Split (1)

train · 367k rows

pred_label stringclasses 2 values	pred_label_prob float64 0.5 1	wiki_prob float64 0.25 1	text stringlengths 182 1M	source stringlengths 39 45
__label__cc	0.631552	0.368448	Peter Sinks, UT Climate Started by IbrChris , Mar 02 2015 09:07 AM, 152 replies to this topic IbrChris Moderating Meteorologist LocationTigard, OR and Portland, OR (work) Peter Sinks are a series of three "sinks" or depressions without an outlet (referred to as dolines geologically) located in the Bear River Range of northern Utah between Logan and Bear Lake. They are known as one of the coldest spots in the lower 48 with a record low of -69 recorded in Feb 1985 (one degree shy of Lower 48 US record). The area has a reverse-treeline (lower portion of sinks have no trees due to cold temperatures rather than lack of moisture). Campbell Scientific has partnered with Utah State University's Utah Climate Center since 2010 in a project to monitor conditions at the sinks. Here it is my aim to explore the data we have received since 2010 as well as the prior records from broken periods of observation dating back to the 1980s. All-time record lows at Peter Sinks (since 1985), temperatures recorded at "Peter Sink" (north sink) unless otherwise noted: Jan: -66 on 1/31/1985 Feb: -69 on 2/1/1985 Mar: -52 in 2002 (early month) at Middle Sink Apr: -41 on 4/1/2008 at Middle Sink May: -19 in 1983 Jun: 3 in 2001 Jul: 15 in 1984 Aug: 7 in 2005 Sep: -10 in 2000 (late Sept 2000 cold wave) Oct: -32 in 2002 (probably Oct 31st) Nov: -47 in 2003 at Middle Sink Dec: -57 on 12/23/1990 Coldest lows since Campbell Scientific instrumentation installed in 2010. Note that none of the records from pre-Campbell era have been broken yet (edit: New record low for July was set in 2015), however the period of record is only 2010-2016 thus far. Jan: -46 on 1/13/2013 and 1/14/2013 Feb: -46 on 2/22/2010 Mar: -40 on 3/25/2013 Apr: -26 on 4/7/2010 May: -13 on 5/7/2010 Jun: 10 on 6/17/2011 Jul: 13 on 7/29/2015 Aug: 14 on 8/4/2016 Sep: 9 on 9/12/2012 Oct: -21 on 10/28/2010 Nov: -44 on 11/16/2014 Monthly mean High/Low temperatures based on Jan 2010-Feb 2015 data Jan: 28.7 \| -4.1 Feb: 29.1 \| -6.2 Mar: 37.5 \| 3.3 Apr: 41.9 \| 9.9 May: 50.5 \| 21.7 Jun: 62.6 \| 28.4 Jul: 73.8 \| 35.9 Aug: 71.7 \| 34.8 Sep: 63.9 \| 26.9 Oct: 49.5 \| 19.7 Nov: 34.4 \| 5.8 Dec: 27.0 \| -3.9 Annual: 47.6 \| 14.4 Let's also look at some other interesting stats, first the WARMEST low temperature recorded each month (2010-Feb 2015) at Peter Sinks: Jan: 28 Feb: 34 Mar: 35 Apr: 35 May: 40 Jun: 44 Jul: 55 Aug: 51 Sep: 50 Oct: 37 Nov: 34 Dec: 31 There have been relatively few occurrences of lows at or above 50 degrees: 55 on Jul 16, 2013 51 on Aug 23, 2013 50 on Aug 4, 2014 50 on Sep 11, 2013 Warmest high temperatures each month (2010-Feb 2015): Like many high elevation locations the temperature at Peter Sinks in wintertime is modulated by subsidence inversions with the warmest temperatures in winter months experienced during periods of strong upper level ridging. Overnight lows however are modulated by wind...to achieve decoupling the wind must go calm at the sink floor, any wind (even 5 mph) will result in too much mixing and keep temperatures from falling much lower than on the rim. The temperature profile can easily decouple during periods of upper level ridging however, which results in some staggering diurnal temperature ranges, the largest of which was 74 degrees on Feb 22, 2010 (high of 28, low of -46). I will continue this thread by adding brief monthly summaries for Peter Sinks (mean high/low, warmest high/low and other interesting statistics as they happen). iFred and luminen like this The Pacific Northwest: Where storms go to die. For some photos and a basic description of what allows the area to get so cold, see http://wasatchweathe...eter-sinks.html Let's compare locations with mean minimum temperatures below zero in January for stations in the western US and see which are as cold or colder than Peter Sinks. I seem to recall a few in Colorado that are slightly colder on average (although absolute minima are likely warmer than Peter Sinks at those locations). I'll use 1981-2010 normals where available and POR normals for areas with less than 30 years of data. Italics indicate value estimated using 1981-2010 PRISM dataset, not official NCDC values. -11.0 Embarrass, MN (for comparison), coldest in lower 48. -10.3 Creede WTP, CO -7.6 Crested Butte, CO -7.5 Taylor Park, CO -7.1 Darwin Ranch, WY -7.0 Boulder Rearing Stn, WY -6.9 Gunnison 3SW, CO -5.6 Antero Rsvr, CO -5.2 Rio Grande Rsvr, CO -5.2 Mt Rainier Summit, WA -4.5 Daniel Fish Hatchery, WY -4.3 Silverton, CO -4.1 Peter Sinks, UT -4.0 Big Piney, WY -3.7 Pikes Peak Summit, CO -3.5 Hermit 7ESE, CO -3.1 Bondurant, WY -2.7 Alamosa 2S, CO -2.7 Cochetopa Creek, CO -2.5 Westby, MT -2.5 La Barge, WY -2.3 Copper Basin, ID (RAWS 1986-2010) -2.2 Waverly 1W, CO -1.9 Medicine Lake 3SE, MT -1.8 Fraser, CO -1.7 Stanley, ID -1.7 Alamosa Bergman Fld, CO -1.7 Lake George 8SW, CO -1.7 Monte Vista 2W, CO -1.7 Sage 4NNW, WY -1.5 Opheim 12SSE, MT -1.5 Shirley Basin, WY -1.3 Kremmling, CO -1.3 Harbison Meadow, CO -1.1 Blue Mesa Lake, CO -1.1 Williams Fork Dam, CO -1.0 Grand Teton Summit, WY -0.7 Scobey 4NW, MT -0.4 Snake River, WY -0.3 Wolf Point Intl Ap, MT Ice fog in the bottom of Middle Sink on Jan 4, 2009 at 8 am. The temperature was -53F. Just found this chart which breaks down the absolute minimums recorded at Peter Sinks with records for the lower 48...Peter Sinks has beaten several and challenges several others. LocationGrand Junction Colorado Very interesting Chris. I am a mountain weather buff (I spend most of my free times in the mountains) and have long been interested in Peters Sink. There are other cold air basins (Peters Sink in unique since it has no outlet) in the Rocky Mountains that can be found either by intention or accident. I've stumbled upon many and have recorded some really cold (especially in summer temperatures) in them. For example, I have recorded a 10F in August in Quinnabaugh Meadows in the Beartooth Mountains of Montana and a 15F at Amethyst Lake in July in the Uinta Mountains of Utah, which matches the 15F record at Peters Sink. For the event at Quinnabaugh Meadows, it actually froze my 2 liter waterbottle close to solid. Sometimes in winter you can walk through these cold air sinks and valleys and notice the changes in temperatures and see the trees much more frosted with ice fog, though I've never recorded any temperatures in winter close to the ones in Peters Sink. Anyway, I would be really interested in hearing where you got the 1981-2010 PRISM dataset data for Mount Rainier, Pikes Peak, and Grand Teton. I am also interested in mountain top temperatures and have created the following webpage: http://www.summitpos...-summits/171585 I would like to get some more complete information for Rainier and Pikes Peak as well as any data for the Grand Teton or any other mountain summits. iFred, Jesse and IbrChris like this Scott you can get the PRISM values here: http://prismmap.nacse.org/nn/ Just enter coordinates in decimal format and select either time series (enter start and end years) or normals. The resolution is 2.5 minutes of Lat/Lon. For time series the elevation of the grid point is noted. While this isn't as good as having an actual station it provides a decent estimate for remote areas. This is one of the more popular "found by Google" pages on the forums. It would be nice to trek out there and set up some cheap temp sensors and record the inversion from the rim to the basin. LocationPhoenix Arizona Maybe I can get my department to do a study on it. iFred and Snowman5678 like this Nov 24: 3.3", 30: 1" (4.3") ::: Dec 2: 4.6", 3: .8", 5: .3", 12: 2.3", 21: .6", 24: 1.4", 25: 1.5", 26: 2.7", 27: 1.5", 30: .8" (16.5") ::: Jan 6: 2.7", 16: 1.1", 18: 1", 21: 5.6", 23: .4" (10.8") ::: Feb 5: 3.7", 6: 4.3", 7: 2.0", 10: 4.5", 15: 3.4", 19: 2.8" (20.7") ::: Mar 2: 3.0", 3: 2.3", 8: 3.2", 13: 6.0", 14: 1.1", 28: 1.2", 29: 3.9" (20.7") ::: April 10: .3", 12: 3" (3.3") Total: 76.3" Dec 4: 3.2", 16: 0.9", 20: 2.1", 23: 1.5", 25: 4.6" (12.3") ::: Jan 6: 1.5", 20: 10.8", 25: 1.5" (13.8") ::: Feb 19: 8.6", 20: 2.4", 23: 7.1", 25: .5" (18.6") ::: Mar 4: 13", 15: 1.8", 17: 5.3", 25: 4.2" (24.3") ::: April 12: 1", 17: 1.3" (2.3") Winter 2016/17 Snow: Nov 17: 3.2", 23: 1.6", 28: 9.2" (14) ::: Dec 1: .5", 16: 2.5", 25: 13" (16) ::: Jan 2: 5", 3: 2.4", 4: 7.7", 12: 1", 19: 1.2", 21: 13", 23: 6", 24: 1", 25: 3.7", 26: 2.5" (43.5) ::: Feb 11: .5", 23: 6.5", 27: 4.5" (13.5) ::: Mar 5: 5.5" (5.5) ::: Apr 8: 2", 9: 1.8" (3.8) ::: May 17: 1" (1) Already being monitored: http://twdef.usu.edu...inks/Sinks.html Peter Sinks Climate Data - 2016 (so far) Monthly average high/low...extreme high/extreme low for 2016 ....................Jan....Feb.....Mar....Apr....May....Jun....Jul.....Aug Avg High......24.6...32.1...34.1...42.6...50.0...70.0...74.9...74.4 Avg Low.......-7.5...-1.6....5.7.....14.6....21.6...30.4...30.4...25.7 Max High......36.....45......46......56......62.....81.....83......79 Min Low.......-41....-28.....-29.....-9.......6......17......17......14 Coldest low: -41 on Jan 1st. Warmest low: 46 on Jul 31st Nights above freezing (32): Jan: 0 (warmest 20) Feb: 0 (warmest 29) Mar: 0 (warmest 22) Apr: 0 (warmest 30) May: 2 (warmest 33) Jun: 9 (warmest 44) Jul: 11 (warmest 46) Aug: 4 (warmest 37) Total: 26 (through Aug) Nights below zero: Apr: 3 May: 0 Jun: 0 Jul: 0 Aug: 0 Noteworthy records: * 2016 so far has fewest number of above-freezing lows of any year on record (2010-present) * Coldest low recorded in Aug since 2010: 14 on Aug 4, 2016 (previous record 18) -4.7 Peter Sinks, UT (2010-2016 data) Updated Peter Sinks mean January low (2010-2016 data) 6.8F this morning at Peters Sink: https://climate.usur...Sinks/index.php Chilly for early September. Interesting, but if you compare the data for the same years for those other stations (2010-2016) Embarrass has dropped way down the list. The past few years 2010-2016 have had some warm winters (if it weren't for 2014, Embarrass would just barely beat Peters Sink). Using the NOW Data from NOAA for 2010-2016 for those stations (the same years chosen for Peters Sink), here are some differences (with the example of Embarrass shown): The order changes somewhat when just 2010-2016 is looked at and Peter Sinks moves up the list: Taylor Park = -9.4 Crested Butte = -8.2 Gunnison = -7.9 Embarrass, MN = -7.8 Peter Sinks = -4.7 Antero Reservoir = -4.5 Boulder Rearing Station = -4.2 In addition to Minnesota, the Wyoming stations for 2010-2016 haven't been nearly as cold as the 1981-2010 averages. Big Piney for example, has only averaged -0.5, much warmer than the 1981-2010 average of -4.0. Had their been a 1981-2010 average for Peter Sinks, it is possible that it also could have been colder than the 2010-2016 average. IbrChris likes this The problem is, 2010-2016 is merely 7 years. That's not nearly long enough for averaging purposes. A few historically warm winters in there, too, for Embarass, MN (2012 and 2016 were both in the top-4 warmest on record). It would certainly appear they are in the same boat as the NW for lack of record cold this century. Nice to see a station in WA makes the list for coldest mean minimum in the US. I've always figured Rainier kicks Mt Washington's arse. I wasn't aware they had an official sensor at the top. Let's hope that is the trend this season! I've always figured Rainier kicks Mt Washington's arse. I wasn't aware they had an official sensor at the top. This is a misconception that a lot of westerners cling to, for whatever reason. Mount Rainier averages much more snowfall than Mount Washington, however, the summit of Mount Washington is both verifiably colder and windier than the summit of Mount Rainier. It's not even close, actually. wx_statman I don't know about the windy part, but the summit of Mt. Rainier is definitely colder. Uh, no it's not. Edit: I'm referring to winter temperatures, not annual temperatures. Just to clear that up. Lacking H20 LocationRidgefield, WA http://www.summitpos...71585#chapter_5 I'm not sure when exactly they compiled this data for Mt. Rainier, but it indicates that its summit is likely colder in DJF by a reasonably significant margin. Which should come as no surprise, 14,411' is pretty D*n high up. "Not even close" might apply, just not how you seem to think. Right now, sustained winds on Mt. Washington are 83mph gusting to 92mph. That's basically a typical day there. Some general info: http://climbing.abou...ingtonFacts.htm Mount Rainier is colder both during the winter and on an annual basis. And why wouldn't it? You're comparing 14,000 feet to 6,000 feet. LOL.."period of record, unknown; 1970s". So, no data on when (or where) these conditions were measured? And what data are you basing your "Mt. Washington is verifiably colder" statement on? LOL, do you honestly think 700-800mb temperatures are uniform between these two locations? Newsflash, upper level temperatures and antecedent humidity levels are verifiably higher @ Mt. Rainier's altitude and location versus Mt. Washington's during the winter. Hence more latent heat release during condensation/orographic lifting, etc. Absolute temperatures @ the altitude of each mountain's summit. http://www.esrl.noaa...es/printpage.pl Not only are you wrong, but you're being a dck about it. Come on dude. luminen likes this https://www.mountwas...conditions.aspx Mount Washington has colder temperatures, higher winds, and lower wind chill values than the summit of Mount Rainier, which is 8,000 feet higher. Wow, seems legit. Science aims for legitimacy. Pacific airmasses keep Mt. Rainier warmer during the winter season relative to Mt. Washington, even with the elevation differential. I'm being a d*k because you're intentionally ignoring quantitatively derivable data in favor of some fairytale. "however, the summit of Mount Washington is both verifiably colder and windier than the summit of Mount Rainier. It's not even close, actually." You were wrong with that statement, even without the hyperbole you added at the end. Then you tried to backtrack and say you were talking about winter temps. Even if we're talking about winter temps, Mount Washington would not be so much colder than Mt. Rainier to the extent that "its not even close, actually." You're wrong. And you're being a dck. You may want to take that up with the National Park Service. I didn't backtrack on anything. I clarified my statement, since we were discussing cold season low temperatures. Nice try. Hyperbole aside, everything I said is accurate. I can't find any history on this station's existence, let alone its location and period of record. You're all over the place. -5.2F average January low on Mt. Rainier summit according to 1981-2010 PRISM data. -2.7F average January low on Mt. Washington summit according to 1981-2010 data @ WRCC. What was your point again? Can you link me to this? Sounds a lot like an interpolative algorithm considering there are no stations on the summit of Mt. Rainier. Doesn't jive with the 30yr averages compiled @ the Mt. Washington observatory either. https://www.mountwas...d-extremes.aspx IbrChris provided the data for Rainier earlier in this thread. http://www.prism.ore...e.edu/explorer/ You can play around with that site if you'd like. I found the paper on it. As I suspected, it's an interpolative model, not an observational network. Will read the paper anyway, though. http://www.prism.ore..._IntJnlClim.pdf There's probably a reason why no long term station exists above 5400', less than halfway up the mountain. It's extremely inhospitable and the cold is part of that. I just crunched the raw data for 1981-2010 @ Mt. Washington. The actual average minimum was -3.1 degrees. Mount Washington is capable of colder extremes, for instance I don't think the summit of Mt. Rainier has seen -50F (the all-time record low on Mt. Washington). But if you're talking about averages its at best a wash, with a likely advantage to Mt. Rainier on a long term basis. Okay, so this is useless, unfortunately. Here's why. The highest resolution I can obtain on this model is 4km, and due to the orientation of the grid cells, none are directly situated over Mt. Washington. Hence, highest grid-cell elevation I can is 4,913ft. The summit of mount Washington is ~6500ft. So, really not helpful at all. Plus we have measured data on the summit. Here's a visual example: LocationEast Vancouver, WA (300') Yeah, there is a reason there is no visitor center reached by a paved road on top of Rainier. You and Dmitri covered it pretty well, but yeah, the argument that the top of Mount Washington is colder than Rainier is laughable. The fact that it has over double the elevation of Mount Washington (and sits at a higher latitude) more than makes up for generally warmer wintertime airmasses PNW vs New England. Pro-tip, Phil. Not backing down on arguments where you are clearly wrong like this really hurts your credibility here. luminen LocationNorth Vancouver, BC Peter Sinks' high of 28, low of -46 on Feb 22, 2010 is definitely awesome. It's almost Mars-like. Yeah, let's deny scientifically derived measurements and thermodynamic principles in favor of fairytales and non existent stations. You westerners get super defensive about your mountains for whatever reason. Maybe because they're all you have to hold onto.	cc/2020-05/en_middle_0126.json.gz/line409
__label__cc	0.706811	0.293189	Bear Pit Human Echoes Site 2015 Arena Year in Review By Joseph Devon • December 23, 2015 Posts Our first full year as an arena is now officially in the books and it is time to rest while we look back over what 2015 brought us. The first trend to jump out at us is an alarming one: the arena only ended the world 3 times this year. Donald Uitvlugt brought the destroyer of worlds to us via butter. Albert Berg let the whole clock run down. Darryl Foster let spiders take over everything. And that’s it. 3 times. In 2014 we ended the world 9 times with a truncated year. What is happening? What does this mean? Have we all decided that this world is maybe worth keeping around? Oh, sure, you could argue that the chemical cocktail hinted at in “Dairy of a Madman” will eventually run rampant. You could say that maybe the bloodthirsty plant in “Plant Life” will grow until it’s unstoppable. Maybe the aliens in nonagon spaceships will succeed in their takeover attempt in “Abysmal Midnight Blue.” Maybe the problems on Mars will never stop getting worse in “Patient #5.” But those aren’t world-ending stories. Dag nabbit, when the arena destroyed the world in 2014 we left no doubt. The agent of demise was going full tilt, looming very large, and about to hit a major town. Hell we met death incarnate 3 times in this year alone. Granted, he was a prompt in his very own battle…but still. Maybe we all just became a bit more intimate as a group. No need for faceless worlds to die when you can get up close and really stick it to an individual, right? After all we had 31 instances where protagonists died at the antagonist’s hands or the other way around. Characters died onscreen this year. Named characters. In half of the stories. In terrible ways. People were cannibalized three times. One guy ate himself. On the other hand we also had joy. True joy. We were schooled in creativity by a child. We had the fear of death diminished not once, but twice through a life well lived. We had fables and fairy tales, we had good conquering evil and childhood revisited in the most perfect of ways. Are we beginning to view the world through a wider lens? Are our experiences becomming richer and more varied as we progress? Or maybe these are all illusions, maybe every extreme is only needed because the artist demands it. Maybe J.R.D. Skinner is right, and all creative types are just chattering madmen in a world gone sane. Or maybe the arena doesn’t need to overthink this. Maybe we just need to update the records, clean up the sands, and look back happily on an amazing year. At least we finally got our bear pit. Before we go, though, we have some thank you’s and some (oddly paired) awards. The Arena “Is This Where I Bet All of My Chips?” Award goes to Albert Berg: Genres, restrictions, convention, these don’t mean a lot when Albert steps into the arena. He seems to have a love of going over all the different ways that he could tackle a prompt, then throwing them all out and betting the farm on the craziest idea possible. This year he’s given us a Choose Your Own Adventure, a reimagined Greek myth (where he wanted half of the story to be in a clear font mind you), a fable, a coming of age story, a potboiler, and the time travel insanity of “Iteration.” Albert has a way of surprising the arena, over and over again. And just when you think you’ve got your feet under you, just when you think you understand what the trick is this time around, he somehow traps you, the reader, in a story forever. With never a dull moment, Albert is the arena’s risk-taker. The Arena Explorer Award goes to Danny Brophy: If Albert tackles whatever he can in the structure of writing, Danny represents the inverse, writing about anything and everything topic-wise with a strange confidence. We still remember his snowman pondering what it felt like to be alive, and we wonder at how someone who enjoyed eating their own flesh became sympathetic to us. We may not always understand where Danny has led us, and the older authors of the arena maybe wish he would give his drafts a few more revisions, but then what the hell do we know? We never brought an artist who uses corpses as canvas, or a surrealist exploration of a pirate’s final moments onto arena sands. With childhood bonds between siblings and fratricide on the table, Danny Brophy is the arena’s prodding curiosity. The Arena Pessimist Award goes to Joseph Devon: It seems odd to be placing this award here, but looking over the past year it becomes obvious that this is where it belongs. Joseph gave us no clear wins in any of his stories. 3 times around the protagonist died, quite obviously. On camera. Once even by way of camera. Yet death is almost preferable to the hopeless lurch some of his other characters found themselves in. In Joseph’s worlds, ties are counted as losses and stalemates are ground out through sacrifice and pain. Even worthwhile battles, like for scientific advancement, get fought for so long that any value is lost. And even in a tropical island paradise humanity is ground into sand. At best, at best mind you, you are left to force some meaning into choosing who dies during a bombing in a world ravaged by war. At worst you watch a carnivorous plant eat your ex-girlfriend knowing full well that you’re next. In a year full of risk, daring to hope was the scariest thing of all, and with an unrelenting line of characters falling short, Joseph Devon is the arena’s vigilant pessimist. The Arena Optimist Award goes to Tony Southcotte: In contrast to Joseph’s record, over the course of 9 stories Tony allowed evil to stand only once, and then that was in a tiny kicker at the end of “Howling in the Deep” after our heroes had escaped. He delved into the worst sorts of places, into mines filled with slaves and the lair of a serial killer. And every time, no matter if the enemy was cancer, a cat, or a mother-in-law, the bad guy was cast down; the flesh eating cockroaches were put back in their cage. Even in a world that seemed covered in blood as with “Broken Chains,” in a land where we see nothing but death and carnage, we are still left with a hero who at least tries to retain hold of his humanity. With knights riding to the rescue on two separate occasions, and the number 1 spot in the Bear Pit (at the time of this writing), Tony is the arena’s reluctant optimist. It has been an amazing year. We want to thank all of our tournament participants. Agreeing to write for three months straight for the arena is something we appreciate beyond measure. Hannah Newell, Lu Whitley, David Webb, and our champion Donald Uitvlugt, thank you. We couldn’t do this all without our judges. Thomas Mays, Jon Jones, Kevin Veldman, Caleb Newell, D.M. Slate, thank you! And worthy of singling out, weighing in on just about every story this year, we want to give a special thanks to Rich Alix. We’ll see you all in 2016. photo credit: Grizzly Bear via photopin (license) photo credit: Hazy Sunset via photopin (license) « TWA Tournament Championship – Butter – JUDGEMENT! “Christmas Haul” by Joseph Devon » Daniel Brophy (@DannyBrophy) To whomever wrote my award speech thingy: if that doesn’t continue to inspire confidence in me to keep writing, then nothing will. To the part about the revisions: I’m all in on revising more, but to get to what I hand in, that isn’t something I shoot off haphazardly. With what time is given from the moment you read the initial prompt until handing a story you have to let go of in, its a truncated struggle to get whatever it is rumbling inside you out into the world. With any idea one comes up with individually, you work at the pace you and the idea are comfortable with, until you reach the deadlines and the goals you choose for yourself. The Arena offers none of that. You must take a chance on an idea the prompt inspires and thrusts into your head and go with it until you beat into something you can be happy with, or surrender and try another and superior and more coherent idea that you can follow along with and beat and think into coherent existence. Most of the time this year, I feel I’ve succeeded. A few times, I haven’t. I don’t try to experiment with form, genre, or style. I find something once I read the prompt that excites me. That feels like something that I haven’t heard of before, or read before, and would be exciting to see where it leads if I continue to follow that initial spark. However, my way of writing isn’t conducive to where I’m happy and sufficiently comfortable to go from initial idea to complete and “I want people to read this” in the two weeks we Arena veterans get. And I wouldn’t ever want that changed. I care about writing for the Arena. I fear it, try to imagine any excuse I can to not have to be a part of it. And I wouldn’t dare give it up. I’ve learned more about writing and grown more as a writer from being an honored and humble participant in the Arena this last year and a half then I have from over a decade of self-taught nonsense before this. To be seen as an explorer, as someone who doesn’t just try new things, but is something new and interesting every time means more to me and fuels me more than I thought possible. For being allowed and given a platform for my more coherent imaginings and disturbed ideas and thoughts, thank you, Writer’s Arena. Thank you thank you thank you. Made it through all that without one swear. See? Growing. Categories Select Category Albert Berg Author Bios Battle Threads Danny Brophy Hannah-Elizabeth Newell Joseph Devon Judgement Posts Previous Challenges Reading with the Arena Stories Tony Southcotte An Announcement from the Arena Tournament 2016 Final Round: JUDGEMENT! 2016 Tournament Final Round “Cloudcuckooland” by Donald Jacob Uitvlugt “Of a Feather” by David Webb omega replica watches replica rolex watches omega replica	cc/2020-05/en_middle_0126.json.gz/line410
__label__cc	0.734133	0.265867	Category Archives: mGlu5 Receptors Production from the C-X-C chemokines interleukin-8 (IL-8) and growth-regulated oncogene alpha Production from the C-X-C chemokines interleukin-8 (IL-8) and growth-regulated oncogene alpha (GRO-) in macrophages is stimulated by contact with individual immunodeficiency pathogen type 1 (HIV-1). and Helps. Altered cytokine creation by cells subjected to individual immunodeficiency pathogen type 1 (HIV-1) plays a part in the systemic symptoms of Helps (cachexia, anorexia, and malaise) (29), HIV-1-related human brain disease (21), and recruitment of immune system cells to contaminated tissues (42). The introduction of extremely energetic antiretroviral therapy (HAART) provides dramatically decreased HIV-1 mortality in america since 1996 (38). Sadly, many sufferers cannot tolerate therapy, and in others, level of resistance to the medications develops (19). As a result, brand-new mobile and viral goals have already been searched for for the treating HIV-1 infections, either by itself or in conjunction with HAART (24). Cytokines and their receptors are one band of such potential goals for therapy of HIV-1 attacks. Before few years, it’s been shown the fact that C-C chemokines RANTES, MIP-1 and MIP-1 suppress HIV-1 replication (12, 13). The activities of the chemokines are thought to be linked to the known reality they are ligands for CCR5, the main coreceptor utilized by monocytotropic isolates of HIV (1, 11, 14, 17, 18). Similarly, SDF-1, the only known ligand for CXCR4, the principal coreceptor for T-tropic isolates of HIV, inhibits the replication of CXCR4-using isolates of HIV (X4 HIV) (8, 20, 36). RANTES, MIP-1, MIP-1, and SDF-1 inhibit HIV-1 replication both by competing with HIV for binding to CCR5 or CXCR4 and by causing internalization of their respective receptors (2, 3, 41). Interestingly, under some circumstances these same chemokines can actually enhance HIV-1 replication (16, 23, 25, 26, 33, 40, 43). The mechanisms by which RANTES and SDF-1 can act to augment HIV-1 replication include increasing viral attachment to, and entry into, target Mmp8 cells (16, 23, 26, 43), activating intracellular signaling pathways (23, 25), and augmenting viral gene expression from the HIV-1 long terminal repeat (33). The role that other chemokines, including two members of the C-X-C chemokine family, interleukin-8 (IL-8) and growth-regulated oncogene alpha (GRO-), may play in controlling HIV-1 replication and pathogenesis has not been well established. IL-8 has been demonstrated to attract neutrophils and T Neratinib cells, stimulate monocyte adherence, and mediate angiogenesis by interacting with the C-X-C chemokine receptors CXCR1 and CXCR2 (6, 22, 27, 31, 47). GRO- was identified initially as a melanoma growth factor and later as a neutrophil chemoattractant (6). GRO- shares 43% amino acid identity with IL-8 and functions similar to IL-8 by means of its ability to ligate CXCR2 (6). Previous investigations have found either a slight inhibitory effect or no effect of IL-8 on HIV-1 replication (10, 32, 35), and GRO- was not previously known to have any effect on viral replication. In addition, neither CXCR1 nor CXCR2 has been demonstrated to function as a coreceptor for HIV entry (19). There is currently great interest in brokers Neratinib that block these same chemokines, or their cognate receptors, for the treatment of a number of illnesses, particularly inflammatory diseases (7). For example, an IL-8-specific monoclonal antibody is currently in use in clinical trials of sufferers with psoriasis (46). Various other drug discovery initiatives targeted at these pathways created SB225002, the initial reported powerful and selective nonpeptide inhibitor of the chemokine receptor (45). This little molecule inhibitor serves as an antagonist of IL-8 binding to CXCR2 (50% inhibitory focus = 22 nM), and Neratinib provides >150-flip selectivity over CXCR1 and various other Neratinib chemokine receptors (45). Many recent findings claim that interfering with IL-8 and GRO- function will be a highly effective therapy for HIV-1 infections. First, elevated degrees of both IL-8 and GRO- can be found in the serum and lungs of HIV-1-contaminated people (15, 34, 44). We’ve recently confirmed that publicity of MDM to HIV-1 network marketing leads to elevated IL-8 production, an impact mediated by Tat as well as the inflammatory cytokine tumor necrosis aspect alpha, aswell as by gp120 (B. R. Street et al., posted for publication). Furthermore, we have defined a book autocrine/paracrine loop where HIV-1 gp120 ligation of CXCR4 on monocyte-derived macrophages (MDM) stimulates the creation of GRO-, and GRO- additional stimulates HIV-1 replication (30a). We demonstrate here that IL-8 stimulates HIV-1 replication in T and MDM Neratinib lymphocytes. We also present that increased degrees of IL-8 can be found in the lymphoid tissues of sufferers with Helps. Antibodies that neutralize IL-8 activity, and antibodies that stop binding towards the receptors CXCR2 and CXCR1, can inhibit HIV-1 replication in T and macrophages cells. Blocking the activities of IL-8 and GRO- using the small-molecule inhibitor of CXCR2 SB225002 also markedly decreases HIV-1 replication. Hence, we have proven the fact that autocrine/paracrine loop where IL-8 and GRO- participate is certainly a potential focus on for antiretroviral therapy. Healing compounds presently under advancement for chemokine-mediated inflammatory disease as a result have the to become exploited for the treatment of HIV infections and AIDS.. This entry was posted in mGlu5 Receptors and tagged Mmp8, Neratinib on June 2, 2017 by Francis Hughes. The coiled person is a definite subnuclear domain enriched in little The coiled person is a definite subnuclear domain enriched in little nuclear ribonucleoprotein particles (snRNPs) involved with processing of pre-mRNA. coiled body disappearance, splicing snRNPs are distributed in the nucleoplasm, the nucleolus continues to be unaffected, as well as the cell cycle normally advances. Furthermore, cells without coiled systems for IC-83 24 h keep up with the capability to splice both adenoviral pre-mRNAs and transiently overexpressed individual -globin transcripts. To conclude, within the proper period selection of this research, no main nuclear abnormalities are discovered after coiled body disappearance. proteins SPH-1 (Tuma et al., 1993). This proteins is normally homologous to coilin at both its amino and carboxy termini extremely, but shows significantly less homology in the inner domain (find Carmo-Fonseca et al., 1994). In the nucleus of amphibian oocytes SPH-1 is normally localized in spheres that are usually equal to coiled systems (for review find Roth, 1995; Gall et al., 1995). The coilin series contains two motifs at amino acidity positions 107C112 and 181C198 that carefully match the consensus series of the easy and bipartite nuclear localization series (NLS)1, respectively (Bohmann et al., 1995and purified using an Ni-NTA agarose affinity column (Quiagen, Hilden, Germany), simply because previously explained (Bohmann et al., 1995and purified mainly because HisCtag fusion proteins by Ni-NTA affinity chromatography. Cell Tradition HeLa cells were cultivated as monolayers in minimum amount essential medium (MEM) with Earle’s Salts supplemented with 2 mM l-glutamine, 1% MEM nonessential amino acids, 50 IU/ml penicillin and 50 mg/ml streptomycin, and 10% fetal calf serum ( Int., Buckinghamshire, England, UK). Immunofluorescence For indirect immunofluorescence cells were cultivated on 10 10-mm glass coverslips. The cells were washed twice in PBS, fixed with 3.7% formaldehyde (freshly prepared from paraformaldehyde) in PBS for 10 min at room temperature, and subsequently permeabilized with 0.5% Triton X-100 in PBS for 15 min at room temperature. On the other hand, cells were 1st permeabilized with 0.5% Triton X-100 in CSK buffer (100 mM NaCl, 300 mM sucrose, 10 mM Pipes, 3 mM MgCl2, 1 mM EGTA, pH 6.8; Fey et al., 1986) comprising 0.1 mM PMSF for 1 min on snow, and subsequently fixed with 3.7% formaldehyde in CSK buffer, for 10 min at room temperature. After fixation and permeabilization the cells were rinsed in PBS comprising 0.05% Tween-20 (PBS-Tw), incubated for 30 min with primary antibodies diluted in PBS, washed in PBS-Tw, and then incubated for 30 min with the appropriate secondary antibodies conjugated to fluorescein (FITC), Texas red, or indodicarbocyanine (Cy5) (Jackson ImmunoResearch Laboratories, West Grove, PA). Finally, the coverslips were mounted in VectaShield (Vector Laboratories, Peterborough, IC-83 UK) and sealed with toenail polish. Visualization of Replication and Transcription Sites For the visualization of replication sites, 50 M bromodeoxyuridine (BrdU; and and data not demonstrated), as previously reported for clone (Rebelo et al., 1996). Table I Immunoglobulin Class, Subclass, and Light Chain Typing of Anti-coilin mAbs Number 1 Immunoblot analysis of anti-coilin mAbs. An 8% acrylamide gel was loaded with either total protein draw out from HeLa cells (2 105 cells/well) (and and and which are also recognized by indirect immunofluorescence on fixed cells. Double-labeling experiments using antibodies directed to RNA polymerase I and UBF reveal that these intranucleolar foci correspond to sites of rRNA synthesis (data not shown; Jordan at al., 1996). Interestingly, the epitope recognized by mAb- is adjacent to a critical serine IC-83 residue (serine 202) which when mutated to aspartate induces the formation of coiled body-like structures inside the nucleolus (Lyon et al., 1997; refer to Fig. ?Fig.22 and and and and and and and and and and and Noteworthy, by 24 h after injection most mAbs reveal an intense micropunctate staining pattern diffusely distributed throughout the nucleoplasm, excluding the nucleolus (Fig. ?(Fig.4,4, and and and and and and and and the sites containing coilin … To further characterize the effect of microinjected antibodies on the coiled IC-83 body, a quantitative analysis was performed. Each mAb was injected into the nuclei of interphase HeLa cells and at Ctgf 0, 6, and 24 h after injection the cells were fixed, incubated with fluorescein-conjugated secondary antibodies, and then double-labeled with a rabbit anti-coilin antiserum (204.3) detected using Texas red fluorescence. For. This entry was posted in mGlu5 Receptors and tagged Ctgf, IC-83 on June 1, 2017 by Francis Hughes.	cc/2020-05/en_middle_0126.json.gz/line411
__label__wiki	0.671794	0.671794	Virulent Memes Finally, we enter the Roger Moore period, for better or for worse. His first gig, Live and Let Die is a pretty weird one too, with a some tweaks from the established formula, but already with firm indications of the tone the series will be taking with Moore as 007. The Opening Bond’s reveal is held back for after the titles as we see a sequence of three other British agents getting bumped off in a manner of bizarre ways. Arguably Maurice Binder’s best opening sequence yet, with voodoo imagery, a really good song (which I’ll get to shortly), HELVETICA that shimmers in and out in a pleasing manner. Yeah, you get it, I love Bond movie titles. With John Barry doing other things, Paul McCartney (and Wings) gets the tap on the shoulder for the title song, which Paul co-wrote with wife Linda, and it’s a good’un. Not even Guns’n’Roses could ruin it a couple of decades down the track. The song gets another rendition by B. J. Arnau during the film proper. As for the main score, another Beatles producer George Martin is on duty, and makes a good fist of working the classic themes and the McCartneys’ title tune into the action. Mostly set in New York, New Orleans and its surrounding bayous, as well as the fictional Caribbean nation of San Monique (when I do the map at the end of this I’ll put the dot between Jamaica and Haiti). While the US locations still can’t help but looking prosaic if not downright tacky, the backwaters of Louisiana don’t seem quite as mundane as Kentucky (Goldfinger) or Las Vegas (Diamonds Are Forever). The New Fellow The first look here he’s immediately wrapped up in some Italian attache in his own place, before being rudely disturbed by M, whom he distracts with an espresso machine while his guest can get some clothes on. There’s one word that immediately comes to mind, and that’s suaaaaave. Moore’s portrayal of Bond is as more of a lover than a fighter, although he is still capable enough of the latter. Whether it’s appropriate to bring the age thing in, well, Moore was even a bit older than Connery, so while he looks youthful enough in his mid-40s, by the time he got to the end of his run you’d think a successful agent would’ve hung up his Walther by then. And by the way, he is still a prodigious sex pest, perhaps even more so… The villain du jour is Mr Big/Dr Kananga (Yaphet Kotto), the Prime Minister of San Monique who also doubles as a heroin kingpin with a chain of restaurants across the US serving as his distribution points. His cunning plan is to dump so much heroin into the States for free through these outlets that it bankrupts his opposition and then he can raise the prices clean up – so, essentially, the Coles-Woolworths strategy. He has an impressive rogues gallery of henchmen working for him, such as Tee Hee Johnson (Julius Harris), who runs a farm with crocodiles AND alligators, and a creepy prosthetic arm which he acquired after his livestock got a little unruly. There’s also Baron Samedi (Geoffrey Holder) who’s got all the moves, enjoys a good laugh, dabbles in voodoo, and is a bit of a herpetologist as well. Rounding out the lieutenants is Whisper (Earl Jolly Brown) who, erm, whispers. There’s no denying that this is pretty much a blaxploitation movie, that just so happens to have an overly mannered British gentleman in it as the fish out of water. Even so, Kananga and Tee Hee are played straight, with the acting much more dignified than the villains were able to muster in Diamonds Are Forever. The Squeeze Jane Seymour plays her first big break, Solitaire, with far more substance than whatever was going on with Tiffany Case last time ’round. Having said that, the role is suitably ludicrous as befits the film. Solitaire starts out as a psychic working for Kananga, being able to reliably foretell the future through the tarot. In which case; with this unique talent, why the hell doesn’t Kananga just go hogwild at the racetrack with Solitaire’s tips instead of dumping horse everywhere? But anyway Bond turns up in San Monique, stacks the deck so it says they’re definitely going to do it, and so they do, and it turns out Solitaire can’t read the tarot anymore because she’s no longer a virgin. Tres awks. Kananga is particularly aggrieved probably more because he wanted to be the one to deflower her than the loss of her prognostication skills. Notably, this also marks Bond’s first (but definitely not the last) inter-racial liaison, as prior to tracking down Solitaire, he also picks up Rosie Carver, ostensibly working for CIA but doubling for Kananga as well. Alas, she becomes the sacrificial lamb before she can cough up any intel. Regular Bond ally Felix Leiter pops up again, in the form of David Hedison. As Leiter usually does, he gets to do all the fixing, writes up all the paperwork, and again letting the British guy wreak havoc as he conducts his investigation on foreign soil. I should mention that it has been incredibly confusing having a different guy for Leiter every time he appears. Hedison does play the role again in a later role – much later. There’s also another return of a sort, with Quarrel Junior, the son of Quarrel from Dr No, running the boat at San Monique. I dunno, assuming that Junior was left fatherless as a result of Bond’s earlier mission, I’m not sure I’d be so cooperative in his shoes, but at least he gets to survive this adventure. The Farce Not so much allies as the comic relief, the Louisiana cops turn up, with Sheriff J W Pepper played as a good ol’ boy by Clifton James. I should cringe at the boat chase segment as a canonical example of what’s bad about the Moore movies. But if I’m going to be honest, I thought it was fairly well done. Anyway, I know already that there are better bad examples ahead. What I couldn’t really get past is Kananga’s demise, where he gets blown up. It’s bad. Probably they thought they had to do something with the shark dart, but the production up to that point is pretty solid, and then bam, it’s amateur hour all of a sudden. And the whole blaxploitation thing? Well, it’s problematic, but the actors playing the role gave pretty good performances. The Gadgets There’s nothing like a good tool that gets you out of a tight spot, or even into one, and Bond finds all manner of applications for his electromagnetic watch. Besides that, this film is pretty low-key in its gadget use, as Q doesn’t even appear this time around, and the only other time Bond gets any hi-tech kit out is tracing bugs around his hotel room on San Monique. Things just seemed to be a bit slicker this time around, putting aside some of the cheap effects mentioned above. There’s no doubt Moore brings a slightly different tone to the character, and the script was written to work in his relative strengths. As Guy Hamilton’s third go as director, it’s definitely a return to form after the scatterbrained Diamonds Are Forever, restoring his record. I reckoned this was a pretty solid, if rather unique instalment in the 007 series, and sets up Roger Moore’s run in the lead role, still the longest to date – and at least at this stage he doesn’t look unfeasibly old to still be doing fieldwork. All the other players range from capable to charismatic, particularly Yaphet Kotto as the enterprising entrepreneur who ends up being crushed by The Man for being the wrong colour. I reckon it’s nice solid 16 out of 20 gris-gris. Categorized in: Miscellaneous 2016.06.04 GrahamComments are off for this post. 2016 Graham Freeman Mikeology Part 1 – To Hergest Ridge, You Should Come The Top Ten 007 Films – A Subjective Opinion	cc/2020-05/en_middle_0126.json.gz/line412
__label__wiki	0.712532	0.712532	Home Global Activities Asia A School for Syrian Children in Istanbul Becomes Official A School for Syrian Children in Istanbul Becomes Official Thursday, 13 December 2018 15:49 Tzu Chi Foundation On November 26, 2018, a school for Syrian refugees set up by the government of Sultangazi, Syrian teachers, and the Tzu Chi Foundation and in Istanbul became an official institution approved by an American educational institute. A nameplate unveiling ceremony was held that day – OZEL EL MENAHEL MILLETLERARASI ORTAOKULU, SULTANGAZI, ISTANBUL. Attending the event at the Menahel International School were the Deputy Governor of Kayseri Province Mr. Ali Uslanmaz: Health Director of Sultangazi City, Mr. Emrah Eray: Syrian Professor Mr. Cuma: a team of Tzu Chi volunteers: 1,600 students and teachers. The day also marked the start of a new semester. With this new status, the students will receive an official diploma after they graduate. The Menahil school was established in 2015 to give Syrian refugee children an opportunity to learn and to live a life of dignity, Tzu Chi volunteers in Turkey worked with Syrian professors and the government of the Sultangazi district of Istanbul to set up the institution. It has since provided education for over 3,000 students. The Tzu Chi Foundation not only gives hope to underprivileged children in Taiwan, it also extended its love to the Syrian refugee children in Turkey. In order for them to receive an official diploma, Tzu Chi volunteers Faisal Hu, Ru-Yi Chou, and David Yu worked to obtain approval for the school from an American educational institution. “Tzu Chi is the only international NGO that provide assistance for education of Syrian children in Turkey which is acknowledged by the government.” Faisal Hu said. Due to the increasing numbers of students, the international school was established, with the support of the local government. The brand new school building has 50 classrooms, which can accept up to 3,000 students. The school was established not only to provide education, but also to give hope for the future. It gives a chance for children to adapt to life in Turkey and maintain their Syrian roots. Hu sought for the help from an old classmate from Libya, who was a government official in Yemen. This old friend referred the volunteers to an American educational institution. During the process, the three Tzu Chi volunteers went through many obstacles; but they were determined to give the children an opportunity for a brighter future. Mr. Ali Uslanmaz once traveled to Hualian in Taiwan to meet Master Cheng Yen and share his gratitude toward Tzu Chi. He said that Master Cheng Yen was like a saint, helping Syrian people in their hour of need. Mr. Emrah Eray praised Tzu Chi for also setting up a medical clinic, which promotes good health and offers medical services and vaccinations. On behalf of Master Cheng Yen, the deputy CEO of Tzu Chi Mission of Charity, Mr. Scott Liu, brought blessings from Taiwan. He said it is “trust” that brings us together. “Syria’s hope is the hope for the world.” Menahil International School needs everyone’s love, so the seeds of love and hope can grow into a big tree. Liu also encouraged the students and teachers: “if you return to Syria, please bring the love of Tzu Chi to your fellow countrymen.” Tzu Chi volunteer Mr. Pan Chi-li represented all the Tzu Chi volunteers around the global to wish the best to the school. Faisal Hu said: “For Syrians, the Menahil International School is not only an educational institution, it is also a place to learn forgiveness and love. It is a school for teachers to teach children their Syrian roots and culture. It is for these children to continue their education, and to keep their smiles and their innocence.” Tzu Chi University Presidential Search Announcement Disaster Risk Reduction Program for Taiwan High Schools Delivering Aid to Refugees with Compassion New Tzu Chi Clinic in Istanbul for Refugees Tzu Chi Provides Financial Assistance to Yemeni Students in Istanbul Tzu Chi Delivers 550 Blankets to Fire Victims in California Tzu Chi Relief Goods Arrive in Indonesia Tzu Chi Begins Relief Effort for Indonesian Earthquake Survivors Tzu Chi Holds Medical Clinics, Gives Relief Goods in Indonesia 【News】Tzu Chi in The World " Getting angry is actually to punish yourself with other people's mistakes. " Many Miss American Dream Life, Like a Diamond Foundation and Czech Embassy Join to Help Myanmar Refugees in Malaysia Students Graduate From Foundation Academies in North America Given Supplies Before Refugees Start a New Life Addressing the Suffering in Our World: A Brief Overview of Tzu Chi Children Celebrating Buddha's Day The Silent Speak Volumes Taiwan Volunteers Prepare Clothes for Syrian Refugees Cultivating a Wholesome Mind: The Four Right Efforts Volunteers in Jordan Give 188,000 Clothes to Refugees From Syria Ground-Breaking Ceremony for Tzu Chi Middle School in Jakarta Living Worthwhile Lives Tzu Chi Volunteers Give Children First Experience of Photography Providing What They Need Character Education in Public Schools The Quiet Dignity of Tea Tzu Chi Academy Seeds of Goodness Tzu Chi Sends 60 Pre-fabricated Houses to Philippines Respecting Life, a Discussion with Jane Goodall Volunteers Deliver Heaters and Gas Stoves to Syrian Refugees in Jordan Tzu Chi Builds Classrooms for Taiwan Elementary School Tzu Chi Holds Distribution for 900 Syrian Refugee Families in Turkey Bringing Love and Care to a Refugee Center Tzu Chi's Aid Efforts for Syrian Refugees in Turkey Monthly Free Medical Care for Refugees in Bangkok, Thailand Tzu Chi 2015 Year in Review Tzu Chi Distributes Rice to Syrian Refugees in Jordan A New School, A New Beginning Tzu Chi Serves Hot Meals to Refugees in Serbia Playing Volleyball, Calming the Heart of Refugees	cc/2020-05/en_middle_0126.json.gz/line414
__label__wiki	0.718325	0.718325	President Carter's book: "Indefensible" "Moronic" "Laughable" Dershowitz v. Carter. D makes a rhetorical point. C won't debate him. Why D, would C debate you? C was president of the US. You are who you are. So why not just attack the guy for his corrupt content and leave out the rhetorical flourishes? Hat tip to Neil. Why won't Carter debate his book? By Alan Dershowitz December 21, 2006 Boston Globe YOU CAN ALWAYS tell when a public figure has written an indefensible book: when he refuses to debate it in the court of public opinion. And you can always tell when he's a hypocrite to boot: when he says he wrote a book in order to stimulate a debate, and then he refuses to participate in any such debate. I'm talking about former president Jimmy Carter and his new book "Palestine Peace Not Apartheid." Carter's book has been condemned as "moronic" (Slate), "anti-historical" (The Washington Post), "laughable" (San Francisco Chronicle), and riddled with errors and bias in reviews across the country. Many of the reviews have been written by non-Jewish as well as Jewish critics, and not by "representatives of Jewish organizations" as Carter has claimed. Carter has gone even beyond the errors of his book in interviews, in which he has said that the situation in Israel is worse than the crimes committed in Apartheid South Africa. When asked whether he believed that Israel's "persecution" of Palestinians was "[e]ven worse . . . than a place like Rwanda," Carter answered, "Yes. I think -- yes." When Larry King referred to my review several times to challenge Carter, Carter first said I hadn't read the book and then blustered, "You know, I think it's a waste of my time and yours to quote professor Dershowitz. He's so obviously biased, Larry, and it's not worth my time to waste it on commenting on him." (He never did answer King's questions.) The next week Carter wrote a series of op-eds bemoaning the reception his book had received. He wrote that his "most troubling experience" had been "the rejection of [his] offers to speak" at "university campuses with high Jewish enrollment." The fact is that Brandeis President Jehuda Reinharz had invited Carter to come to Brandeis to debate me, and Carter refused. The reason Carter gave was this: "There is no need to for me to debate somebody who, in my opinion, knows nothing about the situation in Palestine." As Carter knows, I've been to Israel, the West Bank, and Gaza, many times -- certainly more times than Carter has been there -- and I've written three books dealing with the subject of Middle Eastern history, politics, and the peace process. The real reason Carter won't debate me is that I would correct his factual errors. It's not that I know too little; it's that I know too much. Nor is Carter the unbiased observer of the Middle East that he claims to be. He has accepted money and an award from Sheik Zayed bin Sultan al-Nahyan , saying in 2001: "This award has special significance for me because it is named for my personal friend, Sheik Zayed bin Sultan al-Nahyan." This is the same Zayed, the long-time ruler of the United Arab Emirates, whose $2.5 million gift to the Harvard Divinity School was returned in 2004 due to Zayed's rampant Jew-hatred. Zayed's personal foundation, the Zayed Center, claims that it was Zionists, rather than Nazis, who "were the people who killed the Jews in Europe" during the Holocaust. It has held lectures on the blood libel and conspiracy theories about Jews and America perpetrating Sept. 11. Carter's acceptance of money from this biased group casts real doubt on his objectivity and creates an obvious conflict of interest. Carter's refusal to debate wouldn't be so strange if it weren't for the fact that he claims that he wrote the book precisely so as to start debate over the issue of the Israel-Palestine peace process. If that were really true, Carter would be thrilled to have the opportunity to debate. Authors should be accountable for their ideas and their facts. Books shouldn't be like chapel, delivered from on high and believed on faith. What most rankles is Carter's insistence that he is somehow brave for attacking Israel and highlighting the plight of the Palestinian people. No other conflict in the world -- not even the genocides in Rwanda and Sudan -- evokes more hand-wringing in the media, universities, and human rights organizations than the Israel-Palestine conflict. Jimmy Carter isn't brave for beating up on Israel. He's a bully. And like all school-yard bullies, underneath the tough talk and bravado, there's a nagging insecurity and a fear that one day he'll have to answer for himself in a fair fight. When Jimmy Carter's ready to speak at Brandeis, or anywhere else, I'll be there. If he refuses to debate, I will still be there -- ready and willing to answer falsity with truth in the court of public opinion. Alan Dershowitz is a professor of law at Harvard University. His most recent book is "Preemption: A Knife that Cuts Both Ways." by Tzvee Zahavy at 8:47 PM Labels: israel, politics 1 comment: Times: Israel Economy Strong. No Catastrophe Looming. I live in Teaneck, NJ, a highly educated mainly Orthodox Jewish community. My friends lean to the right politically and have a habit of bashing the government of Israel. Olmert is often called a moron, an idiot, a failure, etc. The way they make it sound, Israel is going to hell in a handbasket. This is a version of what some call "Catastrophic Zionism." These people who believe in CZ love and support an imaginary Israel that is one step from catastrophe. I sit and listen and then say that the facts tell a different story. The government is sound, the society is solid and the economy is good. Israel has problems and is doing a very good job of managing them. There will not be "peace" with the Arabs but there are a lot of intelligent leaders managing the conflict. Sorry friends. You can go ahead and inhabit your CZ universe. Reality reports to us that there is no looming catastrophe. Here is page three of the NY Times today on the Israeli economy. Not a bad year-end report: Amid Political Upheaval, Israeli Economy Stays Healthy By GREG MYRE JERUSALEM, Dec. 26 — For Israel, it has been a typically tumultuous year: Ariel Sharon, then the prime minister, collapsed into a coma on Jan. 4, the radical Islamic group Hamas won Palestinian elections later that month, and Israel fought a monthlong war in Lebanon this summer. But despite the political turmoil and spasms of violence, Israel, it seems, has figured out how to keep its economy charging forward. It was the country’s third straight year of strong growth, with the economy expanding nearly 5 percent. The stock market has been hitting record highs; unemployment is at a 10-year low. Israel’s central bank is lowering interest rates to 4.5 percent on Jan. 1, putting them well below rates in the United States, an almost unprecedented development. The Israeli shekel is trading at 4.2 to the dollar, its strongest level in five years. Further, Warren E. Buffett, the billionaire investor, paid $4 billion for an Israeli company, and Donald Trump is developing a 70-story luxury residential tower on the outskirts of Tel Aviv. “Israelis look at the economy, and they’ve essentially been through these disturbances in the past, and they know the economy is pretty robust and it tends to come back,” said Stanley Fischer, the governor of the Bank of Israel. “Things that happen here have a smaller impact on markets than I think they would abroad.” While the Israeli economy has been thriving, the Palestinian economy has moved in the opposite direction, contracting by an estimated 10 to 15 percent this year, according to the Palestine Monetary Authority. For Israel, the business that best illustrates the economy’s resilience this year is the company Mr. Buffett bought, Iscar Metalworking Company, a global leader in the manufacture of precision metal-cutting tools. In May, Mr. Buffet bought 80 percent of the company, which has its headquarters on an isolated hilltop in northern Israel that offers a panoramic view of the nearby border with Lebanon. Barely two months later, a cross-border raid by Hezbollah guerrillas ignited 34 days of fighting that pushed Israeli troops into Lebanon and drew heavy rocket barrages against northern Israel. One rocket slammed into the Tefen Industrial Park, where Iscar is situated, causing minor damage to a building belonging to another company. Many more rockets crashed nearby during the weeks of war. Many Iscar workers moved their families away from the border region, but the company maintained production, with only occasional slowdowns. “It took us a brief time to adjust, but we didn’t miss a single shipment,” said Eitan Wertheimer, Iscar’s chairman. “For our customers around the world, there was no war.” The northern city of Haifa came under almost daily rocket attacks, and ships stopped entering Haifa’s port, the country’s largest. Some exporters shipped their goods by air at much higher expense in order to meet deadlines. The Tel Aviv Stock Exchange, which has been setting records throughout the year, seemingly shrugged off the war; it was slightly higher at the end of the conflict in August than before it started in July. At the beginning of the year, Israel’s economy was forecast to grow at around 5.5 percent, and will come in at about 4.8 percent, according to Mr. Fischer, who attributed the dip to the war. The article goes on - I recommend that you bookmark the Times country page for Israel. by Tzvee Zahavy at 8:41 AM Labels: israel, money, Olmert, zionism 2 comments: Video: Actual Saddam Hanging Google Video; better delivery: Revver - same video: From Revver - Graphic warning. High traffic - slow response. Poor quality uncensored cell phone video. Makes me think of Purim. The AP reported: The floor dropped out of the gallows, there was a crash and the chamber erupted in shouting. "The tyrant has fallen," someone called. The video showed a close-up of Saddam's face as he swung from the rope. Then came another voice: "Let him swing for three minutes." Asked if Saddam suffered, Haddad told the BBC: "He was killed instantly, I witnessed the impact of the rope around his neck and it was a horrible sight." by Tzvee Zahavy at 8:26 PM Labels: islam, Purim, videos 1 comment: Play Ball: Israel Baseball League Nears Reality With team names like Bet Shemesh Blue Sox, Netanya Tigers, Petach Tikva Pioneers, Jerusalem/Gezer Lions, Haifa/Nahariya Stingrays and Tel Aviv Lightning the new Israel Baseball League is ready to sell tickets. New baseball league says Israel is next frontier for the sport BY SARAH LARIMER THE ASSOCIATED PRESS MIAMI -- Ivan Gluck is a utility man who can pitch and play first and third base as well as the outfield. But at 67, the Holocaust survivor said he'd settle for being waterboy in a fledgling baseball league that looks to export America's pastime to Israel. "I'm not looking for stardom," he said. "I just want to make the team." The enthusiastic but unsuccessful Gluck was one of 65 hopefuls at Friday's tryout for the Israel Baseball League, which welcomes Jews and those of other faiths. Organizers hope to start play this summer, and want to turn the violence-torn country with only one full-sized baseball diamond into the next great baseball nation. "Hopefully, the region will be stable so we can play ball in the summertime," said player development director Dan Duquette, a former general manager for the Boston Red Sox and Montreal Expos. "But you know, baseball could very well be a unifying force for the country. And wouldn't that be something if it was?" The league has attracted castaways from major league teams, former college and high school players who never got their shot at pro ball and regular fans looking for a chance..... by Tzvee Zahavy at 7:24 PM Labels: baseball, israel, sports No comments: Onion: Top Sports Story of the Year? It's funny (and even funnier if you've taught at a big university). Florida State University To Phase Out Academic Operations By 2010 September 14, 2006 Onion Sports SARASOTA, FL—Bowing to pressure from alumni, students, and a majority of teaching professors of Florida State University, athletic director Dave Hart Jr. announced yesterday that FSU would completely phase out all academic operations by the end of the 2010 school year in order to make athletics the school's No. 1 priority. "It's been clear for a while that Florida State's mission is to provide the young men and women enrolled here with a world-class football program, and this is the best way to cut the fat and really focus on making us No. 1 every year," Hart said. "While it's certainly possible for an academic subsidiary to bring a certain amount of prestige to an athletic program, the national polls have made it that our non-athletic operations have become a major distraction." FSU's restructuring program will begin with the elimination of the College of Arts and Sciences, effective October 15. by Tzvee Zahavy at 12:26 PM Labels: humor, sports No comments: LGF: Surprised that docs show Arafat a killer C'mon now LGF. Did you think that Arafat was a saint? So now we have official documents that attest that he was a killer and terrorist. But we knew that all along. What is with this make believe act, now that the proof is more official? PA/HO Department of State E.O. 12958, as amended NO FOREIGN DISSEM / CONTROLLED DISSEM THE SEIZURE OF THE SAUDI ARABIAN EMBASSY IN KHARTOUM In the early evening hours of 1 March 1973, eight Black September Organization (BSO) terrorists seized the Saudi Arabian Embassy in Khartoum as a diplomatic reception honoring the departing United States Deputy Chief of Mission (DCM) was ending. After slightly wounding the United States Ambassador and the Belgian Charge d’Affaires, the terrorists took these officials plus the United States DCM, the Saudi Arabian Ambassador, and the Jordanian Charge d’Affaires hostage. In return for the freedom of the hostages, the captors demanded the release of individuals, mostly Palestinian guerillas, imprisoned in Jordan, Israel, and the United States. The Khartoum operation was planned and carried out with the full knowledge and personal approval of Yasir Arafat, Chairman of the Palestinian Liberation Organization (PLO), and the head of Fatah. Fatah representatives based in Khartoum participated in the attack, using a Fatah vehicle to transport the terrorists to the Saudi Arabian Embassy. Initially, the main objective of the attack appeared to be to secure the release of Fatah/BSO leader Muhammed Awadh (Abu Da’ud) from Jordanian captivity. Information acquired subsequently reveals that the Fatah/BSO leaders did not expect Awadh t be freed, and indicates that one of the primary goals of the operation was to strike at the United States because of its efforts to achieve a Middle East peace settlement which many Arabs believe would be inimical to Palestinian interests. Negotiations with the BSO terrorist team were conducted primarily by the Sudanese Ministers of Interior and of Health. No effort was spared, within the capabilities of the Sudanese Government, to the secure freedom of the hostages. The terrorists extended their deadlines three times, but when they became convinced that their demands would not be met and after they reportedly had received orders from Fatah headquarters in Beirut, they killed the two United States officials and the Belgian Charge. Thirty-four hours later, upon receipt of orders from Yasir Arafat in Beirut to surrender, the terrorists released their other hostages unharmed and surrendered to Sudanese officials. The Khartoum operation again demonstrated the ability of BSO to strike where least expected. The open participation of Fatah representatives in Khartoum in the attack provides further evidence of the Fatah/BSO relationship. The emergence of the United States as a primary fedayeen target indicates a serious threat of further incidents similar to what occurred in Khartoum. by Tzvee Zahavy at 9:43 PM Labels: antiSemitism, islam 3 comments: Video: Tricky-Dick Nixon - out-takes at his resignation After this --> Ford! by Tzvee Zahavy at 10:09 AM Labels: politics No comments: Hitler Comedy by Swiss Jew Oy. Mel Brooks and The Producers have company. JTA links to the DW-World report: Jewish Filmmaker Breaks Taboos with Hitler Send-Up Both German and Jewish sensitivities are to face a severe test next month with the launch of a comedy movie in German that turns Nazi dictator Adolf Hitler into a clown with 90 minutes of juvenile jokes. The title, "Mein Führer: The Truly Truest Truth About Adolf Hitler," gives a foretaste of the send-up, in which a fictional Hitler, depressed in 1944 at losing his war, invites a Jew from a concentration camp to live with him and coach his public speaking. Stills released so far show scenes of Hitler training his German shepherd dog to do "Heil Hitler" salutes or lying in the bath playing with a toy warship. The movie's Jewish director, Dani Levy, has admitted that while he could never make a funny Holocaust movie, he thinks there is nothing wrong with a parody about the Holocaust's Nazi authors. Levy, 49, who is Swiss-born but has lived in Berlin since 1980, says he checked the script first with his mother, a Holocaust survivor, to make sure he was not too off-key with the jibes. ... by Tzvee Zahavy at 10:58 PM Labels: antiSemitism, nazis No comments: Big Snow in Israel None here in NY. Better skiing in the Golan Heights! Ha'aretz: ...Snow began accumulating at Mount Hermon Tuesday morning, and is expected to spread overnight throughout the northern Golan Heights and Galilee mountaintops, reaching the central mountains and Jerusalem by this afternoon. Forty centimeters accumulated at the upper cable car, and 10 centimeters accumulated at the lower one. Officials hope to open the site for skiers by week's end. According to meteorologist Nahum Malik, "there is a chance" the snow will even stick in Jerusalem. Temperatures Wednesday will not rise above 4 degrees, Malik said, before falling again to 1-2 degrees, and reaching zero in the evening. Temperatures dropped Tuesday afternoon to 5 degrees in Safed (a decrease of six degrees from the day before), 3 degrees in the northern Golan Heights, 11 in Haifa, and 12 in Tel Aviv.... by Tzvee Zahavy at 11:28 AM Labels: israel No comments: Jews live long and prosper Why do some Jews live past 90? The UK Daily Record has the answer: GENE AIDS THE ELDERLY A LONGEVITY gene linked to living to 90 or beyond also helps the very old to think clearly. Researchers in the US examined 158 people of eastern European Jewish descent who were aged 95 or older. Those who possessed the gene variant were twice as likely to perform well in a standard mental test than those who did not. Further evidence emerged when the same scientists from the Albert Einstein College of Medicine in New York looked at a younger group of 124 eastern European Jews aged 75 to 85. Within this group, those who did not go on to develop dementia were five times more likely to have the favourable genotype. To what extent the gene variant is found in the wider non-Jewish population remains to be discovered. by Tzvee Zahavy at 9:25 PM Labels: einstein, science 1 comment: Teheran Asskissing Rabbi from Monsey NY You won't believe it. Where does one of the Teheran asskissing rabbis live? Monsey NY! Credit FOX News for the story: Ahmadinejad Handshake Leaves Rabbi's Neighbors Crying Foul By Sara Bonisteel MONSEY, N.Y. — The photograph is jarring, to say the least. Why on earth would a rabbi from New York travel to Tehran to embrace Iranian President Mahmoud Ahmadinejad, a man who says the Holocaust never happened and that Israel should be annihilated? In Rockland County, N.Y., a short drive north from New York City, "love thy neighbor" has been a hard commandment to follow in the weeks since a contingent of fringe religious leaders set out to shake the Iranian president's hand. This small suburban county has the highest percentage of Jews in the nation, and many if not most of them have been seething since leaders of the ultra-Orthodox sect Neturei Karta attended the Holocaust conference in Tehran and seemingly lent their support to known Holocaust deniers. Rabbi Yisroel Dovid Weiss led the Neturei Karta delegation to Iran's capital on Dec. 11 to participate in a two-day conference on whether the Holocaust occurred. Among the other attendees were former Ku Klux Klan Imperial Wizard David Duke and French professor and gas-chamber denier Robert Fuerisson. "This kind of cozying up to tyrants, it's really unconscionable," said Holocaust survivor Walter Greenberg, 73, who lives in the county, only about 20 miles north of New York City. by Tzvee Zahavy at 9:06 PM Labels: rabbis No comments: Israel's Nobelist Nonsense Once I was on the shuttle bus at the U of MN between the east and west banks of the Mississippi. It was one of those 30 below January days. Just as we were about to pull away a professorial type man - who I knew to be a University Professor of Economics came up to the door of the bus. He said something to the driver. The driver answered. I could not hear what they said. But a moment later the driver closed the door and the bus pulled away and the brilliant professor remained standing at the bus stop in the frigid cold. So this is my parable for you. Apply it if you dare to the case at hand. Two brilliant Israeli Nobel Laureates standing at the bus stop in the cold. The bus pulled away a long time ago. They have no clue about the realities of the world. They live in their minds. They inhabit their intellects. That is what they should be doing. It is their job. Yet some journalist decides that they need a platform to express their utter confusion about the state of affairs at the bus stop. So they were given a platform and they proclaimed their pessimism. The bus doors have closed and they will not reach their destinations. But all those on the bus -- those who are not so fortunate to be so brilliant -- they are already there. The State of Israel is a miracle -- the most massive miracle in all of history. Brilliance in chemistry or mathematics apparently prevents these two men from seeing that. Too bad. Here is the report of their pessimism -- their doom and gloom. Pay no attention to it. Two Israeli Nobel Prize laureates foresee a gloomy future for the state By Ynetnews From a political point of view, they are poles apart, but on one topic Prof. Yisrael Aumann and Prof. Aharon Ciechanover are of the same opinion: Pitiful and failed leadership is leading Israel to destruction What worries them most is the deterioration in academics and education. "There is a close connection between the sinking of the Israeli spirit and the downfall of the State," they warn. Everything here seems lacking in values, temporary, one patch on top of another, a thin bandage that can be torn off with any breeze." I heard Aumann at a NY synagogue recently. He has no savoir faire. He is not sophisticated and worldly. He has no credentials beyond his academic knowhow. And the way he applies his academic skills is highly questionable. He clearly lets his biases guide him to his conclusions. As I said, ignore his doomsaying. He and his friend are a source of pride and inspiration to all Israeli academics. But at the same time, they are not credible prognosticators about the future of the State of Israel. by Tzvee Zahavy at 8:38 PM Labels: israel, nobel prize, science No comments: Israel stocks up due to rate cut and better outlook Good economic news for Israel. By Robert Daniel, MarketWatch TEL AVIV (MarketWatch) - Israeli stocks rose after the Bank of Israel surprised the capital markets with a sharper-than-expected interest-rate cut, then followed up by lifting its economic-growth estimates and cutting its expected unemployment rate. The Bank of Israel's rate cut - half a percentage point to 4.5% instead of the widely expected quarter point -- also had a bit of the effect Israel's manufacturers had hoped for, as the shekel, which has hammered the dollar this year, weakened. The bank had cited lower-than-target inflation and the shekel's strength against the dollar for the reduction. The Tel Aviv Stock Exchange's benchmark TA-25 index rose 0.61% to 937.03, the TA-100 index added 0.59% to 933.08, and the Tel-Tech index of 15 top technology issues tacked on 1% to 365.36. by Tzvee Zahavy at 8:21 PM Labels: israel, money No comments: Avnery: Israel is in Asia not in Europe Uri Avnery is "An Israeli author and activist. He is the head of the Israeli peace movement, 'Gush Shalom'." He's carried the torch of the left for 60+ years. This essay, Sorry, Wrong Continent, argues that Israel has no choice but to rethink its relationship to its geographic context, namely Asia. This excerpt from the concluding sections of the essay gives you part of his take on the rhetoric of the right and how to respond to it. ... LATELY IT has become fashionable for politicians and commentators in Israel to speak about the danger of annihilation that hovers, or so they claim, over Israel. It is hardly believable: the State of Israel is a regional superpower, its economy is robust and developing, its technological level is one of the most advanced in the world, its army is stronger than all the Arab armies combined, it has a huge arsenal of nuclear weapons. Even if the Iranians were to obtain a bomb of their own, they would be mad to use it, for fear of Israeli retaliation. So where does this fear of annihilation come from in the 59th year of the state? A part of it surely emanates from the memory of the Holocaust, which is deeply imprinted in the national mentality. But another part comes from the feeling of not belonging, of temporariness, of the lack of roots. That has, of course, domestic implications, too. Consciousness also affects practical interests. The assertion that we are a European people automatically reinforces the position of our ruling class, which is still overwhelmingly Ashkenazi-European, over and against the majority of the citizens of Israel, who are of Asian-African Jewish and Palestinian-Arab descent. The profound disdain for their culture, which has accompanied the state from its first day, facilitates discrimination against them in many fields. A CHANGE affecting the consciousness of a community is not a short-term proposition. It cannot be achieved by decree. This is a slow and gradual process. But at some stage we shall have to start it, and first of all in the education system.... by Tzvee Zahavy at 9:58 AM Labels: israel No comments: Israelis: how to turn a human ear into a radio speaker. From the Jewish Standard's topflight science editor: » Hands-on science turns on students By Dr. Miryam Wahrman Published 12/21/2006 Community , Science & Technology On her first trip to Israel, Ridgewood resident Michelle Kortenaar learned how to turn a human ear into a radio speaker. And when she returned to New Jersey, she brought that skill, and many other novel science teaching strategies, back to her physics and biology classes at the Solomon Schechter Day School of Essex and Union in West Orange. She learned the unique approaches to hands-on science teaching at a summer institute for teachers sponsored by the Weizmann Institute of Science in Rehovot, Israel.... by Tzvee Zahavy at 5:41 PM Labels: israel, science No comments: Manischewitz to make exodus from Jersey City to Newark Josh Lipowsky writes in the Jewish Standard about the impending matza factory move: by Tzvee Zahavy at 6:49 PM Labels: religion No comments: Critics Savage Jimmy Carter "When words collide" is Lois Goldrich's excellent story on the new Carter book in this week's Jewish Standard: Critics challenge Jimmy Carter The furor over former President Jimmy Carter’s book "Palestine: Peace not Apartheid" is not abating, and the Jewish community is voicing frustration over the author’s apparent unwillingness (some say "inability") to acknowledge the book’s factual inaccuracies and omissions. In fact, say those Jews who have met with Carter, his statements have become even more extreme since the publication of the book. Released in November, Carter’s book has come under intense criticism from Jewish organizations that have blasted everything from its title — which evokes comparisons to apartheid South Africa — to its scholarship, which has been described as shoddy and riddled with errors. by Tzvee Zahavy at 6:43 PM Labels: antiSemitism, israel, politics No comments: Not the Israeli Rosa Parks Oy vey. Bloggers in the real world and critics of the weird aspects of religion have started to take note of the bizarre spitting match on a bus in Israel. Let me say this. Based on the email Miriam Shear circulated after the event, she is no Rosa Parks. She was not pacific in her protest. Religion-based gender bias is not the same as socially-based racial bias. Israel today is not the American South in 1955. Israeli women are not going to boycott Egged buses for 13 months and sue in court for rights. Orthodox men do have real problems. They need to learn manners and civility. They need to reform their attitudes and practices regarding women. And yes. Islam is worse. That is no excuse. by Tzvee Zahavy at 11:34 AM Labels: orthodox, women No comments: Slap: Prager Censured by Holocaust Board and Backs Off Only the president can remove a member of the Holocaust Museum panel, according to the Times. The insinuation is that the board would have fired the man for his incendiary comments about Rep. Ellinson's intent to swear in to congress on a Koran. Prager finally backpedals a bit, according to the Times, saying he was just trying to make a point about the bible, implying that he did not really mean what he was saying, raising the question, does he ever really mean what he is saying or does he just spout off constantly to keep himself employed as a wingnut commentator? I've expressed my views here several times on why Prager is wrong. He ought to own up to his mistaken views, retract them and apologize. If not, he ought to resign from the board of the museum. Holocaust Museum Rebukes Member for Koran Comment By RACHEL L. SWARNS WASHINGTON, Dec. 21 — The board that oversees the United States Holocaust Memorial Museum here publicly distanced itself on Thursday from a member who recently condemned the first Muslim elected to Congress for planning to use a Koran during the private part of his swearing-in ceremony. In November, the board member, Dennis Prager, a conservative commentator and radio show host, said that Keith Ellison, the newly elected Muslim member of Congress, should give up his post if he could not take his oath on a Bible, which Mr. Prager said was the traditional religious text of the United States. In its resolution, the council’s executive committee criticized Mr. Prager’s remarks as “antithetical to the mission of the museum as an institution promoting tolerance and respect for all peoples regardless of their race, religion or ethnicity.” Mr. Prager, one of 68 members of the board, known as the Holocaust Memorial Council, was appointed to the unpaid post by President Bush, and is serving a five-year term, which expires in 2011, said Andrew Hollinger, a spokesman for the council. Mr. Hollinger said Mr. Bush had the sole power to remove Mr. Prager. On Wednesday, Representative Virgil H. Goode Jr., Republican of Virginia, was sharply criticized by Congressional Democrats and Muslim Americans for warning that Mr. Ellison’s election to the House posed a serious threat to the traditional values. Critics of Mr. Goode and Mr. Prager noted that the Constitution specifically bars any religious screening of members of Congress and that the actual swearing in of those lawmakers occurs without any religious texts. The use of such texts occurs only in private ceremonies that take place after lawmakers have officially sworn to uphold the Constitution. Mr. Goode stood by his comments on Thursday and told Fox News that he wanted to restrict legal immigration to the United States “so that we don’t have a majority of Muslims elected to the United States House of Representatives.” (Mr. Ellison, a lawyer who converted to Islam as a college student, is an African-American, not an immigrant.) Mr. Prager said Muslim American groups and others had pressured the museum board. “Everybody knows there’s no bigotry in what I said, but they felt they had to do it,” he said in an interview. “I completely respect Congressman-Elect Ellison’s right to take an oath on the Koran, and regret any language that suggested otherwise,” Mr. Prager added in a statement, emphasizing that he began reaching out to the Muslims 20 years ago. “My entire effort in the Keith Ellison matter has been to draw attention to the need to acknowledge the Bible as the basis of America’s moral values. Judeo-Christian values are the greatest single protection against another Holocaust.” In response to questions about Mr. Bush’s reaction to Mr. Prager’s remarks, Nicole M. Guillemard, a spokeswoman for the White House, said by e-mail that President Bush “respects religious freedom and the right to free speech.” Ms. Guillemard did not respond to questions about whether Mr. Bush believed that Mr. Prager should resign or be removed. by Tzvee Zahavy at 11:05 AM Labels: ellison, politics, wingnuts No comments: Yikes: Secular Humanist Rabbis Ordained in Israel Jpost reports on new rabbis. The discussion appended to the article is a hoot. Secular rabbis to be ordained in J'lem Etgar Lefkovits, THE JERUSALEM POST Dec. 21, 2006 In an unprecedented event in Israel, seven secular Jews who view Judaism as a culture, as opposed to a religion, will be ordained as rabbis Friday in Jerusalem. The ceremony, which will be held at the Israel Museum, comes after the ordainees completed three years of study at the International Institute for Secular Humanistic Judaism in Jerusalem. Twenty five additional students are currently studying at the program. The organization, which promotes "secular humanistic Judaism," is closest to the Reconstructionist Judaism movement in the United States, said Oren Yehi-Shalom, 35, who will be ordained at the ceremony. Yehi-Shalom said that the participants do not pray to God, but believe in man's humanity. The group's Web site lists the belief in God "as a literary character," citing the Dutch philosopher Spinoza, who is recognized as the founder of modern Biblical criticism. Yehi-Shalom, who was born to a secular family in the Tel Aviv suburb of Petah Tikva, said he was approached by the organization while working in the field of education and completing his masters at Bar-Ilan University. Those who will be ordained on Friday will work in the field of education, and will officiate at religious ceremonies that will not necessarily include God in them. The group has carried out dozens of such marriage and bar and bat mitzvah ceremonies in Israel, where no Jewish certification is needed to take part, and only a declaration of desire to undergo such a ceremony is needed. The ceremonies would carry no legal standing in Israel though, and would be symbolic at most, since even Conservative and Reform marriages - not to mention marriages by the more left-leaning Reconstructionist Movement - are not recognized by the rabbinate. Still, the ordination of the secular rabbis is bound to attract the ire of the Orthodox establishment in Israel, which has a virtual monopoly over religious issues such as marriages, divorces, and burials. by Tzvee Zahavy at 9:50 AM Labels: israel, rabbis 1 comment: Regan: Jews = Rodents Regan is the victim!? Anyway, Judith does not know how to open a mezuza, says the spokesman. The NY Daily News tabloids it up for the fired publisher. Slurs? Rat's not true, says Regan Two more insiders have come forward to claim that Judith Regan has made anti-Semitic slurs, but her lawyer says the former Harper-Collins publisher is a victim of the 'big lie.' Embattled publisher Judith Regan is defending herself against new claims that she made anti-Semitic slurs. Two publishing insiders allege the woman behind that O.J. Simpson book regularly compared Jewish people to "rodents." "I heard her say it multiple times," one source told us. "She thought Jews looked or acted like rats. She called them 'rodentia.'" Another source said, "I can attest to that. She would call them 'rodentia.' She would just say it in passing. Did I ask her why? I didn't even want to go down that road with her." Regan insists that she never uttered those words. Her powerhouse lawyer Bert Fields said, "She unequivocally denies saying any such thing. She never called Jews rodents or said they looked like rodents. It's absolutely false. It's a lie." Fields also denied an anonymous claim, posted on Gawker.com, that Regan "was constantly muttering about 'Jew agents' in the office and once claimed to staffers that, as a joke, she went through her old apartment building on the upper West Side, took all the Torah scrolls out of the mezuzahs at the doors and replaced them with torn-up dollar bills." "It's absurd," said the lawyer. "First, I couldn't open a mezuzah if I tried. But I know she didn't do it. I don't think she even said it as a joke." Regan was fired last week after she ranted that a "Jewish cabal" was "conspiring" to smear her in the media and ruin her career, a spokesman for her former employer claimed on Monday. News Corp. mogul Rupert Murdoch axed Regan — who made millions for his HarperCollins company — after the tirade, which was aimed at a Jewish attorney for the publishing house, Mark Jackson. Fields has denied she ever used the expression "Jewish cabal" and insisted, "She was trying to say to Jackson that Jews particularly should understand, because of the Holocaust, what it's like to be a victim of the 'big lie' in the media." One of the people who claims Regan uttered the "rodentia" comment allowed, "I wouldn't call her anti-Semitic. She was anti-everything. She would use stereotypes against anyone she was mad at: blacks, gays, Irish. It was across-the-board discrimination." Fields, who is Jewish, said, "I've known Judith for many years. She uses colorful language, but I've never heard her use any racial or religious slurs. I can't speak about sexual orientation." Fields accused HarperCollins execs of "conducting a smear campaign" against his client. "There are a lot of people she's had fights with," said Fields. "If I find out who's saying this stuff, I will sue them." Fields also blamed HarperCollins CEO Jane Friedman for reneging on a promise to let Regan star in a Bravo reality show. " [Friedman] did it for some trumped-up reason," said Fields, "as we will demonstrate in our suit against HarperCollins. We've been holding our fire. But there's going to be a lot about Jane Friedman." News Corp. spokesman Gary Ginsberg insisted, "There's no smear campaign." by Tzvee Zahavy at 7:20 PM Labels: books No comments: Regan Boasted of Mezuzah Vandalism Another bizarre twist to an already twisted story. The woman who wanted to publish O.J.'s book, Judith Regan, allegedly "boasted of removing the scrolls from her neighbors' mezuzas and replacing them with torn pieces from dollar bills." This blogger has learned that when asked about this boast, she reportedly began to reply, "If I did it..." Here is the story from the NY Times business pages. Previous Incident Reported Involving a Fired Publisher By SHARON WAXMAN and JULIE BOSMAN LOS ANGELES, Dec. 20 - Judith Regan, the publisher who was fired last week by HarperCollins in the wake of what executives called anti-Semitic remarks, was investigated and reprimanded three years ago for making an anti-Semitic remark at work, two top executives at HarperCollins have said. According to the executives and another person involved in the incident, Ms. Regan was investigated in the spring of 2003 after an editor complained that she had boasted of removing the scrolls from her neighbors' mezuzas and replacing them with torn pieces from dollar bills. A mezuza is a small slender case containing a scroll inscribed with a prayer that many Jewish families place beside their front doors. The two executives said the company's investigation had corroborated the employee's account and Ms. Regan was reprimanded at the time. A spokeswoman for HarperCollins, Erin Crum, declined to confirm the account. "We do not comment on personnel issues," she said. A lawyer for Ms. Regan, Bert Fields, denied that she had made the remark. The story, he said, stemmed from testimony given by a witness during Ms. Regan's divorce from Robert Kleinschmidt but she had had nothing to do with the incident. Mr. Fields said Ms. Regan had not been investigated or reprimanded over an anti-Semitic remark at work. The furor over Ms. Regan began last month after the News Corporation, the parent company of HarperCollins Publishers, canceled a planned book and television special featuring O. J. Simpson discussing how he hypothetically might have killed his former wife Nicole Brown Simpson and her friend, Ronald L. Goldman. Last week, Ms. Regan was abruptly fired after a heated telephone conversation with Mark Jackson, a lawyer for HarperCollins, in which she reportedly made anti-Semitic remarks. On Monday, Mr. Fields promised to sue HarperCollins for breach of contract. "She would never issue any anti-Semitic remark, and she didn't," Mr. Fields said at the time. "It's an outrageous lie to cover the fact that they have no possible basis for terminating Judith." Mr. Fields acknowledged last week that during the phone conversation, Ms. Regan drew attention to the fact that her boss and others involved in the aborted O. J. Simpson project were Jewish. Still, several people who worked with Ms. Regan, none of whom would speak for attribution because they feared being sued or subpoenaed, questioned whether she was anti-Semitic. They said her personal style was frequently abusive, but that she offended everyone equally. "She was an equal opportunity insulter of everyone," said one editor, who worked for ReganBooks for three years. "I did not think of her as a generalized racist." But the two HarperCollins executives said that many employee complaints had been filed against Ms. Regan, including the one that resulted in a reprimand. In that incident, an editor at ReganBooks, an imprint of HarperCollins, said that in early May 2003 she was in Ms. Regan's office when the publisher made the remark that "she and her former husband would go around their apartment building, changing mezuzas with bits of dollar bills," according to an individual involved in the investigation, whose account was confirmed by the two executives. The editor immediately reported the incident to Greg Giangrande, an executive in the human resources department, who started an inquiry that led to Ms. Regan's reprimand. The incident was not the first time that the editor had complained about ethnic slurs made by her boss, Ms. Regan, the two executives at HarperCollins said. In addition, two former employees said they had received cash settlements as part of a negotiated deal to leave in the wake of their complaints against Ms. Regan. They and others questioned why HarperCollins had tolerated the publisher's behavior. Sharon Waxman reported from Los Angeles and Julie Bosman from New York. http://www.nytimes.com/2006/12/21/business/media/21book.html?_r=1&oref=slogin by Tzvee Zahavy at 11:34 AM Labels: books No comments: A Cheery Chrismukkah to you I was just asking someone today whether everyone forgot about the invention of the OC TV show called Chrismukkah. Here is a story about its current status from the Baptist Standard. Chrismukkah? Hybrid holiday shows tension in religiously blended families By Hannah Elliott Associated Baptist Press DALLAS (ABP)—There’s a new winter holiday on the rise, and it could be the perfect opportunity to enjoy Fa-La-La-La Latkes, Blitzen’s Blintzes, and Christmas trees filled with “menorahments.” It’s not Christmas. And it’s not Hanukkah. It’s both. And the humor and religious syncretism behind the hybrid holiday “Chrismukkah” cut to the heart of modern-day tensions in American society. According to the United Jewish Communities’ National Jewish Population Survey, roughly 31 percent of married Jews in the United States have non-Jewish spouses. For Jews who married after 1995, the intermarriage rate is nearly 50 percent. Chrismukkah was invented for Jewish-Christian families who decide to celebrate both holidays. The term had its first wide pop-culture appearance in 2003, thanks to a mixed-faith family featured on the now-canceled Fox television show The O.C. But several new books are taking the holiday at least semi-seriously, reflecting the increasing number of American families that blend Christianity and Judaism. Chrismukkah: The Official Guide to the World’s Most Beloved Holiday by Gersh Kuntzman, and Chrismukkah: Everything You Need to Know to Celebrate the Hybrid Holiday by Ron Gompertz, both extol the virtues of the Dec. 15-25 celebration. Judaikitsch: Tchotchkes, Schmattes & Nosherei by Jennifer Traig and Victoria Traig also highlights the new holiday alternative. Gompertz, a Jew who moved from New York to Bozeman, Mont., founded the website http://www.chrismukkah.com/. He is married to the daughter of a pastor in the United Church of Christ, and the couple has decided to raise their daughter in the Jewish faith. Gompertz’s family chooses to celebrate Hanukkah. But in addition to lighting the menorah and frying latkes—that’s a traditional Hanukkah potato pancake—they add a Christmas tree. “Frankly, it’s fun to challenge the status quo and question tradition,” he said. “Chrismukkah has gotten people talking, allowing expression of diverse opinion, and it’s helped bring Jewish intermarriage issues to mainstream cultural awareness.” While he sits on the board of directors for Bozeman’s synagogue and calls himself “a proud Jew,” Gompertz recognizes compromise as a key part of fostering a good marriage with his wife, Michelle. It’s one of the reasons they launched the website as a project to express their views as a “real interfaith family.” “While we are typical in the sense that … we never had a political or theological agenda, we certainly don’t believe we represent the beliefs of all interfaith couples,” he wrote on his website. “That said, it has been a nice surprise to find how many others share our beliefs and values. We’ve found that by celebrating both December holidays … we manage to keep peace and harmony within our family.” Chrismukkah fans say the event celebrates both Christian and Jewish beliefs, even if it is a bit tongue-in-cheek. It’s a state of mind for the season—a “multicultural mish-mash of the cherished holiday rituals we grew up with,” Gompertz wrote. And that’s one of the reasons the website is popular, he said. But the reason Gompertz likes his new holiday is exactly why Chrismukkah critics dislike it. In 2004, the Catholic League for Religious and Civil Rights and the New York Board of Rabbis issued a joint statement disparaging the holiday for misrepresenting the spiritual aspects of Christmas and Hanukkah. “Chrismukkah is a multicultural mess that glosses over the historical significance of both Hanukkah and Christmas,” said William Donohue, the Catholic League’s president. “In this vein, we would agree with the recent statement on mixed marriages prepared by the U.S. Catholic-Jewish Consultation Committee. It branded attempts to raise a child simultaneously as both Jewish and Catholic a ‘violation of the integrity of both religious traditions, at best, and, at worst, syncretism.’ From a Catholic perspective, anything which contributes to this phenomenon should be resisted, and that would include Chrismukkah.” The term has also been used disparagingly in recent years by some as a way to describe the commercialization of Hanukkah and the dominance of commercialized Christmas in American culture. Rabbi Jeremy Schneider of Temple Shalom in Dallas said Hanukkah is ultimately about maintaining a Jewish belief system in the face of a larger majority belief system surrounding the Jewish community. To create a “hybrid” holiday, he said, insults both Christianity and Judaism. “Even if the majority of Christians do not take their religious symbols seriously, that does not give Jews license to adopt them and proclaim them secular or American symbols,” he said in an e-mail interview. “I urge my congregants to (imagine) how we would feel if Christians started wearing a tallit, a Jewish prayer shawl, or a yarmulke, a Jewish head covering, and ‘de-Judaized’ them for their own purposes.” In an essay called “Confronting the December Dilemmas,” Ron Wolfson said that by adopting Christmas and its customs, Jews introduce symbols and traditions into their families that are foreign to Judaism. Wolfson is a Jewish educator and president of Synagogue 3000, a Jewish networking and resource center with offices in New York City and Los Angeles. Christmas celebrates the birth of a Messiah whom Jews do not recognize, and Hanukkah celebrates the right not to assimilate into the dominant non-Jewish culture—the very thing that Jews who celebrate Christmas are doing, he said. “Many Jewish educators will advise parents to give children who want to celebrate Christmas a very important message: Christmas is someone else’s party, not ours,” Wolfson wrote. “Just as we can appreciate someone else’s birthday celebration and be happy for them, we can wonder at how beautiful Christmas is, but it is not our party.” Jewish people have many more holidays than just Hanukkah to celebrate, Wolfson continued. It may be difficult to convince Jewish children that they don’t need to trim a Christmas tree or wait for Santa, but once they have experienced the meaning and beauty of their own Jewish traditions, he said, children “will understand that to be Jewish is to be enriched by a calendar brimming with joyous celebration.” Who knows? The kids might not even miss that kosher fruitcake. News of religion, faith, missions, Bible study and Christian ministry among Texas Baptist churches, in the BGCT, the Southern Baptist Convention ( SBC ) and around the world. by Tzvee Zahavy at 7:02 PM Labels: christianity, texas No comments: Diet Rules From Israel: Hang on your fridge אם אוכלים משהו ואף אחד לא רואה - אין בזה קלוריות. אם אוכלים עוגת קצפת ושותים משקה דיאט - הקלוריות של העוגה מבוטלות על-ידי המשקה דיאט. אם אוכלים בחברת מישהו והוא אכל יותר ממך - הקלוריות שלך לא נחשבות. אוכל שאוכלים למטרה רפואית (שוקו חם, גוגל-מוגל, דייסה, ברנדי) לעולם אינו כלול בספירת קלוריות. אוכל הקשור לצפייה בסרט (פופ-קורן עם חמאה, סוכריות, שוקולד) לא נחשב, כי הוא חלק מחבילת הבידור. בחתיכות קטנות של עוגיות אין שומן: תהליך שבירת העוגיה גורם להיעלמות השומן. בדברים שמלקקים מהסכין או מהכף אין קלוריות בזמן ההכנה - כגון השוקולד על הסכין בזמן הכנת כריך שוקולד. מאכלים מאותו צבע הם בעלי ערך קלורי שווה, לדוגמה: פטריות ושוקולד לבן, תרד וגלידת-פיסטוק, לבן וקרם בוואריה. במאכלים קפואים (ארטיקים, גלידות וכד') אין קלוריות כי הקלוריות הן יחידות של חום. by Tzvee Zahavy at 10:07 PM Labels: humor, science No comments: Announcing Charedi Air Attempt-at-humor email that is making the rounds: In view of El Al's handling of the recent unfortunate situation of potentially having aircraft and passengers stranded on Erev Shabbat in the aftermath of a general strike in Israel, I propose that a new Charedi airline should now be established offering the following facilities:- Strict pre flight passenger religious profiling. Booking available through Haimishe Travel Agents only, positively no Internet booking or check in facilities. No airport (or any other) taxes. Flexible departure times, Magen Avraham, Gra, Rabbenu Tam etc. * Security personal to be replaced by modesty police to check appropriate attire. * Exclusive Platinum check in desk for all passengers. * Unique "Maso Umattan" desk to negotiate upgrades and denied boarding compensation. * Flight check in to commence 90 minutes after scheduled departure time. * Unlimited checked in and hand baggage allowances. * Only 279 Passengers may be booked for seating on any flight. Additional passengers may board right before takeoff to "Standing Room Only" area for "Simchas Ya'aleh V'yavo". * Arrival at the departure gate 15 minutes after the last call positively encouraged. * Frequent flyer "Middos Points" awarded on the basis of in flight Blatt Gemora learned. Bonus points available for the most original new Chumras submitted to the Board. * On board fully equipped Beis Hamidrash offering running Minyanim, shiurim and live video links to your Rebbe. Unrestricted use of mobile (Kosher) phones, absolutely no Internet access. * Pilots cabin will be reconfigured to hold 3-5 baby seats (in addition to normal cabin crew). * Emergency under seat inflatable vests will now come in black or dark navy as Yellow is not a Tznisudik color. * To offset operating expenses Charedi Air will lease its planes from a reputable Brooklyn car leasing establishment (don't worry about excess mileage). * Four unique travel classes ranging from the exclusive Rambam First Class for Gedolei Hador only; Shelita Class for Dayanim and senior Rabbonim; Kolel Class for those who have been in full time learning for at least 30 years and Yeshivishe Class with optional seating. Women will be seated at the rear of the hold (subject to receiving permission to board from the modesty police). Women deemed to be immodesty dressed or wearing wigs with Indian hair will be relegated into overhead compartment. * Mashgichim Temidim to replace flight attendants offering a choice of cuisine with outstanding Hechsherim ranging from Bedatz to Monsey Super Glatt. * No refreshments will be served on the following Taanesim:- Taanis Esther, Tzom Gedalyo, Asoro BeTeves, Shivo Osor BeTammuz and Hey Iyyar. * To prevent the possible desecration of the holy Shabbos (chas v' sholom) flights will only be scheduled on Monday to Wednesday. In addition flights will not run on the following days:-Erev Yom Tov, Yom Tov Sheini Shel Golyus, Isru Chag, Purim, 1-10 Av (until after Chatzos). Schedules are subject to disruption after Purim during which time aircraft will be thoroughly Kashered for Pesach. Floor of plane should be granite, hardwood, imported Italian tile or thick carpet. Seat belts will be replaced by "Seat Gartels". "Pre flight" safety video will be replaced by professional make and female actors (all shoimer shabbos who will depict instructions). Free retouching of passport pictures for single girls 16 and over. Lighting should be chandeliers. All cabin crew should be either Hispanic or polish with shared passport. First class isn't booked, it's auctioned for a tzedaka. Baby carriages don't have to be stored, they can be left in the aisles. *Planes are allowed to double and triple park on runways if pilot has to "run into terminal for just a second." by Tzvee Zahavy at 9:53 PM Labels: brooklyn, humor, Maimonides, Purim 1 comment: Carter: He was worse than Bush Remember Jimmy Carter? He was our president in 1979 and in May of that year Time Magazine wrote For yet another week, gas stations almost everywhere kept short hours, closed on the weekend or limited sales to a few gallons because supplies were short, by 5% to 20% of 1978 levels. In most states it was enough of a pinch to make gasoline a major topic of concern, but not enough to force Americans to change lifestyles. In California, however, long lines of cars formed at every open pump, as angry and panicky motorists tried to buy every drop available. One of the great oil powers in the world, and the US in 1979 had a shortage of gasoline!!!!!! And mortgage rates were 17%! Yes 17% In the history of our country, Jimmy Carter was our worst president. Now to cap off his terrible legacy, he calls Israel an "apartheid" state in his new book. Let history record that a chazer bleibt a chazer and a peanut farmer bleibt a peanut farmer. by Tzvee Zahavy at 9:19 PM Labels: politics No comments: Really Biblical: Take your oath while holding your male member There has been an outcry about what's the proper way to swear in a America, a country that some say must be united by the bible. We've written about it several times in this blog. Of course if you really want to perform a biblical oath you might want to consider this manner, as summarized by R. David Freedman. "Put Your Hand Under My Thigh" - The Patriarchal Oath By R. David Freedman In Genesis 24:2-9 Abraham has his servant Eliezer put his hand under the Patriarch's thigh to swear "by the Lord, the God of heaven and earth" that the servant will not arrange a marriage for Abraham's son Isaac with a Canaanite woman. Similarly, in Genesis 47:29-31 the dying Patriarch Jacob has his son Joseph swear to him that he will bury Jacob not in Egypt, but alongside Jacob's own parents in the Cave of Machpelah; and the oath-taking ritual again calls for putting a hand under the Patriarch's thigh. Talmudic tradition1 takes these verses to indicate that the oath was sworn while the circumcised membrum of the Patriarch was held in hand, and derives from this interpretation the rule that all Jewish oaths must be sworn while some ritual object is held in hand. Ordinary people must hold a Torah scroll; scholars may hold any ritual object. In the Times Herald Record today (New York's Hudson Valley and the Catskills) there is an opinion by Kathleen Parker, a syndicated columnist that she calls, "The wolf who cried racist." It is a balanced column that rightly notes with criticism the showboating aspect of Dennis Prager's crusade against Keith Ellison for his desire to swear on the Koran. She also notes with praise the desire by Prager, a Jew, to live in a bible based culture rather than a Koran governed society. In multi-culti America, there's no worse offense than being a "racist," and no word has suffered more abuse. We've had a taste of that recently as Muslim and Jew have slugged it out over whether a Koran can be used at a private swearing-in ceremony for Keith Ellison, the first Muslim elected to the U.S. Congress. Dennis Prager, a popular talk show host and columnist, who happens to be Jewish - as well as a thoroughly decent fellow - wrote a column recently protesting Ellison's insistence on injecting his religious preference into an American tradition: "Forgive me, but America should not give a hoot what Keith Ellison's favorite book is. ... If you are incapable of taking oath on that book (the Bible), don't serve in Congress." Prager has been pilloried from all sides. In the blogosphere, he's been called everything from racist to Islamophobic. Former New York Mayor Ed Koch called Prager a "bigot" and a "schmuck," and is demanding his resignation or removal from the board of the United States Holocaust Memorial Council, on which both men serve. Most entertaining has been a similar demand from CAIR (Council on American-Islamic Relations), lest Muslims worldwide get a negative impression about "America's commitment to religious tolerance." Irony must be basking. CAIR routinely demonstrates intolerance for any opinion deemed insensitive to its views and targets individuals and institutions for cyber-posses and technomobs. Ask any cartoonist who has drawn an image of you-know-who. Back through the looking glass, Prager says his objections have nothing to do with race or religious intolerance but with a concern for American solidarity. His premise is that the country is in danger of unraveling if we continue to erode traditions that are the common threads of the republic. Prager asserts that the Bible has been used for swearing-in ceremonies since George Washington. Which is true, except when it isn't. Not every elected official has used the Bible, including some Jews (Koch, a U.S. representative from 1969-77, used a Hebrew Bible for his initial swearing-in) and some Quakers, including Herbert Hoover, whose beliefs prohibit the swearing of oaths. The U.S. Constitution, meanwhile, leaves plenty of wiggle room for those who prefer not to make religious statements. Eugene Volokh, constitutional law professor at UCLA, has written that requiring someone to swear on the Bible would violate the Constitution's provision that "no religious Test shall ever be required as a Qualification to any Office or public Trust under the United States." It appears that Prager is, at least technically, wrong. But his concerns are not those of a hatemonger. Prager is merely the quarterback in the latest scrimmage over ideas in post-9/11 America. There is a growing sense, both here and in Europe, that Western civilization is under siege by the radical Muslim world, the expressed goal of which is to convert the rest of us. There's not much wiggle room in Sharia law for optional religious practices. Or, we note, accessorizing wardrobes. On a certain level, one can understand Prager's view that introducing the Koran into American government is a taunt to traditional values. On another level, those same values allow us to see Ellison's legitimate wish to swear on the holy book of his choosing. What Christian or Jew duly elected in a predominantly Muslim country would want to be forced to swear on a Koran? The punch line, of course, is that our religious tolerance is shared by few Muslim nations, some of which won't allow a Bible to enter the country. Our better angels may yet be our worst enemies. Obviously, Ellison could forgo the Koran and affirm as others have. That he insists on the Koran is probable cause to infer that he's trying to make a statement and assert himself as a Muslim in the U.S. Congress. Before 9/11, that singular act might not have drawn attention. But that was then. Hoisting the red flag, as Prager has done, isn't an act of bigotry ? or even schmuckery. It is the understandable reflex of a man, who, as Prager himself puts it, knows that a Bible-swearing nation has been, and will be, a better place for Jews to live than one that swears on the Koran. Genius is not required to grasp that concept, but civility is critical to debating these issues. Name-calling and showboating righteousness - or demanding punitive action against those who voice an unpopular opinion ? is the wrong way up a dead-end street. Radical Islam loves that sort of dogmatic intransigence. Kathleen Parker is a syndicated columnist. Her e-mail address is kparker@kparker.-com. http://www.recordonline.com/apps/pbcs.dll/article?AID=/20061219/OPINION/612190324 by Tzvee Zahavy at 3:31 PM Labels: bible, circumcision, ellison, politics, wingnuts 1 comment: Invest in True Religion Stock I discovered recently that you can trade True Religion on the Nasdaq stock market. It trades under the symbol TRLG. This is of course just an apparel company with stores from coast to coast. Not to be confused with Judaism or Christianity or Islam, which are religions that various folks like to label as "true". Last Wednesday I saw a business story about the firm, "Not Much to Worship at True Religion". Seems the stock is at a 52 week low and the analysts are punning away at the company. The story reports, "True Religion is a Los Angles based high-end denim company which designs, develops, manufactures, markets, distributes and sells denim jeans and other apparel, including corduroy jeans and jackets, velvet jeans and jackets, skirts, shorts, t-shirts, sweaters and sportswear. In other words, it’s a parent’s worst nightmare if your kid is into this fashion because jeans for example are priced in the $150 plus range." Let me join in the pun: parents are just praying that their children don't ask for them. by Tzvee Zahavy at 6:42 PM Labels: humor No comments: The Jews: Funny SNL Video spoof of the trailer for the Mel Gibson movie Apocalypto Funny SNL Video spoof of the trailer for the Mel Gibson movie Apocalypto. by Tzvee Zahavy at 9:12 PM Labels: humor, videos No comments: Best 2006 Jews-is-News Opinions Picked by NY Times' Brooks Thse are the Best 2006 Jews-is-News Opinions as picked in his column today, "This Age of Anxiety," by NY Times' David Brooks: Finally, there was the sense the forces of decency were losing ground to primordial ugliness, especially anti-Semitism. John Mearsheimer and Stephen Walt wrote a fevered essay on the power of the Israel Lobby, which cleared ground for a million anti-Semitic rants. Jimmy Carter has just published a book intended to make Israelis look like racists. I’m not sure the classic essay on this latest recrudescence has been written, but Anne Applebaum had a useful piece in Slate called “Holocaust Denial Is No Joke,” and Adam Garfinkle has a comprehensive look at “The Madness of Jewcentricity” in The American Interest. It all adds up to quite a gloomy — though well-crafted — collection of essays, culminating in a National Journal piece by Paul Starobin called “Beyond Hegemony” on life in an age of declining American power. I have to say, I’m as pessimistic about the Middle East as the next guy, but most of this broader existential gloom about America is absurd. The U.S. is in extraordinarily strong shape economically and socially. And whatever their short-term strengths, the Sadrs of the world simply do not have a social model that large numbers of people will want to live under. I'm not Brooks' biggest fan, but he does pick good essays. And of course you gotta read Frank Rich today. He meanders as ususal through the wilderness of conservativism, picking wild berries and delightful fruits to entertain us. He argues that right-wing misuse of religion has run its course and saner heads are bouncing back into the fray. Maybe? No one more dramatically so, perhaps, than Rick Warren, the Orange County, Calif., megachurch leader and best-selling author of “The Purpose Driven Life.” He has adopted AIDS in Africa as a signature crusade, and invited Barack Obama to join the usual suspects, including Senator Brownback, to address his World AIDS Day conference on the issue. This prompted predictable outrage from the right because of Mr. Obama’s liberal politics, especially on abortion. One radio host, Kevin McCullough, demonized the Democrat for pursuing “inhumane, sick and sinister evil” as a legislator. An open letter sponsored by 18 “pro-life” groups protested the invitation, also citing Mr. Obama’s “evil.” But Mr. Warren didn’t blink. Among those defending the invitation was David Kuo, the former deputy director of the Bush White House’s Office of Faith-Based and Community Initiatives. In a book, “Tempting Faith,” as well as in interviews and on his blog, the heretical Mr. Kuo has become a tough conservative critic of the corruption of religion by politicians and religious-right leaders who are guilty of “taking Jesus and reducing him to some precinct captain, to some get-out-the-vote guy.” Of those “family” groups who criticized Mr. Obama’s appearance at the AIDS conference, Mr. Kuo wrote, “Are they so blind and possessed with such a narrow definition of life that they can think of life only in utero?” The answer, of course, is yes. The Christian Coalition parted ways with its new president-elect, a Florida megachurch pastor, Joel Hunter, after he announced that he would take on bigger issues like poverty and global warming. But it is leaders like Mr. Hunter and Mr. Warren who are in ascendance. Even the Rev. Richard Cizik, vice president for governmental affairs at Mr. Haggard’s former perch, the National Association of Evangelicals, has joined a number of his peers in taking up the cause of the environment, putting him at odds with the Bush administration. Such religious leaders may not have given up their opposition to abortion or gay marriage, but they have more pressing priorities. They seem to have figured out, as Mr. Kuo has said, that “politicians use Christian voters for their money and for their votes” and give them little in return except a reputation for bigotry and heartless opposition to the lifesaving potential of stem-cell research. The axis of family jihadis — Focus on the Family, the Family Research Council, the American Family Association — is feeling the heat; its positions get more extreme by the day. A Concerned Women for America mouthpiece called Mary Cheney’s pregnancy “unconscionable,” condemning her for having “injured her child” and “acted in a way that denies everything that the Bush administration has worked for.” (That last statement, thankfully, is true.) This overkill reeks of desperation. So does these zealots’ recent assault on the supposedly feminizing “medical” properties of soy baby formula (which deserves the “blame for today’s rise in homosexuality,” according to the chairman of Megashift Ministries), and penguins. Yes, penguins. These fine birds have now joined the Teletubbies and SpongeBob SquarePants in the pantheon of cuddly secret agents for “the gay agenda.” Schools are being forced to defend “And Tango Makes Three,” an acclaimed children’s picture book based on the true story of two Central Park Zoo male penguins who adopted a chick from a fertilized egg. The hit penguin movie “Happy Feet” has been outed for an “anti-religious bias” and its “endorsement of gay identity” by Michael Medved, the commentator who sets the tone for the religious right’s strictly enforced code of cultural political correctness. Such censoriousness is increasingly the stuff of comedy. So are politicians of all stripes who advertise their faith. A liberal like Howard Dean is no more credible talking about the Bible (during the 2004 campaign he said his favorite book in the New Testament was Job) than twice-married candidates like Mr. McCain are persuasive at pledging allegiance to “the sanctity of marriage.” For all the skeptical theories about the Obama boomlet — or real boom, we don’t know yet — no one doubts that his language about faith is his own, not a crib sheet provided by a conservative evangelical preacher or a liberal political consultant on “values.” That’s why a Democrat from Chicago whose voting record is to the left of Hillary Clinton’s received the same standing ovation from the thousands at Rick Warren’s Saddleback Church that he did from his own party’s throngs in New Hampshire. After a quarter-century of watching politicians from both parties exploit religion for partisan and often mean-spirited political gain, voters on all sides of this country’s culture wars are finally in the market for something new. by Tzvee Zahavy at 10:39 AM Labels: mccain, obama 1 comment: Oy - Time Punts on Person of the Year - It's Me? We know: "It was not the first time the magazine went away from naming an actual person for its 'Person of the Year.' In 1966, the 25-and-under generation was cited; in 1975, American women were named; and in 1982, the computer was chosen." Still, this seems like a cop out. NEW YORK (Reuters) - You were named Time magazine "Person of the Year" on Saturday for the explosive growth and influence of user-generated Internet content such as blogs, video-file sharing site YouTube and social network MySpace. "For seizing the reins of the global media, for founding and framing the new digital democracy, for working for nothing and beating the pros at their own game, Time's Person of the Year for 2006 is you," the magazine's Lev Grossman wrote. The magazine has put a mirror on the cover of its "Person of the Year" issue, released on Monday, "because it literally reflects the idea that you, not us, are transforming the information age," Editor Richard Stengel said in a statement. by Tzvee Zahavy at 11:28 PM Labels: humor 1 comment: Can the Holocaust Happen Again -- Here? One time I apologized to my class at the University of Minnesota because I felt I had alarmed them. In the final lectures of my course of one hundred and ninety students called, "Introduction to Judaism," we discussed the impact on the demography of the Jewish people, and we talked about the philosophical meaning of the destruction of the European Jewish community during the Second World War. These events and circumstances have become known to us as the Holocaust. More and more over the years, the Holocaust has assumed greater importance in the curriculum of this course. Some years ago I spent one lecture on the subject. That year we devoted four hours to issues related to the horrors and tragedies of a dark era just a single generation ago. As part of the process of our discussion in the course I summarize the events and trends in European history and culture which lead up to the establishment of the death camps where millions of Jews were murdered, and of the crematoria, where their bodies were burned. We discuss the issues of the Holocaust against our understanding of more than one thousand years of European Anti-Semitism. We examine then the philosophical and theological responses to the trauma of the Holocaust and try to understand what meaning it all has for the contemporary Jew and for all Americans. In the midst of our lectures describing the facts of the destruction, questioning why the Holocaust happened, how it happened, and what it means, a student in the first row of the class raised her hand and asked with trepidation, did I, the instructor of the course, think that the Holocaust could happen again? Without hesitation, I said yes. And I proceeded to explain why I thought so and how I thought it could occur. The Holocaust was not an accident of history. It was not carried out by a few madmen in the midst of the confusion of war and terror. The most horrible aspect of the Holocaust was the organization and bureaucracy the Nazis created to carry out the murder of so many innocent civilians. Recent books and films dealing with the subject bring out how banal and everyday were the activities associated with the murder of millions. Claude Lantzman's nine hour documentary, Shoah, to be shown here in Minneapolis at the Uptown theater beginning April 13, brilliantly brings home the point. Common bureaucrats in all levels of public service signed the memoranda ordering the slaughter of the Jews. And the average citizen of Europe assisted in carrying out the orders. Many shared in the destruction of the Jews, each in a little, sometimes merely trivial way. After the fact, no one accepts responsibility for the crimes because every individual was just a part of a larger machine. Can it happen again? Can the murder of millions of innocent men women and children happen again? I said yes to my student. Look at your neighbor, your friend, your relative. Someone you know works in the bureaucracy we call the military industrial complex. Perhaps he or she builds part of a missile, a guidance system, or works on some design problem with direct military application. Are they not bringing the reality of the next Holocaust closer Maybe, I said to my class, your cousin goes to work every morning in an ICBM missile silo here in Minnesota or in North Dakota. When, God forbid, the order comes from the Officer to push the button, or turn the key, or enter the code, he or she, your friend or relative, will do it and will launch the missile and murder one million or more innocent civilians in Moscow, or Leningrad, or Berlin, or Prague. I said, there is no doubt in my mind that another Holocaust can happen and will happen unless you students, the future hope of our state and nation do all that you can to bring peace. And then we went on to continue our lecture, on to the next question. A few days later, while I was walking through the corridors of the University, I recalled the look I saw on the faces of some students after I calmly described how it could happen again. It was the look of discomfort, of worry, even of alarm. I felt I had done the wrong thing. I had told them what no one should tell them. That mass murder and death are ordinary things, banal parts of governmental memoranda. That they may be preparing to take part in the process. And worst of all, I insinuated that even if they try, there is nothing they can do to stop or divert the process. I came to class and asked, as I usually do, if there were any questions about the material assigned for the day. But instead of answering the questions, I stopped and apologized. I said I was sorry I answered as I had when asked whether it could happen again. I said I do not know what will happen in the future and should never try to predict. I asked the students to please forget. I assured them that we would confine ourselves to the task of understanding Jewish history and thought and not try to extend our lessons beyond that. Looking at their faces again, I knew they would not forget. by Tzvee Zahavy at 10:16 PM Labels: antiSemitism, Holocaust, Minnesota 2 comments: Crimes, Misdemeanors and Philanthropy “Behind every great fortune is a great crime,” my friend Charlie used to assure me on the golf course as we discussed the meaning of life. He exaggerated to make his point that it is commonly understood that people break laws in the pursuit of wealth. Lately we don’t have to look far to find proof. When the wealthy donate the products of their ill-gotten gains to charities we face some meaty moral issues. Do yeshivas, synagogues and federations have the obligation to investigate the source of the munificence that donors offer? How far must they go to be sure that the money is clean and that the donor is not a crook? Are there circumstances when accepting money from a scoundrel is morally right? In a recent local example Harold Kushner, a billionaire real estate developer and businessman in Essex County, made substantial donations to Jewish charities including Yeshiva University and a local yeshiva, subsequently named after him, the Kushner Academy. Now said individual has been arrested for allegedly paying prostitutes in an effort to suborn the perjury of witness that could testify that he made illegal contributions to political candidates. This is not a “great crime” but the full story of Kushner’s fortune has not yet unraveled. We may derive some moral guidance in today’s scandal ridden times at what some people argued regarding earlier ill-gotten gains. Back in the eighties New Yorker, Ivan Boesky made millions of dollars through the exploitation of illegal insider information. He did not earn his fortune honestly and through hard work. We know that he broke laws with impunity. And worst of all we know that with his dirty fortune he sought and was accorded notoriety and prominence in our community. Boesky served as president of the New York Federation fund drive, as member of the national Holocaust Memorial Council, and as a prominent supporter of the Jewish Theological Seminary. A troubling question was raised then as it should be again now, what should the community do? According to the New York Times of November 28, 1986, the insider trading scandal stirred an ethics debate. This was surprising since the public discussion of morality always has been rare in American society and has been virtually nonexistent in the American Jewish community. One issue that was raised in the controversy back then was whether the activities of the so-called "corporate raiders" were at all ethical? Arguments on both sides supported the self interests of the raiders on the one hand and of the entrenched corporate managers on the other. Whoever was right, one thing was clear. This aspect of the process of amassing great wealth in a short term was not an exclusively theological or religious issue. Surely this was not a problem that was likely to be handled intelligently by theologians. The rabbis certainly could attempt to sort out what should be done with the "dirty money" earned by unscrupulous persons who have transgressed the statutes of our land? Rabbi Wolfe Kelman, executive director of the Rabbinical Assembly of Conservative rabbis, was quoted in the New York Times in 1986 as saying, "There have to be some limits to the prevalence of greed." He suggested a "moral retooling" beginning with a summit meeting of rabbis, cardinals and priests. No one disagreed with this call to justice, echoing, if only weakly, the exhortations of Israel's classical prophets. Note well however that the summit was not held. What if we now held the meeting? On the top of the agenda of any forthcoming moral summit conference or continuing debate of public morality within the Jewish community, we must place several problems: Should philanthropic institutions, rabbinic seminaries, holocaust memorials, synagogues and schools accept donations of "dirty tzedakah"? How far, we must ask, should an institution go to investigate the source of every munificent gift? Once we have discovered that funds received by an institution derived from theft, embezzlement or swindling, should we give those funds back, refuse to make use of the fruits of iniquity? If we put these questions on the agenda the preponderant responses will be that we must look more closely at the sources of monetary donations, we must scrutinize more carefully their sources. But on the subject of returning illegally earned monies already donated to the Federation, the yeshiva, or other philanthropic recipients, we will find understandable resistance. Two paths of argument will emerge. One voice will argue that laundering illegal funds by donating them to worthy causes is good. It cleanses the soul of the donor and allows for some worthy outcome for reprehensible behavior. These gifts serve as sin-offerings of a sort. And anyway, some may say, who can determine whether a dollar given to charity came from a shady deal or a legitimate one? If the charity doesn't take the money, or keeps it and doesn't give it back out of revulsion, and if the Federation and UJA don't use the proceeds of scandal for purposes of ultimate good, then someone else will surely use the money and maybe not for such seemly purposes. And furthermore, the recipient needs to grow and do more of its consecrated work. The local agencies supported by Federations need more funds for their worthy purposes. And the UJA needs the money it has received to do more good for social welfare in the State of Israel. Very few who will raise their voice against this practice will dare to contend that stolen money must not be accepted in any form into the organized community. Few will say that by accepting stolen funds one desecrates the sanctity of a cause; that by honoring the crook, one sanctions immorality. Few will argue that the most effective way to limit greed and corruption is to use the sanctions of society against the immoral elements who would want to be accepted into our organized and orderly world. Yet where do we draw the line? Will we continue to accept money from the Boeskys, Levines, Kushners and their friends? Will we name Yeshivas after them? Will we hold these people up as models of behavior for our younger generation? Perhaps we should demonstrate our moral abhorrence of greed and criminality by rejecting the corrupt and sending back to them the fruits of their corruption with a reminder of an age-old message like that of the prophet Malachi at the end of chapter one, the Haftarah of Parashat Toledot: "You bring (to the Temple) what has been stolen or is lame or sick, and this you bring as your offering! Shall I accept that from you hand? says the Lord. Cursed be the cheat who has a male in his flock and vows it, and yet sacrifices to the Lord what is blemished; for I am a great King says the Lord of hosts, and my name is feared among the nations." To continue to be a great nation we must uphold our moral standards, even when the cost is great. We must set the highest standards for ourselves, our children and for the world around us. That has always been the destiny and primary mission of the Jewish people. Tzvee Zahavy was ordained rabbi at Yeshiva University and holds a Ph.D. in Religious Studies from Brown University. by Tzvee Zahavy at 10:08 PM Labels: kushner, politics No comments: President Carter's book: "Indefensible" "Moronic" ... Times: Israel Economy Strong. No Catastrophe Loomi... Video: Tricky-Dick Nixon - out-takes at his resign... Israel stocks up due to rate cut and better outloo... Israelis: how to turn a human ear into a radio spe... Manischewitz to make exodus from Jersey City to Ne... Slap: Prager Censured by Holocaust Board and Backs... Really Biblical: Take your oath while holding your... The Jews: Funny SNL Video spoof of the trailer for... Best 2006 Jews-is-News Opinions Picked by NY Times... 1988: A Difficult Year for America's Jews Pray for a refuah shelemah for Senator Tim Johnson... Jews: Ahmadinejad to prison for inciting genocide Carter Kisses Rabbis' Asses Ass Kissing Rabbis Excommunicated Billion Dollars for the Technion Amazing: Image of Mel Gibson in Latke Agudah goes beserk over "muddle and malaise" of ga... NIH: Bris Milah may prevent HIV Making the Aaron Kotler Video Lazy Shabbos Rebuild the Giant Buddhas? Video game "The Shiva" stars Rabbi costs $5 Why the El Al Boycott Will Fail Enemy-Loving-Jews Prager Refuses to Apologize for his Nonsensical Ra... CBS: David Duke at Iran Shoah Farce Rabbis Address Iran Shoah Farce El Al Boycott! Doctor challenges Jewish menstrual taboos Gay Decision Not "Tragic" or "Sad" Who Woulda Thunk? Ozick Praises Baeck New Video on Anti-Americanism in the Arab World Jewish Music Mecca in Teaneck Cafe הלפגוט בקנטורס וורלד - Bootleg Video of Chazan Con... If Gays OK then expect earthquakes, fire and brims... Frum Mull El Al Boycott and Ban Our two top Jewish music video posts Prager off the deep end - Jews should swear on the... Rabbi Riskin: Aliyah? Just Talk About It Israel = Nazis: French Woman Candidate OKs Hezboll... Thank God for the Atheists ADL: Ellison is OK; Koran is OK; Prager is ridicul... MN Congressman to Swear on Qur'an Video: CBS busts NYC siren rabbi	cc/2020-05/en_middle_0126.json.gz/line415
__label__cc	0.646575	0.353425	ToRCHI Preview of CHI presentations from DGP Lab UofT Bahen Building, 40 St George St, Room 5187 CHI 2014 Preview at DGP Lab, U of T. TorCHI hosts previews of the Dynamic Graphics Project's Papers at CHI. Since the CHI conference has 15 consecutive tracks these presentations give you a chance to preview CHI sessions ahead of time. DATE: APRIL 9, 2014 7:00PM LOCATION: Bahen Centre at the University of Toronto, 40 St. George Street. ROOM: number 5187, which is a sub-room within 5166. Each talk will be 20 minutes total; 15 minutes talk, with 5 minutes of questions. After the presentations the audience will be invited to discuss the presentations and give feedback. 1. Ricardo Jota - Let's Kick It: How to Stop Wasting the Bottom Third of your Large Screen Display 2. Michael Glueck - Dive In! Enabling Progressive Loading for Real-Time Navigation of Data Visualizations 3. Peter Hamilton - Conductor: Enabling and Understanding Cross-Device Interaction 4. Jishuo Yang - Panelrama: Enabling Easy Specification of Cross-Device Web Applications 5. Dustin Freeman - LACES: Live Authoring through Compositing and Editing of Streaming Video DETAILED ABSTRACTS Title: Let's Kick It: How to Stop Wasting the Bottom Third of your Large Screen Display Authors: Ricardo Jota, Pedro Lopes, Daniel J Wigdor, Joaquim A Jorge Large-scale touch surfaces have been widely studied in literature and adopted for public installations such as interactive billboards. However, current designs do not take into consideration that touching the interactive surface at different heights is not the same; for body-height displays, the bottom portion of the screen is within easier reach of the foot than the hand. We explore the design space of foot input on vertical surfaces, and propose three distinct interaction modalities: hand, foot tapping, and foot gesturing. Our design exploration pays particular attention to areas of the touch surface that were previously overlooked: out of hand’s reach and close to the floor. We instantiate our design space with a working prototype of an interactive surface, in which we are able to distinguish between finger and foot tapping and extend the input area beyond the bottom of the display to support foot gestures. Ricardo Jota is a Post-doc with Daniel Wigdor at the university of Toronto. He joined in 2012 and has been working of reducing the latency of the next generation of devices that you have in your pockets right now. Jota got his PhD from the technical university of Lisbon, in 2011, and has collaborated with the University of Calgary and Microsoft Research in numerous projects. Coincidentally, he doesn't like soccer at all. Title: Dive In! Enabling Progressive Loading for Real-Time Navigation of Data Visualizations Authors: Michael Glueck, Azam Khan, Daniel J Wigdor We introduce Splash, a framework reducing development overhead for both data curators and visualization developers of client-server visualization systems. Splash streamlines the process of creating a multiple level-of-detail version of the data and facilitates progressive data download, thereby enabling real-time, on-demand navigation with existing visualization toolkits. As a result, system responsiveness is increased and the user experience is improved. We demonstrate the benefit of progressive loading for user interaction on slower networks. Additionally, case study evaluations of Splash with real-world data curators suggest that Splash supports iterative refinement of visualizations and promotes the use of exploratory data analysis. Michael Glueck is a second-year PhD student at the University of Toronto. Coupling his fascination for both psychology and computer science, his research focuses on the way users navigate and way-find during interactions with multi-scale information visualizations. Title: Conductor: Enabling and Understanding Cross-Device Interaction Authors: Peter Hamilton, Daniel Wigdor The proliferation of inexpensive connected devices has created a situation where a person, at any given moment, is surrounded by interactive computers. Despite this fact, there are very few means by which a user may take advantage of this large number of screens. We present Conductor, a prototype framework which serves as an exemplar for the construction of cross-device applications. We present a series of interaction methods by which users can easily share information, chain tasks across devices, and manage sessions across devices. We also present a cross-device usage scenario which utilizes several cross-device applications built within our prototype framework. We also describe a user study, which helped us to understand how users will take advantage of a large number of devices in support of performance of a sense making task. Peter Hamilton is a first-year PhD student at the University of Toronto. His research is in Human Computer Interaction, focusing on interactions and applications that span across connected devices. Title: Panelrama: Enabling Easy Specification of Cross-Device Web Applications Authors: Jishuo Yang, Daniel J Wigdor We present Panelrama, a web-based framework for the construction of applications using distributed user interfaces (DUIs). Our implementation provides developers with low migration costs through built-in mechanisms for the synchronization of a UI state, requiring minimal changes to existing languages. Additionally, we describe a solution to categorize device characteristics and dynamically change UI allocation to best-fit devices. We illustrate the use of Panelrama through three sample applications which demonstrate its support for known interaction methods, we also present the results of a developer study, which validates our belief that cross-device application experiences can be easily implemented using our framework. Jishuo Yang is a MSc student at the University of Toronto with a background on HCI and software engineering. He recently completed his thesis on a web framework for distributing UI across multiple devices, and is currently working on bringing the framework to market with the startup company Conductr. Title: LACES: Live Authoring through Compositing and Editing of Streaming Video Authors: Dustin Freeman, Stephanie Santosa, Fanny Chevalier, Ravin Balakrishnan, Karan Singh Video authoring activity typically consists of three phases: planning (pre-production), capture (production) and processing (post-production). The status quo is that these phases occur separately, with the latter two having a significant amount of “slack time”, where the camera operator is watching the scene unfold during capture, and the editor is re-watching and navigating through recorded footage during post-production. While this process is well suited to creating polished or professional video, video clips produced by casual video makers as seen in online forums could benefit from some editing without the overhead of current authoring tools. We introduce LACES, a tablet-based system enabling simple video manipulations in the midst of filming. Seamless in-situ integration of video capture and manipulation forms a novel workflow, allowing for greater spontaneity and exploration in video creation. Dustin Freeman is a final-year PhD student at the University of Toronto. He comes from a hybrid background in theatre, mathematics and engineering. In his research, he explores interface for fluid, spontaneous expression. His thesis work is on a whole-body interface for stage performers to do video editing in the midst of performance.	cc/2020-05/en_middle_0126.json.gz/line420
__label__wiki	0.531531	0.531531	Falcon Finance Your reliable partner in the world of trade 21.11.2019 RubiconFX отзывы 16.11.2019 JP Morgan automates derivatives margin payments with DLT 14.11.2019 55% of the world’s top investors expect a 2020 stock market crash 14.11.2019 Trading quarterly economic announcements on the DAX30 14.11.2019 HSBC partners with SGX and Temasek on DLT for fixed income 13.11.2019 FactSet deploys data platform on OpenFin Nasdaq deploys clearing platform for Johannesburg Stock Exchange Comments Off on Nasdaq deploys clearing platform for Johannesburg Stock Exchange The Johannesburg Stock Exchange (JSE) has implemented Nasdaq’s clearing technology platform for its equity and currency derivatives market. In a statement, the JSE said that the launch is part of a multi-year project focused on migrating all of its markets to Nasdaq’s clearing platform for more efficient collateral management, intra-day risk monitoring and increased margin transparency. Equity and currency derivatives markets at JSE are the first to be migrated to the platform as part of the project, known as ITaC, which is being delivered in phases. “The launch of our new clearing platform is an important milestone in our aim to align ourselves with global best practices using a state of the art, multi-product technology solution,” said JSE’s CEO, Nicky Newton-King. “Technology has become vital for clearinghouses in offering services that stand up to market participants’ and regulators’ demands on robust risk management, transparency and efficiency.” Nasdaq’s market technology is used by more than 250 market participants, including broker-dealers, exchange operators, clearinghouses, central securities depositories and regulators in over 50 countries. “The Johannesburg Stock Exchange plays an important role as the leading African exchange and a prominent global player,” added Michèle Carlsson, managing director and head of business development for Middle East and Africa at Nasdaq. “JSE’s scalable and highly robust clearing solution makes them set for continued growth, innovative product development and compliance with evolving regulatory requirements. We look forward to continuing our journey and long-term technology partnership with them.” Earlier this month, Nasdaq promoted one of its most senior executives to president of European markets in a newly created role, as the exchange operator targets growth in the region. Bjørn Sibbern will be responsible for managing trading, clearing, settlement and data divisions in Sweden, Denmark, Finland, Iceland and the three Baltic countries. The post Nasdaq deploys clearing platform for Johannesburg Stock Exchange appeared first on The TRADE. Open an account now It's free to open an account, takes less than five minutes, and there's no obligation to fund or trade. Demo account Create account Rubiconfx CFD Broker Forex Platforms Development RubiconFX отзывы JP Morgan automates derivatives margin payments with DLT 55% of the world’s top investors expect a 2020 stock market crash	cc/2020-05/en_middle_0126.json.gz/line424
__label__cc	0.657032	0.342968	Why don't we make our own achievements? Posted by Klepsacovic at 6:57 PM \| Monday, June 22, 2009 In How nerfed is WoW? You decide! a little bit ago Larisa explores how WoW has changed in terms of getting easier. My response was this: Overall? Hard to say. WoW used to be harder, but much of that harder was because of terrible balance, not due to actual challenges. Only one real tanking class made it harder to do raids due to lack of tanks, but fixing that is hardly what I'd call a nerf. There's not much to be gained by tallying nerfs and checking the score. If the game is too easy, it means you're not trying hard enough to make it hard. If you're not willing to put in the effort, don't complain. Maybe this is where WoW has been nerfed: challenges are handed to people on platters. There didn't used to be specific challenges spoon fed to raids. If they wanted a challenge they made it themselves. I didn't see that happen often though. Why not? Why do most people not do something unless the devs tell them to do it? My last paragraph is most relevant: Why don't we make our own challenges? Perhaps this helps to explain it: we get banned. But there was a lack of such initiative before this. This isn't the cause. Why don't people make up their own challenges? On my first wander over to Yggradsil I came up with this: (it makes a little more sense in context, but I think it still works) I have noticed that spending less time often results in more fun. Oh sure now and then it's nice to lose a whole day, but for the most part WoW fun has diminishing returns. It starts to get stressful, especially if you spend half your time staring at the LFG interface thinking "I don't need that heroic, I don't need this other heroic, there's nothing to do." It's not just the time though. It's what you think about the time. Is the time work or is it play? Too often I think we start seeing it as work, not rewarding in itself but only for the rewards. When that happens it's pretty obvious why we'd get angry over content getting easier. On the other hand, if play was purely for the fun and experience, then we'd pity those who come after the nerfs because they won't get to play what we played. We're motivated by gear and other tangible (as much as virtual can be tangible) rewards, not as much by experiences. Self-made challenges do not give rewards. The devs don't intended for us to do them, so they don't reward them either. What can change? Ever heard the phrase "not working as intended"? That's another way of saying bug or exploit. The four man kill was not working as intended. The devs wanted the fight done with 10 or 25 people, not 4. Change the philosophy. Rather than having just intended (do this) and not intended (don't do this, or else), add something else: unexpected (that worked? Cool!) I realize this makes things difficult for the devs and GMs. Where is the line between unintended and exploitative? I hate to say it, but City of Heroes/Villains might actually have something to contribute. As far as I can tell from secondhand evidence, the game doesn't really have intention or balance. The result is that people just do fights however. My friend claims it makes them think, I thought it made them never have to plan ahead if just anything works (meaning it goes to the other extreme of non-thinking). A middle ground could be cool though. Take current raid design, loosen it slightly, and ease up on the bans because something was "not working as intended." Upon further review, it appears that what they did falls under the area of what I would call obvious exploitation: getting FL to go past the walls. http://jormundgards.blogspot.com/2009/06/maybe-not-so-tactical.html Still, the fact that it took so long to get any real information is bad PR. The explanation of the GM was pretty bad too, completely failing to convey that the issue wasn't the lack of being hit, but the location of the boss. It's also odd that so many bugs still slip through despite the long development cycle. What disturbs me most is that people think it's okay to blatantly exploit and lie about it. The Perils of a Single Source WoW is not Real Life Blessed by the RNG Dueling Cults "Welfare" is Stupid Midsummer Set Remember when paladins were bad OTs? Possible side-effects of Conquest everywhere Blessing of Sanctuary in 3.2 75 years after we hit level 12 Ret! Iran is moving too fast I like to laugh at angry people Time for bed Addiction, Denial, and Other Words What a difference a night makes Oops: 2.0 Things that should be overpowered, but aren't How a shaman became a paladin Do you ever break the rules?	cc/2020-05/en_middle_0126.json.gz/line428
__label__wiki	0.627858	0.627858	Meaning of the name Obreanna: Boy Names / Girl Names Multi-Gender Names Names By Usage Obreanna Usage: English Interesting stuff. The BBC just shut down their Ouch! disability iessus board, telling everyone they should go use Facebook or Twitter instead (Beeb really haven't been keeping up to speed technically and have been leaned on to cut their web activities). As Ouch! users like me repeatedly pointed out to them, part of the reasons Ouch! was so valuable to many disabled people was the ability to post pseudonymously (in fact it was BBC policy that users should not reveal contact details). That meant that people felt safe in discussing the most intimate aspects of their disability, or their experience of abuse, or discrimination in the workplace, the street or at home. They could retain their anonymity and privacy from anyone trying to track them via their real' name, but still retain the ability to be a known person in a community. What made the Ouch! recommendations to use Facebook particularly ridiculous, if not downright insulting, was that their own columnist, Disability fine person, had already had her own Facebook page deleted for not having a real' name. Facebook, and now it appears Google+, simply don't offer that protection of pseudonymity that some people need to be able to access social media, and for some disabled people, as well as members of other minorities, that's going to mean they are simply unusable. And when it comes down to it, that's discrimination. Know what this name means? Share! © 2009 - 2020 What Does My Name Mean? Privacy Policy Links	cc/2020-05/en_middle_0126.json.gz/line432
__label__cc	0.622869	0.377131	CSHB 236(W&M): "An Act imposing a limited tax on wages and on net earnings from self-employment; relating to the administration and enforcement of that tax; and providing for an effective date." 00 CS FOR HOUSE BILL NO. 236(W&M) 01 "An Act imposing a limited tax on wages and on net earnings from self-employment; 02 relating to the administration and enforcement of that tax; and providing for an 03 effective date." 04 BE IT ENACTED BY THE LEGISLATURE OF THE STATE OF ALASKA: 05 * Section 1. The uncodified law of the State of Alaska is amended by adding a new section 06 to read: 07 SHORT TITLE. This Act may be known as the Alaska Education Tax Act. 08 * Sec. 2. AS 43.10.042(a) is amended to read: 09 (a) A lien imposed under AS 43.10.010 - 43.10.060 is not valid as against a 10 mortgagee or other lien holder, pledgee, purchaser, or judgment creditor until notice of 11 it is recorded in the records of the recording district where the property subject to the 12 lien is situated. However, regardless of the date the liens are recorded, a lien arising 13 out of a tax due under AS 43.45, AS 43.56, and AS 43.75 [AS 43.56 AND 43.75], 14 including the penalties and interest on the tax, is a lien prior, paramount, and superior 01 to all other liens, mortgages, hypothecations, conveyances, and assignments, upon all 02 the real and personal property of the person liable for the tax, and upon all the real and 03 personal property used with the permission of the owner to carry on the business that 04 is subject to the tax. 05 * Sec. 3. AS 43 is amended by adding a new chapter to read: 06 Chapter 45. Education Tax. 07 Sec. 43.45.011. Tax imposed. (a) There is imposed a tax, not to exceed a 08 combined total of $100 a calendar year, on wages and net earnings from self- 09 employment in excess of $600. 10 (b) The rate of the tax is 10 percent. 11 (c) The tax imposed under this section does not apply to wages and net 12 earnings exempt from the tax under federal law. 13 (d) The tax is imposed in a calendar year following a fiscal year during which 14 the balance on June 30 of assets of the budget reserve fund established in art. IX, sec. 15 17, Constitution of the State of Alaska, that were invested in the constitutional budget 16 reserve fund accounts at the state's custodial bank, at current market value, as reported 17 to the department, was less than $1,000,000,000. Once imposed, the tax remains in 18 effect until suspended under (e) of this section. 19 (e) The tax is suspended in a calendar year following a fiscal year during 20 which the balance on June 30 of assets of the budget reserve fund established in art. 21 IX, sec. 17, Constitution of the State of Alaska, that were invested in the constitutional 22 budget reserve fund accounts at the state's custodial bank, at current market value, as 23 reported to the department, was equal to or greater than $2,500,000,000 and is not 24 reimposed until the condition in (d) of this section is met. 25 (f) The commissioner shall certify the balance of assets invested in the 26 constitutional budget reserve fund accounts at the state's custodial bank, at current 27 market value, as reported to the department of the budget reserve fund on June 30 28 within one calendar month following the end of each fiscal year. 29 Sec. 43.45.021. Collection of tax by employer. (a) An employer shall 30 deduct and withhold 10 percent of an employee's wages subject to withholding under 31 26 U.S.C. 3401 - 3406 on the first regular payroll of the calendar year and from 01 subsequent payrolls until the tax due under this chapter is fully withheld. 02 (b) An employer is liable for the tax required to be withheld from an employee 03 unless the employer can demonstrate that the employer relied on proof provided by the 04 employee that the total tax for the calendar year imposed under AS 43.45.011 had 05 already been withheld under this section or paid under AS 43.45.031. A deduction of 06 the tax may not be made from the wages of an individual who provides proof to the 07 employer that the entire tax imposed under AS 43.45.011 on that individual for the 08 calendar year has already been withheld or paid under AS 43.45.031. 09 (c) Tax withheld by an employer becomes due and shall be paid by an 10 employer to the department in accordance with regulations adopted by the department. 11 (d) An employer shall maintain a record of the amount deducted from the 12 wages of each employee and shall furnish an annual statement of the deductions to 13 each employee and to the department in accordance with regulations adopted by the 14 department. 15 (e) The Department of Revenue may, to the extent practicable, coordinate 16 collection and reporting of the tax imposed in this chapter with the collection and 17 reporting of employment security contributions by the Department of Labor and 18 Workforce Development, including permitting the Department of Labor and 19 Workforce Development to collect the tax payments and remit them to the Department 20 of Revenue. 21 (f) The department may by regulation provide for an incentive to an employer 22 or a self-employed individual for electronically filing returns and making payments or 23 for other use of technology or filing methodologies to improve the efficiency of tax 24 administration. Regulations adopted under this subsection must 25 (1) establish the duration, level, nature, and value of the incentive; the 26 value of an incentive established under this subsection may not exceed $300 for each 27 return, application, filing, or payment; and 28 (2) require that the incentive be available only if the return, 29 application, filing, or payment is filed timely with the department under this chapter. 30 Sec. 43.45.026. Employer security. (a) If the department determines that an 31 employer has been delinquent in remitting the tax imposed under AS 43.45.011 in 01 accordance with regulations adopted by the department, the department may require 02 the employer to deposit and keep on deposit with the department a sum equal to the 03 tax required to be withheld by the employer during the 12 months immediately 04 preceding the determination of delinquency under this subsection by the department. 05 If the employer was not required to withhold tax during the full 12 months 06 immediately preceding the determination of delinquency, the department may require 07 a deposit equal to the employer's estimated liability for a 12-month period based on 08 the actual liability for the period during which the employer was required to withhold 09 tax. 10 (b) The department may accept a bond or other security equal in value to the 11 deposit required under (a) of this section in lieu of the deposit required under (a) of 12 this section. 13 (c) The provision of a deposit, bond, or other security under this section does 14 not relieve the employer from any other obligation under this title. 15 (d) The department may apply all or part of the deposit, bond, or other security 16 to payment of the tax imposed under AS 43.45.011, and to any interest and penalties 17 imposed under AS 43.45.021. 18 (e) The deposit, bond, or other security provided under this section is exempt 19 from process, attachment, garnishment, or execution unless otherwise provided by 20 law. 21 (f) The department shall return the deposit, bond, or other security to the 22 employer if the employer is timely in filing and remitting the tax under AS 43.45.021 23 for a period of 24 consecutive months. 24 (g) If an employer ceases to be subject to AS 43.45.021, the department shall, 25 after 12 months have elapsed and all liabilities of the employer to the department 26 under this chapter have been satisfied, refund to the employer any remaining deposit, 27 and cancel any bond or other security accepted by the department under this section. 28 Sec. 43.45.031. Payment of tax by self-employed individual. A self- 29 employed individual shall remit to the department 10 percent of the individual's net 30 earnings from self-employment in accordance with regulations adopted by the 31 department until the entire tax has been paid. 01 Sec. 43.45.041. Refund of overpayments. (a) If an individual pays to the 02 department, directly or through withholding, an amount exceeding the total tax 03 imposed under this chapter during a calendar year and the individual applies for a 04 refund in accordance with regulations adopted by the department, the department shall 05 refund the overpayment to the individual. 06 (b) Interest on an overpayment may not be allowed under AS 43.05.280 if the 07 department refunds the overpayment within 90 days after the date the individual 08 correctly files the refund claim. 09 (c) The Department of Revenue may adopt regulations to coordinate refunds 10 of overpayments under this section with refunds of employment security contributions 11 under AS 23.20.165. 12 (d) An individual may apply for a refund under this section only during the 13 calendar year immediately following the calendar year in which the excess was paid. 14 Sec. 43.45.051. Report of payments to self-employed individuals. A person 15 required to report a payment to a self-employed individual to the federal government 16 under 26 U.S.C. shall also report that payment to the department in accordance with 17 regulations adopted by the department. 18 Sec. 43.45.061. Disposition of tax proceeds. (a) The tax collected by the 19 department under AS 43.45.021 shall be deposited into the general fund and accounted 20 for separately. 21 (b) The legislature may appropriate the estimated amounts to be collected and 22 separately accounted for under (a) of this section for education. 23 (c) The deposit required and appropriation authorized by this section are not 24 intended to create a dedication in violation of art. IX, sec. 7, Constitution of the State 25 of Alaska. 26 Sec. 43.45.099. Definitions. In this chapter, 27 (1) "employee" has the meaning given in 26 U.S.C. 3401; 28 (2) "employer" has the meaning given in 26 U.S.C. 3401; 29 (3) "net earnings from self-employment" has the meaning given in 26 30 U.S.C. 1402; 31 (4) "wages" has the meaning given in 26 U.S.C. 3401. 01 * Sec. 4. The uncodified law of the State of Alaska is amended by adding a new section to 02 read: 03 REGULATIONS. Notwithstanding sec. 6 of this Act, the Department of Revenue 04 may proceed to adopt regulations to implement sec. 3 of this Act. The regulations take effect 05 under AS 44.62 (Administrative Procedure Act), but not before the effective date of sec. 2 of 06 this Act. 07 * Sec. 5. Section 4 of this Act takes effect immediately under AS 01.10.070(c). 08 * Sec. 6. Except as provided in sec. 5 of this Act, this Act takes effect January 1, 2005.	cc/2020-05/en_middle_0126.json.gz/line438
__label__wiki	0.964579	0.964579	Home > Gymnastics > Simone Biles sets all-time medal record at Stuttgart world championships Simone Biles sets all-time medal record at Stuttgart world championships by Clive Morgan - 13 October 2019 14 November 2019 There is surely nothing left that could be surprising about US gymnast Simone Biles. She has dominates the world of women’s artistic gymnastics; is an open book when she has something to say, and she collects medals like many others her age collect shoes. The one thing that Biles doesn’t do, however, is count her medals – it appears that everyone does that for her. Winning her 24th and 25th world championship medals in beam and floor in Stuttgart put the United States gymnast top of the all-time medal charts for the championships. Biles won five gold medals at these World Championships. If she can repeat that at the Tokyo 2020 Olympics it would be a feat no female gymnast has managed at a single Games. But for Biles, it’s not about the statistics. “I’m not a number person,” she said. “[But] I can’t be more thrilled with the performance that I put out at this world championships.” At the age of 22, Biles is a hero to younger gymnasts who grew up watching her routines. “I’m second in the world after Simone Biles, and she’s obviously so amazing. And to be second is super crazy,” the 16-year-old US gymnast Sunisa Lee said after taking silver behind Biles in the floor exercise. “I don’t know how she’s been doing this for so long.” Biles’s 24th medal came on the beam, breaking a tie for 23 with Belarusian gymnast Vitaly Scherbo. Biles scored 15.066 after a near-flawless routine, opting for a simpler dismount than the double-double she performed earlier in the championships. When her score was announced, guaranteeing the medal record, Biles punched the air. “I was really excited. I thought it was going to be at least a 14.8, 14.9, but to see 15, I was like, ‘Well, that’s pretty crazy,’ so I was very proud,” she said. China took silver and bronze with Liu Tingting on 14.433 and Li Shijia on 14.3, respectively. Biles won the floor exercise by a full point, scoring 15.133 despite a step out of bounds on one pass, and blew kisses to the audience after finishing her routine. Her US teammate Lee won silver, her third medal of the championships, while Angelina Melnikova took bronze for Russia. Biles’s winning routine came after a long wait when Brazilian gymnast Flavia Saraiva requested an inquiry into her score, during which time Biles sat on the edge of the floor. Her earlier gold medals came in the team event, the individual all-around and the vault. A fifth place on uneven bars ended Biles’s chances of winning a medal in all six events, which she did in 2018 in her comeback world championships after a sabbatical in 2017. The uneven bars are historically Biles’s weakest event, though she still won a world silver in 2018, and two-time world champion Nina Derwael of Belgium is the strongest contender to stop a gold-medal sweep by Biles and the US women’s team at the Olympics. Biles hasn’t confirmed whether she’ll continue to compete after the Tokyo Olympics, so this may have been her last at the world championships. Blowing kisses to the crowd wasn’t meant as a goodbye to the competition, she said. “It’s just a good floor routine, farewell to just the end of this world championship chapter here in Stuttgart,” she said. Of her 25 career world medals, 19 are gold, against 12 of 23 for Scherbo. Earlier, Russia’s Nikita Nagornyy won the men’s vault for his third gold medal of the championships. He’s the first European man to win the vault since 2010. Nagornyy scored an average 14.966 from his two vaults, beating his friend and Russian teammate Artur Dalaloyan into second place. The bronze went to Ukraine’s Igor Radivilov. The 38-year-old Romanian Marian Dragulescu, a four-time world champion, secured qualification for his fifth Olympics by placing fourth. Britain won its second gold of the championships as Joe Fraser scored 15 points to win on parallel bars. Ahmet Önder was second for Turkey, with Japan’s Kazuma Kaya third. Max Whitlock won Britain’s first gold medal Saturday on pommel horse. Arthur Mariano won gold for Brazil on the high bar, scoring 14.9 ahead of Tin Srbic for Croatia. Dalaloyan took the bronze to end the championships with four medals. Tagged Ahmet Onder Angelina Melnikova Arthur Mariano Artur Dalaloyan Flavia Saraiva Igor Radivilov Joe Fraser Kazuma Kaya Li Shijia Liu Tingting Marian Dragulescu Max Whitlock medal record Nikita Nagornyy Simone Biles Stuttgart Sunisa Lee Tin Srbic Vitaly Scherbo world championships World Acrobatics Society Inducts Nine at Hall of Fame Banquet Simone Biles set to be face of 2020 Olympics after record world medal haul Indonesia to resume international trampoline championship 24 April 2019 14 November 2019 1988 Olympic champion Yelena Shushunova dies at 49	cc/2020-05/en_middle_0126.json.gz/line448
__label__wiki	0.583286	0.583286	Al-Quran Surah 4. An-Nisaa, Ayah 73 Duas from the Al-Quran Surah: 1 Al-Fatiha 2 Al-Baqara 3 Al-i'Imran 4 An-Nisaa 5 Al-Maida 6 Al-An'am 7 Al-A'raf 8 Al-Anfal 9 At-Tauba 10 Yunus 11 Hud 12 Yusuf 13 Ar-Ra'd 14 Ibrahim 15 Al-Hijr 16 An-Nahl 17 Al-Israa 18 Al-Kahf 19 Maryam 20 Ta-ha 21 Al-Anbiyaa 22 Al-Hajj 23 Al-Muminun 24 An-Nur 25 Al-Furqan 26 Ash-Shu'araa 27 An-Naml 28 Al-Qasas 29 Al-Ankabut 30 Ar-Rum 31 Luqman 32 As-Sajda 33 Al-Ahzab 34 Saba 35 Fatir 36 YaSin 37 As-Saffat 38 Sad 39 Az-Zumar 40 Al-Mu'min 41 Ha-Mim 42 Ash-Shura 43 Az-Zukhruf 44 Ad-Dukhan 45 Al-Jathiya 46 Al-Ahqaf 47 Muhammad 48 Al-Fat-h 49 Al-Hujurat 50 Qaf 51 Az-Zariyat 52 At-Tur 53 An-Najm 54 Al-Qamar 55 Ar-Rahman 56 Al-Waqi'a 57 Al-Hadid 58 Al-Mujadila 59 Al-Hashr 60 Al-Mumtahana 61 As-Saff 62 Al-Jamu'a 63 Al-Munafiqun 64 At-Tagabun 65 At-Talaq 66 At-Tahrim 67 Al-Mulk 68 Al-Qalam 69 Al-Haqqa 70 Al-Ma'arij 71 Nuh 72 Al-Jinn 73 Al-Muzzammil 74 Al-Muddaththir 75 Al-Qiyamat 76 Ad-Dahr 77 Al-Mursalat 78 An-Nabaa 79 An-Nazi'at 80 Abasa 81 At-Takwir 82 Al-Infitar 83 Al-Mutaffifin 84 Al-Inshiqaq 85 Al-Buruj 86 At-Tariq 87 Al-A'la 88 Al-Gashiya 89 Al-Fajr 90 Al-Balad 91 Ash-Shams 92 Al-Lail 93 Adh-Dhuha 94 Al-Sharh 95 At-Tin 96 Al-Alaq 97 Al-Qadr 98 Al-Baiyina 99 Al-Zalzalah 100 Al-Adiyat 101 Al-Qari'a 102 At-Takathur 103 Al-Asr 104 Al-Humaza 105 Al-Fil 106 Quraish 107 Al-Ma'un 108 Al-Kauthar 109 Al-Kafirun 110 An-Nasr 111 Al-Lahab 112 Al-Ikhlaas 113 Al-Falaq 114 An-Nas Ayah: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 Juz: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Change Font Options English Font : Arial Courier Courier New Geneva Georgia Helvetica Sans-serif Tahoma Times New Roman Verdana Arabic Font : Al Qalam Quran Me quran Traditional Arabic AbdulBasit(Mujawwad) AbdulBasit(Murattal) AbdullahBasfar Abdurrahmaan-As-Sudais Al-Hudhaify Al-Husary(Mujawwad) Al-Minshawy(Mujawwad) Al-Minshawy(Murattal) Ash-Shaatree Ash-Shuraym Hani-Rifai MisharyRashidAl-Afasy MuhammadJibreel Repeat Ayah Times Show Translations Yusaf Ali Khattab, Clear Quran Al-Quran Grammar Prev Go Next وَلَئِنْ أَصَابَكُمْ فَضْلٌ مِنَ اللَّهِ لَيَقُولَنَّ كَأَنْ لَمْ تَكُنْ بَيْنَكُمْ وَبَيْنَهُ مَوَدَّةٌ يَا لَيْتَنِي كُنْتُ مَعَهُمْ فَأَفُوزَ فَوْزًا عَظِيمًا Asad : But if good fortune comes to you from God, such a person88 is sure to say - just as if there had never been any question of love between you and him -: "Oh, would that I had been with them, and thus had a [share in their] mighty triumph!" Khattab : But if you return with Allah’s bounties, they will say—as if there had been no bond between you—“We wish we had been there with them to share the great gain!” Malik : But if you are blessed with grace from Allah, he will say, as if there was no friendship between you and him: "I wish I had been with them; I could have attained a mighty good fortune!" Pickthall : And if a bounty from Allah befell you, he would surely cry, as if there had been no love between you and him: Oh, would that I had been with them, then should I have achieved a great success! Yusuf Ali : But if good fortune comes to you from Allah they would be sure to say as if there had never been ties of affection between you and them "Oh! I wish I had been with them; a fine thing should I then have made of it!" 590 Transliteration : Walain asabakum fadlun mina Allahi layaqoolanna kaan lam takun baynakum wabaynahu mawaddatun ya laytanee kuntu maAAahum faafooza fawzan AAatheeman Note - 88 Lit.,"he". Note - 590 Just a selfish man's thought. Such men are far from being a source of strength to their community. They are no use in a fight, and the next verse by implication discards them. Disdainfulness Lagging Behind In Jihad Asad \| Malik \| Pickthall \| Yusuf Ali \| Mustafa Khattab 0 votes 0 dislikes Asad 88 Lit.,"he". Yusuf Ali 590 Just a selfish man's thought. Such men are far from being a source of strength to their community. They are no use in a fight, and the next verse by implication discards them.	cc/2020-05/en_middle_0126.json.gz/line451
__label__wiki	0.841755	0.841755	ASN 100 John Todd/isiphotos.com Americans Battle Water Before Soca Warriors The United States men's national team is preparing to take on Trinidad and Tobago with a positive result meaning they'll go to the World Cup. If only they could get onto the field. BY Noah Davis Posted PORT OF SPAIN, Trinidad and Tobago—We've been talking a lot about the weather and the water. It's the rainy season here, which means it rains, which means the field can be wet. Really wet. On Monday afternoon, the United States national team emerged at Ato Boldon Stadium to find the track surrounding the pitch looking more like a moat. As a result, Bruce Arena's squad was virtually unable to train the day before its make-or-break World Cup qualification match. A win or a draw sees the Americans through to Russia and a locker room champagne shower. A loss likely douses all those hopes and dreams. The players made their way out to the grass, some walking and some hitching a ride. First 2 #USMNT players on the field are Graham Zusi (walked across the moat barefoot) and Christian Pulisic (carried over by a staffer) ???? pic.twitter.com/amDHkMrzkQ — Ives Galarcep (@SoccerByIves) October 9, 2017 (Later, as the image above shows, the teenager would walk through—not on top of—the water. Very disapointing.) In a press conference following the attempted training sesssion, the American coach lamented the conditions. "I would love to see one of these hotshot teams from Europe come here and play in our CONCACAF qualifying and really get a taste of this and see what that's about," he said. "This is very challenging, it's like survival of the fittest. They could do one of those TV shows on this. Who will survive in the end, that's basically what this is." This statement drew the predictable series of comments from around the American soccer community. What absurdity, for Arena to suggest that the "hotshot" European teams would struggle in CONCACAF. How could he be so bold, so stupid, so unaware? Except that wasn't his point. Noting that training in a swimming pool isn't ideal is not the same thing as saying Germany wouldn't qualify from the Hexagonal. Frankly, I'd love to see the Germans come to Trinidad and Tobago because it's a lovely country and it would be fun to watch them deal with the rigmarole of playing here. This doesn't mean they wouldn't win. It just means CONCACAF is different, and they might be upset when they needed jetskis to get to training and then watched their best player get kicked and kicked and kicked, too. But enough talk. Ninety minutes to the World Cup. Let's play this game. For Arena, it's all hands on deck, with the kid leading the way. Right? "Hopefully he's fine," the coach responded when asked how Pulisic recovered from Friday night's thrashing at the feet of Panama. Trinidad and Tobago, a squad that's a flicker of the one that was the smallest nation to qualify for the World Cup before Iceland did so yesterday, shouldn't present too stiff a test. But this American squad has managed to make a mess of not supossedly stiff tests during this entire cycle, which is how they got into this must-result mess in the first place. Be prepared for a nervous evening. It's 90 degrees out this morning, and feels like 102. Those numbers drop to 81 and 89 by kickoff at 8 p.m. But the humidity will jump from the mid-70s to the high 80s. You just hope the rain holds off for one night. USWNT takes first step towards Tokyo with 4-0 win over Haiti What's are the goals and objectives for the USMNT ahead of Costa Rica friendly? Lackluster weekend for Americans abroad brings some success, mostly losses Flach seeks roles with the U.S. U-20s & St. Pauli first team in 2020 Chicharito impact, Altidore's headache, Pomykal update, Vassilev & more Tweets from @ThisIsASN/ussoccer Pick Your Starting XI Copyright ©2012-20 American Soccer Now LLC Follow Us: Terms of Use Privacy Policy Survey	cc/2020-05/en_middle_0126.json.gz/line454
__label__wiki	0.682749	0.682749	Photo of the eruption by USGS Scientists Track Leilani Estates Lava Eruption LEILANI ESTATES, Hawaii - The USGS is tracking the eruption that commenced in the Leilani Estates subdivision Thursday evening in the lower East Rift Zone of Kilauea Volcano. (USGS) The opening phases of fissure eruptions are dynamic. Additional vents and new lava outbreaks may occur. The fissure in Leilani Estates (as of 6:00 p.m.) was about 150 m (164 yards) long. (BIVN) – Scientists have issued a new Volcanic Activity Notice as an eruption has commenced in the Leilani Estates subdivision in the lower East Rift Zone of Kilauea Volcano. Shortly before 5 pm, the USGS Hawaiian Volcano Obseravtory says lava was confirmed at the surface in the eastern end of the subdivision. Hawaii County Civil Defense, which reported the eruption occurred at in the area of Mohala Street, was on the scene and “coordinating needed response including evacuation of a portion of the Leilani subdivision.” By 5:40 p.m. that civil defense message was changed to “all residents in Leilani Estates and Lanipuna Gardens Subdivisions are required to evacuate.” (USGS) White, hot vapor and blue fume emanated from an area of cracking in the eastern part of the subdivision. Spatter began erupting shortly before 5:00 p.m. HST. Lava was confirmed at the surface in the eastern end of the subdivision, in the areas of Mohala and Leilani Streets. The Pahoa Regional Community Center near the new Pahoa Regional Park is open for shelter, as well as the Kea’au Community Center for additional shelter needs. (USGS) Areas downslope of the erupting vent are at risk of lava inundation. At this time, the general area of the Leilani Estates subdivision appears at greatest risk. Hawai‘i County Civil Defense is on scene and coordinating needed responses, including evacuation of the Leilani Estates and Lanipuna Gardens subdivisions. In its Volcanic Activity Notice, the Current Volcano Alert Level was upgraded to WARNING. It was previously at WATCH. (USGS) Residents of the lower Puna District should remain alert, review individual, family, and business emergency plans, and watch for further information about the status of the volcano. Filed Under: Breaking Tagged With: Kilauea, lava, Leilani Estates	cc/2020-05/en_middle_0126.json.gz/line462
__label__wiki	0.67892	0.67892	Video by David Corrigan VIDEO: Lava-Locked Puna Community Plans Push For Access Roads PUNA, Hawaiʻi - A gathering was held Thursday on a private farm off Beach Road to discuss ideas to gain access to properties blocked by lava flows. A wall of hardened lava blocks Highway 137 heading towards Kapoho. (BIVN) – Residents of Puna, in need of better access to their lands following the eruption of Kīlauea on the lower East Rift Zone, met on Thursday to discuss their options. Several neighbors living in the area of Waʻawaʻa Subdivision, Papaya Farms Road, Noni Farms, Cinder Road and Kapoho sat together at a private farm located along Government Beach Road in order to share their thoughts. Many are unable to reach their property unless by helicopter. Attendees included Puna councilwoman Eileen O’Hara, Kapoho-area landowner Lono Lyman, and meeting organizer Smiley Burrows, who told everyone about the online petition she started. “Our community in Kapoho needs funding to rebuild roads to access our homes and farms,” Burrows wrote. “In learning the county is allocating no funding to hundreds of residents and farms, I am speaking out for our community, please support our petition to return to our homes.” The petition already has 1,345 signatures. Councilwoman O’Hara told the group that she has submitted a council resolution urging the administration to recover lava-inundated Highway 132. The resolution, which will be heard in committee on November 1, reads: RESOLUTION NO. 732-18 A RESOLUTION URGING THE COUNTY OF HAWAII TQ MAKE RECOVERING THOSE SECTIONS OF COUNTY HIGHWAY 132 THAT WERE INUNDATED WITH LAVA FROM THE MAY 3, 2018 VOLCANIC ERUPTION A TOP PRIORITY IN PUNA’ S RECOVERY EFFORTS, AND COMMENCE PLANNING THE FUNDING AND ROUTING OF A REPLACEMENT ROAD AND IMMEDIATE IMPLEMENTATION OF ALTERNATIVE ROUTES TO ACCOMMODATE RESIDENTS OF AFFECTED COMMUNITIES. WHEREAS, the volcanic eruption in Puna that started May 3, 2018, has resulted in the loss of a significant number of miles of both public and private roadways; and WHEREAS, approximately 3 miles of County Highway 132, which provides the primary access to much of Kapoho, from Lava Tree State monument to Cape Kumukahi was covered by lava from the May 3rd eruption; and WHEREAS, in early May 2018, the County paved a ten-foot wide asphalt strip of the previously graveled 3.8 miles of Government Beach Road from the Hawaiian Shores Recreational Estates terminus at the privately-owned Papio Street, which has a 40-foot right-of way, to the remnant of County Highway 137 built across the 1960 lava flow; and WHEREAS, the paving of Government Beach Road, which is narrow and winding, was completed to accommodate access for the Kapoho area residents and businesses given the direction taken by the May 3rd lava event; and WHEREAS, the recently paved section of Government Beach Road is part of the Old King’s Highway and has always been deemed an emergency access road by the County; and WHEREAS, the initial quarter mile of Government Beach Road no longer follows the original road right-of-way due to cliff subsidence into the ocean and the entire section known as Honolulu Landing is fully within the tsunami zone, making it unsafe as an emergency route during high surf events, such as hurricanes and tsunamis; and WHEREAS, due to the May 3rd lava event, Government Beach Road is now the only access for hundreds of households living along Government Beach Road, in the Waʻawaʻa Subdivision, on Papaya Farms Road, and in the area known as Noni Farms Road, placing these residents in peril due to inability to evacuate by roadway when the area experiences another extreme weather event; and WHEREAS, due to the impacts of the May 3rd lava event, the Kapoho Cinder Pits continue to be utilized by local trucking businesses providing much needed materials for road building, which results in approximately 50 commercial truck trips daily of thirty-three cubic yard cinder trucks traversing the narrow Government Beach Road, navigating the narrow and privately held Papio Street, and continuing six miles up Kahakai Boulevard to Highway 130, through a residential neighborhood where speed limits are set at 35 miles-per-hour, with no paved shoulders and limited pedestrian walkways, thus creating a nuisance and public safety issue; and WHEREAS, a realignment of the Government Beach Road with Coastal Puna Parkway owned by the Hawaiian Shores Community Association, which has an eighty foot right-of-way, twenty-four feet of asphalt, and well maintained grassy shoulders, is supported by the landowner (Habashi) of the property known as Honolulu Landing and desired by the Hawaiian Shores Community Association, owner of Coastal Puna Parkway which the association would like to dedicate to the County; and WHEREAS, the realignment of the Government Beach Road with Coastal Puna Parkway would resolve the problems of subsidence and inundation by the ocean along the stretch of the road known as Honolulu Landing and provide the County with a road right-of-way extending from Hawaiian Paradise Park to Kapoho; and WHEREAS, the nearly 150 active farms, homes, and agricultural lands in the area of Kapoho referred to as Noni Farms that were not inundated with lava, must now take a lengthy circuitous route along old cane roads, across private properties, down the narrow, windy and hilly section of the Government Beach Road connecting to privately owned Papio Street, and then six miles up Kahakai Boulevard to reach Highway 130 increasing the commute to Pahoa by approximately 30- 35 minutes since the lava event; and WHEREAS, there exists an old railroad right-of-way in this area that connects to Kahala Street (Railroad) in Hawaiian Shores Recreational Estates and another section connects to Kehau Boulevard in Nanawale Estates; and WHEREAS, gaining a perpetual right-of-way from the four landowners (Lyman, Chow, Kamehameha Schools/Bishop Estates, and State of Hawaiʻi) holding title to these railroad rights-of-way can be achieved and a portion of this alternative access has already been developed as a gravel roadway for emergency use only and remains behind a locked gate inaccessible to the public; and WHEREAS, developing these alternative roadways was already under consideration as a part of a road connectivity plan for Lower Puna with an internal working group spearheaded by the Mayor’s office to accommodate future growth. The May 3rd volcanic eruption has increased the urgency to develop these alternatives; and WHEREAS, the alternative road access involving the realignment of Government Beach Road and opening of the Railroad right-of-way provide more immediate solutions for accommodating land owners’, needs for access in the Kapoho area, but do not resolve all access issues such as large commercial truck traffic along residential roadways and access to the many hundreds of acres of farmland and dozens of homesteads that were not inundated by lava and which were located south of Highway 132; and WHEREAS, large landowners and commercial operations with expertise, materials, and heavy equipment are interested in partnering with the County to open alternative accesses and rebuild Highway 132; and WHEREAS, rebuilding the sections of Highway 132 that were inundated by lava either along the existing right-of-way or along an alternative path, will resolve access issues for nearly all the Kapoho area communities while private landowners will need to take the lead in developing secondary access from a rebuilt Highway 132; now, therefore, BE IT RESOLVED BY THE COUNCIL OF THE COUNTY OF HAWAII that it urges the County administration to develop these proposed alternative access routes to realign Government Beach Road and open the Railroad right-of-way to Kahala-Street and/or Kehau Boulevard as soon as possible. BE IT FURTHER RESOLVED that rebuilding Highway, 132 and identifying funding sources, obtaining road easements, planning and engineering road construction should be the highest priority for the County Administration. BE IT FINALLY RESOLVED that the County Clerk shall transmit a copy of this resolution to the Honorable Mayor Harry S. Kim at the Office of the Mayor; Director Allan Simeon of the Department of Public Works; Director Michael Yee of the Planning Department; Director Diane Ley of the Office of Research and Development, Director Dianna Sako of the Finance Department; and Joseph Kamelamela of the Office of the Corporation Counsel. Filed Under: Video Report Tagged With: Beach Road, Cinder Road, Kapoho, Kilauea, Noni Farms Road	cc/2020-05/en_middle_0126.json.gz/line463
__label__wiki	0.631498	0.631498	Puritan Publications Westminster Divines Reformed Theology and Apologetics Grace Chapel in TN Semper Reformanda Dr. McMahon Bio Support APM Puritan Bios Christopher Love (1618-1651) Francis Turretin (1623-1687) Jeremiah Burroughs (1599-1646) John Owen (1616-1683) Jonathan Edwards (1703-1758) Everything Edwards William Ames (1576-1633) William Perkins (1558-1602) Links to Buy Books Free Bibles Download Bibles Yearly Bible Readings 1647 Westminster Standards Westminster Standards 1647 Westminster Confession The Solemn League and Covenant Shorter Catechism of the Assembly of Divines Larger Catechism of the Assembly of Divines Form of Presbyterian Church Government Directory of Publick Worship Directory of Private Worship Westminster Assembly Writings Calvinism / Arminianism T.U.L.I.P. and the Doctrines of Grace Ordo Salutis: The Order of Salvation CT Articles Witsius’ Economy of the Covenants Historic Confessions Historical Theology MP3 Sermons / Podcasts The Christian Family Family – A Little Church Theological Articles The Attributes of God Pastoral Theology Main Pastoral Theology and Expository Preaching Articles Sermon Preparation Online Course Pastoral Theology and Expository Preaching Videos A Quiz for Pastors Questions for Pastoral Candidates Questions Pastoral Candidates Should Ask Churches Puritan Era What is a Puritan? Puritan Evangelism Farewell Sermons Exclusive Psalmody Puritan Meditation Puritan Worship The Regulative Principle Magisterial Reformation Introduction to the Reformation History of the Reformation 500 Years Since Martin Luther Arthur Dent (d.1607) An English Puritan Author and Divine Today, many Christians are turning back to the puritans to, “walk in the old paths,” of God’s word, and to continue to proclaim old truth that glorifies Jesus Christ. There is no new theology. In our electronic age, more and more people are looking to add electronic books (ePubs, mobi and PDF formats) to their library – books from the Reformers and Puritans – in order to become a “digital puritan” themselves. Take a moment to visit Puritan Publications (click the banner below) to find the biggest selection of rare puritan works updated in modern English in both print form and in multiple electronic forms. There are new books published every month. All proceeds go to support A Puritan’s Mind. His Works: The Hand-Maid of Repentance. Or, “A Short Treatise of Restitution.” An appendix to his “Sermon of Repentance.” The Opening of Heaven’s Gates. Also titled, “The Ready Way to Everlasting Life.” The Plain Man’s Pathway to Heaven. The Ruin of Rome. An exposition of the book of Revelation, with particular stress placed upon the decay and downfall of Roman Catholicism. A Sermon of Christ’s Miracles. John 9:16. A Sermon of God’s Providence. A Sermon of Repentance. A plaine exposition of the articles of our faith, by short questions and answeres for the vnderstanding of the simple gathered by A[rt]thur Dent … ; especially for the benefit of his owne flocke, who hauing taught his people these points, is carefull that they may learne them ; to this end, that euerie of them of his charge, may be able to giue a reason of their faith. Dent, Arthur, d. 1607. / [1589] A pastime for parents: or A recreation to passe away the time; contayning the most principall grounds of Christian religion. By Arthur Dent preacher of the word of God at South-Shoobery in Essex. Dent, Arthur, d. 1607. / [1606] A learned and fruitful exposition vpon the Lords prayer. By Arthur Dent, sometime minister of the Word of God at South-Suberry, in Essex. Dent, Arthur, d. 1607. / [1613] Biography of Arthur Dent: Arthur Dent (d.1607) was an English Puritan author and preacher. He was born at Melton, Leicestershire. He matriculated as a pensioner of Christ’s College, Cambridge, in November 1571. He graduated B.A. in 1575–6, and M.A. in 1579. Dent served as curate for three years to George Withers, at Danbury, Essex. He was on 17 December 1580 instituted to the rectory of South Shoebury, Essex, on the presentation of Robert Rich, 2nd Baron Rich. In 1582 he was one of the witnesses examined in support of charges brought against Robert Wright, a Puritan minister. About 1584 Dent himself was in trouble with John Aylmer, his diocesan bishop, for refusing to wear the surplice and omitting the sign of the cross in baptism. His name is appended to the petition sent to the lords of the council by twenty-seven ministers of Essex, who refused to subscribe the declaration “that there is nothing contained in The Book of Common Prayer contrary to the Word of God.” Dent died of a fever after three days’ illness about the end of 1607. He left a widow. Ezekiel Culverwell, in dedicating an edition of The Ruin of Rome to Lord Rich remarked on Dent’s diligence. He was considered a good preacher, and his printed sermons ran to numerous editions. His work “The Plain Man’s Pathway to Heaven” was instrumental in converting John Bunyan. Bible Verse: “I am Almighty God; walk before Me and be blameless,” (Gen. 17:1). APM Newsletter APM HOME 500 Years of the Reformation Adoring God in Heaven - by Ezekiel Hopkins (1633-1690) Bible Readings Book Reviews - Take and Read Calvinist Articles Christian Stewardship - What Every Christian Needs to Know Covenant Theology - God's Master Plan Justification By Faith Alone Pastoral Theology and Expository Preaching Puritan Biographies and Works Adoniram Byfield (1602-1660) Alexander Gill (1565–1635) Alexander Henderson (1583–1646) Alexander Hume (1560-1609) Andrew Gray (1634-1656) Andrew Kingsmill (1538-1569) Andrew Perne (1596–1654) Anthony Burgess (1600-1663) Anthony Tuckney (1599–1670) Archibald Campbell (1598-1661) Archibald Johnston (1611–1663) Arthur Hesilrige (1601–1661) Arthur Hildersham (1563-1631) Bartholomew Ashwood (1622–1680) Benjamin Pickering (n.d.) Benjamin Rudyerd (1572–1658) Benjamin Woodbridge (1622-1684) Bernard Gilpin (1517-1583) Blaise Pascal (1623-1662) Brocket (or Peter) Smith (1586–1653) Calybute Downing (1606–1644) Charles Herle (1598–1659) Christopher Elderfield (1607-1652) Christopher Ness (1621-1705) Cornelius Burges (1589–1665) Cuthbert Sydenham (1622–1654) Daniel Burgess (1645-1713) Daniel Cawdrey (Cawdry) (1588–1664) Daniel Featley (1582-1645) David Dickson (1583–1663) Edmund Calamy (1600-1666) Edmund Staunton (1600-1671) Edward Corbet (d. 1658) Edward Dering (1540-1576) Edward Montagu (1602-1671) Edward Pierce (1633-1694) Edward Reynolds (1599-1676) Ephraim Pagitt (1575-1647) Ezekiel Culverwell (1553-1631) Ezekiel Hopkins (1633-1690) Francis Cheynell (1608-1665) Francis Rous (1579–1659) Francis Taylor (1589–1656) Francis Whiddon (d. 1658) Francis Woodcock, (1614-1649) Franciscus Gomarus (1563-1641) Francis Roberts (1609-1675) Gaspar Hickes (d. 1677) George Gifford (1547-1620) George Gillespie (1613-1648) George Morley (1598–1684) George Swinnock (1627-1673) George Walker (1581-1651) Hannibal Gammon (1585-1674) Henry Ainsworth (1571–1622 or 1623) Henry Burton (1606-1654) Henry Greenwood (d. 1634?) Henry Hall (n.d.) Henry Hammond (1605-1660) Henry Newcome (1627-1695) Henry Pendlebury (1626-1695) Henry Roborough (d. 1650) Henry Scougal (1650-1678) Henry Scudder (d. 1659) Henry Smith (1560-1601?) Henry Tozer (1602-1650) Henry Vane Jr. (1613-1662) Henry Wilkinson (1610-1675) (Sr.) Herbert Palmer (1601–1647) Hugh Binning (1627-1653) Humphrey Chambers (d. 1662) Humphrey Hardwicke (n.d.) Isaac Ambrose (1604–1663) James Durham (1622–1658) James Janeway (1636-1674) James Ussher (1581–1656) Jeremiah Whittaker (1599–1654) John Arrowsmith (1602-1659) John Ball (1585-1640) John Beart (1673-1716) John Bond (1612-1676) John Brinsley (1600-1665) John Bunyan (1628-1688) John Campbell (n.d.) John Carter (d. 1655) John Clotworthy (d. 1665) John Conant (1608-1694) John Cook (1608–1660) John Cotton (1585-1662) John Dod (1549-1645) John Downame (1571-1652) John Dury (1596-1680) John Earle (1601–1665) John Eedes (1609-1667) John Flavel (1630–1691) John Forbes (1568–1634) John Foxcroft (n.d.) John Gibbon (b.c.1587) John Glynne (1602–1666) John Greene (d. 1660) John Hacket (1592-1670) John Harris (n.d.) John Howe (1630-1705) John Jackson (1600-1648) John Kettlewell (1653-1695) John Langley (n.d.) John Ley (1583-1662) John Lightfoot (1602-1675) John Maitland (n.d.) John Maynard (1600–1665) John Philips (Phillips) (1585-1663) John Preston, D.D. (1587–1628) John Strickland (1601-1670) John Trapp (1601-1669) John Udall (1560–1592) John Wallis (1616–1703) John Ward (n.d.) John White (1575-1648) John Wilde (n.d.) John Wilson (1588–1667) Joseph Alleine (1634-1668) Joseph Caryl (1602-1673) Joseph Symonds (d.1652) Joshua Hoyle (d. 1654) Josias Shute (1588–1643) Lazarus Seaman (1607–1675) Lewis Bayly (1575-1631) Matthew Henry (1662-1714) Matthew Mead (1629-1699) Matthew Newcomen (1610-1669) Matthew Sylvester (1636–1708) Michael Harrison (1640-1729) Nathaniel Fiennes (1608–1669) Nathaniel Hardy (1618–1670) Nathaniel Holmes (or Homes) (1599–1678) Nathaniel Ranew (1602–1678) Nathaniel Vincent (1639-1697) Nicholas Bound, D.D. (d. 1613) Nicholas Byfield (1579-1622) Nicholas Chewney (1610-1685) Nicholas Proffet (n.d.) Obadiah Grew (1607-1689) Obadiah Sedgwick (1600-1658) Oliver Bowles (1574-1644) Oliver Heywood (1630-1702) Oliver St. John (1598–1673) Paul Bayne (1573-1617) Peter Du Moulin (1601-1684) Peter Ramus (Petrus Ramus) (1515-1572) Peter Sterry (1613-1672) Philip Delme (n.d.) Philip Henry (1631-1696) Philip Nye (1595-1672) Ralph Brownrig (1592–1659) Ralph Venning (1622-1674) Richard Allestree (1619-1681) Richard Byfield (1598–1664) Richard Capel (1586–1656) Richard Gilpin (1625-1700) Richard Heyrick (1600–1667) Richard Holdsworth (1590–1649) Richard Love (1596-1661) Richard Rawlin (1687-1757) Richard Sibbes (1577-1635) Richard Steele (1629-1692) Richard Vines (1600–1656) Robert Baillie (1602–1662) Robert Bolton (1572-1631) Robert Cleaver (d. 1613) Robert Crosse (1606–1683) Robert Harris (1581-1658) Robert Rich (1587–1658) Robert Sanderson (1587–1663) Robert Trail (1642-1716) Samuel Bolton (1606-1654) Samuel Clarke (1599-1682) Samuel Crossman (1623-1683) Samuel de la Place (1580-1637) Samuel Gibson (n.d.) Samuel Lee (1625-1691) Samuel Petto (1624–1711) Samuel Rutherford (1600-1661) Samuel Ward (1577-1640) Samuel Willard (1640-1707) Simeon Ashe (d.1662) Stanley Gower (1600–1660) Stephen Charnock (1628-1680) Stephen Egerton (1555–1621) Stephen Marshall (1594–1655) Sydrach Simpson (1600–1655) Theodore Bathurst (1587–1652) Thomas Adams (1583-1652) Thomas Baylie (1582–1663) Thomas Blake (1597-1657) Thomas Brooks (1608-1680) Thomas Carter (n.d.) Thomas Cartwright (1535–1603) Thomas Case (1598-1682) Thomas Cawton (1605-1659) Thomas Clendon (n.d.) Thomas Cobbet (1608-1686) Thomas Coleman (1598–1674) Thomas Doolittle (1630-1707) Thomas Ford (1598–1674) Thomas Fuller (1608-1661) Thomas Gattaker (1574–1654) Thomas Goodwin (1600-1680) Thomas Gouge (1605-1681) Thomas Hill (d. 1653) Thomas Hodges (1600-1672) Thomas Hooker (1586-1647) Thomas Jollie (1629-1703) Thomas Manton (1620-1677) Thomas Mockett (1602-1670) Thomas Shepard (1605-1649) Thomas Taylor (1576-1632) Thomas Temple (1567–1637) Thomas Thorowgood (n.d.) Thomas Tuke (d. 1657) Thomas Valentine B.D. (1586-1665) Thomas Vincent (1634–1678) Thomas Watson (1620-1686) Thomas Westfield (1573-1644) Thomas White (d. 1672) Thomas Wilson (1563–1622) Thomas Young (1587–1655) Timothy Armitage (d. 1655) Walter Cradock (Craddock or Cradoc) (1606–1659) Walter Marshall (1628-1680) Walter Yonge (1599–1649) Wilhelmus à Brakel (1635-1711) William Attersoll (d.1640) William Bates (1625-1699) William Bridge (1600-1670) William Carter (1605–1658) William Fiennes (1582–1662) William Fulke (1538-1589) William Gearing (1625–1690) William Gouge (1575-1653) William Greenhill (1591-1671) William Gurnall (1617-1679) William Lyford (1598-1653) William Mew (1602–1669) William Nicholson (1591–1672) William Pemble (1592-1623) William Pierrepont (1607–1678) William Pinke (1599–1629) William Price (1597-1646) William Rathband (n.d.) William Sclater (1575-1626) William Spurstowe (1605-1666) William Strode (1598–1645) William Strong (d. 1654) William Twisse (1578–1646) Zachary Crofton (1626-1672) Puritan Evangelism - Gospel Proclamation and the Christian Witness Puritan Worship and the Regulative Principle of Worship The Attributes of God on A Puritan's Mind The Christian Walk and Practical Theology The Creeds and Confessions of the Church The Puritan Era - What is a Puritan? The Puritan Practice of Meditation and Pondering God: Thinking Rightly Through Godly Meditation The Puritans: All of Life to the Glory of God by C. Matthew McMahon The Wild Boar Podcast Westminster Standards - 1647 Westminster Confession of Faith 1647 WCF Witsius’ Covenants Puritan Books A Puritan's Mind © 1996-2020 \| Puritan Publications \| Reformed Theology and Apologetics \| Grace Chapel in Crossville, TN	cc/2020-05/en_middle_0126.json.gz/line468
__label__wiki	0.676241	0.676241	obliq slim meta ii series iphone 6s plus / 6 plus case - rose gold reviews While unlocked iPhones bought from Apple or from AT&T can accept any SIM card for access to any GSM carrier, including T-Mobile in the U.S., these phones can't be activated on Verizon or Sprint. It's true that Verizon and Sprint use a different fundamental network technology from what AT&T and T-Mobile use. But keep in mind that the iPhone 4S is exactly the same in terms of hardware regardless of carrier. This means it has a CDMA radio as well as a GSM radio. But on the "unlocked" iPhone, which can be bought at full price from Apple, and on an unlocked AT&T iPhone, the CDMA portion of the phone is disabled and unusable. Spotify hints that its April announcement has something to do with its mobile app, The invite also states that there will be presentations by Gustav Söderström, Spotify's chief research and development officer; Babar Zafar, vice obliq slim meta ii series iphone 6s plus / 6 plus case - rose gold reviews president of product development; and Troy Carter, global head of creative services, Check CNET on April 24 for complete coverage of the Spotify event, Save the date: April 24, 2018, at 9:30 a.m, ET, It's been known for awhile that Spotify was going to hold an event on April 24, 2018, What wasn't known was what would be announced, Could it be related to cars, its stock or its subscription bundle with Hulu?.. The curved screen doesn't get much use. Plug the phone in and you'll see a little line darting along the border of the screen. It's the Battery Edge, and it'll glow red, yellow, or green, depending on the Priv's power level. You'll also see a little percentage readout, as well as an estimate of the remaining charging time, so you can keep tabs on your phone while it's charging. It runs along the curve, which keeps it out of the way, so you can use your phone while it's plugged in without obscuring the screen. I'm a bit embarrassed about how much I like this, but it's an inconsequential extra that makes the screen's sometimes superfluous curves a bit more useful. Gold members can access a library nearly 50 premium apps, which normally range between 99 cents and $10, for free, Membership to the program is free, Apps include the game Krazy Kart Racing, which sells for $3.43 obliq slim meta ii series iphone 6s plus / 6 plus case - rose gold reviews elsewhere, and SwiftKey X, which costs $4.06, While the Gold program is primarily for Android, GetJar sells apps for BlackBerry, Symbian and Windows Mobile, But iPhone users can't access the site because of Apple's closed iOS platform, Instead, the site redirects iOS apps to iTunes, Updated at 9:22 a.m, PT: to include additional details about the program.. What is new is Google Now, an optional program that can tap into your GPS coordinates and several apps to help you organize your life and anticipate your needs, down to suggestions on when to leave to make a certain appointment on time. The notifications menu also gets thicker descriptions for events that pop up there, and the capability to do things like share a photo or respond to a message. Offline voice typing is new, predictive text is smarter, and overall performance is smoother. In addition, there are resizable widgets, and the NFC feature, Android Beam, can now handle larger files like photos and video in addition to URLs and maps. protect ultimate case for apple iphone 7 and 8 - black/black hedge-hugs iphone case smoulder iphone case atrium case for apple iphone xs - clear ballet flats 39 ballet shoes youtube full movie instant download pdf easy quick knitting pattern to make womens pom pom bedroom ballet slippers indoor shoes all foot sizes 10 p ballet slipper patent t shirt, ballerina gift, dance studio, ballet shoe, ballerina shirt, pp0267 danzcue adult long sleeve nylon ballet cut leotard	cc/2020-05/en_middle_0126.json.gz/line469
__label__cc	0.732019	0.267981	Mmr@ecs.soton.ac.uk (Talk \| contribs) The collections plugin is part of [[EdShare]] suite. It is based on code developed in EdShare and LanguageBox. The goal of this project is to produce a package that allows the easy installation of the collections functionality on a vanilla EPrints installation. The collections plugin is part of [http://edshare.org.uk EdShare] suite. It is based on code developed in EdShare and LanguageBox. The goal of this project is to produce a package that allows the easy installation of the collections functionality on a vanilla EPrints installation. ==Current Version== ==Installation== The latest version of EdShareCollections is 1.0.2 and can be found at the download site. ==Download== The plugin is available for download from http://files.eprints.org. The original collections code was developed by Sebastien Francois and Patrick McSweeny. The EdShare package was created by Marcus Ramsden based upon the original collections code by Sebastien and Patrick. The original collections code was developed by Sebastien Francois and [http://www.ecs.soton.ac.uk/people/pm5 Patrick McSweeney]. Updates and the 3.1.3 version of the package have been made by Marcus Ramsden based upon the original collections code. Collections were packaged for the bazaar by Patrick McSweeney ==The Source== The current definitive source can be found [https://github.com/patrickmcsweeney/Collections on GitHub at https://github.com/patrickmcsweeney/Collections] ==Copyright== This plugin is released under the terms of the GNU General Public License v3. Details of this license can be found [http://www.gnu.org/licenses/gpl.txt here]. =Features= ==Post installation configuration== ==Collections== * Allows a user to remix a number of resources into a new resource. ==Collection Workflow== * A new workflow has been introduced with this plugin. * This workflow integrates seamlessly into your installation of EPrints adding an additional button to the ''Manage Items'' screen for the user. It also adds an appropriate editor screen. The workflow does not interfere with the original EPrint workflow. ==Collection Abstract View== * A different abstract view is rendered for collections. The collection workflow is modified in a similar way to eprint abstracts. 