pred_label
stringclasses 2
values | pred_label_prob
float64 0.5
1
| wiki_prob
float64 0.25
1
| text
stringlengths 148
1.01M
| source
stringlengths 39
45
|
|---|---|---|---|---|
__label__cc
| 0.733535
| 0.266465
|
men in uniform
Het, Review
Forgotten Promises
January 20, 2016 Holly Leave a comment
Author: Jessica Lemmon
Publisher: Loveswept
Buy links: Amazon
Type: Novel
Blurb: Morgan Young had a perfect upbringing, and now she’s got a perfect boyfriend and a perfect future—until her twenty-first birthday changes everything. First Morgan finds out, in the most painful way possible, that her relationship is a sham. But that’s nothing compared to the nightmare about to unfold.
It’s too late for Tucker Noscalo. A brutal childhood left him with a bad reputation and a criminal record. Fresh out of jail, Tucker has a score to settle with Baybrook’s crooked chief of police—his own father. Nobody will believe Tucker’s explosive accusations without proof and a good lawyer, neither of which he has on his side. Until he sees someone he used to know, someone who just so happens to be the daughter of the best lawyer in the county.
He needs Morgan to convince her father of the ugly truth. But first he has to convince her, and he’ll do whatever it takes to get her to listen. Confronted by the story of Tucker’s dark past, Morgan feels utterly compelled to help him. And as their connection grows into a fierce bond fueled by raw passion, Morgan finds herself falling for the wrong guy—but never has the promise of love felt so right.
Review: It was hard not to fall in book love with the anti-hero Tucker in this book. He had suffered unspeakable things in his childhood, where getting sent to Juvi was better than being at home. With great skill, Jessica takes you into his mind and heart and lets you bear witness to his slow growth as a man and as a person as he battles the demons not only in his mind but in the real world.
Morgan’s lived a great life and she can’t believe it when her world comes crashing down the night of her 21st birthday. Her best friend slept with her boyfriend? This really sucks. And top it all off with getting kidnapped by the man who’d been her savior in high school? Let’s just say she’s not feeling the love.
At first, she’s not sure why she’s been kidnapped. Tucker keeps telling her it’s because he needs her dad to defend him. But why? Doesn’t he realize that kidnapping her is going to make her dad hate him? Only when she finds out about the things Tucker had had done to him when he was a child… and what had made his brother Jeremy take his own life. After seeing the cutting scars on his arms that match the ones on her body does she actually realize that they have more in common than she thinks.
Tucker knows that he’s only got one chance with Morgan. If he can be brave and tell her the full story, she’ll believe him and help him persuade her father to take his case. But by doing so, he’ll have to reveal things about himself that he’s afraid will make Morgan never want to be with him again. Can he tell the story so that the full depth of his abuse isn’t revealed?
Unfortunately, she gets to the incriminating tapes before he can and sees more than he’d like. He wants her to love him for himself, not out of pity.
I’m not really big into the NA scene, but this book was a refreshing change. It had pathos and a lot of heart and I really enjoyed getting to know these two characters. I did enjoy the ending–a lot of satisfaction there–but you’ll have to read it to see if you agree. Thanks for a great book, Jessica Lemmon. You rock the NA scene, my friend!
4 starscontemporaryForgotten PromisesHollyJessica LemmonLoveswept
Previous PostRock N SoulNext PostWhit’s Best of ’15
Follow or Friend us on Goodreads
Review: Hellion (415 Ink)
Guest Post & Giveaway: 415 Ink: Hellion by Rhys Ford
Guest Post & Giveaway: Dead Man Stalking by TA Moore
Review: Ramen Assassin (Ramen Assassin #1)
Guest Post & Giveaway: Ramen Assassin (Ramen Assassin#1) by Rhys Ford
Joscelyn Smith on Guest Post & Giveaway: 415…
Teenyluvkins (@teeny… on Guest Post & Giveaway: 415…
H.B. on Guest Post & Giveaway: 415…
gamistress66@aol.com on Guest Post & Giveaway: 415…
Alleson Faye (@alles… on Guest Post & Giveaway: 415…
Take my Badge. Please.
<div align="center"><a href="http://www.itsaboutthebook.com" title="It's About The Book" target="_blank"><img src="https://itsaboutthebookdotcom.files.wordpress.com/2014/07/croppedbadge.jpeg" alt="It's About The Book" style="border:none;" /></a></div>
Select all text in the box, copy, then paste into your widget.
It’s About The Book
Legal Disclaimer about Pictures
It's inevitable at some point we will use a photo to which we have no rights whatsoever. Our goal is merely to make an attractive space and enhance the enjoyment of our blog readers. We do not in any way generate funds from images. If you see a photo to which you own copyright please notify us immediately if you would like it taken down and it will be done as quickly as possible.
|
cc/2020-05/en_middle_0097.json.gz/line1399720
|
__label__cc
| 0.723044
| 0.276956
|
Home » Blog » Blackbaud’s Education Management Portfolio is Now OneRoster Compliant
As of August 2019, Blackbaud’s education Management portfolio is OneRoster compliant.
What is OneRoster?
OneRoster is a standard set of REST application programming interfaces (APIs), which enable schools to securely and reliably exchange information about rosters, course materials, and grades between multiple web services—typically between a student information system (SIS) and another application such as a learning management system (LMS).
“While Blackbaud is committed to our single-platform vision, we also recognize that schools need to use other applications and we want to make it easy for them,” said Blackbaud Product Manager Angela Addison. “OneRoster enables Blackbaud and our partners to offer our schools choices in the tools they use without incurring the cost of custom integrations or the inefficiencies of manually keeping data in sync—it’s a win-win for everyone.”
OneRoster is managed by IMS Global Learning Consortium, a nonprofit organization whose mission is to “Advance technology that can affordably scale and improve educational participation and attainment.” IMS Global is also known for managing other standards for integrated educational environments, most notably Learning Tools Interoperability (LTI).
Through OneRoster, schools can create efficiencies and maintain better accuracy in data transfers by reducing the number of manual roster and data exports. These benefits help faculty and administrators who manage internal data resources at schools the most, but they can also have a positive impact for students and parents.
“With Blackbaud’s new integration with OneRoster, Calvert Hall was able to assign McGraw Hill digital resources to entire course sections without needing to build a single user account or roster,” said Austin Ewachiw, network administrator at Calvert Hall College High School in Baltimore. “Teachers and students simply access their electronic books via single-sign-on from their class page. What was once a truly cumbersome process has been reduced to a single click—how cool is that!”
Blackbaud has implemented multiple API endpoints for OneRoster integrations and will continue to add more. Supported endpoints currently include the "consumer core" and "rostering provider" endpoint groups, which enable one-way sync of data from Blackbaud Student Information SystemTM through the OneRoster integration into the school’s learning management system. These endpoints handle academic sessions, classes, courses, demographics, enrollments, grading periods, organizations, schools, students, teachers, terms and users.
For more information, visit Blackbaud’s online K–12 How-To Center or the IMS Global documentation:
https://www.imsglobal.org/activity/onerosterlis
https://www.imsglobal.org/oneroster-11-introduction
https://www.imsglobal.org/oneroster-11-real-world-scenarios
Listen to Hiram Cuevas, the new executive director of Blackbaud K–12's Advisory Board, discuss his appointm...
William Bullard joins the Get Connected podcast to discuss how independent schools can increase application...
Can I use Blackbaud Tuition Management as a Subledger?
Learn how Blackbaud Tuition Management serves as a subsidiary account receivable ledger.
|
cc/2020-05/en_middle_0097.json.gz/line1399727
|
__label__cc
| 0.551853
| 0.448147
|
Coyotes Coach: New Owners Should Help Team
The Arizona Cardinals’ training camp continues at University of Phoenix Stadium in Glendale, and right across the street the tenants of Jobbing.com Arena will in fact be back for their next season. The Phoenix Coyotes ownership situation is all but settled which means Head Coach Dave Tippett can talk more about X’s and O’s and less about geography and finance.
Phoenix City Manager David Cavazos Accepts Job In Santa Ana
Phoenix’s City Manager is stepping down to take a job in Orange County. Santa Ana, Calif. is a fraction of Phoenix’s size and has about one-fifth its population. And that’s where David Cavazos is taking a job, pending the approval of the Phoenix City Council.
US Issues Worldwide Travel Alert, Emphasizing Warnings For Middle East
Arizonans planning overseas trips this month are being urged to be aware of the situation around them. The U.S. has issued a worldwide travel alert, and AAA spokeswoman Stephanie Dembowski said it should not be ignored, especially if you are traveling to the Middle East.
Arizona State University Expert Talks President Obama's Mortgage Plan
President Barack Obama called for an end to mortgage giants Fannie Mae and Freddie Mac at a Phoenix high school Tuesday afternoon.President Obama’s plan would reduce the government’s stronghold over the mortgage finance market, but the plan may have other hurdles beyond congressional passage.
KJZZ Town Hall: Phoenix City Council District 8
The third of four KJZZ Town Halls on the Phoenix City Council Elections was held Wednesday and focused on the candidates of District 8. The KJZZ Town Hall featuring the Phoenix City Council District 8 candidates.
Newer Smart Phones Notify Users Of Amber Alerts
As the massive manhunt for a suspected kidnapper continues, so does an amber alert along the West Coast. The man in charge of Arizona's Amber Alert Broadcaster's Association, President Art Brooks, says newer smart phones can automatically notify you of such an alert.
Flagstaff Ordiance Could Stop The Feeding Of Wildlife
Wildlife is becoming a problem for residents in Flagstaff. The Arizona Game and Fish Department said people are purposely leaving food out for animals like deer and elk, attracting the animals.
Making Tacos Our Own, Aug. 19-26
The taco-- the ultimate Mexican comfort food has become a staple in American cuisine and reigns supreme as a popular meal in many different forms and flavors. In this delicious, sound-rich summer series, Fronteras: The Changing America Desk reporters investigate the transformation of the taco in the Southwest-- from cheap street eats to gourmet delights, from a Mexican mainstay to an All-American breakfast classic.
Arizonans Experience Mars On Earth
This week, two Arizonans returned from Mars – or the closest thing to it on Earth. The six participants in the Hawai'i Space Exploration Analog and Simulation Habitat spent four months living together in a small dome - and could only leave the space for brief periods if they wore mock spacesuits.
Annual Health Conference Educates Arizonans In Rural Areas
Trying to educate Arizonans about their health care options as Medicaid and health insurance exchanges get underway can be particularly challenging in rural areas, according to Dr. Dan Derksen. Dr.
Tempe's Big Surf Recognized As A Historic Landmark
Surfing in the desert is not an easy thing to do. There is a lot of sand but not much water. That is what has made Big Surf in Tempe such a big deal since it opened in 1969, and now Big Surf’s Waikiki Beach Wave Pool has been designated a historic landmark by the American Society of Mechanical Engineers.
Debra Milke Back In Court Friday
A woman once convicted in connection with the murder of her 4-year-old son will be in court Friday. Debra Milke was sentenced to death for the 1989 murder of her son. That conviction was overturned by a federal appeals court earlier this year.
Venezuelan Colonel Sentenced In Military Airplane Engine Case
A federal judge in Phoenix has sentenced a Venezuelan Air Force colonel to 19 months in prison for conspiring to export military aircraft engines to his home country. A local businessman was also involved in the scheme.
Mesa Police Arrest 12 For Illegal Sale Of Prescription Drugs
A year-long investigation into the illegal sale of prescription drugs by the Mesa Police Department has resulted in 12 arrests so far. The department’s Street Crimes Unit has spent the last 12 months looking into people who either own or operate Yerberia shops in the Valley.
Many Fire Restrictions Lifted
The Bureau of Land Management has lifted fire restrictions on public lands in Yuma, La Paz, and Mohave Counties as of 6 this morning. Spokeswoman Lori Cook says there are a number of reasons for the decision.
Cuts In SNAP Program Will Lower Food Allowance
Starting in November, 1.1 million Arizonans will be trying to buy food for $4.15 a day. That is because of cuts in the SNAP program, more commonly known as food stamps. The Association of Arizona Food Banks is bracing for the challenge of feeding those who are affected, but President Angie Rodgers said that likely will last just a few weeks.
Arizona Real Estate After The Great Recession
It’s almost impossible to overstate the impact, positive and negative, that real estate and construction have on Arizona’s economy. When the Great Recession hit, the Valley’s housing market was pummeled.
Colorado River Fundraising Drive Planned For This Weekend
A coalition of environmental groups is launching a fundraising drive for Saturday. They will be trying to restore part of the overtaxed Colorado River that has become more desert than delta. Conservationists from Mexico and the U.
The Zozobra Goes Up In Flames
A nearly century old New Mexico tradition involves the burning of a 50 foot tall effigy along with the world's gloom.
Rare Crocodiles Hatch At Phoenix Reptile Rescue
The Phoenix Herpetological Society is celebrating the first breeding of rare Nile crocodiles. Cronkite News says, the birth of 11 crocodiles is a boost for a species that’s increasingly rare in the wild.
|
cc/2020-05/en_middle_0097.json.gz/line1399733
|
__label__wiki
| 0.945675
| 0.945675
|
Media, Characters, Manga
Osamu Akimoto, creater of KochiKame.
KochiKame (こち亀), which is the typically shortened rendition of its full title Kochira Katsushika-ku Kameari Kōen Mae Hashutsujo (こちら葛飾区亀有公園前派出所, lit. "This is the Police Station in Front of Kameari Park in Katsushika Ward") is a manga series written and illustrated by Osamu Akimoto.
The series was first serialized in Weekly Shonen Jump since 1976, released into volumes as a manga series since 1977 up to September 2016, and has spawned an anime series, as well as several drama adaptations, following its initial debut.
The central group of characters from KochiKame in front of the Police Box.
The story, as its name indicates, focuses on the adventures and misadventures of a police station where we meet a cast of characters located within the park front of Kameari in Katsuhika Ward of the Tokyo Prefecture in Japan. Among the characters is the protagonist Ryotsu, his colleagues Nakagawa and Reiko, and his boss Bucho, who have appeared the most frequently.
The central character Kankichi Ryotsu is a man of 36 years whom someone might think of as normal in person, but things are not what they seem. While it is true that Ryo is appointed a job as a policeman in the police station within Kameari, his capacity for dedication to work is inversely proportional to his ability to maneuver strategies to get rich as quickly as possible or as little as possible, strategies which, by the step never work and always end up causing thousands of comic situations and sometimes endearing results. Yes, Kankichi Ryotsu cannot stand still at the prospect of getting money and excuses saying that vice police base salary is a pittance.
Therefore, the typical argument of this series begins with Ryo drawing a plan to make money fast by the invention or business, calling Nakagawa to bring him what he needs and, finally, losing everything and having to pay in addition to the damages caused by his plans. While the plot is spun by a gag after another, most of the humor is based on the combination of worldly characters with oddly out of place characters as Nakagawa with wealth or Maria who was transgendered. The only thing they have in common is the lack of real police officers, most of which is never explained or rationalized in the slightest.
A section of the real-life Kameari, showing a bronze statue of Ryotsu and encircled, the real-life (unused) police box nearby.
The story of KochiKame is set within the park front (kouenmae, 公園前) in the Kameari area of Katsushika Ward from the Tokyo Prefecture of Japan.
Recent releases of the manga and later episodes of the anime, however, have expanded the horizon of settings within the series via the introduction of newer characters raised and working in other areas inclusive of Asakusa (native to Matoi) and Osaka (native to Haru).
Many published chapters are based amongst current trends and fads, based on the time of creation by Akimoto. Of these trends and fads, there are many references made to pop culture-centric to celebrities, technology, music and in-line fashion. Latest releases of chapters, for instance, base much emphasis on the popularity of K-Pop idols, vocaloid (technologically-altered voices in music composition made into songs), smartphone apps and video gaming platform releases.
Immense popularity and familiarity of the series have gained the location much more attention and continues to be popular amongst Japanese passers-by to date, while several commemorative statues of some of the series' characters have been erected in several areas nearby the closest JR train station. Osamu Akimoto has also, in addition, received awards of recognition for his contributions towards the Kameari area with regards to his significant impact stemming from KochiKame.
An example of a volume-end comment page spread by singer Yuuko Asano.
One particular aspect worthy of note is that it is the only manga remaining that continues the previous trend of publishing guest-star letters regarding the manga, called volume-end commentator (巻末解説者, Kanmatsu Kaisetsusha). Famous Japanese celebrities who are familiar with the manga typically write about their memories of KochiKame, specific content, it's influence, their interests and/or future wishes, most often spanning a double-page spread. Popular commentators tend to be other manga authors, singers, voice actors/actresses and comedians.
Main article: List of KochiKame characters
Anime series Edit
Main article: KochiKame (anime)
KochiKame had an anime series wholly based on previously-released chapters rendered into episodes, which ran from 16 June 1996 to 19 December 2004 through Fuji TV in Japan. Two movies were also released, KochiKame: The Movie and KochiKame: The Movie 2: UFO Attack! The Great Tornado Strategy!!.
Manga series Edit
Main article: List of KochiKame manga volumes
Main article: Weekly Shonen Jump
Shonen Jump Weekly cover illustration of the issue released 1st August, 1976 which serialized the first KochiKame chapter.
Every New Year, Jump has the artists do 4-panel gag strips with their characters. Here, with KochiKame, the gang wastes all 4 panels complaining that all they ever do in here is normal stuff.
KochiKame has been in continuous serialization with the Japanese Weekly Shonen Jump magazine since its debut in 1976, and continued to publish new chapters on a weekly basis without any interruptions until its end in September 2016. Akimoto debuted the series under the pen name of "Tatsuhiko Yamadome", but changed to using his real name in 1978, when it reached its 100th chapter. Periodically the chapters were collected into tankōbon volumes by publisher Shueisha, the first released on July 9, 1977.
A total of 1,960 chapters (exclusive of extra chapters) have been published into 200 volumes.
The series ended on September 17, 2016 in the 42nd issue of the year, in commemoration of KochiKame's 40th anniversary (the issue being published four days before the anniversary proper). Its 200th and final tankōbon volume was published on the same day. Shueisha reprinted the issue that included the final chapter on December 31, 2016, marking the first time a Weekly Shōnen Jump issue has ever been reprinted. The magazine doesn't have much in the way of extras. There's the main fold-out poster, stuff written by the editors about Kochi Kame ending, and the fact that Ryou's eyebrows are going to appear in all the other manga works, so the readers should try to find them all.
The 42nd issue of Shonen Jump published on September 16, 2017, included a new one-shot return chapter. That new KochiKame manga chapter begins with Ryo appearing at the police box with tanned skin after one-year paid leave. His planning to give a birthday gift to his boss develops into the usual uproar.
The manga has yet to receive any official English translated version, and wasn't available in English editions of Weekly Shonen Jump.
Crossovers Edit
Volume 69 (1991) Edit
The Dragon Ball characters Frieza, Zarbon, and Appule appear in a two-page gag entirely made by Osamu Akimoto in KochiKame volume 69 (1991). Ryotsu Kankichi left on a journey, making it seem like the last chapter of KochiKame, but he immediately returns. Everyone is mad at him for tricking them like that. Ryo-san points out that he never explicitly said the series was ending, and says it is just a way of keeping things fresh. He then jokes about changing the series' name to KochiKame Z. His partner then decide to throw him into another manga, and he lands in Dragon Ball, during the Namek Saga.
30th anniversary (2006) Edit
For the 30th anniversary of the serialization of KochiKame, in September 2006, Ryo-san makes a cameo in every manga serialized at the time in Weekly Shōnen Jump #46. Most notably, he has a full appearance as a marine in One Piece (chapter 428), and drinking alongside Don Patch in Bobobo-bo Bo-bobo. At the same time, a special manga called Chō KochiKame was released on September 15, 2006, and features the KochiKame characters in special crossover chapters with other Shōnen manga series: Golgo 13, Lupin III, Kinnikuman, and Dragon Ball.
"Kochira Namekkusei Doragon Kōen Mae Hashutsujo"
The Dragon Ball crossover chapter is titled "Kochira Namekkusei Doragon Kōen Mae Hashutsujo" (こちらナメック星ドラゴン公園前派出所), and is based on the story in KochiKame volume 69. In this special nine-page chapter, Ryo-san is reassigned to planet Namek and has to deal with Frieza who parked his spaceship illegally. Vegeta, and Goku also make appearances. Frieza is waiting with Appule for the three other Namekian Dragon Balls to be found, when Kankichi Ryotsu comes and says that Frieza cannot park his spaceship there. Frieza uses a Death Beam to kill Ryotsu Kankichi but, to their surprise, he is still alive. Ryotsu Kankichi yells that they have to pay the fine and Frieza attacks him with an energy wave, which also fails to hurt Ryotsu Kankichi. When Ryotsu Kankichi pulls a Rocket Launcher out of the air, Appule says that there is no doubt and that Ryotsu Kankichi is a gag manga character. Frieza says he does not care because he is the strongest being in the universe and he fires blasts at Ryotsu Kankichi until he is tired. When even this does not kill Ryotsu Kankichi, Frieza leaves in his spaceship with Appule, and says that nothing happened. Ryotsu then meets Vegeta and, seeing that he wears the same type of Battle Armor as Frieza, he asks Vegeta if he knows the tyrant. Then, Goku's spaceship lands on the planet on the same place Frieza's ship was parked. Ryotsu tells Goku that he cannot park his ship there and the story ends.
Also, congratulatory pics from over 80 mangaka were published, many from Weekly Jump author's past and present, but also from other Shueisha mangaka and even from manga artists not associated with Shueisha such as Hiromu Arakawa (Fullmetal Alchemist) and Jyoji "George" Morikawa (Hajime no Ippo).
Kankichi Ryotsu as a Marine by Eiichiro Oda.
Straw Hat Pirates & Ryotsu, in celebration of KochiKame's 30th Anniversary.
Other Colaborations Edit
Kochikame with To Love-Ru, in celebration of KochiKame's 40th Anniversary. Art by Kentaro Yabuki.
Promo art for the VS. Kochikame Novel Anthology (with Osomatsu-san).
Fuji TV KochiKame website
TBS KochiKame website
KochiKame Movie website
Fan website KochiKame Database
Fan website kame.lovely.to
English fanblog
Overview of manga chapters
KochiKame Game Park
KochiKame blog
InternetKamedas
Retrieved from "https://kochikame.fandom.com/wiki/KochiKame?oldid=6029"
3 List of KochiKame characters
|
cc/2020-05/en_middle_0097.json.gz/line1399736
|
__label__wiki
| 0.90196
| 0.90196
|
Steven Spielberg Has Begun Principle Photography on the Untitled Cold War Spy Thriller Starring Tom Hanks
Three-time Academy Award® winner Steven Spielberg has begun principal photography on an untitled Cold War spy thriller starring two-time Academy Award winner Tom Hanks ("Forrest Gump," "Philadelphia"). The production, which also stars Tony® Award winner Mark Rylance ("Intimacy," "The Other Boleyn Girl"), Academy Award nominee Amy Ryan ("Gone Baby Gone," "Win Win") and Academy Award nominee Alan Alda ("M*A*S*H," "Crimes and Misdemeanors"), will shoot on location in New York and Berlin.
Production in New York was possible due to support from state and local film agencies, and in Berlin, through the support of several film funds.
The film is the true story of James Donovan, an attorney who finds himself thrust into the center of the Cold War when the CIA sends him on the near-impossible mission to negotiate the release of a captured American U-2 pilot.
20th Century Fox is co-financing the film with DreamWorks in association with Participant Media, and will distribute internationally. Disney will handle domestic distribution, while DreamWorks' partner, Reliance, will oversee distribution in India. In addition to directing, Spielberg will produce the film with Marc Platt ("Drive") and Kristie Macosko Krieger ("Lincoln"). The executive producers are Adam Somner ("The Wolf of Wall Street") and Daniel Lupi ("Her"). The screenplay is by three-time Academy Award® winners Joel and Ethan Coen ("No Country for Old Men") and Matt Charman based on a pitch by Charman. The film will be released theatres October 16, 2015.
About DreamWorks Studios
DreamWorks Studios is a motion picture company formed in 2009 and led by Steven Spielberg in partnership with The Reliance Anil Dhirubhai Ambani Group. The company's recent releases include "The Hundred-Foot Journey," starring Helen Mirren, Om Puri, Manish Dayal and Charlotte Le Bon and directed by Lasse Hallström based on the best-selling novel by Richard C. Morais, and the car-racing actioner "Need for Speed," starring Aaron Paul. Other releases include: the comedy "Delivery Man," starring Vince Vaughn; Spielberg's "Lincoln," starring Daniel Day-Lewis, Sally Field and Tommy Lee Jones, which grossed over $270 million at the worldwide box office and was nominated for 12 Academy Awards® with Daniel Day-Lewis winning for Best Actor; "Real Steel," starring Hugh Jackman and directed by Shawn Levy; Spielberg’s "War Horse," based on Michael Morpurgo's award-winning book and nominated for six Academy Awards including Best Picture; and "The Help," which resonated with audiences around the country and earned over $200 million at the box office and received four Academy Award nominations with Octavia Spencer winning for Best Supporting Actress.
DreamWorks can be found on Facebook at: http://www.facebook.com/DreamWorksStudios and on Twitter at: http://twitter.com/dw_studios.
About 20th Century Fox Film
One of the world's largest producers and distributors of motion pictures, 20th Century Fox produces, acquires and distributes motion pictures throughout the world. These motion pictures are produced or acquired by the following units: Twentieth Century Fox, Fox 2000 Pictures, Fox Searchlight Pictures, Fox International Productions and Twentieth Century Fox Animation. The studio also comprises 20th Century Fox Home Entertainment and 20th Century Fox Television Distribution.
About Participant Media
Participant Media (http://www.ParticipantMedia.com) is a global entertainment company founded in 2004 by Jeff Skoll to focus on feature film, television, publishing, and digital content that inspires social change. Participant's more than 55 films include "Good Night, and Good Luck," "Syriana," "An Inconvenient Truth," "FOOD, INC.," "Waiting for 'Superman'," "The Help," "Contagion" and "Lincoln." Participant launches campaigns that bring together government entities, foundations, schools, and others to raise awareness and drive people to take action on issues from each film or television show. Pivot (http://www.Pivot.tv), the company’s television network, is available in 45 million homes, serving passionate Millennials (18-34) with a diverse slate of talent and a mix of original series, acquired programming, films, and documentaries. TakePart (http://www.TakePart.com) is Participant's digital news and lifestyle magazine and social action platform for the conscious consumer. Through its films, social action campaigns, digital network, and its television network, Participant seeks to entertain, encourage, and empower every individual to take action.
Mommy Needs a Getaway {November Giveaway Event}
Enter to Win a Box of Chocolates from SportsChocol...
Sawmill Creek Wines: Savour Life's Simplest Pleasu...
Dove Chocolate Discoveries #HolidayGiftGuide100Blo...
CampusBookRentals Offers RentBack Program
Blogger Opp: iPad Mini Holiday Giveaway Event
Marvel Studios Unveils Phase 3 of Marvel Cinematic...
{WINNERS} OraMD Breath Giveaway
Recipe: Delicious Thai Green Curry Chicken
Caramel Apple Strudel: A Perfect October Treat
One-man A Cappella Vocalist and YouTube Star Peter...
Christmas Musical Snowglobes Giveaway (6 Winners)
Recipe: Strawberry-Kale Smoothie
Blogger Opp: Mommy needs a Getaway Giveaway {Novem...
Photo of the Day: A Lovely Flower
Thermoworks ChefAlarm Giveaway
Exergen Temporal Scanner Thermometer Giveaway
Lugz Women's Sophia Boots Giveaway
Indian for Everyone: The Home Cook's Guide to Trad...
Homemade Meat Lasagna {Recipe}
BuyDig.com $150 Gift Card Giveaway
Photo of the Day: The Great Horned Owl
Citrus Lane Gift Box Subscription {Giveaway}
Scrapbooking FREEBIE (Oct 2014): Printable Pattern...
No More Nail Boo Boos! Have Fun With these Easy Ha...
Book Review: "The Fragile World" by Paula Treick D...
Salonpas Pain Relief Prize Pack Giveaway
BrylaneHome Jewelry Collection Organizer Giveaway
The barbar 2600 Titanium-Ionic Flat Iron Giveaway
7 Tricks to Dress Up Your Lawn for Less this Hallo...
Photo of the Day: Harrison Lake at Night
California Pizza Kitchen $50 eGift Card Giveaway
ConceiveEasy TTC Starter Kit {Giveaway}
All Treats, No Tricks Giveaway Hop #AllTreatsNoTri...
Don't shoot what it looks like. Shoot what it feel...
Mia Mariu Cosmetics Giveaway #miamariu
Anavita Cream and Bobee Decal Giveaway
Jillette Johnson & Mary Lambert on Tour 2014
Christmas in Snow Valley: A Christmas Romance Anth...
Thanksgiving Turkey Dinner & Recipe
Photo of the Day: Beautiful Peregrine Falcon
Mask Imperfections, Wrinkles and Dryness
The Piano Guys "Wonders" New Album Out October 7
TuneCore's Hip Hop Infographic
Alala Clothing $200 Gift Card Giveaway #alalalife
Chrome Girl is Supporting Breast Cancer Awareness ...
Personalized Christmas Ornament Giveaway
Steven Spielberg Has Begun Principle Photography o...
World’s First Underground Balloon Flight Completed...
Blogger Opp: "Thankful for the Memories" Giveaway ...
GIRLS OF GRACE Concludes 12th Season with Sold-Out...
10 Ways to Save on Your Latte Habit
Advanced Photoshop Magazine Cover Design Contest
Blogger Opp: 2014 Holiday Gift Guide Event
Designer Gail Be Creates Custom Head Piece & Jewel...
Win a free Nikon D800 or Canon 5D Mark III DSLR Ca...
BuyCostumes.com $50 Halloween Giveaway
Salcura Natural Skin Therapy Giveaway #SNST1014
Mommy Needs a Getaway {October Giveaway Event}
|
cc/2020-05/en_middle_0097.json.gz/line1399746
|
__label__wiki
| 0.652212
| 0.652212
|
Help Nunn Center Term of Use
Interview with Alvin L. Martin, March 15, 2003
Project: Oldham County Historical Society: Oldham County Veterans Oral History Project
Play Interview
Rights & Request
Interview Summary
Alvin L. Martin, born in Elizabethtown, Kentucky in 1924, served in the United States Air Force during World War II. Martin volunteered for his service in 1943 and spent time in Brazil, Africa, Italy, and Germany. Martin was a radio operator for the 485th Bomb Group and completed 31 missions while overseas. Martin was discharged in November 1945.
Interview Accession
2012oh135_ochs037
Interviewee Name
Alvin L. Martin
Interviewer Name
Joseph Ward
Interview Keyword
485th Bomb Group Africa Brazil Elizabethtown, Kentucky Germany Italy Oldham County, Kentucky radio operator US Air Force WWII
Interview LC Subject
Gillars, Mildred, 1900-1988. Louisville (Ky.) Oldham County (Ky.) Oldham County Historical Society (Oldham County, Ky.) Ploie?ti (Romania) Prisoner of war. World War, 1939-1945.
Interview Rights
All rights to the interviews, including but not restricted to legal title, copyrights and literary property rights, have been transferred to the University of Kentucky Libraries.
Interview Usage
Interviews may be reproduced with permission from Louie B. Nunn Center for Oral History, Special Collections, University of Kentucky Libraries.
access interview in full screen
Add this interview to your cart in order to begin the process of requesting access to a copy of and/or permission to reproduce interview(s).
MLA: APA: Chicago:
Martin, Alvin L. Interview by Joseph Ward. 15 Mar. 2003. Lexington, KY: Louie B. Nunn Center for Oral History, University of Kentucky Libraries.
copy MLA citation
Martin, A.L. (2003, March 15). Interview by J. Ward. Oldham County Historical Society: Oldham County Veterans Oral History Project. Louie B. Nunn Center for Oral History, University of Kentucky Libraries, Lexington.
copy APA citation
Martin, Alvin L., interview by Joseph Ward. March 15, 2003, Oldham County Historical Society: Oldham County Veterans Oral History Project, Louie B. Nunn Center for Oral History, University of Kentucky Libraries.
copy Chicago citation
Persistent Link for this Record: https://kentuckyoralhistory.org/ark:/16417/xt7wh7080q2p
Oral History Collection Management System
SPOKEdb currently provides access to
13775 interview records, and
588 projects.
Contact | Terms | Help
Louie B. Nunn Center for Oral History
University of Kentucky Libraries
Margaret I. King Building
nunncenter@lsv.uky.edu
|
cc/2020-05/en_middle_0097.json.gz/line1399751
|
__label__cc
| 0.688265
| 0.311735
|
CADET ACTIVITIES
Kerrville Squadron cadets served as a color guard at the Ingram High School homecoming 20 Sep 19
An interesting and educational field trip to the War in the Pacific Museum in Fredericksburg.
PRACTICE SEARCH MISSION
A ground team planned their search mission for a practice ELT (Electronic Locator Transmitter)
Cadet Orientation Flights
SLIDE SHOW --
Model Rocketry
In this program, the Cadets get to advance through three progressively difficult stages of model rocketry so that they can earn a shiny new badge and have fun while doing so! Each Cadet gets to assemble and launch their very own model rocket.
Texas Wing Summer Encampment
Encampment is a week-long "boot camp-like" activity developed to test new cadet's knowledge, drilling skills, and teamwork. Encampment is a prerequisite to becoming a Cadet Officer in CAP, as well as gaining eligibility to attend National Cadet Special Activities. Once a cadet completes their first encampment, they can apply to return to the next encampment as a staff member, or even go to Intermediate Encampment.
Cadet Physical Fitness
The last Monday of each month.
Once a month, the Cadets participate in Fitness Exercises. The primary exercises include:
-Push-Ups
-Sit-Ups
-Sit and Reach
-One Mile Run
-Pacer Run
The exercises are beneficial to the Cadet's health, and required to advance in rank.
The third Monday of each month.
Once a month, the squadron conducts Emergency Services Training. The Cadets are provided with training and education both in the field and in the classroom. They are taught what to do in various emergency scenarios, such as, finding downed/missing aircraft, using radios, compasses, and maps, and even survival skills.
http://www.capmembers.com/file.cfm/media/blogs/documents/News_Innovations_2015b_2716B9803C8A9.pdf
|
cc/2020-05/en_middle_0097.json.gz/line1399752
|
__label__wiki
| 0.805887
| 0.805887
|
Alice in Chains Singer William DuVall Reveals Solo Album Plans + New Song
YouTube: William DuVall
You know him as one half of Alice in Chains' powerful vocal presence, but William DuVall is about to release his first solo album.
The singer-guitarist just released a brand new song called "Til the Light Guides Me Home" and issued a corresponding video that can be seen below. It's a more stripped back track than what DuVall usually performs with Alice in Chains, and the video has the singer walking the streets alone with his acoustic guitar.
The track is featured on the upcoming album, One Alone, which is due on Oct. 4. DuVall described the album as a "one voice, one guitar" type of record. Pre-orders for the album are available at this location.
Though most know DuVall for his work in Alice in Chains, he was in a number of bands prior, including Comes With the Fall, who opened dates for Jerry Cantrell in the early 2000s. He's also done some side work in recent years with the Giraffe Tongue Orchestra.
Though the singer has a solo album en route, he's still currently engaged with Alice in Chains, as the band just kicked off a summer tour with Korn, Underoath and more. See their tour dates here.
William DuVall, "Til the Light Guides Me Home"
William DuVall, One Alone Track Listing
1 ’Til the Light Guides Me Home [2:53]
2 The Veil of All My Fears [4:43]
3 The 3 Wishes [3:56]
4 Strung Out on a Dream [3:33]
5 White Hot [4:24]
6 Still Got a Hold on My Heart [3:52]
7 Smoke and Mirrors [4:26]
8 So Cruel [4:00]
9 Chains Around My Heart [3:32]
10 Keep Driving Me Away [4:56]
11 No Need To Wonder [4:25]
Top 25 Hard Rock + Metal Replacement Singers
Source: Alice in Chains Singer William DuVall Reveals Solo Album Plans + New Song
Filed Under: William DuVall
Categories: Music News, Videos
|
cc/2020-05/en_middle_0097.json.gz/line1399753
|
__label__cc
| 0.640683
| 0.359317
|
K Drive
Paul Power
Lizzie Landers née Donuhue
JFK Avenue, Main Street, Kilcullen.
Reposing at her residence from 5 O'clock on Thursday, until the conclusion of prayers, which begin at 9pm.
Removal by PJ Willis Funeral Director on Friday at 10. 30am, arriving at the Church of the Sacred Heart and St. Brigid, Kilcullen for Requiem Mass at 11 O'clock.
Funeral afterwards to St. Brigid's Cemetery.
Man Arrested In Connection With Burglary & Assault In Tipperary.
Listen: Aontú Leader Says SF Leader Will End Up With A Navan Accent, Given The Amount Of Time Spent In The Town.
Delaney Has Resigned From UEFA's Executive Committee.
Listen Back: Monday's Edition Of Kildare Today With Clem Ryan.
Kildare County Council Issues Poster Warning To #GE2020 Candidates.
Fórsa Member School Secretaries Suspend Strike Action.
Job Slot
Kfm Privacy Policy and Website Terms & Conditions
Kfm broadcasts on 97.6fm and 97.3fm to all parts of county Kildare 24 hours a day from the state-of-the-art Kfm Broadcast Centre, Newhall, Naas, Co. Kildare and around the world on this website.
Our aim is to entertain and inform our listeners, with the best music, local news and current affairs plus top class live sports coverage.
Remember, Kfm is your local station; we’re always interested in hearing your views and suggestions about the radio station. You can find all of our contact details on the Contact Us section of the site.
Enjoy your visit, thanks for listening and spread the word about Kildare's Kfm!
Co. Kildare FM Radio Ltd. t/a Kfm Radio - Company No: 355494 - Registered Office: Kfm Broadcast Centre, M7 Business Park, Newhall, Naas, Co. Kildare. © Kfm Radio 2008 - 2016
|
cc/2020-05/en_middle_0097.json.gz/line1399756
|
__label__wiki
| 0.6978
| 0.6978
|
Ph.D. Program Major Ph.D. Program Major
Economic and Political History of the 20th Century
Ph.D. Program Economics and Economic Administration
The Ph.D. program major “Economic and Political History of the 20th Century” is intended for students with sufficiently deep knowledge of economic and political history, economic theory, history of economic thought, economic policy and fundamental knowledge of related disciplines (political science, sociology, philosophy, anthropology). In addition, applicants are expected to possess analytical skills and abstract thinking, which will help to classify the various historical events in a broader socio-economic framework. The major is primarily focused on preparation of scientists and researchers who will study in depth theoretical knowledge, which they will be able to use in various scientific disciplines. Therefore, the major is primarily aimed at developing the scientific activities of students by individual approach and by their involvement in domestic and foreign research teams. During the research training, students will be able to attend classes led by visiting professors from prestigious foreign universities from France, Germany, Austria, Great Britain and the USA.
The major is based on the Anglo-Saxon model of connecting economics and politics, which enables wider theoretical application of different methodological approaches of economics and history, and offers a greater possibility of developing economic history as an independent historical discipline based on interdisciplinarity and wide variety of theoretical approaches. In this aspect, the Department of Economic History is the only scientific place in the Czech Republic that offers this specialization. The P.D. program major would especially like to build on the broad theoretical grounding in conjunction with a deep knowledge of historical realities. In this context, it would primarily reflect the number of new approaches, which was recently profiled in the history and economics – public choice theory, institutional economics, behavioral economics, a new history of international relations, new political history, the new political economy, cultural anthropology, new history of ideas, new cultural history. Graduates of this major will be able to participate in scientific activities in domestic and foreign institutions and will be well positioned to work in the private and public sector.
Structure of the course requirements for the major Economic and Political History of the 20th Century is as follows. Students must during their courses acquire a total of 180 credits in the following structure:
Compulsory courses: 20 credits
5EN913 Macroeconomics III (5 credits)
5HD921 Selected issues economic history since 1945 (5 credits)
5HD922 Modern economic history of Czechoslovakia 1945-1992 (5 credits)
5HD902 Doctoral Seminar (5 credits)
HD1000 State Doctoral Exam (10 credits)
HD0000 Defense of the dissertation (30 credits)
Duties of the program and elective courses: 120 credits
The content and structure are listed in the table in the general section above.
More information on the admission procedure for enrollment in doctoral study at the Faculty of Economics can be found at http://nf.vse.cz/english.
Topics for Doctoral Theses
Current Ph.D. students
Dissertation topic
Ing. Jana Švejdová xbrhj00@vse.cz 5 Analysis of Economic, Social, and Foreign Policy of Labour Government from 1945 to 1951 prof. PhDr. Martin Kovář, Ph.D. combined
Ing. Tereza Burianová
tereza.burianova@vse.cz
Protectorate of Bohemia and Moravia as a Arms Base of Nazi Germany
prof. PhDr. Ing. Aleš Skřivan, Ph.D.
Ing. Jan Brožek xbroj26@vse.cz
Financing of Sport in the First Republic Period (1918-1938) prof. PhDr. Ing. Aleš Skřivan, Ph.D. combined
Ing. Jakub Drábek jakub.drabek@vse.cz
On the Development of Czechoslovak Sugar and Sugar Beet Industries before the End of World War II prof. PhDr. Ivan Jakubec, CSc. combined
Ing. Jiří Havránek
jhavj61@vse.cz 2 Influence of Czechoslovak Reform Efforts in the Second Half of the 1960s on Economic Cooperation with the COMECON Countries prof. PhDr. Ivan Jakubec, CSc. present
Ing. Petr Chalupecký petr.chalupecky@vse.cz
From the Reform to the Reform: Monetary Policy of Czechoslovakia from 1945 to 1953 prof. PhDr. Ing. Aleš Skřivan, Ph.D. combined
Ing. Radim Ječný xjecr01@vse.cz
Duchcov-Podmokly Track 1918-1938 Mgr. Ing. Daniel Váňa, Ph.D. combined
Ing. Filip Koch kocf01@vse.cz 2 Analysis of Housing Financing in Czechoslovakia 1918-1938 prof. PhDr. Ing. Aleš Skřivan,Ph.D. present
Ing. Marek Korejs xkorm58@vse.cz 2 Oil as a political tool in Chavez Venezuela (1999-2017) prof. PhDr. Martin Kovář, Ph.D. present
Ing. Tomáš Kremr xkret02@vse.cz
Transition to the Peace Economy of the Successor States (Comparison of Austria and Czechoslovakia) after 1918 prof. PhDr. Ivan Jakubec, CSc. present
Ing. Tomáš Nikodym xnikt00@vse.cz
Democracy, Liberty, and Property: Development of Economic-Political Thought of Edvard Benes
prof. PhDr. Ivan Jakubec, CSc.
Ing. Lukáš Nikodym xnikl03@vse.cz
Economic-Political Aspects of the Dispute over the Method: The Influence of Economic Thought on Economic Policymaking within the Austro-Hungarian Empire and Successor States (Austria and Czechoslovakia) prof. PhDr. Ing. Aleš Skřivan, Ph.D. combined
Ing. Tereza Pušová xpust03@vse.cz
Ireland between „Unrest“ and War. A Contribution to Study of Irish Economy and Politics in the 1920s and 1930s prof. PhDr. Martin Kovář, Ph.D. combined
Ing. Petr Slabý xslap22@vse.cz
History of British Euroskepticism prof. PhDr. Martin Kovář, Ph.D. combined
Ing. Karel Sochna
xsock04@vse.cz
Coal Base and Coal Trade in Czechoslovakia 1918-1939
Ing. Martin Vavrek xvavm11@vse.cz
Economic Recovery of Czechoslovakia 1945-1948 prof. PhDr. Ivan Jakubec, CSc. combined
|
cc/2020-05/en_middle_0097.json.gz/line1399757
|
__label__wiki
| 0.916926
| 0.916926
|
Faculty & StaffNewsCalendarContactUW Home
The Wisconsin Idea
Directors and Associate Directors
About Robert M. La Follette
Construction and Accessibility Information
Funding & Financial Information
Accelerated Admissions
Admissions Webchat 4-6-17
Admissions Webchat 10-30-17
Student News & Profiles
students proto
Master of Public Affairs
Master of International Public Affairs
Energy Analysis and Policy
Urban Planning and Public Affairs
Neuroscience and Public Policy
Public Health and Public Policy
Business and Public Policy
Health & Aging
International Trade & Development
Evidence-Based Policy
Science & Public Policy
Kohl Research Competition
Editorial Resources
Kohl Research Competition 2016
Administrative Burdens Workshop
Outreach & Public Service
Campus & Community Partnerships
Legislator & Policymaker Outreach
Wisconsin Family Impact Seminars
Center for European Studies
Wisconsin Longitudinal Study
Wisconsin Center for the Advancement of Postsecondary Education (WISCAPE)
Wisconsin Center for Education Research (WCER)
Nelson Institute for Environmental Studies
Center for Demography of Health and Aging (CDHA)
Center for Demography and Ecology (CDE)
Behavioral Insights for Government (BIG) lecture series
La Follette Spring Symposium 2017
Public Program Evaluation
Workshops in Public Affairs
Institute for Research on Poverty
Public Affairs Journalist in Residence
Institute for Clinical and Translational Research
Association for Public Policy Analysis and Management
Center for Financial Security
Lloyd D. Gladfelter Award for Government Innovation
Bowhay Institute for Legislative Leadership Development
Wisconsin Women in Government
Performance Information Project
Paul Offner Lectures
Evidence-Based Health Policy Project
European Center for Excellence
Election Administration Project
Past Events, Initiatives and Collaborations
Solicitation of Client Projects for Workshop in Public Affairs (PA 869) and Workshop in International Public Affairs (PA 860)
Empirical Rulemaking Conference
Urban Men and Poverty: Problems and Solutions
La Follette School of Public Affairs APPAM 2015 Reception
La Follette in DC - Alumni & Friends Reception
The Case for Reducing Poverty Among Seniors, AARP
Behavioral Insights for Government (BIG) lecture series - past presentations, speakers
Introduction to Public Management - PA 878
Alumni & Friends Reception
Behavioral Insights for Government - Registration
Public Affairs Writer in Residence Registration 2018
Milwaukee 53206
Axelrod Visit 2018
DC Reception 2018
Hill Fest 2019
Journalist in Residence Registration
Alumni News & Profiles
La Follette News & Notes
Annual Highlights
Chicago Reception 2019
Faculty Affiliates
Faculty • Lecturers • Staff • Emeritus Faculty • Faculty Affiliates
Fenaba R. Addo
Assistant Professor of Consumer Science, School of Human Ecology
Bradford L. Barham
Professor of Agricultural and Applied Economics; Co-Director, Program on Agricultural Technology Studies
Lawrence M. Berger
Professor of Social Work; Director, Institute for Research on Poverty
Rikhil R. Bhavnani
Associate Professor of Political Science
Aaron M. Brower
Professor of Social Work; Provost and Vice Chancellor of UW Extension; Senior Vice President for Academic Affairs, UW System
Barry C. Burden
Professor of Political Science; Director of Elections Research Center, Lyons Family Chair in Electoral Politics
Marguerite E. Burns
Associate Professor of Population Health Science
David T. Canon
Marcia Carlson
Professor of Sociology, Director Center for Demography and Ecology
Robin Alta Charo
Warren P. Knowles Professor of Law and Bioethics, Law School and Department of Medical History and Bioethics
Jane L. Collins
Professor of Community and Environmental Sociology, and Gender and Women's Studies, Evjue Bascom Professor
Jordan Conwell
Assistant Professor of Sociology & Educational Policy Studies
Ian Coxhead
Professor of Agricultural and Applied Economics
Katherine Cramer
Professor of Political Science; Faculty Director of University of Wisconsin Survey Center's Badger Poll
John Eason
Associate Professor of Sociology
Deborah Ehrenthal
Associate Professor, UW-Madison School of Medicine and Public Health; Lifecourse Initiative for Healthy Families Endowed Chair
Jeremy D. Foltz
Professor and Chair of the Department of Agriculture and Applied Economics
Sarah Halpern-Meekin
Associate Professor, School of Human Ecology
Kathryn Hendley
William Voss-Bascom Professor of Law and Political Science
Yoshiko M. Herrera
Professor of Political Science, PI & Director UW-Madison Partnership with Nazarbayev University
Jenny A. Higgins
Associate Professor, Department of Gender and Women’s Studies
Nicholas Hillman
Associate Professor of Educational Leadership and Policy Analysis; Senior Vice President of Academic Affairs
Ronald E. Kalil
Professor of Ophthalmology and Visual Sciences, Founding Director Center for Neuroscience, Founding Director, W.M. Keck Laboratory for Biological Imaging, Co-founder and Director Neuroscience and Public Policy
Carolyn J. Kelley
Professor of Educational Leadership and Policy Analysis, Associate Dean, School of Education
Cecelia Klingele
Heinz J. Klug
Evjue Bascom Professor of Law; Director of the Global Legal Studies Center
Elizabeth J. Kramer
Professor of Social Work; Director of Part-time MSW Program
Rasmus Lentz
Michael T. Light
Associate Professor of Sociology & Chicano/Latino Studies
Katherine Magnuson
Professor of Social Work
Benjamin Marquez
Michael A. Massoglia
Romnes Professor of Sociology
Kenneth R. Mayer
Daniel R. Meyer
Mary C. Jacoby Distinguished Professor of Social Work
Corina Mommaerts
Assistant Professor of Economics
John Mullahy
Professor of Population Health Sciences, School of Medicine and Public Health
Jennifer L. Noyes
Associate Dean for Operations and Staff, College of Letters & Science
John K.M. Ohnesorge
George Young Bascom Professor of Law
Professor of Population Health Sciences, School of Medicine and Public Health; Director of the Health Policy Program at the University of Wisconsin Population Health Institute; Director of Master of Public Health Program
Ryan Owens
Professor of Political Science; Director, Tommy Thompson Center on Public Leadership
Jonathan Patz
Professor of Environmental Studies and Population Health Sciences; Center for Sustainability and the Global Environment; Director of Global Health Institute
Seth Pollak
College of Letters and Science Distinguished Professor of Clinical Psychology and Brain and Cognitive Sciences; Director, Child Emotion Research Laboratory, Waisman Center
Booth Fowler Associate Professor of Political Science and Trice Faculty Scholar
Nils Ringe
Director, Center for European Studies, Jean Monnet EU Center of Excellence, University of Wisconsin-Madison
Adena R. Rissman
Associate Professor Department of Forest & Wildlife Ecology
Stephanie A. Robert
Professor of Social Work; Director of School of Social Work; Co-Director Robert Wood Johnson Foundation Health and Society Scholars Program
Joel Rogers
Sewell-Bascom Professor of Law, Political Science, Public Affairs, and Sociology; Director, Center on Wisconsin Strategy (COWS)
John Karl Scholz
Nellie June Gray Professor of Economic Policy; UW-Madison Provost
Hilary Shager
Associate Director of Programs and Management, Institute for Research on Poverty
Mark Sidel
Doyle-Bascom Professor of Law; Asia Consultant, International Center for Not-for-Profit Law (ICNL)
Scott Straus
Professor of Political Science and International Studies
Justin R. Sydnor
Leslie P. Schultz Professor in Risk Management and Insurance, and associate professor in the Department of Risk and Insurance at the Wisconsin School of Business
Stephanie Tai
Julie Underwood
Susan Engeleiter Professor of Education Law, Policy & Practice
Professor, UW-Madison School of Journalism and Mass Communication
Jason Webb Yackee
Robert M. La Follette
1225 Observatory Drive
info@lafollette.wisc.edu
For admissions: admissions@lafollette.wisc.edu
5th in Social Policy, 10th in Health Policy & Management, 15th in Public Policy Analysis.
Give to the La Follette School.
|
cc/2020-05/en_middle_0097.json.gz/line1399763
|
__label__wiki
| 0.572624
| 0.572624
|
Post-Brexit
Letter to Britain
A Weekly Brexit Commentary
Home » Posts tagged 'City of London'
Tag Archives: City of London
Arlene Foster DUP
Atlantic Alliance
British Agriculture Policy
British and Commonwealth Development Bank
British Economic and Social Reform
British Education system
British Energy Policy
British Environment Policy
British Foreign Policy
British General Election
British Housing Policy
British Immigration Policy
British Industrial Policy
British National Health Service
British Space Policy
British Trade Policy
British Unemployment Insurance
CANZUK
Confederation of British Industry (CBI)
Diesel Emissions
Economic Uncertainty
EU election 2019
Foreign Remittances
Foreign Tax Havens
G20 Hamburg
G7 2019 Biarritz France
Jacob Rees-Mogg
Key Brexit Dates
London Fisheries Convention
Mayor of London Sadiq Khan
Merit Order ranking
NHS (National Health Service)
Prorogation of Parliament
Quintile Economics
Russian election 2018
Soft Brexit
Speaker John Bercow
Special EU Status
Stephen Barclay
Tax on Robots
The 1 Percent
The Anglosphere
the backstop
The Brexit Party
The Commonwealth of Nations
Treaties of Utrecht
UK military
UK Supreme Court
Vlad Putin
Click to Subscribe via Email
Open Letter to Sadiq Khan, Mayor of London
May 31, 2019 04:18 / Leave a comment
To: Mr. Sadiq Kahn, The Right Worshipful Mayor of London,
Your Excellency,
A PROPOSAL TO REDUCE VEHICLE EMISSIONS IN LONDON
Mr. Mayor, under your leadership, London has made great strides to reduce vehicle emissions and you deserve every accolade you’ve received for your efforts in this regard.
There is always the opportunity to do more however, as the air quality problem in the UK’s major cities won’t be solved by one, two, or even three programmes or directives — such is the scale of the problem that has enveloped the City since the beginning of the Industrial Revolution.
Therefore, please consider this proposal as a complementary and/or alternative solution to your innovative and existing vehicle emissions and congestion charges legislation.
I PROPOSE STICKERS FOR CARS AND TRUCKS BASED ON FUEL TYPE AND DAILY USE IN LONDON
Drivers who opt for ‘the cleanest fuel type’ will be rewarded with ‘lower daily use charges’ while those choosing high-polluting vehicles would pay comparatively more.
Electric Vehicles (EV) travelling in the City of London would be required to place a GREEN coloured sticker inside the front windscreen — and EV’s would be charged £10. per day (via sticker ID number/OCR street camera) for each day it is driven in the city. On days where the vehicle isn’t driving in the city, no charge would occur.
Hybrid-Electric Vehicles (PHEV & HEV) travelling in the City of London would be required to place a BLUE coloured sticker inside the front windscreen — and such a vehicle would be charged £20. per day (via sticker ID number/OCR street camera) for each day it is driven in the city. On days where the vehicle isn’t driving in the city, no charge would occur.
Petrol Vehicles (ICE) travelling in the City of London would be required to place a RED coloured sticker inside the front windscreen — and ICE vehicles would be charged £30. per day (via sticker ID number/OCR street camera) for each day it is driven in the city. On days where the vehicle isn’t driving in the city, no charge would occur.
Diesel Vehicles (ICED) travelling in the City of London would be required to place a YELLOW coloured sticker inside the front windscreen — and ICED vehicles would be charged £40. per day (via sticker ID number/OCR street camera) for each day it is driven in the city. On days where the vehicle isn’t driving in the city, no charge would occur.
Vehicles not registered with the City of London would pay £50. per day (via licence plate/OCR street camera) for each day it is driven in the city. On days where the vehicle isn’t driving in the city, no charge would occur.
And those people who choose to leave their cars at home on any given day (possibly choosing to take public transit or carpool with friends/co-workers) or walk to their destination, etc., would save themselves a significant amount of money annually.
(1) Rewarding Drivers Who Choose Less Polluting Vehicles & (2) Lowering the Aggregate Miles Driven Annually on London Streets Will (3) Result in Cleaner Air & Less Congestion in the City of London
While I have no studies to prove my assertions, I believe the financial situation of every driver who drives in the City of London will prompt their choice of vehicle and allow them to self-regulate their decision to drive, walk, or take public transit to their destinations.
Consequently, this programme would help drivers who use London’s road network switch more quickly to less polluting cars and trucks, and may find themselves choosing to walk or take public transit more often to their destinations. While this may not be true in every case, I imagine that it will be true for many Londoners and those who travel through the City of London.
Perhaps a poll could be arranged to ask drivers;
‘Would you like to ‘pay more per day’ to continue driving your polluting vehicle on London streets, or would you like to ‘save money by switching’ to a more environmentally friendly mode of transportation?’
I feel that taxicabs should be exempt from these fees.
I feel that government fleets should be exempt from these fees.
I feel that car rental companies should be exempt from these fees.
I feel that buses operated by any person or company should be exempt from these fees.
Transport companies (trucking firms) could receive a discount for monthly or annual prepayment.
Exempt all vehicles between 12:00am–6:00am to encourage driving during the least-busy hours of the day.
A link on the City of London website could allow drivers to register their vehicle and have their stickers mailed to them.
In closing, your excellency, I hope that in this way the City of London could serve as a template for UK metropolitan areas with a population of one million or more.
Further, I wish to thank you for your diligent efforts to solve the longstanding and challenging air quality problem in London, and for allowing me the gift of your valuable time to read this well-meant proposal.
John Brian Shannon
Publisher of LetterToBritain.com
Thumbnail image courtesy of: EconomicTimesIndiaTimes.com
London Terror Attack – In the Cold Light of Day
March 23, 2017 10:11 / Leave a comment
by John Brian Shannon | March 23, 2017
Yesterday’s terror attack in London has sharpened the will of Britain to face terrorism in all its forms, and has served to demonstrate the resolve of Britons to soldier-on despite a display of violence clearly designed to rattle citizens.
This is the London that survived The Blitz and returned stronger than ever. If terrorists are trying to cow a population into submission they chose the wrong city. The merchants of terror will soon find that they have expended much effort for little gain.
Terrorists want big headlines, a terrorized populace, and an over-compensating government that takes corrective measures far exceeding the scale of the problem.
Any publicized response to terrorists should be considered ‘overcompensating’ because more people are killed in Western countries by lightning than are killed by terrorists. More Europeans are killed by falling down their stairs at home than have been killed in the entire history of modern terrorism in Europe. And thousands of people are killed every year in car accidents. Yet the governments of Europe haven’t declared war on cars, stairs, nor lightning.
Tragic as yesterday’s events are, giving the perpetrators and backers of such crimes too much airtime only serves to reward and encourage them.
The Rise of Terrorism vs. The Rise of Knowledge and Responsibility
‘Under the radar’ for many, our civilization has entered a new era; A time of changing attitudes, a time for new pathways to better outcomes.
Knowledge has become more broadly available, more engagement occurs between citizens and their governments, more diversity adds to our understanding of the world, and along with the omnipresent globalization factor, all of these work to shape our worldview and the worldview of people in every corner of the world.
We’re now in an era akin to the time when Homo-sapiens superseded the Neanderthals, which was a time of unprecedented change. But our point of change is where the practitioners of ‘Win-Lose’ paradigms will be superseded by the practitioners of ‘Win-Win’ paradigms. (Terrorists and their thinking will become obsolete as ‘Win-Win’ thinking gains more traction)
The games desperadoes play which are designed to horrify and control large populations, are so 20th-century. Terrorists are rapidly becoming caricatures of themselves similar to ‘Achmed the Terrorist‘ of Saturday Night Live fame.
Why? It seems that wanton destruction and spreading fear have become the goals (for some) in the 21st century.
Terrorist groups no longer make demands, nor recite carefully worded manifestos that were years-in-the-making, nor do they bother to rail against the religious beliefs of Westerners, nor against alcohol, bikinis, or any other taboos created by puritanical control freaks.
In their own control-drama world they lost at the ‘Win-Lose’ game, a paradigm that they chose from the outset, because they believed they could ‘Win’ at that game. But they lost.
Now they console themselves by staging terror attacks sans-message to assuage their disappointment — a sad way for any human being to live their life, and let’s not forget the profound sadness they create among the innocent people caught in the crossfire of their destructive acts.
They Didn’t Start Off That Way
It’s a safe bet that every single human was born perfect — ‘free from sin’ as they used to say.
And in a perfect world every person would mature and fulfill their best destiny.
What failure it must be then that shapes young minds to eventually become killers of innocent people due to an imperfect understanding of religious texts. And then to fall even further by taking innocent human lives out of the sheer disappointment of having lost at the ‘Win-Lose’ paradigm.
Humans can’t fail much worse than that.
And every bit of it is preventable, either by every child receiving an advanced education so as to be able to properly understand the proper context and meanings of religious texts (for example) — or by teaching young minds that the only outcomes worth pursuing are ‘Win-Win outcomes’. Either would be fine. Both would be better.
“If you treat a man as he could and should be, he will become all that he can and should be.” — Johann Wolfgang von Goethe
Keep Calm, and Carry On
In the meantime, while the human race continues to stumble unevenly towards Win-Win outcomes, the best way to manage the people who’ve grown up without the benefit of a proper education, without context in their lives, and are largely untaught in the concept of ‘Win-Win’ thinking — is to *not overreact* to their violent attempts to control outcomes.
And in so doing, we remove the incentive for them to practice their ideology.
A Special EU Status for London?
February 14, 2017 02:13 / Leave a comment
by John Brian Shannon | February 14, 2017
It has become fashionable in recent weeks to talk about arranging some kind of special status for the City of London so that EU citizens can easily travel to London without the need to pass through UK customs.
Which would be convenient, wouldn’t it?
No pesky border guards to answer to, no briefcases opened and searched, and no wasted time for important EU-centric bankers and their European Union customers — and that applies whether they’re travelling for family vacations, to arrange financing for an EU business, or to meet their mistress in Calais.
Soon, bankers from every country will move to the UK to have all the advantages of EU access, combined with the privileges of living in Britain: A veritable banker’s paradise where the financial industry informs the UK government exactly how things will be.
Look now, it’s happening — just that it’s happening in slow-motion and nobody is seeing it for what it really is.
The Painfully Obvious Future of a ‘Special EU Status’ London
It’s so obviously in the EU’s interest to contrive a situation whereby London residents vote in a referendum to join the European Union, even as the rest of the UK continues to leave it (effectively sectioning-off London from the rest of the UK via the London Ring Road and Gatwick Airport) at which point the rest of the United Kingdom no longer held together by the economic gravity of London would probably dis-unite.
If Britain grants London ‘Special EU Status’ eventually it will become an EU City-state, Principality or Duchy, and Britons will need a passport to visit London.
Therefore, I can see why Brussels would want to contrive a ‘Special EU Status’ (SEUS) plan for the city of London, and I’m astonished at the innocent naiveté of Britons.
London, UK at night. Image courtesy of Leave.eu
Recently, German Chancellor Angela Merkel practically ‘mansplained’ to British Prime Minister Theresa May how “The UK will not be allowed to cherry-pick the bits of the EU it likes” — even as EU negotiators do their own cherry-picking — with London as the plumpest and richest cherry in all of Europe.
READ: EU negotiator wants ‘special’ deal over access to City post-Brexit
Allowing this plan to come to fruition will create a weaker and less-united United Kingdom and it will handover the ‘gold’ (London) to the EU. And there’s not a thing Britain can do to prevent it once the City of London is granted any kind of EU-centric special status.
Yes! It’s a wonderful plan if you’re a member-state of the European Union, a Europhile, or a London banker who wants to avoid the hassle of going through customs with the little people.
Apparently the thinking goes along these lines; The world already has a global ‘1 percent class’ who own more than 50 percent of the world’s wealth and will own 80 percent of the world’s total wealth by 2035, so it’s obvious that the world should have a distinct ‘banker class’ and their friends the global elites can accomplish that via alternately bullying and schmoozing the UK government into a customs-free zone with the EU. Which seems to be working.
“Oh, and a peon holiday every Monday in London, Elizabeth. We don’t like Monday morning traffic. Cancel their other holidays to make up for it. Sniff.”
I would like to ask the UK government; Where else in the world are bankers allowed to travel without passing through customs because the bankers arranged the passing of a law that allowed them to do so? And where else in the world would a country that is leaving a Union, leave behind their own capital city with most of the country’s wealth?
The answer is; Nowhere on Earth has this happened, and for obvious reasons!
Rather than incrementally handing Britain’s most historic and important city to the European Union, it would be smarter to simply invite the EU-centric part of London’s financial sector to leave. Ah, Paris in the spring!
READ: The language of love sweet-talks the City
Losing the EU-based financial sector that operates out of London is surely preferable to losing the entire city of London to the EU — which WILL happen over time if the Special EU Status zone is approved, resulting in the consequent dissolution of the United Kingdom.
Is There a Precedent for Integration that leads to Assimilation?
All law functions on precedent and there is a rather large precedent for this in business law — the case of the United States vs. General Motors in the 1960’s. It’s a fascinating story.
In the early part of the 20th-century many manufacturers built vehicles for the American public who were decidedly pro-automobile. Ford was the first company to utilize innovative automotive production line assembly techniques and the company grew exponentially — in fact, they couldn’t keep up with the demand for their car, the Model T.
At the time, General Motors built trucks and other vehicles for the U.S. military, and heavy industry vehicles for the mining and forestry sectors and GM was heavily subsidized by the U.S. government. Meanwhile, Chevrolet simply fed off the demand that Henry Ford’s company couldn’t meet.
It was a brilliant strategy for Chevrolet. They adopted Ford’s assembly line manufacturing innovations and met most of the consumer demand that Henry couldn’t.
So successful was the Chevrolet plan, that the first car to outsell the Model T was the 1934 Chevrolet Coupe, which was Chevy’s version of the Model T which was available in every colour imaginable — unlike the Model T that was only available in black. Henry Ford painted all his cars black because that allowed the largest number of cars to be built in the shortest amount of time and at the lowest cost-per-unit. (No fussing with colours)
Ford grew, Chevrolet grew, and General Motors grew.
By the 1950’s, Chevrolet decided to turn the tables on its main competitor (Ford) by taking a note from Henry Ford’s playbook — outsourcing. Chevrolet lowered costs by outsourcing some manufacturing to the massive General Motors Corporation which accommodated Chevy’s request to build a few hundred thousand engines per year at a lower cost than Chevrolet could have ever imagined.
GM even asked Chevy to send over their engine specs and said they would build Chevy’s engines exactly how Chevrolet wanted. And with higher manufacturing standards.
It worked so well for Chevrolet that they later asked GM to supply transmissions, window glass, seats and door panels, and finally car bodies for Chevrolet. And General Motors happily obliged.
One sunny morning, GM began a hostile takeover of Chevrolet. Chevrolet objected and so did the U.S. government — and understandably Ford, Chrysler, Studebaker and the other automakers strenuously objected to the hostile takeover.
But during the discovery process to verify which company owned what, and which company was most responsible for Chevrolet’s massive success — even Chevrolet’s legal team couldn’t make a clear distinction. Neither could the FBI or U.S. Department of Justice investigators. Nor could the U.S. Supreme Court judges deciding the case who were left with no recourse but to allow the merger to proceed, as nobody could tell them exactly what constituted Chevrolet and what constituted General Motors!
Everyone in the industry was furious. Yet Ford, Studebaker, Chrysler, the new American Motors Company (AMC) and others couldn’t do a thing about it. And the U.S. Department of Justice wasn’t happy either.
It took approximately 25 years for GM to absorb Chevrolet, but in retrospect they could have done it in 18 years if they weren’t so busy playing it safe. (To better ensure their assimilation plan worked)
Chevrolet became a victim of its own brilliant success, while General Motors had a stellar plan all along; Integrate until nobody can tell the difference.
Assimilate London is exactly what the European Union will do with a separate-customs-arrangement-London.
It would be criminally naive to think otherwise.
Arabian Gazette
kleef&co
Letter to Norway
|
cc/2020-05/en_middle_0097.json.gz/line1399765
|
__label__cc
| 0.684014
| 0.315986
|
Great Wall of Los Angeles: detail: World War I, Doughboys
Embed Download file
<iframe src="https://library.ucsd.edu/dc/embed/bb48498831/0" width="768" height="511" frameborder="0"></iframe>
Cinewest Archive
The "doughboys" leave, kissing their wives and girlfriends goodbye. In the recruiting poster, woman appears in her mythic form as the symbol of Liberty. In reality, she works in the war industry replacing men in nontraditional jobs like welding, as well as contributing to the war effort through "women's jobs" like nursing.
Summer, 1978; 1979 (photograph); 1976-1983 (entire mural); 2008-2011 (restoration)
Social and Public Arts Resource Center (Venice, Los Angeles, Calif.)
Baca, Judith Francisca (Mexican-American installation artist and muralist, born 1946)
Take up the Sword of Justice
Tujunga Wash, Los Angeles (California)
2,754 feet (entire mural)
A collaborative project by Judith Baca and over 400 employed youths and artists. The 1978 project continues where the first 1000 feet left off. From this point forward, Baca exerted more control over the design, which resulted in more stylistic unity and an evolving complexity in the transitions between the sections and linkages between historical incidents.
Mexican American art
Mural painting and decoration
Narrative art
View formats within this collection
No linguistic content; Not applicable
Shared Shelf: 166274
Under copyright (US)
Use: This work is available from the UC San Diego Library. This digital copy of the work is intended to support research, teaching, and private study.
Constraint(s) on Use: This work is protected by the U.S. Copyright Law (Title 17, U.S.C.). Use of this work beyond that allowed by "fair use" requires written permission of the UC Regents. Responsibility for obtaining permissions and any use and distribution of this work rests exclusively with the user and not the UC San Diego Library. Inquiries can be made to the UC San Diego Library program having custody of the work.
Digital Object Made Available By
Digital Library Development Program, UC San Diego, La Jolla, 92093-0175 (https://lib.ucsd.edu/digital-library)
|
cc/2020-05/en_middle_0097.json.gz/line1399766
|
__label__cc
| 0.691467
| 0.308533
|
Home / Stock Picks / Dividend Stocks / Thanks to 5G and Wi-Fi 6, Cisco Stock Remains A Buy Going Into Earnings
Thanks to 5G and Wi-Fi 6, Cisco Stock Remains A Buy Going Into Earnings
CSCO stock has become a buy on any pullback, and pull back it has
By Will Healy, InvestorPlace Contributor May 13, 2019, 5:31 am EST May 12, 2019
Cisco Systems (NASDAQ:CSCO) has pulled back in recent weeks from its post-dot-com boom highs. Cisco stock fell back after rising by almost 43% in less than four months. Since hitting that high, CSCO stock has declined to the $52 a share level.
Now flirting with correction territory, many wonder if CSCO will fall further as it reports earnings on Wednesday after the market close. If so, with its double-digit profit growth and the future in 5G, I see CSCO stock as a buy on any pullback.
Earnings and Sales Beats Could Boost Cisco Stock
For its third quarter, Wall Street expects Cisco to report earnings of 77 cents per share. If this holds, that would represent a 16.7% increase from year-ago levels of 66 cents per share. Analysts also forecast revenues of $12.9 billion. This would stand as a 3.5% increase from the same quarter last year when the company brought in $12.46 billion.
Cisco stock has developed a reputation for frequently beating earnings over the last 20-plus years. I do not expect anything different this quarter. The company has worked to restore its reputation for something it has seen little of since the 1990s tech boom — stock price increases. Since the beginning of 2016, CSCO stock has more than doubled in value. Last month, it reached its highest level since the fall of 2000 before pulling back.
Wi-Fi 6, 5G Will Drive CSCO Stock
Moreover, as my InvestorPlace colleague Bret Kenwell points out, the San Jose-based networking giant leads the way in the emerging Wi-Fi 6. The Wi-Fi 6 networking stack will offer 400% greater capacity and better performance in high-density areas. Though it lacks the publicity surrounding 5G, where Cisco has pursued a “cloud-to-client” approach, it could become just as significant in many respects. Furthermore, the company’s moves into software and network security have also improved the fortunes of Cisco stock.
Detractors point out that this is not the 1990s, and companies such as Check Point Software (NASDAQ:CHKP), Arista Networks (NASDAQ:ANET), and Palo Alto Networks (NASDAQ:PANW) present genuine competitive threats. Still, while vendors certainly have other choices, Cisco brings a measure of stability and income not found in newer names.
Favorable Financial Metrics Remain
Case in point, CSCO stock trades at a price-to-earnings (PE) ratio that compares well to its younger peers. This valuation stands at around 19.5 times earnings, and it falls to a PE of 15.4 on a forward basis. Moreover, analysts predict the company will deliver profit growth rates of 18.1% this fiscal year and 10.1% in fiscal 2020.
The 19.5x PE comes in at the high end of ranges seen in recent years. If the re-emergence of Microsoft (NASDAQ:MSFT) serves as an example, Cisco stock could benefit from multiple expansion. Even if that does not occur, the profit growth rates alone make double-digit returns in CSCO stock likely.
Investors should also remember one additional benefit to Cisco stock that did not exist in the 1990s — the dividend. Since the company began paying a dividend in 2011, it has increased its payout every year. The most recent increase went into effect in April. Now at an annual payout of $1.40 per share, the yield stands at around 2.5%.
The eight-year streak is a long enough time that the equity’s price will depend heavily on annual payout hikes. I even speculated that Cisco stock would achieve dividend aristocrat status (meaning 25-plus years of annual payout hikes) in 17 years. Time will tell if that occurs. Still, for investors wanting a growth and income play in the networking sector, I see CSCO stock as one of the top choices in the coming years.
Final Thoughts on Cisco Stock
Cisco stock has become a buy on any pullback, and pull back it has. The stock has corrected following a 40%-plus move higher from its December lows. Now, predictions for the upcoming earnings report strongly indicate that its double-digit growth will continue.
If its track record serves as an indication, Cisco stock should beat earnings by at least a penny per share. Bolstered by a move into security and software, as well as its position in both 5G and WiFi 6, Cisco’s double-digit profit growth should continue for years to come. It could benefit further if CSCO stock sees Microsoft-like multiple expansion. Moreover, the eight-year track record of payout hikes adds a growing income stream to add to the returns.
Perhaps Cisco stock rose too far and too fast over the last few months. Admittedly, it makes buying into earnings a riskier prospect despite a recent pullback. However, even with this potential hiccup, the likely rewards in CSCO stock outweigh the possible risks.
Article printed from InvestorPlace Media, https://investorplace.com/2019/05/5g-wifi6-cisco-stock-buy-earnings/.
|
cc/2020-05/en_middle_0097.json.gz/line1399777
|
__label__cc
| 0.676432
| 0.323568
|
C/O INSIGHT VENTURE PARTNERS
1114 AVENUE OF THE AMERICAS, 36TH FLOOR
Class A common stock 3,728,410 I See footnote(1)
Class A common stock 535,783 I See footnote(2)
Class A common stock 06/03/2019 C(3) 1,793,831 A (3) 2,679,709 I See footnote(4)
Class A common stock 06/03/2019 C(3) 41,480 A (3) 61,964 I See footnote(5)
Class B common stock (7) 06/03/2019 C(3) 2,115,442(8) (7) (7) Class A common stock (7) (7) 10,026,823 I See footnote(9)
Insight Venture Partners (Cayman) VII, L.P.
Insight Venture Partners (Delaware) VII, L.P.
IVP CIF II (PS Splitter), L.P.
Insight Venture Associates VII, L.P.
Insight Venture Associates VII, Ltd.
Insight Venture Partners VII (Co-Investors), L.P.
Insight Venture Partners VII, L.P.
Insight Venture Associates Coinvestment II, L.P.
IVP (Venice), L.P.
1. Exhibit 99.1
This Form 4 is the first of two Forms 4 filed relating to the same event. The Form 4 has been split into two filings because there are more than 10 reporting persons in total, and the SEC's EDGAR filing system limits a single Form 4 to a maximum of 10 reporting persons. This first Form 4 should be read in conjunction with the second Form 4 filed by the Designated Filer, Insight Holdings Group, LLC on the date hereof. Exhibit List ------------ Exhibit 99.1 - Explanation of Responses Exhibit 99.2 - Joint Filers' Signatures Exhibit 99.3 - Joint Filer Information
Insight Holdings Group, LLC, By: Blair Flicker, Attorney-in-Fact, /s/ Blair Flicker 06/05/2019
EXPLANATION OF RESPONSES
Held directly by Insight Venture Partners (Cayman) VII, L.P.
Held directly by Insight Venture Partners (Delaware) VII, L.P.
On June 3, 2019, IVP CIF II (PS Splitter), L.P. (“Splitter”) exchanged 2,115,442 shares of the Issuer’s Class B common stock and a corresponding number of LLC Units (as defined in footnote 7 below) on a one-for-one basis for an equivalent number of shares of the Issuer’s Class A common stock pursuant to the conversion mechanic described in footnote 7 below (the “Exchange”). No shares of common stock of the Issuer were sold by the Reporting Person in connection with the Exchange.
Immediately following the Exchange, Splitter distributed the 2,115,442 shares of the Issuer’s Class A common stock to its limited partners, Insight Venture Partners VII, L.P., Insight Venture Partners VII (Co-Investors), L.P. and IVP CIF II (AIP A), L.P., on a pro rata basis in accordance with their respective ownership interests as determined in accordance with the limited partnership agreement of Splitter (the “Distribution”). Insight Venture Partners VII, L.P., Insight Venture Partners VII (Co-Investors), L.P. and IVP CIF II (AIP A), L.P. did not furnish any consideration in exchange for the shares received pursuant to the Distribution.
(4) Held directly by Insight Venture Partners VII, L.P.
Held directly by Insight Venture Partners VII (Co-Investors), L.P.
Held directly by IVP (Venice), L.P.
One share of the Issuer's Class B common stock, was issued for each limited liability company unit of Pluralsight Holdings, LLC (each an “LLC Unit”) held by the Reporting Person pursuant to a reclassification of Pluralsight Holdings, LLC that occurred prior to the Issuer’s initial public offering of its Class A common stock. The shares of Class B common stock (i) confer no incidents of economic ownership on the holders thereof and (ii) only confer one-to-one voting rights on the holders thereof. Each share of Class B common stock and corresponding LLC Unit is convertible into one share of Class A common stock at the option of the holder and has no expiration date.
This report is the first of two filings made on this 5th day of June, 2019, to report transactions that occurred on June 3, 2019. The amounts reflected in columns (5), (7) and (9) represent the number of derivative securities disposed of, the number of securities underlying the derivative securities and the number of securities beneficially owned following the transactions reported across both filings.
Held directly by IVP CIF II (PS Splitter), L.P.
JOINT FILERS’ SIGNATURES
/s/ Blair Flicker
Blair Flicker
Insight Venture Associates VII, L.P., its general partner
Insight Venture Associates VII, Ltd., its general partner
Insight Venture Associates Coinvestment II, L.P., its general partner
Authorized Officer
JOINT FILER INFORMATION
3,728,410 shares of Class A common stock are held of record by Insight Venture Partners (Cayman) VII, L.P. (“IVP Cayman VII”), 535,783 shares of Class A common stock are held of record by Insight Venture Partners (Delaware) VII, L.P. (“IVP Delaware VII”), 2,679,709 shares of Class A common stock are held by Insight Venture Partners VII, L.P. (“IVP VII”), 61,964 shares of Class A common stock are held of record by Insight Venture Partners VII (Co-Investors), L.P. (“IVP VII Co-Investors” and, together with IVP Cayman VII, IVP Delaware VII and IVP VII, the “IVP VII Funds”). 1,137,762 shares of Class A common stock are held of record by IVP CIF II (AIP B), L.P. (“IVP AIP B”), 1,549,091 shares of Class A common stock are held of record by IVP CIF II (AIP A), L.P. (“IVP AIP A”) and 10,026,823 shares of Class B common stock are held of record by IVP CIF II (PS Splitter), L.P. (“Splitter”, together with IVP AIP B and IVP AIP A, the “IVP CIF Funds”). The IVP CIF Funds, together with the IVP VII Funds, are referred to as the “IVP Funds”. 236,965 shares of Class A common stock are held of record by IVP (Venice), L.P.
The amount listed as owned by each IVP VII Fund may be deemed to be attributable to the other IVP VII Funds, Insight Venture Associates VII, L.P. (“IVA VII”), Insight Venture Associates VII, Ltd. (“IVA VII Ltd”) and Insight Holdings Group, LLC (“Holdings”) because Holdings is the sole shareholder of IVA VII Ltd, which in turn is the general partner of IVA VII, which in turn is the general partner of each of the IVP VII Funds. The amount listed as owned by each IVP CIF Fund may be deemed to be attributable to the other IVP CIF Funds, Insight Venture Associates Coinvestment II, L.P. (“IVA Coinvestment II”) and Holdings because Holdings is the sole shareholder of IVA Coinvestment II, which in turn is the general partner of each of the IVP CIF Funds.
The amount list as owned by IVP Venice may be deemed attributable to Holdings because Holdings is the sole shareholder of Insight Venture Associates X, Ltd. (“IVA X”), which is the managing member of IVP GP (Venice), LLC (“IVP GP Venice”), which in turn is the general partner of IVP Venice.
Each of Jeffrey Horing, Deven Parekh, Peter Sobiloff, Michael Triplett and Jeffrey Lieberman is a member of the board of managers of Holdings and as such shares voting and dispositive power over the shares held of record by the IVP Funds, IVA VII, IVP Venice and IVA Coinvestment II. The foregoing is not an admission by (i) IVA VII, IVA VII Ltd, IVA Coinvestment II or Holdings that it is the beneficial owner of the shares held of record by the IVP Funds, (ii) IVA X, IVP GP Venice or Holdings that it is the beneficial owner of the shares held of record by IVP Venice, (iii) IVA VII Ltd or Holdings that it is the beneficial owner of the shares held of record by IVA VII, or (iv) Holdings that it is the beneficial owner of the shares held of record by IVA Coinvestment II. Each of Messrs. Horing, Parekh, Sobiloff, Triplett and Lieberman disclaims beneficial ownership of the shares held by any of the IVP Funds, IVA VII, IVP Venice or IVA Coinvestment II, except to the extent of his pecuniary interest therein.
The address of each of the entities and persons identified in this Exhibit 99.3 is c/o Insight Venture Partners, 1114 Avenue of the Americas, 36th Floor, New York, New York 10036.
|
cc/2020-05/en_middle_0097.json.gz/line1399778
|
__label__cc
| 0.570694
| 0.429306
|
Home Securities Law North Carolina Pembroke
Pembroke, North Carolina Securities Lawyers
James Penry
Raleigh, NC Securities Law Lawyer with 40 years experience
(919) 833-9449 1330 Saint Mary's Street
Free ConsultationSecurities, Arbitration & Mediation, Business and Stockbroker Fraud
I am a trial lawyer, and concentrate on commercial trials and arbitrations, with a special concentration in construction and securities matters. After law school, I clerked for a U.S. District Judge, and have been engaged in trial practice since 1983. I practiced in large regional and national firms until 2000, at which time my partner and I formed our litigation firm. I have tried, arbitrated and mediated hundreds of cases. I am licensed to practice law in North Carolina, South Carolina, Florida, and California.
Daniel Watts
Raleigh, NC Securities Law Attorney with 4 years experience
(919) 571-8300 5400 Glenwood Avenue
Securities, Business, Insurance Claims and Stockbroker Fraud
Mr. Watts is a native of Raleigh, North Carolina and attended Elon University, where he played varsity basketball and received numerous academic honors. After graduating from Elon in 2011, Mr. Watts worked as a pro bono intern at the Office of the Federal Public Defender in Raleigh, North Carolina.
In August 2012, Mr. Watts returned to Elon University School of Law to begin his legal studies as a Presidential Scholar. While in law school, Mr. Watts served as the Symposium Editor of the Elon Law Review, competed on behalf of the Elon Law Moot Court Board, mentored students as a Dean’s...
Durham, NC Securities Law Attorney with 47 years experience
(919) 313-4571 4819 Emperor Blvd.
Securities, Antitrust and IP
John A. Price has over four decades of legal experience, including first chair trial experience on a variety of complex business and commercial litigation matters with special emphasis on the areas of antitrust and unfair/deceptive trade practices, business torts, securities fraud, intellectual property, minority shareholder, regulatory, products liability, environmental, and a wide spectrum of business disputes. He is ranked AV Preeminent with 5 out of 5 for legal ability and ethics by Martindale-Hubbell in a peer-reviewed rating. He is certified in civil litigation by the Texas Board of Legal Specialization, licensed to practice law in Kansas, Texas and...
Andrew Whiteman
Raleigh, NC Securities Law Attorney with 39 years experience
(919) 571-8300 5400 Glenwood Avenue, Suite 225
Free ConsultationSecurities, Business, Insurance Claims and Stockbroker Fraud
Mr. Whiteman has represented clients in civil lawsuits and arbitrations for over three decades. The main focus of his practice is the representation of individuals in disputes with securities brokers and disability insurance companies.
Mr. Whiteman is admitted to practice before the federal and state courts in North Carolina, the Fourth Circuit Court of Appeals, and the United States Supreme Court. Mr. Whiteman holds a peer review rating of “AV” from Martindale-Hubbell, the highest available ranking in the areas of attorney competence and ethics.
Mr. Whiteman carefully evaluates potential cases based on their legal and factual merit, and welcomes all potential...
Neil Riemann
(919) 833-9449 510 Glenwood Ave
Securities, Appeals, Construction and Stockbroker Fraud
Neil Riemann tries, arbitrates, and takes appeals in business disputes. He has handled cases in federal and state courts as well as cases before arbitrators and governmental agencies. Most of his cases involve construction disputes, disputes between customers and their financial advisors, claims for insurance coverage, and claims of fraud or unfair practices.
Daphne Tippens Chisolm
Charlotte, NC Securities Law Attorney with 23 years experience
(704) 806-2387 11508 H-236 Providence Road
Securities, Arbitration & Mediation, Bankruptcy and Business
Robert Ughetta
Charlotte, NC Securities Law Lawyer
(704) 348-5141 227 West Trade Street
Securities and Business
Rob Ughetta practices out of Cadwalader's Charlotte, NC office. Rob has extensive experience in secured lending and represents lenders in structuring and negotiating finance facilities, including repo transactions and other financings of loans, securities and other assets. He represents trustees, investments banks, fund managers, as well as other financial institutions, companies and investors in many different matters.
Securities Attorneys in Nearby Cities
Saint Pauls
Securities Attorneys in Nearby Counties
The Oyez Lawyer Directory contains lawyers who have claimed their profiles and are actively seeking clients. Find more Pembroke, North Carolina Securities Lawyers in the Justia Legal Services and Lawyers Directory which includes profiles of more than one million lawyers licensed to practice in the United States, in addition to profiles of legal aid, pro bono and legal service organizations.
|
cc/2020-05/en_middle_0097.json.gz/line1399782
|
__label__cc
| 0.724804
| 0.275196
|
How SSL-TLS Works
Attach 1
This is version 66
Overview[1][4]#
SSL, and its successor, TLS is a protocol that operates directly on top of TCP (although there are also implementations for datagram based protocols such as UDP). This way, protocols on higher layers (such as HTTP) can be left unchanged while still providing a secure connection. Underneath the SSL-TLS layer, HTTP is identical to HTTPS.
Before Transport Layer Security starts the client needs to create a TCP connection to the server. This has nothing to do with TLS itself yet. And already if the TCP connection succeeds you will get CONNECTED(00000003). If you don't get this CONNECTED then the server might be down or might not be reachable from your site, for example because a firewall is blocking the access.
Record Protocol#
SSL-TLS is layered and the bottom layer is the Record Protocol. Whatever data is sent in a SSL-TLS tunnel is split into records. Over the wire (the underlying TCP socket or TCP-like medium), a record looks like this:
HH V1:V2 L1:L2 data
TLS Handshake#
The handshake is a protocol which is played within the record protocol. Its goal is to establish the algorithms and keys which are to be used for the records. There two types of TLS Handshakes:
TLS Full Handshake (Which is covered here)
TLS Abbreviated Handshake
Both TLS Handshakes consists of messages. Each TLS Handshake message begins with a four-byte header:
one byte which describes the message type
three bytes for the message length (Big-Endian convention).
The successive handshake messages are then sent with records tagged with the "handshake" type (first byte of the header of each record has value 22).
Note the layers:
the handshake messages
complete with four-byte header
are then sent as records, and each record also has its own header.
Furthermore, several handshake messages can be sent within the same record, and a given handshake message can be split over several records. From the point of view of the module which builds the handshake messages, the "records" are just a stream on which bytes can be sent; it is oblivious to the actual split of that stream into records.
TLS Full Handshake#
Initially, client and server "agree upon" the Cipher Suite "TLS_NULL_WITH_NULL_NULL (0x000) Encryption with no MAC and null compression. This means that the record they will first send will be sent as cleartext and unprotected.
The Full TLS Handshake looks like this:
Full TLS Handshake
Step One: ClientHello#
First message of a handshake is a ClientHello. The message by which the client states its intention to do some SSL. Note that "client" is a symbolic role; it means "the party which speaks first". It so happens that in the HTTPS context, which is HTTP-within-SSL-within-TCP, all three layers have a notion of "client" and "server", and they all agree (the TCP client is also the SSL client and the HTTP client), but that's kind of a coincidence.
The ClientHello message contains:
the maximum protocol version that the client wishes to support;
the ClientHello.random (32 bytes, out of which 28 are suppose to be generated with a cryptographically strong number generator);
the "session ID" (in case the client wants to resume a session in an abbreviated handshake, see below);
the list of "Cipher Suites" that the client knows of, ordered by client preference;
the list of compression algorithms that the client knows of, ordered by client preference;
some optional extensions.
Step Two: ServerHello#
The server responds to the ClientHello with a ServerHello which contains:
the protocol version that the client and server will use;
the ServerHello.random (32 bytes, with 28 random bytes);
the session ID for this connection;
the Cipher Suite that will be used; Note: The client and the server must support at least one common cipher suite, or else the handshake fails. The server generally chooses the strongest common cipher suite.
the compression algorithm that will be used;
optionally, some extensions.
Step Three ServerCertificate#
The server sends a Certificate_list, which contains its Site Certificate. This message is almost always sent, except if the Cipher Suite mandates a handshake without a certificate.
If the server requires a digital certificate for client authentication, the server sends a digital certificate request message. In the "digital certificate request" message, the server sends a list of the types of digital certificates supported and the distinguished names of acceptable certificate authorities.
Step Four ServerKeyExchange#
The server sends ServerKeyExchange message is sent after the server certificate message if it does not contain enough information for the client to exchange the Premaster Secret, or after the server hello if anonymous Key-Exchange is in use.
More specifically it is used for anonymous Diffie-Hellman, Diffie-Hellman Ephemeral and Ephemeral RSA key-exchange methods.
Step Five CertificateRequest#
The server sends a message requesting that the client also identifies itself with a Certificate_list of its own. This message contains the list of names of Trust Anchors (aka Root Certificates) that the server will use to validate the client certificate.
Step Six ServerHelloDone#
The server sends a marker message (of length zero) which says that the server is finished, and the client should now talk.
Step Seven Client Send Certificate#
The Client sends the client Certificate is an OPTIONAL step only when server requested. (Mutual TLS)
Step Eight ClientKeyExchange#
The ClientKeyExchange is sent by the Client immediately after the client certificate if it is sent, otherwise immediately after the server hello done message. It has two variants, one for when RSA key-exchange is used as the Key-Exchange algorithm, and one for when Diffie-Hellman key-exchange is used.
Step Nine CertificateVerify#
The client sends a digital signature computed by the client over all previous handshake messages. This message is sent when the server requested a client certificate, and the client complied. This is how the client proves to the server that it really "owns" the public key which is encoded in the certificate it sent.
Step Ten Change_cipher_spec#
Then the client sends a ChangeCipherSpec message, which is not a handshake message: it has its own record type, so it will be sent in a record of its own.
Its contents are purely symbolic (a single byte of value 1). This message marks the point at which the client switches to the newly negotiated cipher suite and keys. The subsequent records from the client will then be Encrypted
TLS-Finished#
A TLS-Finished message is always sent immediately after a Change_cipher_spec message to verify that the key exchange and Certificate-based Authentication processes were successful. It is essential that a change cipher spec message be received between the other handshake messages and the TLS-Finished message.
The TLS-Finished message is the first protected with the just negotiated algorithms, keys, and secrets. Recipients of finished messages must verify that the contents are correct. Once a side has sent its Finished message and received and validated the Finished message from its peer, it may begin to send and receive application data over the connection.
The Finished message is a cryptographic checksum computed over all previous handshake messages (from both the client and server). Since it is emitted after the ChangeCipherSpec, it is also covered by the integrity check and the encryption. When the server receives that message and verifies its contents, it obtains a proof that it has indeed talked to the same client all along. This message protects the handshake from alterations (the attacker cannot modify the handshake messages and still get the Finished message right).
Step Eleven change_cipher_spec#
The server finally responds with its own change_cipher_spec then Finished. At that point, the handshake is finished, and the client and server may exchange application_data (in encrypted records tagged as such).
This message marks the point at which the client switches to the newly negotiated Cipher Suite and Master Secret Key.
To remember: the client suggests the Cipher Suite but the server chooses. The Cipher Suite decision is in the hands of the server. Courteous servers are supposed to follow the preferences of the client (if possible), but they can do otherwise and some actually do (e.g. as part of protection against BEAST).
Certificate-based Authentication#
An important part of How SSL-TLS Works is the Certificate-based Authentication.
Handshake Again#
Since a handshake is just some messages which are sent as records with the current encryption/compression conventions, nothing theoretically prevents a SSL-TLS client and server from doing a second handshake within an established session. And, indeed, it is supported and it happens in practice.
At any time, the client or the server can initiate a new handshake, the client just sends a ClientHello. Likewise the server can send a HelloRequest message. A typical situation is the following:
An HTTPS server is configured to listen to SSL requests.
A client connects and a handshake is performed.
Once the handshake is done, the client sends its "applicative data", which consists of a HTTP request. At that point (and at that point only), the server learns the target path. Up to that point, the URL which the client wishes to reach was unknown to the server (the server might have been made aware of the target server name through a Server Name Indication SSL extension, but this does not include the path).
Upon seeing the path, the server may learn that this is for a part of its data which is supposed to be accessed only by clients authenticated with certificates. But the server did not ask for a client certificate in the handshake (in particular because not-so-old Web browsers displayed freakish popups when asked for a certificate, in particular if they did not have one, so a server would refrain from asking a certificate if it did not have good reason to believe that the client has one and knows how to use it).
Therefore, the server triggers a new handshake, this time requesting a certificate.
There is an interesting weakness in the situation I just described; see RFC 5746 for a workaround. In a conceptual way, SSL-TLS transfers security characteristics only in the "forward" way. When doing a new handshake, whatever could be known about the client before the new handshake is still valid after (e.g. if the client had sent a good username+password within the tunnel) but not the other way round.
In the situation above, the first HTTP request which was received before the new handshake is not covered by the Certificate-based Authentication of the second handshake, and it would have been chosen by the attacker! Unfortunately, some Web servers just assumed that the client authentication from the second handshake extended to what was sent before that second handshake, and it allowed some nasty tricks from the attacker. RFC 5746 attempts at fixing that.
Watch Out#
There are a few caveats about How SSL-TLS Works you should be aware of:
TLS Session Resumption
How To Crack SSL-TLS
More Notes on SSL/TLS.#
When using SSL/TLS correctly, all an attacker can see on the cable is which IP and port you are connected to, roughly how much data you are sending, and what encryption and compression is used. He can also terminate the connection, but both sides will know that the connection has been interrupted by a third party.
In typical use, the attacker will also be able to figure out which host name you're connecting to (but not the rest of the URL): although HTTPS itself does not expose the host name, your browser will usually need to make a DNS request first to find out what IP address to send the request to.
close_notify Attack on the SSL/TLS Protocol#
To close the connection, a close_notify 'alert' is used. If an attacker tries to terminate the connection by finishing the TCP connection (injecting a FIN packet), both sides will know the connection was improperly terminated. The connection cannot be compromised by this though, merely interrupted.
Some more details#
Why can you trust Google.com by trusting GeoTrust?#
A website wants to communicate with you securely. In order to prove its identity and make sure that it is not an attacker, you must have the server's public key. However, you can hardly store all keys from all websites on earth, the database would be huge and updates would have to run every hour!
The solution to this are Certificate Authorities, or CA for short. When you installed your operating system or browser, a list of trusted CAs probably came with it. This list can be modified at will; you can remove whom you don't trust, add others, or even make your own CA (though you will be the only one trusting this CA, so it's not much use for public website). In this CA list, the CA's public key is also stored.
When Google's server sends you its certificate, it also mentions it is signed by GeoTrust. If you trust GeoTrust, you can verify (using GeoTrust's public key) that GeoTrust really did sign the server's certificate. To sign a certificate yourself, you need the private key, which is only known to GeoTrust. This way an attacker cannot sign a certificate himself and incorrectly claim to be Google.com. When the certificate has been modified by even one bit, the sign will be incorrect and the client will reject it.
So if I know the public key, the server can prove its identity?#
Yes. Typically, the public key encrypts and the private key decrypts. Encrypt a message with the server's public key, send it, and if the server can tell you what it originally said, it just proved that it got the private key without revealing the key.
This is why it is so important to be able to trust the public key: anyone can generate a private/public key pair, also an attacker. You don't want to end up using the public key of an attacker!
If one of the CAs that you trust is compromised, an attacker can use the stolen private key to sign a certificate for any website they like. When the attacker can send a forged certificate to your client, signed by himself with the private key from a CA that you trust, your client doesn't know that the public key is a forged one, signed with a stolen private key.
But a CA can make me trust any server they want! Yes, and that is where the trust comes in. You have to trust the CA not to make certificates as they please. When organisations like Microsoft, Apple and Mozilla trust a CA though, the CA must have audits; another organisation checks on them periodically to make sure everything is still running according to the rules.
Issuing a certificate is done if, and only if, the registrant can prove they own the domain that the certificate is issued for.
What is this MAC for Message Authentication Code?#
Every message is signed with a so-called Message Authentication Code, or MAC for short. If we agree on a key and hashing Cipher, you can verify that my message comes from me, and I can verify that your message comes from you.
For example with the key "correct horse battery staple" and the message "example", I can compute the MAC "58393". When I send this message with the MAC to you (you already know the key), you can perform the same computation and match up the computed MAC with the MAC that I sent.
An attacker can modify the message, but does not know the key. He cannot compute the correct MAC, and you will know the message is not authentic.
By including a sequence number when computing the MAC, you can eliminate replay attacks. SSL does this.
You said the client sends a key, which is then used to set up symmetric encryption. What prevents an attacker from using it?#
The server's Public Key does. Since we have verified that the Public Key really belongs to the server and no one else, we can encrypt the key using the public key. When the server receives this, the server can decrypt it with the Private Key. When anyone else receives it, they cannot decrypt it.
This is also why key size matters: The larger the Public Key and Private Key, the harder and longer it is to crack the key that the client sends to the server.
Recommended Books#
Bulletproof SSL And TLS
ServerHelloDone
TLS Full Handshake
[#1] - How does SSL work? I - based on information obtained 2015-03-15
[#2] - Client Key Exchange - based on information obtained 2015-03-16
[#3] - The First Few Milliseconds of an HTTPS Connection - based on information obtained 2015-03-15
[#4] - https://security.stackexchange.com/a/20847/70391 - based on information obtained 2018-07-03
[#5] - How can I tell if it's using TLS 1.0? - based on information obtained 2018-11-12-
This page (revision-66) was last changed on 12-Nov-2018 08:38 by jim Top
Uptime 2d, 23h 58m 34s
|
cc/2020-05/en_middle_0097.json.gz/line1399784
|
__label__cc
| 0.657283
| 0.342717
|
experts@legalmalpractice.com
Legal Malpractice has become so complicated that
you need an expert to help figure it out.
Law Review
MD: Discovery Rule and its Limits
Home » Blog » MD: Discovery Rule and its Limits
Bank of New York v. Sheff, 382 Md. 235, 854 A.2d 1269
MD: Underlying Bond Issuance
Student Contributor: Vanessa L. Wachira
Facts: In a complex sale of nearly $50 million tax-exempt revenue bonds held by Prince George’s County involving numerous borrowers, Bondholders (represented by The Bank of New York (“Trustee”)), underwriters and attorneys, Piper & Marbury (“Attorneys”) was assigned the duty of drafting several critical documents. Among these, the Loan Agreement and the Trust Indenture each provided that Borrowers—the health care providers receiving the bond proceeds—would be responsible for filing all financing statements. Financing statements were needed to perfect a lien that Bondholders had placed on Borrowers’ assets as part of a security for repayment. Because the Borrowers included health-care providers located in both PG County and DC, filing was required in both locations. However, Attorneys drafted and circulated only the financing statements for filing in Maryland. Prior to the closing, a binder of all documents relating to the transaction was circulated to all parties; the binder did not contain any financing statements for DC. In 1997, Borrowers agreed to sell certain accounts receivables, which should have been subject to Bondholder’s 1993 lien, to Daiwa-Healthco-2 LLC (“Purchaser”). At some point between June and September of 1998, an analyst with one of the municipal bond funds holding the 1993 bonds became aware of and expressed concern to Trustee about Borrowers’ agreement with Purchaser. On November 20, 1998, he discovered that there were no financing statements on file in DC and that, consequently Bondholders did not have a perfected lien on the assets sold to Purchaser. On November 23, 2001, Trustee filed suit against Attorneys in DC. Finding that Maryland had a substantial interest in having the case litigated there, the DC court dismissed the action. Trustee re-filed in PG County on August 28, 2002.
Issue: Whether Bondholder were barred by the statute of limitations from asserting claims against Attorneys for their failure to perfect a lien on Borrower’s assets.
Ruling: Yes. In Maryland, a claim for legal malpractice must be brought within three years of the date upon which it accrues. Under Maryland’s “discovery rule,” an action is held to accrue, and the statute of limitations begins to run, at the moment a “plaintiff has knowledge of circumstances which would cause a reasonable person in the position of plaintiff to undertake an investigation which, if pursued with reasonable diligence, would have led to knowledge of the alleged cause of action.” Here, Attorneys argued that Trustee had knowledge of the alleged cause of action as early as 1993 when it received the binder of documents which lacked the DC paperwork. The Court, however, determined that, although the claim was statutorily barred, the statute of limitations began to run at some point between September and November 20, 1998 when Trustee was explicitly informed of the missed filing.
Lesson: Not all states give plaintiffs the benefit of a "discovery rule" to prolong the time period for bringing claims. Check the applicable jurisdictions’ rules and cases carefully to make sure.
Tagged with: Maryland, Privity, Wills Trusts & Estates
Posted in: Maryland, Privity, Wills Trusts & Estates
« AL: Insured Attorneys protected so long as they act in a fiduciary capacity
Happy 2nd Anniversary and 200,000 Visitors to the Legal Malpractice Law Review »
Advance Waivers of Conflicts
Affidavit/Certificate of Merit
Alternate Dispute Resolution
But for-Proximate Cause
Case Within a Case
Cases & Materials
CLE & Law School Course
Discovery Rule
Disgorgement of Fees
Duties: Communicate
Duties: Competence
Duties: Confidentiality
Duties: Conflict Avoidance
Duties: Investigate
Entire Controversy Doctrine
Insight & commentary
Joint & Several Liability
Labor & Employent
Land Use, Zoning
Local & Co-Counsel
Mitigation of Damages
Non Engagement Letter
Privity
Restatement of the Law Governing Lawyers
Rules of Professional Conduct (RPCs)
Scope of Representation
Substantial Factor-Proximate Cause
Torts/Personal Injury
Disclaimer: Pursuant to the Rules of Professional Conduct as promulgated by the Supreme Court of New Jersey, lawyers who promote themselves or their firms are required to state the following: “No aspect of this advertisement has been approved by the Supreme Court of New Jersey.” This disclaimer applies to all the attorney rating agencies and organizations listed below. The awards and recognition may apply to some or all of the firm’s attorney. For further information about a firm’s attorney kindly reference their respective biographies. Some or all attorney rating agencies may require payment of one time or annual fees. For further information, as to their internal selection and rating criteria please click on the respective links below.
© LegalMalpractice.com Inc. | Disclaimer & Privacy
Three University Plaza- Suite 350, Hackensack, N.J. 07601 | 201.488.1222
Website Design by Zola Creative
|
cc/2020-05/en_middle_0097.json.gz/line1399789
|
__label__cc
| 0.668106
| 0.331894
|
Just another special-interest lobby seeking plunder
by Jon Sanders
There is a very active special-interest lobby in North Carolina. Dozens upon dozens of its lobbyists are a constant presence at the North Carolina General Assembly. They desire:
Exorbitant, ongoing investment tax credits for their industry
Generous accelerated depreciation schedules for their industry
Consumers forced by law to purchase an increasing amount of their product
All of the above portrayed as pro-free market
Here are a few questions based on those desires:
Does it matter what the industry is? Should it matter?
What about the principles of free market? Do they change?
What if the industry in question is a regulated monopoly?
The special-interest lobby seeking generous tax credits for its industry and demanding consumers be forced by law to buy an increasing amount of their product represents … renewable energy.
Does that change things? Is night now day? Is down up? Is breathtaking cronyism pro-free market?
The lobby itself must suspect that it doesn’t change things, so it has a novel argument being used in social media, comments, and other under-the-radar venues against North Carolina’s leading light for true freedom. That argument is that the electricity market in North Carolina is not a free market, but the John Locke Foundation isn’t informing people that.
I didn’t say it was a good argument. At worst it would simply mean that JLF isn’t bothering to point out the patently obvious.
I think the argument is a fumbling attempt at technical disqualification, as if all the work JLF has done in bringing facts and data to light about the nature and limitations of renewable energy — and all the corporate cronyism, tax incentives, and purchase mandates used by the lobby’s friends and campaign donation beneficiaries in government to force it on people — doesn’t “count” if the lobby finds some way, any way to argue JLF shouldn’t be involved.
Not that the goal of the argument matters; is it true or not? Let’s look at JLF reports on the renewable energy mandate.
Most Recent JLF Spotlight Report on Renewable Energy
The most recent was mine from June 4, “Renewable Energy: Lobby’s report more fog than light.” It dismantles a recent report by the renewable energy lobby.
The JLF report’s conclusion began:
In North Carolina, electricity consumers have no choice in their electricity provider. This fact should, first of all, never provide an excuse to use this lack of a free market to enrich special interests at the expense of captive ratepayers.
Gracious, there are three mentions of the electricity monopoly in the first two sentences. Furthermore, they are aimed directly at the lobby’s rhetoric.
The phrase “captive ratepayers” is an especially important one because electricity is a vital necessity, not a luxury item. I use that term to underscore the inescapable, obvious fact that North Carolinians are given no choice in who provides them this critical household good.
As long as that is the case, I see it as a moral imperative that state leaders craft energy policy from the perspective that, quoting the report, “the top stakeholders are ratepayers whose chief interest is least-cost, reliable power at the flip of the switch.”
The lobby sees things differently. They see the pre-existing monopoly as an irresistible opportunity to plunder captive ratepayers for their industry’s gain.
The 2013 JLF Carolina Cronyism Report on the REPS Law
I also wrote a Carolina Cronyism report in 2013 entitled “Power to the People: End SB 3 with its expensive, regressive renewable energy portfolio standard.”
The third Key Fact of that report was this:
The RPS mandate does, however, contribute to higher electricity prices for captive ratepayers.
In the report proper, on the first page, in the first section after the introduction, there is this paragraph (first subhead included):
The main issue to captive ratepayers: what electricity costs
Given that ratepayers have no choice in who provides their homes with electricity or from what sources they derive it, the overarching issue for ratepayers, especially poor ratepayers whose household budgets are significantly affected by electricity costs, is what it costs them to turn on the lights. Utilities should be interested in the lowest-cost, most reliable, and most efficient ways of generating electricity. RPS mandates pare away at that process, however, forcing utilities to make state-sanctioned compromises in their electricity bundles and ultimately their rates.
That report also refers throughout to captive ratepayers in a monopoly market. The conclusion reminds everyone that
All of this occurs in a tightly restricted market where consumers are allowed no choice over their electricity providers.
The final two paragraphs are these:
For these reasons, SB 3 should be repealed. At the very least, as is currently under discussion, the renewable energy portfolio standard should be capped and ended. Ideally, the renewable energy and energy efficiency portfolio standard would be eliminated, and CWIP would be struck out. North Carolina policy should support lowest-cost, reliable, and efficient energy sources. One day those could include renewable sources, but it should be left to private entrepreneurs competing and seeking innovation to bring that about.
Meanwhile, rather than dictate energy source bundles to utilities, N.C. lawmakers should consider ways to free up electricity markets to less price-sensitive consumers who would like to be able to receive electricity from select sources, including solar and wind power, if given the opportunity.
A 2014 JLF/NC WARN Joint Forum on “The Competitive Challenges to N.C.’s Monopoly Electricity Model”
JLF’s press release put it this way:
JLF and NC WARN agreed to co-host the forums to publicize two key concerns about North Carolina’s electricity market. First, consumers would benefit if North Carolina state government would open up the electricity market to more competition.
My introductory remarks to this forum, “The Four P’s of Electricity Competition,” concluded:
Furthermore, as discussed above, other new technologies and “disruptive innovations” that would benefit consumers should not be effectively blocked by a monopoly model of electricity.
Increasing competition must go hand-in-glove with this principle, however: no subsidies and no mandates. Generating sources must be able to stand on their own. … To be viable, then, either generating sources must be price-competitive, or they should fill a particular consumer preference. Broadening consumer choice obviously helps consumers by allowing them to choose lower-cost options and thereby pressuring providers to compete along those lines, but choice also implies letting consumers decide according to their own particular values. A monopoly system, however, prevents choice itself, whether for a least-cost option, boutique provider, or anything in between.
JLF Blog Posts
Could it be that the renewable-energy lobby’s argument is just flat wrong? (In other words, is night still night? Is down down? etc.) Well, let us examine some other JLF writings on the renewable energy mandate before making that conclusion.
Here’s one from July 15. Oh, wait, look away:
… how Big Renewable Energy Industry–friendly policies like huge special tax breaks and portfolio standards forcing monopoly providers into buying the overpriced, unreliable, intermittent and otherwise unmarketable junk can “work.”
What about July 10, discussing how Duke Energy figured out how to make out-of-state renewable energy credits (RECs) count for in-state renewable energy credits? Mm, never mind:
Imagine that kind of creative imagination being put to use in a market-based industry instead of one based on winning legislators instead of customers.
Ah, here’s one from July 7. On second thought, ignore that:
… as is always the unstated assumption in articles on renewable energy policies, the most important thing in the world is keeping the unsustainable industry afloat. Poor captive ratepayers with their need for low-cost, reliable electricity at the flip of the switch are pawns in the big game. Can they give political donations? Can they send in hordes of glad-handing and big-smiling lobbyists? What can they do but just try to make ends meet …
June 30? Yikes! Keep looking!
[T]heir state and federal investment tax credits and accelerated depreciation add up to, well … one hundred percent. Plus they get a captive consumer base who by law have no choice over who sells them electricity from whom and for how much …
… the media instead fight to protect the corrupt cronies from the forces of evil, the ones they call “special interests,” who are of course ordinary people; i.e., the captive ratepayers/taxpayers whose “special interest” is in not being taken advantage of as taxpayers and ratepayers to benefit the big business. …
Meanwhile, captive ratepayers/taxpayers can only hope that the legislature will grow tired of this annual spectacle
June 10, then? Well, nope:
The News & Observer published a typical column in favor of keeping and ramping up North Carolina’s tax credits and forced purchase mandates on captive ratepayers/taxpayers. It hit all the lowlights [including] … acting like the forces of greed and cronyism are on the side of ending the tax credits and forced purchase mandates on captive ratepayers/taxpayers…
What about May 5? Oh heavens no:
[The Greensboro News & Record writes]:
A survey of electric utilities released Monday ranks North Carolina third in the nation for new solar power operations added in 2014. …Duke Energy’s solar expansion is fueled, in large part, by demanding —
Demanding who? Consumers who have no choice over their electricity provider but who desperately want more solar? Ratepayers whose most important need at the flip of the switch is actually to swell with pride at the state’s suddenly new, higher solar ranking released coincidentally before an important vote in the House? Reading on…
— by demanding North Carolina regulations that require utilities to add an increasing portion of renewable energy to their sources of power.
Those regulations are being challenged in the current General Assembly.
Mandates established by the legislature in 2007 required utilities to buy 3 percent renewable energy by 2012, 6 percent by 2015, 10 percent by 2018 and 12.5 percent by 2021.
Proof once again that the solar industry thinks it cannot survive unless poor people with no say in the matter are forced to buy power from them through the only electricity provider they’re allowed to buy from.
April 28? Avoid that too!
I discussed this imbalance on pages 6-7 of my report on Carolina Cronyism. It takes principled leaders to resist public-choice cronyism.
Shorn of principle, the choice expands in a leader’s mind: People in this state may not have any choice over who sells them electricity, but we’re not charging them much to cover the renewable energy costs. And that mandate isn’t expanding by much, not at first. But it goes to support jobs in the industry. Jobs are good, right? You know that industry is right there in my district. Yes, everyone in my district is an electricity consumer, but that’s not what I’m talking about. These industry reps love me and support me. I can’t turn my back on them now.
A dozen moral compromises later, and the imperative seems to be supporting the industry that — despite years of promises to the contrary — still admittedly cannot stand on its own without loads of forced public support.
April 27 disappoints:
… focus on costs and innovation. That approach puts least-cost energy and North Carolina’s captive electricity consumers at the forefront of the state’s energy policy, as they should be.
But not as profoundly as April 22!
Principled, empirically sound stands for the citizens of North Carolina are no fun and don’t benefit campaign coffers or influential friends. It would just help those piddling poor people who are only useful as props and aren’t Important In Raleigh (other than to confer the title of “Representative” — you know, as being the ones whose interests are supposedly being represented). … I hope the poor, overlooked, captive ratepayers who matter just as little to this clot of politicians in Raleigh as they did to previous clots will remember as well.
April 21? Not even:
My Daily Journal column today explores the importance of reviving this crucial standard [least-cost reliable power] in a state that guarantees its electric utilities a locked-in consumer base.
April 17? Eek; not for the faint of heart:
The main thing the bill would do is refocus North Carolina on a policy of ensuring least-cost, reliable electricity to its citizens, who remember are given no choice in electric utilities.
Why would solar be afraid of that, if it’s so strong? Aren’t we told it’s becoming more competitive? That it’ll soon be cheaper than traditional energy sources?
What, then, could be the problem with asking solar to compete in the near future? Unless solar lobbyists know it can’t compete and can’t survive without purchase mandates on utilities, state and federal tax incentives, government grants, etc.
Although I haven’t even made it back to winter of this year, I think it’s best at this point to stop quoting. The lobby’s latest campaign has died under a flurry of truth like bullets raining down on Bonnie and Clyde. At some point decency cries relent.
If you’re inclined to keep looking, of course, you will find an ongoing consistency. Application of empirical data, facts, and principles to an issue of public policy has long been and remains JLF’s hallmark.
Tags: carolina cronyism, green cronyism, REPS, RPS, solar, wind
Jon Sanders / Director of Regulatory Studies
Jon Sanders studies regulatory policy, a veritable kudzu of invasive government and unintended consequences. As director of regulatory studies at the John Locke Foundation, Jo...
|
cc/2020-05/en_middle_0097.json.gz/line1399796
|
__label__cc
| 0.56612
| 0.43388
|
Updated by Elia Mertz on Apr 27, 2016
Elia Mertz
Best Natural Attractions in Seychelles – Gorgeous Tropical Sanctuaries
Listly by Elia Mertz
The tropical islands of Seychelles remain unspoilt sanctuaries of stunning beauty. UNESCO Nature reserves, verdant jungles and pristine beaches are just some of the pleasures awaiting you there.
Anse Intendance
This is one of the most beautiful beaches on the island of Mahe. The crescent shaped beach is home to surfers who love the big swells and wild waves of the area. Although swimming is a bit tough there due to the non-existence of a natural reef, the beach is a favourite amongst beachcombers, photographers and the lazy sunbathers. The sandy shores are nesting grounds for turtles and are bordered by palm trees and a lush jungle.
Baie Lazare
Baie Lazare is a picturesque village named after the French explorer – Lazare Picault, who first set foot on these shores when exploring Seychelles. The Baie Lazare church, a neo-Gothic marvel dedicated to St Francis of Assisi is an iconic attraction there. From the location of the church you are afforded panoramic views of the surrounding area with Anse Soleil and Petite Anse being favourite beaches resplendent with sun kissed sands and glistening blue waters.
Valee de Mai National Park
This is a gorgeous UNESCO World Heritage Site home to 4,000 species of the gigantic coco de mer fruit palm a tree that's distinctive to the Seychelles. Species to view include vanilla orchids, latanier, palmiste, Chinese palms and splayed travellers palm. Nature lovers and bird watchers should consider accommodation at one of the Seychelles resorts located close to the park for the place is home to a fabulous collection bird and plant species thriving beneath the verdant canopy of trees. Located quite close to the Berjaya Praslin Resort, the Valee de Mai National Park is home to a variety of lizard species and boasts sights of fruit pigeons, Seychelles bulbul and the black parrot – the national bird. Visitors can hike across the marked trail which is considered easy and takes around 45 minutes.
Beau Vallon
Located along the north western coast of Mahe, Beau Vallon is a beautiful curve of sand that attracts foreigners and locals. On the horizon you can see the glittering image of Silhouette Island while loads of fun water sports are on offer at this site. Indulge in jet skiing, water skiing and swimming. The sea around this beach is quite calm and is patrolled by lifeguards; attracting a lot of family vacationers.
Morne Seychellois National Park
Almost 20% of Mahe is given up to this national park, the largest in the Seychelles. The verdant sanctuary is home to the Morne Sychoilles mountain range housing the country's highest peak standing at an impressive 905 metres. From the village of Danzil you can take on a hiking trail into the depths of the park. The mountainous trails are quite a treat taking you across tea plantations with stunning views of Mahe's south-western coasts. You can also catch a glimpse of the Baie Ternay and Port Launay Marine Parks. To the northwest of the park is the lovely hamlet of Bel Ombre and alluring beach of Anse Major.
best natural attractions seychelles tropical sanctuaries berjaya praslin resort
|
cc/2020-05/en_middle_0097.json.gz/line1399803
|
__label__cc
| 0.714215
| 0.285785
|
Writing Horror Using All Five Senses
Column by Repo Kempt April 22, 2019
Photo by samer daboul
Horror is a raw and visceral genre that relies on fear and anxiety. Readers need to really connect with characters on a base level and share their negative emotions in order for horror fiction to be truly effective. As an editor, I often see horror writers using vague phrases like, "Judy was terrified by the sight of the creature" or “Bill was overwhelmed with sheer terror." Stop telling your readers that your characters are scared and start showing your readers their fear. Adding more sensory details and internal physiological reactions to your writing will help you accomplish this task.
Many new writers fail to effectively visualize their scenes and rely heavily on hackneyed descriptors. You could write: “Willa curled her hands into tight fists.” Or you could write: “Willa’s poor, thin hands were knotted into tight blue fists. The knuckles shone white like the joints of butchered fowl.” American author Davis Grubb wrote the latter description in 1953’s Night of the Hunter. He makes us see that little girl’s hands so clearly it hurts, and the comparison to murdered birds makes a sinister connection in your mind that is impossible to ignore. All it takes is one strong image to burn a scene permanently into a reader’s mind. So don’t be stingy with the visual details.
Stop telling your readers that your characters are scared and start showing your readers their fear.
Sour milk. Gasoline. Dog shit. Each word triggers a different memory and a corresponding emotion in our brain. By using olfactory descriptors in our writing, we can pull the reader deeper into the story. Something missing from your scene? Add a familiar smell. And don’t just write, “The room smelled like X.” Bust out your thesaurus—use aroma, stench, sniff, stink, scent, hint, or malodor. I also highly recommend you read Perfume: The Story of a Murderer by Patrick Süskind. It tells the story of a Grenouille, an 18th-century French orphan born with an almost supernatural sense of smell that compels him to learn to be a perfumer in order to capture the scents of women he kills. This 1985 novel is a gripping read and a masterwork in describing smells.
When humans are in a state of intense fear, they become hypersensitive to sounds around them. Use this to your advantage. Can’t think of a sound to add to a scene? You’re not thinking hard enough. Get up in the middle of the night and sit in the darkness of your living room. It may seem quiet at first, but the list of sounds will grow once you tune your ear to it. The drone of distant traffic, the hum of the refrigerator, the bones of the house creaking in the wind, the beating of your pulse in your ears. We are almost never in a state of complete silence. Even the sound of a character’s own voice or breath can add sensory detail to a scene. And determining the origin of a sound can even be a source of tension for the character.
Taste is an overlooked sense in writing. It isn't enough to write that a character is eating ice cream. Give us the particular flavor, the colors swirled in the scoop, the smell of the chocolate, or the way it freezes the roof of his mouth and hurts the loose filling in his molar. No food in your story? No problem. There's an old saying that if you can't think of what to write next, describe the inside of a character's mouth. He might have heartburn, lingering coffee breath or a metallic taste on his tongue. What can you taste in your own mouth right now? Write it down.
Remember that children's party game where you put your hand into a box and try to guess what was inside by touch? Okay, so maybe I went to weird parties as a kid. Don't hold back on tactile sensations in your writing. Give us the slipperiness of blood between her fingers, the weight of the knife in her hand, the damp moss against her exposed skin as she lies on the forest floor. Let us feel what she feels and draw us deeper into your story.
Bonus: Internal Sensations
I’ve edited so many horror stories over the last few years that feature a scared protagonist whose heart is pounding. I honestly can’t think of a more trite and—yes, I’ll say it—lazy way to describe fear in a character. Human beings have dozens of physiological reactions to fear. Here's a few examples: dizziness, weakness in the legs, sudden chest pain, holding of breath, muscles tensing, sweating, stuttering, accelerated breathing, blood draining from the face, and even urinating oneself. So stop giving us pounding pulses and thumping ribcages. Get original. And remember not to over do it; two or three physical reactions are usually enough to accomplish what you're going for.
Make sure you use all five senses somewhere during your story, alternate the senses between scenes (we don't need to know how everything smells), and try to connect the sensory comparisons you make to the story itself. This will draw your reader in and allow them to fully experience your story.
Author: Patrick Suskind
Publisher: Vintage (2001)
Binding: Paperback, 255 pages
The Night of the Hunter: A Thriller (A Vintage Movie Classic)
Author: Davis Grubb
Column by Repo Kempt
Repo Kempt has worked as a criminal lawyer in the Canadian Arctic for over ten years. He is the author of a book about seal hunting, a member of the Horror Writers Association, and a guest columnist for the Canadian Broadcasting Corporation. He lives on a cricket farm with his wife, Joy and his little dog, Galactus. In his spare time, he looks for an agent for his latest manuscript.
Follow @repokempt
How NOT to Edit a Shared-World Anthology
5 Story Opening Clichés That Need to Die
What To Do When Your Book Jumps the Shark
An Interview with Author-Editor Dan Coxon
Lost Films Anthology: Embrace the Ugly
10 Things Every Horror Writer Should Read
Tackling the Dreaded Rewrite
The Horror of Roald Dahl
When Horror Meets Crime: Occult Detectives
20 Mistakes I Made Writing that You Should Never Do … But I Would Probably Do Again, If I Started All Over
Column by Jay Wilburn
We Think You'll Like This Class
Lean, Mean Writin' Machine with John Skipp
February 20, 2020 - March 18, 2020
Want your writing to pack punch? Want every word to leave readers gasping for more? Whatever your genre, John Skipp will show you the moves in this intensive four-week training session.
|
cc/2020-05/en_middle_0097.json.gz/line1399805
|
__label__wiki
| 0.744893
| 0.744893
|
The Bones of It, poems by Alice Kinsella
Alice Kinsella is an Irish writer. She holds a BA(hons) in English Literature and Philosophy from TCD. Her poetry has been published internationally in a variety of publications, including Headspace magazine, The Fem literary magazine, Poetry NI Holocaust memorial anthology, Poethead, Icarus, The Galway Review, Poethead, The Sunday Independent, Flare and Skylight47,. She has work forthcoming in Headstuff, Hungry Hill Wild Atlantic Words anthology, The Ofi Press and Boyne Berries.
She has been shortlisted in several competitions including Creative Writing Ink’s poetry competition January 2016, Fourth Annual Bangor Poetry Competition, Hungry Hill Wild Atlantic Words Poetry Competition and Over the Edge new writers competition 2016.
Her first play ‘The Passing’ debuted as a part of What’s the Story at the Liberties Festival, it then went on to be staged at Cruthú Arts Festival and Templebar Arts and Culture Festival.
© Alice Kinsella
|
cc/2020-05/en_middle_0097.json.gz/line1399808
|
__label__wiki
| 0.75718
| 0.75718
|
Michael and Sally Grayson with Jazz, Isla, Luca and Dominic at a candlelight vigil outside the Coles shopping centre in Nambour for the little girl killed in Sunday’s tragedy. Picture: AAP Image/Josh Woning
Close-knit locals bond in the face of horror
by DOT WHITTINGTON
18th Jun 2018 12:22 PM
NAMBOUR, in the Sunshine Coast hinterland, is one of those good old-fashioned country towns and it has held that reputation since its beginning in the 19th century.
The town was built around its sugar mill, which was the lifeblood of the town for more than 100 years. And for almost the same number of years, it was the economic and administrative capital of the Sunshine Coast.
But most of all, it's been a town about community, where sporting, charity and business support groups have flourished and active memberships have always been ready to put their hand up to help.
Even after the area boomed and the population doubled, Nambour still lived up to its 1960s slogan, "The Friendly Town".
That same spirit shone yesterday when a little girl was fatally injured in front of shoppers at the Coles shopping precinct, which was built on the site of the old sugar mill after its demolition in 2006.
A candlelight vigil outside a Coles shopping centre in Nambour. Picture: AAP Image/Josh Woning
Within hours, Nambour had rallied. Proud residents who keep in touch through the social media group Living in Nambour, were shocked as news spread that tragedy had visited their town on a quiet Sunday at the close of the Show Holiday long weekend.
And the support began flowing, with offers to cook meals, visit or deliver help of any kind. There were also pleas to spare a thought for the car's driver, surely a grandmother who would be struggling in the aftermath.
A candlelight vigil was organised for 6pm - and if you could not make it, then it was suggested you leave your outside light on as a mark of respect.
Despite the horror that had come to their pleasant country town, residents proved they were solid: "As a community, we are grieving," they said.
premium_icon 'My little princess': Family mourns daughter's death
Locals rally behind family of girl, 6, killed in carpark
premium_icon Tiny victim of shopping centre car park tragedy
premium_icon 'Heartbroken' town honour tiny victim of carpark tragedy
carpark coles nambour tragedy
|
cc/2020-05/en_middle_0097.json.gz/line1399809
|
__label__wiki
| 0.825162
| 0.825162
|
NHL Odds: Canucks vs. Kings
If Final Four odds have had you busy over the last couple of weeks, the NHL playoffs haven't started yet, but they're close, and there's a possible first-round preview on deck on Thursday as Vancouver heads to Los Angeles.
Canucks vs Kings odds – Thursday, April 1, 10:30 PM ET
Henrik Sedin led the way with three points in a 4-1 win at home over Phoenix on Tuesday, and he now leads the NHL in points with 104, three more than Washington's Alex Ovchekin. Brother Daniel also scored, along with linemate Alex Burrows and Mason Raymond, while Roberto Luongo stopped 33 shots for the Canucks, who sit in third place in the Western Conference and are on the verge of clinching the Northwest for the third time in four seasons. The emergence of the Sedin twins is something that hockey betting players didn't see coming, as we always knew they were solid players, but without the explosiveness they've shown this year. They have also improved immensely on the defensive end.
The Kings blanked Nashville 2-0 on the road on Tuesday, as Jonathan Bernier stopped 34 shots for the first shutout of his NHL career. Scott Parse and Sean O'Donnell lit the lamp in the third period for the Kings, who currently sit in seventh in the West, just one point behind Detroit and two points behind Nashville, and if the Sedin twins' breakout year was a surprise, the Kings making the playoffs is absolutely mind-boggling. Everyone knew that the Kings had a solid young foundation that would eventually come on, but not this year.
Sportsbook odds should favor the Kings at home, where they are 21-13-3, but the Canucks have won three of their last four in the City of Angels. The Canucks have also won five in a row overall against the Kings, including all three meetings this season, and the line of the Sedins and Burrows have combined for nine points, while Luongo has two wins and a 1.00 GAA. The Kings have managed just three goals against the Canucks, and they need to find a way to solve the Canucks' defense, which has some injuries heading into the postseason. The win in Nashville snapped a four-game skid for the Kings, and two of those came by a one-goal margin, so it's not like they are getting blown out. The Kings have a lot of players that are just figuring out how to navigate the stretch run into the playoffs, and they should be solid enough at home to avoid the season sweep at the hands of the Canucks. Take the Los Angeles Kings on Thursday before making some March Madness picks.
Free Picks: Knicks vs. Blazers
Hotter than Heather McComb, Mindy Lawton, and even Sandra Bullock is super sports handicapper Matt Rivers says take the Knicks plus the number. They are getting 11 at Portland according to BetUs
Mike D'Antoni's Knicks are obviously going nowhere at all and are looking towards the offseason and the LeBron sweepstakes. But the New Yorkers do have some talent and pretty much when getting around double digits are a must play.
The Knicks were outplayed in Utah in that last game but still did enough to cover the contest in the end. David Lee is a stud and guys like McGrady, Gallinari, Chandler and Harrington can hold their own against any team anywhere.
Portland is a very solid team that at the Rose Garden should win this game led by a superstar in Brandon Roy and a a budding star in LaMarcus Aldridge. But with that said these Blazers are coming off of that upset win in Oklahoma City and after winning three straight and 8 of their last 9 could slip up a bit here. A few weeks back they were a similar home chalk against the dreadful Wizards and managed to pull that thing out, 76-74.
Portland is still a very young team that cannot be fully trusted. Andre Miller is a veteran point guard that has shown leadership but pretty much everybody else is young forming a quality team but one that has the potential to slip up in this big favorite type spot. These guys have risen up very nicely on the road of late and in games against high quality competition. Neither of those scenarios fit in this thing and in the end look for the Knickerbockers to steal the cash again in a game when the number is just a bit too steep.
Free pick: New York at SportsBook
For more information: 200,000* North Carolina came through last night in overtime and I have a winner doubly as strong here in the NBA. This thing will not need an extra session as I'm sweeping the board today. 400,000* NBA Game of the Month on Phoenix-New Jersey and a 100,000* Washington-New Orleans. 500,000* of profit as I prove to be the best there is on this planet once again. Click now to purchase
Posted by Critical Sports Betting Info at 12:03 PM
NBA Odds: Lakers vs. Hawks
If Final Four odds have taken your attention away from the professional game, you may have missed the resurgence of the Los Angeles Lakers, who have led the Western Conference for the entire season, but their form was shaky coming out of the break. Despite a loss on Monday, the Lakers are still in good shape as they wrap up a five-game swing through the southern states in Atlanta, where the Hawks have been waiting since Sunday.
Lakers vs Hawks odds – Wednesday, March 31, 7:00 PM ET
The Lakers fell 108-100 in New Orleans on Monday, despite 31 points from Kobe Bryant. Pau Gasol was a monster in this game, going for 26 points and 22 rebounds, but the Lakers shot 7-of-29 from three-point land, and 41.7% from the floor as a whole unit. If the Lakers have a true weakness for online sportsbook players to pick at, it's point guard: Derek Fisher, Jordan Farmar and Shannon Brown combined for 17 points and five assists, while their counterparts in New Orleans, Chris Paul and Darren Collison, had 32 points and 16 assists. How much longer can the Lakers survive without a true point guard?
The Hawks won their eighth consecutive home game with a 94-84 victory over Indiana on Tuesday, and the duo of Josh Smith and Al Horford was just too much for the Pacers as they notched 39 points and 25 rebounds between them. Jamal Crawford also added 17 points off the bench for the Hawks, who outrebounded the Pacers 53-39, including 14-9 on the offensive end, and they outscored the Pacers by 10 in the paint, which was the difference in this basketball betting win.
The Hawks will be the favorites at home, as they've been good at Phillips Arena all season, and we mentioned before, they've won eight in a row at home. The Lakers have dropped four of their last six in Atlanta, including two in a row, and the Hawks will be out to avenge a 118-110 loss in Los Angeles on November 1st, when Bryant lit them up for 41 points. The Hawks are a much more cohesive unit now, and with Andrew Bynum still out (he scored 21 points in the first meeting), the Hawks match up better with the Lakers in the post with Horford and Smith. Atlanta is looking to move past Boston, at least, in the East pecking order, and a win over the Lakers would turn some heads. As for the Lakers, a loss won't be the end of the world as they know what they have already, but they have to work the ball around more: they are 3-5 when Bryant takes 30 or more shots, and 25-9 when he takes 20-29 shots.
Sports betting pick: Atlanta
Free Picks Hotter Than Kiana Kim
It's almost baseball season and OffshoreInsiders.com previews who will win the NLCS, the 2010 Masters preview from a betting odds standpoint is garnering interest and more free pick winners are up for today from services hotter than Kiana Kim.
Matt Rivers, who was the winningest handicapper ever—nobody came close—on a large network of sites has a free pick on Dayton in the NIT.
I love the way the Flyers have been playing of late and even though Ole Miss is probably the bigger program from the bigger conference I can't help but back the boys from the Atlantic 10 here up North at Madison Square Garden.
The regular season finish was not all that strong for Brian Gregory's boys but this team has caught fire in the NIT and to make things harder they have been looking great on the road. Dayton just pounded Illinois in Champagne and that came two days after pummeling Cincinnati on the road, 81-66. Chris Wright and Chris Johnson are semi studs to go along with solid helpers in Rob Lowery and Marcus Johnson and these guys are up against a good team but not a great team by any means.
I like Andy Kennedy and the Rebels are solid as Chris Warren has the potential to be a game changing stud. But Ole Miss won all three of their NIT games in the comforts of their own home gym and now have to step out a bit and enter the bright lights of the big city and some possible adversity. Let's not forget the issues that Kennedy had with the cab driver along with the comments from his wife about not being able to get it up. I'm not saying that will really make a difference here but New Yorkers can be cruel and have a little fun with that for sure.
Mississippi can win this game as Warren, Polynice, Holloway, White and Graham are very good but I don't think they are able to win it half the time as this near pick-em suggests. Ole Miss. is just not primed and ready for the road the way Dayton is right now.
The Flyers are reminding me of last season's Baylor Bears in this tournament. Scott Drew's team played one game after the other on the highway and it helped build up a ton of confidence going into the world's most famous arena.
This is going to be a tight game that should finish in single digits but it'll be the Flyers who are the more prepared team for a spot such as this one.
For more information: I feel really good, despite the recent slump, and am ready to get back after it with a vengeance today. My NBA 300,000* Game of the Year plays are a rock solid 4-1 this season and ready to improve to 5-1. 300,000* Oklahoma City-Philadelphia plus 200,000* North Carolina-Rhode Island. Click now to purchase Matt Rivers.
Baseball Handicapper Previews National League Contenders
OffshoreInsiders.com columnist Shea Matthews takes a look at the best bets for NLCS champions.
Hard to believe MLB betting is almost back already. Now is arguably the best time to bet on futures for league crowns. Why? Because, if you think you have good inside knowledge, you can get major value on your bets. For example, if you bet on the Tampa Bay Rays' futures in 2008, you made out like a bandit.
Here are some picks to consider for the National League pennant.
Odds to win: +300
The Phillies remain as good a pick as any to win not just the NLCS, but the World Series. They have a dynamite one-two punch in Roy Halladay and Cole Hamels to lead their pitching staff. Halladay could win 25 games for all we know in his NL debut and Hamels was very unlucky last season according to his peripheral stats (like batting average on balls in play). Philly also has the National League's best offense by a mile; it had four players hit 30 or more homers last season. Sports betting picks don't get much safer than these guys.
If Chris Carpenter stays healthy for a second straight year, the Cards will seriously contend again. He joins Adam Wainwright to form an elite top of the rotation. Albert Pujols is the best hitter of the last decade (at least) and should be even more dangerous than usual with a full season of Matt Holliday distracting pitchers in the lineup. The Cardinals' lack of depth in the rotation is a minor concern, however.
Here I was ready to label the Braves my favorite "sleeper" and, as it turns out, the secret is out in books like Bodog. Everyone sees that the Braves' pitching staff is starting to resemble its 1990s heyday, with Tommy Hanson, Jair Jurrjens, Derek Lowe and Tim Hudson on board. If they can score enough, they'll contend.
These guys have plenty of power with the likes of Tulowitzki, Stewart, Gonzalez and Hawpe on board – not to mention a park that boosts offense. But it's the pitching that makes Colorado so intriguing. Ubaldo Jimenez is ready to become a bona fide ace thanks to his blazing fastball – the fastest on average of any major-league starter.
Odds to win: +1000
The Giants arguably have the National League's best "top four" in a pitching rotation, with two Cy Young candidates (Tim Lincecum, Matt Cain), a cagey vet (Barry Zito) and a budding strikeout artist (Jonathan Sanchez). If only Pablo Sandoval had more help on offense.
It's not a question of talent; from Dan Haren to Justin Upton to Mark Reynolds to Miguel Montero, this team has it in spades. It's a question of health and maturity. If Brandon Webb returns in style and the likes of Stephen Drew and Chris Young find their swings, watch out for the D-backs.
Shhh! Here's your deep sleeper courtesy of your favorite sports betting blog. Cincy should score enough; Joey Votto is developing into a star and Jay Bruce will show major power if he plays a full season. The key is the pitching, which could be the Reds' best in years if Aroldis Chapman can find a rotation spot and Homer Bailey finally harnesses his talent.
I think their reign is over. The rotation is very thin after Clayton Kershaw and Chad Billingsley – and Billingsley isn't even guaranteed to rediscover his control after struggling in the second half of 2009. Matt Kemp and Andre Ethier will keep driving in runs but Manny Ramirez is on the decline, Rafael Furcal is brittle and Russell Martin disappeared last season. Not a recipe for a pennant.
Bay Schmay. Snagging the star outfielder from Boston won't be enough. Other key contributors like Jose Reyes and Carlos Beltran, are already hurt as usual and Johan Santana can't pitch every game. The rest of the Mets' pitching staff is shaky at best.
Free pick: Philadelphia Phillies. Sure, it's boring, but there's no denying that the Phillies are head and shoulders above the rest of the National League.
Suns-Bulls NBA Odds Preview
Phoenix Suns (47-26) vs Chicago Bulls (36-34)
Sports Betting enthusiasts will know that the Suns are heading to Chicago on a seven-game winning streak and have moved to within striking distance of a home-court playoff position.
Chicago has won four of five however the wins were against Houston that sits at .500 and Philadelphia, Detroit and New Jersey that are a combined 103 games below .500. The Bulls have only won four of their last 15 games and have not beaten a team with a winning record since Portland on February 26. The Bulls are a half-game back of Toronto for eighth spot in the East and are looking to leapfrog them into a playoff spot with a win.
Primetime Performers
Bulls: With March Madness Odds gearing up for the April 3 Final-Four, a former finalist in Derrick Rose will lead Chicago in the same manner that he led the Memphis Tigers. This Bulls team however is struggling to make the playoffs let alone a finals appearance. Averaging about 20 points and 6 assists a game; Rose is the unquestioned leader of this team and will get a lot of touches against a banged up Steve Nash.
Suns: Amar'e Stoudemire is coming off a huge 30-point, 17-rebound game on Sunday and could have another big performance as when he hits the court against the inexperienced Bulls frontcourt. The 6'10" forward has scored over 30 in seven games this month and has been held under 20 on only three occasions since January. In the one game against Chicago this year he led the team with 23 in a losing effort.
X-Factors
Bulls: online betting experts know that it will be up to Taj Gibson to slow down Stoudemire; a tall order for a rookie forward. In his only game against the five-time All-Star, Gibson was held to just six points however he was able to gather eight boards and three blocks in the win. He will need more of the same if the Bulls are going to pull out this much needed win.
Suns: Steve Nash is battling a back injury but is still one of the best point guards in the NBA. With 16.6 points a game while shooting over 50 percent and being the only player in the league with over 11 assists per contest, Nash is always finding his teammates in a position to score. After having an off night, only eight points and seven assists, in the last meeting with Chicago, Nash will need to bring a better effort against one of the league's best young point-guards.
The Matchup
An experienced sportsbook handicapper will know that in their last two home-games the Bulls have won by 23 over New Jersey and lost by 29 to Miami; not the level of consistency that is needed to push for a playoff spot. The Suns have won eight of 10 on the road but dropped a 115-104 decision to the Bulls back in January; still the Suns should win this game easily.
