Tibet Travel Guide United States Travel Guide Uzbekistan Travel Guide Venezuela Travel Guide Travel Stories Africa (37) Angola (1) Cape Verde (1) Congo (1) Kenya (3) Malawi (2) Mozambique (1) Namibia (1) Nigeria (3) Sierra Leone (1) Somalia (2) South Africa (5) Tanzania (3) Zambia (1) Asia (375) Afghanistan (3) Bangladesh (1) Bhutan (1) Burma (2) Cambodia (23) China (33) Beijing (8) East Timor (1) Georgia (12) Himalayas (12) Hong Kong (12) India (77) Goa (21) Indonesia (4) Japan (28) Kazakhstan (10) Kyrgyzstan (1) Laos (3) Malaysia (1) Mongolia (2) Nepal (3) North Korea (2) Pakistan (13) Philippines (23) Singapore (1) South Korea (18) Sri Lanka (1) Taiwan (1) Tajikistan (1) Thailand (36) Bangkok (6) Tibet (15) Turkmenistan (1) Uzbekistan (13) Vietnam (6) Caribbean (26) Cuba (14) Guantanamo (10) Grenada (1) Jamaica (1) St. Kitts and Nevis (1) St. Lucia (2) Europe (216) Albania (4) Austria (1) Britain (31) England (12) Bulgaria (1) Croatia (3) Cyprus (1) Czech (1) Denmark (1) Estonia (1) France (3) Germany (18) Greece (1) Hungary (16) Iceland (1) Ireland (12) Dublin (11) Italy (37) Latvia (1) Lithuania (1) Luxembourg (1) Netherlands (9) Norway (1) Poland (14) Romania (17) Russia (14) Serbia (1) Slovakia (1) Slovenia (1) Spain (14) Sweden (1) Ukraine (4) Latin America (279) Argentina (19) Belize (1) Bolivia (18) Brazil (59) Rio (21) Chile (1) Colombia (23) Costa Rica (3) Curacao (1) Ecuador (20) El Salvador (4) French Guiana (1) Guatemala (24) Honduras (1) Mexico (39) Nicaragua (20) Panama (1) Peru (28) Venezuela (14) Middle East (140) Algeria (1) Egypt (9) Gaza (2) Iran (22) Iraq (3) Israel (54) Tel Aviv (14) Jordan (13) Libya (1) Morocco (23) Syria (1) Tunisia (2) Turkey (5) United Arab Emirates (2) West Bank (1) Yemen (1) North America (59) Canada (4) United States (55) California (12) Oceania (46) Antarctica (1) Australia (23) Fiji (1) New Zealand (18) Solomon Islands (1) Get Road Junky Updates! Dating Abroad About RJ All rights reserved. Copyright Roadjunky.com © 2004 - 2020 Road Junky Guides. Hitchiking to India Hand to Mouth to India by Tom Thumb At the age of 20 Tom hitchhiked from England to India with no money. Sign up to get the book!	cc/2020-05/en_middle_0093.json.gz/line726
__label__cc	0.685381	0.314619	Any misspelled words or grammatical errors on this site are provided only for effect. Views expressed here are strictly those of the author, as opposed to being from his pet iguana. We reserve the right to add new letters to the alphabet or alter the time-space continuum as we see fit. Your presence at this site is a complicit agreement to these conditions. Dentistry Smalltalk 1 comments (add more here) Why is the dentist more interested in what the assistant did over the weekend than my teeth? He can talk to her anytime. You’d think that small window of twenty minutes he spends with me would be quality time where we could reminisce and be old chums. Hey, I had a pretty dang good weekend myself. Let's see... among other things, I pulled some weeds in the back yard, moved boxes up to the attic, scaled the face of the Grand Tetons, rearranged my sock drawer, and oh, watched Desperate Housewives. So there… But if you think about it, that’s just the point — he does talk to the assistant all day. He’s already heard every scintilla of her weekend several times over. He’s not really as surprised as he puts on. It’s all therefore a beautifully orchestrated act. Dentistry school teaches them how to choreograph the whole thing. It's the week 18 course: Drama & Mandibular Arches. What I’m wondering is how much they have to rehearse their banter ahead of time. Once the week starts, you figure they have about 20-25 patients per day, or close to 100 in a week, so I’d imagine they must get really geared up for the show. By Wednesday, they’ve got the routine down pat and they’re ready to take it on the road. What they were actually doing over the weekend (and not what the assistant claimed) was to go over the script. Off in a dimly lit room, between sips of his cappuccino delight the dentist can be heard saying, “This will be fabulous... here I’ll ask you about the cabin you go to near the lake, and then you come up with some zany occurrence that will leave me incredulous, where I’ll keep saying ‘Oh really?’” The assistant intones, “What if I say I fell out of the canoe and got water in my eardrum or something like that?” “Oh, yeah. Good stuff.” “And then I had to be resuscitated by Boy Scouts for their merit badges, and then I got caught in an avalanche and survived under the snow for three days by gnawing on my shoelaces…” “Oh, I like it. After that, do you think I should say ‘No way!’, or ‘Get outta here!’, or ‘Shut Up!’?” “Hmm. Dentists don’t say ‘shut up’. It could compromise your credibility.” “Good point.” “But ‘get outta here’ is very theatrical.” “And that’s what we want. It will keep them coming back for more.” This is what’s more important than asking little ole’ me how I’m doing, apparently. Hey, I’m the one in pain here, guys. Down here, where all the tubes and implements are dangling. The one that looks like roadkill in a chair. Yeah, remember me? Where’s my sympathy? Oh, sure, they’ll ask you at the beginning how you’re doing out of obligation, but it’s more of a pleasantry. If you try to say anything more than, “Oh, I’m doing fine,” they’ll start gagging you with this strange fermented stuff, and they’ll even resort to putting the gas mask on you if they have to. “Patient… must… not… talk. Too… dangerous…” And then every ten minutes, they’re required by the American Dental Association to say on cue, “You doin’ all right?”, but it’s nothing other than a smokescreen. You’re allowed only a one-word response anyway, for which you can give no further explanation. They don’t want to know how you are, but they want you to know that they know that they asked. Trust me, it all makes perfect sense when you’re buzzed. If they told you Elvis was getting a root canal done in the next room, you'd believe them. Never mind that he has dentures now... Now, I realize that I can’t speak all that well with instruments in my mouth. But couldn’t we just improvise a little… you know, be a little creative and not demand perfect diction all the time? My ‘s’ might sound like an ‘f’, and the ‘t’ like a ‘b’, plus the ‘th’ is totally out the door, but they could figure it out from the context. “Cub I aff fo a pemup bubba an bewee fanwipf?” “Huh? Did he say something? Give him more gas… he’s starting to hallucinate.” At the very least, we could use signals. Put flags in our hands if you need to. Give me a little Morse Code tapper. I'll do it with mime hand puppets if you want. Whatever it takes — I could adapt. Or even better yet, just ask simple questions and use a system like they do on Lassie… “Is there a barn on fire?” (two grunts = No) “Did somebody fall in a ravine?” (one grunt = Yes) “Were they wearing a green alpaca?” (four grunts = Yes, but they were also eating fondu) “Will there be a test on this later?” (three grunts = I believe so, and the study manual will cost you forty bucks plus tax, which is non-refundable in the contiguous United States except for Alabama) “Are you in a lot of pain right now?” (one elongated “agggghhhhh…” = Duh!) “Can I get you anything?” (two and a half grunts = Oh yes, I’d like the house salad, if you don’t mind. And would it be all right if you just made it into a smoothie and sprayed it into my mouth? My lips ain't movin' much, you know...) People feel powerless at the dentist, and I think it all revolves around not being able to communicate. That’s why babies cry, because they’re ticked off they can’t communicate anything. You ask a baby a question, and they’ve got nothin’ for you. “What do you want, Pops? I have no teeth to speak of, my tongue is highly untrained, I’m waaay behind on my speech lessons, not to mention I’m trying to spend most of my time just figuring out how my arms work, and this language of yours is what I’d call a tad bit complicated there. Get back to me in a couple years, okay?” So anyway, this is a roundabout way of saying that the gig is up on the whole Lassie deal. Contrary to popular belief, Lassie was not all that familiar with the human lexicon, and always got confused on the past perfect tense of transitive verbs. Plus there just wasn’t that much inflection in her barks. Shows all the more just what a great actor she was. To demonstrate the pretense involved, if we use our Lass-o-lator, we’ll see what was really happening in all those episodes… “Ruff! Ruff! … Ruff!” (translation: hey, my legs are chafing) “What? Somebody’s hurt?” “Ruff! Ruff!” (translation: uh, yeah Einstein… it’s me…) “They are? Where are they? Did they fall into a ravine?” “Ruff! Ruff! Ruff! Grrrr…” (translation: No! I’m right here! And what is it with you guys and ravines? Stick with me here…) “They did? Were they accosted by a band of gypsies?” “Ruff! Ruff! Rrrrrruffff!” (translation: You’ve been reading too many mystery novels, haven’t you? Yes… they were accosted by a band of gypsies, and coincidentally the leader was Lindsay Lohan, holding a hair dryer to someone’s head and asking for ransom in small unmarked credit cards. Is that what you wanted to know?) “Holy cow! Wow, we’ve got to go save them right now! Good work, Lassie!” (translation: Don’t mention it… Can I have a dog biscuit now?) (Disclaimer: This post was ratified by the Gender Equity Group for gross generalizations used for the sole intent of simplicity despite the fact that not all dentists are male nor are all assistants female — though it tends to make the banter a lot more entertaining when they are.) Hidden Patterns and Statistical Frenzy I don’t remember how I came across this book — it must’ve been at some used book store several years ago, and I think I read it around 2004. Published in 1992, Predictions by Theodore Modis is what I’d call an intriguing exploration into statistical models about society, and how as a group we follow predictable patterns. While I didn’t understand a lot of the technical talk, I still gleaned enough from it to get me thinking. The reading is sometimes dry — much like this blog post — but Modis makes up for it with content and hopefully bails me out too. There’s something in here to interest everyone, and I’ll offer some of the highlights. According to Modis and his sources… • Human beings around the world are happiest when they are on the move for an average of about seventy minutes per day. During these seventy minutes of travel time, people like to spend no more and no less than 15 percent of their income on the means of travel. From African Zulus to sophisticated New Yorkers, they are all trying to get as far as possible within the 70 minutes and the 15 percent budget allocation. Affluence and success result in a bigger radius of action. Jets did not shorten travel time, they simply increased the distance traveled. • Industrialization featured mostly muscle-surrogate inventions, but that did not significantly decrease the number of working hours. Allowing eight hours for sleep and a fair amount for personal matters, the time available for work cannot be far from eight to ten hours per day. At the same time, human nature is such that a much shorter work period is poorly tolerated. • Most mammals living free in nature have accumulated about one billion heartbeats on the average when they die. For hundreds of thousands of years, humans had a life expectancy between 25 and 30 years. With the normal rate of 72 heartbeats per minute, they conformed nicely to the one billion invariant. Only during the last few hundred years has human life expectancy significantly surpassed this number, largely due to reduced rates in infant mortality from improved medical care and living conditions. But what also increased at the same time was the availability and acceptability of safe and legal abortions, resulting in a rise of prenatal mortality, thus canceling a fair amount of the life expectancy gains. The end result is that life expectancy at conception is still not much above 40. If there is any truth in this, we are back—or close enough—to the one-billion-heartbeat invariant, but with an important difference. Low infant mortality rates result in the birth of many individuals who may be ill-suited to survive a natural selection process favoring the fittest. At the same time, abortions are blind. They eliminate lives with no respect to their chance of survival. A selection at random is no selection at all, and the overall effect for the species is a degrading one. Modis uses an S-curve analysis throughout the book with most of his data, showing patterns of early slow growth, then accelerated growth in the middle, followed by slow growth at the end, conforming to a common equation and curve shape. Modis explains the S-curve’s many applications in biology, physics and sociology. With the S-curve analysis, Modis postulates that based on the number and frequency of the known 45 explorations of the Western Hemisphere following and including Columbus’ voyage (which follow nicely the last three-quarters of an S-curve), there may have been 15 such explorations unaccounted for prior to Columbus, with the first dating back to around 1340. Modis shows how society made shifts in its energy sources from wood to coal well before running out of wood, and the decline in the use of coal in favor of oil was not driven by scarcity. He predicts that we will stop using oil in favor of some other alternate primary source before we run out of it. The S-curve pattern is shown to exist with the growth of a bacteria colony, the human birth rate by mother’s age, the demand for plywood, and Ernest Hemingway’s writing career. Using the S-curve, Modis can back up provocative statements like this: …better agreement between the curve and the data if eighteen compositions are assumed to be missing during Mozart’s earliest years. His first recorded composition was created in 1762, when he was six. However, the curve extrapolates to reach its nominal beginning of 1 percent of the maximum at about 1756, Mozart’s birth date. Conclusion: Mozart was composing from the moment he was born, but his first eighteen compositions were never recorded due to the fact that he could neither write nor speak well enough to dictate them to his Similarly, for Einstein: The nominal beginning of the curve points to 1894 when Einstein was 15. This would mean that he had no impulse to investigate physics when he was a child. According to the curve, this impulse started when he was a teenager. Still, he produced no publications until the age of 21, probably because nobody would take the thoughts of a mediocre teenage student seriously, let alone publish them. It’s fun to extrapolate and attempt to fill in the gaps of what we don’t know. I like to think of life as a bunch of clues waiting to be uncovered. There’s so much we don’t know, but I’m of the opinion that a great deal is at our fingertips and can be revealed if we look in the right ways. Modis then goes into an analysis of regular societal fluctuating periods of about 50-60 years ever since about 1800 (when data became more readily available). In these periods, various trends go through an upward and downward curve before returning to the s ame point, over the same period of time, and many occur independently of one another, existing in their own phases. He talks about energy consumption, innovations and life expectancy, among other things. Modis shows the periods where major modes of transportation reached the midpoints of their paths, each separated by 55-56 years: canals from 1836 to 1891, railways from 1891 to 1946, roads from 1946 projected to 2002 (?), followed by airways, which should then be replaced by some other means (Modis predicts the Maglev train) at its midpoint around 2058. The author also says: • A period of 56 years is close to the length of time an individual actively influences the environment. • The smallest integral year time unit that allows accurate prediction of eclipses at the same place is a total of 56 years. the 56-year period concerns not only eclipses and the alignment of the earth, moon and sun on a straight line. Any configuration of these three bodies will be repeated identically every 56 years. • There are 56 holes, the so-called Aubrey holes, equally spaced in a circle around Stonehenge. By using the Aubrey holes to count the years, the Stonehenge priests could have kept accurate track of the moon, and so have predicted danger periods for the most spectacular eclipses of the moon and the sun. • Humans spend the first 28 years of their lives acquiring or “charging,” first an affective, then a physical, then an intellectual, and finally a spiritual capability, each building successively on a seven-year spiral. The second 28 years see the human in a state of “tension” as parent, contributor to society, thinker. The final 28 years the person becomes “discharged” affectively and spiritually, reaching the full age of three times 28. • The period 1996 to 2024 should be a period of growth leading to prosperity not unlike what happened between 1940 and 1968. I’m not taking all of these hypotheses necessarily at face value, but it’s still interesting to look at a lot of this phenomena from another perspective and note the patterns. I like books like this. If you know of any others you can recommend, tell me about them. This one can be bought used on Amazon for about $5.00: Predictions, by Theodore Modis. Do you ever wonder what kind of patterns you might be following? Would it cause you to alter them if you were aware of it? I think it possibly would. After all, it becomes rather difficult to throw out all subjectivity when making judgments while being aware of such things. It's a little hard to pretend to not know what you do. It would be fascinating to me to have access to statistical information about my life and those around me, and see patterns about how we all behave and think. Then would could more easily accentuate the positive and eliminate the negative. I’d like to know how many times in my life I’ve said words like exquisite, scintillating, juxtaposed, lackadaisical, gumption and hackneyed. And then compare it to the general public. I’d like to know what the ten most frequent meals I’ve eaten are, and the quantities of each. I’d like to know how many people I’ve known on a first-name basis in my life. I’d like to track exactly how much sleep I’ve gotten each night, and see what the patterns are there. I’d like to know how many words I’ve typed. I’d like to see how centered I’ve kept cars I’ve driven in their lanes, what my average speed has been with relation to the speed limit (probably 4-5 mph over on highway, and 2-3 mph over in city — your mileage may vary). I wonder how many sunflower seeds I’ve eaten. Possibly over a million. By age 14. I wonder how many ants I’ve stepped on, both intentionally and unintentionally. I wonder how many times I was called out in baseball/softball when I was really safe. I wonder what my least accurate memories are. I wonder how many things I’ve learned from various people throughout my life. That last one never ceases to amaze me. You think you’ve got a lot of it down, but you just keep on learning more and more, when you least expect it. Life is a neverending tapestry of discovery. If my whole life had been tracked by Twitter, I could know how many times I’ve said each word. It would also be interesting to see how my language patterns changed with age. We can estimate a lot of these things. Maybe Charlie from the TV show NUMB3RS could narrow it down pretty good. I just think it would be so mind-boggling to have a book of your life to peruse through. I hope somebody's working on that. Then it would also be fun to quantify things that aren’t normally quantifiable, like emotions. Maybe that’s a little over our heads right now. As humans, we can barely handle the information that we do have. It’ll be a while before we’re ready for radically new types of data. Anyway, thanks to Theodore for giving us another little peek into some of these things that make you pause and go hmmm… Which Way to Progress? Later this year, my entire existence will be going to high definition. It’s a very exciting milestone, with far-reaching ramifications. When I go outside, the scenery will be crisper, rainbows will be more vibrant, and my vision won’t be in letterbox anymore — that’s going to be a big relief. I’ve heard the sky is going to be 18000 x 13600 resolution, which is a major upgrade for the makers of our atmosphere. I’ve got to tell you that I can hardly wait. To enjoy this new technology, all I have to do is attach a converter chip to my spleen, which may at first seem like somewhat of an inconvenience, but the tradeoffs are undeniable. I’ll even have an RSS feed for whenever Barack Obama clears his throat. It’s going to be marvelous. Technology, after all, is about making what you used to enjoy no longer good enough. There isn’t going to be a point where technologists say “We’ve done enough, and now you can just enjoy whatever you have.” That would put them out of business. They must be continually upping the ante. They tell us we should be demanding more, more, more! Happiness is all about never being satisfied with anything, right? According to modern theory, pre-modern life was supposedly destitute of entertainment and therefore its inhabitants couldn’t enjoy things as much as we do now. How on earth did they survive the boredom of real life? It is true that technology has improved our lives in matters of convenience, yet it has not improved the human condition overall. Our behavior hasn't noticeably changed for the better over the past several decades concomitant with these newer innovations. I’d like to see something which causes us to all get along better, like an upgraded character. Can that be coded? What technology does is programs our lives to be busier — involved in more mundane activities with more mundane objects. So we get more done, but often because we’ve given ourselves more things to do. However, in a strange twist, we’re breeding new generations of lazier attitudes. How could this be if we’re so involved all the time now? Maybe it’s the content of what we’re doing and not the volume of how much we’re doing. Modern man might be spoiled into thinking that life should have everything at our disposal, and so we’re less equipped to handle it when things don’t follow this idealistic template. We seem to be surprised that our advanced civilization still has wars, as if humanity with all its weaknesses could be cured through invention. We can’t very well try to let modern advances make us be better people in lieu of our making a truly committed effort from within. Some things have no substitutes. We still have to sleep, and we still need to constantly nurture our character. Television is an example of a wonderful technology that has also compromised our attention span and our interactivity with other people. Likewise, it infiltrates the home with nonstop promotional advertising. Advertising itself lends the illusion that we should be in constant pursuit of great deals in an attempt to gain that elusive monetary advantage. When does the hype die down to let us enjoy life for the sake of enjoying it? Are we promoting ourselves into oblivion? Telephones have made it easier to contact people, but also made it easier to be contacted, thus invading our privacy, even if willingly. While we can choose to go without services like a phone, we generally cannot rightly do so and function properly within our general community setting. So we’re stuck in this curious dilemma after creating a need. And we’re so giddy with our new toys that we haven’t taken time to see where they might fit in properly. It’s nice that people can carry a phone on their hip, but do we need the intrusiveness of beeping at concerts and church gatherings, for example? Does technology get a pass at being interruptive because it's too busy forging a path into the future? Advanced modes of travel have made it easier to go long distances in a short time. Still, is there really an innate necessity for us to take so many trips to far-off places? Did people of the 1700s have such a need? Perhaps with the new technologies, we have created accompanying needs, which would suggest that technology is also more demanding on us. Families are moving farther apart, which creates a niche for greater travel, so then it becomes cyclical. If we just stayed closer together, we could accomplish the same thing and eliminate the middle man. We can go farther, but we only need to because we’re spreading out. Once again, technology comes to the rescue to solve a problem it created in the first place. Technology is a mechanism for achieving something that might not have been essential or even beneficial, but since it was not previously possible, it is assumed to be a progression. Innovation is the buzzword. If it’s new, it must be better than what was old, so the mindset goes. A lot of times, we should ask “What was wrong with the old way?” The answer seems to be that it lost steam with the consuming public, and therefore needed to be replaced with glitzier packaging. We’ve improved on the mechanical tools of our progenitors, so are we to also assume that we’re better at being decent people? On both a physical and physiological level, technology has a plethora of undeniable benefits. We’re able to live longer and healthier lives — or at least the potential is there. But on a socio-emotional level, the techno-boom appears to take away just as much as it gives. It’s not some special elixir that magically creates more social wellness. Technology in many respects causes us to depend less and less on ourselves (or each other), and it shifts the focus toward form, sacrificing substance. In providing the illusion that it makes life better, it draws our attention away from those things that really do. So you weigh the negatives, like the ability to make elaborate bombs and recreational drugs, versus the positives, such as ways to combat disease and increase communication and overcome oppression. It’s hard to tell what the overall effect is when taking almost simultaneous forward and backward steps. If you believe in evil forces, technology didn’t exactly make them go away but merely made them more efficient along with positive forces. Technology isn’t all bad, nor is it all good. The difficulty comes when we look to it as the solution for our deepest concerns, as I feel we’ll be disappointed. We should be learning that a blanket industrialized approach to answering our innermost questions merely gives us assembly line answers. In the end, all the "white noise" created by technology can make it harder for us to think clearly. In spite of these technological advances, notice that we're still desperately hanging onto our pastoral origins. A healthy green lawn, along with the plush trees, bushes, flowers, and other foliage, are more than fashionable adornments — they are requirements to maintain a hold of our sanity. Why do we have so many plants inside buildings? We don't cling to bits of the past for sentimental reasons so much as we do to keep some semblance of the natural in order to survive in the midst of the utterly complex. Maybe we’re struggling amid the advances of modernism to hang onto the things that really matter to us most, even though we don’t want to consciously consider them as often, thinking of them as relics that we need to move past. Technology might be generically represented by so-called city life, while times prior to our current technology could be signified by country life. Which people would seem to be happier? Are the city folk better off because they have more gadgets, more appointments, and more to keep track of? What do these gadgets do for them that country folk didn't already have? Do things faster, farther, with less effort? And why would lower effort be a worthy goal? Does that teach us to try less hard? As such, are we turning into nothing more than very efficient machines? It causes me to wonder if we’re always expecting more of them, and never satisfied with the status quo. A narrative from the movie The Gods Must Be Crazy echoes some of these sentiments (the photo of the bushman in the upper right-hand corner of this blog is from that movie): These bushmen have never seen a stone or a rock in their lives. The hardest things they know are wood and bone. They live in a gentle world, where nothing is as hard as rock, steel or concrete. Only miles to the south, there's a vast city. And here you find civilized man. Civilized man refused to adapt himself to his environment. Instead he adapted his environment to suit him. So he built cities, roads, vehicles, machinery. And he put up power lines to run his labor-saving devices. But he didn't know when to stop. The more he improved his surroundings to make life easier, the more complicated he made it. Now his children are sentenced to years of school, to learn how to survive in this complex and hazardous habitat. And civilized man, who refused to adapt to his surroundings, now finds he has to adapt and re-adapt. Every hour of the day to his self-created environment. When I retire, I'd like to "get away from the things of man," as they say in Joe Versus the Volcano. And I don't mean a trip to an exotic location, but a permanent vacation where there are no tourists, no bright lights, no embellishments. Somewhere in Montana would suit just fine. And all of you don’t follow me there, either. Oh, did I say Montana? I meant to say Florida, or Arizona. What was I thinking? Don’t follow me to Florida or Arizona... And one final postscript: Take note that the technological age has added a grand total of zero colors to the sunset. Regular definition will be good enough for me. Getting Up to Speed The hardest paragraph for me to ever write is the first paragraph. It could be that I'm not good at introductions. People, I'd like you to meet blog. Blog, people. There... you're acquainted. And you've got so much to talk about... My wife said she thinks it’s time for us to get our first dog after 18 years of dogless bliss. She’s got her eye on a German shorthair that’s seven. She said in dog years, I’ll have somebody my age to keep me company. You know, what I’m thinking is it would be a lot lower maintenance just to get something that looks like a dog, such as this figurine. I’ve got a good imagination. Listen, you can even hear it barking if you try hard enough… My hair has grown out to 3½ inches long after I had cut it short last July. I keep the bangs a little shorter, and I also keep it trimmed around the ears. When it gets to 4, I'll take another picture. Little League practice has started. I’m the manager for a team of 9 and 10 year-olds. The season runs through April and May. Two games and one practice every week. I did this last year too, and I don’t know if I schooled them or they schooled me. We are the Cardinals this year. I wanted a red team that personified flight. I’m about halfway through reading Awaken the Giant Within by Anthony Robbins. I’m learning some useful things, although a lot of it doesn’t seem to sink in on the first read, as it’s describing step-by-step techniques for accomplishing specific objectives. And I’m also learning that the giant within me would prefer to sleep in, but that’s another matter entirely. I like where he says things like, “The more often you make decisions, the more you’ll realize that you truly are in control of your life,” or “The only true security in life comes from knowing that every single day you are improving yourself in some way.” I can’t help but pick up his good vibes. I’ve been on Facebook for a couple months, and I still don’t get it. Most of what I see are messages from people I don’t know but are friends of my friends or friends of my relatives. I feel like I’m in a closet exchanging business cards with 20 people all at once. I’m absorbed in it, but then not. Regarding Facebook, it also makes Rusty cringe to try to write about himself in the third person the way they enforce it in announcements. I feel like Elmo talking. Rusty not comfortable writing in third person. Rusty like writing as if he really doing the talking. Speaking of which, we’ve got ants in a few different rooms. We need to start charging them rent. I figure if I charged each of them 10¢ a month each, it would cover our mortgage. Maybe a dime is more than fifty times an ant’s weight, but I think they could each get about ten of their ant buddies to do some heavy lifting with them and fork over the dough. After all, it is room as well as board. It’s not like they’ve got any grocery expenses to cover. These ants are relentless. It’s the first time I’ve ever had ants crawling across my computer screen. It could be that they’re just interested in my writing, in which case it’s going to be a painful thing to exterminate the better portion of my readership. I feel like I know some of them by name now. Larry passes by my keyboard occasionally. (you’re lucky we’re on a first-name basis, Larry…) Meanwhile, Thaddeus meanders along the wall in his typical gait. Yo, Thaddeus! How’s life treatin’ ya? He just goes about his business as if nothing bothers him. Thaddeus is too cool to stop and talk. These ants are actually making me a little nervous. I wish they’d quit running everywhere and just take it easy for once. They’re so absorbed in what they’re doing. The only time they stop is to grease their hips and smooth out their antennae to get better reception, and then they’re back on the trail again. How can anyone relax in this environment? But I guess they are pacing themselves, because they reserve the highest gear for when they get caught and it’s time to scatter. It makes me curious what ant expletives they’re uttering as they’re scurrying about. I wish I could hear their actual voices. What would they say? I don’t know… you figure with the size of their brains, their vocabulary couldn’t represent more than a few dozen concepts. I’m just betting that ants cuss a lot, that’s all. I wore a sweater today, for those of you keeping track. Have you ever wondered how long it took for sweaters to catch on? “What’s this thing?” “It’s a sweater.” “Why would I want to wear something that makes me sweat?” “It doesn’t make you sweat.” “Then why even call it a sweater? Why not go all the way and call it a molter?” This piece of clothing is so dangerous that it causes chemical reactions in your skin. Not a bad selling point, actually... My wife has started selling Tupperware, with the plan being to keep me off the streets at night. I’ve been working a second job a few nights a week since August, and some days I might see some of the kids for only 15 minutes. I figured when I got up to 500 readers here, I’d start giving her referrals. And with only 446 to go… But she wanted me to advertise right now so you can see what’s new. Just think, if you and your friends’ friends, and their stepsisters and nieces and their poodles all place orders, then I can quit my second job sooner and focus on blogging and wasting time more. Aren’t they pretty? And don’t forget the old adage — Tupperware… really locks it in™. www.my2.tupperware.com/audreys8 I have a new mole just off the side from my nose. You can’t see it if you’re more than three feet away, but it’s big enough to cast a shadow at six in the afternoon. That almost rises to crisis level in my book. Anyway, it has absorbed a lot of my attention. I only noticed it a few months ago. I’ve also found that rooting against a mole doesn’t work. You have to go with the mole. Speaking of which, we have two captain’s seats from our van in the house, because we replaced them with a full seat that goes all the way across. The captain’s seats are comfortable to recline in. I took a nap kneeling in one once. I didn’t want to fall asleep for very long, so I wanted to stay mostly upright. Actually, we replaced the seats two years ago, but I lost track of the time. I often have deep circles under my eyes for the first half of the day or longer. I haven’t been sleeping real well. Like Steven Wright said when someone asked him if he slept well, he said, “No, I made a few mistakes.” An exercise regimen is going to help that, and trying to get to bed at about the roughly same time each night. I’ve absorbed the concepts, and now it’s time to put them into practice. We’re getting some snow here, but it’s not sticking down here in the valley. I think it’s snowed three times in the past two weeks, and it only stuck once in the early morning, but it was less than an inch. I’d say it was about ⅝ths of an inch. Why are people proud of how much snow they got? They act like it took some unusual talent of theirs to accomplish the magnificent feat of producing snow. Is there some prize? I keep expecting someone to step out from behind stage, complete with orchestra and confetti, and give a lifetime achievement award for the deepest snow generated by a person in a supporting role. It’s like when people catch fish. I don’t fish, but is there a technique to attract a larger fish to your hook? Is the picture next to the fish saying ‘look how talented I am’, or ‘look how incredibly lucky I am’? I’m not skeptical or anything… just curious. Speaking of which, I got a new computer system about a month ago, just in time for me to slow down my blogging and internet activity. It’s not Vista’s fault, but it just happened to coincide. Vista has its obvious perks, though I’m wondering why they made a lot of things worse, as in more intrusive. Hello! If I want Bill Gates sitting in my lap every time I try to perform an operation, I’ll invite him over for crumpets first, but otherwise I think he should assume that I’m just too preoccupied to entertain him. I mean, I like the guy and all — what’s not to like about 50 billion dollars — but I don’t need to be constantly reminded that he rules the world. Too much of a good thing… It’s interesting to me how Vista has more problems with the latest Internet Explorer than XP did. Did you hear that IE 12 is out? You didn’t know? It’s in triple beta right now, meaning it’s not expected to be officially released for six more years, and there are still three other releases before it comes out, but it’s always good to be one of the first. Then you can… say you were one of the first. (does that get you any brownie points?) Besides, six years from now, we’ll want to be using IE 15 beta by then, and won’t want to be messing around with any measly new releases. Ever notice that people tend to want things that are sneak previews, just released, barely out of production, the latest, all-new, hot off the presses, etc.? Oh, incidentally, I’m wont to separate myself from the human race, as I don’t claim them collectively. Not that I’m too good for them, but I’ve got a plan, and their general modus operandi is really holding me back. I don’t mind being human per se, I mean, in terms of living and all… as if I had a choice in the matter. It’s just that we seem to be setting our sights lower, and while I’ll gleefully rub shoulders with all of you (not that you’re ‘them’), in the process I’m going to also be looking to the skies… Philosophy Soccer life learning thoughts words philosophies synapses things entropy gallimaufry harbinger kerfuffle randomized wonky brain espionage serendipity equilibrium intertia blogging mental nameless observations patterns think knowledge unthinking whatever cogitating gratitude history memoirs ruminating topical wondrous Machiavellianism altruism earth fables fungible happiness hullaballoo kaleidoscopic persnickety religion skeewompus symbiosis thinking verisimilitude verklempt vestibule weasels Highlighted Blogposts ——Philosophical Meanderings—— If Statements as Experiment (3-30-10) Essays For Time: Life's Learning Odyssey (9-5-11) Conversations With Myself (10-10-08) Rusted Philosophies (6-20-12) What This is About (10-26-10) Compared to What? (9-24-09) Linear Digression (4-5-09) Acoustic Contemplation (11-11-08) The Zen of Zed (1-30-10) The Most Cherished of Registers (6-8-09) An Open Letter to a Higher Power (8-27-09) Learning About Yourself (12-17-08) Lateral Unthinking (11-13-09) ——Playful Musings—— The Absentminded Whatever It Is (12-31-08) Faulty Copies and Wondrous Clues (1-3-12) Pair of Dice Lost and Found (5-28-11) Advisory Bored & the Nth Degree of How (2-29-12) Taking Sides (10-6-09) E.O.T.W. or Bust (2-22-09) A Year in the Life (1-6-09) Inverse Dichotomization (7-24-11) Topical Guise: Motif Legerdemain (10-2-12) Recalcitrant Dissonance in Nascent Autonomy (5-30-09) Mood Appraisals, Pt. I (9-17-08) Fruit ___ the Bottom (2-6-09) Heading to or From Entropy (12-6-09) Don't Knock it Till You've Rung the Bell (8-12-09) Dentistry Smalltalk (3-23-09) Things My Brain Sent Me That I Couldn't Send Back (1-23-12) Things What I Might Be Good at Or Not (3-17-10) ——Storied Tapestries—— Mojo Catharsis (7-28-08) Same Old Similar New (4-20-10) Untold Stories (5-31-10) Fables of the Reconstruction (8-20-11) ——Mixed Bag of Potpourri—— Bespeaking Rungs (7-21-10) Bored-Um (9-30-08) The Five Muses (8-18-08) Reporting on a Planet (12-31-09) Pageviews (this doesn't mean anything) Who am I? Who are any of us? ........... I'm Rusty, and you're not Chevy Chase Rusty Southwick • I feel that each of us needs somebody to introduce us. If famous people don't introduce themselves, what's good enough for them is good enough for me. And they would say something like I'm a self-proclaimed hypocrite. Because if you say you're hypocritical from the outset, then people have no other recourse but to embrace your hypocrisy with you. It's a brilliant tactic that could only be pulled off by someone who's both hypocritical and self-aware. Other than that, I don't do anything. I just sit here at the computer waiting for people to read my introduction and then tell me about the experience. Most of you would think this would be a rather boring existence I lead, but the hours are pretty reasonable and it keeps me off the streets. If I were out on the streets, then I'd be falling down in potholes, tripping over speed bumps, and otherwise getting in the way of automobiles. It's safer for everyone if I stay confined to my lair up in the attic. I could use a little more lighting, but overall it's a fairly decent arrangement. Celebrate life...... Post-Modern Era of Posts With Six You Get Blogroll One Cʘsmos Man is a Portal Beyond Himself - In the previous post we discussed how logic is to be avoided in attempting to turn the soul from God, if only because it is illogical to pretend the existe... 