1.7 Bookmarks For installation instructions head to EdShareCollectionsInstallation. Allows a user to create bookmarks of resources that are currently stored within your repository.	cc/2020-05/en_middle_0126.json.gz/line480
__label__cc	0.538052	0.461948	Difference between revisions of "DXM" GrimReaper (Talk \| contribs) (→‎Second Plateau) === Second Plateau === This pleatu is a bit more intense. You may feel like your stoned and movement may become difficult. The second is supposed to be fun and disorienting. Music is awesome to listen to and you can walk outside and perhaps hallucinate a small-mild amount. You can socialize with friends and you could say you're slightly drunk. This pleatau is a bit more intense. You may feel like your stoned and movement may become difficult. The second is supposed to be fun and disorienting. Music is awesome to listen to and you can walk outside and perhaps hallucinate a small-mild amount. You can socialize with friends and you could say you're slightly drunk. '''Second Plateau dose: 2-5mg/lb.''' Romilar 1968 Ad Dextromethorphan (also known as 'DXM', 'DM' or 'robo') is an over-the-counter antitussive (cough treatment) which when taken at doses exceeding the recommended therapeutic range becomes a powerful dissociative drug which also has some psychedelic properties. While DXM can be used safely it is not an inherently safe drug. Repeated use within a short period of time, combination with certain types of drugs, certain genetic factors and the prevalence of other active ingredients which become harmful at needed doses found in many brands of cough medication make for a chemical which must be used with caution. The high is not for everyone; it is said to loosely follow the rule of thirds: one third hates it, one third doesn't care, and one third like it. It should not be underestimated as a hallucinogenic, at higher dosages mimic high doses of ketamine but with more psychedelic properties. DXM manifests its effects in a series of plateaus, with dose determining which plateau (and subsequently which effects) one will experience. Lower dose plateaus can be well suited to relaxation, light social interaction and listening to music, however higher doses result in a more encompassing dissociative experience which does not lend itself to attentive presence. At high doses it's common to have strong hallucinations, experiences of detachment, depersonalization, and out-of-body experiences. These all-encompassing states are startling and uncomfortable for some. It's mechanism of action is via multiple effects, including actions as a nonselective serotoninA monoamine neurotransmitter, biochemically derived from tryptophan, that is primarily found in the gastrointestinal (GI) tract, platelets, and central nervous system (CNS) of humans and animals. It is a well-known contributor to feelings of well-being. reuptake inhibitor and a sigma-1 receptor agonistA substance that initiates a physiological response when combined with a receptor.. DXM and it's major metabolite, dextrorphan, also act as an NMDAN-methyl-D-aspartate receptor. NMDA antagonists are often dissociatives. receptor antagonistA substance that interferes with or inhibits the physiological action of another. at high doses, which produces effects similar to, yet distinct from, the dissociative states created by other dissociative anaesthetics such as Ketamine and PCP. DXM does not typically show up in normal drug tests however it can produce false positive results for PCP and/or Opioids in extended or specialized drug tests. Proper occasional use should not produce these false-positive results after a couple days have passed. 2 Different Forms 2.1 Extracted 2.2 Gel Caps 2.3 Lozenges 2.4 Syrup 2.5 Delsym 4.1 Redosing 4.2 Predosing 5 Effects 5.1 Positive 5.2 Neutral 5.3 Negative 5.4 After-Effects 5.5 Robo-Walk 6 Plateaus 6.1 First Plateau 6.2 Second Plateau 6.3 Third Plateau 6.4 Fourth Plateau 6.5 Fifth Plateau 7 Harm Reduction 7.1 Dangerous Ingredients Commonly Used in DXM Products 7.2 Interactions 8 Chemistry and Pharmacology 8.1 Pharmacodynamics 8.2 Pharmacokinectics The racemic parent compound racemorphan was first described in a Swiss and US patent application from Hoffmann-La Roche in 1946 and 1947, respectively; a patent was granted in 1950. A resolution of the two isomers of racemorphan with tartaric acid was published in 1952, and DXM was successfully tested in 1954 as part of US Navy and CIA-funded research on nonaddictive substitutes for codeine. The FDA approved DXM in 1958 after research supported its legitimacy and effectiveness as a cough suppressant. After its approval, it was introduced as an OTC medication under the name Romilar, which was introduced as a replacement for codeine containing cough remedies in an effort to cut down on abuse. In early 1960s Beat poets Allen Ginsberg and Peter Orlovsky, musicians such as Daevid Allen Soft Machine, and alternative authors such as Jack Kerouac known to have used DXM in the form of Romilar. In 1973, Romilar was taken off the shelves after a burst in sales because of frequent misuse, and was replaced by cough syrup in an attempt to cut down on abuse. In 1975, the popularity and extensive abuse of DXM was recognized, and Romilar was removed from the OTC market. However, DXM was specifically excluded from the Controlled Substances Act (CSA) of 1970, therefore, it was still legal to produce and use. A few years after its removal from OTC, companies began introducing refined DXM products (e.g., Robitussin, Vicks-44, Dextrotussion) that were designed to limit recreational use by creating an unpleasant taste if consumed in large quantities. Within a short time those same manufactures began to produce forms of DXM with "some appealing flavoring," which led at least one researcher to suggest that the cycle of recreational abuse may be repeated. In 1996, DXM HBr powder could be purchased in bulk from online retailers, allowing users to avoid consuming DXM in syrup preparations. DXM is widely available in over-the-counter cough treatments which appear in different forms including gelcaps, lozenges and syrups. DXM is also less commonly found in a more pure form, either extracted or bought directly from a chemical manufacturer. While there are some products available which contain only DXM as active medical ingredients it is common to find products which contain DXM but also contain enough of another active ingredient to pose a serious risk to the user's health. The ideal source of DXM would be an extraction, but that requires time and a chemical procedure which most people are not equipped to do. It's not a complicated process however it does carry some risks in itself. There is a technique known as the 'Agent Lemon extraction'. Gel Caps DXM Gelcaps such as RobitussinDM Gelcaps or other no-name brand products containing only DXM encased in a gelcap are often the preferred source for DXM users. For most users gelcaps which contain only DXM produce a more clear headed high in lower doses. Most users experience fewer side effects from gelcaps than from syrup however some users report an upset stomach from the gelcaps, indicating that some users may have a sensitivity to the edible plastics used to make the gelcaps. There are also sore-throat and cough medications containing DXM which exist in the form of a hard-candy like lozenge. These sometimes contain only DXM, however most brands of DXM lozenges also contain analgesics such as acetaminophen or benzocaine. Some brands such as Cordicin Cough and Cold (also known as CCC) have a variety of products, most of which contain other active ingredients such as antihistamines or CPM (Chlorpheniramine Maleate) and may have one or two products which contain only DXM. WARNING: Cordicin Cough & Cold is one of the most commonly used sources of DXM, and also one of the most dangerous. Nearly every single CCC product contains other active ingredients such as CPM, which can cause severe and life-threatening symptoms including seizures, shortness of breath or troubled breathing, weakness, loss of consciousness, severe dryness of the mouth, nose or throat, bleeding from the skin, mouth, eyes, rectum and vagina, and possibly death. https://www.erowid.org/chemicals/dxm/dxm_info2.shtml As always when using lozenges always choose a product which only has DXM in it. Cough syrup is the most common source for DXM users. While there are many brand name and no-name syrups which only contain DXM as an active ingredient there are many active and "inactive" ingredients commonly found in cough syrups which can cause negative effects ranging in severity. See Harm Reduction for more information. Some say the high produced from syrup is mostly sedating. You may feel sluggish when using it to get high on DXM, possibly as a result of other ingredients found in syrup however because of the even dispersion of DXM throughout the syrup it is said to produce a more 'solid' trip. Delsym is brand with many formulations which contain Dextromethorphan Polistrex. This is an extended release form of DXM which produced a longer lasting trip with weaker effects. It is said to be very difficult to reach the third plateau using DXM which may be preferable for this reason to beginners or users who would prefer a longer and weaker trip. The dosage below refers to an "average" 180lbs / 80kg person taking DXM HBR. Before dosing it's important to note a few things: HBR and Polistirex doses vary significantly due to polistirex slow absorbsion rate (1mg of DXM polistirex is equivalent to about 6mg DXM HBR). DXM doses are affected by weight. For more accurate dosage information, see the following resources: For a graphical chart of the dosage ranges this chart is helpful. For an easy calculator that does the math for you, this page can be helpful. Before dosing, be sure to read the Plateaus section to know which level you want to dose for. Plateau range dosage for a 80kg (180lb) person. First 122-200mg Second 200-600mg Third 600-1200mg Fourth 1200-1600mg Risk of death 2.2g+ Oral HBR Total 6-8 hours Oral Polistirex Total 8-12 hours Redosing Redosing is not advised. It's better to know how much you've taken at the start of the trip, rather than guestimate how much you're on as you keep dosing. The effects will start to come in waves and may not be pleasant. If you feel the need, it's recommended to take a high initial dose and a lower dose 1-2 hours in. Predosing One should make sure there is only DXM in the product they are taking. Grapefruit juice can potentiate dxm due to intactions with cytochrome P450.[1] The high is not for everyone; it is said to loosely follow the rule of thirds: one third hates it, one third doesn't care, and one third like it. Euphoria, mood lift Increased giggling and laughing Dissociation of mind from body (positive when sought) Creative dream-like experiences Increased tactile sensation Some users report empathy and forgiveness towards other people Visual stop motion effect (flanging or strobing) Visual and aural (auditory) hallucinations Decreased sexual functioning (difficulty achieving orgasm) Confusion, disorientation Skin sensitivity, alters tactile (touch) and skin sensations Robotic, zombie-like walking, "robo-walk" Discoordination, reduced agility Involuntary flexing of muscles Feelings of merging with adjacent objects like a couch or bed (with higher doses) Body itching Rash, red blotchy skin Tachycardia (racing, pounding heart) Some users report feeling disconnected, isolated from others After-Effects Some users report hangover or depression that might last up to a few days. Robo-Walk The robo-walk feels like all of the muscles in your body are activated at once and while strange to the observer is not painful to the individual. You can still walk but detailed coordination such as running, jumping, or maneuvering around furniture becomes much harder if not impossible. However, when you you start getting the effects of robo-walk, you really wouldn't want to be moving around anyway. The best thing to do is get a good pair of headphones, turn off the lights, close your eyes and let your mind wander. There are various 'stages' to DXM trips called plateaus. Traditionally, there are only four plateaus that someone should try to aim for. All of them share general feelings of dissociation, but the strength and effects of these feelings are more pronounced in the later two plateaus. There are two plateaus are commonly associated with a mix of being high on THCTetrahydrocannabinol and drunk on alcohol. If you take a first or second plateau dose, it's totally possible to socialize. Lower plateau doses are relatively easy to hide compared to higher plateau doses and talking with others becomes a lot easier while under the influence of DXM. It would also be fun to chill in your room alone and do whatever you normally do for fun, but it's suggested to try something that will take up most of your attention but allow your mind to wander at the same time. Something like playing a casual video game, or drawing whatever comes to mind. If you take a third or fourth plateau dose, it's recommend to trip alone or with a close friend, as it's not a social drug at this dose. The best way to enjoy it is to lay back and listen to music with your eyes closed. Choosing your destination plateau will depend a lot on what other drugs you've done and how comfortable you are with your mind. People who have never tried any hallucinogen other than THCTetrahydrocannabinol should start at First, while everyone else could start at Second. It is not advised to start at the third or fourth unless you have extensive experience with other dissociatives. First Plateau The first plateau is the lightest in effect. It feels a bit 'off', and is often likened to something of a cross between the effects of MDA and Alcohol. First plateau is usually slightly stimulating. Effects commonly experienced at the first plateau level A shift in thinking perspective; things look and feel 'different' Increased appreciation of music Feeling heavy, sensation of increased body weight Enhanced emotional response & sensitivity Some dizziness or vertigo First Plateau dose: 1-2mg/lb. Second Plateau Second Plateau dose: 2-5mg/lb. Most people stop their DXM journey here, as the final two plateaus are not really 'fun' but 'enlightening'. We don't recommend crossing this threshold until you're ready to move on from games of the mind to exercises of the consciousness. Enjoy the 2nd plat as long as you can because it's more of a fun experience and there is no going back once you've been past it. "Once you see what's behind the curtain, you can't enjoy the show" so they say. Third Plateau Third plateau is a full on dissociative experience. You cannot ignore the feeling inside of you and at this point its no longer a social drug and should be done by yourself or with a sitter. The third plateau isn't 'party-mode' or even 'socialize-mode'. Its more like 'alone-and-tripping-mode'. This is most akin to a "k-hole" that people experience after taking large amounts of ketamine. A lot of dissociation happens at this level, and the internal thoughts can be quite interesting. Using CEV's, DXM users have been known to have extremely vivid, controllable hallucinations and out of body experiences. Third Plateau dose: 5-7.5mg/lb. Fourth Plateau This is the deep meditative state. Few people enjoy going this far, as all you can really do (or want to do) is sit, listen to music, close your eyes, and become a god. You can create universes in your mind just by thinking of them. Fourth Plateau dose: 7.5-10mg/lb. Fifth Plateau Increasing the dosage above forth plateau will lead to level that some people refer to as Sigma Plateau. Keep in mind that this is dangerous, and very unpleasant most of the time, so TripSit is discouraging it. See Dissociative Harm Reduction for general information. Dangerous Ingredients Commonly Used in DXM Products Many products which contain DXM also contain other medication or otherwise non-medically-active ingredients that can cause serious harm in the doses found in DXM containing products. If a user intends to use an OTC cough medication in order to get high on DXM they almost always will have to consume a dangerous quantity of other dangerous ingredients if they are present in the medication. For this reason it is strongly recommended to find a source which contains /only/ DXM. The following is a summary of other ingredients commonly found in DXM products. : Acetaminophen/Paracetamol/APAP is a painkiller commonly found in over the counter flu medication, and is used in many Tylenol and Panadol brand products. Acetaminophen/paracetamol/APAP is hepatoxic in high doses. This means it will damage your liver if taken in high doses. Your body can only process a certain amount of APAP at once before it the normal pathways become saturated. Once the regular pathways used for metabolizing APAP have been saturated the remaining APAP gets broken down in the liver by an enzyme called cytochrome P450. ::: When forced to break down APAP this enzyme produces toxic metabolites! The effects of an acetaminophen overdose may not be apparent for up to sixteen hours after the user has ingested the APAP! This makes APAP overdose even more dangerous because of the chance that a user might take more or not take notice after thinking they are 'in the clear'. Under no circumstances should anyone attempt to use any DXM product containing 'Paracetamol', also known as 'APAP' & 'Acetaminophen'! Guaifenesin is an expectorant. It works by causing the lungs to produce more fluid, making it easier to cough up phlegm. Guaifenesin is added to many OTC cough, cold and flu medications to help treat the 'stuffed up' feeling which often found in viruses and colds. Guaifenesin overdoses cause severe nausea and vomiting in most users. Some users report being able to use products which contain some guaifensin and other users report no negative effects from guaifenesin containing products. It is strongly recommended to avoid products which contain Guaifenesin when using DXM! Antihistamines such as Diphenhydramine are often found in sleep-aids, night-time formulations of cold medications and allergy medications. Antihistamines are sometimes found with DXM in night or 'PM' versions of products, and should generally be avoided when using DXM. When taken in high doses antihistamines can cause dizzyness, nausea, a strong dysphoria, paranoia, delirium and hallucinations. Many antihistamines, OTC or prescription can also have a dangerous synergy with some of the effects produced by DXM. Food Coloring & other "Inactive" Ingredients Many DXM products contain dyes which can cause allergic reactions in some users. Usually these dyes are not harmful in low doses however in doses which may be required for DXM's effects they can become problematic. Tartrazine (FD&C Yellow #5) is one of the most notable coloring ingredients to cause reactions. Cough syrups usually contain one or more chemical used to make them taste sweet. Glucose, sucrose, invert sugar, and fructose are commonly used sweetening agents. These sweeteners pose an obvious risk to people with blood sugar conditions such as diabetes or hypoglycemia. Thickening agents such as propylene glycol or polyethylene glycol are found in most cough syrups. These are not toxic but may cause an upset stomach when consumed in large doses. DXM has several potentially dangerous interactions with pharmaceutical and recreational drugs including some analgesics (painkillers), antihistamines, antidepressants and stimulants. DXM has the potential to cause Serotonin Syndrome if mixed with other serotonergic drugs such as antidepressants, MAOIs, empathogens which affect serotoninA monoamine neurotransmitter, biochemically derived from tryptophan, that is primarily found in the gastrointestinal (GI) tract, platelets, and central nervous system (CNS) of humans and animals. It is a well-known contributor to feelings of well-being. release such as MDMA, MDA, Mephedrone, etc. SerotoninA monoamine neurotransmitter, biochemically derived from tryptophan, that is primarily found in the gastrointestinal (GI) tract, platelets, and central nervous system (CNS) of humans and animals. It is a well-known contributor to feelings of well-being. Syndrome causes discomfort, excitability, irritability, and can be deadly [2] if not treated. See Drug combinations and Dissociative Interactions for more information. Chemistry and Pharmacology IUPAC:(4bS,8aR,9S)-3-Methoxy-11-methyl-6,7,8,8a,9,10-hexahydro-5H-9,4b-(epiminoethano)phenanthrene. Dextromethorphan is the dextrorotartory enantiomerOne of two stereoisomers that are mirror images of each other that are non-superposable (not identical). Think of it like the left and right hand, which are identical aside from orientation. of levomethophan, which is the methyl ether of levophanol, both opioid analgesics. Binding receptors NMDAN-methyl-D-aspartate receptor. NMDA antagonists are often dissociatives. - 7253 SERT - 2015 NET - 110606 Sigma-1 - 23 Sigma-2 - 240 Pharmacokinectics Following oral dosing, DXM is rapidly absorbed from the GI tract. Where it enters the bloodstream, and crosses the blood-brain barrier. At therapeutic doses, DXM acts centrally (brain) as opposed to locally (Respiratory tract). It's rapidly absorbed from the GI tract into the active metabolite Dextrophan (DXO) in the liver by the cytochrome P450 enzyme CYP2D6. Around one in 10 of the Caucasian population has little or no CYP2D6 enzyme activity, leading to long-lived high drug levels. Robitussin brand DXM Gel Caps DXM FAQ DXM timeline on Erowid ↑ http://medicine.iupui.edu/clinpharm/ddis/2d6references/#dextromethorphanSub GrimReaper, Roi, Lightning po, Trees, Sleep, Bjorn, Reality, Physical, 98.212.177.207, Teknos, Spacer, Borax, 71.15.27.17, CustaiCo and Sundown Retrieved from "https://wiki.tripsit.me/index.php?title=DXM&oldid=4462"	cc/2020-05/en_middle_0126.json.gz/line482
__label__cc	0.699199	0.300801	Update on the Airship Ride with Abney Park Categories:Conventions, Events, Music, News, Steampunk Tags:Abney Park, airship, convention, Music, zeppelin Further developments on the aforementioned October 31st airship ride that Abney Park is taking fans on: The band put tickets on sale today at 12 pm, pst. Tickets will be on sale for two weeks or until all are sold. There are “very few” available, but ticket prices are $785 dollars each. Tickets can be found on the Abney Park’s website. The band also reported that they will perform acoustic renditions of music from their albums in mid-flight, as well as vintage airship music from the early 1900s. Other steampunk celebrities who will be aboard this historic flight will include Phil and Kaja Foglio, authors and artists of the Gaslamp Fantasy comic Girl Genius. The following day on November first, and not coincidentally the second day of the California Steampunk Convention, Abney Park and Platform One will be playing an all-ages show at a stadium-sized venue. Admission is included with a ticket to the con, or can be bought separately for$22.50. Author: Forsaken I am the webmaster of this website. I am not the original creator of the website. Wings of steam was originally created by a group of cosplayers at an anime convention. Their domain/website expired in 2013. In 2014, a year later, I personally renewed the domain and restored and redesigned the original website. I definitely do not take credit for the previous owners blog posts. They did an amazing job for a few years on this website, and should be given credit. They put a lot of time into Wings of Steam. ▼Golden Age (64) ▼Conventions (3) Update on the Airship Ride with Abney Park 09/27 Steampunk 2008 Year in Review 12/29 Steampunk Events Forum 01/22 ▼Events (3) Abney Park to take Fans on Historic Airship Ride 09/23 ▼Music (6) Steampunk on MTV 10/01 AIR - A Forthcoming Steampunk MMORPG 10/11 ►Neo-Victoriana (3) ▼News (7) Journal of Neo-Victorian Studies to Publish Steampunk Issue 01/10 Public Service Announcement to Steampunk Crafters and Buyers 01/12 Gandhi’s Pocket Watch Up For Auction 02/10 ▼Steampunk (17) Wings of Steam Anachronistic Society Makes its Debut 09/23 Steampunk is Alive and Steaming 09/25 Victorian Sci-fi Theatre: HP Lovecraft Films 10/10 The World of Gatheryn 10/14 Steampunks for Obama 10/14 Getting Your Home in Gear 11/17 Steampunk Myths and Legends 12/08 2008 Steampunk Gift Guide 12/12 Hot, Steamy Goodness 01/03 Victorian Sci-fi Theatre: Wormtooth Nation 02/10 ►subculture (1) ►Victorian Sci-fi Theatre (3) ►Wings of Steam (1) ►Gentleman (1)	cc/2020-05/en_middle_0126.json.gz/line483
__label__wiki	0.653145	0.653145	S: (n) forfeit, forfeiture, sacrifice (the act of losing or surrendering something as a penalty for a mistake or fault or failure to perform etc.) S: (n) sacrifice (personnel that are sacrificed (e.g., surrendered or lost in order to gain an objective)) S: (n) sacrifice (a loss entailed by giving up or selling something at less than its value) "he had to sell his car at a considerable sacrifice" S: (n) sacrifice, ritual killing (the act of killing (an animal or person) in order to propitiate a deity) S: (n) sacrifice ((baseball) an out that advances the base runners) S: (v) sacrifice, give (endure the loss of) "He gave his life for his children"; "I gave two sons to the war" S: (v) sacrifice (kill or destroy) "The animals were sacrificed after the experiment"; "The general had to sacrifice several soldiers to save the regiment" S: (v) sacrifice (sell at a loss) S: (v) sacrifice (make a sacrifice of; in religious rituals)	cc/2020-05/en_middle_0126.json.gz/line491
__label__wiki	0.718608	0.718608	Foundation / Murderation Shootout At Luciano’s House by robk007 on Apr 2, 2009 • 12:13 am 1 Comment The beloved roots reggae singer Luciano, also known as the Messenger, is known for soaring anthems like “Sweep Over My Soul” and “It’s Me Again Jah.” But on certain songs his voice suggested an edge of something altogether rougher… …as when he sang “Rough Inna Town” with Cocoa Tea on the Xterminator label. Or on world-weary cuts like “Ulterior Motive” and “Who Could It Be Now?” and even the title cut to his classic 1995 album Where There Is Life. Luciano’s righteous image as a messenger of peace and love was compromised somewhat last February when Freckles, a sound engineer with whom he had a financial dispute, attacked and beat him about the head with a metal pipe. In his own defense, Freckles claimed that he was roughed up during a previous visit to Luciano’s yard. Then just last Wednesday morning around 5 a.m., police and soliders surrounded a house owned by Luciano, whose real name is Jepther McClymont. The cops were acting on a tip that Andrew Senior, a.k.a. Conqueror, who was wanted for questioning in connection with six murders in Grants Pen, including the shooting of an old lady, was holed up in the house. Just before daybreak X-amount of shots rang out from inside, where Luciano’s empress and two children, aged 5 and 15, risked getting caught in the crossfire. Three police officers were wounded by the fusillade of gunfire, two of them critically. Conqueror reportedly tried to offer one of Luciano’s children as ransom but he later went down in a cloud of teargas and a hail of gunfire. Luciano was not present at the time of the shooting, but questions persist about his relationsip with the notorious gunman, who was supposedly brought in “to defend certain things.” Tags: Jamaica, Luciano, Reggae Previous postLucky Dube's Killers Convicted Next postVIDEO PREMIERE: Duane Howard "Your Stage" coke says: jah guid rasterman i love yor preching song the roots and culture more fire ayah man	cc/2020-05/en_middle_0126.json.gz/line498
__label__wiki	0.653185	0.653185	"Tot: The Untold, Yet Spectacular Story of (A Filipino) Hulk Hogan" by Mu Performing Arts at Park Square Theatre I attended the Saturday matinee of Mu Performing Arts' world premiere play Tot: The Untold, Yet Spectacular Story of (A Filipino) Hulk Hogan with all three of the Minnesota Theater Lovers (my friends and fellow theater bloggers). As we chatted over our post-show meal at the Afro Deli, it soon became apparent that we had very different experiences at the show. I find this fascinating and actually kind of cool, how two people can watch the same thing and see something entirely different. That's the beauty of theater, a beauty that, like for any art, is in the eye of the beholder; the theater-goer is just as important as the theater-makers in creating the experience. You'll have to head over to Minnesota Theater Love to read their perspective, and read on here for mine. Which is that Tot is, while a bit wacky and unclear in parts, a compelling and moving story of a boy whose world is turned upside down and who deals with it through a rich fantasy world. There are several different realities depicted in the play. First, there's Tot's happy childhood life in the Philippines, living with his grandmother since his parents moved to America to make a better life for their family. After living with her for eight years, he leaves his beloved Lola behind when his parents finally send for him to come live with them in America. Here we enter the world of 1980s America (complete with '80s toys like a Glo Worm), where Tot feels isolated and lonely living with parents who abandoned him and a sudden sister he never knew. Interspersed with this "real life" storyline we see scenes of Tot's imaginary life (although that's not entirely clear until partway through the show). Obsessed with Hulk Hogan and the WWF, Tot invents a character called The Orbiter (named after the street he lived on in the Philippines) an abandoned child raised by a nun who's discovered and turned into a wresting star. He imagines his parents as the cruel announcer and a glamorous woman/wrestling character. The Orbiter is almost destroyed by a wrestler called "The American Dream," until he fights back and conquers not only the other wrestler but also the announcer/father. Meanwhile in the real world, Tot bullies his sister and invents friends as he struggles to adapt to his new life. In the end, I'm not sure if he ever does, or how he does, as we quickly fast-forward to a grown-up Tot returning to visit the Philippines, seemingly with a lot of regrets. the not-so-happy family as their alter-egos (Randy Reyes, Eric "Pogi" Sumangil, Hope Nordquist, and Mary Ann Prado, photo by Rich Ryan) I was moved almost to tears at the end of the play, which I blame on co-director Ellen Fenster, who's made me cry on more than one occasion. And I also blame director Randy Reyes, whose boyish charm is put to good use playing the nine-year-old Tot. He's such a sad, sweet, obnoxious little boy who takes out his pain on his poor sweet sister (played by Randy's real-life sister Stephanie Bertumen). Eric "Pogi" Sumangil is charismatic as Tot's ballroom dancing father, displaying both his charm and his rather disturbing dark side, and the wrestling announcer. Also wonderful is Hope Nordquist as Tot's mother; the mother/son confrontation (why did you leave me?!) is one of the more poignant scenes of the play. Mary Ann Prado is lovely as the loving grandmother and fantasy nun character. And of course Torsten Johnson plays Tot's imaginary wrestling alter-ego, his powerful physicality perfectly suited to the role while still bringing out the vulnerability in the character that's really a little boy's dream of himself. Rounding out the cast are Michelle de Joya and Kyle Legacion as the "chorus," dressed in referee gear and showing placards to the audience between scenes describing the setting. Similar to the last show in Park Square Theatre's Boss Stage, Sandbox Theatre's Queen, the theater space is set up in the round as a boxing ring. The fantasy world takes place on the outer edge of the ring (complete with a red velvet rope that the actors step over while ducking under the imaginary upper rope). The real world takes place in the center, lower, part of the ring, with props stored handily beneath the ring (set design by Sarah Brandner). Samantha Fromm Haddow nicely clothes both the real world and the colorful fantasy world. The wrestling scenes are well choreographed by Brandon Ewald, although a fight scene with a lot of slapping is a bit too real in light of the recent news out of Chicago. This play makes me wonder about the life of playwright Victor Maog (his first full-length play, commissioned by Mu), because this feels very personal and very specific. Yet anyone who's ever felt lost, abandoned, or lonely can relate to the story and the emotions of the characters. Tot: The Untold, Yet Spectacular Story of (A Filipino) Hulk Hogan continues only through June 26. Take a chance on a new play and experience something beautiful and moving, or not so much. That's up to you. Labels: Ellen Fenster, Eric "Pogi" Sumangil, Hope Nordquist, Kyle Legacion, Mary Ann Prado, Michelle de Joya, Mu Performing Arts, Randy Reyes, Samantha Fromm Haddow, Stephanie Bertumen, Torsten Johnson, Tot "Calendar Girls" at Park Square Theatre "South Pacific" at the Guthrie Theater "A Midsummer Night's Dream" by Classical Actors En... "The Bridges of Madison County" on Tour at the Orp... "Le Switch" at the Jungle Theater "Tot: The Untold, Yet Spectacular Story of (A Fili... "The Funny" by Raw Sugar at Bedlam Lowertown 2016 Summer Theater Preview "Brand New Day" at Mixed Blood Theatre "Knight of the Burning Pestle" by Theatre Pro Rata... "Odd Couple" at Lyric Arts "Ballad of the Pale Fisherman" by Transatlantic Lo... "And So It Goes" by Dark and Stormy Productions at... A Reading of "Minneapolis/St. Paul" at the Playwri...	cc/2020-05/en_middle_0126.json.gz/line502
__label__wiki	0.644909	0.644909	Boys State Tournament Will Be Action-Packed For the first half of the sectional championship game at Homestead, March 2, I thought that De Pere didn't have the size to deal with Germantown senior center Luke Fischer because he's 7 foot and had a six-inch advantage over the Redbirds' tallest starter. Then they gave the Warhawks all they could handle, and it scared Germantown Nation. The Warharks won, and they will be one of the usual suspects who are returning to the WIAA Boys State Tournament at the Kohl Center in Madison, March 8-9. But they're not the only familiar ones who are going to show up. One team that won't be there and are a fixture it seems about every year is Madison Memorial. I think people get tired of seeing them winning state every other year or don't care about seeing the overconfident Spartans on the Kohl Center floor. The only way they will get in the building is to buy tickets. And thanks to Mukwonago, who beat Memorial in the sectional final Saturday, we won't see them. Cuba City and Whitefish Bay Dominican will be there again, and they will play each other in the Division 4 semifinals. Last year, they played in the championship game. I wish that Cuba City coach Jerry Pettigue would hang up his whistle because the game has passed him by after 40-plus years as a coach. The present generation of kids won't jump through hoops like the previuos generations did. If it gives him something to do, then don't expect him to quit anytime soon. Lodi is back in Division 3 and will play East Troy in the semis. East Troy better leave for Madison now before the big snowstorm hits their area this week. No use in getting stuck in 10 inches of snow trying to leave town and dealing with delays on the highway. I'm glad to see them make it. I thought they had one of the most talented teams in the Whiz Kids Summer League when I watched them play, especially the 6-9 Prahl twins and Nate Dodge. I like Dodge's game when he can shoot from long range or go to the basket. You can tell that he's a competitor, and I sensed that when I watched his AAU team with the twins on it, Fischer and Bronson Koenig. Oshkosh North proved that last year's appearance at state was no fluke, but they had nothing to show for it except a loss and a return trip back to Winnebago County. I don't see them beating Germantown unless they slow the pace, which Warhawks coach Steve Showalter doesn't prefer. To him, faster is better and getting ahead and staying ahead is his cup of tea. He doesn't do slow. Milwaukee King and Mukwonago will be the game to watch in the nightcap that follows the G-Town vs. Mukwonago contest, around 8:15 p.m. Friday. The Indians faced the stress of playing under their current nickname for a couple of years due to public outcry and now they have to deal with the pressure cooker of the Generals. King is fast, pesky and always outwork their opponents, despite having no starter over 6-3. Ask Germantown what happened to them in the finals and how they barely survived. If G-Town and King meet again in the championship game, expect the Generals to apply the same pressure on the Warhawks. But here's the difference between this year and last year's Germantown team: They have more talented guards that are interchangeable and can handle the pressure. They have more scoring options besides Fischer. Lamonte Bearden represents a change of pace when he's on the court with his scoring and pushing the ball up. He likes to show off a scoop-shot layup for style every once in a while. King don't like stylish players to show them up, so the best way they might take Lamonte Bearden out of the game in the first half is to get him in foul trouble. He can't do anything sitting on the bench, but if Showalter isn't getting good results from backup guards Brian Bearden and Dearionte Hudson, then he'll put Lamonte Bearden back in and hope he avoids further foul trouble. Eyes also will be on Koenig and La Crosse Aquinas, who's a Wisconsin recruit, and Onalaska's Matt Thomas, a candidate for state player of the year. If I had a vote, I'd pick Fischer for player of the year because last year he hid behind a handful of senior leadership and went along for the ride to the state title. This year he had to break out and show his dominance under the basket with some new faces on the team while building team chemistry. Randolph is Randolph and Drummond is Drummond. Personally, I think that will be a great Division 5 title game to watch if both win on Friday. Green Bay NEW Lutheran (27-0) and Germantown (26-0) are the only undefeated teams in the state tournament field. If the Warhawks win state, their unbeaten streak will stand at 56. All the games will be fun to watch, and I plan on taking in some of the key ones up there in the Mad City. I'll give you my analysis of the state tournament when it concludes this weekend. Girls Playoff Preview Published on 02-24-2013 01:20 PM Number of Views: 441 Last week began the start of the WIAA boys basketball playoffs. Now it's the ladies' turn this week. There might be a few surprises along the way as they're usually are. Upset are upsets and expected wins are expected wins. My predictions for some of the area teams to make it to state are bold. Not too many people will go out on a limb like me and pick the teams who will match up against each other throughout the playoffs. I see De Pere and Kimberly squaring off in the Ashwaubenon sectional finals. The Cardinals won the Division 1 state title last year and are a good bet to win their second in a row. The Verona vs. Madison La Follette matchup at Sun Prairie should be a good one. The winner of that game gets the winner of top-seed Mukwonago and Janesville Parker. I predict a Parker-Verona final at Middleton. In the Sheboygan South sectional, Sussex Hamilton should beat Arrowhead in the regional finals at home. Germantown's up-tempo basketball might run Waukesha West off the court to set up a date with their crosstown rivals in the Chargers in the sectional semis at Kettle Moraine. I pick Hamilton to make it to state. My favorite to win the sectional final game between Superior and Oshkosh North at D.C. Everest is North. The drama will unfold in the West Allis Central sectional. An Oak Creek vs. Franklin border battle matchup in the sectional semifinal at Greenfield is on the horizon and it will be intense. This will be as close to a Hatfield and McCoy feud as any in the area. South 27th St. is the dividing line between the cities of Oak Creek and Franklin. They never liked each other and unfortunately they never will. A Milwaukee Riverside and Brookfield Central battle should be interesting in the regionals. Milwaukee King and DSHA will be another one to watch in the regional finals. The odd thing about the King/DHSA matchup is that Shaq Fowler and Arike Ogunbowale are good friends. They won an under-13 national title together. They hang out together and go to Marquette women's games. All the pleasantries between Fowler and Ogunbowale take a back seat on game day in a packed DSHA gymnasium that seats maybe 500. It will be standing room only, trust me. Once the game starts, the friendship is off and the game face is on, along with some pushing, bumping and who knows what else. DSHA has depth and should win the game. Riverside and Oak Creek will play for the trip to state at Central. In the Division 2 sectional at Brookfield Central, Pius and New Berlin Eisenhower should meet with the winner punching their ticket to Madison. An East Troy and Kettle Moraine Lutheran final at Arrowhead should be fun to watch. The playoffs for girls basketball starts this Tuesday. The tournament will be at the Resch Center in Ashwaubenon for the first time instead of Madison. Let The Playoffs Begin All the games of the boys regular basketball season are complete, and now it's time for the "second season." This one, like every year, is always different because if your team wins, it's on to the next game. If your team loses, then the season is over. And so it goes for the WIAA playoffs, which starts this week. In the first full week of March, five champions in five divisions will be crowned. There will be some jubilation and some sadness and crying on the bench because there will be plenty of that. I don't put any weight on the area or state rankings around this time of the year, especialy since March Madness starts two weeks early in the state of Wisconsin. The boys start the postseason this week and the girls will get it on next week. Let us go to my predictions of how things will shake out in some of the sectionals. The hot sectional to keep an eye on out of the four in Division 1 is, well, I will save that for last. In the Homestead sectional, I see Sussex Hamilton, Sheboygan North, Germantown and De Pere being the final four teams there. Germantown and De Pere have a pretty good chance to meeting again like they did last year. The Cardinals haven't forgotten the defeat that the Warhawks put on them in Manitowoc. Sheboygan North could be the surprise team that would upset De Pere because it looks like they would meet in the semifinals. That is, if both teams run the tables and get past the regional rounds. On the other side, Germantown and Sussex could square off in a rematch from last year when they met at Waukesha North. The Warhawks have been the top dog in the area and the state rankings, and they have a more balanced team. I feel sorry for the Chargers. Outside of their guards, they have no size in the post. They certainly don't have a 7-footer on their team as Germantown boasts. If they meet, the pressure of Germantown will be too much to handle, which could result in a 50-point blowout loss. I'm just saying. I think Sun Prairie, Mukwonago, Madison Memorial or Madison LaFollette will be one of the final four teams in the Sun Prairie sectional. It would be nice for the Cardinals to play the game in their own gym with the short trip to Madison on the line if they win. Madison LaFollette appeared to have fallen off the face of the earth. I haven't heard much from them at state since the 1980s when Rick Olson led them to a state title. Madison Memorial is always there at state and has won the championship almost every other year. Mukwonago is the darkhorse team with an outside chance to go to Madison. Oshkosh North got a taste of the state experience last year. They liked it so much that I can see them returning to Madison this year. Appleton North should be one the favorites along with Superior and Neenah to punch their ticket to Mad Town. Superior would have preferred to play a little closer if the state tournament was in Green Bay. But since the boys tournament will remain in Madison, they will have to travel a lot further. If they win the Stevens Point sectional, then the trip will be worth it. And last, but not least, the toughest sectional in Division 1, the Racine Horlick sectional. Oh boy, where do I start on this one? This sectional is one where it's a dog-eat-dog world. Whoever survives this sectional will be bruised up and probably end up limping to Madison. Either Milwaukee Hamilton, Racine Case, Milwaukee Vincent, Brookfield Central or Milwaukee King will take this sectional. I say that because I saw all these teams in the regular season. Case had a rough time against the Generals when they met in a Thanksgiving weekend game, but the Eagles came back strong and will be ready for the co-City champions this time if they meet in the sectional finals. Hamilton wants a piece of King to avenge their loss to them last week, denying the Wildcats a share of the conference title with Milwaukee Washington. But bygones can't be bygones. Both of those teams have players who know each other off the court and Jim Gosz and Tom Diener, the coaches, certainly aren't going out for dinner before the playoffs. They're both intense bench generals and are usually at each others throat as they have been for years. The Vikings, under Marquis Hines, aren't playoff ready, so the conversation with them being in the sectional semifinals stops right here. Star senior Deonte Burton was hesitant to score at times when his coach wanted him to take over the game. He wanted to pass the ball to his teammates more. He will need to take over. Without his farewell party before he moves on to Marquette, Vincent doesn't have a wing or a prayer and are a longshot to make state. If either of those teams play Brookfield Central, they will have to be ready for a slower game where the final score may be in the 40 to 50-point range. They play a 1-3-1 zone, and if whoever they play doesn't have penetrating guards that will break the zone or consistent outside shooters, then it will play into the hands of the Lancers. In Division 2, four City schools will make it interesting in the West Allis Central sectional. Morse-Marshall, Bay View, Bradley Tech and Washington were in the upper division. Enrollment among the playoff qualifiers pushed them down a division. There is an outside chance that one of those schools could backdoor their way to Madison. The bracket setup in Division 1 allows only one City school to qualify for state from the Horlick sectional. Another City school could emerge from the WAC sectional. I think New Berlin Eisenhower, Wisconsin Lutheran, Catholic Memorial and Pius will also have a say of who will represent the area in Madison. Either Onalaska or Rhinelander, in my opinion, will make it to state in the Marshfield sectional. I see a Waunakee and Stoughton matchup in the Janesville Craig sectional with a visit to the Kohl Center on the line. Seymour and Pulaski are the favorites to square up in the Fond du Lac sectional final. The teams I'll look out for as the favorites in Division 3-5 are Racine St. Catherines, Whitefish Bay Dominican, Burlington, Kaukauna, LaCrosse Aquinas and Cuba City. Fasten your seatbelts because the road to Madison starts Feb. 19. Milwaukee Washington Survived Close Game Against Milwaukee South Determined to find a way and a will to win, Milwaukee Washington fought back from a huge deficit to survive a close game at home, Feb. 8, against Milwaukee South. The Cardinals made the Purgolders sweat in the 74-71 final. The win by Washington plus wins by Vincent, King and Hamilton didn't change the position of the City Conference leaderboard. All four teams have a 9-1 conference record, which still makes it a four-way tie for the top spot. South (7-4) was looking for the upset and had the momentum in the first half. They had the crowd stunned on parent and alumni night and got star player Jamaar McKay in early foul trouble with two fouls at the 2 minute mark of the first quarter. McKay stayed in the game. The Purgolders trailed 24-18 after one quarter. Watching Washington for the first time this season left the impression that they had no business beating Vincent or winning eight in a row before the South game or giving Hamilton their only loss of the season. Something changed after their 3-7 start. The Cardinals had a 10-point lead in the second quarter and kept the Purgolders guessing with their quickness and fast break points, but they also had only eight available players and played seven. Give credit to Washington coach Freddie Riley for motivating his team in the locker room after trailing at the half 42-35. It didn't look as if Washington would dig themselves from that hole when McKay and Marvin Wynn picked up their third and fourth fouls, respectively in the third quarter. The Purgolders used an aggressive half-court trap to force defensive turnovers and chipped away at South's lead. After a three-point shot in the left corner by Washington's Nate Hubbard-Cole at the buzzer to end the third quarter, the Purgolders had a 57-55 advantage and their fans behind them chanting "Wash House!" After Deonta Williams' three cut the Washington lead to 69-67 for South, the Cardinals got the ball back but lost it out of bounds. McKay came to the rescue with a layup from an out of bounds baseball pass from the sideline opposite the South bench to make it 71-69 and got a key rebound off a missed shot by the Cardinals. McKay didn't disappoint with his 24 points in the game to get the threee-point win. With a week of action to go, things will get interesting for the City title. Washington plays at Bay View and at home against Milwaukee North. King plays at Hamilton before closing out the regular season at home against Milwaukee Pulaski. Vincent will play Career Tech and Ed (formally Milwaukee Custer) at home and against Hamilton on the road. Hamilton's last two home games will be the toughest as they play King and Vincent. The City title could go down to the wire. If all four teams win the rest of their conference games, then Washington should win the City for the first time in four years. A loss in the final two league games by the Purgolders and that could be all she wrote. That would open the door for Vincent, Hamilton or King to win the league title. Don't Sleep on Milwaukee South While basketball observers of the City Conference are keeping an eye on the title race that will go down to Hamilton, Vincent, King or Washington, do not forget about Milwaukee South. You might disregard them as another south side school that hardly anyone takes seriously. You should take notice and don't sleep on them. If you don't take them seriously, they could sneak up and break that four-way logjam between Washington, Hamilton, Vincent and King. Those four teams have 8-1 conference records entering this weekend. The Cardinals are trying to play the spoiler's role when they play the Purgolders at Washington Friday. They won't contend for the conference championship because they are 7-3 in conference play. But what they can do is make it hard for Washington to take the City away from the three other heavyweights. The Purgolders snuck up on everybody and played good ball up to this point. Unfortunately, they didn't play on Tuesday. King, Hamilton and Vincent won their games a couple of days ago to catch up at 8-1 and make this anybody's race. It should be noted that Washington beat the Wildcats by eight points at home and sneaked by with a 1-point win at Vincent. They don't play the Generals this season. Don't be fooled by their 11-7 overall record. A tough non-conference schedule prepared for the Purgolders for this moment and may carry them well into the postseason. But first, they have to shake this pesky South team, who's second in the conference, at least for now, because there's a four-way tie for first. It would take a great effort by the undersized Cardinals to shock the city and crush the title hopes of the Purgolders in front of a packed house. Alumni Pep Talk Inspires MU Women Against Rivals MILWAUKEE - Before the Marquette women's home game against their rivals to the south in DePaul, some of the former players ... Upset Was There for the Taking MILWAUKEE - Right there, in the palm of their hands, the Marquette women played well enough for half of the game at home, Jan. 30, at the Al McGuire Center, against visiting Rutgers. Unfortunately in the second half, pulling off the upset wasn't in the cards. A relentless push by the Golden Eagles in the first half put the Scarlet Knights in an unfamiliar situation. They found themselves playing from behind and went into the locker room down 29-28. Unfortunately for Marquette, when it rained, it poured. Seconds before halftime, reserve forward Courtney Thomas' right knee buckled. She fell to the floor, and the expression on her face indicated that she was in pain. Whatever the Golden Eagles forgot to do in the second half that worked in the first 20 minutes of the game was left behind the closed locker room doors. Just think, the Scarlet Knights would have been toast if Marquette would have kept the tempo going. The beat went on for Marquette, despite losing Thomas for possibly the season. That was another casualty to their already three-person injury corps, which include Gabi Minix, Ashley Santos and Apiew Ojulu. The absence of Thomas could wither the team down to nine healthy players. Eight, if you leave out little-used guard Margeaux Dupuy, who's healthy but barely gets in the game. The Golden Eagles were down to eight available players anyway after they sophomore center Chelsie Butler fouled out with 7 minutes 51 seconds in the game and the Scarlet Knights leading 48-39. In the end, it was too much speed, physical strength and depth from Rutgers that did in Marquette. The 72-54 defeat evened the Golden Eagles record to 10-10 overall and 2-5 in the Big East. The schedule in the final nine regular season games won't do them any justice. After a home contest against DePaul this Saturday, Marquette will hit the road with trips to Connecticut, Villanova and Cincinnati. Many people will pencil in a Marquette loss to Notre Dame and St. Johns at home on Feb. 17 and 20, respectfully, and against the Bearcats on March 4. That upset sure would have been the highlight of Marquette's up and down season. They are now 0-11 against Rutgers since joining the conference. There won't be too many more opportunities to try to beat Rutgers, and the Golden Eagles would be glad when the Scarlet Knights finally join the Big Ten Conference. Page 2 of 10 First 1234 ... Last	cc/2020-05/en_middle_0126.json.gz/line505
__label__cc	0.737699	0.262301	Brian T. McKee 518-608-6606 or bmckee@kfmadvisors.com Usfeul Links bmckee@kfmadvisors.com Brian joined Keystone Financial Management (Formerly Empire Financial Partner’s) In 2002 after earning a Finance degree from SUNY Albany. As a frequent recipient of the “Achieving Client Excellence Award," Brian fully embraces the standards that lead to achieving “ACE “ status, both as a representative for his clients, and as a leader. In 2009, he was inducted Into the Recognition Hall in the company’s Boston home office. In 2016 Brian McKee was recognized as court of the table qualifying member of MDRT, the premier association of financial professionals. Brian spent over ten years as a leader with JHFN training and cultivating other advisors. Helping his peers with practice management, he was able to utilize this experience to improve his own financial services practice, which now consists of more than 1000 clients. Brian has been a keynote speaker on over 30 occasions and has also participated in the growth and worked as a consultant to accounting and law firms interested in improving their public events and practices. Brian also was a supporter and participant of Veterans on Wall Street, an event promoting the financial services industry to those who served in the armed services. Brian is also a supporter of VETCON, an organization promoting veteran owned businesses. PROFESSIONAL SPECIALTIES Wealth Protection Asset & Legacy Protection Estate/Trust Financial Strategies Charitable Giving Strategies Family Gifting Strategies 401(k) Review Employee & Executive Succession Plan Funding Buy / Sell Agreement Funding Keystone Financial Management 421 New Karner Road We are registered to sell Securities in the following states: CT, FL, ME, MI, NC, NJ, NY, PA, VA, VT, WI We are licensed to sell Insurance Products in the following states: CT, FL, MD, MI, NC, NH, NJ, NY, OH, PA, RI, TX, VA, VT, WV Securities and Investment advisory services offered through Royal Alliance Associates, Inc. ( RAA), member FINRA/SIPC. RAA is separately owned and other entities and/or marketing names, products or services referenced here are independent of RAA.	cc/2020-05/en_middle_0126.json.gz/line506
__label__cc	0.747229	0.252771	IBM just released Cognos Analytics 11.1, which in my opinion raises the bar on self-service, discovery and easy to use analytics. They innovated with the introduction of artificial intelligence (AI), machine learning (ML) and deep exploration in an intuitive, guided interface. As part of the early adopter program, I explored and will share some of these innovative capabilities. The Best Cognos Analytics 11.1 Capabilities 1. True AI-driven BI With the constantly increasing adoption of data science and discovery also came the need to integrate the insights it delivers with an intuitive consumption experience. Many niche vendors provided capability to insert R, Python or other statistical functions into its visualizations but fell short on the interaction with the user. In contrast, thanks to the integration of the Watson Analytics ‘smarts’ (which should be deprecated in mid-2019), Cognos Analytics 11.1 now orchestrates a set of new features intended to empower users with real data exploration. They can augment their visualizations with advanced analytics and deep-dive into their data with the guidance of AI. This innovation is led by a simple optional ‘Explore’ module, accessed from either the welcome portal or a visualization, and launches a ‘card’ interface. From there, the user is shown a diagram that detects the correlation and strength of each field, as a starting point for the discovery. It even suggests the best starting visualization for displaying such correlation. Also, each visualization introduces the user to a few common advanced analytics insights, either via: ‘Details’, suggests patterns and other detected insights that may not be obvious at first look. Clicking on a suggestion adds a new ‘card’ with a way to look at the data. ‘Insights’, adds contextual statistics to the charts. Fields such as average and meaningful differences. ‘Badges’, presents contextual target-driver relationships and weight, associated with predictive strength. Including the best supportive way to visualize it, such as decision tree, heat map, correlation, sunburst, or rules list. ‘Compare’, bring cards side by side to compare data points, whether they are common or unique. This concept of cards (also taken from Watson Analytics), is very effective with user engagement in a workflow, or ‘thought process’. Users can always go back to a previous card and further explore, or modify the content as more insights are discovered. Cognos Analytics already had storytelling in its previous version, and the explore ‘deck’ can be easily exported as a story starting point. 2. Enhanced data preparation for analytics With every ‘data wrangler’ comes the need to prepare the data in order to support a specific use case. However, most of the enterprise reporting platforms have been cautious with this capability as it may conflict with its governance culture. In its initial release, Cognos Analytics introduced the data module: a web-based, simple modeling interface intended for power users or casual admins to connect, map, and associate data sources. However, some necessary key features were missing. Now they are available in this version and include: Data security: modules can implement data level security (currently available for relational data sources only). Data Wrangling and cleansing features, such as splitting columns Support for uploading multiple excel sheets, split into ‘tables’ Support for relative time and comparative date handling using lookup to a calendar table (many calendar formats provided) Append data sets (note: data sets are an efficient way to support dashboards with a flat, columnar file to ensure interactive performance) SQL-based tables and assisted expression editor Multi-grain column dependencies (equivalent to determinants in previous generation) 3. Enhanced Dashboarding Previous releases of Cognos Analytics delivered dashboards using a self-service interface. As a result, it was highly interactive, but a little too simple and limited for some use cases which needed more granularity. Cognos Analytics 11.1 adds many new features to help deliver more flexible and detailed dashboards and effectively leverage real estate. Font and value format/control (long awaited) Custom palettes to ensure associated categories are displayed in same color Advanced analytics and statistical visualizations Show data for individual widgets The long awaited ‘lasso’ on maps and other correlation charts: allow user to select an area of data points as filter AI assistant: innovative feature using natural language. Examples: ‘show me the data available’, or ‘show me the revenue for the product line’. The assistant suggests visualization best suited for the context requested Collaboration: IBM has partnered with Slack, a teamwork collaboration platform, that easily integrates across devices and browsers. Once configured, users can share content and comments in direct messaging 4. What about Report Authoring? Report authoring has always been a strength of the Cognos Analytics platform. In this release, distributing operational reports is enhanced with features to optimize productivity such as: Addition of smart layout and grid/snap tools Navigation UI for quick access to contractual tools and properties Copy / paste any report part into a dashboard Reusable styles Custom color palettes New visualisations, such as river, waterfall, Marimekko and floating charts Cognos Analytics 11.1 May Now Have the Upper Hand The competitive market of business intelligence and analytics opened opportunities for both ‘niche’ vendors and enterprise platforms. In addition, the adoption of data science and advanced analytics evolved separately until now. With this promising new generation of Cognos Analytics, it confirms that you can have it ‘both ways’. It innovates by adding guided exploration and suggestive insights to the user experience, all in an integrated and easy to use interface. Certainly this is an efficient way to introduce advanced analytics to the more casual user, while assisting the business analysts in discovering insights and stories about their data. Posted by James Salmon at 10/18/2018 12:39:10 PM IBM Cognos Analytics latest version 11.1 has definitely caused a stir within the Business Intelligence marketplace; take a look at the videos below to learn what all the hype is about. We are just creating content for a webinar series that will start just before Christmas, if you would like us to get you registered please email james.salmon@budgetingsolutions.co.uk Get to the why with the all new Cognos Analytics: https://www.youtube.com/watch?v=WUe14iGCjJU What's new in IBM Cognos Analytics dashboarding? https://www.youtube.com/watch?v=ChHxD_GyC40 What's new in IBM Cognos Analytics data exploration? https://www.youtube.com/watch?v=yp3aiFa0Nfc What's new in IBM Cognos Analytics reporting? https://www.youtube.com/watch?v=Cw2vAtV3x4g Posted by James Salmon at 2/28/2018 11:00:44 AM I am often asked what is Business Intelligence and what can Business Intelligence do for my organisation? Well I have found a video that explains exactly that and it is only 2 minutes long! Take a look and if you are interested to find out what is IBM's solution to Business Intelligence follow this link: http://www.budgetingsolutions.co.uk/products/ibm-cognos-solutions/ibm-cognos-analytics/ Clients have been calling in with questions about the exciting next generation of the IBM Cognos Business Intelligence platform – known as IBM Cognos Analytics, v11. Besides wanting to know what is new, one of the common questions we hear is: Will my Cognos 10.x skills translate to the equivalent roles in v11? The short answer is yes. Even though v11 presents an entirely new user experience (UX), we have found that for existing users the transition from v10 can be a positive experience. We have created a reference chart about our findings on what skills will translate directly and which will not, followed by detailed notes on our findings and a quick preview of what’s brand new. BUSINESS AUTHORS Query Studio, Analysis Studio, Event Studio, Metric Studio, and Cognos Workspace are not a part of the v11 UX. However, each of these capabilities and objects created from them will migrate 1-to-1 into v11 and will run in their legacy UI in a separate browser tab or window. Objects created in these tools in v11 will also be saved as legacy objects – currently there is no migration path. IBM has announced end of life for these tools after this release. If you intend to continue using any of these studios after upgrading to v11, any current v10.2 training will be 100% relevant. Budgeting Solutions recommends devising a strategy for migrating off from these solutions in the long-term. Contact us for more information. PROFESSIONAL AUTHORS Report Studio and Cognos Workspace Advanced do not exist as-is in v11 UI/UX; however, all of their features and functionality are available in its new authoring piece. Experienced authors will not find migrating from v10.2 to 11 a major challenge. Core techniques learned in a v10.2 Report Studio or Cognos Workspace Advanced environment will be directly translatable to v11 – the same goes for Dimensional Authoring, OLAP Data Exploration, and Active Report authoring. Budgeting Solutions will be offering a one-day New Features for Experienced Authors course which will enable a seamless transition for Report Studio and Cognos Workspace Advanced authors. For a limited time we will be offering a complimentary seat in this new course for each student that registers for our existing Report Studio training course. SYSTEM ADMINSTRATORS The main administration user interface has NOT changed from v10 to v11, nor have the core configuration components. Architecturally this new version is basically the same as v10; however, there are some new installation and configuration options. The most obvious change is to the user experience. However, consuming static reports does not change. Consuming interactive reports has become much more seamless in the new UX, basically making every report available to be enhanced by users similar to Cognos Workspace. Graduated capabilities means that users have a singular UI for consumption, enhancement, customisation, self-service authoring, and data discovery. No more hopping from studio to studio. So, what about all the NEW stuff? There are a lot of brand new, never before imagined, features in v11 such as data modules for self-service modeling and a new dashboarding capability. We are in the process of developing training materials to describe these new features. We will be holding a series of free webinars covering many of these new features. BOTTOM LINE: With v11, users will be getting a two-fer: powerful new features along with a thoughtful transition between the legacy and new versions. Core skills developed in v10 will be either directly or easily applicable in v11. Users should continue to upgrade their skills to get the full value of their existing investment and can be confident that their skills will still be valid after upgrade. With a much needed overhaul of the user interface and a complete re-focus on usability, this release has everyone in the business of analytics talking about it, even customers who once told me they would never consider it as an option. Here's why: 1. Self Service Analytics Every BI vendor big and small claim to be able to provide self-service analytics. So how does this differ from any other offering? Enterprise BI solutions which are maintained mostly within IT or if you are ahead of the game - a BICC (BI Competency Center) - are often viewed by business users as being bottlenecks to analysis. That is, users can't get the information quick enough to make the decisions they need at the right time. This has led to a flood of start-up companies and niche vendors like Tableau who offer their business customers the ability to go rogue and purchase a tool (on the web using their credit card) which allows them to be fully autonomous with their analysis. Bringing back the age old problem that BI vendors and IT teams were trying to solve in the 90's and 00's of multiple versions of the truth. Cognos Analytics aims to address the need for autonomous analytics for business users but still within an enterprise environment by allowing business users the ability to upload and analyse data, even join it to corporate data maintained by IT. Analysis is easily moved from ad-hoc to enterprise-wide reporting without the need to rebuild it in another "enterprise BI" solution to be distributed throughout the organisation. 2. Intuitive Web-Based Interface A complete overhaul of the user interface offers an easy-to-use analytics environment allowing you to do "data discovery" and "traditional BI" in the one place. Many of my customers have implemented both these types of solutions and many are looking to replace one or both with a single solution that can do it all. The best news for IT - everything is done over the web! No desktop applications to maintain, no report reader applications to maintain, no additional browser plugins to maintain (not that Cognos ever had any anyway). 3. Dashboarding The dashboarding capability of the Cognos solution has also had a complete overhaul and for the better. The ability to drag and drop data onto the screen and see the visualisation change to suit the analysis, and simply creating your own dashboard on the fly gives you faster access to information and thereby quicker time to value. Not only is it easy to use, it is also very good-looking, pleasing the VP's of the world who want a pretty dashboard (oh yes, I have seen it time and time again where an organisation introduces a new BI tool because a VP saw a sexy dashboard at a conference and was sold on it immediately). 4. Mobile The mobile app for Cognos BI has always been a winner with its high level of security, sexy dashboards and the ability to have the same reports on the desktop and mobile device without having to rewrite them (in some other vendors solution the reports have to be re-authored to be consumed over a mobile device). The biggest change here is now you can now author your reports on a mobile device. For anyone who is constantly on the road like me, this is a great thing. 5. Easy to Implement Nothing new to existing customers, but for those who aren't as familiar with the Cognos solution, this tool is the fastest tool to implement at an enterprise level on the BI market today. The solution can be deployed over the cloud (described below) or on-premises. The solution is a multi-tiered architecture, highly scalable and highly configurable. This has been the case with the product since day one. A colleague and I implemented the solution many years ago in its first release to thousands of users at a large UK organisation within 2 weeks - a tight timeline with massive success. The solution only grew from there as demand for information escalated within the organisation and we quickly moved the environment over to a multi-server load-balanced environment - about 10-12 servers, all set up within a couple of days. 6. Cloud While we are on the subject, Cognos Analytics is now available as a service on the cloud so it is even easier to get up and running. IBM has data centers all around the world. We all know the benefits of moving to the cloud - the biggest being lower IT and infrastructure costs - but also performance and scalability plays a big factor here too. You can connect to on-premises data sources, however if you are willing to move your data into the cloud (IBM offers dashDB in the cloud) then you will get optimal performance (your business users will love you). 7. Intent-Based Modeling and Search Capabilities There is a lot of smart technology built into Cognos Analytics and it is all based on IBM Watson under the covers. Need to build a report on sales and product but not sure which tables to pull data from within the database? No problem, just create a new data model, type "product sales" and Watson will use the metadata from the table and column names to figure out what you might need to use. Think it looks right? Then it will go ahead and create the table joins for you (which you can modify if you need to) and create a model for you to start building dashboards and reports from. The search works much the same way… it searches the meta data within reports, including comment and headings etc to return to you as search results so you no longer need to navigate through thousands of reports looking for the right report. 8. You can try it for FREE! http://www.budgetingsolutions.co.uk/about-us/contact-us/request-demo/ With the three previous releases of Cognos Analytics containing mainly bug fixes and small enhancements, release 4 made some big changes that should prove to be universally popular. Please download the release notes here Posted by James Salmon at 12/29/2014 2:58:31 PM IBM Cognos 10.2.2 - What’s New IBM’s latest release of the Cognos Business Intelligence product has just taken place and was made available to download on 21 November , this release being 10.2.2 and comes with the branding of ‘Enabling IT Driven Self Service Reporting’. Here we will explore and explain some of new features of the product release and together with Watson Analytics (which is also due for release before the end of 2014) will keep Cognos as the leading Business Intelligence software solution. My Data Sets This allows data (Excel or text files) that live outside of Cognos to be analysed with the full reporting suite. The size limitation placed on the External Data option does not apply and it will create a standalone package for reporting and analysis. Enhancements in this area include:- Most categories and drop zones on the charts are now made optional. Conversion between visualisation types without having to redefine the data points. Three new visualisations have been created - a Chord, Combination and Tornado Chart. Active Reports We can now produce an Active Report in HTML format now which means we can now view those reports in browsers that do not have MIME HTML (MHT) capability. You can now preview your report directly from Report Studio with the click of a button. You can even make changes directly to the report output, seeing results immediately, and those changes will be written back to the report itself. Dynamic Cubes There has been a lot of effort put into the Dynamic Cube product and the new changes in this release further enhance this capability. The Custom Relative Time ability allows the modeler to establish custom relative time members using the same properties available in Transformer. The ability to import Framework Manager Metadata directly and use it as the basis for a Dynamic Cube. Report Authors/Administrators Tabbed Report Output option specifies whether report pages should function as pages or as tabs. Framework Manager has introduced Summary Query Subjects that allow you to specify grouping and aggregation in the model query subject in ways that could previously only be accomplished in the query design itself. The User Interface Profiles tool allows administrators to customize the UI elements and default behaviours for each studio in Cognos for an individual or group of users to create an environment to suit different users’ needs, skills, and comfort level with the technology. In the Profile Editor, you can customize almost any element of the studio, including toolbars, explorers, toolbox objects, and many more. Query and Analysis Studio Although all studios are available from the Welcome page, the number of options on the Launch dropdown menu is reduced. Query and Analysis Studio have always had a short shelf life ever since the introduction of Cognos Workspace Advanced, and the ability to purchase licences was withdrawn , and this release will be last one where these products exist and all 32-bit versions of the product (as well as Microsoft SQL Server 2005 , IE 8 and IE9) will be removed from the next release. To find out more visit http://www.budgetingsolutions.co.uk/products/ibm-cognos-solutions/ibm-cognos-bi/ibm-cognos-bi-10-2-2/ To see the new release in action you can visit the specific YouTube channel https://www.youtube.com/playlist?list=PLBR9T_Kk_isnm3q7RaSRVP-oyAhO035NV that has videos demonstrating the 25 top new features and can try these functions for yourself with a valid IBM user profile at http://cognos10.analyticszone.com/ibmcognos. For those customers with valid product maintenance , this upgrade is free and further details of the upgrade process and to book your upgrade are available directly from Budgeting Solutions on 0115 853 2863	cc/2020-05/en_middle_0126.json.gz/line507
__label__wiki	0.505046	0.505046	Measuring (māṇa or tulanā) is the act of determining the size, length or amount of something. The Tipiṭaka mentions numerous units of measurement. The smallest of these for both weight and length was a ratharenu, that being equivalent to the tiniest grain of dust thrown up by a chariot. A common unit for measuring volume was the nālī, the amount that could be held in a segment of bamboo (Ja.IV,67; Vin.I,249). Another common unit was the doṇa. Originally a doṇa was a wooden receptacle of standard size used for measuring out raw rice. Later it also became a unit of volume. There were 4 aḷhaka or 200 pala in a doṇa (A.II,55). A full meal of rice and curry was equivalent to about one doṇa (S.I,81). After the Buddha’s cremation, his ashes were held in and then divided out from a doṇa. The bones of the average adult male after cremation weigh between 1 and 1.8 kilograms, which, in the case of the Buddha’s remains, could have easily fitted into a doṇa. Other units of measurement were the accharā, catubhāga, ammaṇa, kukku, paṭṭha and the vidatthi (Ja.III,318; VI,339; V,297; 385). The Buddha said that we should not just show love (metta) towards others, but a particular type of love; a love that is immeasurable (appamāṇa). Some love is besmirched by jealousy, lust or the desire to control. Some holds itself back unless it is reciprocated or it gets its own way. Some love gives itself willingly and joyfully to some but withholds itself from others. All these types of love can be measured because they are to some extent limited. www.buddhisma2z.com Retrieved from "http://www.chinabuddhismencyclopedia.com/en/index.php?title=Measuring&oldid=231869" Buddhist Terms All articles of CBE	cc/2020-05/en_middle_0126.json.gz/line513
__label__wiki	0.828401	0.828401	CLEPSYDRA TROPICARIUM CHECK OUT OUR LAST VIDEO BUY TROPICARIUM NOW Clepsydra are back Check the new albumJoin us on tour keep it up to date About the Band. find out more about clepsydra Danilo Ricci Drum & Percussions Mattia Di Bernardo Voice & Bass Sandro Abbondanza Fabio Di Gialluca Clepsydra band was formed in 2002 by two old friends, Fabio Di Gialluca and Danilo Ricci. The idea was to start by hitting the local live scene performing Hits from two famous Power-Trio of the Sixties such as Jimi Hendrix Experience and Cream, and then begin to produce original songs. After performing a great number of shows in the underground scene for a couple of years, in 2005 and 2006 they recorded the first self-produced EPs The Breath Of The Dog and Foam with the bass player Alessandro Petraccia. In 2007 they sign a contract with MP Records, and, with the bass player Phil De Rubeis, the first album, Second Era Of Stonehenge, is released with an international distribution (GTMusic Distribution). The album is recorded with the help of Fabio Liberatore (David di Donatello winner and Soundtracker of Carlo Verdone movies) and succeeds in Europe with the single Foam, which inspires their first video clip. During 2007 and 2008 Clepsydra promote the Album with a long tour and attend various TV and radio shows in Italy including Database (Rock TV), 105 On The Beach (Radio 105), MTV and All Music; the second single and video clip from Second Era Of Stonehenge, The Passer By, is out in 2008 and reach the USA audience (radio and satellite). In the summer of 2008 they open a concert for P.F.M at the Fadini Stadium in Giulianova. At the same time in 2008 the band begins to write new songs and the line-up changes again, now they recruit the bass player Luca Trifoni. On March 2009 Clepsydra release their second studio work, In Other Sunsets, a concept album where the pure power-trio arrangement (guitar, bass, drums) is enriched by the use of violins, sinth, percussions, sitar and organ; a 65 minutes journey among progressive, space rock and psychedelia. Thanks to the worldwide success of the new album both in sales than in positive critics from the press (USA, Holland, Germany, Great Britain, Japan, Canada, France, Sweden), in 2009 the band produce three hits/videoclips: Majestic12\Eyes Only, Lost In The Universe and Along The Cam Nothing More; the hits have a good success on MTV, Rock Tv and on various international broadcasts. In 2009 Clepsydra are among the nominees for the PIMI (International Award Indie Music) at the MEI in Faenza for the category Best Independent Album. Clepsydra’s third studio album, Marmalade Sky, will be released on April 2011 with a new label, Go Down Records, and distributed by Audioglobe for Italy. The work boasts the special production of Amaury Cambuzat (Ulan Bator\Faust), who participates both as co-producer (along with Fabio di Gialluca) and as session-man. The new album recording took the band almost a year of hard work. Marmalade Sky is an emotional meeting that can lead to addiction, a fascinating and extremely psychedelic work that flows like a A and B sides of a LP; the songs start with an intimate and direct approach, and (after few tracks) lead the listeners into a mystical and dreamy experience. The album is recorded with the bass player Phil De Rubeis, who will be replaced on tour by Mattia Di Bernardo. Clepsydra released its fourth album ,“Tropicarium”, in May 2015 on the label Go Down Records. The album is enriched by the sound of a new member: Sandro Abbondanza playing the Fender Rhodes. Tropicarium, developed with the artist Andrea Di Felice and the DJ Andrea Mathis (both participating in lyrics writing), is a work starting from basic embryonic concepts such as a pencil sketch, a trip, a sound, a smell. This particular approach started a kind of “beehive” where everyone has raised their own “species”, making the 13 tracks visible through the canvas painted by Di Felice. The balance of the “Tropicarium” is held firmly by the awareness that everything is cyclical and that what we lose will be found for sure somewhere else. Clepsydra Discography. All our works since 2007 Second era of Stonehenge In other sunsets Marmalade sky Check out now our new video Buy Tropicarium now!Chek our full discography Clepsydra on tour. Live dates to be defined, stay tuned Merchandise. Support us buying our stuff! Marmolade sky S/M/L/XL/XXL Send us a message or contact one of our partner info@godownrecords.com Via Moroni, 92 – Savignano sul Rubicone (FC) Sick Mambo booking.eventiquattro@gmail.com kayabun@hotmail.it info@clepsydraband.it Copyright 2019 Clepsydra> - All rights reserved.	cc/2020-05/en_middle_0126.json.gz/line519
__label__wiki	0.568027	0.568027	The Coastwatchers Association Inc AGM President’s Reports Notices – Expired Campaigns & Resources Charcoalition (2001-03) Batemans Marine Park Dargues Reef Gold Mine Snowy Mountains Hydro Greater Glider Koala Project (2013-14) Pied Oystercatcher Forests and Forestry Lake Brou Logging the Corn Trail RFA Renewals Hunting in National Parks Planning – Eurobodalla Rural Lands Strategy Planning Proposal Planning – New South Wales Cassia Weed Sea Spurge Your Local Environment Eurobodalla Botanic Gardens Islands Around Durras ← Coastwatchers Makes Two Submissions on Koalas to the NSW Government – March 2017 Editorial – Thought Bubbles Dominate the Energy Debate → NSW Nature Conservation Council Critical of the NSW Government’s Biodiversity Offset Policy The NCC has just released a report titled ‘PARADISE LOST’. The report shows that, far from ensuring no loss in biodiversity, offsetting rules are pushing the endangered plants and animals they’re supposed to protect, closer to extinction. EXECUTIVE SUMMARY OF REPORT Biodiversity is fundamental to our wellbeing and prosperity because it provides the basic requirements of life and underpins our economy. Our bushland and native animals are integral to our national identity, an essential part of what makes Australia and Australians unique. Biodiversity in NSW, however, is in steady decline. Almost 80 species of plants and animals have become extinct in the state since Europeans arrived, and there are currently a further 999 threatened with extinction, including 59% of all mammals, 34% of amphibians and 30% of birds. Clearing of native vegetation and habitat modification are the greatest threats to the survival of the great majority of species on the threatened list. After 200 years of settlement, NSW has lost almost half of its bushland through land clearing and only 9% of that which is left is in good condition. The continuing loss of biodiversity in NSW poses a significant challenge for governments who have a responsibility to protect species and ecosystems and a desire to promote economic growth and create jobs by allowing land clearing for urban development, infrastructure, agriculture, mining and other major projects. State and federal governments in Australia, following the lead of governments around the world, have embraced biodiversity offsetting in a belief that it can resolve this conundrum and deliver growth that is ecologically sustainable. In theory, offsetting achieves this by allowing the loss of biodiversity values at a development site on the condition that biodiversity values at offset sites are protected and enhanced, ensuring there is no net loss of values across all sites. The NSW Government has used biodiversity offsetting for more than a decade as an adjunct to land clearing, planning and threatened species conservation laws. The government is poised to significantly expand its use through the introduction of a Biodiversity Offsets Methodology (BAM) that is a central pillar of its new biodiversity conservation and landclearing laws, including a new Biodiversity Conservation Act and Local Land Services Amendment Act. This report provides a timely review of the performance of biodiversity offsets policies in NSW and a critical appraisal of the Draft Biodiversity Assessment Methodology that the government proposes to introduce to supersede them. KEY FINDINGS OF REPORT 1. Biodiversity offsetting schemes in NSW have failed to deliver the promised outcomes. The performance of five existing offsets schemes was examined through the lens of eight Case Studies in the state’s northwest, southwest, Hunter Valley, and in Sydney. These Case Studies demonstrated that biodiversity offsetting in NSW is failing to deliver the environmental outcomes governments and policy makers have promised. In one Case Study (Boggabri/Maules Creek), biodiversity outcomes were deemed to be “Disastrous”. In five others, outcomes were “Poor” (Warkworth, Mount Owen, Huntlee, Albury, Kellyville). Only two Case Studies were found to have resulted in “Adequate” biodiversity outcomes (Namoi, Wagga Wagga), while none resulted in outcomes deemed “Good”. 2. Biodiversity offsetting schemes in NSW have failed to deliver the promised outcomes A review of the key features of the five biodiversity offset schemes in operation in NSW since 2005 found the later models contained fewer best-practice principles and standards than the earlier ones. Schemes were judged on their inclusion of eight features essential for positive environmental outcomes. Only the first offsets scheme (the Environmental Outcomes Assessment Methodology under the NativeVegetation Act) contained all eight features. The Biodiversity Offsets Policy for Major Projects introduced by the Baird government in 2014 contained only one. 3. The Draft Biodiversity Assessment Methodology contains fewer bestpractice principles and standards than any previous scheme and will likely deliver worse environmental outcomes. Many of the weaknesses and few of the strengths of earlier offsets schemes have been carried forward into the new Biodiversity Conservation Act and Draft Biodiversity Assessment Methodology, which the government intends to implement in 2017. The government is proceeding with this model despite warnings from leading scientists, conservationists and lawyers who have identified many concerns. For example: • Clear objectives for protecting biodiversity are lacking • There is no consideration of impacts on water quality, salinity and soil quality • It does not provide absolute protection (red flags or ‘no-go zones) for areas of high conservation value • The like-for-like principle is undermined • Supplementary measures are allowed in lieu of genuine offsets • Mine site rehabilitation can be used as an offset credit • Developers can pay money into a fund rather than find an appropriate offset site • Offset obligations can be ‘discounted’ under the discretion of the Minister • Offset areas are not guaranteed protection in perpetuity • The new scheme is unlikely to meet Federal standards. Biodiversity offsets schemes in NSW are failing to deliver the environmental outcomes governments and policy makers have promised and the design and performance of these schemes is declining. The proposed Draft Biodiversity Offsets Methodology (BAM) sets lower standards and drifts further from best practice than the underperforming schemes it is intended to replace and will consequently be less effective as a conservation measure. Implementing the BAM will in fact add extinction pressures to the very species and ecological communities offsetting is supposed to protect by facilitating the more rapid and widespread destruction of threatened species habitat across NSW. The report makes a series of recommendations. The full ‘PARADISE LOST’. report can be found at: http://www.nature.org.au/media/265228/bio-offsetting-report_v14.pdf This entry was posted in Biodiversity, Ecology, Planning - New South Wales. Bookmark the permalink. Batemans Marine Park Sanctuary Zones to be Abolished 2019-12-23 Batemans Bay High School Report to Coastwatchers Environment Fund Dec 2019. 