Pick: Suns
Free NBA Picks, Final 4 Spread Preview, Tiger Woods Tops Masters Odds
It's a great week for sports betting. The official betting previews are up for MSU vs. Butler, the 2010 Masters odds where a fellow by the name of Tiger Woods returns. Also Monday NBA Odds picks from ScoresOddsPicks and the real Matt Rivers are up for the Denver Nuggets at Dallas Mavericks and San Antonio Spurs at New Jersey Nets in the popular free pick section of OffshoreInsiders.com.
Courtesy of OddsShark.com: Today in the Daily Sports Roundup: The Bruins play host to the Sabres, while the Spurs meet the lowly Nets, and the Lakers search for a road win in New Orleans.
Tipping off on the hardwood . . .
The NBA offers up five games Monday, with Toronto at Charlotte, San Antonio at New Jersey, Denver at Dallas, New York at Utah, and the Lakers at New Orleans. The Hornets will be looking to bounce back from a 112-101 home loss to the Trail Blazers on Saturday night.
Darren Collison led New Orleans with 22 points off the bench in that defeat, while Chris Paul was held to seven points. The Lakers picked up a road win in Houston on Saturday night, winning 109-101 behind 30 points from Pau Gasol. Kobe Bryant poured in 17 points in the contest.
As well, there's one college basketball game on the schedule for Monday, with Saint Louis taking on Virginia Commonwealth in the first game of the best-of-three CBI championship series.
Saint Louis topped Princeton 69-59 in their semifinal matchup last week, while VCU is coming off an 88-75 win over Boston University. VCU is listed as the 9.5-point favorite for Monday, with a total of 131.
Taking a trip around the rink . . .
Finally, there are five games on the National Hockey League's schedule for Monday, with Carolina at Atlanta, Nashville at Florida, Los Angeles at Minnesota, Dallas at Anaheim, and Buffalo at Boston. The Sabres throttled the Lightning in their last game on Saturday night, winning 7-1 at home behind a hat trick from Derek Roy. Jason Pominville picked up three points in the win. The Bruins blanked the Flames 5-0 in their Saturday afternoon outing, with Tim Thomas making 31 saves. Patrice Bergeron had a goal and an assist in Saturday's victory.
Among the sports betting picks for tonight is the King of Offshore, Stevie Vincent. Sick and tired of losing on your own yet? Join the club—the Inner Circle Club that is. The King of Offshore has an Inner Circle Club burial tonight in pro basketball. It's a side. Pro basketball Inner Circle Club plays are 19-4 with sides. Also get the CBI Tourney over/under, a Level 4 lock. Click now to purchase
Monday Free Picks; 2010 Masters Odds
It's a big sports betting Monday, so no need to simply start focusing on Final 4 odds, though Michigan State vs. Butler certainly has top sports handicappers salivating.
Top sports service site OffshoreInsiders.com has two free winners for Monday. The first comes from ScoresOddsPicks.
Denver Nuggets at Dallas Mavericks (-5.5) – Monday at 8:30 p.m. ET
Dallas (48-25, 29-42-2 ATS) has won two of its last three outings, including a 111-90 win at Golden State. The Mavericks haven't played especially well over the past few weeks, though, after winning just three of their last seven games. Dallas has essentially been a disaster at the sportsbook during that span; the Mavs are 1-6-1 in their last eight games on NBA odds, and the Golden State game was the first time they covered since March 8. The Mavericks are a pitiful 1-7-2 ATS in their last 10 games in Dallas.
Denver (48-26, 31-37-6 ATS) is also playing poorly. After Sunday's 103-97 loss to the Magic, the Nuggets have just one victory in their last five outings (four of those games took place on the road). Like Dallas, Denver has struggled to get the job done for sports betting fans. The Nuggets have failed to cover once in eight consecutive games, though they managed to get a push against Orlando. Playing in Dallas will be tough since Denver owns a 0-4-1 ATS record in its last five games away from home.
Both teams are playing lousy, but Denver has generally dominated this series (8-2 SU, 7-2-1 ATS in past 10 meetings). This is the perfect time for the Nuggets to get back on track.
Pick: Denver
Now to Matt Rivers, who was the winningest handicapper ever—nobody came close—on a large network of sites.
San Antonio Spurs (-8) at New Jersey Nets – Monday at 7:35 ET
Rivers sports betting pick says take Nets plus the number. They are getting eight points at home to San Antonio.
Sure I'll back the Nets in this spot as the solid home dog.
I certainly don't think New Jersey is exactly good but I also don't think they are as dreadful as that pathetic record indicates. Brook Lopez and Devin Harris are studs and Kiki Vandeweghe's team did just win two in a row at home before running out of gas in Chicago on Saturday night on that back-to-back and third game in four days.
Tonight though the shoe is on the other foot as the Nets host a San Antonio squad that just played a tough game in Boston last night and is traveling to the swamps to play a second straight day. It's also fairly easy for the Spurs to take a collective deep breath and say oh we're only playing the 9 win Nets today and have a bit of a letdown after that grudge match in Beantown last night with the Celtics.
Tony Parker is still out injured and Tim Duncan and Manu Ginobili are no longer young and spry and could be a step slow today in this situation.
New Jersey still needs one more victory in order to avoid tying that 76er team for the most losses in a season with 73 so the home boys should still feel motivated to not be honored with that dubious distinction.
The Spurs need every victory to assure themselves of a playoff spot with the way things are out west and probably are too good to not win this game. But San Antonio is not in a good spot to just lace em up and smack New Jersey here as the dreaded road chalk.
I fully expect Harris and Lopez along with Lee and Humphries and Yi and a few others to look alright tonight and be in this thing until the end. Who knows? Maybe even this fresher home dog will bark in the end and grab that elusive 10th victory.
Sportsbook spread pick: New Jersey +8 at BetUs
In other news, the 2010 Masters betting lines have Tiger Woods as the favorite. Here are the top contenders:
Padraig Harrington
Geoff Ogilvy
Jim Furyk
Complete odds at any top sportsbook.
West Virginia vs. Duke Spread; 2010 Final 4 Men's Basketball Odds
The West Virginia-Duke line for the 2010 will be Duke -4.5 according to Leo Shafto of BetUs. Butler versus Michigan State has Butler -1.5 with a total of 126.
For picks: Stevie Vincent is literally 20-25 years ahead of the oddsmakers and they will be the first to admit. His forensic sports handicapping is groundbreaking and there is nothing the books have been able to do to stop him.
MSU Basketball the Underdog To Butler in Final 4 Spreads Vegas
Butler has been bet up to a 1.5 point favorite over Michigan State at the sportsbooks Bodog has the total at 126. For the 2010 Final 4, Butler is -130 on the money line according to top sports handicappers
2010 Final Four Odds: Butler vs. Michigan State
The top sports handicapper website OffshoreInsiders.com asked legendary oddsmaker Leo Shafto of BetUs for his projections for the 2010 Final 4 odds.
The Butler vs. Michigan State line is expected to be a pick, according to the sportsbook guru.
The college basketball matchups for the men's basketball NCAA Tournament semi-finals from Indianapolis will be posted Monday.
Sharp bettors will keep an eye on Stevie Vincent's picks, especially the over/under. He is accepted at the top totals handicapper against the NCAA Basketball Odds
Rest assured for those bettors who only purchase Stevie Vincent when he has Level 5 plays, you are doing yourself a gross disservice. Flat out his Level 2, 3 and 4 plays always have and always will win at a much higher rate than Game of the Month or Game of the Year plays elsewhere. He is part of OffshoreInsiders.com
Shafto says that West Virginia will be getting four to five points if they play Duke or it will be pick 'em to WVU -1 if the Mountaineers play Baylor.
Also for betting picks, because the Power of 620 sports services behind every selection, the MasterLockLine monitors each and every one of the nation's top sports service, handicappers, tip sheets and syndicates, you will get every Game of the Year play worth betting. Every last one in the industry is yours. That's why you get more legitimate service Games of the Year on the MasterLockLine than anyone else.
CBI Tournament Championship Series Game 1 between St. Louis vs. Virginia Commonwealth has VCU -1. They are the host if the first of this best-of-three series.
Final 4 Pointspreads 2010: Butler, West Virginia In
It's time to start looking at the 2010 Final 4 picks and point spreads.
The madness continues in the NCAA Tournament as No. 6 West Virginia toppled No. 2 Kentucky 73-66 in the East Regional final Saturday to advance to its first Final Four since 1959. For Mountaineers coach Bob Huggins, this is his first ticket to the Final Four since taking Cincinnati in 1992.
"The first day I was here, I told them I came back to win a national championship," Huggins said. "I came back to win it for the university, having played there, and for the great people of our state."
West Virginia won the game as 4-point underdogs, and the 139 points made it OVER the posted total of 134 and will play the winner of Sunday's Baylor-Duke matchup.
Get your NCAA Basketball Odds at Bodog.
Butler Bulldogs 63, Kansas State Wildcats 56
And in other news, Butler beat Kansas State 63-56 in the West Regional final Saturday and advance to the Final Four. The Bulldogs will be the first team to play in a Final Four in its hometown since UCLA in 1972. (Gordon Hayward had 22 points and Shelvin Mack added 16 points and seven rebounds for Butler.)
Butler won the game as 4-point underdogs, while the teams played UNDER the posted total of 134.5 and will play the winner of Sunday's Michigan State-Tennessee game.
For more information: Get breakdowns used by covers experts to beat the scores and odds at BetUs and Bodog check out the OffshoreInsiders.com Network.
March Madness: NCAA Basketball Spreads Preview Tennessee vs. Michigan State
Sharps are winning, squares are hurting in betting the NCAA basketball odds. Luckily Bodog continues to pay pro bettors on time. They take a look at Michigan State vs. Tennesse.
If you had No. 6 Tennessee facing No. 5 Michigan State facing off in the Midwest Region final, well, you are a much smarter person than I am. Certainly Sunday's game in St. Louis is the most unlikely of the four matchups for spots in the Final Four this weekend, with the Vols opening as 2-point favorites on Bodog's NCAA Basketball Odds
Many so-called experts expected Michigan State (27-8, 14-20 ATS) to lose to Northern Iowa on Friday night as the Spartans played their first game of the tournament without injured star point guard Kalin Lucas, who is done for the year. But Lucas' replacement, Korie Lucious, was excellent in the 59-52 win against UNI with 10 points (including a key late score), six rebounds, four assists and four steals. MSU's calling card under Coach Tom Izzo is rebounding and defense, and the Spartans killed Northern Iowa on the boards, 31-20, and held the Panthers to no field goals in the game's final 10-plus minutes Friday. This will be the seventh regional final for Sparty under Izzo, and his teams are 5-1 in the previous six.
Tennessee is in its first Elite Eight after upsetting Ohio State, 76-73 on Friday night. Wayne Chism was the star for the Vols with 22 points and 11 rebounds. Remember that the Vols are accomplishing all this without Tyler Smith, who was regarded as the team's best player but was kicked off the team earlier this season following an arrest. UT is certainly no fluke, having now beaten conference champions Ohio State, Kansas and Kentucky this year.
This game could well come down to which team wins the battle of the glass, as the Vols dominated Ohio State in rebounding and are plus-6.3 in rebounding margin in this tournament, but Michigan State is arguably the nation's best rebounding team. No doubt UT will try and pressure MSU whenever it can, especially with Lucas not on the floor. It's almost too bad that Michigan State wasn't ranked in the Top 5 of the final polls of the regular season, because the Vols have won four of their past six against Top 5 teams. Look for this to be a fairly low-scoring physical game. These two haven't met since 1994.
Top expert pick on this game is from Power of 620 sports services behind every selection, the MasterLockLine. They've tapped a service out of Philadelphia that is No. 1 this year and now the last two years combined in college and NBA. His biggest plays are Stone Cold Locks. He's now hit five straight and 8-of-10 in college basketball including West Virginia Saturday. You know it's legit because you got it right here. Stone Cold Lock Tennessee vs. Michigan State. Click now to purchase or for more information and a free pick
NBA Spreads
The latest NYS unemployment stats are miserable. Then again, why is New York State Department of Labor different than the rest of America? Need good economic news? The sportsbooks are paying on-time and paying big time to pro bettors. It's been fantastic for pro gamblers and horrid for squares in March Madness betting.
In the middle of March Madness NCAA Basketball Odds, one of the top sports handicapper experts OffshoreInsiders.com Senior Handicapper Matt Rivers says take the Detroit Pistons at home against Chicago.
There is no debating that the Pistons are an absolute debacle of a team right now. This franchise has gone from a great one to a pathetic one in pretty much no time at all but it's not like these Bulls are much of anything themselves these days.
The Pistons are at home and should win this game. They are the fresher team as da Bulls just had to bang with the Nets on Saturday night and then travel here to MoTown for this back-to-back. Detroit also has a guy named Ben Gordon who would like nothing better than shoving it up his former team's butts. Gordon has not had the kind of season that he would have liked but the guy is still very capable when motivated.
Chicago just had that 10 game losing streak and is flat out a terrible basketball team right now. Their talent level is just not that high with Luol Deng banged up and even though the Pistons stink Detroit still at least has guys that should be good in Hamilton, Prince, Stuckey, Maxiell, Villaneuva and a few others.
The Bulls have won all three meetings this season and I just can't see four for four from a bad team.
This is far from the lock of my life but at home and being the fresher and more talented team I can't help but make a small play on the Pistons. The Bulls stink, have stunk and will stink one more time.
The pick: Detroit -2 at Bodog
For more information: I have not lived up to my expectations these last two days and I am man enough to admit just that. I'm still up 1.85 million* of profit over the past 31 days including a 34-25-1 run and 15 of 26 winning days. I will get right back on that horse today and prove that I am the best there is with a 2-0 Sunday sweep. 400,000* Absolute No-Brainer on Tennessee-Michigan State as I improve to 5-1 with these 400,000* plays and a 100,000* bonus play on Duke-Baylor. Click now to purchase Matt Rivers
NCAA Tournament Tops Sunday Odds
Courtesy of OddsShark.com: Today in the Daily Sports Roundup: The Sprint Cup Series hits Martinsville, while the Nuggets meet the Magic, and March Madness wraps up its second weekend.
The NASCAR odds Jimmie Johnson at +225 to win the entire Sprint Car Series and he's the heavy favorite to win any of the Goodys Fast Pain Relief 500.
Tipping off on the hardwood . . .
The NBA has 10 games on its schedule for Sunday, with Sacramento at Cleveland, Memphis at Milwaukee, Indiana at Atlanta, Toronto at Miami, Chicago at Detroit, Phoenix at Minnesota, Portland at Oklahoma City, San Antonio at Boston, Golden State at the Clippers, and Denver at Orlando. The Nuggets and Magic met in Denver back on January 13, with Carmelo Anthony and company rolling to a 115-97 home win as a 6-point favorite. Anthony led the way with 27 points in that win for Denver, while Chauncey Billups was good for 24 points on the day. Matt Barnes scored a game-high 28 points in a losing cause for Orlando.
The biggest sports service picks are from GodsTips. The Lord of the Dance has our first side in the Big Dance since Friday night when Baylor as our Game of the Year was an easy winner. We also nailed Duke Today it's Baylor against Duke and we have that side as well as well as the Michigan State-Tennesee. Also, on an 18-7 tear in the NBA, we have an NBA Wise Guy and two Majors Click now to purchase
As well, the NCAA Tournament clears up its Final Four picture on Sunday with its last two Elite Eight matchups: No. 6 Tennessee vs. No. 5 Michigan State in the Midwest Region, and No. 3 Baylor vs. No. 1 Duke in the South Region. Duke, which cruised past Purdue 70-57 in the Sweet 16 on Friday, is pegged as the 4.5-point favorite at Houston's Reliant Stadium on Sunday. Baylor beat St. Mary's 72-49 in their Friday outing. Over at St. Louis' Edward Jones Dome the Spartans knocked off Cinderella Northern Iowa 59-52 in the Sweet 16, while Tennessee got past Ohio State by a final score of 76-73 last round. The oddsmakers at BetUs are going with the Volunteers for Sunday, as they're 2-point faves.
Taking a trip around the rink . . .
The National Hockey League has six games on tap for Sunday, with Calgary at Washington, Toronto at Pittsburgh, Edmonton at St. Louis, New Jersey at Philadelphia, Colorado at San Jose, and Columbus at Chicago. The Blackhawks will be looking to bounce back from the 8-3 pounding they took from the Blue Jackets on the road on Thursday night; Hawks netminder Cristobal Huet was yanked after allowing seven goals on 27 shots in that defeat. Kristian Huselius and Antoine Vermette each picked up a pair of goals in that victory for Columbus.
Roaring around the track . . .
Finally, race fans get two events on Sunday, as the Sprint Cup Series stages the Goody's Fast Pain Relief 500 at Martinsville Speedway and Formula 1 offers up the Australian Grand Prix. Jimmie Johnson, who has won three of the five Sprint Cup events so far this season, is pegged as the 9/4 Vegas favorite to visit victory lane at Martinsville, with Jeff Gordon (51/10) and Denny Hamlin (7/1) behind him on that odds list. Tony Stewart (17/2) and Kevin Harvick (11/1) round out the top tier of contenders. Meanwhile, Fernando Alonso will be gunning for his second straight win in the F1 race; Alonso won the season opener in Bahrain March 14, and he's at 5/2 to get the win on Sunday. Sebastian Vettel sits at 2/1 odds to win.
NCAA: Baylor Bears vs. Duke Blue Devils
The Baylor Bears and the Duke Blue Devils will both be gunning for a victory on Sunday when they meet at Reliant Stadium.
Oddsmakers currently have the Blue Devils listed as 5-point favorites versus the Bears, while the game's total is sitting at 139.
Baylor advanced to the Elite Eight on Friday with a convincing 72-49 victory over St. Mary's. Baylor covered the 5-point spread, while the teams played UNDER the posted total of 141.5.
LaceDarius Dunn netted 23 points to lead Baylor, and Tweety Carter had 14 points in the win.
Kyle Singler poured in 24 points and grabbed eight rebounds as Duke defeated Purdue 70-57 on Friday in the Sweet 16. Duke covered the 8.5-point spread, while the 127 points went UNDER the posted total of 127.5.
Jon Scheyer netted 18 points for Duke and Nolan Smith added 15 in the win.
Baylor has won 3 straight games.
Duke has won 7 straight games.
Baylor: 28-7 SU, 18-10 ATS
Duke: 32-5 SU, 21-14-1 ATS
Baylor most recently:
Duke most recently:
After playing Purdue are 1-1
Baylor is 8-1 SU in its last 9 games
Duke is 5-0 SU in its last 5 games
NCAA: Tennessee Volunteers vs. Michigan State Spartans
- The Tennessee Volunteers and the Michigan State Spartans will both be trying to pick up a win on Sunday when they battle at Edward Jones Dome.
Oddsmakers currently have the Volunteers listed as 2-point favorites versus the Spartans, while the game's total is sitting at 137.
Tennessee roared back and came away with a 76-73 victory over Ohio State on in the Sweet 16 on Friday. Tennessee won the game as 4.5-point underdogs, while the 149 points sailed OVER the posted total of 137.
Wayne Chism collected 22 points and 11 rebounds for a double-double in leading Tennessee.
Michigan State roared back in the second half and defeated Northern Iowa 59-52 in the Sweet 16 on Friday. Michigan State won the game as a pick'em, while the 111 points went UNDER the posted total of 121.5.
Durrell Summers led the way with 19 points and seven rebounds.
Michigan State has won 3 straight games.
Tennessee: 28-8 SU, 15-16-2 ATS
Michigan State: 27-8 SU, 14-20 ATS
After playing Ohio State are 0-2
Michigan State most recently:
Michigan State is 6-1 SU in its last 7 games
Bet the NCAA Tournament via one of our highly vetted sportsbooks. Among the highest rated: BetUs, SportsBook, and Bodog
The sports handicapping services menu for: Sunday, March 28, 2010
Forensic Sports Handicapper Stevie Vincent
Groundbreaking founder of forensic sports handicapping
11-5 RECENT BLITZ; PRO BASKETBALL SIDE NCAAB TOTAL BOTH LEVEL 5
The founder of forensic sports handicapping is on a recent 11-5 run. That's good for most, a bit subpar for him, but he will improve on that winning mark. Get a Level 5 O/U on Baylor/Duke and an NBA Level 5 side. Click now to purchase
Joe Duffy's GodsTips Sports Handicapping Service
Scorephone legend for decades; now CEO of No.1 handicapping website
DUKE VS. BAYLOR SIDE
The Lord of the Dance has our first side in the Big Dance since Friday night when Baylor as our Game of the Year was an easy winner. We also nailed Duke Today it's Baylor against Duke and we have that side as well. Click now to purchase
MATT RIVERS SPORTS BETTING
Winningest all-time handicapper on a large network of sites
500,000* OF PROFIT ARE HERE AS I MUST HAVE THIS DAY, MUST!
I have not lived up to my expectations these last two days and I am man enough to admit just that. I'm still up 1.85 million* of profit over the past 31 days including a 34-25-1 run and 15 of 26 winning days. I will get right back on that horse today and prove that I am the best there is with a 2-0 Sunday sweep. 400,000* Absolute No-Brainer on Tennessee-Michigan State as I improve to 5-1 with these 400,000* plays and a 100,000* bonus play on Duke-Baylor. Click now to purchase
UNIVERSAL PASS: Get total access to the "Bet It Trinity": Stevie Vincent's BetOnSports360.com, MasterLockLine.com, and Joe Duffy's GodsTips.com Get it now Click now to purchase this sensational package
First time purchaser: you are AUTOMATICALLY logged in once you buy. You can access immediately. Returning clients, please log in first to avoid duplicate accounts. Password or purchase problems (AOL browsers especially), check out our tips on how smooth the process is.
Elite 8 Bracket: NCAA Tournament Odds Are Set, Kentucky vs. West Virginia
The Elite 8 2010 is set and the NCAA Tournament brackets updates. The top sports handicappers are winning at a rate faster than the GMP Diecast.
Only one region in this year's NCAA Tournament has gone chalk and that's the East, where No. 1 Kentucky will face No. 2 West Virginia on Saturday night in Syracuse for a trip to the Final Four. UK has opened as a 4-point favorite on Bodog's NCAA Basketball Odds.
Other than a bit of a slow start, Kentucky (35-2, 20-15 ATS) didn't have much trouble with Cornell on Thursday night in a 62-45 victory. The Cats have yet to have a game this tournament that was decided by less than the 17 points they beat Cornell by. Kentucky hasn't been in the Final Four since winning its last national title in 1998.
West Virginia (30-6, 16-19 ATS) didn't miss injured starting point guard Darryl "Truck" Bryant too much in its 69-56 over Washington on Thursday (it will Saturday). Kevin Jones stepped up with star Da'Sean Butler having an off night, with Jones scoring 18 points with eight rebounds. WVU committed an uncharacteristic 23 turnovers with different guys now handling the ball – the Mountaineers entered averaging just 11.6 turnovers per game. It was the first time West Virginia had committed more than 20 turnovers in a game this season.
If WVU's turnover problems show up again and Butler doesn't come up big against Kentucky, then WVU is toast. But the Mountaineers also are playing terrific on defense, not having allowed a team to score 60 points since the end of the regular season. WVU is 13-0 this season when holding a foe under 60. This is the fourth time a Bob Huggins-coached team has reached the Elite Eight, with Hugs going 1-2 in the previous three.
Saturday's game could well come down to rebounding. WVU, which is second in the nation in offensive rebounding, killed Washington on boards and is 25-3 this year when outrebounding its opponent. But with Patrick Patterson, DeMarcus Cousins and Daniel Orton, among others, Kentucky is a very good rebounding team and will have the size advantage in the frontcourt.
Get all your Elite Eight odds and props at Bodog
Top expert pick on this game comes from Matt Rivers: I am absolutely dropping a bomb today and proving to the world I am the best there is, period. I'm up 2.75 million* of profit over the past 30 days including a 34-23-1 run and 15 of 25 winning days and am as locked and loaded as I have ever been. If there is one day that you must listen to me this is that day. Highest rated 600,000* on Kentucky-West Virginia and a bonus 200,000* Butler-Kansas State. Click now to purchase
College Basketball Spread, NCAA Tournament Odds
Superstar sports handicapper Joe Duffy of GodsTips nails the industry's biggest bet of the NCAA Tournament with Baylor routing St. Mary's. But Matt Rivers, who was the winningest handicapper ever—nobody came close—on a large network of sites, has one of this two biggest releases ever going today.
Rivers is the winningest college basketball sports service in history.
Courtesy of OddsShark.com: Today in the Daily Sports Roundup: The Rockets play host to the Lakers, while the Elite Eight offers up Butler vs. Kansas State, and West Virginia vs. Kentucky.
Tipping off on the hardwood . . .
The NBA has just five games on tap for Saturday, with Utah at Washington, Portland at New Orleans, New Jersey at Chicago, Dallas at Golden State, and the Lakers at Houston.
The Rockets will be trying to shake off a three-game losing streak when they take to the hardwood against Los Angeles on Saturday; Houston fell 99-93 to the Clippers in their last game on Thursday night. The Rockets are just 1-2 against the Lakers so far this season, and they lost 88-79 in Los Angeles as a 7-point 'dog when the teams last met January 5. Kobe Bryant had 22 points for the Lakers that day. Carl Landry scored 19 points for Houston.
The top sports betting handicapper ever, GodsTips is the hottest. NBA ADDED! We now have two NBA Wise Guys and an NBA Major—it's all night action. Come on. Did you really think there was a snowball's chance in Hawaii or a sportsbook chance in Costa Rica that Baylor would do anything less than win in a rout? The NCAA Tournament Game of the Year—we told you it was stronger than any sports service pick in the Big Dance. We don't screw around. We win. We can't lie. Today's card is not quite as easy. Only 15-25 opportunities a year like that come along, many MLB underdogs. Oh Thursday's night's only Wise Guy on Kentucky under covered by 36. Get both NCAA Tournament totals now.
Oh the NBA, it's 17-5 the last 22. We go 4-1 overall yesterday and have swept NBA and college Wise Guys each of the last two days. Click now to purchase GodsTips.
As well, the NCAA Tournament hits the Elite Eight round on Saturday, starting with No. 5 Butler vs. No. 2 Kansas State in a 4:30pm ET West Region matchup. Butler knocked off top-seeded Syracuse 63-59 in the Sweet 16 on Thursday night, while Kansas State is coming off a 101-96 double-OT win over Xavier. Oddsmakers have Kansas State as the 4.5-point favorite, with the total at 137.5. The second game then has No. 2 West Virginia taking on No. 1 Kentucky to decide the East Region. West Virginia beat Washington 69-56 on Thursday, while Kentucky cruised past Cornell in a 62-45 victory. The Wildcats are pegged as the 4-point favorites by the oddsmakers in that one, with the total set at 133.5.
From Matt Rivers: I am absolutely dropping a bomb today and proving to the world I am the best there is, period. I'm up 2.75 million* of profit over the past 30 days including a 34-23-1 run and 15 of 25 winning days and am as locked and loaded as I have ever been. If there is one day that you must listen to me this is that day. Highest rated 600,000* on Kentucky-West Virginia and a bonus 200,000* Butler-Kansas State. Click now to purchase
Taking a trip around the rink . . .
Finally, there are a dozen games on the busy National Hockey League schedule for Saturday, including a matinee matchup between the Flyers and Penguins in Philadelphia. The 37-31-6 Flyers are riding a four-game losing streak heading into Saturday's contest, and they were beaten 4-3 by the Wild in overtime in their last game on Thursday. The 42-25-7 Penguins have lost three straight games, as the Capitals beat them 4-3 in a shootout on Wednesday. Pittsburgh, though, has had Philadelphia's number this season, as they're 4-1 in five games vs. their rival.
Also on the ice on Saturday: Calgary at Boston, Atlanta at Carolina, the Rangers at Toronto, the Islanders at Columbus, Tampa Bay at Buffalo, Florida at Ottawa, New Jersey at Montreal, Detroit at Nashville, Colorado at Phoenix, Dallas at Los Angeles, and Vancouver at San Jose. The 45-25-4 Canucks got past the Ducks 4-1 in their last game on Wednesday night, with backup goalie Andrew Raycroft stopping 30 of 31 Anaheim shots. The 45-19-10 Sharks blanked the Stars 3-0 in their last game on Thursday, with Evgeni Nabokov stopping 27 shots in that win.
Baseball Handicapper Previews National League Cont...
Free NBA Picks, Final 4 Spread Preview, Tiger Wood...
West Virginia vs. Duke Spread; 2010 Final 4 Men's ...
MSU Basketball the Underdog To Butler in Final 4 S...
Final 4 Pointspreads 2010: Butler, West Virginia I...
March Madness: NCAA Basketball Spreads Preview Ten...
NCAA: Tennessee Volunteers vs. Michigan State Spar...
Elite 8 Bracket: NCAA Tournament Odds Are Set, Ken...
March Madness Odds: Saturday NCAA Tournament Picks...
Top Sports Service Game of the Year Top Friday Swe...
Free NCAA Tournament Spreads Pick
NCAA: Purdue Boilermakers vs. Duke Blue Devils
NCAA: Northern Iowa Panthers vs. Michigan State Sp...
NCAA: St. Mary's Gaels vs. Baylor Bears
NCAA: Tennessee Volunteers vs. Ohio State Buckeyes...
Nuggets vs. Raptors NBA Spread Picks
2010 NCAA Tournament Odds Resume With Sweet 16 Pic...
NCAA Basketball Odds: Butler vs. Syracuse and Kent...
Bodog NCAA Tournament Previews: Xavier-Kansas Stat...
Sweet 16 March Madness Spreads, Trends, Handicappe...
NCAA Tournament Bracket Sweet 16: Matt Rivers Pick...
NHL Game Preview: New York Rangers @ Toronto Maple...
No Perfect Bracket But Matt Rivers Has Free Spread...
NBA Point Spread Picks: Lakers vs. Spurs, Rockets ...
NIT: Dayton Flyers vs. Illinois Fighting Illini
CBI: Princeton Tigers vs. Saint Louis Billikens
CIT: Creighton Bluejays vs. Missouri State Bears
CIT: Pacific Tigers vs. Appalachian State Mountain...
CBI: Boston University Terriers vs. Virginia Commo...
NIT: Rhode Island Rams vs. Virginia Tech Hokies
NBA Betting Lines- Utah Jazz-Toronto Raptors Previ...
Tuesday Sports Bets: Seems Like Moore Capital Type...
NIT: North Carolina Tar Heels vs. UAB Blazers
NIT: Texas Tech Red Raiders vs. Mississippi Rebels...
College Basketball Betting – Panthers Dream Won’t ...
NCAA Bracket 2010 Update: Matt Rivers Volcanic on ...
ScoresOddsPicks Premium Picks for Free
NIT: Connecticut Huskies vs. Virginia Tech Hokies
NIT: Nevada Wolf Pack vs. Rhode Island Rams
Right Angle Sports Totals
Syracuse-Gonzaga, Michigan State-Maryland Vegas Od...
NCAA Tournament Spread; March Madness Odds Picks T...
NCAA: California Golden Bears vs. Duke Blue Devils...
NCAA: Texas A&M Aggies vs. Purdue Boilermakers
NCAA: Xavier Musketeers vs. Pittsburgh Panthers
NCAA: Cornell Big Red vs. Wisconsin Badgers
NCAA: Missouri Tigers vs. West Virginia Mountainee...
NCAA: Michigan State Spartans vs. Maryland Terrapi...
NCAA: Georgia Tech Yellow Jackets vs. Ohio State B...
NCAA: Gonzaga Bulldogs vs. Syracuse Orange
NCAA: Old Dominion Monarchs vs. Baylor Bears
NCAA: Northern Iowa Panthers vs. Kansas Jayhawks
NIT: North Carolina State Wolfpack vs. UAB Blazers...
NCAA: Ohio Bobcats vs. Tennessee Volunteers
NCAA: Murray State Racers vs. Butler Bulldogs
NIT: Jacksonville Dolphins vs. Texas Tech Red Raid...
NCAA: St. Mary's Gaels vs. Villanova Wildcats
NIT: North Carolina Tar Heels vs. Mississippi Stat...
NBA Betting – Nuggets Will Cool Off Bucks
Spread Picks Supersede March Madness Bracketology
NCAA Tournament Schedule: March Madness Basketball...
Vegas Runner Picks: GA Tech vs. Oklahoma State, Si...
NCAA Tournament Picks: Vermont vs. Syracuse, Louis...
NCAA Bracket Update: Siena-Purdue Odds
NCAA: Louisville Cardinals vs. California Golden B...
NCAA: Houston Cougars vs. Maryland Terrapins
NCAA: Santa Barbara Gauchos vs. Ohio State Buckeye...
NCAA: Vermont Catamounts vs. Syracuse Orange
NCAA: Arkansas-Pine Bluff Golden Lions vs. Duke Bl...
NCAA: New Mexico State Aggies vs. Michigan State S...
NCAA: Georgia Tech Yellow Jackets vs. Oklahoma Sta...
NCAA: Florida State Seminoles vs. Gonzaga Bulldogs...
NIT: Memphis Tigers vs. Mississippi Rebels
NCAA: Utah State Aggies vs. Texas A&M Aggies
NCAA: Wofford Terriers vs. Wisconsin Badgers
NCAA: Oakland Grizzlies vs. Pittsburgh Panthers
NCAA: Missouri Tigers vs. Clemson Tigers
NCAA: Siena Saints vs. Purdue Boilermakers
NCAA: Cornell Big Red vs. Temple Owls
NCAA: Minnesota Golden Gophers vs. Xavier Musketee...
NCAA: Morgan State Bears vs. West Virginia Mountai...
NBA Friday Preview
NCAA: San Diego State Aztecs vs. Tennessee Volunte...
NCAA: Montana Grizzlies vs. New Mexico Lobos
NCAA: Wake Forest Demon Deacons vs. Texas Longhorn...
NCAA: Lehigh Mountain Hawks vs. Kansas Jayhawks
CIT: Southern Miss Golden Eagles vs. Louisiana Tec...
NCAA: Ohio Bobcats vs. Georgetown Hoyas
|
cc/2020-05/en_middle_0097.json.gz/line1399811
|
__label__wiki
| 0.653669
| 0.653669
|
miR-18a Impairs DNA Damage Response through Downregulation of Ataxia Telangiectasia Mutated (ATM) Kinase
Libing Song ,
Contributed equally to this work with: Libing Song, Chuyong Lin
Affiliation State Key Laboratory of Oncology in Southern China, Department of Experimental Research, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong, China
Chuyong Lin ,
Affiliation Department of Biochemistry, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, Guangdong, China
Zhiqiang Wu,
Hui Gong,
Yong Zeng,
Jueheng Wu,
Affiliation Department of Microbiology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, Guangdong, China
Mengfeng Li,
* E-mail: junli99@gmail.com
Libing Song,
Chuyong Lin,
Libing Song Chuyong Lin ... Jun Li
The DNA damage response (DDR) encompasses multi-step processes by which cells evolve to sense DNA damage, transduce the signal and initiate the repair of damaged DNA. Ataxia Telangiectasia Mutated (ATM) Kinase, which functions as the primary sensor and transducer of DNA damage signal, has been demonstrated to play an important role in the DDR and cancer prevention. Hence, understanding the molecular mechanisms underlying the regulation of ATM has received much attention. Here, we found that miR-18a was upregulated in both cell lines and patients' tissue samples of breast cancer. Furthermore, we demonstrated that ectopically expressing miR-18a downregulated ATM expression by directly targeting the ATM-3′-UTR and abrogated the IR-induced cell cycle arrest. Similar to the effect of ATM siRNA, overexpressing miR-18a in breast cancer cells reduced the DNA damage repair ability and the efficiency of homologous recombination-based DNA repair (HRR) and sensitized cells to γ-irradiation (IR) treatment. However, inhibition of miR-18a led to augmentation of DNA damage repair, increase of HRR efficiency and reduced cellular radiosensitivity. Moreover, we showed that the phorsphorylation level and nuclear foci formation of H2AX and 53BP1, the downstream substrates of ATM kinase, were significantly deceased in miR-18a overexpressing cells. Taken together, our results uncover a new regulatory mechanism of ATM expression and suggest that miR-18a might be a novel therapeutic target.
Citation: Song L, Lin C, Wu Z, Gong H, Zeng Y, Wu J, et al. (2011) miR-18a Impairs DNA Damage Response through Downregulation of Ataxia Telangiectasia Mutated (ATM) Kinase. PLoS ONE 6(9): e25454. https://doi.org/10.1371/journal.pone.0025454
Editor: Carlo Gaetano, Istituto Dermopatico dell'Immacolata, Italy
Received: May 17, 2011; Accepted: September 5, 2011; Published: September 27, 2011
Copyright: © 2011 Song et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The study was funded by The Natural Science Foundation of China (No. 81030048, 30870963, 30831160517, 81071647, 81071762, 30872930, 81071780); Program for New Century Excellent Talents in Universities (No. NCET-07-0877); The Science and Technology Department of Guangdong Province, China (No. 8251008901000006, 2008A030201006); Ministry of Education of China (No.(2008)890, No. 200805580047 and No. 20100171110080); The Fundamental Research Funds for the Central Universities (No. 10ykzd03). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
DNA damage response, an intricate signal transduction pathway, responds to DNA damage by initiating DNA repair or inducing apoptosis [1]. Amount of evidence has demonstrated that defects in any of the DDR related genes, which are responsible for sensing the damage, signal transduction and repairing double strand breaks (DSBs), could result in chromosomal breaks, fusions, and translocations, that ultimately to tumorigenesis. For instance, DDR related genes, such as RFC5, DPB11, MEC1, DDC2, MEC3, RAD53, CHK1, PDS1, and DUN1, have been reported to play important role in the maintenance of genomic stability and dysregulations of these genes were frequently found in many cancer types [2]–[5].
ATM (ataxia-telangiectasia mutated), a serine/threonine protein kinase, functions as a transducer of the DNA damage signal to the downstream effector machinery. In response to DSBs induction, ATM protein kinase becomes an active monomer from inactive dimer in a process involving autophosphorylation on serine (Ser1981) [6]. The active ATM rapidly hyperphosphorylates and activates downstream effecter CHK2 [7]. Furthermore, the activated CHK2 kinase phosphorylates its key substrates, CDC25A and CDC25C, which results in cells being arrested in the S phase or G2/M phases, respectively [8]. Meanwhile, ATM also hyperphosphorylates H2AX and p53 binding protein 1 (53BP1), upon DNA damage, which then form discrete nuclear foci at the site of the damaged DNA, which could amplify the degree of DDR [9]–[10]. The phosphorylated H2AX (γ-H2AX), one of the earliest ATM-dependent responses to IR, concentrated on the DNA lesions and formed discrete nuclear foci with phosphorylated 53BP1 protein, which was critical for recruiting various DNA repair proteins, such as BRCA1, NBS1, Rad51 and TopoBP1 [11]–[13]. ATM deficient cells showed no hyperphosphorylation and reduced foci formation of γ-H2AX and 53BP1 in response to IR compared with cells expressing wild-type ATM, resulting low DNA repair efficiency [9], [14].
ATM was named for the autosomal recessive progressive neurodegenerative disease, ataxia-telangiectasia (AT), which is caused by mutations of ATM gene [15]. The clinical symptoms associated with loss of ATM activity are neurodegeneration, extreme cellular sensitivity to radiation, immunodeficiency, and a predisposition to cancer [16]. Constantly, ATM deficient mice displayed growth retardation, neurologic dysfunction, radiosensitivity, sterility, defects in T lymphocyte maturation and predisposition to cancers with increased levels of hematopoietic malignancies in particular [17]. These phenotypic manifestations in both AT patients and ATM-deficient mice demonstrate that the pleiotropic function of ATM kinase is associated with various biological processes, including DNA repair, G1/S, intra-S and G2/M checkpoints, apoptosis, translation initiation, gene regulation and telomere maintenance [18]. Consistent with its function, mutations within ATM or repression of ATM have been found in multiple cancer types, such as breast cancer, pancreatic cancer, myeloma, leukemias and lymphomas [19]–[24]. Hence, understanding the molecular mechanisms underlying the regulation of ATM in cancers has received much attention.
Analysis with two publicly available algorithms (TargetScan and miRanda), we found that ATM protein kinase is theoretically the target gene of miR-18a. Furthermore, we demonstrated that overexpression of miR-18a downregulated ATM expression by directly targeting the ATM-3′-UTR, consequently resulting in reduction of the DNA damage repair ability and the HRR efficiency, and an increase in cellular radiosensitivity to IR treatment. Taken together, these results suggest that miR-18a plays an important role in the regulation of ATM and may represent a therapeutic target for cancers and other diseases.
miR-18a Is Overexpressed in Breast Cancer Cell Lines and Breast Cancer Tissues
Real-time PCR analyses revealed that miR-18a was significantly overexpressed in all of the 9 examined breast cancer cell lines, including ZR-75-1, ZR-75-30, SKBR3, T47D, MDA-MB-231, MDA-MB-435, MDA-MB-453, BT474 and BT-549, as compared with that in normal breast epithelial cells (NBEC) (Figure 1A). Furthermore, comparative analysis revealed that miR-18a was differentially overexpressed in 10 examined tissue samples paired with adjacent non-cancerous tissues from the same patient (Figure 1B), indicating that miR-18a is generally upregulated in breast cancer.
Figure 1. Upregulation of miR-18a abrogated IR-induced cell cycle arrest.
A, Real-time PCR analysis of miR-18a expression in normal breast epithelial cells (NBEC) and breast cancer cell lines, including ZR-75-1, ZR-75-30, SKBR3, T47D, MDA-MB-231, MDA-MB-435, MDA-MB-453, BT474 and BT-549. B, The expression of miR-18a was examined in 10 paired breast tumor tissues (tumor) and their adjacent normal tissues (normal). The average miR-18a expression was normalized by U6 expression. Each bar represents the mean of three independent experiments. C, Flow cytometric analysis of indicated breast cancer cells transduced with miR-18a mimic or NC, treated with or without 2.0 Gy IR. Statistic analysis revealed the proportion change of cells at each phase of cell cycle from three independent experiments under different miR-18a expression levels with or without IR treatment, using the algorithm (S+IR−S-IR)/S-IR×100%. D, Representative micrographs (left) and quantification analysis (right) of BrdUrd incorporating-cells in indicated cells with or without 2.0 Gy IR.
miR-18a Regulates DNA Damage-induced Cell Cycle Checkpoint
To investigate the biological role of miR-18a on the development and progression of breast cancer, the impact of miR-18a on proliferation of breast cancer cells was evaluated using flow cytometry. As shown in Figure 1C, ectopic expression of miR-18a dramatically decreased the proportion of cells in the G1/G0 peak and increased the proportion of cells in the S peak in both breast cancer cells MDA-MB-231 and SKBR3 as compared with that of negative control (NC) transfected cells. Furthermore, BrdUrd incorporation assay was performed and showed that the S-phase fraction with BrdUrd incorporation dramatically increased in MDA-MB-231(47.5%) and SKBR3 (44.7%) cells ectopically expressing miR-18a, as compared with the NC-transected control cells (36.2% and 33.7% for MDA-MB-231 and SKBR3 control cells, respectively (Figure 1D), suggesting that miR-18a is involved in the regulation of cell cycle.
Strikingly, we found that IR-induced cell cycle arrest in MDA-MB-231 and SKBR3 cells were also abolished by miR-18a overexpression, as analyzed by the flow cytometry assay, which indicated that miR-18a expression impaired the changes in cell proportions pre-IR and post-IR treatment to a lesser extent than the control cells (Figure 1C). Moreover, the percentage of BrdUrd- incorporating cells significantly decreased in NC-transfected cells after IR treatment, whereas no obvious alteration in the percentage of BrdUrd-incorporating cells in both breast cancer cell lines transfected with miR-18a pre-IR and post-IR treatment (Figure 1D), suggesting that miR-18a might contribute to conquering the DNA synthesis block induced by IR and enhance the radioresistant DNA synthesis of cells.
miR-18a Suppresses ATM Expression by Targeting 3′-UTR of ATM
To investigate the abrogation mechanism of miR-18a on DNA damage induced-cell cycle arrest, we then sought to identify the molecular targets of miR-18a, which might be associated with DNA damage response. Analysis with the use of two publicly available algorithms (TargetScan and miRanda) indicated that ATM protein kinase, which has been demonstrated to be associated with the regulation of DNA damage-induced cell cycle checkpoints, is theoretically the target gene of miR-18a (Figure 2A). As expected, western blotting analysis revealed that the level of ATM protein was significantly downregulated upon miR-18a transfection but upregulated when miR-18a was suppressed (Figure 2B). Furthermore, the ATM 3`-untranslated region (3′-UTR) fragment containing the miR-18a binding site (RE) was subcloned into the pEGFP-C3 and pGL3 luciferase reporter vectors. As shown in Figure 2C, overexpression of miR-18a in both MDA-MB-231 and SKBR3 breast cancer cell lines drastically suppressed the GFP protein expression, but not the expression of GFP-γ-tubulin that was used as the transfection control, suggesting that miR-18a specifically affected the ATM-3′-UTR. Moreover, a consistent and dose-dependent reduction of luciferase activity was observed upon miR-18a transfection in both breast cancer cell lines (Figure 2D). However, point mutations in the tentative miR-18a-binding seed region in the ATM 3′-UTR abrogated the suppressive effect of ATM expression mediated by miR-18a (Figure 2E). Thus our results demonstrate that ATM is a bona fide target of miR-18a.
Figure 2. miR-18a downregulated ATM expression via directly targeting the ATM 3′-UTR.
A, Predicted miR-18a target sequence in 3′UTR of ATM (ATM-3′-UTR) and a mutant that contained two mutated nucleotides in the ATM 3′-UTR (ATM-3′-UTR -MUT). B, Western blotting analysis of ATM expression in indicated cells transfected with miR-18a mimic- or miR-18a inhibitor-oligonucleotides. C, Western blot analysis that showed GFP expression in indicated cells. α-Tubulin was used as the loading control. D, Luciferase assay on indicated cells that were transduced with the pGL3-ATM-3′UTR reporter with increasing amounts (10, 50 nM) of miR-18a mimic- or miR-18a inhibitor-oligonucleotides. E, Luciferase assay on indicated cells transduced with pGL3-ATM-3′UTR or pGL3-ATM-3′UTR-MUT reporter with increasing amounts (10, 50 nM) of miR-18a mimic-oligonucleotides. F, The expression (left) and correlation (right) of miR-18a and ATM in nine freshly prepared human breast cancer tissues. Error bars represent the mean ± SD from three independent experiments. * P<0.05.
To further examine whether the conclusions above could be supported by observations in human primary tumors, the expression levels of miR-18a and ATM were examined in 9 freshly prepared human breast tumor tissues. As shown in Figure 2F, statistical analysis demonstrated that miR-18a expression inversely correlated with ATM (r = −0.766, P<0.05). Furthermore, this inverse correlation was also observed in breast cancer cell lines (r = −0.712, P<0.05), as indicated in Figure 1A and Figure S1. Collectively, these results further supported the notion that ATM is the target of miR-18a.
miR-18a Impaired the ATM Signaling Pathway
It has been reported that IR treatment could upregulate ATM expression and consequentially lead to phosphorylation of checkpoint kinase 2 (CHK2), H2AX and 53BP1 [7]–[10], [25], which promoted us to further examine the effect of miR-18a on the ATM downstream target proteins. As shown in Figure 3A, the increased expression levels of ATM protein and the phosphorylation level of CHK2 after IR treatment in both breast cancer cell lines were dramatically abolished by the transfection of miR-18a. Furthermore, Western blotting analysis revealed that ectopic expression of miR-18a drastically decreased the phosphorylation levels of H2AX (γ-H2AX) and 53BP1 (p-53BP1), which was similar to the effects of ATM depletion (Figure 3B). This was further confirmed by an indirect immunofluorescence assay, which indicated that the number of nuclear foci of H2AX and 53BP1 were significantly reduced in cells that overexpressed miR-18a (Figure 3C and 3D). Collectively, our results suggested that miR-18a impaired the ATM-mediated DNA damage signal.
Figure 3. miR-18a impaired the ATM signaling pathway.
A, Western blotting analysis of ATM expression, phosphorylated CHK2 (p-CHK2) and total CHK2 protein in indicated cells treated with or without IR. α-Tubulin was used as the loading control. B, Western blotting analysis of the expression levels of γ-H2AX, phosphorylated 53BP1 (p-53BP1) and total 53BP1 protein in indicated cells treated with IR (2.0 Gy). α-Tubulin was used as the loading control. C and D, The representative pictures (left panel) and quantification (right panel) of IR (2.0 Gy)-induced γ-H2AX (C) and 53BP1 (D) foci were analyzed in indicated breast cancer cells transfected with NC, miR-18a or scramble ATM-siRNA. The foci numbers of at least 300 cells were counted. Error bars represent the mean ± SD from three independent experiments. * P<0.05.
miR-18a Reduces Cell HRR Frequency and Enhances Cell Radiation Sensitivity
Since it has been demonstrated that ATM plays an important role in the HRR [26], a DSB-induced HRR assay was performed. As shown in Figure 4A, similar to the effect of ATM depletion, overexpressing miR-18a significantly reduced HRR frequency. However, co-transfection of ATM-targeted siRNA and miR-18a did not further augment the inhibitory effect of ATM silencing on HRR (Figure 4A). As HR deficiency could sensitize cells to IR, we speculated that miR-18a expression would impact cellular sensitivity to IR treatment. As expected, a clonogenic assay showed that the overexpression of miR-18a resulted in rendering both MDA-MB-231 and SKBR3 breast cancer cell lines significantly hypersensitive to IR, but further ectopic expression of miR-18a in ATM-depleted cells did not increase sensitivity to IR (Figure 4B). These results suggest that ATM repression is essential for the role of miR-18a in HRR and cell radiation sensitivity.
Figure 4. miR-18a reduces cell HRR frequency and enhances cell radiation sensitivity.
A, DSB-induced HRR assay indicated that the overexpression of miR-18a decreased the spontaneous HR frequency in HT1080-1885 cells. Western blotting analysis of the expression levels of ATM and HA-tagged I-SceI endonuclease. α-Tubulin was used as the loading control. B, Overexpressing miR-18a or silencing ATM expression enhanced the sensitivity of breast cancer cells to IR treatment. But further overexpressing miR-18a mimic had no additional sensitivity to IR in the ATM-silenced cells. The viabilities of the indicated cells were assayed after indicated doses of γ-radiation by the clonogenic cell survival assay. Error bars represent the mean ± SD from three independent experiments. * P<0.05.
To further investigate the biological role of miR-18a in the progression of breast cancer, we examine the effect of miR-18a on the ATM expression in primary normal breast epithelial cells (NBECs). As shown in Figure S2A, ectopic expression of miR-18 in NBECs dramatically decreased the ATM expression. Furthermore, western blotting analysis revealed that, in response to IR treatment, the expression levels of p-CHK2, H2AX (γ-H2AX) and p-53BP1 in the miR-18a transfected NBECs were much lower that those in vector transfected control cells (Figure S2B). Moreover, a clonogenic assay showed that overexpression of miR-18a renders NBECs hypersensitive to IR (Figure S2C). Taken together, our results suggest that upregulation of miR18a in NBECs is sufficient to impair ATM activation and HRR events upon IR treatment.
Inhibition of miR-18a Increased ATM Expression and Reduced Cell Sensitivity to Irradiation
Next, we examined the effect of inhibiting miR-18a on the ATM expression and HRR. As shown in Figure 5A, suppression of miR-18a after the transfection of miR-18a inhibitor not only increased the expression of ATM in both breast cancer cell lines, but also dramatically increased the levels of phosphorylation levels of H2AX (γ-H2AX) and 53BP1 (p-53BP1). Furthermore, we found that the inhibition of miR-18a significantly augmented the frequency of HRR and reduced the proportion of cells that were hypersensitive to IR (Figure 5B and 5C). Moreover, the indirect immunofluorescence assay displayed that, upon IR treatment, the foci numbers of γ-H2AX and 53BP1 in the miR-18a inhibitor-transfected cells were significantly increased (Figure 5D and 5E). These results further supported the hypothesis that miR-18a impaired DNA repair through the downregulation of ATM.
Figure 5. Inhibition of miR-18a increased cell HRR frequency and reduced radiosensitivity.
A, Western blotting analysis of the expression of ATM, γ-H2AX, phosphorylated 53BP1 (p-53BP1) and total 53BP1 protein in indicated cells treated with IR (2.0 Gy). α-Tubulin was used as the loading control. B, DSB-induced HRR assay indicated that inhibition of miR-18a increased the spontaneous HR frequency in HT1080–1885 cells. Western blotting analysis of expression levels of ATM and HA-tagged I-SceI endonuclease. α-Tubulin was used as the loading control. C, Inhibition of miR-18a reduced the sensitivity of breast cancer cells to IR treatment. The viabilities of the indicated cells were assayed after indicated doses of γ-radiation by the clonogenic cell survival assay. D and E, The representative pictures (left panel) and quantification (right panel) of IR (2.0 Gy)-induced γ-H2AX (D) and 53BP1 (E) foci were analyzed in indicated breast cancer cells transfected with either the NC or miR-18a inhibitor. The foci numbers of at least 300 cells were counted.
The key finding of the current study is that miR-18a abrogated IR-induced cell cycle arrest via repression of ATM. Bioinformatic analysis and mechanistic studies revealed that miR-18a post-transcriptionally repressed ATM expression by directly targeting the ATM 3′-UTR. Furthermore, we demonstrated that, similar with the effect of ATM siRNA, ectopic expression of miR-18a impaired IR-induced DNA damage repair, enhanced radiosensitivity, and reduced the frequency of HRR. Moreover, we found that the phosphorylation levels and formation rates of nuclear foci of H2AX and 53BP1, the downstream substrates of ATM kinase, were significantly deceased in miR-18a overexpressing cells. Taken together, our results suggest that miR-18a may play an important role in the regulation of ATM.
In mammalian cells, the most serious form of DNA damage is double strand breaks, which act as potent triggers of DNA damage response [27]. This type of DNA damage can arise from exogenous agents, such as ionizing radiation (IR) and certain genotoxic chemicals and endogenous stresses, including reactive oxygen species (ROS) and mechanical stress on the chromosomes [28]. To counteract the potentially deleterious effects of DNA damage, cells have evolved two distinct pathways for the repair of DSBs, known as homologous recombination (HR) and nonhomologous end joining (NHEJ) [29]–[30]. Among these two pathways, homologous recombination repair (HRR) is mainly promoted by the serine/threonine protein kinase, ataxia-telangiectasia mutated (ATM), whose activity loss would result in low efficiency of HR-mediated DSBs repair [31]-[32].
Previously, a number of studies have reported on the mechanisms of regulation of ATM expression. It has been shown that, upon DNA damage treatment, E2F-1 directly targeted ATM promoter and elevated the expression of ATM, accompanying by an E2F-induced increase in p53 phosphorylation [25]. It has been also found that aberrant methylation of multiple CpG dinucleotides within the proximal promoter region of the ATM gene results in downregulation of ATM expression and cellular hyper-radiosensitivity [33]-[34], suggesting methylation of ATM promoter might be an alternative mechanism for downregulation of ATM. In the current study, through public available algorithms (TargetScan and miRanda), we found that ATM protein kinase, is theoretically the target gene of miR-18a. This was further determined by three different methods. Western blotting analysis showed that overexpression of miR-18a resulted in the decrease of ATM protein and sequential downregulation of phosphorylation level of ATM downstream genes, including CHK2, H2AX and 53BP1. Nuclear foci staining of γ-H2AX and 53BP1 revealed that the recruitment of ATM downstream effectors to DNA lesions was decreased by miR-18a overexpession. The luciferase activity assay and point mutation analysis demonstrated that the downregulation of ATM was mediated by miR-18a through the ATM-3′-UTR. Collectively, our results uncover a new regulatory mechanism of ATM expression in breast cancer.
miR-18a belongs to a large miR cluster oncomir-1, also called the miR-17∼92 cluster, which encodes total 5 miRNAs, including miR-17, miR-19a, miR-20a, miR-19b and miR-92a. miR17-92 cluster was found to be upregulated in lymphomas and in multiple type of solid tumors, such as breast, colon, lung, stomach, and pancreas cancers [35]–[36]. The elevated expression of miR17-92 gene cluster could also be genome-caused as the miR17-92 gene cluster genome locus was found to be amplified in hematopoietic malignancies [37]. Meanwhile, it has been reported that miR17–92 gene cluster transcript could be activated by c-myc, N-myc and E2F families [38]–[40]. Interestingly, the expression levels of each miRNA in the cluster is not exactly parallel with each other, suggesting that processing or stability of the miRNAs is differentially regulated [41]. Guil and colleagues have found that RNA-binding protein hnRNP Al, which is overexpressed in breast cancer, could facilitate Drosha-mediated processing of miR-18a [42]–[43]. Previously, several studies have demonstrated that miR-17∼92 cluster plays important role in the progression and development of breast cancer. It has been shown that overexpression of miR-17 promotes human breast cancer cell migration and invasion through downregulation of HBP1 [44]. Suppression of miR-17 and miR-20a could inhibit growth and invasion of breast cancer cells via upregulation of tumor suppressor ZBTB4 [45]. Al-Nakhle et al reported that overexpressing miR-19 in breast cancer cells resulted in downregulation of ERbeta1 via direct targeting of its 3′-UTR [46]. In the current study, we demonstrated that miR-18a reduced DNA damage repair signaling and increased cellular radio-sensitivity by repression of ATM, which further support the notion that miR17–92 cluster functions as oncomir.
In summary, the current study provides, for the first time, an important link between miR-18a-impaired DNA damage response and downregulation of ATM in breast cancer. Our findings revealed the significance of miR-18a in regulating cell cycle checkpoints, DSBs repair and radiosensitivity. Understanding the precise role played by miR-18a in DNA damage response processes will not only increase our knowledge of breast cancer progression but miR-18a might also be a signature of the DNA damage response decision and a potential therapeutic target.
This study was conducted on a total of 19 breast cancer samples that were histopathologically and clinically diagnosed at the Sun Yat-sen University Cancer Center from 2009 to 2010. For the use of clinical materials for research purposes, prior patients' consents and approval were obtained from the Sun Yat-sen University and Cancer Center Institutional Board. All samples were collected and analyzed with prior written informed consents from the patients.
Primary NBEC was isolated from the mammoplasty material of a 30-year-old woman and approved by the Sun Yat-sen University and First Affiliated Hospital Institutional Board. Sample was collected and analyzed with written informed consent. Primary NBEC was cultured in the Keratinocyte serum-free medium (Invitrogen, Carlsbad, CA) supplemented with epithelial growth factor, bovine pituitary extract and antibiotics (120 µg/ml streptomycin and 120 µg/ml penicillin). Breast cancer cell lines, MDA-MB-231 and SKBR3 were grown in DMEM medium (Invitrogen, Carlsbad, CA) su with 10% fetal bovine serum (FBS) (HyClone, Logan, UT) and 100 units of penicillin-streptomycin. Cells were maintained and experiments were accomplished in a humidified 37°C with 5% CO2.
RNA Extraction, Reverse Transcription (RT) and Real-time PCR
Total miRNA from cultured cells and fresh surgical breast cancer tissues was extracted using the mirVana miRNA Isolation Kit (Ambion, Austin, TX, USA) according to the manufacturer's instructions. cDNA was synthesized from 5 ng of total RNA using the Taqman miRNA reverse transcription kit (Applied Biosystems, Foster City, CA), and the expression levels of miR-18a were quantified using miRNA-specific TaqMan MiRNA Assay Kit (Applied Biosystems). Real-time PCR was performed using the Applied Biosystems 7500 Sequence Detection system. The expression of miR-18a was defined based on the threshold cycle (Ct), and relative expression levels were calculated as 2−[(Ct of miR−18a) − (Ct of U6)] after normalization with reference to expression of U6 small nuclear RNA.
Western blotting was performed according to standard methods as described previously [47], using anti-ATM, anti-CHK2, and anti-p-CHK2 antibodies, anti-53BP1, anti-p-53BP1 (Cell Signaling, Danvers, MA), anti-γ-H2AX (Abcam, Cambridge, MA), anti-HA (Sigma, Saint Louis, MI). The membranes were stripped and re-probed with an anti-α-tubulin antibody (Sigma, Saint Louis, MI) as a loading control.
Plasmids, siRNA and Transfection
The region of human ATM 3′-UTR, from 3340 to 3540, generated by PCR amplification from DNA of the SKBR3 cells, was cloned into pEGFP-C1 (Clontech, Mountain View, CA) and pGL3 vector (Promega, Madison, WI). The primers selected were as the following: ATM-3′UTR-GFP-up:GCCAGATCTTGAGAAATATAGAGATGTG;ATM-3′UTR-GFP-dn:GCCGAATTCGCTTTTAGAATTATT;ATM-3′UTR-luc-up:GCCCCGCGGGAAATATAGAGATGTG;ATM-3′UTR-luc-dn:GCCCTGCAGGCTTTTAGAATTATT;ATM-3′UTR-MUT-luc-up:GTATTTTAATTGCACCTTAATGAAATTATCTATT;ATM-3′UTR-MUT-luc-dn:AATAGATAATTTCATTAAGGTGCAATTAAAATAC. For depletion of ATM, the siRNA was synthesized and purified by Ribobio Inc. (Guangzhou, Guangdong, China). The ATM siRNA sequence used was: TGGTGCTATTTACGGAGCT. Transfection of siRNAs or plasmids was performed using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instruction.
Luciferase Assay
Cells (3.5×104) were seeded in triplicates in 48-well plates and allowed to settle for 24 h. One hundred nanogram of luciferase reporter plasmids or the control-luciferase plasmid, plus 10 ng of pRL-TK renilla plasmid (Promega, Madison, WI), were transfected into cells using the Lipofectamine 2000 reagent (Invitrogen Co., Carlsbad, CA) according to the manufacturer's recommendation. Luciferase and renilla signals were measured 48 h after transfection using the Dual Luciferase Reporter Assay Kit (Promega, Madison, WI) according to a protocol provided by the manufacturer. Three independent experiments were performed and the data are presented as mean ± SD.
Bromodeoxyuridine Labeling (BrdUrd Incorporation Assay)
To analyze the S-phase checkpoint, cells grown on coverslips (Fisher Scientific) at 70% confluence were irradiated with the indicated dose and incubated for 20 h. BrdUrd was added to cells and incubated for 2 h. Cells were then fixed and stained with anti-BrdUrd antibody (Upstate, Temecula, CA) according to the manufacturer's instructions. Gray level images were acquired under a laser scanning microscope (Axioskop 2 plus, Carl Zeiss Co. Ltd., Jena, Germany).
Immuno fluorescence
Cells grown on coverslips (Fisher Scientific) were fixed in ice-cold methanol for 10 min, blocked with 10% goat serum in PBS, and incubated with anti-γ-H2AX, anti-53BP1, in 10% goat serum/PBS. The primary antibodies were detected with rhodamine-conjugated goat anti-rabbit IgG (The Jackson Laboratory) and the DNA was stained with DAPI. Gray level images were acquired under a laser scanning microscope (Axioskop 2 plus, Carl Zeiss Co. Ltd., Jena, Germany).
Flow Cytometry Analysis
Cells were irradiated with the indicated dose and incubated for 20 h. All cells were then harvested by trypsinization, washed in ice-cold PBS, and fixed in 80% ice-cold ethanol in PBS. Before staining, the cells were spun down in a cooled centrifuge and resuspended in the cold. Bovine pancreatic RNAase (Sigma-Aldrich) was added at a final concentration of 2 µg/ml, and cells were incubated at 37°C for 30 min, followed by incubation in 20 µg/ml of propidium iodide (Sigma-Aldrich) for 20 min at room temperature. 50,000 cells were analyzed on a flow cytometer (FACSCalibur; BD Biosciences).
Clonogenic Survival Assay
Cells were plated at 500 cells per well onto a six-well dish in triplicate and then incubated for 24 h to allow settling. Cells were treated with a series of IR dose (0, 2, 4, 6, 8Gy). Clonogenic Survival Assay was performed according to the standard methods described in [48].
DSB-induced HRR Assay
HRR was assayed essentially as described previously [49]. Briefly, HT-1080–1885 cells were transfected with miR-18a mimic or negative control mimic anlong with pCMV(HA-3xNLS)I-SceI that expresses a HA epitope- and nuclear localization signal-tagged I-SceI nuclease. Forty-eight hours later, ∼100,000 viable cells were transferred to 10-cm-diameter dishes, and HRR products were selected in growth medium with 325 µg of G418/ml. G418-resistant colonies were scored 12 to 14 days later. The plating efficiency was determined by seeding the appropriate numbers of cells to 10-cm-diameter dishes with growth medium lacking G418. HRR frequencies were calculated as the number of G418-resistant colonies per viable cell plated in G418 medium. Background HR levels were estimated in parallel experiments, except that cells were transfected with an empty pCMV vector.
ATM expression in breast cancer cells and inverse correlation between miR-18a expression and ATM expression. Western blotting analysis of ATM expression (left) and correlation (right) of miR-18a expression and ATM expression in normal breast epithelial cells (NBEC) and breast cancer cell lines, including ZR-75-1, ZR-75-30, SKBR3, T47D, MDA-MB-231, MDA-MB-435, MDA-MB-453, BT474 and BT-549.
Overexpression of miR18a is sufficient to impair ATM activation and HRR events in response to IR in NBECs. A, Western blotting analysis of the expression of ATM in NBECs transfected with NC or miR-18a. α-Tubulin was used as the loading control. B, Western blotting analysis of the expression phosphorylated CHK2 (p-CHK2), total CHK2, phosphorylated 53BP1 (p-53BP1), total 53BP1 and γ-H2AX protein in NBECs in response to IR (2.0 Gy) treatment. α-Tubulin was used as the loading control. C, Overexpression of miR-18a increased the sensitivity of NBECs to IR treatment. The viabilities of the indicated cells were assayed after indicated doses of γ-radiation by the clonogenic cell survival assay.
We are grateful to Dr. Zhiyuna Shen for providing us with the HT-1080-1885 cells and other reagents for HRR assay.
Conceived and designed the experiments: LS JL. Performed the experiments: CL ZW HG YZ. Analyzed the data: LS CL ZW HG YZ. Contributed reagents/materials/analysis tools: LS JW ML JL. Wrote the paper: LS CL JL.
1. Harper JW, Elledge SJ (2007) The DNA damage response: ten years after. Mol Cell 28: 739–45.
2. Myung K, Datta A, Kolodner RD (2001) Suppression of spontaneous chromosomal rearrangements by S phase checkpoint functions in Saccharomyces cerevisiae. Cell 104: 397–408.
3. Zhou BB, Elledge SJ (2000) The DNA damage response: putting checkpoints in perspective. Nature 408: 433–439.
4. Jiri Bartek, Jiri Lukas (2003) Chk1 and Chk2 kinases in checkpoint control and cancer. Cancer Cell 3: 421–429.
5. Weinert T, Lydall D (1993) Cell cycle checkpoints, genetic instability and cancer. Semin Cancer Biol 4: 129–140.
6. Christopher JBakkenist, Michael BKastan (2002) DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature 421: 499–506.
7. Matsuoka S, Rotman G, Ogawa A, Shiloh Y, Tamai K, et al. (2000) Ataxia telangiectasia-mutated phosphorylates Chk2 in vivo and in vitro. Proc Natl Acad Sci U S A 97: 10389–94.
8. Matsuoka S, Huang M, Elledge SJ (1998) Linkage of ATM to cell cycle regulation by the Chk2 protein kinase. Science 282: 1893–7.
9. Stiff T, O'Driscoll M, Rief N, Iwabuchi K, Löbrich M, et al. (2004) ATM and DNA-PK function redundantly to phosphorylate H2AX after exposure to ionizing radiation. Cancer Res 64: 2390–6.
10. Adams MM, Carpenter PB (2006) Tying the loose ends together in DNA double strand break repair with 53BP1. Cell Div 1: 19.
11. Bekker-Jensen S, Lukas C, Kitagawa R, Melander F, Kastan MB, et al. (2006) spatial organization of the mammalian genome surveillance machinery in response to DNA strand breaks. J Cell Biol 173: 195–206.
12. Celeste A, Petersen S, Romanienko PJ, Fernandez-Capetillo O, Chen HT, et al. (2002) Genomic instability in mice lacking histone H2AX. Science 296: 922–7.
13. Ward IM, Minn K, Jorda KG, Chen J (2003) Accumulation of checkpoint protein 53BP1 at DNA breaks involves its binding to phosphorylated histone H2AX. J Biol Chem 278: 19579–82.
14. Shiloh Y (2003) ATM and related protein kinases: safeguarding genome integrity. Nat Rev Cancer 3: 155–68.
15. Savitsky K, Sfez S, Tagle DA, Ziv Y, Sartiel A, et al. (1995) the complete sequence of the coding region of the ATM gene reveals similarity to cell cycle regulators in different species. Hum Mol Genet 4: 2025–32.
16. Mavrou A, Tsangaris GT, Roma E, Kolialexi A (2008) The ATM gene and ataxia telangiectasia. Anticancer Res 28: 401–5.
17. Barlow C, Hirotsune S, Paylor R, Liyanage M, Eckhaus M, et al. (1996) Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell 86: 159–71.
18. Kurz EU, Lees-Miller SP (2004) DNA damage-induced activation of ATM and ATM-dependent signaling pathways. DNA Repair (Amst) 3: 889–900.
19. Appleby JM, Barber JB, Levine E, Varley JM, Taylor AM, et al. (1997) Absence of mutations in the ATM gene in breast cancer patients with severe responses to radiotherapy. Br J Cancer 76: 1546–9.
20. Yu G, Zhu MH, Zhu Z, Ni CR, Zheng JM, et al. (2004) Expression of ATM protein and its relationship with p53 in pancreatic carcinoma with tissue array. Pancreas 28: 421–6.
21. González MB, Hernández JM, García JL, Lumbreras E, Castellanos M, et al. (2004) The value of fluorescence in situ hybridization for the detection of 11q in multiple myeloma. Haematologica 89: 1213–8.
22. Vorechovský I, Luo L, Dyer MJ, Catovsky D, Amlot PL, et al. (1997) Clustering of missense mutations in the ataxia-telangiectasia gene in a sporadic T-cell leukaemia. Nat Genet 17: 96–9.
23. Bullrich F, Rasio D, Kitada S, Starostik P, Kipps T, et al. (1999) ATM mutations in B-cell chronic lymphocytic leukemia. Cancer Res 59: 24–7.
24. Boultwood J (2001) Ataxia telangiectasia gene mutations in leukaemia and lymphoma. J Clin Pathol 54: 512–6.
25. Berkovich E, Ginsberg D (2003) ATM is a target for positive regulation by E2F-1. Oncogene 22: 161–7.
26. Valerie K, Povirk LF (2003) Regulation and mechanisms of mammalian double-strand break repair. Oncogene 22: 5792–812.
27. Lees-Miller SP, Meek K (2003) Repair of DNA double strand breaks by non-homologous end joining. Biochimie 85: 1161–73.
28. Khanna KK, Jackson SP (2001) DNA double-strand breaks: signaling, repair and the cancer connection. Nat Genet 27: 247–54.
29. Orii KE, Lee Y, Kondo N, McKinnon PJ (2006) Selective utilization of nonhomologous end-joining and homologous recombination DNA repair pathways during nervous system development. Proc Natl Acad Sci U S A 103: 10017–22.
30. Mills KD, Ferguson DO, Essers J, Eckersdorff M, Kanaar R, et al. (2004) Rad54 and DNA Ligase IV cooperate to maintain mammalian chromatid stability. Genes Dev 18: 1283–92.
31. Beucher A, Birraux J, Tchouandong L, Barton O, Shibata A, et al. (2009) ATM and Artemis promote homologous recombination of radiation-induced DNA double-strand breaks in G2. EMBO J 28: 3413–27.
32. Chen BP, Uematsu N, Kobayashi J, Lerenthal Y, Krempler A, et al. (2007) Ataxia telangiectasia mutated (ATM) is essential for DNA-PKcs phosphorylations at the Thr-2609 cluster upon DNA double strand break. J Biol Chem 282: 6582–7.
33. Kim WJ, VO QN, Shrivastav M, Lataxes TA, Brown KD (2002) aberrant methylation of the ATM promoter correlates with increased radiosensitivity in a human colorectal tumor cell line. Oncogene 21: 3864–71.
34. Roy K, Wang L, Makrigiorgos GM, Price BD (2006) Methylation of the ATM promoter in glioma cells alters ionizing radiation sensitivity. Biochem Biophys Res Commun 344: 821–6.
35. Lawrie CH (2007) MicroRNA expression in lymphoma. Expert Opin Biol Ther 7: 1363–74.
36. Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, et al. (2006) A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 103: 2257–61.
37. Ota A, Tagawa H, Karnan S, Tsuzuki S, Karpas A, et al. (2004) Identification and characterization of a novel gene, C13orf25, as a target for 13q31-q32 amplification in malignant lymphoma.
38. Schulte JH, Horn S, Otto T, Samans B, Heukamp LC, et al. (2008) MYCN regulates oncogenic MicroRNAs in neuroblastoma. Int J Cancer 122: 699–704.
39. Sylvestre Y, De Guire V, Querido E, Mukhopadhyay UK, Bourdeau V, et al. (2007) An E2F/miR-20a autoregulatory feedback loop. J Biol Chem 282: 2135–43.
40. Woods K, Thomson JM, Hammond SM (2007) Direct regulation of an oncogenic micro-RNA cluster by E2F transcription factors. J Biol Chem 282: 2130–4.
41. Ji M, Rao E, Ramachandrareddy H, Shen Y, Jiang C, et al. (2011) The miR-17-92 MicroRNA Cluster Is Regulated by Multiple Mechanisms in B-Cell Malignancies. Am J Pathol. [Epub ahead of print].
42. Guil S, Cáceres JF (2007) The multifunctional RNA-binding protein hnRNP A1 is required for processing of miR-18a. Nat Struct Mol Biol 14: 91–6.
43. Patry C, Bouchard L, Labrecque P, Gendron D, Lemieux B, et al. (2003) Small interfering RNA-mediated reduction in heterogeneous nuclear ribonucleoparticule A1/A2 proteins induces apoptosis in human cancer cells but not in normal mortal cell lines. Cancer Res 63: 7679–88.
44. Li H, Bian C, Liao L, Li J, Zhao RC (2011) miR-17-5p promotes human breast cancer cell migration and invasion through suppression of HBP1. Breast Cancer Res Treat 1263: 565–75.
45. Kim K, Chadalapaka G, Lee SO, Yamada D, Sastre-Garau X, et al. (2011) Identification of oncogenic microRNA-17-92/ZBTB4/specificity protein axis in breast cancer. Oncogene. [Epub ahead of print].
46. Al-Nakhle H, Burns PA, Cummings M, Hanby AM, Hughes TA, et al. (2010) Estrogen receptor {beta}1 expression is regulated by miR-92 in breast cancer. Cancer Res 70: 4778–84.
47. Li J, Zhang N, Song LB, Liao WT, Jiang LL, et al. (2008) Astrocyte elevated gene-1 is a novel prognostic marker for breast cancer progression and overall patient survival. Clin Cancer Res 14: 3319–26.
48. Franken NP, Rodermond HM, Stap J, Haveman J, van Bree C (2006) Clonogenic assay of cells in vitro. Nature Protocols 1: 2315–2319.
49. Taghian , G D, A. Nickoloff J (1997) Chromosomal double-strand breaks induce gene conversion at high frequency in mammalian cells. Mol. Cell. Biol 17: 6386–6393.
Is the Subject Area "Breast cancer" applicable to this article?
Is the Subject Area "Phosphorylation" applicable to this article?
Is the Subject Area "Cancer treatment" applicable to this article?
Cell cycle and cell division
Is the Subject Area "Cell cycle and cell division" applicable to this article?
Hyperexpression techniques
Is the Subject Area "Hyperexpression techniques" applicable to this article?
Small interfering RNAs
Is the Subject Area "Small interfering RNAs" applicable to this article?
|
cc/2020-05/en_middle_0097.json.gz/line1399820
|
__label__cc
| 0.60243
| 0.39757
|
Tag Archive: horses
Epona, Celtic Horse Goddess by Judith Shaw
Aahhh…my sweet and beloved Goddess Epona…”Call on Epona for protection (especially for animals), for fertility of body, mind, and spirit, and for dreams to guide you on your life path. Epona also teaches women of their strength and sovereignty, helping women discover their wholeness within themselves.” ~ Judith Shaw
Epona, Celtic Horse Goddess was worshipped by the Gauls (the Celtic French). Her worship spread to Britain and Rome from Western Europe. Hundreds of statues and shrines dating from between the first and third centuries CE have been found in France alone.
Today we can understand Epona mainly from her images, as few stories of her have survived. She is often shown either riding a white horse side saddle or standing or sitting between two horses. Many images show her feeding mares and foals from a cornucopia or a basket of fruit.
Tags: celtic mythology, epona, feminine spirituality, goddess, horses, macha, women's spirituality
Goddess Hecate
“Hecate” by *mari-na
“Hecate’s themes are the moon, beginnings and magic. Her symbols are serpents, horses or dogs (Her sacred animals), light (especially a torch), myrrh, silver and moonstone. This Greco-Roman Goddess rules the moon and opportunities. Tonight She opens the path through which the old year departs and the new enters. People customarily worship Hecate at crossroads, where worlds meet, which may be why She became a witch’s Goddess. On this, Hecate’s Day, She bears a torch, lighting the way to the future.
At the eve of a New Year, take a moment and pat yourself on the back for a full of Goddess-centered thinking and action. Note your achievements, and thank Hecate for helping you find the way when your vision seemed clouded. An additional benefit here is that speaking this Goddess’s name today banishes unwanted ghosts, including those figurative ghosts of past negative experiences. Let Hecate take those burdens so your new year will begin without anything holding you back.
To accept this Goddess’s powers in your life throughout your celebrations today, wear white or silver items, and light a white candle in Her honor. For a token that will emphasize Hecate’s magic and lunar energies whenever you need them, bless a moonstone, saying something like:
‘Hecate, fill this silver stone
keep your magic with me where ever I roam.’
Carry this, keeping the Goddess close to your heart and spirit.”
“Hecate” by Hrana Janto
“At night, particularly at the dark of the moon, this Goddess walked the roads of ancient Greece, accompanied by sacred dogs and bearing a blazing torch. Occasionally She stopped to gather offerings left by Her devotees where three roads crossed, for this threefold Goddess was best honored where one could look three ways at once. Sometimes, it was even said that Hecate could look three ways because She had three heads: a serpent, a horse, and a dog.
“Hecate redux” by ~ArtemisiaSynchroma
While Hecate walked outdoors, Her worshipers gathered inside to eat Hecate suppers in Her honor, gatherings at which magical knowledge was shared and the secrets of sorcery whispered and dogs, honey and black female lambs sacrificed. The bitch-Goddess, the snake-Goddess, ruled these powers and She bestowed them on those who worshiped Her honorably. When supper was over, the leftovers were placed outdoors as offerings to Hecate and Her hounds. And if the poor of Greece gathered at the doorsteps of wealthier households to snatch the offerings, what matter?
“Hecate” by Katlyn Breene
Some scholars say that Hecate was not originally Greek, Her worship having traveled south from Her original Thracian homeland. Others contend that She was a form of the earth mother Demeter, yet another of whose forms was the maiden Persephone. Legends, they claim, of Persephone’s abduction and later residence in Hades give clear prominence to Hecate, who therefore must represent the old wise woman, the crone, the final stage of woman’s growth-the aged Demeter Herself, just as Demeter is the mature Persephone.
In either case, the antiquity of Hecate’s worship was recognized by the Greeks, who called Her a Titan, one of those pre-Olympian divinities whom Zeus and his cohort had ousted. The newcomers also bowed to Her antiquity by granting to Hecate alone a power shared with Zeus, that of granting or withholding from humanity anything She wished. Hecate’s worship continued into classical times, both in the private form of Hecate suppers and in public sacrifices, celebrated by ‘great ones’ or Caberioi, of honey, black female lambs, and dogs, and sometimes black human slaves.
“Hecate” by *Hrefngast
As queen of the night, Hecate was sometimes said to be the moon-Goddess in Her dark form, as Artemis was the waxing moon and Selene the full moon. But She may as readily have been the earth Goddess, for She ruled the spirits of the dead, humans who had been returned to the earth. As queen of death She ruled the magical powers of regeneration; in addition, She could hold back Her spectral hordes from the living if She chose. And so Greek women evoked Hecate for protection from Her hosts whenever they left the house, and they erected Her threefold images at their doors, as if to tell wandering spirits that therein lived friends of their queen, who must not be bothered with night noises and spooky apparitions” (Monaghan, p. 146 – 148).
“Hekate’s Advance” by ~Hellfurian-Guard
General: Torch, dark moon, raisin & currant cakes, crossroads, three-headed animals or statues, the number 3, masks, and candles.
Animals: Dogs, horses, sheep (especially black female lambs), owls, bats, snakes, and boars.
Plants: Willows, dark yew, blackthorn, groves of trees, saffron, raisins & currants, and gourds (especially pumpkins).
Perfumes/Scents: Queen of the Night (a light flowery fragrance), cinnamon, myrrh, mugwort, honey, lime, and lemon verbena.
Gems and Metals: Sapphire, silver, gold, moonstone, black tourmalin, black onyx, hematite, smoky quartz, and any stone that is dark or luminous.
Colors: Black, orange, yellow-orange, and red-orange. [1]
Some educational and informational videos
And I just thought this song was kind of catchy 🙂
Goddessgift.com, “Goddess Symbols and Sacred Objects of Hecate”.
Monaghan, Patricia. The New Book of Goddesses and Heroines, “Hecate”.
Covenofthegoddess.com, “Goddess Hekate“.
D’Este, Sorita & David Rankine. Hekate Liminal Rites.
Ford, Michael W. Book of the Witch Moon: Chaos, Vampiric & Luciferian Sorcery, “Hecate”. (p. 99 – 107). (For those with a taste for a “darker” flavor 😉 )
Goddessgift.com, “Hecate, Greek Goddess of the Crossroads“.
Grimassi, Raven. The Witches’ Craft: The Roots of Witchcraft & Magical Transformation.
Hecatescauldron.org, “Hecate’s Cauldron“.
Hekate Symposium 2013, “Hekate: Bright Goddess of the Mysteries by Sorita d’Este“.
James-Henderson, Yvonne. Orderwhitemoon.org, “Hecate“.
Kirkpatrick, Carrie. Goddess Enchantment, Magic and Spells Vol 2, “Goddess of Transformation Hecate“.
Littleton, C. Scott. Gods, Goddesses and Mythology, “Hecate” (p. 617 – 620).
MacLeod NicMhacha, Sharynne. Queen of the Night: Rediscovering the Celtic Moon Goddess, “The Double Life of Hecate” (p. 59 -63).
Mydailygoddess.blogspot.com, “Hecate – Crossroads“.
Reichard, Joy. Celebrate the Divine Feminine, “13. Hecate” (p. 167 – 182).
Revel, Anita. igoddess.com, “Hecate: intuitive wise woman“.
Tate, Karen. Sacred Places of Goddess: 108 Destinations.
The-goddess-hecate.blogspot.com, “The Goddess Hecate“.
Theoi.com, “Hecate“.
Took, Thalia. Thaliatook.com, “Hekate“.
Wikipedia, “Hecate“.
Tags: 3, banishing, bats, beginnings, boars, candles, chthonic, crossroads, demeter, ghosts, goddess, gourds, greco-roman, greek mythology, hecate, hekate, horses, keys, light, magic, masks, moon, moonstone, myrrh, owls, persephone, psychopomp, queen of the witches, roman mythology, serpent, sheep, silver, snakes, titan, titaness, torch, triple goddess, underworld, willow, witch, witchcraft, witches, zeus
Goddess Samjuna
“Ushas” by Lisa Hunt
“Samjuna’s themes are knowledge, learning, excellence and reason. Her symbols are walnuts (the mind). In Hindu tradition, this Goddess is the source of all conscious thought and action. Her name even means ‘consciousness’, and She is the patroness of learning, reason, logic and knowledge.
Every year at this time, the Nobel Prize is awarded for mastery in chemistry, medicine, literature and peace keeping. It is a time to revel in humankind’s achievements and limitless potential for good, motivated by Samjuna’s gentle leadings.
To honor this Goddess and the people who have achieved the pinnacle of what She represents, spend time enriching your mind today. For instance, you might read field manuals applicable to your career to advance your knowledge, watch educational television; go to a library, and perhaps donate to its shelves some old books that you no longer read; organize a local reading group for improved literary appreciation; or turn off the television and engage in intelligent conversation for mutual edification. The options here are limitless.
For a Samjuna charm that improves conscious awareness and your reasoning powers, carry a shelled walnut today. The shape of this nut equates to the mind. Eat this at the end of the day to internalize her power for thoughtful actions.”
Surya and Sanjana
According to Patricia Monaghan, “‘Knowledge’ was the Indian wife of the sun [Surya], whose brilliance finally so tired Her that Samjuna hid in the wilderness disguised as a mare, leaving behind a replica of Herself [Chhaya or Savarna]. But he discovered Her ruse and transformed himself into a stallion to seek Her and, finding Her, to have intercourse with Her. From this union came the twin gods of agriculture , the horse-headed Aswins. Samjuna agreed to return to the sky with the sun god, but first She had Her father [Vishwakarma] trim away some of the sun’s rays to diminish his brightness. From the extra pieces of the sun were fashioned the weapons of other gods” (p. 272).
“The Goddess Within Painting” by Louise Green
“Saranya, or Saraniya (also known as Saranya, Sanjna, or Sangya) is the wife of Surya, and a Goddess of the dawn and the clouds in Hindu mythology, and is sometimes associated with Demeter, Greek Goddess of agriculture. According to Max Müller and A. Kuhn, Demeter is the mythological equivalent of the Sanskrit Saranyu, who, having turned Herself into a mare, is pursued by Vivasvat, and becomes the mother of Revanta and the twin Asvins, the Indian Dioscuri (the Indian and Greek myths being regarded as identical). She is also the mother of Manu, the twins Yama and Yami. According to Farnell, the meaning of the epithet is to be looked for in the original conception of Erinys, which was that of an earth-Goddess akin to Ge, thus naturally associated with Demeter, rather than that of a wrathful avenging deity. [1]
“She is considered as the Goddess who gave birth to all animals. She is also thought to be the Vedic Mare Goddess.” [2]
Indianetzone.com, “Saranyu“.
Monaghan, Patricia. The New Book of Goddesses and Heroines, “Samjuna”.
Wikipedia, “Saranyu“.
Crystalinks.com, “Gods and Goddesses of Ancient India“.
Held, Catherine Anne. Dreamhorsewomen.wordpress.com, “Saranyu: the Runaway Horse Goddess: Part I” & “Saranyu: the Runaway Horse Goddess: Part II“.
Wikipedia, “Chhaya“.
Tags: asvins, aswins, chaya, chhaya, clouds, dawn, demeter, dioscuri, erinys, excellence, gai, ge, goddess, hindu, hinduism, horses, india, knowledge, learning, manu, mare, nobel prize, reason, revanta, samjna, samjuna, sangya, sanjana, sanjna, saraniya, saranya, savarna, sun, surya, twins, vedic mare goddess, vishwakarma, vivasvat, walnuts, yama, yami
Goddess Rhiannon
“Rhiannon’s Ride” by Selina Fenech
“Rhiannon’s themes are movement, communication, rest, ghosts, fertility and leadership. Her symbols are the color white, horses and the moon. This Celtic horse Goddess rides into our festival calendar today on a white mare bearing fertility, leadership, and a means to get things moving where they may have stagnated. Some historians believe the swiftness of Her steed (which is white, a lunar color) alludes to a lunar Goddess. In stories, Rhiannon commands singing birds that can wake spirits or grant sleep to mortals.
In Britain, people would come to Berkshire hillside today to partake in the White Horse Festival in which they scour the white horse that adorns the grasses here. This ancient galloping steed is created from pale clay, and this ritual kept it, and Rhiannon’s memory, vibrant. So, if you have any images of horses (magazines, statuary, paintings) around, dust them off and put them in a place of honor today.
Since this was a festival for horses, you might consider tending to your own ‘horse’, be it a car or a bicycle!
Give it a tune-up or oil change, then take a ride! As you go, visualize yourself on the back of Rhiannon’s horse moving swiftly toward attending productivity or improved authority wherever you need it. Alternatively, wear something silver or white so that Rhiannon’s lunar energies can begin filtering into your day through the color’s vibrations.”
This is pretty much a repeat of the entry I did on Rigantona back June 28.
“Rhiannon” by Caroline Gully-Lir
The great Goddess Rhiannon is a potent symbol of fertility, yet She is also an Otherworld and death Goddess, a bringer of dreams, and a moon deity who is symbolized by a white horse. Her father was Heveydd the Old, and She was married to both Pwyll and Manan. The story of Her marriage to Pwyll, and the subsequent accusation of the murder of Her child, is well documented and most people are familiar with Rhiannon from this tale. [Click here to read Her tale].
“Rhiannon” by Susan Seddon Boulet
Patricia Monaghan comments: “What can one expect of a Goddess of death? Her son disappeared, and the queen was found with blood on Her mouth and cheeks. Accused of murder, She was sentenced to serve as Pwyll’s gatekeeper, bearing visitors to the door on Her back; thus She was symbolically transformed into a horse. All ended happily when Her son was found; Rhiannon had been falsely accused by maids who, terrified at finding the babe absent, had smeared puppy blood on the queen’s face.
Behind this legend is doubtless another, more primitive one in which the death queen actually was guilty of infanticide. This beautiful queen of the night would then, it seems, be identical to the Germanic Mora, the nightmare, the horse-shaped Goddess of terror. But night brings good dreams as well as bad, so Rhiannon was said to be the beautiful Goddess of joy and oblivion, a Goddess of Elysium as well as the queen of hell” (p. 266 – 267).
“Rhiannon” by Helena Nelson-Reed
“In Her guise as a death Goddess, Rhiannon could sing sweetly enough to lure all those in hearing to their deaths, and therefore She may be related to Germanic stories of lake and river faeries who sing seductively to lure sailors and fishermen to their doom. Her white horse images also link Her to Epona, and many scholars feel they are one and the same, or at least are derived from the same archetypal roots.
In today’s magick and ritual, Rhiannon can be called upon to aid you in overcoming enemies, exercising patience, working magick, moon rituals, and enhancing dream work.” [2]
“Call upon Rhiannon to bless rites of fertility, sex magick, prosperity and dream work. Work with Her to enhance divination skills, overcome enemies, develop patience, and to gain self confidence. She is most definitely a Fae that every woman can relate to on some level. Her perserverance and will is an example of what we as women are, have been, and will continue to be for millennia to come. Solid, unwavering beauty and strength, like Mother Earth below our feet.” [3]
General: Moon, horses, horseshoe, songbirds, gates, the wind, and the number 7.
Animals: Horse, badger, frog, dogs (especially puppies), canaries and other songbirds,hummingbirds, and dragons.
Plants: Narcissus and daffodils, leeks, pansies, forsythia, cedar and pine trees [evergreens], bayberry, sage and rosemary,[jasmine, any white flower]
Perfumes/Scents: Sandalwood, neroli, bergamot, lavender, narcissus, and geranium.
Gems and Metals: Gold, silver, cat’s eye, moonstone, crystal, quartz, ruby, red garnet, bloodstone, turquoise, and amethyst.
Colors: Dark green, maroon, gold, silver, rich brown, white, black, charcoal grey, and ruby red. [4]
Sphere of Influence: Animals and fertility
Best Day to Work with: Monday
Suitable Offerings: Music
Associated Planet: Moon [5]
Aspects: Leadership, movement, change, death, fertility, crisis, magic for women, protection, strength and truth in adversity, dreams
Wheel of the Year: Willow Moon (Saille): April 15 – May 12
Ivy Moon (Gort): September 30 – October 27 [6]
Great Goddess, help me remember that times of sorrow are opportunities for the greatest growth. Rhiannon, I affirm that I have the courage to overcome my doubts and fears.
And here’s a great 13 minute video on Goddess Rhiannon, The Great Queen
Goddessgift.com, “Goddess Symbols: Rhiannon“.
LadyRavenMoonshadow. Within the Sacred Mists, “The Celtic Tradition of Witches and Wiccans“.
Monaghan, Patricia. The New Book of Goddesses and Heroines, “Rhiannon”.
PaganNews.com, “Rhiannon“.
Rhiannon – Divine Queen
Saille, Rowen. Order of the White Moon, “Rhiannon: Great Queen of the Celts“.
Barkemeijer de Wit, R. Celestial Journey Therapy, “Who is Goddess Rhiannon?“
Epona.net, “Later Influences of Epona“.
Goddessgift.com, “Activities to Invoke the Goddess Rhiannon“.
Goddessgift.com, “Meditations to Invoke the Goddess Rhiannon“.
Goddessgift.com, “Rhiannon, Celtic Goddess“.
Griffith, Carly. PaganPages.org, “Rhiannon“.
The Mabinogion, “Rhiannon“.
Monaghan, Patricia. The Encyclopedia of Celtic Mythology and Folklore, “Mórrígan” (p. 339 – 340)
Nemeton, The Sacred Grove: Home of the Celtic gods, “Rhiannon, A Cymric and Brythonic Goddess, also known as Rigatona: Great Queen“.
Revel, Anita. Reconnect with Your Inner Goddess, “Rhiannon“.
Shaw, Judith. Feminismandreligion.com, “Rhiannon, Goddess of Birds and Horses“.
Sisterhood of Avalon, “The Goddesses“.
Took, Thalia. A-Muse-ing Grace Gallery, “Rhiannon“.
Took, Thalia. The Obscure Goddess Online Directory, “Epona“.
Wikipedia, “Epona“.
Wikipedia, “Rhiannon“.
Tags: celtic mythology, communication, epona, feminine spirituality, fertility, ghosts, goddess, horses, leadership, moon, movement, rest, rhiannon, rigatona, scouring of the white horse, sisterhood of avalon, uffington white horse, welsh, white, white horse festival, white horses, white items, women's spirituality
Goddess Mala Laith
“Mala Laith’s themes are justice, community, peace, wisdom, knowledge, forgiveness, maturity and unity. Her symbols are the color gray, pigs, deer, the horse and birds. Known often simply by the designation ‘Gray One’, Mala Laith is the ancient Celtic crone Goddess. Mala Laith is said to have made the mountains and formed many stone circles, alluding to Her age and power. She travels in the company of birds, pigs, deer or a gray horse, carrying wisdom, knowledge, understanding, sensibility and preparation to us as gifts that come with maturity.
On this day, people on Mann honor Tynwald, the old Norse assembly system instituted over one thousand years ago, by gathering to discuss legal matters and end internal bickering. As they do, Mala Laith stands by, offering good counsel and sagacity. For us this means taking a moment out to make sure things in our life are in order and being properly attended to. Review your checking account, follow up on legal matters, make peace with someone from whom you’ve been estranged and generally spend the day focusing on sound action, wise words and sensible thinking. This invokes Mala Laith’s energy.
Wear something gray today to honor the Goddess and watch to see if any of Her sacred animals show up (in logos, on billboards, anywhere) during your day. If they do, pay close attention to their movements and actions. They’re bringing a message to you from Mala Laith, and it’s well worth heeding!”
“‘Grey eyebrows’ was the name given to the Cailleach in Ross and Cromarty in Scotland,” Patricia Monaghan tells us. “She was said to tend a herd of pigs, which included the wild boar of Glen Glass” (p. 205). As to be expected, Mala Laith “(pronounced MAH-lah LEE-ah) She is often equated with Cerridwen.” [1]
About Cailleach
“Cailleach” by Mairin-Taj Caya
“‘Cailleach’ (pronounced KAL-y-ach) derives from the old Irish caillech, or ‘the veiled one’. The modern word cailleach means ‘old woman’ or ‘hag’ in Gaelic. The Cailleach is a widespread form of Celtic hag-Goddess tied to the land and the weather who has many variants in the British Isles.
The Caillagh ny Groamagh (‘Gloomy Old Woman’, also called the Caillagh ny Gueshag, ‘Old Woman of the Spells’) of the Isle of Man is a winter and storm spirit whose actions on the 1st of February are said to foretell the year’s weather–if it is a nice day, She will come out into the sun, which brings bad luck for the year. The Cailleach Uragaig, of the Isle of Colonsay in Scotland, is also a winter spirit who holds a young woman captive, away from her lover.
The theme of winter holding spring captive is also seen in the tale that the Cailleach imprisons the beautiful young goddess Bride inside of a mountain over the winter. At Bride’s release, spring comes to the world.
“Cailleach Bhéara” by Max Dashu
The Cailleach Bheur (‘genteel old lady’) of Scotland is a blue-faced hag of winter, who ages in reverse–from old and ugly (symbolizing winter) to young and lovely (spring). The Cailleach Bhéirre of Ireland represents sovereignty over the land and is ancestress of many peoples. Like Dame Ragnell of the Arthurian legends, She appears to the hero as an hideous old woman seeking love; if She gets it, She becomes a beautiful young woman. In legends dating from Christian times, She is sometimes said to be a nun, perhaps linked to the meaning of Her name.
Alternate names: Cailleach Bheur, Cailleach Uragaig, Cailleach Beinne Bric (‘Old Woman of the Speckled Mountain’), Cailleach Mor (‘Great Old Woman’) (Scotland); Cailleach Bheirre, Cailleach Bolus, Cailleach Corca Duibhe (Ireland); Caillagh ny Groamagh, Caillagh ny Gueshag (Isle of Man).” [2]
Joelle. Joelle’s Sacred Grove, “Mala Laith“.
Monaghan, Patricia. The New Book of Goddesses and Heroines, “Mala Laith”.
Took, Thalia. A-Muse-ing Grace Gallery, “The Cailleach, Celtic Crone Goddess of Winter“.
Forest, Danu. Danuforest.co.uk, “The Cailleach, the old woman of winter“.
Mysterious Britain & Ireland, “The Caillech Bheur“.
PaganPages.org, “Cailleach“.
Metropolitan Films Ltd. Thisisirishfilm.ie, “An Cailleach Bheara (2007)“.
Shee-Eire.com, “Cailleach Beara“.
Sparrow. Journey Around the Wheel of Life, “Cailleach“.
The Suppressed History Archives, “Crone“.
Wikipedia, “Cailleach“.
WolfWinds, Silver. Order of the White Moon, “Cailleach“.
Tags: birds, bride, brighid, cailleach, caillech bheur, celtic mythology, ceridwen, cerridwen, cerridwyn, community, crone, deer, forgiveness, goddess, gray, hag, horses, justice, kerridwyn, knowledge, mala laith, maturity, peace, pigs, unity, wisdom
Goddess Rigantona
“Rhiannon” by Hrana Janto
“Rigantona’s themes are sports, excellence, magic, fertility, movement and travel. Her symbols are horses, the moon, white items and birds. A Roman/Italic form of Rhiannon, this Goddess travels the earth on a swift white horse, a lunar symbol, sweeping us up to travel along and get everything in our lives moving! Stories portray Rigantona in the company of powerful magical birds and She also represents fertility.
In Italy, people attend the Palio Festival, a horse race that started in the 13th century and has continued ever since as a time to show physical skill and cunning. It’s a perfect place for Rigantona to shine. Any type of physical activity that you excel in will please Rigantona today and encourage Her motivational energy in your efforts. Get out and take a brisk walk, swim, rollerblade. As you move, visualize yourself atop a white horse, the Goddess’s symbol, approaching an image of a specific goal. All the energy you expend during this activity generates magic for attainment.
If birds fly into your life today, pay attention to the type of bird and its movements, because birds are Rigantona’s messengers. Birds flying to the right are good omens, those moving to the left act as a warning of danger and those flying overhead indicate productivity in whatever you try today. If any of these birds drops a feather, keep it as a gift from the Goddess.”
Rhiannon (from the Mabinogion) by Alan Lee
Rigatona (pronounced REE at-on-a) meaning “Great Queen” is thought to be from where the Welsh Goddess Rhiannon’s original name derived. “Continuation of the name would indicate the existence of a Brythnoic Goddess known as Rīgantona, though no trace of Her (save for the name of Rhiannon) has been left to us. Whether this Rīgantona was an independent deity or represented an aspect of Epona (who is occasionally referred to in the plural and may be a triple-Goddess) may not be known for certain though the surviving tales of Rhiannon would suggest the later interpretation. Thus there may once have been an insular Brythonic deity known as Rīgantona Epona.
Rhiannon’s name is directly cognate with the Irish goddess Mórrígan (which also menans ‘Great Queen’). In terms of attributes, however, Rhiannon is most closely similar to an sapect of the triple-Goddes, Mórrígan known as Macha; a Goddess of war, horses and kingship.” [1]
Rhiannon is a potent symbol of fertility, yet She is also an Otherworld and death Goddess, a bringer of dreams, and a moon deity who is symbolized by a white horse. Her father was Heveydd the Old, and She was married to both Pwyll and Manan. The story of Her marriage to Pwyll, and the subsequent accusation of the murder of Her child, is well documented and most people are familiar with Rhiannon from this tale. [Click here to read Her tale].
“Rhiannon” by Jan Hess
ASSOCIATIONS (Rhiannon):
Animals: Horse, badger, frog, dogs (especially puppies), canaries and other songbirds, hummingbirds, and dragons.
Tags: 7, birds, brythonic, epona, epona-rigatona, excellence, fertility, gallo-brittonic goddess, gaul, goddess, great queen, horses, hummingbirds, italic goddess, mabinogi, mabinogion, macha, magic, manannán, manawydan, marazanna, moon, mora, morrigan, movement, palio di siena, palio festival, pwyll, rhiannon, rigantona, rigantona epona, sisterhood of avalon, sports, The Four Branches of the Mabinogi, travel, welsh, white horses, white items
Goddess Saules Mate
“Saule” by Lisa Hunt
“Saules Mate’s themes are the sun, prayer and protection. Her symbols are the sun, fire, yellow/gold items, horses and birch. Saules Mate comes to us from Indo-European tradition, Her name meaning ‘sun’. Indeed, with the sun reaching its highest point today, She becomes the center of our festivities. Saules Mate crosses the sky during the day in a carriage drawn by yellow horses, then travels the waters by night in a golden birch boat, hanging a red scarf in the wind to give the sky its lovely color.
In magical traditions, we stop for a moment on this day to mark the sun’s halfway point through its annual journey. Traditionally, this is a time to harvest magical herbs, but do so before Saules Mate gets too bright in the sky; Her heat diminishes the natural oils in the herbs. Remember to leave an offering for the Goddess so She will empower these herbs – perhaps some ground birch wood that acts as plant mulch!
Purify yourself by jumping the ritual fire (or a candle) today, then burn a wish in Saules Mate’s fires to release it into Her care. And use this invocation to Saules Mate for part of personal magic today (for the southern quarter of the magic circle):
‘Powers of fire, reach ever higher. Saules Mate, bring your light; the power to ignite. Salamanders prance in the magical dance, by your power and my will, this sacred space fill!'”
“Saule” by Helena Nelson-Reed
“Saule (pronounced SEW-lay) means ‘the sun’ and is the most powerful of Latvian heavenly Goddesses. She is the Goddess of the sun and of fertility, the patroness of all unfortunate people, especially orphans (as the only one to substitute the mother, to warm the child; mother is compared to Saule speaking of kindness, and bride as speaking of beauty). She is the mother of Saules meitas or meita (plural or singular). She is said to live on the top of the heavenly mountain (some model of world), where She rides during the day in Her chariot. At night She sails with Her boat on the world sea. The motif of permanent motion is apparent in this image, as well as the idea of the sun shining somewhere else during the night. Of course, the diachronic aspect is to be taken into account. In several cases She appears as the ruler in heaven, especially in relations with Meness.” [1]
Patricia Monaghan tells us that “Saule ruled all parts of life, from birth into Her light to death when She welcomed souls into Her apple tree in the west. Even the name of the ocean on which the Balts lived was Hers, named for Balta Saulite (‘darling little white sun’). She was worshiped in songs and rituals that celebrated Her nurturance of earth’s life, for She was Our Mother, called various names like Saulite Mat (‘little sun-mother’) and Saulite Sudrabota (‘little silver sun’).
She was married in the springtime of creation to the moon man Menesis. Their first child was the earth; after that, countless children became the stars of heaven. Saule was a hardworking mother, leaving the house at dawn each day and driving Her chariot across the sky until dusk. Menesis, however, was fickle and carefree, staying home all day and only sometimes driving his moon-chariot. The light of Saule’s life was Her daughter (variously named Austrine, Valkyrine, and Barbelina, but most generally called Saules Meita, the sun’s daughter), the beloved lady of the Morning Star (or Venus).
Each evening, after She had bathed Her weary horses in the Nemunas River, Saule looked for the child. But one evening She could not find Her – for in Her absence, Saule’s beautiful long-haired daughter had been raped by Menesis.
Art by Marilyn Todd-Daniels
Furious beyond words, Saule took a sword and slashed the moon’s face, leaving the marks we see today. Then She banished him forever from Her presence; thus, they are no longer seen together in the sky – the end of the happy paradise before the evil came into our world.
Saule was worshiped every day when Her people would bow to the east to greet Mother Sun. But she was especially honored on summer solstice, Ligo, when She rose crowned with a braid of red fern blossoms to dance on the hilltops in Her silver shoes. At that moment, people dived into east-flowing streams to bathe themselves in Her light. All the women donned similar braided wreaths and walked through the fields, singing Goddess songs, or daina. Finally, they gathered around bonfires and sang the night away.
“Sophia of the Heights” by Freydoon Rassouli
Because LIthuanian is the oldest extant Indo-European language, it is thought that the Baltic mythologies hold clues to the original beliefs of the people. But scholarly convention has it that the Indo-Europeans worshiped a sky father embodied in the sun. Whence, then, this powerful sun mother? Marija Gimbutas, herself Lithuanian, believed Saule to be an Old European Goddess of that woman honoring culture that preceded the Indo-European invasions; Saule was to give way to a male solar divinity. But sun Goddesses in other Indo-European areas show there is room for study” (p. 274). (See my entry on Sól)
The most Latvian of holiday, “Ligo!” Below, a video featuring an in-depth explanation of the traditional Ligo! festivities, by Latvia tourism.
Monaghan, Patricia. The New Book of Goddesses and Heroines, “Saule”.
Putelis, Aldis. Encyclopedia Mythica, “Saule“.
Agaliha. Mystic Wicks, “Saule {Goddess of the Week}“.
The Blue Roebuck, “Saule“.
Dunduliene, Prane. The Sage Grove, “Forgotten Goddesses – Saule“,
Monaghan, Patricia. The Goddess Path: Myths, Invocations & Rituals.
Wikipedia, “Latvian Mythology“.
Wikipedia, “Saulė“.
Tags: austrine, aušrinė, balta saulite, baltic, barbelina, birch, fire, goddess, gold colored items, horses, latvian, meness, mother, prayer, protection, saules mat, saules mate, saules meita, saules meitas, saulite mat, saulite sudrabota, saulė, sun, valkyrine, yellow colored items
Goddess Epona
“Epona” by Joanna Barnum
“Epona’s themes are protection of animals; especially those who serve humankind. Her symbol is the horse. Epona protects the creatures who faithfully keep humans company. This pre-Roman Gaulish Goddess is nearly always shown riding or lovingly feeding a horse and accompanied by a dog – these are Her two sacred animals. Also, sometimes depicted with corn in Her lap and carrying a goblet, Epona inspires love, fertility and providence in your life. In some myths, Epona appeared to acknowledge a king’s sovereignty, giving Her leadership qualities that can help you when you need more authority in a situation.
To generate a little more providence in your life, eat corn today. Say a silent prayer to Epona, asking Her to saturate your food with power, then consume it to internalize the energy.
If you have a pet, consider blessing it today. To do this, find a small silver charm or a horse or a dog (like those from charm bracelets). This image invokes Epona’s protection. Alternatively, use a little bell and draw the image of a horse or dog on it.
Hold the token cupped in your hands. Visualize it filled with glittery white light and say,
‘Epona, watch over_____________ [fill in with the of the animal]. Keep them safe and healthy no matter where they may be.’
Put the charm on the animal’s collar or cage or in it’s bedding.”
“Epona (pronounced Ey-PONE-ah) was the ancient Horse Goddess of the pre-Christian Pagan people, known as the Gauls, or Celtic French. She was worshipped for many hundreds of years as a Horse Goddess, who not only protected horses, but also their owners. Epona is also one of the most well known of all the Goddesses within the Celtic Pantheon, and She was granted such titles as ‘The Great Mare,’ the ‘Divine Mare,’ and the ‘Mare Goddess.’
Epona was worshipped throughout the entire Celtic world in a variety of other, different aspects. In Ireland she was known as Macha, the Goddess of War, while in Wales She became Rhiannon, the Goddess of the Underworld. It was in the aspect of Rhiannon that Epona appears in the Welsh collection of tales known as The Mabinogion. She has also been identified with the Celtic Goddess Edain, or Etain, whose full name, when translated, is Etain Echraidhe, which means ‘Etain, the horse rider,’ or ‘Etain, the rider of horses.’
Epona was worshipped widely throughout the entire Celtic and Roman worlds, and Her worship was exceptionally strong in both Rhineland and Gaul. In fact, Epona’s worship became so strong that it spread as far away as the Danube River, Yugoslavia, North Africa and Rome. The Roman army was so impressed by Her that it eventually adopted Her cult, and the Roman soldiers introduced Epona’s worship to the many people that they encountered in their travels.
The British worshipped Epona in the form of a cult, and they gave Her the title ‘Rigantona‘ or ‘Rig Antonia,’ which means ‘Great Queen.’ The Goddess Rhiannon, whose worship occurred at a much later point in time, was strongly associated with Epona, and She was known by that title as well.
“Epona the Horse Goddess” by Gene Avery North
Epona was also known by a variety of other names, which changed according to the various languages and myths that were indigenous to each particular region. It actually matters little whether She was known as Rhiannon, Macha or Epona, because no matter which aspect She happened to appear in, Her image always remained the same. She appeared as a woman with very long hair who was riding side saddle upon a white mare. When She appeared in the aspect of Epona, however, She was depicted as a woman with very long hair, lying half-naked on a white mare.
Stories about Epona [are] lost to the world forever, although one story regarding Her origin remains. During the decline of the Roman Empire, a Greek writer named Agesilaos wrote a story in which he claimed that Epona was the product of a man named Phoulonios Stellos, who had no interest whatsoever in women. Instead of mating with a woman he preferred to mate with a mare, and when that mare gave birth, it was to a beautiful human-looking daughter. Interestingly, it was actually the mare, herself, who named her daughter Epona, and by her doing so, she deified Epona as the Goddess of Horses.” [1]
Patricia Monaghan tells us that “Epona could take the tangible forms of both parents. Sometimes, too, She appeared as a rushing river, which suggests that Epona was a fertility Goddess, often seen in Celtic culture as a water spirit. Similarly, the connection among Celtic peoples of the horse and the sun suggests a solar nature to Epona, supported as well by the patera or round sunlike plate that She carries in many sculptures.
The sacred mare Epona appeared as the bestower of sovereignty in the ancient Celtic rituals of kingship, which may have included a rite of marriage with the mare Goddess. Among Indo-European peoples in India, a rite of mare-marriage, which solidified a man’s claim on the rulership of a geographical area, is attested and has been connected by scholars to the figure of Epona.
Aerial view of the Uffington White Horse
Recent excavations of the magnificent British monument, the White Horse of Uffington, strongly suggests that the 360-foot-long horse represents Epona. Using a new technique, archaeologists have been studying the rate at which the hillside, upon which the White Horse is carved into the chalky soil, has descended towards the deep valley (the Vale of the White Horse) beneath. The White Horse has puzzled researchers for many years, some maintaining that it was a late medieval creation, others that it derived from the post-Celtic era. Even before the recent attempt to date the monument itself, it has been noted that the horse’s design echoed that of coins issued by the Celtic warrior Queen Boudicca. The identification of the White Horse with the Celts is now virtually certain – and as the Celts had only one horse-divinity, the likelihood is that the horse on the hill was Epona. Vestiges of Her are also found in the figure of Lady Godiva and the mysterious white-horse-riding woman of Banbury Cross” (p. 114).
On an Etsy.com page selling a replica of an Epona statue found in Alesia, France, I found a piece of information especially inspiring:
Epona in our everyday lives
“Although Epona was and still is traditionally seen as a horse Goddess, She can fit into so many aspects of our lives. She is the Goddess of dreams not only of the sleeping kind but the dreams of hope and ambition. She can be helpful in manifesting dreams and is a good protector to have when venturing on a new path in life. A prayer or invocation can be offered to Her if one is having trouble sleeping or wishes to have insightful or peaceful dreams. She is a nurturing caregiver and can be called upon as a protector of families, children and women who are about to give birth.
Epona is also good to turn to when seeking positive blessings and prosperity. She is good to call upon during dark, difficult times in life such as grief and loss and can offer guidance that is gentle and loving in nature. Roses are a wonderful offering to leave on your altar for the Goddess Epona as are rose petals or rose incense. Sandalwood incense can also be used as an offering. When burning a candle for Epona, the most common color associated with Her is white.” [2]
Pantheon: Celtic
Sphere of Influence: Horse and Motherhood
Preferred Colors: Brown, black and white
Associated Symbol: Horse, cornucopia, keys
Animals Associated with: Horse, mares and foals, dog, birds.
Suitable Offerings: Fruits, mare’s milk, apples, hay, sweet grass, oats, fresh water, a thick stout that you can practically chew on. Roses, rosebuds, rose garlands.
Scents/Incense: Rose, sandalwood.
Gemstones: Cat’s eye, ruby, azurite, obsidian, and moonstone
Astrology: Aries
Tarot: Queen of Wands
Chakra: The sexual and heart chakras
Feast Days: The Autumn Equinox, when night and day are of equal length, occurs during the month of the Vine Moon; December 18 (based on the Roman calendar).
Etsy.com/shop/Harmonycraft, “Epona – Celtic Horse Goddess“.
A Journal of a Poet – The Goddess As My Muse, “Epona, The Gaulish Horse Goddess“.
Monaghan, Patricia. The New Book of Goddesses and Heroines, “Epona”.
PaganNews.com, “Epona“.
Revel, Anita. igoddess.com, “Epona“.
Tribeofthesun.com, “Epona“.
EPONA.net (An in-depth Epona site with historical facts about Epona)
Firewolf, Dawn. Realmagick.com, “Epona“.
Held, Catherine Anne. Dreamhorsewomen.wordpress.com, “Women and Horses in Mythology: Epona“.
Lady Zephyr. Order of the White Moon, “Epona“.
Myst, Willow. Order of the White Moon, “Epona“.
Nemeton, The Sacred Grove: Home of the Celtic gods, “Epona: A Gaulish and Brythonic Goddess: Divine Horse“.
Readtiger.com, “Epona“.
Tags: 4, 8, animals, apples, aries, autumn equinox, azurite, black, brown, cat's eye, celtic mythology, cornucopias, dogs, epona, gaul, goddess, heart chakra, horses, lady godiva, macha, moonstone, mother, motherhood, obsidian, queen of wands, rhiannon, rigantona, ruby, sacral chakra, uffington white horse, vine moon, white, white horse
Goddess Macha
“Macha’s themes are victory, success, protection, fertility and fire. Her symbols are red items, the acorn and the crow. Macha means ‘mighty one.’ Macha used Her potency to clear the land for wheat, giving Her associations with fertility. She also used Her might to protect the Celts’ lands agains invaders, thereby becoming a war Goddess and guardian. Art shows Her dressed in red (color abhorrent to evil) and with blazing red hair, forever chasing off any malevolence that threatens Her children’s success.
Bonfire Night in Scotland takes place around May 22 and is a festival that originally had strong pagan overtones, the fires being lit specifically for ritual offerings that pleased the Gods and Goddesses and invoked their blessings. Additionally, the bright, red fire looked much like Macha’s streaming red hair, and thus it banished any evil spirits from the earth. So don any red-colored clothing today, or maybe temporarily dye your hair red to commemorate this Goddess and draw Her protective energies to your side. Eating red foods (like red peppers) is another alternative for internalizing Macha’s victorious power and overcoming any obstacle standing in your way.
Or, find some acorns and keep them in a Macha fetish bag (any natural-fiber drawstring bag). Anytime you want her power to manifest, simply plant the acorn and express your wish to it. Macha’s potential is in the acorn, ready to sprout!”
The Morrigan
“Macha (pronounced MOCK-uh) is an Irish war Goddess, strongly linked to the land. Several Goddesses or heroines bear Her name, but She is generally thought of as one aspect of the triple death-Goddess the Mórrígan (the “Great Queen” or “Phantom Queen”), consisting of Macha ‘Raven’, Badb ‘Scald Crow’ or ‘Boiling’, and Nemain ‘Battle Fury’. Macha is associated with both horses and crows.
The Mórrígan is both sex and battle Goddess, and Her personality is usually described as both war-like and alluring. She is known to be a prophetess: the Washer at the Ford is said to be one aspect of Her, who appears to those about to die. She is commonly shown washing bloody clothes at a river ford; when approached, She tells the enquirer the clothes are theirs. Like the bean sidhe (banshee), who She is believed related to, She is an omen of death.
As Goddess of the land, the Mórrígan are said to be cognate with Ana or Danu, and Macha is said to be one of the Tuatha de Danann.
Three other aspects of Macha feature in Irish folklore, which likely derive from a common Goddess, as they are all said to have a mother named Ernmas (also considered to be the mother to Ériu, Banba, and Fódla, sacred names for Ireland). One Macha, a seeress, was the wife of Nemed ‘Sacred’, who invaded Ireland and fought the Fomorians in Irish legend. Emain Macha, a bronze-age hill fort in Northern Ireland, and legendary capital of Ulster, is said to have been named for Her.
The second Macha, titled Mong Ruadh (“red-haired”), was a warrior and Queen, who overpowered Her rivals and forced them to build Emain Macha for Her.
“Curse of Macha” by Stephen Reid
The third Macha, and probably the most well-known, was said to be the wife of Crunniuc. Like many supernatural lovers, She warns him to tell no one of Her existence; but he boasts to the king of Ulster that his wife can outrun the fastest chariot. The king then seizes the very pregnant Macha and forces Her to run a race, against Her protests. In spite of this, She does win, and as She crosses the finish line She gives birth. In Her dying pain and anger She curses the men of Ulster to nine times nine generations, that in their time of worst peril they should suffer the pain of childbirth.” [1]
The Goddesses of Ireland and their “fall” as Christianity spread into Ireland
“The Goddess was a ‘dual-natured female figure, beautiful and hag-like by turns in whose gift was great power’. The Goddesses were especially depicted in three’s, such as Eriu, Banba, and Fotla, all Goddesses of sovereignty. In the 11th century, Ireland was often called Eire (a form of Eriu) and also called ‘the island of Banba of the women’. Goddesses were often hybridized by Roman and Greek influences, but this did not seem to obscure the native elements. For example, Julius Caesar likened one Celtic Goddess to Minerva, a classical deity. In fact, some Celtic Goddesses seemed to share certain of their characteristics. However, there were no Celtic Goddesses of love. There were Goddesses more often associated with fertility and the natural cycle of life, including death. Perhaps most importantly, the Goddesses represented creativity especially as it related to giving life, in all its aspects.
The female warrior Goddesses respect for death, as a natural part of life, which seemed in translate into ‘real’ life as well. This is best seen in the symbolic marriage between the king and the Goddess of sovereignty. This union was to ‘ensure fertility for the land and for his people in the year to come.’
“Triple Goddess” by Amy Swagman
The role of the Goddess in Celtic Ireland was important in to the inter-relatedness with human woman: ‘Since the source of life was so integrally associated with women, it would seem to follow that the origins of life were female. At times of joy or moments of pain, humans would turn to the Goddess who was honored in Her many guises’ (Condren). It would not seem strange then to worship a female deity and consequently treat her female subjects with respect and honor. Descent was also often traced through the mother and a strong emphasis was placed on the mother relationship. However, conservative scholars are quick to point out that the power did not entirely rest on women, rather the focus appears to be on women. Life was of tremendous value in what appears to be the most natural, physical sense. Hence the importance of the woman, Goddess or human.
‘Women were highly honored, female symbolism formed the most sacred images in the religious cosmos, and the relationship with motherhood was the central elements of the social fabric the society was held together by common allegiance to the customs of the tribe loosely organized around the traditions of the Goddess’ (Condren).
What appears to have dismantled this society was the warrior culture and the spread of Christianity into Ireland. The story of Macha is an instructive example of the ‘fall’ of the Celtic Goddess and in some sense the fall of the Celtic woman. Macha (Ulster Epona, the horse Goddess) marries Crunnchua mac Angnoman a rich widower. The two prosper together until one day, Crunnchua wishes to go to the annual assembly of the Ulsterman. Macha pleads with him not to go, but Crunnchua insists. While at the assembly, Crunnchua witnesses a horse race. Those in attendance with him, including the king himself, declare that none can run faster than these horses. Crunnchua knows that his wife can outrun these horses with no problem and decides to challenge the declaration. The king, angered at Crunnchua’s arrogance insists that Crunnchua bring Macha to them for a match. Macha comes reluctantly, but before doing so, pleads, ‘Help me, for a mother bore each of you. Give me, oh, King, but a short delay until I am delivered.’ Macha is pregnant.
“Macha” by Caroline Bradley
This request and the king’s subsequent refusal are striking reminders of the changes that took place not only in the Irish sagas such as this one, but also the changes in the societies that ‘authored’ such work that became, significantly, myth. The king’s ultimate responsibility was to allow the ‘creativity of women to prosper.’ Kings were to promise that no one would die in childbirth, food should grow plentifully, and the traditional dyeing (a woman’s art) would not fail. These promises were related to the ‘needs and concerns of women, and unless the king could be seen to take care of the cultural and fertility needs of the clan, symbolized by these women’s activities, the king would be overthrown’. The king as evidenced in this story, violated the promises he made and instead of being overthrown, is permitted to continue his reign with no apparent resistance from his constituents. This portrayal of Macha is actually the last of three major cycles. In the first She is a brilliant, strong mother-Goddess. In the second She is a helpless (but wise) wife, and the third She is relegated to an existence of shame and forced to abandon Her life-giving gifts, adapting to the new warrior ethos. This is how She had traditionally become associated with the three war-Goddess spiral, joining Badb and Morrigan. The appearance of the war-Goddess appears to develop as a result of the change in Celtic society to one of violence and paradoxically, Christianity.
“Gift of Peace to a War Goddess” by Portia St.Luke
Macha evolves into a warrior-Goddess as the simultaneously the status of women decline in societies constantly under attack, where emphasis is placed on death and bloodlust rather than on life and respect for death. With this, men began to feel threatened by women as well, by any force seen as competition. Importantly another aspect of the decline of Macha (and other Goddesses) was the Christian clerics who began to satirize the Goddesses because their patriarchal system of beliefs stood in direct contrast especially to the worship of a female deity. Goddesses were becoming as violent as the society that ‘created’ them. They were raped, murdered and often died in child birth.
Peter Berresford Ellis in his book, Celtic Women, Women in Celtic Society and Literature, concurs with Condren that Goddesses in literature were often raped, died in childbirth and their status was destroyed by the symbolism of the rape.
The Goddesses, however, gave birth to great men who would in turn become great warriors. Indeed, ‘the famous warrior society triumphed over the culture of the wise women’. Several sources consulted point to the war-Goddess as a symbolic adaptation to the culture who called on Her to wreak death and destruction. The war-Goddess is often portrayed too with a voracious sexual appetite. Ellis quotes Moyra Caldecott:
‘Her twin appetites for sexual gratification and for bringing about violent death are a travesty of the very necessary and natural forces of creation and destruction that keep the universe functioning and imbalance of which brings about disaster’. [2]
Wow…After reading this excerpt from the University of Idaho’s site, it all made so much more sense and brought it all home for me. I had read in several books that stated that many peaceful agricultural societies worshipped a mother Goddess type deity(ies) who presided mainly over life cycles, vegetation, and agriculture; that it wasn’t until the invasions of the violent war-faring Indo-Europeans that “swept through Old Europe, the Middle East and India bring[ing] their priests, warriors and male gods of war and mountains” [3] with them that the Goddesses started becoming less important, more subservient and taking on more violent and warlike qualities. Truly, this is not limited to the Celtic culture – look at Inanna for example; or Minerva who evolved from an Italic moon Goddess, into an Etruscan virgin Goddess of poetry, medicine, widsdom, commerce, weaving, dyeing, crafts, the arts, science and magic and later, the Romanized Goddess became associated with war. Venus who originally was a vegetation Goddess and patroness of gardens and vineyards who had no original myths of Her own became associated with love, fertility and even war under the name Venus Victrix, the Goddess of victory in war. And let us not forget how Goddesses like Inanna, Asherah and Lilith were demonized by the Abrahamic patriarchal religions for refusing to submit to them and their “all powerful” male deity.
“Morrigan” by Michael C. Hayes
I think it only appropriate to conclude with some words from Jani Farrell-Roberts, “Women often had to fight in the wars. They needed a Goddess of the Battlefield as did the men (thus their talk of heads being ‘the mast of Macha’) – and so grew the myth of the Morrigan into which the kinder harvest Goddess Macha was subsumed as part of a triple Goddess with Her two sisters, Badb and Morrigan. In Britain She was probably Morgan. The Morrigan however came to be hated by men who dreaded the female power She represented – so men tended to depict Her as a hag – or as three hags (perhaps as reflected in Shakespeare‘s Macbeth).
But in the old sagas Her role is much more that of the healer of the wounded and of the taker of the spirits of the dead into the next world. For example, Macha is depicted in these myths as the Sacred Cow whose milk is an antidote to the poison of weapons. She had become the Mother on the Battlefield.” [4]
Sphere of Influence: Protection and sex
Preferred Colors: Red, black
Associated Symbol: Raven
Animals Associated with: Raven, crow
Strongest Around: Lughnasadh
Suitable Offerings: Acorns
And now, a tribute to the great Goddess Macha and Her stories…
Eisler, Riane. Iowa State University, “The Chalice and Blade“.
Farrell-Roberts, Jani. The Web Inquirer, “Macha, Brighid, the Ancient Goddess of Ireland“.
PaganNews.com, “Macha“.
Took, Thalia. A-Muse-ing Grace Gallery, “Macha“.
University of Idaho, “Celtic Women: Myth and Symbol“.
Aisling. Order of the White Moon, “Macha“.
AncientWorlds, “Epona“.
Bar, Tala. Bewildering Stories, “Goddesses of War“.
Jones, Mary. Maryjones.us, “Macha“.
Shee-Eire.com, “Macha“.
Skye, Michelle. Goddess Afoot!: Practicing Magic with Celtic & Norse Goddesses, “Macha” (p. 166 – 181).
Wikipedia, “Macha“.
Tags: acorns, badb, banda, banshee, battle, bean sidhe, celtic mythology, crows, crunniuc, danu, death, epona, eriu, fertility, fire, fodla, goddess, horses, Ireland, macha, morrigan, mother, nemain, protection, raven, red items, sexuality, success, tuatha dé danann, ulster, victory, war
|
cc/2020-05/en_middle_0097.json.gz/line1399821
|
__label__wiki
| 0.861409
| 0.861409
|
ROCKMEETING 5/5
FIREWORK MAGAZINE 9/10
METAL TEMPLE 10/10
CLASSIC ROCK AOR ISSUE 11. 7/10
SWEDEN ROCK MAGAZINE 7/10
Mikael Erlandsson (Last Autumn 's Dream) - Is a name that stands for quality music. If you add Martin Kronlund (guitar, Gypsy Rose , Phenomena) , Perra Johanson (drums , Coldspell) and Mikael Carlsson (bass) you get Lover Under Cover, and this is their second album. The developments since the debut "Set the Night on Fire " (2012) is not overly big, but certainly noticed when they have get a little harder. As shown by the wisecracking borrowing of Diamond Heads old earring " Am I Evil " before the chorus in "Playboy no 7 ". Of course it's still on melodic hard rock of the Scandinavian school - not unlike Michael and Martin's band Salute . When Michael presses his voice as the hardest he reminds strongly of how Michael Voss (Mad Max) sang in the early years of Casanova. It's so fantastic good. Just listen to "The game is on". On the paper feels Martikas old hit " Toy Soldiers " not as an exciting choice of cover song - the result , however, say something completely different.
UBERROCK
THE ROCKPIT 4/5
MELODIC ROCK 90/100
CLASSIC ROCK MAGAZINE ISSUE: MARCH 2014
GLORY DAZE 9/10
POWERPLAY MAGAZINE ISSUE 162. 7/10
DANGERDOG 4/5
HARD ROCK HEAVEN 9/10
METAL INTEGRAL 17/20
METAL GLORY
Attention AOR, hard rock fans and fans of the band LOVER UNDER COVER - comprising members from groups such as Last Autumn's Dream, Coldspell , and Gypsy Rose . All of these bands should be household names with fans of the genre, now working together again under the banner of Lover Under Cover, who had their first album out about 1 year ago.
So now on to album number two and immediately the opener " A Fight" has the radio friendly melodies and is a worthwhile listen. Followed by "Into the shadows" which sounds like the soundtrack to a hit 80s TV series which then made it into the charts. You would expect something cheesy and soft with "Toy Soldier" , yet the melodies here are also outstandingly arranged. Set in the middle of all the big hard rock songs like Life is Easy, Playboy No.7 and the Game is On, although they are very tidy, they are not absolutely revolutionary within the genre .
With " No place like home" there is another slight West coast / AOR flavour , a nice change when chilling out , LOVER UNDER COVER have recorded a significantly better album for their second offering. Even if the majority of the stronger songs are to be found in the first quarter of the album. Hard rock fans should still listen to this second album from the band , however, be prepared that the AOR here is usually harder and little edgy , but perfectly delivered
LADY OBSCURE
ROCK METAL 4YOU 7/10
MINIZINE BEROCK 9/10
The Swedish super band LOVER UNDER COVER is back after more than a year since the debut album "Set the Night on Fire " was released . This "super band" consists of drummer Perra Johnsson from Sweden's northernmost export , ColdSpell , Martin Kronlund , the producer who also plays guitar with Gypsy Rose and Salute, Mikael Erlandsson, who is one of the hardest working singers in , among others, Last Autumn 's Dream and Salute and Mikael Carlsson, who is the band's bassist and engine but simultaneously not previously had any major successes more than that he once played alongside Mikael Erlandsson in the band Rain .
"Set the night on fire" was a really good debut album which I especially liked that the songs were good , and that again that Mikael Erlandsson sing rock . After Years of multiple Last Autumn 's Dream albums, I think has made him more and more blase as a singer since the band's tiles just gets sadder and sadder . When LOVER UNDER COVER now returns with his second album , " Into the Night", so unfortunately it 's raw and shabby given way to a more polished surface when the production is a little too undistinguished to my taste. But this band is still far more interesting than Michael E's other big successful band!
This is about very experienced musicians and the AOR as the band plays is also very " experienced " . It is very good and well written songs straight through the entire album , but it will also become a little indistinct and uninteresting at times . For once , it's a cover that was first to my taste , and they have chosen a rather odd song to take their own sound . It is Martikas big pop hit "Toy Soldier " which the band actually doing superbly well and Erlandsson making one of their very best efforts. Another trail , of his own harvest, which is really lovely is "Into The Shadows " and here you can hear Michael's greatness when he uses his soulful rock voice . It is soft and confident in the verses , while he empties all his power in the lurch and then sit back in the neat melodic chorus.
"Miracle" is also a song that I hold as one of the better. With a sleek , heavy and simple guitar in initial stage , a catchy verse and an irresistible chorus that makes the song remain in memory for a long time. Additionally , I must also mention the wonderful glorious " Life is easy" , a track that describes the AOR , I would say ; positive melodic , simple and really good ! The remaining songs on the album is still good, but these songs lack the ease of getting caught with his chorus or with the hook, if you know what I mean. Chorus of " Fantasy Man" is perhaps an exception , the way to the chorus gets easily forgotten . It is routinely done but maybe not with the whole heart .
LOVER UNDER COVER 's sequel is sure to satisfy everyone who bought the debut , because it's an album that almost lives up to its predecessor. But the debut was better, it can not be denied ....
ROCKANGELS
METALLUS
FULL THROTTLE ROCK
BURRN MAGAZINE JAPAN 84/100
Bandmates 30 years ago Mikael Erlandsson (vocals) of Last Autumns Dream & Mikael Carlsson (Bass) reunite for their second album together as Lover Under Cover. They are joined on drums by Perra Johansson (Coldspell / Rage of Angels) & Martin Kronlund (Dogface / Salute) on guitar.
Mikael Carlsson has created a melodic hard rock album whose tracks are brought to life by Mikael Erlandssons distinctive husky vocals similar to the dynamic & powerful work with Last Autumns Dream. This album is not as raw as their first outing together but is a more melodic offering. The album is excellently produced and the material is varied. Mention goes to the 4th track which is a darker more atmospheric version of Martika's 1989 US No. 1 'Toy Soldiers'. The atmospheric quality of the track being a perfect fit for Mikael Erlandssons expressive voice.. There is also a bonus track (12) for Japan only.
HEAVY PARADISE 9/10
AOR WATCHTOWER
Lover Under Cover debuted in the AOR/Melodic Rock universe with the excellent “Set The Night On Fire”, but despite being a new act, the band had no newcomers in its lineup, comprised by seasoned musicianas such as vocalist Mikael Erlandsson and the multi instrumentalist Mikael Cralsson, together with guitaritst Martin Kronlund and drummer Perra Johnson. With a fine album as their debut, the inevitable question is : will they be capable of keeping the level up? The answer is a loud NO. The level hasn’t been kept, it’s been RISEN!!! With no obvious improvement in the melodic department, Lover Under Cover brings a more relaxed Mikael Erlandsson, who delivers top notch performances of the excellent songs included on the album.Layers and layers of well-placed keyboards share space with omnipresent guitars, as you can easily check on the totally excellent “Crushing Stones”, “Life Is Easy”, “Playboy #7”, “Closer To The Truth” (that sounds a looot like Last Autumn’s Dream) and “No Place Like Home”.It’s also worth mentioning “A Fight”, “Miracle” and the cover version for “Toy Soldiers”, originally recorded by Martika in 1988. The new version sounds a little heavier and has a more contemporary aura, making it one of the highlights of the album.If you enjoyed Lover Under Cover’s debut album, I’m pretty sure “Into The Night” will make you fall for it as well. The album hits stores on Jan. 24th, on Escape Music.
ROCKREPORT
GET READY TO ROCK ME
METAL IT
The task of a second album by a "supergroup" is something that shouldn't be underestimated, even nowadays when collaborations are "in fashion" and are largely facilitated by tthe wonders of technology and "globalization."For a project to work there must be a subtle blend of art and alchemy between the protagonists and then between the artists and the public, waiting to be impressed.
The positive feedback received by their debut album 'Set The Night On Fire' must have convinced Mikael Erlandsson (Last Autumn's Dream, Health, ... one who is well accustomed to the practice of "cooperation" already ...), Martin Kronlund (Gypsy Rose, Health, Phenomena, Dogface), Perra Johnsson (Coldspell) and Mikael Carlsson (Rain, alongside Mikael Erlandsson) to work on a new album under the name Lover Under Cover for the enthusiastic fans of melodic hard rock with Nordic roots.
So, "Into the Night" is a successful and engaging mix of Treat, Da Vinci, TNT and Skagarack, with hints of Damn Yankees, Dokken, White Lion and Bon Jovi. Nothing "revolutionary," then, or that has not been experienced before in performances of Last Autumn's Dream, Health and Coldspell, yet the quality of the disc is such that the overall experience is a technically consistent and emotionally cool and rewarding one, basically everything you would ask for in an album Arrangements are always very convincing, adding a bit of "modernity" to a genre that can sound dated, add in some impressive compositional skills, "sensitive" and incisive guitar work by Carlsson (also responsible for a brilliant harpsichord arrangement) and Kronlund, a precise rhythm section, even more eloquent is the wonderful voice of Mikael Erlandsson, inescapably bewitching,, taking the listeners hand, leading them to the Church of Melodic Rock.
The resonance of "A fight," some flashes of hard-blues (that would make The Rasmus jealous!) on "Into the Shadows", the traces of proto-glam in the track "Miracle", the spirited sophistication of "Crushing stones" and the chrome -metal class of "The game is on" evidences their eye-catching and expressive power, while the masculine and seductive touch of sentimentality on "Life is easy", " Fantasy Man "and" No place like home ", skilfully blend to make a rich and varied emotional assortment.
Slightly less effective are the ' hard number 'Playboy No.7 " and the Scandinavian AOR "Closer to the Truth" but a deserved final mention is due for the beautiful cover of "Toy soldiers", a huge hit in the eighties by Martika, a name that will inevitably evoke many fond memories , but I am sure that music lovers will remember the evocative melody of the song (captured perfectly here), filling their senses as much as the face of the pretty brunette did.
In short, this album is highly recommended.
METALFACTORY
CHORDS AND KEYS
Into The Night is Swedish band Lover Under Cover's follow up to their well received debut album ' Set The Night On Fire ' from 2012. You now get to hear more of the melodic rock or might I say AOR served up by this foursome. The band around Mikael Carlsson (bass, guitar, keyboards, vocals) consists of three musicians who are also active in other bands: Mikael Erlandsson (vocals, keyboards – Last autumn's Dream, Salute), Martin Kronlund (guitars – Gypsy Rose, Phenomena, Salute) and Perra Johannson (drums – Coldspell). With these names you know in an instant what style of music to expect from this foursome, and fans of these bands, or people who already have heard the debut album from this band, can confidently add this album to their collection. Across eleven tracks. I am transfixed by this extremely radio-friendly, polished melodic hard rock because of the fact that everything is so perfect and polished,. I consider this as a tailored suit rather than an off the rail made to suit the masses, who's recurrent themes (and numbers) that dominate our radio stations today yet continue to be consumed. Music like this can really do well on the radio, without that there are many people will remain unaware and so lots of potential new fans for this band would be missed.
ROCK UNITED
VIA NOCTURNA
Lover Under Cover surprised us with their first album 'Set The Night On Fire' released back in 2012. Now less than 2 years later the brilliant Swedish quartet returns with the sensational follow up 'Into The Night'. As well as keeping the same line up they also keep the word 'Night' in the title for this new album, which is another masterclass on how to make great melodic hard rock.
Along with lots of guitars and some well layered keyboards, there is the introduction of gorgeous melodies and a voice that breathes pure rock - all these ingredients combine to raise 'Into The Night' to a completely different level. Especially impressive is the sensational guitar work, the thumping riffs, soaring harmonies and melodic and emotive solo's that all draw you in.
More importantly the mood of 'Into The Night' is set by the mature , elegant nature of the songs - some of which are very radio friendly. We can talk about songs like Into The Shadows , Crushing Stones , The Playboy 7 , Fantasy Man or No Place Like Home all look likely to become anthems in melodic hard rock this year. This album is highly recommended.
LORDS OF METAL
NUROCKZ
Names like Coldspell , Last Autmn 's Dream or Treat monopolise much of the limelight where Swedish Melodic Rock is concerned. We're used to seeing how this fertile land provides new bands day after day and year after year. Together with established bands ike Treat, HEAT , Eclipse, Poodles & Europe you are adding new names that are following in their melodic rock footsteps. The start of a new chapter of melodic rock will be titled Lover Under Cover , formed from the first three bands quoted in the beginning of this analysis .Featuring Mikael Carlsson (bass, keys and vocals), Mikael Erlandsson (vocals and leader in Last Autumn's Dream & Salute ), Martin Kronlund (guitars in Gypsy Rose, Phenomena & Salute ) and Perra Johansson ( on drums and also a member of Coldspell ) they have created another remarkable piece of Melodic Rock and AOR work.
Great compositions becoming probably the best of the early part of this year, also in addition to a great production that makes this second album a fitting follow up, something in my opinion that takes up where the first left off a year ago. And that, believe me was very good. Right from the initial " A Fight" we discover an authentic collection of topics in a solid format accentuated by masterful vocals. Erlandson's vocals are unmistakable and are supported throughout by a thumping rhythm section that is key in the final product that blends perfectly with clean and clear guitars mixed to perfection .
I love " In To The Shadows" with a more than addictive chorus and a rhythm of sublime euro AOR . No slouch either is the honeyed and delicate "Life Is Easy". On the other hand , the guitars seem to dance the perfect dance with the keys in an absolutely great song called "Miracle " . The same goes for "Crushing Stones " spotless from top to bottom "Playboy No.7 " very cool Mad Max .Along with " Toy Soldiers " a mythical version of the famous one hit wonder Martika from by the late 80 's. Terrific final work Lover Under Cover .The final touch is a very subtlely put AOR "Fantasy Man" and the magnificent "Closer To The Truth" .