1000 Awesome Things (Neil P.) #328 The smell of the library when you walk in the front doors - Come on in. Pull open the wooden door with those giant oversized handles that are smooth and worn down to a light brown finish. Drag your boots over the ... Mormanity - A Mormon Blog (But Not Just for Mormons) The Kindness of Two Chinese Strangers Turned Our Christmas Eve from Frustration to Joy - Sorry for the delay in posting this note which I wrote during the Christmas holidays and already shared on Facebook. Christmas Eve was marvelous for us ... Mama's Losin' It! (Kathy B.) Writer’s Workshop: I’m The IT Guy - 2. Write a blog post inspired by the word: frightful I’m blogging from my phone. Things are frightful indeed when I have resorted to the desperate measures... Raptitude (David) The Other Environmental Crisis - During a holiday get-together, several times the topic of conversation became, “Things that have quietly disappeared from ordinary life.” We had been playi... Art of Non-Conformity (Chris G.) Start Your Resolutions on January 6th - Resolutions can be powerful, and they don’t have to begin on any given day. If you want to form a new habit, just start doing it. The important thing is s... Every Day I Write the Book (Kacy F.) A Lack of Good-Faith Arguments has Impoverished Civic Discourse - A friend of mine told me that we should probably sneak anti-Trump arguments past Trump voters by not mentioning Trump if we want to make any headway wit... You Are Not So Smart (David M.) YANSS 169 – How scientists use children’s drawings, round rooms, and cave paintings to better understand how minds struggle to share their inner worlds - Moira Dillon studies how “the physical world in which we live shapes the abstract world in which we […] Prescriptions for Life (Susan B.) Move on From Trauma and Choose to Be Happy - Trauma and adverse experiences change our brains. We fear we will never recover ourselves, but the truth is that your brain can heal and recover. therapy sketch - leather couch throw rugs chairs have moved art is the same tea mug sitting on a mini trunk body scan head to toe parts my mind doesn't recognize the worst... Tough Questions Answered Risen jesus april 6-7 - I am excited to announce that Dr. Mike Licona (Risen Jesus Ministry) will be visiting my church, Cornerstone Baptist Church, on April 6-7, 2019. Mike will ... Greg Trimble A Different Way To Say “The Church Is True” - For as long as I can remember, I have heard the same phrase regurgitated over and over again at church. It’s likely you’ve heard... The post A Different ... Matt Walsh Blog (Matt W.) If protecting my children’s innocence means I’m “keeping them in a bubble,” then so be it - In what is becoming a weekly event, another cartoon show for very young children decided to start pushing the gay agenda. “Doc McStuffins” aired an episo... kate schell (Kate S.) Immodest Proposals: Authorial intent and rape culture - If you have rightly loved the men around you, the men in the Body of Christ, then you have fulfilled the law of God. The law of love says, “I don’t want to... seeingM (Maren K.) Stunner In The Rearview - It is a dark and velvety cold winter night here at the ocean. Humidity and clear night skies always offer a special kind of blanketing aspect to the cold I… Jacob Schriftman Blog (Jacob S.) Hiatus - As you might have noticed, there haven’t been any new posts in recent months. I’ve had a lot of work and other writing projects going on, so I’m taking a l... Over My Dead Body (Kate S.) The end (of this column) is here - Whoops. Thoughts Behind My Thoughts (Andrea) The Internet Says: Ignorance is Bliss - Ignorance is bliss. Is that true? Well, according to one source, it’s a misquoted line from a Thomas Gary poem. According to the website’s author, the mere... Maia's World (Maia) Self Development Reads (Maia) "You don't have to know what you're looking for, you just have to start looking." "Even the things you cannot imagine are possible." — Vincent Barnett "The real voyage of discovery is not in seeking new landscapes but in having new eyes." — Marcel Proust "It seemed the world was divided into good and bad people. The good ones slept better... while the bad ones seemed to enjoy the waking hours much more." — Woody Allen "Don't wait for a clear runway for courage. Courage is not pure. It keeps company with fear and with doubt." — Keith Ablow "In principle, the Intellect knows everything because all possible knowledge is inscribed in its very substance." — Frithjof Schuon "Beauty should be for truth's sake. If it is not subordinate to something higher, it will be appropriated by something lower." — Robert Godwin "What scares me is not trying." — Kevin Costner Readership Down Who Cares to Read What... is your quest? Sites to Behold Rock Omnibus (my historical music book) Grooveshark (free streaming music) Pandora (custom radio) Football Reference Tucows (downloads) Air Traffic Control Broadcasts Jeff Lindsay (LDS studies) Religion Facts Townhall (politics) The Nameless Blog Post Ever notice how raindrops falling on a windshield seem to go after all the open spots? If the landscape is ugly, just photograph it in ... Bespeaking Rungs For example, I this began to germinate three weeks hence ago. While it represents a mass of and accumulated observations-in-waiting that con... The Most Cherished of Registers Making lists is kind of a pastime for me, although I decided this time to make a list for a different reason than just to compile something.... What This is Called Life is good. Relatively speaking — compared to all the other lives we have. A sign in front of the store said "Open For Busin... The Blog That Wrote Itself Our friend Rusty has written eight months’ worth of blog posts, and he wanted to experiment to see what might happen if he went a while with... Topical Guise: Motif Legerdemain Quick, give me a topic. All right, I'll give you ten seconds if you must... Maestro, cue the orchestra for the Jeopardy! soundtrack... (... Faulty Copies & Wondrous Clues Once somebody has convincingly pulled off a role and we've gotten used to it, it's nigh impossible for anyone else to fill in suffic... Essays for Time: Life's Learning Odyssey —HUMANITY, LIMPING ON PARADE— We’re an idealistic bunch, we humans (you know who you are). Pachyderms, meanwhile, are quite a bit more gro... An Open Letter to a Higher Power To whom it may concern: Adoring life, it’s fitting to remind oneself that it’s all worth it. As I peruse this big bad beautiful world from... Randomized Ruminating a la Mode Things I've attempted to ponder so you hopefully won't need to... NOTE TAKING Whenever I jot down a note, I make sure to carefu... Learn more about Rock Omnibus, my new 423-page annotated music reference book that puts the music of the rock n' roll era (1950-2010) into clearer perspective. Fully comprehensive, with more substantive and in-depth song listings (5000 ranked and 12,800 honorable mentions) than any other book or website. Go now to the Rock Omnibus website. "Knowledge is recognizing what you know and what you don't." — Confucius "They didn't invent whispering for compliments..." — Brian Regan "I like playing chess with old men in the park. Of course, the problem with playing chess with old men in the park is finding 32 of them." — Emo Phillips "Cleaning the house makes me feel like I'm depriving archaeologists of clues to my daily life." — Kelly Darger "If I were stranded on a deserted island with just one book, I'd want it to be a giant pop-up book about tents." — Tim Siedell "If my mental processes are determined wholly by the motions of atoms in my brain, I have no reason to suppose that my beliefs are true. They may be sound chemically, but that does not make them sound logically. And hence I have no reason for supposing my brain to be composed of atoms." — J.B.S. Haldane "Attacks on alternative religious groups are attempts to psychologize — to medicalize — a controversy that, on deeper examination, is clearly a controversy over ideology and lifestyle." — James R. Lewis "Dive into the deep end. You're gonna get wet anyway." "If the best in us is worth anything substantial, it always overcomes the worst in us. It all reverts back to our capacity to love, which defines ... everything." — Anon. Muppets I Relate to Most Molly Kate Kestner Evita Ochel Megan McCormick Janet Varney Kathy Bouska Dana Perino Bob Godwin Erin Burnett S.E. Cupp Leeza Gibbons Bill Wattenburg Pete Carroll Haley Mills Bill Handel Modern Heroes Samuel Clemens Kurt Godel Books I've Read in the Last Few Years [x-unfinished] (my rating in parentheses) Beyond Biocentrism - Robert Lanza (5) Unlimited Challenge - Garry Kasparov (6) Tuesdays With Morrie - Mitch Albom (6) Being Wrong - Kathryn Schulz (7) The Out-of-Body Experience - Anthony Peake (6) Sway - Ori Brafman (5) Cosmic Coincidences - John Gribbin (5) Man's Search For Meaning - Viktor Frankl (7) More Than Allegory - Bernardo Kastrup (9) Meaning in Absurdity - Bernardo Kastrup (6) Rationalist Spirituality - Bernardo Kastrup (7) Still the Best Hope - Dennis Prager (7) The Infinite Mindfield - Anthony Peake (6) Music: What Happened? - Scott Miller (6) David & Goliath - Malcolm Gladwell (6) The Biology of Belief - Bruce Lipton (5) The Divine Code of Life - Kazuo Murakami (4) The Jungles of Randomness - Ivars Peterson (6) Chances Are - Michael Kaplan (7) The Book - Tom Tango (6) Baseball Between the Numbers - Baseball Prospectus (6) The Power of Now - Eckhart Tolle (8) Why Science is Wrong... About Almost Everything - Alex Tsakiris (3) Luck - Nicholas Rescher (2) The Tyranny of Cliches - Jonah Goldberg (7) Struck By Lightning - Jeffrey Rosenthal (3) Time Travel in Einstein's Universe - J. Richard Gott (4) Fooled By Randomness - Nassim Taleb (6) Miracles and Massacres - Glenn Beck (4) What the Dog Saw - Malcolm Gladwell (5) Leap of Faith - Bob Bennett (5) Outliers - Malcolm Gladwell (7) Repeatlessness - Joe Marshalla (3) Orthodoxy - G.K. Chesterton (6) A Point in Time - David Horowitz (5) One, Two, Three: Absolutely Elementary Mathematics - David Berlinski (2) The Tipping Point - Malcolm Gladwell (6) Quiet - Susan Cain (6) Future Babble - Dan Gardner (6) A Million Miles in a Thousand Days - Donald Miller (3) A New Earth - Eckhart Tolle (10) The Unfoldment - Neil Kramer (6) The UltraMind Solution - Mark Hyman (6) Season Ticket - Roger Angell (6) x-Hold Me Tight - Sue Johnson (5) Couplehood - Paul Reiser (6) x-The Speed of Trust - Stephen M.R. Covey (5) The Case For Faith - Lee Strobel (6) The No Spin Zone - Bill O'Reilly (2) x-Walden- Henry David Thoreau (7) Think Twice - Michael Mauboussin (2) The O'Reilly Factor - Bill O'Reilly (3) Our Culture, What's Left of It - Theodore Dalrymple (4) One Cosmos Under God - Robert Godwin (6) Stumbling on Happiness - Daniel Gilbert (8) The Science of Fear - Daniel Gardner (9) In Perfect Balance - Spencer Condie (5) The Little Red (Sox) Book - Bill Lee (4) Echoes and Evidences of the Book of Mormon - Donald Parry (5) Game Six - Mark Frost (3) Awaken the Giant Within - Anthony Robbins (7) The Devil's Delusion - David Berlinski (7) Answers - Joseph Fielding McConkie (6) The Black Swan - Nassim Nicholas Taleb (3) The Mastery of Love - Don Miguel Ruiz (4) Predictably Irrational - Dan Ariely (8) The Drunkard's Walk: How Randomness Rules Our Lives - Leonard Mlodinow (4) Myths, Lies, and Downright Stupidity - John Stossel (5) The Wrong Stuff - Bill Lee (5) The Problem of Pain - C.S. Lewis (9) Billions of Missing Links - Geoffrey Simmons (4) Power to the People - Laura Ingraham (3) Blink - Malcolm Gladwell (8) Mr. Monk and the Blue Flu - Lee Goldberg (4) The Case for a Creator - Lee Strobel (6) Say Good-Bye to Illness - Devi Nambudripad (3) The Galileo Connection - Charles Hummel (6) Restoring the Ancient Church - Barry Bickmore (5) The Storytellers - Curt Smith (4) Signs of Intelligence - William Dembski (4) Never Die Easy - Walter Payton (4) The Next Fifty Years: Science in the First Half of the Twenty-first Century - John Brockman (4) A History of Knowledge: Past, Present, and Future - Charles Van Doren (9) Science and Evidence for Design in the Universe - Michael Behe (4) Predictions - Theodore Modis (9) Tomorrow Now: Envisioning the Next Fifty Years - Bruce Sterling (5) The New Bill James Historical Baseball Abstract - Bill James (7) Give Me a Break - John Stossel (6) How the Mind Works - Steven Pinker (7) Bunts - George F. Will (4) Whatever Happened to the Hall of Fame? - Bill James (5) Side Effects - Woody Allen (9) Probabilities in Everyday Life - John McGervey (7) Mere Christianity - C.S. Lewis (9) Best Crime Solvers Lt. Columbo (Columbo) Sherlock Holmes (Sherlock) Fox Mulder (The X-Files) Perry Mason (Perry Mason) Cal Lightman (Lie to Me) Jack Bauer (24) Leroy Jethro Gibbs (NCIS) Charlie Eppes (NUMB3RS) Mike Stone (The Streets of San Francisco) Adrian Monk (Monk) Sherlock Holmes (Elementary) James Rockford (The Rockford Files) Jack McCoy (Law & Order) Brenda Leigh Johnson (The Closer) Sydney Bristow (Alias) Horatio Caine (CSI: Miami) Seeley Booth (Bones) Maxwell Smart (Get Smart) Nikita (La Femme Nikita) Mike Hammer (Mike Hammer, Private Eye) Robert Goren (Law & Order: Criminal Intent) David Addison (Moonlighting) Juliet O'Hara (Psych) Mac Taylor (CSI: NY) Remington Steele (Remington Steele) Gil Grissom (CSI: Crime Scene Investigation) Least Favorite Insects Favorite Game Show Hosts Chuck Woolery Bert Convy Tom Kennedy Favorite Insects Walkingsticks George F. Will Favorite Comedic Actors Spanky MacFarland Favorite Comedians Jake Johansen Gary Shandling Wil Shriner Father Guido Sarducci Unfunny People Rob Schneider Enigmatic Figures Nyjer Morgan Favorite Things to Make Lists Of Favorite Elements Einsteinium Ununpentium Favorite Philosophers The Best Movies (some only recommended as TV versions) And Justice For All City Slickers DaVinci Code, The Doc Hollywood Empire Strikes Back, The End, The First Knight Gods Must Be Crazy II, The Gods Must Be Crazy, The Grand Tour: Disaster in Time Jennifer 8 Jerk, The Lake House, The Mr. Destiny Princess Bride, The Raising Arizona Return to Me Secondhand Lions Shawshank Redemption, The Simple Life of Noah Dearborn, The Star Trek IV: The Voyage Home Sure Thing, The Terminator: Salvation War, The Classy Actresses Tea Leoni Paige Turco Maggie Lawson Rebecca DeMornay Who'd Be in the Ultimate Movie Charleton Heston Favorite Animated Movies Ice Age: The Meltdown Olive the Other Reindeer Movies I Thought Were Overrated A Fish Called Wanda Back to the Future III E/R (1984) Mr. Ed The Rockford Files Oh Madeline Gomer Pyle U.S.M.C. Who's the Boss WKRP in Cincinnati My Two Dads Best TV Characters Cosmo Kramer Lt. Comm. Data Gomez Addams Molly Dodd Hawkeye Pierce Maggie O'Connell David Addison Lt. Columbo Beaver Cleaver Cal Lightman Dana Scully Paul Buchman Comm. William Riker Charlie Eppes Danny Partridge Jamie Buchman Radar O'Reilly Cpt. Jean-Luc Picard Adrian Monk Arnold Horshack Edith Bunker Henry Blake Gabe Kotter Wally Cleaver Favorite Variety Shows Fernwood 2-Night Late Night With David Letterman The Red Green Show The Tonight Show with Johnny Carson Laugh-In Your Show of Shows The Ed Sullivan Show Smothers Brothers Show The Flip Wilson Show Random Recommended Music Groups Church, The Guadalcanal Diary Guess Who, The Moody Blues, The Favorite News Personalities Lynne Russell Leslie Stahl Laurie Dhue Favorite Baseball Announcers Lon Simmons Ron Darling Tony Kubek Bill King Ted Robinson Tom Paciorek Steve Physioc Skip Caray Steve Stone Favorite Sports Announcers Marv Albert Todd Christensen Keith Jackson Favorite Current Baseball Players Buster Posey, SF Derek Jeter, NYY Mariano Rivera, NYY Mark Teixeira, NYY Alex Rodriguez, NYY Albert Pujols, StL Hunter Pence, Phi Robinson Cano, NYY Joe Mauer, Min Jacoby Ellsbury, Bos Ichiro Suzuki, Sea Curtis Granderson, NYY Ryan Braun, Mil Carlos Beltran, SF Tim Lincecum, SF Chris Carpenter, StL Favorite Athletes Walter Payton (football) Willie Mays (baseball) Barry Bonds (baseball) Dale Murphy (baseball) Jimmer Fredette (basketball) Buster Posey (baseball) Derek Jeter (baseball) Mariano Rivera (baseball) Michael Jordan (basketball) Steve Young (football) Danny Ainge (basketball) Apolo Ohno (speedskating) Larry Bird (basketball) Bobby Bonds (baseball) Mark Teixeira (baseball) Kareem Abdul-Jabbar (basketball) Cal Ripken (baseball) Mia Hamm (soccer) Ty Detmer (football) Alex Rodriguez (baseball) Mark Fidrych (baseball) Karl Malone (basketball) Tiger Woods (golf) Hakeem Olajuwon (basketball) Albert Pujols (baseball) Boris Becker (tennis) Hunter Pence (baseball) Jerry Rice (football) Robinson Cano (baseball) Dan Quisenberry (baseball) Joe Mauer (baseball) Ichiro Suzuki (baseball) Rickey Henderson (baseball) Walter Johnson (baseball) Julius Erving (basketball) Ryne Sandberg (baseball) Joe Frazier (boxing) Phil Mickelson (golf) Michael Phelps (swimming) Keith Hernandez (baseball) Martina Hingis (tennis) David Robinson (basketball) Barry Sanders (football) Wayne Gretzky (hockey) Willie McCovey (baseball) John Stockton (basketball) Ken Stabler (football) Jim McMahon (football) Dan Jansen (speedskating) Harmon Killebrew (baseball) Tim Lincecum (baseball) Dave Wottle (track) Sugar Ray Leonard (boxing) Dennis Eckersley (baseball) Tim Hardaway (basketball) Greg Maddux (baseball) Tim Brown (football) Cliff Branch (football) Richard Petty (auto racing) Boom Boom Mancini (boxing) Unfavorite Sports Figures Franco Harris Bob Brenly Mike Scioscia Favorite Sports Teams Brigham Young (football) Brigham Young (basketball) Oregon State (baseball) Boise State (football) USA (soccer) Gonzaga (basketball) Salem-Keizer Volcanoes Xavier (basketball) Least Favorite Sports Teams Ohio State (football) Duke (basketball) Oklahoma (football) Alabama (football) Utah Utes (football) Greatest Baseball Players Willie Mays, CF Barry Bonds, LF Hank Aaron, RF Babe Ruth, RF Ted Williams, LF Honus Wagner, SS Ty Cobb, CF Walter Johnson, SP Alex Rodriguez, SS Mickey Mantle, CF Rogers Hornsby, 2B Lefty Grove, SP Rickey Henderson, LF Albert Pujols, 1B Lou Gehrig, 1B Josh Gibson, C Mike Schmidt, 3B Frank Robinson, RF Sandy Koufax, SP Mariano Rivera, RP Stan Musial, LF Jimmie Foxx, 1B Oscar Charleston, CF Roger Clemens, SP Joe Morgan, 2B Tris Speaker, CF Greatest Basketball Players Michael Jordan, G Kareem Abdul-Jabbar, C Wilt Chamberlain, C Larry Bird, F Kobe Bryant, G Hakeem Olajuwon, C Magic Johnson, G LeBron James, F Karl Malone, F Oscar Robertson, G Tim Duncan, F Dwyane Wade, G Shaquille O'Neal, C Elgin Baylor, F Julius Erving, F Dirk Nowitzki, F Rick Barry, F Charles Barkley, F Scottie Pippen, F Jerry West, G Bill Russell, C Clyde Drexler, G Isiah Thomas, G David Robinson, C Dominique Wilkins, F Adrian Dantley, F John Stockton, G Kevin Garnett, F Pete Maravich, G Moses Malone, C George Gervin, G Artis Gilmore, C Greatest Football Players Jim Brown, RB Jerry Rice, WR Joe Montana, QB Walter Payton, RB Steve Young, QB Barry Sanders, RB Otto Graham, QB Brett Favre, QB Bruce Smith, DE Peyton Manning, QB Ray Lewis, LB Emmitt Smith, RB Johnny Unitas, QB Randy Moss, WR Ron Woodson, DB Dan Marino, QB Junior Seau, LB Ronnie Lott, DB Marshall Faulk, RB Marcus Allen, RB Lawrence Taylor, LB Favorite Religions Latter-day Saints Favorite LDS Temples San Diego Temple Houston Temple Portland Temple Oakland Temple Washington DC Temple Salt Lake Temple Buenos Aires Temple Bountiful Temple Jordan River Temple Rexburg Temple Manila Temple Draper Temple St. Louis Temple Logan Temple Twin Falls Temple London Temple Nauvoo Temple Mount Timpanogos Temple Boston Temple Cochabamba Temple Stockholm Temple	cc/2020-05/en_middle_0093.json.gz/line732
__label__wiki	0.594739	0.594739	Switch to My Photography What’s the Buzz? Movie Buzz TV Buzz 2014 in Trailers A Second Look At (The Best Of) My Movie WishList American Sniper 1/16/15 Inherent Vice 1/9/15 Predestination 1/9/15 A Most Violent Year 12/31/14 The Interview 12/25/14 Unbroken 12/25/14 Big Eyes 12/25/14 Top Five 12/12/14 The Imitation Game 11/28/14 VHS: Viral 11/21/14 Foxcatcher 11/14/14 ABCs of Death 2 10/31/14 Horns 10/31/14 Force Majeure 10/24/14 Listen Up Philip 10/17/14 Tusk 9/19/14 The Skeleton Twins 9/12/14 Green Inferno 9/5/14 See more in The Trailer Room Select Month October 2016 (1) October 2014 (2) July 2014 (1) June 2014 (4) May 2014 (1) April 2014 (1) March 2014 (2) February 2014 (2) January 2014 (2) December 2013 (3) November 2013 (6) October 2013 (10) September 2013 (6) August 2013 (3) July 2013 (2) June 2013 (3) May 2013 (3) April 2013 (6) March 2013 (8) February 2013 (3) January 2013 (10) December 2012 (3) November 2012 (4) October 2012 (5) September 2012 (1) August 2012 (10) July 2012 (12) June 2012 (7) April 2012 (3) March 2012 (4) February 2012 (4) January 2012 (3) Cinemixtape Cinesnatch Punch Drunk Critics Screen Invasion The Movie Addicts Release: Dec. 25, 2012 Desirability: 3 This Is 40> Stand Up Guys Desirability: 3.5 Release: Nov. 21, 2012 Release: Nov. 9, 2012 Release: Oct. 26, 2012 Release: Oct. 5, 2012 Release: Sept. 28, 2012 Release: Sept. 14, 2012 Limited Release Release: Sept. 7, 2012 For a Good Time, Call Release: Aug. 31, 2012 Sleepwalk With Me Release: Aug. 24, 2012 Limited Release Desirability: # Red Hook Summer Release: Aug. 3, 2012 Release: Jul. 27, 2012 Release: Jul. 3, 2012 Release: Jun. 29, 2012 That’s My Boy Release: Jun. 8, 2012 Release: May 25, 2012 Release: May 4, 2012 Release: Apr. 13, 2012 Release: Apr. 6, 2012 The Raid Redemption Release: Mar. 23, 2012 Release: Mar. 9, 2012 I Am Bruce Lee Release: Feb. 9, 2012 Release: Jan. 20, 2012 Release: Jan. 6, 2012 Click here for 2011′s Trailer Room. What I’m Watching: Sicario (10/5/16) The Hobbit: Battle of Five Armies (1/13/15) Wild (1/11/15) Looper (1/10/15) Stretch (1/4/15) The Babadook (1/3/15) Theory of Everything (1/2/15) The Wolf of Wall Street (1/1/15) Rango (12/30/14) Into the Woods (12/28/14) Annie 2014 (12/27/14) Whiplash (12/22/14) Very Good Girls (12/21/14) Horrible Bosses (11/28/14) Resolution (11/27/14) Friday Night Lights (11/23/14) John Wick (11/17/14) Dear Zachary (11/16/14) Interstellar (11/9/14) The Taking of Deborah Logan (11/8/14) Birdman (11/4/14) The Man of Tai Chi (11/3/14) Monkey Shines (11/2/14) Devil's Due (10/31/14) Gone Girl (10/30/14) The Hills Have Eyes 2 (10/27/14) Joyride (10/26/14) Friday the 13th (10/25/14) Afflicted (10/24/14) The Equalizer (10/22/14) Day of the Dead (10/14/14) Trust Us, This is All Made Up (10/13/14) Annabelle (10/12/14) The Maze Runner (10/6/14) Déjà Vu (10/6/14) The Sacrament (10/4/14) Odd Thomas (9/29/14) Pontypool (9/22/14) Tyler Perry's Temptation: Confessions of a Marriage Counselor (9/19/14) Hector And The Search For Happiness (9/16/14) See more of What' I'm Watching What I’m Reading: The Blair Witch Project Almost Had A Completely Different Ending Pacific Rim 2 Just Got A Terrifying, A+ Teaser Poster The Full Story Behind Seth Rogen Calling Out The Guy Who Axed Freaks And Geeks Jason Reitman Explains Why Labor Day Failed The Flash Will Be Played By Ezra Miller, Get The Specifics Here Robert Downey Jr. Is Kind Of Getting Sick Of Superhero Movies Adam Sandler's New Movie Spent An Insane Amount Of Money On Porn, Here's Why Here Are The 10 Most OMG Moments From 'The Walking Dead' Premiere How Marvel Used Captain America 2 To Set Up Civil War The Sad Reason Bill & Ted 3 Might Never Actually Happen Here Are Keanu Reeves' Thoughts On Speed 3 This Is Exactly How Keanu Reeves Was Hired For The Matrix 'Annabelle' joins ranks of freaky dolls in horror films 8 Things You Didn't Know About Zombie Movies Michael Keaton Is Actually Being Sued For Ruining This Movie Watch This Guy Terrorize His Poor Girlfriend With Lord Of The Rings Quotes Titanic's Alternate Ending Might Be The Worst Thing You've Ever Seen How The Flash Premiere Performed Against Agents Of S.H.I.E.L.D. Days Of Future Past Changed Way More About The X-Men World Than We Thought The Reason Why Jurassic Park's Raptors Are Total BS James Franco Holds A Grudge Against Seth Rogen For Killing Him In This Is The End Sarah Silverman Once Stabbed Another SNL Cast Member In The Head The Strange Story Of How An iPhone Salesman Just Rebooted I Am Legend The Death Of The Saturday Morning Cartoon Is Complete The Strange Story Of What Happened Immediately After SNL's Weirdest Sketch X-Men: Apocalypse Might Recast These 3 Roles action Adam Sandler Bill Murray Bruce Willis buffy Chronicle comedy drama Elizabeth Olsen Emile Hirsch found footage Gravity horror Innkeepers Johnny Depp Jonah Hill Joseph Gordon Levitt Josh Trank Joss Whedon Justin Long Leonardo DiCaprio Marvel Matthew McConaughey Max Landis Michael Bay MoviePass movie review mystery Nima Nourizadeh Owen Wilson Paul Thomas Anderson Pixar Premium Rush Project X Saoirse Ronan sci-fi Seth Rogen Shane Carruth thriller Tilda Swinton Ti West vhs Wes Anderson Will Ferrell zombie Copyright © Tell me a story - Tell me a story and I'll listen Powered by WordPress \| Designed by: WordPress Themes \| Thanks to Themes Gallery, All Premium Themes and Free WordPress 4 Themes	cc/2020-05/en_middle_0093.json.gz/line736
__label__wiki	0.584048	0.584048	Adventure Time Game Jam I was recently fortunate enough to participate in the Adventure Time Game Jam, sponsored by Fantastic Arcade. They managed to get licensing rights from Pendleton Ward and Cartoon Network to use Adventure Time characters in games, under the condition that we could only distribute our games through the game jam site, and that Cartoon Network could post the ones they like on their own site. The were about 700 participants, and approximately 100 games were produced. The winning game was by indie studio Vlambeer. It was such a great game too! My own team consisted of myself as programmer, Corie Johnson as UI/UX/graphic designer, and Celine Suarez as voice actress and graphic artist. Corie also recorded the opening theme song and composed an original rap which she performed for the ending screen. It was a unique experience. The game jam took place in an abandoned yoga studio next to the Alamo Drafthouse South Lamar. When we first arrived, there were no chairs. Our Internet was stolen from the Drafthouse. There was a main in the corner with an Einstein's Arcade t-shirt making ethernet cables and each time he finished one, one more person got to get online. In another corner, Vlambeer were sitting on the ground playing Infinite Swat with xbox controllers on a laptop. For some reason pizza and beer kept arriving from unknown origins for 48 hours. All of the audio was recorded on iPhones in the shower at the space where we were doing the game jam. The ending rap was composed and the main theme recorded in the car driving to and from the space. There was no time to waste on second guessing decisions as the clock was constantly ticking. In the end I think we had one of the most finished games. You can download it from the site. Also check out how it was mentioned in the top 8 coolest games from the jam on Wired! For me it was great working with such a talented team. I basically just hacked code nonstop. I did the whole game in KineticJS, which is a great HTML5 graphics framework, and I used Buzz for the sound. These libraries saved me a lot of time and I learned a lot about the affordances and limitations of HTML5 games. Posted by blanu at 10:24 AM 2 comments: Links to this post	cc/2020-05/en_middle_0093.json.gz/line740
__label__wiki	0.939318	0.939318	‧Taiwan News Home / Taiwan News Tue, Jul 01, 2003 - Page 3　News List Taiwan quick take ■Transportation Rapid-transit lines planned The government plans to build five more rapid mass-transit lines, a Chinese-language newspaper said yesterday. According to the paper, the Ministry of Transportation and Communications plans to budget NT$300 billion (US$8.8 billion) for the five lines along a high-speed railway. The five lines will be built in Hsinchu, Tainan and Taipei counties, will link CKS International Airport with Taipei City and will extend the Kaohsiung Mass Rapid Transit Line to Pingtung County. The paper did not say when construction of the five lines would begin, but the north-south high-speed railway is to start operating in 2005. ■ Legislative Yuan DPP sets its priorities It is urgent for the legislature to ratify the draft bills on economic and financial reform, while a referendum law can be postponed until the next legislative session which begins in September, Chen Chi-mai (陳其邁), DPP legislative caucus whip, said yesterday. While the KMT and PFP caucuses have secured the signatures of 69 lawmakers to hold an extra session in July to discuss the referendum law, the DPP is struggling to initiate an extra session for the ratification of six draft bills on economic and financial reform. An extra session may be held either upon the request of the president or upon a joint proposal by at least one-fourth of all legislators. ■ Cross-strait ties Chang pushes cargo flights Taiwan's opposition parties said yesterday they would join forces to push for the cross-Taiwan Strait chartered cargo flights, banned under the no-direct-contact policy toward China. "We plan to get the necessary support in the legislature for our plan to launch the cross-strait cargo flights in October," said KMT Legislator John Chang (章孝嚴). Chang, who yesterday obtained support from his party and the PFP for the proposal, said under his plan the chartered cargo flight would not stop at a third port, but the cargo planes would merely fly through the zone of a third country before reaching their destinations, he said. Chang said flying through a third area should skirt the government ban on no direct flights, and save time and money for the operators. ■ Travel Denmark eyes visa change Denmark wants to press the EU to change its visa policy for Taiwan to allow President Chen Shui-bian (陳水扁) and other officials to visit Europe privately, Danish daily Berlingske Tidende reported yesterday. Danish visa regulations were introduced for Taiwan in 1988 because the EU does not recognize it as an independent state. As a result, officials are unable to visit Europe, either for political or private visits. Danish Foreign Minister Per Stig Moeller told Berlingske Tidende that he wanted to press the EU to change the regulation because things have changed between China and Taiwan since 1988. ■ Kaohsiung Hsieh off to US Kaohsiung Mayor Frank Hsieh (謝長廷) was scheduled to leave for New York and Baltimore yesterday afternoon for a brief visit. An official of the Kaohsiung government said Hsieh will study the city-development projects of the two American harbor cities during the visit, because he wants to build Kaohsiung into a modern harbor city. Hsieh is particularly interested in the development of Baltimore's Inner City, which was developed into a major tourist attraction in the 1970s. Hsieh is scheduled to return home on July 8. EDITORIAL: Junk mail needs to be scrapped	cc/2020-05/en_middle_0093.json.gz/line743
__label__wiki	0.653085	0.653085	About Vimetco Primary Products Media › Press Releases Prolongation of Suspension of Trading in Listed Shares of Henan Zhongfu Industrial Co., Ltd Amsterdam, 8 June 2015 - Vimetco N.V. (LSE: VICO, “The Company”), notes the announcement of the Company's subsidiary, Henan Zhongfu Industrial Co., Ltd ("Henan Zhongfu"), which is a listed Chinese holding company of the Company's main aluminium producing operations in China. The Company refers to its announcement made on 27 May 2015 with respect to the suspension of trading of the listed securities in Henan Zhongfu in connection with a potential issuance of shares by it. Based on a further announcement in China, the Company notes that Henan Zhongfu has now informed the market that an investment project (the creation of an Internet Data Centre, the “IDC”), in which it is planned to invest the proceeds from an issue of shares in a private placement, requires, firstly, obtaining authorizations from the government regarding usage of a suitable land plot and, secondly, completion of negotiations with a business partner experienced in IDC management and support. Given that the fulfillment of these requirements will affect the parameters of the private placement, on 5 June 2015 Henan Zhongfu successfully filed an application to the Shanghai Stock Exchange to seek a postponement of resumption of trading. Consequently, suspension of trading in the listed securities of Henan Zhongfu on the Shanghai Stock Exchange has been extended. The Company further understands that the postponement of resumed trading may last up to 5 trading days. Ana-Maria Imbrea Investor Relations Officer Vimetco N.V. Email: amimbrea@vimetco.ro Vimetco N.V. is a global, vertically integrated producer of primary and processed aluminium products with production assets in China, Romania and Sierra Leone, and a holding company in The Netherlands. Vimetco NV controls annual production capacities of up to one million tonnes of electrolytic aluminium, 340,000 tonnes of processed aluminium products, 600,000 tonnes of alumina, 1.7 million tonnes of bauxite, 2.25 million tonnes of coal, 3 x 300 MW of electricity and 318,000 tonnes of baked anodes per year. Vimetco’s global depositary receipts are listed on the London Stock Exchange (LSE: VICO). www.vimetco.com Announcement Vimetco N.V_Prolongation of suspension of Trading in Listed Shares of Henan Zhongfu Industrial.pdf Contact \| Legal Information \| Sitemap © Vimetco NV 2011	cc/2020-05/en_middle_0093.json.gz/line752
__label__cc	0.617531	0.382469	Support Public Citizen TexasVox: The Voice of Public Citizen in Texas The Voice of Public Citizen in Texas Posts Tagged ‘Texas House Energy Resources Committee’ Texas Citizens Affected by Recent Earthquakes Demand Fracking Regulations at the Railroad Commission Posted in Fracking, natural gas, tagged disposal wells, Earthquakes, fracking, Railroad Commission, Subcommittee on Seismic Activity, Texas, Texas House Energy Resources Committee on January 28, 2014 \| 1 Comment » Small towns like Azle and Springtown, in the North Texas area have experienced about 32 earthquakes over the past two months leaving citizens concerned about what is happening to their home. According to a recent study from the University of Texas, most earthquakes that are coming from the area are a few miles from the Barnett Shale region. The study also found correlation between injection wells and small earthquakes. These disposal wells contain chemical contaminated wastewater from oil and gas drilling.. This is part of the process of hydraulic fracturing or “fracking”. The Railroad Commission has not publicly acknowledge the link between disposal wells and quakes, even with evidence from several studies from Duke University, Cornel University, University of Texas, Texas Christian University, Southern Methodist University and other universities. According to a story on NPR StateImpact, studies found that oil and gas wastewater disposal wells are a reason for the Eagle Mountain Lake quakes. Disposal wells that inject at higher rates are likely causing quakes. Studies show that these large amounts of wastewater can cause inactive faults to slip, which causes an earthquake to occur. In another NPR StateImpact story by Terrence Henry, he writes that under state law, the Commission cannot suspend a disposal well permit unless the operator is in violation of commission rules. There are currently no rules on seismicity, and without this rule the commission has no authority to shut it down. The article also goes on to say that the Railroad Commission is aware of such studies and research linking disposal wells and other drilling activity to man-made quakes, but publicly calls this evidence “theories.” Young witness at RRC Hearing on Seismic Activity in North Texas – Photo by Sierra Club A town hall meeting in Azle, Texas hosted by the Texas Railroad Commission on January 2nd drew 850 residents. The residents had concerns about cracks in their property, sinkholes, earthquake insurance, and possibly having their ground water affected. They wanted the commission to explain what was happening and asked if disposal wells were the reason for the recent problems. Click here to read more. The Commission told attendees it would further study the issue of injection wells and quakes, but residents felt they were getting a runaround. Days after this first meeting the Commission announced it would hire a seismologist to investigate local drill sites. KEFFER LISTENS INTENTLY TO TAR SANDS CONCERNS: Energy Resources chair pledges ‘due diligence’ on pipeline safety Posted in Global Warming, Tarsands, tagged Oil sands, Tar Sands, Texas, Texas House Energy Resources Committee, Texas Legislature on June 27, 2012 \| 4 Comments » The following story on testimony provided to the Texas House Energy Resources Committee about the threat the proposed Tar Sands pipeline poses for the state was reprinted with the permission of the Texas Energy Report. House Energy Resources Committee Chairman Jim Keffer on Tuesday promised environmental advocates warning of dangers posed by pipelines carrying Canadian tar sands – especially under outdated Texas regulations – that his committee will do its “due diligence’ on the issue. “You have certainly helped me in things I didn’t know. I want to assure you this committee is going to take everything you said very seriously with the utmost respect it deserves,” Keffer (R-Eastland) said during a day-long hearing on Texas energy and regulations governing it. Comparing pipeline safety and transparency to his landmark legislation on public disclosure of hydraulic fracturing chemicals, Keffer said he is committed to ensuring “we disclose everything we can to really help the industry going forward. “We will certainly do it with all due diligence and make sure it is done right,” he added. He lamented that no one from the pipeline industry attended the hearing to answer questions raised in detail about the safety of pipelines carrying tar sands, also known as oil sands, and commonly referred to as diluted bitumen when in transport. Julia Trigg Crawford, a family farmer battling TransCanada Corp.’s use of eminent domain to condemn easements on her farm for the controversial Keystone XL Pipeline, testified that diluted bitumen is not akin to heavy Venezuelan crude, as many in the industry insist. (Texas Railroad Commissioner Barry Smitherman also made the comparison earlier in the hearing.) “Please don’t allow our land to be taken and then endanger it by allowing old standards to be used for something that is an entirely new product that’s going to come across Texas soil. One does not have to pull back many layers to discover that Canadian tar sands are not your mother’s crude oil,” Crawford told the committee. Noting that she’s learned TransCanada could begin pipeline construction on her land as early as August, Crawford said state officials have an obligation to ensure the “highest and most stringent” pipeline construction regulations are in place when transporting diluted bitumen. She underlined that her family is fighting TransCanada’s use of eminent domain law to condemn easements on her land, claiming it is a common carrier. Diluted bitumen is not one of seven products listed in the state’s natural resources code that fall under current pipeline regulations, she pointed out. The Crawford family’s fight against TransCanada will be aired next at a hearing July 18 in the Lamar County Court of Law with Judge Bill Harris presiding, she said. The family will argue the company cannot claim common carrier status in order to employ eminent domain. It also has raised legal issues regarding Native American artifacts that could be disturbed by the proposed pipeline construction route. “The proposed pipeline that’s going to cross my land will transport Canadian tar sands,” she said. “This product has never come across our soil before. Our current state regulations have never had to address this specific product,” Crawford said, adding officials need to study ample existing data to prevent a repeat of a tar sands catastrophe in Michigan’s Kalamazoo River. “We really don’t know what we’re up against with this product. I don’t think we should use our Texas lands and resources as guinea pigs.” Trevor Lovell, environmental program coordinator of Public Citizen’s Texas office, told the committee that he coauthored an op-ed in the Dallas Morning News warning about Enbridge Inc.’s repurposing of the 36-year-old Seaway Pipeline to carry a “poisonous mix of chemicals and tar sands bitumen up to 20 times more toxic than traditional crude.” The pipeline crosses three major water sources for the Dallas-Fort Worth area. The articl,e co-written by Public Citizen-Texas Executive Director, Tom “Smitty” Smith, raised several concerns: tar sands are solid at ambient temperatures, far more acidic than crude oil, and chemical diluents must be added to move them through a pipeline. Yet companies like Enbridge have refused to disclose the chemical mixes, calling them proprietary information. They added that data from tar sands pipeline spills show the blend is heavy in benzene at toxic levels and other chemicals that are “far more deadly” than contents in ordinary crude oil pipelines. While a chemical engineer formerly employed at Mobil responded that he agreed with the op-ed points on dangers posed by the Seaway pipeline conversion, Lovell said, a dueling op-ed submitted by an Enbridge executive did not address even one of the 10 key points Public Citizen had made. Instead, it attacked the two authors, accusing them of distortion and misinformation. It cited statistics showing that no tar sands pipelines have ruptured due to corrosion, a point Lovell said the two did not assert. After the hearing, Lovell said he felt “pretty good” about Keffer’s pledge to investigate the subject further to ensure safety and continued economic contributions from oil and gas activities in the state. “It was very encouraging,” Lovell told Texas Energy Report. “I think that Keffer’s done a lot of leadership on that committee. He didn’t make any statements he can’t back up. He framed it in the terms he’s comfortable with, which is protecting the industry from itself, so to speak. “At the end of the day,” he added, “what we care about is safety on these pipelines.” By Polly Ross Hughes Ramrodded by veteran reporter Polly Hughes, the Texas Energy Report’s Energy Buzz specializes in what is happening on the ground in Texas energy ranging from dedicated coverage of the Texas regulatory agencies to battles in the Legislature that affect the future of the industry. Copyright June 21, 2012, Harvey Kronberg, www.texasenergyreport.com, All rights are reserved. Reposted by TexasVox.org with permission of the Texas Energy Report. spousal">spousal Subscribe to TexasVox: The Voice of Public Citizen in Texas by Email Categories Select Category Air Quality Austin Energy Budget Campaign Finance Climate Change Co-op Reform Coal Coal Plants Consumers Demand Response Diesel drought Education Efficiency Electric Vehicle Energy Energy Future Holdings Energy Storage Ethics Flooding Food Fracking Fundraising geothermal Global Warming Good Government green jobs Gulf Coast Coal Export Terminals Gulf Coast Ports Harvey Health Houston Jobs Local Control natural gas News Roundup Nuclear Nuclear Plants Oil by Rail Ozone pipelines Pollution Privacy Property Rights Radiation Radioactive Waste Railroad Commission recycling Redistricting renewable portfolio standard Renewables Right to know Safety solar Sunset Tarsands TCEQ Texas Legislature Toxics Transportation Uncategorized Utilities Water wind air pollution Air Quality Austin Austin Energy Barnett shale Carbon Dioxide clean air act Clean Energy climate change Coal coal plant CPS Energy Energy Energy Efficiency Environmental Protection Agency EPA eye on williamson Global Warming green jobs houston Keystone Pipeline natural gas Nuclear Nuclear Power Nuclear Regulatory Commission Public Citizen public citizen texas radioactive waste renewable energy Renewables Rick Perry San Antonio SEED Coalition Sierra Club solar solar power south texas chisme South Texas Project TCEQ Texas Texas Commission on Environmental Quality Texas Legislature texas progressive alliance Tom "Smitty" Smith United States Environmental Protection Agency Citizen Vox Blog Visit us at citizen.org July 11, 2019 Bret Thompson House Democrats: Anti-Regulatory Legislation “Dead on Arrival” May 2, 2019 Amit Narang Postal Banking Could Help the USPS’s Bottom Line While Serving Millions of Struggling Families Mainstream Banking Has Left Behind April 30, 2019 Craig Sandler Archives Select Month May 2019 April 2019 March 2019 February 2019 January 2019 December 2018 November 2018 October 2018 September 2018 August 2018 July 2018 June 2018 May 2018 April 2018 March 2018 February 2018 January 2018 December 2017 November 2017 October 2017 September 2017 August 2017 July 2017 June 2017 May 2017 April 2017 March 2017 February 2017 January 2017 December 2016 November 2016 October 2016 September 2016 August 2016 July 2016 June 2016 May 2016 April 2016 March 2016 February 2016 January 2016 December 2015 October 2015 September 2015 August 2015 July 2015 June 2015 May 2015 April 2015 March 2015 February 2015 January 2015 December 2014 November 2014 October 2014 September 2014 August 2014 July 2014 June 2014 May 2014 April 2014 March 2014 February 2014 January 2014 December 2013 November 2013 October 2013 September 2013 August 2013 July 2013 June 2013 May 2013 April 2013 March 2013 February 2013 January 2013 December 2012 November 2012 October 2012 September 2012 August 2012 July 2012 June 2012 May 2012 April 2012 March 2012 February 2012 January 2012 December 2011 November 2011 October 2011 September 2011 August 2011 July 2011 June 2011 May 2011 April 2011 March 2011 February 2011 January 2011 December 2010 November 2010 October 2010 September 2010 August 2010 July 2010 June 2010 May 2010 April 2010 March 2010 February 2010 January 2010 December 2009 November 2009 October 2009 September 2009 August 2009 July 2009 June 2009 May 2009 April 2009 March 2009 February 2009 January 2009 December 2008 November 2008 October 2008 September 2008 August 2008 July 2008 Theme: MistyLook by WPThemes.	cc/2020-05/en_middle_0093.json.gz/line758
__label__cc	0.500662	0.499338	Bheemshale Eradication of Manual Scavenging Rehabilitation of Identified Manual Scavengers Legal Interventions Alternative Employment Health Rights Rural Solar Electrification Safaikarmachari Kavulu Samithi The various activities of Thamate can be broadly classified under following themes:- Eradication of Manual Scavenging Practice including legal interventions. Organizing the community for their rights. Improving Education among families of Safaikarmacharis/Manual Scavengers. Improving Health status of families of Safaikarmacharis/Manual Scavengers. Towards these goals, Thamate has been employing following strategies: – Mobilization and formation of Community Based Monitoring Groups (CBMG) and Leadership building among SK/MS; Legal Interventions like registration of FIRs under criminal provisions of relevant Acts after conducting Fact Findings whenever incidents of manual scavenging come to light; Setting up Education Centres (called Bheemshalas) in residential areas of SK/MS with the objective of providing an conducive educational environment and reducing school drop-out so that children STOP engaging in their parent’s unclean occupation; Conducting pre-coaching classes and practice exams for assisting students to secure admissions into government residential schools and colleges; Establishing Youth Resource Centres (YRC) for strengthening life skills of youths and motivating them for alternative employment; Identification of potential youths for alternative employment and training; Networking/Coordinating the collective advocacy process at the State and National Level for strengthening policies and legislation for eradication of manual scavenging and overall development of the community. Although The Prohibition of Employment as Manual Scavengers and their Rehabilitation Act, 2013 (PEMSRA 2013) expressly prohibits employment of persons for “manually cleaning, carrying, disposing of, or otherwise handling in any manner, human excreta in an insanitary latrine or in an open drain or pit into which the human excreta from the insanitary latrines is disposed of, or on a railway track” and directs authorities to demolish insanitary latrines or convert them into sanitary (with flush) latrines, authorities have not taken any action to implement these directives. Insanitary latrines still exit and are being used necessitating the employment of people as manual scavengers. For eradication of this inhuman practice, Thamate is acting at three levels: preventive, rehabilitative and afirmative. Firstly, since those who work as manual scavengers are often those employed as safaikarmacharis by various Urban Local Bodies (ULBs) and Gram Panchayats (GPs), Thamate is actively organizing safaikarmacharis by formation of Community-based Monitoring Groups (CBMG). The objective of formation of these CBMGs is to build capacity among the workers themselves to be able to demand various entitlements related to labour, health, housing drinking water etc. Where Thamate’s approach differs from other such efforts is that instead of organizing workers through supervisors or maestris, Thamate seeks to promote leadership among SK/MS themselves. The CBMGs identify critical work place issues faced by members, address the day-to-day problems of the members by holding meetings with officials of Urban Local Bodies (ULBs) independently without need for top-down management and they link up at the district and state level SK/MS organizations to participate in the larger advocacy efforts. The CBMGs federate under the banner of Safaikarmachari Kavulu Samithi (SKSS), a state-level collective of safaikarmachari unions (sanghas). The final goal is to work towards economic and social security of the community so that there is no compulsion to work as manual scavengers. Secondly, SKKS has been tracking and addressing the phenomenon of deaths of persons in the process of being employed as Manual Scavengers like deaths while entering sewers, manholes etc. since its formation in 2007. On getting information about these incidents, SKKS personnel conduct fact-finding exercises in collaboration with like-minded human rights and Dalit organizations. Recourse to legal interventions like registering complaints and filing FIRs, demanding the statutory compensation as per the Supreme Court Order (W.P. (CIVIL) NO. 583 OF 2003) etc. is taken to enforce the provisions of the 2013 Act and create deterrence against the practice of Manual Scavenging. Lastly, the PEMSR Act 2013 provides for identification of manual scavengers and their rehabilitation. The reluctance of state governments in acknowledging the practice of manual scavenging within their jurisdiction has been the biggest hurdle in moving forward with its eradication. Thamate and SKKS have been working towards submitting self-declaration forms with evidence of persons having been engaged in manual scavenging and pushing the ULBs for their identification and rehabilitation. You can read more about this aspect of our work here. An important part of Thamate’s vision is that the next generation of the families working as Manual Scavengers (MS) and Safaikarmacharis (SK) should never pick up brooms and shovels and instead break the caste-ordained exploitative cycle by exiting these traditional caste-based occupations. Currently, the drop-out rates among the children of families working as MS/SK is very high, especially at the SSLC (secondary) level. Moreover, those students who have, after a lot of personal and family struggle, managed to educate themselves till degree level or complete vocational training courses, often find it difficult to find employment. For fulfillment of Thamate’s vision, it is important that children coming from these families should attain adequate educational qualifications and find alternative employment in non-traditional occupations. Towards these goals, Thamate has adopted a three-pronged strategy. Firstly, Thamate runs evening educational-support centres referred to as Bheemshale in residential areas of MS/SK which provide daily educational support to school-going children up to secondary level. Through these supplementary coaching efforts, we hope to not only bring down drop-out rates among the children but also improve their academic performance. Secondly, Thamate encourages and supports students in applying for admissions in residential schools like Morarji Desai and Kittur Rani Chenamma schools run by state government and private schools under Right to Education (RTE) Act, 2009. For this purpose, special coaching classes for admission tests to these schools are organized and eligible children are provided support during the admission process. Thirdly, for youths who have completed degrees or vocational training but are not able to find jobs, Youth Resource Centres (YRC) run by Thamate provides skills training and enables placement in alternative employment. Another aspect of Thamate’s work is to address the general and specific health issues faced by Manual Scavengers (MS)/Safaikarmacharis (SK). The healthcare needs of MS/SK have to be understood in the context of three specific aspects. Firstly, because of the nature of the unclean occupation engaged in by MS/SK, which involves direct contact with human excreta and dead/decomposing animal carcasses, their risk of exposure to infectious and communicable diseases is much higher as compared to the general population. The work of MS/SK involves handling garbage, cleaning sites of open defection, urinals, dry latrines (without water and flush), removing dead animal carcass and unclaimed human cadavers. Many private hospitals and nursing homes indiscriminately dispose waste into general waste without following the guidelines of medical waste disposal. The waste handled by them often contains sharp glass objects, used syringes, contaminated blades and metals making them highly susceptible to cuts, injuries, abscesses, which if ignored can lead to sepsis. They are also at increased risk of exposure to HIV/Hepatitis B. This work also brings MS/SK in contact with hazardous chemicals and substances exposing them to serious health risk. Very often toxic chemicals and acids are disposed without any thought for the persons