2019-12-23 Newspaper coverage – Coastwatchers Environment Fund and Batemans Bay High School 2019-12-02 Dargues Gold Mine update from Coastwatchers’ new representative on the Dargues Gold Mine Community Consultative Committee, Stewart Needham 2019-11-22 Protect Lake Brou 2019-11-12 Coastwatchers sponsor high school native garden 2019-11-12 A weekend of ideas for the future, naturally 2019-11-12 Letter to Forest Monitoring Steering Committee – Sept 2019 2019-11-12 Coastwatchers Submission to Natural Resources Commission NSW Forest Monitoring and Improvement Steering Committee, Nov 8th 2019 2019-11-12 Coastwatchers supports NSW Regional Community Energy Fund application 2019-10-07	cc/2020-05/en_middle_0126.json.gz/line523
__label__wiki	0.717764	0.717764	Critical Hits & Misses #294 4:30 PM Ivonne Martin Critical Hits and Misses, eclipse, fuck yeah, Godzilla, Hulu, monster movies, The Gifted, x-men Edit This is me, hurrying off to relive my delightful monster movie childhood The new X-Men based The Gifted is hitting tv soon, and Bustle has a story on the original character Eclipse (a man of color, incidentally). If you're like me, you might have been raised on monster movies, back when monster movies were awesome. Well, rejoice, because Hulu just quietly added a buttload of Godzilla movies! For today's musical hit, we have Kendrick Lamar and "LOYALTY" Today's critical rolls: Monster flicks? Modern or the old cheesy kind? Do you love 'em? Do you hate 'em? Critical Writ has a super-duper strict comment policy that specifies a single rule above all others: we reserve the right to ban you for being a terribad citizen of the internet. Vambrace Yourselves: The Great Wonder Woman Roundtable Search Critical Writ Nasty Women Is Mandatory Reading Christopher Hastings Talks 'Gwenpool' Google-Glance #1: Overwatch Arrowverse Real Talk Remaketober 2017 - Dawn of the Dead HBO's Game of Thrones Complete S6 Recap For S5 Quitters Ghostbusters: A Post-mortem Roundtable Ghost in the Shell Film Review Ghost in the Shell Film Analysis Part I: Live-action vs. Anime Canon Dark Souls III Diary - Playthrough Journal - Part 1 The Unbelievable Gwenpool #17 Review: A Spectacular Second Chapter Martian Manhunter/Marvin The Martian Review: Isn't That Lovely? All-New All-Different Marvel (8) ANAD Avengers (7) Archie (32) Arrow (28) Berlantiverse (43) Black Mask Studios (7) Books (45) Boom Studios (9) Bunnies (4) Chilling Adventures of Sabrina (3) Civil War II (5) Comics (236) Crazy Ex-Girlfriend (11) Critical Hits and Misses (320) Cute (3) Dark Souls III (5) DC (46) DCWeek (3) F/F fiction (12) feminism (44) Game of Thrones (6) Games (23) Ghostbusters (5) Gwenpool (20) Hamilton (5) Harry Potter (5) House of Lies (4) Howard the Duck (8) Image Comics (16) Interview (4) Jae (3) Josie and the Pussycats (9) Jughead (11) Killjoys (4) Legends of Tomorrow (7) Loki (5) Luke Cage (8) Make a Solicit Check (10) Marvel (130) Movies (50) Mr. Robot (3) Ms. Marvel (9) New Avengers (4) News (12) Off The Beaten Path (4) Opinion (15) Orange Is The New Black (6) Overwatch (15) Person of Interest (9) Poe Dameron (3) Previews (5) Recaps (56) Reviews (286) Roundtables (15) Scream Queens (8) SNL (68) Son of Zorn (5) Star Wars (27) Star Wars Rebels (7) Steam (5) Steven Universe (20) Stranger Things (8) Supergirl (22) The Flash (38) The Flintstones (14) The Ultimate Fighter (8) The Vision (5) The Walking Dead (4) TV (244) UFC (9) Ultimates (5) Vikings (4) We Have Opinions (8) Westworld (10) Wonder Woman (24) Young Animal (4) Critical Writ Archive Remaketober 2017 Week 4: Dawn of the Dead Ghost in the Shell Film Analysis Part IV: Themes Ghost in the Shell Film Analysis Part III: Setting... Remaketober 2017 Week 3: The Last House on the Lef... Ghost in the Shell Film Analysis Part II: Aestheti... Ghost in the Shell Film Analysis Part I: Live-acti... Remaketober 2017 Week 2: The Texas Chainsaw Massac... Praise Amaat, Ann Leckie's New Book Is Out Remaketober 2017 Week 1: IT The Beautiful Ones: Book Review Adrian Martinez Aranwe Quirke Bandit Queen Dominik Zine Elizabeth Ledwell Etienne Domingue Harvey Thornton Ivonne Martin Kinoumenthe Lacey Carew Megan Crittenden Miz Opifex Rachel Vigo Rana Newlove SecretAgentR Tova Crossler Ernström Zachary Krishef Critical Writ is a collaborative blog, a way for a community of genre fiction aficionados to share their thoughts on issues of race, gender, orientation, minority rights, and environmentalism, particularly when it comes to their representation in literature, comics, games, television, and film. Critical Writ is dedicated to fostering socially-progressive discourse on popular culture in a safe and respectful online setting. Critical Writ contributors are free to pursue their interests; they do not receive an editorial mandate to praise or to condemn the object of their critique. This blog is a labor of love for all involved. We do not accept money from the Democratic convention, the Illuminati, or Snake People. It’s not that we would turn down money, it’s just that it’s never been offered. Contrary to popular belief, opinions are surprisingly difficult to monetize. Copyright © Critical Writ \| Powered by Blogger	cc/2020-05/en_middle_0126.json.gz/line536
__label__wiki	0.848689	0.848689	OPEC oil output rises to highest since 2016 despite Iran: Reuters survey https://www.reuters.com/article/us-oil-opec-survey/opec-oil-output-rises-to-highest-since-2016-despite-iran-reuters-survey-idUSKCN1N525W OPEC has boosted oil production in October to the highest since 2016, a Reuters survey found, as higher output led by the United Arab Emirates and Libya more than offset a cut in Iranian shipments due to U.S. sanctions. The 15-member Organization of the Petroleum Exporting Countries has pumped 33.31 million barrels per day this month, the survey on Wednesday found, up 390,000 bpd from September and the highest by OPEC as a group since December 2016. OPEC agreed in June to pump more oil after pressure from U.S. President Donald Trump to curb rising prices and make up for an expected shortfall in Iranian exports. Oil LCOc1 hit a four-year high of $86.74 a barrel on Oct. 3 but has since eased to $76 as concerns over tight supplies faded. “Oil producers appear to be successfully offsetting the supply outages from Iran and Venezuela,” said Carsten Fritsch, analyst at Commerzbank in Frankfurt. The June pact involved OPEC, Russia and other non-members returning to 100 percent compliance with output cuts that began in January 2017, after months of underproduction in Venezuela, Angola and elsewhere had pushed adherence above 160 percent. In October, the 12 OPEC members bound by the supply-limiting agreement lowered compliance to 107 percent as production rose, from a revised 122 percent in September, the survey found. This is the closest OPEC has moved to 100 percent compliance since the June agreement. UAE, LIBYA The biggest increase has come this month from the UAE. Output in October rose by 200,000 bpd to 3.25 million bpd, the survey found, and could in theory rise further as the UAE says its oil-production capacity will reach 3.5 million bpd by the year-end. The second-largest came from Libya where production averaged 1.22 million bpd, the survey found, a rise of 170,000 bpd. Libyan output remains volatile due to unrest, raising questions about the stability of current OPEC production. Saudi Arabia, after opening the taps in June and then scaling back its plans to pump more, supplied 10.65 million bpd in October, more than in June and close to a record high, the survey found. The kingdom, OPEC’s top producer, has indicated it is concerned about potential oversupply, raising the prospect that its next production adjustment could be to rein in output. OPEC’s second-largest producer, Iraq, also raised output in October. Iraqi supply could rise further if Iraq’s new government goes ahead with a deal reached by the outgoing administration and the Kurdistan Regional Government (KRG) to resume exporting Kirkuk crude to Turkey via the KRG. Angola, where natural declines at oilfields curbed production in recent years, boosted supply in October due to supply from a new field, Gindungo. Output is still far below its OPEC target. Exclusive: Saudi arms deal may create few new U.S. jobs Supply in Nigeria rose by 30,000 bpd. Like Libya, Nigeria is not part of the OPEC supply-cutting pact because it often faces unplanned outages stemming from unrest. Output in Kuwait edged lower, the survey found. The country had raised production in July following the OPEC deal, and kept it steady in August and September. Among countries with lower output, the biggest drop - 100,000 bpd - occurred in Iran. Exports fell as returning U.S. sanctions discouraged companies from buying the country’s oil, although the decline was lower than some analysts expected. “Iran is going to come in above expectations,” said an industry source who tracks OPEC output, referring to Iranian supply in October. Production also slipped further in Venezuela, where a lack of funds for the oil industry because of the country’s economic crisis is cutting refinery operations and crude exports. Despite these decreases, OPEC output in October has risen to the highest since December 2016, the month before the supply-cutting pact took effect, according to Reuters surveys. Some of the extra oil has come from Congo Republic and Equatorial Guinea, which joined OPEC in 2018 and 2017 respectively. Before Congo joined, OPEC had an implied production target for 2018 of 32.78 million bpd, based on cutbacks detailed in late 2016 and Nigeria and Libya’s expectations of 2018 output. According to the survey, OPEC excluding Congo pumped about 530,000 bpd above this implied target in October. The survey aims to track supply to the market and is based on shipping data provided by external sources, Thomson Reuters flows data and information provided by sources at oil companies, OPEC and consulting firms. Additional reporting by Rania El Gamal in Dubai; Editing by Dale Hudson Posted by Crude Oil Daily at 1:17 PM No comments: Links to this post Oil Production On Federal Lands To Hit New Record (Credit: Jessica K Robertson, USGS. Public domain.) https://oilprice.com/Energy/Energy-General/Oil-Production-On-Federal-Lands-To-Hit-New-Record.html Crude oil production from onshore federal lands reached a record high over the first seven months of this year, New York Times’ Eric Lipton said in a tweet responding to a claim that oil production in Wyoming had peaked three years ago. Lipton quoted data from the Department of the Interior, which has not been made public yet, as part of an investigation he and climate reporter Hiroko Tabuchi recently published about a second shale oil boom. The investigation cites calculations based in Interior Department data made by Taxpayers for Common Sense, which suggests over 12.8 million acres of federal land were offered for leasing to oil and gas companies in FY 2018, which ended last month. This, Lipton and Tabuchi note, is three times more than the average acreage offered for leasing during the second Obama administration. Take-up has also been higher: leases in the same 12 months were the highest since 2012, the peak of the first shale revolution, as the Trump administration pursues its energy dominance agenda. The figures from the first seven months of this year follow another record set last year. Reuters reported in June that crude oil production from federal lands and waters rose 7 percent in 2017 to the highest since at least 2007 if not longer. The average daily stood at 2.22 million barrels, compared with 2.07 million barrels daily a year earlier. Washington has been doing its best to stimulate a second shale boom by rolling back Obama-era regulations that restricted drilling on federal lands. This has naturally sparked a lot of opposition, so part of the changes introduced by the Trump administration have targeted opponents to the oil and gas industry by reducing the opportunities that drilling opponents have to put the brakes on oil and gas exploration. Earlier this year, the Interior Department approved a policy featuring provisions such as a 60-day deadline for processing proposed lease sales and cutting the protest periods to 10 days. Also, the department repealed a provision approved by the previous administration that gave other users of federal land such as hunters and anglers the power to object to a lease sale. In addition, the public participation in some lease sale reviews was redirected to lower-level government officials, and environmental reviews of lease sales were reduced to six months with BLM officials no longer required to visit the site of the lease while they conduct the review. By Irina Slav for Oilprice.com Posted by Crude Oil Daily at 12:39 PM No comments: Links to this post PDVSA Makes Critical Bond Payment El presidente Nicolás Maduro https://oilprice.com/Latest-Energy-News/World-News/PDVSA-Makes-Critical-Bond-Payment.html Venezuela’s state oil company PDVSA has made a US$949-million payment on a bond maturing in 2020, Argus Media reports, citing sources from the financial sector. The report noted that this is PDVSA’s only bond it has not defaulted on and that the payment included both principal and interest: US$842 million in principal and US$107 million in interest. This bond is backed by 50.1 percent of the stock of PDVSA’s U.S. business, Citgo, with the rest of the stock was offered to Russian Rosneft as backing for a US$1.5-billion oil-for-cash deal that last year sparked worry in Washington that Rosneft could come to control a sizeable portion of a U.S. company if PDVSA defaulted on these particular payments. At the time, the danger of default was seen as considerable. The troubled Venezuelan company also has two more payments on this bond coming due next year, one a US$71-million interest installment and another US$842 million in principal payment. It’s not clear how much longer PDVSA will be able to continue servicing the payments on this particular bond, analysts at JP Morgan, Torino Capital, and Eurasia Group told Bloomberg, which reported on the upcoming payment last week, saying that the government of Nicolas Maduro would make the payment due at the end of this month because it will want to hang onto this key asset as long as possible. Citgo, however, itself has debts of US$3 billion, and some of it may have to be repaid. Earlier this year, Canadian gold miner Crystallex won the right to tap Citgo for compensation of US$1.4 billion for the forced nationalization of its assets by the Hugo Chavez government. Russia’s largest producer Rosneft could also claim Citgo shares, if PDVSA, which had pledged 49.9 percent in Citgo as collateral for loans from Rosneft in 2016, defaults on those loans. After the Khashoggi Murder, Pakistan Shakes Down Weakened Saudi Prince for $6 Billion Pakistan’s Imran Khan rushed to support Mohammed bin Salman as the Khashoggi murder case destroyed the kingdom’s credibility—and the move paid off. https://www.thedailybeast.com/after-the-khashoggi-murder-pakistan-shakes-down-weakened-saudi-prince-for-dollar6-billion?yptr=yahoo Pakistan has emerged as an apparent winner from the international outcry that followed a Saudi hit team’s murder of journalist Jamal Khashoggi in Istanbul at the beginning of October. By rushing to stand by Saudi Crown Prince Mohammed bin Salman, widely accused of ordering the execution, Pakistani Prime Minister Imran Khan got a $6 billion aid package, which he desperately needs to salvage the Pakistani economy. There undoubtedly is more to the deal, including benefits for Saudi-backed terrorist groups in Pakistan. Khan was elected in August as a populist who promised to shake up Pakistani politics and fight corruption. He was aided by the all-powerful army intelligence service, the ISI, which was determined to keep former Prime Minister Nawaz Sharif’s party from regaining power. Khan has long been a harsh critic of the United States and friendly to the Taliban. Better known for leading his country as a cricketer than as a politician, Khan is a man in a hurry. He inherited an economy in crisis, and shortly after the election Khan traveled to Saudi Arabia looking for a bailout. The Kingdom has been a major aid donor to Pakistan for decades, but the Saudi war in Yemen has strained relations. Nawaz Sharif turned down Mohammed bin Salman’s repeated requests for Pakistani troops to help pursue the war against the Houthis in Yemen. Sharif took the Saudi request to the Pakistani parliament, which unanimously voted against sending troops—a stunning rebuke to Riyadh and the crown prince. Without Pakistani armor the war quickly became a stalemate and an expensive quagmire for Saudi Arabia. It costs at least $50 billion a year and has created one of the world’s worst humanitarian crises. “Since the deal was signed, the Pakistani government has removed from a list of proscribed groups two organizations headed by Hafez Saeed – the mastermind of the Mumbai terrorist attack.” The Pakistani “no” on Yemen sent another message. For decades, Saudi Arabia had implied that if it ever needed nuclear weapons it would have access to the Pakistani nuclear arsenal, the fastest growing nuclear weapons inventory in the world. But if Pakistan would not send troops to fight the Houthis, it would surely not send the bomb. Mohammed bin Salman, widely known as MBS, had eroded the Kingdom’s deterrent with his reckless behavior in Yemen. Imran Khan did not get a handout from his first trip in September, but he went back last week, and the Saudi crown prince is now a much-diminished figure in the wake of the Istanbul affair. Once touted as a reformer who would transform the Kingdom, he is now condemned for the murder of Khashoggi, the humanitarian catastrophe in Yemen, a series of diplomatic gaffes, and repression at home. A much advertised investment conference in Riyadh was boycotted by most invitees from the West. The Saudi cover story changed daily. Khan got a deal this time. In fact, he got a bigger deal from his second trip than he had asked for on his first. The Saudis provided Khan with a $3 billion balance of payments deposit at a time when Pakistan’s reserves are at a four-year low. In addition, the Saudis agreed to defer payments for oil deliveries to Pakistan for three years, which is worth at least another $3 billion. The Pakistanis are asking the United Arab Emirates, Saudi Arabia’s junior partner in Yemen, for additional aid. Pakistani Foreign Minister Shah Qureshi has said that there are no strings attached. Asked how the deal happened, the urbane Qureshi said “by the grace of the Holy Prophet.” He was adamant that Pakistan is not changing its approach on Yemen, and since Khan’s party is a strong critic of the war, that’s probably correct. Qureshi also said that the Saudi deal has nothing to do with the ongoing criminal charges against Nawaz Sharif. Since the deal was signed, the Pakistani government has removed from a list of proscribed groups two organizations headed by Hafiz Saeed—the mastermind of the Mumbai terrorist attack, which took place 10 years ago next month. Saeed was one of the few voices who lobbied to send Pakistani troops to fight in Yemen and he has long raised funds for his terrorist activities in the Kingdom. He also has close ties to the ISI, which trained and assisted the Mumbai killers. The ISI also has a long record of killing journalists who write about its connections to terrorists like Saeed. He has a $10 million bounty on his head from the United States. By his own admission, Khan was desperate to get a deal, and he played his cards wisely. He can also seek help from the Chinese and Iranians in the weeks ahead. China has made a multibillion-dollar commitment to build an economic corridor across Pakistan linking western China to the Persian Gulf with a new port at Gwadar on the Gulf of Oman. Khan has said he wants to mediate between Saudi Arabia and Iran to ease tensions in the region and reduce sectarian violence between Sunnis and Shias. Pakistan has a large Shia majority and needs to calm down the Saudi-Iranian proxy war. The United States also needs Pakistan to help it get out of Afghanistan. Donald Trump is a reluctant warrior in Afghanistan. He agreed to stay last year against his own intuition. The Pakistanis have provided sanctuary and safe havens for the Afghan Taliban for 17 years. The ISI trains them and helps plan their military operations. The army leadership has stonewalled American generals and diplomats from three administrations seeking to end the connection to the Taliban. It’s only gotten stronger. Pakistan is still in deep economic trouble and will probably need IMF aid. Khan played the Khashoggi backlash to his advantage in Riyadh, but it is way too soon to suggest that he has a coherent plan to make Pakistan prosperous and corruption free. For now, it is amusing to see Mister Bone Saw—MBS’ new nickname—get shaken down by a batsman. New Houston Oil Pricing Benchmark Launches A new oil pricing benchmark launched Monday that could make Houston the new hub for U.S. oil pricing. The commodities trading firm Intercontinental Exchange Inc., called ICE, initiated the West Texas Intermediate pricing guide that will price oil based on volumes produced from the Permian Basin and delivered to Houston's refining and export hub. The new ICE Permian WTI futures contract will price West Texas oil delivered to Magellan Midstream Partners' large terminal in East Houston along the Houston Ship Channel. West Texas' booming Permian Basin is producing a record volume of about 3.5 million barrels of oil a day - nearly one-third of the nation's total. With those rising volumes much more oil is headed to export destinations out of Houston and Corpus Christi. With most of the nation's oil exports shipped from the Gulf Coast, ICE sees Houston as a more accurate delivery point than the current West Texas Intermediate benchmark that's delivered to Cushing, Okla. Cushing is a major storage and trading hub nicknamed the pipeline crossroads of the world. "We're offering customers a trusted standard for WTI straight from the Permian Basin, and over time, it's one that we think could develop into a benchmark for other grades to price around."said Jeff Barbuto, vice president of oil markets at ICE. https://www.tankterminals.com/news_detail.php?id=5561&utm_medium=email&utm_campaign=Subscribers%20-%20Week%2044&utm_content=Subscribers%20-%20Week%2044+CID_0137ff37361daae612aaa39cfab5b34e&utm_source=weekly&utm_term=New%20Houston%20Oil%20Pricing%20Benchmark%20Launches Posted by Crude Oil Daily at 11:44 AM No comments: Links to this post Who is the Saudi Prince Mohammed bin Salman? - BBC Newsnight In change of tack, Saudi Arabia says Khashoggi's murder 'premeditated' FILE PHOTO: Saudi dissident Jamal Khashoggi speaks at an event hosted by Middle East Monitor in London, Britain, September 29, 2018. Middle East Monitor/Handout via REUTERS https://www.yahoo.com/news/cia-director-heard-recording-khashoggi-killing-during-turkey-085725259.html Saudi Arabia's public prosecutor said on Thursday the murder of journalist Jamal Khashoggi in the kingdom's Istanbul consulate was premeditated, reversing previous official statements that the killing was unintended. The death of Khashoggi, a Washington Post columnist and critic of de facto Saudi ruler Crown Prince Mohammed bin Salman, has sparked global outrage and mushroomed into a crisis for the world's top oil exporter and strategic ally of the West. Saudi officials initially denied having anything to do with Khashoggi's disappearance after he entered the consulate on Oct. 2, before changing the official account to say an internal investigation suggested Khashoggi was accidentally killed in a botched operation to return him to the kingdom. Turkey and Western allies of Riyadh have voiced deep scepticism about Saudi explanations of the killing, with Turkish President Tayyip Erdogan dismissing Saudi efforts to blame rogue operatives and urging the kingdom to search "top to bottom" for those responsible. On Thursday, Saudi state TV quoted the Saudi public prosecutor as saying the killing was premeditated, and that prosecutors were interrogating suspects on the basis of information provided by a joint Saudi-Turkish task force. "Information from the Turkish side affirms that the suspects in Khashoggi's case premeditated their crime," said the statement carried by state TV. The disclosure came a day after U.S. President Donald Trump, the kingdom's staunchest Western ally, was quoted by the Wall Street Journal as saying that Prince Mohammed, also known as MbS, bore ultimate responsibility for the operation that led to Khashoggi's death. Two informed sources told Reuters on Thursday that CIA director Gina Haspel heard an audio recording of the killing during a fact-finding visit to Turkey this week, the first indication Ankara has shared its key investigative evidence. A White House spokeswoman said Haspel would meet with Trump later on Thursday to brief him on the case. Representatives of the CIA declined to comment. "We have shared with those who sought additional information some of the information and findings that the prosecutor has allowed us to share," Turkish Foreign Minister Mevlut Cavusoglu told reporters, without giving specific details. INTELLIGENCE RESTRUCTURING Saudi Arabia has detained 18 people and dismissed five senior government officials as part of the investigation into Khashoggi's murder. Some were members of a 15-man hit team, many of them Saudi intelligence operatives, who flew into Istanbul hours before Khashoggi's death, Turkish security sources say. Turkish police were investigating water samples from a well at the consulate on Thursday after initially being denied access, broadcaster CNN Turk said. King Salman, who has delegated the day-to-day running of Saudi Arabia to his son MbS, on Saturday ordered a restructuring of the general intelligence agency. Saudi state news agency SPA said on Thursday that MbS had presided over the first meeting of a committee to carry out that restructuring and that it had come up with recommendations to improve the agency's work. How Western allies deal with Riyadh will hinge on the extent to which they believe responsibility for Khashoggi's death lies directly with MbS and the Saudi authorities. MbS promised on Wednesday the killers would be brought to justice, his first public comments on the matter after speaking by phone with Erdogan. Erdogan has called Khashoggi's murder a "savage killing" and demanded Riyadh punish those responsible, no matter how highly placed. Cavusoglu said Turkey had no intention of taking the Khashoggi case to an international court but would share information if an international inquiry were launched. Saudi Arabia is the lynchpin of a U.S.-backed regional bloc against Iran but the crisis has strained Riyadh's relations with the West. Dozens of Western officials, world bankers and company executives shunned a major three-day investment conference in Riyadh this week. But striking a defiant tone, MbS told international investors at the conference on Wednesday that the furor would not derail the kingdom's reform drive. "We will prove to the world that the two governments (Saudi and Turkish) are cooperating to punish any criminal, any culprit and at the end justice will prevail," he said to applause. Saudi Energy Minister Khalid Al-Falih conceded on Wednesday that the scandal had hurt the kingdom's image. But he said Saudi Arabia had signed $56 billion of deals at the conference despite the partial boycott and that it expected the United States to remain a key business partner. "The interests that tie us are bigger than what is being weakened by the failed boycotting campaign of the conference," he told Saudi state TV. Britain, like the United States a major weapons supplier to the kingdom, has described Riyadh's explanations for the killing as lacking credibility. France has said it will consider sanctions against Saudi Arabia if its intelligence services find Riyadh was behind Khashoggi's death. For their part, the Trump administration and the U.S. defense industry are scrambling to save the few actual deals in a much-touted $110 billion arms package for Saudi Arabia. (Reporting by Asma Alsharif and Tuqa Khalid in Dubai; Ali Kucukgocmen and Tulay Karadeniz in Ankara; Susan Heavey in Washington; Writing by Mark Heinrich; Editing by Nick Tattersall) Venezuela Drops US Dollar �� Khashoggi killing: Erdogan calls for extradition of 18 suspects \| Al ... Big Oil Walking A Tightrope As Prices Rise https://oilprice.com/Energy/Energy-General/Big-Oil-Walking-A-Tightrope-As-Prices-Rise.html Supermajors have had a great year so far, and their third-quarter results, to be released over the next couple of weeks, are likely to strengthen this impression. But this does not necessarily mean that investors will reward them. Investors have become a lot more careful in the past few years, and chances are they will want to see more proof of post-crisis flexibility and strict cost discipline before stock prices reflect an increase in trust. On the face of it, Exxon, Shell, Chevron, and their likes have everything going for them: oil prices are higher, free cash flow is coming in at higher rates, and there have even been a few discoveries, most notable among them Exxon’s 4-billion-barrel elephant off the coast of Guyana. But Big Oil still needs to be cautious. In a recent article for 24/7 Wall Street, its senior editor Paul Ausick noted the heightened prospects of even higher oil prices after a Reuters report revealed that OPEC has been having trouble lifting production by the promised 1 million bpd. From May to September, the cartel’s combined production plus Russia’s had fallen well short of that figure because of production declines in Venezuela, Iran, and Angola, among others. These, the internal OPEC document that Reuters saw, offset some substantial output hikes from Saudi Arabia, Russia, the UAE, Iraq, and Kuwait. What this means is that there seems to be less spare capacity than optimists believed. This, in turn, means prices are likely to climb further, despite a fresh assurance from Treasury Secretary Steven Mnuchin that traders have already factored in the U.S. sanctions against Iran. Mnuchin’s warning that Washington will insist on importers cutting Iranian crude imports by more than 20 percent most certainly has not helped rein in prices, though its effect has yet to be fully acknowledged. For Exxon, Shell, and Chevron, as well as the rest of the Big Oil club, higher prices are not something to be too happy about. There are already warnings from economists that Brent at US$80 has dampened demand from some major consumers including India. If the international benchmark adds another few dollars, the impact on demand will be more severe, and any negative price impact on oil demand will affect the supermajors. In other words, oil prices, which boosted the industry’s earnings in the first half of the year and is more likely than not to continue boosting them in the third quarter, could push these lower if they rise enough. Another thing investors are watching, Ausick noted in his review of Exxon and Chevron’s expected performance, is cost control. This is still big on the agenda of investors - even if Big Oil itself is slowly slipping back into the deep rut of the cycle: spending big when prices are high and cutting costs when prices drop. For now, this return to the industry norm has been very gradual—oil stocks have been underperforming oil prices consistently and companies are wary of scaring investors off—but if prices continue to be strong, risk appetite is bound to increase for both investors and companies. Big Oil, in other words, is being tested in a context of super volatility in prices brought about by uncomfortable uncertainties surrounding the world’s spare oil production capacity and demand prospects in emerging economies where growth is slowing down. Third-quarter figures might provide some indication as to how things stood at the end of September, but the situation is so dynamic right now they might tell us nothing about the next three months. Houston Takes Center Stage as Major Crude Oil Trading Hub Since the lifting of a decades-old ban on crude exports at the end of 2015, Houston has emerged as a major physical crude oil trading hub, overtaking the country’s primary crude benchmark (West Texas Intermediate, or “WTI”) pricing power long held in Cushing, Oklahoma due to access to major pipelines that run through it and ample storage space. The surge in crude oil production can be tied to the shale boom, particularly in the Permian Basin in West Texas and New Mexico, where vast amounts of crude oil flow directly to the Gulf Coast – oftentimes bypassing Cushing altogether – to destinations such as Asia, Europe and Latin America. Traders and market observers say WTI crude at Houston is a preferred futures contract hub over WTI Cushing because it better reflects global market balance and offers a more liquid market for export customers. Since the lifting of the crude oil export ban, U.S. crude exports have surged nearly 350%, from 490,000 barrels per day (bbl/d) in January 2016 to a record 2.2 MMbbl/d in June 2018, according to the U.S. Energy Information Administration (EIA). Rising oil production in the Permian Basin, which is estimated at around 3.5 MMbbl/d, along with increased U.S. light sweet crude exports to overseas customers, have prompted the launch of new physical futures contracts in Houston that are set to debut later this year. In fact, the U.S. port district of Houston-Galveston earlier this year began exporting more crude oil than it imported for the first time on record, according to EIA statistics. In April 2018, crude oil exports from Houston-Galveston surpassed crude oil imports by 15,000 bbl/d. In May 2018, the difference between crude oil exports and imports increased substantially to 470,000 bbl/d. On July 17, 2018, the Intercontinental Exchange Inc. (“ICE”) announced plans to launch in the third quarter of this year a physically delivered Permian WTI crude oil futures contract, deliverable in Houston. According to ICE, the new futures contract “is designed to provide price discovery, settlement and delivery at Magellan Midstream Partners LP’s terminal in East Houston.” The contract is expected to provide ample liquidity for traders and brokers seeking flexible hedging and trading opportunities for export shipments. Meanwhile, CME Group on September 24, 2018, announced that it intends to offer a new WTI Houston crude oil futures contract with three physical delivery locations on the Enterprise Houston system, pending regulatory review. WTI Houston crude oil futures will be listed with and subject to the rules of NYMEX, beginning with the January 2019 contract month. The new WTI Houston crude oil futures contract expands CME Group’s already robust suite of crude oil futures and options and will complement its global benchmark NYMEX WTI Light Sweet Crude Oil futures. Participants will have the flexibility to make or take delivery of U.S. light sweet crude oil at the Enterprise Crude Houston (“ECHO”) terminal, Enterprise Houston Ship Channel (“EHSC”) or Genoa Junction through the new contract. Enterprise has a network of 19 ship docks along the U.S. Gulf Coast and is the largest exporter of crude oil in the U.S. and the ideal provider of delivery points for this physical WTI Houston futures contract, according to CME Group. Through its network of pipelines, storage and marine terminals, the firm has the capability to handle the flow of more than 4 MMbbl/d of crude oil. Participants will also benefit from access to a diverse group of refiners, storage facilities and export facilities through the Enterprise network. What We’re Hearing Opportune LLP’s Derivative Valuation group has heard very little from our existing clients about the new WTI Permian crude oil contracts delivered into Houston. Unfortunately, this is very common as we often deal with transactions that have already been executed. That being said, we routinely see examples of hedging mismatches. For instance, some companies have marketing agreements that sell WTI at Cushing and are erroneously hedged with Brent crude contracts. These pricing relationships tend to deteriorate over time and eventually result in both losses on production and the hedge itself. These costly mistakes can easily be avoided. https://www.tankterminals.com/news_detail.php?id=5537&utm_medium=email&utm_campaign=Subscribers%20-%20Week%2043&utm_content=Subscribers%20-%20Week%2043+CID_46faede737e501203b8c3e1adacb904b&utm_source=weekly&utm_term=Houston%20Takes%20Center%20Stage%20as%20Major%20Crude%20Oil%20Trading%20Hub Venezuela crisis: Where families buy rotten meat to eat - BBC News Suddenly Toxic, Saudi Prince Is Shunned by Investors He Courted https://www.yahoo.com/finance/news/suddenly-toxic-saudi-prince-shunned-040001756.html He was the man who sold the world on his vision of a Saudi economy no longer dependent on oil. Now Crown Prince Mohammed bin Salman could become the biggest risk to his own project. Everything changed when Jamal Khashoggi walked into the Saudi consulate in Istanbul on Oct. 2 and didn’t come out. Allegations rapidly spread that the Washington-based journalist was murdered by a hit team sent from Riyadh. And suspicion naturally fell on the oil-rich kingdom’s de facto ruler, the 33-year-old heir to the throne. Prince Mohammed, who’s denied any knowledge of Khashoggi’s fate, still has his defenders -– notably Donald Trump. The U.S. president and his top diplomat have cautioned against putting America’s decades-old Saudi alliance at risk while they await the results of a Saudi investigation. But that’s in sharp contrast to a growing chorus of outrage, putting pressure on the White House to act. In Congress, lawmakers from Trump’s own party denounced the prince personally and demanded sanctions. And, crucially for Prince Mohammed’s economic plans, the global business leaders he courted are distancing themselves. The bosses of JPMorgan Chase & Co., Ford Motor Co. and Uber Technologies Inc. are among dozens of executives and policy makers scrapping plans to attend the prince’s business forum next week. ‘Official Complicity’ For a leader who’s staked his country’s future on a surge in foreign investment, that’s an ominous indicator. “What appears to be Saudi official complicity in Jamal’s disappearance, and perhaps death, sends all the wrong signals to the people and groups MBS needs to change Saudi Arabia in the direction he wants,’’ said Gregory Gause, a Saudi specialist at Texas A&M University. The investors the crown prince needs were already wavering. They were fine with showing up at lavish summits, at least until Khashoggi disappeared -– but the money wasn’t flowing. Foreign direct investment slumped more than 80 percent last year. In an interview this month, the crown prince said early data suggested a partial rebound in 2018. But to meet his 2020 targets, FDI needs to soar. Instead, even before the Khashoggi scandal, business leaders had seen enough in Prince Mohammed’s rule to unnerve them. At home, Saudi Arabia detained dozens of prominent local entrepreneurs as part of a supposed crackdown on graft. Abroad, it launched a boycott of Qatar, and got embroiled in disputes with Germany and Canada that threatened commercial deals with those countries. When his father King Salman ascended to the throne in 2015, Prince Mohammed began to leapfrog a generation of more experienced uncles and cousins, and eventually became heir to the throne. On the way he grabbed control over the key levers of the economy, including the central bank and oil giant Aramco, as well as the Defense Ministry. War in Yemen The crown prince set out to change a strict religious culture, and he delivered on some promises, allowing women to drive cars and loosening Saudi social life by permitting cinemas and concerts. Those measures won him fanfares in the West. Meanwhile, Prince Mohammed was abandoning a traditionally cautious foreign policy and seeking to assert Saudi power –- which led him to intervene in Yemen’s civil war. More than three years of Saudi bombing, directed against rebels said to be backed by Iran, has left thousands of civilians dead. On the economic front, the prince wanted to ditch a model based on state handouts of oil cash, and build a new private sector. A key driver was Saudi Arabia’s slowdown after the crude-price shock of 2014. The economy contracted 0.9 percent last year, and while the government expects growth of 2.1 percent in 2019, that’s still only about half the average pace between 2000 and 2014. Prince Mohammed worked hard to court U.S. executives who could potentially help meet his goals. During a visit earlier this year he met Amazon.com Inc. Chief Executive Officer Jeff Bezos and Microsoft Corp.’s Satya Nadella. But Prince Mohammed had to backtrack on some policies. His efforts to cut salaries and allowance met with signs of public opposition. ‘That Has Consequences’ And opposition to any of his initiatives hasn’t been tolerated, in a climate of fear. An economist who questioned the Aramco sale plan was arrested. So were women activists who’d campaigned for an end to the driving ban. So were dozens of people accused of collaboration with Qatar –- a charge also leveled at Khashoggi, before he disappeared. “Was it a planned, horrendous killing, or an operation that has gone badly wrong?’’ said James M. Dorsey, a Middle East scholar at Nanyang Technological University in Singapore. The Saudi response to the crisis has been “abysmal,’’ he said, as authorities responded first with blanket denials and then with “conspiracy theories.’’ “They have lost any high ground,’’ Dorsey said. “That has consequences for MBS.’’ --With assistance from Ziad Daoud (Economist). To contact the reporter on this story: Glen Carey in Riyadh at gcarey8@bloomberg.net To contact the editors responsible for this story: Alaa Shahine at asalha@bloomberg.net, Ben Holland, Bill Faries Exclusive: OPEC, allies struggle to fully deliver pledged oil output boost - internal document https://www.reuters.com/article/us-opec-oil-exclusive/exclusive-opec-allies-struggle-to-fully-deliver-pledged-oil-output-boost-internal-document-idUSKCN1MT1G0 OPEC is struggling to add barrels to the market after agreeing in June to increase output, an internal document seen by Reuters showed, as an increase in Saudi Arabia was offset by declines in Iran, Venezuela and Angola. The Organization of the Petroleum Exporting Countries and allies agreed in June to boost supply as U.S. President Donald Trump urged producers to offset losses caused by sanctions on Iran and to dampen rising prices. Saudi Energy Minister Khalid al-Falih said OPEC and non-OPEC would pump roughly an extra 1 million barrels per day (bpd) following the June agreement. The OPEC document seen by Reuters adds to signs they have yet to deliver the full amount. OPEC says it is on course to do so, although it hasn’t given a timeframe. “It is a work in progress,” OPEC Secretary General Mohammad Barkindo said earlier this week. The internal document prepared by OPEC’s Vienna headquarters for a technical panel meeting on Friday showed that OPEC members, excluding Nigeria, Libya and Congo pumped an extra 428,000 bpd in September compared to May. The OPEC and non-OPEC technical panel called the Joint Technical Committee reviews producers’ compliance with their oil supply pledges. Top exporter Saudi Arabia pumped most of the extra oil, raising output by 524,000 bpd in September compared to May, the document showed. Other increases came from Iraq, Kuwait and the United Arab Emirates. Iran, facing U.S. sanctions on its oil exports from Nov. 4, cut production by 376,000 bpd in September versus May, and has said OPEC and Saudi Arabia are not able to make up for a total loss of its exports. “There is no spare capacity,” Iran’s OPEC governor, Hossein Kazempour Ardebili, said last month. Among other OPEC members, production fell by 189,000 bpd in Venezuela and by 17,000 bpd in Angola. The non-OPEC nations cooperating with OPEC pumped an extra 296,000 bpd since May, the OPEC document showed. Russia increased output by 389,000 bpd, although Kazakhstan, Mexico and Malaysia posted declines. Trump calls Fed his 'biggest threat' Nigeria, Libya and Congo are not included in OPEC’s supply-limiting pact. Including them brings the increase in OPEC’s output in September to 628,000 bpd. Editing by David Evans Ghana Launches First Ever Competitive Bid Round https://www.petroleumafrica.com/ghana-launches-first-ever-competitive-bid-round/ Ghana launched a licensing round on October 15. This is the first open and competitive bidding round that the country has held, previously choosing to hold direct negotiations with oil and gas firms for acreage. Ghana is offering up three blocks in its offshore Central Basin. According to reports, the licensing round has already attracted interest from major E&P firms, which have been conspicuously absent in Ghana’s burgeoning oil and gas sector to date. Initial indications from sources in the Ministry of Energy suggest that BP, ExxonMobil, Total, Chevron Texaco, Rosneft, Sinopec and CNOCC will all be participating in the bidding. The tender process is specifically focused on expediting exploration activity in the Central Basin. Ghana is calling on firms with the financial capacity and technical competence, coupled with the timescale for work program activity. Fiscal terms, including royalty payments to the government and Ghana National Petroleum Corporation (GNPC) equity is also an important issue in the tender process, as well as the equity and skills transfer to local partners under the local content aspect. Don't mention the oil price - U.S. legal threat prompts change at OPEC Akos Stiller \| Bloomberg \| Getty Images Khalid Al-Falih, Saudi Arabia's energy and industry minister, arrives for the 171st Organization of Petroleum Exporting Countries (OPEC) meeting in Vienna, Austria, on Wednesday, Nov. 30, 2016. https://www.reuters.com/article/us-oil-opec-usa-exclusive/exclusive-dont-mention-the-oil-price-u-s-legal-threat-prompts-change-at-opec-idUSKCN1MR0T0 OPEC has urged its members not to mention oil prices when discussing policy in a break from the past, as the oil producing group seeks to avoid the risk of U.S. legal action for manipulating the market, sources close to OPEC said. Proposed U.S. legislation known as “NOPEC”, which could open the group up to anti-trust lawsuits, has long lain dormant, with previous American presidents signaling that they would veto any move to make it law. But U.S. President Donald Trump has been a vocal critic of the Organisation of the Petroleum Exporting Countries, blaming it for high oil prices and urging it to increase output to relieve pressure on a market hovering around four-year highs. That has made OPEC and its unofficial leader, Saudi Arabia, nervous about what it might mean for NOPEC, or No Oil Producing and Exporting Cartels Act. The decision to refrain from discussing a preferred oil price level — one way the group can guide market expectations — underlines how Trump’s aggressive stance on the oil market is unsettling OPEC and testing ties between allies Riyadh and Washington. In July, senior OPEC officials attended a workshop in Vienna with international law firm White & Case to discuss the NOPEC bill, and the lawyers advised avoiding public discussion of oil prices and rather talk about the stability of the oil market, two sources familiar with the matter said. OPEC officials were also advised to explore diplomatic lobbying channels to try and prevent the NOPEC bill from becoming law, one of the sources said. On Aug. 1, the OPEC secretariat sent a letter to the ministers making a similar recommendation. “We solemnly believe that market stability, and not prices, is the common objective of our actions,” UAE Energy Minister Suhail al-Mazroui, who holds the rotating OPEC presidency this year, wrote in the letter, seen by Reuters. “I would like to call upon OPEC Member Countries, as well as our participating Non-OPEC colleagues, to refrain from any reference to prices in their commentary about our collective efforts or oil market condition,” he added. White & Case did not respond to a Reuters request for comment. Specifying oil prices is not the only way OPEC tries to guide the market. By cutting production it can support prices and by raising supplies it can do the opposite, for example. But the private coordination of how to communicate OPEC’s message to the market represents a departure from past practice, when Saudi Arabia would often signal a preferred price level when speaking about OPEC policy and seek to push through actions to achieve that. TIES STRAINED While chances of the law passing this year appear slim, concerns among OPEC members and other oil producers are growing that it may ultimately get the support of Trump, given his open criticism of OPEC and high oil prices. The OPEC letter came two months before U.S.-Saudi relations were further strained when a Saudi journalist disappeared during a visit to the kingdom’s consulate in Istanbul. Turkish officials say they believe Jamal Khashoggi, a critic of Saudi policies, was murdered and his body removed. Saudi Arabia has strongly denied killing Khashoggi. Some members of the U.S. Congress, which has long had a testy relationship with Saudi Arabia, have criticized the kingdom over the case. A Senate source familiar with the bill said renewed interest in NOPEC was likely, as lawmakers weigh any actions in response to Khashoggi’s disappearance. The source, who declined to be named, said that with lawmakers out of town for the next several weeks, it was difficult to measure current sentiment. LITIGATION RISKS MAY BE BEHIND IPO DELAY Over much of the last year, Saudi Arabia irked Washington by pushing OPEC to adopt measures to boost oil prices in a shift from its previous, more moderate stance. Industry sources have linked that shift to a desire to maximize revenues and raise the valuation of state energy giant Saudi Aramco ahead of a planned IPO, a key part of Crown Prince Mohammed bin Salman’s reforms aimed at diversifying the economy. The share float, expected by some to be worth up to $100 billion, has been put on hold, sources have told Reuters. Prince Mohammed said this month the float was postponed to 2021, and several industry sources say the delay was partly because of litigation risks if Aramco was listed in New York, a preferred venue by the Saudi crown prince. “There is a major fear NOPEC could turn into another JASTA,” one of the sources familiar with Aramco IPO preparations said, referring to the Justice Against Sponsors of Terrorism Act which allows victims of the Sept. 11, 2001, attacks to sue Riyadh. Saudi Arabia, which denies involvement in the attacks, had long had broad immunity from the lawsuits. That changed in 2016, when the U.S. Congress overrode then-President Barack Obama’s veto of JASTA. With close to $1 trillion in investments in the United States, including assets owned by Aramco, Riyadh has a lot to lose if the NOPEC bill was passed into law. It would revoke the sovereign immunity which oil producers, including OPEC members, currently enjoy from U.S. legal action. Washington-based legal firm Gibson Dunn and the Saudi embassy there signed a contract in late August, according to a copy of the contract filed to the U.S. Department of Justice. The contract outlines that among its other responsibilities, Gibson Dunn would be “opposing NOPEC”. Saudi Energy Minister Khalid al-Falih has also raised concerns over NOPEC with senior U.S. officials including U.S. Energy Secretary Rick Perry during private meetings, two sources familiar with the talks told Reuters, on condition of anonymity. Additional reporting by Jarrett Renshaw in New York and Yara Bayoumy in Washington; Editing by Mike Collett-White U.S. secretary of state meets Saudi prince to discuss missing journalist... Iranian Tanker Discharges Oil into Storage in China Ahead of U.S. Sanctions A vessel carrying 2 million barrels of Iranian oil discharged the crude into a bonded storage tank at the port of Dalian in northeast China on Monday, according to Refinitiv Eikon data and a shipping agent with knowledge of the matter. Iran, the third-largest producer in the Organization of Petroleum Exporting Countries (OPEC), is finding fewer takers for its crude ahead of U.S. sanctions on its oil exports that will go into effect on Nov. 4. The country previously held oil in storage at Dalian during the last round of sanctions in 2014 that was later sold to buyers in South Korea and India. The very large crude carrier Dune, operated by National Iranian Tanker Co, offloaded oil into a bonded storage site at the Xingang section of the port, according to a shipping source based in Dalian, adding this was the first Iranian oil to discharge into bonded storage in nearly four years. The tanker left the Iranian oil port at Kharg Island on Sept. 12, according to ship-tracking data. The Xingang area is home to several tank farms including commercial and strategic reserves. China National Petroleum Corp (CNPC) [CNPC.UL] and Dalian Port PDA Co Ltd (601880.SS) both operate commercial storage in the area, according to information on their company websites. An investor relations official at Dalian Port declined to comment.A manager at the bonded crude storage site operated by Dalian Port declined to comment whether Iranian oil were moved to the tanks, calling it the “worst time” to give any comment regarding Iranian crude because of the U.S. sanctions. A person at the CNPC-owned storage site who refused to identify himself when contacted by Reuters said it is “impossible” that the oil is stored there. A spokesman for CNPC said he had no information on this matter. An executive with the China office of National Iranian Oil Co (NIOC) declined to comment. NIOC also did not respond to an email request seeking comment if it is storing oil at Dalian. The shipping source said there is no buyer earmarked for the cargo. Three other NITC tankers are set to arrive in Dalian in the next week or two, the ship-tracking data shows. Some of those cargoes are also likely to end up in bonded storage as the refineries in the region, controlled by CNPC, are not equipped to process Iranian oil, said three sources at state-run Chinese refiners. China’s Iranian oil buyers, including state-owned refiner Sinopec (0386.HK) and state trader Zhuhai Zhenrong Corp, have shifted their cargoes to vessels owned by NITC since July to keep supplies flowing as the U.S. sanctions have been re-imposed. Keeping oil in bonded storage gives the shipment owner the option to sell into China or to other buyers in the region. In early 2014, NIOC leased bonded tanks in Dalian and oil from there was shipped to South Korea and India, Reuters reported. https://www.tankterminals.com/news_detail.php?id=5530&utm_medium=email&utm_campaign=Subscribers%20-%20Week%2042&utm_content=Subscribers%20-%20Week%2042+CID_fc29d3ccce162c48f4188b58e8d2ec8a&utm_source=weekly&utm_term=Iranian%20Tanker%20Discharges%20Oil%20into%20Storagein%20China%20Ahead%20of%20US%20Sanctions Saudi threatens to retaliate against any sanctions over Khashoggi disappearance https://www.yahoo.com/news/saudi-threatens-retaliate-against-sanctions-over-khashoggi-disappearance-122305456.html By Andrew Torchia DUBAI (Reuters) - Saudi Arabia on Sunday warned against threats to punish it over the disappearance of journalist Jamal Khashoggi last week, saying it would retaliate against any sanctions with tougher measures, as international criticism increased. Khashoggi, a U.S. resident and Washington Post columnist critical of Saudi Arabia, disappeared on Oct. 2 after entering the Saudi consulate in Istanbul. Turkey's government believes he was murdered inside the building and his body removed. Saudi Arabia has denied that. U.S. President Donald Trump has threatened "severe punishment" if it turned out Khashoggi was killed in the consulate, though he said Washington would be "punishing" itself if it halted military sales to Riyadh, a key ally. "The Kingdom affirms its total rejection of any threats and attempts to undermine it, whether by threatening to impose economic sanctions, using political pressures, or repeating false accusations..." the official Saudi Press Agency (SPA)quoted an unnamed government source as saying. "The Kingdom also affirms that if it receives any action, it will respond with greater action, and that the Kingdom's economy has an influential and vital role in the global economy," the source added, without elaborating. Britain, France and Germany told Saudi Arabia they were treating the case with "the utmost seriousness". "There needs to be a credible investigation to establish the truth about what happened, and - if relevant - to identify those bearing responsibility for the disappearance of Jamal Khashoggi, and ensure that they are held to account," the foreign ministers from the three countries said in a joint statement. "We encourage joint Saudi-Turkish efforts in that regard, and expect the Saudi Government to provide a complete and detailed response. We have conveyed this message directly to the Saudi authorities." The statement, by British foreign minister Jeremy Hunt, France's Jean-Yves Le Drian and Germany's Heiko Maas, made no mention of potential actions the countries might take. The Saudi stock market lost $33 billion of its value on Sunday amid investor worries about deteriorating international relations, one of the first signs of the economic pain that Riyadh could suffer over the affair. In a column published just after the SPA statement, Saudi-owned Al Arabiya channel's General Manager Turki Aldakhil warned that imposing sanctions on the world's largest oil exporter could spark global economic disaster. "It would lead to Saudi Arabia's failure to commit to producing 7.5 million barrels. If the price of oil reaching $80 angered President Trump, no one should rule out the price jumping to $100, or $200, or even double that figure," he wrote. U.S. senators have triggered a provision of the Global Magnitsky Human Rights Accountability Act requiring the president to determine whether a foreign person is responsible for a gross human rights violation. The act has in the past imposed visa bans and asset freezes on Russian officials. Anti-Saudi sentiment in the U.S. Congress could conceivably raise pressure to pass the so-called No Oil Producing and Exporting Cartels Act, which would end sovereign immunity shielding OPEC members from U.S. legal action. A senior member of Saudi Arabia's ruling family, Prince Khaled al-Faisal, has met Turkey's President Tayyip Erdogan to discuss Khashoggi's disappearance, two sources with knowledge of the matter told Reuters without providing details of the talks. On Friday, a source with links to the prince's family said Prince Khaled, the governor of Mecca, had been sent to Turkey in his capacity as special adviser to King Salman. A Turkish official told Reuters on Sunday that the Saudis had said they would allow the consulate to be searched, and that this would happen by the end of the weekend, though he had conceded to "flexibility on this date." "But Turkey is determined on the subject of entering the consulate and carrying out a criminal inspection. There is no alternative to carrying out this inspection. Time is important in terms of evidence," the official said. (Reporting by Aziz El Yaakoubi and Asma Alsharif; writing by Stephen Kalin; editing by Jason Neely/Robin Pomeroy) Zero August US crude exports to China http://www.tankeroperator.com/ViewNews.aspx?NewsID=10148 This was a significant change to the export pattern seen since early 2017. Chinese buyers, led by the world’s top tanker charterer, Unipec, were rumoured to have stayed away – and new data proves it, the organisation said. Current rumours suggest that Chinese buyers returned early this month but to what extent will be clearer later. Despite being left out of the ‘official’ trade war at the last minute, crude oil was removed from the Chinese $16 bill list before it came into force on 23rd August, 2018, crude exports are now taking centre stage. BIMCO’s Chief Shipping Analyst, Peter Sand, explained: ”The tanker shipping industry is hurt when distant US crude oil export destinations like China, are swapped for much shorter hauls into the Caribbean and South, North and Central America. “The trade war is all around us now. What appeared on the horizon half a year ago is now impacting many seaborne trading lanes. All commodities may be impacted regardless of them being officially tariffed or not. What we see in terms of crude oil transport, is harmful to the global shipping industry as well as cumbersome to the exporters and importers of the product,” he warned. In 2017, Chinese imports accounted to 23% of total US crude oil exports. This year, they fell slightly to 22% during the first seven months. In August the share dropped to zero. In September, total US crude oil exports, excluding to china, hit a new record at 6.96 mill tonnes. Exports to Asia jumped in June and July, from a 43% share of total exports since the start of 2017 to reach a 56% share. In August, that share fell back to 46%. The two other major importing regions are Europe (26%) and North and Central America (18%), while South America (5%), Caribbean (2%) and others (4%) make up the rest. (August share of exports in brackets). Sand added: “For the crude oil tanker shipping industry distances often matter more than volumes. Even though volumes were a record high, tonne/mile demand dropped by 19% from July to August, due to the shift in trade patterns. “Exports to Asia are by far the most important. When measuring the tanker demand in tonne/miles, exports of US crude oil to Asia generated 70% of tonne/mile demand on that trade in August– down from 78% in June and 75% in July,” he concluded. Here’s How Much Gas Prices Will Drop Thanks to Trump’s Ethanol Plan https://www.yahoo.com/finance/news/much-gas-prices-drop-thanks-185238894.html President Donald Trump is proposing removing restrictions on the sale of gas with 15 percent ethanol. Ethanol is made from corn, so farmers support the move, but there are concerns about air pollution. The price at the pump might only go down a few cents if the restrictions are removed. President Donald Trump wants to allow sales of gasoline with 15 percent ethanol, known as E15, year-round. Current law prohibits the sale of E15 during the summer — gas in the summer must contain no more than 10 percent ethanol — because the higher ethanol gas can produce more smog in warmer weather. Farmers are lauding Trump’s plan because it would increase the demand for corn, a welcome change since prices have dropped due to Trump’s trade tariffs. An expected potential increase in ethanol demand from China has been stalled by China’s retaliatory tariffs on U.S. goods. Although the percentage change could reduce the cost of a gallon of gas at the pump, the price difference is likely to be minimal. Click to find out which states are actually being hit hardest by Trump’s tariffs. Why Higher Ethanol Gasoline Won’t Dramatically Lower Prices Sal Gilbertie, president and chief investment officer at Teucrium Trading LLC, said in an interview with MarketWatch that “a gallon of ethanol is about 70 cents cheaper than a gallon of gasoline, which means adding 5 percent more ethanol will reduce the price of a gallon of gasoline by about 3 ½ cents.” If demand for ethanol increases, the price could go up, negating the price advantage altogether. GasBuddy reports that the average price for a gallon of regular unleaded gas in the U.S. was $2.904 on Tuesday, Oct. 9. Last year, the average was $2.472. Related: New Trump Tariffs Mean Pretty Much Everything Could Cost More E15 Fuel Won’t Necessarily Help With High Summer Gas Prices Ethanol isn’t the only factor in the changing price of gas from summer to winter. There is a higher demand for gas in the summer, but that’s just one factor. Summer-blend fuel is more expensive to make because the process takes longer and yields less per barrel of oil. These costs can tack on an estimated 3 to 15 cents per gallon, according to NACS, a convenience store and fuel retail advocacy group. Read: The Costly Effects the Weather Has on Your Car Potential Benefits of Using E15 Year-Round According to the Iowa Renewable Fuels Association, E10 represents 97 percent of the gasoline sold in the U.S. The association said that E15 is “an environmentally friendly fuel that burns cleaner than gasoline,” and that raising the blend from E10 to E15 would “accelerate the use of renewable fuel, increase energy security, create U.S. jobs, reduce transportation costs, and improve the environment by displacing conventional gasoline with low-carbon ethanol.” Posted by Crude Oil Daily at 12:45 PM 1 comment: Links to this post OPEC oil output rises to highest since 2016 despit... After the Khashoggi Murder, Pakistan Shakes Down W... Who is the Saudi Prince Mohammed bin Salman? - BBC... In change of tack, Saudi Arabia says Khashoggi's m... �� Khashoggi killing: Erdogan calls for extradit... Houston Takes Center Stage as Major Crude Oil Trad... Venezuela crisis: Where families buy rotten meat t... Suddenly Toxic, Saudi Prince Is Shunned by Investo... Exclusive: OPEC, allies struggle to fully deliver ... Don't mention the oil price - U.S. legal threat pr... U.S. secretary of state meets Saudi prince to disc... Iranian Tanker Discharges Oil into Storage in Chin... Saudi threatens to retaliate against any sanctions... Here’s How Much Gas Prices Will Drop Thanks to Tru... Subsea 7 Wins EPCI Offshore Ghana IEA urges OPEC to open the taps as oil market ente... At Least One Major Country Won't Be Playing Ball W... Tehran says Saudi Arabia unable to replace lost Ir... Ken Langone, Home Depot co-founder, on why capital... Putin is asked: Is it time for President Maduro of... Saltpond Being Decommissioned / Ghana U.S. crude oil shipments to China 'totally stopped... Bill allowing U.S. to sue OPEC drawing renewed int... China LNG Tariff Casts Shadow Over New U.S. Export...	cc/2020-05/en_middle_0126.json.gz/line537
__label__cc	0.623191	0.376809	About CTI-Ship People & Expert Quality Attainment Client & Project list New Building Ships Fleet in Service Green Ship Recycling Certificate Query Sys Asbestos Risk Management Asbestos Survey For Flag State Compliance Asbestos Removal Project Management Asbestos Survey For IMO Compliance IHM Services IHM For Existing IHM For Newbuilding Responsible Ship Recycling Supervision Lab Analysis Of Asbestos Bulk Materials Airborne Asbestos Sampling and Testing Hazardous Materials Testing for EUSRR & HKC Sampling, Inspection And Verification Of Asbestos Free Refractory Ceramic Fibre Survey And Lab Testing CTI POLYNDT PTE Ltd NDT (Non Destructve Testing ) UTM (Ultrasonic Thickness Measurement) CTI Training Center Asbestos-Course IHM-Course IHM online maintenance VIMS software Copyright © CTI-SHIP. All rights reserved Ebola virus and the marine industry WHAT ARE THE RISKS OF CONTRACTING THE EBOLA VIRUS DISEASE FOR SHIPS’ CREWS AND PASSENGERS ON CRUISE SHIPS AND FERRIES. Ebola emerged in 1976 in 2 simultaneous outbreaks, in Nzara, Sudan, and the Democratic Republic of Congo. The present outbreak has struck Guinea, Liberia and Sierra Leone. There is no cure and treatment largely consists of mitigating the symptoms. The mortality rate is between 50 and 60%, but can be much higher if proper care is not available. The disease enters the human population through close contact with the blood, secretions, organs or other bodily fluids of infected animals. In Africa, infection has been documented through the handling of infected primates (chimpanzees, gorillas, monkeys), fruit bats, forest antelope and porcupines found ill or dead, and the consumption of “bush-meat”. It then spreads in the community through human-to-human transmission, with infection resulting from direct contact, through broken skin or mucous membranes, with the blood, secretions, organs or other bodily fluids of infected people, and indirect contact with environments contaminated with such fluids. Burial ceremonies in which mourners have direct contact with the body of the deceased person can also play a role in the transmission of Ebola. Men who have recovered from the disease can still transmit the virus through their semen for up to seven weeks after recovery from illness. The three major shipping organisations (ICS, IMEC, and ITWF) have issued the following advice for all vessels calling at the ports of affected countries or boarding crew who have recently travelled from or through affected countries (currently Liberia, Sierra Leone, Guinea and Nigeria) · The Master should ensure that the crew (and passengers) are made aware of the risks, how the virus can be spread and how to reduce the risk of transmission. ----------The ISPS requirements on ensuring that unauthorised personnel do not board the vessel should be strictly enforced throughout the duration of the vessel being in port. ----------The Master should give careful consideration to granting any shore leave whilst in the ports of affected countries. ----------The shipowner/operator should avoid making crew changes in the ports of an affected country. ----------The crew should be made aware of the symptoms and report any occurring symptoms immediately to the person in charge of medical care or their supervisor. ----------The advice is supplemented with information from the World Health Organization on EVD. See the following link:http://www.who.int/mediacentre/factsheets/fs103/en In addition, CTI Marine Services Division, suggest that: ----------Proper hand washing is practiced by all persons on board before eating or drinking, after going to the toilet, etc. ----------Avoid touching eyes, nose, ears, and mouth especially whilst travelling or visiting public places. ----------Maintain a personal distance of at least 1m between yourself and any person showing symptoms of illness. ----------Stay away from your workplace, public areas, hospitals, etc when you are experiencing any symptoms of illness. Report immediately any symptoms of illness such as sore throat, fever, aching muscles, weakness, vomiting or diarrhoea to your nearest medical facility or supervisor. ----------Practice safe sex at all times. Do not share needles with other people. CTI Marine Services Public Health Consultant commissioned to conduct Desktop Risk Assessment for gold mine project in West African country In light of the emerging EVD outbreak in neighbouring West African countries, one of CTI Marine Services’ Public Health Consultants was contacted to carry out a rapid desktop study and risk assessment for a gold mine development project. Although the mine is situated in a country not affected by EVD, the mining company felt that under its duty of care responsibilities to mine employees, contractors, local workers and the neighbouring community, it should make an assessment of the risks present for EVD transmission and development of an outbreak at the mine. As a result of the study, procedures and standards were developed for prevention of exposure and transmission of EVD as well as infection control at the mine site and for any persons visiting the mine. Subsequently, our Consultant has been retained to conduct an audit at the site to ensure that the proposed measures, procedures and standards have been implemented. CTI Marine Services personnel are available to advise, audit and issue certificates of compliance for a wide variety of public health risks related to illnesses arising from exposure to asbestos, Influenza A virus, Legionella bacteria, Norovirus, contaminated drinking water, etc in marine and land based situations. For further information, please contact: john.chillingworth@cti-cert.com Other CTI Group member website: www.cti-cert.com www.polyndt.com.sg www.cti-cert.org http://www.cem-international.co.uk http://www.cti-cmcs.com http://www.reach24h.com Client & Project Newbuilding Fleet-service Ship-recyling Office-building CTI-Marine www.cem-international.co.uk www.ukas.com www.amsa.gov.au Subscribe to our mailing list to get the updates to your email inbox	cc/2020-05/en_middle_0126.json.gz/line539
__label__wiki	0.693396	0.693396	Last issue's most-read story: TRAGEDY: A DEAF RESCUE DOG IS KILLED IN MISSOURI / Examiner.com DEAF BOY STRUCK BY CAB IN FRONT OF TERRIFIED PARENTS IN BROOKLYN A deaf 5-year-old boy was fighting for his life after he was mowed down by a cab in Brooklyn — as his horrified parents, who also can’t hear, looked on. Timothy Keith’s mother and father were inconsolable after their first family trip to the city turned to heartbreak Saturday. With tears streaming down her face, Timothy’s mother described what happened in a wrenching written interview. “I was with my son. The(n) he walk to road. I say NO to him,” wrote Eva Keith, 29, of Washington, D.C. “I saw taxi yellow so fast. Driver hit my son but my son can’t hear.” / NY Daily News See Also DEAF BOY MOWED DOWN BY BROOKLYN CAB IS BRAIN DEAD, POLICE SOURCES SAY / NY Daily News 95 YEARS IN BEATING DEATH OF DEAF MAN A convicted killer who used a baseball bat to bludgeon a deaf man from behind received a 95-year prison sentence in Allen Superior Court Monday. Manuel Silva, previously found guilty by a jury of killing 39-year-old Christopher Deaton last summer, sat shackled in a chair as family members of his victim called him a coward and told him that no matter what punishment befell him, it'd never make up for what he took away. Afterward, Judge John Surbeck sentenced Silva to the maximum for murder - 65 years - and tacked on another 30 years for Silva's past. / The Journal Gazette DRAMATIC PLANE CRASH TRIAL ENDS ABRUPTLY WITH SETTLEMENTS The legal saga of Alec Naiman, Jeffrey Willoughby and Jessica Willoughby vs. Cessna Aircraft Company ended abruptly last week, after the three 2005 plane crash victims accepted settlement offers. The nearly month-long Edgartown trial concluded Wednesday when Mr. Naiman, the pilot who suffered crippling injuries in the crash at Katama airfield, agreed to a confidential settlement. The Willoughbys -- who were passengers in the plane -- dropped out of the case after they agreed to a $1.7 million settlement offer from Cessna. / Vineyard Gazette WENDY'S FRANCHISE SUED BY EEOC FOR DISABILITY DISCRIMINATION The U.S. Equal Employment Opportunity Commission announced Tuesday that it has filed suit against CTW L.L.C., a Wendy’s franchisee, for denying employment to a hearing-impaired applicant because of his disability in violation federal law. The EEOC charges in its suit that the general manager of a Killeen, Texas Wendy’s refused to hire Michael Harrison, Jr. for a cooker position, despite his qualifications and experience, upon learning that Harrison is hearing-impaired. / EEOC 911 BOARD LAUNCHES TRIAL TEXTING PROGRAM The Vermont Enhanced 911 Board has launched the first statewide pilot program that will allow hearing impaired Vermonters to access emergency services by texting on their cell phones. The trial project will run for the next 6 months and will be available only to Verizon wireless customers. Keri Darling, the director of a group known as Deaf Vermont Advocacy Services, said the new service is a critical step forward for the state's hearing-impaired community. / Vermont Public Radio JUDGE TO DECIDE DISPUTE OVER ARTWORK BY JAMES CASTLE FOUND IN HOME IN BOISE A judge will decide who owns three bundles of artwork by James Castle found tucked away in the famed artist's home and potentially worth thousands of dollars. Artwork by Castle, who lived in a northwest Boise home until he died in 1977, is collected worldwide. Individual pieces have sold for as much as $50,000. Castle was born deaf and mute. The self-taught artist's drawings were made with a sharpened stick dipped in soot and saliva. Some are in collections at the Philadelphia Museum of Art and the Museum of Modern Art in New York. / The Associated Press INSTITUTE FOR DEAF CHILDREN TO CLOSE KC CAMPUS Blaming a lack of enrollment and funding, the Saint Joseph Institute for the Deaf will close its Kansas City Metro Campus in Lenexa this summer. Leaders of the Institute say it has unique services and it was distressing to make the decision to close the campus. / WDAF POLICY TO REQUIRE SIGNING FLUENCY In the 141-year history of the West Virginia School for the Deaf and Blind, there has never been a policy outlining employee sign language requirements. "There is no (sign language) standard at this point that anyone needs to have for any position on campus," said Dr. Lynn Boyer, superintendent of the school. An aggressive new communications policy aims to change that: Starting in July, every employee at the school will be required to attain a certain degree of fluency in sign language or Braille comprehension. / Charleston Daily Mail DEAF, NEARLY BLIND TEEN VISITS WHITE HOUSE Most kids celebrate Easter with egg hunts in their backyard, but only a select few can say they found theirs at the White House. Even fewer can say they participated without the ability to see or hear. Ashley Riva, a 17-year-old student at Perkins School for the Blind in Watertown, and three of her classmates participated in the 134th annual White House Easter Egg Roll on Monday, where they used spoons to carry their beeping eggs in a race against thousands of other participants. / The MetroWest Daily News LETTER: DEAF SCHOOL SEARCH GOT CIRCUMVENTED The Iowa Board of Regents’ appointment of Patrick Clancy as superintendent of the Iowa School for the Deaf was made with very little discussion, no consultation with the deaf community or with deaf education specialists. A search for the most qualified person was circumvented to appoint someone who admits that he has no background in deaf education, his American Sign Language skills are lacking, but he feels it is “less ideal” and “we’ll manage.” / Des Moines Register Need text relay on the go? No problem! Place your calls using Sprint Mobile IP Relay! Go to Google Play, download the Sprint Mobile IP Relay app and start making your calls today! Just download, register and dial! For more information, visit http://www.sprintrelay.com/sprint_relay_services/mobileip.php UK Feature: If you’re living in the United Kingdom and think you're suffering from hearing loss, or just want a new hearing aid, visit Amplifon - for Hearing Aids and more. DEAF AND DUMB GIRL KILLED FOR HONOUR When Sharif told his 20-year-old daughter Rehana that he was taking her to her aunt's home a few miles away, in last July, the deaf and dumb girl had no idea that it was going to be her last journey and that her father would turn her killer. The police investigation revealed that Rehana, who was deaf and dumb since birth, was pregnant. Her parents had approached doctors for `medical termination of pregnancy' but they refused as it was too late and abortion would have been risky. Sharif and his son Sahil then hatched a conspiracy to kill Rehana. / Deccan Herald Ikeja, Lagos, Nigeria COURT REMANDS DEAF AND DUMB OVER HOMOSEXUALISM The Magistrate Court Osogbo, Osun State, has ordered that, one Akinyemi Ojo, 35, a deaf and dumb be remanded in Ilesa Prison for alleged involvement in homosexualism. Ojo was accused of practicing homosexualism with a 12-year-old boy after he had kept him for three days in his room. The prosecutor told the court that the accused had carnal knowledge of the victim by putting his manhood into him, knowing that he is a male. / The Sun JOHNNY DEPP SLAMMED FOR SIGN LANGUAGE MISTAKE IN PAUL MCCARTNEY'S NEW VIDEO Well, this is embarrassing, isn’t it? You try and do something a bit different and special and then Johnny Depp goes and messes it up for you. In the promo for McCartney’s new single, My Valentine, Johnny, along with Natalie Portman are seen making a number of mistakes while trying to sign. First up Nat signs the word tampon rather than appear (oh bloody hell, it couldn’t have been another word could it?) and then Johnny signs enemy while trying to sign valentine (yeah that’s pretty major considering the song is called My Valentine). / Mr Paparazzi PIONEERING COMMUNICATIONS SYSTEM WILL END ISOLATION FOR THE DEAF A groundbreaking communications system is being launched to make life easier for people who are profoundly deaf or have hearing loss. From next month, local charity Deafness Support Network will be offering online interpreters to Cheshire’s 90,000 residents. Deaf people will be able to order pizzas, book holidays, make appointments and talk to friends as conveniently as hearing people. / Runcorn and Widnes World DEAF CHILDREN FIND THEIR VOICES The special (sold-out) evening began with a concert in the elegant new Bourgie Concert Hall of the Montreal Museum of Fine Arts, where 455 well-turnedout supporters took their seats for a concert that won't soon be forgotten. Aptly named Voices: From Silence to Song, the musical program underscored the fact, time and again, that children with hearing loss can appreciate sound and find their own voices with the right specialized support. / Montreal Gazette DEAF RAPPER FEELS THE MUSIC AND SINGS BY SIGNING Here’s something you never hear: “He’s a deaf rapper.” That’s how Marko Vuoriheimo (a.k.a Signmark) is often introduced, not that he can hear the description. Most of us associate music with our earsm but not long after he was born deaf in 1978, Signmark recalls feeling music. Growing up in Helsinki, he “translated” Christmas carols into sign language so that the entire family (his parents are deaf, his grandparents are not) could perform together — a bilingual affair uniting singing with signing. Somewhat improbably, Signmark then discovered hip hop. / Toronto Star FARMERS GOING DEAF The National Centre for Farmer Health is worried about the number of farmers reporting hearing loss. The Centre is conducting noise audits on farms in western Victoria to help people manage noise levels on their properties. Centre director Susan Brumby says shearing and milking sheds, as well as motorbikes and machinery, all contribute to the problem. "There's reports and published articles saying that it's up to 60 per cent (of farmers reporting hearing loss)," she said. / ABC Rural DEAF PERTH COUPLE BURGLED An elderly deaf woman had her handbag stolen from her home while gardening in her backyard with her husband. Police spokeswoman Ros Weatherall said a man broke into the Cooloongup home of an elderly deaf couple while the pair were in their backyard gardening on Sunday about 3pm. An 84 year-old man and his wife were still at the back of their property on Grange Drive when the burglar fled the front of the house with what appeared to be a handbag. / The Sydney Morning Herald DEAF MP LEADS CALL FOR DVD SUBTITLES Members of the deaf community say they feel excluded by most locally made DVDs, which have no English subtitles. Deaf MP Mojo Mathers says most DVD productions do not include subtitles, and ONE News has discovered there is no requirement for them to do so. "I feel really excluded and lots of hard of hearing people in New Zealand feel the same," Mathers said. / TVNZ DEAF BURGLAR ARRESTED AFTER STEALING FROM OVER 30 HOUSES A press conference was held on Friday evening to publicize the success in closing the case of multiple burglaries. The offender was a deaf man, Mr. Weerasak Reuan-a-raam, aged 32, from Nong-pla-lai, Banglamung. The fellow was caught with 16 different stolen items, including electric appliances, Buddha images, music equipment and bicycles. / Pattaya People FINANCIAL PRESSURE JEOPARDIZES EDUCATION FOR DEAF CHILDREN IN ROMANIA Vlad Mateoiu, 12, is a student at the Special School for Deaf Children No. 1 in Bucharest, Romania’s capital. His family lives in Dambovita, another county in Romania, so he stays at the boarding facility connected to the school. But shaky state finances now threaten Vlad’s education. The accommodation center for children who are deaf and hearing impaired, many who come from other counties, will close early this semester and for good if a new staff isn’t hired. / Global Press Institute Experience the superior quality of Sorenson Communications ntouch ® VP, ntouch® PC and ntouch® Mobile - products designed specifically for deaf communication, with input from deaf consumers. With technology optimized for American Sign Language, Sorenson provides unmatched video clarity, making communication easy and the ntouch VP attaches to nearly any size screen. As always, ntouch products are provided at no cost, and experienced Sorenson Trainers make installation and training worry free. More deaf callers use Sorenson Communications than any other provider, and for good reason. Sorenson offers quality, service, reliability and innovative products. To get ntouch products, visit www.svrs.com/ntouch or call 801-386-8500 today and experience the power of your world in touch! Summer vacation! Passport, airplane ticket, toothbrush... What's next? Set up your Convo Phone Number so you can make VRS calls outside of USA. IMPORTANT… contact us before traveling: -- 510-629-5622 (Any VP) -- ConvoHELP (AIM/iChat) -- passport@convorelay.com CHURCH FOR STATEN ISLAND'S DEAF COMMUNITY Hands for Christ Community Church, a church for the deaf community, is slated to begin services in the fall, operating out of The Church That Never Closes in Prince’s Bay. The Rev. Mary Bacheller will serve as pastor of the church, which will minister to some 400 deaf congregants on Staten Island. It is part of the Grace Communion International Church. / SILive.com SIGNS OF A SEXUAL NATURE: DO DEAF PEOPLE WEAR HEARING AIDS IN BED? Our new strand aims to highlight what can be a taboo subject where deaf people are concerned: love and sex. And here’s our first revelation: deaf people have sex. Yep. Amazing isn’t it? So with his first question and revelations resulting from his subsequent, incredibly unscientific research, here’s the debut column from our brand-new expert, Deaf Sex Guru (alas, not his real name). Question one: is ‘bedroom activity’ any different when you’re wearing hearing aids? / The Limping Chicken DEAF CSUNIANS HOST MR. DEAF PAGEANT The Deaf CSUNians organization hosted its 20th Mr. Deaf biannual pageant show Friday, April 13. Aileen Rolon, an academic advisor to the deaf CSUNians organization and National Center of Deafness department said the contestant scores are based on their talent, platform presentation, evening wear, and on-stage interview. “The winner will be expected to perform their talent at the Miss Deaf CSUN pageant next year,” Rolon said. / Daily Sundial See Also MR. CSUN DEAF PAGEANT 2012 (Slide Show) / Daily Sundial ON COMMUNICATING THAT YOU'RE DEAF AT WORK This post on Consumerist.com got me thinking and I'd be interested to hear your opinion. In the post, a man reported about his visit to Target. In the checkout line, his cashier had a sign which read "Cashier is Hearing Impaired." He was worried it was embarassing for the cashier and calling attention to something that might not be a big deal. In my line of work, I work with the public a lot, although it's not retail. Usually at least 60% of my day is spent answering questions from people. This got me wondering if I would want such a sign at the computer I work from. / Hearing Sparks STUDENTS AT MADONNA LEARN SIGN LANGUAGE BY HEART, HAND The students' eyes locked onto Sharon Meldrum as she stood at the front of the classroom. They couldn't glance away or look down at their notebooks. It was quiet, except for the whispers of an interpreter translating Meldrum's sign language for a classroom visitor. Even when Meldrum briefly stepped out of the room, there was no sound as the 15 or so students chatted with one another, their hands and fingers flying. They're part of Madonna University's sign language program, the only one in the state to offer a four-year degree. / Detroit Free Press CPC RELEASES NEW CLOSED CAPTIONING SOFTWARE CPC, the leader in file based closed captioning software, announces today new support for the ultraviolet internet video format. The release of the new MacCaption software will now help make ultraviolet videos accessible for the millions of deaf and hard-of-hearing viewers who rely on closed captioning when viewing videos on the internet. The release was made public at the National Association of Broadcasters (NAB) Convention in Las Vegas, Nev. / Times-Union Fort Morgan, CO DEAF DOG INSPIRES COLORADO DEPT. OF TRANSPORTATION LEADERS "This is trust. This is love. This is what you guys need to have as a team." So said Eric Melvin as he and Anglyne the Amazing Deaf Cattle Dog put on a motivational presentation during a Colorado Department of Transportation workshop for lead workers in Brush last Thursday. He was referring to how Angelyne never takes her eyes off him. The duo was putting on its 243rd show and appeared before almost 15,000 people last year. / The Fort Morgan Times DEAF HIP HOP AND COMEDY COME TO NYU AT 'SIGNS AND RHYMES' There was much anticipation and excitement apparent in the conversations of the crowd assembled for the event “Signs and Rhymes: Intersections of Deaf & Hip Hop Cultures” last night at New York University. Both hands and lips moved feverishly as the large crowd filed into their seats. Having only seen American Sign Language used when providing interpretation during public events, it was incredibly compelling to see an entire crowd conversing with each other. / NYU Local LOCAL ARTIST PORTRAYS MULTIPLE DEAF CHARACTERS IN HALF MOON BAY SHOW An independent deaf-blind man, a deaf prostitute, a man awaiting trial for murder, and a psychologist who serves as an advocate, interpreter and chauffeur for her clients will all make an appearance in Half Moon Bay later this month during "Deaf Poets Society," a one-woman show written and performed by Montara artist Nancy Margulies. Before moving to the Coastside, Margulies worked in art therapy for many years with deaf individuals in the state prisons of Illinois and Missouri. "Deaf Poets Society" is based on what she learned during that time. / Patch.com DEAF PERFORMING ARTIST PUTS ON A SHOW IN CANYON A popular deaf performing artist made a stop in Canyon Saturday night. The Canyon High American Sign Language Honor Society brought artist Peter Cook to our area for the second time through a lot of fund-raising and hard work. His performance last year was such a big hit, they say they had to have him back for a second time. / KFDA DEAF MAN GETS HEARING IMPLANT IN TIME FOR COACHELLA FEST The fact that Justin Tyle is profoundly deaf isn't stopping him from having the time of his life during his seventh year at THE Coachella Valley Music and Arts Annual Festival. This time, however, it will be an entirely different experience. After more than 25 years in a silent world, Tyle received a cochlear implant that allows him to hear. / abc7.com New Sonic-connect Message Alert Device Now you can be alerted to IM messages from Skype, Facebook, Yahoo, Google, and more! The new Sonic-connect instant portable USB device alerts you to any of the most popular instant messaging services as well as other computer notifications like calendar and task reminders. Simply plug the Sonic-connect into your computer USB connection and be alerted with a bright flashing strobe and bright red LED lights when a new message is waiting. The Sonic-connect (SA-SEC100) is available from Harris Communications for only $49.95. For more information, go to http://bit.ly/HarrisComm_DW041512 or contact us at mailto:info@harriscomm.com. BOSTON MARATHON PUSHES BLIND, DEAF ADVENTURER TO LIMIT Conquering challenges is nothing new to adventurer Bill Barkeley. So when the Boston Marathon organizers offered racers the ability to opt out of Monday's event because of the high heat index, Barkeley knew what he had to do. Barkeley has climbed Mount Kiliminjaro and Mount Quandary, he's led a group of teens with hearing loss on a trek through the Peruvian Amazon as part of the No Barriers organization, which aims to help people with disabilities lead more full and active lives. He's also legally blind and deaf. No, weather wasn't going to stop Bill Barkeley. / MLive.com USA DEAF NATIONAL TEAMS TO PLAY AT CREW STADIUM PRIOR TO CREW GAME ON APRIL 28 The USA Men’s and Women’s Deaf Soccer National Teams will play exhibition matches at Crew Stadium on April 28, in advance of the Crew’s regular-season league match vs. the Vancouver Whitecaps that evening. The USA Deaf Women’s National Team will get the day started at 12:30 p.m. vs. Otterbein University, followed by the USA Deaf Men’s squad vs. a selection of Crew Soccer Academy players at 3 p.m. / Columbus Crew DEAF SPEED SKATER HAS OLYMPIC ASPIRATIONS Speed Skater Michael Hubbs has his sights on the 2014 Winter Olympics. A graduate of the Texas School for the Deaf, Hubbs is fast on the ice. Now, he’s training to make it to the Olympics. His career began when he was 10 years old with roller skating. He became a serious skater at the age of 12 and traveled for competition until the age of 16. “By the time I was 16, I started skating on a national level. Later on, when I was 27, I went to the ice and I realized ice skating was quite a bit different from roller and inline skating,” he said. / YNN FLORIDA DEAF HIRES ERIC LEFORS AS FOOTBALL HEAD COACH The Florida School for the Deaf and the Blind football team filled its coaching vacancy on Wednesday, promoting assistant Eric LeFors. LeFors, whose brother Stefan was a quarterback at Louisville and a fourth-round draft pick of the Carolina Panthers in 2005, has been at the school more than a decade. He replaces Johnny Samuels, who retired following the 2011 season. / The Florida Times Union OUTREACH COORDINATOR (GEORGIA) Hamilton Relay, Inc. currently has a full-time position open for “Georgia Relay Outreach Coordinator”. Position summary: This full-time position is responsible for coordinating and implementing outreach activities designed to promote Telecommunication Relay Services (TRS) and Captioned Telephone Relay Service (CapTel®) for Georgia Relay. Preferred education, experience and skills: KNOWLEDGE, SKILLS & ABILITIES: Knowledge of: -- Effective communication and public outreach techniques. -- Knowledge of and ability to understand various communication modes used by current and potential relay users. -- Familiarity with the users communities that could benefit from relay services: o Senior Community o Hard of Hearing Community o Deaf Community Skill in: -- Organizing outreach and educational campaigns. -- Public speaking and confidently communicating verbally to a wide variety of audiences. -- Maintain effective working relationships with Relay Administrator and non-profit and for profit partners, the public and other agencies. -- Communicate effectively both orally and in writing. -- Plan, schedule and organize multiple priorities and a high volume of work. Completion of an undergraduate degree and two or more years of experience in the design and implementation of public outreach program or related marketing experience are required. Experience in the telecommunication field, Traditional Relay Service or Captioned Telephone Service is a strong plus. Excellent presentation skills. Experience in public relations activities. Hold a valid driver’s license. Fluency in English and American Sign Language. Individuals who are Deaf or Hard of Hearing are encouraged to apply. Apply online at: www.workforhamilton.com or contact our HR Corporate office at: (800) 821-1831 by April 25, 2012. Hamilton Relay is an equal opportunity employer and does not discriminate on the basis of race, religion, color, sex, age, national origin or disability. PAHrtners Deaf Services is a dynamic team of behavioral health professionals serving Deaf and Hard of Hearing children and adults. We take great pride that our program is strongly Deaf/HOH centered with about 85% of our staff being Deaf or Hard of Hearing. We provide Outpatient Clinic services, Case Management, Partial Hospitalization, Residential Services and more. We are continuing to grow throughout the Southeast part of Pennsylvania expanding our mental health programs as well as intellectual disability services. PAHrtners is looking for dedicated, motivated, energetic individuals who are fluent in American Sign Language and knowledgeable about Deaf Culture and the Deaf Community to be a part of our team. Check our website at www.PAHrtners.com to learn about our career opportunities and more! E.O.E. ASSISTANT OPERATIONS DIRECTOR for RESIDENTIAL SERVICES: (Full Time Position) The qualified candidate shall possess: Bachelor’s degree in Human Services field with two years of supervisory experience in behavioral health and/or developmental disabilities program; OR a HS with 5 plus years of experience working in the mental health field, two of which must be in a supervisory role. Advanced ASL fluency required. Strong leadership, administrative, organizational and interpersonal communication skills (both in person and in writing) required. Strong ability to manage and complete multiple tasks, priorities and projects as well as the ability to lead, teach, advise and motivate staff and consumers. Regulatory Compliance -Insure compliance with the health, safety, and occupancy regulations and contract requirements of all relevant Governmental and professional accreditation entities. Assure the maintenance of DPW and other licensures as required. Budget -Insures that program expenses are kept within budgetary limits. Work with Operations Director and other fiscal management personnel to develop yearly budgets.. Supervision -Maintain a supervisory process including both individual and group meetings of all program staff for direction, guidance and support. Communicate agency policies and procedures, client information, and all other relevant information to staff as needed. Personnel -Oversee and recruit, hire and train qualified staff to provide sufficient supervision and support to meet client needs, agency standards, and contractual or regulatory requirements. Develop department/division standards in compliance with agency policies. Liaison - Maintain effective working relationships with clients, officials, families and agency personnel. Insure full participation in an interagency planning process for individual clients as well as for service system development and problem solving. Provide ongoing communication with psychiatric service providers such as the psychiatrist, therapists and specialized consultants or practitioners as well as county and state governmental agencies. Send your letter of intent and resumes to: Linda Claypool, Office Manager/HR Email: lclaypool@salisb.com Fax: 215-884-6301 Mental Health Program Consultant (Mental Health Specialist) Deaf and Hard of Hearing Services Division Minnesota Department of Human Services Two positions available: $ 46,312-$ 68,257 annually / Full benefits This position provides culturally affirmative mental health services to D/HH adults coping with mental health issues. The main responsibility of the Mental Health Specialist is to provide psychotherapy/ counseling services and the remaining of time will include clinical case management/coordination, consultation, training, aftercare planning, and community placement assistance for D/HH adults. Fluency in American Sign Language (ASL) At least 2 years advanced profession experience, OR 1 year advanced professional experience plus 2 years professional experience providing direct mental health services to D/HH individuals. Master's Degree in Counseling, Psychology, Social Work or behavioral-health related field Licensed or license-eligible for LPC, LPCC, LP, LICSW or LMFT in the state of Minnesota Contact: Dr. John Gournaris e-mail: john.gournaris@state.mn.us	cc/2020-05/en_middle_0126.json.gz/line555
__label__cc	0.655485	0.344515	Home \| Site Map Wednesday, 29 January 2020 About us \| Contact us You are here > cl-typesetting Home Page cl-typesetting is a complete typesetting system written in Common Lisp using cl-pdf for the direct generation of pdf files. This enables it to be powerful, extensible, programmable and fast. It is intended to be an alternative to the TeX like typesetting systems. cl-typesetting is used to generate reports and documents in production applications. You can see an example generated with cl-typesetting here. cl-typesetting-announce is a low volume mailing list for announces about cl-typesetting and related software. cl-typesetting-devel is a mailing list for discussing development of and with cl-typesetting and related software. The cl-typesetting repository is here: http://www.fractalconcept.com:8000/public/open-source/cl-typesetting/ It's a subversion repository. You can explore it with any browser but you need to get subversion to do a checkout. You can also get a tarball of the current version exported from the repository below. Current version : cl-typesetting-current.tgz Contact me if you are interested to contribute to this project. Home \| Site Map Back to top of page About \| Contact us	cc/2020-05/en_middle_0126.json.gz/line563
__label__wiki	0.803391	0.803391	Keyword: diplomaticimmunity Harry Dunn's parents reject Trump offer to meet suspect at White House 10/16/2019 5:23:29 AM PDT · by sinsofsolarempirefan · 102 replies https://www.bbc.co.uk/news/uk-england-northamptonshire-50064595 ^ crash death after Donald Trump dropped the "bombshell" that she was in the room next door at the White House. Charlotte Charles and Tim Dunn felt "a little ambushed" by the offer made by the US president. Anne Sacoolas, 42, returned to the United States days after the crash which killed 19-year-old Harry. Harry's parents said they wanted to meet Mrs Sacoolas in the UK. Mr Dunn said a White House official told them she would not be returning to the UK, but Mr Trump said he would "try to push this from a different angle". America REFUSES to waive diplomatic immunity for diplomat's wife...after...wrong-way crash' 10/05/2019 4:59:46 PM PDT · by BenLurkin · 63 replies Daily Mail UK ^ \| 10/05/2019 \| Keith Griffith and James Wood FULL HEADLINE: "'This is disgraceful, no way for a so-called ally to behave': Outrage on BOTH sides of the Atlantic as America REFUSES to waive diplomatic immunity for diplomat's wife who has fled back to the States after 'killing British teen in wrong-way crash'" In a statement on Saturday, Northamptonshire Police confirmed that the 42-year-old American woman suspected in the August 27 death of Harry Dunn, 19, has returned to the U.S. Police said the woman had previously informed them that she had no plans to leave the UK. Neither the name of the woman nor her U.S. diplomat spouse... FR now has a Deep State Admin Mod Group going rogue deleting posts aboutthe Deep State [q anon] 12/13/2018 12:07:50 AM PST · by Paladin2 · 164 replies Reearch on FR ^ \| 12/13/2018 \| Moi FR now has Jack-booted Thug Censorship Unbelievable. Wikileaks Dumps Hillary Email Exposing Her Ordering US Diplomats To Steal DNA From UN Leadership 05/07/2018 6:04:52 AM PDT · by stilloftyhenight · 134 replies Goldwater ^ \| 05-06-2018 \| By Red Pill There's an extremely serious dump of emails that came from Wikileaks exposing Hillary Clinton for ordering top US Diplomats to steal the DNA and passwords from United Nations leadership. The stunning email comes from the account of Hillary Clinton that used the address hdr22@clintonemail.com. Why Dirty Diplomats Can Literally Get Away With Murder By 10/12/2017 12:24:26 PM PDT · by nickcarraway · 12 replies New York Post ^ \| October 11, 2017 \| Alex Taylor, Larry Celona and Ruth Brown Its a sleazy scenario that plays out in bars and clubs across the Big Apple: Everybodys having a great time until some creep just cant keep his hands to himself. But early Sunday at Bar None a Third Avenue dive in the East Village where NYU co-eds squeeze in every weekend to chug cheap Bud and dance to 90s rock one of these guys would finally face the consequences. A creep put his paws all over an unwitting young womans boobs and backside, she said, and the victim immediately reported the sleazy moves to a bouncer. Owner Of LaFerrari Caught Terrifying Beverly Hills Neighborhood Claims Diplomatic Immunity 09/15/2015 1:53:52 PM PDT · by upbeat5 · 85 replies eBay Motors Blog via Yahoo News ^ \| September 15, 2015 \| Alex Lloyd A YouTube video that went viral showing a Ferrari LaFerrari and Porsche 911 GT3 tearing through residential streets of Beverly Hills; flying though stop signs while pedestrians waited to cross, narrowly avoiding other motorists has caused outrage, with neighbors pleading with police to take action before someone gets hurt. According to NBC4, the owner of said vehicles is claiming diplomatic immunity, telling a video journalist who asked for comment, I could have you killed and get away with it. The name of the cars owner has not been released, but he is rumored to be part of the... India seeks possible U.S. tax violations in diplomat row 12/27/2013 10:04:38 AM PST · by James C. Bennett · 13 replies Reuters ^ \| Friday, 27 Dec, 2013 \| Reuters NEW DELHI India has sought details about staff in American schools in the country for possible tax violations and revoked ID cards of U.S. consular officials and their families, retaliatory steps for the arrest of an Indian diplomat in New York on criminal charges. The measures suggest that the two countries are no closer to a resolution of a diplomatic dispute over the treatment of Deputy Consul General Devyani Khobragade this month on charges of visa fraud and underpayment of her housekeeper. Khobragade, who has denied the charges, was handcuffed and strip-searched while in custody despite informing U.S. marshals about... Russian Diplomats Medicaid Fraud Raises Questions About Accessing Taxpayer Benefits 12/26/2013 9:25:30 AM PST · by afraidfortherepublic · 15 replies PJ Media ^ \| 12-23-13 \| Bridget Johnson Congress is digging into how foreign diplomats accessed and reportedly defrauded federal benefits programs. According to the U.S. Attorney for the Southern District of New York, 25 current and former Russian diplomats and 24 of their spouses allegedly participated in a scheme to illegally obtain Medicaid benefits for prenatal care and related costs by underreporting their income or falsely claiming that their children were citizens of the United States, Royce noted. Over the course of nearly a decade, they milked the system of $1.5 million in benefits. The U.S. Attorney alleges that the staff of Russian diplomatic offices... Does U.S. Attorney Preet Bharara have something against elite in India? 12/19/2013 5:34:40 PM PST · by rovenstinez · 4 replies Vanity ^ \| Dec 18, 2013 \| rovenstinez Is there something being blocked in the US news, has the U.S. Attorney been carrying a vendetta towards the Indian Caste system and feels now that he has a lower caste in New York that he needs to teach an entire nation about Caste Systems and Human Rights. MY... I would say about 50% of the people who apply for visas lie throught their teeth. It seems that this case is being exploded for some kind of class on CLASS WARFARE. Maids..working for the elite? US diplomat kills man in car crash, leaves Kenya 08/02/2013 9:51:17 AM PDT · by South40 · 43 replies Yahoo News (AP) ^ \| 8/2/2013 \| JASON STRAZIUSO NAIROBI, Kenya (AP) An American diplomat who police say was speeding crossed the center line in his SUV and rammed into a full mini-bus, killing a father of three whose widow is six months pregnant, officials said Friday. U.S. Embassy officials in Nairobi rushed the American and his family out of Kenya the next day, leaving the crash victims with no financial assistance to pay for a funeral and for hospital bills for the eight or so others who were seriously injured. State Dept: Texas cant arrest international election observers 10/26/2012 4:02:02 PM PDT · by Snuph · 194 replies Washington Examiner ^ \| October 26, 2012 \| Joel Gehrke International election observers planning to visit Texas polling places have full immunity from being arrested in the United States, the State Department said when discussing a letter from the Texas Attorney General. Im not going to get into any kind of hypothetical situations or predict where this is going to go other than to say we have every expectation that this will be worked out and to state the fact, which is that under U.S. law they are eligible for immunities, said State Department spokeswoman Victoria Nuland. Reporters tried to get her to state explicitly that Texas could not arrest... Officers investigated over Chinese diplomat's injury (punched in the face) 05/01/2010 5:48:00 AM PDT · by TigerLikesRooster · 3 replies · 474+ views Houston Chronicle ^ \| 05/01/10 \| MOISES MENDOZA and BRADLEY OLSON <p>Three Houston police officers have been assigned desk duties as city and federal authorities scrutinize the arrest of a local Chinese diplomat who says police hit him in the face during a traffic stop last weekend at the Chinese Consulate.