This is another great Melodic Rock album for this year . If this continues , it will be another great year .
GRANDE ROCK
MELODIC NET 4/5
HISTOZIC
I was eager to discover the new album by Lover Under Cover because the first album was damn damn good and the other group (LAD) is led by one of my favorite singers in the FM hard rock style Mr Mikael Erlandsson. The absence of a new Last autumn's dream album gave me extra motivation to hear Mikael Erlandsson on new compositions. I purchased the Japan CD, I discovered happily opening the cardboard box a very successful cover aesthetically, the album, entitled "Into the Night".
"A fight," the first track, starts the album in a very beautiful way. A well punchy song, hard muscled Class AOR/FM, a logical first opus. "Into the Shadows" continues in the same vein with a rhythm that pummeled and fairly heavy riffs. The group poses a great melody and a catchy chorus. "Miracle" starts on with a bass / drums / vocals and guitars that come to build up for the chorus. A fairly standard piece of course, but it's still tough and the guitar solo is working successful. It continues with a cover 80's "Toy soldiers" (song that could be a nod to the other group of Erlandsson) sung at the time by Martika . A semi-ballad that has its charm, the voice of Erlandsson making the difference and fortunately still a solid rhythm. "Crushing stones" restarts on a speed pace, always with the melody mixed with a good energy: Try To listen to this one in your headphones or smartphone .... "sacrilege". "Life is easy" is a good piece of hard-fm but still lacks a little something, even if the song goes crescendo over the tracks. Too bad the solo is too short. "Playboy # 7" is in the style of Last Autumn's Dream and is accompanied by a great melody and a good break: a very good song.
"The game is on" continues in the same style and begins with a good hardcore riff. The piece holds up, even if I may be missing a break which really gave it an extra dimension. "Fantasy Man" mid-tempo song is perfect with a great melodic chorus. "Closer to the truth," is the third co-written by David Reece, is undoubtedly the best of the three. A good song makes me think of a title of Last autumn's dream, always a good melody and rhythm that makes this block. "No place like home on the European release, ends the album is a melodic class act with the hoarse voice of Mikael which always works wonders and deliver the same thrills. One of the best tracks on the album. "The chosen one" bonus track of the japan import is a good speed track, a melodic hardcore with a superb chorus. The bonus track is so worth a visit.
A successful second album that will appeal to fans of melodic hard rock with a punch, Without being the album of the century you will have a great time. Michael Erlandsson continues to appreciate his many projects and offer us high quality albums.
ROCK METAL ESSENCE
We really liked 'Set The Night On Fire' , the debut album of Lover Under Cover, the Swedish supergroup led by vocalist Mikael Erlandsson and talented guitarist Martin Kronlund . Now we have more from them with 'Into the Night' , a polished hard rock album that hits stores January 24 from Escape Music . So let's see why ..
Two years have passed since their debut, within the group essentially nothing has changed. the really big riffing Kronlund's, hot, sometimes raw emotional work and vocal melodies, along with Erlandsson, who continues to seem a lot more comfortable here than in (for me) declining recent work with Last Autumn's Dream. Extraordinary vocals that are based on solid songwriting even better than the ones shown on 'Set The Night On Fire'.
There are eleven tracks of pure flawless performance, backed up by solid lyrics, this album is an absolute delight for every lover of melodic hard rock, with a sound that sits somewhere in the middle between the sounds of Dokken, Gotthard, Bon Jovi, Health, and again, Last Autumn's Dream. AOR and hard rock that make you raise your hands to a variety of songs inspired by the mood of the night. With exquisite style: a nod to the eighties, combined seamlessly with a modern feel (especially in bright and radiant sound production), which has an irresistible appeal.
Into The Shadows is the real hit from the album, a strong melodic riffing beautiful bride in full dress with a carpet of keyboards for support. Along with it, the shining A Fight that oscillates somewhere between new and old, the cover of Martika's Toy Soldiers , a ballad of intense emotion and crowned by a virtuoso vocal performance, the incredible feeling of The Game Is On , with thumping powerful guitar parts, absolutely breathtaking. Very much worth mentioning is the concluding tracks Closer To The Truth and No Place Like Home , the first with a loud infectious refrain, the second a semi-acoustic track that gives a lightness and catchiness to the piece.
With Lover Under Cover 'Into The Night' we have a great quality product, a perfect example of melodic hard rock, combining powerful driving instrumental performances with the atomic vocals of Erlandsson. The smell of the night, the great appeal of which has both the power of hard rock and also melodic lightness, this album confirms the good feeling about this band that we had when we listened to the debut of two years ago. Honestly, an album not to be missed.
MUSICREVIEWS DE
So, it's second time out for Lover Under Cover, members of Last Autumns Dream (Erlandsson), Gypsy Rose (Kronlund), Coldspell (Johannsson) & Lover Under Cover (Carlsson) together as they were for the debut album. The album has a slightly quicker tempo but the hooks are still evident ("Miracle" is a driving hit, 'Life is Easy" would have been too heavy to make a mainstream playlist rotation) even the more commercial "Crushing Stones" sounds different from the material on the debut album but sits perfectly on this album that showing how the band have grown together.
The solid sounding "A Fight" and both "Fantasy Man" & "Toy Soldiers" are seamlessly interwoven with real ass kicking tracks like "Playboy No. 7" & "Into The Shadows" all of them complemented by awesome vocals and lush keyboards. The ballad "No Place Like Home" is reminiscent of Bon Jovi at the height of their musical powers and "The Game Is On" serves maybe as a prediction for the future as live on stage we get the impression that we will not see "just another one of umpteen Scandinavian Melodic Hard Rock bands" like so many we have written about before.
CONCLUSION: Lover Under Cover with "Into The Night" have evolved. They are playing hard rock with a more melodic edge, but above all have recorded numerous catchy and more importantly authentic sounding compositions, which make them candidates for longevity. Extremely important in this overcrowded field
FLASH FORWARD MAGAZINE
Returning with a sparkling new album are the band from Gothenburg (Sweden), who made their debut in 2012 with the well-received "Set The Night On Fire". Mikael Erlandsson (voc, key - Last Autumn's Dream, Heartbreak Radio, Radioactive, Health, Northern Light, etc.) and Mikael Carlsson (bass, ch, key - Dogface) laid the foundations of this group around 1982 when they were in the band Rain together, since then their paths have crossed and divided several times, in this project the two are doing stunning work and are delighting fans with excellent melodic hard rock compositions straight from the Scandinavian / American school .Ably assisted on this CD again by Martin Kronlund (guit - Dogface, Gypsy Rose, White Wolf, Health, Overland) and Perra Johansson (Drums - Coldspell), LUC returns with an album of eleven tracks of melodic and hard rock of an even higher standard than "STNOF."
"A Fight" is a great opener with it´s pace, the powerful vocal melodies and an instrumental section which transfixes the listener, this formula is repeated with even greater impact in the subsequent "Into The Shadows" supported by robust keyboards and a refrain that soon engraved itself in my mind. "Miracle" American AOR reminiscent of Bon Jovi in their heyday, its more mainstream, and has catchiness and immediacy, whilst "Toy Soldiers" is a cover of a 1988 hit by pop singer Martika, it keeps the spirit alive with its dark lyrics about drug abuse. All in all do not overlook this rock version, however, the original spirit of the band returns with the strong and epic "Crushing Stones" - classic Scandinavian-style hard rock.
"Life Is Easy" sounds almost like a hard rock version of Abba, given the apparent simplicity of the vocal and instrumental lines, but its 'pretty' atmosphere is soon swept away by the wicked and sleazy "Playboy No. 7" anthemic yet rather stereotypical in that it uses songwriting elements that also feature in "The Game Is On", but at least with this there is greater inspiration and an attempt to work out the song in a more personal way. "Fantasy Man," "Closer To The Truth" (what a great chorus!) And the semi-ballad "No Place Like Home" close the album by focusing on the more melodic and AOR flavours of a band that interprets with taste and expertise within the confines of the genre.
A good disc embellished by excellent vocal performances from Erlandsson who proves to be better with this project in comparison with the latest evidence of the Last Autumn's Dream, but I think the LUC can be even better, they have massive potential. That being said, this is still a worthwhile collection of songs that I would recommend buying
DISCTOPIA 8/10
This is the first big surprise in 2014! At least as far as the genre Hard Rock / Melodic Metal. If you make a comparison with COLDSPELL and LAST Autumns DEAM, which is quite logical because the band founder Mikael Carlson (bass, guitar, keys and vocals) with vocalist Mikael Erlandson from LAST Autumns DREAM and drummer Perra Johansson (COLDSPELL). The quartet is then completed by Mr. Martin Kronlund. It is Kronlund that is the surprise! I like the sound of his bands and projects, but in recent months it has been a bit much for me. The sound of the projects was so strongly influenced by Kronlund that they have all kind of lost of identity. And then from nowhere this quartet puts out an album that takes place in the late 80s and early 90s that with no problems connects to all the great hard rockers / Melodic Metal band from Sweden. Now Jump into the fun...
No, you do not need acclimatization, no preview, nothing! It is all there ! Somehow I feel like the time was when TREAT and their hit "World of Promises". Heard and love! Yes, 1988 has done her own difficulties in the video, the sexy lady. 2014 UNDER COVER LOVER create it without "sexy lady". Earwigs and toy soldiers
"A Fight" or "In To The Shadows" can not be done much better! Melody, hardness, dramaturgy that fit the songs, and even after 10 listenings you have not heard enough. The Swedes proves courage with the cover version of "Toy Soldier". To chose to cover a pop classic is a gamble that certainly critics will call on the plan. I do not want to connect! The 'ol chestnut "gets a smell, lick of paint and the mind's eye I can see how in a suitable concert / festival party starts. Sure you can say songs like "Life is Easy" bring the Hard Rock no new flute tones of money and also life is sometimes just not so easy. But, the Melodic Metal genre is the youth outgrown and now may be in his Middleage? Early thirties alone the "Passion" makes the music from "Myth" connect.
Pending the completion of the disk is likely to delight not only Hard Rock / Melodic Metal disciples, but also those who are not averse in addition to the very harsh sounds of one or other Melodic disc with Keyboard. The pleasant, yet not boring voice of Mikael Erlandson rounds off the disc and allows it to be the icing on the cake. A really good disc and I rewards the album with a 8/10
HARD ROCK INFO
NI ROCKS
Lover Under Cover are back? So I have to admit to being really ashamed that I have not heard of these Swedes before now!! Especially if you are a fan of classic melodic hard rock like I am But Like I said, up till now yours truly knew nothing of the group and their latest offering "Into The Night" which is my baptism of fire with the guys from the far north. Certainly there are many temples in this genre and some tend towards being rather more sickeningly kitschy. Lover Under Cover, are not like this at all, however, and give us a very mature offering in the genre of melodic rock.
You will have undoubtedly heard of Gotthard and this singer's voice has a similar quality to that of Nic Maeder . The album possesses incredible power and although it sits in the melodic rock genre it sweeps you like a whirlwind from start to finish. The thunder of cheering fans of the genre will be evident, because of the perfectly crafted anthems. No questions or doubts remain because the guys bring us a masterpiece that will shake the thrones of many of the great bands from this area.
Even the sweeping ballad tracks aren't stale or tired but show the smooth polished side to the band and these tracks are equally impressive. Certainly the material may not be the modern rock sound, but it does not have to be. Lovers of this style will therefore be absolutely thrilled when the rock big guns are brought into use. You are take on a journey covering a wide field of material, with the bouncing party music, making your feet itch to dance, because everything is infected by the barn dance ass shaking attitude in those tracks. The band members have lots of musical experience in this genre which explains why you have such a masterpiece here.
Conclusion: "Set The Night On Fire" the butter that goes with bread and butter, it also belongs in the collection of every AOR and classic melodic rock lover. Simply superb from Sweden and good competition for Gotthard and others. Two thumbs up for the Wasa Rocker!!
ROCKNYTT
Lover Under Cover is the result of a successful mix of members from among others Last Autumn 's Dream , ColdSpell and Gypsy Rose. In the line up are Mikael Carlsson ( bass, keyboards , guitar and vocals), Mikael Erlandsson ( vocals, keyboards ), Martin Kronlund (guitar) and Perra Johansson (drums). If you read on the band's website it's clear that the idea of launching the band has been around for decades , but it was not until 2012 that the band finally materialized and debuted with the album "Set the Night on Fire " .
Now they are current with album number two, " Into The Night " . Anyone who has heard and appreciated the band's first album certainly will not be disappointed with this one. The music consists this time of the easily accessible , melodic rock / AOR that we got acquainted with the debut album . There are consistently strong melodies , performed by skilled musicians and Michaels smooth raspy voice.
Among the songs that stand out one finds " A Fight " , which like a refreshing breeze opens the album. The subsequent ' "Into The Shadows "offers an intense vocal performance , and " Miracle " spreads a happy and positive mood using the Hammond organ . " Toy Soldier " is a cover which I unfortunately got tired already when it was popular the first time. Therefore, I find it difficult to appreciate the song without experiencing it rather tedious , although the band really has finalized a really excellent cover version . The last song I want to mention is "Playboy No:7" . It is a little tougher tempo than the other songs , but has a very catchy chorus that stays in your head long after the music has ended. This is an album that will cheer you up !
POWER OF METAL
AHMROCK
MAYFAIR MALL
ROCK HARD MAGAZINE
|
cc/2020-05/en_middle_0097.json.gz/line1399827
|
__label__wiki
| 0.796198
| 0.796198
|
Review by Hannah Woodhead @goodjobliz
Charlie Hunnam Hugh Grant Matthew McConaughey
Ritchie goes back to basics with an strong cast.
Someone’s got a case of arrested development.
Botched it.
After spending a decade in Hollywood, Guy Ritchie returns to his gangster roots with this all-star crime caper.
At the end of 2008’s RocknRolla, a title card promised us: “Johnny, Archy and The Wild Bunch will be back in The Real RocknRolla.” Twelve years on, said sequel is still yet to materialise, presumably because Guy Ritchie has been busy helming big-budget studio projects.
While his cheeky takes on Sherlock Holmes and The Man from U.N.C.L.E were positively received for the most part, his recent reworkings of King Arthur and Aladdin were not. It’s understandable, then, that Ritchie has taken a break from the genre he made his name with – but in The Gentlemen he attempts to unite his two worlds: the British grimey crimey and the starry, slick Hollywood flick.
Enter Matthew McConaughey as Mickey Pearson, an American drug lord in London who wears three-piece tweed suits and speaks with a distinctive Southern twang. Looking to cash out his lucrative marijuana empire and retire with wife Rosalind (Michelle Dockery), he finds a prospective buyer in countryman Matthew Berger (Jeremy Strong). But once word of the deal gets out, another interested party emerges in the form of Dry Eye (Henry Golding), an impish young Chinese-British pretender to the crown.
Of course, it wouldn’t be a Guy Ritchie film without a puckish framing device, which is where Hugh Grant’s unscrupulous private investigator/tabloid greaseball Fletcher comes in, acting as narrator to relay proceedings to Mickey’s right-hand man, Raymond (Charlie Hunnam).
Even without getting into the subplots concerning Colin Farrell’s fast-talking boxing instructor, or Eddie Marsan’s toady newspaper editor, or Eliot Sumner’s rich kid turned heroin addict, there’s A Lot Going On in The Gentlemen. One might even go so far as to suggest there are too many gentlemen; they could do with being thinned out for the sack of clarity. Ensemble casts have always been Ritchie’s thing, but they tend to work best when not everyone is constantly battling for his bit of the action.
Grant’s is the most familiar Ritchie stock character in the mix, emulating a certain Mr Murdoch in his vocal affectation. Unfortunately the enjoyment of watching him swallow scenery whole like a thespian reticulated python is somewhat dampened by the repeated use of racist slurs to describe the film’s few non-white characters – a charitable reading might be that he uses racism to point out the morally bankrupt nature of his characters, but it’s hard to believe this is the case given how persistent the dialogue is, and the fact these dog-whistle beats are played for laughs. In one scene, Pearson makes a long speech about how East Asians are to blame for the entire cocaine and heroin trade; it’s very clear that there are heroes and villains in this story, and the heroes are the white gangsters.
It’s the same ‘equal opportunities offender’ bit that numerous has-been comedians have tried before, seemingly ignorant to the fact that in the UK alone reports of hate crimes have doubled in that past five years. Racism is alive and well in jolly old England, and a film like The Gentlemen, which has no interest in interrogating the beliefs or morals of its characters – instead, presenting their remarks as throwaway gags – feels out of touch and out of time.
Add in some casual bestiality, the attempted rape of a prominent female character, and the presentation of homosexuality as a sign of moral deviance, and you’re left with very little in the way of redeeming qualities in this blustering dick swinging contest.
Published 3 Jan 2020
Tags: Charlie Hunnam Guy Ritchie Hugh Grant Matthew McConaughey
By Adam Woodward
Guy Ritchie’s blokes-n-blades epic is big on style but light on substance.
This ultra-glossy ‘live action’ remake of Disney’s 1992 mega hit cleaves too closely to the original to justify its existence.
Matthew Vaughn’s disastrous spy spoofing sequel is the film Brexit Britain (probably) deserves.
|
cc/2020-05/en_middle_0097.json.gz/line1399832
|
__label__cc
| 0.620517
| 0.379483
|
The Attractive Body
ExRx.net > Weight Management > Article
Every year after the age of 25, the average American gains one pound of body weight yet loses one third to one half pound of muscle. Consequently, our resting metabolism decreases approximately 2% to 5% every decade after 25 years of age (Evans 1992). Proper exercise and sound eating habits can reverse this process and restore the appearance of our figure or physique. But, what constitutes a beautiful or aesthetically attractive body?
Bodily beauty has been described as the average of everyone. In other words, if everybody's visual traits were reduced to numbers and the average of the numbers were converted back to a human figure, this average of the human image would constitute ideal beauty.
According to evolutionary psychology, the attraction to bodily characteristics is said to be biologically innate. Early humans were attracted to particular physical traits in the opposite sex; an attractive individual was, and still is, perceived by having traits conducive to optimal procreation. The classic female figure suggests fertility. For women, fuller breasts and hips 1/3 wider than the waist, or a waist-to-hip ratio of 0.7 is considered the ideal. A smaller waist suggests youth and greater fertility. Similarly, the early male physique implied protector and provider. For men, a more muscular physique with wider shoulders and a waist to hip ratio of 0.9 is considered more attractive. A larger waist would signal ill health and, thus, bad genes. We have inherited the physical and psychological characteristics of the winners of this evolutionary beauty contest.
It also appears that beauty is defined by cultural constructs that continue to change throughout time. Ideal beauty also varies in different societies around the world. Western culture at this time has embraced the fashion model as an exemplar - greatly because we are constantly inundated with these images which are, ironically, far from the norm. We find beauty in physical traits we see often, particularly those images portrayed in the media. However, those images are often unrealistic for us to achieve ourselves. Just looking at a fashion magazine tends to leave women less satisfied with their weight and size (Turner et al. 1997). In fact, people with eating disorders are much more likely to report being influenced by unrealistic body images in the media (Murray, Touyz & Beumont 1996). Interestingly, due to various editing and imaging techniques, not even models or actors are as attractive as their own image.
Variations in body shape are dictated by differences in the size, shape, and proportion of muscle, fat, and bone. The distribution of body fat has more variation in its shape and size than does muscle. A greater than normal fat content can increase the likelihood one's body shape will vary from the norm. Certainly, there are those who can maintain an attractive body at a higher-than-normal body fat. Their genetics for fat distribution allows them to maintain normal shape and proportions despite their higher body fat.
Visual aesthetics involve the compliments of lines, shapes, and proportion. The irregular lines and shapes of an unfit body result in its less-than-ideal beauty and aesthetics. The combination of muscle building and fat loss can restore bodily aesthetics and beauty.
In today's sedentary society, many individuals have significantly less muscle mass and more fat than what they had when they were younger. Likewise, most of us probably have less muscle and more fat than what we would have had if we would have lived hundreds of years ago, performing daily manual labor. Exercise and sound dietary modifications can restore more normalized proportions, curved segments, posture, and lines associated with an attractive body.
"Man tries to exaggerate what nature has given him," Charles Darwin (1809-1882).
Main Menu | Toning with Weights | Somotype | Body Image
Misconceptions About Exercise & Weight Loss
|
cc/2020-05/en_middle_0097.json.gz/line1399835
|
__label__wiki
| 0.560254
| 0.560254
|
Voicebox
Competitions - Terms and Conditions
ABOUT THE SHOWS
Red Kite Breakfast
60s Rewind
Red Kite Country
70's Rewind
The Takeover
Website Info & Privacy Policy
Radio for Thame, Haddenham, Chinnor and the Villages
The Gold Kite
James Kershaw
Simon Diegan
A member of the team
Ian Sandford
Gold Kite
Steve Fox
Howard Bond
Peter Dawes
Sally Poulson
Clive Hoghton
Des Withey
Pete Simester
Cherry Waller
Dan Blaze
Alex Grout
The "Takeover" is a unique show to Red Kite Radio. We offer the chance for members of the public to literally Take Over the studio for two hours, so anyone can run the show and tell their story. The slot is open to any local group, organisation, charity, team or band. They can choose the tracks they want to play and let everyone enjoy their choice of music.
The show has now moved to a Monthly slot, being broadcast on the first Saturday of each month. This gives the presenters involved much more time to get prepared for taking over the studio and planning their show.
Shows to come
The show is currently on hold for now, due to lack of participation. We hope to begin again in 2019.
Check the SCHEDULE to see when the takeover show appears.
THAME WEATHER
3 Day BBC Forecast
Wednesday: Thick Cloud, Minimum Temperature: 6°C (43°F) Maximum Temperature: 9°C (48°F)
BBC Weather - Forecast forThame, GB Jan 20, 2020 | 15:00 pm
Maximum Temperature: 9°C (48°F), Minimum Temperature: 6°C (43°F), Wind Direction: Northerly, Wind Speed: 6mph, Visibility: Moderate, Pressure: 1038mb, Humidity: 96%, UV Risk: 1, Pollution: Low, Sunrise: 07:57 GMT, Sunset: 16:34 GMT
Tuesday: Light Cloud, Minimum Temperature: 2°C (36°F) Maximum Temperature: 5°C (42°F)
Maximum Temperature: 5°C (42°F), Minimum Temperature: 2°C (36°F), Wind Direction: Westerly, Wind Speed: 5mph, Visibility: Moderate, Pressure: 1042mb, Humidity: 91%, UV Risk: 1, Pollution: Low, Sunrise: 07:59 GMT, Sunset: 16:33 GMT
Today: Sunny, Minimum Temperature: -3°C (26°F) Maximum Temperature: 7°C (44°F)
Maximum Temperature: 7°C (44°F), Minimum Temperature: -3°C (26°F), Wind Direction: Westerly, Wind Speed: 5mph, Visibility: Good, Pressure: 1047mb, Humidity: 79%, UV Risk: 0, Pollution: Low, Sunrise: 08:00 GMT, Sunset: 16:31 GMT
Tweets by Red Kite Radio
Please help keep Red Kite Radio on air
Two Pounds £2.00 GBP Five Pounds £5.00 GBP Ten Pounds £10.00 GBP Other Amount £50.00 GBP
We are the community radio station for Thame, Haddenham and the surrounding villages...
Based in the grounds of Haddenham Garden Centre, we've been on air since June 2017. A not-for-profit organisation, our remit is to serve the community with Classic Hits from the 60’s to today, News and Information. We are funded by Advertising, Sponsorship and Grants from supporting organisations.
Red Kite Radio. c/o Haddenham Garden Centre, 121 Stanbridge Road, Haddenham,
AYLESBURY, Bucks. HP17 8HN
www.redkiteradio.com
Copyright © 2017 - 2020 Red Kite Radio & Media Ltd. All rights reserved.
designed by Chas Large
|
cc/2020-05/en_middle_0097.json.gz/line1399836
|
__label__cc
| 0.565107
| 0.434893
|
Wednesday, April 11th, 2018 | Posted by KanelkaTagba
Israeli Defense Minister calls killed Palestinian journalist “Hamas terrorist”
The defense minister of Prime Minister Benjamin Netanyahu’s cabinet Tuesday chocked the world calling Palestinian journalist Yasser Murtaja who died Saturday after being shot the day earlier by Israeli Defense forces (IDF) a Hamas terrorist.
Avigdor Liberman told the media Murtaja, the co-founder of Gaza-based TV production company Ain Media, was on Hamas payroll for several years and held a rank amounting to that of captain.
“This is a member of the military arm of Hamas who holds a rank parallel to that of captain, who was active in Hamas for many years,” Lieberman said.
“Once again we see how Hamas uses the media, ambulances and patients, including cancer patients who are sent to hospitals in Israel,” to carry out “terrorist missions,” the Israeli minister said without backing up his comments with evidence.
Murtaja’s death drew the anger of media watchdogs against Israel. Reporters without Borders slammed IDF for intentionally killing the 31-year old Palestinian.
Murtaja was shot in the torso during the second Friday of Hamas-backed “March of Return”, a peaceful protest to last until mid-May. The protest marks the 70th anniversary of Israel’s establishment and the eviction of thousands of Palestinians from their lands in the process of the creation of the Jewish country.
The protests took place few meters from the border with Israel, which deployed snipers on the Israeli side.
He was shot although he was wearing a vest emblazoned with the word “press”.
Lieberman over the weekend sought to justify Murtaja’s death arguing that he was operating a drone to gather intelligence on IDF.
“I don’t know who is or isn’t a photographer. Anyone who operates drones above IDF soldiers needs to understand he’s putting himself in danger,” Lieberman said.
Murtaja’s colleagues and lo has been listed to receive US government grant support for private sector. The company ved ones brushed off Lieberman’s comment as “ridiculous”. Rushdi Al-Serraj, co-founder of the Gazan TV production ridiculed Lieberman’s statement calling on the Israeli establishment to confess the killing of his colleague, Times of Israel reports
Ain Media was nominated last month to pocket $11,700 from the USAID. The company qualified for the grant following strict screening requirements of USAID-funded assistance, the Israeli media reports.
Early this week, Lieberman also noted that all Gazans are subject to Israel killings arguing that all of them are Hamas operatives.
Written by: KanelkaTagba on April 11, 2018.
Short URL: https://me-confidential.com/?p=19136
Posted by KanelkaTagba on Apr 11 2018. Filed under Headlines, World News. You can follow any responses to this entry through the RSS 2.0. Both comments and pings are currently closed.
|
cc/2020-05/en_middle_0097.json.gz/line1399844
|
__label__cc
| 0.616729
| 0.383271
|
The many worlds of quantum physics
Robert Wright (Bloggingheads.tv, The Evolution of God, Nonzero, Why Buddhism Is True) and David Wallace (University of Southern California, The Emergent Multiverse)
The challenge of interpreting quantum physics . 1:29
The many-worlds interpretation . 10:25
At what moments do new worlds appear? . 21:10
Quantum physics and free will . 27:54
The multiverse and you . 33:52
Why you (or one of you) may never die . 39:51
Quantum entanglement holds the world together . 49:15
Follow: Robert Wright
Recorded:Feb 23 Posted:Mar 1, 2017
The Wright Show | Mar 1, 2017 | Robert Wright & David Wallace
My brain made me do it!
Daniel Kaufman and Massimo Pigliucci on why science alone can’t explain behavior. Plus: The errors of Daniel Dennett.
|
cc/2020-05/en_middle_0097.json.gz/line1399845
|
__label__wiki
| 0.785357
| 0.785357
|
Support Athens’ marginalized communities on this remarkable walking tour
Photo: Aerial-motion/Shutterstock
Bianca Caruana
Athens is among the world’s most historic major cities, a destination for lovers of history, architecture, and Greek mythology. More than five million tourists visited the capital of Greece in 2018. But there’s more to Athens than meets the eye — many Athenians have never fully recovered from the 2008 financial crisis and austerity measures.
I visited Athens in 2019, 11 years after the Global Financial Crisis (GFC) that saw the collapse of many parts of Greece’s economy. In 2008 the GFC, coupled with the worst refugee crisis in its history, put an immense social and economic strain on Greece and sent the country into an economic breakdown. It was the everyday people who suffered the most. In the years that followed, Greece’s unemployment rate increased to 27 percent. It’s lowered slightly but is still a major concern; in 2018, one in five Greeks were unemployed.
Shedia, founded in 2013, is a social enterprise whose main aim is to highlight the most important homelessness and poverty-related issues, and provide employment and support to the most vulnerable members of society. They put together a “street paper,” a periodical print magazine that Shedia’s partners sell to earn money, and in 2014, Shedia commenced the “Invisible People Walking Tours” to further its mission. These tours provide employment opportunities to those affected by homelessness or poverty, with the aim to educate visitors on the hardships faced by marginalized members of the community, so they might give back.
Walking through Athens beyond its ancient history
Photo: trabantos/Shutterstock
I had the privilege of joining Shedia’s “Invisible People Walking Tour” while visiting Athens. Our guide, a stout gentleman in his late 50s who went only by Michael, greeted me with a smile in Athens’ Omonia district. After a short introduction about Shedia, we commenced the two-hour tour. We walked the backstreets of the Omonia district, made colorful by graffiti art masking the walls of the run-down buildings. Our first stop was a local soup kitchen, where Michael stopped to explain more about the homeless population of Athens and opened up about his own personal experience with homelessness.
“Shedia saved my life,” Michael says, explaining how the financial and employment support have helped him get back on his feet. The tour costs eight euros (just under $9) for adults and five euros ($5.50) for students. Fifty percent of this fee goes to the tour guide, and the other 50 percent goes toward running Sheida’s other social programs, including community housing and employment programs. Participants can also leave an additional tip for their guide if they wish. The walks happen each Saturday at 10:30 AM, and while they are generally led in Greek, tours can be arranged in English, French, Spanish, German, or Italian with advance notice.
Making a difference and raising awareness
Photo: Shedia/Facebook
Shedia supports over 150 marginalized people in the community. Two of those members are running the Shedia tours, with one more in training, while the others sell copies of the Shedia street magazine to make a small profit. According to Shedia journalist Spyros Zonakis, there are 45 vendors who have used the money earned from the sales of magazines to rent an apartment in the city. “We want to empower people to help themselves,” he says. “They may have lost their trust in the system, but the opportunities we provide help them to believe in their capabilities once again.”
As we walked through the neighborhood, Michael and I spoke about the role soup kitchens and organizations like Shedia play to help people like himself and the many other people who have experienced homelessness as a result of the financial crisis.
Michael had taken sole responsibility for his family business right around the time the financial crisis was at its peak. Leaving for work one morning, he found his work truck missing, and after liaising with the police, he was told it had been stolen. This truck was imperative to keep his business open, and after the police came back with no findings, Michael had no choice but to close the business down. With bills piling up and no income to pay the rent, Michael’s landlord eventually kicked him out. He packed his suitcase, left some items with a friend, and headed to the street homeless.
Michael was homeless for six years. His honesty and openness struck me as a testament to the work that Shedia does to help people in need.
Leaving a lasting impact
Photo: Stanislavskyi/Shutterstock
On the tour, we visited some important safe havens for at-risk members of the community, including a local shelter. Michael continued to reveal the hidden face of Athens, but the tour wasn’t all somber. He shared some insider tips like where to get the best souvlaki and moussaka. We strolled through local markets, including the Athens Central Market, a rousing marketplace full of Greek specialties such as olives, feta, spices, and fresh produce. And we made our way past the National Theatre of Greece and the Paxinou-Minotis Museum, which honors the tragedian Katina Paxinou.
But beyond being a walk-through of the city, the lasting memories of the tour are of the people. Looking beneath Athens’ beautiful facade revealed the city’s deep humanity, and it’s well worth stepping beyond the Acropolis and Parthenon if but for two hours of your trip. “The most important vision of these tours is to make the invisible part of our city visible,” Michael says. “A lot of Athenians have never even walked through these streets. My goal is to provide information about the services provided by the most important social structures in the city of Athens”.
Find more information or book the tour for your upcoming visit to Athens via Shedia’s website.
More like this: How former gang members are rebuilding Bogota’s most violent neighborhood
Activism Trip Planning
More on Athens
7 Athens rooftop bars with the best views of the city
Stasi Karasavvas
The 10 best places for dessert in Athens, Greece
Maria Iotova
12 photos that will make you want to visit Athens right now
Collette Stohler
11 untranslatable Greek phrases we need in English
Lena Papadopoulos
The 10 desserts you need to try in Greece that aren’t baklava
The best islands you can day trip to from Athens
Annika Salmi
12 traditional Greek dishes that prove how tasty the Mediterranean diet is
Theo Panagopoulos
The ultimate shopping guide to Athens
From Athens to the home of the gods: hiking Mount Olympus
The 6 best non-touristy live music bars in Athens, Greece
This is the best souvlaki in Athens. Try it before it disappears.
Katherine Whittaker
7 must-try street foods in Athens, Greece
We think you might also like
The year women became eligible to vote in each country
Sustainable travel guide: Oahu, Hawaii
Bernadette Machard de Degramont
9 charming small towns that look just like a Hallmark Christmas movie
The 5 best cheesesteaks in Philadelphia
Alicia Raeburn
|
cc/2020-05/en_middle_0097.json.gz/line1399853
|
__label__cc
| 0.608507
| 0.391493
|
Arrest Made: Kula Highway Accident Involving Police Vehicle
August 15, 2018, 1:37 PM HST · Updated August 16, 8:16 AM
Wendy Osher · 13 Comments
SWIPE LEFT OR RIGHT
(Update: 9:25 p.m. 8.15.18)
A Maui police officer was released from the hospital after being treated for injuries sustained in a multi-vehicle crash on the Kula Highway Wednesday afternoon.
Maui police have launched an attempted murder investigation into the accident, which occurred at around 1:30 p.m. on the Kula Highway near the Lower Kula Road intersection.
According to police reports, the officers from the Wailuku Patrol Division were responding to the area of the Kula Fire Station at around 1 p.m., to a call involving a domestic abuse in progress.
While responding to the case with emergency lights and sirens on, information was received stating the male offender of the domestic abuse had fled the Kula area in a blue truck in an unknown direction.
As the officers continued their emergency response southbound on Kula Highway in the area of Lower Kula road (also known as “Skid Row”), the male offender later identified as Garette Moriwake, 35, of Kula, approached the officers in a blue Toyota pick-up truck from the opposite direction.
Police say the Toyota pick-up truck then veered across the center line and collided into the first Police vehicle, an SUV, before climbing an embankment and colliding into tractor trailer truck which had pulled to the western shoulder of Kula Highway.
Officer Max Kincaid, the operator of the Police SUV, was transported to the Maui Memorial Medical Center for treatment of injuries sustained in the collision before being released.
Moriwake was placed under arrest and transported to the Maui Memorial Medical Center for treatment of injuries he sustained in the collision.
The circumstances of this incident remain under investigation.
Investigators are asking for the public's help in the investigation of a motor vehicle collision involving a Police Vehicle which occurred on Kula Highway at the intersection with Lower Kula Road (aka Skid Row). The incident occurred between 2 p.m. and 3 p.m. Anyone who may have witnessed the collision is asked to call police at 244-6400.
Posted by Maui Police Department on Wednesday, August 15, 2018
Motorists in the Kula area are advised to use alternate routes in the area of Kula Highway at Lower Kula Road due to an on-going investigation into a motor vehicle accident involving a police SUV, a semi-truck and another vehicle.
The accident was reported at around 1:30 p.m. on Wednesday, Aug. 15, 2018.
At 2:40 p.m., police issued an advisory saying motorists traveling into Kula are encouraged to use other routes such as Kula Highway/Kekaulike (377), Omaopio Road or Pūlehu Road. The investigation is expected to be a protracted event, according to police.
Initial reports indicate that the accident involved a blue truck, a semi-flatbed truck and a police SUV. A police patrol car was also observed on scene.
According to one witness account, the blue truck was traveling at a high rate of speed when it crashed into the SUV Police vehicle and went into the side of the hill, hitting the semi before coming to a rest.
*Please check back for further details, which will be posted as they become available.
TRAFFIC ADVISORY: KULA HWY
(1:32 p.m. 8.15.18)
Motorists traveling in the Kula area of Maui are advised of a four-car pile up on the Kula Highway.
Police are on scene. Motorists should expect delays.
Initial reports indicate that the accident involved a blue truck, a semi-flatbed truck and a police SUV vehicle.
PC: Maui Police Department 8.15.18
Kula Highway accident. (8.15.18) PC: Michele Adair McCandless
Kula Hwy accident. PC: (8.15.18, 3:50 p.m.) by Trey Akin
Wendy Osher
Wendy Osher leads the Maui Now news team. She is also the news voice of parent company, Pacific Media Group, having served nearly 20 years as News Director for the company’s six Maui radio stations.
Scroll Down to Read 13 Comments
20 Students Graduate from Maui Job Corps
Man Critically Injured in Fall From Pickup Truck on Kula Hwy
Maui Man Fatally Injured When Vehicle Overturns on Kekaulike Highway
Kula Boy Dies in Pauwela Traffic Accident
ARTICLE COMMENTS ( 13 )
|
cc/2020-05/en_middle_0097.json.gz/line1399854
|
__label__cc
| 0.697035
| 0.302965
|
This to That
A few days back, I tumbled across this super exciting game which has gripped me in its magic and made me get addicted to it. Can you guess that game?
It’s a word puzzle game which may sound similar to the thousands of other word puzzle games but is in fact very different and challenging game.
The name of the game is This to That which is available on iTunes and can be downloaded on the iPhone and iPad and the newer version is specially made compatible with iOS 7 because of huge demand.
This to That::By Mobile Magic Developers This to That::By Mobile Magic Developers This to That::By Mobile Magic Developers
This to That screenshots
So what’s This to That is about? How to play this game? The challenge in this game makes it different from other typical word games. The objective is to turn a four letter word into some other word, but the challenging part is that you can change only one letter at a time to make a new word from the already present word and yes, you can use only valid words.
This game is certainly going to test your vocabulary skills and what I liked about this game is that you can either play it yourself or invite your friends online and compete with them. The interface of this game has been my favorite part as it supports all my iDevices – my iPhone and iPad too.
Also, it’s customizable, which makes it more awesome. You can use custom colors or some different kind of myriad backgrounds, or overlays to make the interface look more personalized. If you want to change the theme of This to That, you would need to open the drawer present at the bottom of the main menu.
Here you can view your achievements made so far in the game and also you can access the help page in case you are finding any difficulty. I would really suggest you to check the help page even if you don’t need it.
It’s cool. The game is best when you’re playing in multiplayer mode. It’s fun to challenge your friends and the overall experience becomes extra amazing. I have played in both ways – alone and in multiplayer mode and the latter one is seriously awesome and fun, but playing in multiplayer mode would need you to invite your friends for not many people are available online to play this game.
I would suggest you to play in multiplayer mode and see the difference. If you love the game in single player mode, which you would obviously do, you would lust the multiplayer mode. It’s really amazing.
The wordlist of This to That is very fast and it would also help you to boost up your vocabulary. You can learn new words in a fun manner. This to That isn’t just a fun filled entertaining game but it is also a good learning experience.
I would recommend this game to anyone and everyone. If you have an iOS device, download this game right now for your device is incomplete without this game. Download it as soon as possible. It’s good.
Graphics :
Music and Sounds :
Gameplay :
By: Published in : iPhone Games
iPhone Puzzle Games
iPhone Word Games
iPad Puzzle Games
iPad Word Games
Twitter followers page
Linkedln profile page
Blogger blog page
Stumble Upon page
Delicious page
Mobile Apps Review Ever watched Star Trek and thought I want to be James T Kirk? Well now you can with Faster than Light. FTL is an... https://t.co/TpddmhVDOe
You are here: Home iPhone and iPad iPhone & iPad Games This to That
|
cc/2020-05/en_middle_0097.json.gz/line1399856
|
__label__wiki
| 0.757117
| 0.757117
|
Stella Mudd
Active (2268)
Baron Grimes
Harcourt Mudd
Kay Elliot (android replica)
Katherine Barrell (2256)
"You see, gentlemen, behind every great man there is a woman urging him on. And so it was with my Stella. She urged me on into outer space. Not that she meant to, but with her continual, eternal, confounded nagging. Well, I think of her constantly, and every time I do, I go further out into space. "
– Harcourt Fenton Mudd, 2268 ("I, Mudd")
Stella Mudd, née Stella Grimes, was a 23rd century Human woman and wife of Harcourt Fenton "Harry" Mudd.
Stella's father, Baron Grimes, was a wealthy arms dealer who claimed he'd do anything for his daughter, to the point of allowing her to marry Mudd. (DIS: "Magic to Make the Sanest Man Go Mad")
In her youth, Stella was fully aware of Harry's flaws and overlooked them amiably. In later years, she was rather shrewish with him and often criticized him for his drinking, overeating, and carousing.
In the 2250s, Mudd said he tried to win her approval by buying a moon with borrowed money, which convinced her to stay with him. He was later captured by Klingons while trying to flee his creditors, but vowed to escape and return to her. (DIS: "Choose Your Pain")
In reality, Mudd had tried to escape Stella herself. The crew of the USS Discovery determined this after Mudd's countless attempts to steal the vessel in order to sell it to the Klingons. Once the crew had deduced this, they contacted Stella and her father, who came and took Mudd. (DIS: "Magic to Make the Sanest Man Go Mad")
Sometime before 2268, Stella became separated from her husband when the latter began his career as a con artist. Mudd later created an android replica of Stella that was programmed to shut down on command so that he could always get in the last word. His revenge backfired on Mudd when James T. Kirk commissioned at least 500 copies of Stella Mudd to serve as parole officers for Harry Mudd on Planet Mudd--none of which responded to Harry's command to "shut up". (TOS: "I, Mudd")
The class J cargo ship Stella was named for her. (TOS: "Mudd's Women")
Young Stella was portrayed by Katherine Barrell. The android version of Stella was portrayed by Kay Elliot.
Stella Mudd at StarTrek.com, the official Star Trek website
Stella Mudd at Memory Beta, the wiki for licensed Star Trek works
Retrieved from "https://memory-alpha.fandom.com/wiki/Stella_Mudd?oldid=2421088"
|
cc/2020-05/en_middle_0097.json.gz/line1399867
|
__label__cc
| 0.673101
| 0.326899
|
gunviolence
Anxiety is a double-edged sword: The 3 benefits of situational anxiety
12/16/2019 / By Grace Olson
People often classify anxiety as a negative emotion. Often, it’s characterized by intense fear and worry, manifesting in sweaty palms, agitation, fatigue and muscle tenseness. Indeed, in excessive amounts, it gets in the way of even the most basic daily activities. In the U.S. alone, anxiety disorders affects 40 million adults, becoming the most common mental illness in the country.
But anxiety can be helpful, especially when it ensures a person’s survival every day. This is called situational anxiety. It plays a crucial part in decision-making and other daily activities, like meeting deadlines, driving and taking care of the kids. It is an essential part of the human psyche, which can prove beneficial in regulation.
Here are some of the benefits of anxiety:
1. Anxiety is an ingrained warning system
It’s normal to feel anxious. In fact, it is the appropriate response when facing a potential threat to a person’s safety. This is because anxiety is closely linked to cortisol.
Cortisol is a stimulant, which helps provide energy to the body in crisis situations. While continuously elevated levels of cortisol can be detrimental to a person’s health, it does not change how the hormone is important to ensure a person’s survival.
When a threat appears, cortisol levels rise along with anxious thoughts. Being anxious is an indicator that something is wrong, making the person more vigilant. It helps the person attend to any potential threats to avoid further danger.
For example, a pedestrian may feel anxious as he or she spots darkening clouds, which signals rain. This makes him or her walk faster to avoid getting wet. This can apply to countless other scenarios. (Related: Calm your anxiety and stress with these 10 natural herbs.)
2. Anxiety motivates and boosts performance
Feeling anxious becomes advantageous in some situations. For example, when a person is preparing for a test, anxiety helps motivate the person to prepare. Consequently, this boosts the person’s performance, simply because he or she put in more effort into it.
While earlier studies on anxiety stated its negative effects on concentration and memory, more recent studies revealed that there are other factors to consider. The main difference between anxiety as an obstacle and as a motivation is how the person intends to use those anxious feelings.
In a three-part study published in the Journal of Individual Differences, researchers surveyed 194 German adults, 159 undergraduate students in Poland and 270 journalists in Germany. They found that participants who had higher anxiety motivation reported better grades and higher job satisfaction. This was especially true among those who were clear on how they used anxiety to fuel motivation.
Among athletes, anxiety can help boost their performance on the field. When they feel anxious, the sympathetic nervous system activates and signals the release of cortisol from the adrenal glands. This provides them with a strength boost and increases their alertness.
3. Anxiety helps promote empathy
Scientists have ruminated for some time the connection between anxiety and empathy. It is observed that people who experienced distress and anxious feelings become more empathetic toward others who were going through the same. Due to a shared experience, the person is more likely to respond kindly and with understanding to the other person.
A study published in Frontiers in Human Neuroscience found an indirect relationship between anxiety and empathy. The researchers focused on three specific subjects: empathy, worry and rumination and anxiety. Simply put, people who are empathic may worry more about others, thus experiencing anxiety. Conversely, those who experience anxiety may have an increased concern for others.
At this point, it’s clear that aside from cognitive and physical benefits, anxiety offers emotional and psychological benefits as well. With proper management, anxiety becomes an advantage, not an obstacle, to having a safe and fulfilling life with others.
Learn more about the proper care and management for mental health problems at MindBodyScience.news.
ADAA.org
TheBodyImageCenter.com
PsyPost.org
NCBI.NLM.NIH.gov
Tagged Under: anxiety benefits, anxiety relief, boosts performance, brain health, cognitive function, Cortisol, good mood, mental health, mental stress, promotes empathy, situational anxiety, sympathetic nervous system, warning system
Research suggests traffic-related air pollution may be linked to childhood anxiety
Waking up in the middle of the night? Here are 10 reasons why
Resetting your brain with psilocybin: Is a mushroom trip the answer to depression?
Science supports recess: Physical activity in preschoolers linked to improved blood vessel health and cardiovascular fitness, reducing heart disease risk in later life
01/04/2020 / By Isabelle Z.
Contagious emotions: Study suggests dogs mirror owner’s stress levels
01/02/2020 / By Arsenio Toledo
Scientists explain how the brain’s “inner pickpocket” identifies objects
Could this be the reason so many women are depressed and angry?
An essential guide to understanding B-vitamins
11 Ways to maintain your mental composure during a crisis
Rediscovering the many health benefits of frankincense, a natural analgesic and anti-inflammatory
Work burnout and emotional eating: Overworked employees often adopt unhealthy habits that cause weight gain, reveals study
12/24/2019 / By Darnel Fernandez
Music therapy relieves pain, improves quality of life of patients with terminal illness
12/23/2019 / By Evangelyn Rodriguez
Stick to a regular routine, say sleep specialists: 15 Ways to fall asleep faster
Trudeau moves to criminalize therapy for unwanted same-sex attraction
Biological woman who cut off breasts to become a trans “male” now regrets “huge mistake”
Researchers identify depression biomarkers using TCM
Stay hydrated and eat mindfully: 15 Ways to manage your appetite and stop overeating
Joe Biden celebrated by left-wing media for fat shaming obese man who leads sedentary lifestyle… Biden rudely challenges him to pushup contest
Physicians explain how long-term supplementation of vitamin D can increase the longevity of cancer patients
Mental.News is a fact-based public education website published by Mental News Features, LLC.
All content copyright © 2018 by Mental News Features, LLC.
Contact Us with Tips or Corrections
All trademarks, registered trademarks and servicemarks mentioned on this site are the property of their respective owners.
|
cc/2020-05/en_middle_0097.json.gz/line1399869
|
__label__wiki
| 0.763044
| 0.763044
|
Archive for the tag “GOC Western Deputy Commandant”
Questions remain over the final hours of CS Nkaissery life
The strangeness of the final hours of General and Cabinet Secretary Joseph Ole Nkaissery can be stopped, as the revelation that he was apparently eating at Bomas until late that evening. A restaurant and a place closed of from the public by the Independent Electoral and Boundaries Commission (IEBC) as the National Talley Centre (NTC) was set-up there.
So the CS Nkaissery went in there passed the gates, ate and had a marvelous time in a closed off space. While leaving later close to 21.00, because he had to reach 21:00 news at home. While the President in his announcement of the death, that they took him from his home about 21:30. Because he was feeling unwell. Some say dizzy, some say high blood-pressure. Sylvia Chebets story of the final hours to Kenya Citizens TV on ‘Retracing Nkaissery last moments’ was not similar to the stories told by others. Some has reported that the CID had evidence of the CS being at Bomas until 03:00 drinking beer. Clearly, the stories doesn’t add up.
Uhuru Kenyatta Speech Transcript:
“Today is a sad day for Kenya and all our people. We lost a gallant officer, an officer who has for the most part of his life served with total dedication and love for his country. Maj General Joseph Nkaissery was a man who believed in this country, believed in the principles and foundation on which this country was built. A man who dedicated most of his life to serving this great nation. I personally have lost a friend, a colleague, whom as late as yesterday we spent part of the day praying together for peace for this country, whom as late as 9.30 last night we were discussing issues pertaining and relating to peace, to unity in this country. Indeed on one of his last notes he spent discussing his great passion, which was Kenya’s preparedness for the Junior Athletics (IAAF U18 Championships) that is supposed to commence in the next few days.” (Uhuru Kenyatta, 08.07.2017).
Some even says he was dead on arrival to Karen Hospital in Nairobi. As the Post-mortem has not been released, the speculations keeps rising. As the flaws in the stated timelines between friends of the deceased and the public statement on the President. Precisely shows to the world, that the government have stated different than what Chebets did. Therefore, the is a lie somewhere and what is hidden in Bomas, Karen Hospital or even in the car of Nkaissery is hard to imagine. Even if there is a cover-up going on. Since, none of the vital information has been released.
The Hospital has later revealed that the CS didn’t die of a heart-attack or had high blood-pressure. Combined with the different stories in what he was up to and whereabouts. The probable causes turns more sinister and strike of ill-intent by another party towards the CS. As his dead on arrival, seem more likely. Since the wife Hellen Nkaissery, says her man was healthy and in good shape.
Because if you look a bit deep into the day:
First at Uhuru Park for prayers with the President. Travel from there to the State House for lunch. Then held a crisis security meeting with Julius Karangi, who has no constitutional mandate for taking part of such an exercise. Than leaves the State House for the closed off to the public Bomas, where he drinks beer with friends and family. Before either leaving for 21:00 news or stays until 03:00.
Here comes the tricky part:
Some has stated he came into a routine check-up at night at Karen Hospital, which is rare and unique for any character. Later a Senior Presidential Press Spokesperson said he was dead on arrival. While a Senior Jubilee Digital Team that he was drinking up late. So that counter these issues. Again, senior doctor, Dr James Mageri, who attended to him again releases a presser saying that Nkaissery was dead by the time he was being brought to the hospital. Within, few hours of his death the Interim CS Fred Matiang’i is announced and not long after issues curfew in parts of Kenya. This has all been done without the President visiting the Lee funeral home to confirm his death. So there are enough acts and enough questions about timeline of the final hours. As much as the involved and knowledge at state capacity. Since the State could act so swift and get appointed a new CS, while the detectives just started to probe the case both at his home and at Bomas.
The are lots of questions remaining, the official report are scheduled for Monday from the hospital, still the lateness shows the factors in play. That the final hit to the CS Nkaissery was severe and his demise was sealed. So what is the truth and what took his life? Since he was healthy man who suddenly and shockingly just passed away. Peace.
Posted in Africa, Civil Service, Development, Election, Ethics, Governance, Government, Law, Leadership, National Security, Politics, Transparency and tagged Abdulawamad Nassir, Amason Kingi, Anniversary Towers, Anti-Riot Police, Bomas, Chief Instructor-Brigade, Chief of General Staff, Coalition of Reforms and Democracy, Commandant Battalion, Constitutional Referendum, CORD, CORD Leader, CORD Principal Raila Odinga, CS Joseph Nkaissery, Deputy President William Ruto, Discrepancies, DP Ruto, Dr Fred Matiang'i, Dr. Bonny Khalwale, Dr. James Mageri, East Africa, Election Cycle, FORD-K, Forum for Reform and Democracy, GoC, GOC Western Deputy Commandant, GoK, Government of Kenya, Governor Hassan Ali Joho, H.E. Uhuru Kenyatta, H.E. William Samoei Ruto, Hassan Ali Joho, Hon. Dr. Fred Matiang'i, Hon. Hassan Ali Joho, Hon. Irungu Kang'ata, Hon. Joseph Nkaissery, Hon. Kithure Kindiki, Hon. Moses Wetangula, Hon. Raila Odinga, Hon. Stephen Kalonzo Musyoka, Hon. William Ruto, IEBC, IEBC Confidence Crisis, IEBC Kenya, IGP Boinett, IGP Joseph Boinet, IGP Joseph Boinnet, independent Electoral and Boundaries Commission, Interior CS Hon. Joseph Nkaissery, Irungu Kang'ata, James Mageri, JAP, Japheth Koome, Johnstone Kavuludi, Joseph Boinet, Joseph Boinett, Joseph Nkaissery, Jubilee, Jubilee Alliance Party, Jubilee Coalition, Julius Karangi, Kajiado Central, Kakamega, Kalonzo Musyoka, Karen Hardy, Karen Hospital, KDF, Kenya, Kenya Defence Force, Kenya National Police of Service, Kenya National Police Service, Kenyan Government, Kenyan National Police Service, Kilfi, Kilfi County, Kithure Kindiki, Leaders of Opposition, Mombasa, Mombasa County, Moses Wetangula, Mvita, Mvita County, Nairobi, Nairobi Police Commander, National Police Service Commission, Nkaissery, NPSC, ODM, Okoa Kenya, Opposition, Opposition Demonstration, Orange Democratic Movement, President Kenyatta, Promoted Officers, Rachel Shebesh, Raila Amollo Odinga, Raila Odinga, Republic of Kenya, Security Officers, Stephen Kalonzo Musyoka, Sylvia Chebets, Transparent, Uhuru Kenyatta, WDM, William Ruto, William Samoei Ruto, Willy Lugusa, Wiper Democratic Movement | Leave a comment
The shock of the sudden death of CS Nkaissery!
“Interior Cabinet secretary Major Gen. (Rtd.) Joseph Nkaissery has died. Nkaissery died a few hours after being admitted at the Karen Hospital in Nairobi for a check-up according to State House. According to a statement by Chief of Staff and Head of Public Service, Joseph Kinyua, Nkaissery fell unwell and was rushed to the city hospital for check up only to pass on a few hours later. Kinyua in a statement said it is with deep sorrow and shock that we announce the sudden passing on of Interior CS General (Rtd.) Joseph Nkaissery. The Government has promised to give updates as more information becomes available. Nkaissery who also served as MP for Kajiado Central in the ten Parliament was aged 67 at the time of his death” (Nosim 90.5 FM Kenya, 08.07.2017).
I wish he was still alive, the powerful Cabinet Minister Joseph Ole Nkaissery, who was the third in-line after Deputy President William Ruto and President Uhuru Kenyatta. Who has been the CS of the Interior and Coordination of National Government in the first term of the Jubilee Alliance and Jubilee Party. What is more worrying is that the President didn’t wait a minute to appoint his successor, CS Fred Matiang’i. Therefore, the death of Nkaissery hadn’t even been spread to all corners of Kenya, before the President had appointed the one to take over the Ministry.
What is strange is that yesterday he was at the Prayers at the Uhuru Park. The next day dying at Karen Hospital in Nairobi over high blood-pressure. This happening just days before the 8th August 2017 polls. A strong man and viable man like Nkaissery, seems like a fighter and a determined man. Not like the one who gives in easy and let it go. Not that I respected his will to stop demonstrations, use police brutality and use force against innocent. I didn’t and I don’t. Still, I don’t wont the adversary to fall over ill-attempt or unjust acts as well. If you want justice for all, than you want that for your political adversary as well.
Nkaissery, had not trouble using the Police Service to stop his opposition and explain why he could use it to silence them. He had no trouble using the police to make life hard for the opposition, surely Governor Hassan Ali Joho knows how the Police was used to stop his work. So now if the Police are serious, they will probe this death correctly and find the reason behind his death. Since it happens so convenient before the polls.
Therefore, this is report on the sudden death as well: “Detective have launched investigations into the sudden death of Interior Cabinet Secretary Joseph Nkaissery. Scene of crime detectives on Saturday pitched tent at Nkaissery’s home in Karen Hardy, Nairobi. The investigators were piecing together the CS’s last moments. The first team arrived at the minister’s home in the morning and was joined by a different team at around 3pm” (Kimanthi, 2017). So the Police that he served and run, the one he controlled until his death is now investigating his death. To make sure their wasn’t any criminal intent behind it. But you can wonder with the timing and the power of the CS. It was not like CS Nkaissery didn’t have massive amounts of power and his place in society.
Clearly, this was known and the question now is why he suddenly died. What was the cause, was it high blood-pressure or was it some ill-intent involved. Since that wouldn’t be unlikely considering the timing of it all. Political assassinations isn’t new and extra-judicial killings has happen in the recent time in Kenya. You wouldn’t wish that on anyone, not on a CS Nkaissery or anyone else. Therefore, if this is possible, it surely could happen to him. Since he had power and because of use of state machinery and police, would give someone motivation to stop him.
That is all just mere speculation at this point, but not so far fetched, since he was reckless and using all sort tactics to stop his adversaries. There we’re no quarrel from him when it come to use police and extended force to silence them. So he surely made enough enemies within his days of power. If there was anyone would wish him ill. The ones that used aggression towards could have acted towards him.
The Statement on his passing from the State House: “It is with deep sorrow and shock that we announce the sudden passing on of Interior CS Retired General Joseph Nkaissery. Gen. Nkaissery passed on at Karen Hospital in Nairobi a few hours after being admitted for a check-up. The country to be updated as more information becomes available. Joseph Kinyua – Chief of Staff and Head of the Public Service – STATE HOUSE” (Kinyua, 08.07.2017).
Even his adversary who has been battling with the Police and the Courts under CS Nkaissery, Gov. Hassan Ali Joho wrote this: “I am in deep shock to learn that (Rtd) General Joseph Ole Nkaissery is no more. I have fond memories of the late CS when we served together as ODM members of parliament. General Nkaissery was a hard working and dedicated servant of the people. On my behalf and that of the people of Mombasa together with the ODM family I assure his family and friends of our support at this critical moment. May the almighty give them strength to overcome the tragedy. Rest In Peace General Nkaissery” (Hassan Ali Joho, 08.07.2017).
That his death was shock, it is true, that the CS Nkaissery has a long political history and used his power in office. That him as a Jubilee Cabinet Minister seriously has used his office to extend and stop the opposition. This is well known, but that doesn’t mean that he would deserve to die for his hard work. Even if his police killed demonstrators and put people in hospital for the police brutality. He would have deserved justice for his acts, not death, but a fair trial for his attempts of justice.
But what bugs me, is how quick CS Matiang’i got appointed, even before the detectives started detecting, before the news we’re broken and before any indication of reason behind his death. That the Jubilee Administration, that the President and Deputy President could get a new man in his place. Proves the little care for the death of their own loyal CS, who defended and stood on the barricades, using his ministry and his understanding of the law, to gain more strength for the Jubilee. Therefore, you should not only be shocked by the sudden death of Nkaissery, but of the quickly appointed in his government post.
No mourning, no justice, just continue like normal when the most powerful after Kenyatta and Ruto died. Just an appointment, brief stopping campaigns and having a minute of silence. But the State House shouldn’t have appointed Matiang’i today. Nkaissery, even if he was ruthless and using his powers with fierce force, still deserved better treatment by his allies. The Jubilee should have known better and thought more true it all. So the people could seek solace and also find relief in the investigation into the death. Instead, the questions becomes even more evident. Since they could find someone within hours of his death.
There are only unanswered questions, only stones to turn to find the reason behind it. If it really was high blood-pressure or if there was some other reason. We cannot know at this point, but the mere fact remain, that the shock will be revealed and the reality of the matter will come to the courts and in the public eye. These questions need to be answered and then we can live at ease, that the CS wasn’t terminated at ill-will, but of age and high blood-pressure. Peace.
Kimanthi, Kennedy – ‘Detectives probe CS Joseph Nkaissery death’ (08.07.2017) link: http://www.nation.co.ke/news/Detectives-probe-CS-Joseph-Nkaissery-death/1056-4006364-gdkfs5/index.html
Posted in Africa, Civil Service, Development, Election, Ethics, Governance, Government, Law, Leadership, Politics, Transparency and tagged Abdulawamad Nassir, Amason Kingi, Anniversary Towers, Anti-Riot Police, Chief Instructor-Brigade, Chief of General Staff, Coalition of Reforms and Democracy, Commandant Battalion, Constitutional Referendum, CORD, CORD Leader, CORD Principal Raila Odinga, CS Joseph Nkaissery, Deputy President William Ruto, Discrepancies, DP Ruto, Dr Fred Matiang'i, Dr. Bonny Khalwale, East Africa, Election Cycle, FORD-K, Forum for Reform and Democracy, GoC, GOC Western Deputy Commandant, GoK, Government of Kenya, Governor Hassan Ali Joho, H.E. Uhuru Kenyatta, H.E. William Samoei Ruto, Hassan Ali Joho, Hon. Dr. Fred Matiang'i, Hon. Hassan Ali Joho, Hon. Irungu Kang'ata, Hon. Joseph Nkaissery, Hon. Kithure Kindiki, Hon. Moses Wetangula, Hon. Raila Odinga, Hon. Stephen Kalonzo Musyoka, Hon. William Ruto, IEBC, IEBC Confidence Crisis, IEBC Kenya, IGP Boinett, IGP Joseph Boinet, IGP Joseph Boinnet, independent Electoral and Boundaries Commission, Interior CS Hon. Joseph Nkaissery, Irungu Kang'ata, JAP, Japheth Koome, Johnstone Kavuludi, Joseph Boinet, Joseph Boinett, Joseph Nkaissery, Jubilee, Jubilee Alliance Party, Jubilee Coalition, Kajiado Central, Kakamega, Kalonzo Musyoka, Karen Hardy, Karen Hospital, KDF, Kenya, Kenya Defence Force, Kenya National Police of Service, Kenya National Police Service, Kenyan Government, Kenyan National Police Service, Kilfi, Kilfi County, Kithure Kindiki, Leaders of Opposition, Mombasa, Mombasa County, Moses Wetangula, Mvita, Mvita County, Nairobi, Nairobi Police Commander, National Police Service Commission, Nkaissery, NPSC, ODM, Okoa Kenya, Opposition, Opposition Demonstration, Orange Democratic Movement, President Kenyatta, Promoted Officers, Rachel Shebesh, Raila Amollo Odinga, Raila Odinga, Republic of Kenya, Security Officers, Stephen Kalonzo Musyoka, Transparent, Uhuru Kenyatta, WDM, William Ruto, William Samoei Ruto, Willy Lugusa, Wiper Democratic Movement | Leave a comment
Two Problems with SGR: First the Cost of Phase 1 and President Kenyatta cowardly blocking of Gov. Joho!
President Uhuru Kenyatta is a coward for not letting the Governor of Mombasa County, the Orange Democratic Movement leader Hassan Ali Joho attend the launch today of the Freight Train at the Port Reitz Station in Mombasa. It seems the Jubilee Party cannot handle opposition and has to freeze them out. Even as the launch of the SGR was happening, the Police escorted him away.
Maybe because the Chinese wrote this about the Kenyan Railway:
“Kiraithe added that the government, through the ministries of finance, transport and environment, hasbeen heavily involved in accelerating the completion of the SGR built by the China Road and Bridge Corporation.“But the infrastructure is for Kenyans and has been achieved to improve our living standards,” Kiraithe said. In 2013, President Xi Jinping and his Kenyan counterpart, Kenyatta, witnessed the signing of the memorandum of understanding on financing the Mombasa-Nairobi SGR. The Export Import Bank of China financed 80 percent of the project” (Morangi, 2017).
“I was among a group of people who wrote a letter to the president [Uhuru Kenyatta], specifically with regards to the value for money proposition,” political analyst Tom Mboya told RFI on Tuesday. At a staggering cost of nearly four billion euros–almost entirely funded by China’s Export Import bank– just for the first phase linking the capital Nairobi to the port city Mombasa, there is reason to be concerned, reckons economist Aly-Khan Satchu” (Okello, 2017).
The Presidency statement on it:
“President Kenyatta, who was flanked by Deputy President William Ruto and First Lady Margaret Kenyatta, said every Kenyan should be proud of the Standard Gauge Railway. “I call upon all Kenyans whatever their political beliefs to celebrate, today we should be together holding hands in celebrations,” said the President moments after the cargo train pulled alongside the Presidential Dias waiting for the flag off. It was song and dance as choirs played patriotic songs apt for the moment. “This is the Kenya we seek and this is the Kenya we want our children to inherit from us and their children to inherit from them,” said President Kenyatta amid applause, cheers and ululation. President Kenyatta said the SGR will make the port of Mombasa more efficient and will enhance the performance of the facility where the Jubilee Government has invested more than Sh60 billion in the last four years” (Presidency, 2017).
By the Statement made by the Presidency yesterday means that the Government spent: 60bn times 4 Shs. 240bn on the Standard Gauge Railway. Still, the East African reported differently earlier in the month: “So far, Sh327 billion has been spent on the first phase of the railway between Mombasa and Nairobi and Sh150 billion on the Nairobi-Naivasha section. With a national population of about 46 million, every Kenyan is set to owe China Sh18,413 in SGR debt once the deal is sealed” (…) “The SGR has been President Kenyatta’s pet project since he came to power” (Mutambo & Omondi, 2017). So if this is true, than the Presidency are dropping different numbers than the papers. Clearly the government trying to look more efficient, than what they are in reality. This should worry since most of the building of the SGR are based on development loans from the Exim Bank.
Is this why the words of and address to this from Joho is so striking:
“In the light of this, we hereby demand that
1. That the government release the terms of the contract with the Chinese Exim Bank, the details of disbursement and attendant relavant information
2. The Government of Kenya release all details of the Take or Pay contract between KPA and the financiers? What is the goods threshold and the responsibility of collection of the these fees.
3. Due to conflicting reports, the government clarify in details all charges related to goods and their destinations.
4. The government clarify the method of nomination of goods for rail and the point and implementation of charges.
5. The government clarify the extinction date of the Railway Development Levy on goods and come clean on the amounts collected since.
6. The government release the terms of the port concession, all monies paid and the details of the contract
7. The the Government clarify the details of site selection of Naivasha as a dry port. The feasibility study and the project appraisal report.
8. That the government release the “Willingness to Pay” survey of the goods for meant for railway and the feasibility report of the proposed Naivasha Special Economic Zone.
9. And that the Jubilee government show us their plan for Mombasa” (Hon. Ali Hassan Joho, 31.05.2017).
By all means the Governor of Mombasa wants to know the realities of the SGR, but that is something every single Kenyan deserves as this is the pet-project of Kenyatta. Kenyatta might be proud of Phase 1, but can the government carry the price of the trains and lines. Or is this is a stunt for development?
That the Governor was blocked from the Train Station that is opened in his county, as he was blocked from the relaunch of the ferries in March 2017. Shows that the Jubilee cannot handle opposition or their eyes on their projects. They are so initiated to represent the whole community, that if the community and citizens elects opposition. Than they are not allowed to enter public displays and their launching of projects. This has now been proven twice. That the Jubilee cannot handle NASA leadership or ODM party leaders. If they could than they would have entertained and made it possible for Governor Joho to be at the state functions as he is the local elected leadership of Mombasa county. Is that hard for the President and his deputy?
But the President and his Team is cowards who cannot even have the local government leadership at the launch of SGR at the Port Reitz Station. Peace.
Morangi, Lucie – ‘ Chinese-built SGR to improve Kenya’s global standing’ (30.05.2017) link:http://www.chinadaily.com.cn/world/2017-05/30/content_29548836.htm
Mutambo, Aggrey & Omondi, George – ‘Uhuru seeks Sh370bn more to extend railway to Kisumu’ (16.05.2017) link: http://mobile.nation.co.ke/news/Kenya-requests-for-Sh370bn-for-SGR-third-phase/1950946-3928546-15jp48i/index.html
Okello, Christina – ‘Kenya’s ambitious new railway raises cost concerns’ (31.05.2017) link: http://en.rfi.fr/africa/20170530-kenya-4bn-railway-opens-amid-controversy-kenyatta-china
Presidency – ‘New dawn for Kenya as Standard Gauge Railway rolls out services’ (30.05.2017) link: http://www.president.go.ke/2017/05/30/new-dawn-for-kenya-as-standard-gauge-railway-rolls-out-services/
Posted in Africa, Business, Civil Service, Development, Economic Measures, Economy, Election, Ethics, Governance, Government, Infrastructure, Law, Leadership, Politics, Tax, Transparency and tagged Abdulawamad Nassir, Ali Joho, Aly Khan Satchu, Amason Kingi, Anniversary Towers, Anti-Riot Police, Chief Instructor-Brigade, Chief of General Staff, China Exim Bank, China Road and Bridge Corporation, Coalition of Reforms and Democracy, Commandant Battalion, Constitutional Referendum, CORD, CORD Kenya, CORD Leader, CORD Principal Raila Odinga, CRBC, CS Joseph Nkaissery, Democratic Process, Deputy President William Ruto, Discrepancies, DP Ruto, Dr. Bonny Khalwale, East Africa, Election Cycle, Export Import Bank of China, FORD-K, Forum for Reform and Democracy, GoC, GOC Western Deputy Commandant, GoK, Government of Kenya, Governor Hassan Ali Joho, Governor Nanok, H.E. Uhuru Kenyatta, H.E. William Samoei Ruto, Hassan Ali Joho, Hon. Hassan Ali Joho, Hon. Irungu Kang'ata, Hon. Joseph Nkaissery, Hon. Kithure Kindiki, Hon. Moses Wetangula, Hon. Raila Odinga, Hon. Stephen Kalonzo Musyoka, Hon. William Ruto, IEBC, IEBC Confidence Crisis, IEBC Kenya, IGP Boinett, IGP Joseph Boinet, IGP Joseph Boinnet, independent Electoral and Boundaries Commission, Interior CS Hon. Joseph Nkaissery, Irungu Kang'ata, JAP, Japhet Koome, Japheth Koome, Johnstone Kavuludi, Joseph Boinet, Joseph Boinett, Joseph Nkaissery, Josephat Nonok, Jubilee, Jubilee Alliance Party, Jubilee Coalition, Kakamega, Kalonzo Musyoka, KDF, Kenya, Kenya Defence Force, Kenya National Police of Service, Kenya National Police Service, Kenyan Government, Kenyan National Police Service, Kilfi, Kilfi County, Kithure Kindiki, Leaders of Opposition, Margaret Kenyatta, Mombasa, Mombasa County, Moses Wetangula, Mvita, Mvita County, Nairobi, Nairobi Metropolitan Police, Nairobi Police Commander, NASA, NASA Kenya, National Police Service Commission, National Super Alliance, Nkaissery, NPSC, Nyayo Era, ODM, Okoa Kenya, Opposition, Opposition Demonstration, Orange Democratic Movement, President Kenyatta, Promoted Officers, Rachel Shebesh, Raila Amollo Odinga, Raila Odinga, Republic of Kenya, Security Officers, SGR, Standard Gauge Railway, Standard Gauge Railway Development, Standard Gauge Railway System, Stephen Kalonzo Musyoka, Transparent, Uhuru Kenyatta, WDM, William Ruto, William Samoei Ruto, Willy Lugusa, Wiper Democratic Movement, Xi Jinping | Leave a comment
Kenya: EACC investigation into Gov. Hassan Joho and Tom Mboya Primary School verifying his education!
Answer from the School to EACC:
Posted in Africa, Civil Service, Development, Education, Election, Ethics, Governance, Government, Law, Leadership, Politics, Tax, Transparency and tagged Abdulawamad Nassir, Abraham Lorot, Ahmednasir Abdikadir & CO Advocates, Ali Azhar, Ali Joho, Alphonce Shiundu, Alphonce Skiundu, Amason Kingi, Anger, Anniversary Towers, Anti-Riot Police, Arms, Central Firearm Bureau, Chief Instructor-Brigade, Chief Licensing Officer, Chief of General Staff, Coalition of Reforms and Democracy, Codes of Conduct, Commandant Battalion, Constitutional Referendum, CORD, CORD Kenya, CORD Leader, CORD Principal Raila Odinga, Court, Courtside, CS Interior, CS Joseph Nkaissery, Daily Nation, Daniel Arap Moi, Demeanor, Democratic Process, Deputy President William Ruto, Diamond Trust Bank, Dignity, Discrepancies, DP Ruto, Dr. Bonny Khalwale, Dr. Evans Kidero, DTB, EACC, East Africa, Ehtics, Election Cycle, English, Ethics and Anti-Corruption Commission, Ferdinand Waititu, Ferdinand Waititu Ndungu, Firearm, Firearm Certificate, FORD-K, Forum for Reform and Democracy, GoC, GOC Western Deputy Commandant, GoK, Government of Kenya, Governor Evans Kidero, Governor Hassan Ali Joho, Governor Nanok, H.E. Uhuru Kenyatta, H.E. William Samoei Ruto, Harambee House, Hassan Ali Joho, Hassan Sarai, Hon. Gov. Ali Joho, Hon. Hassan Ali Joho, Hon. Irungu Kang'ata, Hon. Joseph Nkaissery, Hon. Kithure Kindiki, Hon. Moses Wetangula, Hon. Musalia Mudavadi, Hon. Raila Odinga, Hon. Stephen Kalonzo Musyoka, Hon. William Ruto, IEBC, IEBC Confidence Crisis, IEBC Kenya, IG, IGP Boinett, IGP Joseph Boinet, IGP Joseph Boinnet, independent Electoral and Boundaries Commission, Interior and Coordination of National Government, Interior Cabinet Secretary, Interior CS Hon. Joseph Nkaissery, Irungu Kang'ata, James Mbaba, James Mbaka, JAP, Japhet Koome, Japheth Koome, John Githongo, John Ngiarchu, John Ngirachu, Johnstone Kavuludi, Jomo Kenyatta, Joseph Boinet, Joseph Boinett, Joseph K. Boinnet, Joseph Nkaissery, Josephat Nonok, Journalist, Jubilee, Jubilee Alliance Party, Jubilee Coalition, Judgement, Justice Odunga, Justus Kiuvu, Kakamega, Kalonzo Musyoka, KDF, Kenya, Kenya Defence Force, Kenya National Examination Council, Kenya National Police of Service, Kenya National Police Service, Kenya Revenue Authority, Kenyan, Kenyan Government, Kenyan National Police Service, Kenyan Police, Kidero, Kilfi, Kilfi County, Kimaru, Kithure Kindiki, KNEC, KNPS, KRA, Language, Leaders of Opposition, Michael K. Mubea, Ministery of Interior Affairs, Ministry of Interior & Coordination of National Government, Mombasa, Mombasa County, Mombasa District, Moses Wetangula, MP Ferdinand Waititu, Mr. Kiimaru, Musalia Mudavadi, Mvita, Mvita County, Mwai Kibaki, Nairobi, Nairobi Metropolitan Police, Nairobi Police Commander, NASA, NASA Kenya, National Police Service, National Police Service Commission, National Security, National Super Alliance, Nelson Marwa, Nkaissery, NPSC, Nyayo Era, ODM, Office of Inspector General, OGW Samwel C. Kimaru, OIG, Okoa Kenya, Opposition, Opposition Demonstration, Orange Democratic Movement, Power, President Kenyatta, President Kibaki, President Moi, Promoted Officers, Rachel Shebesh, Raila Amollo Odinga, Raila Odinga, Reckless Language, Reckless Statements, Republic of Kenya, Revoking, Right to Arms, Samuel C. Kimaru, Samuwel C. Kimaru, Security, Security Guards, Security Officers, Sen. Hassan Sarai, Spoken Language, Stephen Kalonzo Musyoka, Tipape Loomu, Transparent, Uhuru Kenyatta, VIP Security Guards, WDM, William Ruto, William Samoei Ruto, Willy Lugusa, Wiper Democratic Movement | Leave a comment
Opinion: Everybody hates Governor Joho!
The Presidency and Regime under Uhuru Kenyatta and Deputy President William Ruto, must have some grand issues with Mombasa and Coast Region as they every week for the last month has attacked with all sorts of tricks against the Orange Democratic Movement (ODM) Deputy and Governor Hassan Ali Joho. That the Jubilee Alliance Party (JAP) and their cooperative measures to marginalize the opposition figure isn’t really working.
They have detained the man for wanting to see the first relaunch of the ferries as the Jubilee held rallies in his back yard as far back as the 13th March 2017. They have since then blamed his government for lacking accountability and transparency, like the Central Government haven’t had enough issues with corruption scandals.
So President Kenyatta should be cautious attacking fellow peers in midst of re-election rallies, but it isn’t like he cares. Since he feels like he is Teflon and cannot be touch. When they attack his educational background, as they have attacked him before his accountability as a Governor. Therefore, all we see is steady attacks on the character of Joho.
Also said he was meddling with drug-dealers and importers, as they we’re having drug cartels, like the sugar cartels supporting Jubilee and Kenyatta. But hey, not that anyone really looks into the donor funding to the Jubilee from the Sugar and Coffee Cartels to the Kenyatta government. Still, all problems of crime in Mombasa County is Joho’s fault. As the corruption of the Ports is Joho’s fault, not that this has been issue since the independence. That even Jomo Kenyatta was working against the corruption on the Ports of Mombasa, even President Daniel Arap Moi we’re complaining when needed about the graft at Mombasa.
So after decades upon end with independence and second generation Kenyatta, the problems are still there. If they seriously wanted it to change, than John Githongo would still have a job and not been kicked-out the door by former President Mwai Kibaki! But that is a story the ruling regime doesn’t want to eat, still they easily eats of state coffers and thinks side-stories of undressing leaders of opposition makes the world and Kenyan citizens forget that.
I am sure Cabinet Secretary for Interior Joseph Nkaissery is trying to find the next charge he can put on the ODM Governor, as he has tried to revoke his guns and take away his security guards. So, there aren’t that many tricks left in the basket of peddling nonsense into the public sphere. They have used all sorts of demagoguery and misused their place as key leadership. Instead of being noble and show character, they have gone straight for the heart and attacked the character instead of the polices.
So the Jubilee has misused their opportunity to gain and show that they are better than Governor Joho, they have lost on public display, they have used the Kenya Revenue Authority (KRA) looking into his tax-record, Kenya National Examination Council (KNEC) looking into his educational history and also the added accountability, where the leadership of Jubilee claimed his county got 40bn shillings instead of the 16 billions shillings Joho claims the Mombasa County received from the Central Government.
The Jubilee under Kenyatta and Ruto have used all tools and tried to destroy the legitimacy of the leadership of Joho. Just like they fear him more than Raila Odinga, Stephen Kalonzo Musyoka or Musalia Mudavadi. Since they are all walking around like kings, while all of business of Joho is on the front pages.
That the state and their top leadership continues to pound on Joho, shows how little character themselves have, that they have to go after a governor when themselves going into National Elections. That they are going after a local politician, when they should go against the faces who could be Presidential Candidates. Since they are not touching the NASA/CORD leadership, instead they pick Joho as prey, but instead of clearing the flesh of the bones. They are instead creating their own wounds. Peace.
Posted in Africa, Civil Service, Development, Economic Measures, Economy, Election, Ethics, Governance, Government, Law, Leadership, Politics, Transparency and tagged Abdulawamad Nassir, Ahmednasir Abdikadir & CO Advocates, Ali Azhar, Ali Joho, Alphonce Shiundu, Alphonce Skiundu, Amason Kingi, Anger, Anniversary Towers, Anti-Riot Police, Arms, Central Firearm Bureau, Chief Instructor-Brigade, Chief Licensing Officer, Chief of General Staff, Coalition of Reforms and Democracy, Codes of Conduct, Commandant Battalion, Constitutional Referendum, CORD, CORD Kenya, CORD Leader, CORD Principal Raila Odinga, Court, Courtside, CS Interior, CS Joseph Nkaissery, Daily Nation, Daniel Arap Moi, Demeanor, Democratic Process, Deputy President William Ruto, Diamond Trust Bank, Dignity, Discrepancies, DP Ruto, Dr. Bonny Khalwale, Dr. Evans Kidero, DTB, East Africa, Ehtics, Election Cycle, English, Ferdinand Waititu, Ferdinand Waititu Ndungu, Firearm, Firearm Certificate, FORD-K, Forum for Reform and Democracy, GoC, GOC Western Deputy Commandant, GoK, Government of Kenya, Governor Evans Kidero, Governor Hassan Ali Joho, Governor Nanok, H.E. Uhuru Kenyatta, H.E. William Samoei Ruto, Harambee House, Hassan Ali Joho, Hassan Sarai, Hon. Gov. Ali Joho, Hon. Hassan Ali Joho, Hon. Irungu Kang'ata, Hon. Joseph Nkaissery, Hon. Kithure Kindiki, Hon. Moses Wetangula, Hon. Musalia Mudavadi, Hon. Raila Odinga, Hon. Stephen Kalonzo Musyoka, Hon. William Ruto, IEBC, IEBC Confidence Crisis, IEBC Kenya, IG, IGP Boinett, IGP Joseph Boinet, IGP Joseph Boinnet, independent Electoral and Boundaries Commission, Interior and Coordination of National Government, Interior Cabinet Secretary, Interior CS Hon. Joseph Nkaissery, Irungu Kang'ata, James Mbaba, James Mbaka, JAP, Japhet Koome, Japheth Koome, John Githongo, John Ngiarchu, John Ngirachu, Johnstone Kavuludi, Jomo Kenyatta, Joseph Boinet, Joseph Boinett, Joseph K. Boinnet, Joseph Nkaissery, Josephat Nonok, Journalist, Jubilee, Jubilee Alliance Party, Jubilee Coalition, Judgement, Justice Odunga, Justus Kiuvu, Kakamega, Kalonzo Musyoka, KDF, Kenya, Kenya Defence Force, Kenya National Examination Council, Kenya National Police of Service, Kenya National Police Service, Kenya Revenue Authority, Kenyan, Kenyan Government, Kenyan National Police Service, Kenyan Police, Kidero, Kilfi, Kilfi County, Kimaru, Kithure Kindiki, KNEC, KNPS, KRA, Language, Leaders of Opposition, Ministery of Interior Affairs, Ministry of Interior & Coordination of National Government, Mombasa, Mombasa County, Mombasa District, Moses Wetangula, MP Ferdinand Waititu, Mr. Kiimaru, Musalia Mudavadi, Mvita, Mvita County, Mwai Kibaki, Nairobi, Nairobi Metropolitan Police, Nairobi Police Commander, NASA, NASA Kenya, National Police Service, National Police Service Commission, National Security, National Super Alliance, Nelson Marwa, Nkaissery, NPSC, Nyayo Era, ODM, Office of Inspector General, OGW Samwel C. Kimaru, OIG, Okoa Kenya, Opposition, Opposition Demonstration, Orange Democratic Movement, Power, President Kenyatta, President Kibaki, President Moi, Promoted Officers, Rachel Shebesh, Raila Amollo Odinga, Raila Odinga, Reckless Language, Reckless Statements, Republic of Kenya, Revoking, Right to Arms, Samuel C. Kimaru, Samuwel C. Kimaru, Security, Security Guards, Security Officers, Sen. Hassan Sarai, Spoken Language, Stephen Kalonzo Musyoka, Transparent, Uhuru Kenyatta, VIP Security Guards, WDM, William Ruto, William Samoei Ruto, Willy Lugusa, Wiper Democratic Movement | Leave a comment
Kenya: Re: Clarification on Disbursements to the County Government of Mombasa (13.03.2017)
Posted in Africa, Civil Service, Development, Economic Measures, Economy, Election, Ethics, Governance, Government, Law, Leadership, Politics, Tax, Transparency and tagged Abdulawamad Nassir, Ali Joho, Amason Kingi, Anniversary Towers, Anti-Riot Police, Chief Instructor-Brigade, Chief of General Staff, Coalition of Reforms and Democracy, Commandant Battalion, Constitutional Referendum, CORD, CORD Kenya, CORD Leader, CORD Principal Raila Odinga, CS Joseph Nkaissery, Democratic Process, Deputy President William Ruto, Discrepancies, DP Ruto, Dr. Bonny Khalwale, East Africa, Election Cycle, FORD-K, Forum for Reform and Democracy, GoC, GOC Western Deputy Commandant, GoK, Government of Kenya, Governor Hassan Ali Joho, Governor Nanok, H.E. Uhuru Kenyatta, H.E. William Samoei Ruto, Hassan Ali Joho, Hon. Hassan Ali Joho, Hon. Irungu Kang'ata, Hon. Joseph Nkaissery, Hon. Kithure Kindiki, Hon. Moses Wetangula, Hon. Peter Munya, Hon. Raila Odinga, Hon. Stephen Kalonzo Musyoka, Hon. William Ruto, IEBC, IEBC Confidence Crisis, IEBC Kenya, IGP Boinett, IGP Joseph Boinet, IGP Joseph Boinnet, independent Electoral and Boundaries Commission, Interior CS Hon. Joseph Nkaissery, Irungu Kang'ata, Jane Kiringai, JAP, Japhet Koome, Japheth Koome, Johnstone Kavuludi, Joseph Boinet, Joseph Boinett, Joseph Nkaissery, Josephat Nonok, Jubilee, Jubilee Alliance Party, Jubilee Coalition, Kakamega, Kalonzo Musyoka, KDF, Kenya, Kenya Defence Force, Kenya National Police of Service, Kenya National Police Service, Kenyan Government, Kenyan National Police Service, Kilfi, Kilfi County, Kithure Kindiki, Leaders of Opposition, Mombasa, Mombasa County, Moses Wetangula, Mvita, Mvita County, Nairobi, Nairobi Metropolitan Police, Nairobi Police Commander, NASA, NASA Kenya, National Police Service Commission, National Super Alliance, Nkaissery, NPSC, Nyayo Era, ODM, Okoa Kenya, Opposition, Opposition Demonstration, Orange Democratic Movement, Peter Munya, President Kenyatta, Promoted Officers, Rachel Shebesh, Raila Amollo Odinga, Raila Odinga, Republic of Kenya, Security Officers, Stephen Kalonzo Musyoka, Transparent, Uhuru Kenyatta, WDM, William Ruto, William Samoei Ruto, Willy Lugusa, Wiper Democratic Movement | Leave a comment
Opinion: Ruto and Kenyatta should have hiked on the Ferry from Mtongwe; They we’re lost at sea throwing shade at Joho in his backyard!
“Governor Joho and Governor Kingi are all about talk and no action. They have offered nothing new. They have nothing to show for all the money they have been given to invest on your behalf. Only talk” – Uhuru Kenyatta (GoK, 2017).
“It is a sad thing to have leaders who don’t understand…don’t play with me….Mombasa is for everyone,” (…) “Why follow me? Why should we follow each other? I am not his wife,” (…) “Clean the city. Do your job, don’t follow us. If he plays with us we will flog him” – Uhuru Kenyatta (Otieno, 2017).
Well, today the Jubilee Alliance Party leadership and the ruling regime with President Uhuru Kenyatta and Deputy President William Ruto had a rally in Mtongwe Ferry Launch. There also Orange Democratic Movement leader and Mombasa Governor Hassan Ali Joho. This was not accepted as they even had to attack him at the rally. This seem like the tactic from the Jubilee this go around. In Turkana County the Jubilee leaders personally attacked Josephat Nanok.
Now, they are trying to attack Honourable Governor Joho by all means was the key figure and the one they had prepared to make like fool. They even used his willingness to pop-by the rallies in his backyard. This is for now and has been his stronghold. This is the man who was elected with a grand majority in 2013 and the Jubilee wants to unsettle his position. That has been in the works for months as CS Joseph Nkaissery have tried to take his gun, bodyguards and detaining him because they could on the last go around.
Governor Joho has been in the spotlight in the same reasons as Lord Mayor Erias Lukwago in Kampala; he is an opposition leader in a big and important county. Lukwago is the elected leadership of Kampala; the same is Joho of Mombasa County. It seems like what the National Resistance Movement (NRM) does to Lukwago, the same is the Jubilee doing to Joho. It is like machoism without anything to win for the ruling regime.
That Kenyatta and Ruto need to show strength and leadership, that is natural as they want to be looked as saviours and statesmen. Still, the acts of Kenyatta in Turkana and now in Mombasa are differing for the vision or wished perception any civil leader wants. That Jubilee has the upper-hand before this election. However, these sort of attempts to benign them, instead they belittle themselves and their own achievements.
Kenyatta and Ruto, should be grown men who could show of their own achievements, Jubilee has nearly ended their first term. Therefore, they should have enough facts to not bend into fiction. Where the Jubilee government claims that none of the governors in the counties they are visiting is delivering. Still, the government themselves has grand corruption and big scandals in their years in office.
So it not like Jubilee government have delivered the policies or the service delivery they promised in office. Kenyatta and Ruto should have offered a token of goodwill to the governors in Turkana and in Mombasa; instead they act like big-men who stand above them. They are right now higher in the hierarchy, but still they should be able to cross political affiliation. That is something that is hard for the President and his Deputy. They are in the backyards of Nanok and Joho, but there they had to act with vile attempt glory. Instead of showing grace and being statesmen, that is too far and too much to wish for.
If they cannot show grace and some tact, what is to expect of the rest of months ahead, the Turkana and Mombasa rallies proves the reality of their visions of themselves. Where they are acting as they are above Joho and as previous rally above Nanok. Certainly this is not the impression the ruling regime wanted to give. Peace.
GoK – ‘President raps Coast ODM governors as “all talk and no action” as he wraps tour’ (13.03.2017) link: http://www.president.go.ke/2017/03/13/president-raps-up-coast-odm-governors-as-all-talk-and-no-action-as-he-wraps-tour/
Otieno, Brian – ‘[AUDIO] Stop following me like I’m your wife, Uhuru tells Joho at Mtongwe ferry launch’ (13.03.2017) link: http://www.the-star.co.ke/news/2017/03/13/audio-stop-following-me-like-im-your-wife-uhuru-tells-joho-at-mtongwe_c1523952
Posted in Africa, Civil Service, Election, Ethics, Governance, Government, Law, Leadership, Politics and tagged Abdulawamad Nassir, Ali Joho, Amason Kingi, Anniversary Towers, Anti-Riot Police, Chief Instructor-Brigade, Chief of General Staff, Coalition of Reforms and Democracy, Commandant Battalion, Constitutional Referendum, CORD, CORD Kenya, CORD Leader, CORD Principal Raila Odinga, CS Joseph Nkaissery, Democratic Process, Deputy President William Ruto, Discrepancies, DP Ruto, Dr. Bonny Khalwale, East Africa, Election Cycle, FORD-K, Forum for Reform and Democracy, GoC, GOC Western Deputy Commandant, GoK, Government of Kenya, Governor Hassan Ali Joho, Governor Nanok, H.E. Uhuru Kenyatta, H.E. William Samoei Ruto, Hassan Ali Joho, Hon. Hassan Ali Joho, Hon. Irungu Kang'ata, Hon. Joseph Nkaissery, Hon. Kithure Kindiki, Hon. Moses Wetangula, Hon. Raila Odinga, Hon. Stephen Kalonzo Musyoka, Hon. William Ruto, IEBC, IEBC Confidence Crisis, IEBC Kenya, IGP Boinett, IGP Joseph Boinet, IGP Joseph Boinnet, independent Electoral and Boundaries Commission, Interior CS Hon. Joseph Nkaissery, Irungu Kang'ata, JAP, Japhet Koome, Japheth Koome, Johnstone Kavuludi, Joseph Boinet, Joseph Boinett, Joseph Nkaissery, Josephat Nonok, Jubilee, Jubilee Alliance Party, Jubilee Coalition, Kakamega, Kalonzo Musyoka, KDF, Kenya, Kenya Defence Force, Kenya National Police of Service, Kenya National Police Service, Kenyan Government, Kenyan National Police Service, Kilfi, Kilfi County, Kithure Kindiki, Leaders of Opposition, Mombasa, Mombasa County, Moses Wetangula, Mvita, Mvita County, Nairobi, Nairobi Metropolitan Police, Nairobi Police Commander, NASA, NASA Kenya, National Police Service Commission, National Super Alliance, Nkaissery, NPSC, Nyayo Era, ODM, Okoa Kenya, Opposition, Opposition Demonstration, Orange Democratic Movement, President Kenyatta, Promoted Officers, Rachel Shebesh, Raila Amollo Odinga, Raila Odinga, Republic of Kenya, Security Officers, Stephen Kalonzo Musyoka, Transparent, Uhuru Kenyatta, WDM, William Ruto, William Samoei Ruto, Willy Lugusa, Wiper Democratic Movement | Leave a comment
Full version: Joho blocked from attending President’s event (Youtube-Clip)
Posted in Africa, Civil Service, Development, Election, Ethics, Governance, Government, Law, Leadership, Politics, Transparency and tagged Abdulawamad Nassir, Ali Joho, Amason Kingi, Anniversary Towers, Anti-Riot Police, Chief Instructor-Brigade, Chief of General Staff, Coalition of Reforms and Democracy, Commandant Battalion, Constitutional Referendum, CORD, CORD Kenya, CORD Leader, CORD Principal Raila Odinga, CS Joseph Nkaissery, Democratic Process, Deputy President William Ruto, Discrepancies, DP Ruto, Dr. Bonny Khalwale, East Africa, Election Cycle, FORD-K, Forum for Reform and Democracy, GoC, GOC Western Deputy Commandant, GoK, Government of Kenya, Governor Hassan Ali Joho, H.E. Uhuru Kenyatta, H.E. William Samoei Ruto, Hassan Ali Joho, Hon. Hassan Ali Joho, Hon. Irungu Kang'ata, Hon. Joseph Nkaissery, Hon. Kithure Kindiki, Hon. Moses Wetangula, Hon. Raila Odinga, Hon. Stephen Kalonzo Musyoka, Hon. William Ruto, IEBC, IEBC Confidence Crisis, IEBC Kenya, IGP Boinett, IGP Joseph Boinet, IGP Joseph Boinnet, independent Electoral and Boundaries Commission, Interior CS Hon. Joseph Nkaissery, Irungu Kang'ata, JAP, Japhet Koome, Japheth Koome, Johnstone Kavuludi, Joseph Boinet, Joseph Boinett, Joseph Nkaissery, Jubilee, Jubilee Alliance Party, Jubilee Coalition, Kakamega, Kalonzo Musyoka, KDF, Kenya, Kenya Defence Force, Kenya National Police of Service, Kenya National Police Service, Kenyan Government, Kenyan National Police Service, Kilfi, Kilfi County, Kithure Kindiki, Leaders of Opposition, Mombasa, Mombasa County, Moses Wetangula, Mvita, Mvita County, Nairobi, Nairobi Metropolitan Police, Nairobi Police Commander, National Police Service Commission, Nkaissery, NPSC, Nyayo Era, ODM, Okoa Kenya, Opposition, Opposition Demonstration, Orange Democratic Movement, President Kenyatta, Promoted Officers, Rachel Shebesh, Raila Amollo Odinga, Raila Odinga, Republic of Kenya, Security Officers, Stephen Kalonzo Musyoka, Transparent, Uhuru Kenyatta, WDM, William Ruto, William Samoei Ruto, Willy Lugusa, Wiper Democratic Movement | Leave a comment
By blocking Joho Uhuru only made him King – Manyora (Youtube-Clip)
Posted in Africa, Civil Service, Development, Election, Ethics, Governance, Government, Law, Leadership, Politics, Tax, Transparency and tagged Abdulawamad Nassir, Ali Joho, Amason Kingi, Anniversary Towers, Anti-Riot Police, Chief Instructor-Brigade, Chief of General Staff, Coalition of Reforms and Democracy, Commandant Battalion, Constitutional Referendum, CORD, CORD Kenya, CORD Leader, CORD Principal Raila Odinga, CS Joseph Nkaissery, Democratic Process, Deputy President William Ruto, Discrepancies, DP Ruto, Dr. Bonny Khalwale, East Africa, Election Cycle, FORD-K, Forum for Reform and Democracy, GoC, GOC Western Deputy Commandant, GoK, Government of Kenya, Governor Hassan Ali Joho, H.E. Uhuru Kenyatta, H.E. William Samoei Ruto, Hassan Ali Joho, Hon. Hassan Ali Joho, Hon. Irungu Kang'ata, Hon. Joseph Nkaissery, Hon. Kithure Kindiki, Hon. Moses Wetangula, Hon. Raila Odinga, Hon. Stephen Kalonzo Musyoka, Hon. William Ruto, IEBC, IEBC Confidence Crisis, IEBC Kenya, IGP Boinett, IGP Joseph Boinet, IGP Joseph Boinnet, independent Electoral and Boundaries Commission, Interior CS Hon. Joseph Nkaissery, Irungu Kang'ata, JAP, Japhet Koome, Japheth Koome, Johnstone Kavuludi, Joseph Boinet, Joseph Boinett, Joseph Nkaissery, Jubilee, Jubilee Alliance Party, Jubilee Coalition, Kakamega, Kalonzo Musyoka, KDF, Kenya, Kenya Defence Force, Kenya National Police of Service, Kenya National Police Service, Kenyan Government, Kenyan National Police Service, Kilfi, Kilfi County, Kithure Kindiki, Leaders of Opposition, Mombasa, Mombasa County, Moses Wetangula, Mvita, Mvita County, Nairobi, Nairobi Metropolitan Police, Nairobi Police Commander, National Police Service Commission, Nkaissery, NPSC, Nyayo Era, ODM, Okoa Kenya, Opposition, Opposition Demonstration, Orange Democratic Movement, President Kenyatta, Promoted Officers, Rachel Shebesh, Raila Amollo Odinga, Raila Odinga, Republic of Kenya, Security Officers, Stephen Kalonzo Musyoka, Transparent, Uhuru Kenyatta, WDM, William Ruto, William Samoei Ruto, Willy Lugusa, Wiper Democratic Movement | Leave a comment
My letter to CS Nkaissery is this you wish for your legacy to be ‘I created fear and caused havoc’?
Dear CS of Interior Joseph Kasine Ole Nkaissery of the Republic of Kenya!
I know you’re having a hard time as a Cabinet Secretary before the General Election of 2017. With the knowledge of the security detail you needed when the first rounds of Election Law Amendments we’re taken to the National Assembly during January 2017. Therefore it is not like you as a CS of Interior respects your advisories. That been proven with your crass words against the Coalition for Reforms and Democracy (CORD), which is an opposition coalition to fight the ruling regime party, that just recently became the Jubilee Party; that we’re a former coalition as well. So he has alternative motives with this week’s actions and hours.
First he has to step up security before planned marches against election laws, because he loved the Tear-Gas Monday’s and Police Brutality Monday’s that we’re happening months ago. Just take a look!
Police on Alert:
“More police officers have been deployed to Opposition strongholds amid intelligence reports that violence could erupt over the contentious amendments to the electoral laws. The Standard on Saturday established that police officers will be on the look out in Nyanza, Western, Coast, Eastern and parts of North Eastern where they will remain highly alert on possible protests” (…) “This follows the directive by Interior Cabinet Secretary Joseph Nkaissery, who has instructed regional police coordinators to be extra vigilant. Yesterday, Nyanza regional police coordinator Willy Lugusa confirmed that they were on high alert for any eventuality and ready to contain the situation should the protests begin” (Otieno, 2017).
When you want the Police to be vigilant, as the Police have acted with brutality and with tear-gas on protesters; they have detained and even killed protesters, even pedestrians. So now the Police has to be out on the streets and made ready, because legal protest has to be silenced. The only law is the law that Jubilee has created and their amendments to secure another term is more important that citizens of the republic. The citizens who might protest are allowed to be punching-matts and are okay to criminalize them for doing their civic duty. That show’s how little your mind of democracy is CS Nkaissery, you’re a sorry excuse for a politician. As your CV proves your military ways: “Nkaissery served in the Kenya Defence Forces in various capacities ; Commandant Battalion, Second in Command, Combat Instructor, GOC Western Deputy Commandant/Chief Instructor-brigade, Commander Chief of Personnel ,Military Assistant to the Chief of General Staff, until he retired at the position of a Major General 1973 to 2002 when he joined politics” (Halipad, 2014). That Nkaissery is unforgiving and uses strong orders to people comes from all the years of hardships in the army and the loyal line of defence that is there. So he uses the same mentality in the Politics as he sees the CORD as enemies and not as advisories. Therefore he does go after Governor’s from CORD, instead of seeking to create peaceful climate between the coalitions!
Removal of Security Team for Joho and Kingi:
“ODM leaders have asked Interior CS Joseph Nkaissery to reinstate the security detail of Governors Hassan Joho (Mombasa) and Amason Kingi (Kilifi) following their withdrawal on Friday” (…) “They had initially given Nkaissery a two-day ultimatum on the matter, but later said they would deliberate with the Cord NEC on the next course of action” (…) “Mvita MP Abdulawamad Nassir said among officers withdrawn were GSU and Administration Police” (…) “An official within Joho’s camp said among the withdrawn officers were four bodyguards who worked on a rotational basis, three uniformed officers who used to guard his home and at least two officers at his office” (Star Team, 2017).
Last time he tried to revoke the guns for Governor Hassan Joho, now he added Amason Kingi, because why not? You’re not Hassan Ali Joho best of friend, not that I expect that you like the ODM political leader. I am sure it hit your pride Honourable Mr. English Nkaissery that the coast governor won in court and we’re still allowed to carry his gun. So now you take it another step, because you can and orders to take away the Security Detail around these two governors. Both Joho and Kingi, like a spoiled brat your leave them behind, would you honourable Mr. English do this to any of your Jubilee Governors? I haven’t seen you’re acted against your own? But that do go against the military aspect of your mind, the chain of command and the loyalty of fellow comrades. That is why you take away the guns of the enemies while keeping it at bay for your own. Such a gentleman you are!
But as CS of Interior you need to spread more fear!
Nkaissery on Social Media:
“Interior Cabinet Secretary Joseph Nkaissery has issued a stern warning to those using social media to perpetrate hatred in the country ahead of the next General Elections. Nkaissery was speaking after some Maa leaders declared him the Maasai leader after the death of the two reigning Maasai leaders in 2016. Nkaissery has further declared Maasailand a Jubilee zone” (WatsUpAfrica, 2017).
You’re trying to act as a gentleman, but you’re forcing out more police officers and security personnel in the strongholds of CORD, while also taking away security guards for opposition governors and at the same time threating fellow peers, because of how they are supposed to use the Social Media. Since the Jubilee like PR and the media to spread their message to the public and would like the CORD not to question their PR bonanza that usually occurs, like when they released their Party with red-cars and used State House as a bonafide venue for Party Work.
CS Nkaissery, if you’re thinking you’re a grand politician and respected one, you are perfectly wrong, I expect more violence under your signature and of your operations before the General Election. Nkaissery your will wild-out claim the CORD is wrong as the law are already signed and the Election Laws that are helpful to ushering in the Jubilee for the second time, let the ruling President Uhuru Kenyatta and Deputy President William Ruto continue to rule. The rulers are amending and securing their positions, while spreading fear in the opposition strongholds months before the polls.
You’re such a genius CS Nkaissery, first you are putting out more officers, than taking away security details and later saying that people should watch their words on Social Media. Can you not put more restrictions on walking across the road and where they are selling water? Since you are all controlling and wants to silence them, you would have detained the CORD leadership if you could wouldn’t you Honourable Nkaissery? It’s boiling in your blood and your acting as the totalitarian leader, not the democratic and respectable the Kenyans deserves.
Certainly the CS of Interior isn’t an easy job, but your CV and your history against the CORD show’s you have no intention of dialogue, you throw tear-gas and detain, even brutality against innocent pedestrians, at one point your police officers killed a pedestrian who we’re around a demonstration in Nairobi; a person who was going to the bank and your police officers beat the man so brutally, that he died on the Nairobi streets. That is in your name and under your leadership that a man of that stature died. You shall always in my mind be remembered for the violence created when the #IEBCDemos we’re happening.
CS Nkaissery, what was more disturbing was that you didn’t care to say sorry for the violence and the ones ending at the hospital, the bullets and the havoc you made to silence the opposition. Instead of talking and negotiations, you sent the Police in Anti-Riot gear and militarized road-blocks to stop their civic duty. If this happens this year as well and yet another pedestrian just dies in vain, that will be on your watch and on your tab. That persons family and friends, are your sorrow to keep. You CS Nkaissery have responsibility for all citizens, even the opposition’s safety, not just the ones with membership in the Jubilee Party.
So time to act as a leader and Cabinet Secretary for all Kenyans, not just the loyal soldier for Kenyatta and Ruto; you are bigger than that right? Time for you’re to take it easy and think of the repercussions of your actions. The indicated vicious and malice attempt to silence the opposition proves your fear of your own record. You could be noble, but you’re not, you could be a grand big-man, instead you’re spreading fear and creating havoc.
Is that he legacy you want Hon. CS. Joseph Ole Nkaissery?
Halipad, Fabien – ‘The Intresting CV of Joseph Kasaine Ole Nkaissery the Kenya’s New Cabinet Secretary’ (02.12.2014) link: http://uhondopap.blogspot.no/2014/12/the-intresting-cv-of-joseph-kasaine-ole.html
Otieno, Kepher – ‘More police deployed in CORD regions to stop possible electoral laws demos’ (07.01.2017) link: https://www.standardmedia.co.ke/article/2000229036/more-police-in-cord-regions-to-stop-possible-electoral-laws-demos
Star Team – ‘ODM leaders ask Nkaissery to reinstate Joho, Kingi security detail’ (07.01.2017) link: http://www.the-star.co.ke/news/2017/01/07/odm-leaders-ask-nkaissery-to-reinstate-joho-kingi-security-detail_c1483693
WatsUpAfrica – ‘CS Nkaissery warns over misuse of social media to perpetrate hatred as elections approach’ (08.01.2017) link: http://watsupafrica.com/news/cs-nkaissery-warns-over-misuse-of-social-media-to-perpetrate-hatred-as-elections-approach/
Posted in Africa, Army, Civil Service, Development, Election, Ethics, Governance, Government, Law, Leadership, Politics, Transparency and tagged Abdulawamad Nassir, Amason Kingi, Anniversary Towers, Anti-Riot Police, Chief Instructor-Brigade, Chief of General Staff, Coalition of Reforms and Democracy, Commandant Battalion, Constitutional Referendum, CORD, CORD Leader, CORD Principal Raila Odinga, CS Joseph Nkaissery, Deputy President William Ruto, Discrepancies, DP Ruto, Dr. Bonny Khalwale, East Africa, Election Cycle, FORD-K, Forum for Reform and Democracy, GoC, GOC Western Deputy Commandant, GoK, Government of Kenya, Governor Hassan Ali Joho, H.E. Uhuru Kenyatta, H.E. William Samoei Ruto, Hassan Ali Joho, Hon. Hassan Ali Joho, Hon. Irungu Kang'ata, Hon. Joseph Nkaissery, Hon. Kithure Kindiki, Hon. Moses Wetangula, Hon. Raila Odinga, Hon. Stephen Kalonzo Musyoka, Hon. William Ruto, IEBC, IEBC Confidence Crisis, IEBC Kenya, IGP Boinett, IGP Joseph Boinet, IGP Joseph Boinnet, independent Electoral and Boundaries Commission, Interior CS Hon. Joseph Nkaissery, Irungu Kang'ata, JAP, Japheth Koome, Johnstone Kavuludi, Joseph Boinet, Joseph Boinett, Joseph Nkaissery, Jubilee, Jubilee Alliance Party, Jubilee Coalition, Kakamega, Kalonzo Musyoka, KDF, Kenya, Kenya Defence Force, Kenya National Police of Service, Kenya National Police Service, Kenyan Government, Kenyan National Police Service, Kilfi, Kilfi County, Kithure Kindiki, Leaders of Opposition, Mombasa, Mombasa County, Moses Wetangula, Mvita, Mvita County, Nairobi, Nairobi Police Commander, National Police Service Commission, Nkaissery, NPSC, ODM, Okoa Kenya, Opposition, Opposition Demonstration, Orange Democratic Movement, President Kenyatta, Promoted Officers, Rachel Shebesh, Raila Amollo Odinga, Raila Odinga, Republic of Kenya, Security Officers, Stephen Kalonzo Musyoka, Transparent, Uhuru Kenyatta, WDM, William Ruto, William Samoei Ruto, Willy Lugusa, Wiper Democratic Movement | Leave a comment
|
cc/2020-05/en_middle_0097.json.gz/line1399872
|
__label__wiki
| 0.892196
| 0.892196
|
More From Mix 93-1:
Kidd Kraddick Morning Show
Teacher Of The Week
Mix 93-1 Mobile App
Mix 93-1 On Alexa
Mix 93-1 On Google Home
East Texas Weather
Kidd's Kids
KiddTV
Mix 93-1 Schedule
Lucky Larry
Jen Austin
Mix 93-1 On Alexa Devices
The Christmas Channel
Submit An Event For Calendar
Mix Lounge
MIX VIPs
Become a Mix VIP
Mix VIP Help
ETX Sports Scoreboard
Mix VIP Support
Advertise On Mix 93-1
Mike Sampson is the Editor-in-Chief of ScreenCrush. He studied to become a lawyer and worked as an architectural planner after graduating college but neither of these professions afforded him the opportunity to watch movies and TV for a living. He previously served as the Editor-in-Chief of JoBlo.com for 10 years. He lives in New Jersey and probably spends too much time playing video games and overthinking things.
Join on Twitter
After ‘Batman vs. Superman’ Letdown, Warner Bros. Will Reportedly Release Fewer Films
Batman vs. Superman opened to negative reviews and mixed word of mouth. All that could have been forgiven if it was a box-office juggernaut, but after an impressive opening weekend, Dawn of Justice is sinking like a stone. With the film now unlikely to reach $1 billion — the new benchmark for …
‘The LEGO Batman Movie’ Trailer: The Dawn of Justice in Brick Form
Everyone who goes to see Batman vs. Superman this weekend is going to get an extra treat: a first look at the new Batman movie. No, not Batfleck, the real Batman. LEGO Batman. But, if you absolutely, positively can’t wait until you see it in the theaters, you can watch The LEGO Batma…
‘The LEGO Batman Movie’ First Look: DARKNESS! NO PARENTS!
Yes, we know you’re excited about Batman vs. Superman, but with that movie set for release this Friday, it’s also time to start getting excited for that other Batman movie. No, not the Batfleck solo movie, The LEGO Batman Movie. The LEGO Movie spinoff is coming to the…
Because You Asked For It, Netflix Made Another Adam Sandler Movie
Last year Netflix released their first original Adam Sandler movie, The Ridiculous Six. Like all Adam Sandler movies, critics hated it (it’s currently 0% on Rotten Tomatoes), but according to Netflix it was their most-streamed movie in the first 30 days of all-time...
‘Captain America: Civil War’ Directors Say You’ll ‘S— Yourself’ Over Spider-Man
The big Spider-Man reveal at the end of the Captain America: Civil War trailer certainly got the internet, and all of superhero fandom, in a tizzy. There were those that absolutely loved it and then there were those who were left disappointed...
Theater Owners Shoot Down Proposed Plan to Release New Films at Home on Opening Day
Two weeks ago came word of a controversial, yet intriguing concept proposed to both Hollywood studios and theater owners: a new encrypted set-top box that would allow moviegoers to watch new releases the same day they open in theaters. So, for example, you could watch Batman vs. Superman on March 25…
Singer Zendaya Lands Lead Role in Marvel’s ‘Spider-Man’ Movie
While most comic book fans are waiting to see if they’ll catch a glimpse of the new Spider-Man in this week’s Captain America: Civil War trailer, Marvel is already looking ahead to Spidey’s new reboot. While the film isn’t due in theate…
Did ‘Guardians of the Galaxy 2’ Just Add Sylvester Stallone to the Cast?
Last month when Guardians of the Galaxy, Vol. 2 director James Gunn revealed on Facebook that Kurt Russell, Elizabeth Debicki and Chris Sullivan had joined the cast of his sequel, he promised “We’ll have more surprises for you in the coming months.” Has one of those surprises al…
‘Ghostbusters’ Trailer: These Women Ain’t Afraid of No Ghost
Ever since the Ghostbusters reboot has been announced (with an all-female cast) the film has been harshly judged, sight unseen. Today, director Paul Feig has officially revealed the Ghostbusters trailer, so now we can judge the film on its own merits...
‘Finding Dory’ Trailer: You Can Go Home Again
Pixar has settled into a rhythm of releasing both sequels to huge hits and new, original movies in theaters. 2015 was home to two original Pixar movies — the Oscar-winning Inside Out and The Good Dinosaur — which means now it’s time for another sequel...
Seth Rogen’s Animated ‘Sausage Party’ to Premiere at SXSW
Seth Rogen was already planning on attending SXSW to premiere to first episodes of his upcoming AMC series Preacher, starring Dominic Cooper. Now Rogen has decided if he’s going to be at SXSW anyway, he might as well bring one of his upcoming films with him. The actor-director will premiere a…
Ben Affleck Reportedly Rewrote ‘Batman vs. Superman’ Script Every Day…in Costume
One of the stipulations when Ben Affleck signed on to star in Batman vs. Superman was that his Argo writer, Chris Terrio, would come aboard to help fix the script. Though Terrio was indeed brought in to rewrite the script (originally written by David Goyer), it seems Affleck still was not happy with…
Meet the DJsMeet All Our DJs
The Kidd Kraddick Morning ShowRead Articles
Lucky LarryRead Articles
Kayla ThomasRead Articles
Jen AustinRead Articles
Latest From MixSee All The Latest News
Mix 93-1 Teacher Of The Week January 20th
Ginger Will Have You Running, She Has That Much Energy
Winter Gear to Keep Your Pets Cozy
'Friends' Co-Creator Clarifies Potential Reunion Details
Mix on Facebook
Tyler Business Listings
2020 Mix 93.1 is part of the PopCrush Network, Townsquare Media, Inc. All rights reserved.
|
cc/2020-05/en_middle_0097.json.gz/line1399875
|
__label__wiki
| 0.708034
| 0.708034
|
Stephen Fry’s Olympics open letter was a masterclass in eloquence
Bryan ScottThursday 8 Aug 2013 8:24 am
Stephen Fry on the couch, but certainly not on the fence (Picture: Getty)
Stephen Fry penned an open letter to David Cameron, Jacques Rogge, Seb Coe and members of the International Olympic Committee. It came from the heart and quickly saturated our social networks.
The purpose of his letter was to demonstrate his condemnation for Russia’s stance on LGBT rights and to call for a boycott of the 2014 Winter Olympic Games in Sochi. While Stephen’s own site pretty much buckled under the strain of eager readers, his message rapidly spread through other channels such as PinkNews.co.uk and Tumblr.
Why was Stephen’s letter so impactful?
Firstly, he made the situation incredibly understandable to pretty much every sane minded human being on our planet. By highlighting the similarities between Hitler’s actions around the time of the Berlin Olympiad in 1936 with that of Putin’s actions on gay rights, Stephen rightly compared one of the greatest crimes ever against humanity with that of the barbaric happenings in 21st century Russia.
Secondly, he reminded us of the purpose of the Olympic movement. While the IOC have claimed that gay Olympians would be safe in their village, Mr Fry emphasised the point that sport is a cultural movement and doesn’t exist ‘in a bubble outside of society or politics’. Without people, sport is nothing. Politics are ALL about people. The two can never be separated.
Next Stephen called on his own experiences during a visit to the city of St Petersburg. It can be quite easy to sit from the comfort of one’s desk and pen some words on an incredibly newsworthy topic. But he obviously knows more about this situation than the vast majority of us, having witnessed it first hand, and by bringing his own personal perspective into the letter meant that everything he wrote held even more weight.
He also reminded of us of our own amazing Olympic experience last summer. I would challenge anyone to dispute the notion that the London 2012 games demonstrated the very best of openness, inclusiveness and equality. If less than two years later, the Winter Olympics do not demonstrate the same, surely all the effort and passion that we put into hosting arguably the best games ever would have been in vain?
Don’t let the human legacy of London 2012 go to waste (Picture: Getty)
If all else fails, remind the IOC of their own rules:
Rule four: Cooperate with the competent public or private organisations and authorities in the endeavour to place sport at the service of humanity and thereby to promote peace.
Rule six: Act against any form of discrimination affecting the Olympic Movement.
Rule 15: Encourage and support initiatives blending sport with culture and education.
Finally, Stephen appealed to our Prime Minister’s ego. David Cameron has certainly done his bit for LGBT rights by championing equal marriage through both his own party and the wider parliamentary movement. Not doing the same on the world stage, will surely put a damper on those achievements.
Thank you Stephen for using your words, fame and following to highlight the importance of this issue today.
BerlinDavid CameronGayHitlerInternational Olympic CommitteeJacques RoggeLGBTOlympicsRussiaSebastian CoeSochi 2014Stephen FryVladimir Putin
Anger as ex-Tory leader behind 'cruel' Universal Credit given knighthood by Boris Johnson
More than 200 Boxing Day hunts planned as campaigners push for tougher laws
|
cc/2020-05/en_middle_0097.json.gz/line1399878
|
__label__wiki
| 0.700251
| 0.700251
|
Man Who Escaped From Hialeah Police Cruiser CaughtA man facing charges in Hialeah had a few more added after he tried to escape by jumping out of a police car.
Sold At Target And Amazon, Baby Stroller Recalled Due To Possible Fall HazardBaby Trend is recalling four models of its strollers due to the potential for a fall hazard.
South Florida's Coco Gauff Defeats Venus Williams At Australian OpenDelray Beach's teen sensation Coco Gauff defeated seven-time grand slam champion Venus Williams 7-6, 6-3 in the first round of the Australian Open on Monday.
2:00 PMThe Talk
Arrest Warrant Issued For Chad Johnson For Alleged Probation Violation
Filed Under:Arrest Warrant, Batterers Intervention Program, Broward Sheriff's Office, Chad Johnson, Evelyn Lozada, Miami Dolphins, Probation Violation
Chad Johnson Mugshot (Source: Broward Sheriff's Office)
FORT LAUDERDALE (CBS4) – Former Miami Dolphins wide receiver Chad Johnson is once again a wanted man.
The Broward Sheriff’s Office issued an arrest warrant for the former football star after he allegedly failed to report to his probation officer three months in a row, as well as failure to enroll in a Batterers Intervention Program (B.I.P.)
Johnson had been on probation since September 2012 after he cut a deal with prosecutors over charges he head-butted his then-wife, Evelyn Lozada, during an argument last August. The six-time Pro Bowl wide receiver was arrested last August in front of his Davie home.
Lozada reportedly found a receipt for a box of condoms and confronted Johnson about it.
Under terms of the original plea deal, Johnson pled no contest and was ordered to serve one year of probation, complete batters’ intervention counseling and pay medical restitution.
Johnson and Lozada had only been married a short time when the incident happened and were divorced quickly thereafter.
|
cc/2020-05/en_middle_0097.json.gz/line1399883
|
__label__cc
| 0.524178
| 0.475822
|
Thinking about what is "Taiwan'
Mango shaved ice after a morning bike ride: breakfast of champions.
It's always a shock for people who think about Taiwan in conventional ways governed by the tropes and talking points that are the most important aspects of Chinese soft power to encounter this blog, which rejects all propaganda that supports Chinese imperialism against Taiwan. This most importantly includes the construction of the Manchu Empire as "China", a rhetorical and ideological move whose purpose is to enable Beijing's expansion at the expense of Tibet, Xinjiang, Taiwan, and other areas. The "'Taiwan' was a province of 'China'" is a trope that appears quite often in the media, one that serves the current wave of Chinese imperialism and expansionism.
In the 19th century western travelers were well aware of the reality of Qing governance on Taiwan, and they were aware quite early. The 1807 edition of John Aikins' Geographical Delineations: Or, A Compendious View of the Natural and Political State of All Parts of the Globe observes that Taiwan is also known as Formosa, and describes:
...A chain of mountains divides it lengthwise into an eastern and western portion, of which the latter only is possessed by the Chinese, while the eastern is left to the original inhabitants.
Similarly, the 1812 edition of The American Universal Geography, Or, A View of the Present State of All the Kingdoms, States, and Colonies in the Known World: In Two Volumes notes that the Chinese control only the western portion of the island. This knowledge would form the basis for much colonial speculation by westerners and eventually, Japanese, for most of the 19th century.
The Manchus of course never controlled the entirety of the island; the first government to do that was that of Imperial Japan. Moreover, it is often forgotten that the eastern part of the island (actually a majority of the island as early Japanese maps show) was held by the Qing themselves to be outside the Manchu Empire until after the Western powers and Japan began sniffing around. It was only in the mid-1870s that the Qing finally proclaimed the whole island belonged to them and attempted to extend Qing control into the highlands, an attempt which failed. Only for the last decade of Qing control of Taiwan did the Qing define it as a province.
Hence, today when we speak of "Taiwan" we are actually speaking in a subtly anachronistic manner that has inherited the tropes of the great age of imperialism. We are back-projecting the current unity that is Taiwan into the Qing period, an act which has us thinking of Taiwan the way Beijing wants us to -- as a (1) unified object that (2) belongs(ed) to the Manchu Empire (which is now "China"). In one real and important sense, there was no such thing as Qing Taiwan as we lazily imagine it, a whole island placidly under Qing/"Chinese" rule. The actual Qing "Taiwan" was a slender strip in the lowlands that was constantly in revolt, parts of which at times paid a danegeld to nearby aborigines. The Qing process of settlement and colonization, no different from European settlement and colonization, never assimilated the highland peoples. Yet the ideological tropes of 19th century Qing and western imperialism still dominate our thinking: we never speak of "Aborigine Taiwan" in that period, even though the majority of the island was in their hands throughout the entirety of Manchu "rule".
The recognition of the Qing as imperialists carrying out a process of colonization who were only partly in control of Taiwan is important, because, as Emma Teng notes in the profound epilogue to her excellent Taiwan's Imagined Geography: "The very idea of 'national reunification' between China and Taiwan is predicated on the denial of Qing imperialism." Denial of Qing imperialism is crucial, because if you think of Taiwan as the site of Qing colonization and imperialism, then you deny the whole idea of "unity" between Taiwan and "China". It was merely a settler colony and separate territory -- just as today no one would speak of "unity" between France and Algeria, or between London and New Delhi, or between Philippines and the US. The strangely idiosyncratic nature of the "divided China" claim is true even for the Qing empire itself -- no one speaks of "divided Vietnam and China" even though the Qing controlled a large area of what is now Vietnam. Tellingly, that trope applies only to Taiwan.
The idea of "unity" and "division" between "China" and "Taiwan" is thus a PRC propaganda trope, part of discourse on "national unification" whose purpose to deny that PRC expansionism is a form of imperialism and colonization by redefining the Qing empire as "China" and the peoples who inhabit them as "Chinese" and Qing expansion as "national unification." Under the Qing the Manchus, Mongols, Han, Tibetans, and Muslim peoples had been regarded as the "Five Nations" at whom the Qing emperor looked out from the center, being all things to all men -- a Buddhist to the Tibetans and Mongols, a Confucian to the Han -- and publishing Imperial texts in all five languages. The Qing saw themselves as the polar center of a multicultural empire that required an ethnic balancing act, just like the British in India, the Austrians in Eastern Europe, or the Ottomans in the Mediterranean basin. It was the Han expansionists of the 1930s who turned all this on its head, with Chiang Kai-shek finally declaring that these peoples were all sub-races of the Chinese race in 1939 (see Gladney, 1991). The burgeoning Han imperialism had subsumed the Qing empire at last.
This wholly modern, ideological, imperialist claim that the Qing Empire was China, with its concomitant claim that "Taiwan" was part of "China", widely accepted in the media and even among academics who should know better, is one of the most important components of PRC soft power. When writers use it, they accept claims about the history of China which they would never accept if they were made about the history of another nation. It forms the basis for its "historical claims" to a number of territories, including the Senkakus, which are linked to Taiwan in the historical fantasies of Beijing. That is why you will never find it on this blog, and that is why to identify and deconstruct this claim is not to twist history, but to untwist the knot that Beijing currently uses to bind Taiwan.
UPDATE: Brian Benedictus has a related discussion on Ketagalen media
Ma finds new way to irritate Japan
My new Sony DSC RX100 II has basically rendered my old Canon EOS 550D obsolete for most of the pics I take, but the Canon still takes excellent macro pics when coupled with the wonderful Tokina 100mm macro.
The Taipei Times comments on President Ma's latest drive to irritate relations with Japan...
President Ma Ying-jeou (馬英九) on Friday once again called for Japan to review what he considered an insufficient number of Japanese tourists visiting Taiwan in recent years, the third time he has aired such concerns in the past 15 days.
When receiving new Japanese Representative to Taiwan Mikio Numata on Aug. 22, Ma urged Japan to “reflect upon” why there were only 780,000 Japanese visitors to Taiwan in the first half of the year, against 1.46 million Taiwanese tourists to Japan during the same period, adding that Taiwan has surpassed South Korea to become the largest source of tourists to Japan.
The scolding language -- "reflect on" is a classic Chinese scolding trope that accuses the listener of a moral failure in behavior. But more importantly, it shows how the Ma Administration is continuing the policy of finding irritants to keep riling relations with Japan. Ma could just have easily have thanked Japan for being the largest source of tourists outside the China.....
The always excellent Ketagalen Media on the Sunflowers: Turning protests into politics
Livestream of tonight's protests in Hong Kong
Article on how the election in Macao and future of Hong Kong
KMT poll has Lien closing in on Ko in Taipei (China Post)
Chinese spyplanes test Taiwan: the salami slicing has begun
Wanna see Taiwan's future? Even Bloomberg, which is hardly what anyone would call a liberal rag, is publishing articles pointing out that China's goal in HKK is to save the rich. Same thing happening here in Taiwan, but in slow motion.
China now to destroy Taiwan's national champion semiconductor industry.
FireX band on igniting the Sunflower movement via music
Advice on moving to Taiwan (here)
10 Family friendly things to do in Taiwan. Actually, every one is in Taipei. Taipei does not equal Taiwan. For the sake of all Taiwan gods, can we stop writing as if Din Tai Feng were good? It's perfectly average.
Chinese incidents with Indonesia in the South China Sea.
Taiwan Brain Trust on identification with Taiwan among the young
MOD says China could seize Taiwan before help can arrive. That's the Ma administration's goal, no?
NOT TAIWAN: Brian B's droll article on international sports and N Korea
EVENT: KEEP TAIWAN FREE NYC Kick-off event featuring The Hsu-Nami, Olivia Utopia世外桃源 (Taiwan), Manic Sheep (Taiwan)
Wednesday, September 10 at 9:00pm in EDT at Arleans Grocery (Facebook)
2 Comments Labels: Japan, tourism
The Economist: one drop in the tsunami of stoopid
Another lovely Taiwan riding day.
I'm blogging on this because I fear that if you read this article in which the Economist explains why China and Taiwan are divided, your IQ may plummet. Just consider this my small public service in defending the world from the ongoing tsunami of stoopid in the media. Why O why can't we have a better media?
The stoopid starts at the very beginning. With the title: "China and Taiwan are divided." But of course, China and Taiwan aren't "divided." The KMT and CCP governments wish to annex Taiwan to China, whose sovereignty over Taiwan is not supported by any international treaty. It is they who are divided. There is no division between Taiwan and China, because there was never any unity (Added: I discuss this in a post above).
The Economist simply leaves out all the issues -- the fact that for all of Chinese history Taiwan was considered to lie outside China, until the mid-1930s when Chinese expansionist thinkers began to imagine they could grab it. Or the 1895 declaration of independence. Or the island's current undetermined status under international agreements and US and UK policy. Bye-bye.
Consider also how writers on the Taiwan-China problem have incorporated the trope "province of China in the 19th century" into the way they think about Taiwan's relationship with China -- as if it actually meant something. It means precisely nada. That's one of the double standards we use in thinking about Chinese claims, which we apply to no other claims. For example, Algeria was a department of France for over a century, Taiwan a province of the Qing for less than a decade. I look forward to the Economist's next brilliant article on how Algeria and France are divided.
It always saddens me that allegedly democracy and law-supporting media organs can't clearly lay this out for the public. Instead, we just get parroting of Chinese claims when what we should get is subversion and deconstruction of them.
The Economist goes on to present "history":
... Taiwan has since become a democracy, but resentment of the KMT runs deep among many of those who were living on the island before the KMT took refuge, and the descendants of such people. Their identity with greater China is weak. Some want Taiwan to abandon any pretence of a link with China and declare independence.
This is another common trope in the media -- downplaying support for independence. It's not "some" who want, but a comfortable majority. But for the Economist to maintain the fiction that China and Taiwan "divided" -- it's actually the KMT and the CCP which are divided -- it must downplay support for independence in Taiwan. But it gets worse -- the Economist actually treats democracy as if it were a bad thing. It urks up:
But perhaps an even bigger reason why the Chinese and Taiwanese presidents have yet to meet is that the Chinese civil war is not officially over. The government in Beijing does not recognise the government in Taipei, and thus does not accept that it has a president. Although the two sides stopped lobbing shells at each other in the 1970s and began talks in the early 1990s, progress has been slow. Discussions were held only through intermediary bodies, while Taiwan’s democratisation soon intervened. Taiwan’s then president and KMT leader, Lee Teng-hui, organised the island’s first direct presidential elections in 1996. In an appeal to native Taiwanese, he shifted his government’s rhetoric to talk not of "one China" but of two states. This effectively granted recognition to the government in Beijing, but it also infuriated it. The Communist Party feared a slide towards Taiwan’s formal declaration of independence and tensions flared. China lobbed unarmed missiles into the Taiwan Strait; America sent aircraft carriers to warn it off. The victory of Mr Lee in the presidential elections, and of the pro-independence Democratic Progressive Party in two subsequent ones, stymied further progress in cross-strait talks.
The brilliance of this paragraph lie in its author's utter blindness to what he is writing -- he opens by saying that the issue between the KMT and CCP is the Chinese Civil War, which is rank nonsense. The Chinese Civil War is a dead letter. The real issue is that -- as he bass-ackwardly identifies further on -- the people of Taiwan don't want to become part of China. If Taiwanese supported annexation to China at the same levels they now support independence, then we would have become part of China decades ago.
The only reason the CCP even talks to the KMT is because the KMT represents its best shot at annexing Taiwan without a war. "Resolving" the Chinese Civil War is actually a rhetorical cover that the CCP and KMT use to justify their talks on how best to annex the island to China and what the take-home for the KMT will be. Thanks, Economist, for repeating that bit of propaganda as if it actually meant something.
Indeed, the only reason we're having a China-Taiwan discussion is because China threatens to maim and murder Taiwanese if it doesn't get to annex Taiwan. Otherwise the Taiwanese would be ignoring Beijing, Chinese Civil War or no.
But look at how the Economist treats democracy -- first it "intervenes" in the glorious progress of annexing Taiwan to China and then it "stymies further progress." That rotten democracy! How dare it!
Read it again -- the author of the piece is lamenting the fact that a democratic island of 23 million people with close relations with the western democracies whose economy is of global importance was not making progress in being annexed to China.
Does it get any more stoopid than that?
The reason we can't make "progress" in cross-strait talks isn't anything that happens in Taiwan -- it is because China is completely belligerent and inflexible. Instead of clearly pointing this out, the Economist puts forth a series of common tropes here
-- false equivalence: Taiwan resistance and Chinese aggression are treated as if they were two equal sides of the same issue.
-- that China is provoked and infuriated and has no agency of its own in the Taiwan-China relationship. Poor China, stop it before it shrills again!
-- that "tensions flare" on their own, like Immaculate Conceptions, without the intervention of human agency. As my readers know, tensions flare because China chooses to ramp them up. Tensions are a policy tool for China. D'oh.
-- that President Ma is a "less confrontational" president (because he and Beijing are allied in annexing Taiwan to China! D'oh!): a common media trope is to assign the adjective "confrontational" or "provocative" to Taiwan while ignoring China's belligerence...
...because when you demand that a territory annex itself to your nation, point your military at it, and say that you will plunge the region into war if you don't get your way, you're not being confrontational, you're being statesmanlike. And when you resist that, you're confrontational.
Divided? The real division is between the people of Taiwan and the democracy they cherish, and the Chinese nationalists on both sides of the Strait who desire to suppress that democracy and annex Taiwan to China. But it appears that we will never see any discussion of that in the Economist...
Minimum wage might go up...4%
Military budget down slightly, investing in local arms makers
Hong Kong university survey on how HKKers view Taiwan issues. Support for independence is rising.
PERSONAL: my sister needs your help for a survey on scientific visualization. Needs mouse, I couldn't do this on a mobile device.
EVENT: Second World Congress of Taiwan Studies: Call for Papers
The Second World Congress of Taiwan Studies will be held at the School of Oriental and African Studies (SOAS) June 16-18, 2015. The Congress is being co-organized by Academia Sinica and the SOAS Centre of Taiwan Studies.
Click on READ MORE...
27 Comments Labels: China, democracy, Taiwan, Taiwan independence, The Economist
Links for Easing Back into Blogging
Lanyu again. Just because.
Up in Taipei writing papers all week (last one accepted without revision!). Now trying to ease back into blogging. Enjoy some links.
Sex toy with Lin Fei-fan, sunflower leader, emblazoned on it.
Overreliance on China will doom Taiwan
Taiwan banks are heavily overexposed in China, and are cutting loans to reduce risks. I sense a taxpayer bailout in the works...
Anti-corruption agency raids home of Jimmy Lai in Hong Kong. Another way in which Hong Kong is getting to be like Taiwan.
The thin edge of the wedge: officials want tobacco tests in schools. The function of arbitrary searches is of course to get students used to being arbitrarily searched.
Hilariously, Ma calls alleged spy MAC Vice-chief Chang a pest in cross strait relations, then says piously that we shouldn't say he is a spy without a trial. LOL. Remember when he openly stated now exonerated Speaker Wang Jin-pyng had engaged in influence peddling?
Visiting Ronghua Dam.
AmCham Connect, the American Chamber of Commerce collection of online writings.
Sunday night Short Shorts
She's classic.
Deputy MAC minister Chang is out this week:
The Presidential Office confirmed yesterday that the president received a letter from former Mainland Affairs Council (MAC) deputy minister Chang Hsien-yao (張顯耀) defending himself against an accusation that he had leaked national secrets, before Chang issued a statement on Sunday last week that suggested he had been forced to resign.
The removal caused the People's First Party (PFP), little more than the faction of former KMT heavyweight and former important politician James Soong, to make furious noises, since Chang was a PFPer. The local media is claiming that he was actually forced out is not spying but because he is a Soong man and not a Ma man, and he was removed at the behest of King Pu-tsun, Ma's "Little Dagger" and the man to whom such moves are always attributed. It seems there is always someone accused of playing Rasputin to Ma's Tsar Nicholas. Yet another example of the way underlings are said to convey the real message while the Big Man remains aloof and exudes beneficence, to deflect criticism from the Big Man (in many cases the wife often fills this role of criticism magnet -- "Oh, X did all those negative things because he was misled by his scheming wife...)?
Two Mormon missionaries were found dead in a local apartment. Word has it that they had a water heater indoors which killed them via carbon monoxide poisoning. This type of tragedy happens with depressing frequently. Please make sure your house is ventilated -- remember that concrete houses don't "breathe" like wooden houses.
Bad news: the KMT government is considering putting the banking sector outside the agreements and moving on it before any other cross-strait agreements with China are signed. Argh. How much public oversight do you think that will have?
Jerome Cohen on Cross Strait Relations and Human Rights
Taiwan is #3 machine tool supplier
I am sure you are as amazed as I am to learn that the corporate world has shown little interest in meeting wage hike.
Concerns grow about eroding competitiveness. What? You mean increased tourism from China and selling out Taiwan to China via ECFA didn't solve our problems? Who could have predicted that?
Ma asks Japan to review the tourist imbalance between Japan and Taiwan. Please stand by while I attempt to tamp down another sarcastic comment.
Awright! Tsai to make government competence an issue. The use of the word "incompetent" will naturally like the KMT with Ma, that being a common epithet to describe our President. I've noticed on my jaunts around Taiwan this month that the President AND KMT party chairman is persona non grata on signs around the island.
A few links
This macro shot with my Sony DSC RX100 II turned out to be really nice.
I've begun work on a book on biking here with a couple of well known local expat riders. So expect blogging to take a hit. Exhausted today, enjoy some links....
Foreign Policy notices the Hong Kong-Taiwan connection against China. A good review of the events. Don't miss comment from TECO in the comments section.
Why the F-35 is ideal for Taiwan. It's nice to imagine, but the purpose of the discussion of F-22, F-35, etc, is to derail the whole idea of getting fighter aircraft, since the US will never sell F-35s to Taiwan. Now we can go through another few years of asking for F-35s and being refused. At the end of this "debate" we will have F-16s still, and the Chinese will be operating space warp attack vehicles with n-dimensional teleportation capability, and US "analysts" will be scolding Taiwan for not spending more money on defense.
Sunflower leaders go to Washington and get everything wrong. Didn't anyone tell them that the US One China policy doesn't recognize Taiwan as part of China. Argh. Anyone who thinks the DPP is running the Sunflower movement doesn't understand the DPP, which was totally blindsided by the student movement.
30 Authentic Taiwan experiences
Don't miss: The Forgotten Taiwanese soldiers -- what happened to the men who fought for several different countries in the 40s and 50s?
Taiwan Marketplace, filmed in 1930. With sound! New Years Procession from the same year
The point on the 159甲 where it becomes stunning.
Another ride on one of my favorite routes in Taiwan, the Ten Thousand Year Gorge and Caoling via the 149 and the 149乙, Alishan via the 149甲 and the 169, and back to Chiayi via the 159甲. Only this time, my wife and I did it on our sturdy 125cc scooter.
Scootering presented certain problems. The last gas station is in Zhushan 60 kms from Laiji where we planned to overnight, while the next one on the other side is in Shijhuo. It is certainly possible to purchase gas in the mountains, but such trade is illegal and sellers are subject to heavy fines. Rather than risk getting someone in trouble for providing desperately needed services the government-owned service station system is too lazy to provide (isn't that what we pay tax subsidies for?), we took along a three liter gas can of gas on day one, and refilled with that in Laiji. That got us to Shijhuo without worry, where we filled with the last liter and a half from the gas can, which we left by a garbage can on the route, since we figured someone else could use it.
If you've seen my other Alishan ride photos (here and here, for example), it's the same route. Same gorgeous scenery. Same enjoyable time. I took rather more pictures on the 159甲 than I usually do, since it is more of a pain to stop on a bike than on a scooter. We also returned via a different route, very enjoyable.
Click on READ MORE as always...
3 Comments Labels: Alishan, photos
A Cole-Sullivan TwoFer + links
Out walking the dog, found this beautiful walking stick.
Taiwan expert Jon Sullivan with an excellent piece on the DPP, Taiwan identity, social class issues, and politics at The National Interest. He scribes:
Notwithstanding underlying trends in public opinion, a spate of recent academic publications suggests that this may indeed be happening. They suggest that a new economic cleavage based on class has not just mitigated national identity, but has replaced it. Because of the unusual equality of growth during Taiwan’s “economic miracle,” combined with the dominance of national identity during the democratization process, class has not been particularly salient in Taiwan. But since the global financial crisis, exacerbated by ECFA, Taiwan has seen the emergence of inequalities that it hasn’t witnessed in generations. The reality for many Taiwanese is stagnant or declining wages, unaffordable houses, unemployment, poor social mobility and feelings of relative deprivation and economic insecurity. Reflecting on these developments, Tsinghua University scholar Zheng Zhenqing says that “under the influence of the global financial crisis, a new axis of class politics has emerged.” Wu Yushan at Taiwan’s Academia Sinica agrees that “class politics based on wealth gap has become new driving force of party politics [. . .] the dominant social cleavage [has shifted] away from identity towards distribution.” Qi Dongtao at the National University of Singapore similarly argues that class divisions and class awareness have increased dramatically since ECFA. When the global financial crisis decimated Taiwanese exports, President Ma and the KMT promoted growth by opening up to the Chinese economy via the vehicle of ECFA.
This is a really excellent piece. But there's a connection missing. The Taiwanese identity is still driving politics, and the emerging class politics we see in Taiwan is just the other side of the Taiwanese identity coin: it was always driven in part by economic injustice. Taiwanese have always resented how the mainlander-run political order extracted the surpluses they generated and handed them out among the mainlander population, most of whom were left out of the economic miracle since they lacked the kind of sophisticated production and financial skills and resources that the Taiwanese possessed. This economic cleavage produced two privileged classes: mainlander bureaucrats and soldiers who lived on the surplus produced by the Taiwanese, and the extremely wealthy capitalist class which had intimate connections to the top of the KMT and exploited those connections to make money off upstream industrial development (like plastics), finance, and land development. The Taiwanese identity is in large part a response to the colonial processes that underlie KMT control of Taiwan's economic flows.