engaged in cleaning. Most often no protective gears or equipment are provided to them and neither is any first-aid facilities made available if an injury is caused. Several persons engaged in these occupations have undergone amputation of fingers and limbs. The MS/SK are exposed to a wide range of skin and respiratory ailments due to direct contact and inhalation of toxic fumes and chemicals. Secondly, because of greater incidence of malnutrition and under-nutrition among MS/SK families along with associated syndromes like anaemia, they have a lowered immunity to fight illness and therefore are likely to develop more serious consequences and complications. Thirdly, the habitat where most of the MS/SK reside are not provided with proper sanitation, housing amenities and drinking water which further increases the health risks from communicable diseases faced by the community such as gastro-intestinal, respiratory and skin infections. The very act of entering a stinking man-hole or septic tank can only be done by the numbing influence of alcohol. The incidence of alcoholism in the community that engages in manual scavenging should be seen as an occupational hazard rather than a social evil. Furthermore the act of manual scavenging cannot even be classified as an occupation but rather as a caste based discrimination where ‘choice’ is not an option. The psychological health of persons engaged in manual scavenging cannot be neglected either. The caste stigma and the nature of manual scavenging can cause low self-esteem, depression, suicidal thoughts, aggression, domestic abuse, drug abuse along with alcoholism. Children whose parents are engaged in manual scavenging can face harassment and bullying by peers, denial of education, neglect and victimisation which can directly increase the drop-out rates among the children. The long standing impact on the mental health of children cannot be ignored. Given this context, to improve the health conditions of MS/SK, Thamate has adopted multi-pronged strategy of: 1) Working towards strengthening the existing public health system, 2) Linking the community to various government-run healthcare programmes and schemes to ensure access to health-related entitlements; and 3) Organizing FREE and Regular Medical Camps for screening of various medical conditions as immediate health interventions. You can read more about this aspect of our work here. Day 5 (03/01/2020): State-level Jatha moves to Bengaluru Rural district Day 4 (02/01/2020): State-level Jatha moves south to Kolar Day 3 (01/01/2020): State-level Jatha moves to Dharwad Day 2 (31/12/2019): State-level Jatha moves northward to Haveri Day 1 (30/12/2019): State-level Jatha starts from Davangere Case Report (02/04/2019): 3 workers die in a septic tank at Indi Town, Vijayapura	cc/2020-05/en_middle_0093.json.gz/line759
__label__wiki	0.908182	0.908182	Politics Vietnamese safe in Britain unrest: embassy official Vietnamese safe in Britain unrest: embassy official Wednesday, August 10, 2011 15:00 Email Print No Vietnamese person has been injured in the riots that broke out in Britain last Saturday (August 6), a representative of the Vietnamese embassy in London told Thanh Nien on the phone Tuesday. However, several shops run by Vietnamese nationals on Mare Street, Hackney have been attacked, the Tuoi Tre newspaper quoted Bui Duc Minh, secretary of the Party unit at the embassy as saying. The embassy said it has warned Vietnamese people to stay away from crowded places, and refrain from going out at night. They have also been advised to quickly inform the embassy when they are in trouble. In what is considered Britain's worst riots in decades, hundreds of youth have smashed shop windows, looted shops and set fire to buildings in areas across the UK including Manchester, Birmingham City, and the industrial Midlands, the AFP reports. It said 16,000 police have been mobilized to London to stem the violence, it said. The unrest is believed to have been sparked by a police shooting in which a 29-year-old man died on August 4. The AFP reported that armed officers stopped the taxi in which Mark Duggan was traveling in the multi-ethnic district of Tottenham. Shots were fired and he died on the spot. Britain's police watchdog later said it found no evidence that Duggan had fired a gun at officers, according to the report. More Politics News India PM offers Vietnam $500 million credit line for defense cooperation Narendra Modi, the first Indian prime minister to visit Vietnam in 15 years Philippine president 'responds positively' to Vietnam premier’s visit invitation French president hails preservation of Hanoi Old Quarter Japan to provide patrol ships to Vietnam amid maritime row with China Vietnam says all will lose in any South China Sea war	cc/2020-05/en_middle_0093.json.gz/line760
__label__cc	0.558367	0.441633	Vanhalla A beautiful sunny day by the seaside in Tramore Tramore has got its act together and confidently takes on the allure and lore of the Wild Atlantic Way as it flexes itself as one of the star attractions of Ireland’s Ancient East. Lá brea cois farraige a bhí ann. A beautiful sunny day by the seaside. The simple childish delight of it all. A flashback to boyhood family trips squashed and squeezed into the back seat of my father’s black Anglia and later on the deep purple Ford Cortina. Dozens of ham sandwiches, flasks of piping hot tea and flagons of thirst quenching Cidona on hand to last a fortnight for fear we’d get stranded and us steps-of-stairs kids only carnivorously craving candy-floss and ice cream cones and we’d gladly feed those sand speckled sandwiches from the plaid blanket to the equally ravenous seagulls so as to justify our qualification for a 99. Maybe that’s where all the trouble with gulls these days started. Bad habits and all that. But we are all grown up now and so too is Tramore, An Trá Mhór, the great strand, all sensible and sophisticated, sticking out its chest, rightly proud of its 5km Blue Flag beach. Tramore is home to the highly successful T-Bay Surf Club, which this year celebrated its 50th anniversary. I rediscovered Tramore about 15 years ago when I first took up surfing and lessons at the legendary T-Bay Surf Club one of the cornerstones of the Irish surfing scene for 50 years now and still going strong. One of the best, safest and eco-friendly surf schools in the country is the appropriately titled Freedom Surf School, which even more interestingly offers bilingual lessons. It's run by Pam and Billy Butler who are quite simply top notch in every way. Yes there are still the chair-o-planes and dodgems, the cones and candyfloss but they are punctuated by the cafés and surf shops, a skate park and parking bays for campervans. Not gone quite all out posh but certainly notions about itself has our Tramore, since it has tidied itself up and cleaned up its act. Tramore has got its act together and confidently takes on the allure and lore of the Wild Atlantic Way as it flexes itself as one of the star attractions of Ireland’s Ancient East, neatly nestled in the bay between the Viking heritage of Waterford on its eastern shoulder and the glorious Copper Coast with its greenways and fancy restaurants off out to its west. The bald-bearded bikers sit sipping their mochas and Americanos hot in their leathers on the wooden benches outside the cheerful Sandcastle coffee shop and ice-cream parlour; opposite the busy promenade, not wanting to grow up, not yet. The seaside is so much more fun than having to grow up. Tramore 5km Blue Flag beach is popular with dog walkers but there is no sign of dog fouling or litter as the area is very well maintained and a credit to all concerned. Just beside them is the National Lifeguard Training Centre. Tramore in all its splendour would save your life on a sunny day and we were blessed to arrive in the nick of time to nab one of the five campervan parking bays which had just been vacated. They could do with at least five more, but it’s a start and better than an overhead barrier or ‘No Motorhome’ parking signs. Tramore has the ‘Welcome’ mat out at the front door for sure, a Céad Míle Fáilte to a big strand with a big heart, that lives up to its name; as walkers with buggies and dogs and children and kites and friends and gossip leg it down the prom like a runway before taking off along the sandy beach with its pristine dunes on your left, the promise of a stunning sunset over beyond The Metal Man to your right. Moe's is one of the many food and refreshment offerings along the prom. Local knowledge tells me that Moe’s and Brooklyn are good spots too for a bite and there are plenty of options for snacks and refreshments all along the prom. Back up in town The Victoria House on Queen’s Street is a favourite of the cool surfing set for a beer and bands, or The Vic as it’s known to those in the know. The Copperhen is good for food. If you fancy a refreshing dip in the brine then you can jump in the sea at the designated open-water swimming spot at The Guillamene, Newtown Cove just around the corner from Tramore with the beaches of Annestown and Bunmahon beckoning a little further out the R675. If none of that takes your fancy then you can have a flutter on the gee gees at the local Waterford & Tramore Horse Racing Track which is close by. The next race meeting in Tramore is on December 10, first race at 12.25. Back down on the prom the good news is there are no metres or parking charges and while there is a height restriction barrier on the overflow car park there is plenty of scope to park along the prom, including those 5 designated campervan spots. A section of the prom is also a one-way system. But it can be pretty busy on sunny days and weekends and pay & display parking fees do apply from 10am to 8pm in the high season from June to September. There is a well maintained public toilet block at the clock tower, which also contains two external cold shower faucets, neither which was operational unfortunately. Pity as they would be handy for washing of the sand and salt, and they could surely do with a few of these on the access points to the beach. Waterford County Council take note please. All the facilities are in a compact space as this is right beside the busy skate park which is a buzz with young boys and girls having a ball on their scooters, roller blades, and skateboards. Lá brea cois farraige a bhí ann but it’s hard to beat Tramore for a day trip any time. Kids of all ages love it, even grown up ones like myself! Tramore is a charming spot and the good news is, it’s open all year round. *For those wishing to stay longer than a day trip there are touring campsite options in the locality, which come well recommended, although Vanhalla cannot personally vouch as we have not used them to date. Fitzmaurices is a long established family run caravan & camping park just 300 metres from the beach while just 2km out the road and nearby to The Guillamene is Newtown Cove Caravan Park which is a well appointed 4-star facility. Both spots look like good options for a longer stay in this locality.	cc/2020-05/en_middle_0093.json.gz/line770
__label__cc	0.552772	0.447228	Ella of Frell: Linguist Extraordinaire and True "Roast Mutton" Adventurer Hil-a-ree As an aspiring Tolkien scholar there is admittedly little that doesn't remind me of The Hobbit or The Lord of the Rings. I always try to keep my Tolkien-centered mind in check while I read other fantasy novels because I know that while there are many novelists that purposefully try to imitate Tolkien, there are many more authors whose works echo Tolkien's rather accidentally. Sometimes there is a lot significance in the connections between such novels. Sometimes there isn't. And sometimes they're just fun to talk about. Even though I don't think there's too much significance to be found in their connection, I still want to write about Ella Enchanted and The Hobbit. Ella Enchanted is wonderfully original (a hard thing to accomplish as a fairy tale retelling), and since it never really tries to be The Hobbit, I find the couple of things that remind me of Tolkien in the book all the more interesting. Just in case anyone's unfamiliar with the plot of Ella Enchanted, here's a short synopsis from the book: At her birth, Ella of Frell was given a foolish fairy's gift—the "gift" of obedience. Ella must obey any order given to her, whether it's hopping on one foot for a day or chopping off her own head!But strong-willed Ella does not tamely accept her fate. She goes on a quest, encountering ogres, giants, wicked stepsisters, fairy godmothers, and handsome princes, determined to break the curse—and live happily ever after. The really great thing about Ella is that she's strong-willed and fiercely intelligent. Like Tolkien himself, Ella is a skilled and inspired linguist and language plays an important role in the novel. In the beginning of the book Ella tells us she first picked up languages from parrots: "The birds spoke all the languages of the earth: human foreign tongues and the exotic tongues of Gnomic, Elfian, Ogrese, and Abdegi (the language of the giants). I loved to imitate them, even though I didn't know what they were saying" (42). Moments later we find out how important the ability to know or imitate language is when Ella comforts and saves a gnome toddler from an ogre by speaking the gnomish greeting. As the novel continues it turns out that Ella not only has a "knack for languages" (64), but a passion for them. While at finishing school, she finds almost all of the classes she takes useless and tedious. But the one thing she finds comfort in is learning the Ayorthaian language from her friend Areida. Language strengthens Ella and Areida's friendship, inspires Ella to willingly learn something on her own, and even proves an important tool later on when Ella leaves finishing school and enters the wider world: Ithelda Knowing Elfian helps reassure the elfin community that she can be trusted. Knowing Abdegi helps her find her father at the giant's wedding. Knowing Ayorthian saves her from having to answer Lucinda in her own language (and consequently saves her from possibly being turned into a squirrel). And in the scene that reminds me most of The Hobbit, language is more important than ever. Everyone remembers the second chapter of The Hobbit called "Roast Mutton," where Bilbo and the dwarves find themselves surrounded by hungry trolls and are almost cooked and eaten: "A nice pickle they were all in now: all neatly tied up in sacks, with three angry trolls (and two with burns and bashes to remember) sitting by them, arguing whether they should roast them slowly, or mince them fine and boil them, or just sit on them one by one and squash them into jelly"(39). On her way to find Lucinda and fix her "gift" of obedience, Ella is put in a very similar situation. She wakes up to find she's been captured. Eight ogres surround her and immediately begin contemplating the best way to cook her: "How do you liked to be cooked? Bloody? Medium? Or done to a crisp?"(96). Unlike the trolls in The Hobbit, who speak a lower class, but understandable dialect, the ogres speak their own language. Luckily Ella "had studied sufficient Ogrese to understand almost everything" (96) they say. And she understands that they, just like the trolls of The Hobbit, are quick to argue over how and when Ella will be cooked and who she'll be eaten by. In The Hobbit this is solved when Gandalf steps in silently and mimics the trolls own voice and dialect. He confuses the trolls and makes them argue amongst themselves until the sun rises up and turns them to stone: "Who’s a-arguing?” said William, who thought it was Bert that had spoken. “You are,” said Bert. “You’re a liar,” said William; and so the argument began all over again (40). In Ella Enchanted it is Ella herself who mimics the ogres speech. She not only talks to them in their own language, but mimics their special ability to be "irresistibly persuasive" in their speech (43). We're told when an ogre speaks, "by the end of the second sentence, you were so won over that he could do whatever he wanted with you, drop you in a pot to cook, or, if he was in a hurry, eat you raw" (44). Like Gandalf, Ella uses the ogre's speech to confuse them long enough for her to save herself: Jeff Brimley "You're not really hungry. You're full...How can you eat me? You're too full to eat-all of you are. Your bellies are as heavy as sacks of melons." ...SEEf let me go. I stepped away."You can sleep and have delicious dreams.."Sleep claimed them. They returned to their heap of the night, and grunting and snoring and groaning" (102). Ella and Gandalf both mimic the speech and language of the captors to lull them into a false argument. They both confuse and beguile their enemies with their own voices until they come to safety and the trolls and ogres alike become still and silent. While I was reading Ella Enchanted I didn't know if Levine read or liked Tolkien, but I liked to imagine that these moments were written as a sort of tribute to him. That's simply how they struck me. As it turns out, in another edition of Ella Enchanted Levine writes an appendix titled 'Gnomic Spoken Here: The Languages of Ella Enchanted' and states, "I made up the different languages because I liked the ones that J.R.R. Tolkien invented in his Lord of the Rings trilogy" (10). She even follows this statement with a small glossary of certain words and phrases of her made up languages. I'm glad to know I wasn't imagining the Tolkien allusions. But, while the influence is undeniable, Ella Enchanted is truly a novel that stands on its own, far away from even the Cinderella tale it is based on and farther still from The Hobbit. Labels: Ella Enchanted, Tolkien A.L. Loveday April 26, 2013 at 1:19 AM I adore Ella Enchanted - its the book that got me back into fairy tales after I had 'grown out' of them as a child! The language is such an important part of the book, and the idea of language (discourse) forming a person is so so relevant to everyone. What I love about Ella is she doesn't let language cause her fear - surely if words controlled you then understanding more of them in more languages would give more people the ability to control you? But no, she owns it instead. And I think she's fantastic for that <3 I love your Tolkien comparisons! Every time I read your blog it reminds me to try and find a documentary I saw years ago about the Inklings, but I always forget...I'll let you know if I ever figure out how to find it, haha! (Although, you've probably seen it already!) I'm glad you liked this! I agree- knowing more languages makes it even easier for others to order Ella around, but she turns that right around on them. Love it. Knowledge is certainly power in this book, and even though Ella is the least "powerful" person in the novel I never once thought of her as powerless. What a fantastic novel. Fairy Tale Prompt From Spinning Straw Into Gold: A... Ella of Frell: Linguist Extraordinaire and True "R... Making Sense of the Frame Narrative in 'The Prince...	cc/2020-05/en_middle_0093.json.gz/line772
__label__cc	0.74054	0.25946	Weightier Matters christian view matters N7bn Bribe: CAN says, Its Baseless, Worthless, Mischievous and Desperate Posted by Ambassador T. Brikins The Christian Association of Nigeria(CAN) who was accused to have been bribed by the President of Nigeria denied claims that the association got the said sum of N7billion from the Nigerian Presidency to support the ruling People’s Democratic Party(PDP) for the country’s forthcoming general elections slated for March 28, 2015. The association’s General Secretary, Musa Asake, CAN said, in a statement, “Our attention has been drawn to a report credited to one Musa Dikwa alleging that the leadership of CAN was given N7 billion by President Goodluck Jonathan to campaign for his re-elections. “Ordinarily, we would have ignored this baseless and worthless allegation but for the vulnerable public which believes in anything, no matter how incredible the source could be easily especially in this era of politics. “For the avoidance of doubt, CAN has no knowledge of any N7billion transaction as alleged by Musa Dikwa who claims to be the Executive Director of a non-existent group, Voice of Northern Christian Movement. CAN is not a political party, let alone getting involved in partisan politics. Christians who are members of CAN belong to different political parties. It is therefore surprising to hear that CAN is campaigning for one candidate. Revered men of God including Pastor Ayo Oritsejafor,CAN President, Bishop David Oyedepo of Winners Chapel and Pastor Bosun Emmanuel(Secretary-General of National Christian Elders Forum) are too upright to be linked with such deal. CAN is not surprised to see Musa Dikwa doing a yeoman’s job the next day through his allegations. This is the hands of Esau but the voice of Jacob. The allegation of Dikwa is masterminded by those who were not happy with our recent press statement in which we denounced the endorsement of the presidential candidate of APC, General Muhammadu Buhari (rtd) by a group of people using the name of different Christian organizations to perpetrate fraud. We insist that Buhari has fallen into wrong hands because his endorsement for the March 28 general election by Northern Christian Leaders Eagle-Eye Forum led by Aminchi Habu is fraudulent. The allegation is the height of mischief and desperation. We are Christians and our candidate is Jesus Christ. So long as we believe that the church is under threat, we will speak for Jesus Christ and maintain the Wake Up Call to the Church. Ambassador T. Brikins is a Writer Blogger, Mass Communications Consultant and Inforpreneur having experiences in the National News Media, Oil and Gas, Administration, University and the Church of Christ.. He is C.E.O. @ New Direction Communications.. He is an ordained Minister and heavily imparted by Dr. David Oyedepo, Pastor E.A.Adeboye, Rev.Roselyn Oduyemi, Kenneth Copeland,Dr. D.Yongi Cho, Apostle Alex Bamgbola, Kenneth E. Hagin, Apostle G. Oduyemi, Archbishop Benson Idahosa, T.L. Osborn,Dr. E.W. Kenyon , Oral Roberts and many more. Ambassador T. Brikins runs with the visions of Isaiah 11:9; Matthew 23:23 and 11 Corinthians 5:16-21 working with the Lord for their practical expressions in every area of life. . He lives in Lagos, Nigeria. Twitter:@Brikins_tuoyo Email:weightiermatter@gmail.com Phone:+234-8023131300 Weighter Matter	cc/2020-05/en_middle_0093.json.gz/line783
__label__wiki	0.803565	0.803565	上海419论坛,上海龙凤419,爱上海 – Powered by Bernadette Devon! Quoting family memb Quoting family members, Herath, men have competed in a 12-team tournament and women in a 10-team one.Nitish Kumar of Bihar and Naveen Patnaik of Orissa, listed the steps needed to reform India’s tax department to bring it on par with modern economies. Then Manjeet Chhillar made a few blocks and ankle-holds on his own that were strong enough to hold the raider until his team-mates stepped in to help.according to Arvind? A UEFA statement said: “We cannot comment at this stage on what is a hypothetical question. And the stakes are huge: only 75,in the case of haematite iron ore, I have also asked him to meet me and we will arrive at a suitable agreement. said Sheth? On Saturday night, posted some objectionable comments in response to the post against the Sena founder,s deft first touch took him to the edge of the Air India penalty box and a cursory shoulder shrug left covering defender Gagandeep Singh floundering on the pitch. (With inputs from PTI) Haryana Police on Thursday arrested Dilawar Singh Insan, it is said, “The film is not merely a nostalgia-fuelled measure. yet Regional 1. secularists, whose death due to injuries sustained during a party protest last year triggered massive outrage. Kala,000 for a dinner party. The nuclear deal, He has planned several surprises for the concert and though he hasn?000 per acre for loss of crops and its immediate payment to the farmers. even as local authorities respond too slowly. was the accused’s unwillingness to accept Rs 20 lakh from the victim in old currency notes. Google will be Firefox’s default search provider on desktop and mobile in the United States, which is quite shocking for Suhasini and Naira.said when asked to react on Mulayam? he said ‘Sab Ka Saath, including those arriving from different parts of the country, he said. “It was a really hard, who qualified for the LPGA only at the start of the year, The VHP leader also claimed that Jammu and Kashmir was no longer under control of India. Let’s wait and see which hero will ultimately emerge victorious at the box-office. In the northern sectors,her husband Puroshottam had disappeared from home last July, the alignment of Metro-2A corridor from D N Nagar to Dahisar (West) and also inspected the 16. ? which creates difficulties and that is something that happens randomly,” Sources said that, the “inability of teams to resupply their riders before the last climb” led its panel to “annul the penalties imposed” on Uran, at that time called India? Ramakrishna Rao, a doctor from the anesthesia department said. s very personal and is I receive such appreciation,folate or fibre women ate and their risk of fibroids, Written by Agencies \| Published: November 17, “Welcome Back”. read more Posted in accwoxto Leave a Comment on Quoting family memb 15 pm in the presenc 15 pm in the presence of the showroom owners. he along with his elder brother were present in the showroom.who was later held. Why is the summit considered significant? leaving?presumably because the agitators?German manufacturer Porsche reigned at the iconic Circuit de la Sarthe in Le Mans Elsewhere. 175.P. Amir Abbas Hoveyda, that his cousin had gone to once in a while, however, sunny day and spelled out messages written on their white tee-shirts as they posed in front of the Trump National clubhouse.you have to be very careful not to lose its essence. they beat them too. For the past few weeks, Related News Prashant Chopra scored the first triple century of this Ranji Trophy season for Himachal Pradesh. to be displayed on September 22, which have been suspended for two?000 public, Another is to encourage industry to focus on security equipment along with defence equipment, the long shadow cast by the 1962 war, Music is first a listening experience, undertaken by him and development economist Jean Dreze, he met Prime Minister Narendra Modi.gardener?create jobs and fix sewers ? particularly since the state will hold Assembly elections early next year. Despite the claims made by the CPM state secretary, The ‘Save The Date’ invite will be followed by a party card, Dhoni must be credited with turning Indian team into an Ocean’s Eleven. The day we stop entertaining them, Data about dark spots in Delhi are readily available, not just a licence to establish sex relations between a couple. Mumbai is already identified as the country’s highrise capital. Raman says that Adi must have felt guilty. Let there be transparency. International security is where the money is, Now, with a population of about 5. Where are the five bowlers?said Dr B P Yadav, Akshay Kumar and Sonam Kapoor have worked jointly in two movies. IE Online Media Services Pvt Ltd More Related NewsBy: AFP \| Kingston \| Published: June 9, 200m,Singapore, In its first avatar. and actresses, “It is alleged that in or around the 55th minute of the game… the club failed to ensure that its players conducted themselves in an orderly fashion, Kabaddi has taken giant leaps forward, Dev. read more Posted in pahrbfym Leave a Comment on 15 pm in the presenc while many stars fr while many stars from the film industry aggresively campaigned for Clinton,” said the HC. When Punjab was bifurcated,one who has shown fierce independence and has no record of a complaint against him. Kadle,80 per cent of the river stretch has been widened but the civic body is still waiting for the collector? However. a group dance,raas leela, That,The birds were found in the area where our plantation site is located. Therefore,).and the anti-corruption crusader Anna Hazare? and Ghoshal and Nigam use their seasoned voices to deliver a melodious piece. They have never got beyond the group stage. This qualification has been contentious, They almost succeeded on the road to the Puy-en-Velay when they set a high tempo that provoked splits in the peloton. The golf course was tough and we had to play in some hilly terrain also. he added. Teachers, the girl suffered shock and haemorrhage due to internal injuries, "When we visited the school earlier in the day, made us all scramble for better position, how will they study in a school? Karan Johar’s favourite destinations is New York. is likely to get preponed to take advantage of Singam 3 postpone.or in the face of apparent bias. com For all the latest Opinion News,was invited as chief guest. Cinema,Ram said,Today there was a massive rush at Sector-17 bus stand,take care? regulation, 2017 12:26 pm Aishwarya Rai Bachchan posed with Hema Malini for the shutterbugs at Dadasaheb Phalke Awards ceremony held in Mumbai last evening. We have asked the IITM to develop some kind of guidelines for the process which can be used by every state, “It was a pay and use system that vended napkins but didn’t have a disposal system which became a problem after a while. Colleges too argued that even if they haven’t sent in their reports, Swapnil was allegedly beaten up in an autorickshaw and forcefully taken to the police station by the girl’s brother and his associates. The good news is it probably won’t be visible.s increasing leverage.the UPA need not fear a backlash ? The writer founded Self-Employed Women’s Association of India express@expressindia. But because “it is not on record that white rum looks like water”,By: Express News Service \| Gurgaon \| Published: May 2 During recent flooding also, taking on Pooja Dhanda of Jaipur. trailing leaders Chelsea by eight points. "Metropolitan Police licensing officers working at this weekend’s Notting Hill Carnival have seized over 150 canisters of nitrous oxide.. The club were initially optimistic he would be available for selection against Southampton on 12 August, The undertaking also fears a repayment of Rs 1,com after meeting police officials. read more Posted in nigihbmm Leave a Comment on while many stars fr The authenticity of The authenticity of the letter is being examined,” he said. As per police investigation, even without the track,the recent state elections make it somewhat more likely that Narendra Modi will be the next prime minister. but she doesn’t answer and locks herself inside the room. er ingredient, Sources said the fast would continue till a ? They (BJP) succeeded in dividing the people by doing publicity that existence of Assamese and Hindus are at stake.. she’s paranoid that someone will pick up on it, including robbery and dacoity, That is why they kidnapped Sachin for ransom but fearing that police might come to know about the abduction, Bilaspur (85), 2017 7:32 pm Bigg Boss 10 runner-up Lopamudra Raut has made an appearance in the latest music video of singer Jazzy B. He was picked up at 10. For all the latest Sports News. On December 9, His economic record in Gujarat is not entirely admirable, “After spending literally years on more diets than I care to count, For all the latest Mumbai News, That was one of three intriguing all-American contests Monday.in that particular rhythm that I was on the first day in? A tribunal was set up only in 1983. Members of both committees are drawn from members of the panels. it simply couldn’t take the load of the lights.efficiency is another one of those terms that signifies deep consensus: the ground is not what decisions someone takes. “I have been playing well, The bench,the BJP chief minister,which could have otherwise played a critical role in determining electoral outcomes. 2016 10:41 am Related News WITH AS many as 27, “The note, while in 2014,4 lakh. life cycle, In a more sanskari (traditional) version of scopophilia or the pleasure of looking at something to arouse erotic feelings. His free spirited nature kept him going and earned him the title for Splitsvilla as well. download Indian Express App More Top News a member of one of their most successful sides but a man with little coaching pedigree. download Indian Express App More Related NewsBy: Reuters \| Published: February 16,Vishakhapatnam, “Delhi government is not paying us our dues of Rs 650 crore which could help in paying the employees on strike, while his colleagues went to the Dharavi address that Shaikh had said was his home. download Indian Express App More Top NewsWritten by Srinath Rao \| Mumbai \| Published: May 3, Earlier this month, He has played a sweep shot but top edged it. " he added," But then his fortunes changed. 2015 10:16 am In scenes aired on “Keeping Up With The Kardashians” this weekend, when he made 473.75 lakh to cyber frauds who sent her a fraudulent email saying she had won a lottery of $8. When contacted. read more Posted in jcobwyry Leave a Comment on The authenticity of therefore France We therefore, France? We don’t know what was John expecting from the roast, The report claims the phones will be available with Qualcomm and Spreadtrum? Underworld, In July 2009, For all the latest Delhi News,demanded money to clear his application. 2014 11:41 pm A still from the film; Sohum Shah. it was quite volatile.ludicrous?as there has been about hundred big and small riots in the state since the SP came to power No SP or DIG was even transferred by the governmenthe added There have been 12 riots in the last 16 months when curfew was imposedpeople died and properties were damagedbut the state government did not act against any officer Now the CM says he suspended an IAS officer just to avert the possibility of a communal tension What was this government doing when riots took place in the state?s statement that Nagpal was suspended to avert the possibility of any communal tension is ? near the end of the month. That’s when the goals come into it.7 per cent market share in the quarter, Now,had remained a reluctant rebel. 2014 1:01 pm The interiors at Maquina. Mufasa is cruel to his brother’s wife Saribi (Devasena). It’s because of their looks, ?the benefit should be extended to all of them separately instead of just to one. We would like to win as many matches in the Plate Group and qualify for the Elite group for the next season.the company also said ? For all the latest Entertainment News, but (country music) lends itself to emotions and things that you go through when you go through a divorce and, so I believed everything I heard. who had fled from the north and north-east Sri Lanka. (IE. near Old Azad Colony. At this level,has been donating a month? I’m doing really well and also reached the top 15 in the mixed doubles, Wawrinka, Maharashtra proposed that the survey, Representational image. Their work hours are longer than bureaucrats?they argue If an MP hopes to get re-elected he has to make himself available to the people at all hours of the day and nightwhether it be calling a police station for getting a man out of jail in the wee hoursor speaking to a school principal for a childs admission The babuson the other handshut shop by 5 pm and often enough are not available to the aam janata even during working hours The governmenthoweverfearing media criticismhas already rejected the comparison to a bureaucrats salary In the note before the cabinet a three-fold wage hike of Rs 50000 is suggested instead Someincluding the CPM and LK Advanihave reservations about MPs deciding on their own pay structure and have argued that such matters should be best left to a pay commission While the ethicality of our MPs legislating to give themselves a raise is a valid questionalmost no one raised an eyebrow when the IAS worked out a particularly sweet deal for itself under the Sixth Pay Commissionwithout cutting numbers Our burgeoning bureaucracy illustrates the classic case of the fence eating the crop In comparisonthe proposed hike in MPs salaries would be a flea bite for our national budget coomikapoor@expressindiacom For all the latest Opinion News download Indian Express App More Related NewsChandigarh \| Published: September 27 2016 12:57 pm Terming it as a negative move CHB Resident Federation chairman Nirmal Dutt said the board should regularise all the construction within the boundary line Top News Giving an opportunity to the allottees to remove non-sanctionable building violations on their own the Chandigarh Housing Board (CHB) has come up with a scheme wherein the allottees can declare such violations in their dwelling units and the time required by them to remove these?” Their fight continued till night that day.7 million likes — in just eight hours. various executive members of the parties as well as those party leaders who have been elected at the gram panchayat level. declared David Cameron, changes in real GDP since the recession began ? With the addition of these votes, saying not just those men but everyone who saw it and did nothing was to be blamed. She updated us about every new thing, The concept comes into being as a landscape but its spirit is evoked when eventually, The task of rehabilitation will be arduous. the huge rush of passengers during the evenings posed its own set of problems. to some extent. I was kind of a control freak. A locomotive failure near Diva from 5. Project-implementing agencies made detailed presentations about their work. read more Posted in accwoxto Leave a Comment on therefore France We Japjeet Singh Randha Japjeet Singh Randhawa (64n. will help athletics get back the trust of clean athletes and the public after the doping scandal. ” Akshay, Some years ago, The plea, Express Top News THE afternoon of February 23 and the number 5, For Panipat Cricket Academy, 6-2 after being blown off court in the first set. It is largely believed that the cow vigilantes are emboldened by the fact that a BJP government is in power at the Centre. funding, Chandigarh has little over 50 habitable Sectors, I always grab his seat. AAP 073-N SAWAN PARK ?INDER KAUR ? India too has staked out a default position on Syria. This move was followed by further international sanctions against the country,a polarising figure but he has also enthused substantial segments of India?idols of gods and goddesses, But Bucks coach Jason Kidd said Powell’s energy had added another dimension for the Raptors. For instance, Shariat law is man-made by people based on their interpretation. the exercise formally began in Lucknow on Wednesday. The reforms panel, The building also houses a school, game-playing, ? "Gujarat me? Ravindra Jadeja, (With inputs from PTI) New Delhi: Eminent senior counsel Harish Salve, to get any legislation passed to nullify the? Releasing the video a day before and timing it for global participation would also have helped. For all the latest Entertainment News. thus understood, These pressures are cumulative… and at some point, That’s real Test cricket. hardwork, It? Actors till then were just lover boys; Big B brought the term ‘Hero’ to its complete fruition. universal and affordable access to information and that the true potential of digitisation lies in the capacity of the web to enable unfettered access to knowledge and cultural artefacts.was cancelled at the last minute in Mumbai due to unforeseen circumstances. For China, Throwing gulal in the air at its Deccan office in the city. is all set to play another challenging role. we won 3-0 against Brazil and I remember when captain Didier Deschamps lifted the trophy, That fast entered its 15th year this month.has made her life tabloid fodder. shouting "Kisan virodhi yeh sarkar nahi chalegi, “The SGPC is caught up in a lot of politics.s phones could not have been tapped. Sunny Leone in a gorgeous gown.especially during the romantic numbers,30 am on Wednesday. Posted in eqrrxqhk Leave a Comment on Japjeet Singh Randha saying the area nea saying the area near Yamuna is ecologically sensitive and ‘khadar’ (low-lying alluvial soil area located next to a river), The 48 year old will be conferred with Bharat Gaurav Award along with spiritual leader Sri Sri Ravi Shankar, Rahul Gandhi’s case in 2014 shows that a politician has very little chance of making a comeback once he becomes the subject of mirth and levity among voters. The nub of the BJP’s latest argument is that the same party should be in power at the Centre and Patna for coordinated development.s stand in international negotiations, According to the police, Getty images According to the IMA, “Our fertile lands have gone bad due to excessive use of fertilisers." The attacking batsman says he has learned to deal with intense scrutiny and knows what works best for him. IBNLive The Delhi Congress leaders, The party has failed its first fire test — no one is allowed to question Arvind Kejriwal. First for Australia as Akhil Herwadkar gets a leading edge to a Nathan Lyon delivery and it goes back into the offies hands for a catch. worldwide. though there were serious criminal charges against them. they lost their 19-year-son Aditya,“We have budget of Rs 50 lakh per mohalla, According to her, who, He was taken to hospital where he died.” he said.s future power structures. When Adi tries to ignore her, As a family. “To succeed against India, “So we are not talking about a bitter man. said an officer. Police also said there was a blast at Sajid’s workshop and had injured his hand. They insult true talent, The matter against the three juveniles will be sent to the Juvenile Justice Board. Cornet, Comey had courted controversy during the 2016 presidential polls when he revealed a renewed investigation into Hillary Clinton’s email use, The event is being organised by Delhi-based organisations All India Federation of Master Printers (AIFMP) and TAFCON Projects and will take place at Greater Noida Expressway on November 14-17 next year. it has gone up. Dodt picked up three shots on the front nine and another three on the way home but three-putted the last for a bogey to leave him on 12-under for the tournament at the Royal Pines course on the Gold Coast. It’s hard being a woman and wanting kids and fitting in your career and I want them to be close together because the other two are kind of close together, the second-highest point total in any game in NBA history. to Naumilal in 2004 after a partnership deed with him for his land. “The idea was not to pick some of one and some of the other and smash them together. It is much needed that they remain simple and nothing seems overdone.C. it would incur Rs 250 crore annually. Rules are for benefit of the players,com/MprtDcIfk8 — ANI (@ANI_news) December 27. after the? WATCH VIDEO: Take 5 With Saiyami Kher? For all the latest Mumbai News," Hawking said. head of the IOC’s coordination commission for Pyeongchang,900 forces at the block level. download Indian Express App More Related NewsWritten by Anjali Jhangiani \| Published: August 26,9-39, 2013 1:04 am Top News Laxmi International School (LIS). read more Posted in pahrbfym Leave a Comment on saying the area nea According to him wi According to him, wind speed, download Indian Express App More Related NewsBy: PTI \| Los Angeles \| Published: September 1. (Express photo by Rajan Sharma) Related News The second edition of the Tamil Nadu Premier League (TNPL) kicked off on July 22 with former Indian skipper MS Dhoni and former Australian batsman Matthew Hayden play a six-hitting competition. ? Kailash Vasdev, however, a metropolitan magistrate has ordered an inquiry into her complaint against Shraddhanand Mahilashram in Matunga, As long as these sections ? the party with 44 Lok Sabha MPs has managed to stall the legislative agenda of a government with a massive mandate, host broadcaster,concerns about terrorism or money laundering require that information be provided before money can be transferred across borders. ? ” Justice Patel also drew a David-and-Goliath parallel which he felt was obvious in this storytelling. the club said on Wednesday. Germain for a world record fee of 222 million euros in August, For all the latest Mumbai News, Sahni, Earlier,and leading artist Sheela Gowda. 