</p> Officials: Qatari plane smoker was en route to see jail Al Qaeda operative 04/09/2010 2:56:35 AM PDT · by Scanian · 8 replies · 553+ views NY Post ^ \| April 8, 2010 \| AP WASHINGTON The 27-year-old Qatari diplomat who caused a full-blown, midair security scare when he tried to sneak a cigarette and then joked about it will probably be catching the next flight to Doha, a senior State Department official said Thursday. "His ability to function effectively has been compromised," the official said, adding that the diplomat will probably not be returning to the United States after the incident. Fox News also has confirmed that the diplomat was on his way to Denver for a consular visit with a jailed Al Qaeda operative -- perhaps adding to the tension with the... FBI: No Explosives Found on United Jet in Denver 04/07/2010 8:11:26 PM PDT · by MindBender26 · 128 replies · 4,419+ views ABC ^ FBI: No Explosives Found on United Jet in Denver Authorities Say Qatari Diplomat Told Air Marshals, 'I'm Lighting My Shoes' FBI agents say no explosives were found in the shoes of a Qatar diplomat who was subdued by federal air marshals on a United flight to Denver Wednesday night after allegedly telling the marshals, "I'm lighting my shoes on fire." Authorities say the diplomat was wrestled to the ground and two F-16 fighter jets were dispatched to accompany the 757 on the final 40 minutes of its flight to Denver. Flight 663 originated from Washington Reagan airport. A US security... Obama Order Strips Americans of Constitutional Rights 01/08/2010 9:51:41 AM PST · by opentalk · 34 replies · 1,521+ views human events ^ \| 01/08/2010 \| Roger Hedgecock While our "Constitutional Scholar" president insists on full Constitutional rights for terrorists, he has at least attempted to repeal the 4th Amendment protections for Americans, with particular impact on the men and women in the U.S. military. An Executive Order dated December 17 grants full diplomatic immunity to INTERPOL, the International Criminal Police Organization. This Obama Order immunizes INTERPOL from "search and seizure," from all tax laws, from the Freedom of Information requirements, and puts INTERPOL above the jurisdiction of American Law Enforcement, American Courts, and the Constitution itself. INTERPOL was originally formed in 1923 as an information clearinghouse service... E.O. Amended to Immunize INTERPOL In U.S. 12/23/2009 1:00:48 PM PST · by Clioman · 24 replies · 1,263+ views Threat Watch Blog ^ \| December 23, 2009 \| Steve Schippert Wither Sovereignty? Executive Order Amended to Immunize INTERPOL In America-Is The ICC Next? Last Thursday, December 17, 2009, The White House released an Executive Order "Amending Executive Order 12425." It grants INTERPOL (International Criminal Police Organization) a new level of full diplomatic immunity afforded to foreign embassies and select other "International Organizations" as set forth in the United States International Organizations Immunities Act of 1945. By removing language from President Reagan's 1983 Executive Order 12425, this international law enforcement body now operates - now operates - on American soil beyond the reach of our own top law enforcement arm, the... Diplomats arrested for cigarette smuggling (two North Koreans claimed diplomatic immunity) 11/20/2009 3:24:06 PM PST · by NormsRevenge · 8 replies · 607+ views Reuters on Yahoo ^ \| 11/20/09 \| Jens Hansegard and Nick Vinocur STOCKHOLM (Reuters) Swedish police have arrested two North Korean diplomats on suspicion of smuggling 230,000 cigarettes into the Nordic country, the Swedish Customs Office said Friday. The pair, a man and a woman who have diplomatic status in Russia, were stopped by Swedish customs officers Wednesday morning as they drove off a ferry from Helsinki, the Finnish capital. Customs officials discovered Russian cigarettes in the car driven by the couple, Swedish Customs spokeswoman Monica Magnusson told Reuters. The two North Koreans claimed diplomatic immunity. "They were accredited as diplomats in Russia, but had no accreditation in Sweden," she said.... Does "King of the World" Need a Birth Certificate? 08/05/2009 9:00:11 AM PDT · by jazminerose · 15 replies · 1,207+ views Canada Free Press ^ \| 8/5/09 \| Judi McLeod & Douglas Hagmann Since his arrival at the White House, Barack Obama has been touted as `King of the World rather than USA president. As King of the World, does Obama really need born-in-USA status? On the occasion of their presidents 48th birthday yesterday, Americans still dont know for certain from whence he came, only where he is leading them. There was a mammoth picture of the Birthday Boy on display outside the White House, but no pictures of him pursing his lips to blow out the candles on a birthday cake, which may have served as a reminder that this is a... Grace Mugabe is immune from prosecution in Hong Kong (repeatedly punched photographer in the face) 03/22/2009 10:05:38 AM PDT · by Stoat · 22 replies · 1,050+ views The Times (U.K.) ^ \| March 22,2009 \| Jane Macartney (edit)Hong Kong-based British photographer Richard Jones encountered the 43-year-old wife of Robert Mugabe as she walked down a street near her luxury hotel in the heart of the city to go shopping.She punched him in the face when he tried to take pictures of her on January 15, leaving Mr Jones with bruises and cuts where her diamond-encrusted ring had smashed into his face. Mr Jones told AFP: "I think it's a disgrace for the Hong Kong government to allow a person to walk on a street in Hong Kong, punch a member of the media, and walk free from... Mexican official caught stealing White House Blackberries, invokes diplomatic immunity 04/24/2008 12:38:48 PM PDT · by pissant · 102 replies · 316+ views Michelle Malkin.com ^ \| 4/24/08 \| Michelle Malkin You are not going to believe this story. It is really something else. The White House, I predict, will look the other way at the flagrant law-breaking by a Mexican official caught on tape by the Secret Service filching U.S. government property. After all, looking the other way at systemic law-breaking by Mexico is the official Bush policy. Fox News has the scoop: Whether he was up to no good or simply desperate to play BrickBreaker, a Mexican press attaché was caught on camera by Secret Service pocketing several White House BlackBerries during a recent meeting in New Orleans, FOX...	cc/2020-05/en_middle_0126.json.gz/line564
__label__cc	0.535956	0.464044	reznaf \| 8:00 AM \| Card/Board , Games , Wild West Checkers v1.00 , Wild West Checkers v1.00 APK , Wild West Checkers v1.00 Download Description: A new exciting and extending game: Wild West Checkers. Events in the game take us back in the days of the conquest of the Wild West and fight American settlers from the warlike Indian tribes. The bloody war lasted more than 100 years. Violent clashes took place with varying success and claimed tens of thousands of lives on both sides. According to estimates the U.S. Census Bureau between 1775 and 1890 occurred more than 40 wars, that killed 45,000 Indians and 19,000 Whites. Wild West Checkers offers a peaceful way to resolve conflicts. And who knows, if it had been invented before, perhaps it would have saved thousands of lives! Rules of the game are diabolically simple. Shoot enemy checkers from the game field while ensuring that as many of yours stay on as possible. If yours is the last man standing, you win. You’ll need a keen eye and strong hand to be the victor in this app but more than that, you need clever strategy. Each player gets 8 checkers to start, which are placed on opposite ends of the game field. Go ahead and use your finger to pull back your checker, then let go to shoot toward your opponent’s game piece. Little arrows indicate the direction and stroke power of your shot. The player with at least one checker left on the game field wins the battle. The war is not over with the first battle, though. A second battle starts with the first game’s loser playing with one less checker. Does that ensure that you’ll win this round? No. If your opponent has found an excellent strategy, you may find it challenging to overthrow him in the second game. All is fair in love and war and that includes Wild West Checkers. You never know who is going to win. If you want to give yourself a game playing advantage, fine tune your skills and hone your moves by playing against the app initially. After you’ve developed your game playing skills, invite a partner to join you in a war game. If you’ve practiced and perfected your game, you’re bound to win more than you lose. Just to keep things interesting, there are three levels of complexity: * Easy level — the arrow showing the direction and the force of strike has depicted * Medium level — just the arrow showing the direction of strike has depicted * High level — the arrow hasn’t been depicted at all So, who will you be, the American settler struggling for a place under the sun at least one checker left on the game field, or the American Indian defending their ancestral lands? There’s only one way to find out. Better grab the Wild West Checkers app now so you can start practicing. https://play.google.com/store/apps/details?id=com.maxnick.android.wildwestcheckers http://ul.to/aboaqex8 http://rapidgator.net/file/658448aa781dd47e2ed4de2b178fa0dd/ http://clz.to/g0uqu0mt	cc/2020-05/en_middle_0126.json.gz/line565
__label__cc	0.645591	0.354409	Historical "Whoops!" I had a stupid moment at the preschool yesterday. One that as soon as I said it, I wished I could suck the words right back into my mouth so that no one would hear what I had said. I need more sleep. Oh! I've been subbing all week at a preschool 10 minutes from my house. The city that it's in is primarily Asian, so 99% of the kids there are either Chinese, Japanese, or Vietnamese. A sweet Japanese family was dropping off their little boy with me first thing yesterday morning, and they chatted brightly with each other in their native tongue while they put his lunch and his blanket in his cubby. "I wasn't here yesterday," The little guy bounded over to me and wrapped his hands around my leg, "I was on a trip!" "Oooh," I said, sounding impressed, "Where did you go?" "Mommy and Daddy and I went to the Long Beach Aquarium. And then, we had dinner on the Queen Mary." "The Queen Mary? That ship is very special to my family," I said, (and here's the dumbest thing I've said all week:) "It's very special to us because my grandfather came back to America on the Queen Mary after World War II!" Siiiiiiiiiiiiiiiiiiiiiiiiigh. I'm now insisting on a regular bedtime. Calling All Shipping Pros! Date with God Tape and Rollers An Etsy-Perfect Home: Birds Daily Inspiration: Doily-Covered Soaps How do You Use an Apple? Missing Seagulls My New Favorite Cookie: Vanilla Chai Spice Handmade Giveaway The Problem with Real-Life Friends Sushi up to Our Noses Cha-cha-changes Get Ready for an Attack of the Kim! Breakfast with Paul Still here :-)	cc/2020-05/en_middle_0126.json.gz/line578
__label__wiki	0.684402	0.684402	Clean Transport Total Starts Up the La Mede Biorefinery Total Starts Up the La Mede ... Total Starts Up the La Mede Biorefinery Total has started up production at the La Mède biorefinery in southeastern France, with the first batches of biofuel coming off the line. It is the final step in converting a former oil refinery into a new energies complex. Launched in 2015, the project represents a capital expenditure of €275 million. The La Mède complex now encompasses: A biorefinery with a capacity of 500,000 tonnes of biofuel per year. An 8-megawatt solar farm that can supply 13,000 people. A unit to produce 50,000 cubic meters per year of AdBlue®, an additive that reduces nitrogen oxide emissions from trucks. A logistics and storage hub with a capacity of 1.3 million cubic meters per year. A training center offering real facilities and able to host 2,500 learners a year. Together, these new activities have maintained 250 direct jobs at La Mède. Carbon Dioxide (CO2) Enhanced Oil Recovery (EOR) Market 2020-2030 Year-End Deals available, gain more insights for your budget Download free sample pagesFree sample As part of the site transformation, 65% of the orders to remodel the complex were awarded to local businesses, representing 800 jobs and €140 million in revenue. Total also invested €5 million in the economic development of the Fos-Etang de Berre region, notably by supporting initiatives to create jobs, attract industrial projects and support contractors. That’s five times as much as a typical revitalization agreement. The biorefinery can produce 500,000 tonnes of hydrotreated vegetable oil (HVO), a premium biofuel. La Mède will produce both biodiesel and biojet fuel for the aviation industry. It was specifically designed to process all types of oil. Its biofuels will be made: 60 to 70% from 100% sustainable vegetable oils (rapeseed, palm, sunflower, etc.). 30 to 40% from treated waste (animal fats, cooking oil, residues, etc.) to promote a circular economy. As part of an agreement with the Government in May 2018, Total has pledged to process no more than 300,000 tonnes of palm oil per year - less than 50% of the total volume of raw materials needed - and at least 50,000 tonnes of French-grown rapeseed, creating another market for domestic agriculture. All the oils processed will be certified sustainable to European Union standards. In addition, as part of its palm oil procurement process, Total is taking an extra step by introducing strengthened control of sustainability and respect for Human Rights (see below). “I’d like to thank the teams for all their hard work these last four years to convert our La Mède refinery,” said Bernard Pinatel, President, Refining & Chemicals. “Biofuels are fully renewable and an immediately available solution to cut carbon emissions from ground and air transportation. When produced from sustainable raw materials, as at La Mède, they emit over 50% less carbon than fossil fuels. Our biorefinery will allow us to make biofuels in France that were previously imported.” Source: Total Your Friends' Name Your Friends' Email Interesting news item! Total Starts Up the La Mede Biorefinery More Total News Total Continues to Expand its Footprint in Southeast Asia in Distributed Solar Saft to Build the Largest Lithium-Ion Energy Storage System in the Nordic Countries Total and Envision Join Forces to Capture the Fast-growing Distributed Solar Energy Market in China Total Will Develop the LNG Market in Benin Total Divests Assets in the UK to Petrogas More news in Oil and Gas Wartsila signs a flexible power plant deal and maintenance agreement in Germany Cheniere Energy Celebrates 1000th Lng Cargo Milestone Increasing Value and Extending Statfjord Wartsila Launches New Technical Solution for Fuel Gas Handling Wartsila Exhaust Gas Cleaning System Gets Ccs Type Approval More Oil and Gas news Digital Refining & Petrochemicals Summit 2020 United Kingdom - Jun 3, 2020 More news in Bio DTEs Waste-to-energy Initiative Wins American Biogas Councils Dairy Project of the Year European Biomass to Power Conference The Global Oil Sands market is Expected to be Worth $86.6 Bn in 2019 Atlantic Power Announces Closing of Acquisition of Ownership Interests in Craven County and Grayling Biomass Plants BP Announces Major Expansion in Renewable Energy, Combining Biofuels and Biopower With Bunge in Brazil to Create a World-class BioEnergy Company More Bio news US Microalgae Industry Summit FL - May 27, 2020 Subscribe to our Newsletters News Suggestions? Copyright 2019 - Global Energy World - ASD Media BV News suggestions	cc/2020-05/en_middle_0126.json.gz/line583
__label__cc	0.525407	0.474593	Spy whips up a funny and action-packed 007 parody Paper Towns is flimsy, but with some interesting twists Terminator: Genisys improves on the last two installments, for whatever that's worth Video games and Kung Fu strike back with The Avenging Fist Tremors 5: Bloodlines delivers on gore and action, but misses on comedy Do I Sound Gay? is certain to get people talking Send us your screeners! We're aware that the term independent cinema is so loosely defined these days that most of the indies that people rave about are always populated by big time movie stars and backed by Hollywood studios. We're not saying that's inherently a bad thing, but we here at JustPressPlay are big proponents of the truly independent cinema. The ones home made by talents looking to be noticed and starring faces you've never seen. For that reason, we are accepting unsolicited movie screeners from anyone. We can't guarantee a write-up, but we do want to know about your film. Before you send it over, though, please consider these simple points: • Have a release date. You don't need to be in bed with Fox Searchlight or Magnolia Pictures, but we need to make sure that our readers can find your movie after they read about it. It can be a limited theatrical release, a prominent film festival entry, or a date when it'll be available on DVD, iTunes, streaming, or even BitTorrent if that's your distribution model. • Include info in your package. It can be an official press release or an informal letter you wrote just for us, or both. We prefer it to be as brief as possible, but it should at least have the title, logline, cast/crew credits and release info. • Screeners will not be returned. So don't send us your master copy. Any screener we receive will be destroyed once we're done with them, to protect the property. • Movies under 45 minutes is considered a short. We will therefore treat them as such. • It's not porn. Feel free to send it to us, if you really want to, but chances are we won't write about it. Got all that? Then burn that DVD (or Blu-ray, if you want to be fancy) and send it over to: JustPressPlay 3023 North Clark Street, Box 758 For any questions, contact Lex Walker at This e-mail address is being protected from spambots. You need JavaScript enabled to view it . RSS \| About us \| Screeners \| Ethics policy \| Privacy \| Terms of use	cc/2020-05/en_middle_0126.json.gz/line592
__label__cc	0.745355	0.254645	CATEGORIES ⌄ LETTERS TO LA LA LAND Music Pick Of The Month: Carter V, Lil Wayne I don't know about you but I, along with millions of you, have waited for this album to drop for a long time. Lil Wayne's highly anticipated 'Carter V' highly anticipated album is out and I think its freakin' fire. The long awaited 12th studio album dropped last week, and I have been playing the fifth instalment of The Carter series since it came out. get the album on iTunes or Spotify Have you guys heard it? What do you think? Posted by NOmerovic True and Tried Travel Guide Meet Nermisa ARCHIVE January (15) December (21) November (22) October (20) September (19) August (17) July (17) June (17) May (20) April (18) March (18) February (20) January (20) December (19) November (21) October (16) September (16) August (24) July (18) June (19) May (21) April (14) March (20) February (15) January (18) December (14) November (14) October (14) September (12) August (12) July (19) June (19) May (20) April (20) March (21) February (18) January (23) December (31) November (25) October (22) September (18) August (24) July (24) June (27) May (25) April (21) March (26) February (19) January (20) December (20) November (20) October (15) September (18) August (15) July (15) June (9) May (5) April (6) March (2) February (6) January (10) December (10) November (2) October (7) September (4) August (6) July (4) June (7) May (10) April (1) March (5) February (6) January (3) December (3) November (9) October (2) September (3) August (2) July (1) May (1) December (1) Beauty Favorites: February + a #giveaway Do you have got to beauty products that you never run out of? These five products have been my go to for years. I have switched to many oth... OOTD - Athleisure Style + a #giveaway When this whole athleisure looks movement started, I was all about it, in theory that is, but its something I rarely posted on social media... OOTD - Hunter boots Hunter boots are and I've styled my own Hunter boots with leggings and a hoodie more times than I can count. I'm tired of that co... Copyright 2011-2015 REENN©. Powered by Blogger. ▲ Copyright 2011-2019 REENN©	cc/2020-05/en_middle_0126.json.gz/line614
__label__wiki	0.744555	0.744555	A Creative Environment - The History Here is a picture of the first Light From Darkness Studio in the week that it opened in June 1991. In those days there wasn't a rehearsal studio in Hastings and the idea was to provide a "creative environment" for groups of musicians (of any persuasion) to get together and CREATE. For information about how some took it quite literally, please read on. Not visible in the foreground is MickW playing guitar. Soon after this Mick's first ever band, Lapidari, opened the first ever LIAISON in Hastings supporting Blue Stone Mor on Hastings Pier. Liaison was the name given to the studio's gigs organised and promoted by Phil Little. Lapidari is now Helium Lovesok and are about to release their third self-financed album. They play all over the South East of England enjoying unusual popularity in Dover of all places. They have also appeared at several major festivals in the South and in Holland and Portugal. Phil outside the Studio front door (far left of this alley) In September of 1991 Blue Stone Mor recorded ten songs at Light From Darkness Studios and the results inspired everybody into a frenzy of activity. Led by Dave Cutmore and featuring the excellent songs and vocals of Simon Steadman Blue Stone Mor were a great success in the first Liaison gig in November 1991, which, was attended by none other than Jeff Beck. In January 1992, Liaison moved to The Yorkshire Grey pub were the gigs were put on free thanks to the good auspices of landlord Keith. Blue Stone Mor At about this time Simon Steadman approached Phil and asked him for support to put together his own band which would have a different approach and a different musical style. Simon started off with just a drummer, Chris Vane, who lent some energetic and funky rhythms to push Simon's songs. Within a week auditions were underway for other musicians and a major step forward to the new band was the addition of Ellie Hopkins on violin.With Simon's acoustic guitar a new happy acoustic sound was forming which was driving at the same time. The band were rehearsing three or four afternoons a week at Light From Darkness and the sound that echoed throughout the rest of the huge disused building got more appealing and tighter after every session. Within a month Simon had arranged the bands first gig and had decided to call the band "The Dharma Bums". Phil had a quiet word with him about that and Simon elected to shorten his new band's title to The Dharmas. Chris Vane went off to University and Simon Steadman asked Phil if he knew any drummers and he said he would keep an eye out. A short time later the two bumped inot each other and Phil told Russell about The Dharmas and the next thing he auditioned and was in. The rest, they say, is history, which will be more accurately detailed elsewhere. To recount briefly, people went mad for The Dharmas very quickly. All their local gigs were packed out and in a year they would be putting on their own shows at Hastings Pier's huge ballroom. A couple of years after their inception they were a good festival pull and appeared several times at Glastonbury. Finally signed to a major record company for a six figure sum, fate struck them a blow in the form of a conglomerate takeover and The Dharmas wondering what move to make next. The Dharmas issued their CD themselves. Simon Steadman now fronts a new band with the same rhythm section from The Dharmas, Dave Walton on bass and Russell Field on drums. The band is called Steadman and follows a quite different musical tradition from The Dharmas. You can download songs or purchase their new CD from their web site. Another band using Light From Darkness at this time was Buick Six an accomplished Blues band that featured a rhythm section to die for in Colin Gibson on Bass and Liam Genochy on drums. They have both played on sessions through the seventies, eighties and nineties too numerous to list here. Buick Six still play all over Europe and are a big festival attraction. Roger Hubbard fronts the band on vocals and slide guitar. Buick Six at Light From Darkness Left to Right Colin Gibson - Bass, Liam Genochy - Drums and Roger Hubbard - Guitar Phil Little writes:- The most popular Liaison gigs at The Yorkshire Grey throughout this period were unquestionably the gigs by legendary Welsh progressive band MAN. I was fortuante to play with founder member Mickey Jones for eight years and Mickey is still the best guitarist I ever had the privelege to work with. At about 8-30pm we left the studios to go to the Yorkshire Grey for the gig and this being only the second week since I had taken over the bookings at the pub I was worried about whether there would be enough people there to cover the extra expense of getting MAN in for the gig. I needn't have worried because when we eventually prised open the side door of the pub you could not move through the crowd which was packed into every square inch of both bars. Word had spread and people had come from miles. It was a fantastic night and the MAN band took everyone there on a cosmic trip which seemed to have been out of fashion for decades. Deke Leonard relaxing before his gig at The Yorkshire Grey ------ Dave and Martin from The Dave Thompson Band Watch this space, as they say, for more information on the progress of Musicians who experienced the Creative Environment. Light From Darkness (Click on the image for a full size view) One of the many other bands that made use of the rehearsal and recording facilities at the Light From Darkness Studios in 1992 were teenage band, The Sand Fountains, who were all still at school at the time. LFD promoted their first gig which also was a sell out with the young group rallying all the support of their friends. Following a couple of personnel changes the band changed their name to Day Tripper and became very popular among the new generation of club goers at that time. Other bands who used the studio were The Dave Thompson Band, Peter Kirtley, The Word, The Ordinary Men and many more. LFD's studio and office were in the basement of an empty five story building juct a few yards from the seafront and Hastings Town Centre. The building had once housed the local newspaper but had lain empty for a few years and was in a state of disrepair. We managed to open the studio there due to the broad minded and progressive attitude of the then owner, John Bee. But when the run down listed building returned to the ownership of a bank, it was time for us to move out. To this day the Observer Building is still empty. As of April 1999 near neighbours B&T Keyboards have just opened a small rehearsal studio just a few yards away from the old LFD room. In the Summer of 1993 Light From Darkness sponsored the Hastings Live Music Forum in an effort to bring together the different parties involved in Music in order to address problems which the once thriving music scene in Hastings was experienceing. Out of the Forum grew Music Files, a free local event guided which caught the imagination of the public and was published every month for five years up until September 1998. Now there are at least three free event guides in Hastings and nobody can complain that they can't find out what music is happening in the area. Read more about this period in Hastings live music scene at this link. More recently, LFD organised a benefit concert on 30th April 1999 in aid of the Hastings and Rother branch of Amnesty International who regrettably have only a small membership in the area. This means that the members have to make up, out of their own pockets, the �750 per year required by Amnesty International to approve the branch. The evening featured two Latin American bands, Mambo Jambo with polished and professional renditions of Salsa classics, and Sambalanco, who whipped up a storm with their twenty-piece Carnival Percussion band playing Brazilian Samba. The highlight was a roof lifting finaale from Saambalanco with Mambo's Vincent Salzfaas on Congas, which were nice and load through the PA so they could be heard over the "Bateria". Held at De Niro's in Hastings Old Town we had a full house of 160 people and raised �540 for Amnesty. It was a fantastic night and without exception everybody had a good time, while we also raised the local awareness of Amnesty International. As was hoped, since the first gig others have stepped in to organise and perform at more Amnesty International benefits in the Hastings area. That is really the purpose of Light From Darkness. To demonstrate that with a positive vibe and a little spirit, Anything Is Possible! If you have any comments, questions or suggestions, please e-mail us. E-mail phil@littledrum.co.uk All material on this site is copyright Phil Little 2000.	cc/2020-05/en_middle_0126.json.gz/line618
__label__wiki	0.762756	0.762756	State: Nebraska Region: Lewis and Clark Region County: Dodge County City: Fremont Lewis and Clark Region Fremont, Nebraska Known as the Antique Capital of Eastern Nebraska, Fremont's antique shop owners are busy with vacationers making it a point to stop in on their way through Nebraska. The city's Antique Alley was featured on the cover of Midwest Living Magazine. Fremont is also becoming a northeast Nebraska tourist center. Thousands of people visit the community to ride the Fremont & Elkhorn Valley Railroad and Pathfinder Dinner Train, attend events at Christensen Field, the May Museum, or to take part in the seven-county Fremont 4-H Club Fair in July, and the city's annual festival, "John C.Fremont Days," in August. The Fremont Lakes State Recreation Area draws another 800,000 visitors a year. Seven land speculators from Illinois, calling themselves Pinney-Barnard & Co., claimed land for a town site on August 23, 1856. They named it for "the Pathfinder and famous explorer, General John C. Fremont," who was also a candidate for U.S.President of the newly organized Republican party. The decision to plat a town at this particular location was not just by chance. They established Fremont on the flat area in a "double river valley" -- the shallow Platte to the south and meandering Elkhorn to the north -- with a particular vision in mind. Rivers were lifelines for settlers. For railroads, they were just as vital. Fremont's town-builders came here on a hunch the transcontinental railroad would follow the "Great Platte River Road" west. Ten years after the city was founded when the Union Pacific tracks were laid through the town in 1866, this vision became reality. In the mean time, Fremont had been named county seat of Dodge County (1860) and was well on its way. By 1906 three major railroads had tracks through the city and Fremont had become a manufacturing center. Foundries, broom factories, carriage works, cigar factories, wagon makers, saw mills, a brewery, and many more industries were located along the rail lines. Raw materials were shipped in from the east, and finished products shipped out in all directions. Fremont's destiny was sealed, it would survive. Fremont started through the vision of a small group of land speculators. The vision of the "good life" has never waned for those who followed, and it continues to grow with each generation. Fremont Lakes State Recreation Area The Fremont Lakes State Recreation area just west of Fremont draws nearly a million visitors a year. The 700-acre site has 20 sandpit lakes that provide fishing, swimming, power boating, skiing and jet skiing. There are 200 Fremont, NE Recreation Louis E. May Historical Museum The original portion of the Museum structure, in the Italiante Revival style, was built by Fremont's first mayor, Theron Nye. The Museum is an elegant, two-story brick residence originally constructed in 1874 Fremont, NE Museums George Turner House The George and Nancy Turner House, built in 1867 Fremont, NE Historic Homes Ideal Steam Laundry The original building was constructed in 1884 by Charles Osterman and George Tremaine, wholesale produce dealers in Fremont. The Ideal Steam Laundry, Johnson and Company, proprietors, moved into the building in 1894 and doubled the size of the structure in 1911 Fremont, NE National Register Fremont Dinner Train Experience the ambience...take a look back in time aboard 1940s heated and air-conditioned, elegantly attired cars. The train operates from Fremont to historic Hooper, a 30 mile round trip up the beautiful Elkhorn River Valley. Stop at downtown Hooper's Main Street, built in the 1890 Fremont, NE Excursions Upcoming Events in Fremont We currently do not have any events for Fremont, Nebraska in our database. If you know of events taking place, please add the event Things to do near Fremont, NE The Rolling Hills Country Club and Golf Course offers a public nine hole golf course with a clubhouse that was remodeled in 1... Musbach Museum Highland Oaks Golf Course U.S. 30 Speedway John C. Fremont Days Things to do in Fremont Golf Courses Museums City Walking/Driving Tour Recreation Historic Homes Arboretums Opera Houses Farm Life National Register Historic Courthouses Excursions Railroad History Historic Post Offices Arts Reenactments Events in Fremont Expos Cook Offs Toy Shows Halloween Gun Shows Holidays Car Shows Memorials Faith and Spirituality Collectors Shows Rodeos Festivals Music Shows Craft Shows Downtown Sales Fairs Art Shows Benefits Cultural Festivals Arts County Fairs Reenactments Home Shows Fremont & Dodge County Convention & Visitors Bureau 1420 East Military Ave. Fremont , NE 68026 Email: jlne@fdcvb.org Web: www.fdcvb.org Fremont Chamber of Commerce Email: info@fremontne.org Web: www.fremontne.org Nebraska Travel	cc/2020-05/en_middle_0126.json.gz/line626
__label__wiki	0.690014	0.690014	Fast News Study Shows Civil Right Develope Melt Down People Injured 01/26/2020 [-] Brazier runs second fastest 600m time 01/26/2020 [-] Hope basketball coach fastest to 600 wins 01/23/2020 [-] On Fast Track... 01/22/2020 [-] Trump Impeachment Trial Now on Fast Track With Rules Set 01/22/2020 [-] China's 500-Meter FAST Radio Telescope Is Now Operational 01/22/2020 [-] Why teen depression rates are rising faster for girls than boys 01/22/2020 [-] Fast response How Tokyo Olympics will cope if earthquake strikes 01/19/2020 [-] McGregor makes fast work of Cerrone on UFC return 01/19/2020 [-] McGregor make fast work of Cerrone on UFC return 01/17/2020 [-] Toshiba Touts Algorithm That's Faster Than a Supercomputer 01/15/2020 [-] This contractor says he can build border wall faster and cheaper than govt can... 01/12/2020 [-] U.S. Drinking Deaths Double in 2 Decades With Faster Rate for Women Study 01/11/2020 [-] 2019's Fastest Growing Programming Language Was C, Says TIOBE 01/11/2020 [-] Early concussion treatment tied to faster recovery 01/10/2020 [-] 3D printing of body parts is coming fast – but regulations are not ready 01/10/2020 [-] No One Can Agree How Fast Universe Is Expanding. New Measure Makes Things Worse. 01/10/2020 [-] Mars Loses Its Water Even Faster Than Anyone Thought 01/08/2020 [-] Ethan Brown went vegan, but missed fast food. So he started a revolution 01/06/2020 [-] The Samsung Galaxy Chromebook is Beautiful, Fast, and Expensive 01/06/2020 [-] MIT's New Tool Predicts How Fast a Chip Can Run Your Code 01/06/2020 [-] Realistic Breakfast Made in Dreams Will Make You Ravenous 01/06/2020 [-] On short notice, fast-response force flies to Mideast... 01/05/2020 [-] With hours' notice, US fast-response force flies to Middle East 01/05/2020 [-] Trump threatens Iran with 'fast and hard' response on 52 targets 01/04/2020 [-] A New Trump Rule Would Fast-Track Oil Pipelines Without Consideration of Climate Change 01/03/2020 [-] Catching criminals via FASTag? Why ever not! 01/03/2020 [-] Get Yourself a Memory Upgrade with These Fast RAM Options 01/01/2020 [-] In 24/7 food culture, periodic fasting gains followers... 12/30/2019 [-] Turkey fast-tracks bill to deploy troops to Libya 12/29/2019 [-] Russia Claims New Missile is 27 Times Faster Than Sound 12/28/2019 [-] Fast Retailing, the World' 12/27/2019 [-] Wages rising fastest in decade... 12/27/2019 [-] NEWS MOVES TOO FAST; 'BOMBSHELLS' QUICKLY FADE 12/27/2019 [-] Cannabis use rising faster among depressed Americans 12/26/2019 [-] Sony Can't Make Image Sensors Fast Enough To Keep Up With Demand 12/26/2019 [-] Intermittent fasting could have range of health benefits 12/26/2019 [-] Man Dead in Oklahoma City After 2-Hour Standoff at Fast Food Restaurant Police 12/24/2019 [-] Fast Fashion May Be Cheap, But It Comes at a Cost 12/24/2019 [-] THE FAST MILE... 12/22/2019 [-] Chris Lynn falls a few metres short of fastest Big Bash century 12/19/2019 [-] Fast & Furious Spy Racers Exclusive 'Boat Heist' Clip 12/19/2019 [-] Fast & Furious Spy Racers Exclusive Car Heist Clip 12/18/2019 [-] COMING SOON Fast 50 12/17/2019 [-] Tested The Fastest Broadband for Gaming in the UK 12/17/2019 [-] Daily Briefing Not so fast, FTSE 12/16/2019 [-] Once affordable, Phoenix rents among fastest rising in USA... 12/16/2019 [-] Govt plans to ensure faster availability of new drugs 12/16/2019 [-] Ultra-Fast Computers Could Avert Global Disaster 12/13/2019 [-] At 11.2%, Nov's air traffic growth fastest this year 12/13/2019 [-] Electronic Swiss franc? Not so fast, government says 12/13/2019 [-] 'No ifs, no buts, no maybes... But breakfast first' VIDEO 12/13/2019 [-] Fast and Furious Crossroads Game Announced 12/13/2019 [-] Fast & Furious Crossroads Reveal Trailer 12/11/2019 [-] Greenland's Ice Sheet Melting Seven Times Faster Than In 1990s 12/09/2019 [-] How both car owners & govt stand to gain from FASTags 12/06/2019 [-] Is the Universe Curved? Not So Fast. 12/05/2019 [-] TRUMP DO IT FAST... 12/05/2019 [-] California's economy will grow faster than the nation's, UCLA forecast predicts 12/05/2019 [-] Why the Indian fast bowlers are the world's best 12/04/2019 [-] One of Spain’s Fastest Runners Has an Urgent Message 12/04/2019 [-] Baby Yoda Funko POPs Are Selling Out Fast 12/04/2019 [-] Toronto home prices grow at fastest pace in two years 12/02/2019 [-] Tech, service firms gear up for FASTag 12/02/2019 [-] Is the Universe Curved? Not So Fast 12/02/2019 [-] Think fast 10 limited-time Cyber Monday deals on tech and gifts 12/01/2019 [-] CM orders fast-track trial in Hyd vet rape-murder 11/30/2019 [-] Act Fast Don't Miss These Best Buy Black Friday 2019 Deals 11/29/2019 [-] Govt extends mandatory FASTag roll-out date to Dec 15 11/29/2019 [-] Dopamine fasting is the latest craze in Silicon Valley — and it’s nonsense 11/29/2019 [-] 9 reasons to quit fast fashion this Black Friday 11/28/2019 [-] Parties agree to fast-track reform to arrest violence in Chile 11/28/2019 [-] Appeals court temporarily halts congressional subpoena for Don McGahn’s testimony — and fast-tracks hearing 11/27/2019 [-] There’s Just One Problem With Dems Fast-Tracking Impeachment 11/27/2019 [-] Pokemon Sword and Shield How to Make Money Fast 11/27/2019 [-] Ask Slashdot How Much Faster Is an ASIC Than a Programmable GPU? 11/26/2019 [-] US workforce dying faster than any other wealthy country... 11/26/2019 [-] 'Our fast bowlers are now the best in the world' 11/24/2019 [-] Silicon Valley's Newest Health Fad Dopamine Fasting 11/22/2019 [-] Millennials Seeing Health Decline Faster Than Gen X 11/22/2019 [-] Lego UCS Millennium Falcon Building the Fastest Hunk of Bricks in the Galaxy 11/21/2019 [-] Can 'dopamine fasting' really reboot brain? 11/21/2019 [-] Daily Briefing Not so fast 11/21/2019 [-] NY workers' premiums, deductibles growing faster than wages 11/21/2019 [-] How to Get Money Fast in Pokemon Sword and Shield 11/20/2019 [-] Blueprint for new, faster road to Sydney Airport revealed 11/20/2019 [-] The Bob Cesca Podcast A Rubber Suit and a Really Fast Car 11/18/2019 [-] 'World's fastest car' hits 628mph in warm-up for 1,000mph record attempt... 11/15/2019 [-] S&P Dow Jones, FTSE Russell could fast-track Aramco into indices 11/15/2019 [-] New, 'Hidden' State of Matter Coaxed into Being by Ultrafast Laser Flashes 11/15/2019 [-] 'Fast moving' fire threatens properties on Sydney's doorstep 11/12/2019 [-] This is the fastest star in the galaxy. It came from a black hole 11/12/2019 [-] Better blood test may spot heart attack faster 11/12/2019 [-] Transit System Chief Apologizes to Black Rider Detained for Eating a Breakfast Sandwich 11/12/2019 [-] Hospital sticker prices can rise faster than inflation 11/08/2019 [-] FAST FOOD RAMPAGE... 11/07/2019 [-] Trump Interior Nominee Fast-Tracked a “Deficient” Drilling Permit 11/07/2019 [-] Threadripper 3rd Generation is Here, Plus the Fastest Ryzen CPU Ever 11/06/2019 [-] The Best Mesh Wi-Fi Will Make Your Internet Fast Everywhere 11/06/2019 [-] How to Get the Fastest Horse in RDR2 11/04/2019 [-] Here are the fastest growing companies in New York 11/04/2019 [-] Second McDonald’s Executive Leaves Fast-Food Chain, One Day After CEO’s Firing 11/03/2019 [-] Does fast fashion have to die for the environment to live? 11/01/2019 [-] Gerringong Speedway once boasted Australia's fastest cars but now is a quiet beach park 11/01/2019 [-] The priceless history inside the Reagan Library, narrowly saved from a fast-moving wildfire 10/31/2019 [-] The World's Fastest-Thinning Glacier Identified 10/30/2019 [-] Police want faster data from the US, but new deal faces hurdles 10/30/2019 [-] LIVE VIDEO Firefighters in southern California battle fast-moving blaze near Ronald Reagan Library 10/30/2019 [-] How fast do you walk? Researchers say it could indicate whether you'll develop dementia 10/30/2019 [-] Nvidia Launches GeForce GTX 1660 Super For Faster 1080p Gaming 10/29/2019 [-] Celebrities flee as fast-moving fire ignites near Getty Centre in LA 10/28/2019 [-] LVMH woos Tiffany to tap fast-growing jewellery market 10/28/2019 [-] LVMH woos Tiffany to tap fast-growing jewelery market 10/26/2019 [-] China Innovation Index rises faster in 2018 10/24/2019 [-] Keanu Reeves May Join Fast and Furious Franchise 10/24/2019 [-] Large, fast-moving wildfire explodes in Sonoma County, prompting evacuations... 10/23/2019 [-] Quantum Supremacy From Google? Not So Fast, Says IBM. 10/23/2019 [-] First Fast Food Workers Union in US Prepares to Strike 10/21/2019 [-] 'World's fastest car' unveiled - Can reach speeds over 500mph! 10/19/2019 [-] Best time to exercise is before breakfast study 10/18/2019 [-] 2020 Democrats Are Burning Cash Faster Than They Can Raise It 10/18/2019 [-] Nashville Million-Dollar Homes Shrinking Fastest in USA... 10/18/2019 [-] Star Wars Jedi Fallen Order Won't Have Fast Travel 10/17/2019 [-] Margarita's Insta account demonstrates how she lives in the fast lane 10/16/2019 [-] Switch Media unveils fast-to-market OTT platform 10/15/2019 [-] Trump followed his gut on Syria. Calamity came fast. 10/13/2019 [-] Get a Lifetime VPN Subscription with Faste 10/11/2019 [-] STUDY Walking slowly is sign of aging fast... 10/11/2019 [-] Get a Lifetime VPN Subscription with FastestVPN for under £17 10/11/2019 [-] Fast cars, faster showers Motor racing fans told to save water at Bathurst 1000 10/10/2019 [-] India's automakers hit the fast lane overseas 10/10/2019 [-] 5G rollout will make 4G mobile network faster, expert says 10/09/2019 [-] Daily Briefing Going nowhere fast 10/09/2019 [-] Congress could fast-track Trump impeachment if he refuses to cooperate — here’s how 10/09/2019 [-] Cuomo says he's going to make the subway up to 50% faster 10/08/2019 [-] CSIRO teams with takeaway tycoon to make 'fake meat' fast food 10/08/2019 [-] Most Deepfakes Are Porn, and They're Multiplying Fast... 10/04/2019 [-] 'Sahm Rule' enters Fed lexicon as fast, real-time recession flag 10/01/2019 [-] Fast and Furious 'Candy-Ass Feud' May Finally Be Over 10/01/2019 [-] Subway forced to cough up workers' unpaid wages after crackdown on fast-food sector 09/30/2019 [-] How to Earn FUT Coin Fast in FIFA 20 09/26/2019 [-] Should L.A. Metro spend million so South Bay cities can have faster internet? 09/25/2019 [-] New climate report Oceans rising faster, ice melting more 09/25/2019 [-] One of the Fastest-Spinning Stars in the Galaxy Is Spitting Out Gamma Rays 09/25/2019 [-] Play Faster Than Everyone Else with The Best 240Hz Gaming Monitors 09/25/2019 [-] UK retail sales fall less fast in September CBI 09/24/2019 [-] Mitch McConnell caves to pressure and fast-tracks vote demanding whistleblower report 09/23/2019 [-] Borderlands 3 is 2K's Fastest-Selling Game Ever IGN Daily Fix 09/23/2019 [-] Borderlands 3 Is 2K's Fastest Selling Game Ever 09/20/2019 [-] Far-Right Terrorism Is the Fastest Growing Threat to the U.K., Police Say 09/20/2019 [-] A Stunning New Study Shows How Fast North America’s Birds Are Disappearing 09/19/2019 [-] Residential rents rise at fastest pace in years 09/19/2019 [-] Fast facts about the smoky haze smothering Southeast Asia 09/19/2019 [-] Despite slowdown, CEO pay grows faster than profits 09/19/2019 [-] Make Your Wireless Network Harder, Better, Faster, Stronger 09/18/2019 [-] Socials removing 'violent' content faster... 09/17/2019 [-] Tasmania news Cafe blaze in Hobart, youth charged over fast-food robbery 09/17/2019 [-] Firefox Moving To a Faster 4-Week Release Cycle 09/17/2019 [-] S.Korea removes Japan from fast-track trade 'white list' 09/14/2019 [-] Is this Australia's fastest-growing crop of asparagus? 09/14/2019 [-] How do we know how fast the universe is expanding? It's tricky 09/13/2019 [-] Fast fashion – this industry needs an urgent makeover 09/13/2019 [-] A New Report Says U.S. Airline Carbon Emissions Are Growing Fast 09/13/2019 [-] Philippine fast food specialist Jollibee 09/12/2019 [-] Legal challenge in Belfast against no-deal Brexit dismissed 09/12/2019 [-] Tesla tests Model S with an even faster 'Plaid' 09/11/2019 [-] WATCH Fast food worker mocks deaf woman who couldn’t use drive through speaker 09/11/2019 [-] Under house arrest with son, Naidu sits on day-long fast 09/09/2019 [-] We Visited Belgium, a Country that Banned Lootboxes Fast Travel 09/09/2019 [-] 'Dangerous and stupid' Toby Greene accused of eye-gouging as AFL fast-tracks case 09/07/2019 [-] World's fastest driverless car hits 175mph... 09/07/2019 [-] When it comes to fast train travel, the U.S. lags — badly 09/07/2019 [-] Aerial footage shows a fast-moving bushfire burning at Riverview Ipswich 09/07/2019 [-] AMAZON Pushes Fast Shipping but Avoids Responsibility for the Human Cost ... 09/06/2019 [-] Fast moving bushfire threatening homes in Lisdale 09/06/2019 [-] Peter Dutton rules out fast-tracking visas for Biloela Tamil family 09/05/2019 [-] Human cost of fast, free shipping... 09/05/2019 [-] Iran vows to build centrifuges for faster uranium enrichment 09/04/2019 [-] Iran to develop centrifuges for faster uranium enrichment 09/02/2019 [-] World's fastest ever road car breaks 300mph barrier... 09/02/2019 [-] Cheap and Fast SSDs are the Best Upgrade For Your Gaming System 08/31/2019 [-] The homespun haberdashery stores fighting off fast fashion 08/31/2019 [-] Intermittent Fasting May Be As Beneficial As Counting Calories 08/30/2019 [-] Never See a Loading Screen Again With These Fast SSDs 08/29/2019 [-] SIX FLAGS To Debut World's Tallest, Fastest, Longest Coaster... 08/29/2019 [-] Accused men ordered fast food meal while covered in dead man's blood 08/28/2019 [-] Ghost Recon Breakpoint The Fastest Way to Destroy a Behemoth Tank 08/28/2019 [-] FDA gives fast tr 08/28/2019 [-] Alternate-day fasting associated with weight loss 08/27/2019 [-] Adani urged to fast-track Queensland coal mine project 08/27/2019 [-] World's longest, tallest, fastest rollercoaster 155mph! 08/27/2019 [-] Magnetar May Hold Clues to the Mystery of Fast Radio Bursts 08/26/2019 [-] Earth warmed faster in t 08/26/2019 [-] Customers can make fast-food combo meals healthier 08/24/2019 [-] TESLA driver appears FAST ASLEEP as car zips along at 70 mph... 08/21/2019 [-] Science reveals key to playing England's fast-bowling sensation Jofra Archer 08/21/2019 [-] Iceborne Lets You Boost Through Monster Hunter World Fast 08/21/2019 [-] Terrorists turn to Bitcoin for funding. They're learning fast 08/20/2019 [-] Earth warmed faster in the last few decades t 08/20/2019 [-] The Truth About Faster Internet It's Not Worth It 08/20/2019 [-] Rail link between Kashmir, rest of India on fast track 08/20/2019 [-] Terrorists Turn To Bitcoin For Funding, and They're Learning Fast 08/20/2019 [-] Amy's quest to find the fastest commute 08/19/2019 [-] Sign Language Interpreter Keeping Up With the Fastest Rapper Ever Deserves Her Own Title 08/19/2019 [-] 'Moving fast' Musk's S 08/16/2019 [-] Oil patch bits Airframes Alaska voted #1 fastest growing company in Alaska 08/15/2019 [-] Secret Project techno festival returns to a fast-changing Chinatown 08/14/2019 [-] 'Time is of the essence' Calls to fast track funding for Jabiru 08/13/2019 [-] STUDY Areas With More Fast Food Restaurants Report More Heart Attacks... 08/13/2019 [-] Column FasTrak agencies may have sold out your privacy. Now they want legal immunity 08/09/2019 [-] Update Injured Fast and Furious 9 Stuntman Leaves Intensive Care 08/07/2019 [-] Native bees die three times faster from honey bee parasite, researchers find 08/07/2019 [-] ACLU Sues Over Trump’s Fast-Tracked Deportations Policy 08/06/2019 [-] OK KO! Let's Be Heroes Sonic & Tails Teach KO How to Go Fast 08/06/2019 [-] Making the most of that fast food meal 08/06/2019 [-] New Stars on the Cosmic Block Are Fast, Bright and Pulsating 08/03/2019 [-] Fast and Furious Actors Dic 08/02/2019 [-] Fast and Furious Actors Dictate How Much They Get Beat Up in Fight Scenes 08/02/2019 [-] 12 best fast-casual lunches, from top world cuisines 08/02/2019 [-] Kangaroos start slow but finish fast to beat Hawks 08/01/2019 [-] Who the Hobbs and Shaw Cast Want Added to the Fast and Furious Series 08/01/2019 [-] Fast and Furious spin-off is both improbable and improbably boring 08/01/2019 [-] Johnson holds Belfast talks on Brexit backstop riddle 07/31/2019 [-] Fast & Furious Presents Hobbs & Shaw Review 07/31/2019 [-] PM Johnson holds Belfast talks on Brexit backstop riddle 07/31/2019 [-] PlayStation 4 Becomes Fastest Console To Sell 100 Million 07/30/2019 [-] The Fast and the Furious Presents Hobbs and Shaw Their Story So Far 07/30/2019 [-] Home Affairs admits to deal with Crown to fast-track visas for Chinese visitors 07/28/2019 [-] We only have one planet, but we're still using it up too fast 07/26/2019 [-] The Ice Is Melting Even Faster Than They Thought 07/25/2019 [-] These Are the Fastest-Orbiting Stars Ever Discovered, and They're Spiraling to Their Deaths 07/24/2019 [-] Many Animals Can't Adapt Fast Enough To Climate Change 07/23/2019 [-] Trump Expands Fast-Track Deportation Authority Across U.S. 07/23/2019 [-] Fast and Furious 9 Filming Halted Due to Accident IGN News 07/22/2019 [-] Fast and Furious 9 Stuntman Injury Halts Production 07/22/2019 [-] Trump Administration Expands Fast-Track Deportation Across the U.S. 07/22/2019 [-] Slack's Desktop App Now Launches 33% Faster, Uses 50% Less Memory 07/22/2019 [-] It's a dog's breakfast Racing minister leaves Hadley hanging 07/22/2019 [-] Asus Upgrades the ROG Phone 2 With a Faster CPU and 120Hz Screen 07/21/2019 [-] Arson suspected in fast-moving San Pedro brush fire 07/20/2019 [-] Arctic Summer Melt Shows Ice Is Disappearing Faster Than Normal 07/19/2019 [-] Rick and Morty Season 5 Will Arrive Much Faster than Season 4 07/19/2019 [-] Locally Run ISPs Offer the Fastest Broadband In America 07/19/2019 [-] 'We have been a bit like a fast tortoise' 07/17/2019 [-] Robots are scaling warehouse shelves to get stuff to you faster 07/17/2019 [-] South American bloc eyes fast-track for EU trade deal 07/16/2019 [-] Greenland’s Superfast ‘Ice Slides’ Could Be Bad News for Climate Change 07/14/2019 [-] 'YOU CAN'T LEAVE FAST ENOUGH' 07/13/2019 [-] Amazon Becomes Fastest-Growing Music Streaming Service 07/12/2019 [-] Best SSD 2019 The Fastest Solid-State Drive 07/11/2019 [-] Best SSD 2019 The Fastest Solid-State Drive for Your Gaming PC 07/10/2019 [-] Our Entire Food System Needs to Change—and Fast 07/10/2019 [-] How This Huge, Superfast Asteroid Stayed Hidden in Near-Earth Orbit 07/08/2019 [-] Fast and Furious 9 Charlize Theron and Helen Mirren Confirmed 07/04/2019 [-] Destiny 2 How to get Lumina and Rose Fastest Guide 07/03/2019 [-] Subway got too big, too fast. And franchisees paid the price 07/01/2019 [-] The ‘Trump Doctrine’ is sinking fast 06/28/2019 [-] Fast & Furious Presents Hobbs & Shaw Final Trailer 06/27/2019 [-] Mysterious fast radio burst traced to galaxy 3.6 billion light-years away... 06/27/2019 [-] Italy deploys special powers on Fastweb-Samsung 5G project 06/27/2019 [-] Trump Fast Tracks GMOs, More Synthetic Foods Coming 06/25/2019 [-] How fast is too fast? Paraplegic man pulled over by police for hotted-up wheelchair 06/25/2019 [-] Fast & Furious 9 Begins Filming Vin Diesel and Cast Share Photos 06/24/2019 [-] Raspberry Pi 4 Featuring Faster CPU, Up To 4GB of RAM Launched 06/23/2019 [-] The fast-changing future of real estate 06/20/2019 [-] Greenland ice sheet melting faster than thought study 06/19/2019 [-] Fast and Furious 9 cars arrive in Krabi 06/19/2019 [-] Lisa Millar to replace Virginia Trioli on News Breakfast from August 06/15/2019 [-] Trump’s hamfisted attempt to wag the dog with Iran unraveled fast 06/15/2019 [-] Mississippi fast food cashier ‘terminated immediately’ for ugly racist slur on customer’s receipt 06/14/2019 [-] SCIENTISTS Fast food could cause dementia... 06/14/2019 [-] Fast & Furious Spy Racers Season 1 First Look Trailer 06/13/2019 [-] NBN 'misleading' Canberrans already connected to fast broadband 06/13/2019 [-] Fast and Furious to be filmed in Thailand 06/12/2019 [-] The Next Wave of Amiibo Are Selling Out Fast 06/11/2019 [-] Ericsson Mobility Report 5G uptake even faster than expected 06/10/2019 [-] Intermittent fasting what’s the best method? 06/10/2019 [-] Selling Out Fast Cyberpunk 2077 Collector's Edition Is Up for Preorder 06/08/2019 [-] John Cena Officially Joins Fast and Furious 9 06/04/2019 [-] Godzilla Grew 30 Times Faster Than Any Organism on Earth. Here's Why. 06/03/2019 [-] Arctic Is Thawing So Fast Scientists Are Losing Their Measuring Tools 06/01/2019 [-] Labor Corangamite MP says 'first job' will be ensuring fast rail promise honoured 05/31/2019 [-] India loses the fastest growing economy tag to China 05/30/2019 [-] Will APPLE's roots hold fast amid political storm? 05/29/2019 [-] New Report Warns Planet May Be Warming Twice as Fast as Expected 05/29/2019 [-] Samsung's New Chips Support 100W USB-C Fast Charging 05/25/2019 [-] Young homebuyers scramble as prices rise faster than incomes... 05/25/2019 [-] Young homebuyers scramble as prices rise faster than incomes 05/22/2019 [-] Dutch minister cut gas production at Groningen faster 05/22/2019 [-] Airlines are canceling mistake fares faster but some errors still get through 05/21/2019 [-] People Were Driving Way Too Fast So This Dancing Six-Year-Old Mini ‘Cop’ Stepped In 05/20/2019 [-] California’s Fires Hit Rich and Poor Communities. Guess Which Ones Are Recovering Faster? 05/16/2019 [-] Mexican fast-food major Taco Bell will be in India 05/15/2019 [-] Thief who pinched rare million Ferrari was fast, the salesman furious 05/15/2019 [-] Tim Hortons testing line of Beyond Meat breakfast sandwiches 05/14/2019 [-] Texas Senate revives, fast-tracks religious liberty bill that LGBTQ Caucus killed in the House 05/13/2019 [-] New Supercomputer Will Span Continents, Outrace World's Fastest 05/12/2019 [-] Best RAM 2019 The Fastest Memory to Speed Up Your PC 05/11/2019 [-] How DARPA's Experimental R3D2 Satellite Was Built Super Fast 05/11/2019 [-] Fast Eddys, a pioneer of 24-hour dining long before McDonald's, finally closes its doors 05/10/2019 [-] Citizenship fast-tracked for teens bound for competitions in the US 05/10/2019 [-] 'World's fastest bullet train' starts test runs in Japan... 05/09/2019 [-] Urban Trees Grow Fast and Die Young 05/09/2019 [-] Ministry fast-tracks schoolgirl’s citizenship ahead of US Olympiad 05/08/2019 [-] Fast food offered to Tasmanian school students 05/07/2019 [-] NBA star seeks Ramadan fasting advice for playoffs... 05/07/2019 [-] World's Fastest Supercomputer Coming To US in 2021 From Cray, AMD 05/07/2019 [-] Ferrari shares race ahead after fast start to 2019 05/04/2019 [-] Muslim fasting month of Ramadan to start Monday in Saudi Arabia 05/04/2019 [-] New blood test diagnoses preeclampsia faster, reduces risks 05/03/2019 [-] Key congressman vows to fund and fast-track Gateway program 05/02/2019 [-] Airbus sees Bombardier's Belfast plant as 'key supplier' 05/01/2019 [-] Borderlands 3 Fast Travel Explained 05/01/2019 [-] Stars aligned for Catalan separatists? Not so fast 05/01/2019 [-] Indonesia to Move Capital Away From Fastest-Sinking Megacity 05/01/2019 [-] Republicans want to make discrimination against women legal — and they’re moving fast 05/01/2019 [-] Virginia Trioli to leave News Breakfast for major gig on ABC Radio Melbourne 04/30/2019 [-] 'Under Mamata, Bengal grew faster than India' 04/29/2019 [-] Hepatitis A spreading fast in Florida 04/29/2019 [-] Fast and Furious 9 Adds John Cena to Cast IGN News 04/29/2019 [-] John Cena Joins Fast and Furious 9 04/28/2019 [-] The Fast Arctic Melt Could Cost Us Trillions 04/26/2019 [-] Days Gone How to Fast Travel and 20 Other Essential Tips 04/26/2019 [-] The Universe Is Moving Too Fast and Nobody Knows Why 04/26/2019 [-] Measurements Confirm Universe Is Expanding Faster Than Expected 04/26/2019 [-] Universe expanding faster than thought, no one knows why... 04/26/2019 [-] The Universe Is Expanding So Fast We Might Need New Physics to Explain It 04/25/2019 [-] Cox Cable Testing a Form of 'Fast Lane' Internet For Gamers 04/25/2019 [-] N.Y. says not so fast on congestion-price break for toll payers 04/25/2019 [-] China leads U.S. on potent super-fast missiles 04/25/2019 [-] F1 understudies could be street wise on fast Baku circuit 04/24/2019 [-] Irish striker nets EPL's fastest ever goal 04/23/2019 [-] Australia was promised superfast broadband with the NBN. This is what we got. 04/23/2019 [-] Skipping breakfast tied to higher death risk... 04/18/2019 [-] Central Florida cities among fastest growing... 04/18/2019 [-] Fast & Furious Presents Hobbs & Shaw Trailer 2 04/18/2019 [-] Fast food chain tests CBD-infused burger... 04/16/2019 [-] Samsung Chips Will Get Faster and Easier on Your Battery in 2020 04/11/2019 [-] COMING SOON Crain's Fast 50 04/09/2019 [-] Global Warming Is Shrinking Glaciers Much Faster Than Scientists Thought, Study Finds 04/07/2019 [-] Will Moorhouse is fighting hunger one breakfast at a time 04/06/2019 [-] Fleet Week ship tours filling fast 04/04/2019 [-] Russian Cargo Ship Launches on Superfast Trip to Space Station 04/04/2019 [-] How are vegans responding to fast food chains hopping on the meat-free bandwagon? 04/03/2019 [-] Analysis Is Victoria really getting for fast rail? 04/03/2019 [-] Beto raising money faster than every other Dem... 04/03/2019 [-] Will Fast-Food Diners Pay an Extra Buck for Silicon Valley Soy Patties? 04/02/2019 [-] Ebola outbreak spreading fast... 04/01/2019 [-] Congo Ebola outbreak spreading faster than ever WHO 03/28/2019 [-] Spider-Man's Hunt Is Going Nowhere Fast 03/26/2019 [-] Untreated diabetes triggers Alzheimer's signs at a faster rate 03/25/2019 [-] New technology counts fruit trees 6,000 times faster than humanly possible 03/22/2019 [-] Will Scott Morrison's fast rail plan help him save seats in Victoria? 03/21/2019 [-] Federal Government pledges for Melbourne-Geelong fast rail 03/21/2019 [-] LIST Fastest-shrinking cities in USA... 03/21/2019 [-] Franklin Regional invites senior citizens to free breakfast in May 03/21/2019 [-] Cloud services provider Fastly taps bank for IPO sources 03/20/2019 [-] Fast Food Delivers Even More Calories Than Decades Ago 03/20/2019 [-] Slow Down! Eating Too Fast Can Pile on the Pounds 03/20/2019 [-] U.S. Suicide Rates Rising Faster Outside Cities 03/20/2019 [-] Try This Healthy Makeover for a Favorite Fast Food 03/20/2019 [-] How to Stop Snoring Fast 03/17/2019 [-] The official breakfast cereal power rankings Part I 03/15/2019 [-] What the New Egg Study Means for the Beloved Breakfast Food 03/15/2019 [-] CSR Racing 2 Fast and Furious Trailer 03/15/2019 [-] Level Green Lions to serve breakfast Saturday 03/14/2019 [-] New brand of fast food under the microscope after scientists speed up crop production 03/14/2019 [-] The Asteroid Bennu Keeps Spinning Faster. And Scientists Aren't Sure Why 03/13/2019 [-] Fast start, highlight-reel goal seal South Fayette’s PIHL Class A semifinal win 03/12/2019 [-] Fast food chains agree to end “no poach” agreements 03/12/2019 [-] Scooter startup Bolt nabs Bolt, the world's fastest man 03/11/2019 [-] Scientists know that when a blue whale poos, you have to move fast 03/11/2019 [-] WWE Fastlane All the Match Results 03/11/2019 [-] WWE Fastlane 2019 Live Blog and Results 03/10/2019 [-] Sydney Airport fast running out of space analysts 03/08/2019 [-] Deer Lakes principal recognized for healthy school breakfast initiatives 03/07/2019 [-] Germany Woman cries ‘murder’ for faster response to car blocking garage 03/07/2019 [-] Top 10 fastest-growing, European destinations, Chinese tourists 03/06/2019 [-] FACEBOOK reputation sinking fast... 03/05/2019 [-] A ban on bans of plastic straws? Not so fast, Florida Senate says 03/05/2019 [-] Influence of centrists fading fast... 03/05/2019 [-] This man fasts 17 to 24 hours a day. It's changed his life... 03/04/2019 [-] Businesspeople 'should help fast, sustainable growth' 03/04/2019 [-] Trump celebrates North Dakota football champs with fast food 03/04/2019 [-] Out & About NAACP breakfast fills the air with prayer and praise 03/04/2019 [-] Study Fast Food Calorie Content Has Steadily Increased Over the Past 30 Years 03/01/2019 [-] Fast bikes, nudity and no men inside a wild weekend for full-throttle queens 02/28/2019 [-] World's tallest, longest, fastest dive rollercoaster set to open... 02/28/2019 [-] Motor racing-Leclerc goes fastest yet in F1 testing 02/24/2019 [-] Mt. Lebanon boys start fast in win over Fox Chapel 02/23/2019 [-] AI Taking Fast Food Orders 02/22/2019 [-] VIRGIN conducts highest, fastest test flight yet... 02/22/2019 [-] At fast food drive through person taking order - not person at all... 02/22/2019 [-] Internet access bringing fast changes to Cuba... 02/22/2019 [-] Outdoors Xtras Electronic hand warmer, cash advice and breakfast recipe 02/22/2019 [-] Fast start sends Blackhawk past Southmoreland and into WPIAL 4A semifinals 02/21/2019 [-] 17 people homeless after fast-spreading McKees Rocks fire 02/21/2019 [-] Income inequality is rising so fast, data can’t keep up 02/21/2019 [-] Nancy Pelosi will act fast to terminate Trump’s national emergency report 02/19/2019 [-] Emergency warning issued for fast-moving bushfire in WA's South West 02/18/2019 [-] Worry About Debt? Not So Fast, Some Economists Say 02/17/2019 [-] million Albuquerque electric bus system going nowhere fast... 02/17/2019 [-] India's fastest train falters on its first trip 02/16/2019 [-] Fast start leads Duquesne past George Washington 02/16/2019 [-] Day after launch, India's fastest train breaks down 02/15/2019 [-] Vande Bharat Express, India's fastest train, flagged off 02/14/2019 [-] Electric car sector crying out for fast-charging sites, industry body says 02/14/2019 [-] Every day is Valentine's Day for the fast-breeding endangered bilby 02/13/2019 [-] The official fast food French fry power rankings 02/13/2019 [-] ‘Triggerman’ convicted in ‘Fast and Furious’ US agent murder 02/13/2019 [-] Paedophile's release to depend on fast-tracked psychiatric report 02/12/2019 [-] Eating breakfast may not help you to lose weight Study 02/12/2019 [-] Iowa Appeals Court Upholds Traffic Stop Of Car That Looks Fast 02/12/2019 [-] The British cities where it is now faster to cycle than drive 02/11/2019 [-] Chimps use branch to make ladder, escape Belfast Zoo 02/11/2019 [-] Naidu begins fast to demand special status for AP 02/09/2019 [-] Chinese market drives sales growth of US fast food company in 2018 02/08/2019 [-] Found! Fastest-Orbiting Asteroid Zips Around Sun in Just 165 Days 02/08/2019 [-] 'It was fast and hot' Homeowner's shock as bushfire roared over his fence 02/08/2019 [-] Chinese market drives sales growth of US fast food company 02/07/2019 [-] Trump uses National Prayer Breakfast speech to undermine civil rights of LGBT people 02/07/2019 [-] New York fast-food workers’ payroll law survives free speech challenge 02/06/2019 [-] Breakfast may not help keep pounds off 02/05/2019 [-] Hazare calls off fast; says happy with outcome of talks with CM 02/05/2019 [-] Alysha McNair overcomes 'fast food addiction' to lose 182 LBS 02/04/2019 [-] Earth's Magnetic North Pole Was Moving So Fast, Geophysicists Had to Update the Map 02/04/2019 [-] ‘We have very fast airplanes’ Trump’s bewildering foreign policy pronouncements go far beyond self-parody 02/04/2019 [-] The World's Fastest Supercomputer Breaks an AI Record 02/03/2019 [-] Hazare's fast enters 5th day, villagers block state highway 02/01/2019 [-] Watch a Super-Fast 3D Printer Scientists Call the “Replicator” 02/01/2019 [-] Fast and Furious Presents Hobbs and Shaw First Trailer 02/01/2019 [-] On Day 3 of fast, Anna Hazare's BP, blood sugar levels spike 02/01/2019 [-] GDP growth fastest in last 5 years Goyal 01/31/2019 [-] Hyperfast Shock Waves from a Supernova Heat Atoms to Blazing-Hot Temperatures 01/31/2019 [-] Carrying on the Lillee legacy, Jhye Richardson returns WA bowling to the fast lane 01/31/2019 [-] Why skipping breakfast isn’t as bad as you think 01/31/2019 [-] Most Important Meal? Review Questions Whether Breakfast Is Really Good for Weight Loss 01/31/2019 [-] Breakfast is NOT the most important meal of the day 01/31/2019 [-] First Trailer for Fast & Furious Presents Hobbs & Shaw Drops Friday 01/31/2019 [-] UK car output falls at fastest rate since recession 01/31/2019 [-] Electronics Are 'the Fastest-Growing Waste Stream in the World' 01/31/2019 [-] Is Breakfast Really Good For You? Here’s What the Science Says 01/29/2019 [-] Kate reveals that nine-month-old Louis is 'already a fast crawler' 01/29/2019 [-] Many of Clemson’s black players refused to attend Trump’s fast food feast 01/29/2019 [-] Fast food apps are fuelling childhood obesity 01/28/2019 [-] Fears raised as Superbug spread far and fast... 01/28/2019 [-] Superbug From India Spread Far and Fast, Study Finds 01/28/2019 [-] Metal hunters find WWII-era grenade, shut down fast food restaurant 01/28/2019 [-] Huge hunt is launched as a red PANDA goes missing from Belfast Zoo 01/27/2019 [-] China tests new generation of faster, bigger maglev 01/27/2019 [-] Not so fast Most Germans favor speed limits on the Autobahn 01/26/2019 [-] Roman Reigns Joins The Rock in Fast and Furious Spinoff IGN News 01/25/2019 [-] Roman Reigns Joins The Rock in Fast & Furious Spin-Off 01/23/2019 [-] Pact advances plan for faster Bronx access to Penn Station 01/23/2019 [-] Fast Color Trailer #1 01/22/2019 [-] City fast-tracks crackdown on buildings on stilts 01/22/2019 [-] Where jobs are growing the fastest in NYC 01/22/2019 [-] Run Faster! Treadmill Generating Electricity... 01/22/2019 [-] ‘A Tipping Point.’ Greenland’s Ice Is Melting Much Faster Than Previously Thought, Scientists Say 01/22/2019 [-] Greenland losing ice mass faster than previously thought, study finds 01/22/2019 [-] IMF and CEOs say the global economy is slowing faster than expected 01/21/2019 [-] Panel approves PPP fast-track investment in Orange Line and housing projects 01/21/2019 [-] Chris Evans kicks off his new Virgin Radio breakfast show 01/16/2019 [-] Chris Pratt Is Doing the Daniel Fast Diet. But Is It Healthy? 01/15/2019 [-] The art of going downhill fast 01/15/2019 [-] With staff furloughed, Trump feeds CLEMSON fast food feast... 01/15/2019 [-] Fast food on the menu as Trump congratulates Clemson football team 01/15/2019 [-] President Trump Feeds College Football National Champions Fast Food and Twitter Can’t Stomach It 01/15/2019 [-] Antarctica Is Losing Ice 6 Times Faster Today Than in 1980s 01/14/2019 [-] Not so fast Cuomo’s L-train turnaround is no quick solution 01/14/2019 [-] We need a change and we need it fast 01/14/2019 [-] Not so fast Cuomo’s L-train turnaround is no quick fix 01/13/2019 [-] In Fast-Aging Japan, Elder Care Is a High-Tech Pursuit 01/11/2019 [-] Christian charity provided money to Russians attending National Prayer Breakfast amid influence campaign report 01/11/2019 [-] State of the art 3D printer makes objects 100 times faste 01/11/2019 [-] Oceans warming faster than thought, new research finds 01/11/2019 [-] The Oceans Are Warming Faster Than We Thought, a New Study Says 01/11/2019 [-] Ocean warming faster than thought, new research finds 01/11/2019 [-] Ocean Warming is Accelerating Faster Than Thought, New Research Finds 01/11/2019 [-] Something strange going on as Earth's magnetic pole fast on the move... 01/10/2019 [-] Ocean temperatures rising faster than previously... 01/10/2019 [-] Ocean temperature data shows warming is accelerating faster than we thought 01/10/2019 [-] Federal Court Upholds Traffic Stop Over Fast Blinker 01/09/2019 [-] Not so fast school asked to review casual clothes experiment 01/08/2019 [-] Fast cars and rickety bridges as 'The Grand Tour' returns 01/08/2019 [-] Fast cars and rickety bridges as 'The Grand Tou 01/07/2019 [-] Bolton counters Trump on fast US troops pullout from Syria 01/06/2019 [-] Will BitTorrent's Paid 'Fast Lane' Violate 'Net Neutrality'? 01/05/2019 [-] 'Fast Eddie' hosts sex party days after bouncer's murder 01/04/2019 [-] Zelda BotW How to Make Money Fast 01/02/2019 [-] Jets intend to move fast in filling head coach slot 01/01/2019 [-] Mattis’ final words from Pentagon ‘Hold fast’ with allies 12/29/2018 [-] Gene-Edit to Make Babies Smarter, Faster, Taller? Most Americans Say No. 12/29/2018 [-] Smash Bros. Ultimate How to Unlock Every Character Fast 12/29/2018 [-] Nova breakfast team smoked out of Subiaco studio as arsonists target Adultshop.com owner's bar 12/29/2018 [-] Skipping breakfast increases diabetes risk... 12/24/2018 [-] Chris Evans thanks fans during his last breakfast show on BBC Radio 2 12/23/2018 [-] How fast can e-scooters go, and where are you allowed to ride them? 12/21/2018 [-] Lamborghini made the world’s fastest SUV — and it kinda makes sense 12/21/2018 [-] Canada’s economy grows faster than expected 12/21/2018 [-] Former BBC Breakfast host Bill Turnbull, 62, makes return to TV 12/20/2018 [-] Xbox Should Start Fast in 2019 Unlocked Highlight 12/20/2018 [-] India's fastest train pelted with stones during trial run 12/20/2018 [-] Thrifty Thurston Celebrates with Breakfast and Brunch on New Year’s Day 12/20/2018 [-] Orlando-area rents rising faster than a 12/20/2018 [-] Orlando-area rents rising faster than any other big city 12/19/2018 [-] 'Serbia can move even faster on its path to EU' 12/19/2018 [-] Heat opener Harris smashes fastest WBBL century off just 42 balls 12/18/2018 [-] Driver who smoked ice for breakfast jailed for killing pharmacist in crash 12/18/2018 [-] The fintech way Robinhood Checking moved fast and broke 12/17/2018 [-] Regional NBN users to get faster download speeds, but upload speeds to halve 12/17/2018 [-] Goldman's fast-falling stock means less gold, man 12/14/2018 [-] Ford's new Mustang Bullitt is fun, fast and will turn heads 12/14/2018 [-] 'India is still fastest growing large economy' 12/13/2018 [-] Struggling Fastjet meets conditions to raise cash 12/13/2018 [-] Oslo is a Secret Haven for Gamers Fast Travel/t 12/13/2018 [-] 'Blockchain Developer' is the Fastest-Growing US Job 12/13/2018 [-] Oslo is a Secret Haven for Gamers Fast Travel 12/12/2018 [-] This Dracula ant is nature's fastest mover on record 12/11/2018 [-] Facial recognition technology speeding up fast food service 12/10/2018 [-] Survey finds fast-food workers spat on, abused and threatened 12/07/2018 [-] Animals are adapting to cities faster than humans are, evolutionary biologist says 12/07/2018 [-] India's 10 fastest growing cities; Surat tops 12/06/2018 [-] 'Not going to wait' Berejiklian pushes for fast rail network without Federal Government 12/05/2018 [-] Greenland Is Melting Faster Than Ever 12/05/2018 [-] ABC Radio Brisbane's breakfast team gets a shake-up 12/04/2018 [-] Ambulances show up faster in wealthy U.S. neighborhoods 12/03/2018 [-] House prices record fastest falls since GFC 12/02/2018 [-] Red Dead Online How to Earn XP Fast 12/01/2018 [-] Red Dead Online How to Level Up Fast 11/28/2018 [-] How to Fast Travel in Red Dead Online 11/28/2018 [-] From seed to table in two weeks The fast turnaround crop in high demand 11/28/2018 [-] Live 'The window is closing fast' Qld Premier pleads with residents to leave 11/27/2018 [-] Top 10 fastest growing city destinations 11/27/2018 [-] E-tickets for fast trains to go national 11/23/2018 [-] Impeach president? House Dem say not so fast... 11/21/2018 [-] Luxury homes selling fast developer 11/21/2018 [-] Bombardier cuts 490 jobs at Belfast plant 11/20/2018 [-] 'Fast and furious' dust storm hits regional NSW 11/20/2018 [-] Killing Plants Is the Fastest Way to End the World 11/20/2018 [-] US to remain 'steadfast partner' of Saudi Arabia, Trump says 11/17/2018 [-] Goldenboy Thinks Man of Steel is a Good Movie Fast Travel 11/16/2018 [-] Serbian central bank reports fastest GDP growth in 10 years 11/16/2018 [-] Florida hand recount begins, and Democrats’ hopes fade fast 11/16/2018 [-] Prime Minister for fair dinkumness is losing election options fast 11/15/2018 [-] Morocco inaugurates Africa's fastest train 11/14/2018 [-] Man spots dog drinking pint outside Belfast pub Errigle Inn 11/13/2018 [-] Pilots report seeing 'very fast' UFO above Ireland 11/13/2018 [-] UK pay growth fastest since 2008 as firms face staff shortages 11/11/2018 [-] Palestinian Propaganda “Own Goal” Breakfast Edition 11/09/2018 [-] JAN MOIR Why do grieving men find love so much faster than widows 11/09/2018 [-] Hundreds of Buildings Destroyed as a Fast-Moving Wildfire Rips Through Northern California 11/09/2018 [-] How to Fast Travel in Red Dead 2 11/09/2018 [-] Tens of Thousands Flee Fast-Moving Northern California Fire 11/07/2018 [-] Oceans Are Heating Up Faster Than We Thought 11/07/2018 [-] Sydney-to-Canberra 'very fast train' the focus for Snowy Hydro Fund 11/06/2018 [-] Factbox Fast facts about the U.S. elections 11/05/2018 [-] Senior Citizens Replacing Teens at Fast-Food Joints... 11/05/2018 [-] Palestinians Rail Against Jerusalem-Tel Aviv Fast Train Just Because 11/03/2018 [-] India fastest growing Asian economy 11/03/2018 [-] STUDY More money you make, more fast food you eat... 11/02/2018 [-] Gravity Assist Podcast Planetary Defense with Kelly Fast 11/02/2018 [-] US added 250,000 jobs, wage growth fastest since 2009 11/02/2018 [-] Oceans heating faster than previously thought study 11/02/2018 [-] How to Fast Travel in Red Dead Redemption 2 11/01/2018 [-] A Deadly, Fast-Spreading Form of Super-Ice Could Be Killing Off Alien Life-Forms 10/31/2018 [-] U.S. workers get fastest wage increase in a decade — if you ignore inflation 10/31/2018 [-] Depression is rising faster than any other condition jumping 10/31/2018 [-] Workers' Pay Rises at Fastest Rate in a Decade 10/31/2018 [-] Airbus's Big Problem It Can't Make Jets Fast Enough 10/31/2018 [-] NSW Government reveals 'very fast train' corridor to slash journey between Sydney and Canberra 10/30/2018 [-] Bentley reveals the 'world's first' in-car superfast Wi-Fi network 10/30/2018 [-] 7 Best Ways to Make Money Fast in Red Dead 2 10/29/2018 [-] Australians to be fast-tracked through UK immigration from 2019 10/29/2018 [-] EasyJet `moving fast´ in developing electric planes 10/27/2018 [-] Yelm’s Magnetic Appeal Rural Community is State’s 9th Fastest Growing 10/27/2018 [-] DAVID JONES on why Britain is on a fast-food track to obesity 10/26/2018 [-] Why Indigo is fastest growing airline on the planet 10/25/2018 [-] Smoke alarms with mom's voice wake kids up faster 10/25/2018 [-] ROUNDUP Dozens more breakfast foods test positive for weed killer... 10/25/2018 [-] 'Cancer-causing' weed killer found in DOZENS more breakfast cereals 10/24/2018 [-] Baby died following MRSA outbreak at Belfast hospital 10/23/2018 [-] McDonald's to unveil new breakfast items in U.S. 10/23/2018 [-] Cheetahs The Fastest Land Animals 10/22/2018 [-] Man kills wife, himself at Doral fast food restaurant 10/21/2018 [-] U.S., EU Trade Teams Seek Fast Results and Big Savings 10/21/2018 [-] State hospitals gear up for fast-track responses 10/19/2018 [-] MiSo 3 Years Later Still Fit. Fast. Fresh. And Fun 10/17/2018 [-] Tented Camps Fast Becoming World's Best Resorts... 10/17/2018 [-] Veterans have breakfast together at Goolma station 10/16/2018 [-] 'Alien' fast radio bursts found extremely close to Earth 10/16/2018 [-] Wages grow at their fastest rate since the financial meltdown 10/16/2018 [-] Meet the 50 fastest-growing companies in New York 10/14/2018 [-] Meet the 2018 Fast 50 companies 10/13/2018 [-] Old Salts Sharing Their Stories One Saturday Breakfast at a Time 10/13/2018 [-] World's Fastest Camera Shoots 10 Trillion Frames a Second 10/12/2018 [-] Labor supports fast-tracking the tax cuts for small to medium-sized businesses 10/12/2018 [-] Labor supports fast-tracking tax cuts for small to medium-sized businesses 10/12/2018 [-] First Look at Idris Elba in Fast and Furious Spinoff 10/11/2018 [-] Analysis Unwritten rules in sport are fast becoming a thing of the past 10/11/2018 [-] Veteran Ganga activist G D Agarwal dies after fasting for 111 days 10/11/2018 [-] Unwritten rules in sport are fast becoming a thing of the past 10/11/2018 [-] Super-Fast Stars in the Milky Way May Be Visitors from Beyond 10/11/2018 [-] New Kangaroo Island fast ferry hits dredging cost snag 10/11/2018 [-] Mysterious Deep-Space Flashes 19 More 'Fast Radio Bursts' Found... 10/10/2018 [-] Fact check Is Australia's population the fastest growing in the developed world? 10/10/2018 [-] Mysterious Deep-Space Flashes 19 More 'Fast Radio Bursts' Found 10/10/2018 [-] As Midterms Approach, Fast-Food Workers Plan Strikes in Battleground States 10/10/2018 [-] Scott Morrison promises to fast track new business tax cuts 10/09/2018 [-] Trump renews Fed criticism, says raising rates too fast 10/09/2018 [-] Working to get girls fastpitch softball sanctioned in Wyoming 10/05/2018 [-] Firefox To Support Google's WebP Image Format For a Faster Web 10/05/2018 [-] UK productivity grows at fastest rate since late 2016 10/04/2018 [-] Assassin's Creed Odyssey How to Level Up Fast 10/04/2018 [-] How to Level Up Fast in Assassin's Creed Odyssey Best Way to Play 10/03/2018 [-] Charities spending millions cleaning up fast fashion graveyard 10/03/2018 [-] Fast Striker Gameplay Trailer 10/03/2018 [-] STUDY 1 in 3 eat fast food EACH DAY... 10/03/2018 [-] Almost 40% of Americans Eat Fast Food on Any Given Day, Report Says 10/03/2018 [-] China's software sector sees faster growth 10/02/2018 [-] The country losing residents faster than Syria, as inflation hits 1,000,000 per cent 10/02/2018 [-] Anna Hazare puts off proposed fast, gives govt time till Jan 30 09/29/2018 [-] Miniature horses on their way to breakfast at Nambour Christian College 09/26/2018 [-] How to Earn Fast FIFA 19 Coins in FIFA 19 Ultimate Team 09/26/2018 [-] Breakfast tables are not the same any more 09/26/2018 [-] What does science have to say about intermittent fasting? 09/25/2018 [-] How to Earn Fast FUT Coins in FIFA 19 Ultimate Team 09/25/2018 [-] 'Breakfast is best in South India' 09/24/2018 [-] Armenia among 10 fastest-growing destinations in Europe Bloomberg 09/24/2018 [-] Switzerland’s ‘Eternal’ Snow Is Melting Faster 09/20/2018 [-] Spider-Man PS4 Is Sony's Fastest-Selling First-Party Game IGN News 09/19/2018 [-] Blue Wave in Texas? Not So Fast. 09/19/2018 [-] 'Ultra wealthy' ranks growing faster... 09/19/2018 [-] iPhone XS, XS Max Are World's Fastest Phones 09/18/2018 [-] Electric vehicles on the fast track in Thailand 09/17/2018 [-] Mobile home values rising fast... 09/17/2018 [-] Swollen dams releasing water faster in Lop Buri, Ayutthaya 09/16/2018 [-] Mayer sets decathlon WR after Kipchoge runs fastest marathon 09/16/2018 [-] Dem confidence swells with midterms fast approaching... 09/14/2018 [-] Exports rise at fastest pace in 3 months in August 09/13/2018 [-] Americans Gobbling Up Fake Meat, Milk Faster Than Ever... 09/13/2018 [-] Woodward 'FEAR' fastest selling book in years... 09/12/2018 [-] Storm Isaac, east of Caribbean, moving westward fast NHC 09/12/2018 [-] Bob Woodward's 'Fear' is the fastest selling book since 'Go Set a Watchman' 09/12/2018 [-] No negotiation in sight, Hardik Patel ends fast after 19 days 09/11/2018 [-] 10-year-old called hero for acting fast after woman faints 09/11/2018 [-] Saudi Arabia detains man over video of breakfast with female co-worker 09/10/2018 [-] Destiny 2 Forsaken How to Reach Level 50 Fast 09/10/2018 [-] Strengthening fast... 09/10/2018 [-] Saudi arrests man over breakfast video with woman... 09/10/2018 [-] Spider-Man Is the Fastest-Selling Game of the Year in the UK 09/10/2018 [-] UK enjoys fastest growth in almost a year 09/10/2018 [-] Chargers were never able to get over Hill and his lightning-fast touchdowns 09/07/2018 [-] Hardik Patel shifted to hospital on 14th day of quota fast 09/07/2018 [-] Crain's Fast 50 2018 Frequently Asked Questions 09/07/2018 [-] Athletics-Sprinter Lyles moves fast to a different beat 09/07/2018 [-] Regulators agree to fast track solar projects for Facebook 09/06/2018 [-] Scientists Spot Ancient, Ultra-Fast Wind from the Early Universe 09/06/2018 [-] World's fastest SUV hits 200 mph... 09/06/2018 [-] Answer to longer life could be fasting... 09/06/2018 [-] Nevenka delivers a breakfast pack to a client 09/05/2018 [-] Wages Growing Faster Than You Think, White House Says 09/05/2018 [-] Emaciated Wisconsin teen dies after ‘minister’ parents impose a multi-month religious fast 09/04/2018 [-] US factories grew at faster pace in August 09/04/2018 [-] Gordon, moving fast, aims to hit Gulf Coast as hurricane 09/03/2018 [-] Twenty years after her debut, Tamia remains a steadfast R&B voice 09/03/2018 [-] NSW school fast-tracks therapy dog process in the wake of drought 09/03/2018 [-] Shohei Ohtani fades fast in return in Angels' 4-2 loss to Astros 09/02/2018 [-] Federal Government fast tracks 395m for key infrastructure projects in South Australia 09/02/2018 [-] Federal Government fast tracks for key infrastructure projects in South Australia 08/31/2018 [-] Fast news The week in 60 seconds 08/30/2018 [-] Chuck Schumer Cuts Deal With Mitch McConnell to Fast-Track Trump Judges 08/30/2018 [-] Court Cooper, NAACP can't fast-track amendment challenges 08/29/2018 [-] Schumer Cuts Deal with McConnell to Fast-Track 7 Trump Judges 08/28/2018 [-] Molly Jong-Fast on Trump & Greenwald 08/28/2018 [-] Shoppers evacuated as blaze guts landmark Belfast building 08/24/2018 [-] Lamborghini unveils an even faster Aventador supercar 08/24/2018 [-] Singapore has the world's fastest 4G Network 08/23/2018 [-] East Baton Rouge EMS wins 4th consecutive award for fast response times 08/22/2018 [-] Facebook Wants To Use Machine Learning To Make MRIs Faster 08/22/2018 [-] Police Fast food worker caught on surveillance raping drugged co-worker 08/22/2018 [-] Michael Cohen is ‘on a fast track to being disbarred’ after felony convictions report 08/22/2018 [-] 40 Lubbock schools continue to qualify for national lunch, breakfast program 08/21/2018 [-] The Latest EU, Britain agree to fast-track Brexit talks 08/21/2018 [-] Facebook - yes, Facebook - might make MRIs faster 08/20/2018 [-] How Facebook - yes, Facebook - might make MRIs faster 08/20/2018 [-] Hardik Patel, associates held ahead of fast 08/16/2018 [-] Fast and Furious Paul Walker's Brothers Want to Bring Him Back- IGN News 08/16/2018 [-] Local farmers ate breakfast to celebrate start of KY State Fair 08/16/2018 [-] How gravity will make this new probe the fastest human-made object 08/16/2018 [-] Walmart stock jumps as sales surge at fastest rate in more than a decade 08/16/2018 [-] Report Oatmeal, breakfast foods contain unsafe amounts of weed killer 08/15/2018 [-] Weed-killing chemical linked to cancer found in children's breakfast foods... 08/14/2018 [-] New Rayquaza Is a Fast and Furious Game Changer 08/14/2018 [-] Yes, Men Lose Weight Faster Than Women. Here's Why. 08/14/2018 [-] Android Pie Breaks Pixel XL's Ability To Fast Charge 08/14/2018 [-] As fast-food wages rise, McDonald's owner goes posh 08/13/2018 [-] JCTC students on fast track to careers with Mercedes-Benz 08/13/2018 [-] Mother of 3 shot, killed while ordering breakfast in McDonald’s drive-thru 08/12/2018 [-] Fast moving grass fire at Mutdapilly 08/12/2018 [-] Connecticut's sales tax-free week is fast approaching 08/12/2018 [-] A&W restaurant calls cops on white customer for buying breakfast for elderly Native woman 08/11/2018 [-] Cost of living rises at fastest rate in decade... 08/11/2018 [-] Lady executed while ordering at fast food drive-thru... 08/10/2018 [-] People going it alone for faster NBN are also paying for their neighbours 08/10/2018 [-] These Are the Fastest Creatures on Earth But You'll Never Spot Them 08/10/2018 [-] Chicago initiative will return lost animals to owners faster 08/10/2018 [-] Joel Robuchon Demanding chef rose to top faster than anyone before 08/10/2018 [-] New technology allows 911 dispatch to respond faster 08/08/2018 [-] DeLand cops seek Burger King burglar in possible fast food heist spree 08/08/2018 [-] Farmers are drawing groundwater from the giant Ogallala Aquifer faster than nature replaces it 08/08/2018 [-] One massive bill Property-tax panel had better act fast 08/07/2018 [-] Candace Owens, Charlie Kirk Detail Moment Their Breakfast Became an Assault 08/07/2018 [-] The Universe Is Expanding. But Astrophysicists Aren't Sure How Fast. 08/07/2018 [-] Rajasthan has 48 toll plazas with fast tag Nitin Gadkari 08/07/2018 [-] Melbourne needs fast rail Sydney more than an airport train 08/06/2018 [-] Hollywood near top of list of U.S. cities with fastest rent rise 08/06/2018 [-] Top 10 Fastest Super Bikes In India 08/06/2018 [-] Fossil’s new smartwatches will make your heart beat faster – and show you, too 08/04/2018 [-] Popeyes chicken fast-food chain reportedl 08/04/2018 [-] Armed Forces reshuffle lists delayed as top brass skip breakfast meeting with Prawit 08/03/2018 [-] Feline and hen seeking refuge from CA fire become fast friends 08/03/2018 [-] Lincoln County fire crews battle fast-moving Angel Springs Fire 08/02/2018 [-] Feline and hen become fast fire friends 08/02/2018 [-] As fires burn faster, emergency alerts fail to keep pace... 08/02/2018 [-] Scientists develop faster, coloured 3D printing method 08/01/2018 [-] India's fast-growing economy gets another interest rate hike. There may be more 08/01/2018 [-] Pioneer builder of fast boats and race-proven yachts 08/01/2018 [-] Australian housing prices are falling at their fastest rate in six years 08/01/2018 [-] Pay gains rise at fastest pace of decade... 08/01/2018 [-] Annual US worker pay gains rose at fastest pace since 2008 07/31/2018 [-] Oil drives Canada’s fastest economic growth spurt in a year 07/31/2018 [-] Wages, benefits rise at fastest pace since 2008 07/31/2018 [-] Adorable Little Girl Passes Out Breakfast Burritos to Hardworking Firefighters Battling the California Wildfires 07/30/2018 [-] 50 years on, McDonald's and fast-food evolve around Big Mac 07/30/2018 [-] How England plan to use their fast bowlers during India Tests 07/29/2018 [-] Officials say fast growth to continue, Trump respects Fed 07/28/2018 [-] Hungarian GP Vettel fastest in 3rd practice, Hamilton 4th 07/28/2018 [-] EcoSport success puts Ford on fast track to SUVs 07/27/2018 [-] Uber, Lyft on defense as City Council fast-tracks regulation 07/27/2018 [-] US economy grows at fastest pace since 2014 07/26/2018 [-] Hardik Patel puts up a brave face, will go on fast 07/26/2018 [-] Chart of the day Two Aussies among world's top 20 fastest-rising billionaires 07/25/2018 [-] Why does my phone battery die so fast? 07/25/2018 [-] IBM's Go-To Disrupter Runs Toward Faster Growth 07/24/2018 [-] Fast fashion through the lens of Instagram 07/24/2018 [-] ReactOS 0.4.9 Is Entirely Self-Hosting, Fixes FastFAT Crashes 07/24/2018 [-] Rebecca from Belfast – Why Barclays needs to stop funding tar sands pipelines 07/24/2018 [-] The Latest Israel says downed Syrian plane was moving fast 07/24/2018 [-] Father, son fishing trip goes south fast 07/24/2018 [-] FOCUS-China’s caffeine war Fast-growing Luckin brews up a threat to Starbucks 07/24/2018 [-] How Super Smash Bros. Ultimate Hits Harder And Faster 07/23/2018 [-] Tim Hortons launches all-day breakfast across Canada 07/21/2018 [-] Grand Anne Bed and Breakfast in Keokuk catches fire 07/21/2018 [-] How Fast Can Bumblebee's Cast Transform Bumblebee? 07/20/2018 [-] How Super Smash Bros. Ultimate Hits Harder And Faster Comic-Con 2018 07/19/2018 [-] Horizon Zero Dawn Dev Expands in Order to Make Games Faster 07/19/2018 [-] Mild breeze, fast course for start of British Open 07/19/2018 [-] Researcher of right-wing religious fundamentalism reveals Putin’s close ties to National Prayer Breakfast organizers 07/18/2018 [-] Study Blowhole spray can provide fast data on whale health 07/18/2018 [-] Does Eating Beef Jerky Cause Psychiatric Symptoms? Not So Fast. 07/17/2018 [-] New VR horror game gets scarier if your heart rate isn’t fast enough 07/17/2018 [-] City Council pulls a fast one with waste-transfer-station bill 07/15/2018 [-] Legal Child Porn?, Fast & Furious, Deadly Chase 07/15/2018 [-] Carnoustie presents a fast, brown look for British Open 07/14/2018 [-] Finally, Non-Compete Clauses Eliminated... For Fast Food Workers 07/14/2018 [-] UPDATE Ticks that carry Lyme disease spreading fast... 07/14/2018 [-] Ministry wants to fast-track school director appointments 07/14/2018 [-] Trade Tensions Help BMW Enter China's Fast Lane 07/14/2018 [-] 6 people injured in fastest San Fermin bull run of the year 07/13/2018 [-] Intermittent Fasting 07/13/2018 [-] Agribusiness breakfast focuses on forestry industry and economy 07/13/2018 [-] Prices are rising faster than they have in six years 07/13/2018 [-] Matagarup Bridge to install 'the fast route down' with zipline to Perth Stadium 07/13/2018 [-] 7 fast-food chains agree to end 'no-poaching' policies 07/13/2018 [-] 7 fast food chains agree to end 'no-poach' rules 07/12/2018 [-] Some fast-food chains agree to end 'no-poaching' policies 07/12/2018 [-] Apple launches faster processors on MacBook Pro 07/12/2018 [-] Gravitational waves could reveal how fast universe is expanding 07/12/2018 [-] DC Answers Which Flash Is Faster Barry Allen or Wally West? 07/11/2018 [-] Oklahoma fast-tracking medical marijuana, but with pushback 07/10/2018 [-] Russian cargo ship makes fastest-ever trip to space station 07/10/2018 [-] Eurozone House Prices Rise at Fastest Rate in 11 Years 07/10/2018 [-] Russian Cargo Ship Sets New Record for Fastest Trip to Space Station 07/10/2018 [-] Mumbai Rains hit fast & furious, city shrugs and carries on 07/09/2018 [-] States seeking info on fast food 'no-poach' agreements 07/09/2018 [-] States launch investigation targeting fast-food hiring practices 07/09/2018 [-] Sacred Games The action is fast and furious 07/07/2018 [-] Is intermittent fasting right for you? 07/06/2018 [-] Adidas' vision for the future Personalization, fast 07/06/2018 [-] Hamilton, Bottas fastest in first practice for British GP 07/05/2018 [-] Samsung, Arm Team Up Expect New Mobile Chipset Faster Than 3GHz 07/05/2018 [-] New Xbox One System Update Offers FastStart, Grouping Games IGN News 07/05/2018 [-] New Xbox One System Update Offers FastStart, Grouping Games 07/05/2018 [-] Oman- Ooredoo offers data rollover on fast home broadband 07/04/2018 [-] Fire at fast food restaurant under investigation 07/03/2018 [-] Funko Reveals Mega Man, Cuphead, Jason Voorhees Breakfast Cereals 07/03/2018 [-] Amid inflation worries, June manufacturing sees fastest growth 07/02/2018 [-] Fire growing FAST... 07/02/2018 [-] US factories register faster-than-expected growth in June 07/02/2018 [-] June manufacturing PMI surges to 53.1, fastest growth in 2018 so far 07/01/2018 [-] The Latest Denmark goal fast, but not the fastest ever 07/01/2018 [-] 1st-minute Denmark goal doesn't crack World Cup's 10 fastest 07/01/2018 [-] Grab on fast track to growth in Myanmar 06/29/2018 [-] How one couple turned grocery bagging into a fast-growing business 06/28/2018 [-] Why fast food chains sell Frankenfood 06/28/2018 [-] The best and worst fast-food breakfasts 06/28/2018 [-] In Texas, fasting, prayers and some anger over immigrant children still separated from parents 06/28/2018 [-] DC Finally Reveals Who's Faster Superman or Flash/tit 06/27/2018 [-] DC Finally Reveals Who's Faster Superman or Flash 06/27/2018 [-] Blessing FastCare closing Shopko location 06/27/2018 [-] Ethel Kennedy, 90, to join fast protesting family separation 06/27/2018 [-] Memory Unlikely to Fade Fast for Chips 06/27/2018 [-] Buried Volcanic Vent Heats Up Antarctica's Fastest-Melting Glacier 06/26/2018 [-] Officials tie Hepatitis A outbreak to fast-food worker 06/25/2018 [-] Daily Deals Alienware Gaming PC with the Fastest Video Card Out There for 06/24/2018 [-] Hamilton, Bottas fastest during 1st French GP practice 06/24/2018 [-] Jaipur is the fastest moving state capital in India 06/23/2018 [-] IndyCar's Scott Dixon and Tony Kanaan are fast friends 06/23/2018 [-] How Fast Is Earth Moving? 06/23/2018 [-] Red Flag Warning For North Bay Means Wildfires Will Spread Fast 06/22/2018 [-] NTSB Train going too fast at curve before wreck 06/22/2018 [-] Fast food worker fired after stirring tea with bare hands in viral video 06/21/2018 [-] Seafood tied to more sex and faster conception 06/21/2018 [-] Fast Food Restaurant Employee Fired For Stirring Tea With Her Hands 06/21/2018 [-] Supporters of Trump steadfast despite immigration uproar 06/21/2018 [-] Trump supporters steadfast despite the immigration uproar 06/19/2018 [-] Alexa, send up breakfast Amazon launches Echo for hotels 06/19/2018 [-] Go viral faster with Project Rush, Adobe’s upcoming social-first video editor 06/19/2018 [-] 'In 2017, India was the fastest-growing market globally' 06/19/2018 [-] At 30kph, this will be the fastest driverless vehicle to hit Australia's roads 06/19/2018 [-] What's better than a good breakfast on your Birthday? One that is free! 06/17/2018 [-] Microsoft Is Fixing Office, But Not Fast Enough 06/17/2018 [-] Firefighters Get Upper Hand On Fast-Moving Fire Along Highway 4 06/15/2018 [-] Scooter startup fastest company to reach valuation... 06/15/2018 [-] Aston Martin’s Rapide is still not as fast as a Tesla 06/15/2018 [-] China promises fast response as Trump readies tariffs 06/15/2018 [-] Zara looks to technology to keep up with faster fashion 06/14/2018 [-] Antarctica Is Melting Three Times As Fast As a Decade Ago 06/14/2018 [-] Fed raises interest rates and signals faster hikes are on the way 06/14/2018 [-] Asian stocks slump after Fed signals faster rate hikes 06/14/2018 [-] 30-minute breakfast recipes to kickstart your day 06/14/2018 [-] Antarctica's Ice Sheet Is Melting 3 Times Faster Than Before 06/14/2018 [-] Antarctica’s Ice Sheet Is Melting 3 Times Faster Than Before 06/13/2018 [-] Federal Reserve lifts interest rates, Wall St slips on faster rate hikes 06/13/2018 [-] 'Netflix and Alphabet Will Need To Become ISPs, Fast' 06/13/2018 [-] Fed raises interest rates and signals faster hikes on the way 06/13/2018 [-] Stocks wobble after Fed says interest rates will rise faster 06/13/2018 [-] Fed raises interest rates and predicts faster pace of future increases 06/13/2018 [-] Stocks slip after Fed says interest rates will rise faster 06/13/2018 [-] Tumwater Places Seven, Rochester Five on All-2A Evergreen Conference Fastptich Team 06/13/2018 [-] Ridley Plays Fast and Vicious In Super Smash Bros. Ultimate E3 2018 06/12/2018 [-] Ridley Plays Fast and Vicious in Super Smash Bros. Ultimate 06/12/2018 [-] Fast fashion's Fashion Nova launches menswear for first time 06/12/2018 [-] German VOD revenues growing faster than ever 06/12/2018 [-] IHOP goes IHOB in social media blitz to draw the post-breakfast burger crowd 06/11/2018 [-] Batman, Books, and Bars in Los Angeles Fast Travel 06/11/2018 [-] Dubai non-oil economy improves at fastest rate in 13 months 06/11/2018 [-] Dubai's non-oil sector expands at fastest rate in 13 months 06/09/2018 [-] Public Welcome to Acme Fast Fuel with Non-Ethanol Gasl 06/09/2018 [-] Verstappen posts more fast times in Canadian GP practice 06/09/2018 [-] The Latest Curry, Warriors off to fast start in Game 4 06/08/2018 [-] Max Verstappen fastest in both practices at Canadian GP 06/08/2018 [-] US Once Again Boasts the World's Fastest Supercomputer 06/08/2018 [-] Connected TV emerges as advertising's fastest-growing video segment 06/07/2018 [-] The Latest Warriors tie Cavs with fast 2nd-half start 06/07/2018 [-] How Robots Are Making Better Drugs, Faster 06/07/2018 [-] Sandy Hook teacher destroys Trump’s plan to arm teachers ‘Shootings happen fast’ 06/06/2018 [-] 'Fast Company' editorial staff votes to unionize 06/05/2018 [-] US services firms grew at faster pace in May 06/05/2018 [-] Fast rail the key to 'mega' Sydney, report says 06/04/2018 [-] RBI alone can't enforce a fast banking turnaround 06/03/2018 [-] UAE- Meet the surgeon who fasts while operating on patients 06/02/2018 [-] Yelm Shakes off Early Loss to Earn Third at State Fastpitch Tournament 06/02/2018 [-] Hot Property Newsletter Life in the fast lane 06/01/2018 [-] El Monterey Breakfast Burritos Recalled 05/31/2018 [-] FACEBOOK sinking fast among teens... 05/31/2018 [-] Current lava flows are hottest, fastest of latest eruption 05/30/2018 [-] Evacuations broaden as fast-moving lava threatens homes, roads 05/30/2018 [-] Coastal eco-tourism venture near Cairns gets fast-tracked by minister 05/29/2018 [-] Fast lava from Hawaii's Kilauea volcano closes highway 05/28/2018 [-] Why oil prices are falling fast 05/28/2018 [-] Oil prices are falling fast. Here's why 05/27/2018 [-] Auburn mayor's annual Memorial Day breakfast will honor all veterans 05/27/2018 [-] Eastern Europe remains Dubai International's fastest growing market 05/26/2018 [-] Seattle fastest-growing city in USA... 05/25/2018 [-] Weekend Recipe A Matcha Breakfast Bowl With Kiwi 05/25/2018 [-] How 25 years of breeding led to a fast-growing, no-shearing 'lamb master' sheep 05/25/2018 [-] The Muslims who fast for 22 hours a day in Iceland 05/25/2018 [-] Hariri named Lebanon's PM designate , wants unity government fast 05/24/2018 [-] The fastest, cheapest way from JFK 05/24/2018 [-] Lebanon's Hariri named PM, wants unity government fast 05/24/2018 [-] Home Values Rising at Fastest Pace in 12 Years... 05/24/2018 [-] Police LA woman faked finding razor blade in fast food sandwich 05/24/2018 [-] North Carolina budget fast-track squeezes out amendments 05/23/2018 [-] Danish govt Minister's views on fasting Muslims are her own 05/22/2018 [-] H1Z1 Battle Royale on PS4 Promises Fast-Paced Carnage 05/22/2018 [-] Hammond to pledge superfast broadband for most homes 05/22/2018 [-] McDonald's picks Orlando to test breakfast catering 05/22/2018 [-] Oman construction sector the fastest growing in the Middle East 05/22/2018 [-] Portland's Best Pizza and Games FAST TRAVEL 05/21/2018 [-] Muslims fasting for Ramadan pose danger, says Danish minister 05/21/2018 [-] Danish minister says Muslims fasting for Ramadan pose danger 05/20/2018 [-] Fast flowing lava from Hawaii's volcano threatens to trap residents 05/20/2018 [-] New fast-moving lava is threatening to isolate around 2000 residents 05/19/2018 [-] The Latest 2 lava fissures merge, create faster flow 05/19/2018 [-] Astronomers Discovered the Fastest-Growing Black Hole Ever Seen 05/19/2018 [-] Castroneves posts fastest speed in practice for Indy 500 05/19/2018 [-] The Latest Hawaii authorities warn of fast-moving lava 05/19/2018 [-] Record Heat Means Hurricanes Gain Ferocity Faster 05/18/2018 [-] Texas student 'I just ran as fast as I could' 05/18/2018 [-] Government fast tracks personal data law 05/18/2018 [-] Free breakfast Friday for law enforcement officers in Greenville County 05/18/2018 [-] Privatize the International Space Station? Not so fast, Congress tells Trump 05/17/2018 [-] Protest camps quiet as Gazans fast and fill sandbags 05/17/2018 [-] Luton fast food owner jailed over drugs in takeaway bag 05/17/2018 [-] 'Fail fast,' Souq's Ronaldo Mouchawar tells start ups 05/17/2018 [-] The fastest growing blackhole of the universe has just been discovered 05/16/2018 [-] The Universe's Fastest-Growing Black Hole Eats Suns Like Ours for Breakfast 05/16/2018 [-] The Crew 2 Is a Welcome Reset That Focuses on Fast Fun 05/16/2018 [-] Millions of Muslims prepare for start of fasting in Ramadan 05/16/2018 [-] NAIF fund faces uncertain future despite Government plan to fast-track projects 05/15/2018 [-] Scientists Just Found the Fastest-Growing Black Hole. Here's How Fast It 'Eats' 05/15/2018 [-] Muslim fasting month of Ramadan to start Thursday 05/15/2018 [-] A monster black hole has been discovered, and it's growing very fast 05/15/2018 [-] Lasers Could Make Computers 1 Million Times Faster 05/14/2018 [-] Ramadan fast Should children give up food and water? 