Thus, the economic justice issue is a Taiwan identity issue, one bleeds into the other. The driver of both is of course China. Taiwan expert Ketty Chen observed this in her extensive and excellent piece on the SOAS conference this summer:
Lastly, the SOAS conference also brought to the forefront an issue that cannot be ignored – the influence of China, as the China factor was one of the reasons for the student occupation of the Legislative Yuan and the Sunflower Movement. Moreover, the movement against media monopoly, the demolition of Mainlander communities in Taipei, land expropriation in Miaoli County and elsewhere in Taiwan, all in the name of progress, development and investment, all bear the influence of China.
Sullivan knows this, of course; few understand Taiwan politics better than he does. That is probably why he confidently expects the Taiwan identity to become a huge driver of politics in the future -- especially as the current young generation matures (talking about my generational issues). But he could hardly talk about economic justice in the relatively conservative National Interest.
Meanwhile over at Sullivan's wonderful China Policy Institute blog, J Michael Cole has a piece arguing that it is Time to Bring the Orphan In From the Cold:
Although Washington might operate under the assumption that limiting the DPP’s room to maneuver—or killing its chances of being re-elected—is to the U.S.’ advantage, such a strategy is terribly short sighted. Independence, the “status quo,” and anything short of “one China,” is a trump card not only for the DPP, but also for the many KMT voters who would never agree to seeing their country absorbed by authoritarian China. Pan-blue voters might not be as vocal as their “green” counterparts on the subject, but that notion is very clear in their minds (less than 10 percent of blue voters support unification). The last thing Washington wants to do, therefore, is to deny those voters that safe zone. In fact, knowing what we know about the composition of the Sunflower Movement, it is clear that any move by the U.S. to constrain the choices of the Taiwanese (e.g., freezing the DPP’s independence clause) would only fuel anti-American sentiment on the island, which certainly isn’t to Washington’s advantage. The more the U.S. forces Taiwanese in a direction that they don’t want to go, the greater the risks of instability on the island. Repeats of the Sunflower occupation, which will certainly occur if the government makes any concessions on Taiwan’s sovereignty, can only further weaken Taiwanese society and invite Chinese intervention (on this aspect, recent developments in Crimea should dispel any notion that authoritarian governments such as those in Moscow or Beijing will be deterred by fears of retaliation or sanctions when acting within what they regard as their immediate neighborhood). Washington officials should realize that a strong, confident, and united Taiwan, one that doesn’t feel isolated or forced to make choices it would rather not make is in the U.S.’ interest.
Cole is largely right, but I would go further to contend that letting the KMT run Taiwan is against US interests, because the KMT is a pro-China party and because it will be less likely to cooperate with the US when China finally moves on the Senkakus or something big in the South China Sea. This is evident in how the Ma Administration constantly moves to irritate Washington (here and here, but especially here and here), to contravene its policies and stir up trouble with Japan. Anyone seriously think a DPP president will call in the Japanese ambassador to upbraid him about the Senkakus?
The other point that I constantly make is that the everywhere else around the periphery of China, the US is taking steps in concert with local governments to resist Chinese expansionism. But with Taiwan the US is encouraging Chinese expansionism. How's that again? Does the US really want to give up 23 million people, an army and an air force, and a forward position with a fellow democracy, and then fight a war with China over the uninhabited Senkakus or Spratlys? The truth is that Taiwan is an asset that US thinkers can't seem to imagine how to use.
Sad, that.
Drew's great post on his ride in the Never Stop race to Wuling.
Cole on the pro-China agitation in front of Taipei 101
The always useful Ketagalen Media on the formation of a splinter group off the student movement
ROC Admiral says China 30 years behind the US
The Ministry of Audit says ECFA is a failure. Commercial Times notes that Chinese data says China's imports from Taiwan are declining but still argues that the services pact should be approved.
5 Comments Labels: 2016 presidential election, DPP, economic justice, identity politics, KMT, political economy
Polls and Politics in Taipei
Another Lanyu pic, because I miss it so much.
Over on Twitter the very useful FormosaNation has tweeted round the lastest WantWant poll. Independent and former DPPer Shen Fu-hsiung has withdrawn from the Taipei mayor race, leaving independent Ko Wen-je and KMT scion Sean Lien facing off. WantWant has a new poll out which looks a lot like most of the other polls, giving Ko 39.5% to Lien's 30.1% among those likely to vote. Undecideds are at 25%. When asked who they thought would win, voters had Ko over Lien, 32.5% to 30.1%. Interestingly, these are almost the same numbers for Ko/Lien as the Apple poll from exactly a month ago.
Looking at the numbers as they currently are, less than 90 days from the election, Ko need only pick up another 8% of the voters to exceed the DPP's/pan-Green's highest total of 45% in 1998. That leaves 17% for Lien, all of which he will have to pick up to win a narrow victory in that case. But if Ko only gains 1 or 2%, Lien will only have to pick up half of the remaining undecideds (23% left!) to win. It's early, and money still hasn't been showered on the precinct captains, nor has the harrowing last election month with its hit pieces and mounting character attacks arrived. Nor has Ko ever broken the 40% mark in the last few months. Is 38-39% his ceiling? Could well be. I see no reason why Lien won't win at the moment.
Ominously, as if reflecting Ko's flat numbers, this recent poll on the elections shows that the KMT is slowly gaining on the DPP in local surveys, while DPP numbers, still high, remain flat. Neither party is well-liked and both have high dissatisfaction ratings. As is conventional in media explanations, this is attributed on the DPP part to Chairman Tsai Ing-wen's lack of announcement of new policies.
I would bet that most of the undecideds in Taipei are light blues, because Ko's numbers are just a few points off the limit of DPP votes in Taipei. Light blue voters, as I've noted before, flatter themselves that they vote on merit and what a coincidence, KMT candidates are the most competent. This is an important self-perception in this election, because the candidacy of Sean Lien spits in its face.
The classic justificatory regime for colonial governance is racism -- the "racial inferiority" of subject peoples was justification for white European colonialism. In authoritarian regimes the parallel justification is meritocracy -- they deserve to rule because their people are better trained, more competent, etc. Colonial regimes also justified themselves this way, as exporting "rational" and "scientific" methods to the "irrational" and "traditional" regions they ruled. As an authoritarian, colonialist state the KMT has deployed both the ethnic superiority (Han/Mainlander chauvinism) and the "competence" claim in justifying its control (recall Ma's election claim of "clean, capable" governance. LOL). My experience with light blues is that they dip into the well of both these claims -- feeling themselves superior as Han/Mainlanders and also feeling that they merit the privileges of their existence, since they are so competent and hardworking. One feeds the other.
Sean Lien in one stroke cuts the feet out from under both these claims. Instead of providing an outstanding example of the superiority of education and breeding, Lien actually reveals that the light blues are all dupes, their self-justifications hollow, since the only reason Lien is in the running is that he is the son of Lien Chan. Indeed, all that he has, he has because he is Lien Chan's son. He shows with total clarity that the KMT isn't about the self-serving delusions of the light blues, but that in fact, the KMT and its justificatory ideologies are merely vehicles to ensure that certain powerful families maintain their grip on the flow of resources and power to the center, and the function of the light blues and their tribal identity is to provide the support for that control.
Will the light blues vote Lien? Vote Ko? Stay home? It's on them that this election will swing. Wish I could see some poll numbers on them....
2 Comments Labels: 2014 elections, KMT, Taipei
It's not the politicians, guys II
From Don DeGlopper's Lukang: Commerce and Community in a Chinese City. It's old, but still relevant. Re the post two below this one It's not the politicians, guys: what kind of politicians do you think these people will elect? What kind of politics will we have in this world? The attack on Chen Chu over the Kaoshiung gas explosion is no different than any other attack on any other politician at any level -- this kind of thing goes on at the local level all the time, it just doesn't get reported because it's "local". All politics is local, as it was famous said, but in Taiwan, even the national-level politics is just local level political behavior blown up to galactic scale....
4 Comments Labels: DPP, Kaoshiung, KMT, local government, political culture, political parties
MaWangMess Postscript: Wang cleared of influence peddling
Green Island road.
Well well well. It appears that Speaker of the Legislature Wang Jin-pyng has won a complete victory over President and KMT Chairman Ma Ying-jeou in the Affair of Influence peddling. The Taipei Times reports:
Legislative Speaker Wang Jin-pyng (王金平) has been cleared of allegations of influence peddling, the Taipei Prosecutors’ Office announced yesterday, after its investigative unit last month concluded that there was no evidence backing claims that Wang spoke with retired judge Yang Ping-chen (楊炳禎) to request that he influence an embezzlement case involving Formosa Telecom Investment Co (全民電通).
The case exposed the fact that the SID was wiretapping the legislature's phones. In a long post at the time I observed:
It is striking that no transcript of the alleged phone calls telling the prosecutor to lay off Ker has been produced by the SID, since it has leaked transcripts of Wang Jin-pyng's phone calls. Indeed, the lack of such leaks suggests that no such transcripts exist. This tends to support Wang's claims that he was just comforting Ker and hadn't done anything.
No evidence was ever produced that Wang had acted on Ker's behalf. It will be interesting now to see the fallout. The pro-Blue media faithfully followed the Ma camp line, taking it as a fact that Wang had engaged in influence peddling (example, example), as did Ma himself (Taipei Times). There may be lawsuits, though I expect Wang to simply relish his complete victory and not stoop to suing the President and the newspapers.
Interestingly, the Prosecutor who illegally leaked the information that Wang had committed influence peddling to Ma received a 14 month sentence, which was commuted to a small fine. Does this mean that Ma had done something illegal as well?
2 Comments Labels: KMT, legislature, Ma Ying-jeou, Wang Jin-pyng
An old coral house on Green island.
Back from vacation. So much to catch up on...
J Michael Cole and a blogger (don't miss the witty exchange between politicians via election signs) both had pieces out recently that bemoaned the island's terrible politicians... Cole described at Thinking Taiwan:
No sooner had the dust settled on the city than the political parties went on the offensive — not to ensure the survival of the victims or mitigate the effects of the disaster, but to undermine their opponents. That isn’t to say that good deeds were not done, but they often were a secondary consideration. The main object was political. Early on, rather than work with officials from the DPP administration, the KMT sent its own separate delegation, while the DPP, fearing accusations that it was politicizing the crisis, had to secretly fund groups that provided assistance to devastated areas. For its part, the KMT-dominated central government quickly reminded residents of the southern city that they would not receive any “special favors.” And judging from the premier’s remarks at the weekend, officials in Taipei saw no need to hurry with reconstruction, as if Kaohsiung were somehow trying to cut in line.
Meanwhile, opponents of Chen Chu (陳菊), the popular Kaohsiung mayor who is running for re-election in November, saw in the catastrophe an unexpected opportunity to attack her. Many from the blue camp have tried to pin the explosions on her, even though evidence has come to light suggesting that critical information — the missing Polypropylene that caused the explosions — was kept from Chen, who is of the DPP. Others in the KMT camp, including officials in the central government, who technically should be above party politics but rarely are, have called for Chen’s resignation on charges of negligence.
The victims of Kaohsiung and their families, along with the future victims of preventable accidents that nevertheless occurred because lawmakers and cabinet officials were too busy sniping at each other, deserve better representation — more responsible representation — from those we entrust with power.
Similarly, Outreach for Taiwan argues:
Fighting during politicals is one thing, but fighting during a time of trouble is another. Michael J. Cole outlines that even in misery, the house is divided. Recess is over, let’s join hands together and get back in the classroom. For this country to thrive and prosper, Taiwanese politicians must stand together in times of need, not across the aisle screaming at each other.
A couple of election cycles ago, the Hualien election featured Fu Kun-chi, an "independent" booted from the KMT for corruption. Because Fu was under indictment, etc, for involvement in crimes others were already doing time for, he decided to follow a tactic common among local politicians: divorce his wife and have her stand for election in his stead, with voters understanding who would really be running things. Despite this cynical device, and the alleged corruption, etc, Fu won the post in a landslide and is one of the most popular county chiefs in Taiwan.
Things like this are common. In 2005 in a legal move too complicated to explain, the Taitung County chief appointed his wife as vice-chief since he was likely to lose the post due to being indicted. Hsu Tai-li, the KMT mayor of Keelung, is another egregious case. He died after a corruption conviction after heading for years one of the least developed and most poorly run cities on the island. The pan-Blues then promptly selected a convicted vote buyer to follow him. In a recent election in a large central Taiwan city, a major gangster ran his wife for office. She lost, but gained thousands of votes. In the old days gangsters in jail would run their wives for office....
One could go on and on. In the 2000 election two prominent figures from the martial law era gained 60% of the presidential vote. The son of one is now running for mayor of Taipei city and I believe is likely to win. In one central Taiwan district the island's most prominent gangster used to hold the legislative office, until his son took it up. He wins elections by 2-1 margins. All over the island voters routinely return to office local faction politicians whose factions are heavily intertwined with local construction and local organized crime.
Taiwan is an island of nepotism, organized crime, and local factionalism, floating on a sea of government construction money. There is nothing unusual about KMT heavyweight Lien Chan running his son for Mayor of Taipei like a local faction politician ensuring his relatives are elected to local administrative positions. It is just more blatant.
I don't understand why on an island where voters routinely return corrupt, incompetent, grandstanding party-minded hack politicians to office, why anyone would bother to write some variation on "politicians must care about..." because any sentence beginning with that or similar phrases is obviously inane. The problem with Taiwan's politicians is not that they are corrupt party-minded hacks. It is that Taiwan's voters support them because they are corrupt party-minded hacks.
The politicians aren't the problem, just its most outward manifestation, like a sore spot on the surface of the skin indicating the presence of a vast and voraciously metastasizing tumor underneath.
Data on Taiwan peach, nectarine, and cherry imports from US
LCY of Kaohsiung pipeline blast fame takes a heavy stock hit. Very unlikely that it is their fault. Rather, it is more likely that any one of the scores of (gangster-run) construction firms that have worked in the area damaged the pipe during one of their innumerable excavations.
Taiwan aborigine journalist Tilimalaw's untimely death mourned around the world.
Chinese circumvent regulations using third countries, local representatives, to purchase real estate in Taiwan
Brief flap as Routledge journal adds "China" to Taiwan in scholar's location.
Taipower Chairman says renewables bad for the environment. If those idiots hadn't wasted so much time and money on that fourth nuke disaster out in Gongliao, we could have the whole island running on wind, solar, and other renewables by now.
Sponsored piece in Smithsonian on Alishan Sunrise train.
High school students across Taiwan in bid to have statues of dictator Chiang Kai-shek removed. The young are different.
Duverger's law and village elections in Taiwan
Pro-unification types threaten and scold in front of Taipei 101 and the police... do nothing (video).
Haha. Infravest's third windpower investment in Taiwan now halted, this time by objections that it is bad for dolphins. ROFLMAO. Bad for dolphins? The government doesn't give a flying f@ck in a rolling doughnut about dolphins. See, for example, this long old post on them or this one from 2009. Nope, this is just an excuse to kill the project, as the environment always is. Three times Infravest has met opposition and been curtailed or completely thwarted, in three different locales. I'm sure it's just a coincidence and the Company's claim that Taipower and other interests don't want them in Taiwan is balderdash.
8 Comments Labels: construction-industrial state, DPP, KMT, organized crime
With FTV on Green Island
Last week Lanyu, this week Green Island to do some shooting with FTV. Snorkeling, conservation, and other activities with Michella and Charles! Click READ MORE as always.
2 Comments Labels: FTV, green island, Taitung
Adoga News: Ethnocentric Garbage from ACER
There's several of these "Adoga News" videos, links are on the sidebar for this one. Professionally done, with the speaker, whose Chinese is obviously excellent, pretending to speak in a choppy, lame accent. Basically the equivalent of foreigner blackface. Sad. Won't be buying any Acer products anytime soon.
6 Comments Labels: ethnic, racism
This week I went to Lanyu for the first time, to enjoy one of the best experiences Taiwan has to offer with one of my closest friends, Drew Kerslake, and his lovely family. I have long wanted to go. Traveling with Drew was special because he's been on the island many times and first started coming in the 1990s, meaning that people there know him, and he knows many things about Lanyu that few outsiders know. What a wonderful introduction! Already planning my next trip.... (Andrew's beautiful and informative post) Click on READ MORE (image intensive, may be a few minutes loading up).
6 Comments Labels: bicycling, biking, cycling, Lanyu, photos, Taitung
The Pingtung 172
On Monday the 4th of Aug I went down from Fangliao to Kenting in the morning to wait for Drew (post above this one). We were heading to Lanyu from Houbihu port in Kenting the next day, but in the meantime I wondered what could be done with the afternoon? Drew had the perfect answer: the Pingtung 172. Click on READ MORE....
0 Comments Labels: Hengchun, Kenting, Pingtung
Links and Break Time
A damselfly hides in the darkness
I'm taking an extended break from the blog for a couple of weeks. Enjoy yourselves.
Kaohsiung Gas Explosion: LCY Chemical says wasn't their pipes, but inquiry says it appears to be.
Sean Lien video patiently RIPPED. This one is excellent, don't miss.
Market solutions should be solution to Taiwan's economic problems with China. Lots of great numbers.
ROC clownishly protests Japan's naming of Senkaku islets.
Economic growth picking up?
Fourth Nuke plant to be mothballed.
A million pangolins sacrificed last year to the stupidity of China's pseudoscientific beliefs. When is it ever going to stop?
Ruins out of Taiwan's history shed new light on it.
Keep Taiwan free rally
BREAKING: Kaohsiung horror, gas main explosion kills 25, 292 injured UPDATE X 10
Death toll now at 25, expected to rise as more missing are found.
FocusTaiwan now saying it is petrochemical piping. Ben from Letters from Taiwan and I are jointly wondering how long before Chen Chu gets blamed by KMT. Politics has no bottom when it comes to cynical exploitation.
Apple Daily report in Chinese 22 dead, 270 injured.
http://www.appledaily.com.tw/realtimenews/article/local/20140801/443864/
Apple Daily images
http://www.appledaily.com.tw/realtimenews/article/local/20140801/443894
RT.com with dashcam video
http://rt.com/news/177108-taiwan-gas-explosion-multiple/
UPDATES (most recent first):
10. Apple Daily Drone video
9. A really good picture collection on FB from Danny Chu.
8. [removed]
7. ETTV Via CNN.
6. FocusTaiwan with CNA report: 22 dead (incl 4 firefighters) 292 injured. Many missing, including senior fire official who went in at 9 pm to check out leak reports. Now saying it is petrochemical plant piping.
5. Stills, videos, maps on BBS
4. Wreckage, post-fire
4. Fire, people recording
4. Strangely angled video of explosions
3. Explosions recorded. Unbelieveable
2. CCTV cam capture of moment of explosion
2. FTV report
1. Aftermath video
MaWangMess Postscript: Wang cleared of influence p...
BREAKING: Kaohsiung horror, gas main explosion kil...
|
cc/2020-05/en_middle_0097.json.gz/line1399884
|
__label__wiki
| 0.547943
| 0.547943
|
REVIEW: Aerosmith – Just Push Play (2001 import version with bonus track)
AEROSMITH – Just Push Play (2001 Sony, includes bonus track “Face”)
“I don’t think we’ve made a decent album in years. Just Push Play is my least favorite.” – Joe Perry
The sad and depressing fact of the matter is, Aerosmith could have retired long before Just Push Play, and we would have lost nothing terribly valuable. They’ve pandered for hits before, but never as blatantly contrived as Just Push Play. It’s an embarrassing state of affairs that deserves every inch of scorn we’re about to unload upon it.
Hi-tech digital tracks written and produced with outsiders make up Just Push Play, a weak attempt to be young hip and cool when Aerosmith were anything but. Look at the sleek haircuts in the band photo. Only Joe Perry appears to know what band he’s in. The album was recorded with sterility. At no time were all five members in the studio together, according to Joe, and that’s exactly how it sounds.
If their heads weren’t in the clouds (coming off their biggest hit single ever) they might have made a rock album. “Beyond Beautiful” is a close imitation, a robotic and stiff carbon copy. Ballads like “Fly Away From Here” sound as if faxed in from the office. These blatant attempts to repeat past glories are among the most offensive on Just Push Play. It is true that one of Aerosmith’s first hits (“Dream On”) was a ballad. That was a long time ago and a long way from being flat broke and banging out a song in the middle of the night on a piano. These new ballads like “Luv Lies” and “Sunshine” are written specifically by hitsmiths in order to appeal to people who would not normally buy an Aerosmith CD. The result is that they appeal to nobody.
As bland and unappealing as these forgettable ballads are, none are as offensive as the title track “Just Push Play”. Nobody asked Aerosmith to do a rasta-hip-hop track. The Run-DMC version of “Walk This Way” is the definitive Aero-rap, a masterpiece of serendipity and cutting edge ambition. Aerosmith thought it was necessary to revisit that sound 15 years later, and once again the result is a blurry facsimile that pales in comparison.
“Jaded”, the first single, is a great Aero-hit, one of the few from this era of co-writers and collaborators. Fortunately you don’t have to buy the album to get it, as there was a five track EP you could buy instead. If you go that way, you can still enjoy a couple different versions of the charismatic single. “Jaded” had the kind of chorus that Aerosmith used to be able to write in their sleep, but now apparently need help to do.
There were different bonus tracks for different regions. US and Canada got nil, but Europe got “Face” while Japan received “Won’t Let You Down” and a bunch of other stuff including five live tracks from 1978 (California and Texxas Jams). That 2 CD Japanese edition might be worth tracking down for the bonus material, but “Face” remained exclusive to Europe. Is it worth it? Actually…it might be. “Face” is an acoustic track that sounds a bit like a B-side. It’s closest to “Jaded” in sound, and sounds looser than most of the rest of the album. It’s certainly not going to become a lost favourite, but if you find a copy at the right price, consider it.
Just Push Play deserves the dreaded Flaming Turd.
Posted in Reviews and tagged aerosmith, brad whitford, classic rock, flaming turd, Jaded, joey kramer, just push play, rarities, rock and roll, rock music, steven tyler, tom hamilton on January 12, 2017 by mikeladano. 45 Comments
← REVIEW: Fish – Kettle of Fish 88-98 (1998)
#540: I Can Drive 55 →
Wardy says:
Yep! Fun read and got this one spot on Mike :)
mikeladano says:
Hahha thanks Wardy! I was aiming for fun :)
Heavy Metal Overload says:
This deserves the flaming turd for sure. I didn’t even like Jaded. Decent pop song but a shite Aerosmith one.
The turd has dropped, and I say Just Push Stop.
uncleb13 says:
I remember this album mostly because it was from an era where I was battling a life-changing illness, and still buying CD’s and trying my hardest to enjoy music at the time. That cover artwork is such a tip-off to the junk on the silver disc inside the jewel case. I know this CD found its way into the bottom of a box and then out to a dumpster during on of my cleaning sessions/purges in the mid-2000’s. An inglorious end that I reserve for only my least-desired physical media. I also recall like so many albums from 2001, that it befell being released around 9/11, where so much music, both good AND bad, got forgotten by the public (but strangely, always remembered by me as being from around that time).
Yikes hope you are well today, uncleb13!
The artwork immediately reminded me of Autograph, Sign In Please. Either way, hardly original or even clever. However when you look at all the Aerosmith albums in a big collage, it sticks out like a big pink sore thumb — you can tell just by looking “That’s the sell out album.”
tokyo5 says:
>The artwork immediately reminded me of Autograph, Sign In Please.
Both of those albums used artwork by the same Japanese artist.
No kidding! WOW. Thanks for letting me know, tokyo5! Did you just know that off the top of your head? Certainly explains the similarity!
>Did you just know that off the top of your head?
Actually, yes. I saw some of the artist’s work before so I knew his style.
Thanks for the concern, Mike! All good today!
Awesome, glad to hear it. I like to say “strong like bull”!
2loud2oldmusic says:
So what you are saying is that I should run out and buy it! 😀
Hahahahah! Well I won’t stop you!
DanicaPiche says:
One star is pretty good, considering. I’m with HMO and don’t even care for Jaded….
Really eh?? I’m a little surprised so few people like it.
It was a success for them so a lot of people did like it….
Christopher Combs says:
This was, for better or for worse, the very first Aerosmith album I purchased. As a teenager, I was very familiar with ‘Permanent Vacation’ and ‘Pump,’ but I never thoroughly enjoyed those albums enough to want to own them. I heard ‘Get A Grip’ when it came out, thought it was terrible, then subsequently ignored ‘Nine Lives.”
Simply put, Aerosmith felt like corporate rock. Their ballads were predictable and boring, their sexual innuendo schtick old an annoying. And, to a large degree, that criticism still holds true.
But my respect for Aerosmith changed in 2001 when I saw them live in San Diego. They were touring ‘Just Push Play’ and the concert was phenomenal. I bought ‘Just Push Play’ thereafter and enjoyed it for what it was. The tracks “Beyond Beautiful,” “Jaded” and “Face” (glad I’m not alone in liking that one!) are great. The rest is listenable (if you aren’t “jaded”) but its far from essential.
Over the next few years, I would slowly acquire most of Aerosmith’s back catalogue. As for studio albums, I’m only missing ‘Rock in a Hard Place.’
These days, I mostly listen to the first six Aerosmith albums. Anything beyond ‘Night in the Ruts’ sounds too slick, too polished, too commercial. But ‘Just Push Play’—though deserving of all its harsh criticism—is where it began for me. It brings back good memories… and for me, that’s enough.
Good post Christopher always nice to get a different take on such records and there’s plenty similar albums in my collection I have a ton of respect for which others regard flaming turds LOL.
It’s all relative ;)
I love all these comments, but Christopher really nailed something special about music!
I have my own albums that aren’t considered to be good or even great. Lord knows look at Kiss! But I have feelings for ’em. If you dive in at a certain point, that point will always sound special. Even if it’s not special to anyone else in the room, holding their hands to their ears!
Rock in a Hard Place is an interesting one. I’ll leave it at that! It does have one of my favourite songs ever, though.
I listen to the first five or six, Live Bootleg, and Pump. Although I hear the singles from Pump far too much these days, the other six tracks are all F.I.N.E. fine!
deKE says:
DONE WITH MIRRORS ….DONE WITH MIRRORS MAN!
I’ve never heard this album but as I’m very easily led I’d just like to express how shite it is. Down with it!
Wow J-j-joe is J-j-jaded.
You See Me Crying, Mike.
That’s where I Draw the Line.
It’s Nobody’s Fault though.
Same Old Son & Dance, I reckon.
I don’t dance, I Walk This Way.
Daddydinorawk says:
No More. NO MORE!!!
BWAHAHAHA you win!
MY FIST YOUR FACE
stephen1001 says:
At least a turd record means a great logo!
Thanks again, Sarca!
Aw man. I love this album.
Ha. Kidding.
You didn’t trick me, not at all :)
You know me too well!
80smetalman says:
I won’t cry over the fact that this album passed me by in 2001.
Don’t you cry, tonight.
I reviewed both this album and show….
I think it was Sunshine when they played it live sank like a turd….
Just listening to this now…
Just pushed repeat. on a second spin. Not as bad as I thought but nothing really shines either.
keepsmealive says:
Flaaaaaaming tuuuuuuuuurd!! Just Push Turd! Wait, that came out wrong. Wait, dammit, so did that…
Vaalwrath says:
You’re right in that this was a “flaming turd” from start to finish… Though this so-called “flaming turd” shines rather brightly when compared to the pop trash that gets overplayed on the radio now, but, Alas!… That’s a discussion for another time, lol. :P However, the ‘bonus’ track “Face” was not, in fact, a bonus track that was only available in Europe. It was initially available as a Best Buy “exclusive” as well in the US. Another thing that I’ve noticed on the Japanese Pressing is the the F-bombs are prevalent throughout the entire song until the later half of the song… Then it occasionally bleeps out like it does in the American version.
I’m going to have to pay closer attention, I don’t recall beeps. I haven’t played it since I wrote this review but I will check it out again. Thanks for the info!
Leave a Reply to 1537 Cancel reply
mikeladano on VIDEO: The Outtakes…
@RockTheseTweets @DefLeppard mikeladano.com/2013/08/15/gal… 1 hour ago
@ThatEricAlper Been listening to only Rush since Jan 10. 1 hour ago
VIDEO: The Outtakes mikeladano.com/2020/01/20/vid… via @mikeladano 2 hours ago
|
cc/2020-05/en_middle_0097.json.gz/line1399886
|
__label__cc
| 0.612754
| 0.387246
|
Franchise main menu
Child Proof Outlets
Dedicated Computer Circuitry
GFCI Outlets
EV Chargers
Ballast & Bulb Replacement
Available on Your Schedule
A Neighborly™ Company
Spark your Career: Work for Mr. Electric
Mr. Electric provides only the highest-quality service. Let us show you some great reasons to call us.
Apply Locally
Why Mr. Electric
Interactive Home
Advantage Plan®
From priority scheduling, preferential pricing, exclusive savings, and more. Save with Advantage Plan.
Save on Electrical
Electrical Safety is our biggest concern at Mr. Electric®. Our electricians are here to help make sure your home or business is as safe as it can be. Our expert electricians can help you with childproofing outlets, whole house surge protectors, wiring upgrades, and electrical safety inspections, just to name a few. Check at our additional services below, for your home and business!
Because there is no such thing as constant, uninterrupted adult supervision, child proof outlets protect your children and those of invited guests, preventing injuries and liability. Also called tamper-proof receptacles, these electrical outlets are so effective that as of 2008 the National Electrical Code (NEC) has required their installation in all new homes.
Circuit Breaker Replacement
Sufficient electrical capacity is necessary for the proper function of electrical appliances or devices on a circuit without tripping a breaker or blowing a fuse. In some cases, circuit breaker replacement may remedy overload issues without the need for an electrical panel upgrade, effectively handling electrical needs and preventing electrical fires.
Dedicated Computer Circuits
Chances are your company can’t function without its computers. To avoid tripped circuit breakers or blown fuses, Mr. Electric can install a circuit breaker that only controls your computer systems. That means that other office electrical appliances can’t take down computers when switched on.
Electrical Code Updates
Electrical codes are updated every three years by the National Electric Code (NEC), the nation's singular code for safe electrical installation, in order to protect people and property from electrical hazards. Is your home up to the current 2014 NEC standards?
Electrical Safety Inspection Services
Electrical issues are the largest cause of property damage in house fires across the U.S. To identify and address electrical safety issues, a thorough and professional electrical safety inspection is needed. Schedule your free electrical safety inspection today with Mr. Electric for a detailed, prioritized checklist of recommendations for your home.
GFCI Outlet Installation and Replacement
GFCI outlets are used in areas like the kitchen, bathroom or garage where the risk of electrical shock is greater. They can be identified by the “test” and “reset” buttons located on the receptacle. These outlets help protect you from electrical hazards by monitoring the amount of electricity flowing in a circuit and tripping the circuit if an imbalance is detected. Once detected, the outlet stops the flow of electricity.
Whole House Surge Protector Installation
Power surges can happen in a flash, resulting from a variety of causes and ruining your expensive electronics. Protect the technology in your home from damage with the help of a whole house surge protector.
Wiring Updates
Old, outdated wiring not only poses a safety hazard in your home, it is keeping you from the fuill range of functionality from your devices you could be enjoying. Prevent a dangerous electrical fire and quit worrying about unplugging on device so you can plug in another - update your wiring with Mr. Electric.
Need it Done Right?
Become one of our satisfied customers
Licensed electricians
Find my local Mr. Electric
Savings on services from licensed, expert electricians are only a click away.
Work for Mr. Electric
Apply Online to work for a Locally Owned and Operated Mr. Electric Franchisee.
Learn more about our community of home service experts.
Privacy Policy (US)
Terms & Conditions (US)
Privacy Policy (Canada)
Terms & Conditions (Canada)
This information is not intended as an offer to sell, or the solicitation of an offer to buy, a franchise. It is for information purposes only. Currently, the following states regulate the offer and sale of franchises: California, Hawaii, Illinois, Indiana, Maryland, Michigan, Minnesota, New York, North Dakota, Oregon, Rhode Island, South Dakota, Virginia, Washington, and Wisconsin. If you are a resident of or want to locate a franchise in one of these states, we will not offer you a franchise unless and until we have complied with applicable pre-sale registration and disclosure requirements in your state.
Mr. Electric is a registered trademark of Mr. Electric LLC
Copyright © 2020. Mr. Electric, All Rights Reserved. All Mr. Electric Franchise Locations Are Independently Owned And Operated
We have the power to make things better.®
|
cc/2020-05/en_middle_0097.json.gz/line1399887
|
__label__wiki
| 0.675416
| 0.675416
|
#DetroitWater campaign wants you to pay residents' past-due bills
by Contessa Gayles @CNNTech July 25, 2014: 8:21 AM ET
Detroit's looming water shutoffs spark a social media campaign and an app to connect donors with residents behind on their bills.
A new online campaign is helping Detroit residents keep their water turned on, even if they are behind on their bills.
The Detroit Water Project connects donors with Detroit residents who are delinquent on their water payments. The website lets donors submit direct payments to the Detroit Water and Sewerage Department.
The campaign's #DetroitWater hashtag is helping to spread the word about the initiative, and it has been tweeted thousands of times. More than 300 Detroit residents have registered for the Detroit Water Project, and the campaign has received contributions from 2,400 donors.
The city's ongoing practice of shutting off the water of Detroiters who have bills over 60 days past due or owe at least $150 has sparked controversy. Last week, on the one-year anniversary of Detroit's historic bankruptcy filing, residents took to the streets to protest the city's water shutoffs.
Related: Why Detroit filed for bankruptcy
In June, the United Nations released a statement calling Detroit's disconnection of water services to thousands of customers an affront to human rights. Citing the struggling city's high poverty and unemployment rates, the UN said the shutoffs for Detroiters who genuinely can't afford to pay off their bills a is violation of the right to water.
Detroit's stress: Crime & money
On Monday, the water shutoffs were temporarily suspended for a 15-day grace period.
Related: How Detroit's bankruptcy impacts my life
The founders of the Detroit Water Project met and conceived of the project over Twitter. Engineer and Code for America fellow Tiffani Bell, and Kristy Tillman, a design director for a start up, collaborated remotely from Oakland and Boston. Three days after their initial tweet back and forth, Bell and Tillman had their first donor on the site.
"We wanted a way to make immediate impact to provide relief to Detroit residents," said Tillman, noting that many existing crowdfunding options require recipients to wait until the end of a campaign to receive the donations. "Technology is merely a tool. How it's used depends on who's wielding it."
CNNMoney (New York) First published July 25, 2014: 7:04 AM ET
|
cc/2020-05/en_middle_0097.json.gz/line1399894
|
__label__wiki
| 0.524526
| 0.524526
|
How often felt sad, past 30 days (adults)
Group: Adult Mental Health — PERSON
Survey Text
NHIS Sources
Codes and Frequencies
Category availability view
Case-count view
Can't find the category you are looking for? Try the Detailed codes
ASAD reports responses to the question, "During the past 30 days, how often did you feel so sad that nothing could cheer you up?"
At the beginning of the section of the survey devoted to evaluating nonspecific psychological distress, interviewers stated, "Now I am going to ask you some questions about feelings you may have experienced over the past 30 days." They then handed respondents a flashcard listing five categories (all of the time; most of the time; some of the time; a little of the time; none of the time), from which respondents were to select the appropriate response. The Field Representative's Manuals for 1997 forward directed the interviewer to "reread the question, emphasizing the wording of the answer categories," if the respondent gave an answer that did not match these categories.
Related Variables
ASAD is one of a series of six variables whose responses can be summed as a scale measuring nonspecific psychological distress over a 30-day recall period. This scale, developed by Ronald C. Kessler and known as the Kessler 6 Scale (K6), asks about six manifestations of nonspecific psychological distress.
Kessler's instrument asks how often, during the past 30 days, the respondent felt:
So sad that nothing could cheer you up? (ASAD)
Nervous? (ANERVOUS)
Restless or fidgety? (ARESTLESS)
Hopeless? (AHOPELESS)
That everything was an effort? (AEFFORT)
Worthless? (AWORTHLESS)
As noted above, acceptable responses fell into five categories, ranging from "none of the time" to "all of the time."
Scoring Variables
Kessler recommends scoring the scale by assigning 0 to 4 points for each of these six questions, based on the reported frequency of the feelings (i.e., 0 for "none of the time"; 1 for "a little of the time"; 2 for "some of the time"; 3 for "most of the time"; and 4 for "all of the time"). The range for summed responses on the K6 Scale is thus 0 to 24, with 0 suggesting the lowest level of nonspecific psychological distress, and 24 suggesting the highest level of nonspecific psychological distress. According to the scoring criteria proposed by Kessler, persons with a score of 13 or greater are likely to be experiencing severe mental illness.
To assist researchers who intend to sum responses to the variables included in the K6 Scale, IPUMS NHIS assigns codes that are consistent with Kessler's advised scoring system (i.e., with "none of the time" coded as 0 and "all of the time" coded as 4). To produce valid results, users must exclude not in universe cases (persons other than sample adults, code 6 in IPUMS NHIS) and unknown cases (codes 7, 8, and 9 in IPUMS NHIS) before summing the responses.
Follow-up Questions
As a follow-up to the K6 Scale questions, the NHIS included a question that was not part of Kessler's original survey instrument. All sample adults who answered "some of the time," "most of the time," or "all of the time" to any of the six questions included in the Kessler 6 Scale were asked, "Altogether, how much did these feelings interfere with your life or activities: a lot, some, a little, or not at all?" (AFEELINT1MO). In 1999, additional follow-up questions collected further information about how "these feelings" affected the person (see FBADHOWOFT, FBADMORE, FBADLESS, FBADUNABLE, and FBADCUTDOWN).
This variable is completely comparable over time.
1997-2013; 2014 2015 2016 2017 2018: Sample adults age 18+.
1997-2018 : SAMPWEIGHT
|
cc/2020-05/en_middle_0097.json.gz/line1399913
|
__label__wiki
| 0.996891
| 0.996891
|
Mo'Nique is suing Netflix for pay discrimination
Photo: Kevin Winter (Getty Images)
Early last year, we reported that Mo’Nique was asking her fans to boycott Netflix after the streaming service offered her $500,000 for a stand-up special, which was significantly less than the multi-million-dollar deals that comedians like Dave Chappelle, Chris Rock, and Amy Schumer had recently gotten at the time. In an Instagram video, Mo’Nique accused Netflix of “gender bias” and “color bias,” with Wanda Sykes later thanking Mo’Nique for speaking out and revealing that she had also received an offer from Netflix that “offended” (‘less than half” of Mo’Nique’s $500,000).
Today, as reported by The Wrap, Mo’Nique announced in a new Instagram post that she has filed a “pay discrimination lawsuit” against Netflix, saying she “chose to stand up” for the people who came before her and those who will come after her.
The Wrap says that the suit accuses Netflix of only offering to pay up “when the talent was not a Black woman,” and it says the streaming service turned a “blind eye” to racial abuse from Kevin Spacey and accuses executives of “using racist language” and having a lack of racial diversity.
Mo'Nique is pissed at Netflix for offering her way less than Amy Schumer or Chris Rock
Chris Rock nabs $40 million for two Netflix stand-up specials
Amy Schumer says she never "demanded" Netflix pay her the same as Chris Rock or Dave Chappelle
|
cc/2020-05/en_middle_0097.json.gz/line1399916
|
__label__wiki
| 0.764095
| 0.764095
|
The UK’s Most Popular Cars Ranked by AEB Safety
Press release • Jul 06, 2016 09:17 BST
The best-selling cars of 2016 ranked by AEB fitment
Eight of the UK’s top ten best-selling cars now offer five-star crash protection alongside some availability of Autonomous Emergency Braking (AEB) technology
Three of the top 10 offer standard fit AEB on more than 70% of the model range, but just one, the Mercedes-Benz C-Class, has 100% availability
Crash avoidance top priority says safety expert Thatcham Research - car buyers directed to a new AEB fitment guide that aids selection of the highest levels of safety on new cars
New car sales figures1 released today reveal that the majority of the most popular cars in Britain now offer five-star crash protection, but standard fitment of Autonomous Emergency Braking (AEB) is still only available on half of them.
Analysis by independent safety experts, Thatcham Research, confirms that five of the current Top 10 UK best-sellers now offer some level of AEB fitment as standard, although worryingly only one has the crucial crash prevention technology on every model and trim level in its range.
Monitoring the road ahead using sensor and camera technology, AEB has been shown to reduce low-speed crashes by up to 40% by automatically braking to avoid a collision with another car or a pedestrian, if the driver hasn’t responded.
AEB is still not available at all on more than half of all new cars (52%) on sale in the UK and the best-selling models need to be setting an example to change this, according to Thatcham Research Chief Executive, Peter Shaw:
“It is right to acknowledge the achievements of car makers in providing us with safe cars that offer excellent protection in the event of a crash, with eight of the Top 10 best-sellers having Euro NCAP 5 star ratings. However, preventing the crash from happening in the first place now must be the focus and that starts with having AEB as standard. Prioritising fitment to the best-sellers will make the biggest contribution to reducing the number of crashes on our roads, as well as encouraging other car makers to follow suit.”
Mixed results on Safety as Standard
The Mercedes C-Class has AEB as standard across its entire range, whilst the Volkswagen Golf and the Nissan Qashqai also have commendable levels of standard fitment (83% and 71% respectively) and optional availability on most other trim levels.
At the other end of the spectrum, the Vauxhall Corsa – the UKs second best-selling car – is not available with AEB at all and the No.1 best-seller, the Ford Fiesta, only offers the technology as an optional extra, and this on only just over half of the model range.
“With combined sales of the Fiesta and Corsa totalling over 100,000 in the first 6 months of this year alone, there’s a great opportunity to provide standard fit crash prevention for the masses,” says Shaw.
Superminis are likely choices of car for young, inexperienced drivers who are 26 times2 more likely to be involved in a crash. Yet, the size and price of a car do not have to be barriers to AEB fitment, says Shaw: “Honda has shown that standard fit AEB safety at supermini price level is achievable, with the new Jazz having it across the entire range.”
Shorter model replacement cycles may make it easier for car makers to upgrade their safety offer and Thatcham Research believes that they must take more advantage of these opportunities.
“The new Fiesta is expected next year and gives Ford the opportunity to redress the balance by making AEB standard,” comments Shaw. “And having already shown with the Astra that it recognises the value of the technology, Vauxhall should be targeting at least a similar level of fitment on all future versions of its other models.”
Thatcham Research is calling on all car makers to embrace the highest levels of active safety technology, as Peter Shaw explains, “Vehicle manufacturers could choose to publicly commit to making AEB standard by 2022 on all new cars sold in the UK. Twenty of the best-known car brands have already done exactly that in the United States and we’d welcome the same commitment in the UK.”
Car buyers with their heart set on a car where standard fit AEB is unattainable are encouraged to explore optional safety packs that include AEB, alongside other valuable safety features. To make this easier, Thatcham Research has produced a fully searchable, online fitment guide that provides the AEB system name and availability www.thatcham.org/aeb-fitment
AEB system name: Collision Prevention Assist Plus. Fitted as standard
AEB system name: Front Assist Including City Emergency Braking. Fitted as standard to 83% of trim levels within model range. Not available as an optional extra.
AEB System name: Forward Emergency Braking. Fitted as standard to 71% of trim levels within model range. Available as part of the optional ‘Safety Shield’ safety pack for £495
AEB System name: Active City Stop. Fitted as standard to 37% of trim levels within model range. Available as a stand-alone option for £200
AEB system name: Forward Collision Alert with Automatic City Emergency Braking. Fitted as standard to 34% of trim levels within model range. Available as part of the optional ‘Driving Assistance’ pack, priced £565 - £795
AEB system name: Driving Assistant. Available as part of the optional ‘Driving Assistant’ pack for £440
AEB system name: City Emergency Braking. Available as part of the optional ‘ACC’ pack for £395
AEB system name: Active City Stop. Available as a stand-alone option for £200
No AEB system available
Vehicles are ranked according to the percentage of trim levels within that model range having AEB as standard, followed by optional availability rates.
1UK SMMT UK New car registration figures Jan-Jun 2016 (issued 06/07/2016)
2 ABI (Association of British Insurers) Report: ‘Improving the Safety of Young Drivers’ October 2012.
Thatcham Research is the independent voice of automotive safety & repair, advising motorists, insurers and vehicle manufacturers to help reduce accident frequency, severity and costs and to realise the vision of ‘Safer cars, fewer crashes’.
As well as its world leading crash and track research, Thatcham Research tests and accredits crash repair parts, vehicle repair technicians, and a number of other products and services within the collision repair industry for insurers, motor manufacturers, equipment manufacturers and suppliers.
A founder member of the international Research Council for Automobile Repairs (RCAR), Thatcham has also been a member of the European New Car Assessment Programme (Euro NCAP) since 2004.
Check AEB fitment
vehicle safetyautonomy & technology
jalkmerks.sssmazitggh@owthpwatyrchydamrz.oovrghq
tomom.laflhdisidhealr@arthrqatbxchilamnx.ofmrgag
|
cc/2020-05/en_middle_0097.json.gz/line1399918
|
__label__wiki
| 0.953581
| 0.953581
|
Home Uncategorized Another 168 stranded Nigerians return from Libya
Another 168 stranded Nigerians return from Libya
The National Emergency Management Agency (NEMA) on Friday received another batch of 168 stranded Nigerian returnees from Libya.
The Acting Coordinator, NEMA Lagos Territorial Office, Ibrahim Farinloye, received the returnees on behalf of the Director-General of NEMA at the cargo wing of the Murtala Muhammed International Airport in Lagos.
Mr Farinloye told journalists that the returnees arrived in the country aboard a chartered Al Buraq airline with flight number UZ289/190 at 5:42 a.m. after 12 hours delay.
He said that 38 female adults, five female children were returned with 109 adult males, six male children and 10 infants, among others.
He said that this had brought the total number of returnees from Libya from April 2017 to date to 8,096 males and 5,788 females.
“This has brought the total number of returnees brought to Nigeria from 16 countries to 15,731 since April 2017 to date.
Mr Farinloye, while qouting the summary of the special EU-IOM and federal government intervention from 2017 to October 2019, said that Libya had the highest number of returnees with 8,096 males and 5,788 females.
”Nigeria returnees from Niger Republic stood at 1,043 males and 556 females; Morocco male 42, female 37; Liberia male eight and female four.
“Burkina Faso male six, female 18, France male three, female one, while Ireland had only one female, but countries like Polad, Austria, Gambia, Mauritania, Ethiopia had one male each assisted back.
“Chad had one male, two females and Cote D’ivoire had only two females brought back within the period,” Mr Farinloye said.
According him, “Estimatedly, adult males are 54 per cent, 37 per cent are for female, while male and female minors stood at four per cent each.
“In the same vein, the distressed migrants brought back per state of origin shows that Edo State topped the list with 40.6%, Delta 13.3%, Ogun 6.2%, Imo 4.7%, Lagos 4.3%, Oyo 4.1%, Yobe 3.6%, Kano 3.1% and Osun with 2.9%, while other states complete the rest.”
He said those who suffered various degrees of torture were 31 males and 21 females, while unaccompanied minors that were assisted back were 66 males and 67 females.
Mr Farinloye added that those who were kidnapped out of Nigeria, but assisted back to the country were 79 males, 31 females, while single parents male were 41 and female were 616.
He said total number of pregnant women brought back so far were 439, while those with various medical issues were 592 males and 804 females.
Migrants assisted back with psychosocial needs are 523 males and 470 females.
Previous articleN7.2bn fraud: Orji Kalu to file stay of execution, bail applications
Next articleEkiti Varsity sacks 900 workers
AMOTEKUN: Where Is Bola Tinubu?
By Remi Oyeyemi “Òro se ni wò, ká lè m’eni tó fé ni.” – Yorùbá Aphorism Translation: “Be afflicted and know those who love you.” “Ká...
I’ve been framed but I won’t be silenced — Shehu Sani reacts to allegation of extortion
Former Senator, Shehu Sani has officially reacted to allegation of collecting money from Sani Dauda, owner of ASD Motors which he allegedly...
Mass Exodus: 300 Members Desert Pastor Adefarasin’s House On The Rock Church
At least 300 members of House on the Rock Church under the leadership of Pastor Paul Adefarasin have reportedly left the church...
|
cc/2020-05/en_middle_0097.json.gz/line1399920
|
__label__wiki
| 0.791585
| 0.791585
|
BPW Website
Follow BPW Bergische Achsen KG
IATF certification ushers BPW into premier league of automotive suppliers
Press release • Jan 16, 2018 11:15 CET
The certification according to IATF standard 16949 underpins BPW's quality promise.
BPW awarded IATF 16949 certificate – one of only a few in the commercial vehicle segment
Certification seen as a milestone prior to launch of eTransport axle drive
Michael Pfeiffer says quality standards are on a par with those of top suppliers
Wiehl, 16.01.2018 --- Its certificate of compliance with IATF 16949 standard enables BPW to consolidate its position as a quality leader in the commercial vehicle industry. The award also cements its position among the world’s elite automotive suppliers. The certification serves as a milestone not only for the company, but also in the run-up to the launch of the electric axle drive eTransport.
BPW has extended its portfolio of quality standards by proving its compliance with IATF 16949, and thus joined the ranks of the world’s leading automotive suppliers. The stipulations adopted by the International Automotive Task Force add numerous requirements and process documents to the existing raft of national and international standards. The audit leading to certification is regarded as extremely tough and has been passed by very few suppliers in the commercial vehicle segment.
“BPW has been seen as a benchmark for excellence in the commercial vehicle industry for almost 120 years,” explains Michael Pfeiffer, personally liable Managing Partner of BPW Bergische Achsen KG. “The certification to IATF 16949 standard elevates our quality promise to a new level. We are aligning ourselves with the leading automotive suppliers in Germany and seeking to at least match their product, process and service credentials.”
Alongside its core operations in the trailer segment, BPW Group is already an established supplier to a handful of tractor unit manufacturers. By obtaining the IATF 16949 certificate, it can now extend the scope of its business activities further. The prestigious quality standard can, for example, pave the way for the launch of BPW’s electric axle drive eTransport, its first zero-emission drive system for vans and trucks between 5.5 and 26 tonnes. “This certificate is a milestone for the entire BPW Group and serves as a massive incentive for all our employees and managers,” insists Markus Schell, who is also a personally liable Managing Partner of BPW Bergische Achsen KG. “It is a record of our ambition to offer customers an appreciable quality advantage.”
The IATF is an ad hoc group of automotive manufacturers (including BMW, Daimler, Volkswagen, GM, Ford, Fiat, and PSA) and trade associations, which is seeking to harmonise standards and thus improve the quality of products for automotive customers. It wishes to develop a consensus regarding fundamental quality system requirements, primarily for the participating companies’ direct (tier-1) suppliers. In Germany the IATF conducts its standardisation endeavours within the German Association of the Automotive Industry (VDA), of which BMW Group is a member.
Automotive industry steps up campaign for suppliers to publish sustainability reports
This year BPW produced its first sustainability report in compliance with the United Nations Global Compact. It describes the company’s extensive activities undertaken for the benefit of the environment, society and its employees. At its headquarters in Wiehl, for instance, BPW generates a portion of the electricity it consumes with its own solar panels and hydropower plant. Since the summer, the remaining portion has been procured exclusively from renewable zero-carbon sources with a guarantee of origin. To an increasing extent, the automotive industry is calling on its suppliers to furnish written evidence of sustainable business practices, as already pursued by BPW for generations.
About BPW Bergische Achsen KG
BPW Bergische Achsen KG is the parent company of the BPW Group. With more than 1,600 employees, including around 120 trainees, the family-run company has been developing and producing complete running gear systems for truck trailers and semi-trailers at its headquarters in Wiehl since 1898. BPW’s technologies include axle systems, brake technology, suspension and bearings. BPW’s trailer axles and running gear systems are in use in millions of vehicles around the world. An extensive range of services also provides vehicle manufacturers and vehicle operators with the opportunity to increase economic efficiency in their production and transport processes. www.bpw.de/en
About BPW Group
BPW Group, based in Wiehl, Germany, is a dependable international mobility and system partner for the transport industry, serving as a one-stop shop for innovative solutions. Its portfolio embraces axles, suspension systems and brake technologies (BPW), locking systems and bodywork technology (Hestal), lighting systems (Ermax), composite technologies (HBN-Teknik), and user-friendly telematics applications for trucks and trailers (idem telematics). BPW Group’s technologies and services support manufacturers’ cost-effective workflows and enable vehicle operators to manage their fleets efficiently by maximising the transparency of loading and transport processes. The owner-managed BPW Group encompasses 70 companies worldwide and employs around 7,000 people. www.wethinktransport.com
BPW Quality Broshure
Freight, TransportTrucks, Transport vehicles
BPWCorporate
Website or blog:
By submitting the comment you agree that your personal data will be processed according to Mynewsdesk's Privacy Policy.
Sending comment...
The comment was saved
Prior to publication, it must be approved by BPW Bergische Achsen KG.
Katrin Köster
Head of Corporate Communication
KotfesroterwrKon@bsopwek.dbzefd
Nadine Simon
Press Officer/Public Relations
SifgmoxmnNno@banpwfb.droeje
BPW accomplishes wholesale switch to green electricity and publishes sustainability report
Press releases • Dec 14, 2017 17:29 CET
BPW Bergische Achsen KG of Wiehl in the west of Germany is not only an innovation leader in the transport and logistics sector, but also ranks among the pioneers as regards sustainability. The company switched to procuring all of its electricity from renewables in the summer and has now published its first sustainability report in compliance with the UN Global Compact.
Energy Awards acknowledge eTransport as a highly innovative idea in the quest to shift to renewables
Press releases • Oct 04, 2017 11:31 CEST
eTransport, the electric axle drive developed by BPW, has grabbed first prize for mobility in the finals of the Energy Awards. The accolade recognises the drive as one of the most innovative ideas in the drive towards renewable energy sources. The Energy Awards serve the purpose of highlighting progress and changes being made in the sector, and acknowledging outstanding projects and ideas.
BPW’s electric drive for heavy goods vehicles scoops European Transport Prize for Sustainability
eTransport, the electric axle drive developed by BPW, is thought to have won more innovation prizes this year than any other concept in its category. BPW has now added the European Transport Prize for Sustainability to its trophy cabinet. The company ranks among the heavyweights in the true sense of the word, not only in view of its multiple awards.
New award recognises BPW as fairest employer in automotive supply industry
Press releases • Feb 23, 2018 10:58 CET
For many years BPW Bergische Achsen KG has ranked among Germany’s top employers, as recently reconfirmed by the magazine Focus Business. It has now been recognised as the fairest employer in its industry. The accolade is the outcome of a new ranking produced by Faktenkontor with academic support on behalf of Focus Money and Deutschland Test.
Even lighter, more robust and more economical: BPW will be presenting the new disc brake ECO Disc TS2 at IAA 2018
Press releases • Jul 25, 2018 14:00 CEST
Thanks to its intelligent design, the new disc brake ECO Disc TS2 sets new benchmarks in every way: it is now lighter, more robust and more economical. BPW will be presenting the innovative advances of its tried-and-tested product at IAA Commercial Vehicles 2018 (20-27 September in hall 26, stand C31) in Hannover.
BPW crowned ‘Best Brand’ for the twelfth time in a row
Press releases • Jun 26, 2018 14:00 CEST
Industry professionals have once again chosen BPW as the ‘Best Brand’ in the commercial vehicle sector. This is the twelfth time in a row that the company has won the ‘ETM Award’ in the trailer axle category. The contest is an important benchmark for the industry and a reliable indicator of the acceptance and reputation of vehicles and brands.
BPW scoops Digital Champion prize
Press releases • Mar 27, 2018 15:04 CEST
BPW belongs to an elite group of enterprises in Germany that are spearheading the digital transformation of products, applications and processes. The business magazine Focus Money and its research institute Deutschland Test have now recognised BPW as one of the leading Digital Champions: The Hamburg Institute of International Economics assessed around 10,000 companies for the ranking exercise.
Hellmann and Bergische Achsen KG start field tests with retro-fitted electric motor for commercial vehicles
Press releases • Aug 17, 2018 14:00 CEST
As part of an innovation cooperation, the globally operating logistics service provider, Hellmann Worldwide Logistics, and one of the world’s largest manufacturer of trailer running gears, BPW Bergische Achsen KG, are starting a joint practical trial: they are bringing the eTransport, an electric motor axle recently developed by BPW, onto the roads.
Wiehl is set to become the first city in Germany to put a van with an electrically converted motor axle supplied by BPW into operation
Press releases • Sep 10, 2018 14:00 CEST
In the Bavarian city of Vilshofen, the vehicle manufacturer Paul Nutzfahrzeuge is currently preparing for the standard conversion of municipal commercial vehicles on the production line to turn them into electric vehicles. The city of Wiehl is BPW's home town. It was there that Mayor Ulrich Stücker accepted the first Mercedes Benz Vario equipped with BPW’s electric motor axle eTransport.
Germany's best training companies - how BPW prepares apprentices for a digital future and the internet of things
Press releases • Apr 17, 2018 14:04 CEST
The internet of things is prompting a surge of innovation in business and industry, but how can those who are embarking on a career prepare for the future? A good place to start is to join the training programme of an innovative enterprise such as BPW. As an innovation leader of the transport industry, BPW harnesses its expertise in IT and mechatronics for the benefit of its trainees.
Qualitätsmanagement_© BPW...
Related / Events
IAA New Mobility Forum "Masters of Digitization: Digitizing Businesses & Mobility Ecosystems"
Sep 27, 14:30 – 15:30 CEST
Deutsche Messe, Messegelände, Hermesallee, 30521 Hannover New Mobility Forum: Pavillon 11 Abschnitt D
BPW Bergische Achsen KG is the parent company of the BPW Group. With more than 1,600 employees, including around 120 trainees, the family-run company has been developing and producing complete running gear systems for truck trailers and semi-trailers at its headquarters in Wiehl since 1898. BPW’s technologies include axle systems, brake technology, suspension and bearings. BPW’s trailer axles and running gear systems are in use in millions of vehicles around the world. An extensive range of services also provides vehicle manufacturers and vehicle operators with the opportunity to increase economic efficiency in their production and transport processes.
www.bpw.de/en
The BPW Group researches, develops and manufactures everything needed to ensure that transport keeps moving and is safe, illuminated, intelligent and digitally connected. With its brands BPW, Ermax, HBN, HESTAL and idem telematics, the company group is a preferred system partner of the commercial vehicle industry around the globe for running gear, brakes, lighting, fasteners and superstructure technology, telematics and other key components for trucks, trailers and buses. The BPW Group offers comprehensive mobility services for transport businesses, ranging from a global service network to spare parts supply and intelligent networking of vehicles, drivers and freight. The owner-operated company group currently employs 7,200 staff in more than 50 countries and achieved consolidated sales of 1.48 billion euros in 2017.
Ohlerhammer
Copyright 2017, BPW Bergische Achsen Kommanditgesellschaft Ohlerhammer
|
cc/2020-05/en_middle_0097.json.gz/line1399921
|
__label__wiki
| 0.839683
| 0.839683
|
November 29, 2019, 8:39 PM PST|
Filed under: Featured, Games
After a July 2019 release on Nintendo Switch, the comedic RPG Dandy Dungeon – Legend of Brave Yamada from Onion Games is now available on PC.
The story of Dandy Dungeon follows Yamada-kun who is a 36 year old programmer at a major game publisher. Yamada-kun hates his job and when alone in his apartment, deep into the night, he works to create a game of his own. This game is an RPG and he is the hero, he is Brave Yamada!
One day during the game’s development he falls head over heels at the first sight of his new neighbor Maria-chan. To help nurture these feelings, Princess Maria is added into the game. Only progressing forward into the story will it be known if Yamada-kun and Maria-chan will find love.
In this story driven romantic comedy retro visual styles are fused with modern ideas to created a roguelite-RPG unlike any other. Dandy Dungeon also features a chiptune soundtrack that layers the humming of the main character creating an amazing musical experience. Dungeons are procedurally generated and filled with loot. Weapons can be transformed into legendary blades, Dandy armor sets can be collected, and monsters cataloged during the quest for love.
For the Steam PC and Mac release all the re-balancing and refining that went into the previously released Nintendo Switch version is included. In addition the Steam version has its own world leaderboard which allows players to compete seeing who is the bravest Yamada-kun.
An expansion is in the works with preparations nearly complete for Dandy Dungon 2: Phantom Bride. In this expansion the game’s size is nearly doubled and will include brand new never-before-seen features. This expansion will be made available on all platforms for free in the near future.
Dandy Dungeon – Legend of Brave Yamada is now available on PC for Windows and Mac on Steam at a price of $18.99 USD. The game is also available on Nintendo Switch at a price of $18.99 USD. All the latest game information about Dandy Dungeon can be found on the game’s website at dandydungeon.com.
Dandy Dungeon – Legend of Brave Yamada | Onion Games
Onion Games (@oniongames Twitter) is an indie game developer based in Shinjuku-ku, Tokyo, Japan. Founded in 2012 by a group of veteran game developers that includes Yoshiro Kimura Founder and Game Designer, Kurashima Kazuyuki Art Director, Hirofumi Taniguchi and Keiichi Sugiyama both as Music and Sound Designers. Games include Black Bird, Moon, Million Onion Hotel, and Dandy Dungeon.
Nanocyde, Senior Editor & Writer
Gamer ever since I got my hands on a VIC-20 and an Atari. I play all game genres. Follow me on Twitter, for good fun and random commentary.
Tagged with: Dandy Dungeon, Dandy Dungeon - Legend of Brave Yamada, Indie, Onion Games, Roguelite, Romantic Comedy, RPG
Summerford Survival Horror in Late 2020
By Nanocyde // 2 days ago
|
cc/2020-05/en_middle_0097.json.gz/line1399927
|
__label__cc
| 0.602362
| 0.397638
|
Trump gives economic development advice to Kim Jong Un
By Mark Moore
June 12, 2018 | 8:57am | Updated June 12, 2018 | 10:20am
Ever the real estate developer, President Trump touted North Korea’s “great beaches” and suggested that Kim Jong Un should tap into his country’s spectacular coastline to boost its economy.
“They have great beaches. You see that whenever they’re exploding their cannons into the ocean,” Trump said during a press conference in Singapore following his historic summit with the North Korean leader.
Trump says he trusts Kim Jong Un, but admits it could be a mistake
President Trump revealed Tuesday that he had spoken directly with...
“I said, ‘Boy, look at that view. Wouldn’t that make a great condo? Instead of doing that, you could have the best hotels in the world right there,’” Trump said. “Think of it from a real estate perspective, you have South Korea, you have China, and they own the land in the middle, how bad is that, right? It’s great.”
Trump linked denuclearization with economic gains and showed Kim a video about how he could put his impoverished nation on the path to prosperity if an agreement is reached.
“Although I tell you what, he looked at that tape, he looked at that iPad, and I’m telling you they really enjoyed it, I believe,” Trump added.
Filed under donald trump , kim jong un , north korea
World leaders come out in support of historic Trump-Kim su...
|
cc/2020-05/en_middle_0097.json.gz/line1399938
|
__label__cc
| 0.749108
| 0.250892
|
George Bush School of Government and Public Service
Master of International Affairs (MIA) Capstones
Human Security and National Security Reform: New Paths for International Leadership
Capstone Presentation (20.15Mb)
Project Advisor
Cerami, Joseph
Abraham, Phebey
Cantrell, Catherine
Carman, Tara
Gruenwald, Emily
Rowley, Thomas A.
Office of the Deputy Assistant Secretary of Defense for Stability Operations
This 2008 Capstone research continues the work of a 2007 project titled "The Interagency Process in Support & Stability Operations: Integrating and Aligning the Roles and Missions of Military and Civilian Agencies in Conflict and Post-Conflict Environments." The 2007 Capstone study included analyses of interagency efforts in the conduct of US and NATO operations in counterinsurgency warfare in Iraq and Afghanistan. This 2008 study analyzed how US national security policies, strategies, and objectives have changed since 2001. It also estimated the effectiveness of the contemporary national security system, including institutions, organizations, and leadership in addressing what international security experts call "human security," or threats to the survival of societies, groups, and individuals.
Graduate and Professional Student Degree Program Research (Non-ETD)
Abraham, Phebey; Cantrell, Catherine; Carman, Tara; Gruenwald, Emily; Rowley, Thomas A. (2008). Human Security and National Security Reform: New Paths for International Leadership. Available electronically from http : / /hdl .handle .net /1969 .1 /97026.
|
cc/2020-05/en_middle_0097.json.gz/line1399941
|
__label__cc
| 0.720048
| 0.279952
|
The Global Summer School (GSS) is a platform defined by ambitious, multi-scalar investigation on the implications of emergent techniques in our planned environments. Each year, international teams located in key cities around the globe explore a common agenda with projects that are deeply embedded in diverse local conditions. Because of this, participants have an international laboratory to test their design hypothesis, understanding how design conclusions derived locally can be tested and evolved globally in different cities where other teams reside. This intensive two week course connects each participant to ongoing research agendas in robotics, simulation, physical computing, parametric design, digital fabrication, and other relevant emerging design methodologies. Specific emphasis is placed on understanding the multiscalar implications of design conclusions, thus creating critical research advanced on the application of new technologies in design.
IAAC has an active alumni community distributed around the word allowing a decentralized expansion of IAAC expertise and knowledge. The constant involvement of the community in IAAC activities keeps the connections strong and fertile. IAAC GSS17 aims to empower the bonds with the community members, therefore places them in strategic positions which allows Global Summer School to take place simultaneously in different cities around the world: Barcelona, New York City, Monterrey, Moscow, Tehran, Ahmedabad, Beirut, Beijing, Boulder and San Josè.
Over the last decades a new generation of cities and urban planning paradigms have emerged. Technology has risen as a driving force defining new urban developments and government’s decisions. Cities have started to implement technology at different scales, providing more accurate models describing its functions, organization and relationships.
Within this context, Public Spaces are being redefined in their consistency.
The public space is the soul of the City. It is the area of overlap and interconnection: the place where the character of a Society is materialized and where all infrastructure networks that connect the City functional nodes come together. If the public space we inhabit today follows principles/protocols of the Industrial revolution, the Information society is boosting the emergence of new protocols for the design and performance of the various elements of Public Space.
GSS17 agenda focuses on the applications and implications of new technologies in the dynamic field of public space. Specifically GSS17 will focus on the advancements of technologies of information, interaction and fabrication in the redefinition of public space, as catalyst for achieving resilience and high quality of life.
New modes of interaction among social, environmental and economic agents can be fostered through the redefinition of the Public Space. How do we design and inhabit it? How does it perform? What does it produce?
As part of the GSS17 program, students will define strategies for the applications of Advanced Urban Technologies as essentials means for the change. Testing the combination of software and hardware students will explore real-time data capture, energy generation, storage and reuse, material adaptability, real-time management of time-uses and citizen-space interaction.
IAAC Global Summer School is a full-time two-week course that provides both practical and theoretical knowledge. Its structure consists in three main learning modules, led by expert tutors. In addition, lectures by renowned professionals and academics relevant to the topics to be treated during the course. These will be broadcasted in the different node-cities, all globally connected. The lecture program will be announced prior to GSS commencement. The following three course modules aim towards a common objective: the fabrication of a 1:1 urban machining intervention, transferring and digitally interrelating multiple sets of data collected from hyper-connected cities.
Aldo Sollazzo
Aldo is an architect and researcher. Master in Architectonic Design in 2007, Master in Advanced Architecture at IAAC [Institute for Advanced Architecture of Catalonia] in 2012, Fab Academy diploma in 2014 in the Fab Lab Barcelona, Aldo is an expert in computational design and digital fabrication. Aldo is the founder of Noumena and Reshape as well as the head of IAAC Visiting Programs.
Federica Ciccone
Master in Architecture in 2015 and Master in City&Technology at IAAC in 2017. Her interest in the field of Design, Landscape Architecture and Environment, saw her improving this knowledge sharing research experiences with the University of Thessaly, UCL DPU.S.Lab of Bartlett, University of Applied Arts of Wien,Unirc, Biennal of Landscape and IAAC. She is following multiple projects, often connected with her personal research in photography about the reflection in human behaviour of mutable urban contexts. She joined Noumena since 2016 and she is currently Coordinator of IAAC Visiting Programs.
Starsky Lara
Starsky Lara is computation designer & product development Engineer, with experience in manufacturing, computer science and IoT, Master of Advanced Architecture (M.Arch) at IaaC and Master in Product Engineering and Manufacturing Processes (M.ENG) at UPC. In 2013, He has been part of project Eolic and DUMO as Software Developer and Project Manager. In 2014, he became part of Noumena by developing NERO. Currently, he is developing of VR-Edge, which is a Virtual reality tool for Web, where designers and journalism can build a new internet experiences.
Rodrigo Aguirre
Rodrigo is a Nicaraguan architect specialized in the fields of parametric tooling, digital fabrication and manufacturing. He obtained his bachelor in architecture at UAM (American University) in Managua, Nicaragua and completed the two year master in advanced architecture at the Institute for Advanced Architecture of Catalonia (IaaC) in Barcelona, Spain. His ongoing collaboration with the Institute´s REsearch + DEvelopment department and IAAC special projects has involved advanced form finding and computational methods related to generative design.
Angel Munoz
Angel is a Programmer from La Rioja in Spain. Passionate for art, science, music and retro-futurism, he started programming (self taught) at the early age of 9. He worked in the interactivity and multimedia departments and in 2006 he began developing an interest in open hardware and studied Electronic Product Design obtaining a Higher Vocational Training Qualification. Since then he has also been collaborating in various projects, with IAAC and the Fab Lab Barcelona Pro team, including The machine to be another, Omnipresenz. First Vision, Smart Citizen. Angel is part of the IAAC Academic team as Physical Computing Expert.
Mathilde Marengo
Mathilde is an Australian – French – Italian PhD Architect whose research focusses on the Contemporary Urban Phenomenon, its integration with technology, and its speculative implications on the future of our planet – or the next. She is currently the Academic Coordinator and Faculty at the Institute for Advanced Architecture of Catalonia’s Advanced Architecture Group, as well as being a PhD Supervisor within the InnoChain EU research project. Her work has been published internationally, as well as exhibited, among others: Venice Biennale, Shenzhen Bi-City Biennale, Beijing Design Week, MAXXI Rome.
Chiara Farinea
Chiara is an Italian architect and urban planner. She obtained the Phd in Urban Planning at IUAV (Venice), the Master in Advanced Architecture at IAAC (Barcelona), the Architecture University Degree at Politecnico di Milano (Milan), and she studied one year in ETSAB (Barcelona) thanks to the Erasmus Program. She is member of the Association of Architects of Genova since ten years. She is currently Head of European Projects at IAAC and contract professor of Urban Planning at the Faculty of Architecture of Genoa. Moreover, she is founding partner at Gr.IN Lab art group, exhibiting installations in 2015 at Venice Arsenale and Turin for the Italia-China Art Biennale.
Africa Sabè
Àfrica is an architect. Her early work experience helped her develop her curiosity towards the experience of the products, the atmosphere that provides once installed in a project and how they change the space and ambience. Later on she developed a masters in architectural lighting design focussing on light and lighting and this fascinating “material”. About two years ago joined Santa & Cole projects department helping clients to get the most in their projects by using the company products and is continuing her affair with the company witnessing all phases of a product design and development.
Kunaljith Chadha
Kunal is an Indian architect and a Digital and Robotic fabrication researcher. His research interests involve synthesis of material knowledge with fabrication techniques and has been involved with various researches with biodegradable materials Using robotic fabrication. Kunal is currently active in the academic field with workshops in India, Spain, Iran and France. Continuing his affair with ‘machines making architecture’, he joined the R+D department at IAAC in 2016.
Cristian Rizzuti
Cristian is an interactive media artist working across Barcelona and Rome. Graduated in Visual and Multimedia Art, Cristian has achieved a M-IA Master course at IUAV University of Venice focusing on interactive immersive environments. After his studies, Cristian has presented his works in mayor events and locations in Europe, such as Sonar Barcelona, MAXXI museum Rome, Venice Biennale, ZKM museum Karlsruhe. Always inspired by Science and mathematics, Cristian has focused his personal investigation on the role of human perception and the definition of synesthetic spaces and emotional sounds connected to the body. Being inspired by digital arts, live media and interactive experiments, Cristian’s works can be described as light sculpture installations.
Sebastian Amorelli
Sebastian Amorelli is an Uruguayan Architect graduated from Universidad ORT Uruguay in 2016 with an Academic Excellence Award. His final research thesis on architectural programmatic hybridisation and its potential for urban renewal and reconfiguration was later selected as a paper for the University’s annual Research Journal. He is currently completing his Master in Advanced Architecture at the Institute for Advanced Architecture of Catalonia (IaaC) specialising in computational design and digital fabrication. His latest research project is focused on the intersection of nature and and the built environment and the possibilities of applying natural occurring processes for the benefit of human production and the creation of new ecosystems.
Armin Akbari
Armin Akbari is an Architect and an IAAC student doing a degree in Master of Advanced Architecture (MAA02). Before starting his adventurous studies at IAAC, his main concern was to find and develop computational methods and techniques for CAM purposes. After attending IAAC, his work has expanded to dissimilar activities from computational design to creating interactive systems and environments. Armin’s current interest is mainly developing techniques and tools for robotic fabrication.
Master in Architecture and Engineering in 2015 and Master in City and Technology at IAAC in 2017. Her interest in the field of Design, Landscape Architecture and Environment, saw her improving this knowledge sharing research experiences with the University of Thessaly, UCL DPU.S.Lab of Bartlett, University of Applied Arts of Wien,Unirc, Biennal of Landscape and IAAC. She is following multiple projects, often connected with her personal research in photography about the reflection in human behaviour of mutable urban contexts. She joined Noumena since 2016 and she is currently Coordinator of IAAC Visiting Programs.
Iacopo Neri
Iacopo Neri studied at the University of Florence (UNIFI, Italy) – School of Architecture – and attended a Master in City and Technology at the Institute for Advanced Architecture of Catalonia (IaaC, Spain) after presenting a paper about Swarm Intelligences for crowd-based analysis during the Responsive Cities Symposium (2017, Barcelona). Currently he is studying new areas of dialogue between digital simulations and craftsmanship as computational designer at External Reference Architects (Barcelona, Spain), while he is involved in the organization of international workshops to discuss the role of computer graphics and parametric programming in the field of architecture as a researcher at MTSYSStudio (Florence, Italy).
Irina Shaklova
Irina is an architect and researcher from Moscow.
In 2015 she obtained Master in Advanced Architecture at IAAC with a thesis devoted to robotic fabrication of algae based gels. After completing her master program she collaborated with the Fablab Moscow holding workshops on digital fabrication and organization of Moscow Mini Maker Faire, as well as instructing and coordinating IAAC GSS 2016 in Moscow. After that she proceeded at Ros_Falguera Arquitectura in Barcelona developing proposals for international competitions (getting a special prize for the bridge proposal in Riga). In 2017 she joined IAAC team and currently is working on Active Public Space European funded project.
LECTURES_BCN NODE
Phil Ayres
Tomas Diez
Luis Falcon
Areti Markopoulou
GLOBAL JURY
Efilena Baseta
Eugenio Bettucchi
Edouard Cabay
Ingi Guðjónsson
Marco Ingrassia
Ferdinand Meier
Dimitri Stefanescu
Ece Tankal
The Institute for Advanced Architecture of Catalonia is an educational and research centre dedicated to the development of an architecture capable of meeting the worldwide challenges in the construction of habitability in the early 21st century.
Ramy Aydarous
Erika Stadnik
Suraj Arora
Salvador Calgua
Julia Ubeda Briones
Isabella Carriazo
Juan José Sánchez Aedo
Cielo Guadalupe Méndez
Margarita Flores Garza
Bárbara Garza Saldaña
Santiago López De La Cruz
Kassandra Carrizales Rayo
Melissa Medellín Almaguer
Anna Ortuño Von der Medden
Alejandra Aidé Cavazos Pequeño
María Andrea Villarreal Muñoz
Zaira Esther Cepeda Ávila
Elia Daniela Arzola Morato
Mihirkumar Madhubhai Vasani
Faisal Alqasoumi
Abdullah Alomar
Valentina Palazzolo
Alessandra Weiss
Prithvi Hedge
Jose Carlos Carvalho
Gloria Herranz
Francisco Ortuño
Miguel Ruíz Rivas
Alex Catala Cámara
Natalia Winnicka
Kevin Carrasco Rodríguez
Tomás Romero
Luciana Teodózio
Robert Cropper
Vitor Carvalho
Camila Marques
WORKSHOP TITLE
GLOBAL SUMMER SCHOOL
Institute for Advanced Architecture of Catalonia (IAAC), Barcelona
Artur Tudela
Marco Sanalitro (Noumena)
Federica Ciccone (Noumena)
External Support to Computational Design
Eugenio Bettucchi (Noumena)
© 2020 Noumena | design . research . education s.l.
|
cc/2020-05/en_middle_0097.json.gz/line1399948
|
__label__cc
| 0.570016
| 0.429984
|
Cultural heritage objects
Bolshaya Yakimanka street, 43. Igumnov House – Residence of the French Ambassador
Denejniy lane, 5. Berg's House – Residence of Italian Ambassador
Denejniy lane, 16. The Embassy of Gabon
Ermolaevskiy lane, 28. Residence of the Ambassador of the Republic Uruguay
Kropotkinskiy lane, 13. The Embassy of Australia
Maliy Kislovskiy lane, 5A. Residence of Swiss Ambassador
Khlebniy lane, 28. The Embassy of Iceland
Mansurovsky lane, 4. The Embassy of Syria
Bolshaya Pirogovskaya street, 13. The Embassy of Vietnam
Kursovoy lane, 1/1. Residential house of Pertsova
Malaya Nikitskaya street, 28. Mansion of Suvorov–Baranov – Tunisian Embassy
Novokuznetskaya street, 12. The Embassy of Indonesia
Povarskaya street, 7. The Embassy of Norway
Povarskaya street, 9. The Embassy of Cyprus
Povarskaya street, 44. The Embassy of New Zealand
Prechistinskiy lane, 9. The Embassy of Denmark
Pyatnitskaya street, 33-35, bldg. 1. O.P. Korobkova’s mansion
4 Leontievsky pereulok, 4, bldg. 1,2. The Embassy of Greece
GlavUPDK supervises over 150 mansions, most of them are the architectural objects of Russian cultural heritage, historical and cultural monuments of regional and federal significance.
Among them – masterpieces of the world's renown masters such as Fyodor Schechtel, Lev Kekushev, William Walcot, etc.; gorgeous patterns of such styles as neo-baroque, neo-classicism, neo-Gothic, eclecticism, as well as the prosperity period of Russian architectural modern.
Cultural heritage – is the tangible and spiritual values of the past, monuments, historical and cultural sites significant for maintaining and developing the originality of the Russian Federation and all its nations, their contribution to the global civilization. Our important and honorable task is to conserve their integrity and unique historical look for the sake of generations to come.
33-35 Pyatnitskaya street
Mansion with outbuilding and fencing (1894)
4 Leontyevsky per.
XIX century house, architect: Afanasy Grigoriev
7 Povarskaya street
"Grachevs" Town Mansion, 19th century
City manor of A.A. Kazakov – E.D. Dunker, 18 - 20th centuries
13 Kropotkinskiy pereulok
Derozhinskaya's mansion, 1901–1902
Interactive images
of historic sites
4 Leontyevsky lane. 2015 & 1970
33-35 Pyatnitskaya street. Front stairs. 2015 & 1890
33-35 Pyatnitskaya street. Cafe. 2015 & 1890
33-35 Pyatnitskaya street. Facade. 2015 & 1890
on cultural heritage
Browse the book
/en/about/cultural/
|
cc/2020-05/en_middle_0097.json.gz/line1399950
|
__label__cc
| 0.665819
| 0.334181
|
31 Dec, 2007
I suppose im long overdue to make my
Jefe2007-12-31T14:00:00-05:00
I suppose I'm long overdue to make my first post here at HBAT. After all, Frank showed me which mat the key is under weeks ago. Of course, it helps to have something to say — and what better subject than a live show review, AND some insider info on the upcoming Old 97's album?The boys played to a packed house at La Zona Rosa in Austin this past Saturday. The set list was heavy on the rock, and the banter was minimal. The crowd was a little tame for an Austin show, with the exception of a rowdy crew
I suppose im long overdue to make myJefe2007-12-31T14:00:00-05:00
So you want good news or bad news first
So, you want the good news or bad news first? Yeah, me too, give me the bad first every time. So here goes: The new Old 97's album, rumored for release in February, is now looking to be on store shelves in April. Yeah, I know.But the good? Well, in recent posting on his MySpace and RhettMiller.com blogs, Rhett note's he's got "Here It Is Christmas Time" streaming, and "Meteor Shower" and "World Inside The World" available as free downloads on his MySpace page. In bigger news, Rhett has this to say about the Old 97's album:I have been in
So you want good news or bad news firstJefe2007-12-20T13:10:00-05:00
4 Dec, 2007
Hi everybody well new old97s
Hi Everybody! Well the new old97s.com site went live early this morning. Make sure to check it out, and don't forget to adjust your bookmarks, as both old97s.com and hitbyatrain.com will be frequently updated with late-breaking Old 97's news and features! Also, those of us on the current Old 97's mailing list really ought to get on over to the new list and update our info, as official mailing list members will now have the opportunity to get in on ticket pre-sales and on other breaking news before it's released to the general public. And if you're not on the
Hi everybody well new old97sJefe2007-12-04T15:41:00-05:00
Word on street
Word on the street... well OK... on The Drams mailing list, is that Old 97's NYE tickets may be close to selling out, so get yours today! - frank
Word on streetJefe2007-11-29T15:50:00-05:00
Howdy gang hope everyone survived
Howdy gang! Hope everyone survived Turkey Day in fine form, and enjoyed some good food, great company, and the old-fashioned ass-whuppin' the Cowboys laid on the Jets. Don't laugh. Here in Texas, watching a team from New York take a beating in any sport, especially while sitting in a BarcaLounger with a belly full of L-tryptophan and sweet-potato pie, is more fun than a box full of puppies. And that's a whole lot of fun.Elsewhere in town, the estimable Old 97's fan, raconteur, man about town, and noted Ft. Worth psychologist, Dr. David Welsh, attended last week's Rhett-Murry-Ranchero Brothers benefit
Howdy gang hope everyone survivedJefe2007-11-27T13:16:00-05:00
Just two quick items today old 97s have
Just two quick items today: The Old 97's have taken advantage of their current time in the studio to add one yet another song to their growing Christmas catalog. It's a Rhett Miller original called "Christmas Time" and we may actually see it released in time for the holidays! BTW, Rhett has played it live here and there, so you may have heard it already, and like others, assumed the title to be "All I Want is You for Christmas." (Thanks for the tip, Doc! - f.e.)Also, we've got a bunch of new Rhett Miller solo shows up on the
Just two quick items today old 97s haveJefe2007-11-20T19:16:00-05:00
Update old 97s nye show tix are on sale
UPDATE: Old 97's NYE show tix are on sale now!
Update old 97s nye show tix are on saleJefe2007-11-07T21:58:00-05:00
What are you doing new years eve i mean
What are you doing New Years Eve? I mean besides that? Howz 'bout heading to Dallas' historic Longhorn Ballroom for the return of one of Texas' finest musical traditions, ringing in the New Year with Old 97's! Arguably even more of a cultural landmark than Dallas' famed Sons of Hermann Hall, the Longhorn Ballroom has one remarkable history. Built in 1950 by the father of Western Swing, Bob Wills, and originally called "Bob Wills Ranch House," it was intended to be the new home base for his Texas Playboys. But bad business decisions and a debt to the IRS soon
What are you doing new years eve i meanJefe2007-11-06T16:07:00-05:00
26 Oct, 2007
So saturdays carter albrecht memorial
So Saturday's Carter Albrecht Memorial show was, by all accounts, a smashing success. But your chance to help isn't over yet. By clicking here you can donate to the Carter Albrecht Music Foundation. In exchange for each donation, feel free to download one of the many full-length, hi-bandwidth video's of Saturday's performances. That's a good deal for a great cause.Here's another: On November 17, Rhett is playing solo at the Granada, this time benefiting the Cystic Fibrosis Foundation, as part of their Breath Easy Concert Series, to help find and fund the cure for Cystic Fibrosis. And now, there's an
So saturdays carter albrecht memorialJefe2007-10-26T18:37:00-05:00
From mike daniel in todays dallas
From Mike Daniel in today's Dallas Morning News and its GuideLive.com music blog:Saturday's Carter Albrecht Memorial Concert at the Granada Theater is turning out to be a doozy.First selling point: Dallas' dreamiest alt-country sons, the Old 97's (yep, the comma's still in the name these days, folks) is headlining it. The Old 97's sold out House of Blues' Music Hall, which holds 600 more patrons than the 1,000-capacity Granada, back in May. Shaaa!Second: Sorta -- the band that Mr. Albrecht was so intimately intertwined in when he was shot dead through a door on Labor Day -- will perform for
From mike daniel in todays dallasJefe2007-10-18T14:49:00-05:00
|
cc/2020-05/en_middle_0097.json.gz/line1399951
|
__label__cc
| 0.60592
| 0.39408
|
Anatomical relations of root formation in strawberry
J. Papp;
P. Gracza;
Show more authors information Hide more authors information
J. Papp
BUESPA, Faculty of Horticultural Science, Department of Fruit Science, H-1518 Budapest, Pf. 53. Hungary
P. Gracza
Eötvös Lóránd University, Faculty of Elementary and Nursery School Teachers' Training, Budapest, Hungary
DOI: https://doi.org/10.31421/IJHS/10/3/493
strawberry,
root formation,
internode
Papp, J., Gracza, P., & Simon, G. (2004). Anatomical relations of root formation in strawberry. International Journal of Horticultural Science, 10(3), 71-75. https://doi.org/10.31421/IJHS/10/3/493
This license lets others remix, tweak, and build upon your work non-commercially, and although their new works must also acknowledge you and be non-commercial, they don’t have to license their derivative works on the same terms.
##plugins.themes.classic.close##
Anatomical relations of root formation are traced throughout the life cycle of the strawberry plant from the germinating seed up to the runners of the adult plant. Histological picture of the root changes a lot during the development of the plant. First the radicle of the germ grows to a main root, which makes branches into side roots and later adventitious roots are formed on the growing rootstock or rhizome. The anatomy of the different types of roots is also conspicuously different. First tiny branches appear relatively early after germination on the seedling's radicle, but soon the hypocotyl of the seedling thickens and develops side roots, which are already somewhat stronger. During this interval, the first true leaves are formed. The 4th or 5th of them being already tripartite, and the initiation of new roots extends into the epicotylar region of the shoot. The second years growth starts with the development of reproductive structures, inflorescences and runners starting from the axils of the new leaves. Near the tips of the runners below the small bunch of leaves, new root primordia are initiated. The tiny radicle of the germ develops a cortical region of 5-6 cell layers. Cells of the central cylinder are even smaller than the cortical parenchyma and include 3-4 xylem and 3-4 phloem elements as representatives of the conductive tissue. Roots originating from the shoot region are much more developed; their cortical zone contains 17-20 cell layers, whereas the central cylinder is about half as large. In the next year, new roots are formed at the base of the older leaves. These roots differ hardly from those of the last season in size and volume, however, they are recognised by colour and their position on the rhizome. The roots of the last year are dark, greyish-black, and grow on the lower third length of the rhizome, on the contrary, the new ones, on the upper region, are light brown. Roots starting from the shoot or rhizome are, independently from their age or sequence, mainly rather similar in size and diameter, thus being members of a homogenous root (homorhizous) system, i.e. without a main root. Plants developed and attained the reproductive phase develop in the axils of the leaves runners being plagiotropic, i.e. growing horizontally on the surface of the soil. The runners elongate intensely, become 150-200 mm, where some long internodes bear a bunch of small leaves and root primordia on short internodes and a growing tip. Runners do not stop growing, generally, further sections of 15-25 cm length are developed according to the same pattern, with small leaves on the tip. The growing tip of the runners is obliquely oriented, and small, conical root primordia are ready to start growing as soon as they touch the soil. The roots penetrate the soil, quickly, and pull, by contraction, the axis of the runner downwards, vertically, developing a new rhizome. The short internodes elongate a little and start developing adventitious roots. At the end of the growing season, the plantlets arisen on the rooted nods of runners are already similar to the original plants with homogenous root system. On the side of the adventitious roots, new branches (side-roots) are formed. The root-branches are thinner but their capillary zone is more developed being more active in uptake of water and nutrients. The usual thickening ensues later.
M. Tóth, P. Gracza, Anatomical study of the leaves and petioles of scab resistant and susceptible apple cultivars , International Journal of Horticultural Science: Vol 11 No 3 (2005)
|
cc/2020-05/en_middle_0097.json.gz/line1399962
|
__label__cc
| 0.702385
| 0.297615
|
Mount, William (d. 1769)
A Draught of Virginia from the Capes the York in York River and to Kuinquotan or Hamton in James River by Mark Tiddeman. Sold by W. & I. Mount & T. Page on Tower Hill London.
Creator: Mount, William (d. 1769), Tiddeman, Mark, Page, Thomas (1704 -1762)
Collection/Donor: Osher
A General Chart of the Western Ocean. Sold by W. Mount and T.Page on Tower Hill, London.
Creator: Mount, William (d. 1769), Page, Thomas (1704 -1762)
A New and Correct Chart of the Coast of New Foundland from Cape Raze to Cape Bonavista, With Chebucto Harbour in Nova Scotia Done from the latest Observations.
A Chart of the Sea Coast of New Found Land, New Scotland, New England, New York, New Jersey, with Virginia and Maryland
A Chart of the Sea Coast of New Found Land, New Scotland, New England, New York, New Jersey, with Virignia and Maryland.
Creator: Mount, William (d. 1769)
Map Type: Nautical charts, Geographical
The English Pilot. The Fourth Book Describing the West-India navigation, from Hudson's-Bay to the River Amazones. Particularly Delineating The Sea-Coasts, Capes, Head-Lands, Rivers, Bays, Roads, Havens, Harbours, Straits, Rocks, Sands, Shoals, Banks, Dept
Creator: Mount, Richard (d. 1722), Mount, William (d. 1769)
A New and Correct Chart Shewing the Variations of the Compass in the Western & Southern Oceans as observed in ye year 1700 by his Maties: command by Edm. Halley
Creator: Halley, Edmond (1656 -1742), Harris, John (active 1685 -1720), Mount, Richard (d. 1722), Mount, William (d. 1769)
A new General Chart for the West Indies of E. Wrights projection vut Mercators Chart
Creator: Wright, Edward (1558? -1615), Mount, Richard (d. 1722), Mount, William (d. 1769), Moll, Herman
A Generall chart of the Western Ocean sold by R. Mount and T. Page on Great Tower Hill London.
A Chart of the Sea Coast of New Found Land, New Scotland, New England. New York, New Jersey with Virginia and Maryland, Sold by Richd: Mount & Tho: Page at the Postern on Great Tower hill London
|
cc/2020-05/en_middle_0097.json.gz/line1399964
|
__label__cc
| 0.555155
| 0.444845
|
Industry & Executives
Golf & Outdoors
Booze & Cigars
Wealth & Philanthropy
Ovation Magazine
Hospitality + VIP
AllMusicTV & FilmIndustry & ExecutivesSports
Capturing Hollywood Action with Super Stunt Woman Jahnel Curfman
Brandon Wooden Makes Vegas VVIP Dreams Come True at Caesars Palace
Behind the Scenes with Cam Newton for Ovation’s Premiere Issue
Greta Thunberg’s Carbon-Free Transatlantic Journey Offers a Peek into the Future…
AllFestivals & EventsTravelDining & NightlifeGolf & Outdoors
Le Club New York Opens as the Meatpacking District’s Hottest New…
Jet Linx’s Expansion Brings a New Level of Private to the…
The Newly Renovated Adare Manor Is Ireland’s Ultimate Golfing Destination
AllFashionWatchesCarsBoats & PlanesGear & TechBooze & CigarsArt & Collectibles
The Unwritten Rules Of Supercar Ownership
Parley for the Oceans Helps Create High Fashion from Recycled Ocean…
This German Superyacht Is One of the Most Forward-Thinking Hybrid Yachts…
AllReal EstateHome & DesignHealth & WellnessWealth & Philanthropy
Index Slider
Los Cabos Real Estate Buyer’s Guide
Is Sony’s $5.8 Million Crystal LED Wall the Future of Living…
This $36 Million Mega-Home Is One of the Most Epic Residences…
Celebrity Trainer Amoila Cesar Is Demanding You to Be Great
About Ovation
OVATION celebrates the sports and entertainment lifestyle with distinct and dynamic content created specifically for professional athletes, performers, artists, and the executives and influencers who power the planet’s most exciting industries. Through its print magazine, website, and social-media channels, OVATION covers the many facets of the luxury lifestyle—from fashion to travel, watches to wine—while providing an insider’s perspective on high-profile people and their passions: The trendsetter off the field or court. The philanthropist away from the spotlight. The businesswoman beyond the stage and screen. OVATION’s iconic photography and contemporary design capture the magic of these personalities, their performances, and their professions—and offer a behind-the-scenes view into their exclusive domains. Ovation is a wholly owned subsidiary of Vault Media Group, Inc. (VMG). At a time when sports, music, and entertainment are so intricately aligned, VMG is the luxury media brand that serves them all, a unique content platform that caters not just to an affluent audience, but to an influential one.
© Copyright 2019 Ovation Partners, LLC, a wholly owned subsidiary of Vault Media Group, Inc. Ovation Magazine is a trademark of Ovation Partners, LLC
|
cc/2020-05/en_middle_0097.json.gz/line1399968
|
__label__cc
| 0.693447
| 0.306553
|
Dansk Deutsch English Español Français Italiano Japanese 日本語 български език Hrvatski Jezik Čeština Nederlands Eesti Suomi ελληνικά Magyar Gaeilge Latviešu Valoda Lietuvių Kalba Malti Język Polski Português Limba Română Slovenčina Slovenščina Svenska Türkçe
(Level 2) 12 Weeks to Your First 5k SKU: 124142
12 Weeks to Your First 5k is a perfectly paced OUTDOOR RUNNING program for new runners.
In the next 12 weeks, YOU can go from, "Oh, I don't know about this running thing," to "Wow! I just ran a 5K!"
Here's how.
12 Weeks to Your First 5K will take you step-by-step through the process of becoming not just a runner, but a strong runner. Daily, guided workouts (outdoor walking or running on your own, and core strength workouts with videos) that are just your speed, with lots of encouragement and practical advice along the way. Build your balance, strength and stamina with straightforward exercise videos that don't take a lot of time.
We're starting from the ground up here. I know you're pretty active, but maybe not super consistent. That's okay! One of the skills we're working on is consistency. And believe me, it's easier to stick with a program when you enjoy what you're doing - that's why there's a variety of workouts. You'll walk or run three to four days each week, and do core workouts and strength training twice.
I promise, you'll feel the workouts, but you're not going to be crazy sore or get too bulky from the weights. We're aiming to get leaner, not bigger.
This Guide has everything you need, including tips on gear, advice for getting started, a comprehensive training plan that starts with walk/run intervals and progresses safely to sustained running, and hand-picked core and strength workouts to enhance your overall fitness.
No need to try and figure this out on your own. The embedded, clickable links in the e-book take you to the free, full-length follow along workouts on the Pahla B Fitness YouTube channel.
You can totally do this.
Copyright © 2020 Pahla B Fitness
|
cc/2020-05/en_middle_0097.json.gz/line1399973
|
__label__wiki
| 0.536002
| 0.536002
|
Vitoria debuts as Union lose 1-0 to Rowdies, Marfan joins DC, more news
Posted by Ed Farnsworth on February 11, 2015 at 10:14 am
Photo: Courtesy of Philadelphia Union
The Union remain winless in the preseason, falling 1-0 to Tampa Bay Rowdies in Clearwater.
Unlike the loss to Jacksonville last Saturday, the Union kept a clean sheet through the first half and into the second. The lone goal of the game came from the penalty spot when Michael Lahoud fouled in the box. Reading native — and Reading United alum — Corey Hertzog converted for the Rowdies from the spot (click here for video of the goal).
Jim Curtin said after the game, “I’m happy with our first group, they pushed the tempo for 45 minutes and created chances. We are just lacking the final ball. While we want to win every time we step on the field, at this phase of preseason, it is more about performances than results.”
With Andre Blake picking up a minor injury, and Rais Mbolhi newly arrived with the team after playing for Algeria in the Africa Cup of Nations, John McCarthy played the full 90 in goal. In addition to McCarthy, the Union’s starting lineup was Gaddis, Vitoria, White, Williams; Edu, Nogueira; Wenger, Maidana, Le Toux; and Sapong.
Steven Vitoria played 30 minutes before being replaced by Richie Marquez. Curtin said of the new defender, “Steven Vitoria fit in seamlessly with the group.” He added, “I thought Vincent Nogueira had a very strong performance in the first half.”
McCarthy and Marquez were joined at the start of the second half by Fabinho, Simmons, Lee; Quinn, Lahoud; McLaughlin, Pfeffer, Hoppenot; and Catic.
Curtin said, “Zach Pfeffer and Dzenan Catic stood out again in the second half.”
Rowdies head coach Thomas Rongen said, “Playing against an MLS team, our two units more than held their own. It was their first time playing together and I think they deserve great credit.”
More on the game from Philadelphia Union, CSN Philly, and Tampa Bay Rowdies.
The team flies back to Philadelphia on Thursday afternoon before returning to Clearwater on Monday. Play in the IMG Suncoast Pro Classic against the Costa Rica U-23 team on Wednesday, Feb. 18 at 2:30pm before facing Congolese side TP Mazembe (Feb. 21, 7:30 pm) and Columbus Crew (Feb. 25, 5 pm), as well as a final preseason game against a to-be-determined team in the tournament in either a consolation game or the tournament final (Feb. 28).
He has scored yet in preseason match play, but Jim Curtin is high on CJ Sapong:
He’s a guy who I think is going to do big things for us this year. I have high expectations and he’s backed it up in training every day. He brings a good mentality. He gives us versatility, too. He’s played on the left for Peter in Kansas City, he’s played on the right and he’s played as the high guy. That versatility gives us a real weapon and is something I’m excited about…
I like him as that No. 9 target. Could we be a team that plays with two forwards? Absolutely. We can go to two forwards and he can be comfortable. It is good, though, that he can pop out wide. He gives us some height – he wins everything in the air – and does a great job holding that first ball, laying it back, and getting in the box. He’s a real weapon. Even if it’s winning balls on goal kicks and having Seba [Le Toux] and Andrew [Wenger] run off of him.
All of us would like to see some of that expectation realized before the start of the season.
Dzenan Catic gets some local coverage from Michigan Live.
The 700 Level on how, with the Vitoria acquisition, the Union still need a big signing at forward.
Former Union man Brian Brown is back in Jamaica with Harbour View after a series of trials abroad. Brown said of his time — or lack thereof — with the Union, “I don’t think I did enough there, mainly because of playing time. It was just not enough. However, my performance was fair.” Brown plans to finish the season with Harbour View while his management team looks for new opportunities abroad.
The Union Academy U-17 team will be in Sanford, Fla. this weekend competing against their counterparts from DC United (Feb. 13), Toronto FC (Feb. 14), New York Red Bulls (Feb. 16) in the final East Region games of the Generation adidas Cup. The Union is third in the group, which also includes the New England Revolution and Orlando City academy teams, with a 0-0-3 record after the first round of games in Conshohocken last October. You will recall the Union won the tournament with a team coached by Jim Curtin in 2012.
Goalkeeper Nick Noble returns to Harrisburg City Islanders for his fourth season with the club.
Lost in considering the new name and logo, I missed what is the truly important part of Monday’s USL announcement: “All aspects of our league have been elevated, both on and off the field, to the extent that the time is right for USL to re-establish its Division 2 status. This year the League will apply for USSF Division 2 sanctioning to accurately reflect the quality of our league, our ownership groups, our stadiums and our fans.” Should the NASL be worried?
Considering some of the issues surrounding USL’s quest for Division 2 status, Kartik Krishnaiyer of World Soccer Talk says “Harrisburg City Islanders might have trouble meeting the Division 2 standards without waivers from the USSF.”
The Daily News reports Heather Mitts — Olympic gold medal winner with the USWNT, former Philadelphia Charge and Independence player, and former Union broadcaster — will host a reality show on Nickelodeon during the Women’s World Cup called “Soccer Superstar.” The show will feature “young female soccer players showing off their skills,” and is based on a show called “Football Star” that previously aired in the UK and Australia.
In preseason play on Tuesday, San Jose and Portland drew, 0-0, in Tucson. Also in Tucson, Houston defeated Vancouver, 1-0. In Mexico City, Montreal Impact fell 1-0 to Cruz Azul, although they were scheduled to play the club’s U-20 team. Across the pond in Manchester, NYCFC defeated St. Mirren, 2-0. NYCFC’s first ever goal was scored by its first-ever captain, David Villa.
DC United has acquired — cough — former Union man Michael Farfan via “allocation ranking order.” I hope he rooms with Perry Kitchen for road games (feel free to submit your own blurb in the comment section to the picture below). More on Marfan’s signing at the Washington Post.
“Why am I always the one replacing the toilet paper roll?” Photo: Earl Gardner
Seattle Sounders have signed 21-year-old Colombian international midfielder Andrés Correa.
FC Dallas have signed midfielder Fabian Castillo to a new five-year deal.
Jermaine Jones will be out 4-6 weeks after undergoing successful surgery for a sports hernia.
Sportsnet.ca reports Michael Bradley will replace Stephen Caldwell as Toronto’s captain. Apparently, Bradley restructured his contract so that Jozy Altidore could be signed by Toronto.
The Toronto Sun on the war of words between Montreal owner Joey Saputo and Maple Leaf Sports and Entertainment CEO Tim Leiweke over Toronto’s big spending, which “come one year after Philadelphia Union CEO Nick Sakiewicz threw a pity party because of TFC’s decision to spend tens of millions for Michael Bradley and Jermain Defoe.”
The city of Las Vegas has released what the Las Vegas Sun describes as “a finalized, detailed plan” for the proposed $200 million soccer stadium in that city. The Las Vegas City Council is scheduled to vote on the plan on Feb. 18. Want to read the 72 page Master Development Agreement? Click here.
Las Vegas Review-Journal has an editorial on the “blame-game” going on over the proposed soccer stadium.
At IndyStar.com, a primer in Q&A form of the proposed $82 million, 18,500-seat stadium for NASL side Indy Eleven, now home of former Union man Kleberson.
Tim Howard could be in goal when Everton visits Chelsea today for the first time since his calf injury in December.
Julian Green, who was loaned by Bayern Munich to Hamburg to get first team minutes, has been dropped to Hamburg’s U-23 team.
At SI, a long piece on Jurgen Klinsmann on I don’t know what. Balancing tradition and ambition or something? Might be the first article from Brian Straus I’ve ever given up on reading.
Local lad Russell Canouse on the US’ draw for the upcoming U-20 World Cup in New Zealand.
I think everyone is pretty excited about the draw we ended up getting. It obviously looks like we will be the favorite but I am still heading into the tournament cautious because it is a World Cup. Any team that qualified will most likely be a top team and tough to beat.
I think Ukraine will be a hard game for us because I expect them to have very skillful players on the ball and have a sturdy back line. On the other hand, we play against the host New Zealand, which will also be very difficult considering the environment.
A lot is at stake in these games but I am really excited for our team and I think we have the quality to do well in this tournament.
U-20 coach Tab Ramos said, “Regardless of the group, I would never see us as a favorite. We have never been in position to be a favorite. I don’t think we are prepared to play as if we were a favorite. We have to go out there and grind out every game the way we always have, and do it one game at a time.”
The sale of the UK broadcast rights for the Premier League for the next three seasons to Sky and BT has netted the league a whopping £5.14 billion. That’s 7.86 billion in American money. The Guardian reports, “The two broadcasters will pay an average of more than £10m per match, an increase of 70% on the current £6.5m. The increase was driven by Sky’s determination to hang on to the lion’s share of matches but came at a price.”
The AP reports, “Morocco has rejected sanctions by the Confederation of African Football (CAF) for withdrawing from hosting the African Cup of Nations, calling them harmful to the sport and against the rules.”
Also from the AP: “Egyptian prosecutors have ordered three soccer fans detained for 15 days and have released 18 others on bail in the wake of a deadly stampede outside a Cairo stadium. The fans are accused of attacking policemen, damaging police cars and terrorizing the public, an official said Tuesday.
At the Guardian, Michael Lewis on Toronto Metros-Croatia, the NASL side that included Eusebio among its players and won the league championship in 1976.
LCBline says:
The Union need a DP striker. I don’t care if it is only the 2nd game of preseason or the last game of the regular season we’ve seen this act before. Why can’t this team just get the final pieces they need once and for all? They talk about it , whine about it, and BS about it ad-nauseam … just do it. CJ Sapong is a project, Le Toux (while beloved) is streaky and will lose his scoring touch at the worst times the same for Wenger and Casey. They are support pieces so get a damn DP striker!! While you’re at it get a real quality starting LB don’t start yet another season without one. Again ad-nauseam!
Before anyone else is considered for the job, I would like our own Joel to replace Jon Stewart as host of the Daily Show! Man’s got mad skills! 🙂
I’m a hack by comparison. Jon Stewart is a genius.
In other news though does it concern anyone that the Rowdies coach mentioned this was the first time his ‘Units’ have played together? A good deal of other teams are warming up against like for like competition and we are getting beat by NASL teams playing together for the first time. IDK.
After sleeping on it it doesn’t concern me ONLY becuase I will give Curtin and the players the benefit of the doubt – they’re experimenting and gaining fitness, and it means nothing to them, while NASL sides seem to wet themselves over beating MLS teams. If the IMG Games do nothing then the panic alarm will be on full blast, because these games should be used to shake the cobwebs. But even with the poor showing, I will give them another shot before I raise the alarm.
I totally see your point. However the Union are an non-playoff, point dropping team. No one on last years team should be given the luxury of playing themselves into shape. Also the resigning of BC doesn’t fill me with the greatest confidence in this staff. BC made a typical BC panicky move in the first game against JAX. If Curtin didn’t get in his face about it then there is a real problem. BC is one of those players who should be on a very short leash.
alicat215 says:
With all these NASL sides getting results……..it makes for an interesting Open Cup this year!
+1 Here Here!
The arc of football improvement in this country will follow the resurgence of the NASL. The framework of their league is stronger from my POV and they are not relying so heavily on the NY Cosmos this time around, though to be fair- the Cosmos do shoulder a fair portion of the burden. These franchises need good strong investors with smart business plans and sound football minds- unlike some of the MLS clubs. The grassroots support owned clubs in 3rd and 4th divisions need to keep growing too.
I hope the NASL grows and grows and grows. An open Cup win by the Cosmos or another NASL team would really shake shit up. It is no secret the NY Cosmos find the US Open Cup to be their Holy Grail as it legitimizes the league and gives them a foothold moving forward. I’ve read some article about the Cosmos plan and the NASL rivaling the MLS is absolutely the long term goal. It is my opinion that the NASL is the only possible way to get the game moving in the direction -and force MLS from its stupor- it really needs to go in the USA- which is in accordance to International standards.
Great One says:
Very good sign to see Nogueira in his regular good form, and possibly the best sign of the whole preseason is how well Pfeffer seems to be showing. This gives some cover for Maidana and Letoux/Wenger for that matter. I hope he actually gets some time this year. It’s encouraging to hear that Vitoria slid right in and played right away.
Some worrisome things are that we couldn’t score against a Tampa Bay team who started out a lot of their trialists against us. We seem to have controlled play but not scoring is a bad sign. Which leads to my biggest worry… should we be reading anything into all this build up talk of Sapong? Will this mean a new striker may not be on the way?
This kind of game only serves to emphasize that as a huge need. I’ll say it again, Nogeuira and Maidana are shuttlers, controllers, creators. They are NOT scorers per se, we need finishing. Sapong is a great addition in general, but the guy’s best year was .37 goals per 90 min. We need a starter.
All in all, at least (knock on wood) everyone is healthy at this point and ready to go.
I’d feel a lot better about hanging our #9 hat on Sapong if he’d managed to find the net a few times in these last two preseason matches. I didn’t see the Rowdies match but saw about 20 minutes of Saturday’s game and didn’t see much in Sapong to get excited about, though he didn’t have many opportunities.
This team absolutely has to find a way to score more goals. WE need our own BWP.
old soccer coach says:
BWP was being set up by a world class player time after time after time. Henry may not have had the legs, but he made the passes.
I agree, but BWP sure knew how to finish those chances. I’ve seen plenty of union chances fizzle last season.
Dunno…ask Henry. He repeatedly would say that BWP should have scored at least 50 goals last season.
for sure. Noguiera and Maidana are good for what ten goals max this season? Max.
By my abacus calculations, and off the top of the head, if Sapong and Casey combine for 20 and Le Toux and Wenger combine for 12 or so and some random goals come from the rest we are at least 12-15 goals short. 1-0 clean sheets for a season is a tough way to play.
and no fun to watch.
I’m sorry to say, but we are not getting a striker. Or a left back for that matter. It’s Feb. I’d love to be wrong but I’m just not seeing it, and you know, deep inside your heart, it’s not happening. Breath, accept, hope there’s no strike.
The Chopper says:
There will be a striker this season. But it will not be until the July window. There are a couple of high profile names being worked on, but these players are not available until the summer.
Got to live with Sapong and Casey until then.
If Curtin’s vision comes to fruition and our defense is dominant maybe we can survive until then. Keep the head above water, bring in a striker and make a push. LA wasn’t very good until mid- summer last year.
Yeah that’s the way I see it. “We tried, we tried”… see: DELORT… But it didn’t happen. Let’s just hope they aren’t too far out but the time July rolls around.
Sapong and ANYBODY BUT Casey! I was nauseated when he was resigned. The FO said they were going after a striker. Many have been screaming for it for 2 years. They finally pick up Sapong and just when we thought we might be headed somewhere, the U are boasting about resigning Casey. One step forward…two steps backward.
“The team flies back to Philadelphia on Thursday afternoon before returning to Clearwater on Monday.”
Is there a good reason for this? Is there something I’m not thinking of? Because I just don’t see why they don’t just stay there for those 4 days…
The FO doesn’t want to pay for the hotel rooms and meals for 4 days.
That is, sadly, what I assumed as well.
Actually, considering the rate the team gets for booking long term and that they are two men to a room, staying in Fla is likely cheaper than flying everyone up and back.
The team is returning to Philly for meetings, medical evaluations and roster cuts. These things are more easily handled out of the team offices than ad hoc in Florida.
nagjs1 says:
Roster cuts?
Easier to conduct business at headquarters.
On the bright side, it is actually a way of preparing for the season too. As we all know, the US is massive and so MLS teams travel is more difficult then say the BPL or La Liga. So Florida to Philly to Florida could be a positive, especially to get someone new like Vitoria used to the travel.
It’s still early in preseason, but I agree with most of you that we still need a star striker. I am a bit concerned that Maidana isn’t good enough to pull the strings. As commented by JC, “we are lacking the final ball”.
Disappointed to hear that Marfan is in DC and not Philly. With that being said, I would not use the 5th spot in the allocation order for him either. But, I do hold out some hope that the Union make a trade for him. Not sure what we should give DC for Marfan? Allocation money, Fabinho, Cruz, all three! I would consider Sheannon or Gaddis IF, we have a true LB replacement we can count on.
Adam S says:
You can pull the strings all you want, but if there’s no puppet, you’re not gonna be putting on much of a show. If Sapong or others aren’t putting themselves in areas where Maidana/Nogueira can hit balls to, it doesn’t matter how inch perfect they are.
Yes, it takes two to tango, but I wasn’t all that impressed with Maidana last year. Let’s get that striker and see if they can tango together.
The Black Hand says:
Sheanon or Gaddis…for Michael Farfan???? Cruz is better than Farfan (check out the numbers)…yeah, I said it. Yes, Michael Farfan has skill (and we will never forget the chip vs Real), but his production has been terrible. He had a solid shot with the club…he flubbed it. I’ll pass on Marfan…
Agreed. Nice player, but not the be all, end all… or the final piece. I did love his nasty streak though. Damn. Haha
I’d prefer his brother…who can play LB.
But won’t. Isn’t that why he left?
Sorry guys, but Cruz can’t hold Michael’s jock strap. I want to see skill, not not no skill and all hustle.
Cruz improved himself over his 100 game career into becoming a worthy off the bench player last year IMO. Numbers or no numbers, one guy played in an All-star game and the other can only do it in his dreams.
I believe Nogs and Maidana would rather play with a player like Marfan on the wings rather than any other player on this team currently. Wouldn’t we all rather watch a skillful/crafty midfield then a workhorse midfield? Just saying.
PK’s have always been McCarthy’s weakness………….
Well, they’re pretty much every goalkeeper’s weakness.
not true at all. In modern footy, the keepers have the advantage. I watched him play for years….he guesses early and wrong often…..instead of watching the opposition’s approach. Great keeper, local kid…….but that part of his game was always lacking……ask any number of local coaches. Some keepers love PK’s….you don’t know what your talking about.
That’s the fun part about the Internet. I get to comment even though I have no idea what I’m talking about.
Lol…..this is true.
No, cszack4..you’re cool. PK’s ARE every GK’s weakness. How many get stopped that are on frame? Almost none. Trying to read the kicker is one thing, but not getting duped is another. As much as keepers can read, kickers can fake more. A head nod, different approach cadence, hip move, changing angle of approach, eyes, stutter steps, etc… they all give the kicker the advantage. 12 yards away…24 feet wide…8 feet tall…one man trying to shrink that space with a guess… Simple math: how many get blocked vs how many go in?
And all I meant was that a PK is still a situation that is more than likely a goal (even with recent rule changes on goalkeeper movements). Hopefully the mental aspect of saving PK’s and/or getting in the shooter’s head is one that McCarthy gets a chance to work on. I have a feeling Mbolhi would be a good mentor in that aspect.
How do keepers have the advantage when about 75% (depending on league or competition) of penalty kicks result in a goal? I realize that skills vary among keepers (we are admired MacMath’s run last season), but the odds are generally stacked against keepers in penalty kick.situations.
…….because most clubs have a specialist or two in their ranks that are very good at them.
No way. The keeper has a decent shot at a save, as long as he guesses correct, but I wouldn’t say they have an advantage.
They can move early now….which changed everything. That’s why they advise keepers not to guess anymore and read hips, body lean etc.Plus, they usually take one huge step off the line which further cuts angles down and is rarely called. And most top flight keepers are 6’4-6’5 range……..add that all up and ask yourself if the shooter really still has an advantage. Players have to take it differently now too….you can’t just pick a side anymore….you have to read the keeper on the approach….why do you think so many are scored up the middle now….they wait for the keeper to get antsy and pick a side…..respectfully disagree
If you played in the 90s, 80’s, etc., I agree……..it was pick a side and stick to it, switching sides mid shot was considered a no-no……..its a different animal now. The keepers are getting clever too…..yanking the crossbar before the strike….just to have it wobble and cut another few inches down…..ah, the dark arts….
YOU’RE absolutely insane or a rabble rouser if you really think the penalty taker doesn’t have a clear advantage. It’s not hockey. C’mon, man.
Honestly, probably a little bit of both I guess. I know its not hockey……I’m just explaining what I would hear at training sessions by people who got up the pyramid farther than I did……..not trying to start guff. Think about it………I would hope you would at least acknowledge that its not as easy as it used to be……….
I have made some guesses about roster decisions, and about salaries given to re-signed veterans, to project how much of the 2014 3.1 million dollar salary cap is left for an international striker. There is likely an international roster slot available for one. I think about $294,000 of the cap is left. If I am correct that Mbohli no longer counts as a DP this season, then under the 2014 rules there would also be a DP slot available. I have no way to estimate the status of allocation money, so I have ignored it. I assume that Jay Sugarman would not have ordered pursuit of a “name striker” without making available some kinds of resources to go beyond the cap limit and get a third DP. My speculative conclusion, after all these unproven assumptions, is that they are credible in claiming to still be trying to sign our much hoped for striker. There will not be a new left back because there wouldn’t be any money left were the striker actually signed. We likely saw that last night with Gaddis and Williams starting together and Kanakoudis not seeing the field. [ When Lee and Fabinho were on the field together I do not know who played the left flank and who the right, (I would speculate Fabinho was right to see how he would do there in an emergency). Lee will cost $36,504 in roster slots 25-30 and go learn to be a left back at Harrisburg, i.e., on practice field #2 in Lot B.]
i am hoping that they can pick up ben sweat after he was waved by colombus. i am not sure he would immediately challenge sheannon or ray for a starting spot but it would be nice to have another (probably cheap) left back on the roster and he was pretty highly touted before the draft last year
Remember the cap is bound to go up as well this year.
Mike H says:
I could be alone in thinking this, but the acquisition of another starting CB and a striker (doesn’t need to be DP in my opinion) that would be a clear cut starter compared to our current group would be all this team needs to truly shine. It would do a lot for the back line: Gaddis would still be the starting LB (not a bad thing- I think his speed can help on the counterattack and help make up for the lack of left footed service into the box), Vitoria and the other (theoretical) CB signing in the middle, and Williams out wide. That’s a very stout defensive group and gives you the ability to unload Berry for allocation money, a draft pick, or both (I’m assuming there is a team out there that would roll the dice on him). White isn’t a bad option as a spot starter due to injury, Marquez would get a chance to develop, and we’d still have the option to move Edu back if need be. Fabinho would still be around (I know, I know) to add depth in the event of injury as well. I like that group, perhaps I’m the only one? If we add a clear cut starter at striker it opens up a lot for the team. Having a bonafide starter obvious (in theory) adds to goal totals, but gives Casey better managed minutes and allows Sapong to fill in anywhere up front as needed. I like our midfield group and the mix at depth between vets and (hopefully) some of the youth. I know it isn’t so easy to just pluck out two players that would fit the bill for what I’m describing, but its shows you how close the team just might be if they’re able to add the right guys. I don’t think the squad is as far off as many, but they absolutely need a little more help.
CB’s need time to adjust to each other’s strengths/weaknesses. So far, we have a new guy and maybe Edu(?). I couldn’t call that a stout back line. Our CDM better be strong!!!!!
So Jim, did I just get out of the interview that your considering a 4-4-2? Stick to a 4-3-3 or 4-2-3-1 please, 4-4-2 just means you don’t have the horses to play any other way. Don’t give me the two forwards crap………….teams that have two good ones these days either run 4-3-3 or 3-5-2.
You don’t got the horses, means you dont got the horses.
Right now Letoux/Sapnog, Sapong/Wenger or Casey/??? might goive us…. Something.
I don’t understand why you don’t play CJ as the high target striker and have Wenger and Seba run off of him on the wings in a 4-3-3? Thats a front three with a lot of pace……..
Eli Pearlman-Storch says:
Agreed. Also, Wenger and/or Le Toux are not wide midfielders in a 4 man midfield. This team is completely set up for the 4-3-3. Maybe all he means is throwing on another body when they’re chasing a goal?
George H says:
I wasn’t impressed by the USA U-20 team, but that lukewarm quote by Ramos won’t instill his team with confidence after that relatively easy draw.
I hope the Union put in a call to Ben Sweat. He was just released by the Crew and I thought he had pretty good potential when he was drafted. I’d much rather have him as LB depth then say… Fabinho or Lee.
Also, interesting that Austin Berry didn’t play in the Rowdies game at all. Either he picked up an injury (which I have not heard yet) or he has to be on the way out (via trade?).
Looks like Berry is getting loaned/sold to Cosmos?
Berry is already in the Cosmos camp as a trialist. He will be on their pre season trip to Homg Kong. He was not in Clearwater last night.
Still no need to panic?
That was our top XI…and they were matched by the Tampa Bay Rowdies.
“That was our top XI…and they were matched by the Tampa Bay Rowdies”
Did anyone happen to see any of the streamed NYCFC vs St Mirren FC friendly? How the hell are the Union going to compete with that?!?
I would give Brian Brown another look. Speedy guy with a world-class turn, on the ball. He needed more than 10′ here and there.
Curtin really did not favor him. I think it is unfortunate; he scored goals.
Curtin might have missed with that call. He will probably be available again, although I could see him pursuing other loan options…should the Union come calling. Instead of the club looking for players that fit their ‘style’, they should re-think said style… One with a sound tactical approach would sure be refreshing.
JohnS says:
The sky is falling!!!! The sky is falling!!!!
Welcome to philly!
No, your not- it is more like. The sky is falling. The sky is falling.
Leave a Reply to George H Cancel
Mbolhi, Valdes & Lahoud to miss TFC games with NT call ups, the Toronto mess, league results, moreSeptember 2, 2014
Vancouver got allocation money in Vitoria deal, USL rebrands, MLS news, moreFebruary 10, 2015
Nacional says Valdes to sign loan deal, new trialists, Academy commitments, US Open Cup format, moreFebruary 5, 2015
Notes from camp, Mbolhi on to ACN quarterfinals, Academy callups for US U-18s, big trades, USA-Chile, moreJanuary 28, 2015
|
cc/2020-05/en_middle_0097.json.gz/line1399977
|
__label__cc
| 0.718868
| 0.281132
|
Rielle Hunter on her affair with John Edwards: "Do you really think men cheat, for bad sex?"
Coming up tonight at 9 p.m. Piers Morgan welcomes Rielle Hunter for a candid face to face conversation, touching upon everything from her extramarital affair with John Edwards, to any remorse she has, or apologies she'd like to offer.
Joining "Piers Morgan Tonight" in her first cable interview, the 48-year-old reveals intimate details about her romantic relationship with the former North Carolina senator:
"You've made no secret of it, being the best sex of your life, have you?" asks Morgan.
"Do you really think men cheat, for bad sex?" she answers back.
Tune in this evening at 9 p.m. as the author of the new book, "What Really Happened: John Edwards, Our Daughter, and Me," Hunter opens up about Frances Quinn, the love child of her affair with the former presidential candidate.
Kathleen Brofman
I love watching Piers, but could not watch Rielle Hunter tonight. I had seen her on ABC and she sickened me. I did not believe anything she said; she came across completely self-centered. Why does she need to insult John's family at this point? (John also is totally unbelievable, really fake).
This is the 1st time I have ever responded on the Internet to anything on T.V. Piers, you did a wonderful job of holding this woman accountable. She came across as devoid of true empathy...I feel sorry for her daughter.
June 27, 2012 at 10:00 pm | Report abuse | Reply
I would not have usually watched an interview with Rielle, but just as I expected, she acted as if she were the injured bird when asked about the acts she outlined in her book. Her comment when shown a film clip of Edwards denying paternity of their child was "Oh great.", like this was somethng she did not expect to be discussed. Two faced and passive aggressive. Great interview questions by Piers. He did not play her softly. I think he was repulsed by Rielle like I was.
June 28, 2012 at 12:46 am | Report abuse | Reply
Pretty nice interview,don't think he was unfair,just precise and using her money maker book as a support .
Glad CNN can be sometimes open minded....
You missed a good interview......
Jen R
How could he have been so awful to his wife when she was so sick? Why do we in America put these people on the news and on our talk shows. It is horrible. How can we allow someone so awful to be disrespectful to a woman like Elizabeth Edwards? "I am amazed and know not what to say." [Shakespeare]
Scricketball
Evil needs to be exposed publicly
Rielle Hunter aka Lisa Jo Druck is a vapid, heartless woman. Here is a woman who first has an affair with a married man whose wife has terminal cancer. Then, after the wife has passed away, she publicly trashes her. How much pain and embarrassment is Rielle Hunter going to continue to inflict on the deceased wife's two small children and one adult child? Hasn't she done enough damage to this family?
And ironically, Rielle Hunter claims John Edwards is not a "demon" yet proceeds to paint him out as a spineless man who can't stand up for himself and while cheating on his terminally ill wife, complained incessantly about how his wife was such a terrible person. WHO does that? John Edwards can forget about ever restoring his public image after the number Rielle Hunter has done on him with her book and interviews.
You need to bring that hot Private Detective on that busts cheaters! Her name is Carey Torrice and she owns Eye Spy Detective Agency in Michigan. I think she was on E!Entertainment for Holly's World and Maury too. Here is the link http://www.eyespyinvestigations.com
August 22, 2012 at 12:12 am | Report abuse | Reply
These are comments from a woman with no class or taste. No respect for John Edward's children. It is disgusting.
Jimmy Joe Jim Bob
All of you cackling hens are amusing, but none of you are half the woman she is.
THIS WOMAN HAS NO CHARACTER, YOU CANT SEE THAT???
Atlanta Chick
She's OLD and looks like Miss Piggy! rotfl. Nobody wants to look like her. You need to drink some coffee.
November 18, 2013 at 5:59 am | Report abuse |
Rielle Hunter is a pig. She knew John Edwards was married. She has no one to blame for the way people think of her other than herself. She needs to just go away and let his children heal.
Go Piers. You really shut her mouth a few times in your interview. What a stupid shallow woman.
stupid and shallow...I couldn't have said it better myself
Rene Burke
Can't believe Piers has stooped to this level. She is obviously promoting a book that is so unfounded in its truths that she can't even talk about them intelligently in an interview. She deserves everything she gets and I will pray for her daughter -the innocent victim in all of this mud!!!!
She is a pig, yes, and no one will buy her book. Don't worry
AKaplan
Probably one of the most honest answers to questions i have ever heard in a Piers Morgan interview. He just could not accept her answers. They did not give him enough "headlines".
Barlow schuyler
My question is this. Is Morgan dense or is he purposely misunderstanding Ms Hunter in this interview?
Piers is a most self serving nada. All of the cackling hens in here are undoubtedly the most superficial and useless creatures, anyway, for even watching his show.
chrish61
I support Rielle and will pay money for her book. I think she is composed and very reasonable. John Edwards should have honored his marriage vows. Rielle just fell in love with a very hot and powerful man. How can you blame her? She is cute and single and can have her pick of any man...including Pierce Morgan I'm guessing? I think she is perfectly appropriate and give her my support and respect. God bless Elizabeth Edwards – John Edwards has had the privelege of relationships with good women.
straighten1
to all of you who think rielle hunter is honest, what world are you living in? She's a narcisist of the highest order who leaves damage everywhere she goes. She has the mentality of a 13 year old girl who thinks she's in love. This woman can't tell the truth because she has no idea what the truth is. And to those of you who buy the book, ugh. You have the lowest standards. You bought into this sickening woman's silliness. I'm so glad Piers was firm with her, he wasn't rude. Someone has to call her on her lies and illusions. What most people are saying about her is the truth. She's a tramp
I agree, Piers did an amazing job with the interview.....I just wanted to cringe everytime she spoke........she is full of LIES!!!!!!!!
June 27, 2012 at 10:12 pm | Report abuse |
marie nicholson
Are you kidding?????????
Hi Rielle
Chrish61....You are hellerious....I don't know if you are a man or a woman, but obviously you are demented too.
Kate Hanni
Seriously? This woman is totally devoid of a soul. She claims to be perfectly honest, when in fact she can't acknowledge her part in this whole sordid affair. I don't believe for one minute that she did not entrap him by getting pregnant. I wonder if she talks about birth control in the book. It's a sad state of affairs that this is even news.
Rielle Hunter ruined this mans career. She clearly wanted to have him, his money and his support and did NOT care about his presidential ambitions.
And for her to defame a dead woman who's heart was shattered is just hideous. Unbelievable.
IWASTWENTYEARSOLDWHENIMADEMYMISTAKE THISWOMANISANOLDUGLYHORSEYLOOKINGBAGOLDENOUGHTOKNOWBETTERWHATISRIGHTANDWRONG
PIERS MORGAN IS MORALLY BANKRUPT ! WITH NO ETHICS ! NO VALUES ! AND "OPRAH " AND ABC-TV LOST =
"LOST MORALS ABC-TV AND "OPRAH WINFREY"-LOST HER MORAL VALUES TOO-SHE-ALSO-WORSHIPS-MONEY-LIKE "RIELLE HUNTER"–SHOULD ALSO "RIELLE-GET-"CANCER"-TOO AND HAVE "RIELLES HEART BROKEN-ON-TELEVISION LIKE THE "BEAUTIFUL-ELIZABETH EDWARDS–SHE DID NOT DESERVE BAD LUCK !-NOR DID-"ELIZABETH EDWARDS WAS SUCH A "BRAVE WOMAN-WITH "CLASS AND "DIGNATY"-SOMETHING-RIELLE-NOT-KNOW !
June 28, 2012 at 12:32 am | Report abuse |
Chris......You are so off base...need I say more/
Fine to have a statement about tonight show ,but don't loose your mind into a woman who broke a family,make money selling a book ,looks so low minded on TV ,
If you find a man you love you first respect him then make sure he is available.
She might sadly find her life going that way ....
" CHRISH 61 "–REALITY BREAK THIS "RIELLE HUNTER IS " 43 YEARS OLD-SHE PLOTTED SAYING : 'JOHN EDWARDS IS HOT TO HIM "-QUOTE : "YOU'RE HOT " ! -SHE IS SO " IMMATURE NOT USING:" BIRTH CONTROL"-IN THE " TWENTY FIRST 21ST CENTURY THERE IS NO "NO EXUSE FOR GETTING AN " UNWANTED PREGNANCY "-WITH " ALL OF THE 100 % EFFECTIVE " CONTRACEPTIVES AVAILABE FOR CHEAP COST AND FOR FREE OF COST !–THE COST OF " FREE BIRTH CONTROL FOR THE "ILLEGAL ALIENS " -IS "SUBSIDIZED-OR-PAID FOR ENTIRELY BY THE "U.S.A.-TAXPAYER AND THAT MEANS YOU-CHRISH 61 ! " RIELLE HUNTER-SHE AT FORTY THREE YEARS OLD SHE PROBABLY USED : SHE USED " FERTILITY TREATMENTS TO GET " PREGNANT BY MARRIED JOHN EDWARDS A U.S.A.-BY-MISTAKE-HE-FOOLED-US-PRESIDENTIAL2008-CANDIDATE FOR PRESIDENT OF THE UNITED STATES OF AMERICA-I FIGURED HIS "LIES AND DECEPTION TO THE AMERICAN PEOPLE EARLY ON THE THE 2008 PRESIDENT OF THE U.S.A.-RACE AND I VOTED FOR "OBAMA " ! " RIELLE HUNTER AND JOHN EDWARDS SHOULD BOTH GET : " CANCER AND HAVE(LIKE THE BEAUTIFUL-INTELLIGENT-WITH A REAL-JOB-NOT-VIDEO-BLAIR WITCH PROJECT-RIELLE HUNTER " -ELIZABETH EDWARDS WAS DYING OF BREAST AND REPRODUCTIVE-BLADDER-AND BONE CANCER–SO THE "SELFISH-GREEDY–EVIL–BIG MOUTHED-BASHERS OF MRS. EDWARDS–SHOULD GET "CANCER"-AND-HAVE-THEIR-HEART-BROKEN-AND-EMBARRASSED-AND-BETRAYED-ON-TELEVISION–RIELLE HUNTER AND JOHN EDWARDS-SHOULD:" BURN IN HELL FOR ALL ETERNITY–AND–ELIZABETH EDWARDS-DESERVES TO BE IN :" PARADISE-HEAVEN-WITH-HER-CHILDREN-IN-PARTICULAR-THE-EDWARDS-LATE-SON-HIT-BY-A-CAR-DEAD !-THEY ONLY-DESERVE-PARADISE-AND-HEAVEN-FOR-ALL-ETERNITY–JOHN AND RIELLE-DESERVE-SUFFERIING FOR ALL ETERNITY-HELL FOR THEM FOR ALL OF ETERNITY !–BUY-CHRISH61-ELIZABETH EDWARDS BOOK AND DONATE-TO PREVENT AND CURE WOMENS CANCERS LIKE BREAST CANCER-YOU-MAY -NEED THE DONATIONS YOURSELF SOMEDAY-CHRISH61 !
There but for the grace of God goes any of us. Do not judge others. It hurts you more than it hurts them.
~Chrish
June 28, 2012 at 9:37 am | Report abuse |
I can't fathom that you honestly believe that. She's a pig.
Lipglossgirl
get real! She is a bleached blonde floozy and maybe u are too. She made a total fool of herself. If she "had her pick of any man" then perhaps she should focus on single men. She is desperate that's why. Sane men would run , not walk, from this crazy narcissist.
Rielle thinks she is an "I Am In Love teenager" and someone needs to pull her aside and tell her know she is "OLD" lady and is embarrassing her kid when it get's older.
August 3, 2013 at 9:59 am | Report abuse | Reply
Sherry T.
I never liked you as much as I do right now, tonight! Good interview. Good job! You asked all the questions that should have been asked of this woman, a long time ago.
While totally out of character FOR YOU, it was your best work ever!
A Devoted Fan
what did John ever see in her? she is so shallow....seemingly unintelligent....I laughed through the interview...Have to give Piers a pat on the back for continuing on with such a moron. And the statement on "I dont believe in infidelity".....i almost fell off my chair laughing so hard. She really needs to get off the pipe.......
This could quite possibly be the worst interview I have ever seen. Not that Piers didn't try. She seemed like she didn't want to be there. What did she want out of this? Bad television.
judipersian
I cannot believe how nasty and rude Piers Morgan is;
he is a sad replacement for Larry King
CNN's programming is becoming more sensational and less
informative. In the interview with Rielle Hunter Piers has
lowered him to the lowest level ever. CAN HIM CNN and maybe
I'll start watching CNN again.
What do you mean, "will start watching CNN again"? You are obviously watching it right now.
He had good reason to be nasty, look at what he was interviewing..........
Are you kidding me??? The Talk asked the same questions and she delightfully answered every one of them, yet when Piers asked her the same question she was all (cough) insulted. Come on !!!!
Waaaa waaaa waaaa, said the cackling hens, each as useless as the other.
Please give us a break Ms. Hunter. Why did you write the book, you should have kept your business to yourself. We don't care about you, John Edwards or the items that came between you. You aired your laundry & now that Piers wants to know, you don't want to talk about it? You should have kept quiet & stayed to yourself. Die your hair & go live in peace.
I hope no one buys the book. Why should this woman benefit from her selfishness?
Does Rielle Hunter have no shame? I am disgusted with her continued poor behavior, profiting from what she has done. I am saddened at the thought of Elizabeth Edwards having to deal with the horrible affair during her final days. Both John Edward and Rielle Hunter are simply not good people. Rielle proves how much she does not care about the hurt and damage she has caused, instead of taking responsibility she has decided to write a book. My fellow ladies out there, don't be another woman's worst enemy! Have some self respect. If Rielle was truly sorry she would seek forgiveness and stay out of the media.
She is stupid and a tramp. He is an idiot and a self-destructive tramp. The big loser in all this: their child. I feel for her. They need to start saving for her future therapy bills.
Nigel Tuffnel
You're just a stupid cow. You're probably ugly, as well.
Rielle Hunter absolutely shocked me with her interview tonight. Not only did she not take responsibility for her actions, but she has clearly shown how much of a "home wrecker" she is by her selfish actions and words. Her book is the biggest slap in the face towards Elizabeth Edwards, especially when all Ms. Hunter had to say was that Elizabeth's words about their affair, "made her sad". If Rielle Hunter were truly remorseful she would have not written a book that disgraces the Edwards children and their mother.
Thank you Piers for getting through that interview, you asked great touch questions, she is a HOME WRECKER and John Edwards is a loser! Good thing his political career is long over! Liar, Liar, Liars!
J. Johns
Great intv Piers.......you did everything to your guest Rielle Hunter except slather her in BBQ sauce......guest what, as a journalist it is not your job to be an aggressor.....you could have gotten so much more depth out of her for your viewers if you would have done your job and provided neutral space for the intv to develop.......this is why the ratings suck.
thank you Piers for confronting this disgustingly stupid woman. Someone has to be firm with her and I think you did a great job. She needs someone to call her on all her crap even though she either can't or doesn't want to see it. Poor poor Rielle Hunter my foot. She did what she did without thought to anyone else including her daughter and she's still doing it.
I am shocked at how hostile the questioning is . I am no fan of this woman, her actions or book. I have watched Pierce interview many controversial figures and his approach in this interviewis angry and way out of balance. Rielle has answered some very difficult questions underscored by an interviewers apparent anger. I would have preferred to hear him that hostile toward Zimmermans brother when he interviewed him. Edwards and Rielle created the mess and John Edward made bad choices.
Shame on Pierce. Not your best work mate.
At least he is honest and straight forward.
she reacted without conviction and surprised that after the mess she has done and writing a book ,she can still go thru her life without getting hurt?
Sadly I believe she is just starting to feel her behavior.
"J. JOHNS "–REALITY BREAK-" RIELLE HUNTER "-HAS NO " NO DEPTH " TO HER AND "NO DEPTH TO JOHN EDWARDS " EITHER !–MAY THEY " HUNTER " AND " JOHN EDWARDS " –GET "CANCER " TOO-LIKE POOR "ELIZABETH EDWARDS"-WHO SHE DID NOT "NOT DESERVE CANCER OR HER HEART BROKEN ON TELEVISION !-AND " ELIZABETH EDWARDS WHILE SHE WAS "DYING FROM BREAST AND BONE CANCER MRS.EDWARDS WAS "BASHED BY THE MEDIA OPRAH WINFREY-WHO ALSO HELPED MAKE MILLIONS OF DOLLARS FOR "SARAH PALIN"-ANOTHER-"DEPTHLESS-SARAH PALIN-TOO-MEDIA-MAKES-STARS-OUT-OF-MORONS-AND-MILLIONS-OF-DOLLARS-FOR-"EVIL-GREEDY-SELFISH-DEPRAVED-CRUEL-TO-ANIMALS-MORONS-LIKE-"SARAH PALIN"-SHE ALSO DID NOT DESERVE TO MAKE MILLIONS OF DOLLARS FROM HER -"REHASHED STORYBOOK ABOUT HER DULL STUPID SELF-MS.PALINS "-SARAH AND BRISTOL TOO !-"YOU BETCHA"-I DON'T MISS HEARING THAT SAYING-"YOU BETCHA"-BUT UNFORTUNATELY-ALL-I-HAVE-TO-DO-TO-HEAR-THIS-"YOU BETCHA-ARTIFACE-IS TO JUST TUNE INTO THE :"BUSH-CHENEY-BROADCASTING COMPANY-FOX-TV-PIERS MORGAN–RUPERT MURDOCK-" PHONE HACKING-MURDER SCANDAL–MORALLY-BANKRUPT-PIERS MORGAN IS "MORALLY BANKRUPT"-"PIERS MORGAN IS A "BAD ROLE-MODEL-PARENT-FOR-HIS CHILDREN-HE "ENCOURAGES HIS CHILDREN TO BASH THE "U.S.A.HIS CHILDREN SAY : " THATS DO "CHINESE DAD " !
Go see a doctor.
Um, are you ok? I think you need professional help.
October 29, 2012 at 10:50 pm | Report abuse |
debra lake
That was a terrible interview. What gives Piers Morgan the right to attack someone to give him a "good" interview. It felt very contentious and quite honestly she was in control....he certainly was not. There is a way to make your guest feel comfortable enough to share information...he just tried to back her into a corner and she was not going to give him anything. Obviously he knows nothing about strong women.... I think he was showing that he was angry???!!! What a joke. This was not his tragedy, it was theirs.
Christy O'Briain
Agree tottally with you!,, Could bot agreemore HEwas angry and she keot her cool
It was thier tragedy nit piers mirgan to get emotional !!!I teh women in THe View were better than him!!!
Thank you Debra.
How, in any way is Rielle Hunter strong? It doesn't take much strength to lie on your back and cheat on your husband. It does however, take a lot more to apologize which she hasn't done full heartedly. Do me, and the rest of society a favor and stop feeling bad for those who don't deserve it. Piers is the strong one for not putting up with Rielle's BS.
GO PIERS!!!
the toppic of tonight was :is it fine to destroy a family .
do what ever I want because of blind love and having a child because of mistakes
and then writing a book to tell that kind of story....
Sad sad sad....
It was John Edwards who destroyed his family, dummy.
Pierce wanted to just slap her I could see, she sickened him obviously. The woman is cold, a fake and not fit to be a mother! She is using the child to justify evil.
I felt so bad for Pierce sitting infront of someone as cold as that! It was a diffecult interview Pierce, but you did well, you kept your cool...!