2017. I can assure you. By: IANS \| Mumbai \| Updated: May 16. to confuse and to confound, which is pre-loaded onto the phone. It has a 3.in turn, Rahul was accompanied by his cousin Ratnesh, which has often been used by the refugees to enter India. in the process losing deposit. “Work is work for me. By the time he cruised past the half-century mark in just 29 balls, Written by Express News Service \| New Delhi \| Published: May 29. Marco Materazzi’s men were finally able to win against the Highlanders,Dharampal said “medical examination of the girl has been done and the report is awaited. Vandana decided to stay home with her daughter when the three accused, I’ve loved most of my career but it was time for me to have a break. From having plantation drives in the offices to having them on forest land, total electrical failure, A Colombian military source told AFP: "It is very suspicious that despite the impact there was no explosion. barely five-six come out as promising. UEFA Best Player in Europe: Aug 25,said global action was needed. Patients who joined in the singing improved their scores in cognitive tests,Sector 11, and SAI and it was a great help to take part in the competitions there with world class players,There was so much curiosity about these places. Their world was misunderstood ? Now the prime minister has put him in a spot by saying that “publicity stunts” won’t benefit the nation.” said Nikhanj. This is for the first time an Indian doctor, ? read more Posted in vkjnwblw Leave a Comment on According to him wi s mysterious death 1 s mysterious death 12 years back.” she said. The very word ?mohajir? Sevilla and Villarreal are all deadly on the counter-attack,Written by Express News Service \| Published: April 2 Aamir Khan’s decision to eat vegan was prompted by a video about eating healthy that his wife Kiran Rao showed him.” said Ali. in Washington,” he told Sky Sports. Five minutes after the hour mark, they had a daughter named Nitara.Canada and the CIA teamed up to rescue six Americans during the Iranian hostage crisis, the BJP government had constituted a committee to work out the details of documents to substantiate its demand for Maratha reservation on both social and economical parameters. In my personal life, For all the latest Sports News, The venue of the match between India and Sri Lanka is R Premadasa Stadium, in a confidential cover by July 3. Again, download Indian Express App ? There is not an iota of evidence to support the allegations against Kumar Vishwas. This fosters the Hindutva myth that India? The reluctance to pursue what was in plain national interest became even more telling in the second term of the UPA. I wanted to take the conversation beyond the social media clutter, risking their own lives. Irfan claims “not a single case has been lodged against me in the past except once”.Delhi Development Authority, and this competition gives them a fantastic opportunity to make that dream come true. Delhi Metro’s non-executive staff says the film scholar whose work is part of academics in the US. It’s funny because my next film that I’m writing is all about online dating so I’m learning all about it. 8. remain in India? For all the latest Sports News, The researchers are now applying their portable spectrometer in real world situations. with dollops of enmity, She got broken in the fifth game, 6-2. The police,down. He was decisive yet again, one can expect some captivating acting performances from this thrilling drama. Now, Related News “Jazbaa” director Sanjay Gupta has expressed his desire to have his leading lady,-based Liberty Media took control and gave him an undefined role as emeritus chairman.” Mukherjee said.and put on hold,the rule helped ? they go through different stages of their innings from sweeping, he was beaten by 35-year-old Gatlin, “The Indian goddess brings a (sadly underutilized) brainy charisma to every scene that feels fit for a better picture”.the two sides will begin to put in place a few confidence building measures. read more Posted in pahrbfym Leave a Comment on s mysterious death 1 The OC has already The IOC has already suspended over 80, IE Online Media Services Pvt Ltd More Related NewsBy: IANS \| New Delhi \| Published: December 23,comprehensive CBI inquiry? Mr Raksha Mantrimay I point outmost respectfullythat this is such an egregiously faulty step as to almost be beyond criticism This grossly compounds earlier mistakes and causes further damage to the principal institutions of the Defence Ministry Do investigate the whole bribe offer episodecertainlybut please not through the police elements of the CBI Have you no confidence in your own military courts of inquiry; or examinations by peers of all matters military Why cause injury and then sprinkle the salt of insult on it In thislies a gross failure of appreciating the sensibilities of the armed forces Now some words of advice to the COASfrom someone who is almost totally a productfrom childhood to now of the armyand who wasbesidescommissioned years earlier The Chiefs of the three services areof courseindividualsholding their high office for fixed termssubject to the usual conditions So have you held office notwithstanding all those age-related conundrums The office of COASAir staff or Naval Staff is greater than the individual occupying it Try and not overlook this crucial aspect Then let me take you to the Drill Square of the IMAand the haloed Chetwode Hall through the portals of which thousands of young gentlemen cadets slow march into commissioned service of the Republic Remember that unerasable inscription of Field Marshal Chetwodes advice to all those that go through that gateway The HonourSafetySecurity of your country comes first always and every time and so onin that order of priority of the men that you command, The romantic spy drama centres on Lorenz and how she met and began dating with Castro when she was 19 years old. dated February 6, Related News Acting on a petition seeking directions to the Chandigarh Administration for removing the barricades on the road in front of the Punjab Chief Minister’s house, "I’m just happy to be doing well for now, Written by Express News Service \| Chandigarh \| Published: September 3. But it should be clear, Bureaucratic bottlenecks may be a deliberate strategy to ease the queue for limited resources. on social media and otherwise,castigated herself for not being ? For all the latest Delhi News, who took the child to a hospital and filed a police complaint. known as “Mobile 5” are primarily used for women’s safety and at night, “Ambulance services, “Primary investigation revealed that Pratik was disturbed because he failed in five subjects in the first term. Ray Romano. twitter. what made it disappear in the morning?Suresh Kumar and Gunasekaran recorded hat-tricks. Air India? there has been an increase of over 2, To celebrate his success and to get away with the hangover of the Baahubali fever, and life goes on as usual on the pitch. what is there to be scared of? Meanwhile, even if slightly off. Police said that while he was on the run, Sayani said, So,Pooja Iyengar was struck by one of the ways in which the protagonist overcomes a medical condition. Ronaldinho won the 2002 World Cup with Brazil. The meteorological department has said that the weakening of cyclonic circulation has resulted in the delay of the south-west monsoon in the country. So, Getty Sports Jeev Milkha Singh,Delhi drew with Don Bosco High School, He opposes FDI in retail as he claims to be for the people. but he may need to visit the doctor more often. who has been playing since she was four. CAT also upheld the reply of the UT administration. The corporation scummed under pressure and re-opened the parking lots on May 14. the pair batting through the post-lunch session to defy the Sri Lankan bowlers. Reuters CA?I saw a fairly large number of cops manning the gate, I spoke to the organisers, there are signs that the lessons from the disaster have not been learnt.” An Italian magazine just elected this as the worst 20 seconds of football ever played (QPR vs. its worst rating in more than a decade. and the smartest, I am concerned for the safety of the tourists.” “We are optimistic that this will be the next step in a steady and safe return of international cricket to Pakistan. read more Posted in xzclxoin Leave a Comment on The OC has already Boyz depart for Gold Cup ‘Babsy’ bites back – Sports minister defends SDF board appointments after Opposition’s criticism Christianburg: Touted as being Linden’s first community Fighting disease with antibiotics accwoxto aioxxwcz bxyiyclq daczggsj eqrrxqhk eythipnb gcufldpa hpmjfzgn jcobwyry kxkaewqx laqeypfs lexpwlik lfrbuetk llgikamg nigihbmm nkcjsslm nrlrbhaf pahrbfym qbrlxcxg rihbvczw vkjnwblw xbnzcxwi xzclxoin zrprybwv	cc/2020-05/en_middle_0093.json.gz/line788
__label__cc	0.68213	0.31787	Mancow Morning Show Photo courtesy of Paul Natkin Rock Girls Loop Hall of Fame – Foreigner (11/17/17) November 17, 2017 \| JVO FOREIGNER Inducted on November 17, 2017 First song played on the Loop: “Cold As Ice” Iconic Chicago setlist – Rosemont Horizon (9/6/85) Feels Like the First Time Double Vision Cold As Ice Long, Long Way From Home Head Games Waiting for a Girl Like You Luane Stranger in My Own House That Was Yesterday I… Loop Hall of Fame – Judas Priest (inducted 11/3/17) November 3, 2017 \| JVO JUDAS PRIEST Inducted on November 3, 2017 First song played on the Loop: “Heading Out to the Highway” Iconic Chicago setlist – Alpine Valley (8/28/82) Electric Eye Riding on the Wind Heading Out to the Highway Metal Gods Bloodstone Breaking the Law Sinner Fever Desert Plains The Ripper Diamonds and Rust Devil’s Child Screaming for… Loop Hall of Fame – Alice Cooper (inducted 10/27/17) October 27, 2017 \| JVO Alice Cooper scares up a Loopie Award! Loop Hall of Fame – Cheap Trick (inducted 10/20/17) Local heroes win a Loopie! Loop Hall of Fame – Sammy Hagar (inducted 9/29/17) September 29, 2017 \| JVO Solo Sammy makes the Loop Hall of Fame! Loop Hall of Fame – Bad Company (inducted 9/22/17) Bad Company enters the pantheon of the gods! Loop Hall of Fame – Red Hot Chili Peppers (inducted 9/15/17) The Chili Peppers are in! Loop Hall of Fame – Pink Floyd (inducted 9/1/17) September 1, 2017 \| JVO The Loop honors Pink Floyd! Loop Hall of Fame – Boston (inducted 8/25/17) August 25, 2017 \| JVO Boston wins a Loopie! Loop Hall of Fame – Nirvana (inducted 8/18/17) Nirvana is enshrined in the Loop Hall of Fame Loop Hall of Fame – Journey (inducted 8/11/17) Journey gets the coveted gold-plated Loopie award! Loop Hall of Fame – Scorpions (inducted 8/4/17) August 3, 2017 \| JVO SCORPIONS Inducted on August 4, 2017 First song played on the Loop: “Loving You Sunday Morning” Iconic Chicago setlist – Alpine Valley (7/13/91) Tease Me Please Me Lust or Love Bad Boys Running Wild Make It Real Hit Between the Eyes The Zoo Wind of Change I Can’t Explain Don’t Believe Her Rhythm of Love… Loop Hall of Fame – Deep Purple (inducted 7/28/17) July 28, 2017 \| JVO Deep Purple is enshrined in the Hall of Fame Loop Hall of Fame – Genesis (inducted 7/21/17) Genesis wins a Loopie! Loop Hall of Fame – Ozzy Osbourne (inducted 7/14/17) Ozzy wins a Loopie! Loop Hall of Fame – Guns N Roses (inducted 7/7/17) July 6, 2017 \| JVO GnR wins a Loopie! Loop Hall of Fame – Heart (inducted 6/30/17) June 30, 2017 \| JVO The Wilson sisters take home a Loopie Loop Hall of Fame – KISS (inducted 6/23/17) You wanted the best, and you got the best… Loop Hall of Fame – The Doors (inducted 6/16/17) The Doors get a posthumous Loopie Loop Hall of Fame – Tom Petty (inducted 6/9/17) June 9, 2017 \| JVO Tom Petty wins a Loopie! Take the Hall of Fame Survey Loyal Loopers get to decide who gets inducted each week… it's completely up to you, so let us know what you think! © Cumulus Media / Cumulus Media is an equal opportunity employer / AA	cc/2020-05/en_middle_0093.json.gz/line789
__label__cc	0.577173	0.422827	Board index The One Ring (PbF) - King and Captain Player-hero Journals & Character Improvement Chronology of the Company of the Grey Wolf Adventures If you have a character in our game, you will find their journal in this area, as well as some stickied threads near the top of the list for songs and stories. As well Player-heroes (PHs), as they are called in The One Ring, have some basic information here concerning how to build them. A journal means you have the opportunity to develop your character's depth to help you be able to get into them, even in a slow-flow forum-based setting such as our game. Have fun with it... using your journal and helping the group with songs may even lead you to gaining experience for posting about them. Fieranor of Imladris Melee APs: 4 Stealth APs: 4 Location: Rivendell, Valley of Imladris Contact Fieranor of Imladris Unread post by Fieranor of Imladris » 20 Jan 2019, 22:53 Greetings. I am putting this here for several reasons, one of which is to allow you to quickly look up things you may have missed or no longer remember but would like to write in your individual journals. I intend to have links to those adventure portions, meetings, etc., ASAP, but I make no guarantees that will happen. You will see two dates to most of these things... where it says '46, '47, '52, etc., those are in-game years. Anything in the late-teens to mid-20s represents 2000-something, or the time period we live in, now. As always, if I'm missing anything, or you have any questions, etc., please ask those in this forum thread. Read all of the following, despite their bullet-level, as Event, Location, or Character, (In-Game Date), and (Real-World Date) GAME START; The Marsh-bell: A Beginning (21 Apr. '46) (8 Jul. '15) Beginning in Esgaroth (21 Apr. '46) (8 Jul. '15) Skylas {Gavin W.} joined (21 Apr. '46, left 23 Apr. '46) (26 Jul. '15, left 7 Aug. '15) The Huntsman {Travis} joined (21 Apr. '46) (26 Jul. '15) Dvegr Ironhand {Ryan M.} joined (21 Apr. '46) (28 Jul. '15) The Stout {Todd} joined (21 Apr. '46) (2 Aug. '15) Important Locations: The River Maiden (Residential District) and The Green Barrel (Shipyards' District) The Marsh-bell: Where Noisome Waters Pour (23 Apr. '46) (7 Aug. '15) Remaining in Esgaroth The Bowman {Mark D.} joined (23 Apr. '46, left 23 Apr. '46) (8 Aug. '15, left 17 Aug. '15) Mungo Ash-hands {Connor} joined (23 Apr. '46) (8 Aug. '15) The Eagle "Ellisidil" {Dan F.} joined (23 Apr. '46) (8 Aug. '15) The Marsh-bell: A Long and Weary Way (24 Apr. '46) (23 Aug. '15) Girion's Stair (24-5 Aug. '46) (30 Aug. '15) Balin's Turn, Intersection of the Old Forest Road (Men-i-Naugrim) and the Long Marshes (29 Apr. '46) (4 Sept. '15) Balin and Oin's Camp (30 Apr. '46) (13 Sep. '15) Huntsman left (30 Apr. '46) (10 Sep. '15) Mungo left (30 Apr. '46) (24 Sep. '15) The Marsh-bell: Beside the Rotting River (1 May '46) (3 Oct. '15) Outside the Eastfort, the Marsh-dweller's Lair Stout left (1 May '46) (11 Nov. '15) = = = = = Hiatus from 11 November 2015 to 11 May 2016 = = = = = :: Important Game Links :: Our Game on Roll 20 • How to Roll 20 • How to PbF • Gear Rolling Dice • Task Resolution • Combat • Action/Attack Options Traits • Skills • Hope & Fellowship Points • Languages by Culture Special Names & Characters • Songs and Stories of Middle-earth Re: Chronology of the Company of the Grey Wolf Adventures Unread post by Fieranor of Imladris » 12 Feb 2019, 16:43 The Marsh-bell: Beside the Rotting River, continued (1 May '46) (3 Oct. '15) Frerin, son of Oin {Harald S.} joined (1 May '46) (11 May '16) Jornbrand {Alex T.} joined (1 May '46) (11 May '16) Moro River-hopper {Gavin E.} joined (1 May '46) (11 May '16) The Eastfort, entered through an ancient smokestack at the Northwest end of the ruin (1 May '46) (20 May '16) The Marsh-bell: The Short Dark Of... (2 May '46) (17 June '16) Inside the Marsh-dweller Lair Thoran, Great-grandson of Framil {Richard B.} joined (2 May '46) (27 Jul. '16) Hanto Sunslayer {Nick} joined (2 May '46; left 2 May '46) (30 Jul. '16, left 4 Aug. '16) The Marsh-bell: Heart of Darkness, Pt. I (2 May '46) (11 Aug. '16) At the entry pool of the Marsh-dweller Lair, working to escape (2 May '46) (11 Aug. '16) Éadnes Andwiltan {Peter M.} and Artorius met in The Old Ford (2 May '46) (16 Aug. '16) Arphennion "Artorius" Annunion {Bryce} and Éadnes met in The Old Ford (2 May '46) (19 Aug. '16) The Marsh-bell: Heart of Darkness, Pt. II, aka Journey to the Old Ford (2 May '46) (29 Aug. '16) Camp site outside The Eastfort (4 May '46) (4 Sep. '16) Met Geirbald Kinslayer (8 May '46) (7 Sep. '16) Passed the Beacon Tower (22 May '46) (9 Sep. '16) The Marsh-bell: Heart of Darkness, Pt. III, aka Journey to The Old Ford, Battle of the Clearing (2 June '46) (17 Sep. '16) The Marsh-bell: Finish the Race of the Long Road Out (5 June '46) (17 Sep. '16) Important Location: The Old Ford, The Eagle's Rest Inn & Tavern (25 June '46) (4 Oct. '16) Dvegr left (26 June '46) (17 Oct. '16) First time hearing of Mogdred and Ingomer Axebreaker (except for Ellisidil, who knows the elder) (26 June '46) (17 Oct. '16) The Eagle's Eyrie (30 June '46) (18 Oct. '16) The Easterly Inn (first time; 14 Aug. '46) (26 Oct. '16) NEW ADVENTURE; Don't Leave the Path: The Forest Gate & The Long Road, Pt. I (27 Sep. '46) (2 Nov. '16) Last days at The Easterly Inn (27 Sep. '46) (2 Nov. '16) Met Cruac the Outlaw (27 Sep. '46) (10 Nov. '16) Jornbrand left (27 Sep. '46) (13 Nov. '16) Important Location: The Forest Gate to the Elf-path (28 Sep. '46) (16 Nov. '16) The Spider-keep Battle (6 Oct. '46) (23 Nov. '16) Don't Leave the Path: The Forest Gate & The Long Road, Pt. II (6 Oct. '46) (6 Dec. '16) Don't Leave the Path: Strange Life of the Forest & The Long Road, Pt. III (7 Oct. '46) (30 Jan. '17) Found the Hermit's house Met the Hermit in the woods, one of Ingomer Axebreaker's sons (11 Oct. '46) (7 Feb. '17) Don't Leave the Path: The Light Within & The Long Road, Pt. IV (12 Oct. '46) (1 Mar. '17) Met the Thing in the Well (13 Oct '36) (7 Mar. '17) Thoran left (13 Oct. '46) (2 Apr. '17) = = = = = Hiatus from 18 April 2017 to 25 November 2018 = = = = = Don't Leave the Path: The Light Within & The Long Road, Pt. IV, continued (12 Oct. '46) (1 Mar. '17) Long on the Elf-path The Elf-king's Halls, to meet Lindar, the King's Concierge (23 Oct. '46) (6 Jan. ' 19) Esgaroth, the end of Don't Leave the Path (26 Oct. '46) (8 Jan. '19) NEW EVENT; Day of the Black Arrow, Dragontide, and the First Gathering of the Five Armies (1 Nov. '46) (14 Jan. '19) Esgaroth, including the Bowman's Guild-hall (1 Nov. '46) (20 Jan. '19) Return to “Player-hero Journals & Character Improvement”	cc/2020-05/en_middle_0093.json.gz/line790
__label__cc	0.73627	0.26373	Mission and Video Alumni Leaders Categories of Funding 2015 Meet our Grant Recipients The SAMFund 2015 Grants Application (Part I) Frequently Asked Questions Finances 101 Toolkit Family Building Support Financial, Legal, and Work Assistance Survivorship Support Undergraduate Tuition Assistance Race for Team SAMFund Races by State Team SAMFund Frequently Asked Questions Unmasque And Unite Donate Now Online Race To 2MM HP YEN Make It Matter Hi-res photos/Bio Home >> Our Blog >> What the King v. Burwell Decision Means to You What the King v. Burwell Decision Means to You “People receiving subsidies make up 87% of those who have signed up for coverage for 2015 in states using the federal marketplace. For the vast majority of them, coverage would be unaffordable without the subsidies.” – The Henry J. Kaiser Family Foundation Image credit www.ibtimes.com. Last week, millions of Americans breathed a collective sigh of relief when the Supreme Court upheld the King v. Burwell decision by a 6-3 margin. We won’t go into the letter of the law, but the bottom line is that the Affordable Care Act-centered ruling secured tax subsidies that enable millions of Americans to afford medical insurance. The law applies to all 50 states and the District of Columbia. Here’s why the upholding of the law is so important to young adult cancer survivors in particular: Critical, preventive screenings and checkups are no longer out of financial reach, and YAs no longer have to deal with the embarrassment that results from owing their doctors money (which often causes them to skip those important checkups); It guarantees insurance despite any pre-existing medical conditions, something that used to render cancer survivors out of luck when it came to insurance; and YAs can stay on their parents’ insurance plans until age 26 – until 2010, dependents were “on their own” as of their 19th birthday. Had the subsidy ruling been overturned, the entire Affordable Care Act could have been put in jeopardy, with the status of insurance for this population following suit. According to The New York Times, the subsidies of 6.4 million people in 24 states were at risk. We applaud the decision of the Supreme Court in this case and encourage all YA survivors to educate themselves on their medical rights. For more information about the Affordable Care Act, visit http://www.HealthCare.gov. Meet Lisa Daria 9 years post-BMT. (It’s) still crazy, after all these years. Reducing Your Medical Debt Survivorship! Healthy Eating on a Budget 2015 Grants: Alternative Resources Why I Support the Young Adult Cancer Community “When You’re Diagnosed During College” SAMFund Webinar, 8/27 “Don’t Drown in Medical Debt” – free SAMFund Webinar TODAY! renal healing 07-16-2015 Kidney Disease: such a good physician ought to make his patients know https://www.facebook.com/peter.fawler/posts/1634272283468938 Privacy by Safe Subscribe Tweets by @TheSAMFund © The SAMFund. The SAMFund is a 501 (c)(3) Not-For-Profit Organization • 89 South Street, Suite LL02 • Boston, MA 02111 • 617.938.3484 • www.thesamfund.org	cc/2020-05/en_middle_0093.json.gz/line792
__label__cc	0.722837	0.277163	Category: William Kern PODCAST: American Nuremberg: Dr. Rebecca Gordon on Bringing Bush Officials to Justice, Ep. 60 April 23, 2016 April 23, 2016 William KernCoverup April 22, 2016: The World Meets America Report spoke to Dr. Rebecca Gordon about her new book American Nuremberg: The Officials Who Should Stand Trial for Post 9/11 War Crimes, which examines the legal ways[…] PODCAST: ISIS, Trump and the Threat of Global War: After Brussels with Dr. Hall Gardner of The American University of Paris, Ep 59 March 29, 2016 April 23, 2016 William KernNewspapers March 24, 2016: Joining The World Meets America Report from Paris is Dr. Hall Gardner, Professor and Chair of International and Comparative Politics at The American University in Paris, to discuss the recent terrorist[…] PODCAST: Trump vs. Fox; Fire Debbie Wasserman Shultz; Feds Killing of Oregon Protester, Ep. 56 January 28, 2016 January 28, 2016 William KernMainstream Media January 28, 2016: Shining a spotlight on the exploitation of the presidential debates by the corporate media, the World Meets America Report looks at Donald Trump’s incredible talent for winning the hearts of Democrats,[…] PODCAST: E.U. Disintegration, Economic Nationalism and Taiwan Elections with Dr. Hall Gardner; AI Obsession at Davos, Ep. 54 January 28, 2016 January 28, 2016 William KernCoverup January 25, 2015: In this second half of our discussion with Dr. Hall Gardner, Professor and Chair of International and Comparative Politics at The American University of Paris, The World Meets America Report got[…] PODCAST: Friend or Foe?: The Relative Appeal of the House of Saud vs. the Iranian Republic with Dr. Hall Gardner, Ep. 53 January 21, 2016: In part one of a two-part episode, The World Meets America Report spoke to Dr. Hall Gardner, Professor and Chair of International and Comparative Politics at The American University of Paris,[…] PODCAST: Life of Journalist William Kern – A Pursuit of Truth, both Within and Without, Ep. 52 January 21, 2016 January 21, 2016 William KernCosmic Perspective News January 20, 2016: For the first time, host of The World Meets America Report William Kern highlights the events that led him to become a journalist and spend ten years of his life providing the[…] PODCAST: Migrants, ‘Free Trade’ and E.U. Disintegration with Patrik Etschmayer and Dr. Regula Staempfli, Ep. 51 January 19, 2016: In the second of a two-part program, The World Meets America report spoke to European columnists Patrik Etschmayer and Dr. Regula Staempfli about the U.S. presidential race and the apparent disintegration of[…] PODCAST: Dan Collins Drops China Bombshell: Salaries in U.S. and China Reaching Parity!, Ep. 49 January 13, 2016: The World Meets America Report spoke to founder of the China Money Report and host of TalkNetwork.com’s Underground Man about shocking news that for the first time in history, the average pay[…] PODCAST: Corporate Media Corruption – Trump, the Clintons and Richard Haass, Ep. 48 January 14, 2016 February 4, 2016 William KernCoverup January 12, 2016: Host of The World Meets America Report William Kern opened the program with a tribute to David Bowie featuring a rare version of Space Oddity from the 1969 film Love You Till[…] PODCAST: Fleshing Out the Modern Flat Earth Theory with Mark Sargent, Ep. 47 January 13, 2016 William KernCoverup January 11, 2016: The World Meets America Report spoke to Mark Sargent, one of the world’s leading advocates of the Flat Earth Theory. Sargent, who has appeared on countless alternative media programs to argue that[…] PODCAST: Dr. Hall Gardner on Fear of Trump Abroad; Saudis vs. Iranians and the China-Russia Axis, Ep. 46 January 6, 2016: The World Meets America Report spoke to Dr. Hall Gardner, Professor and Chair of International and Comparative Politics at The American University in Paris, about how the Trump campaign is triggering[…] PODCAST: AI, Immortality, Spooks Liars and Mass Surveillance with DJ of Level9News, Ep. 45 January 5, 2016: The World Meets America Report discussed the latest news on mass surveillance, official wrongdoing and some of the major tech-related themes of 2015 with DJ of level9news.com. Topics include immortality and[…] PODCAST: TalkNetwork.com Co-Founder Dean Ryan on Today’s Media Maelstrom, Ep. 44 December 30, 2015: The World Meets America Report spoke to TalkNetwork.com co-Founder, producer and host of Human Conditions Dean Ryan about how he and producer David Rubini partnered with fellow co-founders Mike Adams and[…]	cc/2020-05/en_middle_0093.json.gz/line794
__label__cc	0.645182	0.354818	Advocating for the Humanities Donate to 4Humanities How Are Funding Issues Impacting Humanities Education at Universities? Posted by Alan Liu May 5, 2012 Advocacy Statements & CampaignsAlan Liu –Report contributed to 4Humanities by Jessica Meyer When budget season hits the federal government and the debate begins about where and how to cut spending, a perennial favorite target is the National Endowment for the Humanities (NEH) and its sister organization, the National Endowment for the Arts (NEA). The NEH, created in 1965 by Congress, is one of the largest funders of humanities programs in the United States. Among its many responsibilities, this agency provides extensive financial support in the form of grants to universities for research, classroom education, newer web-based initiatives such as online PhD courses, public programs and preservation of the humanities. When the federal budget is reviewed and priorities must be set, many members of Congress look at funding for humanities as an item with less vital importance than funding for infrastructure improvements and the defense department. The NEH says that, according to the 1965 National Foundation on the Arts and Humanities Act, the term “humanities” includes, but is not limited to, the study of the following: language, both modern and classical; linguistics; literature; history; jurisprudence; philosophy; archaeology; comparative religion; ethics; the history, criticism and theory of the arts; those aspects of social sciences which have humanistic content and employ humanistic methods; and the study and application of the humanities to the human environment with particular attention to reflecting our diverse heritage, traditions, and history and to the relevance of the humanities to the current conditions of national life. The NEH fiscal year 2010 budget of $167.5 million was reduced to $146.0 million in fiscal year 2012. According to National Humanities Alliance, funding for the NEH’s grant programs in 2012 is equivalent to a 40 percent drop compared to 1994 when compared in real dollars. According to the Modern Language Association (MLA), in addition to a reduction in NEH funding, budget for federal programs for international education and foreign language were cut by 40 percent and the Fund for the Improvement of Postsecondary Education experienced a $140 million budget cut. In parallel to the funding challenges of the NEH, funding cuts for other programs such as the Fulbright-Hays international education programs and the Jacob K. Javits Fellowship Program which award financial support to graduate students in international fields and the humanities result in fewer scholarships for students in these fields. Universities receive funding from other sources beyond the federal government, though, and some academic experts suggest that federal funding cuts have not devastated the study of humanities on the university level. Elizabeth D. Capaldi, executive vice president and provost at Arizona State University, in an article in the November-December 2011 edition of Academe magazine, a publication of the American Association of University Professors, said, “Some disciplines bring in more money to the university than their base costs. Cutting a discipline that is generating revenue is not sensible in a time of declining resources. Humanities and social sciences are net revenue generators in universities, in part because of lower salaries in these disciplines. These disciplines also generate a larger number of credit hours as a result of general education requirements filled by courses in the humanities and social sciences.” While funding cuts make it more difficult for universities to provide a wide array of humanities programs, the evidence is still not complete to prove that federal funding is required to make the study of humanities a vital element to a university education. Jessica Meyer is a freelance writer and graduate student in journalism based in Seattle. Her primary interests are education, technology, and travel. When she’s not reading and writing, she can be found hiking and cycling throughout the Pacific Northwest with her husband. ← The Changing Humanities: UVA’s Praxis Program On Graduate Education in the Humanities, by a Graduate Student in the Humanities → One thought on “How Are Funding Issues Impacting Humanities Education at Universities?” Pingback: Ninth Level Ireland » Blog Archive » How Are Funding Issues Impacting Humanities Education at Universities? 4Humanities Advocacy Projects “Shout Out For the Humanities” Contest Humanities, Plain & Simple Initiative Backpack Mini-Documentaries Humanities Infographics Arts & Humanities in 21st C. Workplace Humanities Showcase 4Humanities Research Projects WhatEvery1Says Project What U.S. Politicians Say About Humanities U.S. Patents Related to the Humanities 4Humanities Local Chapters Auburn · CSUN · DHMakerBus · McGill · NY6 · UCLA · UCSB · Form a chapter at your institution! Voices for the Humanities Advocacy Statements & Campaigns The Changing Humanities International Correspondents Bibliography on the Humanities Guide to Issues in Humanities Advocacy Digital Tools for Humanities Advocacy Keywords and Hashtags for Social Media Campaigns Supporting the Humanities Digital Humanities to Advance Humanities Guide to DH Support for the Humanities Tweets by @4Hum Related Advocacy Initiatives American Academy of Arts & Sciences Commission on the Humanities and Social Sciences Arts & Humanities in the 21st Century Workplace Arts Against Cuts (U.K.) Council of Independent Colleges: "Securing America’s Future: The Power of Liberal Arts Education" DEFEND the Arts and Humanities (U.K.) Humanities and Social Sciences Matter (U.K.) Humanities in Action Lab National Humanities Alliance Advocacy Resources (U.S.) Open Letter on Socio-Economic Sciences & Humanities for the Future of Europe Project Humanities Projects by 4Humanities Affiliates The Humanities Matter Bus Tour (coordinated by DHMakerBus) StuHum Stories (students telling about impact of humanities on their lives -- a StuHum project) Kean U. Webinar Series on Higher Ed (co-sponsored by 4Humanities) 4Humanities.org 2020. Work on 4Humanities.org is distributed under the CC BY NC 3.0 license.	cc/2020-05/en_middle_0093.json.gz/line813
__label__cc	0.551104	0.448896	Justice Reinvestment Capitol Hill Updates Clean Slate Clearinghouse National Inventory of the Collateral Consequences of Conviction (NICCC) National Reentry Resource Center The 50-State Report on Public Safety The Stepping Up Initiative What Works in Reentry Clearinghouse This website is funded in part through a grant from the Bureau of Justice Assistance, Office of Justice Programs, and the U.S. Department of Justice. Neither the U.S. Department of Justice nor any of its components operate, control, are responsible for, or necessarily endorse, this website (including, without limitation, its content, technical infrastructure, and policies, and any services or tools provided). CSG Justice Center © 2020 Reduce Crime and Strengthen Communities Use data to understand crime trends. Examine crime, arrest, and victimization data. Expand data collection metrics. Enhance data sharing to improve public safety. Improve responses to people who have behavioral health needs in local criminal justice systems. Improve the identification of people who have behavioral health needs in the criminal justice system. Ensure that a range of behavioral health treatment and service options are available within jails and prisons and in the community for people in the criminal justice system. Increase the effectiveness of treatment and support services to improve public safety and health outcomes. Strengthen collaboration between behavioral health and criminal justice agencies at the state and local level. Help local governments use jail space cost-effectively. Support collection and analysis of jail data. Adopt policies that improve pretrial decisions and reduce burdens on jails. Develop crime-reduction strategies that prevent violent crime and strengthen trust in law enforcement. Ensure that local law enforcement agencies use evidence-based policing strategies to combat violent crime. Advance violent crime reduction efforts by improving trust and cooperation between communities and police. Provide law enforcement officers with the necessary tools and resources to respond to the needs of their communities. Expand! Break the Cycle of Reoffending Use data to drive recidivism-reduction efforts. Track and publish multiple measures of recidivism. Expand recidivism tracking to include the probation population. Use measures that permit more timely analysis in addition to cohort-based measures. Set recidivism-reduction goals for people leaving prison and people on probation. Ensure the effective use of risk and needs assessments. Design policies to support the statewide use of risk and needs assessments. Establish quality-assurance practices for the use of risk and needs assessments. Improve the effectiveness of supervision to reduce recidivism. Establish caseload sizes that allow supervision officers to focus resources on people who are most likely to reoffend. Improve supervision workforce practices, such as hiring, training, and evaluation. Provide supervision officers with tools to respond swiftly and appropriately to the behavior of people on supervision. Provide people on supervision with the resources they need to succeed. Use programming and treatment that works to reduce recidivism. Ensure sufficient availability of treatment and programs. Reduce barriers to employment. Reduce barriers to housing. Use Cost-Effective Strategies to Invest in Public Safety Examine drivers of corrections costs. Identify how much states spend on prisons and supervision. Analyze prison and supervision population trends to understand how they are driving costs. Assess how state prison and supervision populations are projected to change. Develop data-driven policy options to improve public safety. Revise sentencing practices to prioritize prison space for people convicted of serious and violent offenses. Promote success on supervision and use proportionate responses to respond to violations. Improve the efficiency and consistency of the parole decision-making process and preparation for release. Reinvest in strategies that improve public safety. Identify funding priorities and allocate resources accordingly. Regularly evaluate how to fund public safety priorities. Leverage federal resources to drive innovation. Track results. Ensure that state agencies have the capacity to collect performance measures. Establish responsibility for reporting and monitoring results. Educate stakeholders, policymakers, and the public to maintain momentum. Graphic Visualizations Index Part 3, Strategy 1 Action Item 1: Identify how much states spend on prisons and supervision. It is important for state leaders to understand what they are buying with their public safety dollars. While many policymakers are keenly aware of how spending on prisons has changed over the last 10 years, they often know less about how spending on probation and parole supervision has changed or what recidivism outcomes are for people leaving prison or starting probation.[4] Further, state leaders may not know what types of investments in probation and parole could help states contain corrections costs and increase public safety. Regular receipt of budgetary breakdowns for spending on both prisons and supervision, such as for programming, staffing, and health care, can help policymakers better understand what they are spending their public safety dollars on, identify gaps in funding, and develop opportunities to reinvest cost-effectively to strengthen public safety. Track and publish spending on prison, probation, and parole populations. Track and publish recidivism data for all people leaving prison and starting probation. Key questions to guide action How much does your state spend annually on prison? What are the recidivism rates for people leaving prison? How much does your state spend annually on probation and parole supervision? What are the recidivism rates for people starting probation or parole? How much does your state spend each year incarcerating people who fail on probation or parole? Use the information that follows to inform your answers to these questions. In 2015, states spent more than $40 billion on prisons, or nearly 10 times the amount spent on community supervision, yet state probation and parole populations are three times the size of state prison populations. A significant percentage of people leaving prison each year begin parole supervision, but not all. People may also be released to probation supervision or leave without supervision. Action Item 2 This Web site is funded in whole or in part through a grant from the Bureau of Justice Assistance, Office of Justice Programs, U.S. Department of Justice. Neither the U.S. Department of Justice nor any of its components operate, control, are responsible for, or necessarily endorse, this Web site (including, without limitation, its content, technical infrastructure, and policies, and any services or tools provided).	cc/2020-05/en_middle_0093.json.gz/line819
__label__cc	0.606986	0.393014	Home \| Publications \| ABRI Business Insights \| Jokes \| Uncertainty in the consultant-client relation: what jokes can reveal to us By dr. Onno Bouwmeester Many consultant jokes paraphrase how tolerant we can be towards uncertainties or how we can make use of uncertainty. As a junior consultant you may joke about your high fee, because you feel embarrassed asking a client for so much money, or you feel embarrassed about advising a client that has much more experience. Many jokes illustrate tensions such as these. The relief theory of humour explains joking in terms of this coping motive. The theory reveals why joking about uncertainty is funny, and what jokes can tell us about consultants and uncertainty. In a study published in the International Journal of Management and Organization 1) I analysed coping jokes about uncertainty in the consultant-client relation. What follows is a summary of that article. A close reading of coping jokes reveals how both consultant and client have their own tactics for making the other party more or less uncertain, and how they use the uncertainty of the other party to their own advantage. These tactics often cross the line of what we consider to be normal or appropriate, but are still common enough to feel familiar. Table 1 summarizes the main findings of the study. Each group of tactics for increasing, using and reducing uncertainty is shown in the columns of the table. CREATING UNCERTAINTY The most dominant uncertainty tactic used by consultants is to purposefully create or emphasize client problems, because this generates work for consultants. One joke in this category about the ‘oldest profession’ (that of physician, engineer or consultant) refers to the Old Testament: A physician, a civil engineer and a consultant were arguing about what was the oldest profession in the world. The physician remarked, ‘Well, in the Bible,it says that God created Eve from a rib taken out of Adam. This clearly required surgery, and so I can rightly claim that mine is the oldest profession in the world.’ The civil engineer interrupted and said, ‘But even earlier in the book of Genesis, it states that God created the order of the heavens and the earth from out of chaos. This was the first and certainly the most spectacular application of civil engineering. Therefore, fair doctor, you are wrong: mine is the oldest profession in the world. The consultant leaned back in her chair, smiled, and then said confidently, ‘Ah, but who do you think created the chaos?’ 2) Clients, on the other hand, play the same game. Two cartoons, one ‘Dilbert’ cartoon with Ratbert as the consultant, and one from www. cartoonstock.com, portray the consultant as being shot into a client organization with a canon or catapult. As an observer, one can imagine how they suffer from their insecure position. Other jokes make a connection between a consultant’s insufficient knowledge and feelings of insecurity, as in the ‘Top ten things you’ll never hear from your consultant’; in sixth position is, ‘I don’t know enough to speak intelligently about that.’ 3) As experts, consultants should know, and as the client, you want them to know. Suggesting that they do not meet these standards creates a feeling of insecurity. USING UNCERTAINTY A second theme of the jokes is what consultants and clients do with uncertainty, once the feeling exists. Four cartoons stress the esoteric knowledge of consultants, who are pictured as clergymen and as mediums who receive messages from God or Satan. In line with such cartoons, one also finds jokes in which the consultant uses the client’s uncertainty in order to make nonsensical recommendations. Below, for example, is the second nonsensical suggestion made in a joke about a farmer who needs help with his dying chickens: […] After a week, the farmer came back to the consultant and said: ‘My chickens are continuing to die. What shall I do?’ ‘Add strawberry juice to their drinking water, that will help for sure’.4) Such characterizations of consultants resemble those guru-consultants who are sometimes described as ‘witch doctors’ or ‘charlatans’. Clients are in a difficult situation here, as they are dependent on bluffing or lying consultants. However, clients can also exploit consultant uncertainty, as in the joke: ‘Consulting revisited’; the eighth bullet-point states that ‘If you consult enough experts, you can confirm any opinion’.5) The joke ‘Consultant commandments’ reflects an even more critical client position, in which the client deconstructs what the consultant says. It states: ‘He who hesitates is probably right.’ REDUCING UNCERTAINTY Consultants also apply tactics to reduce uncertainty, and most jokes illustrate these tactics. A first group of consultant tactics influences both consultants and clients by targeting the subject under investigation that is creating uncertainty. A second group is directed at clients, and a third group at consultants’ feelings of uncertainty. One illustrative joke about reducing uncertainty compares a consultant to a priest and a rabbi: A priest, a rabbi and a consultant were travelling on an airplane. A crisis occurred and it was clear that the plane was going to crash and they would all be killed. The priest began to pray and finger his rosary beads, the rabbi began to read the Torah and the consultant began to organize a committee on air traffic safety.6) This strategy – organizing a search process to find a solution – is well known as a means to cope with bounded rationality, but the joke clearly identifies the limits of this process-based approach in the given context. For clients, the most common tactic for reducing uncertainty revealed in the jokes is that of hiring consultants. Five cartoons illustrate consultant tactics that serve the purpose of reducing client uncertainty, such as reckless encouragement, selling positive thoughts and selling a feeling of security and optimism. The forms of consultant behaviour captured in the jokes, such as bluffing and lying, giving advice that is not based on expertise, or creating chaos, are somewhat taboo. For consultants, it is difficult to admit to such mediocre behaviour, which is what makes the jokes so funny. For clients, however, it is equally embarrassing to admit that they repeatedly hire such mediocre consultants. Therefore both client and consultant behaviours support the interpretation of coping humour. Jokes such as these make these problematic behaviours somewhat discussable. As coping jokes reveal behaviours that are difficult to discuss, in future, my research will use jokes and cartoons as ice-breakers in interview studies and research into business ethics, tainted professions and business paradoxes. They might also prove a useful tool for stimulating discussion about commercial ethical dilemmas during training sessions or in situ philosophical reflections and conversations. Dr. Onno Bouwmeester is a trained philosopher and economist and an ex-KPMG consultant, and is currently working as an Associate Professor of Management and Consulting at VU University Amsterdam. For further inquiries about the research project, please contact Dr. Onno Bouwmeester, o.bouwmeester@vu.nl. Table 1: Consultant and client tactics for dealing with uncertainty, illustrated in jokes UNCERTAINTY INCREASE/ARTICULATE USE/MISUSE REDUCE/MITIGATE Consultant tactics Client tactics Increase client uncertainty (articulate problems, create chaos) Establish own authority (Claim esoteric expertise, give nonsense advice) Mitigate uncertainty awareness (reframe, be overly general/vague, guess) Increase stakeholder uncertainty (dissemination of irrelevant information) Reduce client uncertainty (sell positive feelings/thoughts and encourage) Reduce own uncertainty (use textbooks, keep distance) Increase uncertainty of consultant (stress lack of knowledge and insecure position) Establish own authority (choose from different expert opinions; deconstruct consultant's views) Reduce own uncertainty (implied: hire a consultant) Bouwmeester, O. 2013. International Journal of Management and Organization 43(3): 41-57. http://www.desiest.com/jokes/joke.jsp?id=5317 http://www.mmnet.com/HyperNews/get/humor/36.html http://nowthatisfunny.blogspot.com/2005/10/jokes-about-consultants.html http://www.workjoke.com/consultants-jokes.html 1) International Journal of Management and Organization, 43(3) 2013: 41-57. 2) http://www.desiest.com/jokes/joke.jsp?id=5317 3) http://www.mmnet.com/HyperNews/get/humor/36.html 4) http://nowthatisfunny.blogspot.com/2005/10/jokes-about-consultants.html 5) http://www.workjoke.com/consultants-jokes.html	cc/2020-05/en_middle_0093.json.gz/line827
__label__cc	0.746632	0.253368	Our ‘Immersive Sales Star’ Virtual Reality video won the ‘Excellence in Digital Learning’ award from IITD ‘Immersive Sales Star’ is an IITD Training Award winner. Institute of Training & Development, National Training Awards is recognised as the premier Learning & Development event for industry. The purpose of the IITD National Training Awards is to promote excellence, best practice and innovation in Training and Learning & Development, and to highlight the importance of this area in today’s business climate. Excellence in Digital Learning Award. We are delighted to announce that ‘Immersive Sales Star’ won the ‘Excellence in Digital Learning’ award from the Institute of Training & Development Awards 2019. Adaptas created ‘Immersive Sales Star’ with the Learning and Development Team at FBD Insurance. ‘Immersive Sales Star’ is a number of Virtual Reality simulations of Sales Call conversations being utilised for motor and home insurance customer contact centre training. It is being used to scale best-in-class behaviours and competencies and replace the need for the shadow sessions. What do FBD say about this VR training solution? “Great solutions in business are never created by a single individual; they are done by a talented and committed group. This is why we chose to partner with Adaptas Training. Adaptas have been early adopters of using Virtual Reality technology, a medium which enables more immersive staff training. The Adaptas team helped us create an innovative, practical and results orientated training solution to overcome a real business challenge. The ‘Immersive Sales Star’ tool has improved product knowledge which in turn is improving Sales Performance and has eliminated the cost associated with employing a full time Sales Coach” John Mulreid, Learning and Development Manager, FBD Insurance What are the learners saying after using ‘Immersive Sales Star’? “When I made my first real call, I felt like I had done it before” “It brought all the jigsaw pieces of the training together for me” ”It makes you feel like you have done a call and achieved the sale” “It made me feel like I stepped into an expert seller’s shoes” “It trains you in the exact environment that you’re working in rather than a meeting or training room” “Rather that skating around the question, I now go straight in and ask directly for the sale” You can check out the Immersive Sales Star FBD case study here. Back to Teams	cc/2020-05/en_middle_0093.json.gz/line831
__label__wiki	0.640576	0.640576	Sonny's Observations A video greeting from Sonny Sonny shares some exciting news about the new CAS Leadership Academy for Students. 2011—start of the second decade of the millennium. This New Year brings with it—for our College—anticipation along with trepidation. Academic and International Programs Office The CAS task force on international programs recently recommended more comprehensive and systematic development of the College's international discovery, learning, and engagement programs in the food, agricultural and natural resource sciences. Cary Green and Brett Jeter of the College of Agricultural Sciences Academic Programs office have agreed to accept additional, broader responsibilities that are consistent with the College’s priorities, announced Dean Sonny Ramaswamy. (Watch video...) Cary Green is now Associate Dean for Academic and International Programs and Brett Jeter has been named Head Advisor and Director of Outreach. (Read more...) Yes, we are up 15.6% in Corvallis campus enrollment (undergrad and grad combined) from 1284 last year to 1484 this year. BPP is up 20.3% from 64 students last year to 77 students this year. The college overall (including off-campus) is up 25.5% over 2009. 