05/14/2018 [-] Celtics start fast, slow down LeBron James to beat Cavaliers in Game 1 05/13/2018 [-] Zurik Bill due for LACE work? Not so fast, St. John tells LSP 05/12/2018 [-] Beautician found guilty of hammer attack on Belfast woman 05/11/2018 [-] Power turns fastest lap, becomes IndyCar GP pole favorite 05/11/2018 [-] Mayor fights fast food... 05/11/2018 [-] 'Impossible position' Brexit is going nowhere fast 05/10/2018 [-] ‘Destiny 2’ power leveling guide How to get raid-ready fast 05/10/2018 [-] Texas suit could get DACA on faster track to Supreme Court 05/10/2018 [-] Google Announces 8x Faster TPU 3.0 For AI, Machine Learning 05/10/2018 [-] Eating fast food linked to infertility? 05/10/2018 [-] System76 Oryx Pro Linux Laptop is Now Thinner and Faster 05/10/2018 [-] Kids growing too fast? How to photograph kids before moment is gone 05/09/2018 [-] Digital revolution signals faster trains 05/09/2018 [-] Eating fast food linked to infertility 05/09/2018 [-] Hungry, Cash-Waving Bank Robbery Suspect Arrested Eating Fast Food 05/09/2018 [-] Belfast Marathon death Stephen Heaney named 05/09/2018 [-] Waterwheel Ten times faster than a Venus flytrap 05/09/2018 [-] The 10 Fastest Movies to Gross Billion at the Box Office 05/07/2018 [-] The Baseball Report Pujols Gets 3,000th Hit, Kimbrel Fastest To 300 Saves 05/07/2018 [-] Man dies after collapsing at Belfast marathon 05/07/2018 [-] Slideshow 9 ways to fall asleep faster 05/07/2018 [-] In Cities, Wildlife Evolving Astonishingly Fast... 05/06/2018 [-] Retail, hospitality fastest growing sectors in UAE 05/06/2018 [-] 'A very fast-moving situation' Lava shoots through Hawaiian streets 05/06/2018 [-] The political power of a fast 05/05/2018 [-] 'Infinity War' to set record, fastest to surpass billion 05/05/2018 [-] 'Infinity Wars' to set record, fastest to surpass billion 05/05/2018 [-] 'Infinity Wars' to set record, fastest to surpass 1 billion 05/05/2018 [-] Non-oil growth of 5% helps make Bahrain GCC's fastest growing economy in 2017 05/05/2018 [-] Locals swim fast, but Los Alamitos sweeps Sunset League finals 05/05/2018 [-] Fire in the Locomotive of the Fast Train from Sofia to Burgas 05/05/2018 [-] Eating Fast Food Hurts Chances Of Getting Pregnant, Study Finds 05/04/2018 [-] Falling Unemployment Could Pressure Fed to Move Faster 05/04/2018 [-] Revealed how Bahrain became the GCC's fastest growing economy 05/04/2018 [-] Trying to Conceive? Fast Food Could Double the Risk of Infertility 05/04/2018 [-] Regular fast food eating linked to fertility issues in women 05/03/2018 [-] Infinity War on Pace to Be Fastest Film to Earn Billion 05/03/2018 [-] Sony Says God of War Is Fastest-Selling PS4 Exclusive IGN News 05/03/2018 [-] Robot fast-food chefs Hype or a sign of industry change? 05/03/2018 [-] Sony Says God of War Is Fastest-Selling PS4 Exclusive 05/03/2018 [-] Tips to Workout whilst you Fast 05/03/2018 [-] Coast Guard tower-turned-bed-and-breakfast up for auction 05/03/2018 [-] Montgomery police serves breakfast to children before school 05/02/2018 [-] Kangaroos assaulting tourists over fast food cravings... 05/02/2018 [-] Eurozone growing faster than the UK 05/02/2018 [-] Belfast patient recall Private clinic to open helpline 05/02/2018 [-] e-bike vs the rest How much faster are they? 05/02/2018 [-] IMF Mideast not growing fast enough to reduce unemployment 05/02/2018 [-] 5 Essential Spots for Nerds in Seattle FAST TRAVEL 05/01/2018 [-] Robotic exosuits will make us better, stronger, faster, right? Not necessarily! 04/30/2018 [-] Social Work Fake news spreads faster than truth, but bots aren’t to blame 04/30/2018 [-] America's air isn't getting cleaner as fast as it used to 04/30/2018 [-] McDonald's sees breakfast slowdown, but results still strong 04/30/2018 [-] EU Brexit negotiator urges faster action over Irish border 04/29/2018 [-] DP World and Virgin Hyperloop One to develop ultra-fast cargo transport 04/29/2018 [-] Bill to allow fast go-karts passes South Carolina Senate 04/29/2018 [-] People who skip breakfast more likely to have larger waists 04/28/2018 [-] Social media user reveals fast fashion giant names products after loyal staff members 04/28/2018 [-] Vettel fastest in third practice for Azerbaijan GP 04/27/2018 [-] U.S. businesses raise workers' pay at fastest pace in 11 years 04/27/2018 [-] US businesses raise pay at fastest pace in 11 years 04/27/2018 [-] Bottas fastest in first practice for Azerbaijan GP 04/26/2018 [-] Catch Up on 18 Marvel Movies Fast Before Seeing Infinity War! 04/26/2018 [-] TBank ‘Cash Your Book’ loans mean fast cash and keep your car 04/25/2018 [-] Gallatin County growing 3 times faster than rest of Montana, says report 04/25/2018 [-] New Mexico public-college enrollment falls fast 04/25/2018 [-] Fast and Furious franchise headed to Netflix for a new animated series 04/25/2018 [-] Kuwait, Oman to see fastest growth in 2019 04/23/2018 [-] Netflix orders Fast and Furious Animated TV Series IGN News 04/23/2018 [-] Netflix Orders Fast and Furious Animated TV Series 04/23/2018 [-] Bridge repair fast-tracked after plow tire goes through deck 04/23/2018 [-] E-toll collection on highways hits the fast lane 04/23/2018 [-] Can fasting improve health? 04/23/2018 [-] 'Fight not over', says Swati Maliwal at end of fast 04/22/2018 [-] Oil Prices Are Fast Approaching Is The Economy Ready? 04/22/2018 [-] Oil Fast Approaching Is Economy Ready? 04/22/2018 [-] Swati Maliwal ends fast; terms ordinance a 'historic' victory 04/21/2018 [-] Why bull sharks are a fast VANISHING BREED 04/21/2018 [-] Robot designed for faster, safer uranium plant pipe cleanup 04/21/2018 [-] Won't end fast till law implemented Swati Maliwal 04/20/2018 [-] Naidu stages 12-hour fast for 'justice' to AP 04/20/2018 [-] Defending champ Newgarden logs fastest Barber practice lap 04/20/2018 [-] Repair fast-tracked after Epsom woman facing two weeks without power calls Utilities Disputes 04/20/2018 [-] Pravin Togadia calls off 'indefinite' fast in 48 hours 04/19/2018 [-] A willingness to fix the euro's flaws is fading fast 04/19/2018 [-] Hospitals recruit managers faster than doctors and nurses 04/19/2018 [-] Inc. 500 Fastest Growing Company, Payscape, Opens Greenville, SC Office 04/19/2018 [-] Willingness to fix euro's flaws is fading fast 04/19/2018 [-] On fast, Pravin Togadia resolves to help Hindus 04/19/2018 [-] PUBG Savage is Fast and Fun Best Map?!? 04/18/2018 [-] Can you assemble flat-pack furniture faster than a robot? 04/18/2018 [-] Why Stephen Poloz just got bullish on how fast Canada can grow 04/18/2018 [-] Gemma Atkinson and Comedy Dave get breakfast radio show 04/18/2018 [-] Tradeoff No cash but faster lines as restaurants forgo cash 04/18/2018 [-] How Fast Can the Global Economy Go? 04/17/2018 [-] The Baseball Report Mets, Angels, Pirates All Off To Fast Starts 04/17/2018 [-] BAS Robotics is the Fastest Growing Science 04/17/2018 [-] UK wages rising faster than prices as squeeze comes to end 04/17/2018 [-] Atlanta, the fastest growing city is busting at the seams 04/17/2018 [-] No police nod, but Pravin Togadia to go ahead with fast 04/17/2018 [-] Scientists found an enzyme which eats plastic. So they made it eat faster 04/16/2018 [-] DSWD vows fast approval of minors’ clearance 04/16/2018 [-] Westworld 2 review Faster, bigger, better sci-fi television 04/16/2018 [-] Heart of Louisiana Zydeco breakfast in Breaux Bridge 04/16/2018 [-] First look Universal's Fast & Furious — Supercharged 04/15/2018 [-] Cause of Welcome Bay house fire under investigation 'It went up fast' 04/13/2018 [-] Pick a borough Rents are falling, and fast 04/13/2018 [-] Defector Is a Spy Fantasy for the Fast and Furious Generation 04/13/2018 [-] Trump Talks TPP, but Trade Partners Say, Not So Fast 04/13/2018 [-] Volkswagen's new CEO We must change faster 04/13/2018 [-] New Volkswagen CEO We must change faster 04/13/2018 [-] LEADING OFF Mets try to continue fast start 04/12/2018 [-] Qatar- Modi, Shah lead BJP's 'save democracy' fast 04/12/2018 [-] Deadpool 2 Director to Helm Fast and Furious Spin-Off IGN News 04/12/2018 [-] Trump orders faster issuance of air pollution permits 04/12/2018 [-] Asian House Geckos fast invading Australian homes 04/12/2018 [-] The Sandlot Cast Reunion Will Remind You That Life Moves Fast 04/12/2018 [-] As BJP leaders fast, Shah slams Congress's 'politics of disruption' 04/12/2018 [-] LIVE! PM to observe fast today over Parliament washout 04/12/2018 [-] The Fed plans to hike interest rates even faster 04/12/2018 [-] 5G What the superfast connection will mean for you 04/12/2018 [-] PM Narendra Modi's pep talk to MPs, MLAs before fast stir 04/11/2018 [-] Is Facebook regulation 'inevitable'? Not so fast 04/11/2018 [-] The Federal Reserve plans to hike interest rates even faster 04/11/2018 [-] House to heed Duterte's call to fast-track Sereno impeachment 04/11/2018 [-] Police identify Fast Payday Loan robbery suspects 04/11/2018 [-] Why trillion-dollar budget deficits may be on a fast track to trillion 04/11/2018 [-] Narendra Modi, Amit Shah to fast on Apr 12 to protest Parliament logjam 04/11/2018 [-] Polar Ice Is Melting Fast in Both Hemispheres 04/10/2018 [-] PM to observe fast on April 12 to protest Parliament washout 04/10/2018 [-] Fast Dataflow implementation of QCD simulations 04/10/2018 [-] Ajay Maken and Company enjoy greasy breakfast before fast 04/10/2018 [-] Rahul's fast a drama, says BJP 04/09/2018 [-] Mumbai Ex-deputy Mayor Babubhai Bhawanji to sit on fast for hawkers 04/09/2018 [-] Trump promises fast decision after suspected Syrian chemical attack 04/09/2018 [-] Yelm Fastpitch Poised to be Among State Elite This Season 04/09/2018 [-] Rahul leads Congress fast against BJP government 04/09/2018 [-] The Breakfast Club is 'troubling' in the #metoo age, Molly Ringwald says 04/09/2018 [-] Molly Ringwald's concerns over ' Breakfast Club' harassment scenes 04/07/2018 [-] 5 Very Awkward Star Wars Fast Food Commercials 04/07/2018 [-] Labor group on fast food workers regularization Why just now 04/07/2018 [-] Molly Ringwald The Breakfast Club star 'troubled' by hit film 04/07/2018 [-] Rajasthan Congress to observe ‘mass fast’ for peace 04/06/2018 [-] Poisoned ex-spy getting better fast, says hospital 04/06/2018 [-] Red Bull's Ricciardo fastest in 1st practice for Bahrain GP 04/06/2018 [-] EZ Free Bail Bonds, Willing to Help Defendant Fast Release 04/05/2018 [-] Trade war? Not so fast. Why stocks are rallying again 04/05/2018 [-] Superfast 5G mobiles are a step closer 04/05/2018 [-] Valley to fast track economic enterprises plan 04/05/2018 [-] Dwayne Johnson ‘not quite sure’ he’ll be in ‘Fast and Furious 9’ 04/05/2018 [-] H&M's woes mean fast fashion is getting worse, not better 04/05/2018 [-] Sierra Leone election Julius Maada Bio fast-tracks presidential oath in a hotel 04/05/2018 [-] In China’s Tea-Growing Heartland, Coffee Is Fast Becoming the New Flavor 04/05/2018 [-] Audi RS3 Sedan Dramatic comeback for the small fast saloon 04/05/2018 [-] Banks see fast pace for MidEast, Africa deals in bumper year 04/04/2018 [-] Dwayne Johnson 'Not Sure' If He'll Return for Fast 9 04/04/2018 [-] Far Cry 5 Is Fastest-Selling Game in Franchise History 04/04/2018 [-] Far Cry 5 Is Fastest-Selling Game in Franchise History IGN News 04/04/2018 [-] YOUTUBE SHOOTING Fast-Food Worker Rushed To Aid Shooting Victim 04/04/2018 [-] The Milky Way Galaxy Is Growing Faster Than the Speed of Sound 04/04/2018 [-] The World's Fastest Delivery Drone Takes Off 04/03/2018 [-] Stuck fast Tiny birds glued to car park poles in cruel attack 04/03/2018 [-] Free training for truck drivers making border checks faster 04/03/2018 [-] Antarctica’s Mighty Glaciers Are Melting Way Faster Than We Realized 04/03/2018 [-] Antarctica's Underwater Ice Is Retreating 5 Times Faster Than It Should Be 04/02/2018 [-] Tumwater Great Ashley Andrews Returns to Take Over T-Birds Fastpitch Program 04/02/2018 [-] Qatar set to be among fastest growing construction markets globally BMI 04/02/2018 [-] 'Snow' joke Fast-moving April storm closes schools, causes slippery conditions 04/01/2018 [-] BBC Breakfast falls for newspaper's April Fools Brexit joke 03/30/2018 [-] Nissan 370Z is a sports car anachronism — a fast one 03/30/2018 [-] Tasmania police union urges fast-tracked recruitment for Launceston 03/29/2018 [-] The mounting infrastructure crisis Washington isn't fixing fast enough 03/29/2018 [-] Takeaway.com is the fastest-growing company in the Netherlands 03/29/2018 [-] How to file your taxes fast, easy, and in many cases free 03/29/2018 [-] Rival Koreas meet at the border to fast-forward rapport 03/29/2018 [-] Fast Food Nutrition Tips 03/29/2018 [-] UFB Long waits in Far North corners for ultra-fast broadband 03/28/2018 [-] Christian pastors begin fast to press for immigration reform 03/28/2018 [-] Sea of Thieves Is Microsoft's Fastest-Selling New IP of This Generation 03/28/2018 [-] Clock Is Ticking Faster at Tesla 03/28/2018 [-] Destiny 2 Is the Go Fast Update Enough? 03/27/2018 [-] Destiny 2 'Go Fast' Update Buffs All Weapons In PvE IGN News 03/27/2018 [-] Destiny 2 'Go Fast' Update Buffs All Weapons In PvE 03/27/2018 [-] Lucky Dragon rooms, with breakfast and free parking, fall to as low as 03/27/2018 [-] LIVE Sean Payton speaks at coaches breakfast during NFL owners meeting 03/26/2018 [-] Destiny 2 Go Fast Update Developer Commentary 03/26/2018 [-] End of the Nondisclosure Agreement? Not So Fast 03/26/2018 [-] Q&A He's trying to run world's fastest marathon _ backward 03/25/2018 [-] Bridgeport mayor says city council meeting was fastest ever 03/25/2018 [-] Extra police on road as crews work fast to repair Far North washout 03/25/2018 [-] Turkey to remain among fastest growing EMs QNB 03/25/2018 [-] QA He's trying to run world's fastest marathon _ backward 03/25/2018 [-] Turkey to remain among fastest growing EMs in 2018 QNB 03/24/2018 [-] Qatar- Govt's draft useless, will continue fast Anna 03/24/2018 [-] Oracle Releases Java 10, Promises Much Faster Release Schedule 03/23/2018 [-] Peyton Uznanski, Capital High School's do-it-all Fastpitch Player 03/23/2018 [-] Leaders of Today and Tomorrow Youth of the Year Breakfast Reception 2018 03/23/2018 [-] Modi govt in crosshairs as Hazare begins fast 03/23/2018 [-] US durable goods orders rise at fastest pace since June 03/23/2018 [-] 911 calls Police fast on scene of Florida bridge collapse 03/23/2018 [-] FCC's New 5G Rules Favor Fast Setup Over Federal Reviews 03/23/2018 [-] Census estimates show Baldwin County growing faster than the rest of state 03/22/2018 [-] Trump UN appointee busted for bigoted ‘Muslims fast, they also blast’ comments 03/22/2018 [-] 'He'd go down fast' Trump hits back in war of words with Biden 03/22/2018 [-] St. George, Utah fastest-growing metro area... 03/22/2018 [-] Trump 'Crazy Joe Biden' Would 'Go Down Fast' In A Fight 03/22/2018 [-] UK fast fashion brand Missguided to launch across the Middle East 03/22/2018 [-] Pacete War on drugs Shoot fast and shoot first 03/22/2018 [-] Karlovic smashes world's fastest serve 03/22/2018 [-] Dutch house prices rise at fastest rate in 16 years 03/22/2018 [-] Come for a ride on the world's fastest racehorse 03/22/2018 [-] Fed Raises Rates and Signals Faster Pace in Coming Years... 03/22/2018 [-] 'They didn't expect something so small could fly so fast' 03/22/2018 [-] Fed Raises Rates, Signals Faster Pace in Coming Years 03/21/2018 [-] Fed increases key interest rate and signals faster pace of rate hikes next yea 03/21/2018 [-] The Fast Food Labor Movement Has Gone Global 03/21/2018 [-] Victims' Lawyer Pushes Back on Fast Sale of Weinstein Co. 03/21/2018 [-] Scooters are the fastest growing auto segment in India 03/20/2018 [-] Masked gunman robs Alon Food Fast store in Marshall, TX 03/20/2018 [-] Heaven can't wait Church of England offers faster way to pay 03/20/2018 [-] True Hold back then run fast and 'hang on for dear life' 03/20/2018 [-] Fast unto death Movement gaining strength 03/20/2018 [-] Dolphin deaths prompt order to fast-track protection plan 03/19/2018 [-] Linux Mint 19 'Tara' Cinnamon Will Be Faster 03/18/2018 [-] Boston's St. Patrick's Day breakfast is all in good fun 03/18/2018 [-] Apple MacBook sales will grow faster than iPhone, iPad in 2018 Report 03/17/2018 [-] Fast and reliable Red Bull may give Verstappen F1 title shot 03/17/2018 [-] 3 Must-See San Francisco Barcades FAST TRAVEL 03/17/2018 [-] Meet Indo-Anglians India's newest, fastest growing caste 03/16/2018 [-] From deities to disasters six fast growing tourism sectors 03/15/2018 [-] Gattuso lauds Henrikh Mkhitaryan as a technically gifted, fast player 03/15/2018 [-] Tesla's Make-Or-Break Moment Is Fast Approaching 03/15/2018 [-] How fast can a trade war smash the global economy? 03/14/2018 [-] TUSD, police work together for fastest response time 03/14/2018 [-] How Saudi Arabia plans to fast track nuclear energy policy 03/14/2018 [-] How Saudi Arabia plans to fast track nuclear energy plan 03/13/2018 [-] SEMO Electric working to provide fast rural internet access 03/13/2018 [-] Lyft Says Its Revenue Is Growing Nearly 3x Faster Than Uber's 03/13/2018 [-] Video shows US Navy pilot's close encounter with an unidentified fast-flying object 03/12/2018 [-] WWE Fastlane So...Guess Who Showed Up After Charlotte vs. Ruby Riott 03/12/2018 [-] WWE Fastlane Did Randy Orton Win the One Title He's Never Held? 03/12/2018 [-] WWE Fastlane Live Blog Will John Cena Take AJ Styles' WWE Championship? 03/11/2018 [-] Why your breakfast foods contain so many added vitamins and minerals 03/11/2018 [-] WWE Fastlane Card Analysis and Winner Predictions 03/11/2018 [-] Here's how wealthy Amazon CEO Jeff Bezos is in fast food menu items 03/10/2018 [-] What's World's Fastest-Growing Economy? Ghana Contends for Crown... 03/10/2018 [-] New work perk Getting paid faster 03/10/2018 [-] China Fast-Tracks IPO Approval for Foxconn 03/10/2018 [-] The Pacific's fastest woman not the easiest person to train, coaches say 03/10/2018 [-] 'Flippy,' the Fast Food Robot, Turned Off For Being Too Slow 03/09/2018 [-] Intel Launches Optane 800P Super-Charged, Fast, and Pricey SSD 03/09/2018 [-] WWE Insiders Pick Fastlane 2018 03/09/2018 [-] Big Little Lies False Stories Spread Faster than Truth on Twitter 03/09/2018 [-] Here's Why AJ Styles Can't, and Won't, Lose at WWE Fastlane 03/09/2018 [-] Fake news 'travels faster', study finds 03/09/2018 [-] China Fast-Tracks IPO Approval for Foxconn Unit 03/09/2018 [-] Canberra opens public purse for private fast-rail project's plan 03/09/2018 [-] Study False stories travel way faster than the truth 03/09/2018 [-] New Study Twitter Users Spread Fake News Farther and Faster Than the Truth 03/08/2018 [-] Our WWE Fastlane Predictions Will John Cena Weasel His Way into WrestleMania? 03/08/2018 [-] Study Finds 'Fake News' Travels Faster Than Truth On Twitter 03/08/2018 [-] Study finds false stories travel way faster than the truth 03/08/2018 [-] Why Humans Learn Faster Than AI 03/08/2018 [-] Biggest Black Holes May Grow Faster Than Host Galaxies 03/08/2018 [-] Business Blockchain Technology Adoption Happening Faster Than Projected 03/08/2018 [-] She races. She flies. She is India's fastest woman! 03/08/2018 [-] Land beneath Silicon Valley is sinking fast study 03/07/2018 [-] Almere is fastest growing area of the Netherlands 03/07/2018 [-] Healthy advice the importance of breakfast and whole grains 03/06/2018 [-] Intel official Russia, China seek fast, futuristic weapons 03/06/2018 [-] Flippy, robot, flips burgers at fast-food chain 03/06/2018 [-] Schools celebrate National School Breakfast Week 03/06/2018 [-] Kuwait-backed Aston Martin named world's fastest growing car brand 03/06/2018 [-] DARPA Sees Clear Path to Faster Cheaper Space Technology 03/05/2018 [-] Burger Flipping Robot Now Cooking at California Fast Food Chain... 03/04/2018 [-] Unity breakfast kicks off last day of Selma Bridge Crossing Jubilee 03/04/2018 [-] Safety barrier at Falkholt family crash site fast tracked ahead of holidays 03/04/2018 [-] Safety barriers at Falkholt family crash site fast tracked ahead of holidays 03/03/2018 [-] The Five Things That Kill Your iPhone's Battery The Fastest, by Adrian Kingsley-Hughes, ZDnet 03/03/2018 [-] 60th annual Texarkana Kiwanis Pancake Breakfast on Saturday 03/03/2018 [-] On the fast track 03/03/2018 [-] Ryan Blaney claims Vegas pole; Harvick still fast in 2nd 03/02/2018 [-] Prosecutors urge convicted Pennsylvania mayor to resign fast 03/02/2018 [-] Tech elite fast, take ice baths to push bodies... 03/01/2018 [-] Tesla Model 3 review the fast and infuriating @ Engadget 03/01/2018 [-] Manufacturing Expands at Fastest Pace Since '04... 03/01/2018 [-] Boise City, Idaho fastest-growing city... 03/01/2018 [-] Shubhankar Sharma on a fast track from India 03/01/2018 [-] Rockets' fast start dooms Clippers in 105-92 loss 03/01/2018 [-] Rockets start fast, beat Clippers 105-92 for 14th straight 02/28/2018 [-] DOTr hopes inter-agency council, with LGUs, can fix traffic faster 02/28/2018 [-] India is growing faster than China again 02/28/2018 [-] UAE needs to 'refresh' laws faster, says DIFC Courts chief exec 02/28/2018 [-] Blaze Fast-Fire'd Pizza Reports 2017 Results & 2018 Outlook 02/28/2018 [-] Phuket governor wants Trai Trang Beach pollution tackled faster 02/28/2018 [-] App ‘to provide better, faster healthcare’ 02/27/2018 [-] U.S. home prices jump in 2017 at fastest pace in 3 ½ years 02/27/2018 [-] Vettel fastest in Ferrari on cold 2nd day of F1 testing 02/27/2018 [-] HERITAGE FOUNDATION 64% of Trump's agenda already done, faster than Reagan... 02/27/2018 [-] US home prices jump in 2017 at fastest pace in 3 ½ years 02/27/2018 [-] As economy heats up, job sites compete to find candidates fast 02/27/2018 [-] Anti-Semitic Attacks Rose Faster Last Year Than Any Time in 40 Years, ADL Says 02/27/2018 [-] Sheriff Chuck Wright holds annual prayer breakfast Tuesday 02/27/2018 [-] Wet weather isn't going anywhere fast in fact it could linger until Sunday 02/27/2018 [-] NZ economy growing faster than emissions rate 02/27/2018 [-] 'I'm talking very fast' Breathless Barnaby won't rule out a comeback 02/26/2018 [-] Red Bull's Ricciardo fastest on F1's first day of testing 02/26/2018 [-] Eric Monday soaker? Not so fast! 02/26/2018 [-] The State of 5G When It's Coming, How Fast It Will Be 02/25/2018 [-] These cities are getting AT&T's ultra-fast 5G network 02/24/2018 [-] Move over, Burger King. There's a new fourth-largest fast food chain 02/24/2018 [-] The Carson's Store Offers Delicious Breakfast Meals at Affordable Prices 02/24/2018 [-] Airlines Won't Dare Use the Fastest Way to Board Planes 02/23/2018 [-] Houston mayor Recovery from Harvey not fast enough 02/23/2018 [-] 'Fast and Furious' director Rob Cohen looks for a quick sale in Hidden Hills 02/23/2018 [-] Detective Pikachu Amiibo Unlocks Cutscenes Faster IGN News 02/23/2018 [-] Detective Pikachu Amiibo Unlocks Cutscenes Faster 02/23/2018 [-] BT told to share poles for ultrafast fibre internet 02/23/2018 [-] Heroin’s homeless 20 minutes in a fast food bathroom 02/23/2018 [-] Antarctica Is Losing Ice Faster Every Year 02/22/2018 [-] Apps Bring Fast Food to Your Doorstep - But It's Going To Cost You 02/22/2018 [-] He can afford to pay off his student debt faster. But should he? 02/22/2018 [-] Fortnite Update Will Make Building Faster And Easier IGN News 02/21/2018 [-] Fortnite Update Will Make Building Faster and Easier 02/21/2018 [-] Fast food is coming to your doorstep, but it can cost more 02/21/2018 [-] AT&T names first three cities to get its ultra-fast 5G network 02/21/2018 [-] Online streaming grows fast under tightened supervision 02/21/2018 [-] Trump moves to ban devices that make guns fire faster 02/20/2018 [-] Shiffrin relaxed, fast and focused on Olympic combined event 02/19/2018 [-] Trump’s fast-food engorged world is petty, small, miserable, anxious and angry 02/18/2018 [-] Deadline to return old paper £10 notes fast approaching 02/17/2018 [-] Book Abu Dhabi Airport Lounge with Fasttrack.aero Airport Services 02/16/2018 [-] Pony Runs Faster than a Train 02/16/2018 [-] Not so fast Inflation may take a while to stir 02/16/2018 [-] Florida Shooting Suspect Stopped For Fast Food After Mass Slaying 02/15/2018 [-] John Snell talks with Dr. Eric Griggs, M.D. about the benefits of fasting 02/15/2018 [-] Tasmanian election Fast-growing Sorell has locals calling for action on congestion, education 02/15/2018 [-] Police seek faster updates on Yingluck’s travels from Foreign Affairs 02/15/2018 [-] Shiffrin in prime position after fast 1st run of Olympic GS 02/15/2018 [-] Meet bush jockey Emma Bell who is on the fast track to success 02/14/2018 [-] Gov't says health costs to keep growing faster than economy 02/14/2018 [-] AFLX The latest foray into fast-paced sport 02/14/2018 [-] The EU Economy with the Fastest Growth since 2007 02/14/2018 [-] Inflation rose faster than expected in January 02/14/2018 [-] European Union grows at fastest pace for 10 years 02/14/2018 [-] The Latest Dutch skater Wust fastest so far in 1,000 meter 02/14/2018 [-] Fries, not flowers Fast-food chains try to lure valentines 02/14/2018 [-] Why fasting every now and then can be good for body and mind 02/14/2018 [-] Chipotle looks to fast-food chain Taco Bell for next CEO 02/13/2018 [-] Some fries, valentine? Fast food chains aim for sweethearts 02/13/2018 [-] Half-Fast Walking Club decked out in gold for Golden Years theme 02/13/2018 [-] Google Has a New Solution for Faster Mobile Content 02/13/2018 [-] Smiling can boost athletic performance, help run faster 02/13/2018 [-] Railways plans 10,000km of new high-speed corridors for faster journeys 02/13/2018 [-] Less-cool Facebook losing youth at fast pace, explains survey 02/13/2018 [-] Galentine's Day celebrations add activism to breakfast food 02/13/2018 [-] New fast-acting drug could hold key to combating flu virus 02/12/2018 [-] Slow flower farm makes fast recovery after flood 02/12/2018 [-] Kansas City fast-food workers walk off the job in Fight for 15 protest 02/12/2018 [-] Kansas City fast-food workers to walk off the job in Fight for 15 protest 02/12/2018 [-] Less-cool FACEBOOK losing youth at FAST PACE... 02/12/2018 [-] Less-cool Facebook losing youth at fast pace survey 02/12/2018 [-] May and Varadkar head to Belfast amid Stormont deal speculation 02/11/2018 [-] WorldGovSummit Live India, UAE fastest growing markets for Whatsapp 02/11/2018 [-] Launch of Superfast Russian Cargo Ship Mission Aborted at Last Minute 02/11/2018 [-] Amazon takes to the skies, meaning faster deliveries for Prime members 02/11/2018 [-] Heavy rain hits Auckland, streams rising fast 02/10/2018 [-] Behold The fastest cars at this year's Detroit Auto Show 02/10/2018 [-] Watch Russia Launch the Fastest Space Station Cargo Flight on Sunday 02/10/2018 [-] Alibaba's Ma hopes Beijing 2022 can be smarter, cheaper, faster 02/10/2018 [-] As mkt grows fast, tour operators bet high on rural travellers 02/09/2018 [-] Monster Hunter World Is Capcom's Fastest Selling Game 02/09/2018 [-] A Bulgarian Delegation had Breakfast with Trump 02/09/2018 [-] Two-thirds of Dutch businesses now have fast broadband internet 02/08/2018 [-] Wall Street and European sell-off deepens, BOE warns of faster rate hikes 02/08/2018 [-] Fast food workers to rally Feb. 12 for increased wages 02/08/2018 [-] Trump at prayer breakfast faith 'central' to American life 02/08/2018 [-] Dressed for the fastival 02/08/2018 [-] Blame hyper-fast trading algorithms for the latest stock market insanity 02/08/2018 [-] New faster graphene radiation detector developed 02/08/2018 [-] Personal lending increases four times faster than wages 02/08/2018 [-] Deadpool 2 Director in Talks to Helm Fast and Furious Spinoff 02/08/2018 [-] BBC Radio 2 Folk Awards Belfast to host event for first time 02/07/2018 [-] Uber gender pay gap 'explained' men drive faster than women 02/07/2018 [-] Maine's governor wants to gut fast-tracked wind permits 02/07/2018 [-] Cricket's New 'Breeze-Thru' Activation Process Gets You Online Faster 02/07/2018 [-] Lebanon internet strategy present by Ogero for faster connection 02/07/2018 [-] Why some vehicles get Takata air bag fixes faster 02/07/2018 [-] UAE to grow faster at 3.8% on higher oil prices and reforms 02/07/2018 [-] Paekakariki house fire fast and furious 02/06/2018 [-] Quits rise at fastest pace in 17 years, signaling higher pay 02/06/2018 [-] Life in the fast lane Eagles to play at XL Center 02/06/2018 [-] Conviction made in armed carjacking at fast food restaurant 02/06/2018 [-] China's service exports expand fast in 2017 02/05/2018 [-] Soylent rolls out its drinks to more 7-Eleven stores, touting them as fast food 02/05/2018 [-] Polar Bears Could Face Extinction Faster Than Thought, Study Says 02/05/2018 [-] Banks Shutter 1,700 Branches in Fastest Decline on Record... 02/05/2018 [-] Junior drag racing champion lives life in the fast lane 02/04/2018 [-] Superfast Asteroid Zooms Safely By Earth This Super Bowl Sunday 02/03/2018 [-] Govt doing well but could reach goals faster 02/03/2018 [-] South Africa v/s India I enjoy facing fast bowlers, says Ajinkya Rahane 02/02/2018 [-] US Dollar Gains as January NFP Shows Faster Jobs and Wage Growth 02/02/2018 [-] Wage growth fastest since 2009 02/02/2018 [-] FORD selling SUVs faster than can make them... 02/02/2018 [-] A lesson for Kim Jong-un tank warfare is changing fast 02/02/2018 [-] Mkhitaryan, Aubameyang can help Arsenal 'regain sense of fast football' 02/01/2018 [-] New Spec Means Flash Storage Is About to Get Faster 02/01/2018 [-] The Wine Sector has the Fastest Return on Investments 02/01/2018 [-] Three million homes to get ultrafast broadband by 2020 02/01/2018 [-] Huntsville 'hero' student acts fast to help friend having seizure 01/31/2018 [-] FDA fast tracks Protalix's Fabry disease drug 01/31/2018 [-] Black Panther Is Fastest Pre-Selling Superhero Movie 01/31/2018 [-] Compensation Rises At Fastest Pace Since '08... 01/31/2018 [-] Takeda's Zika Vaccine Candidate Receives U.S. FDA Fast Track Designation 01/31/2018 [-] Is TCS moving too fast, too soon? 01/30/2018 [-] Cooper seeks fast movement following elections board ruling 01/30/2018 [-] Europe's economy grew faster than the U.S. last year 01/30/2018 [-] Sir Kenneth Branagh, Freedom of Belfast and the BBC 01/30/2018 [-] Brownback critics mock fasting proclamation with pizza party 01/29/2018 [-] Takeda's Zika vaccine gets U.S. FDA's 'fast track' status 01/29/2018 [-] Italy's Population is Sinking Faster Than the Tower of Pisa 01/29/2018 [-] Strong winds fan flames of fast-moving bushfire near Augusta 01/29/2018 [-] City's newest fast-food chain should do right by animals 01/29/2018 [-] How to Earn Money Fast in Dragon Ball FighterZ 01/29/2018 [-] To counter China, team Donald Trump to build super-fast 5G network 01/28/2018 [-] Watch Man wonders about UFOs after spotting fast-moving mystery light in Auckland night sky 01/27/2018 [-] Man arrested after Belfast explosion, no one injured 01/27/2018 [-] Man arrested after Belfast explosion; no one injured 01/27/2018 [-] Marina probes fastcraft incident 01/27/2018 [-] Televangelist headlining Army prayer breakfast doesn’t even believe PTSD is real 01/27/2018 [-] Australia among countries growing hotter faster report 01/26/2018 [-] U.S. economy grew faster in 2017 01/26/2018 [-] U.S. economy grew faster in 2017, but growth slowed at year's end 01/26/2018 [-] Cuomo vs. the experts Go fast or slow in overhauling the tax code 01/26/2018 [-] Iran Fast Boats STOP Harassing U.S. Navy... 01/25/2018 [-] The Best Kind of Breakfast to Eat, According to Metabolism Experts 01/25/2018 [-] Innerhofer fastest in 1st practice for World Cup downhill 01/25/2018 [-] Burger King trolls net neutrality repeal with 'fast lane' ad 01/25/2018 [-] Qatar We're still growing fast despite Arab boycott 01/25/2018 [-] Celtics pull a fast one in 113-102 win over the Clippers 01/25/2018 [-] Haumea Fast-Spinning Dwarf Planet 01/25/2018 [-] 40 fastcraft passengers injured 01/24/2018 [-] How a village in Essex makes a world-famous breakfast staple 01/24/2018 [-] Burger King trolls net neutrality repeal with Whopper 'fast lane' ad 01/24/2018 [-] 'Serbia's population among worlds fastest shrinking' 01/24/2018 [-] Bacolod, Iloilo fastcrafts hike fare rate by P30 01/24/2018 [-] How Fast Is a Wi-Fi Network? Android 8.1 Will Tell You 01/24/2018 [-] Police Angry fast-food worker beans supervisor with burrito 01/23/2018 [-] New bed and breakfast on the way in Canton 01/23/2018 [-] Fast bowlers Team India's new trump cards 01/22/2018 [-] How a French breakfast biscuit laid siege upon U.S. cereal 01/22/2018 [-] GOP revels in fast start for Trump tax law... 01/21/2018 [-] Village headman’s teakwood home destroyed in fast-moving blaze 01/20/2018 [-] Man who hit NYPD cop was reenacting scene from 'The Fast and the Furious' 01/20/2018 [-] Mayor Broome to sign Fast-Track Cities Treaty 01/20/2018 [-] Trump’s USDA Wants to Make Pork Processing Faster—And More Dangerous 01/19/2018 [-] Why Fast & Furious is going from screen to stage 01/19/2018 [-] Long way before India becomes fast-bowling nation Shoaib Akhtar 01/19/2018 [-] Reservoirs drying fast, state to start water cuts 01/19/2018 [-] The Arctic is heating up faster than anywhere else 01/18/2018 [-] The Latest JFK airlines told to get bags to owners faster 01/18/2018 [-] iOS Update to Let iPhone Owners Keep Phones Running Fast 01/18/2018 [-] Sunshine Coast to Brisbane fast rail project vies for business case funding 01/18/2018 [-] ARE STOCKS CLIMBING TOO HIGH, TOO FAST? 01/18/2018 [-] Sensex's fastest 1000-pt blitzkrieg in over three years 01/18/2018 [-] Are you in the sick boat? Illness spreading fast around WAVE Country 01/17/2018 [-] America's Fastest Spy Plane May Be Back - And Hypersonic 01/17/2018 [-] Nowhere fast 01/17/2018 [-] FIRST ALERT Snow moving in, temps dropping fast 01/16/2018 [-] Miso Let’s be Fit, Fast and Fresh Together 01/16/2018 [-] M.E.N to hold 'Future of Work' breakfast event at Manchester Airport 01/16/2018 [-] How Fast Can Quantum Computers Get? 01/16/2018 [-] UK business secretary seeks fast-tracked Carillion probe 01/16/2018 [-] America's Fastest Spy Plane Back - and Hypersonic... 01/16/2018 [-] UK business secretary calls for fast-tracked Carillion probe 01/15/2018 [-] Apartments in India with Trump name selling fast 01/15/2018 [-] Martin Luther King Jr. Day fast facts 01/15/2018 [-] How Did the Milky Way Get Its Bulge? Fast-Moving Stars May Hold Clues 01/15/2018 [-] Fast food makes the body's defences more aggressive, study shows 01/15/2018 [-] Oman Ooredoo provides superfast fibre broadband for 77,000 homes 01/15/2018 [-] CILA officials bare ‘fast plan’ in Clark 01/15/2018 [-] Pant cracks 2nd fastest ton in T20s 01/15/2018 [-] Derided as violent entertainment, the UFC is fast becoming a serious sport 01/14/2018 [-] World Cup leader Hirscher fastest in 1st run of slalom 01/13/2018 [-] Beware! Fast food can damage your immune system 01/13/2018 [-] Revealed Thailand’s fastest baby 01/13/2018 [-] Gov’t lauded for fast action on Clark airport pilferage 01/12/2018 [-] Camiguin, Bohol-bound fastcrafts to sail off, Jan. 15 01/12/2018 [-] Do This One Simple Thing to Fall Asleep Faster 01/12/2018 [-] Mickey Rain this morning, then temperatures drop fast 01/12/2018 [-] Motörhead Guitarist 'Fast Eddie' Clarke Dies At 67 01/11/2018 [-] Original Motörhead Guitarist 'Fast Eddie' Clarke Dies At 67 01/11/2018 [-] How Astronomers Are Measuring Monster Black Hole Masses Faster Than Ever Before 01/11/2018 [-] Motorhead guitarist Fast Eddie Clarke dies at 67 01/11/2018 [-] OSFI putting Canadian banks on fast track for new capital rule 01/11/2018 [-] The areas where house prices rose fastest in 2017 01/11/2018 [-] German economy grew in 2017 at fastest pace in 6 years 01/11/2018 [-] Disaster council wants Panay River Basin project fast-tracked 01/11/2018 [-] What's sending mysterious repeating fast radio bursts in space? 01/11/2018 [-] Astronomers May Be Closing in on Source of Mysterious Fast Radio Bursts 01/10/2018 [-] Mysterious fast radio bursts explained... 01/10/2018 [-] UKFast opens tech campus to startups 01/10/2018 [-] Stephen Bannon's fast rise, faster fall and uncertain future 01/09/2018 [-] Qatar SC aim to pull a fast one on Al Duhail 01/09/2018 [-] Not So Fast The Net Neutrality War Isn't Over Yet 01/09/2018 [-] Hundreds of men stand in at school’s ‘Breakfast with Dads’ event 01/09/2018 [-] Belfast building forced into foreclosure retains owners 01/09/2018 [-] The Fast Road Connection to Sofia Airport Opens Today 01/09/2018 [-] Agricultural Demand For Water Has California’s Central Valley Sinking Fast 01/09/2018 [-] Traslacion moving smoothly, fast 01/08/2018 [-] Nintendo Switch Tops PS4 As Fastest Selling Console IGN Daily Fix 01/08/2018 [-] Viotek Unveils Fastpad Wireless Charging for iPhone and Galaxy 01/08/2018 [-] Sony Updates Xperia XA2 Series with Faster Processors, Bigger Batteries, and Better Cameras 01/08/2018 [-] Between 10% and 20% of Consumers Have Used Fast Credit Services in December 01/08/2018 [-] Lakers' 42 fast-break points tie franchise record against Hawks 01/08/2018 [-] Qatar- Travel packages for 2018 FIFA Cup selling fast 01/07/2018 [-] Smart speakers are fastest-growing consumer technology 01/06/2018 [-] 'STAR WARS' Fading FAST at Box Office... 01/06/2018 [-] People Are Checking Out ‘Fire and Fury’ From Libraries as Fast as Harry Potter 01/05/2018 [-] Alcohol industry rolls into fast-growing cannabis market 01/05/2018 [-] Nintendo Switch is fastest-selling US home console 01/05/2018 [-] Just a bit faster than Marshawn Lynch’s Media Day session 01/05/2018 [-] Breakfast with Tom Estem Charter School 21 Feb 2014 102904 GMT 01/04/2018 [-] Nintendo Switch Now the Fastest- 01/04/2018 [-] Nintendo Switch Now Fastest-Selling Home Console in the US 01/04/2018 [-] Nintendo Switch Now the Fastest-Selling Home Console in US 01/04/2018 [-] EAST COAST BLITZED BY FAST-MOVING WINTER STORM... 01/03/2018 [-] San Francisco 49ers Season Recap Slow Start, Fast Finish Brings Expectations For 2018 01/03/2018 [-] Fed-up passenger sought fast track on Ryanair wing 01/03/2018 [-] NETFLIXAMAZONHULU increase content spending at faster clip than streaming-market growth... 01/02/2018 [-] How a tiny tummy patch could cut fat fast, and without exercise 01/02/2018 [-] Cold weather items sell out fast at local hardware stores 01/01/2018 [-] MSHP Take your child's coat off before fastening their car-seat 01/01/2018 [-] Argentina accepts faster inflation to boost economy 12/31/2017 [-] Duterte Steadfast in adversity 12/30/2017 [-] Kamala Mills Fire Activists hope for better times, and fast 12/30/2017 [-] Got the flu? Easy steps you can take to get better faster 12/29/2017 [-] Expert Mural inside fast-food joint could be worth 12/29/2017 [-] Restaurant offers free breakfast for first responders on New Year's Day 12/29/2017 [-] Twelve dead, four others seriously injured in fast-moving Bronx apartment fire 12/29/2017 [-] 12 dead in fast-moving New York City apartment fire 12/29/2017 [-] Franchisees fighting mad as fast-food chains slash prices... 12/28/2017 [-] Slideshow Secret fast food menus no one told you about 12/28/2017 [-] ‘The Breakfast Club’ Fans Will Want To Check Out This Never-Before-Seen Clip 12/28/2017 [-] 5 years later, Paris is still fastest in Bormio downhill 12/28/2017 [-] Urban rail growth on fast track 12/27/2017 [-] Centre allots Rs 4K cr for fast track courts 12/27/2017 [-] Minister orders faster verification system for foreign workers after staff reshuffle 12/27/2017 [-] ISIKOFF Mueller probe fast approaching critical crossroads... 12/27/2017 [-] Angeles villagers enjoy PH’s fastest internet connection 12/27/2017 [-] Karlbergsv&#228gen 77 Fastighets AB receives observation status 12/27/2017 [-] Genetically engineered 'super-horses' FASTER, STRONGER, BETTER JUMPERS... 12/27/2017 [-] FHP Driver takes turn too fast, ends up in pond 12/27/2017 [-] Tickets for fastest speeding drivers in Texas revealed 12/26/2017 [-] 'Astonishingly fast race' puts Sydney to Hobart leaders on track for record 12/26/2017 [-] Fast courts off track? 12/26/2017 [-] Superfast battery can fully charge in seconds 12/26/2017 [-] Industrial growth fastest since 2010 12/24/2017 [-] L-G Anil Baijal Fast track construction of Rani Jhansi flyover project 12/23/2017 [-] Rohit equals the fastest T20 century record as India clinch series 12/23/2017 [-] India's Rohit equals record for fastest T20 century 12/22/2017 [-] Net Neutrality Repeal Brace for Internet 'Fast Lanes' 12/22/2017 [-] PHOTOS Rohit equals record for fastest T20 century as India crush SL 12/22/2017 [-] How the other half live in the fast lane 12/22/2017 [-] What India's fast bowlers must do in South Africa 12/21/2017 [-] Not so fast Deputies replay accounts Willis skipped out on 12/21/2017 [-] Editorial Kaikoura's restoration shows how fast work can be done 12/21/2017 [-] Ultra-fast 5G wireless service declared national security priority by White House 12/21/2017 [-] A dollar menu war is coming to fast food 12/21/2017 [-] NASA develops new tool to fast-track search for alien life 12/21/2017 [-] Indonesia's mega fast-rail project runs into trouble 12/21/2017 [-] Firefighters show how fast a Christmas tree can burn 12/21/2017 [-] Idaho Fastest-Growing State... 12/21/2017 [-] SEEK Limited Fastest Growing Jobs on SEEK.co.nz for 2017 12/21/2017 [-] Oman- Jaguar XE SV Project 8 is world's fastest saloon car 12/21/2017 [-] Idaho tops list of fastest-growing states 12/21/2017 [-] Skipping breakfast to burn fat? Not so fast 12/20/2017 [-] 2 rail buffs who pushed for faster trains killed in accident 12/20/2017 [-] After net neutrality Brace for internet 'fast lanes' 12-20-2017 11-30-2016 03-16-2016 07-22-2015 02-03-2015 07-14-2014 12-23-2013 08-21-2013 04-12-2013 11-21-2012 07-09-2012 02-18-2012 10-26-2011 09-26-2011 08-29-2011 08-12-2011 07-13-2011 06-15-2011 05-17-2011 04-13-2011 03-13-2011 02-10-2011 12-31-2010 11-20-2010 10-19-2010 09-12-2010 08-10-2010 07-05-2010 05-23-2010 04-14-2010 03-10-2010 02-05-2010 12-30-2009 11-26-2009 10-22-2009 09-16-2009 08-14-2009 07-10-2009 06-04-2009 04-25-2009 03-23-2009 02-19-2009 01-15-2009 12-08-2008 11-02-2008 09-28-2008 08-29-2008 07-29-2008 06-27-2008 05-28-2008 04-24-2008 03-25-2008 02-22-2008 01-20-2008 12-17-2007 11-18-2007 10-20-2007 09-23-2007 08-29-2007 08-04-2007 07-06-2007 06-08-2007 05-11-2007 04-12-2007 03-12-2007 02-13-2007 01-12-2007 12-11-2006 11-03-2006 09-20-2006 09-03-2006 07-20-2006 06-23-2006	cc/2020-05/en_middle_0126.json.gz/line631
__label__wiki	0.603002	0.603002	INReview > The Scuttlebutt Lounge > Television > Whedonverse > General Discussion Pages (16): « 12 [3] 45 » Last » Print Version \| Email Page \| Bookmark \| Subscribe to Thread INReview Maven No, Angel goes to meet her and we never find out what they said to each other. I agree about the Trio. They were such a riot. What were they talking over when they agreed to team up? Please say they were playing D&D. That would just make that moment even greater gaboman What Would Jack Do? Location: The land, the land down under. Of course they were! At the end of the episode, they've got the lair set up. "Flame Thrower active!" "Action Figures deployed!" My favorite though was when Andrew painted the damn death star on the side of the van, then later on you find out he also added a horn that plays the Star Wars theme !!! When I saw that part of the episode I just started howling with laughter. Oh man...it was priceless And when Johnathon was arguing about the setup of the Death Star being wrong, and Andrew was like, "For your information, I'm using the design of the second Death Star from the Emperor Strikes Back" Right Jonathan's like 'That design is flawed!!!!' Too bad Andrew offs him in the seventh season those two were so funny together Yeah, that gets my vote for Worst Plot Twist Ever. The tv was fuzzy so mom and I clung to the hope that we hadn't seen what really happened. Unfortunately we read up on that episode and we were right. Stupid The First! On the other hand, if I had to pick only one of the Trio to survive, I probably would have chosen Andrew anyway. Johnathon was really really funny also, and together they were even better, but Andrew gave me side aches from laughing so hard. I mean, the man had a wheelchair fight in a hospital!! Every time I'm in a hospital I ask my parents if I can have a wheelchair fight (For some reason they always say no ) hehehe yeah, Andrew was my favorite out of them too. And I guess there just weren't anymore jokes they could make with Andrew and Jonathan fighting... it would've gotten old, I guess. I'm wondering why they didn't stick Andrew in gaol for killing Jonathan though I mean, who would REALLY want him hanging around? I think Andrew would be cool to have hanging around. He would fit in nicely with my other friends and we could wheelchair fight til the cows came home Yeah, just don't turn your back on him Nah, Andrew's cool I forgot what happened to him by the end of the series.... Did he die at some point before the finale? I can't imagine him running into the hell-mouth to kill the ubervampires Can you remind me? Well I couldn't watch the last episode. Blasted tv But I did read about what happened, and he was helping to fight, if I remember right, and something was coming at him that would have killed him. Maybe it was an ubervamp. He didn't die because Anya jumped in front of it. Poor Andrew felt real bad about Anya safricing herself to save him, and then he felt even sadder when he had to tell Xander. I just checked out the transcript at buffyworld.com ... yeah, like you said, he was there. I didn't remember that Principal Wood survived that too... freaky. Didn't like that fellow too much. Him trying to kill Spike and all. Yeah! Stupid Wood trying to kill Spike You just can not do something like that and expect to still have fans Last edited by Pippin on 09-05-2005 at 06:34 PM \| You know, I was watching Angel the other day and wondering how Spike could hurt humans without a problem. Then I realized his chip was removed in the seventh season. Totally forgot about that! They could have repaired it or removed it... Buffy's choice. So she removes it. That was the first sign she'd totally lost her mind Woa! I never knew they had a problem with Spike's chip, and I certainly never heard it was removed! No wonder Spike suddenly got cool again when he came to Angel! Ah, I see, I see. You were confused too. He started getting headaches and the chip was shocking him when he really didn't want it to, so Buffy called Riley, and got a pizzaria or a coffee shop or something instead. Then went on this big long rant asking whether they're really a coffee shop or is it really a big huge government conspiracy... kind of funny. Yep, that sounds like a Buffy script alright Have you watched any of the show FireFly? Another Joss Wheddon show, but was cancelled really quickly. Looks very funny though. Never seen it myself, but it simply looks funny. I only ever got a chance to see one episode when it was on, but that episode got me hooked. Firefly was a masterpiece few can come close to matching I can think of nothing to say about it that would truly do it justice. It was pure genius. Incredible. Beautifully made. Yet another gem by Joss Whedon. My brother's friend owns the whole series (14 episodes or something) and I borrowed them so I could see the whole thing. Idiots must work at Fox. That's the only reasoning I can think of to explain why they canceled it. The movie of Firefly is called Serenity and comes to theaters on SEPTEMBER 30TH!! It's so CLOSE!! My family and I fully plan to see it right when it comes out HECK! Location: Delta House Pip, lemme say, bomb ass avatar. That, and in of itself, is worth gold membership alone. About not seeing Buffy. I'll just say that Buff is the Stuff. At first I did not like the show. My uncle watched it, I clowned like he was a Timberlake fan. Then the episode with John Ritter came on... so, HECK was HOOKED. Watched from there on in. Cool ass show. Angel was hit and miss... more hit, but still was so-so. Whedon is dope, but about Firefly... It was good, but tried to be too much, too soon. Too many plot point smashed into a very, very small ship. Needed to lay strong foundation then build on it. I would say that FOX, as per usual, pulled the plug far to soon, but the show tanked on its own. As for the movie, maybe on DVD, if at all. -HECK! I find Angel hit and miss too. It's good, but I swear if you don't watch the episodes in order it will take you about 5 episodes to get the flow of the story. I watched a season 4 episode, only one, a few years ago and I just sat through it thinking "huh? Who's good and who's bad then?". I've seen a lot of season 5, and it seemed a lot better than it was earlier in the series. I want to see FireFly, but I guess I'll grab the DVDs and that'll be it. I saw an ad for it on TV here saying Coming Soon, but they took it off and I haven't heard anything since then... darn it. Thank, Heck I'm quite proud of my avatar I agree that some seasons of Angel were much better than others. Season five was sooo better than season four, and one was better than two. I generally liked Angel - I just hated the whole thing with Connor, though- , but it wasn't as good as Buffy. That John Ritter episode of Buffy kind of creeped me out. But then again, John Ritter is good at creeping me out Yeah, John Ritter's freaky... Especially with his pretends to ring an invisible bell and dances around like a fairy The thing I don't get about Angel is how did he fall in love with Cordellia? I mean, Buffy was an airhead too, but not THAT bad. They just played the Angel episode here where Spike goes all Vigilante on them, and saves all these people... then asks them if they want to get drunk and listen to the Sex Pistols Oh, yeah, and Angel kept having funky visions of his friends trying to kill him. I don't think I saw that episode, but that definitely sounds like Spike Cordelia changed a lot after she went to LA. If Angel fell in love with her when she was in high school I would say something had to be wrong, but it seems more real with the Cordelia in Angel. Hhhhhhhhhhhhhhhhhhmmmmmmmmmmmmmmmmmm... alright, I'll accept that My mother-in-law will bring me my Angel DVDs in 2 weeks time, I'll start watching it from the start around then Angel the series or a certain season? I loved the way that the first episode of season one began And I miss Doyle Episode 9 of season one was one of the saddest Angels ever, in my opinion. I would say "Bring Back Doyle!!" (in some supernatural form or something, because that's all that they could really do), but the actor is dead now, so that wouldn't work She'll bring me all 5 seasons. The episode they'll play this week on Tele has Cordelia wake up. From the advert, it looks like Spike bites here what's with that? Oh, you know how we were saying earlier that when Buffy comes back to life and goes off to meet Angel, we never know what happens? I was looking through my Buffy comics on the weekend, and there's one special one called "Reunion" in which Xander, Anya and Dawn guess what they did when they met. In the end, there's this big firey demon and that's that. You never actually KNOW what happens, but it was fun enough watching them speculate. Oh, and there was one funny bit when Dawn was telling the story, Anya says "Dawn! Buffy's dress changed", Dawn: "yeah, I changed my mind" maybe you had to see it... Oh, I'll have to find that somewhere I think I remember which episode you are talking about with Cordy waking up. I shall not tell you anything about it because 1) I don't want to spoil anything and 2) I don't remember what happened Well, 2's a good reason not to spoil it I'll check it out on Friday night, if I remember. I often forget its on, to be honest. Since I haven't watched the first four seasons in order (odd episodes here and there), I feel like I've got to catch up on those first. Buffy's like that too. If you miss something early in the season, you may not get something that's happening or some of the jokes they're telling. Oh, while I was going through my comics, I found the comic Joss Whedon did of the original buffy story (from the movie)... but with the Buffy from the TV series in it. It's basically the same story, but some changes... I'll have to read through it properly to find out what. She does actually burns the gym down at the end, which is mentioned a lot in the first couple of seasons of the TV show. First Principle: "You burned down the gym, Buffy" Buffy: "I did, I really did. But you're not getting the big picture here! That gym was FULL of vampir-asbestos." That part was so funny... he tore up the file before he even looked at it, then he's like "I don't care if it says........" <eyes buldge> Then when Fludey (sp?) came in Oh I swear I wanted to throw that weasel off a building. Page generated in 0.08911395 seconds (90.26% PHP - 9.74% MySQL) with 42 queries.	cc/2020-05/en_middle_0126.json.gz/line633
__label__cc	0.722672	0.277328	Support‎ > ‎Awards' How To and Tips‎ > ‎Awards' Guidelines‎ > ‎ 3D Bas-Relief Medals posted Jan 8, 2014, 12:38 AM by Abdallah Absi [ updated Jan 24, 2014, 12:22 AM ] December 2013 - Recycled Papers from Absi Co What are 3D medals? 3D Artwork The Stamping Die Classical Approach Of Producing the Stamping Die The work of Mr. Mohammed Taufic Absi Modern Approach Of Producing the Stamping Die Finishing the Stamping Die Stamping Dies for Proof-Like Medals Sample Images of Stamping Dies Minting or Stamping medals Sample Images of Bas-Relief Medals 3D (3 Dimensional, 3D Relief or bas-relief) medals are medals with bas-relief carvings. Bas-relief is a kind of sculpture in which shapes are carved so that they are only slightly higher than the flat background and no part of the modeled form is undercut. The projecting image in bas-relief sculptures has a shallow overall depth (1 to 5 scale), as on coins, on which all images are in low relief. In the lowest reliefs the relative depth of the elements shown is completely distorted, and if seen from the side the image makes no sense, but from the front the small variations in depth register as a three-dimensional image. More about bas-relief here. Your unique vision of how your medal will look like is expressed by our graphic designers. A detailed design reflecting the central theme of your message is further developed from rough hand sketches using graphic software applications. A sculptor uses these designs to produce a first enlarged (3 times the size of the end product) model sculpt in clay using fine cutting and grating tools (view a video about sculpting a bas-relief here). Alternatively, a virtual model can be created using CAD/CAM software. A combination of both techniques, sculpting and utilizing CAD/CAM softwares, is especially used for human faces. First the sculptor uses conventional tools to produce a bas-relief model, then a CAD/CAM specialist uses a digital 3D scanner to capture the sculpted model and transform it into a 3D virtual model. The 3D model can be edited (manipulated digitally) e.g. scaled up or down or enhanced etc. Enlarged model sculpt in clay The enlarged plaster model is cast from the clay model which in turn is used to cast the brass model to be used on a Janvier’s Pantograph machine to engrave a reduced image on a steel die which is finally used after hardening to stamp the impression on brass blanks producing bas-relief medals A steel die with an impression engraved on it’s surface, this must be hardened to be ready for stamping medals. A medal is produced by striking the steel die against a blank brass (copper, silver or gold) disk. To stamp a 3D impression (the bas-relief) on medals you need a steel stamping die. There are several ways to produce steel stamping dies. Classically the 3D clay model created by the sculptor will be cast in brass and reduced to the proper size on a steel die using a manual pantograph or an automatic special 3D reducing machine called Janvier’s Pantograph or Medallion Lathe. After engraving the impression on the steel die it is hardened to make it ready for stamping medals. Mr. Mohammed Toufic Absi was the first one to introduce a Janvier’s Pantograph to Lebanon and to use it in the early seventies. He developed his own pioneering approach to produce his stamping dies: instead of using the Janvier’s Pantograph to engrave the steel die, he used it to engrave a copper plate - a metal softer than steel, a good conductor and offers a very good resistivity to electric erosion- that is used in turn as an anode (or Medal “Master”) in a spark erosion machine known as well as electric discharge machine (EDM) to transfer the impression to a steel die (or “Workpiece”). This approach is not only faster in producing detailed engravings but it has also enabled Mr. Absi to recycle hardened stamping dies when the impression engraved on their surface is of no use. Clearly, hardened steel dies are not suitable for engraving by the Janvier’s Pantograph due to the hardness they acquire through the annealing process. The surface of a steel die is cleared from any impression using a surface grinding machine, then a new impression is engraved on its surface using the EDM machine through the copper plate engraved using the Janvier’s Pantograph. A Janvier’s Pantograph machine used to engrave a reduced image on a steel die or a copper plate. The impression is reduced from the brass cast to the right to the small copper plate to the left in contoured multi-level relief Surface grinding machine used to clear the impression from a steel die enabling the reuse of a hardened steel die EDM machine used to copy an impression from a “Master” copper plate to a “workpiece” or the steel die Master at top (copper piece), medal die workpiece at bottom, oil jets at left A virtual model created using CAD/CAM software can be utilised to engrave the stamping die in contoured multi-level relief using CAM engravers. A virtual bas-relief is created based on a simple 2D illustration using 3D software A rendered image of the virtual bas-relief to the left: 3D software offers many tools to edit the model and visualise it The same model engraved using a small size CNC on a wax plate as a prototype. The final medal. A virtual bas-relief is created using 3D software based on a simple 2D illustration of an Arabic calligraphy. The die goes through several procedures before it can be used for stamping or coining. It may need to be turned off to be accommodated in the minting collar and minting press. The die is heat-treated to harden it. The exact optimum degree of hardness must be achieved in order to avoid cracking the die under strong pressure while striking. The die surface may need to be smoothed in case a proof-like medal is to be stamped. The impressions (the raised areas or the relief) of proof-like medals are frosted and their backgrounds (medal field) are shiny or brilliant (mirror-like) with minor imperfections. The surface of stamping dies used to stamp proof-like medals must be processed in such a way it is highly polished; also the blanks used for minting must be polished. Read information about minting medals here. View a video about minting medals here. Production of 3D bas-relief medals involves art and technology. Though the process can be time consuming and relatively expensive, the 3D bas-relief medals always stands as an aesthetically appealing product. So, if you are ahead of time, not so tight on budget, and you require medals in large quantities then this might be the option that you are looking for.. To view an updated printable version of this article click here.	cc/2020-05/en_middle_0126.json.gz/line641
__label__cc	0.712784	0.287216	Home Makai Highlights Island Native Island Native: Hawaiian Funnyman Kaleo Pilanca Island Native: Hawaiian Funnyman Kaleo Pilanca When I started writing this feature about Kaleo, it confirmed why he was chosen for this month’s issue. As I prepared to call him, I saw a television program which featured Pilanca and his dad Moon, as they prepared to spend some time together at the beach, surfing, paddling, and just having a great time! I immediately contacted him, only to find him busy doing homework and orchestrating bath time with his young sons. His response was, “Can I call you later?” He later sent a text to let me know that it was getting late, and he needed to tuck them in bed, so he would contact me even later. Pilanca is the true “Mr. Aloha.” When we surfed together, and even on a photoshoot, he warmly greeted everyone with “Aloha.” Yes, everyone. However, Pilanca defers this title to another, and says that Uncle George Kam is Mr. Aloha. Pilanca lives life to the fullest. Every moment is endowed with a good spirit, positive vibes, feel good energy, and the glow, the “Nahenahe”. Growing up in the Waiahole Valley Road on the Windward side of Oahu, Pilanca has surfed his home breaks, including Kualoa Point, Rainbows, BB‘s, Crouchings, Kapapa Island, Sugar Mills, Kaaawa Lefts and Kahana Bay. Pilanca observed, “Eastside surfers wait patiently for southwest winds (Kona Winds) so we can have ‘glassy waves’, as they only happen probably two weeks out of the year! So, when it does happen, I not going lie, I call in sick!” This Kamehameha Schools graduate attended college in Washington, bringing his surfboard so that he could surf, while he attended Eastern Washington State University. This was in spite of the fact that there was no available surf for hundreds of miles. However, his board was available, while he earned a degree in recreational therapy. After coming home with his degree in hand, he worked under the “Red Roof ” in Kaneohe, at the State Hospital. “Working with criminally insane patients, I had to act crazier than them. They would say, stay away from that guy, he is a little bit off!” His ohana includes his wife Carrie “CJ” Pilanca, who is a flight attendant and business manager of their company, KP Entertainment, along with his blended ohana, Christoper, Kanoelani, Moon, Nikki, Hazel, Kainalu and Kaena. Pilanca remarked, “It’s a ‘yours, mines, and ours’ ohana, just like the Brady Bunch. Just add water and shake ‘em up.” The ever-active Pilanca also makes it a priority to have “our time” with his wife CJ. They find the time, in between her taking care of the kids, being his partner in business, a DJ, and an event planner, as well as her job in the air. How is that for having a busy family life? Kaleo is also working on a new television show, “Kaleo‘s Ohana Adventures,” which is set for presentation this spring on OC16. When asked how they met, Kaleo and CJ responded with two similar but different answers! She said: “I met Kaleo at a fundraiser golf tournament. My sister Wendy is the one to ‘blame’ for my meeting Kaleo. She asked me if I could help her at the tournament, and I ended up helping with the set-up of the banquet room. I needed a ride back to one of the holes, and Wendy was unable to drive me back, so she told me to catch a ride with Kaleo. I looked at her and said, “Are you crazy, I don‘t even know who that is!” Her reply was,”He‘s the guy on tv, radio and stuff.” I just gave her a crazy look and said, “I still don’t know who that is!” She walked over to him and asked him if he could give me a ride back out to the course. He said yes. Meanwhile I was standing there in disbelief that she would even suggest that I ride with a stranger! All I could hear in my head was my mother saying to me, “Stranger danger! Stranger danger!” “I waited as Kaleo filled up his beverage before going to the golf cart. I remember that we argued about who was going to drive the cart, and I finally sat in the passenger seat. Kaleo was busy fumbling with his phone and his drink, so I decided to press the gas pedal. He had on his shades (and made sly) but I knew that he was trying to check me out. The next thing I know, I almost fell out of the golf cart because we hit the curb. Whiplash! Fast forward to a week later, when I started getting Facebook event invites from him, for all his future fundraisers and his big comedy show. I asked my other girlfriends who were friends with him on Facebook, whether they had gotten invited too, but they all said no. So, if Kaleo ever says that he sent out invites to all of the ladies, and that I was the only one who showed up, he‘s lying!” I remember that day like it was yesterday. I was at a golf fundraiser, dressed up in character, as a guy called “Uncle Moki.” I was asked to drive the golf cart and to entertain, by heckling the golfers, and to just be an ambassador of Aloha. I would blow my conch shell when the golfers putted. I was sipping on my drink having fun. Out of nowhere, I heard Wendy Pitner (who later became my sister-in-law) say, “Carrie, catch a ride with that guy!” I heard Carrie say, “Who is that guy?” She didn’t know who I was, but I turned on the charm. She came walking towards me like an angel. Her hips swayed with the coconut trees, her smile tantalizing… I just knew I was going sweep her off her feet, and end this with a bang! Hole in one! Nah, nah… Actually, we had our first lovers spat right there, the very first time we met. We argued about who should drive. Being the man, I knew I had to drive and be in charge, and as we drove off, I dropped my phone between my legs, and tried to get it. Meanwhile, I lost track of where I was going, drove off the curb, over some roots, and almost into the water hazard! CJ screamed, so I comforted her, made sure she was ok, and made sure she didn’t have whiplash, because she was holding her neck. I really don’t know what I did that day, but it must have worked, because after that, she couldn’t get enough of me. I began to see this lovely young woman at all of my fundraisers. One after the next. She was stalking me! Actually, I would let many wahines know about my fundraisers, but CJ was the only one that showed up. Although she was stalking me, I guess I really liked and wanted her there…” Having worked at Shriners Hospital for Children, Pilanca uses that experience when spending time with his dad. Pilanca takes his dad, Moon, to the beach every chance they get, at least weekly. “It’s therapy for my dad, as he is living with Parkinson’s Disease.” Pilanca explains simply, “The brain and muscles do not coordinate together. The brain tells him to move his arm, but the arm doesn’t listen.” On these outings, the younger Pilanca assists his dad onto a longboard and pushes him through the gentle waves. He coaches him through exercises with a canoe paddle, while his dad keeps a cadence and switches to alternate sides. All the while, his dad recalls his own time in the canoe. It is time well-spent for both of them. Kaleo is a man in perpetual motion. Whether he is taking his keiki to school or “Pops” to the beach, emceeing events, officiating weddings (yes he is also licensed to perform weddings in the State of Hawaii), planning the next comedy event, or doing homework with the kids, he never stops! Additionally, he is now performing on the Hawaiian airwaves, with a new primetime (6:00pm to midnight shift) show, on Hawaii‘s number- one radio station, 98.5 FM/ Island, and is a game show host on “Play Smart Hawaii.” When asked who his comic inspiration is, he replied, “George Burns.” Pilanca explained, “He was smooth on his delivery, clean, and the crowd loved him! He did this till he was 100 years old! What could be better?” Other comedians that he admires are Robin Williams and Eddie Murphy. Pilanca is an island entertainment treasure, and we all hope that he will be sharing his brand of “Aloha” until he is 100 years old! Next articleIsland Native: Mahina Island Native: Jeff Chang Island Native: Ezekiel Lau Makes the Cut Island Native: Johnny Puakea New Island Eats: Vein at Kaka’ako Lesleyanne Goo - December 14, 2018 High-Intensity Interval Training: Train Smarter, Not Harder Dr. Landon Opunui - November 20, 2016 March #99ActsofAloha Charlie Texiera - March 18, 2019 The Toxic Tuna Tradeoff Dr. Landon Opunui - April 16, 2017 Lono - January 31, 2019	cc/2020-05/en_middle_0126.json.gz/line662
__label__wiki	0.775382	0.775382	2019 Guide Kenyon vs Denison (May 03, 2008) Box score (NCAA) NCAC Softball Tournament Kenyon at Denison (Game 1) May 03, 2008 at Granville, Ohio (Big Red Field) Kenyon 3 (20-18) Player AB R H RBI BB SO PO A LOB Scott Hanrahan dh........ 4 0 1 0 0 1 0 0 1 Pat Gunn ph............. 1 0 0 0 0 0 0 0 0 Scott Burdette ss........ 3 0 1 0 1 0 3 3 1 Tom Hardacker c.......... 4 0 1 0 0 0 3 1 0 Will Smith 1b............ 3 1 1 1 0 2 7 0 2 Jake Calcei 2b........... 3 1 1 0 1 0 1 4 2 Craig Wocl cf............ 3 1 0 0 1 0 4 0 1 Alex Cultice 3b.......... 4 0 1 1 0 0 2 1 1 Jamie Keyte rf........... 3 0 0 1 0 2 1 0 0 Sam Loesche rf.......... 1 0 1 0 0 0 1 0 0 Chris Yorlano lf......... 4 0 1 0 0 1 1 0 0 Geoff Bollier p.......... 0 0 0 0 0 0 1 2 0 Alex Kerr p............. 0 0 0 0 0 0 0 0 0 Justin Cox p............ 0 0 0 0 0 0 0 0 0 Austin Faught p......... 0 0 0 0 0 0 0 0 0 Greg Ward p............. 0 0 0 0 0 0 0 0 0 Sam Giller p............ 0 0 0 0 0 0 0 0 0 Totals................... 33 3 8 3 3 6 24 11 8 Denison 15 (25-16) Danny Pritz cf........... 6 2 4 2 0 1 0 0 0 Tim LaBolt lf............ 6 1 3 2 0 0 0 0 2 Park Smith 1b............ 5 2 1 2 0 0 11 0 1 Aidan Lucas dh........... 2 2 0 0 2 0 0 0 1 Justin Held 2b........... 3 1 0 1 0 0 4 6 0 Tony Christopher rf...... 5 4 4 3 0 1 3 0 1 John Kester rf.......... 0 0 0 0 0 0 1 0 0 Kevin Teague 3b.......... 5 0 2 3 0 0 1 2 0 Andy Johnson ss.......... 2 2 1 0 2 1 1 2 0 Alex Horn c.............. 5 1 2 1 0 1 6 0 4 James Clear p............ 0 0 0 0 0 0 0 1 0 Totals................... 39 15 17 14 4 4 27 11 9 Score by Innings R H E Kenyon.............. 000 210 000 - 3 8 5 Denison............. 403 070 10X - 15 17 2 E - Hardacker; Calcei; Cultice; Bollier; Kerr; Held; Clear. DP - Kenyon 3; Denison 2. LOB - Kenyon 8; Denison 9. 2B - Pritz; LaBolt; Christopher; Horn. 3B - Christopher 2. HR - Smith. HBP - Burdette; P.Smith; Lucas; Johnson. SF - Smith; Held 2. SB - Calcei; P.Smith; Lucas; Held; Christopher. Kenyon IP H R ER BB SO AB BF Geoff Bollier....... 2.2 7 7 2 1 2 15 18 Alex Kerr........... 2.0 7 7 6 2 1 12 16 Justin Cox.......... 0.1 0 0 0 1 0 1 2 Austin Faught....... 1.0 1 0 0 0 0 3 4 Greg Ward........... 1.0 1 1 1 0 1 4 4 Sam Giller.......... 1.0 1 0 0 0 0 4 4 Denison IP H R ER BB SO AB BF James Clear......... 9.0 8 3 1 3 6 33 38 Win - Clear (6-2). Loss - Bollier (4-6). Save - None. HBP - by Clear (Burdette); by Bollier (Johnson); by Kerr (Lucas); by Faught (P.Smith). Umpires - Start: 3:06 pm Time: 2:16 Attendance: 180 Game: DENB5031 Kenyon at Denison (Game 1) - Play-by-Play Kenyon starters: 34/dh Hanrahan; 10/ss Burdette; 19/c Hardacker; 13/1b Smith; 3/2b Calcei; 11/cf Wocl; 1/3b Cultice; 24/rf Keyte; 9/lf Yorlano; 17/p Bollier; Denison starters: 9/cf Pritz; 27/lf LaBolt; 3/1b P.Smith; 17/dh Lucas; 24/2b Held; 20/rf Christopher; 12/3b Teague; 2/ss Johnson; 5/c Horn; 21/p Clear; Kenyon 1st - Hanrahan popped up to 2b. Burdette walked. Hardacker singled to shortstop; Burdette advanced to second. Smith flied out to rf, SAC; Burdette advanced to third. Calcei grounded out to 2b. 0 runs, 1 hit, 0 errors, 2 LOB. Denison 1st - Pritz doubled down the lf line. LaBolt reached on an error by p, bunt; Pritz advanced to third. P.Smith reached on a fielder's choice, RBI; LaBolt out at second 2b to ss; Pritz scored. P.Smith stole second. Lucas walked. Held flied out to cf, SAC; P.Smith advanced to third. Lucas stole second, advanced to third on an error by c; P.Smith scored, unearned. Christopher tripled to right center, RBI; Lucas scored, unearned. Teague singled to second base, RBI; Christopher scored, unearned. Johnson singled to right center; Teague advanced to third. Horn struck out looking. 4 runs, 4 hits, 2 errors, 2 LOB. Kenyon 2nd - Wocl grounded out to 2b. Cultice grounded out to p. Keyte struck out. 0 runs, 0 hits, 0 errors, 0 LOB. Denison 2nd - Pritz struck out. LaBolt singled to right field. P.Smith lined into double play p to 1b; LaBolt out on the play. 0 runs, 1 hit, 0 Kenyon 3rd - Yorlano struck out. Hanrahan singled, bunt. Hanrahan advanced to second on an error by p. Burdette hit by pitch. Hardacker popped up to 2b. Smith struck out. 0 runs, 1 hit, 1 error, 2 LOB. Denison 3rd - Lucas reached on an error by 3b. Held reached on a fielder's choice; Lucas out at second p to ss. Held stole second. Christopher singled through the right side, RBI; Held scored. Christopher stole second. Teague grounded out to ss; Christopher advanced to third. Johnson hit by pitch. Horn doubled to left field, RBI; Johnson advanced to third; Christopher scored, unearned. Kerr to p for Bollier. Pritz singled to third base, RBI; Horn advanced to third; Johnson scored, unearned. LaBolt flied out to cf. 3 runs, 3 hits, 1 error, 2 LOB. Kenyon 4th - Calcei walked. Wocl reached on an error by 2b, advanced to second; Calcei advanced to third. Cultice singled to left field, RBI; Wocl advanced to third; Calcei scored, unearned. Keyte grounded out to 2b, RBI; Cultice advanced to second; Wocl scored, unearned. Yorlano popped up to 2b. Hanrahan grounded out to 3b. 2 runs, 1 hit, 1 error, 1 LOB. Denison 4th - P.Smith reached on an error by 2b. Lucas hit by pitch; P.Smith advanced to second. Held hit into double play 3b to 1b; Lucas advanced to second; P.Smith out on the play. Christopher struck out, out at first c to 1b. 0 runs, 0 hits, 1 error, 1 LOB. Kenyon 5th - Burdette singled to third base. Hardacker hit into double play 3b to 2b to 1b; Burdette out on the play. Smith homered, RBI. Calcei singled up the middle. Calcei stole second. Wocl flied out to rf. 1 run, 3 Denison 5th - Teague grounded out to ss. Johnson walked. Horn singled through the right side; Johnson advanced to third. Pritz singled to shortstop, RBI; Horn advanced to second; Johnson scored. LaBolt doubled to right center, 2 RBI; Pritz scored; Horn scored. P.Smith singled, advanced to second on an error by p, advanced to third, RBI; LaBolt scored. Lucas walked. Held flied out to rf, SAC, RBI; P.Smith scored, unearned. Christopher doubled to right center, RBI; Lucas scored. Teague singled down the rf line, RBI; Christopher scored. Cox to p for Kerr. Johnson walked; Teague advanced to second. Horn flied out to cf. 7 runs, 6 hits, 1 error, 2 LOB. Kenyon 6th - Cultice grounded out to 2b. Keyte struck out. Yorlano lined out to 3b. 0 runs, 0 hits, 0 errors, 0 LOB. Denison 6th - Faught to p for Cox. Pritz singled to left center. LaBolt reached on a fielder's choice; Pritz out at second 2b to ss. P.Smith hit by pitch; LaBolt advanced to second. Lucas hit into double play ss to 2b to 1b; P.Smith out on the play. 0 runs, 1 hit, 0 errors, 1 LOB. Kenyon 7th - Hanrahan struck out. Burdette grounded out to ss. Hardacker grounded out to 1b unassisted. 0 runs, 0 hits, 0 errors, 0 LOB. Denison 7th - Ward to p for Faught. Held flied out to cf. Christopher tripled to center field. Teague grounded out to 2b, RBI; Christopher scored. Johnson struck out. 1 run, 1 hit, 0 errors, 0 LOB. Kenyon 8th - Smith struck out. Calcei flied out to rf. Wocl walked. Cultice grounded out to 2b. 0 runs, 0 hits, 0 errors, 1 LOB. Denison 8th - Giller to p for Ward. Loesche to rf for Keyte. Horn flied out to rf. Pritz fouled out to 3b. LaBolt singled through the right side. P.Smith flied out to lf. 0 runs, 1 hit, 0 errors, 1 LOB. Kenyon 9th - Kester to rf for Christopher. Loesche singled through the left side. Yorlano singled to left field; Loesche advanced to second. Gunn pinch hit for Hanrahan. Gunn hit into double play ss to 1b; Yorlano out on the play; Loesche advanced to third. Burdette flied out to rf. 0 runs, 2 hits, 0	cc/2020-05/en_middle_0126.json.gz/line664
__label__wiki	0.503901	0.503901	Tip: To convert articles to PDF… At the top right corner of every PEP Web article, there is a button to convert it to PDF. Just click this button and downloading will begin automatically. Hauke, C. (2002). CASEMENT, ANN. Carl Gustav Jung (In the series Key Figures in Counselling and Psychotherapy edited by Windy Dryden). London & Thousand Oaks: Sage, 2001. Pp. 168. Hbk. £50.00; Pbk. £15.99.. J. Anal. Psychol., 47(1):113-114. (2002). Journal of Analytical Psychology, 47(1):113-114 CASEMENT, ANN. Carl Gustav Jung (In the series Key Figures in Counselling and Psychotherapy edited by Windy Dryden). London & Thousand Oaks: Sage, 2001. Pp. 168. Hbk. £50.00; Pbk. £15.99. Christopher Hauke Barbara D. Stephens and Susanna Wright Rarely does an introductory text bring much that is new to a subject - especially to readers (including readers of this journal) who are already very familiar with the subject. From the outset, Ann Casement's new introduction to Jung and his psychology impresses as an exception to this. A glance at the organization of the book reveals its freshness: after a mandatory ‘The Life of Carl Gustav Jung’ (which itself is a far from routine read), Casement offers sections on ‘Jung's Major Theoretical Contributions’ and ‘Jung's Major Practical Contributions’, a fourth on ‘Criticisms and Rebuttals’ and a last one on ‘The Overall Influence of Carl Gustav Jung’, plus an extensive bibliography. All introductory books on Jung rely quite heavily on Memories, Dreams, Reflections (Jung, 1963) but the difference here is the way that Casement is up to date with the authorship problems of this book and the research of Shamdasani, for example, that is unravelling the Jung story and unearthing interesting archival material. Now when I teach Jung I can hand students this book instead of repeating all the caveats applicable to Memories, Dreams, Reflections - which is still essential reading but only if accompanied by a critical view, which Casement's succinct chapter has now provided us with. The next forty pages start with a survey of Jung's philosophical influences from Plato through Nietzsche and the neglected F. W. H. Myers, offering just enough for the student to seek further details in specialist texts.	cc/2020-05/en_middle_0126.json.gz/line671
__label__wiki	0.63783	0.63783	Interview with Sylvia Lopez A great and rare glimpse of Sylvia Lopez giving an interview at the height of her career. The interview is in French and it's great to hear her original voice. In the interview she says that her mother was Russian and her father was German...she was fluent in 5 languages and when she made films with American actors like Steve Reeves she said her lines in English to make it easier for the actors. It's a shame she died so young, at the age of 27. She died the same year she made this interview. I created the first (and I believe still the only) tribute on Sylvia in 2010. See below. PEPLUM GIF animation : THE LAST DAYS OF POMPEII Pompeian red? It’s actually ochre Hercules against the Barbarians - Mark Forest The Trojan Horse Serpent of the Nile - Rhonda Fleming Ulysses vs Hercules - Dominique Boschero Golden Voyage of Sinbad - Caroline Munro Goliath and the Vampires Mickey Hargitay and Jayne Mansfield Roman Scandals - Eddie Cantor Damon and Pythias Swordsman of Siena PEPLUM GIF animation : HERCULES UNCHAINED Then & Now : Rosalba Neri Sodom & Gomorrah - Anouk Aimée Desert Warrior Challenge of the Gladiator Carry on Cleo The Beastmaster 3 : The Eye of Braxus - Leslie-Ann... PEPLUM GIF animation : HERCULES AGAINST MOLOCH	cc/2020-05/en_middle_0126.json.gz/line672
__label__wiki	0.638052	0.638052	That $400,000 in stolen money would be worth about $2,867,800.83 today. The $1500 that Mason charges Arlene to find her trailer would be $10,754.25. Definitely a bit over the top as Della comments. Actually, although I realize Perry was testing her, I think he�d get in trouble today with the bar association if he did that. Arlene pays $2500 ($17,923.76) for her trailer and finds $18,000 ($129,051.04). Perry gets a $25,000 ($179,237.55) reward which he turns over to Arlene and her father. The way that girl spends money, she�ll need it. Submitted by billp, 12/27/2008. +Bill Emory states "the robbery took place on Tuesday, May 3rd". This episode was part of the 57-58 season. May 3rd was a Tuesday last in 1955. But Bill Emory has only been fired for the past 10 months. Submitted by PaulDrake 33. 13 April 2015. +Anyone watching the syndicated version of this show will be puzzled about the picture on this page of Della and Paul Brinegar (dressed as the messenger), since that scene is always cut out of the televised versions. Submitted by PaulDrake 33. 13 April 2015 + This episode was unusual in that the murder seemed gratuitous, and as such morally unsatisfying: as has been argued, the victims are traditionally vile persons, or in a few cases - such as Sleepwalker's Niece, where the killing is integral to the plot - the character is (simply) undeveloped; but here neither is true: Uncle George is a nice guy and little reason - perhaps no reason at all in the syndicated versions - is given for his death...but it's PM so we know "someone's gotta get it", sentiment be damned. Lamented by Notcom , 082417. The more I think about this episode, the less sense it makes. 1) How could Arlene not hear someone backing up to her trailer? 2)Why couldn't she go to the police? 3) Where was the stolen money? 4)And, yes, why was George killed? DOD 05/13/18 Tragg arrests Arlene and says the trial is the next day. In court both Perry and Burger have miraculously developed their cases. In fact, Burger says "the state has gone to a great deal of trouble to prepare its case". Those are two fast working attorneys! Submitted by Kilo 3/7/2018. > Ah but we find out (see below) that's not really true...the pitfall of rushing things!! Notcom 120718. Odd that Burger was unaware that Perry didn't lower and raise the shade as a signal when he questioned Perry in court. Tragg knew that when Perry tried to show him why he did it. Apparently Tragg kept that information to himself. Kilo 12/7/2018. Perry placed a want ad in the paper as a way to locate the trailer. I guess we are to assume Mr. Hartsel at the Ideal Trailer Mart responded to the ad. Kilo 12/7/2018. The "I'll throw you to the wolves without the slightest compunction" comment by Perry to Arlene is uncharacteristic. Must be a line straight from the book. Joe B. 05/24/19 In the opening scene we see the sun-bathing Arlene and her trailer in a secluded location. Where did her car go? She must have pulled the trailer there, probably with her Dodge Royal Lancer. Did someone steal her car, too? And, by the way, who tipped off Sackett that Arlene was going to be there with her trailer? It seemed like he knew right where to go. That couldn't have been just a coincidence. Kilo 9/11/2019. Too Many Fairlanes! (See Greg C's CARS Trivia) We see Perry driving his black 57 Ford Fairlane Skyliner (Lic No HGA 056) into George Ballard's driveway in daylight at 21:50 of the CBS/ Paramount DVD. The Skyliner nameplate on the side of the roof is conspicuous. At 26:59, it's dusk and the police lurking across the street in their own black 57 Ford sedan observe a man who they ID as Perry leaving Ballard's house and driving off in a black Fairlane. . . But Hey!... The cops don't notice that it's not Perry's car! The Lic No is MNN 527 (or 521) and it's a Fairlane 2-Door Hardtop! - note how the rear roofline differs from that of the Skyliner. This misidentification is an important story element and one of the most devious & delicious plot devices in any PM episode. Trailer Trouble. However careful the crew were in gathering their Fairlanes, details of the trailer theft were implausible: I doubt that a Jeep could pull Arlene's large trailer out of the woods but there are contrary claims! Even so, any cops spotting Sackett on the road would have stopped him for the excessive (stolen) load. Toaster, lamp & AirCond are seen in Arlene's trailer but Sackett didn't disconnect electrical service. Since Sackett didn't stow anything, the interior would have been wrecked by the time he got to Ideal Trailer Mart. Arlene would have had great difficulty getting her trailer into that wooded, sandy spot, even with her big Dodge Royal Lancer, (Lic No MLJ 766, see "1957 Headlight Oddities" at ep#3 Comments). Added by Gary Woloski, 4/8/12. Had to laugh when Paul handed Perry a photo of the balding, 40-something Paul Brinegar and referred to him as "the kid who swiped the trailer." Submitted by JazzBaby, 7/6/2019.	cc/2020-05/en_middle_0126.json.gz/line673
__label__wiki	0.68336	0.68336	Grooming Business The Pet Elite The Pet Aisle Merchandising & Marketing Pets & Products Natural/Holistic Herptiles Retailer Roundtables Pet Business / March 2015 / A Natural Fit Retail buyers will find all of the products and information they need to tap into the growing natural products trend in The Natural Pet section of the Global Pet Expo show floor. By Melissa Breau The natural pet products movement began as a niche trend. People were looking for healthier and safer options for themselves and their children; and as humanization swept in, that carried over into what shoppers wanted for their pets, as well. But what started out as a trend has evolved into a mainstay of the pet industry. “Natural is not a trend anymore,” says Oscar Tenorio, product line manager of Purelife 4Pets by Vetimed, Inc. (booth 3912), an all-natural line of pet supplements. “It has become a lifestyle. “We have seen this go from the pet food industry all the way to poop bags, where now companies are using recyclable or biodegradable materials.” So, it is no surprise that The Natural Pet Section of Global Pet Expo is consistently one of the most popular sections of the show floor, drawing industry experts, the media and retail buyers alike. Nor is it surprising that this year, The Natural Pet section is larger than it has ever been. That’s good for both manufacturers and buyers, according to Jill Taft, founder of Logic Products (booth 4250) which manufacturers the Barklogic line of natural grooming products. For buyers, she says, “Global is such a big show, and there are so many different categories that it can be overwhelming for them to try to locate products that are relevant to their needs. Having a natural section really cuts down on the amount of time and work a potential buyer has to spend trying to find products that are relevant to their store.” The advantage for manufacturers, on the other hand, is a chance to reach interested buyers who may not be aware of their products. “A buyer who’s looking for a natural pet shampoo may not necessarily think that they want a natural pet toy,” Taft explains. But when these buyers come across a booth with natural pet toys, she says, they think, “Wow, there’s a whole bunch of natural products out here that I never thought of, so let’s explore all of the categories within the natural space.” Naturally Delicious There may be many different types of products that make it into the natural category, but edibles—food, treats and supplements—are still, by far, the largest segment of the industry. “The demand for natural products is a driving force behind the growth of the treat category and one that consumers are placing a greater emphasis on each year,” says Chris Meiering, director of innovation at Zuke’s (booth 4127). Zuke’s offers natural treats and will be debuting a new line of natural and nutritious low-calorie treats called Skinny Bake 5’s at the show. Zuke’s new treats represent just one of the many trends that are popular within the natural treat and food category today. In addition to health-conscious and weight-conscious edibles, demand for alternative protein sources, simple ingredient lists, clear ingredient sourcing, and cleaner manufacturing processes all continue to grow as well. “Alternative proteins have become a hot trend recently among pet parents with dogs that are sensitive to certain proteins, but also [with] those who are in search of ways to keep treat time more enjoyable and varied,” says Meiering. So, retailers should have options that don’t include meat proteins at all. “These vegetable-based recipes are popular for consumers whose pets have allergies, are on raw diets or just want more veggies in their pet’s diet.” “Recent growth in healthy alternative pet foods has been explosive,” agrees Ward Johnson, owner of Sojo’s (booth 4359), which makes the freeze-dried Sojos Complete diet, in addition to several other alternative food and treat options. “Obviously, kibble still owns the dominant market share because of its convenience. But now that more and more pet parents are discovering that fresh, raw food can be convenient, too—there’s no question. Alternative foods will keep growing by leaps and bounds.” “Alternative foods and treats such as raw frozen, raw, freeze dried, dehydrated or baked products have been growing very rapidly in the last few years,” says Olivier Amice, president of Whitebridge Pet Brands LLC (booth 3901), whose family of products includes Cloud Star, and Tiki Cat, Tiki Dog, Gourmet Carnivore. However, the growth of alternative foods and treats may be about more than just the ingredients themselves. “For many years ‘natural’ was primarily an ingredient concept,” Amice explains. “The rationale was if we use ‘good’ ingredients, we will make good products. Now, we understand that the manufacturing process is as important as the quality of the ingredients to measure the quality of natural products.” “Maintaining a standard throughout your chain is critical,” agrees Tenorio. That, he says, includes knowing how to formulate a product and where to source quality ingredients. In the case of raw food, manufacturing might mean not cooking food at all and may be refined simply to formulation; but more generally, an interest in manufacturing processes means that options other than extruded kibble are increasingly being cast into the spotlight. In addition to alternative proteins and new interest in how edibles are handled before making it to the shelf, Amice adds that products, “free of this or that” will likely continue to be key drivers as well. Dan Schmitz, national sales manager at Tuffy’s Pet Foods (booth 4027), agrees that alternative proteins are becoming more popular, but he gets a bit more specific about what shoppers are hoping not to find in their pets foods these days. Grain- and gluten-free products are a growing trend he says. In fact, many experts point to alternative proteins and grain- and gluten-free products as the trends to watch for the year ahead. “We expect a continuing shift to grain-free—and a greater demand for exotic proteins,” says Johnson. Sojos is launching Sojos Wild, a new ultra-premium grain-free, raw, shelf-stable line, at the show, capitalizing on almost all the current trends at once. Eventually, however, Johnson expects the trend to take the next, natural step. “I expect buyers to start looking beyond the absence of grains—to the base ingredients used, instead,” he says. “For example, some brands substitute relatively benign base ingredients, like rice, white potato or tapioca. I expect a growing demand for ultra-healthy alternatives—like sweet potato, peas or garbanzo beans.” Johnson says that is why Sojos Wild is made with purple sweet potato, parsnips, green peas and green beans, with exotic meats as the No. 1 ingredient. Schmitz points out another important—but often overlooked—trend: the importance of high-impact packaging. “Packaging is always something that is important for manufacturers to introduce at Global, and I fully expect this again,” he says. Tuffy’s will be introducing a 40-pound bonus bag of its NutriSource Chicken & Rice product, as well as a new chicken-based diet with a smaller kibble for smaller dogs. Nulo Pet Food (booth 4120) will also be introducing new package sizes for its grain-free kibble product line, Nulo FreeStyle, at the show, says Steve Portch, vice president of sales. What It Means to Be Natural While those trends are mostly specific to natural edible products, some of them run parallel to trends within the natural category as a whole, including materials sourcing, manufacturing processes and health consciousness. Ultimately, that is what natural tends to mean for most shoppers—good for their pets. When asked, no two manufacturers offer up exactly the same definition of the word “natural.” “Package labeling can be deceiving,” says Paula Savarese, president of Dogs Love Kale (booth 4457), which offers all-natural gluten-free dog treats made with kale. Even “all natural” doesn’t always mean healthy, and labels like organic and premium are often used to imply healthy, but aren’t actually any more specific, she explains. “Made in the USA does not [even] necessarily mean that the ingredients actually originated in the U.S.,” she says. It is important that retailers determine what these terms will mean for their store, and then vet products carefully based on that standard. “Choose wisely for your customers,” advises Savarese. “The products and brands offered by retailers play an important role in defining and differentiating them from their competitors,” agrees Johnson. “I think that’s particularly true in pet specialty—where choosing manufacturers who are 100 percent committed to natural products has helped independent retailers successfully compete with the big boxes.” This often means reading ingredient list and talking to manufacturers in depth about how they create their products—a task that would be insurmountable without The Natural Pet section of the floor. “Having a separate ‘natural’ section on the trade show floor helps those independent store buyers quickly find, compare and select the kind of brand partners they’re looking for,” says Johnson. So, even though breaking the floor down into sections doesn’t eliminate the need to do additional research, it at least reduces the amount of time buyers must look specifically for natural products before they can even begin those important conversations. “Breaking the show floor into sections allows the retailers to make better use of their time,” says Portch. That is a trend everyone can get behind. Archive »Related Content The View from the Top Become a pack leader at the Pet Industry Joint Advisory Council's 2015 Top2Top Conference in April. Evolution in Skin Care Recent scientific research has ushered in a new era for maintaining skin health in dogs. Only in Orlando Orlando, well known for its fun and attractions for visitors of all ages, will soon roll out a host of mega-sized thrills, exciting new restaurants and a whole lot more. Copyright 2020 Pet Business Magazine. All rights reserved.	cc/2020-05/en_middle_0126.json.gz/line674
__label__wiki	0.944945	0.944945	Most Liked Quizzes & Personality Tests Past 48 HoursPast WeekPast MonthPast YearAll Time Quiz Likes Comments Hits Date How well do you know Kung Fu Panda by Sinjid Trivia (Movies) 7,268 11 years ago What color describes your spirits personallity best by BlackSlyFox Test (Personality Test) If you had a magical power what would it be by aylashark Just answer honestly by Madhaart What does your life mean by numptyclub Test (Misc.) What kind of tennis player are you by jglag Test (Sports) 20,233 10 years ago What Magical Creature Lives In Your Soul by youngs Who is your Hogwarts Boyfriend by MrsDraco27 What Kind of Heart Do You Have by glasschain What color represents you most by xXDjcandyXx What Is Your Anime Type by Lonewolf188 What Chop Chop Character are You by ReadChopChop What Mind Power do you have by TophanatorLO What are you like socially by GreatAdvice Anime romance story girls by narutovsgara Test (Silly) 13,369 7 years ago What Is Your Inner Animal by PinkDragon20 Dahvie Vanity amp Jayy Von Monroe by Botdf What kind of anime power will you have by bloodwielder Test (TV) minutes in heaven bleach style hehehe by SilentTounge How old will you be when you get married by pinkfox319 who are you selena gomez demi lovato taylor swift miley cyrus by jb1234 What kind of wizard are you by qaz963 What Gun are you by wtfusuck What Ben Alien Force Alien Are You by Celticsboy What evil creature are you by conorkane Test (Movies) < Previous \| 1 \| 2 \| 3 \| 4 \| 5 \| 6 \| 7 \| 8 \| 9 \| 10 \| 11 \| 12 \| 13 \| 14 \| 15 \| 16 \| 17 \| 18 \| 19 \| 20 \| 21 \| 22 \| 23 \| 24 \| 25 \| 26 \| 27 \| 28 \| 29 \| 30 \| 31 \| 32 \| 33 \| 34 \| 35 \| 36 \| 37 \| 38 \| 39 \| 40 \| 41 \| 42 \| 43 \| 44 \| 45 \| 46 \| 47 \| 48 \| 49 \| 50 \| 51 \| 52 \| 53 \| 54 \| 55 \| 56 \| 57 \| 58 \| 59 \| 60 \| 61 \| 62 \| 63 \| 64 \| 65 \| 66 \| 67 \| 68 \| 69 \| 70 \| 71 \| 72 \| 73 \| 74 \| 75 \| 76 \| 77 \| 78 \| 79 \| 80 \| 81 \| 82 \| 83 \| 84 \| 85 \| 86 \| 87 \| 88 \| 89 \| 90 \| 91 \| 92 \| 93 \| 94 \| 95 \| 96 \| 97 \| 98 \| 99 \| 100 \| Next >	cc/2020-05/en_middle_0126.json.gz/line680
__label__cc	0.688898	0.311102	Policies & Registration Please review current studio policies. New students: Contact to inquire about lesson availability. An interview lesson is required (45 minutes / $75) is required for all new students. Registration for returning (admitted) students: click HERE to access the registration form. Consultations: Advanced students looking for performance coaching may sign up for lessons on a "a la carte" basis. Lessons are also available for adults wishing to study on a semi-regular basis. See below for rates. Annual weekly-lesson package includes: 34 School Year Lessons (+ 2 Summer Credits). Lessons will take place during the school year, from late August or early September through late May or early June. Two summer lessons are included (additional summer lessons may be purchased). Recitals. Students are strongly encouraged to participate in recitals. Public performances are powerful learning experiences and serve as goals to practice towards. Typically, 5+ recital opportunities will be offered throughout the course of the school year. Workshops: These may include a visiting guest musician (masterclass) and/or a special presentation (piano technology, dance & movement, yoga, etc). Group Classes.The primary purpose of a group class to practice performing in an informal, supportive setting with peers as the audience. We talk about what to listen for, learn to give constructive artistic/technical feedback, and explore music history, music theory, and practice methods. Studio classes may be divided according to age/level of experience. Typically, 2 classes per year. PLUS: Piano Prodigies Notebook: full of tips, exercises, and a log to keep track of weekly assignments and practicing Piano Prodigies T-shirt: Let the world know that you are a Piano Prodigy! 88 Keys, 10 Fingers... No Problem! Birthday Composition: An original composition or arrangement, written by Elizabeth Borowsky, dedicated to the student Email feedback: Students may email recordings of their pieces during breaks for written feedback Tuition does not include: Fees for participation in festivals and competitions outside the Piano Prodigies studio Admission charges to (optional) ticketed events that we may attend as a group Policy Summary: Students commit to weekly lessons that will take place during the school year and four lessons (flexible) over the summer A calendar specifying lessons, special events, and tuition due dates will be provided. Payment may be made by cash or check. If check, make out to Piano Prodigies. If student is showing continuous lack of preparation, disinterest, disrespect, or is not valuing our time together, I reserve the right to terminate our lessons. 2019-2020 Tuition I. Weekly Lessons (all inclusive, see above) Tuition payments are to be paid in four equal installments as follows: 30-minute lesson package: $475 (annually $1900) 45 minute lesson package: $675 (annually $2700) Payments will be due approximately every 9 lessons. Reminders will be emailed one week before each due date. Late payments will be subject to a 5% surcharge (payment must be made at the next lesson by credit card). Tuition will be prorated for students who are accepted into the studio after the August start date. FAMILY DISCOUNT: combined lesson lengths (e.g. two 30-minute lessons = one 60-minute lesson) receive the benefit of the above discounted tuition cost for longer lessons. II. Consultation lessons (in person or online) - lesson only. Subject to availability.	