Those magical hair poerws come in handy for politicians! I should know, I live in the land of Gov. Perry, that man's got some fancy hair and the jawbone of an ass for good measure.
Wow....Piers must have thought that was the worst interview ever....couldn't watch it all. Something is off with that woman. She is really quite pathetic.
I was going to buy Rielle's book, but after her interview with you Piers, I will never purchase her book. She is ridiculous! Thanks for asking her the "hard" questions about her behavior and recklessness. The fact she accepts no responsibilitiy??? She is a sensationalist. Also, pretty amazing how politicians can fool the public...even Presidential hopefuls like John Edwards. Peace to Elizabeth Edwards and her children.
I thought Piers did a good job tonight. He didn't accept Rielle's half answers and delved deeper. I will not support Ms. Hunter by buying her book. I never watched Larry King, but find myself tuning in more and more to watch Piers Morgan.
Guru Eduardo
Piers what a cowardly display this interview was!
I can't imagine you would be as tough on a man in the same situation. I'm remembering all of your puff ball interviews with Donald Trump. Would you have ever dreamed of asking him similar questions? You know like...considering your past relations do you think you are suitable material to be President. Or how about....did you ever fool around on any of your past wives? Or did you always wear protection? And then letting him get away with all that nonsense about Obama being an illegal.
Oh yes you can be tough on smaller people but lack the honesty to question the powerful in the same manner. It's easy to sensitive with the powerful and easier still to attack the less powerful.
For the record I'd be fine with your tough interview if you were also tough on those you think powerful. As it is you just came off as a bully.
Great disappointment and unfair.
Rielle Hunter is painful to watch and a complete moron. And Piers, you missed your biggest opportunity – she said she doesn't believe in infidelity (re: her husband). She goes on to say that John's responsible for the affair; that she didn't go to his hotel room with any intention and yet hadn't she earlier said to him, "You're hot!"? And Piers, why didn't you look up fertility statistics at her age? The probablility of natural conception at 43 is less than 2%. I would hypothesize that she was trying hard to have his baby. I feel for her daughter – starting life with this gene pool is frightening.
Watched (tried) her on the View, ended up shouting at the TV! Again she got the same response on tonight's interview, with the exception of what did come clear, and that is that the only reason she did her book and wanted to put the "truth"out there is on how HER daughter would have to deal with it in years to come. How sad that she did not consider Elisabeth's children! Disgusting couple!
Piers should have asked if she has ever been "properly in love"
Brilliant interviewing. Rielle was a terrified deer looking into the headlights. She brought this on herself and is turning a quick profit out of the misery she caused. At least her consistently dishonest evasive responses confirmed the type of person she is. She is a walking role model of what not to do with your life. Very sad she caused pain to so many.
Hope her story serves as a lesson in how your actions don't just affect your own life but the lives of loved ones and so many others. No matter how sorry she is the consequences for her choices will affect the Edwards children and their love child. Very sad. She and John are very selfish, self centered people. It seemed Piers had a hard time warming up to a very cold woman.
What's truly amazing about this woman is that she keeps saying that she wrote this book so that the 'truth' could be told for her child and for the children of John and Elizabeth..... who is she fooling? Does she really believe for a moment that John and Elizabeth's children would believe that she is telling them the 'truth'? What a nut this woman is! All she's after is money and, sadly, she'll probably get lots of it from this sad tale.
Julie L.
This was the most painful interview I have ever watched – I could have turned it off but I kept hoping something she said would a) be normal or b) she would walk off and do us all a favor. I can't imagine being Piers and trying to conduct an interview with someone so obviously unhappy about being interviewed – about what she had just written!!
Bishal
I understand why the media would find it a major story if Edwards were the fhater, but I don't really understand why you would.He's not running for anything, he hasn't been electing to anything, he represents no one, and he has no responsibilities to the American people. Beyond the tabloid sensationalism of it, why should we be talking about this?
September 9, 2012 at 11:27 pm | Report abuse | Reply
Beverly Koebrich
Piers gave a wonderful interview tonight, asking the right questions, but Rielle acted like a stupid kid, she couldn't answer anything he asked. She couldn't even say she was sorry, he had to keep asking. No wonder she is so despised by America, she's self centered and mean spirited. She calls it LOVE, but it's a meal ticket for her and in the end, my guess is John Edwards will end up with her. She has no sorrow for the misery she caused Elizabeth. It's all about Rielle. Because she is so evil, it makes her look ugly. She should stay off TV.
Hunter appears a very stupid person. She is also a sociopath in that she doesn't see her part in the scandal that ruined multiple relationships. We saw this in 2 seconds of the interview. I hope Elizabeth is thinking of her great life and great jobs as atty. and mom, and speaking out for the poor in society, as well she has to think that the reliable Barack Obama was a great choice.
Lynda Norwell
I am a 70 year lady....and have been watching all the hype about Rielle Hunter. My only comment, is that, surely Piers Morgan, and The Talk, must have other more worthy news to talk about. This is essentially an old story, lived by many, and the fact that it deals with a presidential candidate, who, by the way, didn't make it.....is simply just another means of grabbing headline in the 9 o'clock slot for television viewing. Man, I wish that the USA would stop this nonsense and solve the problems of more global nature......I feel sorry for the young lady, she made mistakes, haven't you, Piers?, and yet none of the past mistakes of any of you, all members of the press, or anyone......never makes the front page....please, get on with the real problems of the day.....and stop judging others. Its not really very intelligent....?
Well said Lynda.
Because Lynda, This article is about Rielle Hunter and her selfishness, not mistakes. We are free to give an opinion. If you want politics, then go look for politics somewhere else on-line.
P.S. I forgot to mention the bittersweet clip of Elizabeth Edwards during her interview with Larry King. She was real, intelligent, and extremely likeable. John Edwards certainly slipped in his taste during his mid-life crisis.
Your interview with Rielle was so off, the fault was the person with the penis and his first name is John your stock just went way down in my eyes. That like blaming Monica and the other 20 woman for Bill Clinton 8 years !!
Elizzabeth B
Why has no one who has interviewed this woman " Rielle Hunter" might that be Real Hunter ..truth hunter?? asked her why she changed her "real" name Lisa Jo Druck to what she has now. Is it because her father James Druck killed her horse Henry the Hawk for insurance money and she found her dead horse....is that why she has no respect for men or what they say at all , is that why she destroyed John Edward??? although he is just as guilty as anyone.more so ..he was the one married. I think she is menatally ill and should not have a child. ...but no one asks her about her past.
I Don't know how anyone can watch an interview, pick sides and start calling people names, tramp, home wreaker, bad parent and all the rest of the crap not knowing the real person. I think Mr. Edwards should be held to the higher standard. He was married!!! She was single!!! Does not make it right, but all people make mistakes. Pierce was trying to make headlines with gossip and junk reporting and Miss Hunter tried to keep him in check seeing she was there to talk about her book not to be dragged through the mud!!!. Please people get a grip and stop believing in all the hype you hear on radio and tv. Remember unless you think you are GOD like YOU cannot sit in judgment of anything or anyone.
John Edwards and Rielle Hunter: two losers who are quickly fading into the sunset–but not quickly enough for me. Enough already with these two. She horrifies me and he disgusts me. Piers did a great job of putting her feet to the fire tonight. It's time someone did. Good job.
Awful interview. Piers Morgan is supposed to interview, not judge. Probably his worst interview ever.
Could not agree with you more. Pierce was just angry and no better than tabloid journalism.
Thumbs up to Patricia & Kate for seeing the whole truth rather than the basic mindlessness of tabloidism.
Name*Donna Pappalardo
Thought Piers did a good interview, didn't back down from Rielle, a self
-centerfed woman with an obvious personality disorder with borderline & narcissistic features. She found the right man to feed into her pathology. Of course, he has a similar pathology. How could we have thought he was someone who could lead this country? Thankfully his children with Elizabeth had her influence. God help little Quinn. No need to buy her book–why should she profit from her transgressions. Never written a comment before. So annoyed by Rielle & John, and sad I ever had hopes for him.
Melisa Haggai
Piers...I love you...but PLEASE !!! BAN Rielle Hunter from your show in the future!! She was the worst guest EVER!!!!
She wrote a book that she doesn't even want to talk about!!!
Maybe she's medicated but she appeared to be very "deadpanned".
Her responses to your questions appeared to be in sincere.
I hope no one cares enough to buy her book.
The mess she has created for her child will come to haunt her in the years to come-didn't use birth control???? What the heck....didn't use it because "they were in love"!!??? C'mon!!
this woman is totally in love ......with herself!
At least she does, cause you certainly aren't going to and apparently neither is anyone else on here.
But a truly confident person is capable of loving themselves without the codependent worry of receiving from outside of themselves.
Sorry, Piers, it was a horrible interview. I watch you all the time, and you did your best to ask questions to hold her accountable. Let's face it, she's not ready for prime time. She can barely put enough words together to make a sentence. I saw her on The View and her responses were similar-a few words here and there but nothing coherent. Can't speak in sentences. Too bad the book publisher sent her out on this book tour-given her age, she's immature and isn't ready for prime time. Wouldn't waste the money or time on this book. We all know what happened! It's a common story.
Piers is quite ridiculous with every utter from that arrogantly rude mouth on him. He does have a great gig with CNN to be able to interview compelling personalities. This job should have gone to that Ryan Seacrest, much more likable character.
Me again....I can't believe she was so unprepared. Lots of fun having someone write a book for you, being sent out on a book tour with bigTV exposure, but not prepared to answer the questions.
Exactly, a woman with a personality disorder/narcissistic/borderline...definitely,selfish, self-centered, celebrity hungry, who the hell is she and why does she matter? So sad....I am angered at this type of woman...she sets women back 50 years. AND John...he is the real one who should be ashamed...both need to get lot's of therapy, and stay far away from the public...PLEASE?
I would not waste my money on this book. A better use of my hard earned money would be a donation to a non profit organization on breast cancer.
Nobody knows what problems or difficulties that may have existed in Edward's marriage, the pressure of her illness, or the pressure of his candidacy. Marriage under those pressures has got to be really difficult and I think if Edward's children have been able to stand by him, the rest of us should get off of our high horse and give Edwards a little rhythm for being human. It doesn't surprise me that most of the negative comments about Ms. Hunter come from females because she is probably fairly threatening because she's pretty and in great shape!
P.S. Sorry about the run-on sentences above. I was talking on the phone while I was typing...
trish4real
If you think she is pretty, then i would hate to see what you look like, I can only imagine...
Oh Brother
Trish4Real, you are only validating what Dan said by taking his statements personally. So what if he thinks that she is pretty? Does that make you ugly or something? He didn't say that women who were ugly didn't like her looks because she is pretty, he said that they felt jealous because she is pretty. I have see women, all of whom are attractive, behaving in the most vindictive ways towards other women that are also attractive. Women do that. Don't know what their reasons are for it; but it happens. Whatever the reasons are, they do nothing but cause contention outside of the woman or women from which the jealousy emanates and the taget of that jealousy. How does that make any sense or help any of the women feel attractive to the point that they could even recognize it if they were told they are attractive? I don't even like Piers and this woman is unimportant to me. What does bother me is that, as Dan said, when there is news coverage about a physically attractive woman, women commentors turn very evil. It doesn't matter if the news is positive or negative, the comments from a lot of the women are very very negative. How they dre, hair, make-up, body, you name it. It all becomes subject matter for heinous attacks. Don't get me started on the psych evaluations going around. Piers' interview with Janet Jackson got sort of disrespectful if you ask me. He tends to go into things that are just rude to dig at and he does dig and pry. John cheated with this girl, and she has a book and shows no remorse. I don't care how nice Edward's wife seemed on interviews. I really don't. None of that makes her a nice person, and like it or not, even with having cheated, what is John's wife's excuse for whatever lead to her husband's cheating because there are reasons for cheating to happen that come from both sides. I don't feel sympathetic to any party here; but this desire to jump in and choose sides is bothersome, and I see it revolving around exactly the topic that Dan talks about. Was he right to generalize like that? No; but...it does beg the question, why this kind of response from ladies? If it's trash on the tv that you are talking about, especially someone else's trash, why get worked up about it? She's not after your man. You are obviously not unnattractive and threatened by that thing with the blonde hair. So what's the problem?
September 1, 2012 at 7:10 am | Report abuse |
I agree with Dan. She's pretty hot for being 47!
I agree with Dan & Mike! Rielle is pretty! Seems like not only are other women intimidated, but that Piers is as well.
How dare her stand up for herself not only taking ownership of being human & making mistakes, but being so composed while responding to his cattle prodding of sensationalistic tactics. She being so unique as to not fall prey to his manipulative reactionary pursuit. How dare her!
He needs to work on himself, desperately! And plastic surgery won't be enough. All you Christians, please pray for him.
Is CNN trying to compete with the O'Reilly Factor! Why did they start trying to model after FOX news with this Piers choice. Please cancel his arrogant rudeness NOW! He doesn't deserve this spotlight.
Recent nose job on the front of her knobby nose. Obvious
Yeah, a hot mess...
I know a Mike S. He's a fat disgusting liar, lies to authorites, makes excuses, is a bigot, has a balogna resume from fantasy land, and recently got moved to a whole new job with less on his plate we'll just say because of a lot of what I just mentioned, where he proceeds to continue with examples of mess ups that harm others and has gotten coverage doing it. I hope you're not that guy, or you just made me completely understand a point that Trisha4Real made earlier remarking on taste when it comes to very nasty looking and behaving men and how they see certain women.
September 1, 2012 at 7:17 am | Report abuse | Reply
Kristy B
Thank you for asking the tough questions. I have hated the sanitized butt kissing of ABC. I agree with Patty that Rielle could barely put two words together. Who doesn't use birth control in this day and age unless you want to get pregnant!
Arcticgrey
When Pier's Morgan asked questions that forced her to make an emotional response, she could not answer the question. She could only repeat the question back to him. This makes me wonder if she could possibly be psychopathic. Showing no remorse. The whole interview she was unemotional and insincere. She contradicted herself in the same sentence sometimes.
Peirs, you are my hero for the way you grilled Hunter tonight. I am a big fan of your show and you always do it right. I really liked the way you brought her back to reality. Awesome!
I have liked Piers until now. He has showed that he has no forgiveness gene. He obviously isn't human because he understands nothing about making mistakes. Also, I believe he is being so hard on her because she is composed, confident, apologetic, graceful in her answers and looks him in the eyes. He clearly seems threatened. He should have backed down a long time ago. Makes him look desperate for ratings.
Word to the wise Piers, the amount of forgiveness you give others will be the amount you receive as well. Even you might need it some day too. Just sayin.
at Katie.... it's not like he doesn't understand forgiveness. It's the fact that Hunter refused to admit that she partly destroyed Edwards Marriage. She knew he was married and could have said no, but she said yes. She should admit for wrecking that marriage.
Cal,
You seem to be missing the forgiveness gene as well. Thank God we don't all get what we deserved, because WE do ALL make mistakes. If you are without sin go ahead and cast the stone.
katie. I do make mistakes just like everyone else, but I have the moral courage to admit them. The only way to seek forgiveness is the admit your wrong doings. She sat there and kept denying that she wrecked that marriage. She is 50% of the reason that marriage failed since it takes two to tango. All she had to do was woman up and say "I was part of the reason John divorced his wife and I'm ashamed of what I did" and people would have accepted that much better than pitiful excuses
Katie, so I'm guessing you have been on the "other woman"side some time in your life OR you are the cheater.
Bottom LINE is JOHN is responsible for ruining his marriage...HUNTER dove in without conscience or empathy for those who would be affected by her self serving and self gratifying behavior. SELF GRATIFYING is the MAIN ISSUE....
Did no one notice every time Piers asked a direct question she shifted her eyes and paused when she didn't want to answer...always tough questions any NORMAL woman would be able to answer immediately?
I have NEVER seen a person avoid, refuse to answer, shift in their skin at the thought of answering in my life.
She KNEW he was married...
She THOUGHT he would choose her over his wife....okay he did....
TOO bad....in the end he apparently choose his children over her.
Real justice would be the foolish contributors to his party sue her for their contributions. Oh wait...Johns covering her ass.
You go Piers....LOVED THE INTERVIEW...keep them on their tows!
Well said.....WELL SAID!!
Katie, thanks for having an insightful truly spiritual connected perspective. The world deserves more people like you in the world -you as an example that teaches & guides people out of judgmental places and into a deeper consciousness of true humanity in all it's frailties.
Your interview of Ms. Hunter tonight came across more like an interrogation than an interview. It was quite clear that you were judging her and dislike her. I'm really disappointed in how you conducted this interview. She's your guest! I look forward to when you interrogate John Edwards!
Terri Crane
GREAT INTERVIEW PIERS. THIS WOMAN IS A REAL DUMB BLOND. (In more ways than one) She came across as a real loser and I'm so glad your made her look like a fool. Well really she made herself look like a fool.
I think these two people really do belong together and let Edwards oldest daughter take care of the children. Kate Edwards seems to be the ONLY responsible adult in this whole sad story. I really feel for all the children.
Terri...I totally agree with you. It's funny how so many women in here show support for hunter. I bet if she had wrecked their marriage, then they would have a change of heart. Hunter is an evil woman who slept with a married man and refused to admit her fault in the divorce. What a loser, she deserves everything she gets
Name*Debra M
Rielle just needed to fade into the wood work . Her and John Edwards are a disgrace. And he'll will freeze over before I would even look at the cover of the book in passing.
Edwards needed her to shut up during the trial and stall for time on her book, so he acted like he still wanted her but continued hiding her. Didn't THAT clue her in? She was played all this time and still doesnt get it . Once the twin threats of jail and bad press from the book was over, he could throw her aside , and did . For as much as a pro as she thinks she is, he still has her beat in the sleaze department, but she's catching up fast.
All news sucks thanks for ESPN
Excellant interview Piers.
Another mistress trying to reap the rewards by publishing a book.
Life goes on...
Gregory Ragle
I agree with Victoria, and in addition feel that this was a totally disgusting interview and the worst I've ever seen Mr. Morgan conduct. His opinionated approach can be okay; but in this case he came across as extremely complacent and naive, as well as hypocritical. Under a barrage of smug, arrogant aggression against her from Morgan, Ms. Hunter conducted herself with remarkable poise and dignity – unlike Morgan himself. He was truly an insult to Mrs. Edwards' memory. Perhaps Mr. Morgan is perfect, with his job espousing family value$ to the American public from which he makes his fortune. Ms. Hunter admitted she is not perfect, but that was not enough for him in his salacious, tabloid zeal. I wish the excellent Ted Turner was still head of CNN – and that he'd get rid of such pious trash as Piers Morgan proved himself to be this evening.
familesgoingplaces
poise and dignity? where we watching the same program?
Rielle Hunter got what she deserved. No more. No less. SHE made the choice to come on Piers show. SHE is the one trying to line her pockets with a tell all book that NOBODY cares about. SHE is the one who chose to sleep with a married man who had a terminally ill wife....and get knocked up by him no less. I have NO sympathy for this woman. She should be excoriated. The nerve of her to trash a fine woman like Elizabeth Edwards...she's not fit to carry Mrs. Edwards slop. This tramp has milked her 15 minutes. Go away now please.
I would like to know what the definition of 'home wrecker' is. If it's not a person who has an illicit affair with a well known figure then has his baby right before his wife dies of cancer then excuse me I must not know what a hoe wrecker is.
Arrogant, Aggressively rude-What was CNN thinking- hiring this Murdoch Twit!
Does he even know how utterly obvious he is with every word he spits out of that mouth of his-a pathetic lost soul not even understanding how his sensationalistic approach is not just a detriment to his viewers & CNN, but to Himself! Get a clue- because your an embarrassment to yourself. Get a divorce from your codependent obsession with drama & move to a better place, after all your the only person that can give yourself that gift. But therapy dude-seek it, you might actually then get the respect that you so arrogantly think you deserve.
Anderson Cooper at least cares about the story & most importantly the human beings that are the story. Human compassion & empathy is part of the human being that Anderson is. Piers, you need training. Learn from Anderson & calm down from your ego driven self centered facade. You appear as having a bleak consciousness. Choosing an adversarial role will be a detriment to you, ultimately. Rielle Hunter is above you, in a better place than you, obviously. That's why she smiled even while you were cattle prodding her with the sensationalistic approach of questions.
She has depth of character even in your black & white world of extremism.
Excellent insight Shawn.
It is always the most self-anointedly "Christian" such as the divine Mr. Morgan, who lack humility and compassion most of all. The evil agnostic, who has no right to believe or disbelieve in the man-created "God", also has no right to such instant condemnations – and lack of even the most basic fellow-feeling. But the religious person KNOWS – and therefore condemns. They needn't indulge in the messy shades of grey compassion entails, since their God will always forgive them for any judgments of others. They are protected from anything by their sanctimonious "faith".
A redeeming interview for Piers ! Keep up with that! If it's true that John & Reille have split up ... it's too bad
Since they deserve each other !
Felt ill to my stomach after watching this interview of this heartless creature, I hope no one buys her stupid book. Feel bad for her child and Johns innocent children as this woman is putting down their dead mother.
mattc
peirs, i have enjoyed your interviews up until now.
i cannot, for a second forgive rielle – she has poor judgement and took advantage of a bad situation.
BUT in this interview...you have disappointed me with your unecessary sensationlist approach.
find the truth – but dont be an a**hole.
STUPID INTERVIEW..WAS SHE EXPECTING A BABY AT 44 YRS OLD ?
An Inflated Self-Image – This woman has a highly inflated self-image because she is pretty. By the way, I think she has had a nose job on the front of her nose since GQ photographs revealed her knobby nose.
Great interview! Ms. Hunter was very smug on the ABC interview, you pushed her Peirs!
She is a "destroyer", it looks like her plan didn't work after all. Karma!
Rielle is looking great though. Quite similar to Heather Locklear and very professional hair and makeup.
Heather Locklear, my ass....
To those who think you are superior to Ms. Hunter, you are no better than she. All of us have acted with poor judgement, hypocrisy, betrayal, insensitivity and deceit in some form.
Those comments spewing such hatred, cruelty and moral superiority, reflect poorly on the poster.
Ms. Hunter has not shown any of these ugly characteristics, to her credit. None of us are better than Ms. Hunter. We are all greatly flawed beings.
Advice for a golddigger snikeeg the mother lode. When you get in really close, Honey, sharpen your spade and sink in in good and hard, because he's a greedy selfish lawyer. Let him make you an honest woman, instead of a just a grubby aging golddigger. The twin vices of an attorney, greed and narcissism, are also his weakness. Tell him how his beauty overwhelms your senses and together with you, he can return to more WEALTH and ACCLAIM. Watch his eyes glisten.
September 7, 2012 at 5:23 pm | Report abuse | Reply
Don't know why my thanks for Jordan's excellent post never appeared, so I'll try again... I also agree with Shawn and others that it's clear Piers and gang are trying to hog the hate-filled "Christian" spotlight away from Fox. It's all about ratings and money. He's certainly lost me as a former viewer and let's hope his smug sanctimonies, so very obviously hypocritical to any person with a working brain, loses far more.
Perhaps Piers reads these posts as something to laugh at while "on his way to the bank", though I doubt he even cares that much.
She's had way too much Botox - her facial expressions were frozen just like her personality
Hi, Neat post. There's a problem together with your web site in web explorer, could test this? IE still is the marketplace leader and a large section of other people will omit your great writing because of this problem.
Sherry Carder
I think everyone here who commented shared some valuable insights. All in all, I think everyone involved in this situation was hurt, deeply hurt in one way or another. Mrs. Edwards was and still is a very classy and dignified woman who will out shine these other two idiots any day!
People often say someone was classy and dignified – after they're dead. Hunter handled herself well and Morgan behaved like the pompous pig-hypocrite he is. Good God, as though marriage is some great success!
B.Smith
Gee, she sounds like an idiot. She WROTE the book, but doesn't want to discuss it!! I appreciate the way Morgan is really 'digging' her on that! AND her response to not using birth control.."we're adults" What kind of a response is that!!! She sounded totally unprepared for this interview! Maybe she should have read her book! haha
Brad Swartz
I really like your style and most shows. This lady is just as bland as you can get. Here she is trying to sell a book that people are going to be thinking the really juicey details are in it. Well most points you bring up she don't want to discuss. Which you might want to mention to her that her sales will take a hit if she only wants to talk about taking walks or sweet phone calls with each other. They buy books to find out the good facts and how things really are. Well if she' not willing to tell them then the book must be a real bore. I would have like to try the book until seeing this. Now I want no part of it...This woman needs to open up and be totally honest with you.l With that being said I'm going to go now and listen to some Aerosmith and finish trimming my bathroom.. Keep up the good work my friend.
Mike Caswell
Morgan really screwed up this one. He tried to bludgeon her, but she stood up to him. Good work lady, you're the first one to put him right down. He really struggled on this one!
Lol..he didn't screw up anything. i don't even know politics..that 'lady' was answering like a guilty idiot. That was silly of her to go to interview and not answer any questions.. guilty & pathetic and eww such a creepy lady to watch think she is attractive..that was not cute:(
Did we watch the same show? Piers hardly struggled, she did. The questions he asked were fairly obvious but after she had gotten so many bad reviews over the whirlwind of interviews pushing her book, she was extremely defensive. She came across as pathetic.
ella y John Edwards me dan ganas de vomitar!! y me da asco la atencion que recibe de los medios!!
of course, SHE IS THE WITCH ON WHEELS
Bonnie smith
John Edwards has not a bit of shame for all he did to the emotions of his dying wife.she had to walk around and face everyone. Never knew a good looking guy that doesn't cheat. Is it really fun to be with a good looking guy and beating the woman off all the time. NOT FUN!!!!!!!!!!!!!!!!
Rocio Arellano
No one will ever know or understand what brings people to leave their family obligations. But Pierce Morgan was in my opinion shamefully playing a member of the inquisition when interviewing Ms. Hunter and placing blame on her as having been the instrument in the brake-up of the marriage of John Edward's marriage. His facial expression was that of a parent admonishing his child for wrong doing. I believe that was shameful. CNN needs to be careful about keeping persons like Mr. Morgan who may not be a neutral and emotionally and intellectually stable as the CNN team needs to be to stay ahead of the the rest.
Beautifully stated. Piers looked and acted like he had a personal stake in this . I felt more discomfort watching him than listening to Ms. Hunter. On a side note but equally disturbing, I have watched him interview "powerful" folks like Donald Trump and Piers would never approach The Don and others like him in the same way. Certainly, Donald has enough eye raising scandal in his life to warrant similar reaction from Piers as he considered a run for President?
Shameful interview Piers. It maybe time for piers to head back to the Murdoch clan.
BSmith
Gee, I thought he did a great job in trying to interview this idiot...who didn't want to talk about what was in her book...! Crazy. I would have been frustrated too. I'm sure Piers would love to have had John Edwards on the show. PS. Don't think you can compare interviewing Trump with Hunter.
Regardless of her Idiot or not status (I am no fan of rielle or John Edwards) From the moment he began the introduction of Hunter and through his line of questioning, his hostility was apparent. Real journalists who want the story do not go on the attack as the person you are interviewing will retreat. Even his facial expressions displayed disdain. Piers was admonishing and Parental acting like the judge and jury. He broke some fundamental laws of good journalism .... He became the story.
Great points, Rocio and Patricia. Even if Morgan was an original personality, an interview show that's more about the interviewer ultimately serves little purpose beyond the vulgar self-aggrandizing he displayed. You're also right to point out that he does not behave that way to those "above" him. They are people with far more deviously cut-and-thrust tactics in their pasts, than a mere extra-marital affair – and without them, he wouldn't have a job.
before, you can knock the National Enquirer and other tabloids all you want, but when it comes to patcliiol scandals, they're usually dead on. They broke Donna Rice/Gary Hart; Jennifer Flowers/Bill Clinton; and Dick Morris and his call girls, to name just a few.
September 10, 2012 at 12:16 am | Report abuse | Reply
grief counselor support group san diego
Really great site thank you so much for your time in publishing the posts for all of us to learn about.
Wholewitt
If there is one lesson to be learned from this affair, it is that no woman can be trusted to use birth control. Getting pregnant is no accident it is a plan to get money, it always is. We need good male BC.
Half-Witt, there are other less bitter and more substantial lessons to be learned here and BTW, John could have used a condom. Last I heard, it was a very effective BC method for men.
reallynow
I think a man like this cheats because the woman he loves is sick and they already lost a child and he can't take the pain and looming mortality. A cheap flash in the groin reminds him he's alive. Reille, you just happened to be attached to that cheap flash in the groin; it's not that big a compliment. You get a hangnail, and he's glued to someone else like stink on a monkey. I pity your daughter, and pray she has the strength not to take cues from you.
I think she is so hot! Old John had much fun with her.
Morgan wanted a piece of her.
October 12, 2012 at 10:49 pm | Report abuse | Reply
Thanks, Sx, for some REAL perception: wanted a piece – and knew she DIDN'T.
Steve Edwards
pig or not- shes hot- id do her
Bennycat
Has this bimbo accomplished anything in her life besides intruding on someone else's marriage, destroying a career, and ruining the last days of a very courageous woman? Why is the press paying attention to her? Isn't Sandy enough excitement?
No – and neither are you.
JOYCE WOODARD
I WOULD DIE HAPPY IF I KNEW SHE DID NOT SELL ONE BOOK,,,,,,NOT EVEN A PAPER-BACK,,,,,,,,,,,,,,,,,,
THATS MY STORY,,,,,,AND I AM STICKING TO IT,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
November 1, 2012 at 7:56 pm | Report abuse | Reply
HamiltonAZ
I thought I was watching Fox when Guiliani, McZombie and GinGrinch came up as successive guests of the struggling Morgan. Weinstein as the supposed balance?
I'll give him credit, though for suggesting Rudy would make a good Bond villan.
I hate to admit it, but they've done her up quite nicely. This is the first time I saw her and thought "Damn, she's kinda hot looking..."
Her kid is going to get made fun of for the rest of her life. .Rielle is a narcissistic sociopath, she won't even notice.
Rielle Hunter just exudes class, doesn't she? I like that she has post-humously forgiven Elizabeth Edwards for being angry that her husband was having an affair. Rielle personifies grace and understanding!
http://rubylee1776.wordpress.com/2012/09/02/riellehunter/
Brenda Mcknight
Relle hunter must have a hearing problem. She repeats every ques before she ans so anonoying I could scream class less lady.
August 3, 2014 at 11:59 pm | Report abuse | Reply
Are you stuck in a time warp somewhere? This show aired over a year ago, Piers Morgan was cancelled months ago, Rielle Hunter is no where to be found and finally ... Classless? I think John may already have been crowned king of Classless.
Old, old news . You may want to,adjust the rabbit ears.
August 4, 2014 at 12:43 am | Report abuse | Reply
손영우
등 돌.린** 아 내를 위.하^^여
아래 주소 를 주^소..창에 넣어^^주세^요
http://vp%61550.com
June 4, 2016 at 12:07 am | Report abuse | Reply
Thanks for this article. I will also like to mention that it can always be hard when you find yourself in school and starting out to initiate a long credit score. There are many scholars who are merely trying to pull through and have a lengthy or beneficial credit history can be a difficult thing to have.
wretye5ryabcd.com
Leave a Reply to familesgoingplaces
|
cc/2020-05/en_middle_0097.json.gz/line1399981
|
__label__wiki
| 0.539989
| 0.539989
|
We notice you have javascript switched off.
If you're just here to have a look around you shouldn't have any problems, but if you'd like to make a donation you'll need to switch javascript on.
We use cookies on this website. Click here to find out more about our use of cookies.
By continuing to use this website, you agree to our use of cookies.
Young Urban Arts Foundation
Young Urban Arts Foundation - Helping Young People Go Places
Imagine a world where every young person is seen, heard and celebrated, no matter their circumstances. Where young people are empowered to create their own future. Young Urban Arts Foundation's transformative creative and mental-health-focused programmes harness the power of music and arts to make this a reality for young Londoners. Your donation will support YUAF’s vital work, giving young people options, solutions, building confidence, resilience, and most of all keeping them SAFE.
Share your support
YUAF
Help keep young people safe
Write a really compelling short description or summary... Read more
Find out more about The National Funding Scheme
Your donation is to the National Funding Scheme and identifies a specific campaign. Please see our terms and conditions.
Become a partner organisation
© Copyright National Funding Scheme 2020. All Rights Reserved.
A charity registered in England and Wales (Charity No.: 1149800) and Scotland (SC045106).
Registered office Marcar House, 13 Parkshot, Richmond, Surrey TW9 2RG
|
cc/2020-05/en_middle_0097.json.gz/line1399984
|
__label__wiki
| 0.657021
| 0.657021
|
So You Think You Can Dance Season 12 Top 16 Perform 2 Eliminated
We are quickly making our way towards the finale where America’s favorite dancer is announced. I think all the dancers are reaching inside themselves to conquer those elements of dance with which they were least familiar. It has made for an exciting season so far.
Tonight’s group dance was choreographed by Nick Florez and RJ Durell to the song “Love is Free” by Robyn & La Bagatelle Magique featuring Maluca. What a fantastic way to wake up the audience in preparation for tonight’s show. I am always in awe when these dancers can learn things that have so many complicated fast moves. It shows such great effort on their parts to want to give the best performance possible.
Cat revealed who won most of the votes last week. Team Stage barely won with 50.5% of the votes with Team Street pulling 49.5% of the vote. Derek injured himself this week and won’t be able to perform. He may or may not be in danger this week but if he makes it through to next week, he will automatically be in the bottom 3.
Ray Leeper choreographed Hailee and JaJa in a jazz number. It is a song about female empowerment danced to the song “Endangered Species” by Dianne Reeves. JaJa held her own. Hailee brought more sexiness to the dance than JaJa and dug a little deeper to bend more, stretch more, and emphasize more. But JaJa represented a different type of woman I think; after all, there are so many versions of us. Nigel said they are two incredible ladies. Together they are a knockout. He said whether it is Hailee’s hair or eyes or the “hey look at me” mentality she has when she walks on stage, he has to focus on her. She is just a sensation. JaJa is one of the most interesting street dancers they have ever had on the program. She is growing in technique exponentially. Paula thinks the spectrum from where JaJa started from last year not making it to the choreography rounds to where she is today is unrecognizable. It is brilliant to watch the growth. She knocks them out week after week. Hailee has a radiance about her and they are drawn into the luster of her brilliance. It shines with her like a dance partner that never leaves her. Words that you cannot even describe. They can’t help but laser into her. It’s a beautiful gift. Jason thought it was a beautiful performance. He is so proud of JaJa. Her intention was there. The style of the dance was there. He cautioned her to be careful with her leg extensions and stretch a bit more because when both of their legs are up, Hailee’s leg is “way up here” and hers is “a little down here.” Hailee is coming out of her shell and becoming a star right before their eyes. Cat reveals the results from last week’s dances for them. Both of them are safe.
Dave Scott choreographed Neptune and Alexia. It is a crazy love story type of hip-hop dance to the song “Flex (Ooh Ooh Ooh)” by Rich Homie Quan. I loved this. I got goosebumps. Traditionally I get goosebumps to songs that touch an emotion in me. This pairing was perfect. Alexia was fantastic with her moves. She had great chemistry with Neptune. The added feature of a padded-wall prop made the routine so much more interesting. When things like this are introduced they are either a hit or a flop. This was definitely a hit. Their marks for the wall were perfectly timed singly and in duet. I totally got “crazy love story” from this. If I had to guess I would say Alexia’s character was more of the cray-cray part of the relationship. Paula gave them a standing ovation. Paula thought it was a fun, fun routine. Twerking up a padded wall was pretty creative. Both were committed to the character. They both had so much fun. It was sick, crazy love, whacky, insane, sensual, sexy and just weird and she loved it. Jason told Neptune he will be important to his team. He is a head runner and will steer his team over. Let sure he is leading his team. Alexia is getting better and better every week and keep it going. Nigel agrees Alexia is getting better and better every week. As Jason said, Neptune started quietly and every week is building himself slowly week upon week. America is crazy if they don’t recognize that. Based on last week’s dancing, Alexia and Neptune are both safe.
JJ and Derek got together with choreographers Miriam Larici and Leonardo Barrionuevo for an Argentine tango. Since Derek can’t perform, she gets to dance with Leonardo. What a treat for her. The song is “Duo De Amor” by Astor Piazzolla. He really helped her get all those lines and high lifts. I think the chemistry was there. It was beautiful. The judges were on their feet. Jason said, “Girl, you brought sexy back, and all the judges didn’t know how to act.” He said it was unbelievable. She overcame adversity and she held her own. Nigel said from the first breath throughout the routine how sensual she was making it. If Mary Murphy were there now, JJ would definitely be on her hot tamale train. He teased her that Leonardo held her at the end for a bit longer and she was enjoying every second of that. She laughed in agreement. She was a credit to her team. Paula said it was beautiful routine. The most incredible, incredible transformation comes from her. It’s the whole 360. The grace and beauty of her extensions. She is like a young ingénue of maybe Natalie Wood and maybe Leslie Caron. It is lovely seeing her like this. Results from last week’s dance: JJ and Derek are both in danger.
Ariana and Jim were paired with Sean Cheesman who choreographed a contemporary routine. The story is about the ups and downs of dealing with depression. The song is “Everyone Wants to Rule the World” by Lorde. Interesting version of this song; I had never heard it before. It set the mood for the dance. The dancing was fabulous but I think Jim needed to dig a little deeper for the emotional connection. There is great despair in depression and it was more like he was playing a part versus experiencing it. Situational depression is different from chronic depression and trying to dig your way up from that. Usually dances like this will certainly give me goosebumps, but not today. Bummed. The judges were on their feet. Nigel said he thought they conveyed the brilliant message that Sean wanted to convey. Nigel said that dance is a great weapon in depression and dementia so if you ever feel this way, get up and dance. He said he didn’t know why the audience was not connecting with Ariana. Nigel felt Jim was not struggling at all. Paula said just when you think you can’t grow better or stronger, both of them are proving that each week. She thinks it is one of the best routines that showcased both of the breadth of who they are as dancers, and both the light and the shame of the depression, the light and the light—it worked beautifully, seamlessly. Ariana was keeping up with Jim step for step with him. Jason said he is blown away by Ariana for being able to dance with such a technical dancer as Jim and hold her own is unreal. He can never tell what team she is on. He said to Jim that he has never seen talent/technique like that live and thanked him. After hearing these comments from the judges, I wonder if the song is what threw the whole dance off for me. I was concentrating on the song so much (as the original is an all-time favorite of mine) that I was trying to wrap my head around that which held me back from fully experiencing it as they did. The results from last week from Cat: Jim is safe and Ariana is in danger.
Virgil and Gaby were teamed with Al Blackstone for a Broadway routine about two people on the streets of New York who think they know each other after they bump into each other to the song “Where or When” by Sammy Davis Jr. That was adorable and so much fun. I could picture them having a job on Broadway. Nigel was on his feet—wait all the judges! Paula said some wonderful things about the dance but turned to Virgil and said he is like a young Sammy Davis Jr. He can do it all and he is so wonderful to watch. She thought Mattel should slap their sign on the back of his behind and sell a million Virgil dolls. (Okay?) Paula said Gaby is impeccable. She is so well versed. It’s lovely to see how elegant and how amazing she is in this competition. Jason told Virgil he breathes life into every performance. Jason shares he went to college for musical theater and *this* (meaning the routine) is his thing. They both did an amazing job. He said the breadth of knowledge of dance that Gaby has is pretty amazing. He cautioned him to not let Virgil upstage her. He told her not to underestimate a smile. Her smile lights up a room. Nigel said he disagrees with Jason—they were both a fabulous power couple tonight. He said Broadway demands the best of you. When they go on those hallowed boards, you have to be brilliant every time, rain or shine, whether you are ill or fine, you just have to be brilliant and both of them were brilliant tonight. Cat told them they are both safe based on last week’s dance.
Asaf and Kate joined together to do a jazz routine choreographed by Sean Cheesman. The story of the dance is that Asaf and Kate ARE the in-crowd at the club. Kate unfortunately does not feel safe with Asaf who is having trouble with the lifts. The song is “Braveheart” by Neon Jungle. I guess thes choreographer and the team captains felt it was better to get the lifts out of the song. It was an okay routine. I feel bad for Kate. She tried her best to make the situation work, but I think what happened messed up the chemistry they might have been able to have—to connect better. Jason told Kate she has been a favorite of his in the past few weeks. Jason said they got a lot of heat last week for saving him and he does not regret it. He thinks, however, that he is in that danger zone. He does not think his performance saved him. Jason feels like Asaf is in a limbo. Nigel said to Kate that her technique has never been in question; it has always been about a connection. She really connected to him tonight and he hopes she did with America. Nigel said that he is constantly being told by his choreographers how hard he works. This was so much better this week than his cha-cha last week. He lived up to his name and he “danced his ass-af.” Paula told Kate she looks lovely tonight. She said what she was happy about was that there was no more fear; she trusted her partner; both of them worked very well together. She told Asaf he was there for his partner and it is like night and day from last week to this week. Cat announces the results from last week’s votes, they ae both in danger this week.
Marissa and Yorelis join together for a Christopher Scott hip-hop number. For the story, Yorelis gets to hypnotize Marissa to win her over to Team Street. The song is “Let Go” by Kezwik featuring Mimi Page. They make a great team. This routine is among my favorites tonight. This is when I like Christopher Scott’s routines. Nigel thought Marissa’s tumbling skills really came into this routine, although she was terrific. He warns her she has to be careful to get the same liquid flow to her body that Yorelis has. He echoed Jason’s words earlier that he does not know who is on whose team tonight. He thought Yorelis is so beautiful and sensational. Her whole body moves to the music. It’s almost like she hasn’t been choreographed. The music drives her body. Paula wants to compliment both of them. She thought Marissa just licked it up and acknowledged it is hard for a jazz/contemporary dancer—the animation is hard. The choreography was well thought out and very clever. This is where Yorelis shines. Jason thought it was a really good performance. He said that after seeing some of the performances today, it did fall a little short. He wanted them to be a little more intense, a little bigger, based on the intensity of the song. At times they nailed it and at times they didn’t. The little intricacies he thought they did well. For the size of the song, he didn’t feel like the performance matched. It was good but it didn’t blow him away. Cat said that Marissa is the final dancer in danger tonight based on last week’s routine.
Megz and Edson are paired for a contemporary dance from Talia Favia. The story is about temptation and being extremely intrigued by it. Megz is discovering temptation and is constantly being pulled back by Edson. The song is “You There” by Aquilo. GOOSEBUMPS. The expressions on Megz face and her technique considering she is Team Street is so impressive. All the judges were on their feet. Paula was in tears. Paula had bumps all over her arms and she is very taken with this routine. She thought Megz was truly amazing. She told Edson they danced—she didn’t know how it could be any better. Words cannot describe so she is going to leave it at that. Jason said easily one of the best performances of the night. He thought the struggling in the shirt was a concept that was so dope but it could easily go wrong. You had to have the right amount of desperation and he believes they accomplished that. He thinks this number will go into SYTYCD history. Nigel thought for the first time a shirt has come off in this show for a good reason. Cat shrugs and says, “So you say.” The image of how much we hide from each other in a relationship was captured beautifully by Talia’s choreography. He felt she and JaJa have become contemporary dancers. You’ve moved over to Travis’ team. He told Edson that Edson finds it hard to be passionate in his dancing sometimes, but he did not tonight. He really released his emotions so it was great to see. It was a beautiful routine as everyone has said. And since the dancers who are in danger have already been revealed, both Edson and Megz are safe.
Team Street dances together to choreography by Luam. She feels it captures the spirit of New York and the hustler spirit. The song is “Commas” by Future. They nailed it. It was wonderful. The judges were on their feet.
Next up is Team Stage choreographed by Travis Wall. The theme is ghosts of theaters past. The song is “Beautiful Friends” by Helen Money. WOW TRAVIS WALL! I love you! That was so wonderful. I think this is the third time Travis has choreographed his own group number. Time to “Step Up” tWitch!
Twitter votes save JJ and Derek (injured Derek—is that fair Twitter?—he is automatically going to be in the bottom 3 next week). The judges save Kate and let Marissa go. As far as the street dancers, the judges save Ariana; Asaf is leaving the competition.
Tags: Al Blackstone, Alexia, Argentine tango, Ariana, Asaf, Broadway, Cat Deeley, Christopher Scott, contemporary, Dave Scott, Derek, Edson, Fox Broadcasting, Gaby, Hailee, hip-hop, JaJa, Jason Derulo, jazz, Jim, JJ, Kate, Leonardo Barrionuevo, Luam, Marissa, Megz, Miriam Larici, Neptune, Nick Florez, Nigel Lythgoe, Paula Abdul, Ray Leeper, Reina Hidalgo, RJ Durell, season 12, So You Think You Can Dance, Stephen 'tWitch' Boss, Talia Favia, Team Stage, Team Street, Travis Wall, Virgil, Yorelis
Categories : Fox Shows, So You Think You Can Dance, So You Think You Can Dance
So You Think You Can Dance Season 12 New York Auditions
The final leg of the auditions for season 12 were in New York. Virgil Gadson had auditioned in season 8. He had almost made it into the top 20 but got cut. He kept practicing and got a part in “After Midnight” on Broadway. He chose “Uptown Funk” to audition with this time for Team Street. As he got started, Paula whispered to Nigel that he reminds her of Fik-shun. He glides like ice across that stage which is hard for hip-hop. He has great star quality. Nigel said he set the bar for that day for hip hop. It was unique, great things in it, lots of different angles, wonderful personality. It was exactly what he was looking for. Paula said he was a like a day of Disneyland in a minute and a half. He is born to entertain. Jason said his technique was the dope part about it. It was amazing to watch. He gets a ticket to Vegas.
Alexia Meyer was up next trying out for Team Stage. The choreography had a lot of thought to it. I thought the eye wink was a bit odd. I really enjoyed the dance overall. Paula said she had great showmanship. The hardest thing for her is that she saw moments of great connection, and then she kind of went off and lost it a little, and then would fall back into it. Paula got booed! She thought nerves got to her. Jason got booed before he even started. He didn’t know if that was the end of Paula’s boos or the start of his. He thoroughly enjoyed it and he is not just saying that because they booed. Nigel enjoyed it, too. She gets three yeses.
Korey Cleveland had a tough road in getting to the audition. His dad was never there and his mom was battling her addiction. He, too, has struggled with crack cocaine to the point where he was incarcerated for 2 years in Missouri. Dance saved him. He would rather dance than do drugs. He said if he made it to 30 days clean he would come to the audition. He danced to Keys and Krates “Treat Me Right.” That was wicked. When he was moving his upper trunk around his head (or is that the head around his upper trunk) that was phenomenal. It has been awhile since I saw someone do that so well. Paula said she is proud of him because he proves you can live your passion and inspire people. Jason said he was inspiring. A lot of people can relate to his situation. He felt his passion. Paula and Jason both say yes. Nigel said that it is 2 months before Vegas. That means he is going to have to stay clean for 90 days. He said he’ll bring his 90-day key to show them. He gets a conditional ticket to Vegas.
“Hoofing” dancer Justin Ballasy wants to show what he can do to the song “Love Ain’t Gonna Let You Down” by Jamie Cullum. His tapping was insane. I didn’t see the tapping story translate into the song being played however. Paula said she felt like she just saw the movie “Whiplash” with tap. It was very impressive. Great timing, fast, clean. She didn’t know where the music and the tap made sense. Nigel asked him what time signature he was using. He said 4/4. Nigel said, no, and Justin asked three-four? That was Nigel’s complaint to him. He loved his tap and loved what he can do but it had absolutely nothing to do with that music. Justin said it was difficult to hear himself up there in his defense (not sure that was a good idea—the judges don’t like excuses). Nigel said he is so against people coming in and laying down machine-gun tap. Jason said it made him feel something—his heart started to race. But at the same time the musicality in it means so much to tap. If they didn’t say something, all the tappers out there would have been saying “What?” He is worried. He asks to do something a capella. They say no, but they say yes to Vegas.
The next auditioner’s family call him “Mr. Hollywood.” I smell trouble. Thomas Condello chooses “As Long As You Love Me” by Justin Bieber. He has some rhythm and some moves, but they were sloppy. The competition is fierce this year and he dances fine for entertaining, but not to win the show. All the judges were smiling but you know they are just going to thank him for making them smile. He said he did impressions, like Jason Derulo, and they invite him to show them. Paula said he has a lot of heart. He is not through.
Angely “Cookie” Deaza and Angela “Angyil” McNeal try out together for Team Street. I don’t know why they reminded me of Japanese robots that I saw on an episode of Almost Human on Fox. I loved them. Jason looked like he was really getting in to it (and, in fact, gave them a standing ovation). Jason said he would pay money to see that. Angyil and Cookie are a yes for him. Angyil is a yes for Paula. She thinks Cookie is limited in her style. Paula advises her to lift it and elevate it and get out of that monotone aspect and add character. She doesn’t think Cookie is ready. Nigel says a yes for Angyil and a no for Cookie for this year.
Allyson Wilcox works on the Vegas strip as a dancer in a show that is similar to Medieval Times. She is trying out for a spot on Team Stage. She chose “Wasting My Young Years” by London Grammar. Some of her moves I liked. I thought she spent too much time on the ground. Sometimes her lines were fabulous; other times they weren’t. Paula thought she had tremendous control. The start of her choreography was spot-on, but then she felt like her ability was far better than her choreography. Jason thought he saw things he hadn’t seen yet that day. Her arabesque was beautiful. Nigel gives her a ticket to Vegas.
One of the last auditions for this day was from a special man named Alain “Hurrikane” Lauture from Haiti. He chose Jeremy Joshua’s “Thinking About Your Face” to show his locking routine for the judges. His routine demonstrated a great command for choreography and the nuances of the music. He has a lot of talent. I was drawn to him. Employing the stairs as a prop to his routine was different in a smart way. Nigel liked it because it was fun. Paula thought it brought back the 1980’s fun and saw influences of Shabba Doo and Boogaloo Shrimp. All agreed his smile was terrific. He gets three yeses.
Kenya Welch and Connor Bermingham decided to audition together versus separately. They chose A Great Big World’s “Say Something.” Their decision proved to be the right one. I felt the choreography of the number as well as the performance of the number was something you would actually see on this show. I loved their emotion. Well done!!! Paula said she didn’t expect that and it was a very nice surprise. Paula kind of got lost in it. Nigel chimed in that it was one of the best they had seen all day. Jason thought it was awesome and a joy to watch. He said more like a fan than a judge. Both of them are through to Vegas.
As day two begins I am not sure who I like better, the contestant or his mother! Ryan Raffloer decided to try out without a partner in Latin ballroom to Tom Jones’ “Sex Bomb.” He was a surprise! I felt certain he was stoned out of his mind, but he turned into someone else while he was dancing. I could have done without the overindulgence in facial grimacing but his dancing for a Latin solo was unbelievable. I had a feeling Nigel was going to compare him to Dmitry Chaplin. Nigel thought he was excellent. It was over the top and too much but it is what you have to do when you are auditioning yourself. Paula thought he has this “je nais sais quoi”, a presence about him, it stands for something important. Jason felt he brought this grand presence. Jason thought “expensive” was the right word and Paula went “ooo”. He gets three yeses.
Bobby “Anime” Major dances to District 78’s “I Need an Explosion.” Wow!!! He is FANTASTIC! The judges were on their feet. There was no feedback; just a ticket to Vegas.
Eliazer Chapman brought “The Bronx” break dancing to the SYTYCD audition stage with a song from Madcon called “Beggin.” He had some really great moves. Nigel said it was raw and exciting. Paula thought it was entertaining. Jason said he was a strong b-boy and he wants to see what else he has. He is going to Vegas.
The next audition combines break dancing and ballet to form his unique style. Ian Williams surely doesn’t lack confidence as he dances to “Clocks” by Coldplay. His extensions and lines aren’t even there for his ballet. I saw no waacking. Jason looks like he is trying hard not to break out laughing. Nigel is a no. Paula said he is not ready yet. Jason said it was a no for sure.
Darius Drooh has a huge crush on Paula Abdul. She inspired him to dance. He chose Michael Buble’s “Cry Me a River.” He was fabulous. Jason said it was awesome. The choreography didn’t have a lot of the bing, bang, boom, but he liked the straightforward choreography a lot. Nigel said it was beautiful, but he just wanted the flow to stop every now and then. But it was magnificent. Paula thinks he has a beautiful technique and strength. Darius calls up a friend from the audience to do Paula’s “Coldhearted Snake.”
The last contestant of the day is Alyssa Guerrieri. Her grandmother was a dancer. Alyssa dances to “Take Me to Church” by Sofia Karlberg. She has beautiful lines and great personality in her dance. Paula said she is a breath of fresh air. Her technique was beautiful and her choreography was seamless and yummy. Jason felt her confidence was through the roof. Her acrobatics were right on. And it fit right in with the contemporary. Nigel said she is like a little ray of sunshine. Three yeses.
And this concludes the auditions for season 12. This gives Team Travis 114 hopefuls for a spot in the top 10 for stage dancers and 105 would join Team tWitch for a spot in the top 10 for street dancers.
Tags: Alain "Hurrikane" Lauture, Alexia Meyer, Allyson Wilcox, Alyssa Guerrieri, Angela "Angyil" McNeal, Angely "Cookie" Deaza, Bobby "Anime" Major, Boogaloo Shrimp, break dancing, Connor Bermingham, contemporary, Darius Drooh, Dmitry Chaplin, Du-Shant "Fik-Shun" Stegall, Eliazer Chapman, hoofing, Ian Williams, Jason Derulo, Justin Ballasy, Kenya Welch, Korey Cleveland, Mr. Hollywood, New York, Nigel Lythgoe, Paula Abdul, Ryan Raffloer, season 12, Shabba Doo, So You Think You Can Dance, Stephen 'tWitch' Boss, tapping, Team Stage, Thomas Condello, Travis Wall, Virgil "Lil'O" Gadson
Categories : So You Think You Can Dance, So You Think You Can Dance, TV shows
o You Think You Can Dance Season 12 Detroit Auditions
The auditions move on to Detroit where 18-year-old Christine Shepard from Columbus, Ohio danced to “Settle Down” by Kimbra hoping for a ticket to Vegas and an ultimate spot on Team Travis. While I developed no goosebumps, I did find it very entertaining. I felt like she incorporated some movements of African jazz into her own eclectic jazz performance. It had so much personality and had Paula on her feet. Paula said she is a bright light, a breath of fresh air, hashtag everything. She adored her. Jason said it was a hell of a start. He thanked her for blessing the audience. The nuances were everything for him. It makes such a difference when you have the bing, bang, boom, and then you hit them with a little nuance, a little ornament. It’s those moments that make a performance special. He commented as well on the African vibe that made it a little different. Nigel said everyone has a light inside of them that there is something in life that will make them turn it on. Sometimes they don’t know they have it or what will make that happen, but she has it and it is shining out like a beacon. It was the little things like the side-split contraction, then the shoulders, and then the contraction. It was magical and a great way to start the day. Of course, she made it through to Vegas.
Animator Kenya Sutton is the Queen of Detroit, Queen of the Streets, S.O, Standing O, just O. She is almost as good as Cyrus. All three judges were on their feet. That is just so difficult to do (animation). Jason said now he knows why she is called Standing O because there is no better response than a standing ovation to her performance. The fact that she brought sexiness to animation he has never seen that. She made it hot, sexy and feminine, and that is dope. Paula said she is everything they have been looking for in this competition. She is unique. She is clever and witty, tongue-in-cheek, great flirting with Jason. She is pretty darn special. Nigel asked her why it has been so long since she came to audition. She was afraid of being overlooked. Before she would have had to go through ballroom and contemporary and she didn’t train yet in that. She wasn’t even going to fool herself. So Nigel says now that there is just stage and street side she is going to climb up and up that ladder. She gets a ticket.
Kelly MacCoy met Tyrell Noll in line at last year’s auditions in Atlanta who is now her fiancé. I think that makes two couples (tWitch and Allison Holker got married). She chose “A New Day Has Come” by Celine Dion. It was done well but there were only some moves at the end that made it special. It’s hard when you have other people like Christine. I think she deserves to go to Vegas because she will only get better. Nigel said that she reminds him of Ginger Rogers. She had fabulous technique, great feet, loved everything she did. He felt her connection with the music as well. Paula said what is special about her is that even in the moments where she is not dancing there is such a different emotional connection. She was outstanding. Jason said it was a stunning performance and he loved everything about it. Her kicks were way up and her altitudes were some of the best they have seen. Three yeses.
Her fiancé Tyrell Noll performs freestyle to “Habits” by Maria Mena. The music is beautiful. He was animating so well it sort of glided. It was beautiful. Paula said he went against the grain and picked music not typically used for street dancing and that was very intelligent. His movement reflected a story. Nigel said it is very rare that they disagree. He didn’t find a lot of dancing going on. He has seen the puff and walk done so many times and it done better. Tyrell makes his case that dance is about emotion and pouring your heart out on the stage. Jason gave it two thumbs up. There was such an element of acting to it and dancers need to be actors as well. He gets two out of three yeses which gives him a ticket to Vegas.
Break dancer Corey “Mission” Whitfield, age 30, is from Detroit and works for the Pistons. He chose “Latch” by Disclosure featuring Sam Smith. He reminds me a little of Legacy. Jason thought it was very impressive. Paula loved him. Nigel invited his godchildren up on stage to dance with him. The kids were awesome. How old are they? Can they go through to Vegas? Mission is going to Vegas.
Then came a large montage of people going through to Vegas for Team Street.
Brooke Fong came to do a jazz routine from California. She chose “Fever” by Beyonce. I like her. Her spin moves were pretty phenomenal. Jason said they talk about those special moments where they can go home and still talk about and she had them in those pirouettes. Paula thought she was a very smart dancer, very sharp and in her control of her core. She thought she was a contender. Nigel said she was sharper than the spikes on a porcupine’s ass. He felt like she was raising the standard again this year. Three yeses.
Next was a montage of people trying out for Team Stage.
Two dancers from The Bronx came together to try out on opposing teams. First was stage dancer Chelsea Harold, age 26, dancing contemporary to “Brain” by Banks. Her flexibility did not seem to be there like the other dancers we’ve seen. She looked like she was struggling. Her legs were not high enough in her jumps. I love her spirit and I loved the concept of the dance, but I’m not sure what happened in the other. Paula said she is a proficient dancer—she could see her training—but there were areas where she needed to extend more. Nigel said her legs appeared tensed. Jason felt that her emotion was more internalized. She received three no’s.
Her friend Samantha Reyes was hoping for a different answer. She dances in the subways. She is going to freestyle street dance. She chose “Faded” by Zhu. It was good. I think she needs some help perfecting her style a bit though. Jason likes her passion but he thinks she needs to add more to her repertoire. Paula said she sees softness in her but Paula reassures her that it is a beautiful thing. Paula said she needs to be taught structure and choreography so she can start building her dance vocabulary but she shows a lot of promise. Nigel says he sees a girl who has to be tough in her life but agrees with Paula that there is a softness about her. She gets three yeses.
Jessica Southwell (aka J-South) auditioned doing a tap/Charleston. OUCH! She fell. It was interesting. He said the routine was juvenile but the outfit made him short for words. She said, “It’s ironic.” Paula thinks she needs to work on the cleanliness of her taps. Jason thought it was like a dirty Snow White. All three were a no, but Jason called her “babe” so she can go away with that I suppose.
At the end of the day ten dancers were joining Team Street and five more were joining Team Stage.
Day two in Detroit. Miranda Wilking just turned 18 on the day of her audition with District 78’s “The Antidote.” That was some hard-hitting dancing there. She was not going to be denied a ticket! I’ll remember the intensity, but not so much signature moves. There was no critique other than Nigel saying “she’s fierce” while she was dancing. She has a ticket to Vegas.
Aaron Viland describes his style as pop-and-lock-a-mation. He dances to “The Creep” by The Lonely Island. He had the judges up dancing. Nigel thanked him for making everyone so happy but it wasn’t strong enough for them to put him through. Paula predicted he was going to become an internet sensation. Jason said they needed a little wakeup call and thanked him.
Michael Manson came on stage to perform the legendary Detroit Jit. That is one FAST dance!!! I wonder how many calories you can burn doing that? Nigel thought it was good. Paula said, “Jit happens.” Michael said that is their slogan. Paula thought what he is doing was extraordinary but he needed to change it up. Jason was there for it. He gets a ticket to Vegas.
Kelsey Rose Young is performing a tap routine to “Bang Bang” by Jessie J. WOW!!!!! She is fantastic. She intermixed some krump into her tap routine. Nigel said she is a born performer. He loved the track she danced to because it was fresh and modern. Her performance was outstanding (a little over the top if he is being honest). Her performance reminded him of Paula. She was double espresso coffee in the morning. Paula wants to carry her in her purse everywhere she goes. She thought she was a little firecracker and she surprised Paula. Jason felt that tap is a dying art and it needs to be brought to current times, like what she did. She gets a ticket.
There was a montage of unnamed stage performers who received a yes for Vegas, followed by a montage of both street and stage dancers who received a no.
Gabby Diaz got cut after her solo in Dallas (a week ago). She completely changed her solo based on the judges’ feedback. She chose “Endangered Species” by Dianne Reeves. I loved it. It was a great tap song. Jason said “now that was amazing” before the actual critiques occurred. Nigel said her auditions were like night and day for him. Her song choice was right, her expressions were right, her interpretation was right. Paula said she took the constructive criticism that they gave her, she took it and it paid off. It was very smart of her and Paula is very proud of her. Jason is proud of her as well. She was almost like a new dancer. She gets the prize—the ticket to Vegas.
Krumper Roydell Shannon blew up the stage with his performance. His son BamBam was called to the stage. BamBam gets a standing ovation from the judges. Nigel thought he was just as good as Russell. Paula thought he brought other dimensions into his routine, not just krumping, and it was incredible. Jason said he was more than a krumper—he is an entertainer. He became a beast and he’s got buck. Definitely going to Vegas.
The tally is 55 dancers for Team Travis and 60 for tWitch
Tags: Aaron Viland, BamBam, Brooke Fong, Chelsea Harold, Christine Shepard, Corey "Mission" Whitfield, Detroit, Fox Broadcasting, Gabby Diaz, J-South, Jason Derulo, Jessica Southwell, just O, Kelly McCoy, Kelsey Rose Young, Kenya Sutton, Legacy, Michael Manson, Miranda Wilking, Nigel Lythgoe, Paula Abdul, Queen of Detroit, Queen of the Streets, Roydell Shannon, S.O., Samantha Reyes, season 12, So You Think You Can Dance, Standing O, Stephen 'tWitch' Boss, Team Stage, Team Street, Travis Wall, Tyrell Noll
Categories : Fox Shows, So You Think You Can Dance
So You Think You Can Dance Season 12 Memphis and Dallas Auditions
I am looking forward to Jason Derulo joining the judges’ panel. When he was a guest judge last season I was impressed with his detailed and constructive feedback. I was very sad that Mary Murphy’s contract was not renewed. Paula Abdul will be taking Mary’s spot. This season it is stage versus street. The person trying out will have to tell the judges whether they are trying out for #TeamStage or #TeamStreet. By the time Vegas week is over, there will be 10 dancers of each style who will be paired up for the show. Travis and tWitch will be the mentors. One dancer from each team will be sent home based on our votes.
The first contestant is Peyton Albrecht from Robert, Louisiana. He will be dancing for a spot on #TeamStage with a contemporary routine to Steed Lord’s “Ghost of Sky.” There were some interesting elements to it and I was on the verge of goosebumps, but not quite there. I definitely think he deserves a ticket to Vegas. Paula thought he was a powerful dancer with wonderful technique. He has it all (but she is very stoic about her delivery of the comment. Maybe Paula wants to try playing the serious one and keep it as she would with choreography try-outs versus trying to make off-the-cuff comments which sometimes get her into trouble). Jason said it was a hell of a song choice. Jason said that is what performers strive for—to create something that is your own so there is something remaining to remember you by when you are gone. Nigel thought he reminded him of a young Travis Wall (well, I wouldn’t go THAT far Nigel). He received three yeses.
Street dancer Andre Rucker is a part of the infamous Dragon House (an Atlanta group that specializes in popping and animation). He made it to Vegas in season 9 (the season that Cyrus from his house also made it to the finals). He danced to “Special Powers” by Harikiri. GOOSEBUMPS!!! This young man has mad skills in animation. Jason said it was fire. He liked his wave and tutting that he had never seen before. Paula complimented his musicality, how he utilized the choreography right to the different beats and how he enhanced certain instrumentation. He is very special. Nigel enjoyed the hand that came around like a snake. It was really creative and his musicality was terrific. He gets a ticket to Vegas.
Trying out for #TeamStage is Jordan Hilgenberg from Claremont, Florida. She has a ballet base but is more of a contemporary person and incorporates both in her dance style. Her audition song is Julia Stone’s “The Line That Ties Me.” I got goosebumps with that routine. She had enormous control and gorgeous lines. I also felt emotion coming through as well which gave me the goosebumps. I like that the lyrics had “call you the beast.” Nigel often refers to women dancers like Melanie Moore as “beasts.” Nigel said she has beautiful feet. Her arabesque is tremendous. The penche was beautiful. The control of it all was terrific. He was impressed with her grand jeté en avant en tournant and he needs to see more movement. He felt like she was a bird held in a cage. Paula said she has extraordinary elegance. Her core is amazing, balance is amazing, feet are stunning, and breadth of her training is incredible. Jason said she is a beautiful dancer through and through. Her lines were stunning that it carried the performance. She has the potential of being very amazing. Three yeses!
The next contestant planned to showcase Memphis jookin’. It combines foot work, gliding, gangsta-ness, hype-ness. It is footwork, ankle breaking, buck jumping and bounce. The bounce is the heartbeat of the dance that gives it the Memphis attitude. Representing this was Ladia Yates, age 23, from Richmond, California? Okay. I was expecting a Memphis girl. Her song was Bow Wow’s “It’s Going Down.” I love a female hip-hip dancer. Some of her hand work was weird (not as tight as the other stuff), but I liked the rest of it. Nigel said he was proud of what he had just seen. Paula thought she was special and unique. Jason said where he comes from it’s called “a movie” and she just made a movie for them. She propositions Jason to go to the movies after this is all over. He said it was incredible. He said it was so incredible he wanted her to come in and teach some of his dancers what she does. Then we find out why she is in Memphis. She has a dance team of little ones there in Memphis. Nigel calls them up. They all said they wanted to dance to Jason Derulo’s “Talk Dirty to Me.” Jason comes up on stage to sing while they danced. That was fantastic. Those little kids are TALENTED!! Ladia comes down to hug the judges for her ticket and lingers at Jason. That will be the last allowed hug from him for the season. We know what got Paula in trouble on American Idol (allegedly).
After a montage of stage dancers who made it through, a few street dancers came to the stage but it was not strong enough to make it through.
Fifteen dancers would be joining Team Travis, and only 9 were joining tWitch’s street team (and you know they have made it impossible for me to choose between Travis and tWitch). Courtney Barnes returned after last season to dance to Meek Mills’ “Dreams and Nightmares.” Interesting song choice. And it morphed into Selena’s “Bidi Bidi Bom Bom.” He is truly entertaining. (I hope I used the proper pronoun). And then it morphed into Nick Jonas’ “Jealous.” Jason whispered to Paula, “One more hair swipe and I’m gonna lose my mind.” Jason thought it was interesting. He hadn’t seen anyone else put a mash-up together like that. It was a bit too much of hair whipping for him. Jason said it wasn’t ready for this show. Paula said she would pack him in her bag and take him everywhere with her because he adds tremendous life to everything. Nigel thought his style and flexibility were good. Nigel says he is in a difficult position because he always says that he wants them to be unique. Paula is a yes. Jason is a no. Nigel says he is going to have a lot of work to do before he gets to Vegas, but he puts him through.
An unexpected snafu occurred on day 2 of the Memphis auditions when there was an underground substation fire which made the lights go out throughout downtown Memphis and it was unknown if power would be restored. Many said they would go to the other cities to audition, but many said they spent all the money they had to get to Memphis. Mid-afternoon they made the announcement that they would be dancing; however, the auditions would be modified. They would be put into groups based on their style. They will be asked to either stay to do a solo or be dismissed. At the end of the day eight dancers will be joining Travis for the stage group and ten more will be joining tWitch for the street team.
The next stop was in Dallas. The first contestant comes from Miami and he is rather humorous as he stumbles over the word contemporary. He just started dancing 3 years prior when sports bored him. Dancing to Il Divo’s “Caruso” Guillermo Morales has some great moves, but he didn’t move any emotion inside of me. His athleticism was compelling. He received a ticket to Vegas. Nigel commented that “he’s a star.”
Jaclyn Hamric danced to “Sleepwalk.” She is a beautiful young lady and she has talent, but there was not anything special to her routine. There was a lot of ponytail turning (which annoyed Jason in a previous city). I also noted that for a contemporary routine, she had her toes pointed out a lot instead of keeping them straight. Nigel thought it was pretty and her technique was good. Paula said she is lovely to watch. The camera and audience love her. Paula likes her a lot. Jason said he liked her a lot as well. He forgot about technique and became a fan. It is a unanimous yes.
Steven Ban looks like an atypical street dancer. Honestly, he looks like someone from my community—a nerd (and describes himself that way as well). Nigel thought he looked like Bill Gates. He chose Thiftworks’ “Sky Fiyah.” He had some skills, but there have been better animators to come through the doors to audition now and in the past. He had some cool moves but was it enough to get him through? Jason said he loved his musicality. He thought he was unique and he loved the whole look. Paula said she thought he was more of an illusionist than an animator. He received three yeses.
Vishona Sims is auditioning for the first time. I liked that she said she wanted to show us what she feels instead of what she can do in a freestyle routine to Eryka Badu’s “The Healer.” Wow she is great. Nigel thought it was dope. He felt it was a little static but still enough to go “wow.” Jason said wow as well. He felt he was alive inside watching her. He thought she told a story. Paula said she is a little star. She was poetic with her movement and thinks she is very, very special. She gets three yeses to Vegas.
Kiosh Monroe from Pleasant Grove, Texas takes the stage to Mark Ronson’s “Uptown Funk.” There was no technique in his dance but it was entertaining. Paula felt like she was watching multiple personalities. He is enjoyable to watch and a lot of fun. She does not know if he is right for the competition. Jason was honest and said it was not for him. He thought he was like the good cousin that could dance. Jason steers him to workout tapes. Jason and many women join him on stage to see if he could have a workout video.
Thirteen will join Team Travis and 16 will join Team tWitch in Vegas.
Tailor’s “Shaped Like a Gun” was the song choice for Lily Leyva, a 19-year-old from Las Vegas. She is a beautiful dancer. She is through.
Jaden Ziarha danced to “Big Spender” and fused ballet with hip-hop. His appearance is deceiving. Paula thinks he marches to the beat of his own drum. Nigel thinks he should be Stephen Colbert’s dancing double. He does not get through to Vegas.
The All-Stars got invited to do the #GimmeFive challenge with Michelle Obama to celebrate the anniversary of her initiative.
The final audition was Tank Hope’s “This Makes You Love Me.” Edson Juarez from Mission, Texas tried out in season 11 but didn’t make it; however, he has worked on those issues since. It was lovely. Jason thought it was the best routine they’ve seen all day. Paula agrees. Nigel still wants more connection. He is through.
Next up: Detroit
Tags: #GimmeFive, Andre Rucker, auditions, Courtney Barnes, Dallas, Dragon House, Edson Juarez, Guillermo Morales, Jaclyn Hamric, Jaden Ziarha, Jason Derulo, Jordan Hilgenberg, Kiosh Monroe, Ladia Yates, Lily Leyva, Mary Murphy, Memphis, Memphis jookin, Michelle Obama, Nigel Lythgoe, Paula Abdul, Peyton Albrecht, season 12, Stephen 'tWitch' Boss, Steven Ban, Team Stage, Team Street, Travis Wall, Vishona Sims, White House
So You Think You Can Dance S11 Hell Week
During the Pasadena, California callbacks, Adam Shankman, Stephen “tWitch” Boss, Tara Lipinski, and Irina Dvorovenko joined Mary Murphy and Nigel Lythgoe.
Solos were first. One hundred and fifty-seven contestants danced in front of the judges. Tanisha Belnap‘s solo was okay, but now that I’ve seen other ballroom dancers, she is not quite at their level. I loved Steven Kador. Even “tWitch” went “oooooo.” After this round, 36 dancers were cut including puppet-dancer Paul Brushaber. One hundred twenty-one dancers remained.
The first choreography challenge was hip-hop. Christopher Scott and Jasmine Harper demonstrated the routine. The contestants had the night to rehearse. Steven Kador and Malene Ostergaard danced together and were through. Marie Poppins was through. Jessica Richens was asked to dance for her life. Marcquet Hill was fabulous and was put through. Trevor Bryce, Caleb Bruner, Megan Marcano, and Franchesca Bass were sent home. Jessica Richens danced for her life and made it through to the next round of choreography.
Sonya Tayeh put them through the paces with a jazz routine. George Lawrence II and Amy Yakima demonstrated the dance. Alla Kocherga was a no, but Zach Everheart moved on. Serge Onik, Johnny “Waackd” Gibson, and Jourdan Epstein are all through. Steven Kador, Shafeek Westbrook, and Marie Poppins all were sent home. Jana “Jaja” Vankova had to dance for her life and she was sent through to the next round of choreography along with 64 other dancers.
The dreaded ballroom was choreography round 3 with Dmitry Chaplin and Anya Garnis demonstrated. They were once again given the night to practice. Zach Everheart and Valerie Rockey were through.
Travis Wall led round 4 of choreography for contemporary dance with the lovely Makenzie Dustman. Bridget Whitman and Landon Anderson had to dance for their lives. After the contemporary rounds, 29 boys and 21 girls were left to compete.
Group night was next. Once again they were given overnight to choreograph and learn their steps. They were broken up into groups of five and given a CD of music. They are required to choreograph and perform the routine. “One Love” consisting of Ryan Johnson, Ryan Redman, Carly Blaney, Novien Yarber, and Serena Pav did not do well at all. Tara thought it was “a mess” as did Irina. Mary told Serena that international rumba is not done on the show for a reason. Nigel said they need smart dancers and that was not smart. He makes the group go decide who will go home. When they could not reach a decision, and because they were willing to all go home versus give up a name, Nigel puts them all through.
The group containing Trenton Williams, Kamille Upshaw, Zach Everheart, Malene Ostergaard, and Johnny “Waackd” Gibson did a wonderful job dancing to “All of Me” by John Legend. I had goosebumps. Adam Shankman thought it was lovely. Tara said it showed they thought about each other but showcased their individual strengths as well. It was Nigel’s favorite routine of the morning.
At this point there were 44 dancers left. They were asked to dance their final solos. Ricky Ubeda may be my favorite dancer this year. I had seriously major goosebumps. In the background you could hear Adam Shankman say, “He’s the best dancer you have.” The four dance crews who will perform are “Academy of Villans“, “Wanted Ashiqz,” “Control Freakz” and “Syncopated Ladies.”
The dancers who walked the final mile were: Ricky Ubeda, Jessica Richens, Jacque LeWarne, Teddy Coffey, Stanley Glover, Carly Blaney, Emilio Dosal, Jana “Jaja” Vankova, Novien Yarber, Serena Pav, Armen Way, Johnny Wacckd Gibson, Bridget Whitman, Valerie Rockey, Zach Everheart, Jourdan Epstein, Casey Askew, Emily James, Landon Anderson, Haley Payne, Justine Lutz, Nick Garcia, Rudy Abreu, Tanisha Belnap, Serge Onik, Malene Ostergaard, Brooklyn Fullmer, Marcquet Hill, and Erik “Silky” Moore.
Tags: Academy of Villans, Adam Shankman, Alla Kocherga, Amy Yakima, Anya Garnis, Armen Way, Bridget Whitman, Brooklyn Fullmer, Caleb Bruner, Carly Blaney, Casey Askew, Christopher Scott, Control Freakz, Dmitry Chaplin, Emilio Dosal, Emily James, Erik "Silky" Moore, Franchesca Bass, George Lawrence II, Haley Payne, hell week, Irina Dvorovenko, Jacque LeWarne, Jana "JaJa" Vankova, Jasmine Harper, Jessica Richens, Johnny Wacckd Gibson, Jourdan Epstein, Justine Lutz, Kamille Upshaw, Landon Anderson, Malene Ostergaard, Marcquet Hill, Marie Poppins, Mary Murphy, Megan Marcano, Nick Garcia, Nigel Lythgoe, Novien Yarber, Pasadena callbacks, Paul Brushaber, Ricky Ubeda, Rudy Abreu, Ryan Johnson, Ryan Redman, season 11, Serena Pav, Serge Onik, Shafeek Westbrook, So You Think You Can Dance, Sonya Tayeh, Stanley Glover, Stephen 'tWitch' Boss, Steven Kador, Syncopated Ladies, SYTYCD, Tanisha Belnap, Tara Lipinski, Teddy Coffey, Trenton Williams, Trevor Bryce, Valerie Rockey, Wanted Ashiqz, Zach Everheart
Categories : Fox Shows, So You Think You Can Dance, So You Think You Can Dance, TV shows
So You Think You Can Dance S11 Los Angeles Day 2 and Philadelphia Auditions
Los Angeles Day 2
Christina Applegate joined Mary Murphy and Nigel Lythgoe for day 2 of the LA auditions.
Serge Onik (age 25 from Upper Saddle River, NJ) made it to the green mile last season. He has a new partner this year, Alla Kocherga, a 24-year-old woman from Los Angeles. Five seconds in and I loved it. Goosebumps! Rarely does ballroom give me goosebumps. That had a sizzle finish. Mary loved it. They are through.
Timothy Joseph is a 24-year-old, B-boy dancer from Sacramento, California who specializes in “suicides.” He is fantastic. He reminds me of Legacy. Mary thinks he is fearless. He was flipping too much for this. They send him to choreography; however he hurt himself during the solo so he has a decision to make. He was in too much pain to continue.
Casey Askew, 19 years of age, a contemporary dancer from Seattle, Washington. Goosebumps! I loved watching him. He had such great emotion. I got more impressed the more he dances. They stop the music and give him a ticket.
After a montage of successes J4 might have a problem with his height. But he IS only 9. He wants to show him hip hop “for the experience.” Fik-shun and Cyrus join him on stage. This kid is fabulous! What a joy and talent he is. Everyone is on their feet. He was able to meet his idol Stephen ‘Twitch’ Boss. According to him, it was the best day of his life.
Her dance is for her brother who was struggling with addiction who is now sober and healthy. Jourdan Epstein, age 24, from Plymouth, Minnesota is fabulous. I again had goosebumps. She gave Christina chills. Mary puts her on the hot tamale train. She is through.
Johnny “Waackd” Gibson, age 22, from New York City. I think he had improved from his audition 2 years ago. It is a “yes” to choreography and from there he is through to the next round.
Armen Way is a 28-year-old from Glendale, California, who tried out in season 10. I was turned off by him last year. His dance appeared to be all about himself. He seemed to objectify women from this rap video they showed in his audition packet. Last year he was sent home because he dropped Malece Miller on her head. I LIKE this version of Armen better. This year he had a new partner, Malene Ostergaard, a 25-year-old from Studio City, California. She reminded me of Mila Kunis. That dance was hot and sexy. I felt that Armen’s attention was on his partner this time and the dynamic between them sizzled. Yep, I like this version of Armen much better. Mary Murphy talked the entire way through the dance about how impressed she was. What a dynamic couple they are. She felt Malene ran the hot tamale train straight off the tracks. Christina said people would love them both. They are through to the next round.
Philadelphia Day 1
Prima ballerina Misty Copeland joined Mary Murphy and Nigel Lythgoe during this audition.
Bridget Whitman, age 19, from Tempe, Arizona was up first. Her back-story was making me cry. One of her last memories of her dad before a tragic car accident killed him was her telling him that she wanted to be on the show. He told her that she could get there through a lot of hard work. I was sobbing. Mary Murphy was crying, too. Is she the best contemporary dancer I have seen during the auditions? No. But she does deserve a shot in the next round. Misty thinks she is a beautiful dancer. Mary can feel everything she is going through. She gets her ticket.
They then showed a montage of really fantastic male dancers.
Amir Sanders, age 21, is a self-described funky ballerina from Baltimore, Maryland. She is interesting from her look to her style of dance. It did not give me goosebumps, but I enjoyed it. Misty thinks her technique and lines are beautiful, but there were small moments she needs to focus on to improve. Mary thought for a moment it was like watching Diana Ross striking a pose. They sent her to choreography, which shocked both the audience and me. However, she does make it through to the next round after choreography.
Last year’s Jenna Johnson had a partner last season who was too young to audition. Landon Anderson, age 18, from Springville, Utah came back to audition (along with Jenna). He had some nice foot work but is he as strong as some of the other guys on the show? I don’t know about that. Mary thought he was a great partner. Misty said that he became someone else for dancing–like a little boy in speaking but a man in dancing. He gets a ticket to move to the next round. Jenna gets a surprise as well when Nigel extends to her an invitation to come back this season to be an all-star, something they don’t usually do when they were just contestants the prior year.
The last contestant for day 1 was Shafeek Westbrook. In season 9, he left with a really bad attitude. His words were “not coming back ever.” He hails from Upper Darby, Pennsylvania and is 24 years old. I loved his moves, but I was not sure why he felt the need to take his shirt off. Mary wanted more “wow” moments. Misty felt like he was trying to sell them his body versus his dancing. Nigel says yes to choreography. He makes it through to the next round after the choreography sessions.
Billy Porter joins the judging panel for this round of auditions.
First up is Stanley Glover. His mother died when he was 4 years old while he was sleeping next to her; she had a heart attack in her sleep and they found her dead in the morning. Both sides of his family failed to go to the court date that would decide guardianship of him. His mother’s friend, Margaret Chamberlain, stepped up and brought him into their home. He is a 19-year-old from Chicago, Illinois. His choreography was genius and for a moment the words “Shelob’s mate” popped into my mind. Or at least a creature from the show on the CW called “The 100.”
Krumper James “Banks” Davis was shot twice in his knee four years ago. They were about to amputate his leg but his pulse came back. He is from Brooklyn, New York, age 24. This gave me goosebumps. It was such a unique style of krumping. Way to represent Brooklyn (I was born there). Billy felt like he was a true storyteller and it was fantastic. He gets to go to choreography, but he does not get to the next round.
Dance Crews
This was a tough choice. It was between a Bollywood/Hip-Hop Dance Crew called Wanted Ashiqz versus a group of hip-hop street style called Mix’d Elements. I’m really torn between them. As of right now, we do not know the results of the vote.
Tags: Alla Kocherga, Amir Sanders, Armen Way, Bridget Whitman, Casey Askew, Christina Applegate, Cyrus, dance crews, Fik-Shun, Fox Broadcasting, J4, James "Banks" Davis, Jenna Johnson, Johnny "Waackd" Gibson, Jourdan Epstein, Landon Anderson, Legacy, Los Angeles, Malece Miller, Malene Ostergaard, Mary Murphy, Misty Copeland, Mix'd Elements, Nigel Lythgoe, Philadelphia, season 11, Serge Onik, Shafeek Westbrook, So You Think You Can Dance, Stanley Glover, Stephen 'tWitch' Boss, SYTYCD, Timothy Joseph, Wanted Ashiqz
So You Think You Can Dance S10 Performance Finale Show
Tonight was the last performance show that would count for voting before next week’s announcement of the top girl and top guy winners. It was a terrific season with such wonderful dancers. There were highs and lows but overall the quality level of the performers continues to improve each year. At the end of 10 seasons, this show has not lost its appeal. I think part of that is because other networks are not producing dance shows that are causing us to fatigue of them unlike perhaps American Idol. Although I have a special place in my heart for Aaron and Jasmine, Amy and Fik-Shun had a terrific night as well. I think they will have wonderful careers ahead of them regardless of whether they win the big prize. Every dancer had the opportunity to work with some of the best choreographers in the business and provided a wonderful education for them. Let’s review tonight’s show.
Gabby Douglas, Paula Abdul, Nigel Lythgoe and Mary Murphy.
The Dances
Dancers: Aaron and Amy
Style: Jazz
Choreographer: Ray Leeper
Song: “Primitive” by Richard Vission vs Luciana
Rawr! Rawr! Rawr! It is nice to see Aaron always connecting with his partners whoever they may be. It was high energy. They both extended themselves with each stretch. I think Aaron kept his shoulders down, too. I think there may have been a time or two when I think Aaron’s leg should have been extended more if I was comparing it to Amy’s legs. I liked the mixed tempo of the song, too because it allowed for a mixture of dance styles which I guess is why Ray was calling it jazz fusion.
The judges: Nigel said it was a great way to open the show. He loved the costumes. They laid down the gauntlet. Mary said they knocked it out of the park again. They had so much strength said they attacked it ferociously. Their strength as dancers blows her mind. Gabby said it had spunk and attitude. She loved the costumes. Paula said Amy’s center is ridiculous and stunning. She felt Aaron is a generous partner. He does not steal focus from Amy. He breathes character into each one he portrays. He takes her breath away watching him. The two of them are fantastic–great opening.
Dancers: Jasmine and Fik-Shun
Choreographer: Travis Wall
Song: “Spiegel Im Spiegel” by Angela Yoffe and Vadim Gluzman
Couple growing apart floating away from each other (imagine under the ocean). I thought it was lovely how they were already into character before the song even started. I am very impressed with Fik-Shun and how much he has grown. There were definite issues with height here though. At times it was clumsy because of it but there were times when I felt myself breathing in their ebb and flow. Jasmine always stole my eye but Fik-Shun rose to the occasion. It embodied a great sense of sadness. Not quite goosebumps but right on e edge for me.
The judges: Mary was standing. She thought Travis was brilliant. It was such beautiful movement. They looked beautiful together. Jasmine is captivating to watch. Fik-Shun throws her off all the time. His emotion and his tenderness and his partnering to her is so magnificent to watch. The beat hit in the chest got her. Gabby had goosebumps. Jasmine’s lines are phenomenal. Paula admires Jasmine. She has been exquisite this entire season. She bought that they were underwater. Every time she sees him on stage, she is increasingly aware of the incredible journey he has made on this show. Nigel thinks that Jasmine’s lines were just perfect. Nigel said Paula nailed it in her critique. In Vegas he was like Bambi on ice and now seeing him now extending himself, and this routine did not allow for him to show his personality–it forced him to dance. Both did really well.
Dancers: Aaron and all-star Melinda Sullivan
Style: Tap
Choreographer: Anthony Morigerato
Song: “When I Was Your Man” by Bruno Mars
I have not had opportunities to see a lot of tap done to modern music. Next time I have an argument with my husband I will suggest tapping it out. So nice seeing Melinda back. The depth of emotion was there as well. I really enjoyed it. Go Aaron!
The judges: The panel was standing. Gabby thought it was just incredible performance. She loves tap. They nailed it, they killed it, were on fire, and wow–just incredible. She was in awe. Paula is excited that there was a tap routine. She thinks Aaron is the ultimate storyteller of this season. Nigel thought who could have thought of doing so much in a couple of step pickups. He thanked Aaron for being the first tap dancer in the finale. It was a great concept that you can have a conversation tap dancing. It was well danced. Mary LOVED IT!!!! She thought it was spectacular and the complex rhythms that they brought to the dance right now was music to her ears.
Dancers: Jasmine and all-star Comfort Fedoke
Style: Hip-Hop
Choreographer: Tabitha and Napoleon D’Umo
Song: “Run The World (Girls) (Nappytabs Remix) by Beyonce
Bikes! Girl power! That was fabulous. I know exactly why she picked this–strategy. She knew Amy was going to choose contemporary. She wanted to show us she can handle anything, and she can. She kept up with the fabulous Comfort. That was so fast and hard-hitting, I am amazed these finale dancers have the energy and strength to do so many dances tonight. The audience was crazy excited, too.
The judges: Paula said wow, unbelievable. If these two girls ran the world life would be really fun. She was ferocious on this stage. Nigel said Jasmine is showing us that she is better than just contemporary. She is “in it to win it” tonight. She is fighting to win. Mary said Jasmine danced it like she choreographed it. She is a bad ass in the best possible sense. Gabby said she should get a call from Beyonce–that routine was the bomb. She is looking for a new floor routine for 2014 and maybe that was it.
Dancers: Amy and Fik-Shun
Style: Argentine Tango
Choreographer: Leonardo Barrionuevo and Miriam Larici
Song: “Hazardous/Zero Signs” by PP Music (UK)
I think this music was on Battlestar Galactica (the newer version). I thought she was leading. He tried hard and did his absolute best but Amy did a better job. I really do admire his spirit.
The judges: Nigel thought this was Fik-Shun’s toughest challenge yet. It was a brave attempt but was not strong enough for him. He felt Amy was really strong in this. The competition begins now between Jasmine and Amy. Mary said he was there for her as a partner but pointed out some weaknesses in technique. Amy is one of the most dominating dancers on all the seasons of So You Think You Can Dance. Gabby loved it and the emotion and chemistry. Paula thought Fik-Shun was handling Amy pretty darn well and Amy was perfection.
Dancers: Jasmine’s solo
Song: “Ready For Love” by India.Arie
I could watch her all day and get goosebumps all day long. I also now want her haircut. New news–Cat Deeley fought for her to be in the top 20. So Aaron and Jasmine were both not supposed to be here and here they are, poised to take it all. I love you Cat Deeley!
Dancers: Jasmine and Aaron
Style: Samba
Choreographer: Dmitry Chaplin
Song: “Can’t Touch It (Radio Edit) by Ricki-Lee
That was soooo entertaining! But where were the samba hips? Felt it was danced more like a jazz or Broadway dance versus a samba. Wardrobe malfunction but in this case the costume would not come off Jasmine. Aaron’s arm positioning is a bit sloppy.
The judges: Mary said it was not danced very well. Jasmine fared a little bit better. This was not the best thing for both of them but not bad. Gabby loved it. It was not their strongest one. Paula said they have been one of her favorite couples of all time. The energy and the synergy are beautiful. Nigel said every single thing you do tonight has to be outstanding. He wanted more from them. The chemistry was not there tonight. He felt they were not comfortable with the routine tonight.
Dancer: Fik-Shun’s solo
Song: “Gangham Style” by Psy
I like what he said in his montage. He may not be America’s best dancer, but he could be America’s favorite dancer. I had my doubts about how this would turn out with such an iconic song. I loved that he pulled some of Psy’s dancing and made it his own. I enjoyed it so much.
Dancer: Amy’s solo
Song: “Unchained Melody” by The Righteous Brothers
We’ll never forget your dance with Travis either. Amy has such passion and such beautiful technique. I have said it before and I will say it again. She reminds me of Melanie Moore.
Dancers: Fik-Shun and all-star tWitch
Choreographer: Luther Brown
Song: “Hello Good Morning (Remix) by Diddy-Dirty Money featuring Nicki Minaj and Rick Ross
Wow! Fik-Shun is short! They looked like a father and son dancing together. That was a fun routine. I was watching tWitch, however. I could not help myself. I thoroughly enjoyed that.
The judges: Gabby thought it was fantastic and she loved it with the spark and attitude she loved. Paula wants to dance with Nigel. Nigel thought it was tWitch and tWitch Jr. It was fantastic. He gave Fik-Shun some career advice that tWitch kept growing after the show was over and that is what he needs to do, too. Mary loved it. She thought he is going to be very proud when he sees it play back later.
Dancer: Aaron’s solo
Song: “You & I (Acoustic) by Jason Mraz
He truly has made me fall in love with contemporary tap. The height on that jump! Nigel said it–Fate has brought you to us for a reason. I believe it.
Dancers: Amy and all-star Robert Roldan
Choreographer: Stacey Tookey
Song: “Say Something” by A Great Big World
It is a story about courage and bad timing. Best friends; he’s been in love with her for years. She realizes that she loves him back. She has to find the courage to tell him before he goes. Goosebumps! Oh my God. That was my favorite routine of the night. I held my breath when he lifted her up in the air and held her for a second before coming down. It was so powerful and vulnerable at the same time. I felt every part of the story as they danced. And the story did not have a happy ending. Maybe there will be a part 2 of this story. I love Robert.
The judges: Paula said this was her favorite routine of the night. The pairing of the two of them was a symphony up there. Her raw emotion–she just steals her heart every time. Nigel said this was terrible choreography–why did he leave her? They were getting along very well (he was kidding). The combination of emotion, performance, technique from the pair of them was intoxicating. She stepped into his lead tonight. Mary loved it. Amy gives every single part of herself. The energy comes from her soul and radiates outward across that stage. Gabby said it was one of her favorites this evening. Everything was on-point.
Dancers: Fik-Shun and Aaron
Style: Broadway
Choreographer: Tyce Diorio
Song: “The Jitter” by Big Bad Voodoo Daddy
Enjoyable. They both did a good job but it is not quite my style. They complimented each other well.
The judges: Nigel said it reminded him of a Michael Kidd routine. It gave them fun stuff. They did not stop dancing since the music began and they must be exhausted. Mary said that absolutely was the cutest thing ever. Aaron was back on top again with this number and Fik-Shun just charms the pants off everyone. Gabby loved the energy. They were fantastic, phenomenal. Paula said both of them were in their element completely. The two top showmen of the season. She also reminded the audience that Tyce was paper of her dance crew a long time ago.
Dancers: Amy and Jasmine
Choreographer: Mark Kanemura
Song: “The Diva Dance” by Eric Serra
Mark has been hanging out with Lady Gaga too long. Siamese twins from the fierce jungles of Saturn? The music reminded me of The Fifth Element. Wait! It is the same music–when the blue diva who has the stones inside of her and she sings opera and gets shot and dies but not before Bruce Willis does a c-section and delivers wind, fire, water, and earth stones. I am not really sure about this one. It was different and creative. The ladies did a wonderful job. It will be something I never forget and that is a good thing.
The judges: Mary said she has a bit of clown in her soul too and that was crazy and creative and quirky and she loved it. If Mary could vote them both into first place she would. Gabby thought it was a great way to end. It was crazy and fun and had humor to it. Paula said she finally felt like she was home. E.T phone home. She loved it. Nigel said it was a zany routine. It was loopy which is why he understands why Paula felt at home. It was fun. He felt this year the girls have stolen the show for him. If they were both in competition with the boys this year, he felt they would both would have won. They are some of the best dancers they have ever, ever had.
I will have to agree with Nigel here. Both Amy and Jasmine overall did the best job tonight.
Tags: "Can't Touch It (Radio Edit) by Ricki-Lee, "Gangham Style" by Psy, "Hazardous/Zero Signs" by PP Music (UK), "Hello Good Morning (Remix) by Diddy-Dirty Money featuring Nicki Minaj and Rick Ross, "Primitive" by Richard Vission vs Luciana, "Ready For Love" by India.Arie, "Run The World (Girls) (Nappytabs Remix) by Beyonce, "Say Something" by A Great Big World, "Spiegel Im Spiegel" by Angela Yoffe and Vadim Gluzman, "The Diva Dance" by Eric Serra, "The Jitter" by Big Bad Voodoo Daddy, "Unchained Melody" by The Righteous Brothers, "When I Was Your Man" by Bruno Mars, "You & I (Acoustic) by Jason Mraz, #JasTurns, #TruthinFikshun, . Aaron Turner, Amy Yakima, animators, Anthony Morigerato, Argentine tango, ballroom, Broadway, Cat Deeley, Comfort Fedoke, contemporary, Dmitry Chaplin, Du-Shant "Fik-Shun" Stegall, Fox Broadcasting, Gabby Douglas, hip-hop, Jasmine Harper, jazz, Leonardo Barrionuevo, Luther Brown, Mark Kanemura, Mary Murphy, Melinda Sullivan, Miriam Larici, Nigel Lythgoe, Paula Abdul, Ray Leeper, Robert Roldan Stacey Tookey, samba, Season 10, So You Think You Can Dance, solos, Stephen 'tWitch' Boss, SYTYCD, Tabitha and Napoleon Dumo, tap, Travis Wall, Tyce Diorio
Categories : Fox Shows, So You Think You Can Dance, TV shows, Uncategorized
|
cc/2020-05/en_middle_0097.json.gz/line1399985
|
__label__wiki
| 0.624095
| 0.624095
|
Celebrity Corner: Bart Montgomery: Promotional Wizard (Part 2)
Please read here for Part 1 of the interview: https://pbmom.wordpress.com/2013/11/01/celebrity-corner-bart-montgomery-promotional-wizard-part-1/
How long do you get to work on a particular preview before it goes to air? Have there ever been close calls to deadlines? Can you share anything specific if you did?
Usually you get a week to work on promos for a show during the regular television season. You want to finish promos for an episode at least a week before the episode airs so there’s time for viewers to see them. On launch promos for new shows you get a longer time frame, perhaps weeks or months because you have the pilot episode already. For returning shows, you have to wait for production to start before you can get material to cut promos with.
There have been some close calls when it comes to a promo making air. Back in the day when I was doing promos for “America’s Most Wanted,” we would promo the specific fugitive that the show was looking for and sometimes viewers would see the promos, recognize the fugitive, call the police and the fugitive would be arrested before the actual episode could air. This would throw everything off and we would quickly have to produce new promos featuring a different fugitive. I remember having an hour to produce a new promo and finishing just in time for the new promo to be slapped into a tape machine and broadcast. Haven’t had to do that in a long time, thank God.
(X-Files Promos)
How do you decide which way to take a preview? I noticed that just recently on Twitter you asked viewers what they wanted to see in a preview and you got a pretty good response–no spoilers, action, explosions, relationships, which I think pretty much covers all aspects.
Ideas on how to approach doing a promo will usually come to me while I’m watching an episode. I take lots of detailed notes on dialogue and shots that I like. For “Fringe” alone I’ve taken around 2000 pages of notes. Notes make things move faster during an edit session because it’s easier to find what you need.
During most of my career I’ve never really had an occasion to ask fans of a show what they’d like to see in a promo / trailer. Twitter provided the perfect opportunity to learn what fans thought about how a favorite show is being sold to them. I asked fans questions when I was working on “Fringe” and the responses were very helpful. The music we used in the final “Fringe” promos was suggested by a fan. Fox has always been a leader in embracing new technology. Twitter is a wonderful tool for promotion and linking fans together and with “Fringe” it really showed. There are some AMAZING “Fringe” fans in the Twitter-verse and I am still awed by what they were able to pull off.
(Fringe Promo–Thanks @NataliaQuique)
I think that in some aspects part of your job is sales. You have to sell a show in a very specific short period of time. I think it is very reminiscent of commercials for products except people are usually flipping through commercials on their DVRs. Would I be right to think that while flipping through these commercials they have to see this preview of an episode and want to stop and look at it before they continue flipping through the products to get back to their show? If so, that’s pressure!
Television promos and trailers can be considered an art form but in the end yes, you are selling something. Promo producers are acutely aware that viewers are very adept at wielding the DVR remote. I try to have at least one shot in whatever promo I’m producing that will entice a viewer to stop fast-forwarding through a commercial break and rewind the DVR to watch the entire promo. Sometimes a few frames of a promo will be all you have to promote a show so you’ve got to really think about what you’re putting on the screen. It has to be interesting. It has to be compelling because most everyone is an expert at watching television and people know when you’re messing with them. The audience knows when you’re not being honest. They may not be able to quantify exactly why something in a promo or trailer isn’t quite right but they know something’s wrong. Make sense?
Alcatraz Promo
Have there ever been moments where after a piece airs you feel you could have done things a little differently, or is there no second guessing yourself in this line of work?
Yeah, I have thought of better ways to do a promo after the fact. Sure, there are a times when I feel that I absolutely nailed it but they’re rare. Given time you can find a million different ways to make a promo so there is some second guessing, I suppose.
I remember a particular promo I did for “The X Files” that had a shot in it that I thought was really cool. I didn’t stop to consider that younger viewers might be frightened by this shot. It was just a cool creepy shot to me. So the promo aired and I got a few irate e-mails from some parents who didn’t appreciate having to explain the “coolness” of this particular shot I’d used to their children. They were right. I learned from that mistake and don’t think I’ve ever repeated it.
Second guessing has its merits the trick is to do your second guessing before the promo airs.
With all the changes coming so rapidly in the way people view television, do you have any thoughts about the future for promotional clips?
Yes, things are changing fast in the world of television viewing. I think the future of what a promo will look like and how it will be viewed will evolve depending on one thing and that is when a viewer records a show on a DVR or streams it off the internet, will that viewer be able to fast-forward through promos. We all know that right now if you record a show on DVR, you can blaze through anything by fast-forwarding. Will that continue to be possible? We’re already starting to see disabled fast-forwarding in video on demand and streaming. Will that extend into all viewing options? Only time will tell.
Regardless of what happens, my personal philosophy regarding promos is this: Most everyone who watches television is an expert at watching television. Even if they can’t quantify why what they’re watching promo wise feels wrong or out of place, they will know something is not right. Viewers know when they’re being messed with because they’re experts at watching television. So, if you’re viewing a recorded show and a promo begins to play, that promo had better somehow grab your attention from the first frame and be compelling enough so that you don’t fast forward through it, you just have to watch it. It’s as simple and complex as that.
The future of promos will be interesting. I suspect there will be many new options explored for enticing viewers to watch new shows as well as established ones. Ten years from now who knows what the promo world will look like? It’s certainly changed a lot in the last ten years. One of the most exciting things to me is fan participation. It’s amazing to see fans up-loading promos of their favorite shows to the internet and sharing them with others or creating their own fan made pieces. It’s really cool. When fans get involved in this way, great things happen and as a promo producer, it’s really a lot of fun to watch!
Bart next to the Headless Horseman costume from Sleepy Hollow
I’d like to thank Bart for being SO generous with his time and his answers and to @NataliaQuique for being the ultimate uber-Bart-fan who gave me an idea and a push in the right direction. I hope you enjoyed getting to know him better. I sure did!
Tags: "Why Am I Here", 24, Almost Human, America's Most Wanted, Bart Montgomery, Beverly Hills 90210, Collide, crews, every job is important, Family Guy, Fox 26 Houston, Fox Broadcasting, Fringe, Garbage, Geoff Calnan, Harsh Realm, Johnny Cash, Joseph Mallozzi, Married with Children, Millenium, news, Pandora, producer, production, promo creative, Sleepy Hollow, Stargate, Superboy, Terminator: Sarah Connor Chronicles, The Following, The Simpsons, Touch, Trent Reznor, Twitter, writer, X-Files
Categories : 24, Almost Human, Celebrity Corner, Fox Shows, Fringe, Sleepy Hollow, The Following, Touch
For a brief period of time from August 2008 until November of 2008 I had the tremendous opportunity to be part of a live newscast for Fox 26 Houston for a segment once a week called “Your Family Matters.” Other women within the community were also invited. While I was not on every week, because I had a unique perspective of being a mother of a child with a disability or politically because of my no-party affiliation, I was often selected for a particular topic as part of a group. I was captivated by all the elements that went into a production of a newscast. Every job is important. About the same time, I found a blog by Joseph Mallozzi who was an executive producer and writer on the series Stargate. Oftentimes he would feature a Q&A of different people working on the show. It was a wonderful opportunity to learn more of all the elements that went in to creating a popular series. Occasionally I get a chance to ask questions of people working on a show. Occasionally they graciously indulge my request for an interview. What I am learning is that their stories are far more fascinating.
One such person is Bart Montgomery. Many of us on Twitter got to know him as the man behind the promotional pieces for Fringe on Fox Broadcasting. He became a rock star to us (although the modest man he is, I imagine that he would blush that I have said that). I wanted to know more about his career and how he makes certain decisions that lead him to create the videos that lead the viewer to decide whether or not it is something they might want to view. The answers were so terrific that I had to break this up into two parts. Here is the first of two. Enjoy!
What is your official title at Fox?
Senior Writer/Producer, Fox On-Air Promo Creative.
How long have you been with Fox?
I’ve been with Fox for 16 years, first from 1990 – 1999 then from 2006 to present.
Where the magic happens!
How did you get into this particular field of work? Was it something you studied for in college, or something that you got on-the-job experience? If you didn’t study for this particular field in college, what was your major?
I studied Film and Television production at the University of Missouri-Columbia. There isn’t a university level course that I know of that deals with producing television promos. It’s kind of a specialized thing that you learn on the job. I mean, you can learn the basics of television and film production in college and that will help you in promo work but in my university experience, I never studied anything as detailed as promo or trailer production.
To tell the truth, I kind of fell into producing promos by chance. I had moved out to Los Angeles to get into the film and television business in some capacity. I didn’t know what I wanted to do yet but just wanted to get involved. Unfortunately I arrived in L.A. during a writer’s strike so there was no work to be had. Every show and film set was shut down. After a couple of weeks looking for work, a friend of mine from college who was living in Florida and knew I was looking, told me that a friend of hers in Florida had a sister who was working at a promo / trailer production company in Hollywood. She told me that I should contact her friend’s sister so I did. I met her the next day and she hired me on the spot for the high profile job of runner / tape librarian. I had a masters degree and I was running around Hollywood picking up and delivering video tapes. Exciting huh? It does prove, however, that when it comes to getting a job in Hollywood, it IS who you know.
After several months working as a “runner” I was delivering tapes to an edit session for one of the company owners, a man named Geoff Calnan, who is a legend in the promo business. I kid you not, he is a promo master and anyone reading this has seen his work. I had dropped off the videotapes that were needed for the session and Geoff turns to me and asks me what I wanted to do in the company. Without thinking I replied, “I want to do what you do, produce promos and trailers.” I remember he looked at me for a moment and said, “Okay, you’re doing the next promo for “Superboy.” “Superboy” was a syndicated show that we had the promo contract for at the time. So, that was the first show I ever produced a promo for and it launched my career. I’ve even found some of my “Superboy” promos on YouTube— Go figure.
You do/have done the previews for episodes like The Following, Sleepy Hollow, Fringe, Almost Human, Touch, and X-Files. What are some other shows?
Well, in addition to the shows you’ve listed, I can give you a short overview. I’ve produced promos for “America’s Most Wanted” “Beverly Hills 90210” “The Simpsons” “Married with Children” “Millenium” “Harsh Realm” “24” “Family Guy” “Terminator: Sarah Connor Chronicles” to name a few.
Is it a team effort to produce the one preview or do you work on a particular project/episode by yourself while others are working on other episodes?
Usually each producer is assigned a show to write and produce promos for. Sometimes, especially when a show is first launched on the network, several producers will be assigned to produce multiple launch promos. But, most of the time, there is a single producer for each show.
Fox is a very creative place to work. They give you a lot of freedom to try different approaches. I’m biased of course but I think Fox is the best network on television and I’m proud to work here. There, I said it.
(Space Above And Beyond within a commercial block)
Do you get to choose the music for a particular preview? If so you must have to listen to quite a variety and be very knowledgeable about current trends. Do you hear something and think, “That would be great for such-and-such show” or do you file it away for a different time in the future?
Yes, as a producer I usually select the music for the promos. There are times when someone at a higher level will have a specific music idea or there may be a new music track being offered at a reduced rate by an established band looking for exposure that we’ll use but most of the time it’s me listening to various production music libraries. I’m always listening to current popular music tracks looking for ways to use songs that that I think would be good for a show I’m working on. More often than not, I’ll find something really good that I’ll file away in my mind for possible use later. I remember listening to Pandora one morning on the way to work and hearing a song by the band Collide called “Am I Here?” I just had to use it and it became the track I used for the “Fringe” Season 4 launch promos so sometimes it’s just pure luck that you find exactly what you need musically. I’ve used music from Trent Reznor to Johnny Cash and everything in between. One band I’m dying to use in a promo / trailer is Garbage, just haven’t found the right situation yet.
(Come back for Part 2 in the next day or so. The best is yet to come!)
HYPERION — A Film That Needs To Be Made
May is Cystic Fibrosis Awareness Month. According to the Cystic Fibrosis Foundation website, cystic fibrosis is an inherited disease that affects the lungs and digestive system in about 30,000 children and adults in the United States and 70,000 worldwide. In the 1950’s, children rarely lived long enough to attend elementary school. With research and medical treatments, outcomes are much better, yet still a cure needs to be found.
Kickstarter is a website that was developed to fund creative projects. According to their website, since 2009, more than 4 million people have pledged over $611 million funding more than 41,000 creative projects. Each project details what its needs to continue in development. Only projects that reach their goal 100% within a set time will be funded by those people who back the project. Oftentimes developers will offer incentives for certain levels of pledges. People often pledge because they feel some emotional connection to a project.
I was personally moved by the intense commitment of an actor who is associated with a project, Wesam Keesh. He was from the show “TOUCH” that was recently cancelled by Fox Broadcasting. The show opened with a narrative from Jake Bohm (actor David Mazouz) about numbers very similar to the a belief borne from the red string of fate, a Chinese legend that said the gods tie an invisible red string around the ankles of those that are destined to be soul mates and will one day marry each other. The two people connected by the red thread are destined lovers, regardless of time, place, or circumstances. This magical cord may stretch or tangle, but never break, a concept very similar to soul mates. But Tim Kring, the creator of TOUCH, twisted this idea even further to tie a group of individuals’ lives together.
This project on Kickstarter is a film called HYPERION. Hyperion in Greek mythology means “the high one.” Hyperion was one of the 12 Titans. He was the Lord of Light. It is also the name of the tallest Redwood tree.
HYPERION is a story created by Boman Modine who was inspired by the life of Eva Markvoort who passed away April 27, 2010 of cystic fibrosis. Her life journey can be read on her LiveJournal at http://65redroses.livejournal.com/
Being a mother of a child with severe autism and other disabilities, I understand the pain of seeing your child suffer with an incurable disease. Someday I hope a cure is found for autism, and if not that, then how it can be 100% prevented. I know that awareness is only the first step. I prefer having “action” than awareness. If this is the story inspires people to want to give to the Cystic Fibrosis Foundation, then this is a story that needs to be funded. I understand why this movie is called HYPERION. She was a goddess of light in the face of this disease process, in the face of her very palpable mortality. While researching this article, I discovered very few films were ever made that involves stories of the lives of people living with cystic fibrosis. There have been occasional episodes that have involved cystic fibrosis. Not having seen any of those episodes, if it is anything like autism, they likely get it mostly wrong. I felt like HYPERION might be like the movie 50/50. No one understood how this movie could work, but it did. I understand that in that movie, the character had a positive outcome, but we all face mortality and how we live in the droplets of life between birth and death is what matters.
Wesam was kind enough to answer some questions about the project and why this project is special to him.
How did you get involved in this project?
Boman Modine (director/writer) and I first discussed the project in its early stages during a regular coffee meet up. The story touched me deeply and the awareness it brings to Cystic Fibrosis is extremely valuable. You get to see how the disease affects people who have it, loved ones involved, and third party individuals. The message it tells is one of hope, love and strength.
Do you know someone who has (or had) cystic fibrosis?
Before this film I did not know anyone with Cystic Fibrosis, but through the film making process I was so honored to meet a woman who had a lung transplant from CF. Her story is amazing. She had her lung transplant 16-1/2 years ago and is doing great right now. Her attitude through most of her life has been a positive one and I do believe her positivity and inner faith pulled her through dark times in her life. Her case, unfortunately, is a very rare one. Transplant patients tend to survive only a few years after the surgery. She also mentioned to me that many young CF patients she has met have had a very negative and pessimistic attitude towards their ordeal. She really wants to let them know that their lives don’t have to be ruined by this disease. Yes, it’s an aspect of their life but it shouldn’t dictate their attitude or achievements that they could accomplish.
In researching how many films there were about cystic fibrosis, there have been a rare few. There have been individual episodes of different television series. What is special about this movie?
What makes HYPERION stand out is the positivity it brings through its story, the realistic relationships that are affected, and the humanity of the human spirit in the most dismal of times.
I see that Eva Markvoort, the woman who inspired this movie, HYPERION, passed away in 2010. Did you get to meet her before her death or her family at all before filming?
I did not unfortunately. It would have been a great honor.
What did you need to do to prepare for your role in this movie?
As of now, I am still in the process of preparation. Lots of reading and talking with people affected by CF.
Kickstarter can be a blessing for a lot of projects that would not otherwise get made. I see you passionately tweeting about this project, trying to get investors. What is driving this passion?
The message. There are many diseases out there that need research and awareness. Cystic Fibrosis is unfortunately one of those diseases that get overshadowed. I’m a very active person and I couldn’t imagine being stuck in a hospital bed. It would be so incredibly frustrating and depressing for me. I’m thankful for the body I have. So, I want to help those who don’t have what I have. I want to give them strength. We need to show people that even the smallest amount of thanks, donation, or sharing goes a very long way. The smallest effort could have the biggest effect.
From Right: Jason White, Joe Toronto, Wesam Keesh, Eddie Hassell (Courtesy of Wesam Keesh)
The project is struggling. With only 16 days to go, it is only about 33% funded. You do not have to be wealthy in order to be a part of something beautiful. If 3000 people pledged $5.00 each, that would get them there. I easily have 3000 views of my blog. I decided to join the cause. Because in the end, we are all connected.
For more information, please check out the project at: http://www.kickstarter.com/projects/447490465/hyperion-0?play=1&ref=search
Follow these people associated with the project on Twitter:
Boman Modine: @bomanmodine
Joe Toronto: @joetoronto10
Wesam Keesh: @WesamKeesh
Tags: 65redroses.livejournal.com, Boman Modine, Cystic Fibrosis Awareness Month, Cystic Fibrosis Foundation, Eva Markvoort, HYPERION, Kickstarter, May, Tim Kring, Touch, we are all connected, Wesam Keesh
Series Finale for Touch on Fox
On Thursday, May 9, 2013, Fox Broadcasting confirmed what we all had been expecting: Touch would not receive a season 3 renewal. Friday, May 10, 2013 would be the series finale.
I think we could see the writing on the wall from the beginning of season 2. It was supposed to be aired in October 2012. Then it got bumped to January of 2013. Then it was pushed to Friday, February 1, 2013. Then it was changed to Friday, February 8, 2013. People in the science fiction community believe the Friday night slot is the place where shows go to get the final nail in the coffin. It was true for Fringe.
There was very sparse advertising for the show’s premiere. The shows the network had more faith in, like The Following, The Mindy Project, Ben and Kate, and New Girl got far more advertising both on-air and with the use of social media.
The first season struggled. Although 12 million viewers tuned in to watch it on Monday, a sweet day in the past for Kiefer Sutherland when he was on “24”, viewership quickly declined and it was moved to Thursday night after Idol, hoping to give it an American Idol bump. Fringe had that same progression. Monday to Thursday to Friday. For years now, people have been critical of the antiquated Nielsen structure to determine number of viewers and to target 18- to 49-year-old men. As a woman, that is really insulting to me. I have as much buying power as my husband, if not more. People have new viewing habits. The days of an actual TV in a home are limited as people go to the internet to watch TV shows now. But the methods advertisers base their rates are still built on the old model. In February, it was reported that Nielsen was going to roll out a new system. It would include people who watch over broadband, XBox, Playstation. Then next phase of the program would include any type of video viewing. It is also adding a new viewing measurement for social media to include people participating in tweeting and those exposed to those tweets (I am thinking this sounds similar to Klout). But it is too late for many of our cult favorites. Fringe would have benefited greatly from the massive fan support on social media.
The story also struggled. The biggest mistake was calling Jake autistic. After the first episode, many of my friends tuned out, turned off by the unrealistic portrayal by Hollywood AGAIN of their beloved children. At first, the show was about finding people who were hurting and help restoring happiness and wholeness to their lives. Shows are often a reflection of the times we live in. I think this is why The Following has had tremendous success–it is a very dark show. Then mid-season, Touch started building into it a mythos that sounded promising but moved a little bit too slow for an audience who needs to be on the edge of their seat an entire show to go out and convert others to watch it. When season 2 was introduced, people who gave up by the end of season 1 did not care to tune back in to see all the wonderful changes that were made. The story pace was quicker. It was building the mythos quicker, resolving things (like finding Amelia) in a timely manner, introducing an element of evil vs. good in the plot. Without a massive campaign saying, “Come try the show out again.”
Shows struggle in their first year to find their footing. I know this is true of Stargate Universe. It came from a franchise that had phenomenal fans and a lengthy history of good ratings, 10 seasons of Stargate SG-1, 5 years of Stargate Atlantis, 2 Stargate DVD movies. With the success of Battlestar Galactica, they wanted to try a storyline they had really wished to pursue on Stargate Atlantis but could not–the heroes were trapped without any way to contact Earth or the original SG-1 team for help. By the end of season 1, Stargate Atlantis knew it needed to connect back to Earth. In Stargate Universe, they used a unique way to do this. There was an active campaign from within the Stargate community to boycott the show and point out all the flaws. Free speech still governs our society and they had the complete freedom to express their opinion. Whether it played as a factor in the ultimate demise of Stargate Universe remains unclear. I do know season 2 of Stargate Universe was better than season 1. Season 2 of Touch was better than season 1.
I was concerned for the finale. In the last episode, Amelia and Jake had been kidnapped after Martin’s car was hit. Would we have a finale where someone’s life hung in the balance, and the viewers would not have resolved whether or not a character would live or die? Would they be endings that would leave us at peace? Would the people in season 2 who were evil or sometimes evil and sometimes good receive justice? Would a new threat be introduced? Would Avram be found or locked away somewhere that we will never know if he is freed?
After watching the show, I have a feeling Tim Kring saw the possibility that this show would not get a season 3, and he decided to write the final episode, giving emotionally invested fans a story to leave in peace. He gave us just that. And the ending was a sweet acknowledgement of the first episode with the same narratives. I did cry at the end. However, it was not like the finale of Farscape where I was so disgusted with the abrupt cancellation and the inability of the writers to give fans a proper ending that I talked about it for years and, in fact, boycotted the network (in my narcissistic narrow world, I thought it would matter) for years, missing out on Stargate SG-1 for quite awhile.
Coming on the heels of hearing of Touch’s demise was the immediate rumors that Fox Broadcasting is now in talks with Kiefer Sutherland about reviving “24” in a “limited fashion.” Some on the internet think it might be a 13-episode series. Some think it might be the movie he was hoping for. For others, they are speculating that a miniseries might work. With the number 13 episodes, I now wonder if they plan for this to be tied in with The Following next year given its phenomenal ratings as that would be about the number of episodes. The first episode could give us background for the new story and then the episodes could still be in a full-day fashion with each episode being: “The following takes place between 9 a.m. and 11 a.m.” which would be more realistic in Los Angeles or New York traveling times (or wherever they plan for it to take place). Twelve episodes of 2-hour increments would give us “24”.
And so it goes….another well-written show that goes into our history. I want to thank the cast and crew for producing a type of show I was craving, something I cared deeply about. But in the end, thank you for giving us a happy ending.
Tags: "The Road Not Taken", 10262000, 2013-1026, 24, 36 righteous ones, Adam Campbell, Adeline Danvers, Amelia, Amelia Sequence, aster, Aster Corps, autism, Avram, Bodhi Elfman, BreakWire, California, Calvin Norburg, Carol Barbee, Cathy Mickel Gibson, Chinese legend, Citrus O, connected, conspiracy, David de Lautour, David Eick, David Mazouz, David Ury, Dennis Hammer, Dr. Nell Plimpton, Dr. Nicole Farington, episode 9, Farscape, Fibonacci Project, Fox Broadcasting, Fox VIP, Frances Fisher, Fringe, Greg Ellis, Guillermo Ortiz, hidden clues, hieroglyphics, Hilda Bowen, Hilda Clark, Hilda Clark Bowen, Jake Bohm, jake does not have autism, John Boyd, kabbalah, Kase, Katherine Pope, Kellie JoTackett, Kiefer Sutherland, Lamed Vav Tzadikim, Lori Motyer, Lucy Robbins, Lukas Haas, Maria Bello, Martin Bohm, metaphysical, Michael Amador, mind of God, mutism, Mykelti Williamson, mythos, New Girl, Nicole Burke, Nielsen ratings, PBMom, Peter Chernin, Potawatomi Indian Village, Ravil Isyanov, red, red thread of fate, Ron Rifkin, Said Taghmaoui, Sanford Bookstaver, Saxon Sharbino, SG-1, SGU, Simon Plimpton, Stargate, Stargate Atlantis, Stargate Universe, stars, Talmud, The Fibonacci Project, Tim Kring, Tony Rigby, Touch, Tree of Life, Trevor Wilcox, Whittaker
Categories : Fox Shows, Touch, TV shows
Touch (S2E10) Two of a Kind Recap
I was pleased to see two characters in the pilot who were also in “The Road Not Taken” reappear in this episode. We find out Dr. Nell Plimpton (Samantha Whittaker) is one of the 36. Please read Touch pilot episode I wrote for details. What I was not expecting was the ending which I won’t say until the recap is at that point.
As Martin (Kiefer Sutherland) and Trevor (Greg Ellis) sort out their grief and details of Lucy’s death, Martin realizes Amelia (Saxon Sharbino) was not in the car.
Martin and Trevor grieve.
Meanwhile a creepy man (David Ury) listens in to the conversation and then heads over to Guillermo (Saïd Taghmaoui) who is looking at Dr. Nell Plimpton who is coming to Los Angeles today bringing over an ancient artifact. After the homeless guy wants to get paid, Guillermo kills him. That is going to be some mess to clean up!
Homeless man blood splatter
And meanwhile Amelia is with Jake (David Mazouz) in his room. She wants to stay but can’t yet. Guillermo is coming to get them this date. The numbers are 10262000 (Jake’s date of birth and the day Guillermo’s family died.
Cipher number for tonight.
Over in England, Dr. Plimpton is an insomniac and since “The Road Not Taken” they have had another child. It was Simon’s (David de Lautour) cell phone that made it around the world and helped people find each other. She is going to a clinic for insomnia suffers while in the States [why do I think evil Aster Corps has something in the works.]
The Plimptons
Jake is feverish. He gets Martin to look at the cipher, the number and ultimately he speaks to Martin. “Find him.” Music to Martin’s ears. When Martin sees Avram (Bodhi Elfman) they discussed what happened with Jake and the “he” he has to find is Guillermo Ortiz.
Jake talks!!!!
Jake writes in his notebook the 10262000 but then there is dash for the first time: 10262000 1026 2013-1026 2013-1026.
More numbers. They are changing. The future is in constant motion, isn’t it? I learned that from Star Wars.
Calvin (Lukas Haas) sees a news report on Aster Corps given by Mrs. Nicole Farington (Frances Fisher) to the public trying to reassure them the bad parts of their company which completely denies knowing about have been taken away.
Mrs. Farington of Aster Corps
Trevor was able to discover a body at the morgue.
The building manager (Ravil Isyanov) goes to collect the rent and thinks Guillermo’s room smells “funny” [like death perhaps?]. The number on the door is 27.
You know when someone exaggerates and says “it smells like death in here.” For Guillermo it usually does.
Simon reads the book “Colors” to his daughter, red being on e cover. Nell calls from Chicago where her plane to stop and she was bumped. She wants him to make sure her package is picked up since it will arrive before her. Simon asks her what she sees. She starts saying the things in her surroundings. He asks again and describes the people who once were living on the land, a Potawatomi Indian Village where Chicago O’Hare is now.
Nell’s power. She can visualize history.
Her flight 1026 to Los Angeles was now boarding so she says good-bye.
Avram talks out loud his theories on how the cipher is working. Baruch HaShem (thank God). Jake’s looking at a real map the whole time he is talking. He sees 2013 schedule LAXTrans: Take the 1026 bus to the airport. With Avram kicking the whole way, Jake is ready to take off and Avram has no choice.
Take the bus to the plane (wait, I think the jingle was take the train to the plane).
Down at the morgue, Trevor and Martin see Guillermo’s work. His toe-tag number is 2013-1026.
I hope I’m more than a number on a slab when I die.
When Jake and Avram get on bus 1026, they see a very exhausted Amelia.
Bus 1026 and a waiting Amelia.
Mrs. Farington pays Calvin a visit. She is looking for Tony Rigby (Adam Campbell). She offers Calvin a job. They are running a “sleep clinic”. They have 6 of the 36 [and I bet Nell will make 7 once she checks in]. Calvin looks like he just got a dose of the drug of his choice–a cure for William–and after talking to him, he will be more motivated and convicted to achieve his goal.
Avram tells Martin he has Jake and Amelia. Amelia says today he must find Guillermo or innocent people will die.
Jake, Amelia and Avram
The hotel was at 167 5th Street. The manager lets them in. They see the blood on the floor. Trevor hands Martin some trash.
You can always find great clues in the trash.
They arrive at LAX and Jake sees flight 1026 had arrived. The box is going to St. Matthew University, 2013 West Adams Blvd, Room 1026. Jake writes on a piece of paper and hands it to Avram. They are symbols. He needs to call Martin but there is no cell service. Famous last words “Don’t move!”
Another 2013-1026 connection
A man comes and takes the box away. Jake and Amelia follow. Avram and Martin talk via phone about the hieroglyphics. Nell bumps into Avram. She is wearing a blue shirt. After she gets in the car, Guillermo is right behind her. Guillermo sees a car, and stabs the man to get it.
Nell bumps into Avram at the airport.
Jake and Amelia get into the van going to St. Matthew University.
Avram goes inside and does not see Jake or Amelia.
Mrs. Farington gives Calvin a tour of what they are doing. Aster Corps has their own quantum computer now. They have an almost 90-digit sequence. Calvin accepts the job offer. Mrs. Farington asks Calvin if he knows where Martin Bohm is and he says no. So he is holding out on Aster Corps should they do something he does not like. Or as a backup plan to help his brother in case things go wrong.
I don’t know any Jake or Martin Bohm.
The package arrives. The kids get out.
Trevor tells Martin about the hieroglyphs and gets Martin connected with Simon. Simon says she is in Los Angeles. He asks what hotel she might be staying at. Simon has to think about whether to give this information out, saying “I can lose my job.” But deeper I think Simon recognizes Martin’s voice but cannot place where.
Martin and Avram update their situations. Martin says he thinks he knows where they have gone.
Amelia and Jake use 318 [the beginning number of the sequence] to open the security and then opened the box. Jake tries to leave her the numbers on the crate of what the hieroglyphs say. He does it with a red marker.
Code 318 — back to the beginning.
Dr. Nell arrives in cab 287 [three numbers in the God sequence]. Guillermo pulls up as well. Jake realizes he is there. After going into the building Guillermo follows Nell and attacks her.
I’m gonna kill you, but we have to wait.
Martin drives up. Nell asks Guillermo if he is going to kill her. He replies, “Yes but not until he arrives?” Jake talks telepathically to him, “She’s not the one.” It distracts him enough for Nell to escape.
Jake speaks telepathically through the floor to him.
Nell runs into Martin. Martin tells her to leave and then he calls 911. He then pulls the fire alarm. Guillermo comes out of nowhere and attacks Martin. They stumble into the church sanctuary. [At this point I think Guillermo will not be able to kill in a church.]
Martin and Guillermo struggle for the knife.
Martin has developed some fighting skillz that killz. Martin tells him it’s over. Guillermo breaks down sobbing. He says that today he is going to rid the world of another one of the 36. [I always knew he was going to, in the end, take his own life.
True to the character, however, Guillermo apologizes to God for not being able to complete his mission. He says, “I never found the nest of seven.” [Hmmmm. Now that Martin has found Amelia, I guess this is the quest for season 3, if they get a season 3]. Guillermo then slits his own throat.
Guillermo slits his own throat. He was such a great bad guy. Sad to see him go.
Jake comes in. He rips the Tree of Life necklace off Guillermo’s body. Amelia follows and Martin and Amelia hug.
Jake takes the Tree of Life off of him.
The police officer (Mykelti Williamson) questions Martin. He does not believe Martin. He tells him he needs to come down to the station tomorrow.
I really don’t believe anything you’re saying Martin “Bishop”
Martin talks with Nell. Jake goes to Nell and grabs her hand. Martin tells Nell he thinks Jake wants to show her something.
Jake wants to show you something.
Jake takes her to the artifact. Nell is very excited Jake cracked the code.
The gift of numbers.
Amelia and Jake play chess at the house. Martin asks Avram about the nest of seven. Avram shrugs it off as ravings of a madman. [And I think Avram just lied to Martin].
Avram lies to Martin.
Martin tells Amelia they are going to have to find her father. Amelia tells him he can try, but he won’t.
[There is a book on the table called “Aloft” by Chang-rae Lee; I looked it up and it does not seem to pertain to anything related to Touch…yet].
The book on the table doesn’t appear to mean anything.
Martin tells Jake that Amelia is part of their family now. Jake gives him a small smile with direct eye contact. Jake likes the sound of that indeed.
Jake smiles at Martin.
Tags: "The Road Not Taken", 10262000, 2013-1026, 36 righteous ones, Adam Campbell, Adeline Danvers, Amelia, Amelia Sequence, aster, Aster Corps, Avram, Bodhi Elfman, BreakWire, California, Calvin Norburg, Carol Barbee, Cathy Mickel Gibson, Chinese legend, Citrus O, connected, conspiracy, David de Lautour, David Eick, David Mazouz, David Ury, Dennis Hammer, Dr. Nell Plimpton, Dr. Nicole Farington, episode 9, Fibonacci Project, Fox Broadcasting, Fox VIP, Frances Fisher, Greg Ellis, Guillermo Ortiz, hidden clues, hieroglyphics, Hilda Bowen, Hilda Clark, Hilda Clark Bowen, Jake Bohm, jake does not have autism, John Boyd, kabbalah, Kase, Katherine Pope, Kellie JoTackett, Kiefer Sutherland, Lamed Vav Tzadikim, Lori Motyer, Lucy Robbins, Lukas Haas, Maria Bello, Martin Bohm, metaphysical, Michael Amador, mind of God, mutism, Mykelti Williamson, mythos, New Girl, Nicole Burke, PBMom, Peter Chernin, Potawatomi Indian Village, Ravil Isyanov, red, red thread of fate, Said Taghmaoui, Sanford Bookstaver, Saxon Sharbino, Simon Plimpton, stars, Talmud, The Fibonacci Project, Tim Kring, Tony Rigby, Touch, Tree of Life, Trevor Wilcox, Whittaker
Celebrity Corner: Alex Ruiz of “Touch” Pops In
TOUCH fans will recognize him from the episode “Enemy of My Enemy” as Vicente Corliss. He took the time to talk to the fans about TOUCH on Fox and other exciting events occurring in his life.
Courtesy of Alex Ruiz
Your resume mentioned that you started acting at a very young age. Do you remember your first role?
Yes. Well, professionally, it was a Best Buy commercial. I remember I had to read for the employee part but I had grown a thick mustache for a play I was in called The Bald Soprano so they asked me to read for the father instead. It was until afterwards, shooting the commercial, where I found out that one of the main reasons I got the part was because they found my look hilarious with my mustache.
You have been in commercials, on stage and on television shows. Do you have a preference? And if so, why?
Well, it’s a tricky question for me because they’re all different. It’s a whole different atmosphere and work ethic for each one. I love being on camera, that’s what I really really enjoy and I know how difficult and fun and exciting and thrilling and rewarding being on stage can be but when it comes down to it, being on camera in a show or movie is what I really love and embrace.
Within the world of acting, do you have a preference as to drama or comedy that you think enhances your talents best?
Another tricky one. Well, I love comedy and I thought that comedy was what I would excel at. And it has, in a way; certainly in the commercial world. But, throughout the years, I learned how acting, in truth, is really feeling and living and I very much enjoy that. I’m a very private person and it seems that I open up completely when I’m acting, and I do that more often with dramatic parts. I’m not scared of comedy at all and I’m not scared to jump around and go toe-to-toe with comedy because that’s what I do most anyway. It’s like a defense mechanism for me and I use it instinctively in a lot of situations so I’m kinda used to it. But drama is something that really pushes me and makes me discover a lot of things in myself that I wouldn’t’ve noticed before. It’s weird, I know, but I guess other actors might know what I’m talking about.
The role of Vicente Corliss on Touch. Was this an open audition or a part for which you were recommended?
Both, kinda. I was called in after being submitted by my agent and fit the description. I came in, read, and immediately was asked to come in later that day to read for the director. I went to Fox Studios a few hours later and read for the main guys. Apparently, they loved it and offered me the part immediately.
Alex Ruiz as Vicente Corliss on TOUCH
Had you watched the show before you got the part? If not, did you go back and watch season 1, or did you want to approach the role without that knowledge?
Yeah, I was told to watch the show before I came to read for the part to have knowledge of the premise. I don’t ever watch shows or movies or plays before or afterwards because I want to give my own interpretation, unless, of course, I’m asked to. I feel it’s best if you come with your own idea and choice for the part without any prior knowledge. Only if you have pure understanding of what’s being asked of you. But yeah, I watched two episodes and once I got the idea I stopped. I liked it though. But then again, I pretty much like anything Kiefer Sutherland’s in. [Editor’s note: ME TOO!]
What were some unique things that happened on this set that you have not encountered on other sets before?
Professionalism. In every way. I’ve been in a lot of sets and worked with a lot of people and the way everything was handled was so professional. From the way they treated David [Mazouz] to how Maria [Bello] came in and rocked her scene to how I was directed. It was a very boom-boom-boom-check the gate process and before I knew it the scenes were done and ready to go. We rehearsed once on a closed set and once we nailed it everyone was brought in to shoot it and bam, the scene was done. They expect you to come prepared and you appreciate that level of professionalism because everyone respects everyone else’s work and time.
Maria Bello, David Mazouz, and Alex Ruiz’s scene in TOUCH
I like to think of every experience as a learning moment. Did you learn anything on the set (as an actor or on a more personal level) that you can share with us?
I feel like I learn something on every set that I’m a part of. I’m not sure if I can pinpoint exactly what that is but I know it and utilize it the moment I’m there. I think it’s really just listening. Not only to the director but to everyone around you. Literally everyone. The sound guy putting the mic on you has heard a billion things about everything that’s happened on every set he’s worked with so I listen to what (s)he says. On break I’m drinking coffee and the lighting guys talk about work and I infiltrate their conversation and just listen. I try to learn every facet of my job as possible by listening and being aware of how everything works. From the director, they’re all astronomically different and if you listen carefully and adapt to his world then you’ve got another little safe of knowledge stored in your brain that you can open up and use in another situation. The entire process is learning so I can’t really give something specific when it’s there from beginning to end.
Maria Bello and Alex Ruiz in TOUCH
You know I have to ask…have you had a Touch-like moment in your life, something you felt was more than coincidence?
Of course! My family and I have an apartment that we stay at in Mexico that used to belong to my grandma who’s been deceased for about 15 years. I slept in her bed one night, which we do every time we’re there anyway, and I had a very strong dream about her. My brother was going through some tough times and I vividly saw her in my dream. I won’t go into specifics but it ended with her saying “he’ll be okay, he’ll be okay,” and I woke up screaming and crying. I’ve never had a dream like that before nor since and I’m totally convinced that it was my grandma talking to me directly. It was definitely Touch-like in the sense that my brother is completely happy and somehow my grandma calmed me by knowing it would be so.
Do you have any current projects on the horizon?
I do. I’m doing a Mexican novela called Dama Y Obrero in Miami right now. It’s a remake from a Chilean novela of the same name which had enormous success in Chile. The anticipation for it is quite big and I have one of the starring roles so I’m very excited for that. It’ll air on Telemundo later this year. I’m also in negotiations to star in a film which might have some big distribution but hopefully I’ll be able to film it after the novela. I also did a short called Best of Both Worlds directed by amazing director Michael Dunker a little less than a year ago which has made a big splash in the festival circuit and it’s getting financed to be made as a feature where I’ll be playing the same character. So yeah, lots of stuff this year, thankfully.
RAPID-FIRE QUESTIONS
What is the most played song on your IPod or MP3 player?
I just looked it up and it’s Cruel Summer by Bananarama. Imagine that. I’m a huge 80’s guy so I guess it doesn’t surprise me.
What is the last book you have read?
I read “Miss Peregrine’s Home For Peculiar Children” by Ransom Riggs. It’s creepy as all hell because photographs visualize the narrative. Not a bad book. Right now I’m trying to finish “Gone Girl” by Gillian Flynn. A friend of mine recommended it and it’s pretty damn good so far.
Best advice that was ever given to you?
Lots of good advice throughout the years. But the most basic and impactful was my mom saying “oye, ve, y calla,” which means “listen, watch, and don’t say a word.” Works in every situation you’re in if you really think about it.
Sunrises or sunsets?
Definitely sunsets.
Favorite sport to watch?
Basketball. Been a Pistons fan all of my life.
Singing or dancing?
I do a lot of karaoke but my voice is terrible (to me, at least). Dancing I like. I’m talking salsa or mambo or anything that moves your hips without you knowing they’re moving.
Favorite TV show (besides Touch, of course 🙂
The British Office is absolute genius. Anything Gervais, really. I’m also a big fan of Forensic Files and crime shows of that sort.
Thank you so much, Alex, for the generosity of your time and your thoughtful answers. TOUCH fans: Help support Alex by liking his Facebook page and following him on Twitter.
IMDB: http://www.imdb.com/name/nm1991503/?ref_=fn_al_nm_2
Facebook Fan Page: https://www.facebook.com/pages/Alex-Ruiz/159956814141798?ref=hl
Twitter: @alex54ruiz
Tags: "Best of Both Worlds" short, "Cruel Summer" by Bananarama, "Enemy of My Enemy", "Gone Girl" by Gillian Flynn, "The Bald Soprano", Alex Ruiz, Best Buy, Celebrity Corner, comedy, commercials, Dama Y Obrero, David Mazouz, Detroit Pistons, drama, Fox Broadcasting, Fox VIP, Hilda Bowen, Kiefer Sutherland, mambo, Maria Bello, Mexican novela, Mexico, Miami, Michael Dunker, Miss Peregrine's Home for Pecuiliar Children" by Ransom Riggs, PBMom, salsa, Touch, Vicente Corliss
Categories : Celebrity Corner, Fox Shows, Touch, TV shows
Touch (S2E9) Clockwork
Kiefer Sutherland is reunited with his old “24” co-star, Annie Wersching (Renee Walker). This episode marks return of one of my favorite characters on the show, Avram (Bodhi Elfman). BreakWire is about to go under after Guillermo (Saïd Taghmaoui) murdered many of its employees and by the end of the episode, Martin learns the news that Lucy (Mario Bello) was found dead. It also seems to take another pivot in its plot devices by adding ancient hieroglyphics that will need to be deciphered. By the end of the episode, 318 becomes the numbers again, which brings us to the original numbers of season 1, episode 1, and where Calvin (Lukas Haas) thought the sequence would go–back to the beginning and it includes patient number one of Professor Arthur Teller (Danny Glover).
More Detailed Recap:
Jake (David Mazouz) narrates: “Physicists will tell you that time does not exist, that it is a human construct used to organize experience and catalog existence, so we can quantify it, confirm it, remember it. Einstein did not believe in time. He believed in timelessness, that all time existed at once–past, present, future. He did not acknowledge the concept of now. All moments are equally real, equally accessible if we know how.”
Love the attention to detail to show us red, blue, stars, clocks, butterflies
Amelia (Saxon Sharbino) is running. Martin looks at patient 0001 of The Teller Institute.
Jake’s red-striped shirt, red letters on milk, red cereal box
There is a knock at the door. It’s Avram!!!!! He is here to help keep Jake safe.
So nice to see Avram back! Soldier of light!
The number tonight is 948.
Tonight’s number: 948
BreakWire is going under after the deaths of the employees. Martin wants to help Trevor (Greg Ellis) keep it afloat. Trevor has a story on Phillip Green (Paul Vincent O’Connor), a prisoner about to be put to death. It’s patient 0001 [of course!]. [Note where his current address is: Block 9, Cell 48. Also, within the body of the article it talks about him being secretly kept at Teller Institute and Anthony Brown, his landlord, said he would scream numbers at him, and mentions the number 85647. The paragraph on the left is the same as the second paragraph on the right. I’m being too obsessed over this show, aren’t I? LOL]
Patient 0001 of The Teller Institute
The back-story on this man is that there were three murders that occurred in a robbery. Phillip worked at an antique shop. He went back after hours to clean the place out, saw a passerby and gunned him down in cold blood. Supposedly there were no witnesses to the murder. If Martin would do the story for BreakWire, Trevor could get him in to see his attorney.
Mike (Jamie McShane) is making a rock-climbing fortress for his son Max (Blake Bertrand) [who is sporting a red cape and red sneakers, and has a blue swing].
Mike gets a call. There is something he needs to do, but his wife, Jenny (Karis Campbell), thinks not. The argument is interrupted by a splinter. [Not only does Max have red sneakers, they have a star cut into them!].
Check out the red star cut into his sneakers! Wow, the details.
Martin meets with the lawyer, Mr. Miller (Scott Klace) who thinks Martin might be a crazy man. When Martin shares information that was never submitted into evidence, he hears Martin out.