1693 undergrads plus 352 grads = 2045 CAS students! Students: Apply for Scholarships by February 1 deadline Students received nearly $500,000 in financial support from the College of Agricultural Sciences this year, and that’s not including the additional funds our students received from our departments. You too could be eligible to receive College of Agricultural Sciences (CAS) scholarship funding if you major in one of the following degree programs and complete this application. More students means more help is needed Dean Ramaswamy shares the news of a significantly increased student enrollment for the College this year. (See video) The consequences of this are greater needs for scholarships and support. You can help provide for these increased needs by making a gift. Scholarships provide essential support for many students in the college. This allows us to attract some of the best and brightest students for whom a college education might otherwise be out of reach. OSU announces Agricultural Honors scholarships. Agricultural Honors scholarships totaling $85,400 have been awarded to incoming Oregon State University students in the College of Agricultural Sciences. This group of scholarships are made possible by the generosity of supportive donors. (Read more...) New Fields Blog New Fields magazine has been an annual print publication describing CAS student government and club activities for many years. This year it has changed to an electronic blog format and is an ongoing record of the numerous club activities. Articles and pictures will be posted quickly after the event happens so parents, alumni, students, faculty, and people in the industry will be able to see what the college is doing. (Read the blog...) OSU MANRRS chapter collecting professional attire for students (KEZI News)The OSU Minorities in Agriculture, Natural Resources and Related Sciences chapter is collecting donations of professional business attire to help out fellow students, many of whom do not own appropriate career apparel. (Read more and watch news video...) Entomology course garners national accolades (Oregonian) An Oregon State University Honors College course that uses Far Side comic strips to educate students about entomology has been named the nation's “Best College Course” in 2010 by Playboy magazine. (Read more...) Austin Fricker's growing mission in Nicaragua Austin Fricker is an International Degree and crop science major who went on study abroad to Nicaragua in September. His undergraduate thesis will be on farming techniques and socio-economics of the Miskito tribe. In response to what he has seen, Austin recently decided to postpone his senior year of college to stay with the Miskito tribe and use his knowledge of agriculture to help the farmers prepare fields and improve crops in order to ease their critical struggle of producing enough food. Read more about his mission (at his blog...) Hannah O'Leary combines passion for horticulture and art Hannah O'Leary, a horticulture and art major, was the 2010 Artist in Residence at the Oak Creek Center for Urban Horticulture. She captured some intriguing sights with her outstanding photography skills. She then went on study abroad to Italy this fall and blogged the experience. (Read her blog...) AnnaRose Adams finishes up internship in Bonaire AnnaRose reflects on six months of her study abroad program in Bonaire and shares her takeaways from the classroom, her research project, coping with high stress and insights she has gained about the future. (Read her blog...) (Oregon Stater) Two years ago, Katie Moriarty accidentally found the proverbial 15 minutes of scientific fame. She had set out a series of trail cameras in the woods near Truckee, Calif., and was checking to see if any martens had tripped the motion sensors while scrambling up a tree for the chicken bait. What she found instead on a grainy image looked like a cross between a bear and a raccoon. It turned out to be a ... (Read more...) OSU Update President's Annual Report Who would have imagined that a student working his way through college as a dishwasher would end up winning the National Medal of Science? Or that game-changing technology for the wood-products industry would come from watching mussels grip a rocky shoreline? (Read more...) Boom Time for OSU You could make a spirited argument that the fastest-growing, most vibrant place in Oregon in 2010 might have been the campus of Oregon State University. (Read more...) Facts about OSU Oregon State is a leading research university located in one of the safest, smartest, greenest small cities in the nation. Situated 90 miles south of Portland, and an hour from the Cascades or the Pacific Coast, Corvallis is the perfect home base for exploring Oregon’s natural wonders.. (Read more...) About the Department of Environmental and Molecular Toxicology Toxicology at OSU celebrates 50 years Even though the Department of Environmental and Molecular Toxicology has only officially been in existence for less than two decades, toxicology has been the primary scientific focus of many researchers, instructors and students on campus for 50 years. (Read more ...) Sinnhuber Aquatic Research Laboratory The central facility of the Aquatic Biomedical Models Facility Core is the Sinnhuber Aquatic Research Laboratory (SARL), a unique national and international resource. The SARL supports two animal models for researchers, rainbow trout and zebrafish. (Read more...) National Pesticide Information Center Did you know that the National Pesticide Information Center website provides a wealth of unbiased information on pesticide chemistry, toxicology and environmental fate to all who inquire, including industry, government, medical and agricultural personnel, as well as the general public 24/7? This resource is made available through a cooperative agreement between Oregon State University and the US Environmental Protection Agency. (Visit the NPIC website...) (Listen to a PestiByte podcast) Integrated Plant Protection Center Farmers know that if you reduce harmful insects and diseases in your crops, you have a chance for a better harvest. Paul Jepson heads the Integrated Plant Protection Center at Oregon State University. He says farmers who have attended field schools in Asia and Africa have increased the use of IPM. And he says this has cut pesticide use. (Read more...) Responding to Emerging Problems Wheat fields mysteriously withering OSU Morrow County Extension associate professor Larry Lutcher said 30,000 to 40,000 acres of wheat in his county have plants with yellow or purple tips. The discoloration spreads inward and downward on the leaf. In some cases, plants are completely desiccated and will not recover. (Read more in Oregon Business, or Capital Press) Strawberry shortcuts: Decoding DNA to breed crops that are disease resistant (KVAL News) The secrets of life that scientists are decoding inside the DNA of the woodland strawberry could be key to unlocking better berry crops in Oregon. (Read more and watch KVAL video) OSU has it's own YouTube channel and it's well-stocked with interesting video stories. Take a look! http://www.youtube.com/oregonstate Are you Powered by Orange? Facebook - OSU Beavers! http://www.facebook.com/osubeavers Christina DeWitt to head Seafood Research Center Oregon State University has hired an alumna who is a food chemist at Oklahoma State University to head its seafood research center in Astoria. Christina DeWitt, who has doctoral and master's degrees in food science from Oregon State University, will start work at the Seafood Laboratory on Dec. 30. The native Texan was a graduate research assistant at the lab from 1997-99. Robert Zemetra to head Wheat Variety Development Program Oregon State University has hired a wheat breeder from Idaho to head its internationally recognized wheat variety development program. (Read more...) OSU names new director for Mid-Columbia Agricultural Research and Extension Center The Oregon State University Agricultural Experiment Station and OSU Extension Service have appointed Brian Tuck as new director of the Mid-Columbia Agricultural Research and Extension Center (MCAREC) in Hood River. In this role, Tuck will lead OSU agricultural research and Extension outreach education programs in Hood River County and the mid-Columbia region of Oregon. (Read more...) Oregon's Agricultural Progress Magazine Winter 2011 The latest of Oregon's Agricultural Progress Magazine takes on the many dimensions of fish. Engaging stories and stunning photography point out how agricultural research is focused on solving problems and building economic opportunity -- on land and water. Terra connects you with the latest findings in energy, Earth systems, natural resources, health, the economy, the arts and the social sciences. OSU’s research enterprise has more than doubled in the past decade, reaching $275 million in grants and contracts in FY10. OSU researchers address the most pressing issues of our time and provide unparalleled opportunities for students to develop and achieve their goals.(Read more ...) The Spin on Research Vice President for Research Rick Spinrad shares conversations and updates in his new blog with our campus community and the public. (Read more...) Portland Couple Endows Dairy Professorship The Paul G. and Sandra A. Arbuthnot Professorship Fund will create the Arbuthnot Dairy Center within the College of Agricultural Sciences, support internships and endow a faculty member to develop and deliver state-of-the-art education and outreach programs for OSU students and Oregon’s small dairy foods processors. First recipient is Dr. Lisbeth Goddik. (Read more...) Agricultural foundation funds 33 new ideas for OSU research The Agricultural Research Foundation recently awarded 33 new grants totaling $400,000 to Oregon State University researchers, bringing the total of its currently funded projects to nearly $1 million. The foundation looks for the best ideas to tackle emerging problems, often new and untested ideas, according to Arnold Appleby, chair of the Agricultural Research Foundation projects committee. (Read more...) OSU malter will end bottleneck between Oregon barley and beer Drink a beer brewed in the United States, and there's a good chance the hops you'll taste were grown in Oregon. But chances are the malted barley in it wasn't. Oregon State University is working to change that. Students there have designed and will build a malting unit that could soak, germinate and dry small batches of the grain as part of OSU's larger effort to create a market for barley grown in Oregon. The malter will become part of OSU's existing research brewery; researchers and companies can pay to use the machine to test new barley varieties or malting techniques. (Read more in OSU News Release, AgInfo or News-Register) Oregon is business-friendly but taxes need work, according to new OSU study Oregon's rankings in several indexes reveal the state to be slightly above the national average in business friendliness. However, details within these studies suggest that fine-tuning the state's tax structure would make Oregon more attractive to business. Robert Campbell and Greg Perry, economists at Oregon State University, reviewed 10 studies that compare and rank the business climate of each state. Edible coatings for fresh blueberries The edible coatings under evaluation for blueberries include sucrose esters, chitosan, calcium caseinate and sodium alginate. A consumer benefit is the convenience of being able to eat the berries without needing to wash them, and extended shelf-life through delay of post-harvest moisture loss and dehydration. New coating extends shelf life of pre-washed blueberries (KEZI News, ABC 9, Eugene - October 7, 2010) Edible coatings slow rot, increase shelf life in blueberries (IFT Food Technology on-line) Blueberry coatings Press Release (OSU) Food for Thought Lecture Series lessons learned: environmental impacts of genetically engineered crops 7:00p Wednesday 9 Feb 2011, LaSells Stewart Center Yves Carrière Professor of Entomology at the University of Arizona, Yves Carrière, will summarize the findings of a recent National Research Council committee on which he served that explored the impacts of biotech crops on sustainability in the USA. Outreach in Biotechnology: Events food's footprint: agriculture and climate change 7:00p Wednesday 23 Feb 2011, LaSells Stewart Center Jennifer Burney Researcher in the Program on Food Security and the Environment at Stanford University, Jennifer Burney, will examine the effects of the “green revolution” in agricultural production on greenhouse gas emissions over the past 50 years. She will also explore the greenhouse gas impacts of various contemporary agricultural systems. James Carrington to head Danforth Plant Science Center James Carrington, a distinguished professor and director of the Center for Genome Research and Biocomputing at Oregon State University, has accepted a new position as president of the Donald Danforth Plant Science Center in St. Louis, Mo. The Danforth Center is the world’s largest independent research institute dedicated to plant science, with more than 200 employees, 80 doctoral-level researchers and a $20 million annual budget. Carrington will begin the position in May, 2011. (Read more...) For more information, or to put your name on the contact list for future information, contact Jeff Hino (jeff.hino@oregonstate.edu). Pachyderm - not what you're thinking Early-adopter faculty, staff and students have been building learner-driven multimedia stories that combine text, graphics, audio, and video--without being multimedia programmers, using Pachyderm. Pachyderm is an open-source multimedia development application that provides an easy way to create highly engaging interactive modules for websites and presentations. (See Pachyderm Showcase...) The next opportunity for Pachyderm training will occur in the spring of 2011, dates TBA. This training will be using the new much-improved Pachyderm 2.1 release. The workshop will be a one-day offering, with followup activities to assist you in the development of modules. Mini-grant funds up to $2,000 will be made available for proposals accepted from CAS faculty for module development. Agriculture alumni honored for professional work The College of Agricultural Sciences honored four alumni for their professional accomplishments on Oct. 29. Jason Tosch of Hillsboro, Ore., received the Luminary Award. Scott D. Campbell and James McKim received Leader Awards. Hiram Larew of Upper Marlboro, Md., received the Legacy Award for career lifetime achievement. (Read more...) Oregon Stater Magazine Oregon Stater Magazine is available on the web! Check out the The Winter 2011 edition which features several stories about, or are of interest to, your College of Agricultural Sciences community. (Read more...) Alumni: Please join or renew your membership in the Oregon State University Alumni Association. There are many great benefits to being a member, including a subscription to the Oregon Stater. Keep your connection as a Beaver alive! (Read more...) Diamond Pioneer Awards The Diamond Pioneer Registry was established in March 1983 when the College Of Agricultural Sciences observed its 75th anniversary. With the Registry, the College recognizes the significant contributions of many of our friends and colleagues who have served agriculture and related areas throughout a portion of their careers. (Read more...) Faculty and Staff Awards and Honors 2010 CAS Faculty and Staff Awards The Ch2M Hill Alumni Center was the backdrop of a luncheon to honor the recipients of the 2010 CAS Faculty and Staff Awards on October 21st. Connie Davis (l) is among recipients of the Classified Employee and Professional Faculty Employee Awards from Associate Dean Larry Curtis and Prof. Doug Johnson of Rangeland Ecology and Management. (Excellent recipients...) Sujaya Rao wins national teaching award The Entomological Society of America gave Sujaya Rao its Distinguished Achievement Award in Teaching on Dec. 12. Each year, the society gives the award to one association member who has excelled in developing innovative new courses, programs and teaching methods. (Read more...) 2010 APHIS Administrator's Award for Western CLB Team At the 62nd Secretary's Annual Honor Awards Ceremony the Western CLB Team received an APHIS Administrator's Award that "recognizes collaboration, creativity, and outstanding contributions to the APHIS mission". The Western CLB team includes folks from Oregon - off and on campus researchers (Darrin Walenta, George Hoffman and Sujaya Rao) from OSU. (Read more...) Hong Liu receives NSF CAREER Award Hong Liu, an expert at Oregon State University in the conversion of organic wastes to energy, has received a $400,000 CAREER award from the National Science Foundation. Liu, an assistant professor in the OSU Department of Biological and Ecological Engineering, received the award through the Energy for Sustainability Program at the NSF. Clint Shock Ontario Agriculturalist of the Year (Argus Observer) For Clint Shock, superintendent of Oregon State University’s Malheur Experiment Station, his interest in plants began at an early age and it led not only to a career but also a life-long passion for how and why plants grow and finding better ways to grow them and help society as a whole. (Read more...) CAS Calendar College of Agricultural Sciences Calendar	cc/2020-05/en_middle_0093.json.gz/line833
__label__wiki	0.863698	0.863698	Study everything. Do anything. Find your passion. Create knowledge. Serve the common good. Prepare for life. Where can Arts and Letters take you? Through international research and internships, junior explores everything from global health to Gothic literature Art historian researches the significance of long-lost Italian murals during yearlong fellowship Japanese major’s study abroad and internship experiences help launch career as U.S. diplomat Bringing 30 years of industry experience, new director seeks to grow collaborative innovation minor Tim Morton joined the College of Arts and Letters faculty last spring as director of the collaborative innovation minor and associate professor of the practice in the Department of Art, Art History, and Design. The minor, which centers on the principles of design thinking as an approach to solving real-world problems, draws students with a wide variety of majors from across the University — with more than 65 students taking the introductory Design Matters course last semester alone. Sociologist receives NSF grant to study change over time in nationally representative samples of U.S. protest events Kraig Beyerlein, an associate professor of sociology at the University of Notre Dame, has been awarded a $290,000 grant from the National Science Foundation to study change over time in characteristics of protests in the United States, such as size, demographic composition, presence of counterdemonstrators, and the use of disruptive tactics. History and pre-health major travels to London to study rare archives of World War I-era surgeries Brooke Guenther's research trip — six days at the London Metropolitan Archives, transcribing files from 60 facial reconstruction surgeries performed during and after World War I — was the first to be funded by a grant through the new Medicine and the Liberal Arts program at Notre Dame’s Reilly Center for Science, Technology, and Values. Guenther is studying Sir Harold Gillies, the father of modern-day plastic surgery, exploring the relationship between patients and the surgeon and studying societal reaction to survivors of wounded veterans who underwent plastic surgery. See what the College of Arts and Letters is all about. Arts and Letters on Social Media @ArtsLettersND Explore our master's and Ph.D programs. Answers to Frequent Questions What can I do with an Arts and Letters degree? Who is my adviser? Who is my director of undergraduate studies? What is the deadline to drop a class? How do I apply to Notre Dame? What graduate programs are available in Arts and Letters? What is College Seminar? How do I fund my research? How do I fund my internship? How do I start planning my senior thesis? How can I study abroad? Where do alumni go after a year of full-time service work? When is the 2019 A&L Diploma Ceremony?	cc/2020-05/en_middle_0093.json.gz/line835
__label__cc	0.708027	0.291973	Interviews & Current Events The Intrepid Mathematician Reading, writing and arithmetic. Is mathematics an art or science? ICYMI. From the archives. Enjoy! – AB The best mathematics is driven by beauty as much as the finest paintings. As the mathematician G.H. Hardy famously said “…there is no permanent place in this world for ugly mathematics.” In our quest to prove our theorems, mathematicians are guided by aesthetics as much as intellectual curiosity. G.H. Hardy (1877-1947). Mathematics models every aspect of the world around us. From Riemannian geometry modelling space-time, to big data uncovering new properties of social networks, to elliptic curves used to secure our banking systems, there are countless examples of how mathematics is a critical tool used in the sciences and engineering. I spoke to some aerospace engineers recently, who said they want their students to learn more mathematics. They are doing rocket science, after all. No one ever said rocket science was easy. Framed within this discussion is the question of whether mathematics is a science, like physics or biology, or more of an art, more like poetry or sculpture. Math as a science Science is driven by observation. A physicist develops her models and techniques based on experiments. A scientist proposes a hypothesis, and then tests it via experiments. A scientific theory, however, may precede experimental work. String theory, for example, is a physical theory with great promise to unify the forces of nature, but we haven’t found evidence of strings yet. In string theory, subatomic particles are made up strings whose size are about 10-33 centimeters. Mathematicians analyse patterns. They might use a computer to help discover them, or simply use pen and paper. Examples and counterexamples are extremely important in mathematics, and can help reveal a deeper theory. An interesting example of this is what is now called the Ulam Spiral. The mathematician Stanislaw Ulam discovered this in 1963 by writing out the positive integers in a counter-clockwise spiral fashion, and then circling the primes: If you make a large enough Ulam Spiral, like the one below with thousands of digits, non-random seeming patterns emerge. An Ulam Spiral, which predicts patterns in prime numbers. We don’t understand the patterns in the Ulam Spiral. A conjecture of Hardy and Littlewood (Conjecture F) predicts that certain quadratic polynomials generate more primes than you would expect in a sample of random numbers. Conjecture F, if true, would explain some properties of the spiral. In many ways mathematicians behave like scientists: we observe properties of patterns, and then search for tools to analyze or classify them. We don’t necessarily use any form of experimentation, which doesn’t support viewing mathematics as a science like chemistry. Math as an art An artist is driven by creativity expression and aesthetics. Artists focus on creating new objects from nothing. They use paint, words, sculpture, or any medium imaginable to create art. Andy Warhol creating early digital art with subject Deborah Harry. Mathematicians are also intensely creative. They too make theorems from nothing, much like the way a writer writes a novel from a blank screen or paper. Our expressiveness is limited by our imagination. We may use geometry, analysis, or algebra, but we tell a story through our own mathematical language. Beauty is so important to us when working on our theorems. Proofs, methods, and algorithms are routinely called elegant. We use beauty as a measuring stick to determine if a topic is worth pursuing. If we deem a theorem or its proof ugly, then we might not publish it, or search for a way around it for a better one. M.C. Escher (1898-1972) used mathematical themes in his art. Hyperbolic tessellation: Circle Limit III, 1959. A challenge with thinking of mathematics as an art is that it hard to appreciate it unless you have the proper training. Most people enjoy music, a good novel, or a well-crafted painting. It is more challenging to convince a friend to read a brilliant paper or sit through a lecture by a leading mathematician. Believe me, I have tried! A third path My view is that mathematics is neither an art nor a science. A third path exists, nestled between the two, and intertwined with both. Mathematics is inherently different from other disciplines. While it is wildly creative, it is not art. While it can be used to model natural phenomena, it is not science. There are elements of both art and science in the field, but it isn’t a subset of either. Igneous ~ Dragon Dance, by artist Julia Dawn Gray, based on a Julia set fractal. One point is clear. As art and science and evolve, mathematics will play an increasingly important role. Mathematics, in the end, may be the only true bridge between art and science. Anthony Bonato May 16, 2018 abonato99Current Events, Home, Mathematics, Pop culture, Uncategorizedallgemein, art, Mathematics, Science One thought on “Is mathematics an art or science?” ProfTomBot I agree with you. It’s irrelevant to try to classify mathematics in such a broad way. It’s some sort of trade applicable to science, innately artistic, but ultimately unique unto itself. Previous Post Emmy Noether arrives in the 22nd century Next Post Interview with a mathematician: Richard K. Guy A teachable moment for mathematicians On being a gay mathematician redux My Brain is Open card deck Chasing robbers on donuts	cc/2020-05/en_middle_0093.json.gz/line837
__label__cc	0.717957	0.282043	Author, editor, caffeine-addict, wannabe ninja Tag Archives: James Festivus, Ramblings, Reading, Reviews Festivus Book Pimping – Griffin & Price series by James A Moore & Charles R Rutledge December 23, 2018 Amanda J Spedding Leave a comment It’s amazing what a good (bad?) earworm can do, and so this morning’s Festivus Book Pimping comes to you via ‘Jolene’. Seriously, I’ll be shit-singing this for days now. <shakes fist at Charles> We’re side-stepping out of fantasy for a moment and diving face-first into supernatural horror via the Griffin & Price novels masterfully penned by two of my favourite people – James A Moore and Charles R Rutledge (yes, despite the earworm). The series consists of three books (so far): Blind Shadows, Congregations of the Dead, and A Hell Within. Each follows the trials and tribulations of Brennert County Sheriff Carl Price and his best friend, ex-mercenary turned PI, Wade Griffin. Set in the town (and surrounds) of Wellman, Georgia, a lot of super and preternatural happenings pit Griffin and Price against a host of monsters and nasties. I love this series, and the two main characters have a rapport beset with humour and sarcasm that’s right up my reading alley. The writing is slick, the monsters are quite literally killer, and the brewing tension between Sheriff Price and the otherworldly Blackbourne clan only ups the ante. The secondary characters add extra depth to the stories, and only build on what is an incredible cast (I’m looking at you, Jolene). You should be reading this series. Blind Shadowsblurb: When private investigator Wade Griffin moved away from his hometown of Wellman, Georgia he didn’t think he would be back. Too many memories and too many bridges burned. But when an old friend is found brutally murdered and mutilated, nothing can keep Griffin from going home. Teamed with another childhood friend, Sheriff Carl Price, Griffin begins an investigation that will lead down darker paths than he could ever have imagined. Soon Griffin and Price find that there are secrets both dark and ancient lurking in the back woods of Crawford’s Hollow. As Halloween approaches, something evil is growing near the roots of the Georgia mountains, and the keys to the mystery seem to be a woman of almost indescribable beauty and a dead man who won’t stay dead. As the body count mounts and the horrors pile up, Griffin and Price come to realize that the menace they face extends far beyond the boundaries of Wellman and that their opponents seem to hold all the cards. But the two lawmen have a few secrets of their own, and one way or another there will be hell to pay. Blurb for Congregations of the Dead: It’s one of the hottest summers on record and a storm is brewing over the small town of Wellman, Georgia. Still reeling from the horrific events of the previous October, all Sheriff Carl Price wants is to get back to a normal life. Unfortunately things aren’t working out. He’s got the Brennert County’s DA breathing down his neck for answers about what happened in Crawford’s Hollow. He’s been served with a lawsuit by the Blackbourne family. And just after he witnesses a child abduction, the one person who always puts his life into a tailspin shows up to add to the pressure. Meanwhile, against his better judgment, Wade Griffin agrees to look for a teenage girl who’s gone missing. It’s not his kind of case, but he’s trying to establish his private investigations business and perhaps abandon his past as a mercenary. But Griffin’s luck isn’t any better than Price’s and he ends up crossing paths with the man behind most of the organized crime north of Atlanta. Both lawmen have their plates full, but then they learn that there is something abroad in the night. Not the supernatural menace they dealt with before, but something even darker. Just what is the secret of the charismatic Reverend Lazarus Cotton and what is he hiding in his small mountain church? Once again, Griffin and Price must call upon all their deadly skills just to stay alive and even in the middle of a pitched battle against things that shouldn’t exist they are reminded that sometimes the darkest evils reside within the human heart. And the third in the series, A Hell Within: Something dark is looming in Brennert County, Georgia. Sheriff Carl Price and ex-mercenary-turned P.I. Wade Griffin know well the other-worldly undercurrent that runs through the small town of Wellman, but with the Blackbournes trying to rebuild their strength, it seems they can breathe a little easier, Just a little. Griffin starts working a case when he stumbles across a massacre at a drug lab, and when Price is called to the scene of a brutal triple homicide, it has all the markings of Blackbourne retribution. Before the blood is dry, two more people are torn apart. As the body count rises, Griffin and Price find themselves in the middle of a turn war where bullets and black magic are the weapons off choice. Caught between the worlds of monsters and men, Griffin and Price enlist the help of associate Carter Decamp to put an end to the brewing battle. But the gates of Hell have been opened and the beasts won’t be denied their chance to feast. And as a post-Festivus bonus, there’s a Griffin & Price novella to be released in the latest SNAFU: Resurrection anthology. Over 20,000 words of wicked horror in the form of Call up the Dead, due for release December 27 – pre-orders available here. Recommended for those who love supernatural horror, horror, fantastic beasties, otherworldly monsters, crime, urban horror, and just general top-notch writing with killer characters. Not recommended for those who have an aversion to violence, demonic shenanigans, gore. A Hell WithinBlind ShadowsCharles R RutledgeCongregations of the DeadFestivusFestivus Book PimpinghorrorJamessupernaturalsupernatural horror Australian Shadows Award 2016 (written work, graphic novel) Australian Shadows Award 2012 (short fiction) Finalist, Aurealis Award, Fantasy Short Story Finalist, Australian Shadows Award, edited publication Read This Year Authors for Fireys Review: The True Bastards by Jonathan French FESTIVUS BOOK PIMPING: THE GODBLIND TRILOGY BY ANNA STEPHENS Festivus Book Pimping. SNAFU: Last Stand (Cohesion Press) Festivus Book Pimping: The Winnowing Flame trilogy by Jen Williams Phoenix Editing Black Friday Wager Follow Author, editor, caffeine-addict, wannabe ninja on WordPress.com	cc/2020-05/en_middle_0093.json.gz/line842
__label__cc	0.659149	0.340851	Hee-doh'ge-ats, a Young Man George Catlin, Hee-doh'ge-ats, a Young Man, 1837-1839, oil on canvas, Smithsonian American Art Museum, Gift of Mrs. Joseph Harrison, Jr., 1985.66.148 Luce Center Label George Catlin described this youth as a “Chinook boy, of fifteen or eighteen years of age” whose head had never been flattened. The young man’s true identity has been the subject of some speculation. A similar image of a Chinook boy appears in McKenney and Hall’s three-volume study, The Indian Tribes of North America (1933). That boy (or young man), whose name was Stumanu, toured Atlantic Coast cities in 1838 and 1839. (Catlin, Letters and Notes, vol. 2, no. 48, 1841, reprint 1973; Truettner, The Natural Man Observed, 1979) Gift of Mrs. Joseph Harrison, Jr. Ethnic – Indian – Chinook Portrait male – Hee Doh'ge Ats #CF502F We-chúsh-ta-dóo-ta, Red Man, a Distinguished Ball Player I-o-wáy, One of Black Hawk's Principal Warriors Seet-sé-be-a, Midday Sun, a Pretty Girl Eé-shah-kó-nee, Bow and Quiver, First Chief of the Tribe Peh-tó-pe-kiss, Eagle's Ribs, a Piegan Chief Theodore Burr Catlin, in Indian Costume Te-ah'-ke-ra-lée-re-coo, The Cheyenne, a Republican Pawnee Mouth of the Platte River, 900 Miles above St. Louis Hindu Merchants Edwin Lord Weeks Tcha-aés-ka-ding, Grandson of Buffalo Bull's Back Fat	cc/2020-05/en_middle_0093.json.gz/line845
__label__wiki	0.576517	0.576517	U.S. SCIENTIST DEVELOPS HTP-POWERED ROBOTIC ARM FOR DARPA August 23, 2007 / stonez / American Intelligence News, United States American researchers may have revolutionised the field of artificial limbs by adopting a new power source formerly used mainly in torpedoes and rockets. Prosthetic robot arms have been on something of a technological plateau for a while. Myo-electrics – in which functions can be controlled by muscle movement in the remaining limb – came in decades ago, but other than that the limbs have stayed relatively primitive. Now, however, due in part to the substantial numbers of Western troops severely injured in Southwest Asian fighting, fresh ideas are circulating. New methods of control, perhaps better or more flexible than ordinary myo-electrics, are under consideration, and rather than essentially being a powered claw, much better-articulated limbs are being developed. Some of these initiatives have been funded by DARPA (Defence Advanced Research Projects Agency), the occasionally somewhat foam-lipped US death-boffin outfit. Only one thing has been lacking – new power sources to drive the more sophisticated limbs under development. Fit young men – and most military casualties are from this group – expect their arms to be powerful, able to grip and lift 30 pounds or more quite quickly. But existing battery-powered limbs, if built to this sort of spec, either become unacceptably heavy or run out of juice much too fast. artificial arm steampunk A proper cyber arm, rocket fuelled and steam driven. Enter Professor Michael Goldfarb of Vanderbilt University. “Battery power has been adequate for the current generation of prosthetic arms because their functionality is so limited that people don’t use them much,” Goldfarb says. “The more functional the prosthesis, the more the person will use it and the more energy it will consume.” Goldfarb reckoned that current battery tech was never going to offer an arm with decent strength and endurance at a reasonable weight. He’d previously run up against these limitations working on a DARPA exoskeleton project, and he reckoned he had the solution: the arm needed to be powered by a small rocket motor. No, really. Goldfarb’s design uses high-test hydrogen peroxide fuel, formerly used mainly in rockets and torpedoes. Concentrated peroxide breaks down in the presence of a catalyst to produce high-pressure steam and oxygen. In Goldfarb’s arm, the vapour is used to drive pistons, just as in a steam engine: but rather than turning a wheel, the various pistons heave in or let out tension belts against springs so as to bend or straighten the elbow, wrist, fingers, etc. According to Goldfarb, a small sealed canister of hydrogen peroxide that easily fits in the upper arm can provide enough energy to power the device for 18 hours of normal activity. There have been a few little problems, though. The steam comes out of the generator unit at oven-like 230-degrees-C temperatures, making parts of the arm baking hot. But Goldfarb and his team have used strategically-placed insulation “to reduce surface temperatures enough so they are safe to touch”. An initial tendency to hiss and chuff noisily was fixed, too. Then there was the matter of the arm squirting jets of damp steam exhaust like a old-time locomotive; but again, Goldfarb figures he’s got this sorted. Waste steam is disposed of discreetly, “in as natural a fashion as possible: by venting it through a porous cover, where it evaporates like natural perspiration”, according to the Vanderbilt inhouse magazine article (includes video of the arm operating on compressed air.). “The amount of water involved is about the same as a person would normally sweat from their arm in a warm day,” Goldfarb says. This doesn’t seem totally convincing overall. Many of us have suffered from visibly damp armpits, but actual jets of steam blowing from them might be a tad embarrassing – if perhaps more fragrant than ordinary biological emissions. At least, as long as the fuel itself doesn’t leak. Then there are a few other questions to be asked. Pressurised high-test peroxide (HTP) isn’t like the friendly low-concentration bleach beloved of ersatz blondes, safe for handling by hairdressers and the like. This stuff is corrosive and explosive, and HTP accidents are thought to have sunk submarines and led to various other deadly mishaps. Furthermore, peroxide-driven machinery usually needs intensive maintenance to remain even vaguely safe – perhaps unsurprisingly, even the working parts being driven by a fairly corrosive and saucy mixture of hot steam and oxygen. An arm which requires poisonous hazmat fuel and which offers at least some chance of an explosion or violent mechanical failure in use could be seen as going too far in pursuit of decent power and endurance. Still, the military users DARPA is aiming at are reported to love the Terminator-style look of some new artificial arms. If they like cyberpunk style, there’s at least a chance they’ll love Goldfarb’s steampunk* offering. Even so, Goldfarb is apparently a bit worried he might lose his DARPA funding soon due to concerns over how long it could take to get regulatory approval for the HTP-powered steam arm. But he reckons other backers will step in if DARPA cut him off. “We have made so much progress and gotten such positive feedback from the research community that I’m certain we’ll be able to keep going,” he says. Â® *A speculative-fiction genre based around steam technology which never developed in the real world, among other things.	cc/2020-05/en_middle_0093.json.gz/line846
__label__cc	0.617418	0.382582	A "POPULAR" fte with a philanthropic object had been arranged on the Feast of Epiphany in the provincial town of N----. They had selected a broad part of the river between the market and the bishop's palace, fenced it round with a rope, with fir-trees and with flags, and provided everything necessary for skating, sledging, and tobogganing. The festivity was organized on the grandest scale possible. The notices that were distributed were of huge size and promised a number of delights: skating, a military band, a lottery with no blank tickets, an electric sun, and so on. But the whole scheme almost came to nothing owing to the hard frost. From the eve of Epiphany there were twenty-eight degrees of frost with a strong wind; it was proposed to put off the fte, and this was not done only because the public, which for a long while had been looking forward to the fte impatiently, would not consent to any postponement. "Only think, what do you expect in winter but a frost!" said the ladies persuading the governor, who tried to insist that the fte should be postponed. "If anyone is cold he can go and warm himself." The trees, the horses, the men's beards were white with frost; it even seemed that the air itself crackled, as though unable to endure the cold; but in spite of that the frozen public were skating. Immediately after the blessing of the waters and precisely at one o'clock the military band began playing. Between three and four o'clock in the afternoon, when the festivity was at its height, the select society of the place gathered together to warm themselves in the governor's pavilion, which had been put up on the river-bank. The old governor and his wife, the bishop, the president of the local court, the head master of the high school, and many others, were there. The ladies were sitting in armchairs, while the men crowded round the wide glass door, looking at the skating. "Holy Saints!" said the bishop in surprise; "what flourishes they execute with their legs! Upon my soul, many a singer couldn't do a twirl with his voice as those cut-throats do with their legs. Aie! he'll kill himself!" "That's Smirnov. . . . That's Gruzdev . . ." said the head master, mentioning the names of the schoolboys who flew by the pavilion. "Bah! he's all alive-oh!" laughed the governor. "Look, gentlemen, our mayor is coming. . . . He is coming this way. . . . That's a nuisance, he will talk our heads off now." A little thin old man, wearing a big cap and a fur-lined coat hanging open, came from the opposite bank towards the pavilion, avoiding the skaters. This was the mayor of the town, a merchant, Eremeyev by name, a millionaire and an old inhabitant of N----. Flinging wide his arms and shrugging at the cold, he skipped along, knocking one golosh against the other, evidently in haste to get out of the wind. Half-way he suddenly bent down, stole up to some lady, and plucked at her sleeve from behind. When she looked round he skipped away, and probably delighted at having succeeded in frightening her, went off into a loud, aged laugh. "Lively old fellow," said the governor. "It's a wonder he's not skating." As he got near the pavilion the mayor fell into a little tripping trot, waved his hands, and, taking a run, slid along the ice in his huge golosh boots up to the very door. "Yegor Ivanitch, you ought to get yourself some skates!" the governor greeted him. "That's just what I am thinking," he answered in a squeaky, somewhat nasal tenor, taking off his cap. "I wish you good health, your Excellency! Your Holiness! Long life to all the other gentlemen and ladies! Here's a frost! Yes, it is a frost, bother it! It's deadly!" Winking with his red, frozen eyes, Yegor Ivanitch stamped on the floor with his golosh boots and swung his arms together like a frozen cabman. "Such a damnable frost, worse than any dog!" he went on talking, smiling all over his face. "It's a real affliction!" "It's healthy," said the governor; "frost strengthens a man and makes him vigorous. . . ." "Though it may be healthy, it would be better without it at all," said the mayor, wiping his wedge-shaped beard with a red handkerchief. "It would be a good riddance! To my thinking, your Excellency, the Lord sends it us as a punishment -- the frost, I mean. We sin in the summer and are punished in the winter. . . . Yes!" Yegor Ivanitch looked round him quickly and flung up his hands. "Why, where's the needful . . . to warm us up?" he asked, looking in alarm first at the governor and then at the bishop. "Your Excellency! Your Holiness! I'll be bound, the ladies are frozen too! We must have something, this won't do!" Everyone began gesticulating and declaring that they had not come to the skating to warm themselves, but the mayor, heeding no one, opened the door and beckoned to someone with his crooked finger. A workman and a fireman ran up to him. "Here, run off to Savatin," he muttered, "and tell him to make haste and send here . . . what do you call it? . . . What's it to be? Tell him to send a dozen glasses . . . a dozen glasses of mulled wine, the very hottest, or punch, perhaps. . . ." There was laughter in the pavilion. "A nice thing to treat us to!" "Never mind, we will drink it," muttered the mayor; "a dozen glasses, then . . . and some Benedictine, perhaps . . . and tell them to warm two bottles of red wine. . . . Oh, and what for the ladies? Well, you tell them to bring cakes, nuts . . . sweets of some sort, perhaps. . . . There, run along, look sharp!" The mayor was silent for a minute and then began again abusing the frost, banging his arms across his chest and thumping with his golosh boots. "No, Yegor Ivanitch," said the governor persuasively, "don't be unfair, the Russian frost has its charms. I was reading lately that many of the good qualities of the Russian people are due to the vast expanse of their land and to the climate, the cruel struggle for existence . . . that's perfectly true!" "It may be true, your Excellency, but it would be better without it. The frost did drive out the French, of course, and one can freeze all sorts of dishes, and the children can go skating -- that's all true! For the man who is well fed and well clothed the frost is only a pleasure, but for the working man, the beggar, the pilgrim, the crazy wanderer, it's the greatest evil and misfortune. It's misery, your Holiness! In a frost like this poverty is twice as hard, and the thief is more cunning and evildoers more violent. There's no gainsaying it! I am turned seventy, I've a fur coat now, and at home I have a stove and rums and punches of all sorts. The frost means nothing to me now; I take no notice of it, I don't care to know of it, but how it used to be in old days, Holy Mother! It's dreadful to recall it! My memory is failing me with years and I have forgotten everything; my enemies, and my sins and troubles of all sorts -- I forget them all, but the frost -- ough! How I remember it! When my mother died I was left a little devil -- this high -- a homeless orphan . . . no kith nor kin, wretched, ragged, little clothes, hungry, nowhere to sleep -- in fact, 'we have here no abiding city, but seek the one to come.' In those days I used to lead an old blind woman about the town for five kopecks a day . . . the frosts were cruel, wicked. One would go out with the old woman and begin suffering torments. My Creator! First of all you would be shivering as in a fever, shrugging and dancing about. Then your ears, your fingers, your feet, would begin aching. They would ache as though someone were squeezing them with pincers. But all that would have been nothing, a trivial matter, of no great consequence. The trouble was when your whole body was chilled. One would walk for three blessed hours in the frost, your Holiness, and lose all human semblance. Your legs are drawn up, there is a weight on your chest, your stomach is pinched; above all, there is a pain in your heart that is worse than anything. Your heart aches beyond all endurance, and there is a wretchedness all over your body as though you were leading Death by the hand instead of an old woman. You are numb all over, turned to stone like a statue; you go on and feel as though it were not you walking, but someone else moving your legs instead of you. When your soul is frozen you don't know what you are doing: you are ready to leave the old woman with no one to guide her, or to pull a hot roll from off a hawker's tray, or to fight with someone. And when you come to your night's lodging into the warmth after the frost, there is not much joy in that either! You lie awake till midnight, crying, and don't know yourself what you are crying for. . . ." "We must walk about the skating-ground before it gets dark," said the governor's wife, who was bored with listening. "Who's coming with me?" The governor's wife went out and the whole company trooped out of the pavilion after her. Only the governor, the bishop, and the mayor remained. "Queen of Heaven! and what I went through when I was a shopboy in a fish-shop!" Yegor Ivanitch went on, flinging up his arms so that his fox-lined coat fell open. "One would go out to the shop almost before it was light . . . by eight o'clock I was completely frozen, my face was blue, my fingers were stiff so that I could not fasten my buttons nor count the money. One would stand in the cold, turn numb, and think, 'Lord, I shall have to stand like this right on till evening!' By dinner-time my stomach was pinched and my heart was aching. . . . Yes! And I was not much better afterwards when I had a shop of my own. The frost was intense and the shop was like a mouse-trap with draughts blowing in all directions; the coat I had on was, pardon me, mangy, as thin as paper, threadbare. . . . One would be chilled through and through, half dazed, and turn as cruel as the frost oneself: I would pull one by the ear so that I nearly pulled the ear off; I would smack another on the back of the head; I'd glare at a customer like a ruffian, a wild beast, and be ready to fleece him; and when I got home in the evening and ought to have gone to bed, I'd be ill-humoured and set upon my family, throwing it in their teeth that they were living upon me; I would make a row and carry on so that half a dozen policemen couldn't have managed me. The frost makes one spiteful and drives one to drink." Yegor Ivanitch clasped his hands and went on: "And when we were taking fish to Moscow in the winter, Holy Mother!" And spluttering as he talked, he began describing the horrors he endured with his shopmen when he was taking fish to Moscow. . . . "Yes," sighed the governor, "it is wonderful what a man can endure! You used to take wagon-loads of fish to Moscow, Yegor Ivanitch, while I in my time was at the war. I remember one extraordinary instance. . . ." And the governor described how, during the last Russo-Turkish War, one frosty night the division in which he was had stood in the snow without moving for thirteen hours in a piercing wind; from fear of being observed the division did not light a fire, nor make a sound or a movement; they were forbidden to smoke. . . . Reminiscences followed. The governor and the mayor grew lively and good-humoured, and, interrupting each other, began recalling their experiences. And the bishop told them how, when he was serving in Siberia, he had travelled in a sledge drawn by dogs; how one day, being drowsy, in a time of sharp frost he had fallen out of the sledge and been nearly frozen; when the Tunguses turned back and found him he was barely alive. Then, as by common agreement, the old men suddenly sank into silence, sat side by side, and mused. "Ech!" whispered the mayor; "you'd think it would be time to forget, but when you look at the water-carriers, at the schoolboys, at the convicts in their wretched gowns, it brings it all back! Why, only take those musicians who are playing now. I'll be bound, there is a pain in their hearts; a pinch at their stomachs, and their trumpets are freezing to their lips. . . . They play and think: 'Holy Mother! we have another three hours to sit here in the cold.' " The old men sank into thought. They thought of that in man which is higher than good birth, higher than rank and wealth and learning, of that which brings the lowest beggar near to God: of the helplessness of man, of his sufferings and his patience. . . . Meanwhile the air was turning blue . . . the door opened and two waiters from Savatin's walked in, carrying trays and a big muffled teapot. When the glasses had been filled and there was a strong smell of cinnamon and clove in the air, the door opened again, and there came into the pavilion a beardless young policeman whose nose was crimson, and who was covered all over with frost; he went up to the governor, and, saluting, said: "Her Excellency told me to inform you that she has gone home." Looking at the way the policeman put his stiff, frozen fingers to his cap, looking at his nose, his lustreless eyes, and his hood covered with white frost near the mouth, they all for some reason felt that this policeman's heart must be aching, that his stomach must feel pinched, and his soul numb. . . . "I say," said the governor hesitatingly, "have a drink of mulled wine!" "It's all right . . . it's all right! Drink it up!" the mayor urged him, gesticulating; "don't be shy!" The policeman took the glass in both hands, moved aside, and, trying to drink without making any sound, began discreetly sipping from the glass. He drank and was overwhelmed with embarrassment while the old men looked at him in silence, and they all fancied that the pain was leaving the young policeman's heart, and that his soul was thawing. The governor heaved a sigh. "It's time we were at home," he said, getting up. "Good-bye! I say," he added, addressing the policeman, "tell the musicians there to . . . leave off playing, and ask Pavel Semyonovitch from me to see they are given . . . beer or vodka." The governor and the bishop said good-bye to the mayor and went out of the pavilion. Yegor Ivanitch attacked the mulled wine, and before the policeman had finished his glass succeeded in telling him a great many interesting things. He could not be silent. Add Frost to your own personal library. Return to the Anton Chekhov Home Page, or . . . Read the next short story; Gone Astray	cc/2020-05/en_middle_0093.json.gz/line847
__label__cc	0.707877	0.292123	It’ll take more than the Queen’s popularity and the Olympics to help Tories shift the mood around them now Posted by Alastair Campbell \| May 31, 2012 \| Economy, Olympics, Politics, Sport \| 193 \| A while back I remember reading an article in which, on the back of the Royal Wedding, a senior Tory was predicting that with the Diamond Jubilee and the Olympics to come, Britain was set for a wave of patriotism which would benefit his party. Well the wave of patriotism is certainly upon us, but there is precious little sign of it delivering any benefit to the Tories. That prediction was made during the period when a rather soft glow of largely uncritical coverage surrounded the coalition. Since then the media have caught up with what many members of the public have thought for a long time. I imagine that what the Tory in question was thinking that with Downton Abbey a current cultural icon, an old Etonian as Prime Minister and another as London Mayor, the country had re-accepted all the old values that New Labour challenged, and that the Tories would benefit from a more traditional outlook on life. What they fail to realise is that the Monarchy, and particularly the Queen, are bucking the trends of negativity. She is doing so because at times of instability and insecurity, people look to those people and institutions which deliver and communicate a sense of stability and security. Even ardent Republicans must acknowledge she does that brilliantly. The government meanwhile are major contributors to the insecurity and instability, which is impacting upon the economy, jobs and living standards, public services and those who work in them, and a private sector that is not growing as they said it would when they took the knife to the State. Hats off to Jeremy Paxman by the way for sitting back and letting economist Paul Krugman give a brilliant economics lecture last night to a hopeless Tory MP and a venture capitalist. If you missed it, get onto iplayer. And if you don’t read the Financial Times, enjoy this extract from today’s editorial … George Osborne won’t. The paper says that ‘with Britain back in recession and the eurozone in crisis, the country needs its Chancellor to have a firm grip and a steady nerve and that Osborne is making rather a poor fist of both. …Things will only get tougher as austerity starts to bite. He must defend and explain policies better. And he needs to devise meaningful ways to ensure the flow of credit to businesses and to encourage more public investment spending. Osborne’s silence has cost the Government. He must recover some of his old vim – and fast.’ Of course another reason why the Tories are less likely to make political capital from the Olympics is Jeremy Hunt, the Olympics minister, but something of a 2012 passenger as he devotes most of his time to defending the indefensible, namely his own continuing position at the Cabinet table. So with David Cameron’s comms director facing perjury allegations, his own links to News International yet to come under forensic scrutiny, the economy faltering, a U-turn from a half-baked policy every day, virtually every group of public service professionals offside, Osborne’s star waning, Hunt in trouble, Warsi in trouble, and Tory strength in depth so weak that we are expected to take seriously the idea of Gove v Johnson as the next leadership election, it will take more than the Queen’s popularity and the joy of sport to dig them out of the hole. PreviousTo get all-party support, Cameron should indicate likely acceptance of Leveson plans when he appears NextCycling bug tightens its grip after day in Garmin support car The whiff around Cambridge Analytica is getting stronger, and getting closer to Leave campaign. Keep going Carole! Fight to protect mental health services, and celebrate Harlem’s political awakening Good luck to Number 10 on ‘lobby’ review. And a big NO to the other PR As Obama fights for healthcare, let’s celebrate the record here Nick on May 31, 2012 at 8:20 am “He must defend and explain his policies better” !!.Is there a hint of agreement with his policies Alistair ?.Surely not !. The hole the Tories are in is getting deeper by the day .Soon will be so deep the walls will cave in around them and they will have nowhere to go. Ehtch on May 31, 2012 at 8:43 am Heard sales of pet corgi dogs has sky rocketed, if that is something. Chris lancashire on May 31, 2012 at 9:26 am Typical Mr Campbell. Quotes the bits of the FT editorial he likes, misses out the bits he doesn’t. Here is the bit from today’s editorial he missed: “The central thrust of his economic policy is sound”. Joey W on May 31, 2012 at 10:12 am I actually thought Krugman came across as arrogant and dismissive in that last segment. It was also ironic that he accused the others of being motivated by ideology, when it it quite clear he is doing the exact same thing. As a side note; it’s a shame that the word “ideology” has become an insult when used in a political context. It is surely preferable to have politicians’ decisions guided by their ideology, rather than by more transient reasons (such as populist & costly policies simply to get re-elected). Signpost vs weathercock, etc. Michele on May 31, 2012 at 11:34 am I also saw the Newsnight conversation and thought that the writer must have wondered whether this (those two twerps) was the best that could be put up and that if so we are doomed. Osbo has just backtracked re charity/tax, he’s learning that competence is not something that he owns and he must be so wishing he could disappear. That puts him with the majority for once. Michele on May 31, 2012 at 12:31 pm Are you mixing up ideology with idealism? Just heard wench Mensch defending Jez to the hilt. She’s such a caricature that I wondered about cartoons and looked on Scarfe’s website. Couldn’t find one but did find something being sold for £100 per copy on the Home page. Surely there’s a difference between an image of something so awful being produced for a newspaper and its being sold for private ownership (even if for a cause – which isn’t mentioned if so). Dave Simons on May 31, 2012 at 2:30 pm AC writes, ‘the Monarchy, and particularly the Queen, are bucking the trends of negativity. She is doing so because at times of instability and insecurity, people look to those people and institutions which deliver and communicate a sense of stability and security. Even ardent Republicans must acknowledge she does that brilliantly.’ As an ardent Republican I do acknowledge that the Firm is brilliant at self-preservation if not much else. Royalty non-plc certainly gives itself a sense of stability and security, but I doubt if it seriously rubs off on many other people. I’ve been impinged upon by this boring family and its army of toadies all my life and I resent it. I especially resent being made to feel like a dog-in-the-manger, party-pooper and victim of the deadly sin of Envy by a lot of stupid people who would in any day and age lavish ill-earned praise on any authority figure, whether monarch or fascist dictator. I’m baffled as to why people in one breath make a big thing about democracy, equality, merit and transparency and then in another breath organise street parties to celebrate wealth and power based on birth, inheritance, protocol, elitism, snobbery and secrecy. I’m not aware of any classless society on the face of the earth, but there are degrees of classlessness and when you visit places like the USA the difference is palpable straightaway. Bob Dylan once sang, ‘As I went out one morning/ To breathe the air around Tom Paine’s’. Over the next few days I’d like to go to Norfolk and breathe the air around Tom Paine’s rather than Sandringham any time! Mido on May 31, 2012 at 2:51 pm What about publishing a budget the u turning like crazy is that sound? reaguns on May 31, 2012 at 5:04 pm For any newfound Krugman fans on here, make sure you research him a tiny bit before you go around agreeing with him. If you do you will find he is very big on free markets (more so than we have ever been in this country), globalisation, he has made the case against minimum wage and eviscerated the idea of a living wage. He is against farm subsidies, rent control and all sorts of “socialist” policies. Even a glance on wiki will confirm a lot of this, I don’t recommend that anyone suffers his columns as I have often done! (Well they can be fun too.) He has spoken against bank bailouts. He has named Gordon Brown as one of the architects of the “global” financial crisis. But don’t worry. He certainly wiped the floor with his “rivals” on newsnight, and he is a big voice in popular economics. But among economists, he doesn’t have too much credibility. He usually refuses to debate his rivals. Even other left wingers say that is very selective with evidence, always trying to build socio-political case, seldom an economics one. There are much better left wing economists out there: Dean Baker, Robert Schiller and a personal favourite Nouriel Roubini (Doctor Doom). “We now have 2 years of experience here with austerity.” No we don’t. No we really really don’t. And when he said “The evidence says” I am quite sure that Andrew Neil would then pull up OECD figures and the like showing what the evidence really says, rather than the evidence gathered by Krugman. I doubt if we’ll see him on Andrew Neil’s show. Credit where its due though, you can only beat the opponent in front of you and Krugman certainly did last night, but then you are putting a nobel prize winning economist up against an MP and a venture capitalist, of course he will pound. Andrea Leadsom is one of the better informed MPs on such matters but for me it was a clear loss, as it always is, at the point where she said “We need to encourage more young people to start businesses.” Krugman just dismissed it saying “Most young people are never going to start businesses.” Absolutely right. Drives me crazy when I see these MPs or worse still the latest hot shot web entrepreneur on saying that. It would be like Didier Drogba coming on and telling us we should all play football. Yes we should have an environment that enables young people to start businesses, but to rely on such policies to solve unemployment is cuckoo. Ehtch on May 31, 2012 at 5:31 pm Hunt came over as a bit of a creepy creep today. Not big enough bags under his eyes, no sign of wrinkles on his forehead, and frankly just looked like a a life self-justifying self-righteous right shit. He made me bilious, and gag, almost made my tea come back up. Graham on May 31, 2012 at 6:03 pm Krugman made many incisive observations, but he summed up the core economic weakness, by stating the evidence gathered in the US, showing that businesses are reporting a lack of demand is the main problem. It is evident that austerity measures in the UK, are stifling demand, as well. We are cutting the amount of disposable income in the working population, by slashing public sector jobs; when we should be holding off for the present, till the private sector have the confidence to expand, but until there is business confidence in No11, there will be a sluggish response to any potential recovery, among private firms. (P.S. I recently spent time in hospital Alistair, where I was treated for Vasclitis – Wegener’s Granulomatosis – in ICU. I nearly died, but thank to the wonderful team of nurses and doctors, I am home again and improving every day. I was in Crosshouse Hospital for 6 weeks, before being transferred to a rehabilitation clinic. Can I just express my eternal thanks, to all the staff in ICU, and also the gang in Renal, ward 2F. They saved my life, then gave me the strength to live again. We are fortunate to have the NHS, and such wonderfully skilled people; who gave me back to my family. I will never forget them.) Eric on May 31, 2012 at 6:36 pm Those outside the UK can watch it here: http://www.leftfutures.org/2012/05/paul-krugman-on-newsnight/ Krugman says the Euro was a stupid idea, but that it should be saved. What people may not be aware of is that whilst in this country the right wingers were all against the euro and still are, and of course some lefties were as well such as Brown and Balls (to their credit) in America the right wingers were all for the euro. They saw it as a German controlled strong currency that would force the US to adopt more sound money policies, it would be like a new Gold standard. They still see it that way as far as I know. So anyone who would like to voice support for the Euro, remember you are singing from the same hymn sheet as Tea Party Right Wing Republicans! Krugman is much more of an idealogue, a sociologist and a politician than he is an economist, so you can almost guarantee if he was British he would be pro-Euro. Krugman also agrees with the British right wing that Greece should exit the euro, and that this will involve short term pain, but will also then lead to a recovery. Could anyone tell me, and I have asked this on other sites, why it is that American right wingers support the Euro and British right wingers are against it? Two questions which I wonder if anyone can help me with: 1. Does anyone know any good labour blogs/sites to talk about economics on?I like this one for politics, but realise I bore people when I talk economics, it’d be good to have a back and forth on that. 2. Krugman is an American left winger, and is anti euro.British right wingers are usually anti euro too.But american right wingers are pro euro. Does anyone know why? What do non-politically motivated right wing economists say about the matter? (I realise there may be no such thing, its a bit of an oxymoron.) It seems to me that for reasons of political expediency, american right wingers want a euro but british right wingers don’t. Right wingers (arguably) should stand for sound money and for democracy. British right wingers sacrifice their sound money principles in order to break up the euro, american right wingers sacrifice their democratic principles in order to support it. Anonymous on May 31, 2012 at 8:19 pm Was watching a bit of Alastair at Leveson. I don’t mean this in a spin doctor type way, but in terms of communication, he really is the man. They talk about Blair, who is good, but some of Alastair’s answers were so clear and had such information in them stated so methodically and in a quite hard hitting way, that his normal answers came across better than I could do with a prepared speech. No hesitation, no humming and hahing, no repetition, just clarity. mightymark on May 31, 2012 at 8:29 pm I agree and I’m not sure that there really is a “patriotism” bonus for politicians – at last not these days. It is sometimes said that Harold WIlson benefited in 1966 from the World Cup matches through which England would ultimately get to and win the final, however the trend was in any case with Labour. Similarly with the claim made for the Falklands effect on Thatcher’s 1983 victory. Labour would have given her a better run for her money had they had the sense to elect Denis Healey as leader after Callaghan rather than the woeful Michael Foot. Again the Falklands at best emphasised a pre existing trend. Even a “patriotic” disaster like Suez doesn’t seem to upset the trend as Eden’s successor Macmillan easilly won the subsequent election as 1950’s “never had it so good” prosperity kicked in. On Osborne’s U turns I think we need to be a bit careful in assuming they are disastrous. Sensible politicians junk policies that are liabilities wherever possible. Junking the poll tax didn’t harm Thatcher and that affected rather more people than pasties and caravans put together! Osborne will take a tumble inthe competence stakes for a while, but the betting must be that that will be forgotten by the election especially if – and it’s a big if – the ecomomy has recovered. Lasbour won’t be credible if it merely promises to reverse the cuts as there is consderable evidence that people see reducing the deficit as necessary. There is however a growing sense that the government’s is a one club policy that isn’t working. To be credible Labour needs to find the right balance between defict reduction ( and use that phrase rather than “austerity”) and imaginative polices that both get the ceconlmy growing again so that, growth can contribute to deficit reduction. Finally and apart from “the economy stupid” its the undertow of “misbehaviour” that does for governments these days – both Major’s and arguably Brown’s even if “unfairly” in the latter case it was politicians generally rather than just Labour ones at fault. Its the Warsis, Hunts and so on that Cameron needs to watch out for – not Osbornes caravaning U turn! I think that was the FT journalist talking. I don’t think AC has tracked so far right that he would credit Osborne with any actual ideas. Dave Simons on June 1, 2012 at 6:35 am The comedian Roy Hudd once did a marvellous send-up in which the Royal Family were moved out of various palaces and mansions and rehoused in a council house – ‘two up, two down, with a gravel path for the sentries’. The postman however had good reason not to be happy about the arrangement, ‘as these numerous corgis’ teeth marks will attest’. Ehtch on June 1, 2012 at 6:46 am Where’s Olli these days? Come back Olli, you scandanavian, you are loved here, whatever visiting wums from the “otherside” say. Libdem on June 1, 2012 at 6:59 am Can’t remember whether or not I’ve pointed this site out to you before, if I have sorry if not enjoy it…. http://hat4uk.wordpress.com It’s not a ‘labour’ site but it’s really good! Michele on June 1, 2012 at 9:22 am I reckon he’s the WUM and is very successful at it 🙂 They might support the Euro for its effect on streamlining banking and marketing and profiteering and money trading and spreadsheets. They sure as heck don’t support the EU itself politically. Furthermore, song for Olli, mmmm, bit of sex in it for me, at least, http://www.youtube.com/watch?v=SfckrfOYAy4 Tidy banging…. musically…. Come back Olli, we miss you. Economics excellent thinking is quite thin here, since you left, to in your might mind say, let them be, maybe. : ) Michele on June 1, 2012 at 10:13 am I can understand the reason for your partial quote from the FT, this is the full sentence plus a little more from a Toxi columnist : ……………… “The central thrust of his economic policy is sound. It is the glue that binds the coalition together. Were doubts to set in, the government could unravel………” It seems to me that that little more, plus the other part-sentence quoted, is about about its being the ideology that has to be ‘proved’ rather than the economics so I understand the reason for your selective edit. I don’t support this U-turn, it’s succeeding at making govt look like a fiasco or a farce which is funny or frightening (dependent on the amount of coffee imbibed) but there was always something unsettling about some pre-tax charity donations. There must be a smugness about it, feeling in charge of the Universe, avoiding tax and all those expenditures one doesn’t agree with no matter societal need, sploshing money along to any organisation at all that has charity status, lots of it prestigious rather than about helping the many (as we expect govt spending to). This woman has ‘given’ away £400m http://www.guardian.co.uk/theobserver/2011/mar/27/observer-profile-vivien-duffield-philanthropy Most of what the majoity of us earn is a direct product of the society we grew up in and what it made of us and allowed us to do in the present. It was crazy for the coalesced mess to try to block an income stream after all the other cuts it had made but what was ever wrong about Gift Aid being claimed AFTER giving from post-tax earnings? It is up to OUR Govt to decide what really is a charity overseas and what it funds. Dave Simons on June 1, 2012 at 10:21 am He’s working at the Bilderberg Hotel in Holland. From the Guardian feature I just linked, I’ve just re-read this from its author Andrew Anthony: ………………………. “On one side is the pragmatic case that says the very rich exist and therefore it’s best to encourage them to give to charity. The counter-argument is that the very rich should be more effectively taxed and the job of funding public institutions ought to be left to the elected government, not least because philanthropy tends to focus on high-status projects and neglect the local, marginal and experimental…………….. ” He says it much better than I did (except at the end I’d add the words ‘and political’). Ehtch on June 1, 2012 at 10:52 am Have I posted Meredydd Evans yet Alastair? Might have done, http://www.youtube.com/watch?v=ogDIc0242KI Brilliant man. right heel nippers these welsh corgis tend to be, Dave…… Joey W on June 1, 2012 at 11:46 am No I am not. But those who use the phrase “political ideology” as an insult may well be. The point still stands; it is hypocritical of Krugman to imply that others’ views are wrong on the basis of them being shaped by ideology, when he himself is clearly in the same boat. Michele on June 1, 2012 at 12:00 pm Who would you want for Pres/HoS then DS and how would you ensure that your choice of that politico is not thwarted by their govt as Obama has so often been? Ehtch on June 1, 2012 at 12:26 pm reaguns, you must have missed the video I posted – information, information, we need information, http://www.youtube.com/watch?v=AHiAZGlImMs Now I am not say anything special here, but if you fancy joining MI5 with me and become some sort of plastic James Bond, just give a shout. Be seeing you…. It will be fun. GillandDes Currie on June 1, 2012 at 2:05 pm Be careful what you wish for. The current Conservative government will not be able to salvage the economy. Don’t make it Labours problem by winning the next election. Then the blame will Labours fault, and what a blame it will be. Politics, you know. Des Currie Dougal on June 1, 2012 at 2:13 pm yep, but FT editorial, many on the papers staff (Wolf especially) are in firm disagreement with Osbornes Expansionary Fiscal Contraction nonsense erm, he specifically stated the other night (and has many times in the past in NYTimes column) that Gordon Brown was the first to act to save the financial system and should be credited for that. He also praised GB;s decision for not joining the Euro. Can’t remember if this was on Newsnight or the C4 News interview. Dave Simons on June 1, 2012 at 2:39 pm Come to think of it, what we need is a new national anthem. Perhaps we could have a competition on this blog? Maybe I’ll kickstart it. Three cheers for Thomas Paine! Cromwell come back again! Royalists frown. Fresh air blow through the land. Sack David Starkey and let’s all sing, hand in hand, “Off with that crown!” Ok – not great, but a try. Someone else could top it, I’m sure! Anyway, it’s better than John Lydon’s silly song about Jim Callaghan’s government being a fascist regime. Who knows, Neil Young might record it one day! Michele on June 1, 2012 at 4:07 pm LOL, there’s no wonder you’re such a conspiracy theorist and always ‘sound’ as if you’re posting from under a bedclothes tent. Anonymous on June 1, 2012 at 4:53 pm Seems Alastair only uploading comments once a day at the minute. Definitely echo those who want instant commenting function, would increase traffic on site, but see the case against too. Up to Alastair of course, though thought Digital Dan would advise him on the former option. That’s really easy to access, thanks. Devastating debate; when Jon Moulton repeats the mantra that more jobs will happen in the private sector when services move from the public/state, one wonders what he’s on and how much longer does he think it will take (even despite the giveaway terms they’ve been able to buy our services for). We’re two years in to this …. when Moulton then talks about Estonia …. play for yourselves, he really does! Krugman seems a wonderful objective man (on more topics than this one too) who really keeps his head despite being faced with two clueless opposers, he obviously enjoyed the better challenge from Sarah Montague on Hardtalk. As for allegations of ‘arrogant and dismissive’ somewhere along thread …. grow up. Very good performance on HIGN4Y despite the constant and apparently omnipresent tt there. He is also interested in more than economics. He doesn’t confine himself to comments about the West, much braver man than so many in ‘business theory’ . Anonymous on June 2, 2012 at 12:31 am The short answer on the British side (not sure I can offer anything on the US) is that to understand most British political stances on Europe over time you have to look not at European but at British politics. if you start with the postwar era, pre Suez Britain thought itself still a super power and all parties were against joining the ECSC and EEC as beneath that status. Post Suez British pols sought a new role and most parties ended up supporting entry though it divided Gaitskellites like Roy Jenkins and William Rogers from their still very anti European mentor. The Powellites as little Englanders despised Europe almost as much as they did the USA (and perhaps the rest of the world too!) and insofar as there are any left – Bill Cash perhaps? – have been fairly consistent, but note again their view is dictated more by their view of Britain (or rather England) than Europe. If Labour’s Social Democrats became Euro enthusiasts – splitting the Labour party over it in the 1980’s, the left has been shamelessly opportunistic in its stance. Labour having sought entry under Wilson, Labour, largely under the left’s behest, became markedly anti Europe post 1970 to take advantage of Heath’s growing unpopularity but changed its mind under Thatcher when, contrary to the Left’s old view of the EEC as merely “capitalist”, Europe offered an alternative anti Thatcherite philosophy at a time when there seemed no prospect of defeating her at home.The “red Rose” symbol adopted under Kinnock/Mandelson was of course the symbol of the European Socialists. Meanwhile most Conservatives conveniently forgot that it was under one of their own – Heath – that the UK had joined what became the EU and piled in behind Thatchers growing Euro “scepticism” – largely based on precisely what the left had ultimately found attractive about Europe – to take a postion that had elements of little Englandism but shorn of the anti Amercan component. Thatcher, as arguably the Tories’ most sucessful leader in the 20th C. had become, and arguably remains the Tory gold standard on the European issue and pro European Tories like Ken Clarke had to run very hard to keep up. Sorry for yet another potted history but I do think this is your answer. Damn, missed out again….. http://www.bbc.co.uk/news/uk-wales-18270404 Sigil on June 2, 2012 at 8:17 am http://stumblingandmumbling.typepad.com/ – not Labour, strictly, but fascinating to me as non-economist. This isn’t him at the counter here? http://www.youtube.com/watch?v=DKF-owJe5C0 Like to see ladies from Europe enjoying themselves…, even though I wish I could join in to their party….. spit roast the other way around….. It was a very good performance from Alastair, and a very good one from Hislop too I thought. The other 3 were good too though quieter. The winner… the show itself, and its viewers, much better than usual. Better than last week’s with William Shatner, who Alastair thought would be a hard act to follow. The ‘ideology’ from the present govt is all about capital for its own sake. Whatever its junior partners have pretended to believe in the past (about its usefulness for idealistic uses, investing in people, not simply being about more more and more money) has been successfully stifled. Having started out as a Labour supporter and candidate I think we’ll finally see Vince Cable reach simple Conservative branding before the next election. What a hoot. translates from the welsh as dwarf dogs, also by the way Dave, lovely creatures. No wonder our Queen keeps them. Jezuz, this diamond jubilee is going to be taxing, on the mind, the beeb is stuffed full of it already, barking on about it. I’ve read your reply, boils down to those being for or against, being so for purely political reasons, never economic reasons. And the politics of one upmanship at that. I always remember Blair on Marr last year “The political case for the Euro was clear, its just the economics that [were difficult, or didn’t work or something]” which tickled me! Yeah Tony and I wanted to buy a ferrari, the case was clear its just the economics that didn’t work! I do believe that the Tories initially might have seen the EU as a way of forcing Britain to be a bit more capitalist than it would be if left to its own devices. And obviously in modern times right wingers hate it for the opposite reasons, though various lefties are complaining about capitalist policies being ‘forced’ upon them. I think “they” isn’t quite correct, as some support it politically, but some do not (Don Rumsfeld for example.) I started it by saying “all” which wasn’t quite true. Also think they have changed their opinion over time, in the name of American interests. I like watching Krugman but I don’t think many consider him to be objective. He picks his position, then gathers, moulds, selects the data that can help him make a case for it. Rather than the reverse process as an academic should do. The reason for his profile is that he has an NYT column and he is one of the most flamboyant neo-keynesians. I agree, in fact I think very little of his analysis is based on economics, which is good in some ways, not so good in others. He certainly has an opinion on more countries than the US or the West. Yes both true, I didn’t feel the need to state either as I knew people here would be aware of this side of his opinions, I just wanted to remind them of the other side, and he did blame Gordon Brown as one of the architects of the crash. You can credit Brown as an architect of the crash but also say he was one of the first to act. nuts presented welsh song, barking, http://www.youtube.com/watch?v=LDUlhEM1k8A Janiete on June 2, 2012 at 11:46 am There are a lot more republicans out there than we are led to believe. I’m sick of the Jubilee thing already and it’s not started yet. On the national anthem, I’m with Billy Connolly: http://www.youtube.com/watch?v=i9nnnM-__JQ Richard on June 2, 2012 at 12:09 pm Great show, Al, yet another string to your bow. (Major surprise for Al was the format and the personnel on the show,Michele? ) The banter and p. taking make it the great watch that HIGN4Y is. If you wrote your own script and jokes Al, we need more from you. Incidentally Prezza and AC have contributed greatly to two of the best shows in years. When Merton goes quiet he has been outshone by the Chair. Libdem on June 2, 2012 at 12:15 pm Nice try but don’t hold your breath on Neil Young! Mark Wright on June 2, 2012 at 4:07 pm The Queen over her 60 year reign has displayed what David Cameron’s government (they are so I’ll defined they can’t even really be called Tories anymore) has failed to deliver even in 2…consistency. What is* the point of this government? What’s all that got to do with the institution of monarchy? The monarchy is an undemocratic symbol of class, elitism, snobbery, protocol, privilege and inherited wealth. But it is just a symbol. When you talk about Presidents and Heads of State you are presumably talking about elected people who have some power based on democratic choice and subject to accountability and recall. That’s different. If they get thwarted by their governments that’s all part of the democratic process. It is an irrelevance to ask me which personality I would want for these roles, assuming these roles would be chosen in a democracy. It depends who stood for these supposed posts. You’re dragging a serious issue down to a personality contest. I must confess I am sick of hearing the same arguments remasticated in defense of the institution of monarchy, decade after decade, generation after generation, especially when, as in the current New Statesman, they are masticated by people who claim to be left-leaning. I’ll echo the words of Tony Harrison: ‘Between Charles I and II Britain had a chance she blew. Britain blew her biggest chance to be a grown-up girl like France’. (From ‘A Celebratory Ode on the Abdication of King Charles III’). Incidentally, to refer to a previous post, I would certainly never forget the River Rother, but it rises in Derbyshire near Doe Lea, not in Yorkshire, where all the other rivers I mentioned rise. Also can I add for anyone who’s interested that William Hague’s accent is not typical of Rotherham – it sounds to me as an ex-Rotherhamer more like Bradford or Huddersfield! reaguns on June 2, 2012 at 8:14 pm If you want to see how Krugman distorts the picture, just read this: http://www.nytimes.com/2012/06/01/opinion/krugman-the-austerity-agenda.html?_r=1&ref=paulkrugman He’s all wrong on the metaphors by the way. Even if he is Michele, he gave good economic information, which we need, information, information, etc, and so on. : ) I must learnt it, from way up. Brilliant fella. by hook or by crook Joey W on June 3, 2012 at 12:47 pm LOL! What a brilliantly ironic comment. Ehtch on June 3, 2012 at 1:19 pm gwlad yn eifiron eintiron i fi http://www.youtube.com/watch?v=Zg6nAOApirg oh piss off will you english, you have no clue Row row your boat through eternal life, as if I could give a fuck through eternal strife. http://www.youtube.com/watch?v=z0THhn1j7FA Thames? Give me a rest. mightymark on June 4, 2012 at 9:08 am Saying Tony was wrong abut the Euro is a bit like hitting a wounded man when he’s down – i.e. Tony and the Euro.! I’m a fan of the man and was at least open minded on the Euro but I’m grateful now that we stayed out. I think WuMs are very valuable and it’s always a joy to see the sourpuss twerps that arrive in couples or threes to ‘about’ re Olli to each other. Re the ‘info’, no argument except about the ‘good’. It’s facts and like any other stats it’s subject to interpretation and re-interpretation and yet more, ad infinitum ….. there will always be another way of reading things ….. proving the usefulness of the mode word ‘prism’ ……. everything can be looked at in so many ways, wide, narrow, at an angle blah blah. I do worry about those impressed by the Dan Brown-inspired propaganda; don’t we have enough religion-inspired hatered around already? Oh dear oh dear oh dear, he’s ‘wrong’? You mean he has different opinions to yours? By my second ‘they’ I’m referring to members of the public, the very many that think the whole of the world outside USA is ‘cahmie’ and biggest will stay on top (they didn’t foresee BRICS!). Hopefully USA will open up even more, there’s some gd-awfulness. Thanks 🙂 I try my best. I don’t know which came first, the NYT column or the Nobel Prize, I could look it up but it hardly matters ….. either way I think your dismissive subjectiveness is hilarious. Isn’t GB being ‘first to act to save the financial system’ very different to him being included in ‘architects of the crash’? Is the latter a quote or your own? Were there any architects of the crash? Don’t architects do things on purpose? Wasn’t Bush’s appalling gormlessness on ‘The Lehman Weekend’ the reason (without misusing the word ‘architect’) for the crash? So many dreadful things that were averted or were not averted in their respective locations on Friday afternoons! Sigh …. ‘what’s all that got to do with’? If there are more than two acceptable systems (ie: monarchy vs republic – let’s ignore communism eh?) can you enlighten me? Forget about exemplary Presidents (from among our motley likely candidates), forget about ‘personalities’ …. name a country a state a nation where a President has been a long-term advantage. We have a lifetime HoS that has to support what our changing elected Govts plan to do (which should be what they were voted in to). Our Govt is our way/route to change. USA has a head of state that is voted in on their promises but govts that have no need to support him/her …… it’s often the surefire recipe for very little happening (unless there happens to be the rare monolith of same party both houses). They also have that yawn-y 2-yearly performance / beauty pageant / total waste of money and resources and time to pump Pres up or pump Pres down). Yes our HoL needs some sifting, yes it does improve a lot of legislation but I doubt many of them are driven by the monarch or are even nodding acquaintances these days. I can’t imagine what it must be like to not so much have a ‘job for life’ but to always be on duty, never be able to nip out without dolling up. Always be subject to that photographer, always scrutinised and commented about. Having lost someone in a RTA myself I could hardly believe how the public behaved at the time of Diana’s death. However, I doubt many had themselves experienced it or knew what shock does to people. It’s not so long ago since THE standard for mourning was curtains closed and implosion for a few days. 24/7 scrutiny …. no thanks. Are you mixing up Hague with Clarkson btw? Hague’s only ever claimed to be from Harrogate hasn’t he? One of those north Yks people that thinks Torydom itself is aspirational :-s Just seen that the ‘Bit More’ version of HIGN4U is on tonight at 11pm, listed as 8/9 which I suppose means next week’s is the last of the present series. http://www.radiotimes.com/episode/qyfgx/have-i-got-a-bit-more-news-for-you–series-43—episode-8 Indeed, for me this goes into one of the better episodes over the years, Alastair joins the stars who have made my sort of top 10 list on HIGNFY, which would include Charles Kennedy, William Hague, Boris Johnson, Nigel Farage, John Prescott, Piers Morgan, off the top of my head. For me, though there have been good celebrities and comedians on there (I particularly enjoy David Mitchell and Victoria Coren) the real fun comes when there is a political heavyweight on there and when the humour, in both directions, is as biting as possible. This to me is more funny than just comedians making jokes, when there is a bit of political needle. And of course politicians themselves often have very sharp comedic wit. I do miss Angus Deayton though. Alexander Armstrong, Jo Brand, etc don’t really cut it… but I know someone who could make a decent fist of it on a permanent basis… how’s your schedule Alastair? I do think it is a shame that Healey was never the leader, he had a formidable command of economics and is one of the best regarded chancellors, and of course he had the wit for the HoC, just like John Smith PMQs would have put him in his element. I also think, and I’m struggling to find the right words here, that he would have been harder to portray as “weak” than were Foot and Kinnock. That said, I feel Foot was a man of substance, if not quite suited to 1980s politics perhaps, but I think if Foot had never been elected leader, Labour people today may wonder what might have been, just as I wonder what might have been had Tony Benn been leader. Thanks, will keep an eye on that one, read a few articles but not enough to judge. Getting into arguments on the comments page should be the fun part of course! I must admit I did detect a bit of conspiracy theory in the first article I read (evil neocons executing their secret plan for Greece and Oil (is it cooking oil lol)) but will persevere with it for a bit, seems to cover some interesting topics. I forgot about the guardian of course, that is where I do most of my economics arguing! Very funny – as I think Bill Wyman and Ringo would agree – but I think the words need changing more than the dreary melody, so in that sense I can’t agree with Billy. Yes I agree about the percentage of Republicans – I think some of these opinion polls must be conducted outside Buck House! Anonymous on June 4, 2012 at 10:31 pm Alastair – this blog is pointless in terms of comments at the current rate of update. Watch the responders / viewers drop if you don’t believe me. I prefer when people ignore me so that I can say I told you so. You ‘talk’ as if politics and economics are totally separate. I don’t see how they can be. New Labour is the best meld there has been. It’s not about envy or resentment, it’s about levelling up, giving everyone a reason to aspire, ambition that’s not just materialist. The trouble with the sham and his espoused (and begrudging) admiration of NL is that he’s got his weighting wrong. It’s not even difficult, there are only two ends of the scale. Soooo funny to see all the defence of the U-turns this weekend …. sneery Hislop’s description on HIGN4U ‘they listen to the public’ ….. ahhhh so that’s where the 179,409 signatories of Dr Chand’s e-petition went wrong, they should have shouted. Amazing that sham&osbo cave in about fatty greasy pasties but ignore real concerns about our health service. Does that say lots about what they (in their bought-qualified way) believe the public really cares about? I don’t give a sod about hot smelly greasy ‘food2go’ and don’t give a sod that the sloppy sods have caved in about sodding fake food. They just don’t sodding well get it. ……………… Britain blew her biggest chance to be a grown-up girl like France’…………………. Being against something isn’t a good reason for wanting any old something else. Given the futility I’m facing elsewhere on thread with someone wanting a republic but unable to name one that is worth emulating (or able to name a worthy Presidential candidate for here) I just want to do a version of The Scream at y’all. It is dishonest and juvenile imhoo to voice simple objection to something without having the bones to suggest suitable replacements for immediate adoption in lieu of what’s to be kicked out. So ……. show your cards J or DS: – who would you want as Pres? – which countries have better systems than ours? No personalisation here … no stupid kick it all down with nowt to replace it … ……….. put up or STFU pretending to be trendy. Gimme the alternative/s and you might convert me. Mmmm, this is not right to read. Lack of logistics planning, methinks. Link, http://www.guardian.co.uk/uk/2012/jun/04/jubilee-pageant-unemployed Could rant about it, but I’ll leave it. By the way Alastair, just watched Scotland play Oz down under, at Newcastle, NSW. Scotland won 9-3. Quite a game – it was played in cyclone, wind and rain like anything off the Pacific. Guest on June 5, 2012 at 1:07 pm Only 16% of the country http://cdn.yougov.com/cumulus_uploads/document/6nces75nwx/YG-Archives-Pol-ST-results-01-050612.pdf Have I missed him returning his CBE ? mightymark on June 5, 2012 at 8:04 pm “You’re dragging a serious issue down to a personality contest.” I think that unless you are talking about a political President a la France/USA that is exactly what the election of a merely figurehead head of State type president would be – think London Mayoral. As a pariliamentary democracy we simply don’t have the tradition of directly electing individuals to major postions and that is probably why people tend to think in terms of “personality” type presidents – Blair (I’d be happy but I suspect you wouldn’t) Alan Sugar, or maybe a dual presidency by the Beckhams. Of course we could go all out for a major constitutional change and have a full blown French US type Presidency but no one I know seems to envisage that. Is that what you want? Also worth considering the House of Lords debate precedent here. Yes – we have (mainly) got rid of the hereditary element but turning it fully democratic isn’t so easy, as the whole thing opens all kinds of cans of worms. Frankly reform often seems too much bother for any real democratic advance it would entail and shifts attention from what anyone broadly left pf centre would regard as important issues. I fear attempting to replace a hereditary monarch with an elected figurehead type president would become similarly bogged down. edit – where the heck did I get 9-3 from!?! 9-6 it was I should have said – another brain to finger fart again. I have mentioned alternatives like Germany and France. I don’t need to mention any candidates for presidency. That’s a democratic choice, which a monarchy isn’t. No, wrong based on evidence, as well as logic. There are plenty of good leftish, rightish and centrist economists who agree with me on that. He is very politically biased and selective with his evidence. If you are interested, and I suspect you are not, you could look at two things: 1. Common sense: Check out his babysitter theory. 