cc/2020-05/en_middle_0126.json.gz/line687
__label__wiki	0.841004	0.841004	PJM ONLINE Polish Journal of Microbiology Formal requirements Manuscript processing Preparation of Manuscripts – regular paper and minireview Preparation of Manuscripts – short communications Formatting manuscripts’ files Formatting: Literature and references Species-Specific Identification of Human Adenoviruses in Sewage MAGDALENA WIECZOREK, ARLETA KRZYSZTOSZEK and AGNIESZKA WITEK. National Institute of Public Health, National Institute of Hygiene, Department of Virology, Warsaw, Poland Corresponding author: M. Wieczorek, National Institute of Public Health, National Institute of Hygiene, Department of Virology, Warsaw, Poland; e-mail: mrechnio@pzh.gov.pl Submitted 21 August 2014, revised 10 December 2014, accepted 23 December 2014 Human adenovirus (HAdV) diversity in sewage was assessed by species-specific molecular methods. Samples of raw sewage were collected in 14 sewage disposal systems from January to December 2011, in Poland. HAdVs were detected in 92.1% of the analysed sewage samples and was significantly higher at cities of over 100 000 inhabitants. HAdV DNA was detected in sewage during all seasons. The most abundant species identified were HAdV-F (average 89.6%) and -A (average 19.6%), which are associated with intestine infections. Adenoviruses from B species were not detected. The result of the present study demonstrate that human adenoviruses are consistently present in sewage in Poland, demonstrating the importance of an adequate treatment before the disposal in the environment. Multiple HAdV species identified in raw sewage provide new information about HAdV circulation in the Polish population. Keywords: adenoviruses’ detection, sewage, species-specific identification Human adenoviruses (HAdVs) are members of the Adenoviridae family, group of medium-sized viruses characterized by a nonenveloped icosahedral nucleocapsid and a double stranded DNA genome. The Adenoviridae family consists of five genera, of which the genus Mastadenovirus includes human viruses classified into 57 serotypes clustered into 7 subgroups (A-G). Human adenoviruses have different organ tropisms, causing a wide variety of clinical manifestations including respiratory tract infections, acute conjunctivitis, cystitis, gastroenteritis and systemic infections in immunocompromised patients. Subgroup A, F and G species primarily infect the gastroenteric tract, but only types 40 and 41 (subgroup F) have been strongly associated with gastroenteritis. Enteric adenoviruses multiply in the gastrointestinal tract, and are excreted in large numbers in the faeces of infected persons (even more than 108 copies/g of stool). The main source of adenoviruses in the environment is human faecal matter. Viruses cannot replicate outside their host’s tissues and therefore cannot multiply in the environment; however, they can survive in the environment for extended periods of time and have good tolerance for changing environmental conditions. HAdVs are extremely common in wastewater throughout the year, with concentrations between 103 and 107 genome copies/L reported in municipal wastewater from different geographical areas (Katayama et al., 2008; Fong et al., 2010; Kishida et al., 2012; Rodriguez et al., 2013;). In seawater, the enteric adenoviruses have been shown to be substantially more stable than either polio 1 or hepatitis A virus (Enriquez and Gerba, 1995). Many studies have suggested that HAdV is a good candidate as a fecal pollution indicator because of its known stability and persistence in aquatic environments compared to other enteric viruses (Pina et al., 1998; Hundesa et al., 2006; Albinana-Gimenez et al., 2009; Fong et al., 2010; Hewitt et al., 2013). During the last years, more attention has been focused on the sewage virological quality, the risk of virus-associated waterborne illness, the need for routine monitoring viral contamination and the environmental surveillance through the analysis of sewage. The presence of enteric viruses in sewage and hence in environmental surface waters reflects the infectious status of the population and constitutes a public health risk. The aim of this study was species-specific identification of human adenoviruses in sewage from Poland. Sewage samples from 14 sewage disposal systems in Poland (located in 13 towns) were examined for the presence of adenoviruses by molecular methods. Predominant adenovirus species in sewage were determined. Sewage samples. Samples of raw sewage were collected in 14 sewage disposal systems from January to December 2011, one sample a month. A total of 163 sewage samples were processed according to the protocol described earlier (Zurbriggen et al., 2008). To describe the process briefly, AlCl3 (final concentration, 0.5 mM) was added to 500 ml of sewage sample, and the pH was adjusted to 3.5. Following the addition of 250 µl of a SiO2 slurry, the samples were stirred for 30 min., followed by centrifugation at room temperature and 1500 × g for 5 min. to pellet the SiO2. The virus was recovered by rocking the pellet for 20 min. with 3 ml of 50 mM glycine (pH 9.5) containing 3% (wt/vol) beef extract. After centrifugation for 5 min. at 4 °C and 1500 × g, the concentrates were used to DNA extraction. DNA extraction and PCR. Viral DNA was extracted from 100 µl of concentrated sewage using spin columns (QIAamp DNA stool kit – Qiagen) following the manufacturer’s instructions. PCR was carried out using human adenovirus group-specific primers complementary to regions of the hexon gene (ADV-F, ADV-R) and HAdV species-specific primers (Table I). PCR amplification was performed in 25 μl volumes containing 23 μl of reaction mixture (Platinum PCR SuperMix with additions of 200 nM of each primer) and 2 μl of DNA extract. Amplification with group-specific starters started with an initial denaturation at 94 °C for 5 min., followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, and final extension at 72 °C for 5 min. Reaction mixtures were then held at 4 °C. Amplification with species-specific starters started with an initial denaturation at 94 °C for 5 min., followed by 30 cycles of denaturation at 94 °C for 60 s, annealing at 56 °C for 60 s, extension at 72 °C for 120 s., and final extension at 72 °C for 5 min. Reaction mixtures were then held at 4 °C. Amplification products were analysed in 1% agarose gels, GelRed-stained and viewed with the Molecular Imager Gel Doc system (BioRad Laboratories Inc.). Statistical analysis. To identify statistical significance, a Student’s t test analysis was performed online (http://www.physics.csbsju.edu/stats/). Results with p values of less than 0.05 were considered significant. Oligonucleotide primers used in this study Target Name Sequence (5′→3′) Amplicon size (bp) References Human adenovirus ADV-F GCCACGGTGGGGTTTCTAAACTT 131 Gunson et al., 2009 ADV-R GCCCCAGTGGTCTTACATGCACATC HAdV species A AdA1 GCTGAAGAAMCWGAAGAAAATGA 1444–1537 Xu et al., 2000 AdA2 CRTTTGGTCTAGGGTAAGCAC HAdV species B AdB1 TSTACCCYTATGAAGATGAAAGC 670–772 Xu et al., 2000 AdB2 GGATAAGCTGTAGTRCTKGGCAT HAdV species C AdC1 TATTCAGCATCACCTCCTTTCC 1988–2000 Xu et al., 2000 AdC2 AAGCTATGTGGTGGTGGGGC HAdV species D AdD1 GATGTCAAATTCCTGGTCCAC 1205–1221 Xu et al., 2000 AdD2 TACCCGTGCTGGTGTAAAAATC HAdV species E AdE1 TCCCTACGATGCAGACAACG 967 Xu et al., 2000 AdE2 AGTGCCATCTATGCTATCTCC HAdV species F AdF1 ACTTAATGCTGACACGGGCAC 541–586 Xu et al., 2000 AdF2 TAATGTTTGTGTTACTCCGCTC Sewage samples were collected each month from each sampling site. In total, 163 samples of raw sewage were investigated by molecular methods. Out of the 163 samples analysed, 150 were positive for human adenoviruses using HAdV group-specific primers (92.1%). The percentage of PCR-positive samples in different sampling months was 76.9% (October) to 100% (February, March, June, July, August, November) (Fig. 1). The percentage of PCR-positive samples at the different sampling sites range between 75% and 100% and was significantly higher at cities of over 100 000 inhabitants (p = 0.027) (Fig. 2). Fig. 1 Adenovirus positive sewage samples depending on season. A total of 163 sewage samples were examined for the presence of A, B, C, D, E and F species of human adenoviruses by molecular methods using species-specific primers. Adenoviruses from species A were found in 32 specimens (19.6%). The percentage of positive samples in different sampling months was 7.1% (June, July, September) to 57.1% (March) (Fig. 1), with the highest detection rate in the winter and early spring. The percentage of samples positive at the different sampling sites ranged between 0% and 58.3% and was higher at cities of over 100 000 inhabitants (not significantly different). Adenoviruses from B species were not detected in sewage. Adenoviruses from species C were found in 19 specimens (11.6%). The percentage of positive samples in different sampling months was 0% (April, May, September, October) to 50.0% (March) (Fig. 1). The percentage of samples positive at the different sampling sites ranged between 0% and 33.3% and was higher at cities of over 100 000 inhabitants, this difference is not significant. Adenoviruses from species D were found in 18 specimens (11.0%). The percentage of positive samples in different sampling months was 0% (January, February, August, October) to 28.6% (May) (Fig. 1). The percentage of samples positive at the different sampling sites ranged between 0% and 37.5% and was higher at cities of over 100 000 inhabitants (not significantly different). Adenoviruses from species E were found only in two specimens (1.2%) collected in August and December from two different cities. Adenoviruses from species F were the most prominent species detected in sewage, they were found in 146 specimens (89.6%). The percentage of positive samples in different sampling months was 78.6% (September) to 100% (February, April) (Fig. 1). The percentage of samples positive at the different sampling sites ranged between 50% and 100% and was significantly higher at cities of over 100 000 inhabitants (p = 0.017) (Fig. 2). Fig. 2 Percentage of adenovirus positive sewage samples at cities with a population over and below 100 000 inhabitants. The asterisk indicates a statistically significant difference (p < 0.05). Adenoviruses have been detected in sewage worldwide. Recent metagenomic studies have shown that multiple types of viruses can be found in raw sewage (Cantalupo et al., 2011; Ng et al., 2012). In this study, sewage samples were used to detect of diversity of HAdVs in wastewater. Samples of sewage were collected from several locations around Poland. Samples were evaluated by PCR assay for the presence of human adenoviruses. Our investigation confirmed that sewage is a rich source of adenoviruses. HAdVs were detected in 92.1% of the analysed sewage samples and was significantly higher at cities of over 100 000 inhabitants. Our results are in agreement with Puig et al. (1994), reporting detection of HAdVs in 100% of sewage. In other studies, HAdVs were detected in 56 and 20% of sewage and treated effluent samples, respectively (Pusch et al., 2005). Katayama et al. (2008) detected HAdVs in 100 and 99% sewage and treated effluent, respectively. Adenoviruses were detected in sewage during all seasons. Adenovirus infections have been observed to occur throughout the year with little or no seasonal variation in shedding. After infection, HAdV excretion by the host can last from months to years (Jiang, 2006) and the consequent lack of a seasonal pattern for this viruses in sewage has been confirmed by several studies (Jiang, 2006; Katayama et al., 2008). Fig. 3 Proportion of adenovirus positive and negative samples depending on sampling site (names of cities with population over 100 000 are underlined). All samples were subjected to species-specific PCR for detection human adenovirus species A, B, C, D, E, and F. Species F adenoviruses mainly, but also A, C, D, G cause diseases of intestine. HAdV-A was identified as the etiologic agent of a diarrhea outbreak in a hematology hospital ward in London (Jalal et al., 2005). Recently, HAdV-D and -C were detected in faeces of children with diarrhea in Bangladesh, Kenya and Brazil (Jarecki-Khan et al., 1993; Filho et al., 2007; Magwalivha et al., 2010). In this study, species F was identified as the predominant in sewage (89.6%), followed by species A, C, D and E. We detected all species of human adenoviruses associated with intestine infections. Seasonal differences in detection were observed for species A, C (peak in March) and D (peak in May). Probability of detection of species F in sewage was determined by population size. Adenoviruses from species F were detected in 99% samples at cites over 100 000 inhabitants. This trends agrees with results from other environmental studies. Barrella et al. (2009) detected the presence of human adenovirus from species F in 82% of sewage samples. Fong et al. (2010) isolated adenoviruses from species F (63%), A (29%), B (3%) and C (3%) from raw sewage and primary effluents. Santos et al. (2004) isolated adenoviruses 40 and 41 (species F) from 62 of 69 sewage and surface water samples collected in San Paulo, Brazil, over a 3-year period. In South Africa, species F, D and C (serotype 2) were isolated from treated drinking water and river water, human adenovirus species D isolates were predominant in treated drinking water (van Heerden et al., 2005). Adenovirus species F has been identified as one of the most prevalent viruses globally in the etiology of childhood gastroenteritis. The HAdV serotypes 40 and 41 (species F) have long been recognized as the main etiological agents of 1-20% of acute viral gastroenteritis in children (Cruz et al., 1990; Jothikumar et al., 2005; Shimizu et al., 2007). Shimizu et al. state that 50% of all adenoviruses found in stool specimens are types 40 and 41 (species F). HAdV-40 is known to be widespread in the European population, where it can cause outbreaks of gastroenteritis, mostly in children during winter. After infection, HAdV types 40 and 41 can cause mortalities as much as 50% in immunocompromised individuals (Echavarria, 2008). Considering that these viruses are shed for extended periods in faeces, urine, and respiratory secretions of infected persons (Jiang et al., 2006), their high prevalence in this study suggests a high incidence of species F infections in the host population. Several authors have suggested that the enteric serotypes 40 and 41 (genus F) dominate overall HAdV serotypes in sewage. Although some recent studies have demonstrated (Sinbanda and Okoh, 2012; Bibby and Peccia, 2013) that HAdV-C were more frequent detected in sewage and environmental samples than HAdV-F. In the present work HAdV-C were detected in 11.6 % of the sewage samples, but study results differed depending on sampling site (from 0 to 33%) and sampling month (from 0 to 50%). Bibby and Peccia (2013) identified species C in 78% of sewage samples. These results do not seem to be divergent taking under consideration that Bibby and Peccia collected ten samples in winter months from five wastewater treatment plants, served population ranging from 100 000 to 1 000 000 people. In the present study, human adenoviruses in sewage were detected by direct nucleic acid amplification from sewage concentrates by PCR. A number of studies have demonstrated that PCR is more rapid and sensitive than cell culture for adenovirus detection and species-specific identification by PCR is a popular method used to conduct adenovirus characterization (Xu et al., 2000). Nevertheless serotyping of adenoviruses on the basis of sequencing of PCR products is potentially more informative. Methods used for the identification of human adenoviruses in raw sewage have many limitations, mainly due to the nature of the samples examined. Raw sewage usually contains organic compounds at high concentrations, which may inhibit PCR reaction. In conclusion, this research demonstrates that human adenoviruses are consistently present in sewage in Poland. Human adenovirus species F was the most prominent adenovirus species detected in sewage, but molecular analyses indicated the presence of additional adenovirus species. HAdV species A, C, D and E were found in sewage samples, demonstrating the occurrence of multiple HAdV species in sewage. The presence of adenovirus species in sewage may represent a public health risk particularly taking in account immunocompromised individuals. Raw wastewater represent a significant source of pathogens that has a potential to contaminate aquatic environments and very important is adequate treatment before the disposal in the environment. This research was undertaken as part of 14/EM.1/2014. The authors thank Tobiasz Wieczorek for his help with the figures. Albinana-Gimenez N., M.P. Miagostovich, B. Calgua, J.M. Huguet, L. Matia and R. Girones. 2009. Analysis of adenoviruses and polyomaviruses quantified by qPCR as indicators of water quality in source and drinking-water treatment plants. Water Res. 43:2011-2019. [PubMed] Barrella K.M., P. Garrafa, T.A. Monezi, C.M. Harsi, C. Salvi, P.A. Violante and D.U. Mehnert. 2009. Longitudinal study on occurrence of adenoviruses and hepatitis A virus in raw domestic sewage in the city of Limeira, Sao Paulo. Braz. J. Microbiol. 40:102-107. [PubMed] Bibby K. and J. Peccia. 2013. Prevalence of respiratory adenovirus species B and C in sewage sludge. Environ. Sci. Process Impacts. 15(2):336-8 [PubMed] Cantalupo P.G, B. Calgua, G. Zhao, A. Hundesa, A.D. Wier, J.P. Katz, M. Grabe, R.W. Hendrix, R. Girones, D. Wang and others. 2011. Raw sewage harbors diverse viral populations. MBio. 2(5):e00180-11 [PubMed] Cruz J.R., P. Caceres, F. Cano, J. Flores, A. Bartlett and B. Torun. 1990. Adenovirus types 40 and 41 and rotaviruses associated with diarrhea in children from Guatemala. J. Clin. Microbiol. 28:1780-1784. [PubMed] Echavarria M. 2008. Adenoviruses in immunocompromised hosts. Clin. Microbiol. Rev. 21:704-715. [PubMed] Enriquez C.E. and C.P. Gerba. 1995. Concentration of enteric adenovirus 40 from tap, sea and waste water. Water Res. 29:2554-2560. [Link] Filho E.P., N.R. da Costa Faria, A.M. Fialho, R.S. de Assis, M.M. Almeida, M. Rocha, M. Galvao, F.B. dos Santos, M.L. Barreto and J.P. Leite. 2007. Adenoviruses associated with acute gastroenteritis in hospitalized and community children up to 5 years old in Rio de Janeiro and Salvador, Brazil. J. Med. Microbiol. 56:313-319. [PubMed] Fong T.T., M.S. Phanikumar, I. Xagoraraki and J.B. Rose. 2010. Quantitive detection of human adenoviruses in wastewater and combined sewer overflows influencing a Michigan river. Appl. Environ. Microbiol. 76:715-723. [PubMed] Gunson R.N., A.R. Maclean, S.J. Shepherd and W.F. Carman. 2009. Simultaneous detection and quantitation of cytomegalovirus, Epstein-Barr virus, and adenovirus by use of real-time PCR and pooled standards. J. Clin. Microbiol. 47:765-770. [PubMed] Hewitt J., G.E. Greening, M. Leonard and G.D. Lewis. 2013. Evaluation of human adenovirus and human polyomavirus as indicators of human sewage contamination in the aquatic environment. Water Res. 47:6750-6761. [PubMed] Hundesa A., C. Maluquer, S. Biofill Mas, N.A. Gimenez and R. Girones. 2006 Idendification of human and animal adenoviruses and polyomaviruses for determination of sources of fecal contamination in the environment. Appl. Environ. Microbiol. 72:7886-7893. [PubMed] Jalal H., D.F. Bibby, J.W. Tang, J. Bennett, C. Kyriakou, K. Peggs, D. Cubitt, N.S. Brink, K. N. Ward and R.S. Tedder. 2005. First reported outbreak of diarrhea due to adenovirus infection in a hematology init for adults. J. Clin. Microbiol. 43:2575-2580. [PubMed] Jarecki-Khan K., S.R. Tzipori and L.E. Unicomb. 1993. Enteric adenovirus infection among infants with diarrhea in rural Bangladesh. J. Clin. Microbiol. 31:484-489. [PubMed] Jiang S.C. 2006. Human adenoviruses in water: occurrence and health implications, a critical review. Environmental Science and Technology 40:7132-7140. [PubMed] Jothikumar N, T.L. Cromeans, V.R. Hill, X. Lu, M.D. Sobsev and D.D. Erdman. 2005. Quantitative real-time PCR assays for detection of human adenoviruses and identification of serotypes 40 and 41. Appl. Environ. Microbiol. 71:3131-3136. [PubMed] Katayama H., E. Haramoto, K. Oguma, H. Yamashita, A. Tajima, H. Nakajima and S. Ohgaki. 2008: One-year monthly quantitative survey of noroviruses, enteroviruses, and adenoviruses in wastewater collected from six plants in Japan. Water Res.; 42:1441-1448. [PubMed] Kishida N., H. Morita, E. Haramoto, M. Asami and M. Akiba. 2012. One-year weekly survey of noroviruses and enteric adenoviruses in the Tone River water in Tokyo metropolitan area. Japan.Water Res. 46:2905-2910. [PubMed] Magwalivha M., M. Wolfaardt, N.M. Kiulia, W.B. van Zyl, J.M. Mwenda and M.B. Taylor. 2010. High prevalence of species D human adenoviruses in fecal specimens from Urban Kenyan children with diarrhea. J. Med. Virol. 82:77-84. [PubMed] Ng T.F., R. Marine, C. Wang, P. Simmonds, B. Kapusinszky, L. Bodhidatta, B.S. Oderinde, K.E. Wommack and E. Delwart. 2012. High variety of known and new RNA and DNA viruses of diverse origins in untreated sewage. J. Virol. 86:12161-12175. [PubMed] Pina S., M. Puig, F. Lucena, J. Jofre and R. Girones. 1998. Viral pollution in the environment and in shellfish: human adenovirus detection by PCR as an index of human viruses. Appl. Environ. Microbiol. 64:3376-3382. [PubMed] Puig M., J. Jofre, F. Lucena, A. Allard, G. Wadell and R. Girones. 1994. Detection of adenoviruses and enteroviruses in polluted waters by nested PCR amplification. Appl. Environ. Microbiol. 60:2963-2970. [PubMed] Pusch D., D.Y. Oh, S. Wolf, R. Dumke, U. Schroter-Bobsin, M. Hohne, I. Roske and E. Schreier. 2005. Detection of enteric viruses and bacterial indicators in German environmemtal waters. Arch. Virol. 150:929-947. [PubMed] Rodríguez R.A., P.M. Polston, M.J. Wu, J. Wu and M.D. Sobsey. 2013. An improved infectivity assay combining cell culture with real-time PCR for rapid quantification of human adenoviruses 41 and semi-quantification of human adenovirus in sewage. Water Res. 47:3183-3191. [PubMed] Santos F.M., M.J. Vieira, P. Garrafa, T.A. Monezi, V.H. Pellizari, C.M. Harsi and D.U. Mehnert. 2004. Discrimination of adenovirus types circulating in urban sewage and surface polluted waters in Sao Paulo city, Brazil. Water Sci. Technol. 4:79-85. [Link] Sibanda T. and A.I. Okoh. 2012. Assessment of the incidence of enteric adenovirus species and serotypes in surface waters in the eastern cape province of South Africa: Tyume River as a case study. The Scientific World Journal Article ID 949216 [PubMed] Shimizu H., T.G. Phan, S. Nishimura, S. Okitsu, N. Maneekarn and H. Ushijima. 2007. An outbreak of adenovirus serotype 41 infection in infants and children with acute gastroenteritis in Maizuru City, Japan. Infect. Genet. Evol. 7:279-284. [PubMed] Van Heerden J., M.M. Ehlers, A. Heim and W.O. Grabow. 2005. Prevalence, quantification and typing of adenoviruses detected in river and treated drinking water in South Africa. J. Appl. Microbiol. 99:234-242. [PubMed] Xu W., M.C. McDonough and D.D. Erdman. 2000. Species-specific identification of human adenoviruses by a multiplex PCR assay. J. Clin. Microbiol. 38:4114-4120 [PubMed] Zurbriggen S., K. Tobler, C. Abril, S. Diedrich, M. Ackermann, M.A. Pallansch and A. Metzler. 2008. Isolation of sabin-like polioviruses from wastewater in a country using inactivated polio vaccine. Appl. Environ. Microbiol. 74:5608-5614. [PubMed] PJM Supplementary Files PTM Announcements Purchase of DOI numbers for articles and implementation of a modern publication platform for the Polish Journal of Microbiology are funded with the financial support of the Ministry of Science and Higher Education under agreement No. 659/P-DUN/2018 for science dissemination activities. Editorial Office PJM e-mail: editorial.office@pjmonline.org PJM is published by Polish Society of Microbiologists. Copyright © 2020 PJM ONLINE . Powered by WordPress \| Theme: AccessPress Ray	cc/2020-05/en_middle_0126.json.gz/line689
__label__wiki	0.742324	0.742324	Chicago’s Cardinal Cupich removes pastor who was sex abuse victim For the second time this year, Chicago Cardinal Blase Cupich has unceremoniously removed a pastor with a reputation for Catholic orthodoxy. First, it was Father C. Frank Phillips of St. John Cantius Church (click here if you're not already familiar with what transpired in that situation). Now it's Father Paul Kalchik of Resurrection Parish. From Catholic blogger Oakes Spalding's Sept. 22 post (click here to read his post in its entirety): Just hours ago, new Chicago Auxiliary Bishop Mark Bartosic arrived unannounced at Resurrection Parish on Chicago's Northwest side and told Pastor Paul Kalchik that he had just minutes to get his belongings together and vacate the premises or the police would be called to arrest him for trespassing. Father Kalchik was about to perform a wedding. Soon after, Father Kalchik left for an undisclosed location, accompanied by his brother who had been visiting the parish. Bishop Bartosic performed the wedding instead, hastily slipping out the door of the church only seconds after concluding the ceremony. Father Kalchik had been ordered by Cardinal Cupich and the archdiocese to report for psychiatric counseling and perhaps confinement yesterday after controversy broke concerning the exorcism and burning of a 'gay rainbow flag' on parish grounds last week. Father Kalchik recently announced – click here to read the text of his Sept. 9 homily – that he had been molested by two men, one of them a priest, on two separate occasions in his past. Since the flag-burning incident, he's reportedly been the recipient of threats of rape and death. His parishioners are said to be supportive of him. From ChurchMilitant.com (click here to read the article in its entirety): Church Militant confirmed Saturday [Sept. 22] that Father Paul Kalchik, pastor of Resurrection Parish in Chicago, has fled his parish and gone into hiding, one day after two chancery priests threatened him that if he did not get psychiatric treatment, Cardinal Blase Cupich would ensure he'd be taken away by police. 'The full frontal attack took place this evening, and the attack resulted in me not saying the evening Mass, nor leading the Rosary Benediction,' Father Kalchik told Church Militant Friday night about the confrontation with Monsignor Dennis Lyle and Father Jeremy Thomas, both vicars for priests.... According to parishioners Miriam and Wayne Smith, who spoke with Kalchik immediately after the confrontation, the vicars for priests 'attempted to order him to pack his bags and leave, but he refused.' 'Father Kalchik told them that he had done nothing wrong and that he was going nowhere,' the Smiths told Church Militant. 'They continued to use crude and threatening language that upset the staff members present very much.' In a disturbing twist, the two vicars for priests alluded to Kalchik's death when he continued to refuse to leave with them. 'Father Kalchik told those two enforcers that he had Mass to celebrate in the morning and that he was needed in the parish,' the Smiths continued. 'The response from the two was to ask him, 'What would happen if you were dead?'' Catholic attorney and child advocate Elizabeth Yore is another supporter of Father Kalchik. Ms. Yore is the former general counsel at Illinois DCFS, where she investigated the first of many sex abuse allegations against notorious ex-Chicago priest Daniel McCormack. (McCormack subsequently pleaded guilty to molesting five boys, was laicized by the Church, and currently resides in a state facility for sex offenders.) "This is how Francis-church handles the explosive clergy sex abuse scandals: They employ gestapo tactics against a good and holy priest who also happens to be a sex abuse victim, both as a child and as a seminarian," Ms. Yore said in an email to me. "Is this the Francis-church of mercy? Rather, this is the action of a tyrannical and callous cardinal who is roundly disliked and scoffed at by Chicago archdiocesan priests for his bully stunts, like this one. "Catholics are fed up with good and holy priests being persecuted by the hierarchy. Unfortunately, Cardinal Cupich just opened 'a rabbit hole.'"	cc/2020-05/en_middle_0126.json.gz/line696
__label__cc	0.629664	0.370336	Is Choosic the new music discovery app we have all been waiting for ? Andre Spiteri 23rd June 2015 Mu Tech Corner0 Comments 0 The digital age has had a huge impact on the music industry. Not only have YouTube and streaming services such as Spotify and Pandora made it possible to listen to your favourite music from virtually anywhere in the world, it has also become much easier for independent artists to release their material and reach a wider audience without label backing. On the one hand, this has been a much needed shot in the arm for an industry that has had an especially hard time adapting to the internet. The flip-side is that self-producing and releasing material is now so simple that, overwhelmed with the choices on offer, it can be much easier for listeners to stick to what they know. Choosic is an attempt to resolve this problem by making music discovery interactive and fun. The basic premise is simple. Choosic streams songs randomly. If you like a song, you swipe to the right and save it to your playlist. If you dislike a song, you swipe it to the left and into oblivion. The app offers a mix of established artists and artists you’ve probably never heard of before. The more you use the app, the more attuned it becomes to your musical tastes and the more accurate its recommendations become. On paper, this is a pretty neat idea. Swiping and algorithms which determine your tastes are hardly new concepts but, to Choosic’s credit, no-one had ever thought of applying them to music streaming and discovery before. The concept feels fresh and Choosic’s creators definitely deserve kudos for out-of-the-box thinking. The app is beautifully designed and very simple to use. Once you sign up, you are prompted to choose your three favourite genres of music. Whenever you load the app, it goes straight into discovery mode and starts automatically playing songs for you to swipe to the right or to the left. A drop down menu on the top left of the screen allows you to go to playlist mode, where you can play the songs you had previously saved to your playlist. The interface is fluid and intuitive, and swiping away becomes surprisingly addictive. Streaming worked without a hitch even on my no-frills 3G plan. The randomisation engine seems to have a bias towards emerging artists, at least in my case, but this is a good thing. Where Choosic gets top marks for design, usability, originality and its music discovery function, it doesn’t fare too well in other respects. Some of its drawbacks may well be deal-breakers for the more dedicated music aficionados. The choice of three music genres is unnecessarily limiting. It will be unpopular with listeners that have eclectic tastes or wish to set a particular mood. Playback in discovery mode stops unless you keep swiping. In a way, this is part of the appeal, as it makes music discovery an interactive and fun process. However, it also means that music discovery necessarily has to be an activity. You cannot leave the app in the background whilst doing something else. This doesn’t seem like such a big deal, since the songs you like are saved to a playlist for future listening. There is however only one playlist ordered by date, and so far it cannot be sorted any other way. This is a huge bummer, and renders the app practically useless for most other applications except music discovery. All in all, the app is a great tool for music discovery. It makes the process simple, fun and interactive. Unknown artists stand to benefit most from the app, and would do well to make sure that they are on it. Unfortunately, there is not much else one can do with it. Choosic’s creators would therefore do well to give the app some more functionality, or at least make integration with other music services a possibility. Download the App Now ! Music & technologyChoosicAppsMusic AppsTinderMusic Discovery Previous ArticleRetrospective \| NWA - Straight Outta Compton Next ArticleInterview \| Five minutes with Irini Mando Andre Spiteri Andre is a lifelong music fan, and has been recording and gigging with various rock and metal acts for the past 15 years. He likes the word "octopus". Music and Technology forever connected? OTCUPTV 26th October 2013 Five minutes with Choosic’s Project Manager Alessia Sannazzaro Andre Spiteri 8th July 2015	cc/2020-05/en_middle_0126.json.gz/line699
__label__wiki	0.544179	0.544179	Activists In Jerusalem Protest Chief Rabbi Calling Homosexuality An 'Abomination' Carlos Santoscoy In an interview released Friday, Jerusalem's chief rabbi called homosexuality an “abomination.” Rabbi Shlomo Amar lashed out at Israel's LGBT community in an interview with an Israeli newspaper. “I call it a cult,” he said. “It's a cult of abominations, it is obvious. It's an abomination.” “The Torah says it is punishable by death. It is in the first rank of severe offenses … They say 'leaning,' 'perversion' – this is nonsense. There is lust, and a person can overcome it if they want to, like all lusts. This is among the most forbidden lusts, the most severe,” Amar added. Amar also criticized rabbis who reach out to the LGBT community: “There is no such thing, to show understanding or tolerance for this. A simple truth needs to be stated – there is a severe prohibition, and there is no allowance for it.” LGBT rights activist Oded Fried said in filing a police complaint that Amar's comments were an incitement to bigotry. According to the AP, Amar's comments were protested by dozens of activists who held rainbow pride flags outside Amar's office. Israel is majority secular but nationalist and ultra-Orthodox leaders such as Amar are increasing in power.	cc/2020-05/en_middle_0126.json.gz/line700
__label__cc	0.661929	0.338071	Ameghiniana GARCIA, Rodolfo A; SALGADO, Leonardo; CORIA, Rodolfo A and CHIAPPE, Luis M. Embryonic osteology of titanosaur sauropods from Neuquén (Argentina): ontogenetic and evolutionary considerations. Ameghiniana [online]. 2010, vol.47, n.4, pp.409-430. ISSN 1851-8044. Titanosaur embryonic remains are described from megaloolithid eggs collected in the Anacleto Formation (Late Cretaceous) at Auca Mahuevo in Neuquén province (Argentina). These remains include complete articulate and disarticulate skulls, and numerous cranial and appendicular isolated elements. The embryonic skull is short, high, and presents numerous fenestrae, most of which are known in adult titanosaurs. However, the morphology of the maxilla and jugal is very different from that of adult titanosaurs. These elements show a series of processes that arise from their central body, which seem to have become reduced and transformed during ontogeny. The dental formula (Pm4 M7-8 /D10?) is similar to that of known adult titanosaurs. Detailed osteological study of these remains shows features of taxonomic, phylogenetic, and evolutionary significance. Several of the characters, including the snout with "stepped" anterior margin and the infratemporal fenestra extending ventrally to the orbit support the identification of the embryos as eusauropods. Other characters, such as the absence of crown denticles and the presence of a preantorbital fenestra are considered to be synapomorphies of Neosauropoda. Finally, the posteriorly wide skull and a maxillary notch at the ventral margin of the skull are regarded as synapomorphies of Titanosauria. Characters such as relatively large orbit, short rostral portion of the skull, long alveolar rows, "egg tooth", tooth crowns lacking wear facets, frontal occupying practically the entire dorsal margin of the orbit, and nonossified postcranial axial skeleton are typical characters of sauropod embryonic and juvenile stages. Keywords : Dinosauria; Titanosauria; Embryos; Ontogenetic development; Late Cretaceous; Anacleto Formation; Auca Mahuevo; Argentina. Maipú 645 Piso - 1 (C1006ACG) Ciudad Autónoma de Buenos Aires, República Argentina Tel./Fax: (54 11) 4326-7463 comedito@apa.inv.org.ar	cc/2020-05/en_middle_0126.json.gz/line705
__label__wiki	0.587493	0.587493	Scientific Excellence Georeferenced. The neighborhood matters. While the current dynamics of Worldwide Science outputs are rising to the surface Research Institutions from developing countries with important results; the location of Institutions holding excellence outcomes, that is, those which represent a truly and significant science advancement does not seem to be changing. Although a formal study would need a detailed analysis by scientific fields, an exploratory analysis of the group formed by the Research Institutions which annually publish 100 scientific papers or more (3,000 worldwide, as indexed in Scopus database) reveals that the resulting geographic distribution has a strong bias which is explained by research spending patterns in different regions of the world. There is a large concentration of institutions in North America, Europe, India, China and Japan, and to a lesser extent, in the southern hemisphere, in Chile, Argentina and more prominently in Brazil, South Africa and Australia. Neighborhood influence By depicting Research Institutions grouped into four levels of Normalized Impact (NI), a picture, as the one exposed, of the geographic distribution of Research Excellence around the world is obtained. Taking into account that, with odd exceptions, institutions reaching NI scores higher than the world average (values higher than 1) are concentrated in North America, Western Europe and Australia/New Zeeland, we must conclude that if the geographic bias in Scientific Outputs is high, it is even higher the bias affecting the Scientific Impact. Impact can be considered to reflect the use researchers make of the scientific knowledge previously generated. With this in mind, the map suggests that those regions that produce the most (Western Europe and North America) firstly use the knowledge being generated in their area, justifying this way the concentration of large impacts in highly productive regions and implying that Research Institutions in the most productive regions worldwide accumulate a reputational capital, which is due to the geographical context where they are, and on the other hand, that is unattainable for institutions located in less productive regions. It is still to be seen what will happen with China, a newcomer to the elite of more productive scientific countries in the world. Put another way, the neighborhood of a Research Institution affects the scientific reputation it can achieve in global terms, unless it can go beyond its neighborhood through inter-regional alliances with reputed institutions from highly productive regions. Scientific Dependence To developing countries, an unintended consequence of the need to collaborate with researchers from highly productive regions is what it could be called “scientific dependence”. Even though it is difficult to measure the role played by researchers in scientific works by just studying the affiliation fields, what we really know is that certain Research Institutions show extremely high rates of International Collaboration (IC) which indeed can be associated to situations of scientific dependence. I.e. when an Institution’s IC reaches or exceeds 80% of its total output, in such a way that its exclusive production ends being marginal, it is clear that it operates in a “scientific dependence” situation. Furthermore, when an institution shows high collaboration rates jointly with an outstanding impact (NI) within its own country and/or region, such impact will be most likely due to the collaboration, and it may be concluded that there exists an external scientific dependence. Some countries from Latin America constitute an example and an interesting case of scientific dependence in cases where a less scientific development, a highly international collaboration rate and a relatively high impact in a regional scale come together. See the high correlation between IC and NI values in the following table. Country Output IC NI Brazil 135,259 25.35 0.77 Mexico 52,527 38.65 0.75 Argentina 34,927 42.93 0.90 Chile 20,534 52.64 0.95 Venezuela 8,489 44.40 0.65 Colombia 8,292 53.90 0.83 Cuba 6,915 39.38 0.46 Puerto Rico 4,476 57.95 1.00 Uruguay 2,711 64.66 0.95 Peru 2,654 75.77 1.13 Costa Rica 1,946 71.17 1.16 Science Indicators of Spanish Public Universities We are releasing here a small post with some interesting indicators that can help contribute to shed light on the performance of the Spanish Scientific System, these specifically are related to publicly-funded universities. The table is available as a pdf and can be downloaded here: Science Indicators of Spanish Public Universities The list below is a description of the indicators you will find on the table. Normalized Impact (NI): (ordering criteria) weighted citation average of universities. By normalizing citation counts for differences among fields this indicator represents, in an indirect way, the Average Scientific Quality of the universities. Analysis Period: 2005-2009 Weighted Scientific Production (WSP): It is the result of assessing each scientific paper by its Normalized Impact and then adding them up for an entire institution. In this way, each paper counts higher than 1 when cited above world average (in its field, type and year) and lower than 1 when cited below. Analysis Period: 2008 Equivalent Full-Time Faculty Productivity (EFTF-P): Scientific Output by Equivalent Full-Time Faculty. Year 2008. Total Expenditure in Research (TER): Combination of the different Research Expenditure Items at a University. Year 2008. Expenditure per Paper (EP): Average expenditure per published scientific paper at a University (considering its Weighted Scientific Production). Year 2008. Total Equivalent Full-Time Faculty (EFTF): Number of Full-Time Academics by converting part-time to full-time equivalents. Year 2008. Expenditure per Equivalent Full-Time Faculty (TER/EFTF): Relationship between Total Expenditure in Research (TER) and Total Equivalent Full-Time Faculty (EFTF). Year 2008. Overall thoughts about Normalized Impact The evolution of the Normalized Impact of Spanish universities highlights the overall average impact improvement in Spanish system, as well as a slight decrease in top-notch universities. It remains true that the whole Public System is balanced and comparable with scientifically developed countries, specifically when compared with some English-speaking countries. More than 75% of Spanish public universities are above the world average impact, however none of them reach impact average levels higher than 50% of the world average. The following chart relates the academics’ productivity average and the Normalized Impact of universities (columns EFTF-P and NI in the table) and shows that there exists a clear positive relationship between these variables. In other words, in those universities where academics’ quantitative output in terms of scientific publications is higher, their qualitative outcomes are higher too. This means that as faculty’s publication activity at universities becomes more intense, the average quality of its outcomes reach higher peaks, among other things as a consequence of the higher chances of scientific synergies that take place within the institutions. Institutional Collaboration in Global Science Felix de Moya Anegon. Nowadays, georeferenced maps of science are becoming widely used in a number of ways in Research Analysis and Evaluation because of their ability to represent context information; see for instance Beauchesne’s captivating images in his post on Maps of scientific collaboration between researchers or Bornmann & Waltman’s geographical density maps. There are many more examples. However I will be posting on a different kind of map: a Scientific Collaboration Map that overtakes issues regarding the topographical rigidity exhibited by the former. The proposed maps represent the nearly 3,000 Research Institutions which account for about 80% of the world scientific output. In the picture, institutions are linked one another based on Research Collaboration as stated on paper affiliations (the list of institutions in the chart is exactly the same to the one used to elaborate the Scimago Institutions Rankings World Report 2010) According to the algorithm used to make the picture, collaboration links act as gravitational forces in such a way that the closeness between nodes (and clusters) represents collaboration strength; each node represents an institution and colors symbolize world regions. Scientific collaboration tends to take place among neighbors (preferably but not exclusively) so one might expect that a graph illustrating collaboration links among Research Institutions should group them into regions, as in the figure. This regional cluster formations, besides highlighting intra-regional vs inter-regional collaboration strength, helps us analyze the degree of centrality reached by the different regions of the world within the global network of Research Institutions. You can observe not only size differences in regional sub-networks but also how “central” are different regions within scientific knowledge generation and communication processes. Reputed vs. Emerging Science In these kind of representations, centered positions tends to reflect higher reputation levels while peripheral ones imply larger local collaboration patterns. As a consequence, researchers belonging to centered institutions are requested to collaborate by researchers from all around the world. As it was to be expected Research Institutions from Northern America (USA and Canada) and Europe compete for central positions. These regions have intense research collaboration links as the wide contact front between institutions from both regions highlights. Meanwhile, the self-organizational system of World Science keeps on pushing outwards to traditionally peripheral regions (Asia, Latin America, Middle East and Africa) despite these regions currently exhibit larger Growth Rates than central ones. In fact, despite the impressive increasingly important role played by Asia in Global Research Outputs, mainly due to Chinese Science grown, their institutions are still far from reaching the reputation levels achieved by some European and Northern American’s Research Institutions, hence the outlying position showed by the Asian Cluster. It is so, even though Asia and Northern America have strong collaborations links affecting many Asiatic Countries. Latin America, Oceania and Middle East These regions maintain priority collaboration links, at a regional scale, with at least two regions each. Latin America with Europe –mainly Spain and Portugal- and Northern America; in this case the picture shows that Latin America – Europe collaboration links are so intense that the boundary between both regions is not well defined in the map. Similarly, the deep links that Australian and New Zeeland Research Institution has with Northern American counterparts lead to the blurred boundaries observed in the map between Oceania and Northern American Regional Clusters. The Middle East region deserves an isolated view. It is the unique region divided into two separated areas in the map. Arabic countries are placed at the bottom of the map primarily connected to Europe, mainly East Europe (white nodes), and a lesser extent to Asia and Northern America; while Israel sets itself in the junction of Europe, Northern America and Latin America. The overlapping nodes from Western and Eastern Europe depict only one research cluster for Europe; suggesting there is not Western Europe separated from Eastern Europe in terms of Research Collaboration. African Institutions share their collaboration links between Europe and Middle East. Japanese Institutions fit their institutional links among the Northern American collaboration web. Further Analyses It turns out obvious that the relative weight of Biomedicine and Health Sciences is very important in this kind of representation given the skewed thematic distribution shown by the world research output and the fact that all those papers with authors belonging to the same institutions are excluded. In the future will be appropriate to carry out more thorough analyses devoted to concrete scientific fields where possible collaboration pattern differences are highlighted, meanwhile this post can serve as a discussion provoking contribution. Félix de Moya Anegón is Research Professor at the Institute of Public Goods and Policies (IPP) from the Spanish National Research Council (CSIC), his academic interests include scientometrics, bibliometrics, research evaluation and science policy; he has published around 100 papers in these fields. He is SCImago Research Group‘s main researcher, where he has led renowned bibliometic projects including Scimago Journal & Country Rank, Scimago Institution Rankings and The Atlas of Science. Prof. De Moya is also advisor for Science Policy issues for national organizations of science and technology and research institutions around the world. The research impact of National Higher Education Systems Felix de Moya Anegon. Research is not the only activity carried out at universities, but we know Higher Education Institutions’ (HEIs) ability to generate scientific knowledge is an obvious symptom of general performance. The existence of renowned researchers in universities is not by itself a sign of global quality, however nowadays it is hard to think about advanced human capital training unconnected to high quality knowledge generation processes. In this regard, bibliometric indicators measuring the average quality of HEIs research outputs are valuable reference marks of research capability when it comes time to disseminate the acquired knowledge and spread it to the students. For this reason, it makes sense to put HEIs through benchmarking processes using the Normalized Impacts (NI)* reached by its research outputs. And it will make sense as well to compare the impact distributions of National Higher Education Systems to assess aspects such as the level of heterogeneity of universities within a country or its compared average level, so that policymakers consider whether is better to sacrifice homogeneity to promote top-class institutions, or otherwise the excellence can be reached for the system itself without having to give up equity. The following chart generated from the World Report SIR 2010 (based on Scopus data) shows, in a comparative way, the Normalized Impact Distributions for all the universities belonging to the world’s 50 most productive countries on scientific knowledge. [Download data: Microsoft Excel \| Open Office] Universities within countries are distributed in quartiles ranging form higher to lower NI. As can be seen on the chart, the 50 countries can be divided into two groups: on one hand, those which have more than 75% of its universities over the world average and; on the other, those which have the same percentage underneath. We find 24 countries in the first group featuring USA, UK, Germany, France, Canada, Italy and Spain and 26 in the second one including China, Japan, Korea, India, Brazil and Russia. It might be surprising the presence of Japan or Korea in the second group, but it is not. We must consider that NI distributions show the average value of the international visibility reached by universities research outputs in those countries. Therefore the fact of being technologically developed countries is not incompatible with the relatively low research visibility showed by its academic institutions. The reasons for this are varied and this may not be the place to deal with them, but it can be pointed out briefly that according to the SIR World Report 2010 while one can easily find large Japanese and Korean Companies carrying out high-profile research amongst the world’s Top 100 ordered by NI (i.e. Toyota, Nippon, Samsung, Toshiba, Fujitsu, Hitachi and Mitsubishi) it is otherwise hard to find a Japanese or Korean university in the same ranking Top 400. It also worth analyzing the level of homogeneity shown by different National Higher Education Systems. The chart shows some countries having similar NI values for all their universities, these countries, which belong either to the first or second before-mentioned groups, show small differences between extreme NI values, i.e. Belgium and Ukrania. On the contrary, the most heterogeneous countries, from an NI perspective, are those whose universities manage to reach very high impact rates jointly coexisting with other ones presenting very low NI rates. This phenomena is not only related to the size or complexity of educational systems, but also to Public vs. Private balance and the level of openness to the globalized market of the different National Higher Education Systems. To conclude I would mention that the systems’ ability to attract talent is one of the most supporting factors in rising research reputation and, attached to it, the scientific visibility reached by universities around the world. * Normalized Impact scores indicate the scientific impact that institutions have over the scientific community. In order to obtain a fair measurement of such impact, its calculation removes the influence due to institutions’ size and research profile making it ideal for comparing research performance. [More] A new venture We are starting up Scimago Lab’s blog with this post. The blog aims at set itself up as the main channel to show our particular vision about our work as well as important issues relating to research evaluation, quantitative analysis of scientific information, scientometrics news and so on. We will also inform and discuss here about Scimago Lab‘s product schedule, development, and strategic directions. We are confident this blog will be as useful to you as exciting to us and encourage everyone interested to participate and set your ideas out. The Scimago Lab staff	cc/2020-05/en_middle_0126.json.gz/line706
__label__cc	0.73875	0.26125	Welcome to Solanaceae Source Solanaceae Source aims to provide a worldwide taxonomic monograph of the nightshade family, Solanaceae. The family is of considerable economic importance and contains species that are used as food (potatoes, tomatoes and eggplants), medicines (henbane and deadly nightshades) and in horticulture (petunias). We began this journey with the on-line monograph of all species in the mega-diverse genus Solanum. The National Science Foundation (NSF) funded the Solanum project as part of the Planetary Biodiversity Inventories (PBI) mission from 2004-2009. In 2011 we added the names for all members of the family to the resource with the collaboration of the International Plant Names Index (IPNI), and are working through these with the help of the Solanaceae community worldwide. This increases the coverage to all 90+ genera of the family and will contribute to diverse projects such as the World Flora On-Line that is contributing the the Global Strategy for Plant Conservation. The Solanaceae Source BRAHMS database serves data on names and specimens for the website and is worked on continuously. The website and database behind it are constantly being updated and improved - we hope you will bear with us as we both improve the site and the data that underpin it. Solanum phoxocarpum Voronts. Solanum leptopodum van Huerck & Mull.-Arg. Solanum tanysepalum S.Knapp Solanum stenopterum A.R.Bean Solanaceae Source in SpeciesLink Brazilian specimens of the Solanaceae Source database became available today through SpeciesLink, Brazil's major biodiversity data portal. A total of 1,466 specimens of Solanaceae from the Natural History Museum London (BM) are now available within SpeciesLink searches, integrating the specialist database for the nightshade family with Brazil's digitally available collection data. A new Solanum from the heart of Texas New species are not only found in the back of beyond - solanum gurus Lynn Bohs and Stephen Stern together with Jeff Keeling of Sul Ross State University have just described Solanum cordicitum from Valentine, Texas - proving that botanists have excellent senses of humour! Read the University of Utah press release here and the report in Science. Solanaceae selected as a pilot family for the Flora do Brasil project Brazilian botanists came together at a series of workshops held at the Brazilian 64th Congresso Nacional de Botânica in Belo Horizonte (Minas Gerais) to map out the ambitious project of describing the extraordinary plant diversity of the country by 2020, as a contribution to meeting the first target of the Global Strategy for Plant Conservation. Brazil holds almost 10% of the world’s plant diversity – understanding Brazil is really important for understanding global plant diversity! More news and events Back to northern Peru - land of the wild tomatoes! Sandy Knapp is going back to northern Peru with NHM colleague and dipterist (fly) curator Erica McAlister to collect insects off wild tomato and potatos in the Andes NE of Trujillo. Follow the blog on the NHM website for what they find! Peru - February 2014 Sandy Knapp is in Peru again, this time with the NHM team working on Solanaceae and their associated insects - potatoes and tomatoes will be the targets. Follow her blog on the NHM blog site - collecting begins in the valleys of the department of Lima. Sandy and Lynn are off to the forests of Brazil, to join Leandro Giacomin, Joao Stehmann and Isabella Rodrigues for collecting and Solanum fun! We will be in Bahia and Minas Gerais, with some conference action in the middle - follow the trip on the Seeking nightshades in South America blog at the NHM London. More field work reports Enquire about the project or send us your comments using our online enquiry and feedback form. Guidelines for citing information on the Solanaceae Source website. SOL newsletters Keep up to date on the progress of the International Solanaceae Genomics Project (SOL)	cc/2020-05/en_middle_0126.json.gz/line710
__label__wiki	0.503177	0.503177	My Picks for the Top Twenty Albums of 2016. I should probably always call these "The Top ____ Albums I Listened To in ____" because, you know, it ain't definitive and I don't claim it to be - I'm just one man. And when I look at other year-end lists, they're really well rounded with a ton of shit I never got to, but I just exercise the myopic luxury of assuming all that stuff is garbage. It's a time-honored tradition of mine! Here are the albums that dominated my 6-disc CD changer this year: (Oh, another note: Run the Jewels just dropped RTJ3 and it's technically still 2016, but its original release date was January 2017, so it'll be on next year's list.) This record's dope and mad thumpy, and a sweet stop-gap between Summertime '06 and the next full-length masterpiece everyone is expecting from this dude. He'll deliver. "Pimp Hand" 19. Kendrick Lamar - untitled unmastered. Kendrick flexing, showing that even the tracks on his studio floor are doper than what most rappers are leading with. I didn't listen to this one nearly as much as To Pimp a Butterfly, but I probably should have. 18. Royce Da 5'9" - Layers Rap curmudgeons who whine about lyricism being dead in hip-hop must be caught up in a perpetual loop of hate-watching the trash-rap that teenagers go nuts for on YouTube, because there are plenty of rappers (old and young!) who still wanna go toe-to-toe with anybody. Royce has always been that dude, and since he gotten sober he's dug his heels in even further, and you can really hear it in his music. This record is dense, and you can tell he put everything into it. Mad passionate. "Tabernacle" 17. Lloyd Banks - Halloween Havoc 3: Four Days of Fury Banks is another one of those dudes, like Royce, who hasn't slipped a bit on the lyrics, and he just won't stop dropping virtually feature-free albums where all he does is rap his ass off. He actually put out another mixtape in 2016, before this one, called All or Nothing - Live it Up, and it's solid, too. And it appears he just released another EP last week. If anyone ever accused Banks of dick-riding Fif, they best retract. "Money Crime" 16. G-Unit - The Lost Flash Drive You know my ears perk up for G-Unit rarities! This is such a bizarre set of songs that it somehow works, even down to the absurd, six-minute Young Buck freestyle that runs through a barrage of ridiculous beats. There's not a lot of 50 on this thing, which is curious, but I think they're interested in letting Kidd Kidd get his. Fair enough. Will this make new fans for the G-Unit? Nah. Is it crazy Tony Yayo still gets paid to rap? Indeed! "Superville" 15. Cousin Stizz - Monda Can't remember how I got turned onto Stizz, but as soon as I heard it I had a tough time shaking his track "500 Horses." That beat? Come on, man. The rest of this mixtape is equally dope, and more sweet antidote for those who think modern rappers don't have shit to say. Love this dude's voice. "Every Season" 14. Swet Shop Boys - Cashmere Heems links up with the cool pilot dude from Rogue One to make a record that is much more original, much less predictable, and lots more fun than that film. Pakistani beats and political raps hidden inside Heems' stony, fun-times drawl. Gets a little grimy, too. India in this. "T5" 13. NOFX - First Ditch Effort I don't always go in for new NOFX records, but I ended up listening to this one quite a bit this year for whatever reason. They just keep doing it, man! "Oxy Moronic" is classic Fat Mike, with ridiculous puns ("Klonopinions," etc.) aimed at a very serious issue - the legal drug trade. And it's over four minutes long - these guys are growing up. "Sid and Nancy" 12. Dumbfoundead - We Might Die Dumbfoundead is a battle rapper, among many other things, and he's got lyrics for days. This new mixtape is dense but to the point, with ten tracks that get in, get out, and leave you wanting just a little bit more. That's the way to do it. And when Nocando shows up, you know it's on. "Murals" 11. Danny Brown - Atrocity Exhibition Danny Brown's weirdness knows no bounds, and it's not hindering him a bit. This record is strange as ever, but his prowess for getting beats together that match both the tenacity and unpredictability of his vocals is becoming more and more apparent as his reach grows. DB knows who to work with, and he apparently hasn't even come close to saying what he needs to say. Check his verse on the new RTJ! "Pneumonia" 10. Spark Master Tape - Silhouette Of A Sunkken City We still don't know exactly who Spark is, but he's opening for Run the Jewels on their upcoming tour and Eminem's manager keeps yapping about him, so shit's about to get real. Either he's the next big deal or the backlash - which has already begun - will be swift and this will all be "exposed" in some shitty internet post. Whatever. I still find it interesting, though I will admit this record wasn't a huge step forward. But it was a step. "All About the Money" 09. Descendents - Hypercaffium Spazzinate They've still got it! Maybe this record is why I dipped into the NOFX one. 16 tracks, none touching 3 and a half minutes - you know what you're getting into here. The hooks are hooky, Milo sounds refreshed and ready, and songs like "No Fat Burger" lean heavy on the old-school noddery without resorting to self-parody. Tough to do! That's why the Descendents are good. "Shameless Halo" 08. David Bowie - ★ Would I have listened to this record if Bowie hadn't died this year? Maybe not, but I did, and anytime an artist with status like David Bowie kicks off a record with a ten-minute song, I'm interested. Most artists can't do that, wouldn't dare do that. Bowie does, and it's only the intro to what is a massive record, one that does somehow seem to shut it all down. Of course he put something out right before he died. It would've been odder if he hadn't. "I Can't Give Everything Away" 07. Alex Cameron - Jumping the Shark Alex Cameron doesn't really have those scars. It's all part of...something that takes way too long to explain. Listening to his music gives some insight, but not nearly enough, and it's all working to keep me fitfully intrigued. But it's the songs that are really great, with the stark and chilly videos adding to the overall impression. It's a bleak one, but hey: you can dance to it. "Mongrel" 06. Young Thug - Jeffery Thugger can pull together a full-length, man. This one's a little more "look at me and where I am!" than Barter 6, but dude's getting supremely famous and it would fuck with anyone. So yeah, the hunger's gone, but the beats and hooks are still there, as is that wonderful dress he's wearing that got so many rap dudes pissy. Keep it coming. "Harambe" 05. Kevin Gates - Islah I'm going to live long enough to hate Kevin Gates, and when it happens, I'll gladly let it wash over me. Until then, I will continue to sporadically listen to his music, especially this album, which features - and honestly this is the single most shocking thing I could say about a rap record in this day and age - NO FEATURES. This is his record, front to back, and it really does hit you when you listen to it. It's just one big lump of this dude's life, which is constantly on fire. He's loving his kids one moment, ending your shit the next. He's telling you material things are worthless, than rapping about his diamonds. And throughout being chillingly polite about ALL of it. 04. Radiohead - A Moon Shaped Pool Radiohead are in that aforementioned Bowie category where they can skip the system, put something out just the way they want it, and you better be ready to deal with it, extensively intricate intros and all. This one is, not shockingly, a terrific record, because at this point this band is apparently incapable of really dropping the ball and laying an impenetrable brick on an unsuspecting public. I think there are still those hoping for some weird regression into the guitar-effect onslaught of OK Computer, but it ain't happening. Sounds like they're sampling snores and using them as rhythm devices. We're wayyyy past "Paranoid Android" here. I mean, I'm not even sure if the drummer's in the band anymore. "Burn the Witch" 03. DJ Shadow - The Mountain Will Fall Shadow still getting it done! He's hindered, like a lot of "breakthrough" artists, in that he's never going to be able to sufficiently replicate the influence and overall undying majesty of Endtroducing..., which is something he shouldn't be held to, especially considering the real strides he's made in developing and expanding the trademark sound of his music while still staying true to the sample-based shit he's known for. This record is pure Shadow: mostly instrumentals but with some guest spots that enhance, not distract. Thick beats. "The Mountain Will Fall" 02. Open Mike Eagle & Paul White - Hella Personal Film Festival Art rap for the masses! These beats aren't exactly of the kind Mike Eagle usually rides; they're way more 70's-AOR samply, but when paired with Mike's equally buttery vocal effortlessness, it all comes together. I saw Open Mike Eagle perform here in Portland earlier this year and the crowd there was as diverse as any you'd see. I wasn't the old dude, I wasn't the young dude - I was just another person in this group of everybody. It kind of reminded me of wrestling a little bit, in that there's something for everyone in this dude's music. Can't say that about a lot of musicians or rappers. And he even raps about wrestling! It's all there. "Admitting The Endorphin Addiction" 01. Kristin Kontrol - X-Communicate I was a casual fan of the Dum Dum Girls, but man: this one caught me by surprise. I definitely listened to this record more than any other in 2016, and in fact I'm really shocked this album wasn't more of a big deal. Sounding as much like it came out in 1986 as it does 2016, this is a no-filler lineup of 10 synth-pop songs that all deserve to be there. Maybe it's taking folks a second to put together this pivot that the former Dee Dee made this time around, because it was a big one, but these songs are strong enough to stand alone, no backstory needed. Hope I get to see her live soon, because I'd love to see these songs pulled off on the spot. "White Street" Posted by Wockenfuss at 3:14 PM No comments: Labels: Year-End Lists Early October Record Shopping at Reckless in Chicago, Part Three: The Loop. This is the Reckless location that was about five blocks from my hotel, but I made the last one I went to so I could just walk it back and not take another Uber. Though I did have a fun time getting rides in Chicago. Got the vibe that the drivers weren't usually picking up or dropping off people at record stores. But hey, that's me: I'm fucking cultured. I had spent a good amount of my allotted dough at this point, so I went into the Loop Reckless - the smallest one; it's not cramped, but it's close - looking to get some bang for my buck. I ended up with a bunch of weird stuff, some of which I'm just now remembering buying. What a whirlwind! The Halflings - "A Kiss for Christmas" 7" (1995) Even more for my Christmas collection. This is on red vinyl, but of course there was a green edition, too. That's the spirit. And that's some 90's punk. Richard and Willie - Waitin For Gas (1979) Laff Records, of course. Ribald stand-up comedy, no doubt. With track titles like "Leon Spinks" and "White Dudes," I'm figuring this is right in my wheelhouse. Jackie Kannon's "Prose from the Cons" (196_) "A comedy album recorded live and featuring convicts of Southern Michigan Prison." Sounds hilarious. Hal Masters - The Funny Side of the Street (1961) This thing was in crazy good shape and there's a naked lady on the front, so I needn't further convincing. The back describes him as "controversial," and I'm a little scared to find out what that's referring to. Probably a number of things, but really, isn't he just pointing out our differences? Victor Buono - Heavy! (1971) Stand-up comedy that seems to focus on his weight. Should be uncomfortable! Wildman Steve - Wild! Wild! Wild! Wild! (1970) I've been lucking into these "party records" lately. Dirty stuff. Wild, even. Franklyn Ajaye - Don't Smoke Dope, Fry Your Hair! (1976) Another comedy record. This one's on Warner Bros. but I'd never heard of this dude. Great cover, weird title - I hesitated for a second but then made my move. Bill Carty "Blasts Off!" (196_) This cover is as terrifying as it was the first time I saw it. Jesus, Bill. Wayne Juhlin - My Kinda Town (1975) Private-press spoken-word/comedy thing from mid-70's Chicago. Looooove shit like this. The Marillac Chorus Orchestra and Jazz Combo - Music from Marillac (1972) This is another gem, a private-press LP of a recording of an orchestral and choral performance by a Chicago-area all-girls private high school in the early 70's. Looks like it's never been played. Nice topper to all the rando records I copped this trip. And that was it. And thanks to Southwest's new no-fee baggage policy, I got it all home for free. Dude, I'm getting really good at this. Reckless got some great stores, son. Labels: Vinyl Excursions Early October Record Shopping at Reckless in Chicago, Part Two: Lakeview My last day in Chicago was a Monday and I had to be on a plane around 7. I got up early, checked out of my hotel, and by 10:30AM I was at the Reckless on Broadway, their biggest location and the one where I've had great luck over the last few years. This time around I didn't come up on any big scores, vinyl-wise, which was odd, but I did get a bunch of cassettes. I picked up a few the first night, too - this is all of 'em: Not bad at all. They had tons more rap tapes the last time I was there, though, and I've been retro-kicking myself for the last 12 months, regretting not pulling that trigger. But what's done is done, and I'll come up on that King Tee tape some other time. Here are the records I did get: Mosquito - Mosquito 7" (1992) Jad Fair and Sonic Youth's Steve Shelley crank out some distorto-jangle weirdness. One dollar. Rappin': Music From the Original Motion Picture Soundtrack (1985) I am pretty sure I've never seen this movie but I couldn't pass this up for three bucks. Peebles. Never been cool. Oh he'll try, but he just can't get there. At the same time, the late, legendary Larry Smith ("My man Larry Larr, my name DJ Run") produced a bunch of tracks on this thing and I can't front on that. Monie Love - "Monie in the Middle" - The Remixes 12" (1990) Oh I'll get down with some Monie Love. This is a 3-song 45RPM 12" from the UK that features 3 remixes that are mad club-ready and seem more suited for overseas than here, but that was often part of her struggle. Though if you listened to her, you'd think she was from Brooklyn or some shit. A very underrated female rapper. Latifah knew. MC Ren - "Same Ol' Shit" 12" (1993) Three-song 12" single with a radio, album, and instrumental version. Ren in '93 on Ruthless. I bought this just so I could have it and flip by it and remember how awesome MC Ren is. Edwin L. Baron - Relaxation and Self Improvement (1955) This was made in Chicago and while I don't think it's a particularly rare or sought-after LP, I probably wouldn't have found it in Portland. More photos of this relax-master right here. The Ravers - It's Gonna Be a Punk Rock Christmas (1978) On Rhino Records with crazy festive vinyl. This was surprisingly cheap and it's in great shape. My Christmas-record collection is two crates deep at this point. I'm a force come December. Chartbusters: Hit After Hit (1984) I love K-Tel comps from the mid-80's. I keep records like this in the front room of our house. They make great mixes for cleaning or eating or just hanging out. And they sometimes have the deeper cuts that they thought would end up being big hits but weren't: This one's got "Adult Education" by Hall & Oates and "She's Strange" by Cameo. Pretty sweet. And that was it for the Broadway shop. Here's a few more pics: Early October Record Shopping at Reckless in Chicago, Part One: Wicker Park. Chicago: The City On the Go. The Windy Apple. The Jewel of the Nile. Yes, I'm practically a Chi-land local at this point, so how 'bout dem DA BEARS, huh? Gimme a sec, just need to wring the kielbasa juice outta the ol' push-broom. Well son of a fuck Ditka, I ended up back in Chicago again this year. The weather was mild, my leisure time was little, but I still managed to hit all three Reckless Records locations over the course of a consecutive evening and an afternoon. Was in town for three days before I had a chance to sneak off on Sunday night and hit the Wicker Park location, which I think is the newest one, but maybe not super-new. Either way, it's the one I hadn't been to before, so I wanted to check it out this time around if I did nothing else. It's a great little store, essentially a slightly smaller version of the Broadway location, which is their big'n. It was my first record-shopping stop of the trip, so I had to limit myself a bit to leave room for two more stores worth of digging. I left an NM copy of An Evening With Wild Man Fischer on the shelf, and I'm feeling tinges of regret. But it's too late now. Here's what I did get: Frank Zappa - The Old Masters Box Two Sampler (1987) I used to own this record. I bought it when I lived in Eugene in probably '95 or '96, most likely at House of Records. I sold it on eBay in the mid-2000s along with a few other records that I immediately regretted getting rid of and have felt stupid about ever since, enough to ignite my ongoing mission to replace those records and make myself whole again. While I still haven't found the limited-edition Mr. Bungle picture disc I sold in a moment of true darkness, I did finally find this, a fairly inconsequential LP in the larger scheme of things, but one that is important to me. I feel good about it. And it's even got the catalog inside, just like my old copy did. Sampler of Zappa remasters with one unreleased Mystery Disc track. Big Daddy Kane - "All of Me" 12" (1990) This is my least favorite Big Daddy Kane single, and maybe my least favorite song from his entire catalog, though "I'm Not Ashamed" is always very tough to beat. "All of Me" is a duet with Barry White that is a huge whiff and overall really not good. And there's an extended remix on here! Fantastic. I somehow did not have this but I do have a test pressing of it. Deep. Mykill Miers - "Raw Shit" 12" (2001) Mykill Miers! This was a buck I think. Tracks from his second record. I loved rap like this in the early 2000s. Still sounds dope. LA Dream Team - Kings of the West Coast (1986) Sealed for three bucks. Before Dre and the Wreckin Cru, there was The Dream Team. Side F/X - "A Swift Kick" 12" (1989) I had never heard of these dudes but I liked their baseball uniforms and hey: that name is pretty clever. 5-song EP-ish type thing. West Coast Crew - "Jail Bait" 12" (1985) Electro-rap that is not quite as troubling as the title suggests, but certainly troubling nonetheless. V/A - The Compton Compilation - Sound Control Mob "Under Investigation" (1989) Catchy title! This comp is a year past Straight Outta Compton and features Lonzo from the Wreckin Cru overseeing the whole thing and eating some crow along the way. Cash-in? Eh, I guess. Features tracks from CMW and others not as notable. An answer to NWA and the Posse in a way. This was one of my more high-priced items on this trip, though it was only $15. Teenage Talk-In (1969) Hey kids, let's rap! Whatever's on your mind, though you know I'll be swingin' the ol' convo right back to Jesus every time! Here's a picture of The Beatles to make you think we might not suggest you ignore your overwhelming urges and instead channel that energy toward respecting your parents. Yo-Yo - Total Control (1996) Yo-Yo, deep into the 90's. Never heard this one. She's got a hot new look. V/A - Rap It Up (1986) A K-Tel rap comp that I don't think I ever owned, but definitely eyed when I was a kid. Two songs from Timex Social Club and one from Full Force was not sweetening the deal. Let's be careful what we call "rap" here. And that was that for the first night. Much more to come. The Purest Form of Stallionism. My name's Wockenfuss. I live in Portland and make rap music and collect records. This blog used to be me writing about my music collection, but now it's mostly me writing about how I'm collecting more records, and where I'm going when I do it. Usually it's places in Portland, but I make a point to check out record stores when I'm out of town, too. There is no free music here, but if there's something on this site that you're just dying to hear and it's out of print and you literally cannot find a way to buy it, I might be able to help you out. Email me here. My favorite record stores right now: Amoeba (Hollywood) Music Millennium (Portland) Speck's Records & Tapes (Portland) Crossroads (Portland) Exiled (Portland) PDQ (Tucson) Wax n' Facts (Atlanta) Fantastyland (Atlanta) Easy Street (Seattle) Reckless (Chicago) Burger (Fullerton) Wockenfuss Whatever I finds, I keeps. Early October Record Shopping at Reckless in Chica... 2000's hip hop/rap (85) 2000's rock (81) 2010's rock (1) 60's Rock (31) 80's hip hop/rap (19) 80's pop (8) 90's rock (136) At the Movies (29) Event Attendance (18) I Went to a Show (28) Internet Buys (1) Milestone Post (7) New Music Review (2) Shit Shootin' (10) Special Report (3) Stallion Alert (9) Vinyl Excursions (82) Year-End Lists (17)	cc/2020-05/en_middle_0126.json.gz/line720
__label__cc	0.665268	0.334732	by Carl Lombard Written by Carl Lombard What is Glutamine? Glutamine is the most abundant amino acid (building block of protein) in the body. The body can make enough glutamine for its regular needs. But during times of extreme stress (the kind you experience after heavy exercise or an injury), your body may need more glutamine than it can make. Most glutamine is stored in muscles, followed by the lungs where much of the glutamine is made. Glutamine is important for removing excess ammonia (a common waste product in the body). It also helps your immune system function and may be needed for normal brain function and digestion. You can usually get enough glutamine without taking a supplement because your body makes it and you get some in your diet. Certain medical conditions, including injuries, surgery, infections, and prolonged stress, can lower glutamine levels. In these cases, taking a glutamine supplement may be helpful. From University of Maryland Medical Center Benefits of Glutamine Supplementation “Several studies show that adding glutamine to enteral nutrition (tube feeding) helps reduce the rate of death in trauma and critically ill people. Clinical studies show that taking glutamine supplements strengthens the immune system and reduce infections, particularly infections associated with surgery.” “Glutamine may help prevent or treat multiple organ dysfunction after shock or other injuries among people in the intensive care unit. Glutamine supplements may also help in the recovery of severe burns.” “Glutamine helps protect the lining of the gastrointestinal tract known as the mucosa. For that reason, some researchers believe that people who have IBD (ulcerative colitis and Crohn disease) may not have enough glutamine. However, two clinical trials found that taking glutamine supplements did not improve symptoms of Crohn disease.” “Athletes who train for endurance events (like marathons) may reduce the amount of glutamine in their bodies. It is common for them to catch a cold after an athletic event. Some experts think that may be because of the role glutamine plays in the immune system. For this select group of athletes, one study showed that taking glutamine supplements resulted in fewer infections. The same is not true, however, for exercisers who work out at a moderate intensity.” http://umm.edu/health/medical/altmed/supplement/glutamine Sources and How to Take It Dietary sources of glutamine include plant and animal proteins such as beef, pork, poultry, milk, yogurt, ricotta cheese, cottage cheese, raw spinach, raw parsley, and cabbage. Glutamine, usually in the form of L-glutamine, is available by itself, or as part of a protein supplement. These come in powders, capsules, tablets, or liquids. Standard preparations are typically available in 500 mg tablets or capsules. Take glutamine with cold or room temperature foods or liquids. It should not be added to hot beverages because heat destroys glutamine. Some athletes can have high intakes of l-glutamine because of their high energy and protein intakes and also because they consume protein supplements, protein hydrolysates, and free amino acids. Acute intakes of glutamine of approximately 20-30 g seem to be without ill effect in healthy adult humans and no harm was reported in 1 study in which athletes consumed 28 g glutamine every day for 14 d. Doses of up to 0.65 g/kg body mass of glutamine (in solution or as a suspension) have been reported to be tolerated by patients and did not result in abnormal plasma ammonia levels. However, the suggested reasons for taking glutamine supplements (support for immune system, increased glycogen synthesis, anticatabolic effect) have received little support from well-controlled scientific studies in healthy, well-nourished humans. “Alterations in amino acid transport-as GLN shares the transporters with other amino acids, enhanced GLN intake may impair amino acid distribution among tissues and their absorption in the gut and kidneys.” “Effect of the withdrawal of GLN supplementation-due to the adaptive response of the organism to enhanced GLN consumption, the withdrawal of GLN may enhance the risk of health problems resulting from GLN deficiency. It is concluded that enhanced intake of GLN has substantial side effects, and long-term studies should be performed to justify chronic consumption of a GLN-enriched diet.” “Glutamine powder should not be added to hot beverages because heat destroys glutamine. Glutamine supplements should also be kept in a dry location.” “People with kidney disease, liver disease, or Reye syndrome (a rare, sometimes fatal disease of childhood that is generally associated with aspirin use) should not take glutamine.” “People who have psychiatric disorders, or who have a history of seizures, should use caution when considering supplementation with glutamine. Some researchers feel that taking glutamine may worsen these conditions.” “Many elderly people have decreased kidney function, and may need to reduce their dose of glutamine.” https://hero.epa.gov/hero/index.cfm/reference/details/reference_id/2821157 Glutamine (abbreviated as Gln or Q; encoded by the codons CAA and CAG) is an α-amino acid that is used in the biosynthesis of proteins. It contains an α-amino group (which is in the protonated −NH3+ form under biological conditions), an α-carboxylic acid group (which is in the deprotonated −COO− form under biological conditions), and a side chain amide which replaces the side chain hydroxyl of glutamic acid with an amine functional group, classifying it as a charge neutral, polar (at physiological pH) amino acid. It is non-essential and conditionally essential in humans, meaning the body can usually synthesize sufficient amounts of it, but in some instances of stress, the body’s demand for glutamine increases and glutamine must be obtained from the diet.[2][3] In human blood, glutamine is the most abundant free amino acid, with a concentration of about 500–900 µM.[4] Post Workout Supplements: What You Actually Need For Recovery What is DHEA? Dehydroepiandrosterone (DHEA) is a hormone produced by the body’s adrenal... What is Fish Oil? Fish oil is a very effective nutrient and contains important omega 3 fatty acids... What is Acesulfame Potassium? Acesulfame-K – also known as Sunette, Sweet One, Sweet... What is Protein? Protein is found throughout the body—in muscle, bone, skin, hair, and virtually... What is Flaxseed? Flaxseed, or linseed (Linum usitatissimum L.), comes from the flax plant, which... What is Creatine? Creatine is a chemical that is normally found in the body, mostly in muscles but... Carl Lombard When to Take Glutamine \| Supplement Science says: […] experts agree that glutamine should also be taken right before bed. Studies have shown that taking 5g of glutamine before bed […] What is Glutamine? \| Supplement Science says: […] Glutamine is available as a supplement, but for those who prefer to consume their nutrients whenever possible, there are several foods that naturally contain high levels of glutamine. For example, spinach, cabbage, beans and legumes, animal proteins, and dairy are all foods with glutamine. Heat can destroy glutamine in vegetables, so when eating glutamine-rich vegetables, make sure to eat them raw or in a juice. […] Top 5 Best Testosterone Boosters for Building... How To Increase Testosterone… Naturally! Top 5 Best Brain Supplements Top 5 Best BCAA Supplements That You Need in Your... 4 Essential Ingredients for ANY Pre-Workout Formula The Difference Between the 3 Types of Whey Protein:...	cc/2020-05/en_middle_0126.json.gz/line725
__label__wiki	0.763734	0.763734	A daily summary of squadron activities for the month is provided below. Additional details for significant events may be found at the linked text. April 1, 1945: VMB-613 is attached to Marine Air Group Ninety-Four (MAG-94). Four planes flew regularly scheduled sector searches. One plane conducted a snooper flight over Kusaie Island. One hunter-killer flight to Wotje (Aircraft Action Report 34). April 2, 1945: One plane flew a regularly assigned sector search. One plane conducted a snooper flight over Kusaie Island. Three hunter-killer flights and one additional anti-sub flight were flown, all negative. April 3, 1945: Patrols of shipping lanes commenced pursuant to Change 3 dated 1 April 1945, to Operations Plan No. 2-44 and Operations Order 7-44. Two planes flew regular shipping lane patrols between Kwajalein and Eniwetok. Five hunter killer flights were flown, all negative. One aircraft flew a special security patrol off Kwajalein Atoll. April 4, 1945: Two planes flew assigned shipping lane patrols. Two planes conducted searches of friendly atolls. One plane operated from Majuro in search of reported floating obstacle. One plane conducted a search flight over Kusaie. April 5, 1945: Two planes flew assigned shipping lane patrols. One plane searched remaining friendly atolls. Search out of Majuro for floating obstacle negative. April 6, 1945: Two planes flew assigned shipping lane patrols. Majuro obstacle search negative, secured. April 7, 1945: Two planes flew assigned shipping lane patrols. One plane conducted a search flight to Kusaie. April 8, 1945: Two planes flew assigned shipping lane patrols. April 9, 1945: Two planes flew flew assigned shipping lane patrols. One plane flew to investigate oil slick, negative. April 10, 1945: Two planes flew assigned shipping lane patrols. One search flight over southern friendly atolls, not complete coverage. April 11, 1945: Two planes flew assigned shipping lane patrols. Four hunter-killer flights. One plane searched Kusaie. One search flight over northwest friendly atolls, not completed. Two planes conducted a special search for reported task force, identified as friendly tugs and tows. One plane escorted VMF-111 on a strike to Ponape. April 12, 1945: Two planes flew assigned shipping lane patrols. One plane searched remaining friendly atolls to the south. One plane searched Kusaie. April 13, 1945: Two planes flew assigned shipping lane patrols. One plane searched northeast friendly atolls, and one plane completed coverage of the northwest friendly atolls. April 14, 1945: Two planes flew assigned shipping lane patrols. One plane took off for Kusaie but weather prevented the completion of the mission. One special flight for ground radar training purposes was conducted. April 15, 1945: Two planes flew assigned shipping lane patrols. April 17, 1945: Two planes flew assigned shipping lane patrols. One plane searched northwest friendly atolls. One ground radar training flight. April 19, 1945: Two planes flew assigned shipping lane patrols. Southern friendly atolls were covered by one plane. One search flight to Kusaie. One local photo flight. April 20, 1945: One plane flew assigned shipping lane patrol. One flight in aid of ground radar training. April 21, 1945: Two planes flew assigned shipping lane patrols. Three planes made search flights over northeast and northwest friendly atolls. April 22, 1945: Two planes flew assigned shipping lane patrols. One search flight over Kusaie was conducted. April 23, 1945: Two planes flew assigned shipping lane patrols. One search flight over Kusaie. One weather reconnaissance flight. April 24, 1945: Two planes flew assigned shipping lane patrols. One search flight over southern friendly atolls. One flight in support of ground radar training. April 25, 1945: Two planes flew assigned shipping lane patrols. Three planes in search flights over friendly atolls, coverage not complete. One plane flew a search flight to Kusaie. April 26, 1945: Two planes flew assigned shipping lane patrols. One plane completed coverage of northwest friendly atolls. One plane flew a photo flight to Mejit Island. April 27, 1945: Two planes flew assigned shipping lane patrols. One plane conducted a special administrative flight to Engebi, Eniwetok Atoll. April 28, 1945: Two planes flew assigned shipping lane patrols. One plane conducted a search flight to Kusaie. One anti-sub flight negative. April 30, 1945: Two planes flew assigned shipping lane patrols. One anti-sub flight. Four planes flew hunter-killer flights. SHIPPING LANE PATROL: A convoy sails under the watchful eyes of three of VMB-613's crews. These patrols of the shipping lanes began on April 3, 1945 and continued through the end of the war. Photograph: U.S. Marine Corps, Clell Q. Thorpe Collection (Courtesy of the University of Houston Libraries) CHANGING A NUMBER ONE STACK: Three of VMB-613's aircraft mechanics perform maintenance on the engine of one of the squadron's aircraft. Through the efforts of the maintenance section, VMB-613 had the lowest operational loss rate of all Marine Bombing Squadrons. Note that the aircraft's "package guns" have been removed. Photograph: U.S. Marine Corps (Courtesy of William A. Kehr) TOUR ON TARAWA: Sergeant John J. Gavin (in cockpit) and his crew flew to Hawkins Field on Tarawa to conduct missions against the Japanese-held islands of Ocean and Nauru. Photograph: John Gavin (Courtesy of Bill Remick) CLEANING THE CANNON: Aircraft armorer, Master Technical Sergeant Lloyd M. Staggs, "punches" the bore of the 75mm cannon on one of the squadron's aircraft. Photograph: U.S. Marine Corps, Arthur H. Navarre Collection (Courtesy of Diane Hindy) PREPARING A DEPTH BOMB: Under the supervision of Technical Sergeant Oscar L. Robinson, VMB-613 armorers install hydrostatic and contact fuzes onto a depth bomb prior to loading it onto an aircraft. The engine of the aircraft can be seen in the background of the photograph. VMB-613 FLIGHT LINE: In this photograph of VMB-613's flight line on Kwajalein six of the squadron's PBJ can be seen awaiting action. The aircraft in the foreground is MB-8. Photograph: U.S. Marine Corps (Courtesy of Roy Thorson) ON PATROL: As one of VMB-613's aircraft patrols an assigned area, heavy cloud formations can be seen in the background. Such weather was typical in the Marshall and Eastern Caroline Islands. ENGEBI AIRSTRIP: An aerial view of the fighter strip on Engebi Island, Eniwetok Atoll. Following the capture of the island, Seabees extended and improved the old Japanese airstrip. VMB-613 did not use Engebi as a forward operating base, although an number of administrative flights were made to the island. Photograph: U. S. Marine Corps SEARCHING FOR JAPANESE: Seen from the radio-gunner's position, a surveillance flight over an island in Likiep Atoll reveals only palm trees and a peaceful lagoon. Note the empty mount for the .50 caliber machine gun in the left foreground of the photograph. In order to increase the aircraft's patrol range, these guns were removed, along with the Plexiglas window. Photograph: Marine Bombing Squadron Six-Thirteen (Courtesy of William A. Kehr) NAVIGATOR AT WORK: Navigator, Technical Sergeant William A. Kehr keeps a close vigil on his aircraft's position in the navigator's compartment of his PBJ-1H. Due to the vast expanse of ocean with few landmarks, absolute navigational precision was essential to locate targets, and more importantly, to ensure a safe return to the airstrip on Kwajalein. B-29 SUPERFORTRESS: B-29 bombers headed to the bases in the Marianas routinely used the aviation facilities on Kwajalein Island to refuel before continuing on their long journey overseas. The same applied for B-29s returning to the United States. One squadron member compared the traffic on the airstrip at Kwajalein to Grand Central Station. Photograph: Marine Bombing Squadron Six-Thirteen (Courtesy of Robert Klinke) 4TH MARINE AIR WING AREA: Taken shortly after VMB-613's arrival on Kwajalein, this photograph shows the 4th Marine Air Wing's mess and office facilities. The long conjoined building in the center is the enlisted men's mess hall (far left), the galley (middle), and the officer's mess hall (right). The building at the center right. served as the offices for the Commanding General, the Intelligence, and Communications. Photograph: Marine Bombing Squadron Six-Thirteen (Courtesy of Clifford E. Willis) TENT CITY: The forward echelon for Headquarters, 4th Marine Air Wing was located on Kwajalein. The tents served as billets for the Wing officers. This photograph was taken on December 27, 1944, shortly after VMB-613 arrived on Kwajalein. On that particular day, the temperature was reported to have been 127 degrees—in the shade! PREVIOUS PAGE TOP OF PAGE Copyright © 2008 Marine Bombing Squadron Six-Thirteen Association. All Rights Reserved.	cc/2020-05/en_middle_0126.json.gz/line735
__label__cc	0.733157	0.266843	Did You Know…A Swede Designed The Iconic Coca-Cola Bottle Did You Know is a semi-regular feature where we highlight a Swedish factoid that we just have to share. In 2015, the Coca-Cola bottle turned 100 years old. That anniversary prompted widespread coverage of the history of the bottle and its designer, a Swede named Alexander Samuelsson. Alexander Samuelsson According to Coke’s website, Samuelsson was a glass blower working at the Root Glass Company in Terre Haute, Ind., which entered a national competition to design a new bottle to distinguish Coca-Cola from its competitors. The creative brief, according to Coke, was to design a “bottle so distinct that you would recognize it by feel in the dark, or lying broken on the ground.” As the story goes, Samuelsson enlisted colleagues Earl Dean and Clyde Edwards to research design possibilities. They came up with a cocoa pod with an elongated shape and distinct ribs. Samuelsson led the company’s application to patent the design. To read more, check out these pieces from Mental Floss and Business Insider. Want more Umgås? Sign up for the monthly email that includes our most popular stories. Umgås is your online destination to celebrate Swedish life and culture in the United States. Read More By Umgås Staff	cc/2020-05/en_middle_0126.json.gz/line741
__label__cc	0.713449	0.286551	Forums > US Discussion > Conspiracy Theories > 9/11 Explosive Connections - The 9/11 Masterminds Discussion in 'Conspiracy Theories' started by Angelo, Jan 14, 2019. Aug 24, 2019 #311 LA RAM FAN Platinum Member ranfunck said: ↑ fuck ya its a cover up and the skipper is a dumbass what else do you expect out of a troll who ALSO believes in magic bullets? buttercup said: ↑ This sums it up, for those here who have short attention spans. I always post that video to the NON shills who are just stupid fucks who are in denial mode,they never have any answers to counter it. Angelo said: ↑ LA RAM FAN said: ↑ Connect the money dots. the shills and the bush/obama dupes cover their ears and close their eyes anytime you show them videos of pesky facts they cant counter. they do this EVERYTIME like clockwork when you post- It doesn't help when people clutter up the board with Infowars junk news. That's just playing the devil's advocate and keeping people misinformed. Alex Jones has big balls, and I respect him for taking on the establishment, but he's a nutcase. He went over-the-top conspiracy theorist about everything and lost credibilty - even Jesse Ventura or someone like that knows when to shut up about certain things. Jones is part of the controlled opposition. For many years I did not believe it because it did not make any sense.However when you think hard about it it makes plenty of sense,what better way to have someone keep tabs on truthers than have a plant who appears to be on your side and appears to be against government corruption He exposed how he is really working for them with Bohemian Grove. Nobody goes into that and comes out it alive unless of course they have been approved by them to do so. Me or you ,we could not go in there and take film footage like that and expect to come out of there alive. Dale Smith as well exposed him in one of his podcasts. they would have killed off jones years ago IF he was REALLY for us. same as they did with Bill Cooper who was the REAL person that exposed 9/11 as an inside job. Jones has lied always claiming HE exposed 9/11 when it was cooper and he also LIED saying cooper was an alchoholic.everybody that knew cooper said he never touched the stuff. here is a video of where cooper exposes jones as the liar he is. cooper was a patriot who tried to get the truth out and really DID care about government corruption and paid the deadly price for it. check out the video where he exposes the lies jones made up about him. I have TRIED to get MW to wake up about jones and told her to watch this video,but she dismissed it of course. At least three notable anomalous events occurred at the World Trade Center in the weeks and months leading up to September 11, 2001, which may have related to the imminent terrorist attacks but could not have been caused by al-Qaeda, the group supposedly responsible for 9/11. There was an increase in security at the Trade Center in the two weeks before 9/11, for reasons that are unclear, which only ended the day before the attacks. Also, the fire alarm system in World Trade Center Building 7 was placed on "test condition" every morning in the seven days before the attacks and on the day of 9/11. While it was in this mode, any alarms would be ignored. WTC 7 was a massive skyscraper located just north of the Twin Towers, which mysteriously collapsed late in the afternoon of September 11. And some of the elevators in the Twin Towers were out of service in the months before the attacks, supposedly due to maintenance work or modernization. It seems odd that these events happened at the World Trade Center just before the Twin Towers were the target of a terrorist attack and three of the Trade Center buildings collapsed. It would have been notable if just one of them occurred in the period leading up to 9/11. The fact that all three did is remarkable. Osama bin Laden—the man who supposedly ordered the 9/11 attacks—and his al-Qaeda terrorist organization would surely have been unable to bring about these events. Therefore, if the official account of 9/11 is true and they were responsible for the attacks, then it must have been just a coincidence that these events occurred before September 11. But if the events were related to preparations for the attacks on the World Trade Center, this would cast serious doubt on the official narrative of 9/11. A new investigation of the attacks would be necessary to determine if the unusual events at the World Trade Center in the period leading up to 9/11 were significant and, if they were, what their purposes were. All the same, we can at least consider possible reasons for them. It is possible, for example, that they related to efforts to secretly prepare the Twin Towers and WTC 7 to be brought down with explosives as part of the 9/11 attacks. Perhaps the heightened security at the World Trade Center and the supposed maintenance work on the elevators were intended to create cover stories for the men who were planting the explosives. If a person inquired about mysterious workers they had seen at the Trade Center, they could be falsely told these men were there to repair the elevators or help out in response to the heightened security. Or if someone asked about unusual work they had noticed being carried out in the buildings, they could be told this work related to repairs on the elevators, even though it in fact related to the preparations for demolishing the buildings. Security Alerts, Disabled Fire Alarms, and Unused Elevators: Suspicious Events at the World Trade Center Before 9/11 oh yeah there were many evacuations that took place in the prior weeks before 9/11 which some of the workers that had worked there for YEARS,said that was UNPRECEDENTED in all the years they had been there,just one of dozens of coincidences the coincidence theorists dismiss though as just plain coincidences. its the same thing with the JFK assassination,same as that one,there are so many coincidences that occur,that it gets so absurd they dont become coincidences anymore. i bring this up to people i know outside the boards and these stupid fucks always dismiss it and have no answers,they just say crap like that doesnt prove anything cause they dont want to look at the evidence that it does. HereWeGoAgain said: ↑ You give her to much credit. She ? Gets zero credit from me being a 9/11 truth denier. Muhammed Gold Member North Coast, USA Muhammed said: ↑ ,falling in their own foot print, Why do you nutjobs always say that? Because it defies logic to have three buildings fall into their own footprint one of which only caught fire,modern high rise building dont collapse due to fire. And to have the twin towers fall into their own footprint when one side received the most damage makes zero sense. Common sense tells us they would have toppled in the direction of the damage. this troll ignores the laws of physcis.LOL One of which ONLY caught fire. Fucken dumbass. Are ya fucken stupid!! ONE OF WHICH ONLY CAUGHT FIRE!!!! To people with a brain that would indicate it wasnt hit by a fucken jumbo jet you dumbshit!!! thats admiral IDIOT for you,fucking dumbass indeed.LOL[/QUOTE]How do you suppose it caught fire? HereWeGoAgain Diamond Member Fuck Y'all I'm From Texas! thats admiral IDIOT for you,fucking dumbass indeed.LOL How do you suppose it caught fire?