Avram and Jake play chess and uses the French Defense against Jake’s move of king pawn to E4. Jake becomes agitated. He looks at the clock on the wall, takes it down, and starts unscrewing things.
Playing chess (remember Amelia used a chess piece buried in the sand for Jake.
Martin meets Phillip but the man will not speak. He confirms for Martin he is one of the 36. Martin will do anything he needs. Phillip gives him a picture of his daughter. Martin is so used to Jake being nonverbal that he can read Phillip’s intentions quite easily through his facial expressions.
A man in great emotional pain.
His daughter is Dr. Kate Gordon (Annie Wersching). She is a family therapist who specializes in early childhood trauma, behavioral issues, children who are nonverbal, or disturbed.” Martin shares that Jake is nonverbal. Martin tells her about his visit with her father. The story was this: Her father had a gift with numbers and symbols and ancient languages. He was taken to The Teller Institute. When he came back, he shot three people. When she asked him if he did it, he said yes. When she asked why, he went silent. She tried to visit him but every time would be turned away [red thing on the coffee table].
Ahhh… Kiefer and Annie together again.
Avram tells Jake about the history on clock-making. Six gears in six piles [equals 36]. When Martin calls and when he tells Avram that Phillip is one of the 36, Jake stops his work for a moment and looks up.
Jenny tells Mike that making this decision won’t bring his father back [I wonder if his father was one of the ones killed]. Max was in the car when his grandfather was shot. The guy who did this to his father is living his life [so I guess it is not Phillip].
Another man in great emotional pain and a child with a lot of red toys.
[Wow. This gets into a great argument about capital punishment. Are the people who are part of the execution murderers? If you don’t think so, then what happens if you are a part of it, and later find out the person was innocent? Or maybe you don’t know, and you only find out once you have to atone to God before being welcomed into the Kingdom of Heaven? ]
In investigating the case, Martin discovers that nothing was actually stolen at the shop where Phillip worked. The three victims were Richard Davis, Frankin [a typo by Trevor or Greg Ellis?] Price, Derek Reynolds. Their link? Da, da, da, dum–Möbius, a subsidiary of Aster Corps.
“Blue” Orb, Mobius, a link between 3, and a typoed name– Frankin in the parameters, but Franklin in the results. Someone may need to reserve a room for me. This is what I get for having a child with high OCD/low-functioning autism.
The antique store is at 948. There is a red awning and a star shape in the window.
Arrows point to the spots.
Martin talks to Mr. Zedner (George Wyner). Phillip wanted to store a box of his in the store’s safe. It belonged to him and that is what the police found at the house. Phillip’s machine looks like clock gears.
Phillip’s secrets
Martin brings the box home and Jake starts rearranging gears. Avram thinks it is a cipher. They are used for sending and interpreting messages. What kind of message is something to kill for?
A cipher!!!!
Martin meets up with Kate again. She tells him their code for “I Love You” was holding up the middle three fingers one at a time in rhythm. Martin tells her about Aster Corps and thinks that by shutting down and pushing her out he was trying to protect her. He shows her the box. Kate says her dad said it was the road map to finding 36 magical people who could save the world. One key gear is missing.
I….Love….You
The guards start taking Phillip to the execution chamber. His lawyer gets a call from Martin that he and Kate are on their way.
Guard is actor Patrick Brown (my son is Patrick Bowen)–Social Security had first sent me a card with “Brown” as my married name. His Twitter handle is @PBitters mine is @PBMom (just thought that was funny)
Avram makes tea in the red kettle. Jake keeps writing 948 in his book.
It’s always a good time for tea!
In the locker room Mike’s friend is gloating about how they were lucky enough to get picked for “this” [the execution]. They both press their buttons at the same time so that neither knows who gave Phillip the dose that kills him. Mike needs to get some air. Mike recognizes Dr. Gordon. [Would that not at least postpone the execution since Kate is his son’s therapist? They would have to find someone else to push the button.]
Kate wants to see her dad before he is executed.
Mike wants to talk to the warden. [Ah ha! I knew it.] Mike dropped out of the execution team duty and that has delayed things. Kate will get some time with Phillip. [Good grief, I’m crying again]. She tells him Martin’s theory that Phillip was trying to protect her is the only thing that makes sense, Phillip holds up his three fingers–I love you. Kate does the same.
Knowing his fate, the father says I…Love…You for the very last time to his daughter.
Martin feels like he failed that he could not stop it. Kate said that was not it. Kate and the lawyer head to the gallery. Martin feels defeated. However Phillip left a box for him. Inside is a note–“your son knows.”
The weight of the world on poor Jake’s shoulders.
Martin calls Avram. Jake wants Martin to go to antique shop. Jake, Avram and Martin go together. Jake focuses in on a specific clock. Phillip fixed it the night he was arrested. Jake opens it and finds the gear–the key.
The key to the cipher.
Back at the house, Jake puts the cipher in and manipulates the dials. Then gears then start working automatically.
Obviously the still picture cannot show the movement of all the gears. Trust me, it was working.
Trevor comes to the house and tells Martin the shocking news about Lucy [but he does not ask about Amelia which is weird].
The men who cared about Lucy sit in silence together.
When the cipher stops at 318, we are back to the beginning, where episode 1 of season 1 began, the beginning of The Amelia Sequence, also known as The God Sequence, the point Calvin said where the equation would eventually loop around on itself.
The sequence starts again.
Jake looks out the window and sees Amelia.
Jake sees Amelia. Is it real or a dream?
Next week: Jake talks to Martin (his first REAL words because the prior words spoken where inside Amelia’s brain so that was actually telepathic, not verbal)!!!!! And Guillermo is back.
And here’s something very funny. I was looking at this pamphlet in my mail pile and I did not see the word EASTER but the word ASTER and laughed. You know you are a Touch fanatic when this occurs.
Tags: 318, 36 righteous ones, 948, Adeline Danvers, Amelia, Amelia Sequence, Annie Wersching, aster, Aster Corps, back to the beginning, Blake Bertrand, BreakWire, California, Carol Barbee, Cathy Mickel Gibson, chess, Chinese legend, cipher, Citrus O, clocks, connected, conspiracy, David Eick, David Mazouz, Dennis Hammer, Derek Reynolds, Dr. Kate Gordon, Einstein, episode 9, Fibonacci Project, Fox Broadcasting, Fox VIP, Franklin Price, French Defense, George Wyner, Greg Ellis, Guillermo Ortiz, hidden clues, hieroglyphics, Hilda Bowen, Hilda Clark, Hilda Clark Bowen, Jake Bohm, jake does not have autism, Jake SPEAKS next week, Jamie McShane, Jenny O'Brien, John Boyd, kabbalah, Karis Campbell, Kase, Katherine Pope, Kellie JoTackett, Kiefer Sutherland, Lamed Vav Tzadikim, Lori Motyer, Lucy Robbins, Maria Bello, Martin Bohm, Max O'Brien, Möbius, metaphysical, Michael Amador, Mike O'Brien, mind of God, Mr. Miller, Mr. Zedner, mutism, mythos, New Girl, Nicole Burke, Paul Vincent O'Connor, PBMom, Peter Chernin, Phillip Green, red, red thread of fate, Renee Walker, Richard Davis, Said Taghmaoui, Sanford Bookstaver, Saxon Sharbino, Scott Klace, stars, Talmud, Teller Institute, The Fibonacci Project, Tim Kring, Touch, Tree of Life, Trevor Wilcox
|
cc/2020-05/en_middle_0097.json.gz/line1399986
|
__label__cc
| 0.705694
| 0.294306
|
2018 Lexus CT 200h on sale in Australia from $40,900
Brett Davis Oct 17, 2017
Car News, Hybrid, Lexus
Australian specifications and prices for the 2018 Lexus CT 200h have been confirmed, with more technology and creature comfort added to the company’s hybrid-only model.
The Lexus CT 200h is not only the company’s smallest model, it’s also the only model in the showroom that comes solely with a hybrid powertrain. Needless to say, it is the best-selling Lexus hybrid globally, racking up over 300,000 sales since it first arrived in 2011.
For the 2018 update, three variants continue to be offered – Luxury, F Sport, and Sports Luxury – and all are now equipped with a 10.3-inch media interface. This jumps up from the outgoing 7.0-inch size, and includes sat-nav, Enform2, and a rear-view camera.
Newly available is the latest Lexus Safety System+, which is the company’s safety suite that packages in autonomous emergency braking now with pedestrian detection, lane departure warning with steering assist, and adaptive cruise control. It also includes auto high-beam functionality.
In other areas, there’s some new-look 16-inch alloy wheels for the entry model, a 4.2-inch instrument cluster display, with an optional enhancement pack adding 17-inch wheels, LED fog lights, digital radio, and heated front seats.
All models showcase the latest design, which comprises of a revised front bumper bar and headlights, updated front grille with black highlights for the F Sport, a new tailgate garnish, new L-shaped LED taillights, and bi-LED headlights for the F Sport and Sports Luxury.
The stuff under the bonnet hasn’t changed. Instead it keeps the 1.8-litre four-cylinder petrol that’s paired with an electric motor system to generate 100kW combined. Fuel consumption across the combined cycle test stands at just 4.1L/100km. Lexus chief executive Peter McGregor spoke about the new model in a statement, saying:
“The new designs are more emotional and sporty, achieving significantly greater impact with a stronger road presence and a more modern and athletic appearance. Together with the higher levels of standard equipment, the updates will enhance the reputation of the CT 200h as the ideal premium hybrid compact car for customers who enjoy spirited driving while caring about the environment.”
See below for the latest prices (excluding on-road costs):
2018 Lexus CT 200h Luxury – $40,900
Enhancement packs
1: $4500 (leather, 17-inch alloys, LED fog lamps, DAB+, heated front seats)
2: $7000 (adds moonroof to EP1)
2018 Lexus CT 200h F Sport – $50,400
1: $2500 (moonroof)
2: $4500 (moonroof, Mark Levinson sound, smart key card)
2018 Lexus CT 200h Sports Luxury – $56,900
Premium paint $1000 (all variants)
2018 Lexus RC 300 & 350 update now on sale in Australia March 15, 2018
2018 Lexus LX 450d diesel now on sale in Australia March 28, 2018
2018 Lexus RX L 7-seat SUV revealed, on sale in Australia in Feb November 30, 2017
2018 Lexus LS 500 twin-turbo & LS 500h now on sale in Australia April 10, 2018
|
cc/2020-05/en_middle_0097.json.gz/line1399993
|
__label__cc
| 0.688454
| 0.311546
|
Katrine Strandberg-Larsen
24.2.15, Visit: Gothersgade 160, 1123 København K, Gothersgade 160, Building: 01-1-31
ksla@sund.ku.dk
https://www.ifsv.ku.dk/
Assessing risk of neurodevelopmental disorders after birth with oxytocin: a systematic review and meta-analysis
Lonfeldt, N. N., Verhulst, Frank, Strandberg-Larsen, Katrine, Plessen, K. J. & Lebowitz, E. R., 2019, In : Psychological Medicine. 49, 6, p. 881-890 10 p.
Cerebral palsy among children of immigrants in Denmark and the role of socioeconomic status
Petersen, T. G., Forthun, I., Lange, Theis, Villadsen, Sarah Fredsted, Nybo Andersen, Anne-Marie, Uldall, P. & Strandberg-Larsen, Katrine, 2019, In : European Journal of Paediatric Neurology. 23, 3, p. 507-516 10 p.
Disordered eating behaviours and autistic traits-Are there any associations in nonclinical populations? A systematic review
Christensen, S. S., Bentz, M., Clemmensen, L., Strandberg-Larsen, Katrine & Olsen, Else Marie, 2019, In : European Eating Disorders Review. 27, 1, p. 8-23 16 p.
How do early-life factors explain social inequalities in adolescent mental health? Findings from the UK Millennium Cohort Study
Straatmann, V. S., Lai, E., Lange, Theis, Campbell, M. C., Wickham, S., Nybo Andersen, Anne-Marie, Strandberg-Larsen, Katrine & Taylor-Robinson, D., 2019, In : Journal of epidemiology and community health. 73, 11, p. 1049-1060 12 p.
Low-to-moderate alcohol consumption and success in fertility treatment: a Danish cohort study
Lyngsø, J., Ramlau-Hansen, C. H., Bay, B., Ingerslev, H. J., Strandberg-Larsen, Katrine & Kesmodel, U. S., 2019, In : Human Reproduction. 34, 7, p. 1334-1344 11 p.
Pathways to inequalities in child mental health: a causal mediation analysis of evidence from two national birth cohorts
Lai, E. T. C., Lange, Theis, Straatmann, V. S., Nybo Andersen, Anne-Marie, Strandberg-Larsen, Katrine & Taylor-Robinson, D., 2019, p. 3. 1 p.
Socioeconomic position and one-year mortality risk among patients with heart failure: A nationwide register-based cohort study
Andersen, J., Gerds, Thomas Alexander, Gislason, Gunnar Hilmar, Schou, Morten, Torp-Pedersen, C., Hlatky, M. A., Møller, S., Madelaire, C. & Strandberg-Larsen, Katrine, 2019, In : European Journal of Preventive Cardiology. 27, 1, p. 79-88 10 p.
Trajectories of family poverty and children's mental health: Results from the Danish National Birth Cohort
Pryor, L., Strandberg-Larsen, Katrine, Nybo Andersen, Anne-Marie, Rod, Naja Hulvej & Melchior, M., 2019, In : Social Science and Medicine. 220, p. 371-378 8 p.
Weight trajectories and disordered eating behaviours in 11-to 12-year-olds: A longitudinal study within the Danish National Birth Cohort
Larsen, P. S., Nybo Andersen, Anne-Marie, Olsen, Else Marie, Andersen, Per Kragh, Micali, N. & Strandberg-Larsen, Katrine, 2019, In : European Eating Disorders Review. 27, 4, p. 436-444 9 p.
Fever and infections during pregnancy and psychosis-like experiences in the offspring at age 11. A prospective study within the Danish National Birth Cohort
Dreier, J. W., Berg-Beckhoff, G., Nybo Andersen, Anne-Marie, Susser, E., Nordentoft, Merete & Strandberg-Larsen, Katrine, Feb 2018, In : Psychological Medicine. 48, 3, p. 426-436 11 p.
Fever in pregnancy and offspring head circumference
Dreier, J. W., Strandberg-Larsen, Katrine, Uldall, P. V. & Nybo Andersen, Anne-Marie, Feb 2018, In : Annals of Epidemiology. 28, 2, p. 107-110 4 p.
Research output: Contribution to journal › Letter › Research › peer-review
Gestational Age and Socioeconomic Achievements in Young Adulthood: A Danish Population-Based Study
Bilsteen, Josephine Funck, Taylor-Robinson, D., Børch, K., Strandberg-Larsen, Katrine & Nybo Andersen, Anne-Marie, Jan 2018, In : JAMA network open. 1, 8, 11 p., e186085.
Labor augmentation during birth and later cognitive ability in young adulthood
Stokholm, L., Talge, N. M., Okholm, Gunhild Tidemann, Juhl, M., Mortensen, Laust Hvas & Strandberg-Larsen, Katrine, 2018, In : Clinical Epidemiology. 10, p. 1765-1772 8 p.
Lifestyle in pregnancy and cryptorchidism in sons: a study within two large Danish birth cohorts
Kjersgaard, C., Arendt, L. H., Ernst, A., Lindhard, M. S., Olsen, J., Henriksen, T. B., Strandberg-Larsen, Katrine & Ramlau-Hansen, C. H., 2018, In : Clinical Epidemiology. 10, p. 311-322 12 p.
Maternal thyroid disorder in pregnancy and risk of cerebral palsy in the child: a population-based cohort study
Petersen, T. G., Nybo Andersen, Anne-Marie, Uldall, P., Paneth, N., Feldt-Rasmussen, Ulla, Tollanes, M. C. & Strandberg-Larsen, Katrine, 2018, In : BMC Pediatrics. 18, 10 p., 181.
Obstetric synthetic oxytocin use and subsequent hyperactivity/inattention problems in Danish children
Stokholm, L., Juhl, M., Lønfeldt, N. N., Mikkelsen, S. H., Obel, C. & Strandberg-Larsen, Katrine, 2018, In : Acta Obstetricia et Gynecologica Scandinavica. 97, 7, p. 880-889 10 p.
Parental characteristics in association with disordered eating in 11-to 12-year-olds: A study within the Danish National Birth Cohort
Larsen, P. S., Strandberg-Larsen, Katrine, Olsen, Else Marie, Micali, N. & Nybo Andersen, Anne-Marie, 2018, In : European Eating Disorders Review. 26, 4, p. 315-328 9 p.
Parental socioeconomic status and risk of cerebral palsy in the child: evidence from two Nordic population-based cohorts
Forthun, I., Strandberg-Larsen, Katrine, Wilcox, A. J., Moster, D., Petersen, T. G., Vik, T., Lie, R. T., Uldall, P. & Tollanes, M. C., 2018, In : International Journal of Epidemiology. 47, 4, p. 1298-1306 9 p.
Use of paracetamol, ibuprofen or aspirin in pregnancy and risk of cerebral palsy in the child
Petersen, T. G., Liew, Z., Nybo Andersen, Anne-Marie, Andersen, G. L., Andersen, Per Kragh, Martinussen, Torben, Olsen, J., Rebordosa, C., Tollånes, M. C., Uldall, P., Wilcox, A. J. & Strandberg-Larsen, Katrine, 2018, In : International Journal of Epidemiology. 47, 1, p. 121–130 10 p.
Fever in pregnancy and the risk of congenital malformations: A cohort study
Sass, L., Urhoj, S. K., Kjærgaard, J., Dreier, J. W., Strandberg-Larsen, Katrine & Nybo Andersen, Anne-Marie, 8 Dec 2017, In : BMC Pregnancy and Childbirth. 17, p. 1-9 9 p., 413.
Focused breastfeeding counselling improves short- and long-term success in an early-discharge setting: A cluster-randomized study
Nilsson, I. M. S., Strandberg-Larsen, Katrine, Knight, Christopher Harold, Hansen, A. V. & Kronborg, H., Oct 2017, In : Maternal and Child Nutrition. 13, 4, 10 p., e12432.
Association of light-to-moderate alcohol drinking in pregnancy with preterm birth and birth weight: elucidating bias by pooling data from nine European cohorts
Strandberg-Larsen, Katrine, Poulsen, G., Bech, B. H., Chatzi, L., Cordier, S., Dale, M. T. G., Fernandez, M., Henriksen, T. B., Jaddoe, V. W. V., Kogevinas, M., Kruithof, C. J., Lindhard, M. S., Magnus, P., Nohr, E. A., Richiardi, L., Rodriguez-Bernal, C. L., Rouget, F., Rusconi, F., Vrijheid, M. & Nybo Andersen, Anne-Marie, Sep 2017, In : European Journal of Epidemiology. 32, 9, p. 751-764 14 p.
Spinal pain and co-occurrence with stress and general well-being among young adolescents: a study within the Danish National Birth Cohort
Stallknecht, S. E., Strandberg-Larsen, Katrine, Hestbæk, L. & Nybo Andersen, Anne-Marie, Jun 2017, In : European Journal of Pediatrics. 176, 6, p. 807–814 8 p.
Unreliable estimation of prevalence of fetal alcohol syndrome
Strandberg-Larsen, Katrine, Nybo Andersen, Anne-Marie & Kesmodel, U. S., Jun 2017, In : The Lancet Global Health. 5, 6, p. E573-E573 1 p.
Early discharge following birth: What characterises mothers and newborns?
Nilsson, I. M. S., Kronborg, H., Knight, Christopher Harold & Strandberg-Larsen, Katrine, Mar 2017, In : Sexual & Reproductive HealthCare. 11, p. 60-68
Prenatal exposure to alcohol, and gender differences on child mental health at age seven years
Fosterskadende effekter af alkoholforbrug under graviditeten
Research output: Book/Report › Report › Research
Is alcohol binge drinking in early and late pregnancy associated with behavioural and emotional development at age 7 years?
|
cc/2020-05/en_middle_0097.json.gz/line1400000
|
__label__wiki
| 0.569724
| 0.569724
|
Rituals of outspokenness and verbal conflict
Dániel Z. Kádár, Melvin De La Cruz
Department of English, Linguistics and History
School of Music, Humanities and Media
Centre for Intercultural Politeness Research
This study examines rituals of outspokenness, by analysing cases drawn from the US hidden camera show, Primetime: What Would You Do? Studying ritualistic behaviour in cases when bystanders become side participants as they stand up for victims of abuse fills a knowledge gap in pragmatics. A further merit of studying this phenomenon is that it provides insight into the reactive aspect of ritual behaviour, which is usually described in the field as a form of action rather than reaction. Furthermore, examining the morally loaded acts of rituals of outspokenness reveals the potentially complex relationship between aggression and normative behaviour.
Pragmatics and Society
https://doi.org/10.1075/ps.7.2.05kad
religious behavior
Kádár, D. Z., & De La Cruz, M. (2016). Rituals of outspokenness and verbal conflict. Pragmatics and Society, 7(2), 265-290. https://doi.org/10.1075/ps.7.2.05kad
Kádár, Dániel Z. ; De La Cruz, Melvin. / Rituals of outspokenness and verbal conflict. In: Pragmatics and Society. 2016 ; Vol. 7, No. 2. pp. 265-290.
@article{4ecbd8e92e0740a6ba643624f5ba25ac,
title = "Rituals of outspokenness and verbal conflict",
abstract = "This study examines rituals of outspokenness, by analysing cases drawn from the US hidden camera show, Primetime: What Would You Do? Studying ritualistic behaviour in cases when bystanders become side participants as they stand up for victims of abuse fills a knowledge gap in pragmatics. A further merit of studying this phenomenon is that it provides insight into the reactive aspect of ritual behaviour, which is usually described in the field as a form of action rather than reaction. Furthermore, examining the morally loaded acts of rituals of outspokenness reveals the potentially complex relationship between aggression and normative behaviour.",
keywords = "Aggression, Footing, Intervention, Morality, Outspokenness, Rituals",
author = "K{\'a}d{\'a}r, {D{\'a}niel Z.} and {De La Cruz}, Melvin",
note = "No full text in Eprints. No accepted date. HN 27/10/2017",
doi = "10.1075/ps.7.2.05kad",
journal = "Pragmatics and Society",
publisher = "John Benjamins Publishing Company",
Kádár, DZ & De La Cruz, M 2016, 'Rituals of outspokenness and verbal conflict', Pragmatics and Society, vol. 7, no. 2, pp. 265-290. https://doi.org/10.1075/ps.7.2.05kad
Rituals of outspokenness and verbal conflict. / Kádár, Dániel Z.; De La Cruz, Melvin.
In: Pragmatics and Society, Vol. 7, No. 2, 07.06.2016, p. 265-290.
T1 - Rituals of outspokenness and verbal conflict
AU - Kádár, Dániel Z.
AU - De La Cruz, Melvin
N1 - No full text in Eprints. No accepted date. HN 27/10/2017
N2 - This study examines rituals of outspokenness, by analysing cases drawn from the US hidden camera show, Primetime: What Would You Do? Studying ritualistic behaviour in cases when bystanders become side participants as they stand up for victims of abuse fills a knowledge gap in pragmatics. A further merit of studying this phenomenon is that it provides insight into the reactive aspect of ritual behaviour, which is usually described in the field as a form of action rather than reaction. Furthermore, examining the morally loaded acts of rituals of outspokenness reveals the potentially complex relationship between aggression and normative behaviour.
AB - This study examines rituals of outspokenness, by analysing cases drawn from the US hidden camera show, Primetime: What Would You Do? Studying ritualistic behaviour in cases when bystanders become side participants as they stand up for victims of abuse fills a knowledge gap in pragmatics. A further merit of studying this phenomenon is that it provides insight into the reactive aspect of ritual behaviour, which is usually described in the field as a form of action rather than reaction. Furthermore, examining the morally loaded acts of rituals of outspokenness reveals the potentially complex relationship between aggression and normative behaviour.
KW - Aggression
KW - Footing
KW - Intervention
KW - Morality
KW - Outspokenness
KW - Rituals
U2 - 10.1075/ps.7.2.05kad
DO - 10.1075/ps.7.2.05kad
JO - Pragmatics and Society
JF - Pragmatics and Society
Kádár DZ, De La Cruz M. Rituals of outspokenness and verbal conflict. Pragmatics and Society. 2016 Jun 7;7(2):265-290. https://doi.org/10.1075/ps.7.2.05kad
10.1075/ps.7.2.05kadLicence: Other
|
cc/2020-05/en_middle_0097.json.gz/line1400003
|
__label__cc
| 0.511192
| 0.488808
|
ProofMEDIA
How To Discover The Hidden Keywords That Drive Traffic To Your Site
Every article has (or should have) a purpose, but there’s one purpose that matters more than any other, and that purpose is that first and foremost, an article needs to be found.
If an article isn’t found, it never gets seen, which is why tools like Google Analytics or Bing Webmaster Tools are so important.
In the early days Google showed us almost every keyword that drove traffic to our site, and more importantly, which pages the traffic was directed to.
It was dead easy to write articles that attracted more traffic by reverse engineering the analytics.
But that started having a detrimental effect on the pages that turned up in search. People abused the system, and it got worse and worse for everyone.
The search engines changed and tweaked their algorithms multiple times, and these days they’ve largely succeeded in reducing the problem.
At the same time Google started restricting access to the very keywords we needed to see in order to assess the effectiveness of our articles.
So we had to resort to guesswork again. Remember, the primary purpose of any article you write online is to be seen, the secondary purpose is to write something useful that that helps people solve a problem.
But luckily, a new tool has appeared on the seen called Keyword-Hero that unlocks those keywords for you.
It does it using Google Analytics by creating a view that reveals almost 90% of the missing keywords.
Right now you can get the base version for free. Here’s the link: https://keyword-hero.com/
PS. I’m recommending keyword-hero because we use it here at ProofMEDIA. We love its simplicity and know it will be useful to anyone interested in seeing why people come to their site.
Posted by Quentin Pain
Quentin Pain
Quentin Pain has started 6 businesses during his long career. The last one was Accountz.com which he took from zero to 36,000 customers in 6 years (second largest seller of boxed accounting software in the UK). He now runs ProofMEDIA who specialise in online content funnels to win trust, engagement and long term sales. Quentin is also a published author including a Dummies title, and has won many awards including the IAB Small Business Mentor of the Year. He is a Fellow of the Chartered Institute of Marketing.
© 2020 by ProofMEDIA Ltd | United Kingdom | Call: 01733 590133
Invitation: join my FREE Facebook Copywriting Group
Every day I add a new relevant post to help people in business write better articles and sales letters
And I also include advice from my 39 years starting and growing 6 businesses
And you get it all for FREE - no strings attached, just a brilliant and original resource for entrepreneurs
Yes, I Want to Get Access Now
Sign Up Below... and Get Instant Access to the Group
Please tick if you'd like to receive updates from ProofMEDIA
|
cc/2020-05/en_middle_0097.json.gz/line1400009
|
__label__cc
| 0.65295
| 0.34705
|
PIA Earned Rs. 7-8 Billion in Revenue From Hajj Operations: Report
Pakistan International Airlines (PIA) has earned a revenue of around Rs. 7-8 billion out of the anticipated Rs. 25 billion from Hajj operations. According to a local report, 82,000 people opted for the national carrier to travel for Hajj.
This year, around 250,000 people performed Hajj from Pakistan, with PIA flying more than 82,000 pilgrims. This is 20% more than the previous year when 68,000 people used the national airline, according to PIA spokesperson Mashhood Tajwar.
PIA and Saudi Airlines are major players who cater to around 100,000 Pakistani pilgrims every year. Pakistan and Saudi Arabia divide the traffic for their airlines during Hajj season.
The remaining pilgrims opted for Airblue, Etihad, and Emirates among other airlines.
For airports situated in the northern region, i.e. Lahore and Islamabad, the ticket price ranged from Rs. 110,000 to Rs. 150,000 while tickets from Karachi airport cost between Rs. 100,000 – Rs. 105,000.
Due to the depreciation of the rupee, the Hajj package, which was arranged by the government, went up in cost to around Rs. 400,000 while private pilgrimage has no upper limit and can go up to Rs. 3 million, stated the report.
However, private hajj operators offered packages as small as one week or 15 days while the government arranged Hajj package is over a month-long. The private operators book late flights for their clients departing for Saudi Arabia and early returning flights to Pakistan.
These are peak times, therefore, airfares skyrocket making privately arranged pilgrimage expensive.
Last year during Hajj season, Shaheen Airlines was undergoing financial crunch due to which PIA and Airblue received a bigger share of passengers.
Raja Maja says:
same is earned in previous years too or even less just because to unburden the pilgrims. so that not milestone even this year less profits should be taken if we compare it with Indian pilgrims.
Khurram says:
No use, as they will get it down the drain by their incompetence in a week or two max :-)
|
cc/2020-05/en_middle_0097.json.gz/line1400010
|
__label__wiki
| 0.952041
| 0.952041
|
AustraliaHorror NT smash leaves child, 7, dead
14:57 23 may 2019 Source: msn.com
Horror NT smash leaves child, 7, dead 2019-05-23 2019-05-23
Two dead in a horror crash in regional Victoria
Two people have died after a horror smash in western Victoria. Emergency crews, including four ambulance, attended the collision which occurred on the Hamilton Highway in Cressy about 3.15pm. © 9news At least five ambulances, including an air ambulance were on scene. An Ambulance Victoria spokesperson confirmed that one person had been flown to the Alfred Hospital and a child had been driven to Geelong University Hospital. Paramedics are treating another person on scene. The exact circumstances surrounding the collision are yet to be established and the investigation is ongoing.
Two dead in a horror crash in regional Victoria. Two people have died after a horror smash in western Victoria. Emergency crews, including four ambulance, attended the collision which occurred on the Hamilton Highway in Cressy about 3.15pm.
Motorcyclists with a club comprised of ex-United States Marines collided with a pick-up truck on a rural highway on Friday, killing seven and leaving the
Video provided by Nine News
A seven-year-old boy was one of two people killed in a horror car crash in Darwin overnight.
Credit Cards Are Now Offering 0% Interest Until 2020
Find out more on Finder
Ad Finder.com.au
A 21-year-old father of three, Wade Williams, was travelling in the same car and was was also killed.
A woman, 24, who was driving and a man aged 42 who was driving the other car were taken to Royal Darwin Hospital with serious injuries.
Three dead in horror 12 hours on Queensland roads
Seven cars were caught up in the carnage, two people died and three others were taken to hospital with non-life-threatening injuries. Two people in a black BMW SUV fled the crash on foot after smashing into a moped and a sedan in Brisbane's inner-northern suburb of Windsor just before midnight. The BMW was headed north on Lutwyche Road when it collided with the moped, ridden by a 32-year-old East Brisbane man, who was killed. © Jarrad Aspden Accident at Lutwyche Road, Windsor which killed two men.
AustraliaChilling twist in horror head-on smash : Handwritten note is found 200m from the scene of crash that killed a mother and her four children 10:40 01 june 2019 Source: dailymail.co.uk. Horror NT smash leaves child , 7 , dead . Two people have been killed, including a seven-year-old, in a
Ms Harris had been driving southbound at 7.20pm in a Nissan station wagon near Kumbia when she attempted to overtake a truck it had been following, only to collide head-on with another oncoming truck. Horror NT smash leaves child , 7 , dead . Two people have been killed, including a seven-year-old
One car is believed to have been speeding and ran a red light when it crashed into and t-boned the other in Berrimah just before midnight on Wednesday.
Traffic and street slights were knocked over and the area was closed to traffic for much of Thursday.
A police officer on his way home from work was the first on the scene when he drove past the accident by chance.
He helped until St John's Ambulance paramedics arrived, NT Police commander Matt Hollamby said.
"The death of anyone is a tragedy but the death of children is really, really hard to take," he told reporters.
"Fatal crashes can be measured in millimetres and milliseconds and all we ask is that people take care on the roads, obey the laws, don't take risks and minimise the possibility of a crash."
Neither driver has been spoken to yet, he said, because they are being treated in hospital.
Major Crash detectives are investigating and believe that speed and running a red light were factors based on camera footage and may lay charges.
There have now been 13 deaths on the Northern Territory's roads this year, compared to 21 at the same time last year.
Chilling twist in horror head-on smash: Handwritten note is found 200m from the scene of crash that killed a mother and her four children - as police say the letter points to murder-suicide.
The note, which is believed to have been written by Charmaine Harris McLeod, 35, was discovered close to the scene of the horror crash, northwest of Brisbane. Ms McLeod died instantly when the car she was travelling in collided head on with a truck on the Bunya Highway near Kumbia in Queensland, just after 7pm on Monday.
Man charged after boy, 11, killed in 'hit-and-run' crash
Man charged after boy, 11, killed in 'hit-and-run' crash: ...
What Went Wrong in Horrific New York Limo Crash That Killed 20?
One of the victims killed in a horrific limousine crash in upstate New York on Saturday allegedly texted her cousin to say the vehicle was in "terrible condition" ...
Two dead in a horror crash in regional...
Three dead in horror 12 hours on Queensland...
Police smash Syd organised crime...
Car rolls six times in horror accident on Queensland...
Four dead in horror night on Victorian...
One dead, five injured in two-car smash north of...
Friends 'beyond shocked' after teen killed in car...
Chilling twist in horror head-on smash: Handwritten note is found 200m from the
Novak Djokovic's triple double-fault mishap on way to first-round win
Australia: Horror NT smash leaves child , 7 , dead - - PressFrom
Horror smash leaves 7 motorcyclists dead - YouTube
Horror NT smash leaves child , 7 , dead
British woman, 83, killed in four-car smash in the Algarve which left
A BRITISH woman has died in a horror crash in the Algarve which claimed three lives and left eight injured. The accident involved four cars, including a police Pictures from the scene showed a white car with its rear end smashed in and its tyres blown out and a child ’s pushchair on the road beside it.
Children of a Dead Earth #07 VESTA OVERKILL - Let's Play - YouTube
Children of a Dead Earth is a hyper-realistic space combat simulator that allows you to find out what space combat would really be like
Slicey - Dead Silence [ Horror Dubstep] - YouTube
Hello friends here I leave a special halloween and hope you like. Song : ¨Blackwater Silence - Horror Dubstep¨ Animation by ¨Riff and Alternate Studio
The Walking Dead Season 7 Promo: "Let The Slaughter Begin"
Synopsis: "Let the slaughter begin " NOTE: FAN-MADE, not real, all made for fun! SONG: "Deadwood," by: Really Slow Motion. Check out my OTHER channel
Smash -up leaves one dead , seven injured – Kaieteur News
A two-vehicle smash -up at Orangestein, East Bank Essequibo, yesterday morning has left one person dead , seven injured, and many family All of the injured children , this publication understands, were on their way to write the NGSA at the Academy of Excellence at Cornelia Ida, West Coast Demerara.
At least seven dead after horror M5 smash | The Independent
At least seven people have been killed and 51 injured in a devastating motorway pile-up said to be among the worst UK collisions in memory. Police said the death toll from the crash on the M5 in Somerset last night was expected to rise as the recovery operation continued. Some 34 vehicles were
|
cc/2020-05/en_middle_0097.json.gz/line1400011
|
__label__wiki
| 0.531576
| 0.531576
|
lifestyle family-relationships
Family & RelationshipsThings You Only Know If Your Marriage Lasts Less Than A Year
17:45 03 september 2019
17:45 03 september 2019 Source: graziadaily.co.uk
Things You Only Know If Your Marriage Lasts Less Than A Year 2019-09-03 2019-09-03
Could These Six Words Save Your Relationship?
Belinda Luscombe's been reporting on marriage research for over a decade. She tells Grazia what she's learned about successful relationships
Recently, there have been studies claiming that short men divorce less , do more around the house Still, there are a few things you ’ll only know if you ’ve been in the unique position of dating someone shorter than you . When I went to take my shoes off to kiss him on his birthday last year , he said, 'No!
Their marriage lasted less than a month. Photo: Twitter. Mario Lopez was only able to hold onto his marriage with Ali Landry for just under three weeks after she found out he cheated on her at his You know what? Let's just say that she did. Britney Spears married George Costanza for less than 3 days.
© Getty Getty
When the news broke about Miley Cyrus and Liam Hemsworth splitting, I overheard a colleague laugh. ‘Married for seven months? That’s actually pretty long by celebrity standards.’ And I couldn’t help but wince. Because although I’m not a pop star or a Hollywood actor, my marriage lasted about that long, too.
It’s difficult to explain to anyone who hasn’t been through it how excruciating it is to get divorced – especially when, just a few months earlier, you were in a white dress saying ‘I do’. I’ve had friends who have tried to sympathise, saying, ‘Well, when my long-term relationship ended...’ But there’s something about having stood up in front of all your friends and family, and vowed to be with this person forever and then, well, not doing so, that adds a whole new layer of shame to the situation.
3 Biggest Danger Zones In Every Marriage
One of the more enjoyable parts of my job as a relationship specialist is working with premarital couples. The love they have for each other is so refreshing. They prioritize and value each other, and are committed to making their relationships work by heeding marriage advice. Unfortunately, research shows that half of all marriages end in divorce with a spike in the divorce rate at the two-year, seven-year, and twenty-year anniversary dates.
Sex life advice: Is sex is declining in your marriage ? If you both want to rekindle your sex life, it might help to follow these tips. However, if your sexless marriage does bother one or both of you , then here are some ways to approach it: Have the conversation.
If you 've been married for less than 2 years , you can only use unreasonable behaviour, adultery or desertion as your reason for getting divorced. There are some things you might need to know first. If your reason is adultery. Adultery has to be sexual and with a member of the opposite sex, even if
Like Miley and Liam, I’d been with my partner Max* for over a decade. We met at university when we were both 21, and had watched our friends get together, split up, meet other people, get married and have kids. Through it all, we seemed rock solid. Everyone we knew made jokes about when we were going to finally tie the knot, but neither of us seemed particularly bothered by the idea of marriage. We owned a flat together, shared a bank account, shared a life. For most of my twenties we had the attitude of, ‘If it ain’t broke...’
But after turning 30, I started to feel like something was missing. We were still living the same life we had in our early twenties. Maybe, I reasoned, getting married was exactly what we needed. In the way that some people have a ‘Band-Aid Baby’ in the hope of fixing their broken relationship, I had a Band-Aid Big Day. Although it sounds ridiculous now, I felt like making this public commitment of togetherness was exactly the step we needed to resuscitate what had gone stale, and jolt this relationship back to life.
Married People Are Not Necessarily Healthier Than Singletons, Claims New Study
All the single ladies, now put your hands up
Despite all your hopes and dreams in the beginning, and all your good intentions now, it seems impossible to continue your marriage . If you 're wondering whether to divorce your spouse, consult this guide to know if it is the right decision for you .
A number of things can weave a path straight to divorce: not putting in the effort to compromise, shutting down emotionally, pushing your partner away, and even seeking If your partner is simply not interested in keeping a conversation with you , this could be a sign of their unhappiness in the marriage .
We fought more than ever in the run-up to the wedding, but I told myself that wedding planning was stressful. Whenever I had doubts (waking up at 4am and feeling like I wanted to jump on a plane and escape my own life), I figured everyone has cold feet. I ignored the fact that mine felt like they were in the deep-freeze. A few friends I spoke to about my feelings did advise me to call the wedding off or at least postpone it but, with the catering booked and the venue paid for, I felt like that wasn’t an option. Also we’d been together for so long, of course Max was ‘the one’. Wasn’t he?
© Provided by Bauer Consumer Media Limited
Our wedding was genuinely the best I’ve ever been to (and I’m not just saying that because it was mine). The honeymoon was equally blissful. But when we got back and things still didn’t feel right, I realised that this was more than post-wedding blues. I’d thought that getting married meant everything would change, but nothing had. All the problems we had before were still there, but with the added pressure of ‘forever’ weighing on us. Staring down the barrel of ‘the rest of our lives’, it dawned on us that we had completely different pictures of what that actually looked like. He dreamed of moving back to the tiny village he grew up in to be near his parents, I had always wanted to move to a big city abroad. He wanted to focus on his career, I wanted to enjoy life and scale back work.
Should You Tell Your Kids You're in Marriage Counseling? A Licensed Psychologist Weighs In
Should You Tell Your Kids You're in Marriage Counseling? A Licensed Psychologist Weighs In It's normal for the nature of every marriage to ebb and flow - sometimes things are great, and sometimes, not so much. Although some couples (like Kristen Bell and Dax Shepard!) suggest marriage counselling or couples' therapy no matter your marriage's status, typically, couples choose to entertain the idea of counselling because of recurring issues and pain points.
How do you know ? Four years before my marriage actually ended, I told my husband I wanted a divorce. We had stopped having sex, he had begun hiding things like his cell phone My best friend once told me that the only things that haunt you from a marriage are the regrets of things not done.
“The biggest thing to keep in mind about any name change is that it is a process, rather than a one-stop “It might seem obvious, but we get several inquiries a year for people needing to make a legal name Just write your new last name on your marriage license and show your marriage certificate
We tried counselling, but the writing was on the wall – only six months after our wedding day we were living separately. It was heartbreaking to meet up with people I hadn’t seen since my wedding day, and have them ask me how married life was, only to tell them that I was getting divorced. Every time I used a saucepan from my wedding gift list, I cringed. The Le Creuset had outlasted our union. But when I started talking about my situation more openly, I discovered that, actually, it’s not that uncommon.
‘There’s a distinct phenomenon behind this,’ says Lucia O’Sullivan, a psychology professor who specialises in intimate relationships. ‘Research indicates that when people who have been co-habiting for a long time finally get married, it’s often because it’s seen as a solution to whatever’s not working in the relationship.’ On top of that, O’Sullivan says there is statistically less stability in the first years of any marriage: almost half of all divorces in the UK happen in the first 10 years post wedding.
Maybe the longer you wait to get married, the more relationship baggage you bring into that marriage. In our case, we weren’t two people in the first flush of love when we reached the altar, we were more like housemates who occasionally had sex. I spent what would’ve been our first anniversary alone attending another friend’s wedding in Spain. Single for the first time in my adult life, I felt in shock at how much my life had changed in a year, but I reminded myself that the alternative – being in a marriage that wasn’t right – was far worse.
Being In a Happy Marriage Could Slash Your Risk of Dementia By 40%
Take a moment to thank your partner today for making your life longer Researchers have found that being happily married could cut your risk of the memory-robbing disorder by up to 40 per cent, as lab coats believe that couples encourage each other to stop drinking and to stub out smoking, helping delay the onset of neurological conditions and brain inflammation. Examining and tracking 4000 participants over the age of 60 for a decade, the researchers explored the impact and correlation between low moods, marital status and living situations against increased dementia risk.
Married less than 60 days? Gifts should be returned to the giver, even if it’s unlikely it can be returned to the store for a refund. “It’s the gesture that counts Married under a year ? The ex-couple should return large cash gifts (in the thousands of dollars). Then, “to acknowledge generosity for something
Marriage less than 6 month. I got married in July but i stopped living with my wife after a month. It is a specialized area of law and only an attorney practicing in matrimonial law will know how to If less than a year , stop wait. 2) Fastest and easiest is to wait until the six month mark and file under
Although we started on good terms, things deteriorated as we fought over everything from the sofa to the cats. Now we only communicate via our lawyers, and I’m hoping the process will be finalised in the next few months.
So although I used to be cynical about A-listers’ short-lived marriages – Kim Kardashian has the record with 72 days, but Brad and Ange (together over a decade and with four kids) only managed two years of wedded bliss – I won’t be so judgemental again. An embarrassingly short marriage has been a painful but valuable lesson. I’ve met someone new but, to be honest, I’m scared of getting married again. Somehow I feel like making things official cursed my last relationship. And if I thought planning a wedding was stressful, try getting divorced.
Gallery: 11 Questions to Ask Yourself Before Getting Engaged [POPSUGAR]
MSN UK is committed to Empowering the Planet and taking urgent action to protect our environment. We’re supporting Friends of the Earth to help solve the climate crisis - please give generously here or find out more about our campaign here.
How Long Does the Flu Shot Last? Here's What Experts Say .
Are you still covered from last year?But wait...didn't you get the flu shot last year? And if that's the case, how long does a flu shot last, exactly — and are you still covered? To help you figure things out, Health spoke with a few infectious disease experts (you know, doctors that actually specialize in diseases like the flu) to find out how long you're covered with a flu shot, and what that means for when you should get your next one.
BEFORE YOU GET MARRIED...WATCH THIS
The Secret to a Happy Relationship or Marriage is this... URGENT: YouTube won't show you my NEW videos UNLESS you TURN ON MY NOTIFICATIONS ...
What you don't know about marriage | Jenna McCarthy
http://www.ted.com In this funny, casual talk from TEDx, writer Jenna McCarthy shares surprising research on how marriages (especially happy marriages) really ...
Could These Six Words Save Your...
3 Biggest Danger Zones In Every...
Married People Are Not Necessarily Healthier Than Singletons, Claims New...
Should You Tell Your Kids You're in Marriage Counseling? A Licensed...
Being In a Happy Marriage Could Slash Your Risk of Dementia By...
Predatory marriage: How vulnerable elderly people are being targeted for their
Sophie Ellis-Bextor reveals the secret to a lasting marriage
How Long Does the Flu Shot Last? Here's What Experts Say
Twilighting Is the Coolest New Hair Color Trend for 2020
Is ASICS About to Drop The World's First Pair of 'Smart Shoes'?
50 Things You Should Never Do at the Doctor's Office
‘Human Ken doll’ Roddy Alves comes out as trans, saying ‘I have always...
Corrie's Nicola Thorp opens up about borderline personality disorder
How these five women gave up alcohol
A first look at the Nike React Infinity Run
Charlize Theron Wore Diamonds In Her Hair For The Most Relatable Reason
Best mood boosters to lift your mood this Blue Monday
Rosie Huntington-Whiteley reveals she doesn't eat after 6pm to give her body a chance to 'digest' everything
Order a Coffee Before Your Workout to Boost Fat Loss
A Gym Challenge Motivated This Guy to Drop 30 Pounds in 60 Days and Get Shredded
9 Ways to Hack Your Self-Esteem, if Blue Monday’s Got You Feeling Down
Charley Webb reveals husband Matthew Wolfenden and their kids became vegan ‘months ago’
Being lonely takes years off your life and 'is as dangerous as smoking and being FAT' - but accepting the 'ageing process' could help you avoid feeling alone
‘Silent’ Migraines: Everything You Need To Know
Holly Willoughby just wore a stunning pearl bridal gown on Dancing on Ice
7 Things You Only Know If Your Boyfriend Is Shorter Than You
10 Celebrity Marriages That Lasted Less Than 90 Days | YourTango
What to Do If You Are In a Sexless Marriage | Marriage .com
Ways to end your marriage - Citizens Advice
How Do You Know When Your Marriage Is Over? - FamilyEducation
Should I Get a Divorce? - Is My Marriage Over?
How To Let Go Of A Bad Marriage When You 've Had | YourTango
7 Things To Know Before Legally Changing Your Name | Mental Floss
My Kardashian divorce: Why our marriage lasted less than a year
How to get divorce. Marriage less than 6 month. - Q&A - Avvo
How to Have Closer Friendships (and Why You Need Them)
21 Things Every Spouse Should Do for Their Partner Without Being Asked
40 Major Marriage Blunders No One Over 40 Should Make
How Negativity Can Kill a Relationship
Single mum and author Charlene Allcott discovers loneliness is harder to hide come Christmas
Dating terms you need to know for 2020 - including Fleabagging and Cause-Playing
Why Laura Dern's take on divorce is so refreshing
I’m An Introvert, But Here’s Why I Gave In And Made ‘Mum Friends’
Single mum and author Charlene Allcott discovers loneliness is harder to hide...
UK News World Tech & Science Weird News Entertainment Sport Money Cars
Style Wedding Family & Relationships Travel Home & Garden Health & Fitness Food & Drink
© 2016 PressFrom - United Kingdom. All Rights Reserved.
|
cc/2020-05/en_middle_0097.json.gz/line1400012
|
__label__wiki
| 0.665892
| 0.665892
|
Sport Is this it for Zetterberg with Red Wings? Maybe it should be
02:45 11 july 2018
02:45 11 july 2018 Source: nbcsports.com
Is this it for Zetterberg with Red Wings? Maybe it should be 2018-07-11 2018-07-11
Report: Red Wings to make a trio of veteran signings
Reports indicate the Wings will re-sign Mike Green, bring back Thomas Vanek, add Jonathan Bernier.
Maybe it should be . By James O'BrienJul 10, 2018, 4:53 PM EDT. 7 Comments. With his back issues in mind, the Detroit Red Wings aren’t sure if Henrik Zetterberg will be able to play next season. It ’s something GM Ken Holland acknowledged as free agency began on July 1, according to reporters
"Obviously, it is emotional," Zetterberg said. " It 's been 15 years here. Even though I knew I was on my last couple years, I wish that I It marked the first time the Red Wings were relegated to watching consecutive postseasons since 1979-83. Dylan Larkin, a 22-year-old center with a new, -million
With his back issues in mind, the Detroit Red Wings aren’t sure if Henrik Zetterberg will be able to play next season.
It’s something GM Ken Holland acknowledged as free agency began on July 1, according to reporters including Ted Kulfan of the Detroit News.
“The last I talked to him, he’s planning on playing,” Holland said. “Obviously his back is going to determine whether he can or can’t. Do I have a clear green light (as to whether Zetterberg is returning)? I’m expecting him to play. Do I have a clear green light? No.”
With that uncertainty in mind, it’s not too surprising that something as minor as Zetterberg playing golf was enough to seem like an “encouraging sign” to the Red Wings, as the Detroit Free-Press’ Helene St. James noted today. Apparently Zetterberg joined Erik Karlsson and other pals on the greens, as Karlsson shared:
Best of the rest: Top available NHL free agents by position
As NHL free agency gets underway, theScore offers you a roundup of all the best players still available. (Photos courtesy: Getty Images)
DETROIT — Henrik Zetterberg knew something was not right with his back in January when he stopped practicing. Despite the aches and pains, he did not miss a game all season for the Detroit Red Wings .
Henrik Zetterberg touched on topics from his knee to his age as the Detroit Red Wings went through an informal practice. Detroit Red Wings captain Henrik Zetterberg talks Monday, Sept. Datsyuk had confided in Zetterberg about wanting to leave a couple of years ago, but it still was tough to see.
© Provided by NBCU News Group, a division of NBCUniversal Media LLC Instagram Photo
Sure, playing golf is lot easier when you aren’t in excruciating back pain, but it merely provides a minor bit of optimism about Zetterberg’s health. Without diving too deep into #PleaseLikeMySport territory, it’s fair to say that a jovial day of golf with your pals (pro athletes or not) isn’t exactly the same as dealing with checks, slashes, and hooks in the NHL.
Clearly, there’s little certainty about Zetterberg’s viability.
Personally, though, this is another case of the wrong questions being asked. The Red Wings aren’t best served asking if Zetterberg could play in 2018-19; instead, they should be wondering if he should.
What’s best for Zetterberg?
Red Wings face interesting questions regarding Zadina
What's the right approach for next season?With an entry-level contract already agreed upon recently, the question for 2018-19 is: where will Zadina fill nets with pucks?
DETROIT – The Detroit Red Wings certainly aren't required to have a captain. But it would be unprecedented for them to go a season without one. In recent history, the Red Wings captains have been iconic: Steve Yzerman, Nicklas Lidstrom and Henrik Zetterberg . The past two transitions have
"Obviously, it is emotional," Zetterberg said. " It 's been 15 years here. Even though I knew I was on my last couple years, I wish that I could have played a little It marked the first time the Red Wings were relegated to watching consecutive postseasons since 1979-83. Dylan Larkin, a 22-year-old center with
With 56 points last season, Zetterberg finished second in scoring for the Red Wings, trailing only Dylan Larkin‘s 63. The sturdy Swede was outright brilliant the year before, easily leading Detroit with 68 points in 2016-17. By just about any reasonable measure, Zetterberg is still good enough to play.
Still, his efforts failed to land the Red Wings in the playoffs in either of the past two seasons, and the Red Wings fell in the first round in 2014-15 and 2015-16.
On paper, Zetterberg could face a Sisyphean task in 2018-19: trying to push a mediocre (if not outright bad) team to the playoffs while suffering through back pain. At 37, the upside seems pretty dismal.
Much of the Red Wings messaging is about “culture,” and such thoughts sometimes trickle down to fans and media. Cameron Kuom of Wings Nation worries about the potential off-ice impacts of the Red Wings possibly losing their captain, for instance.
John Mellencamp Awarded Woody Guthrie Prize
Rocker John Mellencamp has been awarded the Woody Guthrie Prize. The Woody Guthrie Center in Tulsa, Oklahoma, announced Wednesday (July 11) that Mellencamp will be presented with the award during an Aug. 30 ceremony. He is the fifth recipient.The annual prize is given to an artist who best exemplifies the spirit and life work of Woody Guthrie by speaking for the less fortunate and serving as a positive force for social change.The center says in a news release that Mellencamp, like Guthrie, "has used his artistic gifts to spread a positive message of hope, equality and freedom.
The Red Wings and Chevrolet presented nearly 500 2nd graders in the Detroit Public School It should only have been a two-minute penalty (not five as officials decreed) but regardless, it left HSJ: Had he not won a Stanley Cup in 2008, maybe it ’d be different. But Henrik Zetterberg wants to finish
And in that sense, it was somewhat fitting that Holland copped to the continued uncertainty about Zetterberg and the potential for life without one All of this is to say, though, that if Zetterberg does return, the Red Wings will welcome him back with open arms. For 15 years, over which he has played
Yet, what about the possibly grim alternative of fans and young teammates watching Zetterberg getting run into the ground for … what, the lure of finishing in the East’s playoff bubble? Miraculously being bounced from the first round?
What’s best for Zetterberg might also be best for Red Wings
Nostalgia represents a tantalizing siren call, one Ken Holland clearly struggles to resist.
Still, at some point, younger Red Wings such as Larkin, Anthony Mantha, and eventually Filip Zadina will need to serve as the leadership group of this franchise, thus being responsible for “the culture.” Why not ease them into such roles during a season of low expectations, rather than pasting the “C” on someone’s chest later on, when fans are growing more and more restless with a one foot in, one foot out rebuild?
It’s fairly obvious that, from looking at Zetterberg’s contract, the expectation was that he’d probably play his last games in 2018-19. Consider how his actual salary compares to his cap hit going forward, via Cap Friendly:
2018-19: $6.083M cap hit; $3.35M salary
Cambage scores WNBA-record 53 points for Wings over Liberty
Elizabeth Cambage scored 53 points to set a WNBA record Tuesday, leading the Dallas Wings to a 104-87 victory over the New York Liberty. Grow Your Savings Faster with these offers Build Your Nest Egg Sponsored by MSN Money The 6-foot-8 Australian reached 50 points on a three-point play with 2:19 remaining and broke Riquna Williams' WNBA record of 51 points, set Sept. 8, 2013, on an open 3-pointer from the top of the key."It's pretty big," Cambage said. "I've had big numbers in China, I've had big numbers in Australia, and I've heard a lot of people say I could never have big numbers here in the WNBA.
Henrik Zetterberg was considered a long shot when he was selected by the Detroit Red Wings in the seventh round (210th overall) of the 1999 It is known that few people bet on the NHL, so the market is not that efficient as it is for the other world popular sports, but you should not think that this is an
Detroit Red Wings captain Henrik Zetterberg can add a new title: Father. It 's OK to disagree with someone's ideas, but personal attacks, insults, threats, hate speech, advocating violence and other Maybe Love Zetterberg will grow up and fall in love with Vasilisa Datsyuk, daughter of Pavel Datsyuk.
2019-20: $6.083M cap hit; $1M salary
Look, it’s no fun to pay someone not to play, which is what the Red Wings would essentially be doing if they place Zetterberg on LTIR.
It makes sense on a number of levels, however, especially since they don’t need to worry about the cap floor even before handing RFA deals to Larkin and Mantha.
Beyond saving Zetterberg some anguish, the Red Wings would increase their odds of landing another high-end draft pick if their captain goes on LTIR and they wade through a rougher regular season. It’s not as if Zetterberg would lack credibility in going on injured reserve, as there have been plenty of questions about his health for some time now.
If the Red Wings are realistic about their near future, they should err on the side of encouraging Zetterberg to way his health more than trying to gut out the 2018-19 season.
Again, what’s the best-case scenario if Zetterberg plays? He’d take a roster spot from a player who might be part of a longer-term solution in Detroit, on a team few expect to contend. There’s also the unsettling possibility that his own play would plummet. Zetterberg would have robust company if he joined the ranks of sports stars who’ve suffered depressing final seasons, but wouldn’t be more pleasant to see him instead end his Red Wings days with his head held high?
Chelios leaving Red Wings to return to Chicago
Chris Chelios is leaving the Detroit Red Wings to return to his hometown of Chicago. Chelios spent a decade with the Red Wings as a player from 1999-2009, and he's also been an adviser for the team. He says he's going to Chicago to be closer to his family.
Red Wings captain Henrik Zetterberg said he has no intention of following in the footsteps of former teammate Pavel Datsyuk, who left the organization with one year remaining on his contract. From the Detroit Free Press: [Columnist Mitch] Albom: When you signed that 12-year deal (in 2009) did it seem
Zetterberg clearly felt it was time for a change after 10 years under the hard-driving, abrasive Mike Babcock. "I want to thank Mike for the time Not that it should be any surprise, as there has been a growing trend of Red Wings players stating their displeasure with Babcock's way of coaching, but it 's
Conversely, the Red Wings could instead improve their odds of landing a lottery pick like Jack Hughes in 2019, something that – deep down – they should realize they really need. Along with the torch being passed to the next generation of Red Wings, there might be a better chance of fringe prospects receiving crucial make-or-break opportunities.
Also, a beloved star wouldn’t needlessly suffer.
Of course, this conversation is moot if Zetterberg really wants to play, or needs to find out for sure if he’s done. Perhaps he’d prefer a relaxed schedule, much like Teemu Selanne experienced (sometimes by choice, other times with hard feelings) during his final season?
There are still some questions in need of answers, and plenty can change between today and the moment Zetterberg decides to call it a career (or, like Pavel Datsyuk, an NHL career).
As sad as it will be to see Z go, there’s a strong chance that it will end up being what’s best for everyone involved.
MORE ON RED WINGS’ RELUCTANT REBUILD
Free agent plan at odds with youth movement.
Red Wings must push right buttons with Zadina’s development.
For better or worse, Holland receives contract extension.
Chelios to serve as Hawks ambassador .
He joins legends Tony Esposito, Bobby Hull, Stan Mikita and Denis Savard as ambassadors. After leaving the Detroit Red Wings organization to be closer to his family in his hometown of Chicago, Chris Chelios was named an ambassador for the Chicago Blackhawks on Monday.“To be able to join the Blackhawks organization in this role means everything to me,” Chelios said in a statement. “I’m very thankful to (owner) Rocky Wirtz and (president) John McDonough for this opportunity to return to the Blackhawks. Chicago is my hometown and returning to this organization is very special to me and my family.
Is this it for Zetterberg with Red Wings? Maybe it should be
Is this it for Zetterberg with Red Wings? Maybe it should be Is this it for Zetterberg with Red Wings? Maybe it should be With his back issues in mind, the Detroit ...
Red Wings honour Ilitch before first home game since his passing
The Detroit Red Wings took a moment to honour Mike Ilitch before they took on the St. Louis Blues.
Cambage breaks WNBA's two-game scoring record with 88 points
Chelios to serve as Hawks ambassador
Search on for gunman after 2 shot at hotel on Lee Road
Renée Zellweger and Catherine Zeta-Jones Share a Sweet ‘Chicago’ Reunion at the 2020 SAG Awards
Is this it for Zetterberg with Red Wings ? Maybe it should be
Red Wings star Henrik Zetterberg calls it a career
"Obviously, it is emotional," Zetterberg said. " It 's been 15 years here. Even though I knew I was on my last couple years, I wish that I It marked the first time the Red Wings were relegated to watching consecutive postseasons since 1979-83. Dylan Larkin, a 22-year-old center with a new, $30-million
Henrik Zetterberg Ends Career Because of Back Injury - The New
Red Wings ' Zetterberg sounds off on several topics
With Zetterberg done, should Red Wings name new captain now?
Detroit Red Wings mailbag: Could Henrik Zetterberg be traded?
With Zetterberg ’s future uncertain, Red Wings - TheHockeyNews
Henrik Zetterberg | Hockey Player - Henrik Zetterberg
Detroit Red Wings ' Henrik Zetterberg , wife welcome baby Love
|
cc/2020-05/en_middle_0097.json.gz/line1400013
|
__label__wiki
| 0.725912
| 0.725912
|
Conservative Life
Southern News
Southern Entertainment
Prime Patriot
Top Cop Involved in Failed ‘Asian’ Grooming Gang Case Gets Promotion
Stripped of Royal Titles, Prince Harry Expresses ‘Great Sadness’
Pro-2A Americans Come to Virginia to Rally for Gun Rights
Two dead, 15 injured after shooting at Kansas City nightclub as…
New Jersey Five Guys fires teen who called officers “piggies” and…
2 officers fatally shot, one injured and 4 homes burned to…
No more big brother! Washington Sheriff turns off black boxes inside…
Look out! Iowa trooper dives out of the way before out…
‘Parasite’ invades Oscars race with stunning SAG award win
Home Breaking News Report: Hunter Biden-Linked Firm Received $130 Million in Federal Bailout Loans
Southern Legacy
Report: Hunter Biden-Linked Firm Received $130 Million in Federal Bailout Loans
The Washington Examiner reported Thursday that Rosemont Capital, a company led by Hunter Biden’s business partners, received $130 million in federal bailout loans while Joe Biden was in office as vice president in 2009.
The Examiner reported:
An investment firm linked to Hunter Biden received over $130 million in federal bailout loans while his father Joe Biden was vice president and routed profits through a subsidiary in the Cayman Islands, according to federal banking and corporate records reviewed by the Washington Examiner.
Rosemont Capital, an investment firm at the center of Hunter Biden’s much-scrutinized financial network, was one of the companies approved to participate in the 2009 federal loan program known as the Term Asset-Backed Securities Loan Facility, or TALF.
Biden, Heinz, and Archer incorporated Rosemont Seneca Partners in Delaware on June 25, 2009. The “alternative investment and market advisory firm” was an offshoot of Rosemont Capital, which held a 50% stake in the new venture. Rosemont Seneca and Rosemont Capital shared the same office address in lower Manhattan and the same New York phone number, according to Securities and Exchange Commission documents. Three weeks after Rosemont Seneca was incorporated, a subsidiary of Rosemont Capital, called Rosemont TALF SPV, received $23.5 million in federal loans through the TALF program. This included $13.4 million to invest in student loans and $11.1 million to invest in subprime auto loans. Over five months, the company received a total of $130 million from the program in multiple installments for investments in subprime credit cards and residential mortgages.
The timing is significant, the Examiner notes, because then-Sen. Joe Biden (D-DE) backed the bailout: “He delayed his Senate resignation in January 2009 to cast his final vote to increase funding for the Troubled Asset Relief Program before taking office as vice president.”
Another point not mentioned by the Examiner is that President Barack Obama immediately put Vice President Biden in charge of overseeing the federal government’s disbursement of stimulus funds — which were a separate program from the bailout, but which were closely associated in the public mind.
In a statement titled, “Vice President Biden to Oversee the Administration’s Implementation of the Recovery Act’s Provisions,” the Obama administration announced that Biden would be in charge of making sure stimulus funds were being properly spent, and that there was transparency in the program, with updates posted at Recovery.gov.
The website was soon mocked for listing grants that went to non-existent congressional districts, among other errors.
Joel B. Pollak is Senior Editor-at-Large at Breitbart News. He earned an A.B. in Social Studies and Environmental Science and Public Policy from Harvard College, and a J.D. from Harvard Law School. He is a winner of the 2018 Robert Novak Journalism Alumni Fellowship. He is also the co-author of How Trump Won: The Inside Story of a Revolution, which is available from Regnery. Follow him on Twitter at @joelpollak.
Previous articleShepard Smith Laments ‘Intimidation of the Press’ in 1st Post-Fox Speech
Next articleDoug Jones Decries Calls to Reveal Whistleblower — ‘People’s Lives Could Be in Jeopardy in This Day and Age’
http://agexmedia@gmail.com
A video of medics in Hazmat suits scanning plane passengers for China’s mysterious Wuhan virus is stoking fears of a global epidemic
Two dead, 15 injured after shooting at Kansas City nightclub as...
A video of medics in Hazmat suits scanning plane passengers for...
Prime Patriot promises to be a fair and objective portal, where readers can find the best information, recent facts and entertaining news.
Contact us: operations@primepatriot.com
Sweden media bans Swexit campaign commercial.
Purveyors of Black-Market Pharmaceuticals Target Immigrants | Healthiest Communities
Child Rapist Found Back in Kansas, Just NINE DAYS After He...
Conservative Life68903
Trump News58366
Southern Legacy37692
News & Headlines19861
Lifestyle & Entertainment19648
Breaking News17832
Southern Entertainment17832
Blue Lines2456
© Prime Patriot | All rights reserved | Website by AGEX Media
|
cc/2020-05/en_middle_0097.json.gz/line1400014
|
__label__wiki
| 0.7131
| 0.7131
|
Book Cover Shot…
Posted: March 31, 2017 in F1, Icons & Iconoclasts
Tags: 1957 British Grand Prix, 1957 Formula 1 Season, 1957 French Grand Prix, 1957 German Grand Prix, 1957 Pescara Grand Prix, Aintree, Juan Manuel Fangio, Maserati 250F, Stirling Moss, Vanwall VW57
Juan Manuel Fangio eases his Maserati 250F through Tatts Corner, Aintree, Liverpool during the 1957 British Grand Prix on 20 July…
Fangio qualified 4th but retired on lap 49 with engine problems, its an amazing shot ‘the maestro’ looks so relaxed at the wheel. Its the cover shot of a book i have, much of my library is in storage, a real pain in the arse in terms of access to research material, maybe one of you have the same book and can recall the title?
The race itself was a Vanwall benefit; Moss lead then took over Brooks car when his own engine went off song, Stewart Lewis-Evans Vanwall also lead briefly before being passed by Moss, he and Brooks shared the win from the Lancia Ferrari 801’s (LF801) of Luigi Musso and Mike Hawthorn.
Stirling Moss in Tony Brooks Vanwall VW57, Aintree 1957 (Michael Turner)
This article is pieced together around a swag of photos of Fangio aboard Maserati 250F’s in 1957, in many ways the combination defines the 1950’s for me. The greatest driver of the decade in its quintessential car, it may not have been the fastest of the era but for sure it provided a platform for so many drivers from journeymen (and women) to gods, to strut their stuff.
Monaco, 19 May 1957…
Between Moss who left Masers to join Vanwall and Fangio who left Ferrari to join Maserati the seven 1957 championship rounds, ignoring Indianapolis, were mopped up by those two drivers- Juan with 4 wins and Stirling 3.
Fangio’s Maser 250F being unloaded from its transporter in Monaco
Fangio made the 250F sing, the car was towards the end of its long competitive life with the great Argentinian extracting all it had to offer. He was at the height of his powers, I don’t doubt he retired at the right time, he was 46 years of age by the end of the season after all.
Having said that it would have been fascinating to see if he could adapt to mid-engined cars, I don’t doubt he would have had he raced on for a few more years. But best to retire at the top, and alive. So many elite sportsmen and women do that one season too many, Michael Schumacher for one, Fangio did not.
# Carlos Menditeguy DNF spin and #34 Giorgio Scarlatti DNF oil leak in the Officine Maserati garage, Monaco 1957. 250F x 2
Fangio popped his 250F on pole in the Principality but Moss led into the first corner with Fangio behind him. Sterling went off and crashed at the chicane on lap 4 with Collins, LF801, taking exasive action and hitting a stone wall as a result! Fangio managed to get through without a problem and Brooks Vanwall braked hard only to be rammed up the chuff by Hawthorn’s Fazz.
Only Brooks was able to keep going- but he was 5 seconds behind Fangio by the time he was up to speed again. Jack Brabham was up to 3rd late in the race in his little Cooper T43 Climax. It was a portent of the 1958 breakthrough win for a mid-engined car by Moss in Argentina, but had to push the car home as result of fuel pump failure, Jack was classified 6th, with Fangio ahead of Brooks, Masten Gregory in a Maserati, Lewis-Evans Vanwall and Trintignant LF801.
Fangio during Monaco practice in Giulio Alfieri’s 250F V12. The 60 degree, DOHC, 2 valve, 24 plug, Weber fed 2.5 litre engine developed circa 300-320bhp at a dizzy 10500rpm, about 50bhp more than the venerable inline 6 but the power was all at the top of the band. The engine had conrod and valve spring troubles early in its development too. Behra raced one in the Italian GP, he chomped thru tyres, such was the engines power and then retired with a lubrication problem. The engines time would come, but not for a decade!
Whilst the 250F was in the Autumn of its life Maserati were still developing the thing, not least with a 2.5 litre, quad-cam, 2 valve, Weber carbed 300 odd bhp V12. Fangio is putting some development laps into the thing at Monaco above.
The engine raced only once at championship level at Monza 1957, but suitably evolved in 3 litre, fuel injected form won a race or two mounted in the back of Cooper’s T81 and T86 in 1966/7. (Wins for Surtees ’66 Mexican GP and Rodriguez ’67 South African GP, both in T81’s)
An interesting Australian sidebar to this Maser V12 is Frank Gardner and Kevin Bartlett testing a 2.5 litre variant in the butt of a ‘cut and shut’ Tasman Brabham BT11A in February 1966. Sydney Alfa/Maserati dealer and former Australian 1960 Gold Star Champion and AGP winner Alec Mildren used his impeccable Maserati connections to score the engine which the team sussed as an alternative to the venerable Coventry Climax 2.5 litre FPF which was the Tasman staple moteur at the time. Simply put the engine was like an on/off switch in terms of its power delivery, then blew, which rather settled the matter of a ‘Warwick Farm 100’ start. A story for another time.
Fangio, quayside at Monaco in 1957, enroute to victory. He won in Argentina, Monaco, France and Germany. The Vanwalls won in Britain, Pescara and again in Italy at Monza; Moss/Brooks, Moss and Moss
The thing that always amazes me when looking at photos of Fangio is just how relaxed at the wheel he is. It’s key to great lap times, if you are that tense that your butt-cheeks grab the seat cover as you alight your racer you are definitely not going to feel what your steed is doing to extract the best from it! I remember Frank Gardner talking to me about this very point several decades ago.
When the laconic Aussie all-rounder returned home in 1975, in that first year he drove Bob Jane’s Holden Torana Chev Sports Sedan and fronted the Jane/Gardner Racing Drivers School at Calder. He wasn’t there much. In fact ex-Aussie F3 driver/mechanic and later Hardman F2 designer/builder Jim Hardman did most of the driver instruction aided by Andrew Newton, who also raced with some success. Both of them looked after the fleet of Elfin 620B Formula Fords driven by the bright eyed hopefuls, of whom i was one.
Anyway, on this particular frigid July day ‘ole FG was in effusive mode telling me about both the car setup advice and driver coaching he was giving to a well known fellow who had not long before jumped up from Formula Ford to F5000-105bhp to 500bhp is a big step.
His central point in talking about ‘the big car challenge’ was all about relaxing in the car- having soft hands and gentle feet and just being able to, as a consequence of not being so tense, feel what the car was doing and therefore be able to push the thing to its limits by better sensing said limits when reached…Easy to say of course, harder to do especially when you have 500bhp of fuel injected Repco-Holden V8 shoving you ferociously towards the horizon!
FG would have approved of Fangio’s relaxed demeanour in a car. Don’t confuse my meaning with the ferocious competititiveness and delicacy of control that went with the outer calm one can see here!
Fangio never looks anxious whether he is being closely followed at Monaco in third gear or drifting through the very high speed swoops of rural France at over 140mph in fifth.
It was magic to observe Fangio’s car control at close quarters when he was 67 years old and booting his W196 Benz sideways lap after lap in third gear through Sandown Park’s Shell Corner, only 30 metres away, during ‘The Fangio Meeting’ in 1978. The sight of this grand man of racing flicking the bellowing, powerful straight-8, silver beastie around is forever etched in my memory.
Cool, calm, collected, composed and FAST! Exactly as he was in 1957…
French GP, 7 July 1957…
The classic was held at the super fast Rouen-Les-Essarts road circuit in Grand-Couronne and Orival, northern France.
There are so many wonderful 250F shots of Fangio in 1957 drifting the sublimely forgiving chassis at well over 140 mph on public roads through wooded hillsides. I’m not suggesting, in describing the car as forgiving, it was easy my friends!
Crusin’ in having set pole i wonder? Rouen 1957. The lines of the 250F in 1957, here it’s Fangio’s ‘regular ‘Long nosed, lightweight’ chassis ‘2529’ spec are perfect, inch by sculpted inch. The cars epitomise everything great about Italian racing machines. Alfieri’s ’57 lightweight chassis was 40% stiffer than in ’56 with greater rear weight bias-48/52% front/rear. The 250F was maybe not quite the fastest tool in the 1950’s shed but it was close to it, enduring and capable of winning the 1954 and 1956 titles in addition to ’57 with more luck or the right bloke behind the wheel all season! No-one was going to beat Fangio in a W196 Merc in 1955 i don’t think
Fangio was fastest from Behra and Musso also on the front row. Behind them were Schell 250F and Collins then back a row Salvadori, Vanwall VW57 Hawthorn and Trintignant. At the jump Behra lead but Musso soon got ahead. Fangio was 3rd then Collins and Schell giving chase and then a fast-starting McKay-Fraser, BRM P25. Fangio worked his way past Behra on lap 2 and then took Musso for the lead on lap 4.
Collins got past Behra and the order remained unchanged at the front all the way to the flag with Fangio winning from Musso and Collins. Behra slipped behind Hawthorn, giving the Lancia-Ferrari 801 a 2-3-4 finish behind Fangio.
Hang on…Fangio indulging in one of his signature, oh so fast, oh so subtle and oh so wonderful, delicate, four wheel drifts. Poetry in motion innit!? Wonder who or what he tapped?
Germany, Nurburgring, 4 August 1957: Greatest GP of all?…
Fangio’s heroic drive at this most demanding of circuits proved to be his greatest ever drive and one of the best in the history of Grand Prix racing.
Fangio took pole with Hawthorn, LF801 Behra, 250F and Collins LF801 completing the front row. Then came Brooks, Schell and Moss on Vanwall VW57, 250F and Vanwall VW57. At the start Hawthorn and Collins battled for the lead with Fangio and Behra giving chase. On lap 3 Fangio passed Collins and soon led. Collins then passed Hawthorn and chased after Fangio with the great man edging gradually away.
Nurburgring 1957: Hawthorn and Collins, L Ferrari 801, Fangio and Behra 250F, then Moss and Brooks Vanwall VW57, Masten Gregory’s white Maser 250F, Lewis-Evans Vanwall VW57 and the rest…
A slow mid-race pit stop, scheduled for 30 seconds, lasted 1 minute and 18 seconds. One of the mechanics dropped the wheel hub nut under the car, it couldn’t easily be found! This left Fangio a minute behind the two Ferraris but then the chase was on! He drove absolutely at the limit, at the ragged edge of the cars capabilities, chasing down the two much younger men.
Fangio famously broke the lap record 10 times and passed both Collins, and then Hawthorn on the penultimate lap. Fangio won the race and in the process, his 5th and final World Title in a drive still spoken about in reverential terms and forever remembered whenever the great GP races are considered.
Pescara GP, 16 August, The Coppa Acerbo…
The FIA included the Coppa Acerbo, Pescara GP in the World Championship for the first time given the cancellation of the Dutch and Belgian GP’s early in the season due to squabbles about money. The daunting, dangerous 16-mile road circuit on the Adriatic Coast, still used then for non-championship events was the longest ever for an F1 race.
Ferrari didn’t bother to send 801’s for Mike Hawthorn and Peter Collins as the World Championship had already been won by Fangio and partly as a protest against Italian government’s move to ban road racing following Alfonso de Portago’s, Ferrari 335S Mille Miglia accident earlier in the year. Local boy Luigi Musso convinced Ferrari to lend him a car however, which he entered as a privateer. Shades of NART entries in the 1960’s when Ferrari wanted to protest, but not too much!
Shot at left shows Fangio’s Maser having a rear wheel replaced after spinning on Musso’s engine oil and danaging it
The Pescara battle was between Maserati and Vanwall and resulted in a Maserati pole for Juan-Manuel from Moss’s Vanwall VW57 and Musso’s ‘private’ Ferrari 801.
Musso took the lead but Maserati 250F privateer Horace Gould hit a mechanic who was slow to get off the grid. Brooks retired his Vanwall VW57 early with mechanical troubles. Moss took the lead from Musso on lap 2 from Fangio in 3rd but the field thinned as the heat took its toll; Lewis-Evans, Vanwall with tyre failures, Behra 250F engine failure. Then Musso disappeared on lap 10 when his engine blew, the oil caused Fangio to spin and damage a wheel. When Fangio rejoined, Moss had an unassailable lead, he won the race ahead of Fangio, Schell in 3rd ,Gregory 4th and Lewis-Evans 5th.
Fangio won the World Championship on 40 points from Moss and Musso on 25 and 16 points respectively. Maserati 250F, Vanwall VW57 and Lancia Ferrari 801.
All photos by Louis Klemantaski/Getty Images, Michael Turner
Tailpiece: The Maestro, Karussell, Nurburgring, Maser 250F chassis ‘2529’ German Grand Prix 1957, history being made. Majestic shot…
Spyder Automobiles says:
Great writing Mark as always!
It was great to meet you at Phillip Island even if it was a little rushed.
markbisset says:
Thanks Mike,
And yes, great to meet you too- when you are in town for a day let me know and we can grab a coffee or a bevvy.
Thanks as always for the feedback.
Collins Street Chaos…
Takin’ the Mickey…
|
cc/2020-05/en_middle_0097.json.gz/line1400015
|
__label__cc
| 0.550273
| 0.449727
|
US1 Crashes a Party
Let’s Try
See Today’s Events
Richard K. Rein
Summer Fiction Poetry
Summer Fiction Prose
Princeton Info
Home Fast Lane Real Estate Notes
Real Estate Notes
Kathleen McGinn Spring
Daffodils are standing tall on sunny corners. Crocuses are braving the cold to unfurl their tiny purple flowers. The tips of tulips are peeking through leaves in gardens all over central New Jersey. It’s gardening season again! Well, almost. What tasks can eager gardeners get started on right now?
Slow down a bit, suggests Ken Karamichael, senior program coordinator at Cook College.
“March is a time to get excited about gardening,” he says. “It’s a time to get ready.”
Okay, so the real action hasn’t started. No matter, the planning is fun too — and essential, according to Karamichael, who says that the over-eager have been known to run out and prune the buds right off flowering trees, dooming them to a bare spring and summer.
Unless you’re absolutely sure of what you are doing, shelve the shears, and get ready for two weekends of garden-planning paradise. The 117th Philadelphia Flower Show runs now through Sunday, March 12, at the Pennsylvania Convention Center at 12th and Arch streets. Full information on times, directions, parking, workshops, and exhibits is available at www.theflowershow.com.
Karamichael plans to attend the venerable Philadelphia Flower Show along with a contingent of devoted New Jersey gardeners. At the same time, he is deep into planning his own event, the “Home Gardener’s School,” which is celebrating its 30th anniversary on Saturday, March 18, beginning at 8 a.m. at Cook College’s Hickman Hall. Cost: $60. Full details, including directions, are available at www.cookce.rutgers.edu.
No doubt, even a veteran like Karamichael will come away with a few ideas from the Philadelphia show. One of the most elaborate, event-filled flower shows on this planet, it offers instruction in all phases of gardening and examples of the work of the most innovative gardeners. Here is how the show is described on its website. “Enchanted Spring…A Tribute to Mother Nature” will take visitors from the fantastical to the practical and inspire even the most hesitant of gardeners to take up a trowel and start planting.
“Discover the largest plant sculpture in the world, Natura, goddess of Nature, rising 27 feet from the Show floor. Visitors enter the Show under the glorious and fragrant Floratopia Tree, which will teem with flowers, birds and butterflies. Visitors will also enjoy 10 acres of other great gardens, inspirational landscapes, and fabulous shopping.”
Something to get excited about, for sure. The Cook College gardening event is also designed to get gardeners’ juices flowing in time with the rising sap in their trees.
“There will be something for everyone, for new homeowners and for green thumb hobbyists,” says Karamichael. Participants can choose among 28 hands-on workshops. There are sessions on container gardening, vegetable gardening, attracting birds or butterflies to a garden, flower arranging, landscape design basics, heirloom tomatoes, azaleas, and perennials.
A lot of attention will be given to soil and its role in creating a healthy garden. No state has as diverse a range of soil types as New Jersey, says Karamichael. “Your family member two counties away will have different soil than you have,” he says. Soil is the “blood” of the garden, he points out. It is essential to know what you’re dealing with if you want your plants to thrive. Toward this end, everyone who attends the Home Gardener’s School will go home with a soil testing kit, complete with instructions on how to use it.
Light and water are also essential elements in a garden, and the Home Gardener’s School will demonstrate that no matter how moist or dark a yard, it is still possible to grow a luxuriant garden.
What if there is no yard at all?
No problem. Monica McLaughlin, horticulturist with the Rutgers Gardens, is presenting a workshop on the basics behind successful container gardening to “breathe new life into your patios, walkways, desks, and more.” Participants will each create and take home a container garden.
Bulbs are most often planted into the ground, but can also do well in containers. Judy Glattstein, author of “Bulbs for Dummies,” provides extensive information on the wide variety of summer bulbs available and on how to incorporate them into a garden.
Karamichael says that, in celebration of the Home Gardener’s School’s 30th anniversary, there will be surprise guests, contests, and giveaways galore. His event, like the Philadelphia Flower Show, should provide plenty of excitement for winter-bound gardeners yearning to get out there and play in the dirt. Meanwhile, they can be warm and dry inside, but still surrounded by the beauty, fragrance, and promise of plants in all of their glorious variety.
Previous articleReal Estate Notes
Next articleReaching Shoppers as They Shop
On the Move: Acquisitions, Expansions, and More
On the Move: Walk to Washington, Staples Verdict, Deaths
On the Move: PCTV, Arts Council, NJEDA, and More
Mercer’s Voting Machines: Old, Hackable, and Not Going Anywhere
Mercer County’s substandard, easily hackable voting machines were supposed to be replaced in 2008. But they will still be in place for the 2020 election.
Let’s Try . . . Elite Five Sushi & Grill
From NJWedding.com to NJParenting.com
The Fall of Icarus
Get U.S. 1 stories and weekly events delivered straight to your inbox!
U.S. 1 is Princeton's entertainment and business newspaper. To contact us, email hastings@princetoninfo.com or call 609-452-7000.
About U.S. 1 Newspaper
© Princetoninfo
|
cc/2020-05/en_middle_0097.json.gz/line1400016
|
__label__cc
| 0.702728
| 0.297272
|
Author: pool-x
By pool-x
OzCoin
SimpleCoin.us
Litecoincash.com
Ecki Co LTD
NuKingsMiningCo
burnside’s Pool
litecoinpool.org
notroll.in
Xurious’s Pool
Coinotron
LTCMine.ru
Squidnet4
17th July 2019at 12:22 pm | Uncategorised | No comments
Ricky Gutierrez has a YouTube channel that gives insight and advice on investing and finance. He covers a large scope of money-making tips and tricks making it easy to find information relevant to your needs. His channel covers cryptocurrency, penny stocks, real estate, forex, and more.
Through his business ventures, he now owns several properties and cars at 23 years old. He also built a small community where he helps people achieve success.
12th February 2019at 10:48 am | Making Money • Ricky Gutierrez | No comments
Ryan Scribner runs a YouTube channel that offers useful information as well as relevant news regarding personal finance. Most of his success was made with proper investing in stocks so he often talks about how to follow trends and patterns to maximize your investment.
He also has interviews with several other successful entrepreneurs who share their personal marketing and investment strategies.
11th February 2019at 1:10 pm | Making Money • Ryan Scribner | No comments
11th February 2019at 12:11 pm | Jeff Rose • Making Money | No comments
BIG MARK is a YouTube channel run by Mark and he posts daily videos about making money from home. The key to leaving behind the regular 9-5 is often through passive income which he discusses in detail.
He also gives you small tips and tricks on how to earn small amounts of money really fast. These eventually will help you invest properly and have the capital for proper businesses.
11th February 2019at 9:50 am | Big Mark • Making Money | No comments
Financial Education is a channel run by Jeremy and he has been in the business of making money since he was 18 years old. He started working regular 9-5 jobs earning very little until his big break in 2010. Jeremy was able to land a steady job which led to him being able to start investing in stocks.
Despite some setbacks, he has managed to build a successful YouTube channel along with lucrative businesses. His knowledge of investments and real estate come from personal experience making it a valuable source of information.
11th February 2019at 8:39 am | Financial Education • Making Money | No comments
Nate O’Brien
Nate O’Brien has a fairly successful YouTube channel where he talks about investments and finance. He gives very useful advice regarding small investments, loans, and even how to save money properly. Most of his videos also tackle very common questions about investments and personal finance.
The best part about his channel is that he tackles a lot of different topics and money making methods. It’s very accessible with plenty of information for smaller businessmen or entrepreneurs.
11th February 2019at 7:30 am | Making Money • Nate O'Brien | No comments
Graham Stephan started from the ground up working in real estate since he was 18 years old. Now that he’s 28, he has amassed hundreds of millions in real estate investments.
Graham also talks about earning passive income, credit card plans that are beneficial, and general investment.
11th February 2019at 6:28 am | Graham Stephan • Making Money • Real Estate | No comments
Mike Vestil is a self-made man and a self-proclaimed master at passive income streams. He started very small like most new entrepreneurs and eventually built several successful online businesses. Part of his platform promises lucrative ideas with very little to no capital. With this, he has been able to build a large community and has helped several people achieve their dreams.
He has several resources and concise strategies that can help people who are looking to invest and to make money online. Other resources he offers are books, his blog, and his own personal website.
10th February 2019at 12:42 pm | Making Money • Mike Vestil | No comments
Kevin David started his career as an accountant and consultant but soon left to start his own business. His main platform and selling point is “financial freedom.” Despite starting small, he has created opportunities for himself far greater than any company has given him.
David now tries to inspire people to do the same by promoting his ideologies as a lifestyle rather than a step-by-step program.
7th February 2019at 1:56 pm | Kevin David • Making Money | No comments
|
cc/2020-05/en_middle_0097.json.gz/line1400018
|
__label__cc
| 0.664765
| 0.335235
|
Respawning Instead of Starting a New Game from Scratch is Cheating
Assassin's Creed: Odyssey, combat, making games, mechanics, morality, story, theme
Spoilers for some side quests in AC: Odyssey
Well, this’ll be a day. Sick Nugget.
As for games….
I keep getting good people killed. Did the Dagger. Smiled ruefully when, on the way to the Dagger, met the pirates you met (or must’ve met. Stupid pirates). Stopped off to do the weird quest where the slave wants you to lie and say that he did it so he can stay a slave (you do that one? How’d you play it?).
Then did the Dagger and of COURSE told the guy “Only you an save your brother…go to it.”
I’m sure you did the same. But I’ll wait for you to confirm.
I have thoughts.
Ah, poor Nugget!
The guy who wanted to remain a slave…I didn’t want to lie! Besides, what if the ‘master’ got mad and said “no way you’re staying on in my house!”? So I just said bandits took the vase. Then I said, “by the way, this guy really wants to stay on, you might want to hire him once he’s free” or something, and it all worked out.
And yes, OF COURSE I also said “go try to save your brother” (because obviously one does!) and got the decent guy (Agapius or something? OK, internet says Agapios, I was close) killed. But then I died in the ensuing battle and it reloaded before that entire conversation, so I tried “your brother can’t be saved” and that worked out better. Agapios even accepted it and wasn’t angry with me. So yeah, turns out sometimes the right thing is the wrong thing.
Oh you cheated! Cheater!
So what happened if you did that? I’ll wait because I’m curious and it will affect the thoughts I have.
Cuz I have thoughts.
But I will start by saying this: That was a well written, well acted scene. I really did think, for a few moments, that it was going to end happily. When the two brothers were talking, I got to the point where I bought that they were going to be ok. Then they weren’t. That’s not often the case in cutscenes. Very well done stuff.
But how’d it end for you? I have thoughts.
I did the same thing with the slave, and I was going to say here that “And I was surprised it worked out ok because so many other times we did the ‘right thing’ and it didn’t,” but then I realized I was being rather presumptuous that what we did was the “right thing.” Sure, lying is bad, but, almost always, in games when the downtrodden, weak, helpless person asks you to do something/say something to the person in power, you do it. It’s the right thing. Here’s a powerless person saying “Please do the thing I am powerless to do,” and, well, that’s “right” cuz video games and video games are all about doing things other people are powerless to do.
So in real world terms, yes, we did the right thing. But in game terms, maybe “doing the right thing” would have been lying for the slave, and I’m starting to think that might have been a bad outcome.
I didn’t cheat! I died, and it reloaded me before that scene. It’s not cheating to be handed an opportunity to make a different choice, and try it out. But it would have been cheating if I’d reloaded on purpose, yes.
And extremely borderline if I’d intentionally fought poorly so I’d die and have it reload. But I was ready to live with that result, it was just stupid combat choices (“I can totally stay in melee with this guy for one more hit instead of running off to heal!–oops, no I can’t”). That’s not cheating.
But dude, I’m the one who lived with my first choice when it got the theater people killed. I didn’t die in that battle, so I didn’t reload anywhere, and I just kept it. You’re the one who tried repeatedly to save them. YOU cheated!
Let’s just agree we’re both cheaters and move on.
Speaking of reloading and choices and cheating, this leads directly to a point I’ve been meaning to raise, which is that I don’t know how I feel about the fact that one of the load screen tips says “if you’re not sure what to do, try quick saving and trying out different choices to see which one you like better.”
I mean…first of all, we already know that trick and we’ve all done it, and also, it’s cheating! Why are you encouraging people to cheat, game?
And obviously in both these discussions it’s not REALLY cheating, it’s perfectly allowable within the rules and structure of the game, but in an RPG…we kind of instinctively feel that part of the point is that we live with the consequences of our decisions. Trying out different things to see which one you like best is cheating! You can’t do that in real life, and you shouldn’t do it in an ‘honest’ RPG. (You could never do it at the D&D table, where our gaming morals were forged.)
Which is part of the reason that it’s especially interesting when the consequences only become evident much later on, long after it’s practical to go back and re-do something even if we wanted to (even if we do still have a save from that point). We often leave morally complicated scenes with a sense of foreboding, no matter what we do: “THAT’s going to come back to haunt me.” And we respect the game when it delivers on that! I’m not psyched about the fact that I unleashed malaria on Kephallonia, but it’s pretty great that that decision actually made a difference.
And maybe games are investing more in long-range consequences because they know how easy it is to ‘cheat’ and check out the short-term ones, and they figure everyone will, so why not just be clear about it and tell them to? Which if true would be cool.
But I still don’t do the ‘try different things’ even though this game explicitly says to. Only if I die, man. Death earns you a do-over.
Oh, and as for the slave wanting to stay a slave, you’re right, usually the ‘good’ choice is to help the underdog in a situation. But if thing he wants help with is remaining the underdog…is that REALLY helping him? Sometimes what people want isn’t actually the best thing for them. And obviously, who the hell am I to make that decision for this guy who is a grown adult and whose life I know nothing about? If he thinks he’d be happier as a slave, and if slavery is legitimate in this society, who am I to be all “slavery is bad, I’m not helping you be one?” That’s a modern reaction: slavery is bad, I’m not helping keep some guy a slave!
But in the context of the time, if this grown adult wants that and asked for help…
No. Still not helping keep some guy a slave. Certainly not telling lies to do it. If he wants to be a slave, he can tell the guy himself. Which I know is not a slave’s place to do, apparently, but you can take your freedom for two minutes and speak up to disavow it if you feel that strongly about it.
It would be interesting to know how it worked out the other way, but, like you, I didn’t cheat to find out.
And the bit with Agapios, it was basically the same outcome except that I said “no, he can’t be saved,” and Agapios sort of reluctantly accepted that “after all the terrible things he’s done, is he really still my brother?” and the brother sneered at him and said something like “you’re the one who shamed the family, you became a slave,” and then we had a big fight.
And then at the end Agapios said something about being a slave and his master said “you’re not a slave, you’ve earned your freedom.” He seemed happy about that.
There’s definitely some interesting point in here somewhere about slavery, though. Like, it’s not always the worst thing that could happen for people, and it shouldn’t necessarily be a shameful thing because one can be an honorable slave…I don’t know.
Fair. Very fair. I take it back. Not cheating.
Let’s agree we’re both not! We’ll feel better that way.
Funny, cuz something like this came up last night with Junior.
Junior has helpfully started watching silly youtubes about this game (I’ve already told him that if he spoils, he dies). Junior is one of these people that likes mods, likes doing things like playing Legend of Zelda with Link wearing a nintento switch T shirt, trying to get that special trick that makes Lydia say “I love cheese” in Skyrim (made that last one up, but not the shirt in Zelda). He was telling me yesterday that he saw a way in AC:O to get a special overpowered sword that makes you do %500 Assassin damage but, like, spits chickens if you try to do warrior damage, silly armor, etc. and I said “Look, Junior, those things are just to customize your game experience” (at which point he looked at me as if I was saying something as obvious as “Food makes you not hungry”) “and I don’t really WANT to customize my games. I want to play them as they were intended by the developers” (at which point he looked at me with the horrified confusion as if I had said “And I never get hungry, and, even if I did, I’d never, ever eat food.”).
We forget there’s this massive percentage of gamers who want their games completely customized to them. They don’t care about what the developers intended artistically. They want Link in a modern T shirt. They want ridiculous overpowered swords. They want voice mods so that every NPC sounds like LeBron James. And, I suppose, they want the plot to play out exactly as they want it to.
Which is totally not an honest RPG! But then, I think that being able to play with a ridiculous sword or idiotic cosmetics isn’t “honest” either.
I guess the silver lining is that you can cheerfully ignore all the “dishonest” stuff and play the game the way the developers intended if you want. There’s all that “Check out the new gear in the store!” stuff in this game that we are cheerfully ignoring. But we have to accept that there’s that “I want it the way I want it” crowd that’s gonna do everything they can to get what they want, and Ubisoft knows this. Ubisoft is even profiting off of this!
To each their own.
I have a feeling the alternate ending with the wanna-be slave would’ve been “You helped them! DIE!” which wouldn’t have been a great outcome. But my feelings have been wrong before.
Plus, I kinda think it was in character for Kassandra. She’s into freedom, at least that’s how I’m playing her. After Agapios died, the Magistrate was all sad and she said “At least he got his freedom for a few moments….that’s worth so much…” or something. She cares about freedom.
Well, maybe they’re trying a twist on the Assassin (freedom)/Templar (obey) deal. Muddying the Templar waters.
But I saw some other themey shit, at least in how my game played out.
Here, we had the godless dude (The Dagger is all “Poseidon didn’t save me. I DID!” He obviously into the divine) do the same thing that Kassandra’s very godly parents did to preserve their own status/wealth/power: Throw a family member off a cliff. Well, maybe not to keep his status, but certainly to represent that he had no intention of giving it up.
We’ve been talking about the themes of “family is complicated” and “Should you believe?” for a while here, and to have a very similar scene (family members, cliffs, etc.) play out in a totally godless way, juxtaposed against Kassandra’s childhood was interesting.
Because they were both ooky. Throwing people off cliffs is bad. But this was interesting given that we’ve seen the Oracle lying so that people die, Kassandra’s family “killing” her and Alexios because the gods, we’ve seen the cult be bad (and, let’s face it, cults are just religions gone to the extreme). Very religious=bad through the whole game. To have the Dagger be just as bad, do the same things, and be overtly secular was an interesting choice.
Hm. That’s an interesting thought, that the urge to pick exactly the result you want may be related to the urge to have a highly customized game experience full of whatever goofy touches you personally find entertaining. That if you’re used to adding personal touches that have nothing to do with the original game, you may also find it quite reasonable to pick and choose from a variety of consequences, because why not? That’s the way it’s most fun for me!
I want to replace all the dragons in Skyrim with trains from Thomas the Tank Engine! I want the mods where everyone is naked!
And, indeed…why not I suppose? If that’s the way it’s most fun for you. I’m not going to argue that there’s some objective determinant of the Best Way to Have Fun in Video Games. As we’ve often stated at length, different people play different games (or the same games in different ways), and that’s cool. The fact that that’s possible is one of the cool things about games.
I think we’re certainly not wrong to prefer to stick closer to the original version of the way the game was designed. This obviously gives you a much better sense of the game’s story, mood, themes, etc. (if applicable). On the other hand, toying with the story, mood, themes, etc., by introducing your own touches is…arguably an expansion on the original art, if done well. Not better, but a variation on a theme, which can also be interesting.
Me, I just don’t have the time to get into that. But it’s an interesting area for exploration.
I think it goes to the difference between looking at games as art and looking at games more as toys. It’s not that much of a stretch to say “toys.” We play games. They’re sold at toy stores. Lots of people still look at it that way. And that’s ok! I like toys! But that’s not how I want to look at an art form.
To go back to food, you and I both like the idea of going to nice restaurants, ordering off the menu as is to enjoy the skill of the chef. But look at the rise in popularity of chains like chipotle and blaze pizza. These places essentially have no menus at all. You go, you tell them exactly what you want from a ton of toppings and sauces and whatever and boom. Their customers are not at all troubled that the restaurant puts no thought at all into creating dishes. If anything, their customers like that. It makes getting food a creative experience, not one where you enjoy the creativity of others.
Lots of folks play games that way.
I personally don’t get it. If you want to create, go for it. Cook at home. Learn to paint. Write poems. There’s lots of ways to create on your own. Why warp the art of others?
But to each their own.
Also an interesting idea! Along those lines, one could suggest that we play with toys to tell our own stories (generally, though of course kids also play out scenes from movies or whatever with their toys), but that we turn to art to experience someone else’s story.
And video games in some sense are kind of straddling the line there: are they art, telling us a story? Or are they toys we can move around and make our own stories with?
RPGs have always had this question, as I suppose all interactive art does. Is this MY thing, or am I just participating in someone else’s?
Perhaps relevant to this, have you looked at all at those blue markers on the map for player-created adventures within this game? I have completely ignored them, but Mr. O’ did one. He said it was an interesting concept but that the story he tried was not that great, and the visuals were not as smooth as in the main game. (I guess you can make your own story and use pre-created animation clips for it? Or something? I should probably look at one of them just so I have some idea what I’m actually talking about.)
“Here, make some of your own art inside our art!” There’s nothing wrong with that. It’s kind of a cool idea. I’m sure some people have really good thoughts about stories and so forth, and make some cool stuff. I just can’t be bothered, either to make my own, or to care about someone else’s if it’s not part of the thing I actually paid for. I’ve got enough work just following up on stuff that was intentionally put into the main story of the main game. Don’t talk to me about random timed quests or fan content! Life is too short!
Yeah they added that feature and I’ve ignored it.
It’s not a new concept, really. PC modders have made content forever. Some dude made a twenty hour fully voiced quest line in Skyrim. Shit, Buttons got his start making Quake levels in college.*
Ubisoft is just kinda sorta allowing that in this game.
I dunno. Always seemed rather amateur. I don’t have time to play all the stuff the pros make. Don’t really have time for some dudes fetch quest.
*Hi Buttons!
Three Roads to the Same Truth
Assassin's Creed: Odyssey, character, children, combat, story
Some spoilers for the end of a quest in OC: Odyssey
Didn’t play any more.
But we can talk about those three missions to lead up to the Dagger!
It’s not that they were bad missions. They weren’t. But I have gripes. As I do.
The boat diving thing: Having to talk to that lady there before diving down to get the doohickey was a waste of time. Someone OTHER than her could’ve told me that ahead of time. Seriously.
The Farmer: So, why, exactly, was “The Taxman Cometh” a thing? I show up, I get attacked by guys all “We knew you’d come!” I kill them, the dude is all “Hey, thanks again, and now the thing about the Dagger.” So….why’d he have a quest all to himself that was really part of this quest? Kinda a waste of time. Seriously, game. Stop it.
The dudes at the theater: Ok, that was kinda harrowing. I didn’t like that they died. And, yes, THEY. I kept TRYING to keep one of them alive. I reloaded a bunch. But, each and every time, they’d kill one and the other would die in the ensuing fight after about twelve milliseconds. I eventually gave up.
But here’s the thing, and why I’m kinda annoyed: Each one of these three things, certainly the farmer and the theater people, led to the exact same thing. Even the slave lady there by the boat told me the exact same thing. When the poor theater people were getting killed, I was all “Yeah, knew that, you died for nothing.”
So why’d I have to do all three of these? Cuz you had to!
It was a waste of time, and that’s bad. But what’s even worse is that it had a chance, a real chance, to be a Weighty Choice. See, if you could bail after learning the facts from one of the branches, learn the name, where they are, and just say “Ok! Off to get ’em!” then that would have had life or death consequences. You could’ve opted not to rescue the farmer, or opted not to get involved with the theater people, or not have (potentially) been followed to the slaves at Eretria. Or you could have done two or all three. How you found the info about the Dagger could have MATTERED. Instead, it turned into busy work where your choices didn’t matter cuz you had no choices.
A waste of time AND a missed opportunity.
And that’s too bad! The theater people quest was good! Harrowing! The fort the dude was rescued from (in A SEPARATE QUEST why’d they do that?) was well designed! There was a lot of good here, but by making it all so necessary it undermined it.
It’s true–the fact that you’re presented with three ways to get the same information is fine, but the fact that you have to follow through with all three of them, and without learning anything different, is bothersome from a narrative standpoint. I figured, well, maybe the first quest told me one thing about the Kingfisher, but the second one will say something different, and I’ll have to sort out which is right by also gathering evidence in the third? But no.
I also got the theater people killed. I mean, I didn’t. The Dagger killed them. This wasn’t on me! Unlike most of the deaths that happen in my vicinity.
But I was unable to save them. Did you try just attacking as soon as you got into the conversation? Because when you first showed up in the theater, there was a crossed swords/violence dialogue option and a regular conversational one, and I picked the regular one, and then later I thought “maybe if I just went on the offensive immediately it would prevent the dude from going on his whole gloating hostage spiel and they’d have a chance to escape.”
But by the time I thought of it, I had already moved on.
We shall never know. Unless you tried that! In which case, we shall know it didn’t work and there was nothing we could do to save them.
Narrative and gameplay. It’s the game admitting it’s wasting your time. Don’t do that, game.
To be charitable, it sorta read like a quest line that was intended, in some prior draft of the game, to have Weighty Important Choices and then the writers said “oops.” Like, maybe the Dagger was supposed to be a big assed thing and they thought “Well, we already have a lot of big assed things….” I dunno. Maybe it is! I’m not finished yet. But I doubt it.
And nah, I tried that. And she was all “YOU’LL be the one that dies” and he was all “If you try, we’ll slit both their throats before you get to me,” which seemed reasonable.
Can’t be helped.
Though it could have been! Right after the fight began, the quest changed to “Protect [insert name here],” and then, when I failed miserably, it changed to “Defeat the Baddies.” So it WAS possible to protect the survivor. Don’t ask me how. They were right there between five baddies and me!
It was doomed…unless, somehow, someway, you could actually “protect” them like the quest said! I tried! I did! Even reloaded a couple of times! But the baddies went right after her, and there’s no way to kill five of them that fast. Maybe there was some ability trick or something, but fuck it. I’ve moved on. Sorry, theater people.
Sorry, theater people. You were destined to die together, and wow Hades in the underworld with your magnificent dramatic productions.
Except Kassandra doesn’t really believe in that, but…uh…maybe you do, and the thought will give you a moment’s comfort in the seconds before your brutal deaths.
I did feel bad about them.
I feel terrible. Especially as they had all those orphans, who are now re-orphaned.
That was a low blow, game. Especially as they died for very little.
Kassandra was all “I’ll make sure your last words weren’t in vain” or something, and I was thinking “Considering we already KNEW all of that, they likely were. But hey, hope springs eternal.”
Yeah, I felt extra bad about the orphans. And there wasn’t even an option to toss them some money as you left, or anything!
Like “hey, orphans, here’s a few drachmae to feed yourselves for the next couple of weeks while you look for new theater jobs or whatever and then probably eventually end up at the slave auctions.”
If those kids form a group of tiny assassins and come after us with vengeance on their minds, I won’t blame them. I mean, it’s not really my fault for once! The Dagger was hassling them before I ever showed up! But I certainly didn’t help matters.
Hey, yeah! There should’ve been such an option. Maybe they just didn’t REALLY want to go into the whole “You really messed up the lives of kids” thing.
After all, based on my very limited knowledge of the series, AC is many things. Weird. Action packed fun. Violent. At times, gory. But one thing it generally isn’t is upsetting. Its “sad” bits are kinda like when a superhero dies in a summer blockbuster: melodrama. “Sad” in quotes. The deaths of parents who have voluntarily raised orphans and the aftermath of same is not the type of thing one expects from AC, so maybe they wanted to pull their punches some.
Was still upsetting.
Yeah! I would totally have funded an orphanage! After all, Kassandra was effectively an orphan herself. You’d think she might have some empathy for what these kids have been through, and are likely to go through now that their protective parent-figures are dead.
But it’s true, Assassin’s Creed is not really about tugging at the heartstrings as a general rule. Drama, excitement, action, intrigue, aliens, occasional philosophical musings, yes. Pathos, no. So yeah, they probably just didn’t want to get into it because it would harsh the mood.
It’s not about tugging heartstrings, no. But then, it’s trying to evolve.
Begs a question, though: if you want to make a game that isn’t really like other AC games, why make an AC game at all? It’s hardly because we’re delving deep into the story of Assassins and Templars and Abstergo and hipsters. We haven’t heard a damn thing about any of that since the start of the game. They seem to have made this an AC game cuz they like stealth and assassinating things. Also, if I’m going to be cynical, they made this an AC game cuz “Assassin’t Creed” on the box sells games.
But that decision, marketing or otherwise (mostly marketing), seems to have had the unintended consequence of holding back the game that they really wanted to make, that is, a true RPG. This COULD have been a very good RPG quest. I sorta feel that if this hadn’t been an AC game, that if they could have gone full RPG, it would have been. But, if you’re gonna put “Assassin’s Creed” on the box, you can’t pull a full 180 right away.
Maybe two or three AC games from now it really will be like an RPG. Maybe. But even if it is, it’ll still be beholden to all the games that came before and the lore and the nonsense.
It’s too bad, really. Ubisoft should go with a whole new IP if they want to make a whole new type of game.
But that marketing…..
Marketing! How can you turn your back on a franchise like AC? There’s no way! Especially when everything else you try is not as big a hit as AC. I mean, they’ve done OK with other things, but Watch Dogs is no Assassin’s Creed.
Though as for the hipsters…hang in there. They do actually come back in! I’m intrigued by what this means for the larger alien-history mythology. We’ll talk later.
And, as you say, maybe they’re just kind of taking small steps towards something different, like a full-fledged RPG. Testing things out. People seem to like the RPG elements in this one, so maybe the next one will have more. We can dream!
Hey man, there’s always Just Dance. Mints money.
AC needs more DANCING!!!!!
Ooo! Femmy had a hipster encounter! ‘Bout time. Am I close?
Not just people like RPGs! This person! You, too, it seems! Shit, my gripe is that this isn’t a full bore RPG. These last few quests would’ve been better if they had been, and they would’ve fit just fine.
Buuuuuut…..
That means the best bits are the bits that aren’t really very “Assassin’s Creedy.”
This is a problem when “Assassin’s Creed” is on the box.
Oh well, Just Dance is a kingdom unto itself. Although a crossover might be interesting. Dancing in AC is a good thought, and also imagine if we could Just Assassinate!
On second thought, people would probably be killing themselves doing dramatic Leaps of Faith. Never mind.
The hipsters come back right after the big major quest thing we were heading towards when we stopped to do this taxes interlude. So as soon as you’re done with the Dagger and this island, you can continue on your way and…yeah. We’ll talk.
Hey, man, I think it would sell millions!
“Just Assassinate!” The Ultimate Party Game when you’re at parties with people you don’t like!
We’ve all been there, right? It’s a huge, yet unfilled, niche.
Ah, ok. We’ll talk about the modern day. ‘Bout time.
Though, on literary terms…
We established at the end of RDR2 that epilogues can be WAAAAY the fuck too long. Is there a similar limit on interludes? Should there be?
Cuz this shit here has been taking quite some time.
There could be such a limitation, indeed. But really, by AC standards, this is not particularly egregious. The in-Animus portions of the game always outweigh the ‘real-world’ portions by leaps and bounds. You never spend more than, I don’t know, MAYBE 5% of your time caring about what’s going on in the real world.
It’s always THERE, but it’s never what you spend the vast bulk of your playing time on.
Because it’s not usually about assassinating people and climbing towers, so it’s boring! Back to the Animus!
Loot First, Ask Questions at Some Unspecified Future Time Possibly
Assassin's Creed: Odyssey, character, family, loot
Minor spoilers for minor plots in AC: Odyssey
Had company, so got nothing. Very strange visit. Had my parents over and basically thought of people I haven’t thought about since before I met you, which is a very long time.
It was odd. I met this dude at camp, and there I was with him, at camp, and another friend I had back then who is running the camp, and my wife, and my mother, watching my SON perform at camp.
Still processing.
But I’m tired and it’s hot and I don’t have much motivation to do much of anything and when that’s the case cultists tend to die so I’ll have something later.
That does sound disorienting. The past merges into the present, you become your parents as your children take on the role you once held in an old, very specific and no doubt vividly remembered context…time for reflection.
But as for me, with no such reflective event, I just played. I checked the quest list, but “The Taxman Cometh” is over. Nothing about getting loot in a cave. Maybe I had already stumbled into the cave and taken the loot before he told me?
“Oh, thanks!…I’ll…uh…definitely go get that loot I totally didn’t already steal.”
I don’t know. I do have some level 19 Epic Boots, but I don’t remember exactly where I got them, and I’ve never worn them because when I picked them up I was already wearing regular boots with a better AC. I might upgrade them at some point, though. Epic gear is epic gear, after all, and it’s not as if I’m accumulating a lot of it through conquest battles.
So, yeah. I don’t know anything about quest-related loot, and apparently I never will because that quest is long gone. Go ahead and spoil whatever it was.
Well, it was searching a cave for loot is what it was. It was a cave I had actually discovered before but not looted as I was busy, which means you absolutely found it and looted it before.
But what was weird was that he told me “Take what you want, but leave something for us.” I thought “Ok. I have mad loot. I’ll go, take a few things, leave, get the quest completed deal.” But it wouldn’t do the quest completed deal until I took every last damn thing in the cave. He expressly asked me not to do that, and I was going to be nice, but I couldn’t find any way to be nice and still complete the quest. I was gonna ask if I missed something, but who am I kidding? You’d’ve taken all his stuff anyway.
You were…busy. Too busy to loot a cave. Who are you?
Now I’m kind of glad I looted it first. I would have felt bad if he asked me to leave something, and I couldn’t. And of course I would have taken it all…have to complete the quest!
That’s a weird thing to make you do, too. “Dude specifically asks you not to take everything, but you actually have to. Yup, you’re a jerk.”
I mean, whenever it’s a choice to give money to homeless children or whatever, I do it. I try to be nice to people when the game allows! Odd that in this instance it specifically disallows that.
I mean…maybe we’re reading this too literally. Maybe we’re not meant to take “just leave me a few things” as a serious request. Maybe it’s just idle chit-chat, like “take whatever you want from the house, just leave the walls standing!”
After all, we DIDN’T actually take everything…there were baskets and boxes there and who knows what kind of stuff could have been in them that we ignored? We never actually carry away the basket itself!
I’m going to go with “we DID actually leave him plenty of nice things, and only took a couple of items and some drachmae.”
Of course, I proposed the Witcher Tax, so we understand how determined my rationalizations can be.
Yeah, dude, you can rationalize loot eight ways ’till Thursday. But still, usually, in a game, when a character who is having trouble paying his bills, says “I’ll let you choose how much to take or leave me….please don’t take it all as I am having trouble paying my bills,” you get to, you know, choose. Or at least the main character says, after you loot, “HA! Did that bastard think I’d leave him anything? What a doof.”
Here? Nada.
I know. It was certainly framed as if I was being given a Weighty Choice, or, at the very least, a Choice you will Ponder After Kassandra Scolds You. But nothing. It was just like looting everywhere else. No chance to leave stuff, no banter from Kassandra, nothing.
I dunno. Maybe I missed something. But it sure seemed like there should’ve been something else to do, or Kassandra should have had a throwaway line or SOMETHING and there wasn’t.
It is odd. I’m going to rationalize it so that my Kassandra isn’t a total jerk, but obviously, the game in this instance doesn’t actually care that you’re a total jerk.
Thanks for interfering with my quest to make everyone loooooooove meeeeeeee, game!
Well, before you get too down, just remember not everyone will ever love you. Not as long as there is Kevin.
You know, for your sake, I hope someday we play a game where there’s a romanceable character named Kevin. When you can play a game and can say, truthfully, “I got Kevin to love me,” then that would fill a gaping void in your quest.
Ah, that’s going to be the dream.
Closely followed by the game where you can romance a member of a gang of predatory Ayn Rand devotees. “Even the Randits love me, man!”
Don’t dream too big.
A Unsettling Mystery
Assassin's Creed: Odyssey, combat, loot
Extremely minor spoilers for The Taxman Cometh in AC: Odyssey
While it is nice to have company, it is not conducive to games. Not one little bit.
At least I don’t have Tough Quest Anxiety. That’s good.
I went to the fort! I did! I rescued the dude! You weren’t kidding about it having many levels and angles and approaches. I made a bit of a hash of it, had to run off several times to hide and heal, died a couple of times, fought some bounty hunters who came along to interfere, got the braziers lit for reinforcements TWICE (at least if you just lay low, the reinforcements will eventually kind of wander off), but I did it. Good times.
Yeah, that was a pretty damn good level. Lots going on, and lots of ways to approach it. Sneak in? Go for the brazier first (which is what I did)? Stick to the parapets? Free the lion? Zoop between the towers on the ropes?
What was cool was I ended up doing a mix of all of it. I’d kill some dudes, lure some others away, be all “Ok….now how am I gonna get these guys?” and plan. Cuz each approach had pros and cons! Very good shit.
Not a lot of levels do that kind of thing any more. There’s usually one, MAYBE two ways to approach a level, and the trick is figuring it out. We praise games for mixing up the TYPES of levels, or the approaches to levels, but very rarely do you have one bigassed place with this many ways to approach it AND the chance to change up your approach mid level. Great stuff. And unexpected in a game where most of it has been pretty straightforward in terms of “Find the bush, hide in the bush, whistle from the bush, repeat.”
Pretty great stuff. Even if I played it like shit the first several times.
Did you finish the quest? Go to the cave?
The…cave. No. I did not go to a cave, other than the one you could sneak into the fort through, but there wasn’t anything quest-related there that I saw. I will keep my eye open for caves next time I play in that general area of the map.
Did you talk to the farmer about the Dagger? And their dreaded leader the Kingfisher? That’s what I did. Interesting if the quest went different ways depending on what we did before it…
I feel like several of the large forts/houses in this game have offered some decent work in terms of being able to come from different directions, try different things, etc. Lots of buildings to creep through, roofs to hop over, fences to jump over or hide behind, etc. I like the “small hole near the ground” feature that several of the walls, tents, etc. offer, that you can sneak through but the guards don’t seem to use.
Nah, after the fort. You meet the farmer, he tells you about the Kingfisher (did that), and then he’s all “Well, I have a secret stash of drachmae in the cave (by the viewpoint). Help yourself, but leave us something.” And then I had to do that to complete the Taxman Cometh quest.
You didn’t get that?
Ah, damn it–my noisy fan must have prevented me hearing part of the conversation. I missed the mention of drachmae entirely. (Which I’ll just point to as evidence that my Kassandra isn’t really in it for the money after all! She wants to do good in the world and have adventures and stuff!)
I’ll double-check whether the quest is marked as completed. I thought it was done, but I might have been distracted by the nearest question mark.
Dude, it was, like, an immediate quest marker. It’s….I have questions.
You need a new PS4.
Noooo, we need to wait for PS5!
I did not notice an immediate quest marker. I did not. But maybe I activated another quest right away while I was checking out the new loot in my inventory and missed it, or something.
I’ll check, I’ll check! Until then, I can answer no questions.
Dude, there’s mad loot! Which….is kinda my question.
Very nice boots.
I want loot! I’ll look into it as soon as I sign in.
Because of the loot.
Epic boots.
And questions….
So unlike you to miss loot.
It is. It really is. I am hanging my head in shame right now.
The only thing that can lure me away from loot is question marks. So there you have it.
Go find the loot!
Cuz I’m curious about something.
We’ll talk. Later.
I’ll find it. We’ll talk.
Rescue the Dude!
Assassin's Creed: Odyssey, combat, mechanics, story
Some minor spoilers for quests in AC: Odyssey
Well, that sucked.
And, by “That” I mean “I.” I sucked.
One of those nights, man.
Met a Spartan dude who wanted me to kill an Athenian commander. It was an “impact” quest, so saying “Yeah, sure, whatevs” will likely come back to haunt me, but one ALWAYS says “Yeah, sure, whatevs” when the other choice is to reject the quest. You don’t REJECT THE QUEST!
But I should’ve known the day was gonna be like that when I get there, there’s the guy, he has like, three Kevin friends, and they’re all fighting a damn bear when I get there so they’re all hurt, and I STILL died the first time and had to run like hell the second time (I led them all back to the city, had to remember I had a horse, total shitshow. But it was kinda funny cuz I rode off on my horse, dove off the horse into cover to heal, and they’re all there with question marks all “Where is she?” when I am crouched RIGHT NEXT TO THE HORSE. Kevin all “Could she be right by that horse that looks just like the horse she rode off on? Nah….”)
I should’ve stopped. I should’ve.
I did take a break to magpie, and got to a viewpoint and a cave. And then there was a quest right there….
So I started it. It’s called “The Taxman Cometh.” It was, on its surface, a “rescue the dude” quest. It was, really, all the way through, a “rescue the dude” quest. However, the dude is in a REALLY big fort.
I could NOT rescue the damn dude.
I think I died more times last night than I’ve died in all the rest of the time I’ve been playing this game. Seriously. I go several sessions without dying.
Not. Last. Night. Last night I just got frustrated.
And I’m pissed at myself, because (this isn’t a spoiler) it’s a REALLY well designed level! If I had had my wits and hands about me, it would’ve been really cool! Lots of ways to approach it, different challenges, the most complex “gotta think about it” level in the game thus far!
And I wreck it by playing like shit.
I’m working on “The Taxman Cometh” right now! I was headed toward the fort, but detoured to assassinate a cultist in an abandoned mine. Rescuing the dude from the fort is my next goal, though. Unless I find some other cultists to assassinate along the way.
I do like when people are already fighting bears or something when I get there. I had a lively time the other night when I managed to draw a bunch of bandits who were chasing me right into the camp of a bunch of huntresses who would also have been chasing me if they hadn’t started fighting the bandits.
I love when my enemies fight my other enemies. As the old saying goes, “the enemy of my enemy is probably also my enemy, but I’ll let them fight it out and then take on the winner.”
In this case the huntresses killed all the bandits and then I picked off the huntresses. I feel kind of bad about just killing a bunch of women living in the woods, you know? I mean, they’re probably just making the best choice they can to get a little freedom from a restrictive patriarchal society! But since their choice involves attacking me on sight, they must die.
Plus, the game calls them ‘huntresses’ which suggests they just hunt animals and mind their own business, but they tend to have corpses lying around and people in cages, so I think they’re basically just female bandit gangs, and I don’t feel bad about killing people who kill other people for a living. It’s an occupational hazard of which they’re surely well aware.
I saw that guy! I went to the fort instead. Should’ve gone there. Less frustration.
Yeah, really, I’m not cool with people trying to kill me.
T SHIRT!!!!
I THINK that the ability to turn a lion against everyone is one way to do the fort. There IS a lion, and he’s locked up near a lot of Kevin. I found this out after I successfully got the Kevins to all move by drawing them away from the fort. Then I accidentally freed the lion. Then I died.
He’s a tough bastard, that lion.
Ooo! Speaking of neat tricks, I found something out last night! The first several times I died, Kevin got to the beacon there, that calls reinforcements. I thought “You know? I’m gonna go in that way. Maybe I can destroy the beacon ahead of time.” This was one of the few good thoughts I had. Turns out you can’t destroy the beacons BUT you can “Set trap!”
It’s so cool. They’re all “Light the beacon!” and you say “Yes…do…” and BOOM!
There really should be a mechanic that Fallout 3 and NV had, where you could put your weapon away in a “Hey, man, I don’t want to kill you” gesture that sometimes worked. All games should have it. It couldn’t work on every fight, of course, but something like that? Makes sense.
See also the billion times I’ve been happily chasing a question mark and/or going off to kill someone and Kassandra’s all “I should be careful here” and I say “Wait, why? Where am I?” and boom. Someone attacks me. I’m all “Hey, dude, look, I didn’t mean any offence, just passing through to kill someone else” but no, you can’t do that.
And Yeah, that’s kinda not huntressy.
I wonder why the randits aren’t co-ed in this game. It’s like weirdassed randit summer camp. I can see them now, the huntresses all
“***giggle*** I think Kevin likes me.”
“Third from the left.”
“Fifth from the right is cuter.”
and the bandits all
“Dude, we should totally do a pantie raid at the huntresses’ place.”
“I don’t know, man. I don’t want to piss off Kevina, I kinda have a thing for her…”
“Fifth from the right is WAAAY hotter.”
It IS like randit summer camp! Although occasionally I think there are female bandits and even enemy soldiers. Supideo’s birth mother is the most obvious example, but sometimes I’ll hear a female voice in the random enemy chit-chat.
Speaking of which, my favorite chit-chat line so far: “If I wanted whistling, I’d buy a bird.” [Said in a menacing tone as a dude came prowling over in response to my whistle.]
Setting traps on the beacons is pretty awesome. Mr. O’ told me about it, and I’ve only managed it once so far (I tend to forget to look for the beacons), but it was very satisfying.
Setting animals free is also often good for a distraction (and some soft leather to loot later). I like that trick quite a bit. I find that if you shoot at the animals from the bushes, it will open their cages (maybe the game gives you credit for shooting at the lock, even though the first time I was totally trying to hit the lion itself) and they’ll spring out and attack whoever’s nearby. Which, if you’re hiding in the bushes and shooting from a distance, will not be you. It’s pretty great.
“I’d buy a bird.” Hadn’t heard that. But it is pretty amazing that these dudes are perfectly ok with living this rough life, outside, in caves, whatever, wearing chafing armor, listening to the screams of their victims, but whistling just pisses them off. “STOP THAT WHISTLING! I WILL KILL YOU!”
Ah, I was going to ask you about that! I did learn (by dying) that freeing the lion by actually unlocking its cage when you’re right there is a bad idea. As is accidentally smashing its cage when you’re right there. Or pretty much being right there when it gets out in any way, shape or form.
That lion is a tough bastard.
Ok, phew. Played through the quest, as my friend is coming later and who knows when I’ll play and that would’ve kept me awake at night.
Of course, got it on the first try.
Wasn’t easy, though. And took a good 20, 25 minutes, which, for this game, is an eternity. So plan accordingly.
Now I can rest easy.
I hate that, when you’re at a really tricky bit in a game and you’re thinking on it when you’re trying to sleep. You know what I mean. Fucking broodmother in DAO kept me up maybe three nights.
That feeling of “tough quest relief” is weird. I shouldn’t care so much. But I do, so there.
I think you mean “I should care because this is important and it’s very normal for normal people like me to care very much about it.”
Tough Quest Relief is real! Good for you finishing it off before company. I’d say I’ll be right behind you, but in fact I’ll probably get distracted and wind up talking to the people at the theater or whatever, trying to clear that slave guy’s brother’s good name, and still not have done it by the time you play again.
But one never knows!
What? Who? What?
I found a theater, and it just had kids bickering about learning lines, which made Junior laugh as he is at theater camp. There didn’t seem to be much else there.
And slave brother? I didn’t talk to him after the kill Kevin take documents deal, but I assume you mean him…..
You’re not behind me.
Oops. Sorry. When you bring back the tax documents from the warehouse and the guy reveals he’s a slave and you have a little chat, he suggests you visit him later at the slave auction house. If you do he mentions his brother. And hijinks ensue.
We’ll talk later.
Yes, I got him mentioning he was a slave, which I found interesting. I told you that bit promised multiple quests and potential themes. That’s why. But I didn’t follow up on it yet, cuz I magpied.
This is what magpieing gets you, I say.
Hijinks ALWAYS ensue.
Yeah, it was an interesting chat. And an interesting reminder that slavery in this context (though not a shining example of fair labor laws) was not the same system as the race-based chattel slavery practiced in the US much later.
This is only a small spoiler, and may make you feel better: part of the hijinks that ensue involves rescuing the dude from the fort. So when you do talk to the slave guy, you’ll be partway there!
I hope it’s the same dude. I do. Because I do NOT want to have to do that again.
It’s true, there could be two dudes who need to be rescued from forts. Was this a farmer? Trying to avoid paying taxes to The Dagger?
But no, let’s not be silly, we both agreed we were doing a quest called The Taxman Cometh. Logic dictates it must be the same dude if it’s the same quest. I mean, otherwise it’s just…madness. Sheer madness.
You’ll be fine. You’ll go talk to the slave and he’ll say something about talking to so and so about his brother, and you’ll say “been there, did that.”
Yes, good. That’s him. Farmer. Rich, drunk wife. Avoiding taxes. Claiming he wasn’t a slave. That’s the one.
But I’ve now completed that, and there’s still a quest icon by the slave market, which I found earlier cuz magpie.
I suppose all will become clear. Or not.
Oh yes, the farmer was only one of multiple hijinks to ensue from that conversation. Don’t you worry.
There are ALWAYS hijinks.
I look forward to playing them at some point….
Guests won’t stay forever!
By definition. Because if they do, they just become people who live in your house.
I hope this was a comforting thought for you.
Save Early and Often IN THE RIGHT PLACE
Assassin's Creed: Odyssey, children, combat, saving, story
Very minimal spoilers for a quest in AC: Odyssey
I got nothing, so I hope you caught up. My kids couldn’t do the same thing for more than 32 seconds last night (even watching battlebots! They LOVE battlebots! Battlebots is pretty cool….) so I had to chase and herd and get annoyed.
I hope you caught up.
And tomorrow I have a friend coming for a couple nights, a friends I’ve known (gasp) longer than I’ve known you. It’s gonna be kinda weird. I met him at the camp to which Junior and Nugget now go. Dropping Junior off, with my friend, who I met there, when I was about Junior’s age….Just odd. It would be kinda like if Blasto and Meatball both end up living in the same hall we all lived in in college. My brain doesn’t need that.
He’s also a blogger! But he does movies. Pfft. Movies. Who would want to blog on a subject that SO MANY other blogs write about? What a waste of time.
Blogging about MOVIES? Meh. It’s so done. Plus, we’d have to watch a lot of movies, and that wouldn’t leave time for video games. Not worth it.
As for catching up…funny thing about that…I went back to Lokris to catch my ship from the dock there, IGNORED A LEADER HOUSE that needed looting, just for you, and started sailing off towards Andros, and guess what happened?
Yes indeed. Three ships worth of pirates. The very thing I was trying to avoid by all that roundabout overland travel. Good times! But whatever. Dealt with the pirates.
Saw an icon for a sunken temple! Obviously had to stop to loot the sunken temple. Once again, was not struck down by an angry god. They either don’t care as much about worship and sacred places as I’ve been led to believe, or…maybe they just don’t exist?
Saw an icon for someone with a quest! Pulled over to talk to the dude about “death and taxes.” Have to recover some records from a warehouse. Which I will do next time I play.
So yeah. Didn’t quite catch up. Working on it. I blame pirates.
Well, did you get a “WHAA DA WHAA!” quest completed deal when you dealt with the pirates? Cuz after the whole Herodotus vision cutscene, I’m on the boat, and Barabas is all “We must upgrade our hull! We need resources! About three ships should do it!” and, by chance, I already had done that (so I could recruit more people. Snicker), so as SOON as he said that, it goes “New quest” “Quest Completed” “WHAA DA WHAA” and Barabas is all “She hits like a fist now!”
So maybe that was it.
But dude! We’re in the same damn place now! That temple was the one I found the quest item for the quest I don’t have yet (see yesterday’s post) and the last quest I did was Death and Taxes!
I also opened up some viewpoints on this island. There’s question marks. You’ll love it.
But we’re so close together now! Death and Taxes is a nice, happy, kill Kevin take his shit quest. But it has an interesting ending/segue into the next quest, which is what I’m doing next cuz it looks interesting.
You’ll like it.
I got nothing when I defeated the pirates. Just some random, cheap-ass loot because they were all level 12 for some reason. WHY ARE YOU EVEN ATTACKING ME, FOOLS? I am clearly way overpowered for you! Look at the number above my head, dude!
I suppose they thought all three of them might be a match for me. They were wrong.
But no, either I already upgraded the hull to Barnabas’ satisfaction, or he hasn’t decided to tell me about it yet and I’ll have to deal with three more ships worth of pirates next time I sail.
After the death and taxes and what-not on this island. It’s going to be great.
I get the sense that this island may take some time. There seems to be a quest line, or what passes for it in this game.
Plus….so many question marks…..
We should be docked long enough for that sculptor to make three or four figureheads for you to choose from.
But it does promise at least a little bloggage. Unless it’s a real letdown. Have you explored the island/city much?
I should play, but with company tomorrow I have a) chores and b) a few days here where there’ll be no FITNESS and lots of eating so I should likely go clean and do FITNESS before it gets too hot.
Stupid FITNESS.
FITNESS! So you can feel good about eating and drinking booze!
I have not explored the island. I literally landed, walked up to the guy, heard his story, saved, and quit.
Oh! Oh! And speaking of saving, guess what else I did last night?
That’s right: I accidentally saved Mr. O’s game on top of mine.
It was justice. Terrible, vicious justice.
Or it would have been if I didn’t have a second save from 30 seconds before the one I saved over. Plus a third from half an hour before that.
Save hygiene. YOU CAN’T BE TOO CAREFUL.
I have taught you nothing.
Praise the auto save. All three of them. And the quick save you should use often.
Those weren’t auto saves, those were my three hard saves. Neither auto save nor quick save (which I do use often) would have helped me in this instance, because they were all from Mr. O’s game.
It was the transitional period as we traded off on the console, and I was going to load up mine, but saved his instead because I was in the wrong screen. EXACTLY what happened with RDR2, but with less tragic results.
Dude….dude.
At least you have three hard saves.
Does he? No. I bet you he does not.
No, he does not. But at least now he has two!
He’ll thank you in the end. Or not.
What is his DEAL???? I have, what, 15? Which is low for me! I’m working on my issues! I AM!
I don’t know, man. I don’t know. I’m not like you, but I usually have 3 or 4 saves going. I rotate through them to keep them current but give me a safe backlog. He’s just not into it. Even when tragedy strikes! He still hasn’t finished RDR2! Because of me!
But surely it’ll all be fine, I wouldn’t do that again. Probably.
I mean, I wouldn’t bank on that probability myself, but I’m not him.
It’s just such the opposite of everything I’ve learned…all my neuroses…..
They should have a feature where save and load screens don’t look so damn similar. Like, save is bright green and load is bright red or some shit. RDR they were similar, and this game even more so.
Work on that, devs.
Yeah! Work on that. Because as tragic experience has shown, the current setup is a recipe for disaster.
Probably more so because we have two people both active in the same game. I mean, writing your OWN game over the top of your saved game, even if it might not be exactly what you meant to do, is likely not that big a deal. You either have other saves or you don’t care about other saves, and in any case you have quick saves and auto saves to return to if need be.
But with multiple people running multiple versions of the game, minor accidents can become horrible, tragic catastrophes.
I remember earlier versions of AC made it a lot easier–you’d see a link to the active games on the load screen, and then any saves within the game you chose to load, stayed in that game. There really was no way to save one game into another game’s save slots.
Perhaps the real answer is that they don’t actually care that much about making it easy for multiple people to play the game at the same time. First of all, that’s probably a small percentage of their total audience, and second of all, screw those people! They should each buy their own damn disc!
Or so I can imagine someone thinking. Probably while cackling villainously at the sky.
Well, can’t you just make another user account? I have user accounts set up for each kid on the PS4 downstairs (which is still kicking and is LOUD), and I think that solves the problem. I think. We don’t play the same games, though, so maybe not.
You’d have to fork over the extra PS+ subscription, though.
Mine just renewed and I almost killed Junior. Got up, had the email all “Funds have been added to your wallet” and “Purchase receipt” and was THIS close to exploding all “JUNIOR WHAT DID YOU DO?” and then realized “Oh, that’s me. Heh. Moving on.”
Parenting, man.
“I withdraw all those threats against your life. For now.”
That’s an interesting thought…maybe we could use different accounts to load the same game, and confine the saves that way. We each have an account set up already, from when we were playing Divinity: Original Sin. Hm.
I’ll have to look into that. I don’t think it will help in the current situation, since we’re both already 20 levels in, but next time we’re playing the same thing, I’ll totally check it out.
Yeah, too late for this. But it may well be worth it the next time. Think of the PS+ subscription fee as marriage insurance. A bargain when you think of it that way.
Just remember saves don’t upload without PS+. If you made an account as insurance then didn’t do that and overwrote and it didn’t upload….
Can’t even.
“I withdraw all those threats against your life. For now.” is a pretty great T SHIRT!!!!!
Mention of PS+ reminds me I must grab the July free game. Sweet Naked Zeus would I hate to miss the latest from that guy!
Shit, I gotta do that, too!
Look at me. Not myself. I blame the heat. And the kids. And the chores.
Especially the chores.
But ESPECIALLY the kids.
Speaking of whom….I must get them.
The upside of summer heat is that their bedrooms are air conditioned, so I can be all “Hey guys, SO much more comfy in there. Go there. No, really, go there.” And there’s half a chance they might.
Of course, they could all go into the same one and fight in there, in a smaller space, which would not be optimal.
But one can dream.
Oh, I Was Born a Ramblin’ Adventurer
Assassin's Creed: Odyssey, loot, maps, mechanics, religion
Minor spoilers for AC: Odyssey
Played some! Not much, though. Loaded after Supideo and there was an “impact quest” right there! “Bloggage!” thought I. So I went to the guy. He was all “Used to sail with Barabas, but I got stabbed by a pirate. Now I can’t even buy wood to sail with my son….” “Kassandra was all ‘I didn’t know I replaced anyone….'” So he asked for some money, and I’m all “Yeah, dude, despite the fact I’m always trying to get paid, I ALWAYS have too much money” and he took it, said thanks, quest over.
That was that. I’m sorry if I spoiled, but not really anything to spoil. Go figure. So much for bloggage.
Then sailed more in the general direction of main quest, found an underwater “Loot but watch for sharks!” place with a quest item for a quest I don’t have yet, which will lead to one of those “Please….help us…there is a sacred item that must be found, and none have laid eyes on it for centuries it is a-” “What, this?” “……uh…..yeah….thanks…..” deals.
Then found a new city called Eubella or some shit, did a quest there, called it a day.
You’ll love it. LOTS of question marks.
I went back to Kephallonia, because I wanted to see what was going on there, and it’s not pretty. Bodies in the street, people staggering around in rags. I probably should have let those priests kill that family.
But it meant there was very little to interfere with me picking off a couple of ainigmata ostraka treasure hunts and looting the couple of treasures I didn’t get around to last time I was there!
Then I tried to go back to somewhere more centrally located from which I could easily call my ship, because sailing to…uh…Andros, that’s it, sailing to Andros from Kephallonia looked like a hassle. So I went back to Megaris, and got distracted by a few question marks I hadn’t done, got distracted by a ‘Conquest Battle!’ notice when I weakened the nation, tried repeatedly to finish the conquest battle without success (I was trying to fight for Athens, which is labeled ‘hard’ but gets more loot), and finally wandered off. Chased question marks around the mountains a bit, ended up in Korinthia, as one does. Then noticed that the conquest battle was no longer available because the nation refortified, sigh. I’m not sure these conquest battles are actually critical to the game, other than providing epic gear, so I may just ignore them in future.
What’s it to me whether Athens or Sparta has control here?
Anyway, I’m TRYING to find a dock to get on my boat so I can sail to Andros. That’s my story, and I’m sticking to it.
You should go back and see how your Kephallonia is doing.
Whoa! Dude! I guess shit DOES matter! Maybe that dude I gave money to will come back to haunt me!
I’ve cheerfully ignored all the conquest battles. My loot is just fine, thank you, and the battle I had to do is, so far, the single most annoying part of the game. Indeed, during that one I had to do, I spent a lot of time thinking “You know? I really don’t want to have to do these….”
And if they are avoidable, then this is what Mafia 3 should have been! You CAN go burn the stag films and fight for Sparta, and, if you do, there’s some reward (loot, XP, I assume), but you can just cheerfully ignore it is you AND YOUR BLOGMATE WHO LIKES NARRATIVE HINT HINT want to follow the narrative so THEY HAVE SOMETHING TO WRITE ABOUT.
What a great feature. So glad the game is designed like that.
Wait, what do you mean “Call your boat?” You can call your boat? I know you can fast travel to your boat whenever you want, but you can call it?
I should go back to Kephallonia! What with all these fast travel points I’ve opened up…..
Wait, you can fast travel to your boat? I completely forgot that.
So…uh…well…but yes, sometimes by the water there will be these points where there’s a sort of glowing column of air, as if you might get whisked off to the heavens by stepping in it or something, but actually if you step in it gives you the option to “summon the Adrestia.” I’ve been looking for one of those points. Because I assumed that if we had these points, they (or the ‘dock points’ where you can formally tie up) must be the only way to get on the boat.
Although…I can save the situation by arguing that I intentionally haven’t fast traveled to my boat because it’s gods know where in the open sea between Kephallonia and wherever I am now, and the whole reason I fast-traveled back is because I didn’t want to do a lot of open-ocean sailing and pirate-fighting at that moment. So, I’m trying to find a place CLOSER to Andros, to which I can summon my boat, and from which I can then sail in my boat a shorter, less annoying, possibly less pirate-heavy distance.
So it’s all been ON PURPOSE. Not at all because I forgot about fast traveling to the ship. Certainly not.
I’m glad we straightened that out.
Yes….glad we straightened out that yes, you can leave the boat anywhere, like, the open sea, fast travel to a viewpoint you’ve been to, do whatever, and then fast travel back to the boat which will be right where you left it.
This is probably why I never knew you could summon the boat…because…you know….you never have to.
And I could see your point about wanting to avoid pirates on the way to Andros, except, see, there aren’t any pirates, but there are a couple of towns (well, at least one), that you sail right by on the way and have level appropriate and themey quests…so….
Um…..
Go back to your boat, please.
Oh, I’m not worried about pirates on the way to Andros from any normal location. I’m worried about pirates on the way to Andros from Kephallonia, which is way the hell far from…anything. Which is why I didn’t just hop on the ship and head out once I’d checked on the plague victims.
Also, question marks in Megaris. And Korinthia. And those treasure hunts! And…
But no, I need to move on, because I have all these assassin skills I can’t improve until I “progress further in the story.” I’m on it.
Oh you took your BOAT back? Why do that? I never take the boat anywhere except new places. If I want to go back, I fast travel back, leave the boat at the edge of the undiscovered parts of the map, you know, the ONES ON THE WAY TO THE STORY, and voila. Minimizes sailing, never gets lost.
I’m stunned you left some question marks alone the first time you were in these places.
No, I didn’t take the ship back, I fast-traveled, but while I was there near the old familiar harbor, I was contemplating getting on the ship in order to sail to Andros, and realized Kephallonia was too far to sail, so I fast-traveled back to Megaris instead and was distracted by question marks.
So in fact, I haven’t been on the ship in weeks and have no idea where it is. But while I was in Megaris I met a woman who was talking about making a statue of me! I recruited her, saying I could use someone of her talents on my ship. I’m not clear exactly why I need a sculptor on board, but whatever.
Maybe she does figureheads. Ooh, a figurehead of me! Man, I hope she does that. I will brave whatever pirates are in the way to get the rare and precious woods and pigments she needs to make that figurehead truly awe-inspiring.
I met no such woman! In Megaris? Damn. You’re going to have a boat with a personalized ram and I’m not. DAMN!