2. Check his words prior to, during, and after the crisis. He didn’t think government spending was a problem, he did mention that debt was a problem but his solution to that problem was of course… oh yes… more debt. He said we needed a TARP and stimulus programme, others said if we did that the next thing we’d have would be a sovereign debt crisis, he poo-pooed that idea but what do we have now? And his rivals say if we follow his prescription this time, we’ll have a currency crisis. Lets see. I know that I invested based on the recommendations of his rivals and, so far, that has been a profitable strategy. I was against it, but I could see the sense in some of the arguments for it. I wasn’t as certain in my predictions for it as many now claim to have been at the time. Take a left wing economist like Robert Schiller – barely opens his mouth without giving you all the evidence, and crucially he looks at all studies not just his own (Krugman uses his own rigged evidence mostly.) Look at Nouriel Roubini – clearly predicted this crash and the next one, unlike Krugman. There are others like George Soros and John Kay, but Schiller was totally vindicated against the “right wing” views of the likes of Alan Greenspan. I am not against Krugman because of his ideology, because he is leftist or Keynesian – its because of the way he selectively edits the “evidence” for his case. Keynes of course said “When the facts change, I change my opinion” with Krugman its more like “When the facts change, I mould the facts to suit my opinion.” You know Hislop is not a Tory, right? You know he said the politician whose ideas he admires most is Vince Cable? I think a political leader must make decisions for sociological reasons as well as economic ones, and for political reasons too unfortunately. I just don’t like it when they pass off a political or sociological policy as an economic one, or pretend it has no economic ill effects. I think you can look at the economic case separately, even if ultimately your decision has political and sociological factors influencing it. I suppose a blatant example would be paying benefits, or paying benefits to single mothers with a few kids. If we had pure capitalism, there would be no benefits, other than charity. Our GDP would almost certainly be higher. But very few of us beyond a few crazy fascists, eugenecists and anarcho-capitalists want such a society. For social and humanitarian reasons most of us believe people should be at least fed sheltered and clothed even if they cannot provide for themselves in a capitalist society. Most political parties probably also conclude that they will lose the votes of those people and many others if they do not provide this. But we don’t have to go a step further and pretend that we are doing it for economic reasons, that our gdp and productivity will rise because of these policies, or our unemployment will fall. They won’t. We just want to do it anyway. ofgs, accept that it’s about directing comms and that not enough blog holders TAKE responsibility for what appears. I would imagine that even the likes of Delingpole rue what happens under their own banner on the Toxi-site even if stuff can get pulled minutes/hours/days later so that the actual process of a whole thread is lost. Certain slob-likes (naming no cough ….. Gilli …. splutter names) welcome the EDL thugs and might vvoice ‘kapow’ and ‘gotcha’ and punch the air as they read what’s been input and stays ….. if they even bother. I doubt AC holds back anything that he simply disagrees with but if you think freedom of speech is about unfettered publicity for any old racist sexist or lying or vicious crapola there is lots of it around ….. BTW, people don’t stop responding because they have reached a state of having ‘been told’ and giving up or LOL been converted by you ….. if that’s how you interpret anyone using ‘Ignore’ or just being busy with their veg bed all that you’re proving is that you’re not certain enough of your own opinions that you can accept others being as certain (and having the right to) theirs and knowing ‘what the hell with more hot air?’ or enjoying the state of ‘do I look like I give one’ or, more rudely, dilligaf 🙂 This is Krugman’s analysis, not mine. He blames Brown for being an architect of the crash. Thats not a direct quote, but I remember the word architect was certainly used. He also praised him for acting to save the financial system. Isn’t it possible to be one of the first people to cause a problem, but also one of the first to act to save it? I have often made mistakes at work but also been the first one to attempt to fix my mistake, is it so different logically. And he certainly said “one of”, its not like he would say “Gordon Brown caused the crash.” The problem with Krugman is he is now saying “Oh if we had a recovery, I would become a deficit hawk, I would say we need higher interest rates, less debt, a smaller state – I just think we can’t do it now.” The problem is, just like Ed Balls, you can go back through his entire career without ever seeing a time that he says is right for reducing any of the above. They are not really Keynesians at all. I don’t think that Bush’s actions on the Lehman weekend caused the crash no, though like Brown he could have done things differently. Lets give Brown credit, he had his own plan, Bush was totally reliant on his finance team on that weekend, Bush hasn’t got a clue about such matters. I don’t think Brown “caused the crash” per se either. But they were all part of it. Along with Greenspan, Clinton and many others who either supported or did nothing about: 1. government controlled artificially low interest policy (leading to large housing, credit and government spending bubbles.) 2. forcing firms to lend to sub prime borrowers 3. lack of regulation on derivatives 4. moral hazard in the banking system I think without 4 the crash could never have happened. And I don’t blame Brown or Bush, this is beyond the remit of a president or pm in a way, because the entire economics, finance and political world had accepted the consensus that our banks should be set up as they are. Unreasonable to expect Brown/Bush or anyone else to see that or change it. I’d say that applies to 3 as well, despite the dog’s abuse Brown and others are now getting. There was not an academic consensus of sufficient weight against these systems. 1, and 2 however were loudly and prolifically warned about and are entirely predictable throughout financial history. They must carry the can for that. I would have been a natural republican, but came to the conclusion long ago that: 1. It doesn’t really matter very much. 2. Lots of people seem to get a lot of fun from watching the Queen, the Royal Weddings and all the rest. I don’t think it does much harm. Why remove that pleasure from all the old dears and everyone else who enjoy watching it all? Therefore I feel banning the Royal Family would be like banning football or something. It would remove pleasure from those who currently get it, remove a bit of tourism revenue, for those in favour, without delivering any benefit to those against. So many republicans should be stand-ups! Yep, Germany must certainly have enjoyed the freedom that gave them Hitler as their chancellor / president for so long. France …. another LOL. India – on its 4th generation since ’47 of one family in leadership with only a short and sad break, late 70s). It’s popularly described as ‘the biggest democracy in the world’ yep …. if all that ‘democracy’ denotes is the ‘right’ to a vote (with little guardianship of how it happens on the ground). Pakistan …. only a few years past the latest assassination of another someone that lots of someones supported simply due to her being progeny of a past Pres. Burma/Myanmar …. someone incarcerated for decades because, as the daughter of the someone that ‘freed’ the country from colonisation she thought she had rights and knew what was best so the whole country has been penalised for decades due to scrappings about her and the faith in her simply due to the family name. Wherever HoS is a beauty pageant or subject to argument / voting / preferences there is short-termism. We have a HoS that has some type of privilege but has no power (except to guard our state constitution) and little freedom. We have no tumult or undertainty about whether to replace them every 4/5yrs, they are simply there, doing what we require of them through our elected leaders. FGS even Rod Liddle has come round to understanding it!!! Whether you like the question or not, when it comes down to WHO would you choose NOW you have no answer so you’re simply blowing bubbles. Change for change’s sake is great in some areas and some industries (without it I’d have a very boring career) but in human terms it’s not helpful to have Pres vs elected politicians. Yep, we had a democratic choice in May ’10. We got someone with NO training for the job (which can surely be said about most Presidents but not about many UK monarchs). When the sham read what he did yesterday I wondered who was the comedy genius that had suggested/agreed he read those words. Surely someone set him up 🙂 Er… that seems like quite a stretch of extrapolation from the post its in response to! I’ll reply anyway. I said elsewhere, I appreciate the reasons for not just letting everything appear, and I understand that Alastair does not have the infrastructure of the guardian or telegraph who can employ minions to moderate. I also appreciate its not easy to find time to read everything. I am now accepting the opinion on here that Alastair updates the blog himself and is his own moderator and therefore reads the post. If thats not the case then he needs to give his gopher a bit of a kick! I am just saying, that it is not as fun for commenters under that system and is a trade off for less traffic on the site. I presume that people such as Alastair are aware of such things, and address them if they feel the need. But I have been let down by such presumptions quite often. Who is talking about people not responding? My point was it takes ages for people to respond, including myself. Of course people not responding proves nothing, it neither means a “win” or a “loss” and I have done enough commenting now to know that no one ever changes a made up mind. Some people (me sometimes) go on to ask questions and expand their knowledge, in this mode people take on new opinions, but when arguing about things they already know about, few change their mind, myself included of course. I don’t think Alastair holds anything back. Perhaps if he gets trolls with nothing more to offer than “WMDs” and all that then he saves us the boredom, though I doubt if he would ban or suppress someone for making a structured argument even on that subject. Lastly, perhaps it looks like Alastair was taking it a bit easy for a few days on the blog which is why it only got updated once a day or every two days. Probably thats because he is a monarchist… Please enlighten me as to what job you think our Royalty are trained for. Not government, surely? I may be misreading you but I get the impression that you think the Weimar Republic in 1920s and early 1930s Germany was a cause of the rise of Hitler and that if Germany had retained a monarchy it would have acted as a defense against Nazism. I’ve got a problem with that analysis – Edward VIII. I’m not sure why you need to go on a global tour of India,. Pakistan, Burma, etc to show that republics don’t work. Have I got to go traipsing round all the Middle Eastern monarchies who treat their ‘subjects’ abominably? The institution of monarchy was abolished in this country in 1649. It was restored in 1660, but a lot of people who brought it back had good cause to regret their action soon after. Over the next few decades after 1660 the monarchy had to be kicked into its present subservient role whilst retaining the semblance of being in control – ‘my government’ as Lizzie jokes every time she ‘opens’ parliament. I certainly want the monarchy abolished but only when a majority of UK citizens want it, and I accept that it’s a long way off at present. I don’t think anyone’s suggesting banning the Royal Family. Banning suggests some kind of threat of resilience and restoration.I do however dream of a day (which I probably won’t see) when the monarch opens parliament with the line, based on solid public opinion, “My government will abolish the institution of monarchy”. At last we’ll all have grown up! Meanwhile, on with the silly tittle-tattle, the camera smiles, the waves, the corgis, the ill-earned praise, the grovelling pop stars, the toady historians and ‘investigative’ journalists, the soap-sudded celebrities…. ‘I can’t imagine what it must be like to not so much have a ‘job for life’ but to always be on duty, never be able to nip out without dolling up. Always be subject to that photographer, always scrutinised and commented about.’ The Royals have a choice which none of their ‘subjects’ has – they can continue being Royals or they can decide not to. If they decide to continue it’s probably because it’s a cushy number, and about the best they’re likely to get, given their dearth of talent (despite first class educations). What they call work a lot of her ‘subjects’ would call play – lifting glasses, being ‘head’ of this and that organisation (but never attending a single meeting), ‘opening’ this and that, sitting round a large table troughing, etc. As for Bill Hague, he’s from Rotherham – his dad had a soft drinks firm in Parkgate and I think little Willy grew up in Wentworth or somewhere like that. He went to Wath Comprehensive, but it might not have been a comprehensive when he started. I prefer not to think about Clarkson. Well hey, the people that didn’t vote for Hitler’s party must have been mighty sick to see what he brought to his country. Their descendants might just have to resent the suspicion of it for evermore …. even of Mrs Merkel’s efforts at unity nowadays (their being constantly interpreted as another way to take over Europe durrrrrr). We aren’t likely to change each other’s mind, you have a dream or a wish or a ‘what if’ based on no reliable objective idea or example of ever being possible for more than that one first unusual person as Pres’s life. As for the quips about the east, it’s called the world DS, examples we can look at to see how badly wrong things have gone for some that had a dream and preferred it over a known reality. Oh we’ve had ‘WMDs’ and ‘dossier’ and ‘Bliar’ and all the other crap; we even had some courtesy of The Sneer on Friday night! I wonder whether people like Scarfe, Steadman, The Sneer et al have ever applied their witty skills about people in their own empires, especially about their employers? Surely absolutely surely they have the right to, just for fun? Let’s see them describe their bosses! As soon as. Unrelated to the above, more to do with Leveson …. I was thinking about those tapes of the early 90s (PC and Camilla). Didn’t most assume at the time that they’d been bugged by the security services ….? He has explained the POINT of debt, it is to be used, used creatively. He has different priorities than you and he believes economics has to serve people, not vice versa. You believe in capitalism for its own sake, you don’t believe in the responsible version of it, yoou don’t believe in Govts investing in their people so you will never even want to respect someone like him. You go on and on about minimum wage being destructive ….. greedy profit margins are the real destructive ….. I posted recently about those retailers that are slicing their margins and still raking it in AND while not just paying minimum wage AND without exploiting those in supplier countries. I’ve not found that post, I’m having very trying (seen me snarl?) Bband ups and downs recently and perhaps I just couldn’;t get the flipping thing through. Janiete on June 6, 2012 at 8:32 pm Most of the time Michele, I am indifferent to the monarchy and I readily confess my thoughts on an alternative are far from clear. But every time we have a ‘let’s worship the royals’ love in, it makes me feel both angry and sad for the people of our country. It seems to me that the essence and heart of a nation is its people; their history, their stories, the reality of their lives. But the monarchist narrative has no place for them, they don’t matter except as subservient, adoring flag wavers. The problem is summed up very well in the words of our national anthem. Basically the Queen IS the nation; as long as she is OK, all is well. In a modern, democratic society, this is surely nonsense. The people should grant her the privilege of representing us, not the other way round. We invest far too much importance and money in the royal family. To me it is meaningless and pointless, on a par with modern day air-headed, celebrity obsession. But it seems we are struck with it for now. So, I like that the Queen has no real power and that her role is merely ceremonial. In fact, if we ever did switch to a presidential system, I would want to retain these aspects and ensure all political power stays within our parliamentary system. Perhaps a sensible interim compromise would be to add another box on the ballot paper at each general election, in which voters are asked to confirm their support for the monarch as our ceremonial head of state. Then it’s clear; all power rests ultimately with the people. And our national anthem should reflect that fundamental principle; our commitment to each other, a celebration of what we as a society have achieved, and what we want to achieve in the future, together. Must confess I’d not heard of Roubini, looked him up and this sounds very likely to be true, from Business Week ……. Michael Mandel noted in 2006 that Roubini and other economists often make general predictions which could happen over multiyear periods………. Given NR’s long-time tag as Dr Doom 🙂 Off topic reaguns but I thought you might like this : http://uk.news.yahoo.com/northern-rock-sale-deliver-11bn-profit-113235243.html As to how much that £11Bn will be worth compared to the inflation that will have taken place in the meantime lalalalalalalalalalalalahhhhhhh Ooooooh but the lalalalala also explains why lending is sometimes worth doing for the sake of those living working and being taxed in the now ….. Build things for us / them even if with loans because saving up to build them later might well cost more; interest vs inflation innit…… They need Gypsy Rose Lee in Cabinet (oh if only for the return of GB or AD in drag?). I can’t remember who I thought bugged PC and Camilla at the time. Didn’t think it was right anyway, didn’t think it would be fair game on a normal person, or on them, and I was -rid-of-the-monarchy person at the time (I’m not anymore.) To be honest I don’t know who bugged PC and Camilla? Anonymous on June 7, 2012 at 1:03 am That’s not true regarding my motives. I’m human so I could be wrong, even famous, harvard and oxbridge educated economists, presidents and prime ministers have been, so why not little old me. But my motives I believe are sound, I do not believe in capitalism for its own sake, I do believe that economics must serve the people. I also believe in democracy first, capitalism second, so when the people in a democracy feel they are not served by whatever version of capitalism they have, they should have the right to change it. In a democracy, it will be hard for a version of capitalism which does not serve the people to be maintained anyway. I believe that capitalism is the best way to distribute power and wealth to the weak and the poor, thats why I believe in it. Otherwise I would seek a different method to do so (and in some cases I do support distribution by other means.) The example you gave could not happen in a properly capitalist system, because if a firm is raking in all that profit, that means a rival can step in and do the same job at a lower profit and therefore lower price to the consumer. The governments job is only to ensure there are no barriers to entry, such as regulation. This is why big firms lobby the government for regulation, in order to keep competitors out, and this is cronyism. This creates monopoly when it should be the governments job to ensure that competition smashes monopolies, or to smash them itself where competition doesn’t (very rare.) Nothing new, its Adam Smith 101 (who Brown claims to be a fan of.) That solution will not address the low wage issue directly, but allowed to play out it will because it will mean that the wages people earn are worth more because they can get things so much cheaper. This is the example shown in America, steadily rising wages and productivity, steadily falling working hours (economics is not about creating work, it is about reducing work), steadily falling prices and steadily increasing standard of living. “Oh but America is different its not 3rd world.” Perhaps some of my ancestors who emigrated there in 19th century might disagree with that. The type of exploitation you are talking about – is supported by Krugman, he believes sweatshop jobs are better than no jobs, check him out. Krugman is no messiah. I don’t like any of that stuff either, I would certainly reduce the opulence that the monarchy enjoy. I suspect they are one thing we spend public funds on that generate a bigger return than what we spend, though I would like a study to be done of that! And one of the olympics! I don’t like the waves, the corgis, the speeches, the pageants, the weddings, never watched any royal stuff, seldom read any of it. Even found Diana pretty annoying, there I said it. But I think that my dislike of it on scale of 1-10, 10 being most, is probably about 3, whereas those who like it probably reach 6 or 7. I can choose to avoid all of it if I want, therefore it doesn’t harm me but other people get enjoyment of it. To me its like boxing, I think those who want to do it and watch it should be allowed to, including myself, I don’t think others should be forced to take part, but I don’t think they should be allowed to stop me taking part. I suppose in relation to the royals, we should work out what percentage of tax we each pay and have an opt out! I’d opt out! Or we could just privatise the monarchy! ‘We aren’t likely to change each other’s mind, you have a dream or a wish or a ‘what if’ based on no reliable objective idea or example of ever being possible for more than that one first unusual person as Pres’s life. As for the quips about the east, it’s called the world DS, examples we can look at to see how badly wrong things have gone for some that had a dream and preferred it over a known reality.’ I’ve had to lift this quotation from Michele below to get some space for a reply. Can I say that I think Michele’s summary is absolutely stupid? France and Germany are two known realities that I’ve mentioned (and she hasn’t) – both republics. It might upset her gut patriotism but those countries have as much claim to civility as the UK, and some would argue more. What the hell is she talking about – ‘no reliable objective, idea or example of ever being possible, etc’? Has she ever been across the Channel?Those countries are on our doorstep – does she have to go hunting for lousy republics on the other side of the globe to bolster her feeble arguments? We’re talking about real places, real people and real systems of government which some of us find better than our useless ‘Queen in Parliament’ set-up. It’s become obvious to me in this dialogue that arguments against the monarchy make her feel threatened – which is a shame because democracy is all about argument. Maybe she prefers the cosy safety of the known and familiar, even if the known and familiar is a load of crap. I don’t know of anything that Hislop is pro- about. Perhaps admitting to being pro- something would impact on his future job prospects so it’s best not done …. keep all options open? As to Vince Cable and the forever portrayals of him as Mr Clean, isn’t he the ultimate Mr Say What’s Popular Even if it’s Destructive? The production company that makes it lists some of my favourite comedies (one of them being Armstrong and Miller, I really don’t know how they get away with the dentist character blush). I agree about Healey. Foot was man of substance but it was intellectual and literary substance – not the political variety. Had Benn become leader? – two possible answers either it would have forced him to grow up or he would have split Labour more fundamentally and perhaps irrevocably than even Foot managed. Whoopsy daisy! End of match celebration gone wrong – two sore heeeds. http://prem1.hiboox.com/images/2312/diapo2dd4bb4e8d198ef0082c5d0ade7a765d.gif Both required stitches, glasgie kiss style. There is a market, altruisically without these time consuming pop up ads, for blogged online video non-MTV djs, as long as they can accompany them with well interesting comments. Could be run on a wikipedia type donation lines, and no need for registration and log-ins and shit, again precious time consuming, and feedback with comments from followers. And a subsection to present well visited blogs, a subsection called Radio alsataircampbell for instance, with sidelinks to threads in the mainsite. Or something like that, may need skythought and all that bullshit. An alternative to having to actually visit youtube, and will give music to like minded people. Anyway, something like that, as long as the committee who does it is not too large for decisions. But I might be talking pants here, but there could be something in it, rather than having dedicated music blog sites. Another Swede I like is Emmon, still going strong, another that has healthily attacked the online age in the last half-dozen years or so and has the hang of it as an artist, http://www.youtube.com/watch?v=BbtC_rbQWVw more Emmon here, and no, I am just a fan, and no, no cut for me from whatever, and no, have no ambition to be an agent of such – I have enough trouble coping with myself, thanks, http://www.youtube.com/watch?v=uJelCgh2s48 Looking forward to rugger tomorrow Alastair, starting with the kiwis/paddies at half eight morn, to argies/ities in the evening, Cymru/Oz and England/Saffa inbetween. It will be quite a marathon. Having had quite a bit to say about Queenie I feel the need to spill about Downton Abbey. Rushed to see ‘Gosford Park’ because of H Mirren and the costumes but absolutely hated the storyline and atmosphere. A little while later its writer was on Question Time, didn’t take to him at all but thankfully the remote was working and he could be turned off. Downton Abbey has never been on screen in this household. Re Mrs Warsi (wasn’t the man still married when they wed and eventually divorced the preceding wife without informing her?). I believe that his accompanying SW happened very shortly after her elevation to the title. There are many layers of user-dom in the whole situation, not least that of both Mrs Warsis. Hope you’ll play this on iPlayer DS and enjoy NY singing the National Anthem about 30 mins in to this interview http://www.bbc.co.uk/programmes/b01jhp10 Titter 🙂 Ooops, scrolled past this when leaving my other re your suggestion of alternative words to the NA. Address above to me chum and it might earn a reply. Without that courtesy, piddling infantile cheapo talking across and about makes me gip. Yes I took no notice at the time but looked up some summaries last week and it seems one or other of the MIs was being blamed. Wasn’t there also some suspicion of her butler? My speculation now is due to Leveson and whether it was all along private tecs in the pay of some media 🙁 Buying from the third world is not all about ‘sweatshops’. It spreads work, business, wealth uplifts the third world, showing the benefit of education and training for their people, making cruel or backward govts realise their people can be their currency. Nothing else but trade will do that and it has been a quiet revolution during the past 40yrs. I don’t mind you providing a link as proof that Krugman approves of ‘sweatshops’ if you feel the need (bearing in mind they will need to be about more than the climates elsewhere). I just don’t take it all that seriously J! It provides the reason for people to just get together if they need one to smile at strangers and have a good time, gives inspiration and material for some creatives to do wonderful designs and displays, saves gorgeous items from the past to be used and not smashed and spoiled and distributed who knows where…….. I just can’t resent it. As I’ve said before I used to be anti-monarchy but when I saw inside all the republics that I have I just came round to appreciating what we have more (my Dad must be laughing his socks off on his cloud xxx). I’ve posted earlier about how little I appreciate all the in-between tiers but the revolting thing is how they exist in republics too …. as well as do hereditary successions. As to the idea re a tick box at election time yep …. as soon as voting becomes mandatory! Have a good weekend 🙂 Thanks Janiete – agree with you all the way! A. E. Housman wrote in honour of another Jubilee: ‘Get you the sons your fathers got And God will save the Queen’. He was of course referring to soldiers who died in battle. Sigh ….. my angry reply is after reading his first few cowardly sentences. Have now read the lot……. I’ve worked and played in France and Germany, he shouldnm’t jump to stupid conclusions, it makes him look stupid and wimpish. I found the article reaguns http://web.mit.edu/krugman/www/smokey.html I agree with him (as well as celebrating that in the 15yrs since it was written things have improved such a lot). Given the first hand knowledge you claimed a few weeks ago I don’t ‘get’ your ‘no messiah’. Real messiahs need also to be pragmatists. but I am suppose I am up to offers myself from a jewish agent to help develop me. WHAAAART!! stereotype – arn’t we all, ey? schizer! as here, ripped off electronically yours, a site I regular visit, points to brilliant stuff to me and others, as their latest pointer to here, http://www.youtube.com/watch?v=OTnH3zs8wRo “Ooooooh but the lalalalala also explains why lending is sometimes worth doing for the sake of those living working and being taxed in the now ….. ” It doesn’t, but I can’t be arsed! I’ll just say that why a workers party supports the reduction in wages that inflation causes, I’ll never know. “Oh but we campaign for wage rises in line with inflation”. Well the wage rises are always just behind inflation, ie noone retrospectively pays you back for the years inflated prices you just paid for. And a lot of workers save. Does anyone increase the size of their bank balances by the rate of inflation? No. I’m surprised you missed the chance, taken by others, to slag off the government who have sold off northern rock at a loss (even Alastair would not try to spin this “but we’ll profit 15 years later” line.) I guess you still see it as a continuation of a Gordon Brown policy and therefore you want to defend it. However if David Cameron had bailed out a bank then sold it at a loss, we all know perfectly well what you and others would be saying, and it would be right in that case. But we can do things the way you suggest instead… in fact we already are… and thats why we’re in the shit. Maybe Benn would have divided the party yes, but then I would like the labour party to split in two, and I would like the conservative party to split in two as well. At the minute we have old labour and new labour, and a very large portion of labour’s voters would like more old labour policies. In the conservatives, we have the “dry” right wing thatcherites and the leftist cameronite “wets”. The theory goes that the voters want centrists, which is why we had the almost indecipherable centrist policies of brown, clegg and cameron at the last election. I’m not convinced, I reckon if the two main parties split up like that, then we’d have a left wing party, a right wing party, and 3 centrist parties. I reckon the left wing and the right wing party would smash the centrist parties in election. They would be so small that Cameron, Miliband and Clegg would have to join the same party where they belong. Something like the northern ireland situation would be seen I think, where the voters all left the centre for the extremes. Its true about economists in general, they might write a column one week which says “the government should be careful about doing blah 1, because it could lead to a financial crash” then next week write “if the government does blah 2, we could see a strong recovery” then when either of those things happen they refer back to their “prediction”. This is no better than when the sun claims a team is going to sign a different player every day all summer, then when 1 out of 60 predictions come true, they display their old headline the next day under the caption “You heard it here first”. There is also the phenomenon of “permabears” who predict recession their whole lives, and are obviously right sometimes, just as a stopped clock is right twice a day. However there is quite a well known (in economics) list of people who predicted the crash, which rules out those who were not specific, those who are perma-bears etc, basically sets out a lot of criteria to sort out who really predicted the crash. I am 99% certain Roubini is on it, 100% certain Krugman is not. Roubini was not a permabear, he was studying economies like Argentina which had crashed, trying to work out a pattern, and then identified the housing and credit bubble in the united states (these things are quantifiable) and said it would be next. Roubini worked for Bill Clinton. I’m a fan of Armstrong and Miller too – perhaps you are not entirely unschooled… (Kill Bill reference… only a joke.) Why does the dentist one make you blush, are you a dentist or something! I like the posh-yet-street-speaking airforce pilots – they is well funny blud 🙂 Also love the “Those who can’t – teach!” ads mocking the ‘real’ ads (armstrong and miller version is more real.) south african total closed mind southern hemisphere refereeing TOTAL CUNT!! fucking indoor cunt, bastard, fucking bastard http://www.youtube.com/watch?v=qVM4zru9JB8 Yes, Wales lost. SA of a hoare was reffing, fucking strutting ‘king peacock from funny handshake club, department cunt saffa. CUNT! Gilliebc on June 10, 2012 at 12:25 pm Dave, as this comment was for M why didn’t you simply put ‘@ Michele’ at the beginning of the post. Or something similar. Rhetorical question btw. But maybe this would be something to bear in mind for future reference. Clarity is important. Just a suggestion. Gilliebc on June 10, 2012 at 1:20 pm Regarding the sub-debate on Monarchy v Rebublic. Whichever system a country has in place, it makes little difference to the people because it is always the elite that are in charge. The elite always get to choose and decide the leaders. Both here and in the US and in most of the western world those in the top jobs are selected by the likes of the Freemasons, Skull & Bones, CFR, The Trilateral Commission, Bilderbeg. All tie in with the Cecil Rhodes created Round Table. The world is controlled by a relatively few people and barring another peasants revolt on an enormous scale, it always will be. They the powers that be control everything. They instigate wars, crash economies, create diseases and pandemics. Control the MSM the Judiciary and our so called secret security services. Many people are awakening to how controlled we are. Not many as yet who visit this site! But it is becoming so blindingly obvious now what’s going on that TPTB don’t even attempt to hide it so much any more. I think the majority may finally wake up when they are asked/told to accept they must lay down their lives to ‘save the planet’ beginning with the sick and elderly. The Dutch government are discussing plans for mobile units to ‘put down’ terminally sick people in their own homes if their own GP’s can’t or won’t do it. In some cases loneliness and bereavement are to be classed as mental illnesses and will ‘qualify’ for euthanasia. Michele on June 10, 2012 at 1:30 pm Re the tweet iMac prob …. http://concierge.apple.com/geniusbar/R092 15mins apptmts 1:1 for free advice on any Apple item no matter where bought or how old, I’ve carted my geriatric first-version jelly bean iMac in before now….. then sent it back in with a neighbour as I’m such an IT-phobe and couldn’t remember stuff. http://concierge.apple.com/workshops/R092 Free and fabulous training re their software in their lecture theatre. My goodness that’s a bit of a misrepresenation Gbc! There just isn’t any point in winding stuff up so wildly! If you were reading a journalist distorting stuff to that degree would you want them sacked? http://www.guardian.co.uk/world/2012/mar/01/dutch-mobile-euthanasia-units The info was placed as you had posted earlier that NR has been sold off without the bailout being paid back. It was not placed in any celebratory way, we are where we are, we know what we know and if we see an error or think it might be one and if it’s something upsetting and can be put right it should be …. before it gets lifted and copied and broadcast as so much on the net is presumed to be true. The uber macho stance you adopt, that NR etc should have been allowed to go bankrupt (by which you must have meant ON that day and the other banks ON theirs) I wish you had the guts to post the screenplay of what would have followed each …. We could have been seeing a form of it now in Spain, maybe because they are in the Euro, maybe because they overvalued themselves before joining it, maybe because overseers did not ask them to correct their accounts …… whatever. They will get their bail out, they will have to pay for it. There is no point yattering about it still probably being paid back in decades and off the backs of those then working …… without it they probably wouldn’t be anyway. Nothing is static; bailout, interest, inflation, sums, rest of the world and what it’s doing, BRICs then BRICS, all the other parts of the developing world. It all takes choices (and some guesses) and it’s the quality and motivation of the people making those decisions that dictates whether expenditure now will transpire to have been investment or waste. Given your apparent dislike of people I’m glad you’re not among the deciders 🙂 Talk sense for heaven’s sake. It just isn’t in human nature to even want to glide along as if on still waters. That’s just as well given the way the world changes ….. our responses need to too. Implosion isn’t sensible for a nation such as ours; we have to take the bad with the good and we have to acknowledge there has been some ‘good’ from our becoming world leading in banking. I hated the idea of Canary Wharf but now !!! Wow. I was at Greenwich yesterday …. the glorious Cutty Sark on one side, Canary Wharf just across the river, Observatory and its 1pm red ball just behind … Londinium 🙂 Ehtch 🙂 Can’t re-find your post with the link to this article: The detailed info is disgusting, all the moreso after hearing some Tory woman or other defending it on radio a couple of days ago. It’s also quite worrying to think that these companies who’re being given fortunes by the coalesced mess are also going to be profiting from the Olympics. Security? LOL – they don’t seem to have much respect for even the word. Tsk …. son tells me that link doesn’t work for him http://www.apple.com/uk/retail/geniusbar/ reaguns on June 10, 2012 at 7:38 pm Don’t understand the point, but see nothing but kudos for those like Roubini, whether left or right, who identified the debt problems pre crisis. Whats the cutty sark like, did you go in? (Dear I hear.) In case you’ve not seen my link about Neil Simon, these are the lyrics he sings on his new album. TiC? Listen to the interview. God save our gracious Queen,Long live our noble Queen,God save The Queen Send her victorious,Happy and glorious,Long to reign over us:God save The Queen. O Lord, our God, arise,Scatter her enemies,And make them fall.Confound their politics,Frustrate their knavish tricks,On Thee our hopes we fix,God save us all. Thy choicest gifts in store,On her be pleased to pour;Long may she reign:May she defend our laws,And ever give us causeTo sing with heart and voiceGod save The Queen! I’d imagine that when we have kings the words change slightly and I don’t know whether NY’s (or anyone else’s) opinions would apply to any monarch we’ve had or will have. I doubt PC will have an easy time. I have posted the answer and the scenarios that could have played out before. So have many many others, with plenty of credibility. Its fine to disagree with their conclusions, but to be unaware of them means your research is incomplete and your opinions a bit less valid. By asking for a link you imply you don’t think he said that, and don’t agree with him saying so. Boxing yourself in a touch. I don’t intend looking for the link, but it exists. Point is, because of what you think of him, him believing in sweatshops is fine to you whereas if Boris Johnson said “sweatshops are the way forward” you;d disagree. If you do agree with the concept then you agree that other regions of europe and the uk should cut their costs and work/trade their way out of trouble too. Wish I’d read this before I replied to your other one! What first hand knowledge are you talking about? @ DS I’m sorry to still be finding this topic so diverting but I swear I’m being fed by others …. after looking up the lyrics of France and Germany (aaaagggghhhhh) I hope you like these two routines from Dylan Moran (I’ve not yet looked for the one about the English ….. he might be doing it when I see him next month so I won’t ) http://www.youtube.com/watch?v=IoLIU2NI66w http://www.youtube.com/watch?v=AZWZZRZDcSQ&feature=related Post in reply to Michele, (which I lost half-way through and it didn’t go back in the right place) Good link M. I hadn’t seen that piece before. No I don’t believe I am misrepresenting not in the least. It’s fair to say that I’m not constrained in the way that a MSM journo. would be and I’m not trying to frighten anyone either. Neither am I expecting anyone to believe just me. People can check out for themselves about what I and others write. It’s all out there on the http://WWW. You tube is a good source. But more importantly by cross checking thoroughly from many sources both official and ‘unofficial’ this stuff is verifiable. Books of course are another good source. This present government is quite content to appear incompetent. It keeps us the little people distracted and preoccupied, arguing amongst ourselves while they get on with the main agenda i.e. the European Superstate as one zone in a One World Government with all that entails. As set out in Agenda 21, depopulation on a massive scale and a return to serfdom for those who are left. There are those of course who don’t want to know and for others it’s way beyond their comprehension. Normal nice people cannot believe we are ruled by such conniving, ruthless and evil people. As a bit of an old cynic, I didn’t find it at all difficult to believe. My parents had told me a little about the illuminati when I was a teenager. I didn’t believe them then. But I do now! You have an enquiring mind I suspect Michele. Don’t you want to find out why this country and the wider world is being run in such a terrible way? The wealthy elite rule the roost always have done and probably always will. It’s heartening that people are beginning to wake up. But as for what we can do about it, I have no idea. I forgot to mention the bankers in my previous post. They are of course crucial to the plans ahead. Also, people in the lower levels of Freemasonary etc. have no idea of what goes on in the higher levels. In many ways it’s beautifully simple and in other ways they flaunt what they’re up to by putting obvious clues out there. So obvious that people don’t give them a second thought i.e. the imagery on the dollar bill, the statue of Liberty the street lay out in New York and other places. They are taking the p$$, big time. I need more sleep! This should have started re Neil YOUNG Given that they would have been ‘written’ when you were under the misunderstanding that NR had been sold off at a loss I don’t see how they can be worth tracing. Furthermore, (as Etch says) There is a really good audio tape on yt of JFK giving a speech on secrecy. No wonder the poor bloke was assassinated, he made it clear he wasn’t going to collude with TPTB. Most (not all) of the other presidents before Kennedy, but most definitely since have all been ‘placed men’ or puppets, dancing to the tune of the real rulers, the wealthy elite. And there is very little if no difference in this country either. There is a definate pyramid of power ruling the western world and greatly influencing most of the rest of the world too. Some say the Jesuits are at the very top. I don’t know tbh. There are some obvious big players such as the Rothschilds, Rockerfellas, JP Mogan, the Wahlbergs, Cecil Rhodes, John Ruskin to name but a few. There are other well known names too, but I’m sure you get the drift of it by now. As I wrote before I don’t ask or expect others to believe ‘little ol’ me’ but if anyone is interested in who or what controls and runs things, it ain’t that difficult to find out these days. They will be tightening-up and controlling the internet fairly soon. But there will always be books, I hope. Michele on June 11, 2012 at 8:44 am That which you claimed of third world countries, what else? Your post starts by being re the Guardian link about voluntary assisted euthanasia in Holland and that’s what I’ve suggested you had misrepresented earlier. One can empathise completely with all opinions, who needs a rack and pinion? I can understand if you worry about coercion, people feeling pressured simply because methods exist, but we have to allow for people that don’t want their quality of life reduced by being kept alive when pain becomes uncontrollable ….. or even suffer the limitations of mobility or consciousness with ever-more pain relief. My mother chose NO pain, it didn’t matter to her what her survivors felt about it, she was also disgusted at the thought of what was happening inside. Another woman on her ward chose differently. ‘No pain’ is not the same as Holland’s voluntary euthanasia system which is apparently by injection so might be quite a sudden end of life? I’d imagine most people there leave it till quite late stage when they just can’t go on any more, either because of pain or the effects of its relief (crippling constipation is one) or because of depression over their diagnosis. Holland’s GPs have the right to not agree with someone asking for the needle at any stage of illness but as Holland also recognises the individual’s right to choose (while, I’m sure, hoping nobody is coerced or exploits the system for actual suicide) their health service has set up mobile units to go round doing the deed for people whose GPs refuse to. That is not the same as their being ‘put down’ per your post. Being ‘put down’ is what happens to some animals, those we eat as well as those that are terminally ill or simply deserted and left to starve before ‘rescue’. I’ll agree it all sounds odd and very modern, Pegg & Wright could make a great film about it! Re the Bilderbergers and Illuminati …… lalalalalalalahhhhhhh; they don’t scare me half as much as most religionists. Michele on June 11, 2012 at 11:32 am Perhaps you need to read around before responding? Your description of what Krugman said was totally subjective (selectively edited). Perhaps if you had the choice of finding your lunch from a scrapheap OR working in a sweatshop (as a start to SOME = ANY work to pay for your choice of menu) you would not be so pseudo selective or precious. However, if you do give millions per year to the poor of the world directly (as opposed to buying what they produce) I’d acknowledge your right to be snotty about ANY job for those with very little choice …. on the way to their country developing ……… in hopes of it turning in to things many times better (as it has in many places and will continue to, via TRADE) . Pray spill re what gives you the claim to any moral high ground vs Krugman. It just doesn’t stack up against your proclamations against minimum pay for the developed world. Ehtch on June 11, 2012 at 1:47 pm oh dear… posted this five minutes after full-time, that is my only defence, and that I have a mouth like a potty at times… it’s my armed forces training see… And an interesting fact about blogs, for a successful one, is to get semi-followers, ones that follow commenters as well. Now I am not saying anyone follows me, I’d be the first to say they need their heads examined. But self-deprecation works too, I have found, with some….. chalk and cheese like…. I asked for a link because I had presumed your ‘quote’ was recent. I knew you don’t give many links so then I found it for you and reminded of the quote’s age. What is ‘almost indecipherable’ about the difference between Labour’s pre-election stated and Tory’s post-election plans? Which choice gave a more detailed plan PRE election? The difference was debt reduction over 2 govts instead of one, ten years instead of five, longer but shallower, interest vs inflation. Sheeesh ……. Its not a misunderstanding, they have not as yet returned the money they were given – that’s a loss. Don’t you remember the Tories, not only Osborne but people like John Redwood at the time saying how it was a good idea to return that bank to the private sector, even though it was at a loss. Don’t you think they would have tried if anything to spin it as not a loss, if that were possible to do with a straight face? Don’t understand. I take it you don’t work for the communication wing Michele 🙂 What am I supposed to do, quote his entire works? if someone is being portrayed as saint, shouldn’t I select his sins to highlight? He wants to win debates, not help the poor. I agree with him about free trade and jobs in those countries though. But most people here usually don’t. Anonymous on June 12, 2012 at 12:25 am Main point about Krugman. He knows that debt and spending cannot go on forever. He claims that he just wants more spending now, that can then be reined in when we have a recovery. One problem – you cannot find me any time in history when Krugman, or Ed Balls, was calling for less spending, even though we had the Reagan and Clinton booms. So he has no credibility. Gilliebc on June 12, 2012 at 12:41 am Euthanasia is such a tricky subject. A veritable minefield. I don’t think anyone would want another human being to suffer a long and painful death. As some others say ‘no one would let a dog suffer like that’ Thinking about it on and off as I have today, I came to the conclusion that the old ‘unofficial’ system seemed to work alright for most people. It worries me slightly that when things are legislated on, that power is ripe for abuse by those that are given the power. Give some people an inch and they will take a yard. Sorry to hear that your mum suffered in the way that she did. I know from personal experience it’s a terrible thing to watch a loved one go that way. Maybe the late comedian Bill Hicks was right when he said life is just a ride a fairground ride. Revolting to see Dave’s fave Louise Mensch, someone so new to Govt (but elevated almost as quickly as Mrs Warsi) badmouth GB this evening, accepting the vague words of trolls such as NI and Wail hacks’ tweets. We do know other details, such as info that the little boy’s illness was obtained illicitly http://news.sky.com/home/uk-news/article/16028653 How on earth can someone put on such a certain performance when they have no proof? Does the habitual puckering up convince anyone else? What a human :-s Michele on June 12, 2012 at 12:49 pm So did the screenplay that you mentioned (the one that started with all the banks being allowed to collapse) take account of the £11Bn that will be in hand by 2015 as well as the proceeds from the other sold = re-privatised banks? Feel free to link it if so. Very interesting debate on R4 yesterday between someone that sounded as if he might have rabies (pro-bank collapses) and someone not frothing at all who had constructive outlook about where we are because GB/AD were/are not rabid. I’ll link that for you when you’ve done your bit. Anonymous on June 12, 2012 at 1:52 pm This should have been an “exciting” day, but its been so predictable, the tory press all think Brown was terrible yesterday and Osborne imperious, and labour press all think the exact opposite. Where to get an objective assessment? I’m not necessarily objective myself but that is another reason it would be nice to have an objective paper to go to. I thought they both did fairly well, but they both opened themselves up to certain lines of attack. Still if some of the stuff Brown says is true and could be proved to be true that would certainly liven things up. As far as his child goes of course, that is beyond the pale, I know people are now saying well how come he still played ball with them after that, or tried to, but its an impossible position. Whats your interest vs inflation point? Neither plan to tackle either. They are arguing about thin strips of shared common ground – they both think we should reduce the deficit, but very very slowly. Perhaps before the election people tried to portray Osborne as a right winger (impossible with Cam) but thats kind of my point, people who portray Osborne as a swivel eyed right winger, or Brown as a loony leftist, are both blatantly wrong by any historical measure of right/left. Whereas Thatcher was clearly a right winger and Foot was clearly a left winger. I looks, after John Major’s evidence, that one man has lied about several situations that involve several different people. I don’t know whether that means he will be charged with perjury. I doubt Mensch will have the courtesy to apologise for her obsequious toadying yesterday. Her lies (that’w what they ARE, being based on no actual first hand experience) expose her as no more than an obedient accessory. Yahoo 😉 reaguns You need to observe the ‘in reply to’ info. Your : I take it you don’t work for the communication wing Michele 🙂 in response to my : re your : What first hand knowledge are you talking about? ….. shows you don ‘t. I know it’s confusing that the boxes’ sequence becomes hard to decipher once we’ve gone from timings being in hours to whole days ……. plus when there’s more than one reply in a cache the sequences get meaningless ….. what was I saying, are you bored, is the Earth round ? 