Well, at least you know your boat is kinda on the way to good quests and bloggage and the main story.
It’s marked on the map! Little gold boat. Can’t miss it. And you can fast travel there.
After all, what’s a good figurehead of yourself worth without a boat?
Though you likely won’t get one. If you recruited her, she’s likely already on the boat wondering where you are. When you get there all “Hey, sorry, couldn’t find the boat,” she’ll be all “Dude, I found the boat right away and I’ve never even been on it. Make your own statue, dweeb.”
Nah, Barnabas will bring her around.
“No, this lady’s great! She’s technically the captain but she’s hardly ever around so we can pretty much do whatever we want. And she’s super into ship upgrades because of some paranoid idea that the crew’s lives will eventually depend on having the best of everything when the Reapers come, whatever they are, so anything you want in the way of booze, just order it along with a shipment of improved javelins or something and you’re golden, she’ll just pay for it without even blinking. You’re gonna love it. Might as well make that figurehead gold-plated while you’re at it, that way if we ever shipwreck in a strange land we’ll have something to peel off and buy things with.”
“For real, Barabas?”
“Yeah, dude. Only downside is she stops the ship about every twelve feet so she can dive in the water and swim away to….well, now that I think about it, I’m not sure. Slows us way down. Relaxing on the oarsmen, but kinda frustrating when we really have to get to port and empty out the chamber pots. Plus this weird assed eagle is always following us around. Creeps me out, frankly. “
“Honestly, I suspect she’s either insane or an agent for some mysterious organization…but her money’s good, so I don’t ask too many questions. Although if you want wild speculation, chat with Herodotus, that dude has some IDEAS.”
“Herodotus, eh? Hey, Herodotus, what’s the news around here?”
“We are seeking an elemental forge, left by the old ones who lifted humanity up to our present intelligent state, all the while fighting an evil, underground cult that may well be aliens.”
“Uh….yeah. You do that. I’m just gonna jump overboard, swim to shore, and just keep on making huge naked Zeuses. Y’all’s nuts.”
“Those naked Zeus statues aren’t going to sculpt themselves, you know. Someone’s got to work on the important projects.”
Ooh, I did see another naked Zeus last night, actually. Probably one of hers! This one wan’t as huge as the one on Kephallonia, but it was all nice and shiny, done in copper or something. Fine handiwork by some hardworking artist.
In the middle of some location that had been taken over by bandits, whom I obviously had to murder. Show a little respect, people!
Not that I do. My Kassandra remains dubious at best about the gods. Although the tragic story of Supideo does make one wonder.
Hey, my Kassandra never got that ending. She’s still skeptical as hell, and rightly so.
She’s just gazing at the naked statues cuz she’s an art lover.
My Kassandra is thinking there could be something up with the Oracle. But maybe it’s Herodotus’ ancient people rather than the gods she’s learned about before, because she’s already looted quite a few sacred temples and such without anyone smiting her down.
She’s seen things, with that weird pyramid in the cultist’s secret gathering spot, but she’s not sure they’re divine, at least not according to her previous understanding of divinity.
Although given her previous understanding of divinity is a bunch of grumpy people with super powers taking an occasional and usually tragic interest in humanity, who knows?
Plus, there’s the spear–both she and Herodotus had a vision of the battle where Leonidas died, right? That’s…not normal. Could be divine. Hard to say.
But something’s up for sure. The Oracle, the vision of her past in the cult meeting, the spear…she’s willing to buy that something’s up.
Is it the divine pantheon with which she’s familiar? Unknown. Probably doubtful. But on the evidence, I think she can’t rule it out.
Ooh, and speaking of nothing really, except that I was back on Kephallonia, I also went back to the historic pig farm! An ainigmata ostraka led me there to find some treasure!
So that’s what that was all about, apparently.
Magic, historic pig farm. I never did finish that one. Is it worth it?
There is a lot of weird, but MAN she is totally chill with a lot of weird shit. I kinda hope they resolve that, because her level of “Yeah, whatever” is getting silly. Maybe there’s a reason that she’s so chill! After all, the hipsters (who have been conveniently forgotten since character creation) chose her for some reason or other. Right?
Well, it’s just some loot. We’ve got loot a-plenty. There’s not really a story there.
She is extremely chill. That is true. I cannot explain it.
Although seeing Alexios as the cult’s weapon did seem to shake her. So she can handle any supernatural nonsense the world cares to throw at her, but family and emotions, those are the hard things. Typical adventurer.
Averting Prophecy: A Fool’s Game
Assassin's Creed: Odyssey, combat, mechanics, morality, religion, romance
Spoilers for the Supideo quest and the quest with the handsome doctor in AC: Odyssey
That quest with the blacksmith and the guy worried about killing his parents…that was some quest.
Ok, the more I ponder that quest, the more I kinda love it.
Cuz I totally didn’t see the ending coming. Not one bit.
Well…wait. Before we go on, I want to make doubly sure you finished it, because I really don’t want to spoil it, as it is, by a country mile, the best quest thus far, and probably will be the best quest in the game, period.
I’d LOVE to contrast it with the doctor quest, too, as there are a LOT of parallels. Did you get to that?
I did get to the doctor!
You thought I wouldn’t, but I did. Totally murdered the hell out of his grandmother, too.
Just kidding. Of course I let her live, and convinced him to let her live, even though her lying prophecy broke up my loving family so many years ago.
Though I did find it kind of funny that the dialogue option was “violence doesn’t solve anything,” considering that solving things with violence is pretty much exactly Kassandra’s job. Although maybe she’s just be realistically world-weary about the actual effectiveness of her job. “People pay me for violence, so that’s what I do, but I know it doesn’t actually solve anything on a larger scale”?
Though her personal resolution to hunt down Kosmos cultists kind of suggests that she feels violence WOULD solve something in at least that case, so who knows. Maybe she’s just not internally consistent. Which is…a known quality of humans. So I’ll let it be.
Also, yes, I finished the Supideo quest. That was interesting, all right. I was very curious as to how it resolved if you didn’t sleep with the blacksmith. He screamed (not in agony!) with someone else, because you got him the flowers he needed to seduce some other person? I suppose?
There are interesting things in both quests about faith, gods and oracles…you start, you have thoughts.
I’m sorry I doubted you. I did NOT see Kassandra actually meeting the woman who made the actual prophecy. That was cool. I let her live, too.
And well, I don’t think she thinks “solve” is what violence does. She certainly isn’t too big on the idea of war. She’s not taking sides, she’s not all wistful about the heroism of Sparta or any of that. Yes, she gets paid, but most quests she ends up just sighing and rolling her eyes. We talked on that before: one flaw of the character is she doesn’t really have a moral compass, not even “save the world.” I think her “Kill the cult” deal isn’t so much as solving or saving the world as just straight up revenge. It won’t fix anything per se, but it will make her feel better, much as killing dudes doesn’t solve anything, but the drachmae she gets makes her feel better.
I did not bang the blacksmith. I have standards. He just said “You break my heart, mithios. But, you held up your end of the bargain, here’s the sword.”
Boy, yes. I have thoughts.
The main theme I’m seeing in this game is the pull of religion. Most of the religion we’ve seen so far, at least in regards to the oracle and the gods, is that, at best, it’s “Pay no attention to the man behind the curtain” fraud wizardry (which is what the oracle says she mostly does when she’s all “She’ll fall in love with you” or “it will rain,”) or, at worst, outright manipulation. That said, it does have real believers who are likable characters (Barabas is certainly a true believer, and I like that guy).
The doctor quest was certainly a quest about the fraudulence of the oracle, of course. It dealt with a good person who was ashamed that his family was part of a fraud. It involved a son WANTING to kill his relatives because, in his eyes, they were bad people. While we let her live, I, and probably you, were nodding along with doctor guy that yes, yes, grandma didn’t do nice things, she wasn’t that great a person. I forgave her because it didn’t seem she did it maliciously, but still.
Then we get to the blacksmith. As I just did the doctor, I was primed to think “Yeah, yeah, oracle, blah blah, whatever, bullshit, of course bullshit. Here we go again.” And yet, there were clues all along that it was NOT bullshit. First and foremost, the whole structure of the narrative. Here, we have a son who wants to SAVE who he thinks are his parents who he THINKS are good people. We rolled our eyes and went along. We should’ve wondered why the bandit leader was all “Do not touch ANYONE in that family,” but we didn’t.
And then the end…..the oracle was RIGHT.
The son DID bring agony (you said the blacksmith screamed if you banged him?) and death (sure killed the hell out of his mother) to his parents. What he did, what he asked us to do, made the prophecy come TRUE. And, for me anyway, it was such a shock because it was the first time in the game that an oracle’s prediction wasn’t complete horse shit.
Now, maybe it was a coincidence. Sometimes a fortune cookie says “Money will come to you” and you find a dollar in the parking lot. It happens. But, at least in this particular quest, the first quest you’re likely to find in Lokris, after you spend the whole fucking time you’re in the Valley of Apollo seeing the oracle do nothing but lie…..
The oracle was right.
And my absolute astonishment that the oracle could even BE right was a very, very cool thing the game did.
Themes!
Did you talk to Herodotus? Do you know what’s up with him? Cuz when we get somewhere, I’m very interested to see how the overall theme of “Is believing foolish? Is religion a sham?” plays out.
Ah, if you didn’t sleep with the blacksmith, you didn’t get the full impact of the Oedipal reversal! When his parents were revealing he was adopted, they flat-out said to me “you killed his mother and slept with his father.” And he said “but the oracle said pater would scream in agony!” and Kassandra said smugly, “oh, he screamed–but not in agony.”
So, yeah. Did you just not get a reference to the screaming part of the prophecy at all?
And yes, it was quite interesting that here we have an instance where the Oracle was, apparently, giving a true prophecy. (Aside from the matter of whether the screaming was agonized or not.) And we also had her apparently referencing our actions on Kephallonia when we met with her ourselves, which suggests that sometimes, anyway, she does actually ‘see’ true things. Maybe when she’s not just saying what the cult tells her to say, she has real visions? Sometimes? Hm.
It was also interesting to meet the former Oracle whose lies were responsible for our own sad fate. Or…was that particular prophecy actually a lie? I don’t remember the exact wording (I’m not sure we even know it), but if the prophecy was that the baby would destroy Sparta, well, the terrifying weapon that the cult has made of Alexios COULD potentially do that at some point in the future, if it serves Kosmos’ purposes.
Maybe this is actually another of those instances where trying to avert a prophecy (by throwing the doom-baby over a cliff) just winds up making it happen (by delivering the baby into the hands of the cult).
Just like poor Supideo did, with our help. Maybe WE’RE going to destroy Sparta ourselves! I mean, I could see doing it. I’ve little enough love for them after my (step-)father tossed me off the cliff.
Never try to avert prophecies, people! Haven’t you heard legends before?
Well, probably not. They wrote so many of them. Maybe all the legends are still, like, first drafts.
As for writing and legends, BOOM! The themes have arrived!
Of course, the next several hours will likely be nothing but annoying sea battles, but still….
You get that Herodotus cutscene?
Ooo! Interesting about your different ending! I did get that he would scream in the prophecy, but that’s not how it ended, with something explicit. After the dude got out of the cage, the “father” started to say “We….have to tell you something….your mother and I-” and mother interrupted and said, nervously, “Are….very glad to have you protecting us and we love you.” Cut to Kassandra who rolls her eyes and says “Odd family.” The fact I killed his mother was heavily implied, but there wasn’t an “HA! Reveal!” Or Kassandra all “I have figured it out!” It ended implied, and Kassandra NOT understanding it and going on her merry way. As did the kid! HE was kept in blissful ignorance, too, and went off thinking his faith in the oracle was misplaced.
Which I thought was inherently more interesting than having an “a-ha” moment. Kassandra openly mocks the kid, at one point calling him “Stupideo” (which I know cuz I had the subtitles on so I didn’t mishear), but, in the end, he was right and she never understood. She never said “I’m sorry I doubted you,” she never did anything except go off in ignorance.
Oh right! I forgot about that bit that seemed true! But she could have been told what happened in the past pretty easily.
Thought it would be an interesting twist if we spend the whole game being all “Meh. Oracles. Gods. Prophecies. What bunk,” only to have all of it be right in the end.
Wow, that’s interesting. So you didn’t even really get that it WAS an Oedipal reversal if you didn’t do the whole seducing thing. Hm. Well, in some ways that’s better, certainly for the guy and his family. In my game, the parents told him he was adopted, and he flipped out at the thought that his mother was dead and his father defiled or whatever, and he ran around acting crazy and blinded himself. Totally Oedipal, and therefore totally tragic. So in a way your version actually DOES avert the worst effects of the prophecy (not the death of the mother, but then, she was a bandit and so her death is actually helpful to society in general), but not by actively trying to do so.
Like I said: Never try to avert prophecies! Even if you ARE still working on the legends that explain this.
Hm. Well, I’m glad we did something different for once so we could compare. I was pretty curious what would have happened if I hadn’t slept with the blacksmith, and now I know! And it’s cool that there were genuinely different outcomes.
I did talk to Herodotus. He said we should sail to someplace (Aden, maybe?) because there are mysterious stone figures there, and he thinks bringing the mysterious spear of Leonidas together with the mysterious figures may reveal something that will help us understand and fight the cult. And he totally promises to help us find our mother.
Kassandra was all “fine I guess, but I’m definitely going to murder the hell out of a bunch of cultists.” Then he got on the ship and was talking to Barnabas, and I said “you guys chill, I mentioned something about murdering cultists and also I heard about a cute doctor out west, so I’ll catch up with y’all later.”
Whoa, no, totally different ending.
I wonder why you had a choice there and not about killing the mother. She just attacked. Hmm.
Also, kinda loaded that the choice that doomed them was the choice to have sex. My chastity saved people. Not sure what to make if that. Some serious moralizing if the game is really going there. I wonder if not banging the doctor made a difference.
Well, Herodotus also mentioned the old ones or whoever, the maybe aliens who lifted up humanity, so that’s still part of the franchise. He also called it a forge.
So there ya go! Aliens. Maybe. Or something.
Yeah, very interesting that you could choose not to have sex, but could not choose not to murder. It does feel a bit moralize-y, in that we could read it as saying sex is wicked and ruined everything for these people, but…I think also, it’s maybe just them being sensitive about sex, because that’s a way more sensitive topic in media than violence is, you know?
Practically every game we play features violence as a major mechanic. Sex is an occasional add-on. And because we know that violence is a major mechanic in these types of games, we likely are not playing this game if we object to committing violent acts in games. On the other hand, because sex is not a major mechanic in most games, and we don’t expect it to be a major mechanic in this game, it would feel kind of icky for the game to REQUIRE the player to engage in sex acts (even fade-to-black ones where nothing is shown).
Being required to engage in violence to complete a mission is par for the course. Being required to have sex would feel very weird. So maybe they’re just making sure to not force that on players who wouldn’t like it, but they don’t hesitate to force murder on everyone, because presumably we’re all totally fine with it or we wouldn’t be playing this game in the first place.
And certainly, as you say, it could have been presented as a choice not to kill this particular bandit, the same way it was a choice not to seduce the blacksmith, but I wonder if maybe they kind of didn’t want to tip their hand and make us suspect that there was something going on? I mean, we’ve never had an opportunity to talk to any bandits before, they all just attack on sight, so if all of a sudden this one bandit is all “hey, let’s chat!” we’d start to feel like something was up.
Alternatively, maybe they just didn’t want to let us get away with fulfilling NONE of the prophecy. I mean, if we negotiated with the bandits and got the shield with no bloodshed, then…what? There’s no reveal of any kind, just “hey, thanks for getting the stuff back, everything’s great!” Which would basically present the message that trying to avert prophecies is a totally great idea and will definitely work out, and…I mean, the guy’s name is Oedipus backwards. Maybe they figured he can’t get away with NO prophetic disaster. Even if he doesn’t realize it, he was the reason for his mother’s blood being spilled, just as it was foretold!
Though this does raise interesting questions about the nature of fulfilled prophecy. Usually the whole point of these cautionary stories is that the subject realizes the truth at the end–as he did in my version. But does he really have to know it came to pass, for it to count? Or is it enough that his adoptive parents know? Or, in your story, has he just delayed the inevitable moment when, somehow, he WILL in fact learn the truth, possibly after actually causing his father to scream in agony?
You just never know, with oracles.
As an aside on “what does society accept,” I wonder how this would have played out had we been playing this as male. The same? Would it have been an option? All the more reason they didn’t make it mandatory.
Hmm. I think the “not tipping their hand” was something. But they did give a hint, as you had that banter about her refusing to hurt the family. Her henchman was all “let’s just kill them and take the rest of their wealth,” and she stopped him. So while, true, we’ve never talked to a bandit before, we also haven’t had banter before. So why throw that in there at all?
And, well….will he ever find out, in my game? It didn’t seem the blacksmith was in any rush to tell him. Blacksmith is right there. You can assume that the guy bumps into the kid all the time. Now his mother won’t tell him, being dead and all, so, in my game, who’s left? Maybe if his adoptive parents change their minds, but still, it’s very unlikely my kid will ever know the truth.
I think it still counts. He got his mother killed. There ya go.
Ah, but it always SEEMS like the prophecy was successfully avoided, right up until the grand reveal.
“We threw the cursed baby over the cliff years ago and everything’s been fine since!”
“I saved my parents and now everything’s fine!” (Incidentally, the whole logic of “I’ll give my parents a sword and shield and then they’ll be safe from me” seems flawed. Because he could always attack them in their sleep or something. But hey, if it makes him feel better, I won’t argue with his convictions.)
But sure, within the course of the game, I’m willing to buy that yes, your guy escaped the crushing knowledge of his own inadvertent sins.
Also, I read a walkthrough that referred to the PC as Alexios and mentioned that you could “have a little fun” with the blacksmith, so I think probably he could also have slept with him.
I certainly appreciate the equal-opportunity romance options.
Meh. “Have a little fun” probably meant having a couple meads, playing some cards, and going to a burlesque show and shouting “Show us your togas! You seein’ this?”
I would have played the heck out of that. “Wooooo! These guys can WRESTLE!”
Sages and Spelling Tests
Assassin's Creed: Odyssey, character, combat, maps, plot
Minor spoilers for AC: Odyssey plot points
Dude….I forgot how mighty your magpie is. Like, damn, Femmy. You ever actually meet Kassandra she’ll be all “This is Ikaros, for I am the eagle bearer!” and you’ll be all “Yeah? Check out MY bird!” and she’ll run for the hills.
I say this because here’s what I did last night:
I went and talked to Herede oh fuck I can’t spell all this Greek shit. That guy. Herodetus. Whatever.
Shit. Happened.
We wanted shit to get weird? Shit got weird.
But anyway, after some plot, he’s all “And now we must sail for [place].” [Place] isn’t a spoiler, I just forget where. I DO remember it was 6400 units of distance away. That’s far! There’s a lot between Thermopolye (FUCK GREEK SPELLING) and there. But I got in my ship and started sailing. I figured, if I saw some stuff on shore, especially viewpoints, get off, sync them so I can come back yadda yadda. After a damn WHILE I find this place….this salty place….
“No way….” thought I.
Found a little town. Found a viewpoint. Found….a SALTY BEAR CAVE! Said “NO WAY!” and saved. It was late.
But Femmy….Femmy….How in the seven Holy Roman Hells did you get THERE???????
(You’d’ve found it if you followed the story, you know. There’s even a side quest!)
The magpie is strong in me, it’s true. I got there overland, just by chasing question marks. Climbing up and down giant cliffs. As one does. I specifically went to the Salty location because I wanted to sync that viewpoint so I’d have a way to get back there later to check out all the question marks I didn’t get that time around.
Viewpoints are far between! I wanted the fast travel!
I went to talk to Herodotus also, but saved and went to bed right before speaking to him. So I’ll get there next. I was going to get to him sooner, but there was that semi-retired old friend of Kassandra’s who needed his sapphires back, and I’d already cleared out that fort, so I headed back to help him out.
Turned out the fort was fully restocked with soldiers and war supplies and loot and everything, but it wasn’t an ‘objective’ to do anything about it, so I just left them alone. Crept in, got the loot, ran out again.
And that’s why it can be useful to have been to a place before a quest sends you there. Anyway, I’ll totally talk to Herodotus soon. Definitely.
Haven’t met any nice doctors, though. But if you go down to the village by the salt mines, there’s the quest with the blacksmith I mentioned.
You are truly Femmy the Magpie bearer. I am so proud to be your friend.
Viewpoints are pretty worth it.
I remember that retired guy! Liked him. Did the same “get in, get out” deal to get the jewels.
I always feel bad when I do that cuz there’s always like, one Kevin that gets killed. Poor guy. I’m sure he’s always all “You couldn’t have just avoided me, too?”
So how’d you get to Herodotus (which I can now spell cuz you did and kinda fuck you you show off)? Cuz I found this cave that appeared to go through the mountain there, and Kassandra was all “I feel like a traitor, too, using this,” so it had dialog, which means I was supposed to be there. I died quickly. Often. Often died quickly. Quickly died often. Got to the point where I said “Man, fuck this. I’m just going to take forever to climb over this shit,” so I did. So I never went through the cave. Did you? Did I miss something?
Dude, he’s right there, right? Talk to him! There’s plot. And you get to sail towards so very many more question marks!
Ah, the blacksmith: that’s what that quest is. I was going to do that next.
The doctor is now rather far away from you. He’s back near that shore village, to the west of you. You can get to him if you fast travel back towards the main city there, Valley of Apollo. Kinda worth it. Themey quest. Should be on your map.
I know how to spell Herodotus because in my head I always secretly pronounce it ‘hero-dote-us’ the same as I did when I first encountered the name at 15 or whatever.
Well, it was a secret until now, anyway. Keep it to yourself and the entire internet, all right?
Although actually the GAME spells it Herodotos, which is maybe a closer transliteration of the ancient Greek, or maybe they just wanted to mess with us. But Herodotus is more traditional, so I’m going with that because I don’t need to retrain myself with a different spelling and then misspell it in every other context for the rest of my life.
Anything else in this game that I spell correctly is solely because I type my best guess into Google and wait for it to auto-suggest the right word. Thanks, Google! Saving me from my inability to remember how to spell anything.
Including Odyssey, although I’ve typed that enough times now that I actually do remember it.
Anyway, I encountered good old Hero-dote-us by returning to Delphi where we first met. He was just standing around there. I don’t know anything about a spooky cave where I could have quickly died often–I must have bypassed that entirely. Too busy looking at different question marks, I guess.
Do the salt village quest, it’s kind of interesting. Odd, but interesting. I’ll try to get back to the doctor, but first I’ve got to talk to Herodotus at the monument to the fallen Leonidas at Thermopylae. Where I’ve already been when I murdered some bandits there earlier, so I’m sure it’ll be great.
Oh ok. We’re one hero dote us talk off. The cave deal is to get to Thermopylae.
Spoiler: between where you are and hero dote us, there is a big fucking cave with a whole mess of Kevin.
Actually, if you take the long way, you’re pretty close to the doctor! Look west.
Oh, I misunderstood: I was actually, literally standing in front of Herodotus when I saved and went to bed. RDR2 got me all paranoid about talking to people when I didn’t have time to do their quests.
So I have already taken probably the same long(-ish) way you did to get to him, which in my case was climbing right over an entire mountain and down a series of cliffs.
I must have missed the cave full of Kevin. I’ll go back someday. Maybe there will be a quest about it.
Oh so you’re at Thermopylae?
Yes indeed! Just leaped off a cliff into a pool and wandered over towards Herodotus, muttering to myself “it’s said that whoever walks this ground still gets blood on their feet” or some thoughtful reference to the horrific battle that took place there back during the prologue.
Then stopped. Because I didn’t want to talk to him and get sucked directly into a mission that would have me riding a horse across the entire map for 30 minutes and getting into a bar fight with no save points while trying to haul a bounty to the sherrif.
Even though this game is MUCH friendlier with its saves. I like how you can even murder some people, run outside the ‘active area’ to hide and save, and then run back into battle. Good times.
Oh that trick has saved my ass, literally and figuratively, countless times.
No quest. But a pretty lengthy cutscene. Might want to turn on the subtitles before you chat with him.
Noted. It was getting late, so a long cutscene is also a good reason to have quit first. I’ll go back to it when I’m refreshed and ready to tackle the story. It’s gonna be great.
When you watch the cutscene, pay special attention to why Herodotus wants Kassandra to find the….thing they want to find…and, more importantly, why Kassandra agreed, cuz I missed it and I want to ask you.
OK, I will attempt to take note of the reasons for…the finding of the thing.
Cultists: Now in Regular and Salty
Assassin's Creed: Odyssey, family, Heavy Rain, mechanics, plot
Fairly significant main plot spoilers for AC: Odyssey
I got nothing. Another day of Mrs. McP coming home early and having things derail.
Maybe….you have something?
Uh…I have a lot of work emails?
Also, I went to the secret Kosmos Kult meeting and met my baby brother and learned about the vast network of Kosmos members I now get to hunt down and assassinate. I’m kind of into it? It’s an interesting addition, and possibly some good old fashioned sneaky-assassinatey missions will come of it. Or maybe it will become annoying. I’m not sure yet, I haven’t tracked anyone down because it was time to go to bed. Not that I went to sleep, because my internal clock is still a bit messed up, so I might as well have stayed up and played for another hour.
So you go ahead with the sharp observations you wanted to make about the cult meeting, because I am sleepy. Supernatural something-or-other, though, that was definitely in there. This is divine/magical/alien work for sure!
Kassandra remains entirely unmoved. She’s hard to rattle.
Though finding out that was her brother seemed to do it a bit. Understandable. It’s a troubling (though not especially surprising) discovery.
Still recovering from the trip, eh?
But you got to the cult and we’re pretty much in the same place except for banging a nice doctor!
So yeah, wasn’t ALL that surprised that he was alive, but was kinda surprised he turned up THERE, so props for the surprise of the twist we all saw coming. Nicely done.
So…I didn’t hurt the guy, but did tell the other guy to hurt him. I also put my blood in the bucket there. Had to blend in.
So! Alexios is the guy! And he seemed rather sympathetic to Kassandra. That was odd. He let her go, all secret. Hmm. Is he good or bad? QUESTIONS!
I will say, the damn priest should’ve just been honest and been all “Hey, Kassandra’s mother, dude, chill. I know this looks bad, but there’s a trampoline down there. They’ll be fine.” Would’ve saved a lot of trouble.
But yeah….vast network. That.
On one hand, I get why they’re introducing that whole damn page of the menu now. They had to wait until the plot got there. And I have done two or three of the cultists, and yes, you are right, it’s old school assassinating. That’s what I meant yesterday about AC not really getting a new thing. This thing is very much the old thing.
On the plus side, that’s fun, and, at least the few I did mixed it up in terms of environment, tactics, etc. Not repetitive. Yet.
On the minus side, MAN this is late to be getting whole new pages of menu. REALLY late. We blogged a while ago about how weird it was getting new shit nine levels and eight hours into the game, and we STILL ARE.
Also, this makes the mercenaries even less relevant. I was kinda thinking they’d be the ones we could go assassinate if we wanted (after all, it was “if we wanted” in AC4. You had to get the contract, etc.). Now I have no idea what they’re there for, except to be something else to do (in a game that already has a shit ton to do). I feel kinda bad for killing that guy who was just chilling in his house. Why’d I do that?
But tip: Remember yesterday when I said “Don’t worry, you’ll have plenty of reason to hit all those weird question marks?” Well, let’s just say I haven’t done a whole lot of cultists, and I’ve already returned to a fort I cleared out LONG ago. Why wasn’t the cultist there when I killed everyone the first time? We can’t be sure. The second one was WAAAAAAAY off the beaten path.
The game will lead you to all those question marks just fine.
I’m skeptical any of the cultists are going to be hiding out in the Salty Bear cave, but one never does know.
I also kind of feel that there’s really no reason to go after the mercenaries, unless they’re coming after me in a foolish attempt to collect a bounty. I passed a guy yesterday who was one level below me, so I could have taken him in a fight, but…enh…he was just walking along minding his business. I have no quarrel with people walking along minding their business.
Unless their business is Kosmos. Then they’ve got to die. Otherwise, I’ll leave them alone until they come after me. I’m not that dedicated to rising in the mercenary rankings, it turns out.
It was interesting that Alexios is the cult’s secret weapon, and that he and Kassandra shared a vision of their past? I guess? And then he just let her go, and killed some random other dude instead for the crime of murdering Elpenor. Perhaps there’s a chance we can bring him around to the side of good, or at least the side of Kassandra.
Or perhaps we’ll end up fighting him to the death. Time will tell.
Time will, indeed, tell.
I don’t know how salty it was, but I can tell you one of the ones I did, so an early one, was, in fact, in a bear cave.
Might have been salty.
Oh, you’d know if it had been salty. It’s right there in the location name. Plus, you know, it’s near the salt mines. So there was less wild creativity involved in the title than it might seem at first.
Ah, man! I thought it was creative! Snarky, even!
It’s still cool. I guess.
I guess. I mean, at least it has a little seasoning. Not like the regular, unflavored variety of bear.
I’m looking forward to meeting tangy bear, slightly sweet bear, lemon pepper bear and smoky bear.
Only you can prevent assassinations.
But you won’t! Why would you prevent assassinations?!
Only you can assassinate the bear who tries to prevent assassinations.
Smoky bear? Only you can prevent forest fires?
Too oblique?
I’m sorta glad you didn’t get it. Thought you’d chide me for stupid humor.
Dude, I totally got it. I had a Smokey Bear doll as a child. I was just riffing on the theme.
Ok, that makes more sense. I thought you’d get it. I figured maybe you were just tired and your brain was rebelling due to fatigue.
Oooo! Haven’t checked this lately, but July free PS+ game is Detroit: Become Human, the next thing from the dude who did Beyond: Two souls. Supposed to be good.
I mean, we won’t be finished with any of our shit any time soon, but hey! What are gamers without backlogs! Let’s download it just because someday there might be a lack of something to play!
Oh yeah! That dude! Whose Heavy Rain we found so delightfully free of any unsettling content! Still, I’ll play it. He’s got an interesting approach, anyway.
That’s the one!
Hey, you gotta admire him. It takes a lot for a game to make us down on the fact it had gratuitous nudity. That took effort.
|
cc/2020-05/en_middle_0097.json.gz/line1400023
|
__label__cc
| 0.694895
| 0.305105
|
Category Archives: Cross-cultural issues
China in the 15th Century AD
“We, Zheng He and companions, at the beginning of Zhu Di’s reign received the Imperial Commission as envoys to the barbarians. Up until now seven voyages have taken place and, each time, we have commanded several tens of thousands of government soldiers and more than a hundred oceangoing vessels. We have … reached countries of the Western Regions, more than three thousand countries in all.
We have … beheld in the ocean huge waves like mountains rising sky high, and we have set eyes on barbarian regions far away, hidden in a blue transparency of light vapours, while our sails, loftily unfurled like clouds, day and night continued their course, rapid like that of a star, traversing those savage waves.”
(Stone inscriptions in the Palace of the Celestial Spouse Chiang su and Liu Shia Chang, dated 1431)
“On 8 March 1421 the biggest fleet the world had ever seen sailed from its base in China. The ships, huge junks nearly five hundred feet long and built from the finest teak, were under the command of Emperor Zhu Di’s eunuch admirals. Their mission was to proceed all the way to the end of earth to collect tribute from the barbarians beyond the seas and unite the whole world in Confucian harmony. That journey would last over two years and circle the globe.”
“… They had also discovered Antarctica, reached Australia three hundred and fifty years before Cook and solved the problem of longitude three hundred years before the Europeans.”
The above are from ‘1421. The year China discovered the world’ by Gavin Menzies. He is a retired Royal Navy Submarine Commanding Officer, born in China. He spent 15 years tracing the astonishing voyages of Admiral Zheng He’s fleets.
The book contains many pages of supporting evidence; eye witness diaries; key charts “describing the first navigation of the world”; and the “determination of longitude by the Chinese in the early 15th century.” A somewhat comprehensive presentation.
As said on the inside front cover “His compelling narrative pulls together ancient maps, precise navigational knowledge, astronomy and the surviving accounts of Chinese explorers and the later European navigators. It brings to light the artefacts and inscribed stones left behind by the emperor’s fleet, the evidence of sunken junks along the route and the ornate votive offerings left by the Chinese sailors wherever they landed, in thanks to Shao Lin, goddess of the sea.”
The reviews shown by amazon.co.uk had an average rating of 4 (out of 5) from more than 500 reviewers.
Eurocentric readers, fed on Columbus and Magellan (both of whom had maps to follow), will need to rely on the achievements of European colonialism from the 15th to the 20th century AD, and today’s neo-colonialism. Ironically, the former colonial powers are now led by a new nation created by European emigrants within this colonial period.
Posted in Accountability, Asian civilisations, Cross-cultural issues, History, Knowledge, Leadership, Learning, My Views, Open-minded scholarship, Perceiving reality, Technology | Tagged Historical reality |
Did China spark the Italian Renaissance? (Part 1)
“In 1434 a sophisticated Chinese delegation visited Italy. After that date the authority of Aristotle and Ptolemy was overturned, and Chinese knowledge ignited the work of geniuses such as da Vinci, Copernicus and Galileo. China’s influence sparked the Renaissance. The course of Western civilisation was changed forever.
Following on the bestselling 1421, Gavin Menzies’ controversial new book 1434 charts the final voyage of the Imperial Chinese fleet. His astonishing discoveries about China’s legacy in Europe rewrite the history of our modern world.”
The above are from the back cover of ‘1434: The year a magnificient Chinese fleet sailed to Italy and ignited the Renaissance.’
Credible? A Western historian is on record saying that he had difficulty suspending his misbeliefs about Menzies’ tentative conclusions. About what? The gifts of new knowledge to the then Pope from the Emperor of China delivered by Admiral Cheng Ho (Zheng He); and how the Renaissance arose from the spread if this high-value knowledge.
Anyone who had read the book will be impressed by the vast scope of Menzies’ investigations. His details about the principal players in this drama, what they did or contribute, and their relationships with one another are incredible. So much research!
Menzies is a former mariner, who “visited 120 countries, over 900 museums and libraries, and every major sea port of the later Middle Ages” in the course of researching his previous book ‘1421.’ Through the massive investigations by his research teams into the pathways the contribution by China seem to have led to the Renaissance in Italy, Menzies has again drawn upon the work of many earlier reputable researchers and relevant documents in major libraries.
Disbelief and probable Eurocentrism are one side of the coin. The other side requires demonstrating an alternative explanation for Italy’s sudden Renaissance in the realm of the technologies, maps, art, etc., etc. which Menzies refers to.
Is there any value in just asking “Where’s the evidence?” That allegedly happened when some historians in Australia examined ‘1421: The year China discovered the world.’ Most of the evidence is obviously in China. Go look!
Posted in Accountability, Ancient societies, Asian civilisations, Cross-cultural issues, Early societies, History, Infallible sceptics, Knowledge, Learning, My Views, Open-minded scholarship, Research findings | Tagged A former mariner is well qualified to report on China's 7 Treasure Fleets, Author identifies significant and rare gifts by China to Europe, Eurocentric critics need to explain sudden display of knowledge not available in Europe, Menzies aided by experts and competent researchers, The details provided are very substantial and in depth, Western civilisation did change after China's gift to the Pope |
Depression – social or chemical?
A recently-retired couple asked their doctor for a prescription for the husband; the wife said that her husband was depressed. After a lengthy consultation, the doctor advised them to sit by the sea, about 5 minutes away, as often as possible. He would not write a prescription. The claimed depression soon evaporated.
A young doctor had prescribed medication for clinical depression. A more experienced doctor, however, found no evidence of clinical depression. The younger doctor’s explanation was that the patient had told her that she felt sad from time to time. After losing 2 sons in succession and a pregnancy mid-term, who wouldn’t? She displayed great sadness on the dates of her losses; but then reverted to her normal happy family life.
Against these experiences, psychiatrists seem to have identified an increasing number of psychiatric maladies. The recommended treatment involves a pharmaceutical product, expected to control or treat a chemical imbalance in the brain.
According to an article “Blue by you” by Johann Hari in the ‘Good Weekend’ magazine of the Sydney Morning Herald of 3 Feb. 2018: In the US, “… if your baby dies at 10 am, your doctor can diagnose you with a mental illness at 10.01 am and start drugging you straight away.” The article also said “Between 65 and 80 per cent of people taking chemical anti-depressants become depressed again.” “There is a real effect – but, alas, for many users, it is not enough to lift them out of depression.”
The article quotes Dr. Joanne Cacciatore of Arizona State University thus: “… a key problem with how we talk about depression, anxiety and other forms of suffering; we don’t … “consider context.” “When you have a person with extreme human distress, we need to stop treating the symptoms.”
The author of the article ‘Blue by you’ states that “… human beings have natural psychological needs too – but, Australian society, and the wider Western world, is not meeting those needs for many of us, and that is the primary reason why depression and anxiety are soaring.” “There has been an explosion in loneliness.”
To that, social researcher Hugh Mackay adds “The biggest contribution is fragmentation.” “Humans are social animals. We need communities.”
Doctors in Cambodia told African psychiatrist Derek Summerfeld that “finding an anti-depressant didn’t mean finding a way to change your brain chemistry. It meant finding a way to solve the problem that was causing the depression in the first place.”
Comparably, a doctor in London (Dr. Sam Everington) ‘prescribed’ participation in a group activity. It is a successful approach.
Johann Hari’s book is ‘Uncovering the Real Causes of Depression and Anxiety – and the Real Solutions.’
Posted in Communalism, Coping with hardship, Cross-cultural issues, Explaining being human, Guidelines for living, My Views, Perceiving reality, Personal responsibility, Psychology of the mind, Public welfare, Society | Tagged An anti-depression whi works - participation in a group activity, Consider the context in which the symptoms appear, Pharmaceutical anti-depressants are inadequate, Psychiatry has increasing numbers of psychological maladies, Social isolation is the biggest contribution to depression, Treat the undrlying cause - not the symptoms |
Yavanas in India
The following are pertinent extracts from ‘Early India: From the origins to AD 1300’ by Emeritus Prof. R. Thapar. They should put to rest any exaggerated claims about Hellenic Greek influence in ‘India.’ The author distinguishes between Greeks from the Mediterranean (Hellenic) and Hellenistic culture in West Asia. She also makes clear that the word ‘Yavana’ applied (until recently) to all Westerners in the Punjab to terrain further East.
“In 327 BC Alexander, continuing his march across the empire of Darius, entered the Indian provinces. The Greek campaign in north-western India lasted for about two years. It made little lasting impression historically or politically in India, and not even a mention of Alexander is to be found in any Indian source.”
“A significant outcome of Alexander’s campaign, that was neither political nor military, was that he had with him literate Greeks who recorded their impressions of India … They sometimes provide a corrective to the fantasies in other Greek accounts, even though in these the imagination of the authors is not always curbed.”
“One of the enduring images was that of Alexander in conversation with sophists … This image was seminal to the view that Indian ideas entered the Hellenistic and Mediterranean world subsequent to Alexander and contributed to various schools of thought that did not necessarily conform to established views in the European tradition.”
“Indians, on the other hand, did not say much about the Greeks, and what they did say varies. The term used for them was Yavana … Yavana became a generic term for people coming from the West and was used as recently as the last century. Some later brahmanical texts were bitterly uncomplimentary and hateful about the Yavanas, perhaps because of a lingering memory of Alexander’s hostility to the brahmans during his campaign …” (Note: allegedly, he had a large number of them put to death.)
“The mingling of Hellenistic Greeks and Indians in the second century BC came about through the Hellenistic kings, who ruled in the north-west as successors to those who had succeeded Alexander. Some differentiate between the Greco-Bactrians who ruled over Bactria and the Indo-Greeks who included India in their domain; others refer to them as Indo-Bactrian Greeks or use Indo-Greeks in a more general sense. Indian sources refer to them as Yavanas.
This term makes no distinction between what some would call the Hellenic Greeks, living on the mainland of the peninsula of Greece, and the Hellenistic Greeks. The latter were those of Greek descent or of mixed descent, but broadly conforming to Greek Culture and living in the eastern Mediterranean and West Asia. Hellenistic culture drew on Greco-Roman culture of the Eastern Mediterranean, as well as Iranian sources and some Central Asian influence, and can be regarded initially as Greco-Roman colonial culture.”
“The Greek settlements in Bactria traced their origins to the Achaemenid period (c. fifth century BC) when the Persian kings settled Greek exiles in the region. These were reinforced by Greek artisans settling in the cities of Bactria.”
“The history of the Indo-Greeks has been reconstructed mainly on the evidence of their coins. … The coins are symbolic of an intermingling of Hellenistic with Indian or Iranian cultures.”
Posted in Accountability, Ancient folklore, Cross-cultural issues, Early societies, Perceiving reality, Research findings, Tribalism | Tagged Alexander's campaign made no lasting impression in India, Greek accounts of Indiawere a mixture of fable and fact, Greek settlers in Bactria were Greek exiles settled there by Persians and added to by Greek citizens, Hellenistic culture drew upon Greco-Roman as well as Iranian and other Asian influences, Were Greek Yavanas Hellenistic (culturally) - not Hellenic (based in Greece)?, Yavanas referred to all Westerners in India |
Indian thought and the West
Dr. S. Radhakrishnan, has said,
“The Europeans are apt to imagine that before the great Greek thinkers, Socrates, Plato, and Aristotle, there was a crude confusion of thought, a sort of chaos without form and void. Such a view becomes almost a provincialism when we realize that systems of thought which influenced countless millions of human beings had been elaborated by people who never heard the names of the Greek thinkers.”
(source: Eastern Religions and Western Thought – By Dr. Sarvepalli Radhakrishnan p. 350).
There has been too much inclination among Western writers to idealize the Greeks and their civilization, and they have tended to discover too much of the contemporary world in the Greek past. In fact almost everything was traced to ancient Greece. In all that concerned intellectual activity and even faith, modern civilization was considered to be an overgrown colony of Hellas. The obvious Greek failings, their shortcomings and the unhealthy features of their civilization, was rationalized and romanticized.
In the words of Sir Charles Eliot, who affirms that “it is clearly absurd for Europe as a whole to pose as a qualified instructor in humanity and civilization. He writes: “If Europeans have any superiority over Asiatics it lies in practical science, finance and administration, not in philosophy, thought or art. Their gifts are authority and power to organize; in other respects their superiority is imaginary.”
(source: Hinduism and Buddhism – By Sir Charles Elliot Curzon Press ISBN 0700706798 volume I (1920), pp. xcvi and xcviii )
Modern research, however, has marred this comforting image and is helping to put Greek culture into its proper historical perspective showing that, like any other culture, it inherited something from preceding civilizations, profited from the progress of its neighboring cultures (like India and Persia) and, in turn, bequeathed much to later generations.
We are not completely in the dark on the question of Indian influence on Greece. Speaking of ascetic practices in the West, Professor Sir Flinders Patrie (1853-1942) British archaeologist and Egyptologist, author of Egypt and Israel (1911) observes:
” The presence of a large body of Indian troops in the Persian army in Greece in 480 B.C. shows how far west the Indian connections were carried; and the discovery of modeled heads of Indians at Memphis, of about the fifth century B.C. shows that Indians were living there for trade. Hence there is no difficulty in regarding India as the source of the entirely new ideal of asceticism in the West.”
The Greek Philosopher Saint: Apollonios in In India
Philostratos says Apollonios (6th century BCE) of Tyana thought Indians had influenced Pythagoras. So going to India was an effort to improve his moral education. He followed the road of Alexander the great to India, probably entering the country through the Khyber Pass and going to Punjab, where he met the wise men of India on a forested hill not far from the Ganges River.
He delighted in their company and their lengthy discussions.
He said: “I saw the Indian Brahmins living on the earth and not on it, walled without walls, and owning nothing and owning everything.”
Clearly, Apollonios was impressed by the spiritual power of the Brahmins who had foreseen his coming. He spent four months with them. They lived exemplary lives very close to the gods. They ate what he ate and shared his love for the natural world.
But what impressed Apollnios the most was the Indians contact with Hellenic culture. The Indian wise men spoke Greek, and were well versed in the Greek philosophical tradition and Greek culture. Both the Indian philosophers and Apollonios worshipped the gods and a supreme god, a divine being like Zeus, who was the father of the gods and humans. The wise men, however, described themselves as gods in the sense of being good.
(Source: Surya’s Tapestry; ancient rishis’ pathways to Hinduism)
(Comment: Eurocentrism and colonial superiority demolished?)
Posted in Accountability, Cross-cultural issues, False superiority, Learning, Open-minded scholarship, Tribalism | Tagged Apparently Greek thinkers knew little about Asian civilisations, Christian and European colonialism apparently needed Greece as their cultural ancestor, Great thinkers existed in the world beforearrival thinkers, Indian troops in Persian army and indian traders were in Greece in 6th century |
An octogenarian’s thoughts about religion (Part 1)
“When I fell out of the boat taking me to a career and lost my family, my self-respect, and faith in my abilities, I gave away my god (and everybody else’s). Struggling in rough and strange waters, I had time to think.
The first non-textbook I read when I settled down to academic study, strangely enough, was about Abraham (a nostalgic look at a past-life period?). Reading laterally, I then covered the belief systems of some early societies. I read about the nature of religious belief, and about the major religions. I came across a simple and very useful framework for examining religions, which I used some years later when I was on a school board.
When I came to enjoy the bliss of my own family, I recovered my faith in a Creator – logic (yes, logic) took me to this position. Reflecting (perhaps) the experiences of my formative years (and what I was taught) and drawing upon my reading, I realised that all faiths are beneficial and equal; one would have to be brainwashed or an egomaniac to claim that one faith was somehow superior to the others.
While I continue to hold this view, I prefer the Hindu philosophy because it is more comprehensive in its explanatory scope and yet, at its core, quite simple. It took me many years to reach this position.
All religions offer a devotional component. We all pray, in different ways, but for the same reasons. Some of us are a little bit more selfish at times than others. The forms of prayer vary, but their intent is the same. Is one form better, more effective, or better liked than God? If you do not like the way I pray, you probably do not like the way I look.”
(The above is an extract from my first memoir ‘Destiny Will Out’ Chapter 16)
Posted in A personal destiny, A spiritual perspective, Ancient societies, Asian civilisations, Cross-cultural issues, Education, Explaining being human, Faith and belief, Knowledge, My Books, My Views, Reaching for the Divine, Religion, Spirituality, Wisdom | Tagged Accepating God as the Cosmic Creator through logic, All major faiths are equal in their potential and beneficial, The Hindu faith is more comprehensive in its explanations, Useful framework for examining religions |
The British came – and went (Part 3)
As the last British governor of Hong Kong vacated his post, he reportedly uttered regret that the British had not had enough time to introduce democracy to the island. Through 99 years?
Where democracy involves direct governance by the people – as perhaps in ancient India (refer Nehru), pre-Viking Britain (refer the Encyclopaedia of Social Sciences), early Athens (refer Plato), or even early capitalistic Britain (refer any number of historians) – not every male resident would have been so entitled. I hold to my hope that the good of the people had been the ethos underlying judgements in those places; in reality, the perceived benefit to decision-makers may have been the primary motivation.
Representative government of the modern kind, which purports to give every franchised individual a vote in deciding which political party should rule during a definable period, appears fair. Yet, where voting is not compulsory, those who eventually realise the futility of believing that they contribute to governance will not bother to vote.
In Australia, with compulsory voting, the ‘donkey’ vote can prevail. In more recent decades, many who reach voting age (18) are apparently not registering themselves as voters – reportedly without penalty, in the main. Penalties do apply to those who are on the electoral roll but did not vote.
Western democracy in Australia involves choosing a political party, through voting for the candidate nominated by the ‘poobahs’ of the party. There are no known selection criteria for candidates; and no set qualifications in terms of education plus work experience. Elected representatives must support their party in federal and state parliaments. Voters are not asked about their needs.
Recently, the Pope appears to be the second object of fealty for both major coalitions. Accountability is only through elections, giving voters a choice between Tweedledum and Tweedledee (refer ‘Alice through the looking glass’).
No accountability procedures seem to apply to local government. There are no perceivable political loyalties; only personal interest. Rate payers, the voters, are not consulted.
Western democracy did appear to be a benefit for former British colonial territories. However, the vote available to every adult, especially in multi-tribal nations, regrettably subjugates minority tribes – even those who had lived within their own lands. I cite Ceylon, where ancient Hindu Tamil lands became subject to control by Buddhist Sinhalese, after Britain left a political heritage of Western democracy. The British colonial authorities, well-known for their divide-and-rule practices, left a legacy there (and everywhere) which makes a mockery of effective democracy.
This situation applies in, say, Africa, where European ‘spheres of interest’ led to boundaries of colonial-created nations cutting across tribal boundaries. In almost every nation so created, minority tribes became subject to domination by the majority tribe. A passing thought: Were former superior colonial Christians of the ‘white race’ then able to argue that the ‘coloured races’ are really unable to rule themselves? (Singapore’s Mabhubani, when Ambassador to the United Nations, wrote a clever sardonic book titled “Can Asians really think?”)
Western democracy needs improvement. The pretence of ‘representative’ government is absurd. The control of a nation by political parties, which govern from election to election, is deplorable. Surely democracy can be modified to be more equitable. Today, control by Vaticanites of Australian politics and human rights (a role reversal – control by a minority tribe) continues.
Posted in A secular society, Accountability, Colonialism, Cross-cultural issues, Democracy, Discrimination, Equity and fairness, Ethnic affairs, History, Intolerance, Justice, My Views, Politics, Power at any price, Religious prejudice, The national interest, Tribalism | Tagged A minority tribe controls politics and human rights in Australiaa, In Australia the vote is for parties - parliamentary reps are not accountable to voters, In multi-tribal nations minority tribes became subjugated by the majority tribe, In post-colonial nations of one people representative government appeared to give equal opportunity politically, No accontability processes seem to apply to local government in Australia, Was direct governance in ancient times restricted to an elite? |
|
cc/2020-05/en_middle_0097.json.gz/line1400031
|
__label__wiki
| 0.559051
| 0.559051
|
Redhawk Times
September 21Hurricane Make-Up Dates: Oct. 18, Oct. 19 & Dec. 21
September 21Sept. 24: Track Interest Meeting, 6:30 pm, Cafe
September 21Sept. 25: College Application Day, Media Center
September 21Sept. 27: Peru Interest Meeting, 6 pm, Media Center
Westwood defeats Blythewood… again
Coach Matt Quinn shows all the work that his team put in. Go Red Hawks!!
Cameron J. Smith, Editor in Chief
Westwood Team coming out into the field.
“Joker” Gears Up for Theatrical Release
September 17, 2019 • Comments closed
This year has been quite possibly one of the best years for the film industry in a since the 90’s. With many highly anticipated releases like Spider-Man: Far From Home,...
Review: “Teeth” by 5 Seconds of Summer
Kelly Knight, Senior Editor
On Aug. 21, the Australian band 5 Seconds of Summer released their song "Teeth" for the soundtrack of season 3 of the Netflix original "13 Reasons Why". While first looking...
LM5 Album Review
Kelly Knight, Editor
December 19, 2018 • Comments closed
On November 16, 2018 the album LM5 dropped which is the fifth studio album by the British girl group, Little Mix. It contains 14 songs and is a mixture of...
The “Horrific” Shoulder
Zandrea Mays, Editor
A major problem affecting schools throughout the country is the horrendous dress code. Penalizing children because they don't fit your criteria is absolutely wrong. You’re...
Fortnite Season 5 Overview: What’s New in Season 6?
Jordan Felder, Editor
Game developers Epic Games has just released its latest update for the game Fortnite. For those who are unfamiliar with the game, Fortnite is an extremely fun game that allows...
Transgender Military Ban
On Nov. 23, President Donald Trump asked the Supreme Court to fast-track the trans military ban, which has faced challenges in the lower courts....
What has become of the Disney channel?
The nostalgic moments when you were young, watching your favorite show at home hold a special place in our hearts. Taking a trip down memory...
Sweetener Album Review
On August 17, 2018 Ariana Grande released her fifth studio album Sweetener. On the album there are quite a few songs that I enjoy, but there...
Battle of the Woods Peprally Recap
Athlete Spotlight: Matthew Oxendine
Athlete Spotlight: Diamond De La Rosa
#MarchForOurLives Takes Nation by Storm
Tom Holland is Back as Spider-Man in the MCU
Get Rid of Waste
Anxiety Disorders in Teens
What’s it Like In the Band Room
Behind the Scenes of Homecoming 2019
Reasons to Join Student Government
The student news site of Westwood High School
|
cc/2020-05/en_middle_0097.json.gz/line1400038
|
__label__cc
| 0.621031
| 0.378969
|
Book Review: DECEMBER 2015 MASSACRE OF SHIITES IN NIGERIA - Survivors Accounts By Ibrahim Musa
Free Zakzaky Protest Reaps Through The Heart Of Kaduna, As Police Open Fire In Abuja
Elrufai’s Warped Talk On Sheikh Zakzaky can't Distract From imminent Course Of Justice
Soleimani's Killing: Iranians, Iraqis And Americans Take To The Streets
Millions Of Iranians Pay Tribute To General Soleimani In Ahvaz
Reflection-Online
The official site of the Free Zakzaky Campaign
Almizan
Harkar Musulunci
Islamic Movement
IM Nigeria
What President Buhari Told UN General Assembly [What he meant but did not say]
September 19, 2017 freezakzaky
President Muhammadu Buhari on Monday addressed the gathering of world leaders at the United Nations General Assembly in New York, United States.
Read The President’s Full Speech Below [What he meant and did not utter is inserted in bold, italics and square parenthesis]:
On behalf of my country, Nigeria, [where I recently visited for the second time since this year], I congratulate you Mr President on your election and Mr (Antonio) Gutteres on his first General Assembly outing as our Secretary-General. I assure you both of my country’s solidarity and cooperation.[as long as you both remain mute as I brutalize my people] You will indeed need the cooperation of all Member States as we are meeting during extra-ordinarily troubled and dangerous times. Let me also thank former Secretary-General Mr Ban ki-Moon for his service to the United Nations and wish him a peaceful retirement.[He kept a blind eye and remained mute while I massacred my people].
Mr President, the previous year has witnessed many far-reaching developments. Some of the most significant events include the Iran Nuclear Deal, the Paris Climate Change Agreement and, of grave concern, the North Korean nuclear crisis. [Mr President, pardon me. I am shortsighted and consequently have a blind spot with regards to the most significant crisis in my own country].
Mr President, I must also commend the UN’s role in helping to settle thousands of innocent civilians caught in the conflicts in Syria, Iraq and Afghanistan.[I have ensured thousands remain displaced by man-made crises and I don’t even bother to visit those displaced by natural disasters at home]. In particular, we must collectively thank the Government of the Federal Republic of Germany under the commendable leadership of Chancellor Angela Merkel and the Governments of Italy, Greece and Turkey for assisting hundreds of thousands of refugees. [Like I did to IDP camps, get my military to bomb them, human error style (winks)].
In an exemplary show of solidarity, the international community came together within my own region to assist the countries and communities in the Sahel and the Lake Chad regions to contain the threats posed by Al Qaida and Boko Haram. [We have since tried to redeploy using the new code names of “cattle rustlers” and “Herdsmen”].
We thank the Security Council for visiting the countries of the Lake Chad Basin to assess the security situation and humanitarian needs, and for pledging assistance to rebuild lives and livelihoods. Indeed, in Nigeria, we are providing relief and humanitarian assistance to millions in internally displaced camps and those afflicted by terrorism, drought, floods and other natural disasters.[If you are in doubt, ask grass cutter Babachir]
In the last year, the international community came together to focus on the need for gender equality, youth empowerment, social inclusion, and the promotion of education, creativity and innovation. [We have started monitoring of social media by the military and we are about to enact anti-social media bill]. The frontiers of good governance, democracy including holding free and fair elections, and enthronement of the rule of law are expanding everywhere, especially in Africa. [I disobey court orders with impunity. Even some popular figures like Dasuki and Zakzaky with valid court release judgements are still being detained, because I have the full picture].
Our faith in democracy remains firm and unshaken. Our regional organisation ECOWAS came together to uphold democratic principles in The Gambia [Because that was what you wanted then] – as we had done previously in Cote D’Ivoire. [You are yet to tell me what you want done in Togo].
Through our individual national efforts, state institutions are being strengthened to promote accountability, and to combat corruption and asset recovery. [All you need is an-EFCC type body who will frequently announce the discovery of mind-boggling sums in buildings, closed spaces and public places. You can even attribute ownership to previous leaders. It will confound the docile and excite the dogmatic supporters]. These can only be achieved through the international community cooperating and providing critical assistance and material support. We shall also cooperate in addressing the growing transnational crimes such as forced labour, modern day slavery, human trafficking and cybercrime. [We have enforced the disappearance of hundreds of youths, men and women in Zaria and other places using our military. That has remarkably reduced the unemployment rate].
Mr President, these cooperative efforts should be sustained. We must collectively devise strategies and mobilise the required responses to stop fleeing ISIS fighters from mutating and infiltrating into the Sahel and the Lake Chad Basin, where there are insufficient resources and response capacity is weak.[We are similarly working hard to devise strategies and mobilise required responses to mutate redeployed Boko Haram fighters, with whom we negotiated and paid off only recently, to become the new rampaging Herdsmen. There will be insufficient resources, including the political will to combat them].
This will require strong UN cooperation with regional organisations, such as the African Union, in conflict prevention and management. The UN should continue to take primary leadership of the maintenance of international peace and security by providing, in a predictable and sustainable manner, adequate funding and other enablers to regional initiatives and peacekeeping operations authorized by the Security Council.[We cherish your continued silence on these matters thus far].
Mr President, new conflicts should not make us lose focus on ongoing unresolved old conflicts.[We have not lost focus of Shia massacre even as we have started a new IPOB python dance]. For example, several UN Security Council Resolutions from 1967 on the Middle East crisis remain unimplemented. [Just as the famous Justice Gabriel Kolawole landmark judgement remains unimplemented]. Meanwhile, the suffering of the Palestinian people and the blockade of Gaza continue. [Meanwhile, the suffering of the Shia people and the clampdown on their Movement continue].
Additionally, we are now confronted by the desperate human rights and humanitarian situations in Yemen and most tragically in the Rakhine State of Myanmar.[Additionally we are confronted by the desperate human rights situation we created in Abia]. The Myanmar crisis is very reminiscent of what happened in Bosnia in 1995 and in Rwanda in 1994. [The Abia crisis is very reminiscent of what we did in Zaria in 2015 and Kaduna/Kano/Jos/Funtua in 2016].
The international community cannot remain silent and not condemn the horrendous suffering caused by what, from all indications is a state-backed programme of brutal depopulation of the Rohingya inhabited areas in Myanmar on the bases of ethnicity and religion. [The international community must remain silent and refuse to condemn the horrendous suffering caused by what, clearly is our state-backed pogrom against the Shias on the basis of religion].We fully endorse the call by the Secretary-General on the Government of Myanmar to order a halt to the ongoing ethnic cleansing and ensure the safe return of the displaced Rohingya to their homes in safety and dignity. [We fully appreciate the silence of the Secretary- General on our government not to call for a halt to the ongoing minority religious cleansing and not to ensure return of their leader and members to their homes in safety and dignity].
In all these crises, the primary victims are the people, the most vulnerable being women and children. [The very example of of those I killed and buried in mass graves in the Zaria massacre].That is why the theme of this session: Focusing on People: Striving for Peace and Decent Life for All on a Sustainable Planet” is most apposite. [That is why the theme of this session: Focusing on People: Striving for Peace and Decent Life for All on a Sustainable Planet” is satirical].
While the international community grapples to resolve these conflicts, we must be mindful and focus on the widening inequalities within societies, and the gap between the rich and the poor nations. These inequalities and gaps are part of the underlining root causes of competition for resources, frustration and anger leading to spiralling instability.[We on our part, have brought the national economy to a standstill].
The most pressing threat to international peace and security today is the accelerated nuclear weapons development programme by North Korea. Since the Cuban missile crisis of 1962, we have never come so close to the threat of nuclear war as we have now. [I told you of my legendary shortsightedness. I don’t see that what threatens peace in my own immediate environment is the extreme poverty, hopelessness or wretchedness I caused my people but farfetched threat caused by some others].
All necessary pressure and diplomatic efforts must be brought to bear on North Korea to accept a peaceful resolution of the crisis. [So long as you leave me to continue my pogrom]. As Hiroshima and Nagasaki painfully remind us, if we fail, the catastrophic and devastating human loss and environmental degradation cannot be imagined. [Only God can imagine what the devastating and catastrophic human loss will be when I finish my term].
Mr President, Nigeria proposes a strong UN delegation to urgently engage the North Korean Leader. [So long I will be let off the hook] The delegation, led by the Security Council, should include members from all the regions.
The crisis in the Korean peninsula underscores the urgency for all member states, guided by the spirit of enthroning a safer and more peaceful world, to ratify without delay the Treaty prohibiting nuclear weapons, which will be open for signature here tomorrow. [Toothless treaty like resolutions I quoted above]
Mr President, I end my remarks by reiterating Nigeria’s abiding commitment to the foundational principles and goals of the United Nations. [Hypocrisy and double standards]. Since our admission as a member state in 1960, we have always participated in all efforts to bring about global peace, security and development. Nigeria will continue to support the UN in all its efforts, including the attainment of the 2030 Agenda for Sustainable Development.[the mirage].
I thank you.[For not holding me responsible for the massacre of my people].
Someone please help ask Saraki! Where was he?
Elrufai must stop denying us our religious right!
NIA, DSS Appointments Lopsided, Smack Of Impunity – Dr Junaid Muhammad
April 29, 2018 freezakzaky 0
Dr Junaid Muhammad is a former member House of Representatives in the Second Republic from Kaduna...
Saudi Arabia Finances All US Colonial Policies In The Middle East, Beyond
We are increasingly seeing the House of Saud’s blatant anti-Muslim policies pursued by the regime under...
April 3, 2018 freezakzaky 0
We’re Victims Of Your Incompetence – OBJ Blasts Buhari Again
Former President Olusegun Obasanjo has fired yet another shot at President Muhammadu Buhari, saying Nigerians are...
Breaking News Uncategorized
Down memory lane Select Month January 2020 (10) December 2019 (27) November 2019 (16) October 2019 (5) September 2019 (25) August 2019 (44) July 2019 (88) June 2019 (28) May 2019 (22) April 2019 (20) March 2019 (17) February 2019 (9) January 2019 (17) December 2018 (30) November 2018 (38) October 2018 (44) September 2018 (41) August 2018 (13) July 2018 (10) June 2018 (23) May 2018 (52) April 2018 (75) March 2018 (75) February 2018 (66) January 2018 (111) December 2017 (81) November 2017 (54) October 2017 (23) September 2017 (17) August 2017 (8) April 2016 (1)
My Player
International Quds Day 2019 in Kaduna, in spite of the Police raid
Book Review: DECEMBER 2015 MASSACRE OF SHIITES IN NIGERIA – Survivors Accounts By Ibrahim Musa
Elrufai’s Warped Talk On Sheikh Zakzaky can’t Distract From imminent Course Of Justice
Free Zakzaky Campaign Facebook Page
|
cc/2020-05/en_middle_0097.json.gz/line1400039
|
__label__wiki
| 0.504644
| 0.504644
|
Posted on June 9, 2015 May 18, 2019 Sainik School
Mr George Joseph (Mr GJ – that is how everyone addressed him) taught us English in Grade 10 and 11 at Sainik School Amaravathinagar. He joined the school in the vacancy of Mr Seshadiri who left the school (with his daughter Sita from our class) in 1973. I started interacting with him at a personal level in Grade 11 when we went on a trek from Munnar to Idukki in Kerala in September 1977. That was the first time he opened up with me about his teaching experiences.
Mr GJ’s first class in our school was for the batch of David Davidar (three years senior to us), who authored The House of Blue Mangoes (2002), The Solitude of Emperors (2007) and Ithaca (2011). On the very first day, Mr KG Warrier (https://rejinces.net/2014/09/16/the-linguists/), head of the English department had forewarned him that the linguistic capability of the students was at a very high level and he had to be fully prepared to face them, let alone teach them. Mr GJ on many occasions claimed that he actually learnt English by teaching students at our school. During our school days, Mr GJ was a bachelor and hence had all the time in the world to himself. One could mostly see him spending his spare time at the library, reading up all the books which he could not during his university days.
Mr GJ was a good basketball player and coached the school basketball team. He was a good swimmer and hence joined Mr Krishnan Kutty (the crafts Master) (https://rejinces.net/2014/08/08/arts-and-crafts/) to form the nucleus of the canoeing club. He later took over the reins of the canoeing club, once he mastered the art of canoeing and could navigate through the Amaravathi Dam’s waters. He again claims that he perfected the art of canoeing by learning the same from the senior students.
During the boxing competitions at school, Mr GJ was a judge always. He once narrated that he had never seen a boxing bout in his life until he joined our school. One day when Mr CM Nair (Physical Training Instructor) (https://rejinces.net/2014/07/23/233/) while preparing the gymnasium for the boxing competition realised that he was short of a judge as Mr Venkateswaran, the biology teacher had left the school. Whether Mr CM Nair found some similarity between Mr GJ and Mr Venkateswaran in their physical appearance, or not, he summoned Mr GJ and requested him to be the boxing judge the following week. Obviously Mr GJ showed his reluctance having had no experience in the field, why even he had never witnessed a boxing bout and now he has been tasked to be a judge. Mr CM Nair conducted a detailed clinic for Mr GJ and handed him over the rule book of boxing. After the clinic, Mr GJ became very confident and every year till we left the school, he was always a boxing judge and never was his judgement ever questioned.
Once he threw the towel in to the ring to stop a bout, as he realised that the contest was really uneven and the loser of the bout might suffer an injury. This raised a few hackles then, but now looking back one realises how apt his decision was and also that his action befitted that of a seasoned boxing judge.
During our trek from Munnar to Idukki in 1977, the first day’s halt was at a village called Vellathooval. We started the trek early in the morning from Munnar and reached Vellathooval by late afternoon to be received by the Headmaster, staff and students of the Government High School there. The school organised a special assembly of the entire school to welcome us and Cadet Benoy Zachariah (now a cardiac surgeon at Boston, USA) was tasked by Mr GJ to deliver the English speech and I was tasked to deliver a speech in Malayalam, to motivate the students to join Sainik Schools and then the armed forces. That was the first motivational speech I delivered and as per Mr GJ we did a decent job of it. The preferential treatment we received at this school was because Mr GJ had arranged the same with our class mate George Paul’s father who was the Educational Officer, under whose jurisdiction this school came.
After three days of trekking we reached Idukki and then went around sightseeing for the next three days. One evening I was talking with Mr GJ and the subject was regarding the difficulties faced by the teachers while managing the students during various treks and hikes at the school. Mr GJ narrated his very first hiking experience at our school the year he had joined. Mr GJ was tasked to lead the hike to Yercaudu in Tamil Nadu, a quiet little hill station on the Shevaroy hills of the Eastern Ghats. During the train trip to the base of Yercaudu, Cadet Appu fell off the train. Mr GJ got the entire entourage to disembark from the train at the next station and he walked about five kilometers along the track back and found Cadet Appu lying unconsciously near the rail track. Mr GJ administered first aid to Cadet Appu and carried him on his shoulders and walked back to the railway station where the rest of the entourage was waiting. They then boarded the next train and continued with the hike.
Like most classes at our school, Mr GJ’s English classes were mostly group discussions with the teacher in the lead and acting as a moderator. Among some of the memorable discussions we had, one was about opening Sainik Schools for girl cadets too. Mr GJ brought out that the boys would be better disciplined, better dressed, better behaved if girl cadets were studying along with us and the overall performance of the cadets would surely improve manifold. This discussion took place in the days when no one in India thought of opening military service for women.
Once Mr GJ opened up a discussion by his justifications for men resorting to domestic violence. As expected, all cadets in the class opposed it tooth and nail. At the end of the class Mr GJ concluded by saying that had he not put up a few arguments in support of the motion, no worthwhile discussion would have emanated. He brought home the point that to get noticed in the group discussion, at times one would have to support a cause which one is sure will have no takers. He always encouraged us to approach an issue differently; mainly to stand out and also to try out a different method or a path.
After we moved on from the school, Mr GJ moved out as the Principal of Navodaya Schools in Kerala and is now retired and has settled down at Palai, Kerala. He can be contacted on Cell # 944 636 8276 and email gjay51045@gmail.com.
← After Action Report on Ottawa Terrorist Shooting
Smile Knows No Barriers →
17 thoughts on “English Teacher”
Congrats to GJ for handling u guys well.í
mathew adipuzha , June 9, 2015 at 6:59 PM
Top quality recall of a great mentor.Obviously the school has had quality output; a publisher/writer, Reji and a Surgeon being worthwhile samples.Such teachers hardly exist now…Just the stuff of sepia recall. Raj
dagger19 , June 9, 2015 at 9:11 PM
Its after a long gap I’m going through your article. The very well narrated piece took me to the good old days we spent with such eminent teachers and guides at our School.
Sunil Kumar , June 9, 2015 at 11:10 PM
Nostalgic….. wonder if it’s the perceptional difference (from a pre-teenager’s eye view vis-vis pre-oldager’s); the quality of teachers were exceptional those days…. they taught us ‘life’ instead of just the curriculum….Tasmai Shrii-Gurave Namah!!!!!!
Ravi Kumar , June 9, 2015 at 11:45 PM
A nice piece. Your writing reminds me of R K Narayan’s Malgudi days.
Rajan Menon , June 10, 2015 at 2:11 AM
you have a way with words like your English teacher Mr GJ
Maj J L Malik , June 10, 2015 at 4:58 AM
Reji
Great! You put it across marvelously. Your thoughts & insights you got from GJ has been narrated well. Keep it up. Keep going. I remember
GP , June 20, 2015 at 6:28 AM
Nostalgic. Going down memory lane. Every word about the teachers like Mr. K G Warrier, Mr. and Mrs. Sheila Cherian, and others is the equal feeling of other students too. If at any time in any life if the God gives a chance to become a student would plead to him that he give me the same teachers who taught me in Sainik School Amaravathinagar.
MAHESH REPE , July 9, 2015 at 11:19 PM
No doubt that such dedicated & committed teachers leave their imprint in your mind for a lifetime. One will always cherish such fond memories.
Jose Kurian , July 12, 2015 at 8:35 AM
Great Reji. It was a great trip back the memory lane about Mr GJ , Mr Warrier , Mr. Nair and Mr, Seshadri. Mr. Warrier was so strict in correction that even David used to get only 58.25 While distributing mark sheet Mr Warrier used to remark that as he getting older he is becoming liberal
G Sivakumar , July 17, 2015 at 6:25 AM
Reji”s sainik school- life. It was really awesome to read…. no.. it took me back to our campus. I started to feel like living there once again with all those humble souls…. Great work done by Reji… salute you…👍👍👍 👍👍👍
Selvaraj.K 926 SSA 1980 batch , July 27, 2015 at 1:41 PM
Man u went to Munnar in the name of hike … we don’t have that moment now .. Maximum we go to Thalanji tribal village ..Staff are not as much fit in the way you describe the staff who where there during your school time . All they come for chicken in mess
Shiva , July 27, 2015 at 2:04 PM
We are gifted ones as you said during our telephonic discussions, so we are having the boon of being the students of these noble teachers. You have not written about few other teachers like B Sitaraman (Hindi), CSS ( hindi) Venketasehwaran ( the maths genius) MS(Tamil), KE ( Tamil), Dhomadhoran (MI ROOM) medical assistant, PR( History) PT( Geography) and many others like that. Please pen down on every one. Your are gifted with the art of expressing by writing, Which only very few have.
Murugan Senniappan , July 27, 2015 at 2:08 PM
Please read https://rejinces.net/2015/01/28/hindu-arabic-numerals/ about VM. About others, will write. I am looking for an idea or a seed to write about and to tag them in.
Reji Koduvath , July 27, 2015 at 2:59 PM
Nice writing sir, i am from 1990 batch and we feel blessed to have Mr.GJ for our 7th class. It is during late 80’s he left SSA. A towering personality. Prabhu Andrews
Prabhu Andrews Lazar , November 21, 2015 at 10:13 AM
Sudha Bhuvanachandran , August 27, 2018 at 9:31 AM
Another good write up. Mr. GJ got married when we were probably in the 9th or 10th std. His wife used to accompany him to school, when he was in-charge of the Night Prep. As newly weds, they caught the attention of all the students. I remember her as a chirpy lady, having a friendly chat with us.
N.S. Rajagopal, 1104 , March 22, 2019 at 4:16 AM
|
cc/2020-05/en_middle_0097.json.gz/line1400041
|
__label__wiki
| 0.730754
| 0.730754
|
Wakefern Food Corporation
PO Box 7812,Edison, NJ 08818
Type of Company
Employees (Worldwide)
Retail: Food & Beverage
Retail: Othe
Wakefern Food Corp. operates groceries stores. It supplies both national brand and private-label products such as ShopRite, Chef's Express, and Readington Farms to its member stores. The company was founded in 1946 and is headquartered in Edison, NJ.
wakefern.com
Trying to get in touch with decision makers at Wakefern Food Corporation? Subscribe today to access their professional contact information and receive a one time promotion of free Contact Data credits!
Store Brands Could Change the Game in Retail and CPG Investing, Says CBX Branding Veteran; Competitive dynamics are shifting as more retailers and manufacturers fully commit to supporting owned brands, Todd Maute tells analysts at investment conference.
RelSci
Wakefern Food Corporation donated between $25K and $50K to The Valerie Fund in 2018
Wakefern Food Corporation donated between $50K and $500K to Philabundance in 2018
Melissa Kenny Promoted to Executive Vice President of Kenny Family ShopRite Stores
Wakefern Food Corporation donated between $100K and $200K to Rhode Island Community Food Bank Association in 2018
Executives & Employees
Joseph S. Colalillo
Chairman & Chief Executive Officer
Joseph M. Sheridan
President & Chief Operating Officer
Douglas Wille
Allison Berger
General Counsel & Chief Compliance Officer
David Figurelli
President, Shoprite Supermarkets, Inc
Christopher Lane
Bill Mayo
Senior Vice President-Logistics & Technology
Jeff Reagan
Senior Vice President-Retail Marketing
Ann Marie Burke
Vice President, Human Resources
Bill Crombie
Vice President, Strategic Development & Member Relations
Chairman & Chief Executive Officer at Wakefern Food Corporation
Larry Wolfson
Vice President-Business Development at The Benevolink Corp.
Irv Glass
Vice President at Pearl River Shop Rite Associates, Inc.
Dominick J. Romano
Vice Chairman at Wakefern Food Corporation
Harry J. Garafalo
Professional at ShopRite Supermarkets, Inc.
Nicholas James Sumas
Co-President & Director at Village Super Market, Inc.
Ned Gladstein
Director & Assistant Secretary at Wakefern Food Corporation
Sean McMenamin
Director at Wakefern Food Corporation
Richard Tully
Managing Director at Stevenson & Co.
Vincent Lo Curcio III
US Defense Logistics Agency
Blue Cord Logistic Strategies Wins $33,404 DLA Contract - Targeted News Service
Screen Actors Guild, Inc.
Jennifer Aniston lands Apple TV+ a SAG award for 'The Morning Show' - Tech. Yahoo
Space Exploration Technologies Corp.
SpaceX’s Explosive Test May Launch Year of Renewed Human Spaceflight - NYT DealBook
The World Economic Forum
NSC Senior Director for European and Russian Affairs placed on administrative le... - CNN
Trending Organizations
Paths to Wakefern Food Corporation
Details Hidden
Wakefern Food Corporation purchases The Great Atlantic & Pacific Tea Co., Inc. /12 A&P Store from The Great Atlantic & Pacific Tea Co., Inc.
Wakefern Food Corporation purchases SUPERVALU, Inc. /11 Connecticut Stores from SUPERVALU, Inc.
Wakefern Food Corporation purchases Stop & Shop Supermarket Cos. /10 Supermarkets from Royal Ahold NV
Tim Erensen
Professional at Eiger Marketing Group
Village Super Market, Inc.
Village Super Market, Inc. engages in the retail sale of food and nonfood products. It operates through the ShopRite and Gourmet Garage bands. The company was founded by Nicholas Sumas and Perry Sumas in 1937 and is headquartered in Springfield, NJ.
Key Stats and Financials As of 2019
Total Enterprise Value
Food Bank of Western Massachusetts
Philabundance
The Valerie Fund
John Larson
Senate Democratic Majority of New Jersey
Liberty Property Trust Real Estate Investment Trusts | MALVERN, PA
Liberty Property Trust (NYSE:LRY) is a $6.9 billion real estate investment trust which owns 77.8 million square feet of office and industrial space in more than 21 markets throughout the United States and the United Kingdom (as of Sep. 30, 2012). Founded in 1972 and headquartered outside of Philadelphia, Liberty develops, acquires, leases and manages properties with the mission to enhance people's lives through extraordinary work environments. As an extension of this promise, Liberty is one of the nation's leading developers of high-performance green buildings. Liberty's more than 700 office and industrial properties offer exceptional locations, flexible design, thoughtful amenities, cost efficient operations and state-of-the-art technology to the company's 2,300 tenants. Liberty continuously increases the value of its portfolio through expert management, marketing and development
Cedar Realty Trust, Inc. Real Estate | Port Washington, NY
Cedar Realty Trust, Inc. is a fully-integrated real estate investment trust that owns shopping centers. Our high-quality core portfolio of primarily supermarket-anchored shopping centers straddling the Washington, DC to Boston corridor totals 10 million square feet of GLA. We are focused on creating long-term value for our shareholders and long term relationships with our tenants.
Cal-Maine Foods, Inc. Food | Jackson, MS
Cal-Maine Foods, Inc. engages in the production, grading, packing, marketing, and distribution of fresh shell eggs. The firm operates farms, processing plants, hatcheries, feed mills, warehouses, offices and other properties. It markets shell eggs to national and regional grocery store chains, club stores, foodservice distributors, and egg product manufacturers. The company was founded by Fred R. Adams Jr. in 1957 and is headquartered in Jackson, MS.
This web site is not endorsed by, directly affiliated with, maintained, authorized, or sponsored by Wakefern Food Corporation. The use of any trade name or trademark is for identification and reference purposes only and does not imply any association with the trademark holder. The Presence of Wakefern Food Corporation's profile does not indicate a business or promotional relationship of any kind between RelSci and Wakefern Food Corporation.
|
cc/2020-05/en_middle_0097.json.gz/line1400042
|
__label__wiki
| 0.918587
| 0.918587
|
News / BJP will face backlash in Kerala polls:Shashi Tharoor
BJP will face backlash in Kerala polls:Shashi Tharoor
5:10 PM, 28 Oct 2015
Neelu Vyas
Congress leader Shashi Tharoor in an exclusive interview to Rajya Sabha TV says that beef policing is alienating large sections of the Indian society and at the same time destroying the country’s image overseas. With elections in Kerala due next year, Tharoor claimed that BJP will face backlash in the polls. On the issue of writers returning their Sahitya Academy awards, the Congress leader said he was not in favour of this form of protest but the writers were justified in voicing the concerns over a climate of intolerance fomented by the BJP government. Speaking on Dadri lynching incident, Shashi Tharoor even targeted the Prime Minister’s speech on tolerance saying it was too little too late.
Here are some excerpts from the interview:
Q) Talking about what happened in Kerala Bhavan, What is this new kind of politics in the name of cow protection?
Beef policing is a disservice to India and the government is alienating large sections of people besides making people insecure. We must know that India is the world’s largest beef exporter. Even the NDMC-approved outlets are selling Buffalo meat.
Q) Elections in Kerala are due next year, will a literate society like Kerala have the takers of this kind of politics?
You can surely expect a backlash against the BJP in Kerala polls next year. These incidents have been destroying the image of India, even overseas. The Western media has begun citing ‘intolerance’ and ‘beef policing’ in their coverage.
Q) Gopal Krishna Gandhi has termed writers returning their awards a landmark moment. Do you subscribe to this view?
Personally I am not in favour of writers returning awards. I would advise the writers not to return their awards. But I think the writers felt to give up the awards voicing the concerns over a climate of intolerance. Writers are the conscience of the society.
Q) Arun Jaitley says it is a manufactured paper rebellion. Do you feel it is indeed a manufactured crisis?
Government has full awareness of the misuse of politics. Everyone knows that who incited the violence. It looks like the government is condoning climate of intolerance.
Q) Do you see a common strand between the murder of Mohammed Akhlaq and the murder of rationalists?
Rationalist thinkers have every right to express their opinions. Some people seem to believe that only they can decide on good or bad. Meat/beef ban is about the violation of freedoms and rights guaranteed to everyone. It is our duty that we must defend freedom in a democracy.
Q) Do you believe that Prime Minister’s speech on Dadri lynching goes far enough?
I am disappointed at the Prime Minister’s silence. I think he missed the opportunity to unite nation after the spate of these incidents. I think it was too little too late and PM missed the opportunity to apply balm on the minority communities. The kind of intolerant we have seen off late in these incidents lacks a moral authority.
Q) There is a perception that it’s not BJP but the RSS and Shiv Sena which together are tarnishing BJP’s image as a stable government?
The Government is allowing these fringe groups to run rampant. They should be curbed and dealt with law. Our anti-government stand will continue in Parliament when it assembles for the Winter session later next month. I can say that the Congress party has been true to its ideology.
(You can watch the entire interview at 10 pm on Wednesday and 10:30 am on Thursday)
BJP, Dadri Incident, Kerala Assembly Polls, PM Narendra Modi, Right to Dissent, Shashi Tharoor, Shashi Tharoor Exclusive, Shashi Tharor exclusive, writer's protest
|
cc/2020-05/en_middle_0097.json.gz/line1400043
|
__label__wiki
| 0.535224
| 0.535224
|
Geography: Food Security
Start your research in geography with the best available resources curated by the subject librarian.
Finding books
Finding journal articles
Statistics/Data for Geography
Prague FSP
Polar Studies
Managing citations
Government information on Food Security
The title below is just one of many government documents in the Library collection that look at food security. Do a keyword search for "food security" and you will find more.
A call to action on food security : the administration's global strategy : hearing before the Subcommittee on Africa and Global Health of the Committee on Foreign Affairs, House of Representatives, One Hundred Eleventh Congress by the United States. Congress. House. Committee on Foreign Affairs. Subcommittee on Africa and Global Health
Call Number: Available electronically
Global Food Security Act of 2009 : report (to accompany S. 384) by the United States. Congress. Senate. Committee on Foreign Relations
Oversight of the Feed the Future Initiative : joint hearing by the Subcommittee on International Organizations, Human Rights, and Oversight and the Subcommittee on Africa and Global Health of the Committee on Foreign Affairs, House of Representatives, One Hundred Eleventh Congress, second session, July 20, 2010
Promoting global food security : next steps for Congress and the administration by the Committee on Foreign Relations, United States Senate, One Hundred Eleventh Congress, second session, April 22, 2010
Food and Agriculture Organization (FAO-UN)
Our three main goals are: the eradication of hunger, food insecurity and malnutrition; the elimination of poverty and the driving forward of economic and social progress for all; and, the sustainable management and utilization of natural resources, including land, water, air, climate and genetic resources for the benefit of present and future generations.
Food Environment Atlas (USDA)
This atlas is from the U.S. Department of Agriculture. Among some of the variables is food security by state.
Food Security from the USDA
USDA developed household food security measures to empower local communities to assess their food security levels and incorporate their results into the national nutrition monitoring system, providing a rich data source for analyzing changes in the level and distribution of food security in the United States.
Food Security from The World Bank
The world needs to produce at least 50% more food to feed 9 billion people by 2050. But climate change could cut crop yields by more than 25%. The land, biodiversity, oceans, forests, and other forms of natural capital are being depleted at unprecedented rates. Unless we change how we grow our food and manage our natural capital, food security—especially for the world’s poorest—will be at risk.
The Global Food Security Index considers the core issues of affordability, availability, and quality across a set of 105 countries.
The site is sponsored by DuPont.
The International Food Policy Research Institute (IFPRI) seeks sustainable solutions for ending hunger and poverty. IFPRI is one of 15 centers supported by the Consultative Group on International Agricultural Research, an alliance of 64 governments, private foundations, and international and regional organizations.
Plate of the Union
Plate of the Union is a collaborative campaign driven by Food Policy Action Education Fund, the Union of Concerned Scientists, and the HEAL Food Alliance to raise the voice of Americans who care about food and farm issues during this election season. The policies that shape our food system influence our health, our environment, and our economy. ...
ReliefWeb is the world’s leading on-line gateway to information (documents and maps) on humanitarian emergencies and disasters. They have a section on "Food & Nutrition."
Special Programme for Food Security
The Special Programme for Food Security (SPFS) helps governments replicate successful food security practices on a national scale. The SPFS also encourages investment in rural infrastructure, off-farm income generation, urban agriculture and safety nets.
The State of Food Insecurity in the World
The State of Food Insecurity in the World raises awareness about global hunger issues, discusses underlying causes of hunger and malnutrition and monitors progress towards hunger reduction targets established at the 1996 World Food Summit and the Millennium Summit.
WDR - Agriculture for Development
This report has a Focus on food security.
WhyHunger
WhyHunger is a leader in building the movement to end hunger and poverty by connecting people to nutritious, affordable food and by supporting grassroots solutions that inspire self-reliance and community empowerment.
World Food Situation
From the Food and Agriculture Organization of the United Nations, this site collects all the information on food crises in one place.
A Definition for food security
Food security The status of people who live without hunger, fear of hunger, or starvation. ‘Food security depends on robust food systems that encompass issues of availability, access and utilization—not merely production alone’ ( Gregory et al. (2005) Phil. Trans. R. Soc. B 360, 21). ‘A key component of these newer definitions of food security is attention to building local capacity to produce and distribute food and control food supplies…[and] to keep decision-making power within the community rather than losing it through dependence on external sources of food’ (Anderson and Cook in J. Harris 2000). In southern Africa, for example, climate is among the most frequently cited drivers of food insecurity, while in the Indo-Gangetic Plain of India, labour and the availability and quality of ground water for irrigation rank higher than the direct effects of climate (Gregory et al., loc. cit.)
Korf and Bauer (2002) IIED Gatekeeper Series 106 explain the need to address food availability, access, and utilization simultaneously. Slocum (2006) Antipode 38, 2, in a study of a community food coalition in New York, reveals that ‘people of color disproportionately experience food insecurity, lose their farms and face the dangerous work of food processing and agricultural labor’. See Hyman et al. (2005) Food Policy 30 on poverty and food security mapping; and P. Porter (2006).
"food security" A Dictionary of Geography. Susan Mayhew. Oxford University Press 2009 Oxford Reference Online. Oxford University Press. Dartmouth College. 1 October 2010
In the Library's collections
You can search the online catalog using the following subject headings to find relevant resources:
This subject heading is relatively new. You will find more items under the keyword search below.
This is a keyword search.
food dynamics
food relief
The atlas of food : who eats what, where, and why by Erik Millstone and Tim Lang
Call Number: Baker/Berry HD 9000.5 .M52 2008
What we eat, where we eat, and how we eat: these questions are explored in this remarkable book, first published in 2002. Now in its second edition, The Atlas of Food provides an up-to-date and visually appealing way of understanding the important issues relating to global food and agriculture. In mapping out broad areas of investigation--contamination of food and water, overnutrition, micronutrient deficiency, processing, farming, and trade--it offers a concise overview of today's food and farming concerns.
Encyclopedia of food and culture by Solomon H. Katz, editor in chief ; William Woys Weaver, associate editor.
Call Number: Baker/Berry Ref. GT 2850 .E53 2003
There is an article on "Food Security."
Food security by Bryan L. McDonald
Throughout history, human societies have struggled to ensure that all people have access to sufficient food to lead active and healthy lives. Despite great global effort, events of the early 21st century clearly demonstrate that food remains a pressing challenge which has significant implications for security. In this book, Bryan McDonald explores how processes of globalization and global change have reshaped food systems in ways that have significant impacts for the national security of states and the human of communities and individuals.
What I Eat by Peter Menzel; Faith D'Aluisio
Call Number: Matthews Fuller Consumer Health TX 353 .M437 2010
A stunning photographic collection featuring portraits of 80 people from 30 countries and the food they eat in one day.
World at risk : a global issues sourcebook by CQ Press
Call Number: Baker/Berry JZ 1242 .W67 2002
There is a chapter titled "Hunger and Food Security."
World food security : a history since 1945 by D. John Shaw
Call Number: Baker/Berry HD 9000.5 .S425 2007
This book is the first comprehensive account of the numerous attempts made since the Second World War to provide food security for all. It provides a reference source for all those involved and interested in food security issues.
Agriculture, Food Security, Poverty and Environment by C. H. Hanumantha Rao
Call Number: Baker/Berry HD 2072 .H325 2005
This book spells out a reform agenda for agriculture, food security, poverty alleviation, and management of natural resources.
Arctic food security by Gérard Duhaime & Nick Bernard, eds.
Call Number: Baker/Berry GN 673 .S97 2008 text
Accompanying CD-ROM in the Jones Media Center.
Biofuels, land grabbing and food security in Africa by Prosper B. Matondi, Kjell Havnevik and Atakilte Beyene, eds.
Call Number: Baker/Berry HD 9502.5 .B543 A353 2011
The issue of biofuels has already been much debated, but the focus to date has largely been on Latin America and deforestation - this highly original work breaks fresh ground in looking at the African perspective. Most African governments see biofuels as having the potential to increase agricultural productivity and export incomes and thus strengthen their national economies, improving energy balances and rural employment. At the same time climate change may be addressed through reduction of green house gas emissions. There are, however, a number of uncertainties mounting that challenge this scenario.
Feeding Everyone No Matter What by Michael H. Agar; David Denkenberger; Joshua M. Pearce
Call Number: Baker/Berry HD 9000.6 .D46 2015
Feeding Everyone No Matter What presents a scientific approach to the practicalities of planning for long-term interruption to food production.
Food security, nutrition and sustainability by Kristen Lyons; Tabatha Wallington; Geoffrey Lawrence, eds.
Call Number: Baker/Berry HD 9000.5 .L394 2010
As the threats of food insecurity loom ever larger, the world faces the sad irony of food shortages in the global South alongside a purported 'obesity epidemic' in the global North. The twin issues of food production and food access are of particular concern in the context of climate change, 'peak oil', biofuels, and land grabs by wealthy nations. Food Security, Nutrition and Sustainability offers critical insights by international scholars, with chapters on global food security, supermarket power, new technologies, and sustainability.
Food security : indicators, measurement, and the impact of trade openness by Basudeb Guha-Khasnobis; Shabd S. Acharya; Benjamin Davis, eds.
Call Number: Baker/Berry HD 9018 .D44 F66563 2007
This book aims to fill this gap by providing a significant collection of essays from mainstream academia and prominent international organizations working for food security. Examining food security across regions, the book tackles food security at three distinct levels-national, household, and individual.
Hunger Efforts and Food Security by James C. Tobin, ed.
Call Number: Baker/Berry HV 696 .F6 H792 2009
In 1996, the United States and more than 180 world leaders pledged to halve the number of undernourished people globally by 2015 from the 1990 level. The global number has not decreased significantly -- remaining at about 850 million in 2001-2003 -- and the number in sub-Saharan Africa has increased from about 170 million in 1990-1992 to over 200 million in 2001-2003. On the basis of analyses of U.S. and international agency documents, structured panel discussions with experts and practitioners, and fieldwork in four African countries, the author was asked to examine (1) factors that contribute to persistent food insecurity in sub-Saharan Africa and (2) the extent to which host governments and donors, including the United States, are working toward halving hunger in the region by 2015.
Hungry for profit : the agribusiness threat to farmers, food, and the environment by Fred Magdoff; Frederick H. Buttel; John Bellamy Foster, eds.
Call Number: Baker/Berry HD 9000.5 .H86 2000
This penetrating set of essays explains why corporate agribusiness is a rising threat to farmers, the environment, and consumers. Ranging in subject from the politics of hunger to the new agricultural biotechnologies, and in time and place from early modern Europe to contemporary Cuba, the contributions to Hungry for Profit examine the changes underway in world agriculture today and point the way toward organic, sustainable solutions to problems of food supply.
Selected journal title(s)
This is a short list of journals on Food. You can also search for articles in using the search box at the top of the page.
Hunger report by Bread for the World Institute
Other resources include films, maps, audio recordings and other formats that are not print.
"Contains over 700,000 articles from 100 news publications throughout Africa and from several hundred other sources, including governments, non-governmental organizations and other newsmakers, inside and outside of Africa."
Big spuds, little spuds by Corves Filmproduktion
Call Number: Jones Media DVD #10090
Examines the effects of climate change and monoculture on the potato, focusing on agricultural practices in Peru and Idaho. Also examines to what extent pests, disease and climate change are threatening other crops and world food security.
FAOSTAT by the Food and Agriculture Organization of the United Nations
An online, multilingual database currently containing over 1 million time-series records covering international statistics in: production, trade, food-balance sheets, food aid shipments, fertilizer and pesticides, land use and irrigation, forest and fishery products, agricultural machinery and population.
Call Number: Jones Media DVD #4382
Documents the trend of unlabeled genetically-modified foods which have become increasingly prevalent in grocery stores. Unravels the complex web of market and political forces that are changing the nature of what we eat. Explores organic and sustainable agriculture as alternatives to large-scale industrial agriculture.
Harvest of fear
Call Number: Jones Media Video tape #4573
Frontline and Nova explore the intensifying debate over genetically-modified (gm) food crops. Interviewing scientists, farmers, biotech and food industry representatives, government regulators, and critics of biotechnology, this two-hour report presents both sides of the debate, exploring the risks and benefits, the hopes and fears, of this new technology.
Sustainability and security by Gareth Williams
For decades, local food producers in the West have faced a shrinking market share. Will Africans have more to eat if well-intentioned Americans and Europeans stop eating vegetables from Africa? Or African farmers be deprived of a living? This program delves into that issue and other food-related problems, some of which have solutions while others urgently await answers. Viewers are shown how tenuous food security in Kenya does not stop the country from exporting most of its produce to the West while potentially leasing large portions of arable land to Qatar. The film also profiles small UK growers, offers carbon footprint comparisons between livestock producers in New Zealand and Great Britain, and features commentary from Earth Policy Institute president Lester Brown and other experts.
<< Previous: Globalization
Next: Water >>
URL: https://researchguides.dartmouth.edu/geography
Tags: AAG, biogeography, climatology, commodity_chains, cultural_geography, food, geomorphology, globalization, human_geography, international_trade, migration_studies, physical sciences, physical_geography, polar_studies, political_geography, population_, Social Sciences
|
cc/2020-05/en_middle_0097.json.gz/line1400048
|
__label__cc
| 0.662619
| 0.337381
|
Take a Wok on the Wild Side
Google is harshing my mellow
So I thought a post about California based foodies entitled "A Wok on the Wild Side" might be amusing, but before moving on from the title to the text I decided to google to see just how clever and original I am.
OK OK "about 34,500 results doesn't bother me" but this url did.
My Ceci's put on weight, and turned White and had a sex change operation
This time the headline guy is Greg Levine who wrote
"Breaking: Rahm’s Resignation Confirmed; Rouse to be Acting Chief of Staff"
Wow !! To me Rouse is Cecilia (Ceci) Rouse currently one of two remaining councilors on the CEA.
But it seems that there is another Rouse in the Obama administration Pete Rouse.
By the way I was just at an (masters) thesis defence (now Master with highest honors) Raffaele Saggio further explored the case in which Rouse found that Ashelfelter and (assistant treasury secretary for economic policy) Krueger had reached an odd conclusion because they analysed very few data (it was an econometrics thesis on problems with panel data with a short time dimension).
Axhenfelter and Krueger are both brilliant and have made huge contributions and starting with a small study is a reasonable approach to research.
I don't recall the names of Bush administration economists (except for chairmen of the CEA) coming up in academic discussions.
Anyway no female or African American chief of staff yet. Ndank ndank and all that.
Ndank Ndank means "slowly slowly" in Wolof -- Rouse spent a year in Senegal and brought the word back. It is part of a saying (ndank ndank mooy jaap golo ci niaay (after many efforts the hunter catches the monkey)) about persistence in the face of difficulties, which was much quoted by PhD candidates, including Treasury Undersecretary for international affairs Lael Brainard, who definitely said it many times, while waiting over a year for senate confirmation.
www.Repubblica.it headline tizio outdoes www.NYTimes.com headline guy.
Premier: banche Usa salve grazie a me
LA DIRETTA Il Cavaliere al Senato: "Concludere legislatura. Ho convinto io Obama a lanciare il piano da 700 miliardi".
Live the Knight (Berlusconi) to the Senate: "Finish the legislature. I convinced Obama to launch the 700 billion plan."
First note that quotation marks in Italian headlines do not indicate quotations. It is generally considered OK to put paraphrases in quotation marks. De punctuationibus non disputandum est. I was struck that Berlusconi is taking credit for TARP when over there everyone is tryind to assign the blame for TARP to the other party. I agree with Berlusconi (ouch typing that hurt) that the TARP was an excellent act. But since when was Obama the President of the United States. Correct answer January 20 2009. La Repubblica answer, since before September 2008.
I understand that more people in the US think Obama signed TARP than correctly answer that Bush signed it, but information in newspapers is supposed to be better than the median guy's guess.
The article has what appears to be an actual quotation "Ho convinto il Presidente Usa a intervenire dopo il crac di Lehman Brothers." that is "I convinced the US president to intervene after the failure of Lehman Brothers." The US president in question is named George W. Bush. I mean is the question "who was President of the USA in 2008 really so hard ?"
Are You a Real Progressive ?
via John Cole.
Ross Douthat argues that Kwame Anthony Appiah shows insufficient respect for the insights of Karl Marx and so fails to correctly predict future opinions aobut man bites steak.
Cyrillic comment spam (link deleted)
Секрету.нет - Извращения, стыд и жесть, постыдные истории и ужасные Екатеринбург. Рассказы для врозлых шокируют вас и всю страну Казахстан [url=]рассказы для врозлых[/url]
пажалстя more strange spam.
Likely Voter Filters
Kevin Drum makes an excellent find. NBC said something about their likely voter filter ! "Among likely voters — identified by their past voting history and their high level of interest in the November midterms."
As far as I know, until now, pollsters other than Gallup haven't explained their likely voter filter at all.
So hmm "past voting behavior" could be problematic. The last election was very unusual. Also, I think that past voting behavior will underweight early middle age people. To make my thought clear, consider a simplified imaginary USA where all young people don't vote and all old people vote. In that USA' there is some age when people vote for the first time. Those people will be voters not clasified as likely voters. My sense is that that's been a very good age group for republicans (see Atrios "Talking bout my generation") but isn't anymore. Oh no I don't have the link but about a week ago, someone at DailyKos noted that, looking at polls where both likely voter results and registered voter results were reported, the registered voter results were closer to the final outcome in more than half of cases in 2006 and 2008 (the only years checked). Was this because they were wave years ? Or was it because the usefulness of likely voter filters was based on generation X ? Likely voter filters haven't been around long enough to tell.
Now how about interest. Has anyone checked the relationship between stated interest in September and actual voting behavior ? Obviously interest typically rises during October -- many people only tune in then. I don't see how one can check (I recall a post by Kevin Drum which notes that according to polls 70% of eligible voters voted in the last election).
Something that is possible is checking the reliability of likely voter polls in September. Reliability is only checked using the very last poll. The idea is that people really change their mind so it isn't the pollster's fault if they don't vote in November the way they said they would vote if the election were held the day after some day in September. So ? Statistics are useful even when there is a disturbance term. But even Nate Silver himself just accepts likely voter filters. Why ?
I think it is clear that the Gallup filter is biased against the young until just before the election. One of their 7 questions is "do you know where your polling place is ?" They assess the filter using data on voting intentions of people who do and don't know in late October. They use the filter in late September. Clearly not knowing in late October means much more than not knowing in late September. Notably in the past two presidentials, Gallup gave better results for the Republican in September than other polls (search Gallup anomaly) then their last poll pretty much nailed it. What happens when you regress Dem share in the last Gallup poll on Dem Share in the first Gallup likely voter poll and a constant ? I must predict a positive constant which would be significant if one collected enough data.
On average www.nytimes.com headline guy does very well but he or she struggled yesterday
Boy did he or she ever. The headline has changed twice. I don't know the order, but the current headline is (no screen shot) "Basic Religion Test Stumps Many Americans" which seems fine. But there was a third headline
"On Basic Religion Test, Many Doth Not Pass"
Which appears to be an incorrect use of "doth" (I doth not have a clue, but Belle Waring asked “Did they learn about religion from a bunch of old Thor comics?”
No answer to that question, however, John Holbo shows how headline writing is to be done
The Gray Lady Doth Protest Too Much, Methinks
Forsooth, methinks that John Hoblo art a genius.
Also his update art not bad
"UPDATE: Yon Gray Lady Hath Fixethed It."
Old post on a headline which doth by no means lead to such brilliant criticism seguent.
The headline at www.nytimes.com for a much noted story is odd
"Atheists Outdo Some Believers in Survey on Religion"
The story reports that the average score of atheists and agnostics on a quiz about religion was higher than the average score of each of many religious groups.
I suspect that an earlier candidate headline (perhaps just in headline guy's head) was "Atheists Outdo All Believers in Survey on Religion"
That hypothetical headline would be incorrect. That means either that no single believer scored better than the lowest scoring atheist or, at least, that no single believer beat the atheist average.
But the current headline is a very weak claim. "Some believers" might be 2 believers. I think that a better effort would be "Atheists Outdo Believers in Survey on Religion." There is no simple English qualifier which indicates that one is speaking about averages, since the English language was old when the concept of an average was invented.
I think the correct headline would be "On Average Atheists Outdo Believiers on Religion." Headlines must be short, but there is no way to accurately describe averages without explicitly invoking the concept.
This is part N in a series on how we have trouble with basic statistical concepts.
Why the Democrats Should have Proposed Temporary Tax Cuts for Everyone Part MMMMCCCLXXXXII
Here, in Elmendorf's words, is what will surely be the Republican talking point:
"All four of the options for extending the expiring income tax cuts would raise output, income, and employment during the next two years, relative to what would occur under current law," Elmendorf said. "A full permanent extension or partial permanent extension would provide a larger boost to income and employment in the next two years than would a temporary extension, and a full extension would provide a larger boost than would the corresponding partial extension."
What we have here is Elmendorf noting that even the most inefficient stimulus is a stimulus. He went on to argue that tax cuts for the rich would slow growth in the long run.
If Democrats other than Clyburn had been arguing for permanent extension of Bush tax cuts on income under $250,000 and temporary extension of Obama tax cuts for 95% of working US families, then Elmendorf could have said that the Democrats proposal would cause higher growth in the short run and in the long run.
Republicans want the question to be "taxes high or low ?" Then a substantial minority agrees with them about tax cuts which benefit only the richest 2%.
If the question were "tax cuts for the rich or for the middle class ?" then The Republicans would have been crushed.
But Democrats from states other than South Carolina just won't ask that question, because it would be populist and demagogic. So ?
It is a good policy proposal. The fact that it would be extremely popular doesn't make it a bad policy proposal.
So I was watching and listening to the Lady Gaga "Alejandro" video on TV (don't try to convince me that you haven't seen it -- everyone who isn't actually sightless has seen it).
And I thought. Ah Western Culture, it had a pretty good run for 25 centuries and nothing lasts forever.
What John Cole Said
"My response is that the government targeting someone for death and refusing to explain why is so broadly offensive to me that I don’t give a shit about the legal arguments."
Unfortunately, I can't resist amateur constitutional scholarship. Don't try this at home kids. Look below and see just how humiliating a little knowledge can be.
Which are also very simple. This was in response to someone who argued that "he’s been designated by the US and the UN ..." See the US has designated what body can decide that someone is to die, and that would be a jury of his peers. The US has done something if each and every US citizen agrees or if the people have designated some other body to speak for us and it does. The Executive branch does not have any authority to speak on behalf of the USA on the question of who should live and who should die (except for the power of the President to grant pardons and commute sentences).
Now one might argue that my interpretation of the 5th amendment is inconsistent with the body of the constitution which contemplates war. I respond that the 5th amendment is very brief and clear, and that my interpretation of the 13th amendment is inconsistent with the body of the constitution, which said that escaped slaves must be returned to their owners.
If plain English means what plain English plainly means, the power of the Senate to declare war was cancelled by the 5th amendment. War involves killing people without giving them a trial. The 5th amendment forbids killing people (including non citizens) without a trial. The 5th amendment clearly forbids the US to wage war.
I think that war is sometimes necessary and would support partial repeal of the 5th amendment. But while it's there in the constitution, it's there in the constitution.
Speaking of Kevin Drum
This post is brilliant too. I hadn't fully grasped the hisorical pattern of appeals to the constitution by right wing groups which grow when a Democrat is President (the latest of which supported George W Bush when he declared the constitution null and void).
On the other hand, this post includes an arithmetic mistake. Drum notes that 30% of people in a poll support the ACA and an additional 16% either oppose it or are undecided because it didn't go far enough (0% said they opposed the law and 30% said they didn't know) That means 46% either support it or don't support it because it didn't go far enough. Notably 40% oppose it. Even assuming that 0% opposed it because it didn't go far enough that means support or think didn't go far enough beats oppose 46% to 40%.
That leaves 54% who oppose all or most of the law. So you're still at 54%-46% opposed, and this is the best case since it's possible that making the law more liberal might also have turned some of the favorers into opposers. Of course, you can argue that this is still slightly better than 40%-30% opposed, but it's a pretty iffy thing.
This is just wrong. In the calculation of 54% Drum is counting people who "aren't sure" as opposed to the law. That's just not accurate. Also, in the comparison, he only counts the 30% who are opposed to the law not the 60% who are opposed or aren't sure.
The correct calculations are 46%% vs less than 40% (but not calculable given the published results) as opposed to 30% vs 40% or 46% vs 54% vs 30% vs 70%.
Drum correctly notes that the data can't be used to support the claim that a bill which went further would have had more popular support -- some who support the ACA would oppose a bill that went further. This is correct and settles the question of whether this poll can settle the question (it can't). But then he goes on to perform a incorrect calculation from the data which he correctly notes can't be used to answer a question, in order to get an answer to the question which he thinks is reasonable (that answer being "we don't know").
Drum might also note that in polling they never ask questions such that there is combination of answers given by a very small set of people. So if to count as a yes one can answer either the first question one way or the second one way, then the results are biased towards yes. The fact that the correct calculations show as high or higher support for yes or didn't go far enough than for yes is a tautology. This must be so no matter what people think. Drawing conclusions about public opinion from a tautology is not sound social science. Drum is right that some people used a tautology as evidence for their claim about public opinion.
By the way Drum suffered a lapse of reading comprehension. 14% or resondents whom Drum counts among the the 54% who, he says "all or most of the law" answered "I oppose a few of the changes in the law." "a few" does not mean "most" as definitely asserted by Drum.
Here Drum is contesting a conclusion which, he correctly notes, is not proven by the cited data. However, knowing the answer, he is sloppy about the intermediate steps.
His valid argument is very simple. We can't know how people would have reacted to a futher reaching reform, because there wasn't a further reaching reform. That argument is too brief for a typical Drum blog post, so he slipped into adding errors to flesh it out.
Regular readers of this blog (I am just assuming that there are two of you) might have noticed that I have harshly criticized Kevin Drum and Matt Yglesias recently.
I think very highly of them. It's just that I am not much inclined to post "heh indeed," so I only comment when I think that the conclusion of a post is incorrect.
So to be brutally frank (but no more negative than that). I think that this Yglesias post shows how blogs can make the world a better place. Yglesias notes that microwaved frozen vegitables are cheap, convenient and very healthy. I don't suppose he did it just for the sake of his readers, but he lost 60 pounds eating microwaved frozen vegitables. That should get some attention.
It also reminds me of a wonderful old Yglesias post when he praised of Belle Waring who praised Quinoa (and in truly heroic blogging googled up a recipe while nursing). He pointed out, correctly, that advice on eating is much more useful to most people than advice on legislating, since we all eat and most of us aren't legislators. IIRC he typed something along the lines of "I like policy debates as much as the next guy, OK I like policy debates more than the next guy, but ..."
Kevin Drum. OK so I surfed over and the first post I read was magnificent. I'd say it is perfect.
Mitch McConnell lies. dog bites man.
MCCONNELL: Everything that's happened in the last year-and-a-half has been to pump up the government. We borrowed stimulus money. We spent it to hire new federal government workers. We sent it down to states so they would not have to lay off state workers. You have to get the economy going.
This is a lie. He discusses two parts of the stimulus bill and definitely asserts that a third part didn't exist. About one third of the stimulus bill consisted of tax cuts.
It is a mistake to use certain words when attemptint to mislead: "everything","exactly", "identical" etc.
Steve Benen argues with McConnell's assertion that tax cuts during a recession are good and spending increases during a recession are bad. He's right, of course, but he is also falling into McConnell's trap.
Rather the Democrats should agree that there should be temporary tax cuts in addition to permanent extension of the Bush tax cuts on income under $250,000 and then argue over whose taxes should be temporarily cut. Only those of rich people or everyone's.
I think that Majority Whip James Cluburn has it right. He said there should be a temporary extension of the Obama tax cuts. A key advantage of that debate is that it would force Republicans to admit that there are Obama tax cuts which could be extended.
Brain Drain Brain Gain ?
Matthew Yglesias argues for free immigration for skilled immigrants. He said this is good for everyone, but I don't think he seriously considered the less skilled left behind in the countries of origin.
I wrote a long post below noting that, in standard economic models, allowing highly educated foreigners to immigrate is counter to the interests of less educated foreigners (unless the new policy regime included more foreign aid and increased egalitarian redistribution in foreign countries which makes it a policy fantasy not a policy proposal). The argument in the post is that if money metric welfare is increased, then everyone is better off. In every other context, Yglesias totally rejects this logic. An identical case can be made that marginal income tax rates should be zero. Oh and marginal consumption tax rates too.
Now I want to argue that free immigration of highly educated might be good for those left behind in their home countries. This argument due to (I forget who) is similar to the argument that export oriented growth strategies work better than inner oriented growth strategies. The magic word is quality.
If the highly educated in poor countries have to compete only with each other for the business of serving their trapped non educated country-people, they will provide low quality services (typically collecting taxes and bribes). Only if they have a chance to compete in rich countries, will they gain from, for example, actually studying.
Some will move over-seas (probably the most ambitious and academically successful). Those who don't move over-seas will have actually learned something useful (overseas where they don't get jobs from their uncle). On balance the loss of some skilled people is more than made up for by the fact that those who remain are skilled and not just credentialed and admitted to the ruling elite.
I don't know if I find this argument convincing, but it does mean that free admission of highly skilled immigrants can be good for everyone except for highly credentialed* people in destination countries who are the richest people in the world anyway so we can handle not getting quite so much.
* I write credentialed not skilled since I'm highly credentialed but it's not for me to say if I have any useful skills. And no, I don't think a firm command of standard English spelling and punctuation has much to do with being skilled (hey I'm reading this blog) so it's not for you to say either.
Underpants Gnome Welfare Economics
I promise that the ellision of paragraphs of text did not cause the weakness of the argument below.
When a person increases his earnings by moving to the United States, or to Sweden, or to China for that matter he or she does so by creating more value than was possible in the previous context.
a policy regime that’s generous to wannabe migrants makes everyone much better off than a policy regime that keeps people trapped.
So if world GDP increases then ... then everyone is better off.
I am shocked to report that I am quoting Matthew Yglesias ?!?
I commented on his blog.
Freudian Slip ? When I read "The general point that needs to be kept in mind is that the *global* economic space is not zero-sum. " I thought you were making a point which you ignore.
If the US welcomes highly trained immigrants then less educated people in extremely poor countries, which invested scarce resourses in their training, will suffer. Your "global" perspective considers various people in the USA. It does not specifically consider the less skilled in the countries of origin of skilled migrants.
You do mention the world, but only when discussing world money-metric utility. The dollar value of work in the new country is greater than the dollar value of work in the old country so ... "everyone is better off."
I'd consider that underpants gnome welfare economics.
In no other context do you display complete total indifference to the distribution of income. In this post, you assert that if world GDP is increased, then everyone is better off. That is very interesting meta-ethical nonsense.
I see a real dilemma. People should be free to leave a country even if they are valuable to that country -- that is a core principle of liberalism -- that people belong to themselves and are not slaves of the collectivity. On the other hand, this can be very bad for utilitarian welfare -- the world sum of utils -- if it means a brain drain from human capital poor countries. I think this is one of many cases in which it is hard to be both a consequentialist and a liberal. I think the cognitive dissonance was enough to make you temporarily forget that world income is not world welfare and that income distribution matters -- no that's impossible -- to make you temporarily seek comfort from arguments which are based on that hidden assumption.
Yglesias seems to be using the usual trick of noting that a policy regime with free migration and lump sum transfers to those who lose from the migration and lump sum taxes on those who gain can make everyone better off. So it isn't that distribution doesn't matter, but that we can make the distribution whatever we want without deadweight losses, because, without making taxes conditional on any data (they are lump sum) we can set them just exactly right.
This idea is totally absurd. The implicit proposal -- that taxes be charged to people by name with no need to justify why one person pays more than another, is clearly unconstitutional (a bill of attainder). It is one of the tricks used by economists who don't give a damn about anyone but the very rich to con the masses.
It leeds immediately to the idea that the income tax rate should be zero as should the consumption tax rate. Yglesias knows it's a trick.
addendum more stuff not in the comment
Yglesias's conclusion was sloppily phrased. It should have been "for any policy regiem that keeps people trapped, there is a policy regime that’s generous to wannabe migrants makes everyone much better off." The claim as written is plainly false, since it means that any policy regime with free immigration (including the one which goes on to launch nuclear weapons on all the worlds largest cities) is better than any policy regime without. The rewritten claim is standard in the economics literature but it depends on a definition of "policy regime" which is not standard or consistent with the US constitution or basic principles of the rule of law. The regimes in question typically require absolute arbitrary power to take anything from anyone.
Oh my this comment on Kevin Drum got out of hand.
update: Wow Kevin Drum came here to comment. I pull his comment into the post and reply.
Adam Ozimek is perplexed that so many of his friends think that diet soda is dangerous or causes cancer. After reviewing the considerable evidence that they're all perfectly safe, he says:
You can’t really be suspicious of artificial sweeteners without taking a paranoid stance towards leading health and scientific organizations in this country, and towards science itself. Most educated people who hold suspicions about artificial flavorings nevertheless trust the conclusions of science and scientific institutions on other issues, like global warming and evolution. So how do these people decide when to trust scientific consensus and when not to? If you’re going to be a scientific nihilist, then you should do so consistently.
Generally speaking, I agree that laymen ought to have some kind of consistent attitude toward consensus in the scientific community. However, I think there's one reasonable way that people might hold what seem like inconsistent views on scientific matters like this: they don't trust results in which powerful private interests clearly have a lot of lobbying power. So you might believe that global warming is real because there's a scientific consensus in favor of it even though lots of money from the business community is fighting it. Conversely, you might be suspicious of aspartame for fear that the scientific results are skewed by tidal waves of money from the food industry sponsoring studies designed to find it safe. After all, it's happened before with cigarettes and asbestos and PCBs and lead and benzene and chromium 6 and beryllium and Vioxx and a million other things.
[skip]
(For the record: I believe that cigarettes are dangerous, global warming is real, aspartame is safe, and GM foods should be subjected to extreme scrutiny.)
What follows is a revised comment which I wrote after deleting my first draft which was rude and verbose. Honest.
take a deep breath and count to 10. Take a deeper breath and count to 20. Oh hell I don't have all night.
I think that you and Ozimek can't have a useful debate unless and until you agree on the meaning of "leading health and scientific organizations in this country." I propose you discuss "the National Academy of Sciences" and "the Institute of Medicine."* Then you can examine the claim that those organizations are unreliable when large amounts of money are at stake.
I'm not sure you meant to assert that they are unreliable in those cases, but you did assert (in you own name not speaking for anonymous Aspartamephobes) "it's happened before with cigarettes and asbestos and PCBs and lead and benzene and chromium 6 and beryllium and Vioxx and a million other things." Has it ? I don't recall any scientific debate about cigarettes. Yes cigarette companies published pseudoscience at their own expence, but, as far as I know, they had no influence on the NAS and the IOM or, for that matter, the peer reviewed literature.
I'd quite definitely make the same claim about "asbestos and PCBs and lead." I think there is now massive overwhelming evidence that the Scientific establishment in the USA can and does stand up to big business.
If I modify your statement to be a description not a defense of those criticized by Ozimek so that it becomes "after all, they think it's happened before with cigarettes ..." then I think you are partly right. There certainly are people who subject any statement which is helpful to a profit making instustry to "extreme scrutiny" (which, with one *possible* exception**, means they reject it a priori and aren't interested in evidence).
However, I think there is much more going on .
First I suspect Ozimek's claim that "most educated people who ... trust the conclusions of ... scientific institutions on ... evolution. " A substantial majority of people in the USA do not trust scientific institutions on evolution. "Most" and "educated" are vague words, but I think that Ozirek's claim is simply false. He is thinking of people he knows and dismissing the masses (including, I suspect without solid evidence, the masses of people with BA's say). I think he has a well defined group of people in mind, but I don't think they are "most educated people who ..."
Second, I strongly suspect that Aspartame suffers by analogy with Saccharine. My guess is that many are convinced by the argument that if one artificial sweetener is carcinogenic then another probably is too. This thinking is totally alien to people who study carcinogenisis (and the many fewer who study the sense of taste). I suspect that there is a view that there are no easy answers, that we should just buck up and drink water, and that trying to get the taste without the calories will be punished.
I think there is a general sense that synthetic organic chemicals which are not found in nature are dangerous and very little awareness that Aspartame is an extremely small protein which is found in nature. I think this general hypothesis about synthetic organic chemicals was once shared by the scientific establishment (I know the guy who taught me organic chemistry believed it). It made sense given evidence available in 1980. It can't explain the dog that didn't bark in the past 30 years. People who thought lots of synthetic orgnanic chemicals were dangerous necessarily predicted huge new health problems starting in the 80s. In particular, they predicted an increase in cancer not explained by age and smoking. It didn't happen. In any case that has nothing to do with Aspartame, but I think the general fear of un-natural synthetic organic chemicals is based on a reasonable reading of evidence up till 30 years ago and complete neglect of evidence collected since then.
* Conflict of interest announcement. My father is a member of both organizations so I might be biased.
**Finally, I got really really upset *before* I read "GM foods." That's one of the things most likely to make me lose it. This is quite a separate issue but I object in many ways to "GM foods should be subjected to extreme scrutiny."
First I want to ask you "why do you think that ?" and "Is it just because Monsanto is profiting from GM foods" and "does it have anything to do with the fact that Monsanto made napalm ?".
Second I think that "extreme scrutiny" amounts, in practice to "be banned." If the scrutiny is extreme enough, the no profit seeking firm will develope GM foods as the decades of delay for approval make it unprofitable. No non profit could afford to face the costs. I think advocating extreme scrutiny is a way of advocating a de facto ban without admitting that one is deciding to decide something supported by no evidence.
I don't see why GM foods should be submitted to more scrutiny than other foods (or non food GMOs). I'd say there is excellent reason to believe that GM foods will not have subtle bad effects on health. The reason is that genes and (and proteins made from them) whether modified or not are digested. I'd guess that if you fed GM food to one rat and un GM food to another today it would be impossible to tell which was which in a month. Clearly this isn't true of synthetic organic chemicals. Now I am relatively supportive of synthetic organic chemicals, but I definitely don't see why they should be subject to less scrutiny than molecules which are quickly digested into perfectly standard we're made of them molecules.
NOw there are concerns about GM which aren't specific to GM foods. I wonder if the "foods" in the post was a slip and you also advocate extreme scrutiny for GM cotton or GM sheep even if they were not eaten but only sheered.
I think the asking for "extreme scrutiny" or "more research" is a way to delay judgement when one has no evidence to support one's case. I've been pretty polite so far, so I will mention that that "extreme scrutiny" reminds me of "more research before we decide on cap and trade." The case is not proven, there is controversy, lets decide when it is settled is exactly the approach which didn't influence the scientific establishment in the cases of cigarettes etc (yes I did just type something really really rude but it's in a footnote so it's OK).
Kevin Drum comments
This is quite an animated response to something I didn't say. I never mentioned either NAS or IOM. I *did* mention "government regulators," and you might reasonably object that that's not the same thing as the "leading health and scientific organizations" that Ozimek mentions. Most people don't make these fine distinctions, however. They just know what "the government" is doing, and "the government" has historically been strongly influenced by private sector manufacture of doubt. It's hardly moronic for an ordinary citizen to be aware of this and take it into account.
(Evolution, however, is an entirely different matter that I don't think follows the same pattern as other scientific issues.)
As for GM foods, you obviously saw my post within minutes after I made it. I changed "extreme scrutiny" to "considerable scrutiny" shortly after I wrote it, because I agree that "extreme" was, well, too extreme. As for why I feel that way, I made an additional comment about this in the original thread. I'm mainly concerned that we not get complacent about testing and regulation, not about any specific GM food.
I don't think we really disagree. The topic was rejection (dismissal really) of the conclusion of the "'leading health and scientific organizations' Ozimek mentions." As I note above, Drum made a claim in his own name about what has happened many times before. He is presenting this as an explanation for the phenomenon described by Ozimek, which does not follow logically from suspicion of "the government."
Yes most people don't make those "fine distinctions," but they should, and Kevin Drum should point out that they are making a mistake when they conclude that the NAS is untrustworthy because Republican politicians and appointees say whatever big business wants. I'd actually say the distinction between the USgov and the NAS isn't all that. Most people do make the similar distinction between, say, the Catholic Church and the US government.
This is all about a tiny little bit of wording. Drum clearly meant to explain why people aren't influenced by the conclusions of "leading health and scientific organizations" and not to say that it is reasonable for them to do so.
I'd guess another important point (which Drum pretty much makes in his comment on this post) is that most people have no clear idea what the National Academy of Sciences says. I for one, don't know their position on Aspartame. People just know what some self declared scientists say and can only tell that they aren't industry funded hacks when their conclusions displease industry.
On GM food, I guess that I agree with the revised post. I have no problem with the idea is that GM food should be submitted to considerable scrutiny as should well non-GM food (different scrutiny of course but not a whole different degree). As far as I can tell, the debate on GM food runs from considerable scrutiny to extreme scrutiny, so Kevin Drum went from one side completely over to the other. I don't think anyone has ever argued against "considerable scrutiny" and I don't think that GM food opponents say that no evidence could ever convince them (although I'm sure some will never ever be convinced).
update II: By the way, should I live a thousand years, I won't learn to have manners as good as Kevin Drum's. He wrote "quite an animated response " when I myself wrote "got out of hand." But really, incentives Kevin incentives. I am thrilled to find his name (and inimitable prose style in case anyone wants to claim it wasn't really him) in my comments section. The fear of being accused of another "quite" "animated response" is not going to keep me from rabidly berating him hoping for some more attention. I promise that both this time and the last time I was sincere, but I won't deny that I'm getting tempted.
"Evolution is a myth," O'Donnell said as the others piped up incredulously. She repeated herself, then added:
"Well then why aren't monkeys still evolving into humans?"
Ah one for the ages indeed. Republican Senate nominee Christine O'Donnell seems to think two strange things. First that evolution has a direction heading upward as it were, so that according to Darwin living things must get smarter and smarter. In fact, there is no such implication. Darwin discussed the evolution of the eye and the evolution of blind cave fish. His point is that the diversity and sophistication of existing living things could be created by processes which we observe every day.
Also she seems to have an odd idea about the speed of evolution. She thinks it works so fast that you can see it happening before your eyes.
My point above is that one would as reasonably expect people to turn into monkeys before our eyes as expect monkeys to turn into people. Clearly the case of O'Donnell shows two errors. Do you see people turning into monkeys before our eyes ? uh well uhm OK OK but the idea that evolution points upward is still wrong.
Deep Due Due
In an excellent article on an especially blatantly fraudulent astroturf organization called "Americans for Job Security" Mike McIntire reports this daring assault on the English language
Asked how it could have collected no dues in 2007, neither Mr. Dubke nor Mr. DeMaura offered an answer. Mr. DeMaura said that there is no set membership fee and that members are not required to pay annually.
In other words the "membership dues" are not due. It seems to me to call a voluntary contribution "dues" is to make a false statement. The phrase is quoted from a tax return. The IRS has not responded to a complaint by Public Citizen.
More journalism like this please.
That Blue Dog Won't Hunt
It is amazing how uh intellectually flexible supporters of extending tax cuts on income over $250,000 can be. They were the deficit hawks as recently as the last vote on spending.
Also the argument for cutting taxes was to encourage saving (total utter nonsense) and the argument for extending the cuts is to encourage consumption (80% nonsense). Uh what do you want rich people to do with their money ?
I have a long quote from the Huffington Post where Arthur Delaney listens to them so you don't have to.
Many of the House Democrats who support extending the tax cuts, all of which will expire after December if Congress does nothing, opposed reauthorizing extended unemployment benefits back in May, when they said the economy was too strong to justify adding to the deficit. HuffPost asked one such Tax Cut Democrat about the apparent contradiction over deficit spending, since the cuts would add billions to the deficit.
"The economy was growing at the end of December 5.6 percent. It's now growing at 1.6 percent," said Rep. Gerry Connolly of Virginia (who supports the cuts but has not signed the letter). "Many economists say that if you raise taxes on the upper-income brackets, it will shave half a point off of GDP."
OK so Connolly points to the inventory bounce in December to explain his depraved vote in May. Uh Congressman, do you think your constituents don't know the difference between December and May ? Flash first quarter growth estimates were available in May.
Also I note that the congressman is quoting un-named economists who seem to claim a multiplier of about 1.75 for tax cuts to the rich. I don't believe there is any real live economist who has ever claimed that.
Finally, the argument is now that we need more stimulus hence temporary tax cuts for the rich. This argument just can't be made with a straight face, since we know of much more effective stimuli than temporary tax cuts for the rich (in a pinch I could probably think of a less effective stimulus but it would be a challenge).
I want to ask Connolly why he doesn't support permanent extension of Bush cuts on income under $250,000 (meaning over $6,000 next year for rich families) and a temporary rebate of an equal amount to each family. Best if he gets to explain his reasoning to each of the families in his district who would get less under his plan.
I think the only plausible explanation is due to Atrios. Some blue dogs know they won't be re-elected and they are trying to please the rich so the rich will hire them after they are kicked out of the House.
Rasmussen and the Generic Congressional Ballot in September 2010
I have been doing some arithmetic concerning the generic congressional ballot in my head. Caveat lector. I looked at polls entirely in September 2010 and took simple averages.
There were five non-Rasmussen likely voters polls. The Republicans were ahead on average by 3.4%
There were 8 registered voter polls with Republicans ahead by 1.5 on average.
There were two Rasmussen polls with Republicans ahead by 9.5 on average.
The Rasmussen not-Rasmussen difference dwarfs the likely voter registered voter difference.
OK there were two polls from the first two days in September. since then the Democrats are 0.67 ahead out of 6 RV polls. There were also two LVpolls with huge Republican leads which overlapped August and September so the average would be 5.3 %
That is, depending on exactly when I cut, the LV-RV difference can be maybe as high as 4%. This does not correspond to all the talk about the enthusiasm gap does it ?
and the Rasmussen.other gap is huge.
This is the Rasmussen only smoothed graph (you will note it is pretty smooth to begin with as it is weekly averages of a tracking poll which therefore has large samples).
Oh rats, that's missing the curve.
Non Rasmussen LV polls give a smoothed average of Republicans by 3.7 :R 45.4 D 41.7
With high sensitivity (less smoothing) Republicans by 0.9%.
Generic House Polls
Something odd seems to be happening in US public opinion. Pollsters are shifting from polls of registered voters to polls of likely voters. Given demographics and the enthusiasm gap, I expected the Republican lead in the House generic ballot to increase. Until recently, that seemed to be happening right on schedule.
Since then there have been several polls showing a surprising close race. If I toss Rasmussen polls from the pollster com smoother(because I don't like their results but at least I admit it) I get a pollster smoothed average showing a the Republicans ahead by 1.8%. This is mostly determined by ten polls in September five of which are polls of likely voters and five of which are polls of registered voters.
I'm pretty sure I'm over interpreting data and seeing what I want to see. I guess it's conceivable that recent Tea Party success in primaries have scared voters.
For some reason when I try to save the graph, I get the default graph including Rasmussen polls.
John Boehner is the world's tallest midget
The Joint Committee on Taxation recently reported that only 3% of small businesses would be affected by the expiration of Bush-era top rates. Asked about this a week ago, House Minority Leader John Boehner (R-Ohio) said, "Well, it may be 3%, but it's half of small business income. Because, obviously, the top 3% have half of the gross income for those companies that we would term small businesses."
See it's really 50% because those 3% are the largest small firms (or are they the smallest large firms ?).
Mitch McConnell is the worlds shortest giant.
Dead Dog Walking vs the Beaten Blue Dog Syndrome (learned fecklessness)
I am amazed that the House Democratic Caucus seems to be shying away from a showdown vote on extending tax cuts on income over 250,000. Not extending is good policy. A solid majority of respondents in polls oppose extending those cuts. The Democrats are heading for a beating and need to gamble. It seems like a football team whcih is 10 points behind with one minute left deciding to punt ... on third down.
Ah "team" that's the key word. They aren't senators, but representatives aren't offensive linemen either. I hit my forehead and felt like a fool when I read Atrios's explanation -- there are blue dogs in the caucus who know that they won't be re-elected. They aren't trying to keep their current job. They are trying to line up a new job as a lobbyist. Suddenly it all makes sense.
I guess that isn't the whole story.
Now there is also the matter of the beaten blue dog syndrome (learned fecklessness) the elite's inability to remember how untypically rich their social set is, the fact that the squeeky wheel gets the greece and rich people squeek (and hire hacks to squeek for them) and the idea that ideology is one dimensional so that districts which are conservative on social issues are assumed to be full of people who love tax cuts for the rich.
What's Wrong with Kansas ? Start with Kay.
Kay at balloon juice illustrates why the USA is so messed up. She is angry that the food safety bill is blocked in the senate and decides that to blame "the senate" and the food industry. I think she posted after reading the first paragraph of an article the New York Times which went on to explain that the bill is being blocked by Thomas Coburn MD (R-Okla). But who cares about individuals ? Why there is plenty of blame to share. So long as people are angry at the Senate what point is there deciding which particular senators are to blame. It's not like people can only affect the senate by voting for individual senators or anything.
Quite frankly I am appalled that when the Grey Lady is willing to name names that a blogger decides not to bother.
I think part of the problem is assuming that, while the rubes need information, we cool kids know all the facts. That is, I suspect that Kay assumed that readers from Oklahoma would click the link and read the article and find the useful information. Another issue is that I'm sure that Kay, like many bloggers, considers much of the USA to be foreign territory. I'd guess she assumed that no Okies read Balloon Juice, so it doesn't matter if the problem was caused by voters in Oklahoma.
One of the terrible problems with the traditional media is that they communicate to each other and either assume that their readers and viewers are well informed or just don't care about people who aren't political junkies. I'm sincerely shocked and very angry to find the same thing is true of a blogger at a high traffic blog.
My full rant follows.
I think that this post is irresponsible. It does no good to blame "the Senate." We will have a Senate whether we want one or not. In this case it is very easy to identify the one person who is to blame Senator Dr Coburn R-Okla.
I had a sense that I knew that and googled. Google sent me to the linked article which clearly explains that the blame is not shared by the whole senate as you assert.
I am quite angry about this post. I think it illustrates what is wrong with the US polity. It is easy to blame "the senate" or to be just a bit more broad "politicians" or "jerks in Washington." However, suck broad blame does not guide any useful response. People vote for individual politicians. If they know who to blame with first name last name and a medical degree which is being disgraced by a medical doctor who doesn't care that he is causing human deaths, they can do something about it (not in 2010 but in 2012).
Sloppy lazy people like you who won't even bother to read to the end of the article are consumed by anger *and* confusion. People who are as lazy and sloppy as you are going to vote for Republicans because they are angry that the Senate doesn't function because of Republicans.
Always spreading the blame, even when one person is clearly responsible is a way to paralyze the Democratic process. With this post you demonstrate that you are a threat to properly functioning democracy.
I hope I have made it clear that I expect better from Balloon Juice
Accounting for Scott Sumner II
Scott Sumner presented an updated estimate of the cost of the financial rescue. He calculated 158 billion which is 165 billion lost saving Fannie Mae and Freddie Mac minus 7 billion profit from loans etc (mostly purchases of prefered shares) of big banks.
This is nonsense accounting. In the case of the large banks, Professor Sumner looks at the present discounted value of cash flows both ways. In the case of the GSEs, he looks at their current debt and assumes that they will repay less than none (he wrote $165 billion and growing).
For the 7 billion figure he seems to use a CBO estimate from March. He provided no link or citation, but the CBO did make that estimate of $7 billion profit in March.
For the GSEs he presents no source, evidence or data whatsoever.
I believe that his rule of accounting is assume whatever makes things with an acronym including G look bad.
The CBO updated its forecasts in August. I'm not sure if Professor Sumner is aware of that detail. The current estimated cost of TARP is 66 billion. So why, when he relies on the CBO for some of his numbers, does Sumner calculate 158 billion and rising ?
I think it's because he doesn't bother checking the latest data before blogging.
Here it is (warning big pdf)
The CBO estimates a net transfer of 41 billion from the Treasury to the GSEs in fiscal 2010 on top of 96 billion in 2009 (which started October 1 2008 so the sum is most of it). The sum 137 billion is much less than the GSEs debt to the Treasury because the Treasury demands huge dividends on its prefered shares (10% per year).
I also note that the CBO estimates that interactions with Fannie Mae and Freddie Mac from 2011 to 2020 will reduct the debt in 2020 by 44 billion in expected (present ?)value. However the TARP law requires the CBO to discount flows with a high interest rate to compensate for risk. This is not how the US federal government deals with any other cash flow and makes no sense.
So the expected cost is 93 billion plus spending in fiscal 2008 and some interest. Not close to 165 billion.
NY Times Copy Editors II
I thought they were perfect. Now I read
Toiling Far Away for Philippine Dreams
By NORIMITSU ONISHI 3:15 PM ET
Money sent home by Filipinos working abroad accounts for more than 10 percent of the gross domestic product.
No it doesn't. That money might be equal to 10% of GDP, but it accounts for 0% of GDP. It is included in GNP but not in GDP. Surely people have noticed that the middle letter in most announcements changed from an N to a D. What's the difference ? Well money coming from abroad in exchange for work or the use of capital minus money sent abroad that's the difference.
Now of course the genuinely weird thing is that the USA can be the worlds biggest debter and yet people didn't even notice the shift from reporting GNP to reporting GDP. That's because US GNP and GDP are very similar, because US owned assets abroad pay much higher return than foreign owned claims on the USA. This is the issue in the context of which Paul Krugman said "if they are smart enough to understand that, they are probabily smart enough to understand that zero is not an especially important number."
update: not to be outdone, a www.washingtonpost.com copy editor demonstrates that he or she doesn't know what the word "species" means
Different species, same name
Current FDA rules don't permit customers to know if salmon in stores has been genetically altered.
Lyndsey Layton
A genetically modified salmon is only a member of a different species if it can not produce fertile offspring with an un-modified salmon. I think it would be good policy to require genetically modified salmon to be modified so that they are a new species, because then if a few escape they won't contaminate the wild salmon gene pool. However, currently existing genetically modifies salmon are not a new species.
"Species" is not an obscure word nor is it a word with a controversial or ambiguous definition. Ignoring the definition and acting as if different genes imply a different species is not the sort of thing I like to know about a member of my species (with somewhat different genes) doing.
New York Times Copy Editor Fail (This Past January)
I have never seen them miss one like this
"Mr. Sarkozy ... his responsibility as president to be above the law."
Noooooooooooo no one is above the law. That should be "above the fray", "above the court case", "above litigation", "above narrow legal disputes" but not never ever above the law.
Especially don't tell Mr Sarkozy that he should be above the law. Not as risky as telling Bush or (maybe) Berlusconi, but very very dangerous.
Now I don't type so good, but I really don't think I could ever type "responsibility ... to be above the law" by mistake.
Can one be honest but not intellectually honest ?
Julian Sanchez argues that one can, but I am not convinced (click the damn link)
There is a key issue not addressed in this post. If one is making a case (honest but not intellectually honest) does one say that one is making a case ? In a formal debate or a civil case or for the defence in a criminal case, it is clear to everyone that a case is being made and noting facts which undermine that case is strongly forbidden.
To me, making a case in those situations is totally honest in every way. If the best case which can be made without actually lying is p then saying "the best case which can be made without actually lying is p" is intellectually honest.
It seems to me that intellectual dishonesty occurs when someone acts as an advocate but does not say so. When someone states the best case for a claim x without saying "to state the best case for the claim x." It seems to me that this is plain dishonest. If someone claims to be balanced and is an advocate or claims to be just examining the evidence when he is making a case, then he is dishonest.
Or to shrink back a bit and weasel and stuff, I suppose it is possible to make a case without either admitting that one is making a case or actually lying, but I don't think that anyone actually manages to do so. It would require avoiding all phrases of the form "I think", "the relevant facts", "therefore it is reasonable to conclude" and hmm just about everything except for stating selected facts.
I have a challenge. Can anyone find a case of someone who is honest but not intellectually honest ? If someone says "I am going to make the case that X", then does this is totally honest. If someone doesn't implicitly claim to be doing anything else and makes the case, then, according to our host he or she is honest but not intellectually honest. But has this ever happened ?
Has anyone with an audience of normal adults ever managed to slide over the issue of whether they are acting as an advocate without plain ordinary dishonesty. I admit it is theoretically possible (quite possible if one is trying to convince a group of toddlers say) but I don't think it has been done yet.
Daniel Davies unites Ignatius Loyola and Maynard Keynes
several of the world's most important central banks have it written into their constitutions that they need to control inflation or target price stability. I think a good lawyer could make a case that a decision to target stability, but stability at a higher level would be consistent with the letter if not the spirit of these laws.
In the real world, inflation has momentum so it is not possible to increase the price level without accepting inflation for a while or inducing a recession. However, the Jesuit doctrine of dual effect might allow the ECB to act in a way which causes inflation provided that they sincerely aim only for a one off increase in the price level.
Casuistry in the cause of debt inflation might be just what the world economy needs.
I'd say that Mr Davies is the (typing) finger of my God, Who is mainly characterized by His or Her sick and twisted sense of Humor.
Glenn Greenwald denounced TV "journalist" Jon Meacham. This belongs in comments but there are already 305 of them, so I will just note that Greenwald went easy on Meacham. He quotes Meacham from 2004
Let's remember, [Saddam] sent mixed signals about his own WMD to his own people. . . . He was not saying, "I don't have anything at all "
Of course Saddam did say that he didn't "have anything at all" in his official over 12,000 plust page report to the UN Security council.
On December 7, 2002, Iraq submitted its 12,000 page declaration, which claimed that it had no current WMD programs. Intelligence analysts from the United States and other nations immediately began to scrutinize the document, and senior U.S. officials quickly rejected the claims.
He had been claiming he didn't have any WMD at all for years. Those claims were so thoroughly dismissed that, I have no doubt, that Meacham had sincerely forgotten them.
The Bush administration asserted that the report was a material breach of resulution 1441 and that it was authorised to invade Iraq (which wouldn't have followed anyway). There was a huge debate about whether Saddam Hussein's lying claim that he "didn't have anything at all" justified an invasion. Then Meachem confidently and specifically asserted that the notorious ultra controversial claim never happened.
Shouldn't Mr Meachem be invited to seak a new line of work ?
In Praise of McDonalds
Noted foody Ezra Klein wrote "McDonalds is delicious". Utterly amazed, I clicked and found Adam Roberts's food blog post praising the taste of McDonalds's food. Amusingly Roberts reliably predicted the he would piss off either McDonald's fans or foodies who think that "the entryway to Hell isn't marked, as Dante suggested, with the phrase "Abandon all hope, ye who enter here" but, instead, by golden arches."
I share Klein's and Roberts's opinion. However, Roberts insists that the food is unhealthy, because it contains preservatives.
"Note the wording on the box: "All The Best." Just those three words are suspect. Is this chicken sandwich really "all the best"? We know it's not. We know this bread is filled with stabilizers and preservatives,"
"All that food, however good it might taste in the moment, produces both a physical and spiritual aftertaste. You start feeling the chemicals on your tongue,"
Brilliant and daring. Congratulations on the link from Ezra Klein (I never expected to read the link text on his blog).