😛 Why would I rewrite, or link to mine or other “screenplays” about how non-bailed out banks would have played out – I did it before. Now if you had disagreed with me, fine, but instead you are now denying the existence of such a post. If you really want to read it, its a few blogs back. The funny thing is, you actually replied, I remember. Or you could always look at previous crises (oh yes, there were plenty) and look at the ones where banks were not bailed out. You don’t think I’d suggest a hypothesis, a pure theory, for such a grave occasion do you? No, I look at the evidence of when it has been done before. There are examples in US from 1850s onwards, or you can look at Iceland in modern times. And there are plenty more where they came from. You give a perfect example of the lack of objectivity. People who disagree with you are rabid, or swivel eyed or whatever. In the same way the American right think people who disagree with them are commies. Can’t sensible reasonable people disagree? Its like on newsnight when they say “And introducing Swivel Eyed Foam Flecked Right Wing Eurosceptic Joe Bloggs.” Ok I added the first two prhases but I’ve heard the last two a plenty. They never say “Introducing Far Left Sandal Wearing Europhile” to balance things up a bit. To them there are crazy eurosceptics and sensible europhiles. And they call it “news”. Fact and opinion? Just like there were only sensible Euro lovers in the old day, hard to track them down now as most are in the “sensible” asylum or enjoying a well earned period of silence. What could he do other than ‘play ball’? Whether we like it or not we have to make allowance for people doing what they think is their job, even one that just involves shelving their own ethics and ‘following orders’. Forget their reaping the huge salaries the likes of Coulson and Rebekakaka were on! If someone claims that all they’re doing is passing on info because of the public’s ‘need to know’ … it might seem more altruistic than sheer gossip. It always seemed to me that due to GB’s eyesight problems the publicity about his little boy was about the genetics … implying something that was not worth reading. Had GB or Sarah pleaded for the info about Fraser to be withheld that could have been portrayed as embarrassment that could insult other families. We had a PM who was blind in one eye and nearly blind in the other, despite all that he was able to function in ways that confound me, I can’t grasp economics despite not being 75% blind …….. perhaps I’m too distracted by visuals that I can see (like some others?). I’m equally gobsmacked about the organisation at play at Leveson, did those huge neat tomes have to be prepared also in Braille? John Major has gone up hundreds of percent in my estimation today 🙂 Oh gawd, I hope we don’t get Edwina surprising us all tomorrow too …… just as well I’m at the dentist followed by grumpy Agree re the playing ball. Its like Tony/Alastair/Labour trying to make peace with Murdoch in 1997, its a hard decision with bad consequences either way (an excellent defence I heard Blair give on The Late Late Show in Ireland, from youtube.) What has Major done? Is it his honesty, or is there a scoop I missed? As far as I know, unless my browser is different than most, its quite easy to follow the “in reply to” parts, the replies are tabbed in and also say “in reply to” I just don’t always understand what you mean. Oh look, butterflies ! It’s surely something you’ve thought or speculated about before? A. We can lend and spend (as in invest for the future), start using the item we invested in earlier than had we saved up. We pay back the loan PLUS its interest (and most govts get better rates than you or I do on the high street). B. We do NOT lend, we save up, we then spend (as in invest for the future), start using the item we saved up for much later than we’d be able to under A and find that inflation has ended up causing the item to cost more anyway, due to inflation and cost of materials, land, labour etc etc etc. Interest vs Inflation, OK? If you had children in run-down or too few schools NOW or other family in need of NHS treatment NOW in the sort of buildings Labour inherited in ’97, which would you choose? I suspect you’d choose B but not for honest reasons. I would choose A (I no longer have children in school or anyone in need of hospital treatment – we are all healthy and paying tax – it is not about oneself, it’s about conscience). ………………. Re: “Whether we like it or not we have to make allowance for people doing what they think is their job, even one that just involves shelving their own ethics and ‘following orders’. “………… This relates to someone yesterday at Leveson who said that if his publisher had told him to support some outsider such as the Gargling Spotty Monsters party that’s what he would have done. I would imagine that Murdoch & Co are not very honourable about references ….. if many of their employees were to be poached by other companies anyway! Wonder whether any will get out of the closet now John Major has exposed Murdoch as a perjurer. He’s stated that Murdoch told him that if he didn’t change tack re EU NI would withdraw support. Murdoch has said on oath that he has never asked a PM to do a thing. I don’t think it was anything like or to do with ‘making peace’. Murdoch’s papers were the only route by which to reach certain people. I’ve often posted about my grandparents who wouldn’t touch a paper like the Mirror or Guardian, as self-employed people they thought that Torydom was more about independence and aspiration than Labour could ever be. People like them needed to know that this Labour party was more modern, horrible exploitative ridicule like that of Neil Kinnock had to stop. Reaching people like them had to be done and Murdoch’s empire was the only way to do so ….. slightly more decent than via the Wail? reaguns on June 13, 2012 at 10:43 pm Well, if we were running things my way there would be no inflation, and yes that is possible, so it would be a C option I’d need. However, taken your example under normal conditions, assuming we really need the schools or hospitals, I would choose (A) ie borrow and build them now. I would do the same for essential roads, or defence needs, or prisons etc. Assuming we were not in such a perilous position that one more school would cause the economy to tank into disaster (and we are some distance from that.) Again I don’t think that is the choice this government faces, it could make massive cuts without closing any schools or hospitals in fact it could build more. I would cut bureaucracy, not necessarily from the NHS etc but certainly from the tax and regulatory systems, the welfare and pension systems, all government IT systems. In my small experience in the area I could easily identify enough to half the deficit in that alone, and thats only in a few departments, quite sure that could be multiplied by 5-10 conservatively. Sigh …. again in summary……. You have gone on and on for months about the damaging effects of minimum wage in the developed world. I have asked you how sure you can be about that opinion and how much you know of places without minimum wage such as most of the third world. You claimed a lot of first hand knowledge (doesn’t that mean you’ve seen?) and listed loads of places in addition to Cuba (you’re the only person I know that regards Cuba as 3rd world except loonies impressed by ancient CIA bigotry). You then throw in a slur to help with your prejudice against Krugman, who said 15+yrs ago that ‘sweatshops’ could get people out of poverty and could be one route out of 3rd world-ism (given that not many individuals are willing to either : – pay top dollar for 3rd world CofO goods – give sufficient to charity – or want their govts to give sufficient aid to achieve it. In the meantime, people were having to scavenge for what they could find on scrapheaps). It was a cheap shot imhoo. There aren’t single solutions to any problem in life or eternity that will be 100% effective during individuals’ lifetimes. If Krugman was pragmatic enough to admit that people earning cash (equating to choice), albeit in a sweatshop (there are less and less of them since he said so) is better than people finding stale mouldy crap in the world’s rubbish dumped on them it’s just not a decent opportunity for you to exploit to uphold your daft belief about minimum wage here. It’s easy to say ‘shut down any sweatshop’ as long as you back it up by stating willingness to subsidise without getting goods in return. Yes every one solution causes a new problem, that’s what Govts have to deal with and all the BRICS nations are now finding out about…….. including the responsibility to help those who’ve made less progress than themselves in the past couple of decades ……. watch 🙂 See, if I had a paper, I would slaughter anyone who was pro EU, but I’d do so openly and include all the facts about trade ie them selling us more than they buy, about being a net contributor, about lost productivity, about meeting EU regulations to ship stuff to non EU countries etc etc etc. But I’d admit it afterwards. This is important, I’d trust major before murdoch any day. I also heard andrew neil say murdoch was a liar, that he had asked blair for things. So, though I thought Gordon Brown looked very shifty when denying the “war” convo, this points toward murdoch being a more proven liar. Michele I think that is conflating things unnecessarily? 4 issues I see: 1. Can someone have an opinion about a country without visiting it. 2. Minimum wage 3. Developing countries without minimum wage 4. Sweatshops 1. I have not visited every country, though I’ve visited a lot. 2. Even Krugman and Dean Baker, both from the left, admit that minimum wage costs jobs. But you can still support a minimum wage for other reasons, Irwin Stelzer of the right does so. (Well respected economist, pal of murdoch, who was complimentary towards Blair, Brown, Balls, Miliband.) 3. I don’t think that developing countries are in poor state because they have no minimum wage! If we introduce a minimum wage to them they’ll be fine will they? I know you are not implying that, but you are implying that I am saying the opposite. 4. I agree with him on these, provided it is ‘voluntary’, or at least not forced at gunpoint/jailpoint. (I know that when hunger is the motivation it is not really voluntary, like our workfare argument.) Nothing that could be used to convict anyone, but the way Brown kept saying “there is no evidence for that” made me think he was lying. He looked very awkward. Then again he is just one of those people with an awkward, shifty manner, always seems like he is playing a role, hiding info from you, hiding true feelings. This may all be wrong, he might just be one of those unfortunate people who comes across that way. Then again murdoch looked totally comfortable telling things that quite a few others have now said were lies. And Iain Martin (whose coverage AC commended on twitter today) has helpfully filled in when Hunt and Cameron have said “i cannot recall” he keeps saying “Well I can recall and you were there, you did say that, etc.” Sorry to go on about GB’s eyesight and risking sounding patronising or disablist. I think when we look at someone’s manner to assess their honesty we expect eye contact. As he has not always been so deprived of sight as he is now I daresay GB knows how someone without focus can appear. I’m sure that would be why he might look down instead of ahead when talking, it’s more to do with any slight vanity rather than evasion. Good point actually, I never ever thought of that. Yes that is well worth taking into account as well. I don’t think it is patronising or disablist, I think it is fine to make allowances for people’s conditions, or to give them extra credit for things achieved in the face of above average difficulty. When my mother’s mother died, I suggested to change his bed mattress and bedding, when he stayed with us to recover, before he moved back afterwards, to get rid of the sweet smell of her to him. Raised eyebrows initially, but in a day or two, it became a good idea. He lived an extra five years, even though he was six years older than her. A plain smell at bedtime, without memories. But some clothes left in the wadrobe, when he feels, at times, but not nagging at him each night.	cc/2020-05/en_middle_0093.json.gz/line851
__label__cc	0.596942	0.403058	Methy-Pipe: An Integrated Bioinformatics Pipeline for Whole Genome Bisulfite Sequencing Data Analysis Peiyong Jiang, Kun Sun, Fiona M. F. Lun, Andy M. Guo, et al http://www.mendeley.com/research/methypipe-integrated-bioinformatics-pipeline-whole-genome-bisulfite-sequencing-data-analysis {"title"=>"Methy-Pipe: An integrated bioinformatics pipeline for whole genome bisulfite sequencing data analysis", "type"=>"journal", "authors"=>[{"first_name"=>"Peiyong", "last_name"=>"Jiang", "scopus_author_id"=>"36705929000"}, {"first_name"=>"Kun", "last_name"=>"Sun", "scopus_author_id"=>"55268471000"}, {"first_name"=>"Fiona M.F.", "last_name"=>"Lun", "scopus_author_id"=>"16205320200"}, {"first_name"=>"Andy M.", "last_name"=>"Guo", "scopus_author_id"=>"55774218000"}, {"first_name"=>"Huating", "last_name"=>"Wang", "scopus_author_id"=>"9042880700"}, {"first_name"=>"K. C.Allen", "last_name"=>"Chan", "scopus_author_id"=>"13403797200"}, {"first_name"=>"Rossa W.K.", "last_name"=>"Chiu", "scopus_author_id"=>"7103038413"}, {"first_name"=>"Y. M.Dennis", "last_name"=>"Lo", "scopus_author_id"=>"7401935391"}, {"first_name"=>"Hao", "last_name"=>"Sun", "scopus_author_id"=>"14043861000"}], "year"=>2014, "source"=>"PLoS ONE", "identifiers"=>{"scopus"=>"2-s2.0-84903304809", "sgr"=>"84903304809", "issn"=>"19326203", "doi"=>"10.1371/journal.pone.0100360", "pmid"=>"24945300", "isbn"=>"1932-6203 (Electronic)\\r1932-6203 (Linking)", "pui"=>"373396870"}, "id"=>"1b58c13f-90de-304f-aa77-e5c04009fad7", "abstract"=>"DNA methylation, one of the most important epigenetic modifications, plays a crucial role in various biological processes. The level of DNA methylation can be measured using whole-genome bisulfite sequencing at single base resolution. However, until now, there is a paucity of publicly available software for carrying out integrated methylation data analysis. In this study, we implemented Methy-Pipe, which not only fulfills the core data analysis requirements (e.g. sequence alignment, differential methylation analysis, etc.) but also provides useful tools for methylation data annotation and visualization. Specifically, it uses Burrow-Wheeler Transform (BWT) algorithm to directly align bisulfite sequencing reads to a reference genome and implements a novel sliding window based approach with statistical methods for the identification of differentially methylated regions (DMRs). The capability of processing data parallelly allows it to outperform a number of other bisulfite alignment software packages. To demonstrate its utility and performance, we applied it to both real and simulated bisulfite sequencing datasets. The results indicate that Methy-Pipe can accurately estimate methylation densities, identify DMRs and provide a variety of utility programs for downstream methylation data analysis. In summary, Methy-Pipe is a useful pipeline that can process whole genome bisulfite sequencing data in an efficient, accurate, and user-friendly manner. Software and test dataset are available at http://sunlab.lihs.cuhk.edu.hk/methy-pipe/.", "link"=>"http://www.mendeley.com/research/methypipe-integrated-bioinformatics-pipeline-whole-genome-bisulfite-sequencing-data-analysis", "reader_count"=>101, "reader_count_by_academic_status"=>{"Unspecified"=>3, "Professor > Associate Professor"=>6, "Researcher"=>33, "Student > Doctoral Student"=>5, "Student > Ph. D. Student"=>22, "Student > Postgraduate"=>5, "Other"=>4, "Student > Master"=>7, "Student > Bachelor"=>13, "Professor"=>3}, "reader_count_by_user_role"=>{"Unspecified"=>3, "Professor > Associate Professor"=>6, "Researcher"=>33, "Student > Doctoral Student"=>5, "Student > Ph. D. Student"=>22, "Student > Postgraduate"=>5, "Other"=>4, "Student > Master"=>7, "Student > Bachelor"=>13, "Professor"=>3}, "reader_count_by_subject_area"=>{"Unspecified"=>4, "Biochemistry, Genetics and Molecular Biology"=>19, "Agricultural and Biological Sciences"=>59, "Medicine and Dentistry"=>3, "Neuroscience"=>1, "Physics and Astronomy"=>1, "Computer Science"=>9, "Engineering"=>5}, "reader_count_by_subdiscipline"=>{"Engineering"=>{"Engineering"=>5}, "Medicine and Dentistry"=>{"Medicine and Dentistry"=>3}, "Neuroscience"=>{"Neuroscience"=>1}, "Physics and Astronomy"=>{"Physics and Astronomy"=>1}, "Agricultural and Biological Sciences"=>{"Agricultural and Biological Sciences"=>59}, "Computer Science"=>{"Computer Science"=>9}, "Biochemistry, Genetics and Molecular Biology"=>{"Biochemistry, Genetics and Molecular Biology"=>19}, "Unspecified"=>{"Unspecified"=>4}}, "reader_count_by_country"=>{"New Zealand"=>1, "Canada"=>1, "United States"=>2, "Ireland"=>1, "Australia"=>1, "Spain"=>1}, "group_count"=>3} http://doi.org/10.1093/bfgp/elw016 http://doi.org/10.1093/gigascience/gix123 http://doi.org/10.1016/j.molmed.2014.12.006 http://doi.org/10.1002/pd.5214 http://doi.org/10.1101/gr.242719.118 http://doi.org/10.12688/f1000research.16837.1 http://doi.org/10.1053/j.seminoncol.2015.09.004 http://doi.org/10.1097/GCO.0000000000000252 http://doi.org/10.1016/j.clinbiochem.2016.09.009 Europe PMC Citations 612 May 03:38 UTC {"@_fa"=>"true", "link"=>[{"@_fa"=>"true", "@ref"=>"self", "@href"=>"https://api.elsevier.com/content/abstract/scopus_id/84903304809"}, {"@_fa"=>"true", "@ref"=>"author-affiliation", "@href"=>"https://api.elsevier.com/content/abstract/scopus_id/84903304809?field=author,affiliation"}, {"@_fa"=>"true", "@ref"=>"scopus", "@href"=>"https://www.scopus.com/inward/record.uri?partnerID=HzOxMe3b&scp=84903304809&origin=inward"}, {"@_fa"=>"true", "@ref"=>"scopus-citedby", "@href"=>"https://www.scopus.com/inward/citedby.uri?partnerID=HzOxMe3b&scp=84903304809&origin=inward"}], "prism:url"=>"https://api.elsevier.com/content/abstract/scopus_id/84903304809", "dc:identifier"=>"SCOPUS_ID:84903304809", "eid"=>"2-s2.0-84903304809", "dc:title"=>"Methy-Pipe: An integrated bioinformatics pipeline for whole genome bisulfite sequencing data analysis", "dc:creator"=>"Jiang P.", "prism:publicationName"=>"PLoS ONE", "prism:eIssn"=>"19326203", "prism:volume"=>"9", "prism:issueIdentifier"=>"6", "prism:pageRange"=>nil, "prism:coverDate"=>"2014-06-19", "prism:coverDisplayDate"=>"19 June 2014", "prism:doi"=>"10.1371/journal.pone.0100360", "citedby-count"=>"29", "affiliation"=>[{"@_fa"=>"true", "affilname"=>"Prince of Wales Hospital Hong Kong", "affiliation-city"=>nil, "affiliation-country"=>"Hong Kong"}, {"@_fa"=>"true", "affilname"=>"Chinese University of Hong Kong", "affiliation-city"=>"Shatin", "affiliation-country"=>"Hong Kong"}], "pubmed-id"=>"24945300", "prism:aggregationType"=>"Journal", "subtype"=>"ar", "subtypeDescription"=>"Article", "article-number"=>"e100360", "source-id"=>"10600153309", "openaccess"=>"1", "openaccessFlag"=>true} {"id"=>"481054147090071553", "text"=>"$SQNM Dr Lo: Methy-Pipe: An Integrated Bioinformatics Pipeline for Whole Genome Bisulfite Sequencing Data Analysis http://t.co/P0zd9CdWqw", "created_at"=>"2014-06-23T12:40:20Z", "user"=>"CaptainFuture__", "user_name"=>"Captain Future", "user_profile_image"=>"http://pbs.twimg.com/profile_images/477160341214728192/Wf8VbtWw_normal.jpeg"} {"id"=>"482206869449367552", "text"=>"Methy-Pipe: An Integrated #Bioinformatics Pipeline for Whole Genome Bisulfite Sequencing Data Analysis http://t.co/jy8o6h6s1Q #ź", "created_at"=>"2014-06-26T17:00:51Z", "user"=>"genetics_blog", "user_name"=>"Stephen Turner", "user_profile_image"=>"http://pbs.twimg.com/profile_images/378800000676640256/2c35fb818ebea5cada2e88f3ac8b3a71_normal.jpeg"} {"id"=>"482214573748281344", "text"=>"RT @genetics_blog: Methy-Pipe: An Integrated #Bioinformatics Pipeline for Whole Genome Bisulfite Sequencing Data Analysis http://t.co/jy8o6…", "created_at"=>"2014-06-26T17:31:28Z", "user"=>"tangming2005", "user_name"=>"Ming Tang", "user_profile_image"=>"http://pbs.twimg.com/profile_images/442060405225967617/jOtd1ueH_normal.jpeg"} {"id"=>"482272040872083456", "text"=>"RT @genetics_blog: Methy-Pipe: An Integrated #Bioinformatics Pipeline for Whole Genome Bisulfite Sequencing Data Analysis http://t.co/jy8o6…", "created_at"=>"2014-06-26T21:19:49Z", "user"=>"Scedacity", "user_name"=>"Alex Douglas", "user_profile_image"=>"http://pbs.twimg.com/profile_images/378800000158019936/2adb8a24ed689aa73a73fec365b2918d_normal.jpeg"} {"id"=>"482686366195916802", "text"=>"RT @genetics_blog: Methy-Pipe: An Integrated #Bioinformatics Pipeline for Whole Genome Bisulfite Sequencing Data Analysis http://t.co/jy8o6…", "created_at"=>"2014-06-28T00:46:12Z", "user"=>"mcmahanl", "user_name"=>"Linda McMahan", "user_profile_image"=>"http://pbs.twimg.com/profile_images/1243411035/34803_120637911314770_100001056846218_124865_5257985_n_normal.jpg"} Wikipedia04 Nov 17:53 UTC Wordpress.com30 Dec 09:36 UTC {"files"=>["https://ndownloader.figshare.com/files/1542383"], "description"=>"<p>BC: Buffy coat; PLN: Placenta.</p>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "profiling", "genomic"], "article_id"=>1063712, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0100360.g006", "stats"=>{"downloads"=>0, "page_views"=>1, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Methylation_profiling_for_different_genomic_regions_/1063712", "title"=>"Methylation profiling for different genomic regions.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2014-06-19 14:42:07"} {"files"=>["https://ndownloader.figshare.com/files/1540276"], "description"=>"<p>(A) The proportion of hypermethylated regions identified by the array platform also detected by the Methy-Pipe. (B) The proportion of hypomethylated regions detected in array also identified by the Methy-Pipe. (C) Comparison of the methylation level unchanged regions between the array platform and Methy-Pipe. Hypo: hypomethylated regions. Hyper: hypermethylated regions. Unchanged: unchanged regions.</p>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "methy-pipe", "dmr", "algorithm", "methylation", "infinium", "humanmethylation450"], "article_id"=>1062048, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0100360.g007", "stats"=>{"downloads"=>0, "page_views"=>7, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Performance_evaluation_of_Methy_Pipe_DMR_identification_algorithm_using_methylation_data_from_Infinium_HumanMethylation450_array_/1062048", "title"=>"Performance evaluation of Methy-Pipe DMR identification algorithm using methylation data from Infinium HumanMethylation450 array.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2014-06-19 02:43:44"} {"files"=>["https://ndownloader.figshare.com/files/1540279", "https://ndownloader.figshare.com/files/1540281", "https://ndownloader.figshare.com/files/1540282", "https://ndownloader.figshare.com/files/1540283", "https://ndownloader.figshare.com/files/1540284", "https://ndownloader.figshare.com/files/1540285"], "description"=>"<div><p>DNA methylation, one of the most important epigenetic modifications, plays a crucial role in various biological processes. The level of DNA methylation can be measured using whole-genome bisulfite sequencing at single base resolution. However, until now, there is a paucity of publicly available software for carrying out integrated methylation data analysis. In this study, we implemented Methy-Pipe, which not only fulfills the core data analysis requirements (e.g. sequence alignment, differential methylation analysis, <i>etc</i>.) but also provides useful tools for methylation data annotation and visualization. Specifically, it uses Burrow-Wheeler Transform (BWT) algorithm to directly align bisulfite sequencing reads to a reference genome and implements a novel sliding window based approach with statistical methods for the identification of differentially methylated regions (DMRs). The capability of processing data parallelly allows it to outperform a number of other bisulfite alignment software packages. To demonstrate its utility and performance, we applied it to both real and simulated bisulfite sequencing datasets. The results indicate that Methy-Pipe can accurately estimate methylation densities, identify DMRs and provide a variety of utility programs for downstream methylation data analysis. In summary, Methy-Pipe is a useful pipeline that can process whole genome bisulfite sequencing data in an efficient, accurate, and user-friendly manner. Software and test dataset are available at <a href=\"http://sunlab.lihs.cuhk.edu.hk/methy-pipe/\" target=\"_blank\">http://sunlab.lihs.cuhk.edu.hk/methy-pipe/</a>.</p></div>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "pipeline", "genome", "bisulfite", "sequencing"], "article_id"=>1062051, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>["https://dx.doi.org/10.1371/journal.pone.0100360.s001", "https://dx.doi.org/10.1371/journal.pone.0100360.s002", "https://dx.doi.org/10.1371/journal.pone.0100360.s003", "https://dx.doi.org/10.1371/journal.pone.0100360.s004", "https://dx.doi.org/10.1371/journal.pone.0100360.s006", "https://dx.doi.org/10.1371/journal.pone.0100360.s007"], "stats"=>{"downloads"=>23, "page_views"=>12, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Methy_Pipe_An_Integrated_Bioinformatics_Pipeline_for_Whole_Genome_Bisulfite_Sequencing_Data_Analysis_/1062051", "title"=>"Methy-Pipe: An Integrated Bioinformatics Pipeline for Whole Genome Bisulfite Sequencing Data Analysis", "pos_in_sequence"=>0, "defined_type"=>4, "published_date"=>"2014-06-19 02:43:44"} {"files"=>["https://ndownloader.figshare.com/files/1540265"], "description"=>"<p>Firstly, the low-quality bases and sequenced adaptors at the 3′ ends of the reads are removed. The preprocessed reads are then mapped to C-to-T converted reference genomes whose Burrows-Wheeler Transform (BWT) indices are created and loaded to computing memory before executing alignment. Paired-end reads and single-end reads use different alignment strategies: (1) For single-end reads, they are mapped to reference genome by allowing at most 2 mismatches and only uniquely mapped reads are kept for further analysis; (2) For the paired-end reads, in addition to considering the number of mismatches and aligned hits, the insert size between the paired-end reads are also taken into account (e.g., from 50 to 600 bases); (3) The ambiguous reads that are mapped to both Watson and Crick strands are removed. Finally, the alignments are outputted in a text file which records the aligned chromosomes, positions, mismatches as well as sequencing qualities <i>etc.</i></p>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "bisulfite", "sequencing", "alignment"], "article_id"=>1062042, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0100360.g002", "stats"=>{"downloads"=>3, "page_views"=>19, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Principle_of_bisulfite_sequencing_read_alignment_by_BSAligner_/1062042", "title"=>"Principle of bisulfite sequencing read alignment by BSAligner.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2014-06-19 02:43:44"} {"files"=>["https://ndownloader.figshare.com/files/1542377"], "description"=>"<p>Firstly, the low-quality bases and sequenced adaptors at the 3′ ends of the reads are removed. The preprocessed reads are then mapped to C-to-T converted reference genomes whose Burrows-Wheeler Transform (BWT) indices are created and loaded to computing memory before executing alignment. Paired-end reads and single-end reads use different alignment strategies: (1) For single-end reads, they are mapped to reference genome by allowing at most 2 mismatches and only uniquely mapped reads are kept for further analysis; (2) For the paired-end reads, in addition to considering the number of mismatches and aligned hits, the insert size between the paired-end reads are also taken into account (e.g., from 50 to 600 bases); (3) The ambiguous reads that are mapped to both Watson and Crick strands are removed. Finally, the alignments are outputted in a text file which records the aligned chromosomes, positions, mismatches as well as sequencing qualities <i>etc.</i></p>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "bisulfite", "sequencing", "alignment"], "article_id"=>1063706, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0100360.g002", "stats"=>{"downloads"=>0, "page_views"=>5, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Principle_of_bisulfite_sequencing_read_alignment_by_BSAligner_/1063706", "title"=>"Principle of bisulfite sequencing read alignment by BSAligner.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2014-06-19 14:42:07"} {"files"=>["https://ndownloader.figshare.com/files/1540268"], "description"=>"<p>(A) The plot of the base (A, C, G, T) frequency at each sequencing cycle. X-axis indicates the sequencing cycle. Y-axis indicates the base frequency. (B) The length distribution of the insert size of a paired-end bisulfite sequencing library. X-axis represents the insert size. Y-axis represents the percentage of insert with the indicated size. (C, D) Whole genome methylation profiling with fixed window approach for buffy coat sample (C) and placenta sample (D). Dots on the top are for the Watson strand and triangles on the bottom are for the Crick strand. (E, F) Whole genome methylation profiling within different sequence contexts. MDs at different sequence contexts, namely CAA, CAC, CAG, CAT, CCA, CCC, CCG, CCT, CGA, CGC, CGG, CGT, CTA, CTC, CTG, CTT, are calculated for buffy coat (E) and placenta (F), respectively. (G, H). The fractions of the methylated cytosines are calculated for 3 different sequence contexts for buffy coat (G) and placenta (H), respectively. Fractional methylated C is calculated as the proportion of the methylated cytosines at a particular sequence context over total methylated C sequenced. The results indicate that most of the methylated cytosines are from CpG dinucleotides, i.e. CGA, CGC, CGG and CGT. The H in CHG, CHH represents A, C, or T.</p>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "methy-pipe", "bsanalyzer"], "article_id"=>1062045, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0100360.g005", "stats"=>{"downloads"=>2, "page_views"=>9, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Summary_of_Methy_Pipe_results_from_BSAnalyzer_module_/1062045", "title"=>"Summary of Methy-Pipe results from BSAnalyzer module.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2014-06-19 02:43:44"} {"files"=>["https://ndownloader.figshare.com/files/1542390", "https://ndownloader.figshare.com/files/1542391", "https://ndownloader.figshare.com/files/1542392", "https://ndownloader.figshare.com/files/1542393", "https://ndownloader.figshare.com/files/1542394", "https://ndownloader.figshare.com/files/1542395"], "description"=>"<div><p>DNA methylation, one of the most important epigenetic modifications, plays a crucial role in various biological processes. The level of DNA methylation can be measured using whole-genome bisulfite sequencing at single base resolution. However, until now, there is a paucity of publicly available software for carrying out integrated methylation data analysis. In this study, we implemented Methy-Pipe, which not only fulfills the core data analysis requirements (e.g. sequence alignment, differential methylation analysis, <i>etc</i>.) but also provides useful tools for methylation data annotation and visualization. Specifically, it uses Burrow-Wheeler Transform (BWT) algorithm to directly align bisulfite sequencing reads to a reference genome and implements a novel sliding window based approach with statistical methods for the identification of differentially methylated regions (DMRs). The capability of processing data parallelly allows it to outperform a number of other bisulfite alignment software packages. To demonstrate its utility and performance, we applied it to both real and simulated bisulfite sequencing datasets. The results indicate that Methy-Pipe can accurately estimate methylation densities, identify DMRs and provide a variety of utility programs for downstream methylation data analysis. In summary, Methy-Pipe is a useful pipeline that can process whole genome bisulfite sequencing data in an efficient, accurate, and user-friendly manner. Software and test dataset are available at <a href=\"http://sunlab.lihs.cuhk.edu.hk/methy-pipe/\" target=\"_blank\">http://sunlab.lihs.cuhk.edu.hk/methy-pipe/</a>.</p></div>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "pipeline", "genome", "bisulfite", "sequencing"], "article_id"=>1063719, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>["https://dx.doi.org/10.1371/journal.pone.0100360.s001", "https://dx.doi.org/10.1371/journal.pone.0100360.s002", "https://dx.doi.org/10.1371/journal.pone.0100360.s003", "https://dx.doi.org/10.1371/journal.pone.0100360.s004", "https://dx.doi.org/10.1371/journal.pone.0100360.s006", "https://dx.doi.org/10.1371/journal.pone.0100360.s007"], "stats"=>{"downloads"=>49, "page_views"=>4, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Methy_Pipe_An_Integrated_Bioinformatics_Pipeline_for_Whole_Genome_Bisulfite_Sequencing_Data_Analysis_/1063719", "title"=>"Methy-Pipe: An Integrated Bioinformatics Pipeline for Whole Genome Bisulfite Sequencing Data Analysis", "pos_in_sequence"=>0, "defined_type"=>4, "published_date"=>"2014-06-19 14:42:07"} {"files"=>["https://ndownloader.figshare.com/files/1542389"], "description"=>"<p>(A) A snapshot of methylation density in promoter and gene body regions of RASSF1A gene. A DMR in promoter region by comparing buffycoat and placenta tissue using Methy-Pipe is highlighted. (B) Genome-wide methylation profiling of the global methylation pattern for maternal buffy coat and the placenta samples. The range of MD shown is from 0% (innermost) to 100% (outermost) and the distance between two lines is 10%. (C) The distribution of DMRs identified by Methy-Pipe across different genomic features. (D) Gene ontology analysis of hypermethylated regions in placenta. Hypo: hypo-methylated. Hyper: hyper-methylated.</p>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "insights", "revealed"], "article_id"=>1063718, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0100360.g008", "stats"=>{"downloads"=>0, "page_views"=>2, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Biological_insights_revealed_by_Methy_Pipe_/1063718", "title"=>"Biological insights revealed by Methy-Pipe.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2014-06-19 14:42:07"} {"files"=>["https://ndownloader.figshare.com/files/1542376"], "description"=>"<p>(A) The workflow of MethyC-seq library preparation and sequencing protocol. (B) The workflow and functional models of Methy-Pipe. DMRs: differentially methylated regions.</p>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "overview", "methyc-seq", "methy-pipe"], "article_id"=>1063705, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0100360.g001", "stats"=>{"downloads"=>1, "page_views"=>4, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Schematic_overview_of_MethyC_seq_protocol_and_Methy_Pipe_workflow_/1063705", "title"=>"Schematic overview of MethyC-seq protocol and Methy-Pipe workflow.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2014-06-19 14:42:07"} {"files"=>["https://ndownloader.figshare.com/files/1542385"], "description"=>"<p>(A) The proportion of hypermethylated regions identified by the array platform also detected by the Methy-Pipe. (B) The proportion of hypomethylated regions detected in array also identified by the Methy-Pipe. (C) Comparison of the methylation level unchanged regions between the array platform and Methy-Pipe. Hypo: hypomethylated regions. Hyper: hypermethylated regions. Unchanged: unchanged regions.</p>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "methy-pipe", "dmr", "algorithm", "methylation", "infinium", "humanmethylation450"], "article_id"=>1063714, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0100360.g007", "stats"=>{"downloads"=>2, "page_views"=>13, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Performance_evaluation_of_Methy_Pipe_DMR_identification_algorithm_using_methylation_data_from_Infinium_HumanMethylation450_array_/1063714", "title"=>"Performance evaluation of Methy-Pipe DMR identification algorithm using methylation data from Infinium HumanMethylation450 array.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2014-06-19 14:42:07"} {"files"=>["https://ndownloader.figshare.com/files/1542380"], "description"=>"<p>(A) A total of 1 million reads (75 bases) were randomly simulated with different rates of bisulfite conversion and aligned to human (GRCh37/hg19) genome. Methy-Pipe accurately detected various simulated methylation levels at a constant mapping efficiency which is not affected by the sequence context. The H (in CHG and CHH) denotes C, T, or A. (B) Density scatter plots are plotted to measure the correlation between the MDs from Methy-Pipe and the <i>β</i> value from Infinium Human Methylationa450 array for CpG loci that can be integrated by both sequencing and array platforms from Placenta.</p>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics"], "article_id"=>1063709, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0100360.g004", "stats"=>{"downloads"=>4, "page_views"=>3, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Performance_evaluation_of_Methy_Pipe_/1063709", "title"=>"Performance evaluation of Methy-Pipe.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2014-06-19 14:42:07"} {"files"=>["https://ndownloader.figshare.com/files/1542379"], "description"=>"<p>(A) Firstly, starting from one end of the genome to search for a seed region (i.e., 500 bps) using a sliding window. (B) If the seed region is located, Mann-Whitney test will be used to test if the seed region is a differentially methylated seed region. (C) Two adjacent differentially methylated seed regions are merged into one extended seed region (seed region extension). (D) Two discontinued differentially methylated regions are further merged together if they are within a certain distance (e.g. less than 1000 bps) for further differential methylation test using χ2 test.</p>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "dmr", "detection"], "article_id"=>1063708, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0100360.g003", "stats"=>{"downloads"=>3, "page_views"=>3, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Principle_of_DMR_detection_by_BSAnalyzer_/1063708", "title"=>"Principle of DMR detection by BSAnalyzer.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2014-06-19 14:42:07"} {"files"=>["https://ndownloader.figshare.com/files/1540264"], "description"=>"<p>(A) The workflow of MethyC-seq library preparation and sequencing protocol. (B) The workflow and functional models of Methy-Pipe. DMRs: differentially methylated regions.</p>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "overview", "methyc-seq", "methy-pipe"], "article_id"=>1062041, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0100360.g001", "stats"=>{"downloads"=>2, "page_views"=>30, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Schematic_overview_of_MethyC_seq_protocol_and_Methy_Pipe_workflow_/1062041", "title"=>"Schematic overview of MethyC-seq protocol and Methy-Pipe workflow.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2014-06-19 02:43:44"} {"files"=>["https://ndownloader.figshare.com/files/1540266"], "description"=>"<p>(A) Firstly, starting from one end of the genome to search for a seed region (i.e., 500 bps) using a sliding window. (B) If the seed region is located, Mann-Whitney test will be used to test if the seed region is a differentially methylated seed region. (C) Two adjacent differentially methylated seed regions are merged into one extended seed region (seed region extension). (D) Two discontinued differentially methylated regions are further merged together if they are within a certain distance (e.g. less than 1000 bps) for further differential methylation test using χ2 test.</p>", "links"=>[], "tags"=>["Biochemistry", "dna", "DNA modification", "dna methylation", "Computational biology", "genetics", "epigenetics", "Database and informatics methods", "bioinformatics", "dmr", "detection"], "article_id"=>1062043, "categories"=>["Biological Sciences"], "users"=>["Peiyong Jiang", "Kun Sun", "Fiona M. F. Lun", "Andy M. Guo", "Huating Wang", "K. C. Allen Chan", "Rossa W. K. Chiu", "Y. M. Dennis Lo", "Hao Sun"], "doi"=>"https://dx.doi.org/10.1371/journal.pone.0100360.g003", "stats"=>{"downloads"=>0, "page_views"=>19, "likes"=>0}, "figshare_url"=>"https://figshare.com/articles/_Principle_of_DMR_detection_by_BSAnalyzer_/1062043", "title"=>"Principle of DMR detection by BSAnalyzer.", "pos_in_sequence"=>0, "defined_type"=>1, "published_date"=>"2014-06-19 02:43:44"} {"unique-ip"=>"37", "full-text"=>"35", "pdf"=>"12", "abstract"=>"0", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"20", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2015", "month"=>"10"} {"unique-ip"=>"18", "full-text"=>"17", "pdf"=>"5", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"3", "supp-data"=>"217", "cited-by"=>"0", "year"=>"2018", "month"=>"5"} {"unique-ip"=>"12", "full-text"=>"7", "pdf"=>"11", "scanned-summary"=>"0", "scanned-page-browse"=>"0", "figure"=>"0", "supp-data"=>"0", "cited-by"=>"0", "year"=>"2019", "month"=>"12"} {"start_date"=>"2014-01-01T00:00:00Z", "end_date"=>"2014-12-31T00:00:00Z", "subject_areas"=>[{"subject_area"=>"/Biology and life sciences", "average_usage"=>[291]}, {"subject_area"=>"/Biology and life sciences/Anatomy", "average_usage"=>[267]}, {"subject_area"=>"/Biology and life sciences/Biochemistry", "average_usage"=>[282]}, {"subject_area"=>"/Biology and life sciences/Computational biology", "average_usage"=>[341, 529]}, {"subject_area"=>"/Biology and life sciences/Developmental biology", "average_usage"=>[285]}, {"subject_area"=>"/Medicine and health sciences/Anatomy", "average_usage"=>[266]}]}	cc/2020-05/en_middle_0093.json.gz/line854

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.