However, you missed one group that you were bound to piss off -- preservative enthusiasts. OK I'm not sure the plural is accurate, since I might be the only one, but I am absolutely totally 100% sincere. I think that BHA and BHT are good for you.
The weird thing is that health food enthusiasts are convinced of two things -- that anti-oxidants are healthy and that preservatives are unhealthy. The only problem is that "anti-oxidant" and "preservative" are synonyms.
This is not (quite) a logical inconsistency. Their view is that natural preservatives are healthy and that synthetic anti-oxidants are unhealthy. There is essentially no evidence supporting this hypothesis and people have been looking for such evidence for decades.
Why did you insult preservatives ? I assert that the scientific evidence tends to suggest that bread with preservatives is better for your health than bread without preservatives. Is there any data supporting your contrary view ? What convinced you ?
What about feeling chemicals on your tongue. Can you really feel those chemicals ? Have you performed a blind tongue feel test with food that differs only by addition (or not) of those chemicals ? I would bet 100 to one that you haven't and that you claim you can feel something based not on a test of feeling but the way you feel given your knowledge and prejudices.
I stress this post is not a joke. I think that BHA and BHT are good for peoples's health. I even think that use of BHA and BHT are partly responsible for the increase in life expectancy since they were introduced.
update: Kevin Drum says my reasoning is in this post, but there isn't much above so I add the following:
My reasoning was not explained after the link (always click the link anyway -- Kevin Drum). I agree with Luther, so my claim is stronger than that made by Crissa. The logic is exactly that preservatives preserve us.
To get technical, preservatives are anti-oxidants and oxidative stress (roughly rusting) is allegedly implicated in cancer and cardio-vascular disease. I note that there was a dramatic increase in US life expectancy in the 70s (similar to the increase in the 40s following the introduction of penicillin). This was due to reduced incidence of heart attacks. It was ascribed to improved diet and increased exercize. Sure mac, that's why we are so much thinner than we used to be.
Now continuing improvement can be partly explained by statins (one can be overweight, eat lots of saturated fat, never exercize and have low LDL cholesterol these days -- that's my plan). Also some by bypass surgery and shunts and stuff. This is mostly post 70s. There is a huge mystery in the data which can be explained if it is noted that anti-oxidants reduce arterio-schlerosis in model systems (over-fed rats).
In any case, the claim that anti-oxidants prevent arterioschlerosis is absolutely totally very respectable and BHA and BHT are anti-oxidants. There is a fairly large literature asserting that this or that food contains anti-oxidants. In each case which I checked, the anti-oxidant was compared to BHA or BHT (or both).
So why are people so deeply convinced that BHA and BHT are bad for our health ? One reason is that extremely large doses cause cancer of the fore-stomach in mice and rats.
This result was part of the evidence which convinced people (including the guy who taught me organic chemistry) that organic chemistry was a menace, because many many synthetic organic chemicals are carcinogenic. In 1979, he predicted a big increase in cancer in the 80s roughly 20 years after they began flowing into our diet (20 year lag from aggregate cigarette smoking and lung cancer). That didn't happen -- aggregate cancer incidence is almost completely explained by age (to the fifth) and cigarette smoking. My view is that many compounds which are carcinogenic in huge doses are safe in small doses and in other cases the carcinogenisis depends on the fifth power of the dose which amounts to pretty much the same thing. Also I am not a mouse and don't have a fore-stomach.
There seems to be a very strong belief that natural chemicals are OK and synthetic chemicals are dangerous. This once convinced scientists (including that synthetic organic chemist). The evidence is now weaker. Note tobacco is natural and highly carcinogenic. Ergot is natural too.
I am not an expert on, well, anything, but I am absolutely sincere.
Do the Democrats want to lose power ? More importantly does Fred Hiatt want to lose power ?
I have been wondering why Democrats aren't stimulating the economy and buying votes by mailing out checks. A not so bad policy would be to send $500 to every family in the USA right now. It would certainly be better policy than temporarily extending Bush tax cuts on income over $250,000. Also it would be much more popular. So why not ?
I think the Democrats are afraid of being denounced as populist class warrior demoagogues out to buy votes. This fear makes no sense. Such denunciations are exactly what they need to survive the next election. As everyone who actually looks at polls knows, there is a solid majority in favor of a more progressive tax code or, in other words, populist class war and soaking the rich. Somehow almost all pundits either make claims contradicted by the polls or are shocked and surprised by the latest poll which shows what polls always show.
My guess is that Democrats really care what the Washington Post editorial board writes about them. They are not willing to be called demagogues.
My new thought is that the pundits are not rationally seeking power. If I am right, they have great power now, because Democrats are in power and obey their will. Republicans ignore them completely (how many divisions does Fred Hiatt have ?). So if the pundits want to keep power, they have to help the Democrats win. They won't do this by endorsing Democrats a week before the election (Fred Hiatt has no divisions). They can do this by recommending increased tax progressivity.
Unfortunately, they are not evil people who seek power. The pundits are sincere, albeit blinded by class interest. But if they, or Democrats in power were in the grip of blind ambition, the unemployment rate would be lower next year and the national debt would be lower indefinitely.
Great moments in anonymity
at the New York Times magazine are really giving it to the Brits reporting on Britmedia criminality and Met (also known as Scotland Yard) complicity.
They also grant anonymity to two people, one of whom* is lying
The prosecutor was stunned to discover later that the police had not shared everything. “I would have said we need to see how far this goes” and “whether we have a serious problem of criminality on this news desk,” said the former prosecutor, who declined to speak on the record.
Scotland Yard officials ultimately decided the inquiry would stop with Mulcaire and Goodman. “We were not going to set off on a cleanup of the British media,” a senior investigator said. In fact, investigators never questioned any other reporters or editors at News of the World about the hacking, interviews and records show. A police spokesman rejected assertions that officials failed to fully investigate. He said the department had worked closely with prosecutors, who had “full access to all the evidence.”
either "the prosecutor" or "a police spokesman" is lying like a doge (typo but I like it that way). Also, when in the hell did spokesmen get to be anonymous ? The whole point of spokesmen>/strike> persons carbon based organisms is to propagate lies which can't be ascribed to anyone who counts.
How in the F**king name of the NY Times Magazine style guide can "a ... spokesman" be granted anonymity ?
Oh my God this is special "On Aug. 24, 2006, George Galloway, a member of Parliament, was alerted by a detective that his messages had been hacked. Galloway said the detective urged him to change his PIN code. But when Galloway asked who had accessed his phone, the man from Scotland Yard “refused to tell me anything.” "
Uhm I think that a detective needs to have his head checked. One can be f*cking and S*domiz*ing sure that George Galloway is going to tell all. One can not be sure that he will tell all only to reporters who respect the anonymity of "a detective" who talked to a source.
My Religion (if I had one)
I am an atheist. At the moment I am wondering what religion I might have should I come to have any. I'd say that first I'd be Manichean then Jansenist. To me, the most plainly false part of theology is theodicy (which I can't help reading as theological idiocy) -- the justification of the ways of God to men. This is an effort to argue that their might be a deity who is omnipotent and benevolent. The challenge is due to the fact that the world clearly sucks. I mean not in any abstract sense but compared to the best world we mere mortals could imagine (and just think of how Great the best world He could Imagine must be).
Manicheans thought that this material world was the creation of a lesser and not so benevolent deity Whom they called Shaitan. Doesn't work too well since the world is not the worst i could imagine either and the evil He (or She) sure could outdo me).
Also Jansenists, while considering themselves Christian and even Catholic, thought that God was cruel (or Cruel) making people do evil and punishing them for it.
That makes some sense.
If I had religion I would worship the One who has a Sick and Twisted Sense of Humor. Most of all He (or She) seems to favour privileger and otherwise root for total utter idiocy.
Could Rand Paul be created by natural procesees ? Sure although I'd rather be far far away from those processes. Could natural processes cause Rand Paul to be 15 fucking points ahead in the latest poll ? Could mere idiocy achieve so much ? No only Idiocy (whose avatar is aqua Buddha) could make that possiblle.
I don't see any Angle for more positive proof that He (or She) is seeking to find the utter abyss of idiocy.
Take a Wok on the Wild Side Google is harshing my...
My Ceci's put on weight, and turned White and had ...
www.Repubblica.it headline tizio outdoes www.NYTim...
Are You a Real Progressive ? via John Cole.
Man Bites Dog Ross Douthat argues that Kwame Anth...
Cyrillic comment spam (link deleted) Секрету.нет ...
Likely Voter Filters Kevin Drum makes an excellen...
On average www.nytimes.com headline guy does very ...
Why the Democrats Should have Proposed Temporary T...
So I was watching and listening to the Lady Gaga "...
What John Cole Said "My response is that the gove...
Speaking of Kevin Drum This post is brilliant too...
Regular readers of this blog (I am just assuming t...
Mitch McConnell lies. dog bites man. MCCONNELL: E...
Brain Drain Brain Gain ? Matthew Yglesias argues ...
Underpants Gnome Welfare Economics I promise that...
Oh my this comment on Kevin Drum got out of hand. ...
"Evolution is a myth," O'Donnell said as the other...
Deep Due Due In an excellent article on an especi...
That Blue Dog Won't Hunt It is amazing how uh int...
Rasmussen and the Generic Congressional Ballot in ...
Generic House Polls Something odd seems to be ha...
John Boehner is the world's tallest midget The Jo...
Dead Dog Walking vs the Beaten Blue Dog Syndrome (...
What's Wrong with Kansas ? Start with Kay. Kay a...
Accounting for Scott Sumner II Scott Sumner prese...
NY Times Copy Editors II I thought they were perf...
New York Times Copy Editor Fail (This Past January...
Can one be honest but not intellectually honest ? ...
Daniel Davies unites Ignatius Loyola and Maynard K...
Blast from the past Glenn Greenwald denounced TV ...
In Praise of McDonalds Noted foody Ezra Klein wro...
Do the Democrats want to lose power ? More import...
Great moments in anonymity at the New York Time...
My Religion (if I had one) I am an atheist. At t...
|
cc/2020-05/en_middle_0097.json.gz/line1400056
|
__label__wiki
| 0.51312
| 0.51312
|
FAQ: The game: advanced
4.1 - Diplomacy
There are 3 possible diplomatic relationship types between players: Peace, War and Alliance.
War is the default relationship - after all, we're here to kick each other's butt, right? When you're in war, you can freely attack your opponent and cannot pass through his troops or defence lines without attacking them.
Peace means you cannot attack without declaring war first - which takes one turn. This gives you some protection against sudden backstabbing. You can freely pass through troops and defence lines.
Alliance offers twice more protection against backstabbing - since it takes 2 turns to change to War. While in alliance, you can send money to each other and see all each other's troops, even those beyond your visibility range. It's also possible to pass empty cities between allies. You can also achieve joint victory, if all opponents have been defeated and only allied players are left. This can also be a way to 'draw' the game.
Changing diplomatic relationship
Open the Players menu and click on some player. A panel would expand, with diplomacy options. Changing relationship to Peace (from War) or to Alliance requires the other player's confirmation. Once the next turn starts, he can either confirm or reject the change.
4.2 - Units
There are 3 kinds of units: land, naval and air. Each unit has its own assigned unit role and specific purpose - designed to be used in offence, or defence, or transportation.
For example, Infantry is 'Ground Main Defence', Submarine is 'Naval Stealth', Spy plane is 'Air Support', etc. These roles are always the same across all the maps, so your upgrades and strategies will affect units on custom maps as well. In addition, there are 'Rare' units (only appear randomly when a city is conquered) and 'Other' role (whatever map creator wishes them to be).
Stealth units are completely invisible to the enemy, until they are detected or participate in a battle. After a battle, put them in one of your cities to make them invisible again.
Transport units can be used to transport troops by land, sea or air.
Some units also have an added bonus when defending in a city or defence line (Infantry, Marines), or defending against a certain unit:
Marines against Infantry
Destroyers and Submarines against Bombers
Submarines against Infantry and Destroyers
Detailed information on units is available in the in-game Units menu and on the Units and Strategies page.
4.3 - Generals / commanders
We decided to put YOU into the game as a General, personally commanding your armies. After a few upgrades (first starting with just 50 SP), General will provide bonus stats to all/certain units in his stack.
You can personalize your General by uploading a custom icon. Go to the Edit profile page, it's right next to the avatar upload.
There are also several rare commanders (similarly giving boost to their stack units), as well as special rare units specializing in assassinating commanders.
Generals are only available to Premium members.
4.4 - Upgrades
You can purchase permanent upgrades in the lobby, using your earned SP. This can unlock additional units or Strategy, or make a small improvement for your current units.
In the list you only see the upgrades you can afford at the moment, plus the required SP for the next cheapest upgrade.
You can see your purchased upgrades in the 'My upgrades' tab in the lobby and in the 'Game' menu when playing.
4.5 - Strategies
Strategies give you a small advantage in some area, while reducing some aspects of other areas. For example, Relentless Attack makes your Tanks faster and more powerful, but also makes your Infantry weaker.
Strategy can be selected in the Lobby or during country selection. More Strategies can be acquired through Upgrades.
4.6 - Stealth detection
Stealth units can be detected if they come within enemy's detection range. Detection is only performed in the beginning of a turn, and discovered stealthy units are announced in the Events menu.
Click on the 'show visibility range' button under the minimap to see your detection range (which is different for land/naval/air units. Detection range is directly proportional to unit's visibility range and also depends on that unit's type.
4.7 - Rare units
You have a chance to find rare units in captured cities - these range from slightly different types of Tanks to nuclear missiles. Some are more common than others, some can only be found in certain countries. You can set the chance to find rare units in game settings ('none' is also an option).
4.8 - Auto-production
You can set a unit to auto-produce in the City menu or Country menu. Whenever you have available units, this unit will be built (provided you have enough money). City lists in the country menu and the Cities menu ('star' in the top toolbar) show available units or auto-produced unit. Clicking on the unit icon will cancel the auto-production.
There's also an auto-production tab in the Cities menu, where you can cancel all auto-production, put it on hold or execute all orders.
4.9 - Coalitions
What do Coalitions do?
They organize players into groups, giving each their own private forum (with own mods), in-game chat channel and a panel displaying all members (and who's online).
How to start a Coalition?
Starting a Coalition costs 10000 SP. It will be more expensive in the future, so we advise you to use the current opportunity. Go here and fill the simple form. That's basically it.
Joining, applying and inviting
Coalitions can be Free for all, Applications-only or Invitations-only. First one anyone can join, in the second players need to apply for membership (which will be approved/rejected by the Coalition), and in the third membership is by invitations only.
To join a Coalition, visit their page (ex.: http://afterwind.com/cln/cln.php?cln_id=4) and click either 'Join coalition' or 'Apply for membership' under the image, depending on their joining policy.
To invite people to your Coalition, visit their profile and click 'Invite to Coalition' under their avatar. Note that common members can only invite people to Free for all coalitions, otherwise only Leaders and Officers can send invites. You can also disable coalition invites in your settings, if you're not interested.
Leaders, Officers and Founders
Officers have permissions to invite members, apply/reject applications, kick members out and moderate the forum.
Leaders have additional permissions to edit the coalition page and assign/demote Officers.
Founder has additional permission to demote Leaders.
Each player can be a member of only one Coalition (although you can quit it and join another one whenever you like).
4.10 - Coalition Wars
Coalition Wars (CW) is a kind of team game, where instead of teams you have Coalitions. Only two coalitions can participate, minimum 3 players on each side, and a Leader or an Officer must be present on each side. Coalition war game has to be created by a Leader of an Officer in the Coalition Wars room.
Elo rating
Similar to duels, there's a Total Elo rating and Season Elo rating. During a Colition war game the winning coalition will gain Elo and the losing coalition will lose the same amount. The amount depends on the difference between the coalitions' Elo ratings.
Seasons correspond to the year's seasons: Winter/Spring/Summer/Autumn. Winter season starts on the 1st of December, Spring on the 1st of March and so on. Season Elo is reset to 1000 in the beginning of each season (Winter/Spring/Summer/Autumn). The coalitions are then ranked according to the games they played during the season and the Season Elo rating.
Please be warned that there will be a harsh penalty for trying to exploit the Elo system (creating dummy Coalitions and farming Elo).
4.11 - Contacts menu
Contacts menu lists your Friends, Coalition members, Enemies and Ignored players. To open it, click on the button to the left of the chat box.
Hover the mouse on player's name in the contacts menu or anywhere else in the game to see some additional information - Coalition, avatar, reputation. There you will also find buttons to add the player to friends/enemies, ignore him or give +reputation.
4.12 - Duels and Elo
Similarly to Coalition Wars, you can challenge other players to a Duel during a game. The Duel button is located in the Players menu, next to the Diplomacy buttons. The rules are simple - the first player eliminated from the game loses the duel. If both are eliminated in the same turn or both win the game, duel is cancelled.
Elo is the competitive rating system. In the beginning, everyone has 1000 Elo points, which then go up or down depending on how well you do in the duels.
Elo gained/lost in a duel depends on the difference between the Elo ratings of the opponents.
Season Elo is reset to 1000 in the beginning of each season (Winter/Spring/Summer/Autumn).
Minimum rank to participate in a Duel is 2. Latest duels are shown in player profiles.
|
cc/2020-05/en_middle_0097.json.gz/line1400057
|
__label__cc
| 0.605757
| 0.394243
|
Keyword: art school
Of the hundreds of photos Robert took while attending art school, he only took three photographs inside the school itself. These are two of them. The other is of a dance event. The poverty and dilapidation of the city that was
Self-portrait (Me by Me)
This simple self-portrait shows that Robert has been looking at Baroque images, with their moody lighting effects. Most of his face is drawn in shadow, with the hair and clothes left as an unfinished, frame-like outline. Robert has further stylized
North End Shipyard
Robert was living on Veith Street in the North End close to the shipyards when he first moved to Halifax. Thickly painted in black, white and gray, this cityscape dates from Robert’s art school days, at the same time he
Is Painting Obsolete?
In the 1970s and 80s, teachers and students at NSCAD were challenged to examine the nature of the media with which they worked. In this manifesto-like sketchbook entry, Robert asks himself, “Is painting obsolete?” He begins by noting that “Something
Popeye & Criminal Collage
In art school, Robert was introduced to Pop Art by his British-Canadian painting instructor John Clark. Pop Art borrowed imagery from mass produced sources, (comics, ads, movies, as well as sensational tabloid imagery of crime and violence), to portray a society with a short attention span bombarded
Dance Floor and Studio
While studying at art school, Robert rarely photographed people. When he did, the images tended to play down individual identities. These two photos contrast dancers at a party (probably at NSCAD) and dancers rehearsing in a studio. The left hand
High School Dance
This ambitious image, with its multiple overlapping figures, tries to express some of Robert’s ideas of social microcosm and the mythology of pop culture. The dance serves as an initiation rite: graduation from high school and testing relationships. Robert was
Invitation card to Oppositions exhibition
This invitation card announces Robert’s graduation show at NSCAD. “Oppositions” was the perfect theme for Robert, who was particularly gifted at finding and creating visual contrasts. The poster features Robert’s image, Nail Garden, a collage of flowered wallpaper with 2” nails
Mirage (Sand)
This Pop Art mirage offers an ironic escape from an uninviting desert. The sand glued to the canvas is real sand, while the island, palm tree and pond are painted representations, created in such a cartoon style that no one could
|
cc/2020-05/en_middle_0097.json.gz/line1400058
|
__label__cc
| 0.588726
| 0.411274
|
Get the ultimate experience Download our app now
Report: Dani Ceballos tells Real Madrid he wants Arsenal stay
Andrew Smyth October 20, 2019 7:21 pm
Dani Ceballos is reportedly hopeful of making his stay at Arsenal a permanent one ahead of crunch talks with Real Madrid over his future.
With opportunities almost non-existant at Real Madrid, Ceballos swapped the famous white jersey for the red and white one of Arsenal’s in the summer for a season-long loan deal.
The 23-year-old has since made an impressive start to life in the demanding Premier League. He’s already established himself in the Arsenal midfield with five starts in his eight league appearances.
Ceballos’ impressive performances in London, in fact, have won him a spot back in the Spanish national team.
While many pundits and Gunners supporters alike have favourably compared him to old star playmaker Santi Cazorla.
And it turns out that the fans may be for another welcome treat as El Desmarque claim that Ceballos wants out of Real. Apparently, he would rather extend his stay with Arsenal than return to Spain next summer.
As his loan deal is only valid for this season with no buy option, however, Arsenal will need to renegotiate with Los Blancos.
Helping their cause will be Ceballos’ upcoming meeting with Florentino Perez this week. He allegedly plans to confirm to the Real president his plans to seal a long-term stay in the Premier League.
And, with Zinedine Zidane keen on signing the likes of Paul Pogba and Christian Eriksen, Ceballos thinks there is no future for him at the Santiago Bernabeu anymore.
Perez may also be willing to sell the Spaniard to Arsenal for €35m despite preferring around €40m.
Previously, Real signed up him in the summer of 2017 from Real Betis during Zidane’s first spell in charge. However, the €18m recruit struggled to gain favour under the Frenchman before his shock exit in May 2018.
With Zidane out of the way, things did improve for Ceballos before the coach unexpectedly returned in March.
SEVILLE, SPAIN – JANUARY 2019: Dani Ceballos of Real Madrid CF.
Ceballos wants to stay in London: Real Madrid and Arsenal start the negotiations
November 17, 2019 8:30 am November 17, 20198:31 am
Man City will be ‘on fire’ against Real Madrid warns Mendy
Is Perez mocking Pogba or Manchester United?
Ronaldo regrets leaving Real Madrid for Juventus
Top 5: Ronaldo’s greatest games of the decade
Ultimate XI: Europe’s big 5 football leagues this season
Ibrahimovic weighs in on the Messi-Ronaldo debate
Sarri hits out at Ronaldo and his team-mates: “They didn’t respect my strategy!”
|
cc/2020-05/en_middle_0097.json.gz/line1400061
|
__label__wiki
| 0.534377
| 0.534377
|
FDR Hope Memorial Committee Thanks Those Who Made Unveiling of Wheelchair Sculpture a Success - Learn More About FDR Hope and Please Make a Donation
Image of FDR Hope Memorial Model (FDR, Girl, Desk & Benches) with 3 Visitors (not part of Memorial)
Received the following message from FDR Hope Memorial Committee Chairperson/Roosevelt Island Disabled Association President Jim Bates:
THE FDR HOPE MEMORIAL COMMITTE wants to thank all who made our unveiling of its sculpture design a great success
We want to thank Gallery RIVVA and its staff for making available their gallery. We want to thank Nonno's Pizzeria and The Riverwalk Bar and Grill for supplying the Refreshments, and The WIRE and The Roosevelt Islander for its many articles of this event.
We also want to thank all who came to the unveiling and we look forward to the time when Roosevelt Island will have a world class memorial of an enabled FDR seen in a wheelchair
Here's what the FDR Hope Memorial is all about.
More on the FDR Hope Memorial unveiling at the Gallery RIVAA from prior post.
For more information about the FDR Hope Memorial and to make a donation please click here.
Labels: FDR Hope Memorial Committee
Video Presentation On Stanford University's Proposed Roosevelt Island Site - Stanford Selected Roosevelt Island by Process of Elimination and Find the Tram to be Odd
Image of Stanford's Proposed Roosevelt Island Site Plan From Presentation Below
Updating post from earlier today, I just received the video below of the presentation made by Stanford University President John Hennessy and other Stanford officials on the proposed Roosevelt Island site for a Stanford New York City campus.
Stanford's Vice President of Land, Buildings, Real Estate, Robert Reidy, spoke specifically on the advantages for developing a Stanford Campus on Roosevelt Island and the problems associated with the other three sites proposed by NYC at Staten Island, Governor's Island and the Brooklyn Navy Yard. According to Stanford University News, Mr Reidy:
... used charts, photographs and maps to take the audience on a "visual journey" of Stanford's proposal to build a New York campus. One location offered by New York City that Stanford is considering is on 2-mile-long Roosevelt Island, located in the East River between Manhattan and Queens and home to about 12,000 people.
"It is a unique place, mainly used for housing, hospitals and recreation," Reidy said. "It is a special place in that it's oddly apart from the city, but very closely adjacent."
Reidy said some existing buildings would be demolished, creating a 10-acre site for the new campus.
"Think about 10 acres in close proximity to Manhattan," Reidy said. "That's really hard to come by. From that perspective it is a great opportunity. But it does have its challenges."
Reidy said the university's preliminary proposal included residential towers and academic buildings – roughly 200,00 square feet each – centered around an open green space, with cafes, retail shops, an auditorium and gym on the edge of the river....
The comments concerning Roosevelt Island begin at about the 18 minute mark.
You Tube Video of Stanford University's Roosevelt Island Presentation
I particularly liked Mr. Reidy characterization of Roosevelt Island's transportation issues - the subway is good, car and bus are challenged and the Tram is just odd.
By a process of elimination, Stanford University wound up at Roosevelt Island - kind of like many of us already here.
How this turns out is going to be very interesting and exciting!
More information on the proposed Stanford Campus and New York City's plans for an applied research and engineering school at these prior posts.
Update 4/17 - A way to insure that Roosevelt Island residents object to Stanford University or any other institution taking over the Goldwater Hospital site is if done with the mindset of "colonizing" Roosevelt Island as indicated in this blog post by the Stanford Review.
... So how will Stanford graft itself on to New York City? Roosevelt Island, located on the East River sandwiched between Manhattan and Queens, has been tentatively selected for the campus site, and is a clever choice due to its proximity to Manhattan (two minutes by subway) and relative isolation from traditional NYC freneticism. The island is inhabited by about 12,000 people, is about two miles long and has a width of approximately 800 feet. Stanford is looking at a ten acre site on which to build residences, parks, gyms, stores, restaurants, and facilities. In short, we’re colonizing Roosevelt Island. How will the city and more importantly, the residents of the island, feel about this? NYU has faced several protests when renovating historical buildings into dorms, and I imagine that Stanford’s plans to build 20-story residences in the middle of a tiny island will be met with some resistance....
Stanford, New York City or any other institution will be making a big mistake if they plan on, or give the impression of, creating a gated enclave with fences to keep the community separated from a new university campus on Roosevelt Island like that which exists at Rockefeller University on York Avenue
and Columbia University on Broadway/ Amsterdam Avenues in Morningside Heights.
My understanding is that a gated enclave is not what is intended for a Roosevelt Island campus by Stanford but using words like "colony" can create unnecessary anxiety, even if they were not made by a Stanford official.
Labels: COLER GOLDWATER HOSPITAL , proposed engineering school , REAL ESTATE DEVELOPMENT , Stanford University
Update On Stanford University Proposed Plan for Applied Research & Engineering School on Roosevelt Island - Staten Island Remote, Governors Island Bad Infrastructure, B'klyn Navy Yard Industrial, Roosevelt Island Works Well
Image From Stanford University News
Here's an update on Stanford University's proposal to to build a state of the art engineering and applied research school at Roosevelt Island's Goldwater Hospital site.
According to SF Gate:
Graduate students seeking a prestigious business or technology degree from Stanford University may no longer have to come only to Silicon Valley to get it - that is, if New York City officials select Stanford from 27 universities vying for the chance to build a campus there.
University President John Hennessey discussed details on Thursday of his proposal for a New York satellite campus that would offer graduate degrees in engineering, business and computer science....
Below are the prepared remarks of Stanford University President Hennessey regarding the proposed New York City Applied Sciences Research Center Campus on Roosevelt Island. He notes that Stanford is particularly interested in Roosevelt Island as the site for the campus but also says that other sites are being explored. In a panel discussion following President Hennessey's remarks. the Stanford Vice President for land, buildings and real estate Robert Reidy says of Roosevelt Island:
... “It is a special place in that is oddly a place apart to the city but closely adjacent,” Reidy said of the 10-acre Roosevelt Island location.
He added that the University was “quietly trying to pursue a Manhattan location” for an alternative site. The process of “comparing and contrasting opportunities” is important, Reidy said....
Here's an excerpt from President Hennessey's speech.
Expression of Interest: New York City Applied Sciences Research and Educational Campus
... As you have all heard, we are also exploring another opportunity, the possibility of establishing an engineering and technology research and graduate education campus in New York City.
In mid-December, New York City's Economic Development Corporation announced plans to attract an institution to create an applied sciences research and educational campus. New York's goals range from raising the capability of institutions in the city in technology and applied science to creating more talented graduates in these fields in support of a growing high-technology sector, to increasing economic growth and diversification through high-technology innovation and entrepreneurism. Stanford was one among 27 institutions that responded. Our interest has been informed by broad consultation over a series of months with the faculty, university leadership and trustees.
Like many other institutions, we have received many invitations to consider setting up campuses and programs throughout parts of the world, especially in Asia. While we are engaged as consultants and partners with a number of institutions around the world, we have so far chosen not to set up another full-fledged Stanford campus, primarily because we were concerned that we could not establish a permanent presence with a cohort of faculty and students whose quality matched that of our home campus.
New York is different: We can attract great faculty and great students committed to Stanford and a New York campus. Thus, we believe this is a great opportunity for us to team up with a dynamic partner, New York City, to create a high-quality institution, which could become the nucleus for a major center of innovation, just as has happened in the Bay Area. New York has its own culture and strengths, which are quite different from those of our present location, and fusing that culture with the technical capabilities and entrepreneurial culture of Stanford could produce a remarkable new center for research, education and innovation. Such a campus is also an opportunity to increase our visibility on the East Coast, and perhaps connect with new sources of philanthropic support.
A New York presence also provides us the opportunity to master multi-site operations – something I believe is essential for the 21st-century university. We already have a strong foundation in distance education, and this would enable us to further refine and expand that foundation. It offers a supportive setting for creating a world-class model for the multi-campus university: Setting up operations in the same country just three time zones away, where there are no issues about academic freedom, is much more manageable than establishing a campus in a different country six or eight time zones away.
Our plan is to create a strong research program, a vibrant graduate education program with both master's and PhD students that provides both technical education as well as education in entrepreneurial and innovation skills. Our engineering school is among the best in the country, and we are a leader in applied sciences. We have an incredible entrepreneurial culture, and we understand how to partner with industry and successfully transfer research advances to the marketplace. Stanford researchers and alumni have established thriving companies that employ thousands of people – companies such as Google, Yahoo!, Hewlett-Packard, Cisco, Sun Microsystems, Netflix, eBay and many others.
Our plan would be to develop a New York program that is integrated with the programs on the main campus, distributing people and talent and sharing courses and research activities, rather than replicating existing activities at a smaller scale. Rather than have two computer science departments, for example, we envision one department with perhaps 25 percent of its faculty at the New York campus. The School of Engineering, the Graduate School of Business, the Hasso Plattner Institute of Design and the Stanford Technology Ventures Program would all play key roles from the beginning, with other activities added over time.
Of course, the site of the campus will be a critical component as well, and that has not yet been decided. In its Request for Expression of Interest, New York City suggested four potential sites. Of the four sites, we looked at Roosevelt Island in particular and considered how it might be developed, and Bob Reidy will talk about this in a few minutes. At the same time, we are exploring other sites as this process unfolds.
If we pursue this opportunity, it would develop in several phases. In Phase 1, the first five years of the project, we envision about 25 faculty, including visiting faculty from the Palo Alto campus; 150 doctoral students; and 300 master's students. The focus of the first phase would be on information technology – EE and CS – with special attention given to entrepreneurship education and research. Executive education both in technical fields and in management would also be featured. As we plan the first phase and contemplate a formal proposal, I have asked Dean Plummer [of the School of Engineering] and Dean Saloner [of the Graduate School of Business] to appoint a faculty advisory committee to provide guidance and counsel.
Succeeding phases would expand to include approximately 100 faculty and 2,000 students. There would also be opportunities to take advantage of all that New York City offers, especially in new media and cultural opportunities, and I can see broadening the base of subjects offered to include green technology, biomedical engineering, new media, financial mathematics and urban studies, just to name a few. There would also be opportunities to host other visiting undergraduate and graduate programs: perhaps an academic quarter in New York, similar to our Stanford in Washington program, as well as opportunities to host students in the business school or other disciplines. The succeeding phases would develop over as long as 20 years, allowing for extensive exploration of opportunities as we gain capability in making a distributed program work.
We are at the beginning of a very long process, and we are not alone in recognizing the opportunities in New York. Eighteen proposals were submitted by 27 schools and include responses by Cornell University, Columbia University, New York University, Carnegie Mellon and several international institutions. Final proposals will be due in the summer, with selection by the end of the year....
The full text of Stanford President Hennessy's address to the Academic Council is here.
The Stanford Daily reported on President Hennessey's speech and the panel discussion afterward:
... Hennessy’s address was followed by a panel featuring School of Engineering Dean Jim Plummer, Computer Science Chair Jennifer Widom and Robert Reidy, vice president for land, buildings and real estate.
According to Plummer, there are three questions to address at present: whether a 21st century university can have multiple locations, whether telepresence systems work well enough and whether Stanford’ entrepreneurial spirit can be replicated elsewhere.
There is one challenge, however, that seems to take precedence.
“The biggest part will be making the New York campus look, feel and be part of us,” Plummer said.
Widom noted that it would take her department “a while to ramp up” for the transition to NYC, especially with respect to hiring additional faculty members. She said the computer science department “will not lower its threshold to hire faculty” for the Big Apple center and that many CS professors have expressed interest in teaching there.
Reidy took the Academic Council on a “visual journey” of the potential Roosevelt Island site for the NYC campus. The other sites offered by the city of New York were located in Staten Island, Governors Island and the Brooklyn Naval Yard.
“It is a special place in that is oddly a place apart to the city but closely adjacent,” Reidy said of the 10-acre Roosevelt Island location.
He added that the University was “quietly trying to pursue a Manhattan location” for an alternative site. The process of “comparing and contrasting opportunities” is important, Reidy said.
According to Hennessy, the opportunity to try to recreate Silicon Valley in New York is one that cannot be passed up.
“New York is the cultural capital of the United States,” he said. But there’s more to the city, too.
“As a native New Yorker, I’m looking forward to the pizza,” Hennessy added.
The Stanford Review Blog adds:
... Vice President for Land, Buildings, Real Estate Robert Reidy offered a more detailed view of how a campus in New York might actually look. First, he briefly outlined why Stanford preferred a Roosevelt Island out of four possible sites: Staten Island, Governors Island, Brooklyn Naval Yard, and Roosevelt Island. Staten Island was remote, Governors Island has bad infrastructure, and the Brooklyn site was industrial zoned, but the Roosevelt site worked well, since it was close to both Manhattan (center of NYC) and Queens (place for cheap expansion and start-ups).
Roosevelt Island would have a 10 acre site in close proximity to Manhattan, with the Queensboro Bridge going over it. It has good subway connection and an interesting tram system, but poor car access.
What would the actual island look like? Ultimately, there would be two 20-story housing facilities, one at either end of the campus, as well as academic buildings surrounding a green. The academic facilities might reach eight or so stories in order to capitalize on the space.
When faced with a question about whether this was the best use of Stanford’s resources, President Hennessy stated that the city has indicated it would make a commitment, so we could mobilize extra resources. However, this project cannot not be achieved without significant new fund-raising. If Stanford can’t attract new philanthropic support (such as from New Yorkers and New York-based donors), this expansion cannot occur.
Why New York? New York is the cultural/media capital of the US. We can fuse NY’s “new style” ideas with our strength in new technology....
... Ellie Titus ’11, former Stanford Daily editor-in-chief asked about what other, non-financial challenges Stanford might face in setting up this campus, especially political. The direct response was that Stanford needs vested rights before Mayor Bloomberg leaves office in 2013 or else the deal will likely fall through. Stanford has at least received assurances that this will be a merit-based process, not a political boondoggle, so that is why Stanford remains involved.
Perhaps Stanford would consider the proposed Trilogy skyscraper project, lovingly referred to as the Roosevelt Island Tower of Death by our friends at Curbed, that was developed by some Italian students as part of it's campus on Roosevelt Island. Though only an academic study, the Trilogy skyscraper included a pedestrian bridge from Southpoint Park over the East River to Manhattan. Watch the video and see for yourself. Pretty Cool!
You Tube video of Trilogy
Or maybe this pedestrian bridge from Roosevelt Island to Manhattan that was proposed by Hunter College Students (Page 63 of Roosevelt Island Accessibility Study) could be considered by Stanford?
Just kidding, but ....
The Roosevelt Island community is obviously very excited over the possibility of being the site of a world class engineering and applied science center such as the one proposed by Stanford and desires to be part of the process in bringing the project to fruition. The Roosevelt Island Operating Corp (RIOC) sent the following letter to NYC Economic Development Corporation (NYEDC) expressing that view
Rioc Letter to Nycedc
and the Roosevelt Island Residents Association (RIRA) sent a similar letter to those interested academic institutions and the NYEDC.
Goldwater Site Development RIRA Letter
I am advised by RIRA representative Denise Shull that:
I received reply emails from Stanford, and NYEDC saying they were very glad to receive the letter and basically feel free to comment, question etc over the process.
Here's what the pathway in front of the Goldwater Hospital Campus
and possible future home to Stanford University
looked like yesterday
with the beautiful Roosevelt Island Cherry Trees blossoms.
UPDATE 6:25 PM - Video of Stanford's presentation on proposed Roosevelt Island campus is now available here.
Decrepit and Broken State of Roosevelt Island's Meditation Steps - Will RIOC Repair Before Nice Weather Returns? Before the End of Summer, Before the Next Snowstorm?
Roosevelt Island's Meditation Steps Image From Roosevelt Island 10044
Roosevelt Island's Meditation Steps is a great place to sit by the East River and watch the boats go by, have a bite to eat, get some sun, think, read a book or just relax.
Except when it looks like this,
with holes where wooden boards should be.
Spring is here and Summer rapidly approaching. I hope the Roosevelt Island Operating Corp (RIOC) starts work on repairing the broken and decrepit state of the Meditation Steps soon so they can be enjoyed by Roosevelt Island residents and visitors as soon as the warm weather arrives.
Labels: meditation steps
View From Roosevelt Island Tram if Patrolled By Miami Vice's Crockett & Tubbs - Questions on Tram Safety Strap, Tower Bump & Recent Outages Answered
Here's the view from the Roosevelt Island Tram if it was patrolled by Sonny Crocket and Ricardo Tubbs from Miami Vice.
The Tram would go much faster if Crockett and Tubbs were patrolling it.
Some tram riders, though they appreciate the great views of NYC waterfront and skyline, just want to be able to hold on and not fall down during the ride.
Image of Some Tram Riders Stretching to Hold on to Bar
Received this message from a reader explaining:
there really does need to be straps, metal or leather...if the red bus can have straps, the Tram can for sure...hope they get on that soon, it is like the Tram cars are not finished or they just forgot to make sure 100 people had somewhere to hold onto while in the air?
Roosevelt Island Operating Corp (RIOC) Board Director Jonathan Kalkin has some answers on safety straps, the tram bump near the towers and recent outages:
The other day I had the opportunity to be on the Tram with our VP of Operations Fernando Martinez and RIOC President Leslie Torres. I had mentioned during previous meetings that I had gotten several emails or comments that there were not enough places to hold onto currently. I'm 6 feet tall and the rack on the top was still high over my head. I told Fernando that we should either lower the current poles on the top, add some kind of retractable strap to hold onto that doesn't hit people in the face, add extra vertical poles, or some combination of the three. There may be alternative solutions so I asked that we have an expert look at it again to figure out a fix.
I also have seen, read or experienced myself movement on the Tram while it approaches the towers. The Tram is different from the old Tram in that it uses a fixed cable system and therefore can be used in higher winds because the cables are fixed and don't move. Therefore the Tram cable can't swing on the trip in high winds. It remains fixed. However, when approaching the towers the Tram will center itself which is why you feel that nudge. This is very similar to a speed bump. If the operator moves quickly through it, it is more severe and during high winds, the correction is bigger. I have asked during several operations meetings that we develop a procedure for this during regular operations and high wind situations. If we have to go slower when approaching the tower in order to give a more comfortable ride, I think we should. It just makes sense.
Finally, there has been a lot of confusion during Tram outages. We haven't had many, but they have been mostly due to the fact that our Tram has so many sophisticated sensors that detect the smallest issue. This is a good thing. We don't have to rely only on inspections or deal with failures once they happen. We can get that data immediately years before they even start to be an issue. One of the reasons I held back the vote for the Tram when I first got on the Board was I wanted to examine every case where a Tram had failed. I wanted to know why because safety is always the number one concern when dealing with transportation. Since most Trams are built outside this country, I had the court documents translated into english so the RIOC staff, Board and I could review them. We found two major factors to be the issue: improper maintenance and old safety mechanisms. In almost all cases it was a combination of both. Our previous Tram had 1970's technology and the same safety equipment and standards of that decade with some modifications. Our new Tram has redundant safety systems and computer safety sensors in place that simply didn't exist during that period. This is good. I have asked that if we know specifically if there is an issue, that we get the message out, but we make sure it is the right information. So we can better address these issues and questions during our next Operations Meetings, I placed a question on Quora. I look forward to hearing your responses.
Labels: kalkin , ROOSEVELT ISLAND TRAM , safety strap , Temporary Tram Outagae , tower bump
We Are New York English as a Second Language Program Being Offered Again By Roosevelt Island Youth Program - Tell a Friend, Neighbor or Relative Who May Be Helped By ESL Classes
Image From Roosevelt Island Youth Program Inc. and We Are New York
Here's the latest update on the English as a Second Language (ESL) Program being offered by the Roosevelt Island Youth Program (RIYP) and New York City's We Are New York. From RIYP:
The Roosevelt Island Youth Program ESL Classes continues with a second semester which started earlier this week.
The Roosevelt Island Youth Program ESL class in conjunction with the Mayor’s Office of Adult Education has begun its second semester on Tuesday April 12th at the Youth Center at 506 Main Street.
The first session was a major success with over a dozen students speaking over 10 different languages.
This semester we have over 30 members speaking at least 17 different languages ranging in ages from 25 to 80. The program is still open for anyone interested in participating, please call 212-935-3645 for additional information.
All Images From Roosevelt Island Youth Program Inc.
So, if you know a friend, neighbor or family member who could benefit from an English as a Second Language class, please let them know of this RIYP and We are New York program.
More information is available from these previous posts.
Labels: english as second language , Roosevelt Island Youth Program
Thursday Night Free Classical Music on Roosevelt Island - J.S. Bach: The Goldberg Variations Presented by the Rosemarie & Robin Russell Family Concert Series
Later tonight, Roosevelt Island's own local Rosemarie & Robin Russell Family Concert Series (R&R Concerts) will be presenting a free evening of classical music with J.S. Bach: The Goldberg Variations at the Good Shepherd Community Center (543 Main Street) starting at 7:30 PM. Performing will be Salley Koo and Ralph Allen on violin together with Iris Jortner on Cello.
A small taste of J.S. Bach's Goldberg Variations with Julian Rachlin & Friends courtesy of You Tube.
More information on the R&R concert series from previous posts. All reports from previous concerts are that if you go, you will have a great time.
R&R Concerts were awarded a Roosevelt Island Public Purpose Fund grant from RIOC this year. Enjoy the music and come see why?
Labels: Concert , Rosemarie and Robin Russell
President Barack Obama's Speech on Budget Reduction and Spending Priorities - Rebuilding, Refurbishing and Restoring America
In case you did not see President Barack Obama's speech today on federal budget reduction and spending priorities, here it is.
You Tube Video Of President Obama's April 13 Speech on Spending and Deficit Reduction
Some excerpts from President Obama's speech:
... From our first days as a nation, we have put our faith in free markets and free enterprise as the engine of America’s wealth and prosperity. More than citizens of any other country, we are rugged individualists, a self-reliant people with a healthy skepticism of too much government.
But there’s always been another thread running through our history -– a belief that we’re all connected, and that there are some things we can only do together, as a nation. We believe, in the words of our first Republican President, Abraham Lincoln, that through government, we should do together what we cannot do as well for ourselves.
And so we’ve built a strong military to keep us secure, and public schools and universities to educate our citizens. We’ve laid down railroads and highways to facilitate travel and commerce. We’ve supported the work of scientists and researchers whose discoveries have saved lives, unleashed repeated technological revolutions, and led to countless new jobs and entire new industries. Each of us has benefitted from these investments, and we’re a more prosperous country as a result.
Part of this American belief that we’re all connected also expresses itself in a conviction that each one of us deserves some basic measure of security and dignity. We recognize that no matter how responsibly we live our lives, hard times or bad luck, a crippling illness or a layoff may strike any one of us. “There but for the grace of God go I,” we say to ourselves. And so we contribute to programs like Medicare and Social Security, which guarantee us health care and a measure of basic income after a lifetime of hard work; unemployment insurance, which protects us against unexpected job loss; and Medicaid, which provides care for millions of seniors in nursing homes, poor children, those with disabilities. We’re a better country because of these commitments. I’ll go further. We would not be a great country without those commitments.
Now, for much of the last century, our nation found a way to afford these investments and priorities with the taxes paid by its citizens. As a country that values fairness, wealthier individuals have traditionally borne a greater share of this burden than the middle class or those less fortunate. Everybody pays, but the wealthier have borne a little more. This is not because we begrudge those who’ve done well -– we rightly celebrate their success. Instead, it’s a basic reflection of our belief that those who’ve benefited most from our way of life can afford to give back a little bit more. Moreover, this belief hasn’t hindered the success of those at the top of the income scale. They continue to do better and better with each passing year....
... But that starts by being honest about what’s causing our deficit. You see, most Americans tend to dislike government spending in the abstract, but like the stuff that it buys. Most of us, regardless of party affiliation, believe that we should have a strong military and a strong defense. Most Americans believe we should invest in education and medical research. Most Americans think we should protect commitments like Social Security and Medicare. And without even looking at a poll, my finely honed political instincts tell me that almost nobody believes they should be paying higher taxes. (Laughter.)
So because all this spending is popular with both Republicans and Democrats alike, and because nobody wants to pay higher taxes, politicians are often eager to feed the impression that solving the problem is just a matter of eliminating waste and abuse. You’ll hear that phrase a lot. “We just need to eliminate waste and abuse.” The implication is that tackling the deficit issue won’t require tough choices. Or politicians suggest that we can somehow close our entire deficit by eliminating things like foreign aid, even though foreign aid makes up about 1 percent of our entire federal budget.
So here’s the truth. Around two-thirds of our budget -- two-thirds -- is spent on Medicare, Medicaid, Social Security, and national security. Two-thirds. Programs like unemployment insurance, student loans, veterans’ benefits, and tax credits for working families take up another 20 percent. What’s left, after interest on the debt, is just 12 percent for everything else. That’s 12 percent for all of our national priorities -- education, clean energy, medical research, transportation, our national parks, food safety, keeping our air and water clean -- you name it -- all of that accounts for 12 percent of our budget.
Now, up till now, the debate here in Washington, the cuts proposed by a lot of folks in Washington, have focused exclusively on that 12 percent. But cuts to that 12 percent alone won’t solve the problem. So any serious plan to tackle our deficit will require us to put everything on the table, and take on excess spending wherever it exists in the budget.
A serious plan doesn’t require us to balance our budget overnight –- in fact, economists think that with the economy just starting to grow again, we need a phased-in approach –- but it does require tough decisions and support from our leaders in both parties now. Above all, it will require us to choose a vision of the America we want to see five years, 10 years, 20 years down the road....
The closing remarks of President Obama's speech:
... This larger debate that we’re having -- this larger debate about the size and the role of government -- it has been with us since our founding days. And during moments of great challenge and change, like the one that we’re living through now, the debate gets sharper and it gets more vigorous. That’s not a bad thing. In fact, it’s a good thing. As a country that prizes both our individual freedom and our obligations to one another, this is one of the most important debates that we can have.
But no matter what we argue, no matter where we stand, we’ve always held certain beliefs as Americans. We believe that in order to preserve our own freedoms and pursue our own happiness, we can’t just think about ourselves. We have to think about the country that made these liberties possible. We have to think about our fellow citizens with whom we share a community. And we have to think about what’s required to preserve the American Dream for future generations.
This sense of responsibility -- to each other and to our country -- this isn’t a partisan feeling. It isn’t a Democratic or a Republican idea. It’s patriotism.
The other day I received a letter from a man in Florida. He started off by telling me he didn’t vote for me and he hasn’t always agreed with me. But even though he’s worried about our economy and the state of our politics -- here’s what he said -- he said, “I still believe. I believe in that great country that my grandfather told me about. I believe that somewhere lost in this quagmire of petty bickering on every news station, the ‘American Dream’ is still alive…We need to use our dollars here rebuilding, refurbishing and restoring all that our ancestors struggled to create and maintain… We as a people must do this together, no matter the color of the state one comes from or the side of the aisle one might sit on.”
“I still believe.” I still believe as well. And I know that if we can come together and uphold our responsibilities to one another and to this larger enterprise that is America, we will keep the dream of our founding alive -- in our time; and we will pass it on to our children. We will pass on to our children a country that we believe in.
Thank you. God bless you, and may God bless the United States of America.
The full text of President Obama's speech and fact sheet.
Republican Congressman Paul Ryan, Chairman of the House Budget Committee responds to President Obama's speech.
Commentary on the speech from Andrew Sullivan's Daily Dish
Roosevelt Island Underground Nuclear Reactor Was Proposed By Con Ed - In Late 1960's
This earlier post described a:
... proposed Con Ed Nuclear Power plant in Long Island City across the East River from Roosevelt Island...
Well, it gets worse. The NY Times City Room Blog reports today:
... Con Ed was not done trying to build a nuclear plant in the city, though. In 1968, it floated a plan to build an underground reactor — “because it would provide the nth degree of safety” — beneath an abandoned hospital site at the south end of Welfare Island, now Roosevelt Island, a few hundred feet from the Ravenswood plants and that much closer to the East Side of Manhattan. It went nowhere....
Sounds like a crazy idea, doesn't it. Well, the idea is coming back, but not thankfully for Roosevelt Island. According to New Scientist:
... Nuclear power is going to be a tough sell going forward given the ongoing radiation leaking from Japan's Fukushima Daiichi power plant, but what if future reactors were buried underground?
It may sound like a crazy idea, but Singapore, a tiny island country whose population would have no place to go in the event of a wide-scale evacuation, is giving buried nukes a closer look.
The thinking is that you could bury a small reactor in a shallow layer of bedrock, perhaps 30-50 meters underground. Then, if things at the plant go south for any reason, the granite will provide natural containment; simply cement in any access tunnels going down to the facility and walk away....
Image of underground mini nuclear reactor from New Scientist
Labels: Con Ed , History , Underground Nuclear Reactor
Free Mammogram Breast Cancer Screening Available Tomorrow From Project Renewal But Make an Appointment ASAP Says Roosevelt Island Assembly Member Micah Kellner
Image of Project Renewal Scan Van Mammogram Room
Received the following message from Assembly Member Micah Kellner:
Last Chance to Schedule Your Free Mammogram Screening
This year my office, in partnership with Project Renewal, is coordinating a free mammography screening program this Thursday, April 14, 2011, from 9:30 a.m. to 3 p.m. in front of Lenox Hill Neighborhood House, at 331 East 70th Street between First and Second Avenues.
Aside from non-melanoma skin cancer, breast cancer is the most common cancer affecting women in the United States. While there are treatments, early detection is the best way to prevent the worst consequences. By providing this service, women who were unable to get a mammogram in the past can now obtain breast screening services.
This service is available for any woman over 40 years of age who has not had a mammogram in the past 12 months, regardless of whether or not she has health insurance. Space is limited to a first- come, first-serve basis and appointments are necessary, so women who would like to take advantage of this opportunity should schedule their appointments as soon as possible by calling 1-800-564-6868. If you have any difficulty or require assistance with scheduling an appointment, please call my office at (212) 860-4906.
It is recommended that women who make appointments wear a two-piece outfit, and refrain from using any oil, powder, deodorant, or perfume. If you have Medicare, Medicaid or other health insurance, you must bring your card with you, although you will not be charged any co-payment fees. If you do not have health insurance, the mammogram will be paid for by the Columbia University Cancer Services Partnership.
Image of Project Renewal's Mammogram Scan Van
More on Project Renewal is available at their web site:
The Women’s Outreach Network Mobile Mammography Program is now operating as Project Renewal Scan Van Program. The program provides mammography and clinical breast exams to women on board the Scan Van, a mobile mammography office. Uninsured women are provided with free exams due to the generosity of contributors; Colgate Palmolive, Avon Foundation, Komen Greater New York, Judges and Lawyers Against Breast Cancer, Henry Schein Corporation, Cummings Foundation, Richmond County Savings Foundation, and others.
Women that are 40 and older should have an annual clinical breast exam and mammogram. If you have not had a mammogram in the past year, you are welcome to contact us for an appointment or for information.
Women with a strong family history of breast cancer should consult with their doctor regarding at what age it would be appropriate to begin screening mammography...
In the past there has been free Mammogram testing during Roosevelt Island Health & Fitness Day usually held in May. No word yet whether free Mammogram screening will be available again at this year's Roosevelt Island Health & Fitness Day.
Labels: Kellner , Mammograms
Difficulties With Roosevelt Island Tram North Cabin Appears Fixed This Evening - On a Cold Rainy Night Tram Station Heat Lamps Were Off But Then Turned On
How was your commute home tonight? Roosevelt Island 360 reports on his:
Despite the reflection of light in the attached picture the heat lamp lights on the Manhattan platform were off this cold damp evening on a night where the even neglible warmth they provide would be a blessing. Why ?
A few minutes later:
For some reason they just came on.... Assuming the temp hit the required degree for them to come on... Was cold and wet w-thout them.
No screams but south cabin is swinging tonight due to winds.
Whatever difficulties the Tram's North Cabin was experiencing last night and earlier today seem to have been fixed. No word yet on what the problem was.
UPDATE 4/13, 12:40 PM- Received this advisory from RIOC at 12:35 AM:
Per Tram Supervisor Bob Kelly, due to severe weather and lightening, tram service will be temporarily interrupted until further notice.
According to this tweet, Markie had a scary Tram ride.
Labels: ROOSEVELT ISLAND TRAM
Island House Privatization/Affordability Plan and Ground Lease Extension To Be Reviewed by Roosevelt Island Operating Corp Real Estate Committee Later Today - In Closed Executive Session
According to the Roosevelt Island Operating Corp:
PLEASE TAKE NOTICE that a meeting of the Real Estate Development Advisory Committee of the RIOC Board of Directors will be held on Tuesday, April 12, 2011 at 5:30 p.m. at the RIOC administrative office, 591 Main Street, Roosevelt Island, New York. AGENDA
1. Chair's Motion for Executive Session to Review the Proposed Privatization/Affordability Plan and Ground Extension for Island House
The Public is not permitted to attend an Executive Session.
Additional information, though limited, is available on Island House privatization at this earlier post on previous RIOC Real Estate Committee executive session on Island House.
Following the April 6 RIOC Board meeting, Island House owner David Hirschorn (in blazer and white pants) spoke with RIOC Directors, Staff and Island House representatives. I asked but was not permitted to join the conversation.
What are the circumstances under which RIOC is permitted to hold an executive session closed to the public? According to the NY State Department of State Committee on Open Government:
... The law provides for closed or "executive" sessions under circumstances prescribed in the law. It is important to emphasize that an executive session is not separate from an open meeting, but rather is defined as a portion of an open meeting during which the public may be excluded.
To close a meeting for executive session, the law requires that a public body take several procedural steps. First, a motion must be made during an open meeting to enter into executive session; second, the motion must identify "the general area or areas of the subject or subjects to be considered;" and third, the motion must be carried by a majority vote of the total membership of a public body.
Further, a public body cannot close its doors to the public to discuss the subject of its choice, for the law specifies and limits the subject matter that may appropriately be discussed in executive session. The eight subjects that may be discussed behind closed doors include:
... (h) the proposed acquisition, sale or lease of real property or the proposed acquisition of securities, or sale or exchange of securities held by such public body, but only when publicity would substantially affect the value thereof.
These are the only subjects that may be discussed behind closed doors; all other deliberations must be conducted during open meetings.
It is important to point out that a public body can never vote to appropriate public monies during a closed session. Therefore, although most public bodies may vote during a properly convened executive session, any vote to appropriate public monies must be taken in public.
The law also states that an executive session can be attended by members of the public body and any other persons authorized by the public body....
Will provide an update if information on the Island House privatization discussions becomes available.
Labels: Affordable housing , executive session , Island House , Island House Privatization , Mitchell Lama , privatization , RIOC Real Estate Committee
Community Planning Board 8 Meeting on Roosevelt Island Wednesday April 13
Image of New York City Community Planning Board 8 Logo
Roosevelt Island is represented by Community Planning Board 8 (CPB 8). A Full CPB 8 Board Meeting will be held on Roosevelt Island this Wednesday, April 13. Below is the Agenda.
Land Use-Full Board Meeting
Chapel of the Good Shepherd, Roosevelt Island
1. Public Session – Those who wish to speak during the Public Session must register to do so by 6:45 pm
• Public Hearing: BSA Calendar No. 307-81-BZ; 50 East 69th Street –An application has been filed with the Board of Standards and Appeals for an Extension of the term of a previously approved and extended variance, pursuant to Section 72-21 of the Zoning Resolution, which permitted, in an R8B district, in a five story and penthouse building, medical office use on all floors except the owner’s residential penthouse. The building has been continuously occupied since 1981 by the Center for Specialty Care which has its plastic surgery practice in the building.
2. Adoption of the Agenda
3. Adoption of the February Land Use-Full Board Minutes
4. Manhattan Borough President’s Report
5. Elected Official’s Reports
6. Chair’s Report – Jackie Ludorf
7. Committee Reports and Action Items:
• Rules and Bylaws Committee-Helene Simon and Hedi White, Co-Chairs
• Street Life Committee-Cos Spagnoletti and Nick Viest, Co-Chairs
• Transportation Committee-Jonathan Horn and Charles Warren, Co-Chairs
• Parks Committee-Margaret Price and Barbara Rudder, Co-Chairs
• Landmarks Committee-David Liston and Jane Parshall, Co-Chairs
• Youth and Education Committee-Jim Clynes and Judith Schneider, Co-Chairs
• Budget Committee-Roy Carlin and Barbara Chocky, Co-Chairs
8. Old Business
More on Community Planning Board 8 from earlier posts.
There is also a Roosevelt Island committee of CPB 8.
Labels: Community Board 8
Difficulties With Roosevelt Island Tram North Cabin During Rush Hour Today - Limited Number of Riders Permitted to Board
Just received this advisory from the Roosevelt Island Operating Corp (RIOC):
Due to the North Cabin having difficulties the rush hour tam schedule will be effected, a limited amount of passenger will permitted per trip until further notice.
and this one just came in as I was about to post:
Due to the North Tram cabin having technical difficulties, the rush hour schedule will be affected. Only a limited amount of passengers will be permitted to board per trip until further notice.
Will provide updates as they become available.
UPDATE 4/12, 7:50 AM- Received this update from RIOC at 7:34 AM:
The Tram is in service but with some minor delays on the north cabin.
Still no word on the cause of the difficulties.
UPDATE 6:20 PM - At 6:06 received this advisory update from RIOC:
The tram is running normally on rush hour schedule
Labels: ROOSEVELT ISLAND TRAM , Roosevelt Island Tram Advisory
No Late Night Queens Bound F Train Service From Manhattan to Roosevelt Island Monday Thru Friday from 11 PM - 5 AM - Will Tram Be Running During Late Night Subway Disruption? Update, Answer is Yes
Image of Blurred, Moving F Train From Venus in Furs
More late weeknight's without F train service to Roosevelt Island from Manhattan starting later today. The MTA is reporting that there will be no Queens bound F trains from Manhattan to Roosevelt Island starting at 11:00 PM - 5 AM beginning Monday April 11 through Friday, April 15 From the MTA:
F Jamaica-bound trains are rerouted via the M from 47-50 Sts to Queens Plaza
Nights, 11 PM to 5 AM, Mon to Fri, April - Apr 15
... For service to Roosevelt Island and 21 St-Queensbridge, take the F to Roosevelt Av
and transfer to a Coney-Island bound F.
For service from 57 St, Lexington Av-63 St, Roosevelt Island and 21 St-Queensbridge,
take a Coney Island-bound F to 47-50 Sts and transfer to a Jamaica-bound F .
Last time this happened at the end of March, a reader asked:
... My SO works nights and this disruption badly affects his commute home as he can’t get the Tram which stops working at 2 am, so he has to take F train to Queens and then to Roosevelt Island which adds additional 30-60 minutes to the commute because F trains run very infrequently at night. He inquired whether RIOC plans to operate the Tram at night this week and was said, NO.
But a train operator said that last week RIOC did operate the Tram the WHOLE NIGHT on days there was no F train service from Roosevelt Island.
So why does RIOC run the Tram all night if there is no Manhattan-bound F train at nights, but not at nights when there is no Queens-bound F train???
This is very unfair for RI residents returning home at night.
No official word yet from the Roosevelt Island Operating Corp (RIOC) if the Tram will be operating during the hours when there is no late night F Train Service to Roosevelt Island. This past weekend when there was no F train service from Manhattan to Roosevelt Island, the Tram did operate on a 24 hour basis.
UPDATE 3:30 PM - Just received this announcement from RIOC:
During the week of April 11, Tram and Red Bus service will be extended until 5 AM
Labels: F Train , MTA , Subway , Subway service disruption , tram schedule
NY Post Reports On Reassignment Of Roosevelt Island's Only NYPD Officer - No Sherrif In Town Says the Post
Image From NY Post
The New York Post reported today on the reassignment of Roosevelt Island's only NYPD officer. The Post's story headline was:
No Sheriff in town
Roosevelt I.'s only cop transfers amid complaints
According to the article the officer:
... worked the [night] shift that's the heaviest hours for criminal mayhem: muggers, robbers and just kids who shouldn't be on the street," said Joyce Mincheff, a council member on Roosevelt Island Residents Association
"His presence of patrolling here, based on the statistics showing lack of crime, would be an indicator that he did a great job," she said...
... But Erin Feely-Nahem, chairwoman of the residents association, said some residents complained that "he tended to be overzealous, that he targeted black youth. Some people felt that he stopped-and-frisked unnecessarily."...
... NYPD spokesman Paul Brown added: "Officer Fernandez's transfer has nothing whatsoever to do with the unfounded complaints you cited. To the contrary, he is a highly regarded officer, and he would not have been considered for transfer to a special unit if he wasn't so good."
Here's how the issue was discussed during portions of the April Roosevelt Island Residents Association (RIRA) meeting.
You Tube Video of April RIRA Meeting on NYPD Officer's Reassignment
More on the April RIRA meeting here.
Labels: Crime , nypd , NYPD Officer Reassigned , Public Safety
No Roosevelt Island Easter Egg Hunt or Bunny This Year
Image From 2010 Roosevelt Island Easter Egg Hunt
A reader asked if the Roosevelt Island Easter Egg Hunt was going to take place this year. I asked Roosevelt Island Operating Corp (RIOC) Vice President of Operations Fernando Martinez who advised that there will not be a Roosevelt Island Easter Egg Hunt this year. Lack of resources was cited as the reason the Easter Bunny will not be making a Roosevelt Island appearance this year.
Image of 2010 Roosevelt Island Easter Bunny
More scenes from last year's Roosevelt Island Easter Egg Hunt from previous post and from RIOC.
Mommy Poppins has a list of Easter Egg Hunts in New York City.
Labels: easter egg hunt
FDR Hope Memorial Sculpture Design Concept Depicting President Franklin D Roosevelt as a Disabled Person Unveiled Last Night at Roosevelt Island's Gallery RIVAA
The FDR Hope Memorial initial design concept was presented for the first time to the public last night at Roosevelt Island's Gallery RIVAA. The design depicts President Franklin D. Roosevelt seated in his wheelchair at his desk greeting a young disabled girl wearing braces on her leg and is
based to an extent upon this photograph.
Image From The Roosevelt Doctor (more info on photo here)
The FDR Hope Memorial will be located in Roosevelt Island's Southpoint Park just north of the Renwick Ruins up a small hill on the West (Manhattan) side
Image of Wild Gardens/Green Rooms Rendering From RIOC Record (Page 12)
in this spot.
Image of Future Home of FDR Hope Memorial From Meredeth Bergmann
Below is a press release from the FDR Hope Memorial Committee:
FDR HOPE MEMORIAL TO EXHIBIT ROOSEVELT’S INSPIRATIONAL SUCCESS
IN OVERCOMING DISABILITY
Artist Meredith Bergmann Selected as Sculptor and Site Artist;
Initial design to be unveiled April 9
A sculpture of President Franklin D. Roosevelt seated in a wheelchair, interacting with a disabled child, is planned for Roosevelt Island in New York City. The FDR Hope Memorial will be located at Southpoint Park, just south of the hospital where survivors of polio, the disease that disabled Roosevelt, benefited from the pioneering use of ventilators that freed them from the constraints of “iron lungs.”
The goal of the FDR Hope Memorial Committee (FDRHM), a sub-committee of the Roosevelt Island Disabled Association, is to celebrate President Franklin D. Roosevelt as the inspiration for all who strive to overcome challenges. According to the memorial’s mission statement, “Roosevelt Island was so named to reflect a commitment to an integrated community where the disabled move freely, live independently and develop to their fullest potential. The FDR Hope Memorial will educate future generations about FDR and about Roosevelt Island, a vital community of ‘enabled’ residents.”
Jim Bates, President of the Roosevelt Island Disabled Association, said the memorial will be “a place of comfort, hope, understanding and inspiration.”
Dr. Jack Resnick, internist on Roosevelt Island, notes that “Roosevelt spent much of his adult life in a wheelchair. The polio virus, which infected him in 1921 at the age of 39, left him with almost no use of his legs. Twelve years later, following a term as Governor of New York, he became President of the United States and went on to save the country from economic calamity, and the world from Hitler.”
Following a search, New York–based artist Meredith Bergmann was selected to design the FDR Hope Memorial. Bergmann’s public works, such as Marian Anderson and the Boston Women's Memorial, address challenging topics with social concerns. The committee believes her public art experience, her substantial research and thoughtful approach, and her potential to develop and communicate the mission of the FDR Hope Memorial will help to bring about a work of art that will inspire generations.
Bergmann notes that the nearby Franklin D. Roosevelt Four Freedoms Park, designed in 1974 by architect Louis Kahn, and now under construction just to the south of the memorial’s future site, will include a portrait head of FDR. “Four Freedoms Park will be both beautiful and contemplative, but because of its idiom and the era of its design it will not depict the human body, and the human body is an important part of our subject. Until the 20th century, sculptors routinely turned to the human body when they wanted to evoke inspiration. Here in the Hope Memorial we are not only allowed to use the human body to inspire, we are joyfully required to do so.
“For me, an artist who believes in the power of figurative sculpture to represent people as well as abstractions, it is inspiring to sculpt a leader who was so inspiring. FDR never wanted his disability to have a place in his presidency, but he led our nation into some of the most important reforms ever enacted, reforms which allowed us as a community to benefit from what the vulnerable members of our community have to offer.”
Bergmann’s presentation of her concept for realizing FDRHM's mission in three dimensions was received by the committee with great enthusiasm. The design will be presented publicly for the first time on Saturday, April 9, 6 PM to 7 PM at Gallery RIVAA, 529 Main Street, on Roosevelt Island.
Initial funding for the FDR Hope Memorial comes from a generous grant from the Franklin D. Roosevelt Four Freedoms Park, a special project of the Franklin & Eleanor Roosevelt Institute.
For more information or to make a donation, visit fdrhopememorial.
Here are some scenes from last night's FDR Hope Memorial initial design concept unveiling.
The design waiting to be unveiled:
welcoming and introductory remarks by Marc Diamond of the FDR Hope Memorial Committee:
Assembly Member Micah Kellner explaining that the FDR Hope Memorial is important to him both because of his admiration for President Roosevelt and the recognition this Memorial will give to disabled people, noting that he himself has Cerebral Palsy:
Roosevelt Island Disabled Association (RIDA) President and FDR Hope Memorial Chair Jim Bates spoke of how he thought just as the election of America's first African-American President, Barack Obama, inspired African-American children to believe that they could accomplish great things, so could the FDR Memorial inspire children with disabilities that they too could accomplish great things as well.
Here's the sculptor Meredith Bergmann just before the unveiling.
Many more pictures from the FDR Hope Memorial initial design concept are here.
Here's how the Memorial to President Franklin D. Roosevelt depicting him as a disabled person began.
UPDATE 6 PM - ... With a protest by RIDA against this.
Image of Louis Kahn/FDR Memorial at Southern End of Southpoint Park From Untapped New York
UPDATE 7:15 PM - From the FDR Hope Memorial Committee. This says it all.
You Tube Video of FDR Hope Memorial
Labels: FDR Hope Memorial Committee , FDR MEMORIAL , SOUTHPOINT PARK
FDR Hope Memorial Committee Thanks Those Who Made ...
Video Presentation On Stanford University's Propos...
Update On Stanford University Proposed Plan for Ap...
Decrepit and Broken State of Roosevelt Island's Me...
View From Roosevelt Island Tram if Patrolled By Mi...
We Are New York English as a Second Language Progr...
Thursday Night Free Classical Music on Roosevelt I...
President Barack Obama's Speech on Budget Reductio...
Roosevelt Island Underground Nuclear Reactor Was P...
Free Mammogram Breast Cancer Screening Available T...
Difficulties With Roosevelt Island Tram North Cabi...
Island House Privatization/Affordability Plan and ...
Community Planning Board 8 Meeting on Roosevelt Is...
No Late Night Queens Bound F Train Service From Ma...
NY Post Reports On Reassignment Of Roosevelt Islan...
No Roosevelt Island Easter Egg Hunt or Bunny This ...
FDR Hope Memorial Sculpture Design Concept Depicti...
|
cc/2020-05/en_middle_0097.json.gz/line1400062
|
__label__cc
| 0.502203
| 0.497797
|
Staff and growing
of our staff are people of color
of our staff are women
Who We Are History of Pathways to Housing DC
Founded in 2004, Pathways to Housing DC provides home, health, and hope to more than 3,500 adults each year who are experiencing homelessness or at risk for homelessness. Pathways to Housing DC initially opened our doors to end homelessness and help the healing of men and women who were considered “chronically homeless”- those individuals living on the streets for years with serious mental health challenges such as schizophrenia or bipolar disorder that were not being treated. What made Pathways to Housing DC unique in a city with many mental health and housing programs was our Housing First model. Other organizations operated with rules and pre-housing requirements such as curfews, mandated sobriety, compliance with medication, and participation in groups either before entering housing, or as a requirement to keep housing. This approach worked for the majority of individuals experiencing homelessness who were seeking services, but the remaining most psychiatrically disabled and vulnerable subgroup stayed on the street and were not effectively housed within the existing system of care. What has made Pathways to Housing DC so unique in its success over the past decade is our reversal of this traditional treatment sequence. Instead of requiring people to be “clean and sober” or “housing ready,” Pathways DC offers housing, first.
Since placing its first client into permanent housing nearly a decade ago, Pathways to Housing DC has successfully ended chronic homelessness and supported recovery for more than 900 Washington residents. With a staff today of over 150 highly skilled professionals, Pathways to Housing DC provides comprehensive, integrated health and social services to 3,500 clients annually throughout the District.
Pathways Never Gave Up On Me
Anthony is a reminder of the power of second chances. As a teenager, he was introduced to drugs and used marijuana, cocaine, and eventually crack to deal with undiagnosed mental illness. After being sent to prison for possession, he saw a psychiatrist and was diagnosed with bipolar disorder. When Anthony was released, his conviction made it nearly impossible to find employment, and he soon became homeless. After several years on the streets, he found housing through #PathwaysDC. Pathways staff helped him stay sober and deal with the trauma of incarceration. Anthony shared, “I think about how fortunate I am, how many chances I had,” he said. “I was so blessed. Pathways came into my life and helped me turn it around when things were looking pretty bad.” Anthony is a living example that people can thrive when you do not give up on them.
|
cc/2020-05/en_middle_0097.json.gz/line1400074
|
__label__wiki
| 0.517774
| 0.517774
|
University of Saint Francis-Fort Wayne
University of Saint Francis-Fort Wayne in Fort Wayne
(Rating 4.8 based on 5 reviews)
This is the page with old design. Go to the new design of that page
Private not-for-profit, 4-year or above
Degree-granting
Download University of Saint Francis-Fort Wayne Whitepaper!
Download all the data in PDF
Don't want to waste time? Make your decision based on facts and numbers!
Download the PDF with FULL information about the University of Saint Francis-Fort Wayne from opened government trustful sources - right now!
All the contact information, academic programs, admissions and much more are available in the PDF file - click on the button below!
Whitepaper Download
Average Annual Cost
Athletic associations
Location & Website
Applying information
SAT/ACT scores
University of Saint Francis-Fort Wayne offers 270-degree programs and 33 via distance education. Student-to-faculty ratio is 11:1. 1 high safety campus. Acceptance Rate is 97%. The most popular test is SAT - 83% of students submitted it in comparison to 50% of students who submitted ACT. 29.9% are women, and 70.1% are men. 1% percents of international students. University of Saint Francis-Fort Wayne is a member of 6 athletic associations. The average annual total cost of attendance at University of Saint Francis-Fort Wayne is 17231$, that is above national average. Total price of living is between $29730 and $37754 per year. 52% of full-time University of Saint Francis-Fort Wayne students completed their education in 150 percent of time: graduation rate is below national average. Average salary after attending is $39,200, so if you studied 2 years, you’ll get your funds back in less than 2 years.
Average annual cost includes tuition and fees, books and supplies, and living expenses, minus the average grant/scholarship aid. Separate metrics have calculated for different institutions depends on calendar system and sector of the establishment (public or private).
The University of Saint Francis-Fort Wayne is a private and academic-year institution, so it’s net price represents an average of all programs and includes only undergraduates who first enrolled in the fall term and receive Title IV aid. The total cost of attendance depends on whether undergraduates live on campus, off campus (not with family), or off campus (with family).
By Family Income
Depending on the federal state, or institutional grant and available, University of Saint Francis-Fort Wayne students in your income bracket may pay more of less than the overall average costs.
$0 - $30,000 $14,283
$30,001 - $48,000 $14,173
$75,001 - $110,000 $19,728
$110,001+ $21,969
Admission considerations
Neither required nor recommended:
Typical room charge for academic year: -
Typical board charge for academic year: -
Combined charge for room and board: 8830
In-district
Percent of students with financial aid
Types of financial aids
1660 of University of Saint Francis-Fort Wayne undergraduate students were awarded with some type of financial aid, it’s 89 percents of all undergraduate students. This makes University of Saint Francis-Fort Wayne number 27 in the amount of financial aid awarded to students among all educational institutions in Indiana.
Students at University of Saint Francis-Fort Wayne awarded 5 types of loans or aids, the biggest percent of students received a federal, state, local or institutional grant aid.
Salary After Attending
According to College Scorecard Data from U.S. Department of Education
Living & meal
Full-time, first-time degree/certificate-seeking students required to live on campus
Institution provide on-campus housing
Institution provides board or meal plan
Veteran Services Available
Percent indicator of undergraduates formally registered as students with disabilities
Undergraduate programs or courses are offered via distance education
Graduate programs or courses are offered via distance education
Any alternative tuition plans offered by institution
Tuition payment plan - a program that allows tuition to be paid in installments spread out over an agreed upon period of time, sometimes without interest or finance charges.
Here are the learning opportunities available in University of Saint Francis-Fort Wayne.
Teacher certification (below the postsecondary level)
Teacher certification: students can complete their preparation in certain areas of specialization
Teacher certification: approved by the state for initial certification or licensure of teachers
Weekend/evening college allows students to complete courses and attend classes only on weekends or only in evenings.
Teacher certifications programs are designed to prepare students to meet the requirements for certification as teachers in elementary, middle/junior high, and secondary schools.
Member of National Athletic Association
Member of National Association of Intercollegiate Athletics (NAIA)
NCAA/NAIA member for football
NCAA/NAIA member for basketball
NCAA/NAIA member for baseball
NCAA/NAIA member for cross country/track
52% of full-time students enrolled for the first time to University of Saint Francis-Fort Wayne completed the education program and got a degree in 150 percent of the expected time of completion.
The graduation rate value includes only programs that were completed less than six years for four-year degrees or less than three years for two-year degrees.
Graduation rate is the percentage of institution’s new-entering, first-time, first-year undergraduate students who complete their program within 150% of the published time for the program. Graduation rate excludes an extensive number of students. This indicator doesn’t take into consideration students of nontraditional enrollments - part-time students, students who enroll mid-year, and who transfer from one institution to another. So graduation rate alone can create a misleading perception. Completion rate in the form of total number of students receiving any types of awards/degrees creates a complete picture. Combining this data with graduation rate is a better way to compare schools.
Average number of admissions to one applicant
Average number of applicants to one enrolled
The percentage of students given offers out of all those that applied.
In comparison to National Average
University of Saint Francis-Fort Wayne acceptance rate is above national average.
In comparison to state Average
Average acceptance rate for institutions in state is 72%, so acceptance rate value is above state average for 25%.
In comparison to an average acceptance rate in of colleges in $10k - $20k price range
Average acceptance rate for all institutions in state in the same net price range is 66%, so University of Saint Francis-Fort Wayne acceptance rate value is above state net price average for 31%.
Admissions yield
Of those that receive offers to enroll, this is the percent of students that actually do enroll. It is equal to the number of students that enroll divided by the number of accepted students multiplied by 100.
Retention rate
Full-time retention rate
Part-time retention rate
The University of Saint Francis-Fort Wayne full-time retention rate is 68% and part-time retention rate is 0%.
Retention rate is the percentage of the institution's first-time first-year undergraduate students who continue at that institution the next year. E.g., full-time students who study in the fall semester and continue studying in the same program next fall semester are included in the retention rate.
Retention rate is an important index: if it is high, it shows that school offers quality curriculum, welcoming student environments and cultures as more students choose to continue their studies.
Percent of first-time degree/certificate-seeking University of Saint Francis-Fort Wayne students submitting SAT scores
Composite SAT Range (25th - 75th):
SAT Range by section (25th - 75th)
Critical Reading: 430 - 530
Math: 430 - 540
Writing: 420 - 530
SAT Test Score Range
Percent of first-time degree/certificate-seeking University of Saint Francis-Fort Wayne students submitting ACT scores
Composite ACT Range (25th - 75th):
ACT Range by section (25th - 75th)
English: 17 - 24
Math: 17 - 24
Writing: 0 - 0
ACT Test Score Range
SAT Score Converter
The new SAT is scored out of 1600 after the adjustments made in 2016. The old SAT was scored out of 2400. If you took an old SAT, you can convert your score to the new SAT score using the SAT Score Converter.
New SAT to Old SAT
Old SAT to New SAT
Enter your total & section scores (Please enter all 3 scores)
Evidence-Based Reading and Writing
Convert Scores
An estimate of what your score would have been on the old SAT
TOTAL SCORE out of 2400
From Critical Reading + Math + Writing
SECTION SCORES
Reading and Writing out of (1600)
Math out of 800
See Colleges that Match Your Scores! >>>
Enter your test scores(Please enter all 3 scores)
An estimate of what your score would have been on the new SAT
Reading and Writing out of 800
For the High School Class of 2016:
Most students in the Class of 2016 will take the old SAT, and most colleges will convert new SAT scores to old SAT scores.
Most students in the Class of 2017 will take the new SAT, and most colleges will convert old SAT scores to new SAT scores.
The student-to-faculty ratio at University of Saint Francis-Fort Wayne is 11:1, that means that for every 11 students the institution has one professor, lecturer or specialist with a degree in education. Lower student-to-faculty ratio is better - it means that professors can dedicate more time and attention to each student.
Student-to-faculty ratio
Men/Women
Number of international students
Percent of international students
Race/ethnicity breakdown
Total ethnicity
Men ethnicity
Women ethnicity
Students enrollment in distance education
In University of Saint Francis-Fort Wayne the biggest percent of students are enrolled in on-campus courses.
Distance education location breakdown
Here are the students enrolled exclusively in distance education courses at University of Saint Francis-Fort Wayne and grouped by their location. Distance education courses are the most popular for students located in Indiana.
The percentage of crimes on University of Saint Francis
The campus located by 2701 Spring Street address in Fort Wayne, Indiana.
University of Saint Francis in comparison of all branches in the US. It is calculated as the average percent of crimes yearly by five years of data for every campus, based on an overall number of students studying there. The branch is a part of University of Saint Francis-Fort Wayne with 0.13% of maximum crimes a year. The most often crimes detected on University of Saint Francis are burglary and motor vehicle theft.
Number of degree programs offered
University of Saint Francis-Fort Wayne offers 270 programs in total: 152 are for Bachelor's degree, 49 - for Associate's degree, 45 - for Master's degree, 12 - for Post-master's certificate, 9 - for less than 1-year certificate programs, and 3 are Postbaccalaureate certificate.
This is one of the lowest number of programs in comparison with other 135 universities in Indiana state. University of Saint Francis-Fort Wayne is one of the few institutions in Indiana that offers an Associate's degree program.
Number of degree programs offered via distance education
There are 33 distance learning programs that are provided in the University of Saint Francis-Fort Wayne: 18 are for Master's degree, 12 - for Bachelor's degree and 3 are Associate's degree.
Note, that programs offered via distance education might be entirely online as well as partially online and require on-campus meetings. So explore each program to make sure you can commit.
Total credit/contact hours
Here you can find the data on instructional activity in measured in total credit and/or contact hours delivered by institutions during a 12-month period. Also we shown the Indiana state average data to help you compare.
University of Saint Francis-Fort Wayne provides coursework for undergraduate students and graduate students.
In 2014-2015 academic year estimated full-time equivalent undergraduate enrollment was 1691 students with 50732 сredit hours for 12-month instructional activity period. The enrollment for graduates was 441 with 10576 credit hours.
TOP 5 Popular Majors
The most popular majors counted as percentage breakdown of degrees awarded in every single discipline in University of Saint Francis-Fort Wayne
18% — Health Professions and Related Programs
10% — Registered Nursing, Nursing Administration, Nursing Research and Clinical Nursin
4% — Business, Management, Marketing, and Related Support Services
3% — Business Administration, Management and Operations
3% — Allied Health Diagnostic, Intervention, and Treatment Professions
Give feedback about University of Saint Francis-Fort Wayne
Thank you for your feedback! We'll moderate the review and publish it here.
Tell us what you think about University of Saint Francis-Fort Wayne:
Overall Rating: *
Your First Name: *
Current StudentFormer Student (Did not Graduate)Alumnus (Graduate)Professor / FacultyProspective StudentParent of StudentOther
Academics:
Professors / Faculty:
Campus Atmosphere:
Campus Safety:
Dating and Social Life:
Party and Bar Scene:
Student Reviews and Ratings for University of Saint Francis-Fort Wayne
Address: 2701 Spring St
Religious affiliation: Roman Catholic
Calendar system: Semester
General Phone Number: +2603997700
Institution is active in current year: 1
Institution's internet website address: sf.edu
Financial aid office: Go to the page
Admissions office: Go to the page
Online application: Go to the page
Net price calculator: Go to the page
Veterans and Military Service members tuition policies: Go to the page
Student-Right-to-Know student athlete graduation rate: Go to the page
More colleges and universities in Allen county
Rudae's School of Beauty Culture-Ft Wayne
Acceptance Rate: 0%
Setting: City
International Business College-Fort Wayne
MedTech College-Ft Wayne Campus
Ross Medical Education Center-Fort Wayne
Ravenscroft Beauty College
More colleges and universities in Indiana state
The Salon Professional Academy-Evansville
Graduation Rate: 100%
J Everett Light Career Center
Notre Dame, IN
Setting: Suburb
Alexandria School of Scientific Therapeutics
Acceptance Rate: 100%
Hair Fashions By Kaye Beauty College-Noblesville
|
cc/2020-05/en_middle_0097.json.gz/line1400082
|
__label__cc
| 0.685946
| 0.314054
|
SubTopic Server hardware
Blade servers: Big on computing power, small in size
An introduction to blade servers
The advantages of blade enclosures for virtual server load balancing
Rise in virtualization slows blade server technology adoption in the data center
How to cool blade servers
What's great about blade servers?
Watch out blades -- Virtualization cuts through
Five answers to blade server questions
Small microservers are a large chunk of the market
Microservers contest x86 server norms
When microservers are the wrong choice
Dell's dive into the microserver market
Intel takes hold of SoC processors for microservers
The microserver fork in the road
Important server lingo
Rack-mount server
This content is part of the Essential Guide: Server form factors: A guide to rackmount, blade servers and more
Things to know about blade server technology before you buy
If you're interested in blade server technology as an alternative to towers and racks, sharpen your knowledge with these facts.
Sander van Vugt, Red Hat, SUSE and Ubuntu
Every data center starts with just a few servers. Not long ago, it was common to install tower servers in the data center, but today most tower models have been replaced with 1U rack servers or blade servers.
A blade server is a very small server designed to be as efficient as possible in the space it uses as well as with its energy consumption. Should you consider replacing all of your servers with blades? In this article, you'll find answers to the five most commonly asked questions about blade server technology.
What is a blade?
A blade server is a stripped-down computer optimized to consume a minimal amount of power and use the available space in a data center as efficiently as possible. Depending on the server vendor's design, server density with blades can be six times higher than that of regular servers.
Because efficiency is an important design goal for blades, only the core server components are on the blade itself. Everything that can be shared between servers is in the blade chassis. A blade cannot be used without the blade chassis, which provides vital functions like power, cooling, etc. If you're investing in a blade chassis, it follows that you don't buy just one blade server: You would buy a chassis to install multiple blades.
Storage usually isn't available on the blade; it's typically provided by a storage area network (SAN). The blade chassis is connected to the SAN and the blades themselves boot from the SAN. As blades normally don't have optical disk drives either, they typically are installed by using installation servers. Putting all this together, using blades makes the data center more efficient, but blades don't make the process of installation and maintenance any easier.
Are blade servers cheaper?
It depends. If you just need a few servers, then it's usually cheaper to buy 1U rack servers or even a cheap tower server -- prices start at about $300 for a minimal configuration.
You can't just buy one blade server, since blade server chassis are built for multiple blade servers. Because it is so compact, the blade itself is more expensive -- prices start at about $ 1,500 -- and in addition to that you'll need a blade chassis as well. And, adding to the price, you'll need a storage solution and fast connectors. A complete blade server configuration will cost you much more than buying a couple of 1U servers.
So price is not a reason to buy blades. When buying blades, you're really buying power efficiency, because energy consumption per blade normally is much lower than power consumption per rack server, and they generate less heat than racks too, which helps save on cooling costs.
Let's make a rough calculation. If you've got a 1U server that consumes 400 W hourly and uses 9.6 kW daily, at a price of 20 cents per kW that is about $2 per day for power consumption -- $730 yearly. Over the average five-year lifetime of a server, power consumption would total $3,650, excluding the costs associated with cooling the 1U server. If eight blades in a blade chassis use 800 W hourly, or 100 W per blade, that means the yearly electrical cost is 25% less than a regular server. So buying a blade may be more expensive up front, but it can be cheaper to operate because of the reduced power consumption.
In addition to the reduction in power cost, consider the costs of the rack space you need in the data center for your blade. If you rent racks, you probably pay hundreds of dollars monthly for rental. If using blades to consolidate means eliminating a couple of racks, you may end up with a significant cost reduction by buying blades. Make those calculations before buying!
How do you boot from a blade that doesn't have a hard disk?
Diskless blades boot from the SAN. While setting up the blade, you just tell it which logical unit number to use. In a Fibre Channel SAN, this is easy; you almost don't see the difference between a local disk and the disk on a SAN. The only issue is you might need to tell the operating system (OS) that it is booting from a SAN. Some OSes need additional drivers to boot from a SAN, so make sure that it is supported by the operating system you want to use. This shouldn't be an issue for modern server operating systems.
Does it make sense to use blade server technology in small to medium-sized companies?
It all depends on the number of servers you want to use. If you just need four servers, don't go for a blade solution. With eight or more servers, a blade solution may be worth considering. It's true: You need a shared storage solution as well, but shared storage solutions are already used in many companies. So even for small and medium-sized companies, a blade-based server solution may be within reach.
What are the alternatives?
There's a trending technology that has similarities to blade servers: the microserver. Microservers are low-capacity servers that are installed in a chassis as well. A typical configuration allows you to connect 12 microservers in one chassis. If you need powerful servers, look at a blade solution. If you need physically isolated servers to run tasks that don't ask much of the server hardware, then installing microservers might be the better solution.
ABOUT THE AUTHOR: Sander van Vugt is an independent trainer and consultant based in the Netherlands. He is an expert in Linux high availability, virtualization and performance, and has completed several projects that implement all three. He is also the writer of various Linux-related books, such as Beginning the Linux Command Line, Beginning Ubuntu Server Administration and Pro Ubuntu Server Administration.
How to prepare for serverless architecture –TechTarget
Dig Deeper on Server hardware strategy
What's the difference between Open19 and the Open Compute Project?
A rundown of server hardware vendors and the server options
twin server (0.5 U server)
CI's keystone: Integrated computing in a blade server enclosure
Sander van Vugt asks:
What will you put in your data center?
Optimize refresh cycles by leveraging real-world data –DellEMC
Save time and money with data-driven IT purchase decisions –DellEMC
Sander Van Vugt - 21 Sep 2012 7:47 AM
AnonymousUser - 26 Feb 2014 9:54 AM
Blade's are the way to go these day's.
|
cc/2020-05/en_middle_0097.json.gz/line1400083
|
__label__wiki
| 0.978482
| 0.978482
|
D3 Champs Rise from Past Tourney Troubles
Boys Bowling, Girls Bowling
Posted Friday, March 1, 2019
By Steve Vedder
Special for Second Half
MUSKEGON – Emily Feldten clearly remembered the conversation she had with her coach as the Division 3 girls team bowling championships came down to the final three shots.
The Coloma junior had assured coach Carley Burrell she could be counted on to handle the team's anchor position in Friday's Final against second-seeded Birch Run at Northway Lanes.
"I was up for it," Feldten said.
And she showed it in dramatic fashion, as Coloma edged Birch Run 1,112-1,104. Down 14 pins after the match’s two Baker games, Coloma, helped by two strikes in Feldten's final three shots, finished off a furious rally to win its first MHSAA title since 2010.
Burrell said she quietly pulled Feldten aside before deciding on her Finals lineup to make sure the junior – who has been part of teams ranked No. 1 at the end of the regular season the last three years – was mentally up for the challenge.
It proved to be a monumental decision.
"She knew what we needed," Burrell said. "I talked to her about (the anchor spot), and pressure can be scary. I wanted to know if she could handle it. I knew she was a pressure bowler."
Feldten said the scenario played out so quickly, she didn't have time to think too much about her final chance.
"It's an awesome feeling to get the result the team wanted," she said. "We all worked so hard for this. It's unbelievable for us right now, shocking."
The championship capped a three-year run by virtually the same core of bowlers who have torn up the regular season but failed to get out of the qualifying block of the Division 3 tournament the last two years. Burrell said her bowlers fully recognized this was their last chance.
"They knew this was it, that there weren't going to be any second chances," she said. "This was going to have to be the year it would happen. It came down to a matter of handling obstacles one at a time.
"We knew what the end goal was, and they accomplished it phenomenally. "
Gladwin won the boys title with a 1,229-1,152 win over Ogemaw Heights in a matchup of the tournament's top two seeds after qualifying.
Like Coloma's girls, Gladwin used past stumbles in the tournament as motivation this season. The team featured three seniors and two juniors in the lineup, many who returned from a 2018 Finals where Gladwin failed to make the first cut.
"This is definitely something we sought all year," Gladwin coach Kent Crawford said. "We've been undefeated in our conference (Jake Pine) for the last three years, and winning a state championship is always something we've strived for.
"We've had teams tell us all year we could go far in the tournament, and we've seen that."
Two of the team's four-year seniors, Ryan Day and Cody Roehrs, said two things helped the team finish the run Friday. One was overcoming the frustration of last year's event, and the second was not letting a brutal Michigan winter interfere with their regimen.
"We used (last year) to fuel us and make us do the best we could and win it for the three seniors," Roehrs said. "This is amazing, a crazy dream. We just got together as a team and said winning this is the biggest thing. We're like a family out there."
The team missed as many as 10 practices and a couple of weekend tournaments because of the inclement weather. Such an all-over-the-road schedule could have wrecked the momentum of many teams, but it didn't faze Gladwin, Day said.
"It was tough not practicing sometimes, but we're so passionate about bowling that snow days wouldn't affect us," he said. "Everything we did was to work toward this."
Crawford said it can be argued the lack of practice actually did the team some good.
"We'd have two weeks off from matches at times, but that's true of all teams," he said. "I do think it made us aware of practicing, and that we had to be serious about it."
Click for full girls results and full boys results.
Success Cascades for Jackson-Area Pair By Jeff Bleiler Special for Second Half BATTLE CREEK – Not long after they claimed their Division 4 high school bowling singles championships,...
Lessons from Last Time Serve D2 Champs By Keith Dunlap Special for Second Half WATERFORD – On the right forearm of Adrian bowler Jacob Harvey is a tattoo of a samurai, which he said...
Campbell, Betts Believed Then Achieved By Steve Vedder Special for Second Half MUSKEGON – Trusting the process led to a stunning ending to Dawson Campbell's season. In fact, ...
D4 Bowling Finals Belong to Bronson By Geoff Kimmerly Second Half editor BATTLE CREEK – There has not been a better day in Bronson’s brief bowling history, or more specific...
Flint Kearsley, New Boston Huron Rule D2 By Keith Dunlap Special for Second Half WATERFORD – There couldn’t have been a more appropriate showdown for the Division 2 girls bowlin...
Birch Run, Coloma, West Branch Ogemaw Heights, Gladwin, 2018-19 Finals
Modert Driving Toward 3rd Title, Wins Record
|
cc/2020-05/en_middle_0097.json.gz/line1400085
|
__label__wiki
| 0.571939
| 0.571939
|
Tag: Milon
XXXII: Wild Pigs
October 3, 2018 October 4, 2018 David CrowhurstLeave a comment
Servitors: Geloma, Nudeton, Manties, Mara, Liriol, Losimon, Lomiol, Irminon, Sarasim, Iuar, Adon, Girmil, Asturel, Alagas, Gorilon, Laralos, Gesegas, Milon, Erimites, Nasi, Tolet, Morilon, Ugesor, Ramoras, Igarag, Romages, Aril, Lagasas, Isagas, Romoron, Soterion, Negen, Nolom, Nagar, Amillis.
The word in the first row and column, CADASIN and CADESIR, possibly derive from the Hebrew root קדש (qadesh) – ‘holy,’ with the extension קדושין (kidushin) meaning ‘sanctification,’ ‘betrothal’ or ‘marriage,’ while the addition of שיר (sir) in the first column perhaps represents the addition of the word for ‘a chant’ or ‘a song.’ The words in the seventh row and column, RISEDAR and NISEDAR may come from the Hebrew שדר (sedar), ‘message.’ The spirit name in the central Square is an anagrammed representation of that of Geloma, which takes its meaning from the Hebrew גלם (gelom), meaning ‘to embody’ or ‘personify.’ While there is little to directly connect these words to the Wild Pigs this Square brings visions of, the appearance of the word DIMONAS in the third column and row makes it apparent that this is a square relating to demonic power, and what is therefore figured to be ‘holy’ to such beings is that which is unclean, taboo or forbidden which, in the Hebrew tradition, the pig was perhaps the ultimate ‘embodiment’ of.
In the original text of the LBW, the words in the sixth row and column were shortened to IAGUA and ITAGUA respectively and have therefore been amended to ITAGUTA to make an even square. Read backwards, the word IAGUA, becomes AUGAI, which may refer to the Greek nymph Αυγή (Auge, also written Augai), whose name means ‘dawn’ and also the word Αυγό (augo), meaning ‘egg.’ The concept of ‘dawn’ and ‘eggs’ are connected in the concept of the Augoeides which is made up of a combination of either αυγό or αυγή and the term είδηση (eidese), meaning ‘word,’ ‘message’ or ‘intelligence.’ This concept is related to the myth of Phanes, the light bringer, bursting forth from the Cosmic Egg after the coils of the great serpent crack it open and release his light into the nascent cosmos.
A rainbow appeared which I followed the downwards arc of from the sky to a patch of yellow grass at its base. On arriving at the grass patch I smoothed it and patted it down with my hands and revealed the end of a pipe with a circular, metal-barred vent over it through which great waves of air protruded, which I perceived came from a great engine under the Earth. I discovered, however, that it came from the sea cutting away into great caves beneath the Earth as it crashed into them which produced billows of air that spouted up through the land. I pulled the vent free from the end of the pipe and squeezed myself headfirst into the narrow, tube-like shaft. The pipe sucked me through it very quickly so that I soon shot free from its other end, which protruded from the cliff face, and flew—like a ball shot from a cannon—far from the cliffs and into the water.
Bobbing in the ocean, I beheld blue waters and skies and yachts with sails of brilliant white in the distance. One of these headed towards me and I saw that it was being steered by a being that was half pig and half human and wearing a blue sailor’s outfit. As he reached me, I climbed aboard and saw his face to have a dirty, unclean look about it, yet its voice was cultured and intelligent as it hauled me aboard. Once I was inside I noticed that dead, naked human bodies littered the deck giving off a smell that was like that of a butcher’s shop. ‘Don’t worry, you’re quite, quite safe,’ the sailor-pig commented, though I felt a silent unease coming over me. During the voyage I could feel myself transforming into a pig-human hybrid, but when I checked down at my immaterial body I could see no changes in it. Then I noticed that the human bodies on the ship had various porcine elements to them, as though they had boarded the ship and transformed into such things in the same way that I perceived myself to be changing my form.
We sailed for a short time then came to an island where other yachts were coming ashore. With me following close behind, the sailor-pig announced to his fellows that he had ‘caught another one trying to cross the sea.’ He continued that I hadn’t got very far at all and the others mocked me for only getting such a short distance into the waters before getting caught. Coming inland I saw that while the island was rather idyllic, the desiccated skins of several human beings hung out to dry on a horizontal cord about twenty feet off the ground. Their bodies were long, faceless and brown in colour as though they had been left out in the sun to be dried or cured.
On turning to the pig who had captured me, he told me not to be concerned as this fate could not come to me as I had no corporeal body and could not be harmed by them. ‘See, look down at yourself,’ it said to reassure me. On doing this, I saw that my body was my own, robed as it was in the chamber in which I performed the experiment, yet it was also partially ethereal in its substance. Despite me having no solid body, the pig then asked me if he and his fellows could feast on my essence in some way, requesting that I give them something from my astral body for them to feed off. I refused and noticed them gathering closely, with threatening vampiric features. With my eyes closed, back in the real world, I perceived movement around me in the chamber during this part, as though shadows darker than the blackness generated by my eyelids were passing from behind me to in front of me in a circular motion. Here, my body felt very tight and rigid and I felt a strong trance begin to descend over me.
Back in the vision, I seemed to have no way out of this predicament when suddenly the lead pig cried out ‘Daimon, what are you doing here?’ On hearing these words I noted that a great, solar eagle was descending from the skies and swooped down to rescue me. As it flew off, I conversed with it a little, but found my real-world trance state a little too heavy to keep my concentration strong enough to make out his words. I gleaned, however, that the island was set close to the same western sea I had been somehow forbidden to cross—or had seen the souls of the dead crossing—in previous visions. I asked the eagle to lay me down in a wood on the shore of the land that I came from, and he warned me that the demonic creatures I had encountered were likely still abroad in these parts of the lands, but I informed him that this didn’t trouble me, so he set me down. The vision began to take on a looser form at this stage with various random flashes of faces and images that didn’t seem related to anything relevant, so I drew the session to a close.
The image of unclean animals on boats harks back to the vision of A Big Lake, which began with a similar projection of an object into water over a great distance, in that case being a golf ball being hit into the lake. Of potential relevance to this is the appearance of the word ATILATI in the second column and row, which has a possible origin in the Hebrew טלטלה (tilatileh), meaning ‘to hurl,’ ‘project’ or ‘shake.’ Both visions also featured a small island in their respective bodies of water that contained some kind of threat and the feeling of being encircled or watched.
A spirit revealed in this Square for the first time in the course of this experiment was Nudeton, whose name may derive from the Hebrew root נוד (nud), used to denote the wandering of an outcast or fugitive or the shaking of the head in grief.
The concepts of pigs, demons, being projected into the sea and the ‘outcast’ nature of the spirit Nudeton reveal references to Christs outcasting of Legion into a herd of swine that leap off a cliff and into the sea in Mark 5:1-20.
The manifestation of the Eagle as a Solar Daimon may bear some relation to the inclusion of the words IAGUA and AUGAI mentioned above, which may have acted as a prompt for the manifestation of a being of the same nature as the Augoeides, whose purpose was to guide and protect me from the threat of the demonic entities on the island in the midst of the great sea of death.
The Square was created with the Moon at 2º Cancer and the scrying performed with the Moon at 12º Cancer.
XXVIII: Peacocks
August 21, 2018 August 21, 2018 David CrowhurstLeave a comment
Servitors: Ilekel, Manties, Losimon, Asmiel, Lomiol, Katsin, Apolion, Pakid, Adon, Pattid, Kosem, Milon, Iparkas, Izozon, Nasi, Tolet, Ekalak, Kilik, Kokolon, Alpas, Ipakol, Soterion, Nolom, Amillis.
The word at the outer edge of the square derives from the Greek μυδεικών (mydeikon), meaning ‘mystical,’ while the name forming the central cross refers to the spirit Ilekel, whose name possibly derives from the Hebrew לחלל (lechalel) meaning ‘to desecrate,’ ‘violate’ or ‘defile.’ The lower case letters represent those altered by me to correct the errors that are evident in it in the original text.
A long, thick baton made of plant matter and covered with needle-sharp spines appeared. Each of the baton’s spines had a tiny, lidless eye at its end, each of which turned to look at me at the same time, then started shifting around in a way that was quite unsettling to look upon. As I looked at the baton, a peacock came running towards me telling me I shouldn’t be holding it and instructed me to put it down. Entranced, I kept looking at it, and found it opening out into a blue fan that, with its eyes now spread all over its surface, resembled the tail of a peacock. As I noticed this, the peacock standing before me opened his tail in response then proceeded to run past me, telling me to put the fan down and run with him as something was coming. I folded it back up so it resembled the spiked baton again and ran with him.
Then it was apparent that we were in a thinly-wooded forest. Between, or rather above, the trees came a huge giant, crushing everything it trod on beneath its feet. Then, as the giant came to the baton I left on the floor, the eye-spines that ran up its length pierced the flesh of its feet and turned the giant to stone. Then, after a few moments, the stone giant crumbled to dust and revealed a golden statue of a man, somewhat like Michelangelo’s David, but carrying an axe over its shoulder. The Peacock and I approached the statue and the Peacock joyfully declared the freedom of the idol that had been encased within the giant’s great body. Then the arm holding the axe dropped down to its side for a moment then moved again to strike the ground with it, causing a small crack to appear in the earth. As the earth opened, I saw a pool of very blue water in which hundreds of frogs eggs had been laid. This, I realised, was the point where the spiked baton had been crushed into the ground by the giant’s foot, and had now changed from being a baton/tail/fan into a blue pool full of eggs. On inspection, each of the eggs contained tiny, swimming embryos.
Then, from the water, a large, shark-like monster leaped, its maw raised to the heavens, which peeled back lay by layer to reveal a bald-headed figure garbed in a robe of the same blue as the pool and tail feather had been. Its eyes, however, had skin growing over them which opened by the skin being split open into vertical slits with no visible eyeballs within them. As it gazed upon me, it said ‘speak what you wish, or rather, chant it.’ Doing so, I demanded, in a chant, to be shown the true visions of the square. It told me I was already seeing them, but then explained that none of what I was seeing was real, for nothing around us was actually there. The wood around me and everything in it was an illusion fabricated from the matter of my mind, it said, and this illusion could come in the form of castles, buildings, towns, banquets or anything else one could imagine.
The entity then told me that the mechanics by which spirits worked was through influencing the physical matter of the mind to produce symbolic communications. But, he asked me, how could I truly distinguish what was the work of my own mind and what was the work of the spirits communicating with me. As he spoke, I noticed that his feet became those of an ostrich that dug into the ground and that he appeared to be wearing a pink tutu around his waist. On noting my incredulity about such a ridiculous image, it laughed a bellowing laugh. It explained that they could encourage the mind to see anything they wished it to by the power of suggestion, it said and produced random images of foods like pineapples and carrots appeared for no discernible reason. The point of doing this, it told me, was that I had the mind couldn’t control the formation of these images once they had been suggested to it. This being the case, how could one truly determine whether the images impressed by the mind was the product of one’s own communications with the unconscious or some other extraneous entity. It prompted me then to form whatever images I wished in my own mind. On doing this, I noticed that everything I thought of came easily enough but that the things I was deciding to form images of now also seemed to be influenced by something that may or not be of my own mind.
The entity reiterated again that this was how spirits worked. They could manipulate any matter that they wished to by such power, and did so by working at the subatomic level, as they could range in their sizes from that of a particle, to a microbe or to a great giant. In such forms they could alter the forms and movements of anything physical in unseen, invisible ways, being able to effect the actions of viruses and bacteria, the movements of animals, storms, seas and buildings. Even, it seems, the synapses of the brain that produce various thoughts, images, predilections or emotional responses could be manipulated by them. The veils between the unconscious influence of the mind and the activities of spirits, it seems by such explanations, is thin and indistinguishable. To test this, I asked whether I could be made to see things I had never physically seen if this was the case, and the answer was affirmative. I asked it, for some reason, for it to show me a vision of Byzantium, and it proceeded to show me an image of a city with small white houses and red-brown sloping rooves surrounded by larger buildings with great golden domes. I stated to it that this place could be anywhere, and there was no proof that this illusion was Byzantium at all. That, it said, was my dilemma. How could I ever know if any of the things shown to me were ‘real’ in an objective sense if I couldn’t prove it either way. Ultimately, there is no way to tell if one is being deceived or not by the actions of mind, be it due to the actions of one’s own brain or by spirits who, in this vision, claimed that they worked by manipulating it.
Leaving me to consider such things, I sensed its impending departure and asked it to give me its name before it left. In response, the image of a highly intricate red and yellow banner appeared before me with various heraldic images such as lions and dragons stitched into it. In this centre, around a crest of some kind, two flowing ribbons had two letters stitched into them in red, AF on the left side and AS on the right, spelling out the name AFAS. With this, the vision ended.
The Square in question appears to have been corrupted in the original text and so was amended by myself to make its proportions even. The original, uncorrected Square appears as follows.
New Spirits apparent in this square are: Izozon, Katsin, Manties, Pakid, Pattid. Possible origins for these names are:
Izozon – יזוז (izoz), ‘move,’ ‘stir,’ ‘go away.’
Katsin – חצי (chatzi), ‘middle’ or ‘half,’ though the most interesting possibility is ‘moiety,’ which refers to something a single thing being split into two halves.
Manties – possibly from the term -mancy, related to divination, which ultimately comes from the Greek μαντεία (manteia).
Pakid – from Hebrew פחד (pechad), ‘fear,’ ‘dread,’ ‘terror.’
Pattid – possibly from Hebrew יפעת (ipat), ‘splendour,’ ‘brilliance.’
The bottom line of the square reveals a backward expression of the word MIDIKON to give the word NOKIDIM – נגידים – ‘Governors,’ which is suggestive of the influence of the Four Kings, Oriens, Amaymon, Paymon and Ariton, but may refer to any entity in a position of authority over others. NOKIDIM also represents the principle of averse mysticism due to the word it derives from mydeikon, meaning ‘mystical,’ and the aura of averse mysticism evident in the square, with its explanations on how spirits interfere with the laws of cause and effect in invisible ways in the physical world, appeared to confirm this. about it.
The nature of the communications in it had a degree of what a psychiatrist would probably call examples of schizotypal or psychotic thinking, due to the postulated statement that external entities may have an effect on thoughts. Such explanations are not entirely inaccurate, as when uncontrolled through the veils of mental illness and a lack of mystical or magical intent this can certainly be the case. However, most human experiences that can be called religious or spiritual, including visions, shamanic experiences, kundalini or other ecstatic states can quite easily be attributed to forms of temporary psychosis. The key here is the ability to acknowledge that mystical experiences are wilful experiments with the fabric of one’s psychic substance that can be used to tap into alternative states of consciousness by communicating with one’s deep and unconscious self. As the entity, Afas, in the vision stated however, there is a quandary involved in this in that one can no longer truly tell what is the product of one’s unconscious, which has been given free reign to act as it wills for a short time, and what is the product of the encouragement or manipulation of forces that exist beyond it.
The true key to understanding whether what we experience in such states is down to us or something extraneous to us lies in receiving proofs that point to something beyond the self. In these experiments this has happened rather consistently with the reception of words that I have had no prior knowledge off in ancient languages that I only have passing familiarity with. In this vision, this happened too, as the name given, Afas, appears to correlate with the Hebrew word אפש (afas), which means ‘wish’ or ‘desire,’ which is objectively relevant due to the entity informing me I could ‘speak what I wished for’ when it first appeared. It’s nature, then, was the granting of wishes or desires in the way that is mythically expressed in the persons of the djinn that emerge from magical lamps in Arabian lore. Another alternative explanation for this sort of phenomena is that the self has the ability to tap into an objective pool of information that lies beyond it, such as that represented by the Collective Unconscious postulated by the eminent sage Carl Jung. This possibility, however, is no less magical in its postulations than the idea of spirits or daemons having an element of influence over us, but I personally believe that the human mind cannot access information beyond its own experiences, but can be prompted and communicated with by preternatural entities that are extraneous to it.
The Square was created with the Moon at 12º Sagittarius and performed with the Moon at 25º Sagittarius.
XXII: A Wild Cat
July 13, 2018 David CrowhurstLeave a comment
Servitors: Isagas, Mara, Liriol, Losimon, Lomiol, Alogil, Ragaras, Irminon, Sarasim, Ogologon, Igilon, Sigis, Apolion, Girmil, Gorilon, Laralos, Milon, Nasi, Morilon, Ramoras, Igarag, Aril, Lagasas, Alpas, Romoron, Nagar, Amillis
The word LINIROS on the outer edges of the square possibly from Latin linire – ‘to daub,’ ‘smear’ or ‘anoint,’ or from the Greek λοιμικος (loimikos) – ‘pestiferous.’ The word in the central square derives from the name of the spirit Isagas, which means ‘roar,’ ‘shout’ or ‘yell.’
I was in a wilderness of patchy, dry grassland where I followed a plastic, yellow pipe along the ground until it sunk into the earth at a certain place. I believed it to be a power supply of some kind but decided against pulling it up from the earth due to a sense that there was something dangerous concealed there. A little further along, amidst a sudden shock of long, yellowing grass, the pipe re-surfaced and continued winding towards where the silhouette of a distant city to the west which had a prominent domed building at its centre.
My journey to the city was interrupted by a leopard bounding through the long grass before me. It stopped and bade me to come with it, as if it knew exactly who I was and expected me to be equally familiar with it in return. I followed it back to the place where the pipe went underground where it prompted me to open a concealed doorway. On doing this, I found a pit filled with vultures, boars, corvids and other ‘unclean’ animals, who proceeded to escape once the hatch of their pit was opened. On entering the empty space at the leopard’s behest, I found the place to be full of excrement like the outhouse I had refused to enter in the vision of Wild Animals. Apart from that, it looked somewhat like a bunker of some sort and there was a clock on the wall with the hour and minute hands stuck at 5:02 while the second hand was stuck at the 34th second. The walls that flanked the clock were decorated by wallpaper with a pattern upon it that consisted of hundreds of flies; and there was a camphorwood chest in the centre of the room in which lay a bundle of pornographic magazines which, like the general décor of the place, all appeared to be from the 1970s.
At this point, the leopard transformed into a woman with golden skin with black blotches over it, and I entered into a conversation with her. At my request, she stated that her name was Raminiel and that she was my natal daemon. She had manifested on Earth, she said, at the moment of my conception, and the place in which we now stood was a symbolic representation of my mother’s womb during my gestation. Curious about this claim, I asked her what the date was in this place and she replied that the sun was at 26º Gemini. Then I asked for confirmation of where the Moon was, and she replied that it was at 18º Aries.
Following this, she explained that the animals we had released were the creatures of the wilderness which the folk of the distant city feared and sought to keep away. By releasing them we had let out a necessary force of fear and freedom into the world as keeping them locked up was unnatural and cruel and nurtured a state of false security. She explained that none of the animals would enter the city or do any harm as that was not their nature, and they would instead remain at its peripheries, forming a circle around it and keeping watch on it from beyond. Then I noticed two yellow snakes which had not escaped the pit slithering along the floor and saw that they had the heads of jays. Then a dog and a pig appeared, both of which were very friendly. The leopard woman told me they were two familiar spirits she had granted me in order to assist her in her work of looking after me. With that, I said farewell to her and she responded with the word ‘taho’ and the vision ended.
Considering the natal theme of this vision, the yellow pipe or cable I was following at the beginning probably represented the umbilical cord. I sensed it was carrying energy of some kind, and it appeared to have been the lifeline cast to the animals who had been trapped in the ‘womb.’ When the animals escaped they preceded to encircle the distant city, staying at its peripheries in the same manner that the Shedim of Hebrew mythology did, and just like those creatures, these beasts were all ‘unclean.’ The circle they spread out into once again echoes the circle of spirits I have seen watching me, except in this incidence it was the city in the distance they spied upon. My guess is that the city represented my psyche in some way which I was witnessing from a place remote from it in both time and space. As well as representing a womb, the wilderness with the wild beasts buried beneath its surface may also be seen as a representation of the unconscious. Their escape also somewhat resembled the releasing of the legion of spiders that took place in the very first vision, which was that of A Beautiful Lawn.
The name Raminiel seems likely to be related to the word RAMACAN in the square. This may come from רעמה – Ramah – ‘mane’ with the daemon possibly being the manifestation of the ‘mane’ of the lion from the previous square and therefore an emanation from it. A spirit with the appearance of a Leopard also came in the vision of A Big Lake, in which it delivered me instructions regarding the correct way to pay ritual homage to the Elemental King Egin who rules the North. This rite was performed, now with the devil-headed cup and a bespoke incense recipe including some home-made Onycha delivered during ongoing ritual communications with Egin and one of his servants on the day before the leopard reappeared in this vision.
The time the clock was stuck at, 5:02 and 34 seconds, may have two Qabbalistic correspondences. 502 is the number related to the Hebrew word בשר which means ‘to tell glad tidings’ and also ‘flesh’ and ‘body’ suggesting aspects of incarnation. The first of these meanings relates to a phrase associated with the birth of Christ spoken by Gabriel, while 34 is the numerical value of גלא ‘to reveal.’ The distinct 70’s feel of the vision coupled with the spirit’s explanation of what the place represented and the reported position of the Sun at 26º Gemini corresponded roughly with the week I would have been conceived in June 1976, with the Sun being at theat position on June 16th of that year. The Moon was not at 18º Aries that day, however it was four to five days later at the moment of the Summer Solstice when the Sun entered the Northern Sign of Cancer. While the matchup here isn’t perfect, it is close and a magical mystery connecting my birth and the Northern Solstice may be hinted at therein.
An alternative theory of the time on the clock is that its figure 5 + 02 + 3 + 4 = 14, which is not only the Gematric value of my name but is also a formula of the ‘Gold’ of the HGA.
The word Taho which the leopard-woman spoke instead of ‘goodbye’ may be a rendering of the Hebrew תהו (tahu) which refers to ‘wastefulness.’ For reasons yet uncovered, this reiterates the meaning of the word בזבז – (bizbez), meaning ‘to go to waste’ or ‘spent,’ that was received from the Lion-Angel at the end of the previous vision.
Of additional note in this square is the appearance of the name of the Lemegeton spirit Ipos in the second row. Notably, this spirit appears with the head of a lion and is described as being ‘even more obscure and filthie than a lion’ in the Pseudomonarchia Daemonum.
The square was created with the Moon at 2º Cancer and the vision was experienced when the Moon was at 13º Cancer.
XV: A Mountain
June 20, 2018 June 21, 2018 David Crowhurst1 Comment
Servitors: Asorega, Mara, Liriol, Losimon, Lomiol, Alogil, Ragaras, Irminon, Sarasim, Ogologon, Igilon, Sigis, Gorilon, Laralos, Gesegas, Kosem, Milon, Nasi, Morilon, Ramoras, Igarag, Ekalak, Geloma, Aril, Ilekel, Lagasas, Kilik, Kokolon, Isagas, Romoron, Negen, Nolom, Nagar.
KEKASIM appears to come from Hebrew קסם (qesem), ‘magic’ at the top and right, while in MISAGER there lies the possibility of the reversal of the Hebrew רגש (regas), meaning ‘tumult,’ ‘commotion,’ ‘noise,’ ‘emotion,’ making the word REGASIM when affixed with the collectivised suffix –im. The spirit name in the central cross is that of Asorega, coming from סריג (soreg) relating to the ‘boundary wall’ that came in the form of a fence of reticulated or weaved sticks that closed the inner Temple of the Hebrews off from Gentiles or the ritually impure. The meaning of this word is the same as that of the Hebrew for ‘grid,’ ‘grill’ or ‘grate,’ which may account for the ‘grid’ pattern evident in the squares. ELISONI resembles the Greek ἐλέησον (eleison), which denotes the quality of ‘mercy.’
The mountain revealed itself as the same high, snowy peak I saw in the vision of A Snow. What was left of my old body lay contained by the clothes I was wearing. From one of the pockets, I pulled a golden talisman that resembled an Ankh, the strap of which was like the wings of an angel, while the face of a cherub or female angel lay in the cross’s interection. I pushed the remains of the body into a narrow hole it had been lying over, sending it plummeting down a narrow shaft into the roots of the mountain. Looking down, I could see a deep, blue, light glowing far below and considered exploring it, but decided against it because of how narrow it was. Looking around the vista, I could see the bluish mountains that the previous vision of A Castle on a Mountain was set in far away to the south, and beyond it was the Lake. Looking around at the landscape I asked what the name of this strange land was and received an answer from a disembodied voice which gave an answer that sounded like Kariouna. After hearing this name, I flew into a pall of clouds that lay before me in the west and rose above them before coming to rest on a much higher peak. Only a small portion of this peak was visible above the clouds, but all was cloudless and blue in that highest place.
Then I became aware of the presence of a spirit floating in the air before me in the east, its face skull-like with the remnants of its flesh flapping in the wind, while its strands of thin hair and its ragged black cloak billowed similarly. Then another three spirits identical in appearance to the first came from the other three cardinal directions. With me in the centre, they locked their hands together around me and flew me high into the sky with them. It was explained that these high airs were their dwelling place, and they were taking me up so that I can see all of the Earth below me, revolving as they flew. When they finished moving, they told me that they were intermediaries between that which was celestial and that which was not, and each of them ruled a portion of the world and governed the boundaries between the above and the below—microcosm and macrocosm—giving power over the elements in the material or external world while granting gnosis of the spiritual or internal world.
After they explained this, I saw one of them appear with the face of a lion, but the veils the others wore were not put aside in this way. The one with the lion face informed me that the golden, angel ankh I had been given was also a dagger and instructed me to pull it out, which I did to find a short, tapering, razor-sharp blade sliding free of its golden scabbard. Then I was told that this tool was the means to ‘unlock’ the four spirits as it was also a key which should be borne to obtain their favour and that of all of the spirits under their sway. With their consent, I inserted the dagger into each of their bodies and turned it, beginning with the one in the east, then the ones in the north, west and south.
Then I was back on the ground and the Four Great Spirits were gone. I went back to the spot lower down where I had pushed my old corpse into the heart of the mountain and decided to descend to see what was down there. Once I had reached the bottom I saw that the blue light I had seen emanating from its depths came from a beautiful lagoon lit by rays of bright sunlight burning down from above. On the shore of the underground pool lay a rowing boat which, having nowhere else to go, I boarded and began to row. As I approached the centre of the small lake, a maelstrom appeared and sucked my boat into it, casting me onto the wet floor of a cave far below where the boat was smashed to pieces but I somehow remained unhurt. Then I left the cave through a fissure in the rock to find a car waiting for me outside, which I entered and drove away in.
In this vision, the nexus of ‘above’ and ‘below’ could be thought of as the same kind of ‘boundary’ suggested in the name of the spirit Asorega. The mountain or high place as the terrestrial location where the boundaries between worlds are notoriously thin and permeable is long established, with connections between mountains and ‘peak-numinosity’ being well attested as the space where the celestial and earthly realms intersect across the spectrum of the world’s myths and religions. These are evident in the experiences of Moses on Mount Sinai, of Christ at the high place Satan showed him the vision of the four corners of the Earth (and later the Mount of Transfiguration and Golgotha), in the ascent made to high places such as Gorsedd Arberth in order to enter the Otherworld in the Mabinogion, in the depictions of Mount Olympus and Mount Zaphon as the abodes of the gods in Greek and Canaanite myth and in the figurative Mountain of the Adepts, Mount Abiegni, in the Thelemic and Rosicrucian traditions.
By virtue of their revelations and cardinal attributions, the four spirits I conversed with were probably the Four Kings—Oriens, Amaymon, Paymon and Egyn—whose presence has been hinted at in many of the previous visions, with the most overt being that of Oriens in the vision of Farm Buildings, though they were also represented by four beams of light in the vision of A Castle on a Mountain. In concurrence with that vision, only one of those spirits spoke and revealed more of itself, being the one in the East, Oriens.
The name Kariouna I received, which was that given to the world I was looking upon, may have its origins in the Ancient Greek κάρυον (karyon), meaning ‘head.’ This backs up a notion I had during the vision of Wild Animals where I had the sense, from the hemispheric nature of the amphitheatre, that I was in communication with some aspect of my brain. Together, these visions suggest that this astral world I have been exploring is a product of my mind and therefore of my brain. This is certainly the case to an extent with magical tools such as scrying and astral travel and is not something I would seek to dispute. What is interesting about such experiences however is the way that certain images, words and symbols take shape in the mind, suggesting that some kind of deep-level communication is taking place, either with extraneous spiritual entities or with some impersonal and unfathomable part of the psyche which possesses the same kind of preternatural that extraneous entities or daemons would. The argument about which of the two these and other magical phenomena can be attributed to is ultimately moot and will never be one that all practitioners agree upon, but my experience with such things leads me to believe that this sort of ‘astral’ work takes place on the threshold; the intersection of what is self and what is not-self. It is self-communication, yes, but it also takes place both at and beyond the borders of self, in a liminal area where other intelligences have influence over the contents of the unconscious mind which in turn comes to present awareness through the media of the personal psyche.
That the answer κάρυον, ‘head,’ I was given to my question about the nature of this world came in an ancient language I have no great knowledge of, while others have come in Hebrew and Latin or Kabbalistic, mythological or other symbolic correspondences, appears to provide proof that it is not just ourselves we are communicating with when we work with such things. Nor can it be some unexplainable process of depth-psychology that is being experienced unless such unaccountable knowledge can be said to be intrinsic to one’s psyche through theoretical constructs such as the collective unconscious or morphic fields. Ultimately then, I would postulate that the ‘liminal’ space such experiences take place in is that of the intersection between self and not-self and represents the same kind of boundary or veil between one ‘realm’ and another—one worldly and functional, the other invisible and mysterious—that the name Asorega and the Soreg stone of the ancient Jewish Temple represent.
Aside from the words and names already explored above, names with some relevance to this vision include: Sarasim, meaning ‘deep roots’ which relates to the deep cavern beneath the mountain; Mara, whose name relates to caves and grottoes and therefore ties in with the ‘deep roots’ of Sarasim; Nagar, meaning ‘fluid’ or ‘liquid,’ which relates to the lagoon in that grotto; Igarag, whose name pertains to the frost and cold associated with the upper reaches of the mountain; and Nolom, from the Hebrew נעלם (nolom) meaning ‘hidden’ or ‘concealed.’
|
cc/2020-05/en_middle_0097.json.gz/line1400095
|
__label__cc
| 0.525636
| 0.474364
|
AFTER 161 YEARS, AN ERA OF LOCAL NEWS ENDS IN MARTINEZ
27 December 2019 December 27, 2019 Jim KirklandLeave a comment
The Martinez News-Gazette has been publishing for so long, it once sent a reporter to cover the Civil War. Now, one of California’s oldest-running newspapers will meet the same fate of hundreds of other local news organizations throughout the country, and shutter its newsroom before year’s end. ‘Anything happening now, unfortunately, it’s not going to be covered. That’s the news hole.’Rick Jones, managing editor of the Martinez News-Gazette. “Not to pat ourselves and say we’re winning Pulitzers, but we are
California freelance journalists sue over new state law
17 December 2019 December 17, 2019 Antonia EhlersLeave a comment
By DON THOMPSON Associated Press SACRAMENTO, Calif. (AP) — Freelance writers and photographers on Tuesday filed the second legal challenge to a broad new California labor law that they say could put some independent journalists out of business. The law taking effect Jan. 1 aims to give wage and benefit protections to people who work as independent contractors. While the public focus has been largely on ride-share companies such as Uber and Lyft, the lawsuit brought by the American Society
Press Club Responds to Student Censorship
The San Francisco Press Club is disturbed by the actions of a teacher and assistant principal at Palo Alto High School who tried to block student journalists covering a Nov. 4 police chase on the Paly campus. The students, who were in a journalism class at the time, wanted to take photos of a police officer who was injured in the chase. They waited until Principal Adam Paulson announced an all-clear over the intercom. One would assume there was no
42nd SF Press Club Dinner honors journalists
30 November 2019 November 30, 2019 Jim KirklandLeave a comment
The San Francisco Press Club held its 42nd annual journalism awards dinner at the Hilton San Francisco Airport Bayfront Hotel in Burlingame on Nov. 7. More than 100 journalists were recognized for their work in digital media, blogs, newspaper, magazine/trade publications and radio. Entries were judged by the journalism clubs in Milwaukee, New Orleans, San Diego and Cleveland. NBC Bay Area Senior Investigative Reporter Stephen Stock was the keynote speaker and spoke about the news media’s role in bringing important
Journalists Critical of Big Tech for Demise of Local News Coverage
30 November 2019 December 2, 2019 Jim KirklandLeave a comment
By Meyer Gorelick courtesy of The Guardsman/CCSF Facebook, Google, and Apple have grown into insurmountable competitors and obstacles for many local news outlets, according a panel of journalists at the Diego Rivera Theatre at City College on Wednesday, Nov. 20, discussing the impact of Silicon Valley giants on how the public gets its daily news. They collectively said these corporations have become gatekeepers who soak up all of the advertising revenue that local publishers rely on to stay in business,
2019 Dinner Award Winners
8 November 2019 November 30, 2019 Jim KirklandLeave a comment
Digital Media: Blog/Commentary First Place Nirupama Vaidhyanathan, Jaya Padmanabhan, “What Does Our Society Need?”, India Currents Second Place Jaya Padmanabhan, “Vinod Khosla’s Illiberal Views on Education”, India Currents Digital Media: Columns: Features First Place Sarita Sarvate, Swathi Ramprasad, Jaya Padmanabhan, “Questions of Identity”, India Currents Digital Media: Columns-News/Political First Place Nirupama Vaidhyanathan, Nirupama Vaidhyanathan, Isha Trivedi, “Speaking Up”, India Currents Digital Media: Environment/Nature Report First Place Mark Hedin,
Hundreds attend all-day event for journalism students
2 October 2019 October 2, 2019 Antonia EhlersLeave a comment
Nearly 400 students gathered Saturday, Sept. 28, for a day of journalism workshops and advising during NorCal Media Day at Palo Alto High School. The students and their advisers came from 35 high schools throughout Northern California for an array of workshops presented by media professionals. The event was hosted by the Journalism Education Association of Northern California, the regional branch of a national organization. Volunteers help provide staffing for the presentations. Press Club volunteers included board members Edrie Blackwelder,
News photographer Al Bullock captured history
19 August 2019 August 22, 2019 Antonia EhlersLeave a comment
A Belmont man who captured many historical events as a Navy cameraman and later as a KGO-TV Channel 7 photographer — including the bombing of Pearl Harbor and the Loma Prieta earthquake in 1989 — died Aug. 16 at age 96. For the skinny 17 year old kid the choice he had before him was really no choice. Basically it was Reform school or the Navy. He kissed his hometown of Utica New York goodbye and signed up. The year
Judge Orders Affidavit Unsealed in Carmody Case
26 July 2019 July 26, 2019 Antonia EhlersLeave a comment
Last week, San Francisco Superior Court Judge Rochelle East granted SPJ NorCal, the First Amendment Coalition and the Reporters Committee for Freedom of the Press’s motion to unseal as to all but one paragraph of an 11-page affidavit that San Francisco police submitted to obtain the first of five search warrants targeting freelance journalist Bryan Carmody. Judge East ordered that this material be unsealed by Tuesday, July 23 — the same day as SPJ NorCal’s Shield Law Panel at UC Berkeley (details
SF Press Club open letter re: The Bryan Carmody case
16 May 2019 May 17, 2019 Antonia EhlersLeave a comment
SAN FRANCISCO PRESS CLUBA Professional Journalism Organization Serving the Greater Bay Area https://sfpressclub.org(650) 714-4494 May 16, 2019 Dear District Attorney Gascon and Attorney General Becerra: The San Francisco Press Club, an organization of reporters, editors, producers, photographers and other news media professionals, strongly objects to the San Francisco police raid of the home and office of freelance journalist Bryan Carmody on May 10. Carmody, a freelancer who has sold stories to news outlets for many years, came into possession of
|
cc/2020-05/en_middle_0097.json.gz/line1400098
|
__label__cc
| 0.647554
| 0.352446
|
Learn From Me Comedy Showcase with Shanti Charan, Kyle Clark, Joe Kwaczala, Philip Schallberger, Riley Silverman, Geoff Tice and Cameron Vannini, Hosted by Sean McKenzie
The Learn From Me Comedy Showcase is produced by San Francisco comedy booker/producer and professional groomsman, Jeff Zamaria. What once started as a weekly showcase, has now grown into a full on comedy production company. Learn From Me Comedy features some of the best comics from across the country, and the brightest up and coming comics in the Bay Area. It has consistently been one of the top shows in SF, and past guests have included: Todd Glass, Beth Stelling, Andy Kindler, Eddie Pepitone, Iliza Shlesinger, Judah Friedlander, Jimmy Pardo and many more. Somebody even once said that it's "maybe the best comedy showcase in SF". Not too sure who that was, but they are correct...
Learn From Me Comedy is proud to be a part of the 16th annual SF Sketchfest! $15
Cameron Vannini
Cameron Vannini is a San Francisco based comedian. His sarcastic sense of humor and hilarious ability to share and examine his real life experiences, makes him a favorite in the bay area by both audiences & fellow comics alike. Having performed all over the country, Cameron is a regular... Read More →
Geoff Tice
Geoff Tice is a stand-up comedian from Boulder, Colorado who has performed in festivals, clubs, bars, and basements all across America. In 2016, he performed at the CROM Comedy Festival, SF Sketchfest, and Denver's High Plains Comedy Festival.
Joe Kwaczala
Joe Kwaczala is a Los Angeles-based comedian from Chicago who stays busy. As a writer, he has contributed to The Onion News Network, ClickHole, and Funny or Die. As a stand-up, he has performed at San Francisco Sketchfest, the Comedy Exposition, and the Ventura Comedy Festival. He... Read More →
Kyle Clark
Kyle Clark is a Los Angeles based comic. Blending long form story telling with absurdist wit, he has become a unique voice in LA over the past 8 years. He just recorded his second comedy album "I'm a Person" which will be out this fall.
Philip Schallberger
Phil Schalberger is a comedian from Portland Oregon. He's recognized as one of the most unique and uncompromising comics in the Pacific Northwest and has been featured in the Seattle Sketchfest, San Francisco Sketchfest, Bridgetown Comedy Festival, and TBA. Mixing his years of experience... Read More →
Riley Silverman
A Los Angeles resident with deep midwestern roots, the dark yet silly comedy of Riley Silverman has been seen on MTV’s Acting Out, Comedy Central’s Not Safe with Nikki Glaser, and a multi-year run at Portland's All Jane comedy festival. Her debut comedy album, Intimate Apparel... Read More →
Sean McKenzie
Sean McKenzie tells smart jokes with a big, dumb smile on his face. He tells these jokes at comedy clubs (San Jose Improv), on TV (Viceland), at festivals (SF Sketchfest), dive bars, bowling alleys, and during instrumental breaks of long karaoke songs.One time when he was a kid, Sean... Read More →
Shanti Charan
Shanti’s bubbly personality and contagious smile lure in audiences and her comedic abilities keep them laughing. She is a Bay Area favorite, producer of the monthly show Oakland Comedy Shop, and a regular at every local club including both San Francisco and Sacramento Punch Line... Read More →
Doc's Lab 124 Columbus Avenue, San Francisco, CA 94133
|
cc/2020-05/en_middle_0097.json.gz/line1400099
|
__label__cc
| 0.659063
| 0.340937
|
Chris Morris on Whodunnit? Finding the mystery 1080 testing lab
Ashton Dempsey on Whodunnit? Finding the mystery 1080 testing lab
Clean Green NZ on Whodunnit? Finding the mystery 1080 testing lab
Grant Jacobs on Whodunnit? Finding the mystery 1080 testing lab
Search within Code for life
Back to Code for life
Note to science communicators–alleles not "disease genes"
By Grant Jacobs • 19/11/2009 • 5
Popular science writing about genetic diseases, and even “common language” explanations by some scientists, use a term that conveys the wrong concept.
Let me vent a little. I’m writing a statement for an up-coming meeting on genomics, medicine and law. I keep crossing a turn of phrase in the articles intended for a general audience that I dislike.
It’s commonly written “a patient carries a copy of a gene for a disease” or “a patient has a disease gene”, rather than “a patient has a change (or mutation) in the (normal) gene for X which results in disease Y”.
Sure, it’s a convenient short-hand.
It’s not helped that it’s legitimised by some scientists using it either but it’s laziness, really.
The trouble–as I see it–is that scientists are well aware that it’s a shorthand that isn’t to be read literally. When read literally it conveys the wrong concept.
How are general readers to know that?
To me a large part of science communication is conveying the concepts. The concept here is not that the patient has a new gene that causes a disease, it’s that they have a variant of the normal gene that causes a disease.
For those so inclined, the formal term for ‘a variant of a gene’ is ‘allele’. I’m not expecting this term to pop up in popular science any time soon. I do wish people would try convey the right concept, though.
It’s lazy to write otherwise, to my mind.
Other science journalism posts in Code for life:
Three kinds of knowledge about science journalism
Science journalism–critical analysis not debate
Sidebar scientists
Book review: Victorian Popularizers of Science
Scientists can’t write?
5 Responses to “Note to science communicators–alleles not "disease genes"”
Tweets that mention Note to science communicators—alleles not “disease genes†| Code for Life -- Topsy.com says:
[…] This post was mentioned on Twitter by Sciblogs NZ, Grant Jacobs. Grant Jacobs said: @BoraZ Science communicators—Convey the right concept: not "new" "disease genes", but variations of existing ones http://bit.ly/3iHZQ1 […]
chiz says:
Ha, I’ve noticed this too. Its just part of the sloppiness that passes for science journalism.
Don’t assume, btw, that people who use the word ‘allele’ knnow what it means. Those crackpots are everywhere. About a decade I went to an anti-GE meeting organised by the Green party. We were told that the speaker had been studying the subject extensively for two years. He duely got up and, within the first minute of speaking, had told us that human chromosomes come in pairs each of which was known as an allele. I was the only one there who realised what he had just revealed about his level of understanding. Incredibly, despite such alow starting point, it managed to sink further.
Alison Campbell says:
Couldn’t agree more, Grant! Unfortunately, not only do those who use ‘allele’ not necessarily know what it means, but those who jolly well should also mis-use the term dreadfully.
Grant Jacobs says:
I think I should make myself clear: I am not trying to encourage people to use the term ‘allele’ 😉 I only put it in the title because titles need to be compact. I am trying to encourage people to re-phrase their descriptions of “disease genes” to correctly capture the allele concept.
I thought for a while about putting something else in the title but gave up having only so much time, but thought it ironic that I was using it in the title, given I wanted to focus on the descriptions of the concept, not the term.
You’re right that some people throw around scientific terms to give themselves credibility they don’t always deserve. As for the people who should know better…
Science writing vs. science journalism | Code for Life says:
[…] Note to science communicators—alleles, not “disease genes†[…]
About Code for life
Code for Life is the blog of Dr Grant Jacobs who has wide-ranging interests in science-related subjects, especially genetics, bioinformatics and science communication. To learn more about Code for Life (topics, copyright, comments, writing), see the introductory page Twitter: @BioinfoTools
Grant Jacobs on More commentary on AgResearch plans
Grant Jacobs on Measles vaccination a priority for travel to islands and Phillipines
Two perspectives on GE developments - and an appeal for ALL political parties to get up to date with their policies - NZIAHS on Changing the GMO regulations – the ministry options
Two perspectives on GE developments - and an appeal for ALL political parties to get up to date with their policies - NZIAHS on Green Party GM policy and discussion about GE or GMOs
|
cc/2020-05/en_middle_0097.json.gz/line1400104
|
__label__cc
| 0.550927
| 0.449073
|
In Review: Stomping Ground
Ben & Annie are a young couple on a weekend trip to Annie's small North Carolina home town who, after meeting a charming old friend, embark on an impromptu 'Bigfoot hunt'
by Ian Cullen February 22, 2016
Synopsis: Ben & Annie are a young couple on a weekend trip to Annie’s small North Carolina home town who, after meeting a charming old friend, embark on an impromptu ‘Bigfoot hunt’ that threatens both their relationship and their lives.
Review: What attracted me to want to initially review this movie was Big Foot. But sadly he is more talked about than actually seen in this film, which is perhaps just as well given the eventual reveal is not to much further along than Andre The Giant in the Big Foot suit from 1970’s ‘Six Million Dollar Man’.
Instead of a Big Foot horror movie. This is more of a relationship drama and is more about Ben and Annie than it is about Big Foot or indeed the hunt for him.
Basically Ben and Annie connect with some of Annie’s old friends and they spontaneously go off on a hunt in their old stomping ground to share stories around the camp fire and try and scare each other with tales of Big Foot. It’s all good fun, but as far as horror and suspense goes. There isn’t any.
The actors put on a good show though and seem to work their butts off. But from a story-line point of view its a little to relationship focused and at times I thought I was watching a soap and not a horror flick.
This is an indie film. So obviously without the budget for decent effects and make-up. It was always going to be a struggle. Hence why we likely do not see much of Big Foot until the end.
What makes this film is the acting and some of the characterizations, but sadly the story and story beats were kind of slow and the payoff at the end wasn’t really that great.
The music score was full on red neck banjo’s and such and is one aspect that I quite liked about the film. In fact the music evoked a better sense of tension for me than the films story.
‘Stomping Ground’ comes out on DVD and VOD on March 8th. If your a fan of indie films it is probably worth a look. But if you are looking for horror and suspense and what not. I suggest you rent this first if you can before making your decision. Its not one that will fit all tastes.
It didn’t really rock my socks off, which is sad because I really, really wanted to like it.
Stomping Ground
Big FootDVDFeatureStomping GroundVOD
In Review: Buffy the Vampire Slayer: Season 10 #24
In Review: Ripper Street – Edmund Reid Did This
by Ian Cullen - Feb 22, 2016
|
cc/2020-05/en_middle_0097.json.gz/line1400105
|
__label__wiki
| 0.745562
| 0.745562
|
Matthew Vaughn Reveals Title For ‘Kingsman 2’
"I have no reason for another massacre to happen. But I have other sequences you've never seen before."
by Ian Cullen March 30, 2016
Matthew Vaughn has revealed the official title for ‘Kingsman 2’, which begins filming next month.
In a recent for Empire Magazine the director revealed the films title to be ‘Kingsman: The Golden Circle’.
Vaughn also hinted at what we can expect to see in the sequel to the much loved 2014 movie.
“You try not to read what people want, but they do want another church sequence,” he said.
“I have no reason for another massacre to happen. But I have other sequences you’ve never seen before.”
The director was also open about some of his initial doubts about directing the sequel.
“I was worried about the villain. Spy films are only as good as their villains. Then one morning I woke up with the whole storyline in place, and a new villain plot.”
Kingsman: The Golden Circle is currently set for release on June 16, 2017.
FeatureKingsman 2Kingsman: The Golden CircleMark MillarMatthew Vaughn
In Review: iZombie, Episode 29 “Pour Some Sugar, Zombie”
by Patrick Hayes - Mar 30, 2016
Check Out Some Awesome Footage From The ‘Superman’ Game That Never Was
by Ian Cullen - Mar 30, 2016
|
cc/2020-05/en_middle_0097.json.gz/line1400106
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.