[/QUOTE] From small pieces of debris that caused a fire. No modern day high rise has ever collapsed due to a fire. Which is what the NIST report claimed. How do you suppose it caught fire? Which is what the NIST report claimed.[/QUOTE] the newest shill coming on to here to end up with shit on his face for the day after you took him to school Could you explain the bizarre convoluted reasoning that you used to come to that ridiculous conclusion so that I may metaphorically rip it to shreds and shove it up your ass? Or do you concede that you cannot? Look it up your damn self. And dont pull some shit from the middle east where building codes are non existent. The joke's on CNN Thinker101, Jan 29, 2020 at 8:59 AM Billiejeens Osiris-ODS Dick Foster, Jan 29, 2020 at 10:39 AM Political Cartoon ClosedCaption, Sep 22, 2015 Lakhota	cc/2020-05/en_middle_0126.json.gz/line743
__label__wiki	0.595208	0.595208	Veolia engineers four truck-mounted potable water treatment plants for the Kingdom of Lesotho Menu News & Media Press Events Newsletters Case studies Key Technology Files Newsletter Articles Brochures Multimedia 16-05-2017 - Sebenza, Gauteng, South Africa Veolia Water Technologies South Africa (Veolia) was contracted to design and build four generator-powered, potable water treatment plants (WTP) which were mounted on the back of 4x4 trucks, a first for Veolia South Africa. Each mobile WTP has the capacity to treat 200 m³ of river water to potable standards per day, which will be used for distribution to communities in Lesotho, Southern Africa. In a first for Veolia South Africa, the water treatment specialists designed and built four generator-powered potable water treatment plants, mounted on the back of 4X4 trucks. Used for communities in Lesotho, each mobile water treatment plant has the capacity to treat 200 m³ of river water to potable standards. Veolia was awarded the contract by a Lesotho-based technology provider, Unique Trading (Pty) Ltd under the management of Philemon Phamotse, initially contracted by the Lesotho Ministry of Water. The project involved the design, manufacture, build and delivery of four mobile WTPs for use in the land-locked Kingdom of Lesotho. The mobile plants are mounted on four diesel-powered 4x4 trucks to treat river water destined for remote areas in rough terrain. The river water is pumped into the mobile plants to undergo clarification, Ultra Filtration (UF) and disinfection. The plants contain ceramic membrane UF units designed for their ruggedness under rough conditions and their ability to accept varying water qualities without the need for excessive cleaning, when compared to conventional UF membranes. “This differs greatly from our conventional packaged water treatment plants, which normally consist of a clarifier, sand and activated carbon filtration as well as disinfection technologies,” points out Victoria Tutubala, Project Engineer, Veolia Water Technologies South Africa. These water treatment package plants are designed locally using technologies from Veolia’s sister companies, such as the membranes, which are sourced from Veolia in the USA and the housing from Veolia Germany. “While these truck-mounted mobile WTPs are a first for Veolia in South Africa, the engineering of these units has allowed for ease of assembly because we used our expertise in package plants to modularise the system and reduce manufacturing time and costs,” Tutubala explains. “Subsequent to equipment manufacture, our engineers built all the treatment process equipment onto a built-for-size frame, and the entire structure was then mounted on to the 4 x 4 truck load area.” Process equipment for each plant consists of a raw water feed pump, basket strainer, clarifier, ceramic membrane UF unit, chemical dosing unit, compressor, backwash and air receiver tanks, and the entire WTP is generator-powered. Additionally, each mobile unit will have its own UF clean-in place (CIP) skid for use when required. From order to delivery took only between 12 and 13 weeks, with all equipment design, manufacture, construction and mounting carried out at Veolia’s Sebenza facilities in Johannesburg East. “The factory acceptance testing (FAT) was also conducted in Sebenza,” Tutubala concludes. “Our customer’s personnel training in Lesotho served as commissioning, as the plants are designed for ‘plug-and-play’”. Veolia group is the global leader in optimized resource management. With over 163 000 employees worldwide, the Group designs and provides water, waste and energy management solutions that contribute to the sustainable development of communities and industries. Through its three complementary business activities, Veolia helps to develop access to resources, preserve available resources, and to replenish them. In 2016, the Veolia group supplied 100 million people with drinking water and 61 million people with wastewater service, produced 54 million megawatt hours of energy and converted 30 million metric tons of waste into new materials and energy. Veolia Environnement (listed on Paris Euronext: VIE) recorded consolidated revenue of €24.39 billion in 2016. www.veolia.com Victoria Tutubala Project Engineer, Engineered Systems Tel. +27 (0) 11 281 3600	cc/2020-05/en_middle_0126.json.gz/line744
__label__wiki	0.786455	0.786455	UK: London Bridge knife attacker known to cops, wore electronic tag, had links to jihad terror groups Once again the abject failure of the British response to the jihad terror threat is illustrated, but nothing will change. The usual condemnations will be issued, the usual candlelight vigils will be held, politicians will issue the usual vows to crush terrorism, and everything will go on as before until the next jihad attack. “LIVE: London Bridge knife attacker known to police and had links to terror groups,” Sky News, November 29, 2019: What we know so far about the terror attack Sky News’ foreign editor Deborah Haynes says it is believed the attacker was linked to Islamist terrorism. She added: “It’s not yet known whether that’s potentially Islamic State, potentially Al Qaeda, potentially another group.” The attacker was a convicted terrorist who had recently been released from prison and was wearing an electronic tag, according to The Times The report added that he was a guest at a Cambridge University conference on prisoner rehabilitation at Fishmongers’ Hall – where the attack began – and later threatened to blow up the venue. It went on to quote unnamed Whitehall sources as saying the attacker had been released from prison around a year ago after serving time for a “terrorism-related offence”, and had agreed to wear an electronic tag. The attacker was known to police and had links to Islamist terror groups, according to a security source quoted by the Press Association…	cc/2020-05/en_middle_0126.json.gz/line748
__label__wiki	0.728768	0.728768	Doom Bloodfall DLC Review Tobias Jurss-Lewis With Bloodfall, Bethesda released the final piece of premium DLC for one of 2016’s most heralded shooters. So far, each piece of Doom’s premium DLC has simply contained new maps, demons, guns and customisation options. Predictably, Bloodfall follows suit. Bloodfall’s new playable demon is a familiar one, mainly because it’s one that gave players a great deal of grief in the campaign. The ‘spectre pinky’ demon is low to the ground, vicious and able to become invisible. These traits certainly encourage a new play style, but it’s a style that’s inefficient. Pinky is difficult to control and lacks the punch that previous demons packed. By that same token, he’s still a bit of fun. But then again so are children’s toys. And just like kid’s toys, this demon’s novelty wears off. The DLC also features three new maps: Empyrian, Boneyard, and Outbreak. And if it’s not clear from the names, the developers are definitely running low in the demonic/gory ideas department. Truth be told, it’s always fun – to one extent or another – to play new maps on a familiar game, but I couldn’t stop feeling that it wasn’t just the game that felt familiar: these maps did too. This was particularly true of Boneyard, a map made entirely of flesh, teeth and demon bones. Carnage is, irrefutably, an important part of Doom, but at the same time, it’s an aesthetic that is best used to decorate a map, not to entirely construct one. Similarly, the overrun UAC facility on Outbreak is almost identical to maps we’ve seen before both in multiplayer and the campaign. Demonic gore scattered across a grey science facility is a familiar site this far into Doom’s lifespan. Were it free, I’d see no issues with Outbreak. It’s functional and well designed, and it can play host to some amusing matches. But as an inclusion of DLC at this price, it’s a definite letdown. On the contrary, the Colosseum that comprises the Empyrian map, is remarkable and it’s a fitting host to the violence of Doom’s multiplayer. It does echo environments we saw in Argent Breah (a map from Doom’s second DLC), but the interactive, crumbling battlements create new gameplay opportunities and make this map truly spectacular. Speaking of new gameplay opportunities, Bethesda finally bit the bullet and offered up a grenade launcher. In all candour, I can’t say too much about this weapon. It functions exactly as expected. If you’ve mastered trajectories and the grenade-dip you can play for direct hits with Doom’s newest device. If not, you’re able to bounce grenades off the walls and down the tunnels of the (now) myriad of multiplayer maps. Bethesda also offers players lateral thrusters, which gives Doomguy a third jump and greater control of the airborne trajectory. Both are long overdue additions to the game, and they’re probably the highlights of Bloodfall. There’s plenty of fun to be had with Doom’s latest features if you can find a game… This is a problem I mentioned in my review of the Hell Followed DLC: the Doom multiplayer scene is clinging to life by a thread. Of the small portion of gamers playing Doom online, there’s an even smaller portion that have this latest DLC. What I’m saying is that, on the whole, Bloodfall provides a few bonus features and a few worthwhile maps for a multiplayer scene that’s just hanging on. As I said with the previous DLC, this isn’t Bethesda’s fault, but it’s still a pretty sizeable downside. The decision you face, at the end of this all, is whether the content and limited play time is worth the cost. And it pains me to say this – because Doom was one of 2016’s most impressive releases – it’s not. Previous articleXbox One & Xbox 360 – In Stores This Week 23rd – 29th January 2017 Next articleSylvio Review I'm 20 and Australian and I'm currently studying a Bachelor of Journalism. I also liked Dark Souls. Truth be told I actually started gaming on the PS2. However, I quickly converted to Xbox with the release of the 360. My all time favourite games are Final Fantasy X and the Witcher 3. And that's about all I'm going to say because I'm terrified of telling people personal things. Replicate Colin McRae’s highlights as the DiRT Rally 2.0 free ‘Flat Out’ pack is detailed and dated F1 2019 expands once more with even more DLC additions Code Vein’s Hellfire Knight DLC delivers new foes, weapons, Blood Veils and more! − 7 = zero Omensight Review Gift of Parthax Review Donut County Review Glass Masquerade Review Edna & Harvey: Harvey’s New Eyes Review The Forbidden Arts Review	cc/2020-05/en_middle_0126.json.gz/line750
__label__wiki	0.91104	0.91104	Montreal Alouettes end losing streak MONTREAL – The losing run is over for the Montreal Alouettes, who look like they’ve found their starting quarterback halfway through the CFL season. Jonathan Crompton made his first CFL start as the Alouettes used touchdowns by S.J. Green and newcomer James Rodgers to defeat the Ottawa Redblacks 20-10 on Friday night. Montreal Alouettes quarterback Troy Smith injured Montreal Alouettes’ player Chad Johnson has parking issues Bombers won’t take Alouettes lightly The former Edmonton Eskimo completed 15 passes for 245 yards as the Alouettes (2-7) ended a six-game losing streak and took over second place in the feeble East Division. READ MORE: Montreal Alouettes quarterback Troy Smith injured “It was a great team win,” was Crompton’s only assessment of a win that came despite two drive-killing turnovers, but was aided by the expansion Redblacks’ 135 yards in penalties. Wallace Miles had a 27-yard pass-and-run TD in the fourth quarter and Brett Maher had a field goal on Ottawa’s opening drive as the Redblacks (1-8) lost a sixth game in a row. “It’s tough to win when you’re not scoring,” said Ottawa coach Rick Campbell. “No team can take the amount of penalties we take. “We can’t have the moment be too big or emotional for us, where we lose our way. We need to keep the yards we earn by not taking penalties. We’ll keep working at it.” READ MORE: Alouettes fire Campbell, name Schonert receivers coach, Garcia QBs coach It was as close as the Alouettes have been to a must-win game this season: at home against the expansion Redblacks and giving Crompton his shot after Troy Smith and Alex Brink struggled in the starting job. Crompton found Duran Carter for five receptions for 127 yards while Green caught five for 48 yards. Running back Brandon Whitaker rushed for an even 100. WATCH: Anthony Calvillo retires from football “He won the football game,” coach Tom Higgins said of his quarterback. “One of my best friends, Ron Lancaster, said the only evaluation for a quarterback is ‘can you win with him?’ “He brings that to the table.” Crompton’s best moment came after Miles’ touchdown pulled Ottawa to within three points with 6:14 left to play. On the ensuing drive, Crompton hit Carter with a 48-yard pass that set up Rodgers’ 17-yard scamper around the left side for a TD in his first CFL game. READ MORE: West Island football team takes the Ice Bucket Challenge Rodgers signed this month as a replacement for injured kick returner Larry Taylor, but also saw some time in the backfield. Sean Whyte added a field goal and had three punts roll into the end zone for singles for Montreal. A season low of 19,440 turned out to Percival Molson Stadium for a flag-filled game that until the fourth quarter had few big plays from either offence to cheer. Crompton, who relieved Brink in the second quarter of a loss last week in Winnipeg, was not on the field for the first TD. Tanner Marsh, who plays in short-yardage situations, threw the one-yard touchdown pass to Green in the first quarter after the Alouettes were stopped twice at the one. WATCH: A career as a professional football player A pair of turnovers had Montreal settling for an 8-3 halftime lead despite controlling much of the play. The Redblacks got a 30-yard Maher field goal 3:16 into the game. Whyte added a punt single early in the second quarter, but Montreal had a drive end when Crompton’s wobbly pass was picked off at the Ottawa eight by Travis Brown for his first career interception. Another drive ended when Whitaker fumbled at the Ottawa two, with the Redblacks’ Jerrell Gavins recovering in the end zone. READ MORE: Calgary Stampeders open season with 29-8 win over Montreal Alouettes Whyte got his third rouge early in the second half and added a field goal. The Redblacks made a game of it as Henry Burris led an 80-yard drive capped by Miles’ TD. Crompton reportedly winked at Carter in the huddle, then hit him with the pass that turned momentum back to the Alouettes and sealed their long-awaited win. “We still have room to improve,” said Carter. “We left points out there. “We could have made the game a lot easier early on. But we showed all the teams in the CFL that we’re a good team and we’re not going away. It does wonders. It’s like in basketball, where one shot goes in and then you start making them all. That’s what we want to do now.” WATCH: Montreal Alouettes at season’s start Ottawa’s last gasp drive ended with a turnover on downs. The Redblacks’ bright spot was Miles’ seven catches for 101 yards. Burris went 21 for 34 for 245 yards. Campbell called it another learning experience for his new team. “There’s a lot of good football players who are going to be around Ottawa for a long time and we can’t lose sight of that when we’re losing like this,” he said. “We’ll keep coaching them and finding ways to be better.” Notes: Chad (Ochocinco) Johnson returned from injury for Montreal, bumping Kenny Stafford from the line-up, but did not make a catch. Ex-Alouette Moton Hopkins was scratched for Ottawa along with Matt Albright. The Redblacks wore their all-black home uniforms with the hard-to-read red numbers. Comments Off on Montreal Alouettes end losing streak Hong Kong’s rising defiance challenges Beijing’s playbook on dissent ‘There are some indications of foul play’: EPS on suspicious death in southeast Edmonton Rescuers locate 20 miners trapped in gold mine landslide in Nicaragua « Teachers struggling to make ends meet, look for second jobs — FedEx halts BC wine shipments to other provinces »	cc/2020-05/en_middle_0126.json.gz/line758
__label__cc	0.713147	0.286853	Go to Page: [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [Next] AcrylaStone Plaques Employee Awards AcrylaStone plaques are acrylic and have unique "stone" look and feel. AcrylaStone plaques are durable and weather resistant that work well for both interior and exterior awards. This product provides incredible flexibility with it coming in 7 different colors and 6 different sizes. These distinctive awards are sure to be something anyone would be proud to put on their wall. Employee Awards PDASBK44 4" X 4" AcrylaStone Black PDASCA44 4" X 4" AcrylaStone Camel 5" X 7" AcrylaStone Carmel PDASBK810 8" X 10" AcrylaStone Black PDASCA810 8" X 10" AcrylaStone Carmel AcrylaStone Plaques Employee Awards PDASGR44 4" X 4" AcrylaStone Grey PDASGR810 8" X 10" AcrylaStone Grey PDASCH44 4" X 4" AcrylaStone Chocolate PDASWH44 4" X 4" AcrylaStone White PDASCH810 8" X 10" AcrylaStone Chocolate PDASWH810 8" X 10" AcrylaStone White PDASEV44 4" X 4" AcrylaStone Evergreen PDASSS44 4" X 4" AcrylaStone Sandstone PDASEV810 8" X 10" AcrylaStone Evergreen PDASSS810 8" X 10" AcrylaStone Sandstone Acrylic & Resin Eagle Employee Awards Spectacular and majestic are two words that cannot begin to describe this unique eagle award that is a stylish mix of acrylic and resin. The Eagle is highly detailed with it proudly showing its head to the side while the feather form a beautiful backdrop as if to cradle the acrylic. The stunning look of a bronze finish and wood base complete the look. These awards are available in your choice of three different sizes 7" X 8" X 3", 8" X 8" X 3" or 9" X 8" X 3". The acrylic insert can accommodate any of your personalization needs. These are truly special awards that can be used for just about any recognition purpose. Employee Awards Acrylic & Resin Eagle - Copy Employee Awards Spectacular and majestic are two words that cannot begin to describe this unique eagle award that is a stylish mix of acrylic and resin. The Eagle is highly detailed with it proudly showing its head while its wings are spread upward forming a stunning frame for the acrylic. The stunning look of a highly polished bronze finish and a black wood base complete the look. These awards are available in your choice of three different sizes 9 1/4" X 7 3/4", 10 1/4" X 8 1/2" or 11 1/4" X 9 3/4". The acrylic insert can accommodate any of your personalization needs. These are truly special awards that can be used for just about any recognition purpose. Employee Awards 10 1/4" X 8 1/2" Acrylic Flame Award Employee Awards Elegant is the only term that one can use when describing these Acrylic Flame Awards. A contemporary look for a flowing flame along with a bevel edge that adds depth and enhances a large engraving or laserable area that can accommodate any of your personalization needs. The matching acrylic base completes the look. Flexibility is a key component for these awards that come in your choice of three sizes 7 5/8", 8 5/8", or 9-5/8". These are beautiful awards that anyone would be proud to give or receive. Employee Awards PKT43537-J 7 5/8" Jade Acrylic Gem Obelisk Employee Awards Elegant is the only term that one can use when describing these Acrylic Gem Obelisk awards. A beautiful obelisk design that incorporates a rich colorful blue tint and beautiful cuts to reflect light that enhances a large engraving or laserable area that can accommodate any of your personalization needs. Flexibility is a key component for these awards that come in your choice of three sizes 6" X 2 1/2" X 1", 8" X 3 1/2" X 1 1/2" and 10" X 4 1/4" X 2". These are beautiful awards that anyone would be proud to give or receive. Employee Awards PD86506-B Acrylic Gem Obelisk 6" X 2 1/2" X 1" Acrylic Gem Obelisk 8" X 3 1/2" X 1 1/2" Acrylic Gem Obelisk 10" X 4 1/4" X 2" Acrylic Peak Award Employee Awards Elegant is the only term that one can use when describing these Acrylic Peak Awards. An unique peak design that incorporates beautiful cuts to reflect light and add depth all enhance a large engraving or laserable area that can accommodate any of your personalization needs. This award sits atop a matching base with angled face. Flexibility is a key component for these awards that come in your choice either clear or jade and three sizes 6-3/4", 7 3/4" or 9-3/4". These are beautiful awards that anyone would be proud to give or receive. Employee Awards PDKT43136 PDKT43136-J Arrowhead Clear Award Employee Awards Elegant is the only term that one can use when describing these Acrylic Arrowhead Awards. An arrowhead shape with wide bevel edges enhances a large engraving or laserable area that can accommodate any of your personalization needs. A matching acrylic base completes the overall look. Flexibility is a key component for these awards that come in your choice of clear or jade finish and three sizes 8 5/8", 9-5/8", or 10-5/8". These are beautiful awards that anyone would be proud to give or receive. Employee Awards 10 5/8" Clear 10 5/8" Jade Benjamin Rosewood Piano Finish Clock Employee Awards Elegant is the only term that one can use when describing this Rosewood Piano Finish "Benjamin" desktop clock. Classic in design it boasts at large clock face that is open to reveal the clock mechanical, while Roman numerals, and intricately styled hour and minute hands create a stunning look. The Rosewood Piano Finish is the final touch to this incredible item that anyone would be proud to either give or receive. With an overall size of 9" X 12" there is room on the bottom for a plate to add any personalization needs. Employee Awards Rosewood 9" X 12" Bethesda Crystal Employee Awards These Bethesda Crystal awards are an ideal way to recognize the ultimate in achievement. These awards mix blue and clear crystal together to give a dramatic effect. The blue colored crystal frames the clear crystal in the center allowing plenty of room for any of your personalization needs. A choice of 3 height sizes, 7", 8-1/2", or 9-3/4" provides flexibility for your event. All crystal awards can be layered or sandblasted for personalization. A handsome blue presentation box is also included with these items. Imagine the expression of the person when they see their name on one of these impressive awards. Employee Awards PCRY00462A 7" Crystal / Blue PCRY00462B 8-1/2" Crystal / Blue PCRY00462C Bethesda Crystal Graphite Employee Awards These Bethesda Crystal Graphite awards are an ideal way to recognize the ultimate in achievement. These awards mix graphite and clear crystal together to give a dramatic effect. The graphite colored crystal frames the clear crystal in the center allowing plenty of room for any of your personalization needs. A choice of 3 height sizes, 7", 8 1/2", or 9 3/4" and 2 other color choices, Blue or Topaz provides flexibility for your event. All crystal awards can be laser engraved or sandblasted for personalization. A handsome blue presentation box is also included with these items. Imagine the expression of the person when they see their name on one of these impressive awards. Employee Awards PDCRY00464A PDCRY00464B 8 1/2" tall PDCRY00464C Bethesda Crystal Red Employee Awards These Bethesda Crystal awards are an ideal way to recognize the ultimate in achievement. These awards mix vibrant red and clear crystal together to give a dramatic effect. The red colored crystal frames the clear crystal in the center allowing plenty of room for any of your personalization needs. A choice of 3 height sizes, 7", 8 1/2", or 9 3/4" and 3 other color choices, Blue, Graphite, or Topaz provides flexibility for your event. All crystal awards can be laser engraved or sandblasted for personalization. A handsome blue presentation box is also included with these items. Imagine the expression of the person when they see their name on one of these impressive awards. Employee Awards Bethesda Crystal Topaz Employee Awards These Bethesda Crystal Topaz awards are an ideal way to recognize the ultimate in achievement. These awards mix Topaz and clear crystal together to give a dramatic effect. The Topaz colored crystal frames the clear crystal in the center allowing plenty of room for any of your personalization needs. A choice of 3 height sizes, 7", 8 1/2", or 9 3/4" and 2 other color choices, Blue or Graphite provides flexibility for your event. All crystal awards can be laser engraved or sandblasted for personalization. A handsome blue presentation box is also included with these items. Imagine the expression of the person when they see their name on one of these impressive awards. Employee Awards Black Finish Magna Plaques Employee Awards These Black Finish Magna plaques is the perfect fit when you need a plaque for your award needs. These plaques are unique in that they come with an acrylic cover that attaches to the plaque using magnets to hold it securely in place. These awards as they are available in 2 different sizes 8" X 10" or 9" X 12". They are laserable and all provide ample room for whatever you personalization needs might be. Employee Awards PFP1810K Black Finish Resin Acrylic Magna Plaques Employee Awards These Black Finish Resin Acrylic Magna plaques is the perfect fit when you need a plaque for your award needs. These plaques are unique in that they come with an acrylic cover that attaches to the plaque using magnets to hold it securely in place. They also have a unique gold design pattern that runs the length of the plaque giving it a nice rich look against the glossy black finish. These awards as they are available in 2 different sizes 7" X 9" or 8" X 10". They are laserable and all provide ample room for whatever you personalization needs might be. Employee Awards PRFP179-K PRFP1810-K Blue Spectra Star Award Employee Awards Elegant is the only term that one can use when describing these Gold Spectra Star Acrylic Awards. A beautiful star design that incorporates a rich blue tint base that adds depth to a large engraving or laserable area that can accommodate any of your personalization needs. Flexibility is a key component for these awards that come in your choice of two sizes 5 1/2" or 6-1/2". A gold tint version is also available. These are beautiful awards that anyone would be proud to give or receive. Employee Awards P86435-B 5 1/2" Blue / Clear Bravo Acrylic Awards Employee Awards Elegant is the only term that one can use when describing these 1" thick Bravo Acrylic Awards. Each piece has a unique 3D fan cut pattern on the sides that flows into a big sweeping arc across the top leaving a large engraving or laserable area that can accommodate any of your personalization needs. These are available in clear and your choice of three sizes 5" X 7", 6" x 7 1/2", or 7" x 8 1/2". These are beautiful awards that anyone would be proud to give or receive. Employee Awards 5" X 7" Clear Celebration Clear Award Employee Awards Elegant is the only term that one can use when describing these Acrylic Celebration Clear Awards. A unique shape along with a frosted design and gold stars enhance a large engraving or laserable area that can accommodate any of your personalization needs. The matching acrylic base completes the look. Flexibility is a key component for these awards that come in your choice of three sizes 6 5/8", 7 5/8" or 8 5/8" and are available in only a clear finish. These are beautiful awards that anyone would be proud to give or receive. Employee Awards Cherry Finish Magna Plaques Employee Awards These Cherry Finish Magna plaques is the perfect fit when you need a plaque for your award needs. These plaques are unique in that they come with an acrylic cover that attaches to the plaque using magnets to hold it securely in place. These awards as they are available in 2 different sizes 8" X 10" or 9" X 12". They are laserable and all provide ample room for whatever you personalization needs might be. Employee Awards PFP1810C Cherry Finish Perpetual Plaques Employee Awards These Cherry Wood Finish Perpetual Plaques are the perfect way to recognized annual award winners. The plaques come in a beautiful cherry wood finish and come in three sizes 9" X 12", 10 1/2" X 13", and 12" X 15" to give you lots of flexibility for whatever your needs might be. The header and individual plates come standard with each plaque and are made of brass. Your annual award winners will be proud to have their names on any of these perpetual plaques. Employee Awards PPP1912C PPP11013C Chesapeake Crystal Employee Awards These Chesapeake Crystal awards are an ideal way to recognize the ultimate in achievement. These awards mix blue and clear crystal together to give a dramatic effect. The blue colored crystal make a sweeping pattern to the bottom and side of the clear crystal in the center allowing plenty of room for any of your personalization needs. A choice of 2 sizes, 7 7/8" and 8-1/2" provides flexibility for your event. All crystal awards can be layered or sandblasted for personalization. A handsome blue presentation box is also included with these items. Imagine the expression of the person when they see their name on one of these impressive awards. Employee Awards Chroma Acrylic Plaques Employee Awards If you are looking for something different in glass awards then these Gold Chroma Acrylic Plaques are just what you are looking for. This unique product features an elegant design that frames whatever personalization requirements you may have and can either be sandblasted or lasered directly on the front. The product includes an easel back so it can sit on a desk Available in three different sizes 6 1/2" X 8 1/2", 7 3/4" X 9 3/4" or 8 3/4" X 11 3/4" and three different finishes Gold, Sienna, and Rust gives you plenty of flexibility for your award needs. These items are packed in a standard white box that can also be used when presenting the award. Employee Awards PDCP16585-GB PDCP1810-GB If you are looking for something different in glass awards then these Sienna Chroma Acrylic Plaques are just what you are looking for. This unique product features an elegant design that frames whatever personalization requirements you may have and can either be sandblasted or lasered directly on the front. The product includes an easel back so it can sit on a desk Available in three different sizes 6 1/2" X 8 1/2", 7 3/4" X 9 3/4" or 8 3/4" X 11 3/4" and three different finishes Gold, Sienna, and Rust gives you plenty of flexibility for your award needs. These items are packed in a standard white box that can also be used when presenting the award. Employee Awards PDCP16585-MK PDCP1810-MK If you are looking for something different in glass awards then these Rust Chroma Acrylic Plaques are just what you are looking for. This unique product features an elegant design that frames whatever personalization requirements you may have and can either be sandblasted or lasered directly on the front. The product includes an easel back so it can sit on a desk Available in three different sizes 6 1/2" X 8 1/2", 7 3/4" X 9 3/4" or 8 3/4" X 11 3/4" and three different finishes Gold, Sienna, and Rust gives you plenty of flexibility for your award needs. These items are packed in a standard white box that can also be used when presenting the award. Employee Awards PDCP16585-XK PDCP1810-XK Circle Acrylic Awards Employee Awards Elegant is the only term that one can use when describing these 1" thick Circle Acrylic Awards. Each piece has a beautiful cut around the upper edge that adds depth and a flat bottom allows it to sit anywhere. A large engraving or laserable area that can accommodate any of your personalization needs completes these awards. Flexibility is a key component for these awards as they are offered in either clear or jade and your choice of four sizes 4 1/4" X 4", 5 1/4" X 5", 6 1/4" X 6", or 7 1/4" X 7". These are beautiful awards that anyone would be proud to give or receive. Employee Awards 4 1/4" X 4" Clear P44234-J 4 1/4" X 4" Jade Clear Jewel Award Employee Awards Elegant is the only term that one can use when describing these Acrylic Jewel Awards. A unique look of a large jewel with eye catching cuts that adds depth and enhances a large engraving or laserable area that can accommodate any of your personalization needs. The matching acrylic base completes the look. Flexibility is a key component for these awards that come in your choice of clear, sapphire or jade finishes and three sizes 6 3/8", 7" or 8". These are beautiful awards that anyone would be proud to give or receive. Employee Awards PKT43735-B 6 3/8" Saphire 7" Clear 7" Jade 7" Saphire Clear Obelisk Award Employee Awards Elegant is the only term that one can use when describing these Acrylic Clear Obelisk Awards. A beautiful obelisk design that incorporates beautiful cuts to reflect light and add depth all enhance a large engraving or laserable area that can accommodate any of your personalization needs. This award sits atop a sleek black weighted base. Flexibility is a key component for these awards that come in your choice of three sizes 8 3/4", 10-1/4" or 11 3/4". These are beautiful awards that anyone would be proud to give or receive. Employee Awards Clear Pinnacle Award Employee Awards Elegant is the only term that one can use when describing these Clear Pinnacle Acrylic Awards. A unique tapered shape with 3D cut patterns that enhance a large engraving or laserable area that can accommodate any of your personalization needs. The matching acrylic base completes the look. Flexibility is a key component for these awards that come in your choice of a clear or jade finish and three sizes 6 1/8", 8 1/8" or 9-5/8". These are beautiful awards that anyone would be proud to give or receive. Employee Awards Clear Rectangle Award Employee Awards Elegant is the only term that one can use when describing these Clear Rectangle Acrylic Awards. A simple rectangle shape with a slight bevel edge around the boarder leaves a large engraving or laserable area that can accommodate any of your personalization needs. Flexibility is a key component for these awards as they are offered in your choice of clear or jade finish and three sizes 7-1/2", 7 3/4", and 8 3/4" tall. These are beautiful awards that anyone would be proud to give or receive. Employee Awards Concord Crystal Employee Awards These Concord Crystal Oval awards and are an ideal to recognize the ultimate in achievement. Boasting bevel cuts along the outer edge that reflect light and your choice of a blue or black base makes this a striking award. In addition to your choice of either a blue or black base you can also pick from 3 different sizes, 4" X 6 1/4", 4 1/2" X 7 1/4" or 5" X 8". All of these awards have plenty of area for your personalization needs and are sure to be a hit at your next recognition event. All crystal awards can be laser engraved or sandblasted for personalization. A handsome blue presentation box is also included with these items. Imagine the expression of the person when they see their name on one of these impressive awards. Employee Awards Blue 4" X 6 1/4" Black 4" X 6 1/4" Blue 4 1/2" X 7 1/4" Black 4 1/2" X 7 1/4" Blue 5" X 8" Black 5" X 8" Contour Glass Diamond Award Employee Awards These Contour Diamond Glass Awards feature stylish mirror accents and beveled edges for a sharp appearance. The diamond shape provides plenty of area for whatever your personalization needs might be. These awards can be laser engraved or sandblasted. Sitting atop a beveled glass base this product is available in three different sizes, 7" X 4" X 2", 7 3/4" 4 1/2" X 2" and 8 1/2" X 4 3/4" X 2" These are awards that everyone would be proud to give or receive. Employee Awards Contour Diamond 7" X 4" X 2" Contour Diamond 7 3/4" X 4 1/2" X 2" Contour Glass Imperial Award Employee Awards These Contour Glass Imperial Awards feature stylish mirror accents and beveled edges for a sharp appearance. The overall shape provides plenty of area for whatever your personalization needs might be. All glass awards can be laser engraved or sandblasted. Sitting atop a beveled glass base this product is available in three different sizes, 7" X 4" X 2", 7 3/4" X 4 1/2" X 2" and 8 1/2" X 4 3/4" X 2". These are awards that everyone would be proud to give or receive. Employee Awards Contour Imperial 7" X 4" X 2" Contour Imperial 7 3/4" X 4 1/2" X 2" Contour Glass Rectangle Award Employee Awards These Contour Glass Rectangle Awards feature stylish mirror accents and beveled edges for a sharp appearance. The overall shape provides plenty of area for whatever your personalization needs might be. These awards can be laser engraved or sandblasted. Sitting atop a beveled glass base this product is available in three different sizes, 7" X 5 1/4" X 2", 7 3/4" X 5 3/4" X 2" and 8 1/2" X 6" X 2". These are awards that everyone would be proud to give or receive. Employee Awards Contour Rectangle 7" X 5 1/4" X 2" Contour Rectangle 7 3/4" X 5 3/4" X 2" Contour Rectangle 8 1/2" X 6" X 2" Contour Glass Sail Award Employee Awards These Contour Glass Sail Awards feature stylish mirror accents and beveled edges for a sharp appearance. The overall shape provides plenty of area for whatever your personalization needs might be. All glass awards can be laser engraved or sandblasted. Sitting atop a beveled glass base this product is available in three different sizes, 7" 3/4" X 3 1/2" X 2", 8 1/2" X 4" X 2" and 9 1/4" X 4 1/2" X 2". These are awards that everyone would be proud to give or receive. Employee Awards Contour Sail 7 3/4" X 3 1/2" X 2" Contour Sail 8 1/2" X 4" X 2" Contour Glass Tower Award Employee Awards These Contour Glass Tower Awards feature stylish mirror accents and beveled edges for a sharp appearance. The overall shape provides plenty of area for whatever your personalization needs might be. These awards can be laser engraved or sandblasted. Sitting atop a beveled glass base this product is available in three different sizes, 7" X 4" X 2", 7 3/4" 4 1/2" X 2" and 8 1/2" X 4 3/4" X 2" These are awards that everyone would be proud to give or receive. Employee Awards Contour Tower 7" X 4" X 2" Contour Tower 7 3/4" X 4 1/2" X 2" Coronet Jade Award Employee Awards Elegant is the only term that one can use when describing these Acrylic Coronet Jade Awards. A unique design that incorporates beautiful cuts to reflect light and add depth all enhance a large engraving or laserable area that can accommodate any of your personalization needs. This award sits atop a sleek black weighted base. Flexibility is a key component for these awards that come in your choice of three sizes 7 3/4", 9 1/4" or 10 3/4". These are beautiful awards that anyone would be proud to give or receive. Employee Awards Corporate Acrylic Peak Awards Employee Awards Elegant is the only term that one can use when describing these Corporate Acrylic Peak Awards. An unique peak design that incorporates beautiful cuts to reflect light and add depth all enhance a large engraving or laserable area that can accommodate any of your personalization needs. This acrylic award sits atop a sleek black weighted base. Flexibility is a key component for these awards that come in your choice of three sizes 7 3/4", 9 1/4" or 10 3/4" and are available in a clear finish. These are beautiful awards that anyone would be proud to give or receive. Employee Awards PPSA3-22-10 Clear 7 3/4" Clear 10 3/4" Corporate Acrylic Phoenix Arch Awards Employee Awards Elegant is the only term that one can use when describing these Corporate Acrylic Phoenix Arch Awards. An arch shape acrylic is held between two art deco Phoenix wings that enhances a large engraving or laserable area that can accommodate any of your personalization needs. A sleek black base completes the look of this acrylic award. Flexibility is a key component for these awards that come in your choice of two sizes 8 3/4" or 9 3/4" and a choice of antique gold or black pearl uprights. These are beautiful awards that anyone would be proud to give or receive. Employee Awards P19936-G-21-10 Gold / Clear 8 3/4" P19939-K-21-10 Black / Clear 10 3/4" Corporate Acrylic Photo Frame Award Employee Awards Elegant is the only term that one can use when describing this Corporate Acrylic Photo Frame Award. The frame is designed to display a 4" X 6" horizontal or vertical picture. Held together with powerful magnets and it has an area for a plate to accommodate any of your personalization needs. These are beautiful awards that anyone would be proud to give or receive. Employee Awards P46468-21-10 Clear 7 3/4" X 5 3/4" Corporate Acrylic Press Fit Awards Employee Awards Elegant is the only term that one can use when describing these Corporate Acrylic Press Fit Awards. You have your choice of five different shapes to choose from, arrowhead, arch, swatch, basketball jersey or sleeved jersey. Each has their own unique design elements that enhance a large engraving or laserable area that can accommodate any of your personalization needs. A sleek black base completes the look. All measure 6 1/2" tall and are the perfect award for your next corporate event. Employee Awards PARC-2-21-10 Arch 6 1/2" Jersey 6 1/4 Sleeveless Jersey 6 1/4 PDARC-2 PDDIA-1 Diamond 6 1/2" PDIA-1-21-10 PDSWA-3 Swatch 6 1/2" PSWA-3-21-10 Corporate Acrylic Shooting Star Awards Employee Awards Elegant is the only term that one can use when describing these Corporate Acrylic Shooting Star Awards. A unique sweeping pattern in gold and black culminates at the top of the award with a star while enhancing a large engraving or laserable area that can accommodate any of your personalization needs. The matching acrylic base completes the look. Flexibility is a key component for these awards that come in your choice of three sizes 6 5/8", 7 5/8" or 8 5/8" and are available only in a gold / black finish. These are beautiful awards that anyone would be proud to give or receive. Employee Awards PDKT84146-G Gold / Black 6 5/8" Corporate Acrylic Star Awards Employee Awards Elegant is the only term that one can use when describing this Corporate Acrylic Star Award. Clean lines from the the bottom of the base culminates at the top of the award to form a star. The beveled edges enhances a large engraving area that can accommodate any of your personalization needs. The part measures 7 1/2" X 4 1/8 X 3/4" and the large oval acrylic base completes the look. This is a beautiful award that anyone would be proud to give or receive. Employee Awards Acrylic Star 7 1/2" Corporate Ascent Glass Awards Employee Awards Sophistication and an elegant appeal are the highlights of this line of Ascent Glass Awards in a jade finish. A bevel cut in the glass runs around the perimeter and frames the large personalization area which can be either sandblasted or laser engraved. Sitting atop a beveled glass base this product is available in three heights 7 1/2", 8 1/2", and 9 1/2" giving you plenty of choices for your award needs. A beautifully padded and lined blue presentation box completes these fine awards that anyone would be proud to give or receive. Employee Awards P71408-J-10-10 7 1/2" X 3/8" Corporate Crest Desk Stand Glass Awards Employee Awards Sophistication and an elegant appeal are the highlights of this line of Corporate Crest Desk Stand Glass Awards. A bevel cut in the glass runs around the perimeter and frames the large personalization area which can be either sandblasted or laser engraved. These items are made to sit on desk or credenza as the have silver tone pin that is inserted at the bottom allowing the award to sit an angle so it can be easily viewed by all. This product is available in a jade finish and three heights 6", 7", and 8" giving you plenty of choices for your award needs. A conventional white box is also included for that can be used when presenting the award. Employee Awards P72316-J-9-10 4" X 6" X 3/8" Corporate Crystal Cube Employee Awards These Corporate Crystal Cube awards are ideal to recognize the ultimate in achievement. As the cube name implies these are cubes and have a cut in one corner so it sits at an angle so the personalization is visible on a desk. A choice of 4 cubes sizes, 1 1/2", 2 1/4", 3" and 3 3/4" are available to give you flexibility for these awards. All crystal awards can be lasered or sandblasted for personalization. A handsome blue presentation box is also included with these items. Imagine the expression of the person when they see their name on one of these impressive awards. Employee Awards Cube - 1 1/2" 01PD96022 P96022-1-10 Cube - 3" Corporate Crystal Diamond Employee Awards These Corporate Crystal Diamond awards come with a matching crystal base and are ideal to recognize the ultimate in achievement. The diamond is facetted and in a pear cut. A choice of 3 height sizes, 7", 8", or 9", and with plenty of area for your personalization needs, these crystal diamond awards will be a hit. All crystal awards can be lasered or sandblasted for personalization. A handsome blue presentation box is also included with these items. Imagine the expression of the person when they see their name on one of these impressive awards. Employee Awards Diamond - 7" Corporate Crystal Eclipse Employee Awards These Corporate Crystal Eclipse awards are ideal to recognize the ultimate in achievement. These awards mix vibrant color and elegant crystal together to give a dramatic effect. The crystal is cut with a slight bevel edge and allows plenty of room for any of your personalization needs. These 1" thick crystal pieces come in your choice of Black, Amber, or Blue while 3 sizes, 6" X 7 1/2", 7" X 8 3/4", and 8" X 9 3/4" provides the ultimate in flexibility for your event. All crystal awards can be lasered or sandblasted for personalization. A handsome blue presentation box is also included with these items. Imagine the expression of the person when they see their name on one of these impressive awards. Employee Awards Black 6" X 7 1/2" X 1" Blue 6" X 7 1/2" X 1" Amber 6" X 7 1/2" X 1" Corporate Crystal Everest Employee Awards These Corporate Crystal Everest awards come with a matching crystal base and are ideal to recognize the ultimate in achievement. A bevel cut pattern around the outside of the "peak" shape of the award adds another dimension to these awards. With a choice of 3 height sizes, 7", 8", or 9", and with plenty of area for your personalization, these crystal Everest awards will be a hit. All crystal awards can be lasered or sandblasted for personalization. A handsome blue presentation box is also included with these items. Imagine the expression of the person when they see their name on one of these impressive awards. Employee Awards Everest - 7"	cc/2020-05/en_middle_0126.json.gz/line765
__label__wiki	0.50186	0.50186	HomeBen Affleck Breaks Silence After "Slip" In Sobriety Ben Affleck Breaks Silence After "Slip" In Sobriety Throughout the end of the week, the Oscar victor raised worries about his restraint when TMZ posted a video of him, clad in a Halloween veil, faltering as he advanced toward the traveler entryway of a stopped SUV. Presently, he's taking a stand in opposition to the episode. "All things considered, you know, it occurs," he told paparazzi while heading into ex Jennifer Garner's home. "It's a slip, however I'm not going to give it a chance to crash me." Surely, the 47-year-old is hoping to leave this more grounded. "Collectedness is troublesome and slippery for everybody battling with fixation and Ben has recognized he's going to mistake occasionally," a source recently told E! News. "It was never as though this was just behind him." Next, with assistance from his calm mentor, he intends to get right in the groove again, a subsequent insider shared. "He's extremely dedicated to his recuperation and realizes he utilized terrible judgment," the source included. "He is paying the piper and managing it. These things can occur however he laments the decisions he made. He needs to be better for his children and plans to be." Affleck's mistake comes only one day after he opened up about his recuperation on Instagram. While making jokes about features about his private life, the whiz paused for a minute to advance an extraordinary reason. "HA, you got me. I'm dating," he imparted to his 4 million devotees. "Yet, how about we be not kidding for a minute and discussion about something that is really significant. I have been in recuperation for over a year and some portion of that is assisting others. @themidnightmission is a staggering association that aides those deprived with lodging, preparing, improvement and recuperation. I'm making a gift today in light of the fact that there are individuals fighting dependence consistently that don't have the assets and need assistance. @raya, you in? Who else is with me?" Back in August 2018, after an intercession arranged by Garner, the Justice League on-screen character entered recovery for the third time. "Ben was having an extremely intense time," a source told E! News at the time. "He keeps on fighting compulsion. He connected for help." Months after the fact, the star, while in out-understanding consideration, shared a sincere post about his battle. "This week I finished a multi day remain at a treatment community for liquor habit and stay in outpatient care," he composed on Instagram. "The help I have gotten from my family, associates and fans implies more to me than I can say. It's invigorated me the and backing to talk about my disease with others." "Engaging any fixation is a deep rooted and troublesome battle," he proceeded. "Therefore, one is never truly in or out of treatment. It is a full-time responsibility. I am battling for myself and my family. Such a large number of individuals have connected via web-based networking media and spoken about their own voyages with enslavement. To those individuals, I need to state much obliged. Your quality is moving and is supporting me in manners I didn't believe was conceivable. It realizes I am not the only one. As I've needed to remind myself, in the event that you have an issue, getting help is an indication of mental fortitude, not shortcoming or disappointment." Ben Affleck addresses ‘slip’ after stumbling outside party: It won’t ‘derail me’ Ben Affleck progressing recuperation won't be wrecked following one night, he says. Hours after he was seen bumbling outside a Halloween party in West Hollywood, Affleck — who has been real to life about his battles with liquor abuse — said he won't let a "slip" discourage his advancement. "It occurs. It was a slip. Be that as it may, I'm not going to give it a chance to crash me," the 47-year-old on-screen character educated TMZ on Sunday when asked regarding the earlier night's gathering. Affleck didn't remark when asked whether he'd return recovery. Affleck was shot Sunday with ex Jennifer Garner and their kids. They are guardians to girls Violet, 13, and Seraphina, 10, and child Samuel, 7. On Saturday night, Affleck was seen on video seeming to lose his equalization while leaving the Unicef Masquerade ball. Wearing a dull suit and a skull veil, the Oscar champ was shot clutching a SUV to relentless himself. It isn't clear what caused Affleck to lose his balance. A source revealed to Page Six on Sunday that moderation is "troublesome and tricky for everybody battling with habit," and "Ben has recognized he's going to foul up now and again … it was never as though this was just behind him." In front of his night out, Affleck talked about his recuperation in an Instagram post, and furthermore tended to his invasion into web based dating, after Page Six only uncovered he was on the VIP benevolent dating application Raya. "HA, you got me. I'm dating," Affleck composed. "In any case, we should be not kidding for a minute and discussion about something that is really significant. I have been in recuperation for over a year and some portion of that is assisting others." He proceeded, "@themidnightmission is an inconceivable association that aides those deprived with lodging, preparing, improvement and recuperation. I'm making a gift today in light of the fact that there are individuals engaging dependence consistently that don't have the assets and need assistance. @raya, you in? Who else is with me?"	cc/2020-05/en_middle_0126.json.gz/line766
__label__wiki	0.775531	0.775531	Home Reviews Lucknow Central movie review: Farhan Akhtar-starrer see-saws between musical drama, message film Daddy movie review: Arjun Rampal is believable only in fits and starts Cast: Farhan Akhtar, Ronit Roy, Ravi Kishan, Diana Penty, Deepak Dobriyal, Gippy Grewal, Rajesh Sharma, Inaamulhaq Director: Ranjit Tiwari Music director: Tanishk Bagchi, Rochak Kohli, Arjuna Harjai Producer: Nikkhil Advani Genre: Thriller film/Crime Duration: 2h 15m Orson Welles famously said ‘Nobody gets justice. People only get good luck or bad luck’. The fate of a young man who is wrongfully implicated in a murder case hinges on this sweeping quotation. It might sound a bit naïve for a prison drama, but then events in director Ranjit Tiwari’s Lucknow Central lean more towards sentimentality than sagacity. Kishen Mohan Girhotra (Farhan Akhtar) is a small town man with big dreams of becoming a professional singer. Overnight, he becomes the victim of a corrupt and corruptible system when he is wrongfully implicated for a murder and sentenced to life imprisonment. This sudden jail-time derails his desire to become a recording artist and perform in front of large audiences of appreciative fans. After 18 months in Moradabad jail, he is transferred to Lucknow Central, an intensive prison under the tough watch of a jailer (Ronit Roy). As soon as he enters his new home, Kishen gets pulled into prison politics and powerplay — which allows screenwriter Aseem Arora to introduce a number of prison drama tropes. So besides the heartless, iron-fisted head jailer (Roy has perfected the grimace and menacing stare), there’s a bully operating a fiefdom inside, canteen clashes etc. However in Lucknow Central, Kishen has a purpose. Under orders from the chief minister (Ravi Kishan), on to a do-gooder who believes in prisoner reformation (Diana Penty), Kishen volunteers to put together an in-house band. This band will compete with others from state jails in a jailhouse rock contest. The dream is to start a band; but the plan is to escape — that’s Kishen’s sales pitch as he carefully recruits band-mates, not for their musical abilities but for skills that will facilitate a jail break. After a lumbering first hour, it’s with the introduction of fellow inmates, played by solid actors such as Deepak Dobriyal, Gippy Grewal, Rajesh Sharma and Inaamulhaq, that the story hits it strides. Because until then you are trying to find a reason to sympathise with a flip-floppy character like Kishen. He’s a nice guy, but even though he is wrongly accused, he barely puts up a fight, accepting his fate rather benignly. Also the writers use the above mentioned quote by Welles as a kind of sweeping theme under which to brush away the judicial part of a prisoner’s life. Unlike Qaidi Band, these are not under trial prisoners embarking on a clumsy and poorly thought-out jailbreak. All but one of them is a lifer, guilty of their crime, and together they have meticulously mapped their escape. Tiwari hits his stride in the final hour of the film as the bands ready for the contest. There is redemption and resignation, and a final speech, designed to evoke an emotional surge. Kishen begins to find his spine only once he becomes a band leader. Akhtar is sincere but does not entirely get into the skin of a small town man. Plus his beefiness subtracts some authenticity as you observe a prisoner who has faced starvation and is burdened by bad luck but remains gym-toned. There’s also very little time spent on showing the band rehearse, which makes their ability to perform as a unit a little arbitrary. Having said that, the choreography and energy in both ‘Kabootar’ and ‘Kaavaan Kaavaan’ make the two songs enjoyable. But the background music and narrative pacing are choppy. Ravi Kishan’s ministerial khadi couture belies his social media savvy. He’s flanked by number crunchers tracking trending topics. He’s fun to watch as the progressive but caustic politician who taunts the prison officers remarking on how their uniform is the same shade of khaki as the traffic police. Dobriyal, Grewal and Inaamulhaq deliver thoughtful performances, though Penty’s styling and faux earnestness make her seem like she wandered onto the wrong set. Tiwari’s handling of the jail scenes are commendable even if the climax is a little contrived. And while this jailhouse rock-on see-saws between musical drama and message movie, its origins in a true story (about a real life prison band called Healing Hearts) and it’s notation on the merits of reformation give it soul. Critic's Rating Previous articlePriyanka Chopra’s gaffe leaves Sikkimese incensed Next articleBREAKING NEWS : Baahubali design for Amaravati? – TV9	cc/2020-05/en_middle_0126.json.gz/line767
__label__cc	0.545582	0.454418	It's National Pancake Day at IHOP this March 7, 2017 IHOP® Restaurants In The Philippines Join In In Celebrating Their 3rd National Pancake Day, Tuesday March 7, 2017 On March 7, all IHOP® restaurants in the Philippines will once again join locations throughout the United States, Canada, Puerto Rico, Guam and Mexico in celebrating a unique and beloved IHOP restaurant tradition: National Pancake Day. From 7 AM to 10PM on Tuesday, March 7th, all 5 IHOP locations will be offering guests the opportunity to enjoy unlimited servings of their world famous buttermilk pancakes for only P250, to enjoy in the restaurant. P 200 out of the P 250 generated from those pancakes will once again be donated to the Kythe Foundation, which provides children with cancer and chronic illnesses the chance to learn, play, and grow while in treatment, even if they’re in the hospital. National Pancake Day began in the United States in 2006 and in the past decade has raised $20 million dollars for children’s health charities in the local communities. Last year, IHOP Philippines joined the celebration, raising nearly P400,000 for the local Kythe Foundation charity. “When, we launched the National Pancake Day promotion 11 years ago, we had no idea that it would become so successful and so warmly embraced by our franchise partners, our team members and our guests” said Daniel del Olmo, President, of International, DineEquity Inc, the parent company of IHOP restaurants. “It is especially gratifying to see it become a tradition in the Philippines, knowing that our guests are enjoying our pancakes while raising money that will make a positive impact in the lives of children throughout the country.” “We’re grateful to Global Restaurants for embracing this wonderful IHOP tradition” “Last year, IHOP Philippines, with the public’s generous and kind hearted support, was able to raise nearly P 400,000 for the Kythe Foundation Charity through our National Pancake Day initiative. This year, we are once again elated to take part in IHOP’s arguably most popular and clearly most impactful tradition,” said Archie Rodriguez, CEO of Global Restaurant Concepts Inc., IHOP restaurant franchisee in the Philippines. “With every single IHOP restaurant in the Philippines participating in our 3rd National Pancake Day, we are hoping to raise a total of P500,000 this year for the Kythe Foundation to aid, in our own small way, in improving the quality of life and alleviating the condition of our children battling pediatric cancer.” Available at IHOP Century City Mall, Araneta Center, Mall of Asia, U.P. Town Center, and Bonifacio Global City. #IHOPNPD2017 #kytheat25 http://instagram.com/thefoodalphabet Labels: IHOP , IHOP Philippines , National Pancake Day Shakey's Chicken N' Mojos at 40% off!!!! Shakey's Chicken N' Mojos at 40% off All Day Monday! Mark you calendars! Enjoy Shakey's Chicken and Mojos at 40% off a... A Five-Star getaway at Marco Polo Ortigas Manila New Easter Starbucks Cards are coming your way thi... Xiao Long Bao and more at Paradise Dynasty Go on a magical journey with McDonald’s new Smurfs... Easter Sunday brunch at Hotel Jen Manila Summer happiness with new Baskin-Robbins ice cream... Hola! Gringo comes to The Atrium, SM Megamall Create your own Epic Experiences with Visa Makati Shangri-La, Manila introduces The Picnic, A... The secret behind Jollibee Burger Steak’s charm Celebrate the graduate at Marco Polo Ortigas Manil... P25 Halo-halo at Mang Inasal!!! Feast on something new at Yabu! A Taste of Vietnam at Crimson Hotel Filinvest City... Welcome the Summer Heat with the New Jollibee Salt... A different kind of radiance at Flow Spa Summer Surprise: Shakey’s Introduces the All-New S... The Remaking of an Icon: New Luxury Hotel Group Ni... Be a hero with McDonald’s new DC Girls and Justice... What do Chefs Sandy Daza, Boy Logro and Rosebud Be... A new culinary path with the new Executive Chef at... It's National Pancake Day at IHOP this March 7, 20... The Fountain of Youth revealed at Bijin Nabe The Grove Sunday Community Market: A Celebration o... Buy 1 Take 1 Sundae at McDonald's!!!! Marco Polo Ortigas Manila marks Philippines' hospi...	cc/2020-05/en_middle_0126.json.gz/line774
__label__cc	0.587107	0.412893	The Muddraker Harvey Mudd College's student newspaper Harvey Mudd College’s Summer Institute By Guadalupe Quirarte / July 5, 2017 Harvey Mudd College’s annual Summer Institute Program (SI) is a two-week summer program that takes place in August where approximately 28 incoming freshmen participate. This program seeks to select a diverse group of students and specifically aims on targeting underrepresented voices in STEM. The overall purpose of the program is to ease students’ transition into college. The program is divided into two areas. The academic side of the program is centered on having the students have an early start into Math 30B which is proof based Calculus. The leadership side of the program is led by The Office of Institutional Diversity and focuses on discussions revolving around identity and social justice. However, this is simply a generic view of SI. Having participated in SI last summer, I have to say there is a deeper impact this program integrates that cannot be communicated through a detailed description of the activities and events the students participate in. I realized that the best part of choosing to participate in SI is the people I met and the close-knit community we built. SI not only gave me a glimpse to how college life is like before starting school, but also how to manage one’s time and to appreciate the art of learning. Listening to Prof. Jacobsen’s passionate lectures every morning as he let us dive into his calculus from scratch form of approaching the subject ignited my love for the course. His enthusiasm and energy lit up the room and truly made us all feel welcomed. I learned how working in groups and collaborating with others can help us solve problems in a more diligent and efficient manner. Balancing homework with other activities helped me value teamwork and problem solving. Leadership became an integral part of the experience as Dean Sumi’s workshops led us to explore a wide range of topics centered on social justice. This allowed me to understand the dynamic of our group and how we all could work together to understand our unique perspectives. Through my first year at Mudd I realized that the goal of these workshops was to encourage us to become leaders and educate others about the importance of integrating social justice into our STEM focused education. It is quite simple to become blinded by all the work throughout the years and lose sight of the impact our work has on society. Topics ranged from privilege, defining one’s identity to understanding imposter syndrome. With a wide range of topics, we learned more about one another as we respected each other’s views. Every SI group will be unique as we learn how to educate ourselves and others about our own identities and differences. Even though only a small portion of incoming freshmen participate in SI each year, I believe as Mudders we should all educate ourselves about societal issues in order to help foster an inclusive community in Mudd where all voices are heard and valued. What is ASHMC? By Muddraker Staff / November 8, 2019 What to Bring: The Updated List By Kyle Grace / August 21, 2019 Caltech Plaque Prank By Tiffany Madruga / April 26, 2019 Reduce Single Use Campaign By Muddraker Staff / April 26, 2019 Humans vs. Zombies Photos! By Domenico Ottolia / November 1, 2018 The Muddraker’s Annotated version of The “What to Bring” List Relaxation Ritual Categories Select Category Arts & Leisure (13) Campus Life (32) Community (9) Debate (2) Dining (5) Fiction (2) Humor (12) Oct 2019 (3) PROFiles (9) Science (13) Sports (3) Sustainability (1) Uncategorized (5)	cc/2020-05/en_middle_0126.json.gz/line779
__label__wiki	0.87291	0.87291	Ben Stokes launched a memorable blitz on the Proteas to effectively take any chance of a home win out of the equation on day four of the second Test match at Newlands on Monday. The England’s all-rounder’s onslaught was as unorthodox as it was effective as he shared a partnership of 92 with Dom Sibley and contributed 72 off the runs scored off just 47 balls with 7 fours and 3 sixes. The old firm of Jimmy Anderson and Stuart Broad took charge as England bowled themselves back into the series and an almost certain first innings lead on day two of the second Test match against the Proteas at Newlands on Saturday. The Proteas finished the day on 215/8, still 54 runs in arrears with only Kagiso Rabada and Anrich Nortje left to bat with Vernon Philander. Just how significant England’s likely first innings advantage will be remains to be seen but bearing in mind that this has been an unusually low scoring New Year Test match with 18 wickets having fallen for less than 500 runs it looks like being important. India needed just two overs to wrap up the final Freedom Series Test match against the South Africa at Ranchi on Tuesday by an innings and 202 runs margin and clinch a 3-0 series triumph and, with it, 120 points in the ICC World Test Championship. Shahbaz Nadeem took the remaining two wickets in successive balls, the final one in bizarre fashion when he dismissed Lungi Ngidi caught and bowled as the ball deflected off the non-striker, Anrich Nortje. Rohit Sharma was named both Man of the Match and Man of the Series for his aggregate of more than 500 runs that included three centuries, one of them being a double. South Africa tripped up in final of Tusker Safari Sevens South Africa lost 19-14 to Kenya's Morans team in the final of the Tusker Safari Sevens at RFUEA Grounds in Nairobi after a slow start in the first half saw the visitors concede 19 points against the locals. The home side, consisting mainly of the Kenyan HSBC World Rugby Sevens Series squad, scored three tries in a six-minute spell, with the SA side falling off tackles they were making earlier in the tournament. South Africa end Japan's fairy tale run with second half display The Springboks produced a second half revival to clinch a place in the Rugby World Cup semi-finals after a ‘nervous’ first 40 raised hopes for a packed home crowd of a repeat of the ‘Miracle of Brighton’ which had seen Japan turn the rugby world on its head with victory over South Africa four years ago. The Springboks stretched away from an edgy two-point halftime lead (5-3) with 21 unanswered points in the second half. Rohit's double ton takes India near 500, Pacers reduce South Africa to 9/2 India had a near perfect second day to the final Freedom Series Test match against South Africa at Ranchi on Sunday when Rohit Sharma and Ajinkya Rahane both achieved further personal landmarks and the home side then dismissed both the South African opening batsmen cheaply. Their only disappointment for India would have been the fact that most of the final session was again lost to bad light, but the home side still held an overwhelmingly strong position, having declared at 497/9 and then reduced the Proteas to 9/2 by the early close. Rohit, Rahane put India back on top after early Proteas burst Rohit Sharma batted India through a difficult new ball period after Virat Kohli had again won the toss to score his third century of the series and put his side on the way to another substantial first innings total against the Proteas on the opening day of the final Freedom Series Test match at Ranchi on Saturday. Sharma finished the day unbeaten on 117 (164 balls, 14 fours and 4 sixes) for his sixth career century and in the process took his series aggregate past the 400-run mark. His partnership with Ajinkya Rahane for the fourth wicket – so far 185 runs in a little more than 42 overs – was also an Indian fourth wicket record against the Proteas, improving on the 178 that Rahane and Kohli had put together in the previous match at Pune.	cc/2020-05/en_middle_0126.json.gz/line783
__label__wiki	0.753728	0.753728	"Potential witness must be jailed until leaving US": "An immigration judge has ordered a potential witness in the investigation into the fatal shooting of a Chechen man by an FBI agent last month to leave the United States no later than July 1, and to remain in jail until she departs, raising an outcry from a civil rights group seeking a full accounting of the man’s death. Federal immigration officials arrested Tatiana Igorevna Gruzdeva, a 19-year-old aspiring foreign language teacher from Russia, on May 16 for overstaying her visa. They discovered the violation when the FBI and other law enforcement officials began investigating Ibragim Todashev, her roommate in Orlando, about his ties to the Boston Marathon bombing suspects. Six days later, a Boston FBI agent shot and killed 27-year-old Todashev in their apartment. Officials with the Council on American-Islamic Relations in Florida, which is conducting its own review of the shooting, said they wanted to talk to Gruzdeva about the FBI’s actions in the days and weeks leading to Todashev’s death. Council leaders are concerned that federal officials are sweeping her out of the country before she could provide information to them and law enforcement officials." Cover-up story: "Cover Story: How the NSA Targets Germany and Europe" (worried that NSA employees might get terminal cases of carpal tunnel syndrome): "SPIEGEL has decided not to publish details it has seen about secret operations that could endanger the lives of NSA workers." "The Guardian Revealed An NSA 'Scoop' Then Deleted It From The Website" "British Paper Duped into Fake NSA Scoop by Obama-Is-Gay Crank" The large ad hominem argument seems to be intended to obscure the fact that the underlying story is true. The court oversight amounts to "a bulk collection order for internet metadata 'every 90 days'". Hasbara is expensive: "Americans give $274 million to aid Israeli settlements - new report" Oh-oh: "Jewish ex-Argentina gov’t official to be probed in AMIA bombing": "The Jewish ex-interior minister of Argentina will be investigated for his ties to the AMIA Jewish center bombing. The Buenos Aires Federal Appeals Court last week ordered the probe of Carlos Vladimir Corach in connection with an illegal payment of $400,000 to Carlos Telleldin, an auto mechanic who was among those charged in the 1994 attack that left 85 dead and hundreds wounded." Front-runner Vaguely insulting Holder as a comic-book villain Barnaby Jack We Gotta Get out of This Place The conspiracy behind the the remubarakization of ... Iron Wall The two sides of Kerry's mouth Lynching in the 21st century Hastings Endgame? Game changers? Michael Hastings crash New sphinx 'Improving' the lies The Official Story is the least likely explanation... Saudi subtlety Lots of stories today, some true The Snowden Effect Prince Bandar must be bushed Underhanded Coup, what coup? I’m not a crook. The coup in Egypt Evil seems to be the theme, as always	cc/2020-05/en_middle_0126.json.gz/line785
__label__cc	0.552232	0.447768	This Privacy Policy governs the manner in which the School collects, uses, maintains and discloses information collected from users (each, a “Student”) of the School. This Privacy Policy applies to the School and all Courses offered by the School. We may collect personal identification information from Students in a variety of ways, including, but not limited to, when Students enroll in the School or a Course within the School, subscribe to a newsletter, and in connection with other activities, services, features, or resources we make available in our School. Students may visit the School anonymously. We will collect personal identification information from Students only if they voluntarily submit such information to us. Students can refuse to supply personal identification information but doing so may prevent them from engaging in certain School related activities. The School may collect and use Students’ personal identification information for the following purposes: We may use information in the aggregate to understand how our Students as a group use the services and resources provided in our School. We may use Student email addresses to send Students information and updates pertaining to their order. Student email addresses may also be used to respond to Student inquiries, questions, or other requests. We do not sell, trade, or rent Student personal identification information to others. Student may find advertising or other content in our School that link to the websites and services of our partners, suppliers, advertisers, sponsors, licensors and other third parties. We do not control the content or links that appear on these websites and are not responsible for the practices employed by websites linked to or from our School. In addition, these websites or services, including their content and links, may be constantly changing. These websites and services may have their own privacy policies and customer service policies. Browsing and interaction on any other website, including websites which have a link to our Student, is subject to that website's own terms and policies. The School has the discretion to update this Privacy Policy at any time. We encourage Students to frequently check this page for any changes. You acknowledge and agree that it is your responsibility to review this Privacy Policy periodically and become aware of modifications. By enrolling in the School, you signify your acceptance of this Privacy Policy. If you do not agree to this Privacy Policy, please do not enroll in the School. Your continued enrollment in the School following the posting of changes to this Privacy Policy will be deemed your acceptance of those changes. © WritingBold Academy 2020	cc/2020-05/en_middle_0126.json.gz/line788
__label__wiki	0.8079	0.8079	Nicki Minaj Details Past Abusive Relationship: “I Really Used to Think Love Had to Hurt” Fans have seen Nicki Minaj show her tough exterior in the music and interviews, but that’s not to say that she hasn’t gone through some hardships. On Sunday (Sept. 1), Nicki opened up to the Barbs on her Twitter page and revealed her own experience in a past abusive relationship. In a series of tweets, the rap superstar urged her followers to refrain from passing judgment on other women in toxic relationships. "When u see a woman in a toxic relationship, rather than laugh & say mean things, try to offer sound advice from your heart & root for her to learn her worth," she tweeted. "We’ve all been there. I saw my parents fight & argue non stop & never divorce, so I thought this was normal behavior." Nicki, who completed her European tour earlier this year, then went on to talk about being in an abusive relationship. "I rlly used to think love had to hurt. So I could never look down on anyone else. We are merely human," she wrote in part. "It’s not easy to leave. Especially in the world of IG where all ppl want to do is post relationship goal pics for clout & attention. A man should make you feel safe, not afraid." She also expressed how her past relationship turned violent. "I remember being so afraid to speak cuz I never knew when that person would be in a particular mood and I could maybe say one wrong thing that would get me hit," she admitted. "So the diff you see in me now is that feeling when a woman feels lifted up, safe, appreciated & unconditionally loved." The "Megatron" rapper hopes for people to judge less and uplift more. "But I first had to learn how to love MYSELF," she continued. "If you wouldn’t let a man treat your mother, your sister or best friend like that b/c you LOVE them, then you wouldn’t let a man treat YOU like that b/c you love YOU. This isn’t about judging. We judge too much. Lift them up." Nicki had previously talked about her dark moments in her past in a trailer for her upcoming Queen documentary last year. In a teaser posted on her Instagram page last October, she recalled her father's violent behavior toward her mother and how that affected her. "I remember when my mother would let my father be violent with her. And she always brings up this story, as a little girl I would stand in front of my mother and go like this," she said showing her arms in defense. "And then all of a sudden, that was my life." Currently, the Queen creator is in a loving relationship with her fiancé Kenneth "Zoo" Perry. The couple are expected to get married very soon. Read Nicki Minaj's tweets about being in an abusive relationship below. 20 Great Albums From Female Rappers Over the Years Source: Nicki Minaj Details Past Abusive Relationship: “I Really Used to Think Love Had to Hurt” Filed Under: nicki minaj	cc/2020-05/en_middle_0126.json.gz/line793
__label__cc	0.719815	0.280185	« Alton Sterling Micah Xavier Johnson – a rant in 500 words or less » Fri Jul 8th 2016 by abagond A picture Castile posted of himself on Facebook. Philando Castile (1983-2016), a Black American school cook, was shot dead during a Routine Traffic Stop by a police officer in Falcon Heights, Minnesota, a White suburb of St Paul. Castile had a gun, but it was not in his hand. His girlfriend, Diamond “Lavish” Reynolds, showed part of the stop live on Facebook. This was at 9.00pm on July 6th 2016, less than 48 hours after Alton Sterling was killed in Baton Rouge, Louisiana. The video starts after the four or five shots have been fired. Castile is covered in blood and seems to be passing out. Reynolds says, “Stay with me.” Pointing through the car window is a nervous police gun. Reynolds is trying to remain calm: her four-year-old daughter is in the back seat. Police tell Reynolds to get out of the car and walk backwards with her hands up. One officer points a machine gun at her like she is a dangerous criminal. Another officer is holding her daughter. They tell her to get on her knees. They put on handcuffs. Her daughter is crying. Reynolds asks why she is being arrested. They say she is being “detained” while they sort things out. When the ambulance comes, she cries out to God. Before the video, according to Reynolds, they were pulled over for a broken tail light that was not broken. A “Chinese” police officer tells them to put their hands in the air – and then asks Castile for his licence and registration. Then: “As he’s reaching for his back pocket wallet, he lets the officer know: ‘Officer, I have a firearm on me.’ I begin to yell, ‘But he’s licensed to carry,’ After that, he [the officer] began to take off shots: ba ba ba ba. ‘Don’t move, don’t move!'” The police will not say who did it. The case is being investigated by Minnesota state’s Bureau of Criminal Apprehension (BCA), the same that found no wrong in the killing of Jamar Clark in November. There have been protests both at Larpenteur Avenue and Fry Street, where the shooting took place, and at the governor’s mansion in St Paul. The governor, Mark Dayton, came out of his mansion when Reynolds was there. He apologized to her and promised justice. President Obama said all Americans “should be deeply troubled” by the Sterling and Castile shootings, that they are not Isolated Incidents but “symptomatic of the broader challenges within our criminal justice system.” Hillary Clinton, who is running for president, tweeted: “America woke up to yet another tragedy of a life cut down too soon. Black Lives Matter. #PhilandoCastile -H” Donald Trump, also running for president, that loudmouth who wants to “Make America Great Again”, said – nothing. A parent of one of the students at the school where Castile worked: “My borderline autistic son hugged him every day. You guys. This was a GOOD MAN. This was a violent murder, an execution. A horrible, horrible act of racist violence. I am sick.” – Abagond, 2016. Update (July 8th, 16:22 GMT): The Sterling and Castile shootings led to protests across the country last night. The one in Dallas ended with 11 police officers getting shot. Five have died. Police say it was the work of snipers. Castile’s killer has been named: Jeronimo Yanez, who has been with the force for four years. His name is Spanish and he does not look particularly “Chinese”, though the picture quality in this photo is not great: Philando Castile dashcam video also died in police custody: Alton Sterling – same week Jamar Clark – same state Walter Scott – also killed after being pulled over for a broken tail light Sandra Bland – also drove while Black Peter Liang driving while Black What to do if stopped by the police yet more racism in Minnesota: Christopher Lollie University of Minnesota blackface video The whiteness of Laura Ingalls Wilder The 1920 Duluth lynching Black Brute stereotype on Fri Jul 8th 2016 at 02:18:19 sharinalr When Obama can engage in police reform thenot I will listen. on Fri Jul 8th 2016 at 02:21:25 michaeljonbarker The NRA has remained silent on the two shootings. Appernemty guns rights only apply to white people. The Second Admendment Foundation, a small gun rights group, has called for an independent investigation into Philando Castile’s death. Reason magazine writes a piece about the events. http://reason.com/blog/2016/07/07/black-lives-matter-and-so-do-their-gun-r on Fri Jul 8th 2016 at 03:50:12 Mary Burrell Watching the YouTube of his life seeping out of him was horrible and the girlfriend’s hysteria was just horrendous and a small child was witnessing this. So even when you comply just as this young brother did you can still die. May his soul rest in peace. My heart is heavy. on Fri Jul 8th 2016 at 03:52:38 abagond And it gets worse: at protests in Dallas, 10 cops have been shot, 3 are dead. on Fri Jul 8th 2016 at 04:47:35 Origin I’m not surprised. Escalating violence always seemed inevitable. It was only a matter of “when” in my mind. The justice system has no credibility as a system that serves all Americans and when that happens, some people will take matters into their own hands. on Fri Jul 8th 2016 at 04:57:26 Michael Jon Barker This is what the media will focus on. The police become the victims and BLM agitates violence. Their is no evidence at this point that the shooters were Black. My gut instinct is that the shooters were former military because of how they pulled this off. I’ve been reading that the shooters were snipers who shot at police from elevated positions. I don’t think they were directly associated with the protests. on Fri Jul 8th 2016 at 05:46:01 jefe was shot dead during a Routine Traffic Stop by an Asian American police officer Does anyone know the ethnic background of Jeronimo Yanez? I can’t find it online. The information around the Dallas incident is constantly evolving. The “facts” will probably be a lot different by later this morning. I suppose that will be a matter for another post. on Fri Jul 8th 2016 at 07:16:44 Michael Cooper Criminal activity from police officers shouldn’t be a shocker to people anymore. Unfortunately, more and more cops are becoming active criminals. Earlier today I was conversing via Google+ with a White commenter on the recent deaths of Alton Sterling and Philando Castile. But, as usual, the White commenter (who’s actually a well-known troll) threw the “White-on-Black” violent crime script at me like a baseball pitcher. No worries, I belted his crime script “out of the park.” I told him that the murders that are committed by Black men are mostly committed by marginalized street gang members named Pookie or Baby Ray-Ray. The murders that are committed by White men are mostly committed by White professionals and businessmen like Orville Fleming (California fire chief), Michael Slager (oath-taking police officer), David Viens (chef), Charles Merritt (business owner), Brian Karl Brimager (retired Marine), Timothy Loehmann (police officer), Raymonf Clark III (Yale laboratory technician), Bradley Stone (Marine), Brian Randone (fashion model), Johannes Mehserle (oath-taking police officer), Joshua Thomas Bohl (blue-collar worker), Daniel Pantaleo (oath-taking police officer), etc. There’s a huge difference. The White commenter mentioned DeMarquise Elkins (Black man). In 2013, 17-year-old Elkins was sentenced life in prison for fatally shooting a White baby in a stroller while trying to rob the child’s mother. I asked him if Elkins was a business professional or a young marginalized gang member? He didn’t reply. I also asked him is Elkins serving life in prison? Again, no reply. I mentioned Brian Karl Brimager (White man). In 2011, 36-year-old Brimager – a retired Camp Pendleon Marine – admitted to stabbing his girlfriend, dismembering her body and hiding a backpack with her body parts in a remote jungle in Panama. In February, Brimager pleaded guilty to second-degree murder in the death of Yvonne Baldelli. In May, Brimager was sentenced to 26 years in federal prison. Both Elkins and Brimager committed violent murders but one gets life in prison and other gets 26 years. Race plays a MAJOR in America. on Fri Jul 8th 2016 at 07:25:49 AccessDenied I believe this is exactly what the establishment wants. A continual and widening against races as well as supposed authority that patrol the streets. Violence is not the answer but it is the reaction one gets when put in a corner. on Fri Jul 8th 2016 at 08:59:27 Buddhuu I saw the video of the poor lady stuck in the car with Mr Castile as he died, with the police who murdered him still yelling at them. I also saw the video of Mr Sterling’s execution. Much of the reaction to the cop deaths will no doubt be in line with what the shallow, idiot musician Joe Walsh has been vomiting on Twitter. The deaths of black people will be ignored but the deaths amongst police will be seen as justification for more demonisation of an entire race. I’m only surprised it took this long for (what seems likely to be) some kind of organised resistance to take action. I’ll be surprised if it doesn’t happen again. When the system doesn’t act to protect you then you have to protect yourselves. That poor lady and kid in the car with Philando Castile… I can’t condemn a fight back. Ask the liberals who will condemn it what alternative steps they are taking to address the situation. on Fri Jul 8th 2016 at 11:14:35 v8driver this is not good, at all, the civilians will be paying for this every time the lights start flashing in the rearview on Fri Jul 8th 2016 at 12:56:57 cleonette Just heard they tired to pin the shooting on a black man whom was open carrying at the protest. His picture was put on CNN as a suspect. A person at the protest released cell phone video that showed the suspect on camera when the shooting began. Witnesses are saying the shots actually orginated from police vehicles as well and there were so many bullets flying they think it was multiple shooters. I should add that the video released showing the black suspect showed standing peacefully when the shooting started. He was not involved in any way. In Dallas the protesters will be lumped in with the cop killer. on Fri Jul 8th 2016 at 14:32:29 Solitaire I would not be at all surprised if the sniper(s) were white supremacists. They know the shootings will initially be blamed on BLM, maybe permanently if the snipers manage to elude detection. I haven’t been able to find it yet. The media has switched to calling him Hispanic/Latino instead of Asian/Chinese, but I haven’t been able to find anything but speculation on his actual racial origin. If you have seen the photo, he’s definitely not a white Hispanic, although he could possibly be part white. He didn’t look obviously Pilipino or Guamanian to me, but I’ve been wrong before. on Fri Jul 8th 2016 at 15:35:38 blakksage My heart goes out to the families of Alton Sterling and Philando Castile. Rest in peace brothers! The shooting incident in Dallas is just a small sample of what will eventually take place. White people or this country as a whole should brace themselves because of what they’ve collectively done to Yah’s people over the past 500 years or so. There will be no escaping of judgment for them, … just watch. Jeremiah 16:16 “Behold, I will send for many fishers, saith the LORD, and they shall fish them; and after will I send for many hunters, and they shall hunt them from every mountain, and from every hill, and out of the holes of the rocks.” https://m.facebook.com/story.php?story_fbid=10209748506817968&id=1489932727&refid=8&_ft_=qid.6304980745473452756%3Amf_story_key.-3670805484913371559 @Solitaire The only reference I could find to suggest that he might be Asian was from the girlfriend who at one point said he was a “Chinese” cop, but that does not explain his Hispanic name and ambiguous racial look. Anyhow, since Abagond had labelled him as “Asian American”, I thought he must have access to information that is not easily found online. Otherwise, I think it might be best not to affix the racial label until we know more. But the media also had problems affixing racial labels to gunmen like George Zimmerman and Elliot Rodger and police felons like Daniel Holtzclaw. The msm can’t be trusted to tell the truth they bend and twist the narratives. And because it’s Black Lives Matter they are just going to conflate everything. And in regards to the tragedy in Dallas something is very fishy. Something they are hiding and trying to bid their time so they can concoct a lie. I hate all this conspiracy garbage. I based “Asian American” on Reynolds’s description of him being “Chinese”. But since his name is Spanish and since he does not look clearly “Chinese” in the picture I could be pretty sure was him, I took out “Asian American” from the post, but I left in her description since it is clearly marked as an eyewitness account. Update: The Sterling and Castile shootings led to protests across the country last night. The one in Dallas ended with 11 police officers getting shot. Five have died. Police say it was the work of snipers. (see above for the picture I added to the post). I assumed Abagond wrote “Asian American” because at that time that is how the press was describing him, and to the best of my knowledge, the press was basing that solely on Diamond Reynolds’ description. It’s understandable that she would not necessarily be able to accurately identify his race, especially under the extremely traumatic circumstances. But the press shouldn’t have run with it as fact until independently confirmed. As you and I both know, his Spanish name doesn’t preclude his being of Asian or part-Asian descent, but it does make it unlikely. What happened was blow back. But don’t expect that fact to be apart of mainstream reporting. “But this phenomenon is by no means restricted to international affairs. It can characterize civil unrest as well. Again, what we saw yesterday in Dallas was, if not something even more diabolical, blowback.” “The American people feel under siege. Different populations feel besieged by different forces. Black Americans especially have suffered decades of persecution by the American “justice” system: police brutality and harassment, mass incarceration, being nickel-and-dimed by tickets and fines, etc. And especially since the summer of 2014, they have been seeing a litany of viral photos and videos of black Americans having been gunned down, throttled, and broken by the police.” “This violence too is driven by collectivism. Law enforcement officers are granted an exceptional status in society: a special dispensation to mete out violence with impunity. This caste privilege has instilled deep tribalism in many police officers, which is amplified by training and police union propaganda. Cops are trained to be obsessed with “officer safety” and to effectively treat those outside the “blue tribe” (whom they ostensibly “protect and serve”) as an enemy population: as if every American they detain is a potential quick-draw gunman ready to shoot them down in a millisecond. This paranoia, combined with the impunity of the badge, is what makes an encounter with the police so potentially lethal: especially for black civilians.” “Take the collectivism of “blue” tribalism explained above and add, for some individuals, the collectivism of racial terror (irrational, hateful prejudice that every black male is a potential super-predator), and you begin to understand the epidemic of police violence against American blacks.” http://fee.org/articles/the-sniper-shooting-in-dallas-was-both-murder-and-blowback/ on Fri Jul 8th 2016 at 16:57:59 TeddyBearDaddy The officer could be a Filipino… which doesn’t make the crime any better or worst. Sorry, Abagond — we cross-posted and I didn’t see your explanations and revisions before writing my most recent comment to Jefe. on Fri Jul 8th 2016 at 19:03:42 Afrofem @Michael Cooper I love, love, love your responses to the White commenter who tried to tie you up with the Black on Black crime (or the Black on White crime) scripts that Black folk often encounter on comment sections, forums or social media. I’m not surprised that all you heard back from him or her was “no reply”. White on White crime results in 26 years in prison. Black on White crime results in life in prison or death. Blue (police) on Black crime results in a two week (or longer) paid vacation, no prison time and in some cases, a huge payday. http://www.truth-out.org/buzzflash/commentary/darren-wilson-reportedly-receives-a-large-bounty-of-financial-support-for-killing-michael-brown on Fri Jul 8th 2016 at 19:26:36 villagewriter Jesse Williams speech still ringing in my mind. He set fire on many peoples seats. @Buddhuu There are non-violent alternatives. Every “fightback” need not be done with fists, knives or guns to be effective. Considering the rising levels of panic that the Palestinian BDS movement is inspiring in certain circles, it seems that economic non-participation and institutional divestment are potent weapons against people who value money over human life. https://electronicintifada.net/blogs/rania-khalek/pro-israel-groups-vow-eliminate-bds I saw this on your website’s About page and completely agree with your ideas that: “… revolutionary approaches are futile unless preparatory groundwork has been done to educate people… it is necessary to have working social structures and logistical processes in place to act as examples. Change must be evolutionary as much as revolutionary.” I think a combination of “fightback” tactics are most effective. They must be held together with an overarching vision of where people want to be instead of what they think is possible now. @villagewriter I agree. Jesse Williams speech was well timed, not just for events in the US, but also in a global context. “…in regards to the tragedy in Dallas something is very fishy. Something they are hiding and trying to bid their time so they can concoct a lie.” I thought about that last night when I heard about the police being shot. I wondered who would have the most to gain if police were shot and killed. BLM protesters didn’t even make the top one million list as suspects on that type of operation. White Supremacists groups, however, made the top three list. They have been plotting massive violence for a long time. What better spark than killing cops and having the media blame non-violent BLM protestors? on Fri Jul 8th 2016 at 20:01:39 gro jo Obama on the dead Dallas cops: All cop lives matter. there’s a protest march in north philly now close to temple univ., i am a bit tired for that right now Who gains ? Whenever individuals, groups ect attack State agents it’s the State that benifits through gaining more power over people and more laws are passed restricting the civil liberties of all American citizens. Last night set the precedent that a government “robot” was used to blow up the shooter. I belive that this is the first time a drone has been used to kill an American citizen on U.S. soil. In the view of the State what happened last night was an insurrection. @gro jo Yes, that miserable mountebank has never be able to get the words, “Black Lives Matter” past his lying lips. on Sat Jul 9th 2016 at 00:01:22 Mary Burrell I hope Mark Hughes sues The Dallas Police Department they singled him out as a person of interest in the sniper shootings in Dallas last night. @Abagond: Will you be doing a post on the shootings of the police officers in Dallas and the sniper Micah Xavier Johnson? on Sat Jul 9th 2016 at 00:12:43 v8driver supposedly they duct taped a claymore antipersonnel mine to the bomb robot that’s posse comitatus violations again i only said it four times before on here or something, it’s escalating for sure on Sat Jul 9th 2016 at 00:40:12 michaeljonbarker 5,413 vs. 10. The last time 5 cops died in one day was 9/11/01. 5,413 days ago. The last time the cops killed 5 civilians in one day was 6/27/16. 10 days ago. Copied from a FB post. on Sat Jul 9th 2016 at 02:34:27 Afrofem @michaeljonbarker One that the State planned for and duly provoked to achieve its own ends. on Sat Jul 9th 2016 at 02:36:13 KingRaized Why is everyone stating the victimm is Black American when he has a Spanish name? We are all hating, going against one another, killing one another. It’s a total collapse of each other. Freedom, justice, love, respect, compaison, is going away. Hate is rampant all over America. It seems as lately that every person in America. Be it, Suburban, Rural , Urban etc areas are tearing each other up. Don’t you’s get it? If we continue this we are making is easier for militant Jihadists to finish us and then who are you going to hate distrust and tear to shreds? NOTHING…… Nothing will be left. We will all have invited them into our house to do with us as they see fit. Smarten Up……… on Sat Jul 9th 2016 at 19:15:16 TheHipHopRecords (@TheHipHopRecord) The animal (Jeronimo Yanez) deserves the electric chair. He’s on paid leave. So the system is already protecting him. His girlfriend is truly amazing in the way she kept her calm. They would’ve happily killed her and maybe spared the young child. They would’ve covered it up. She stayed calm to tell the story and to stay alive at least for her daughter. Without her recording we would never have seen this. Meanwhile you had a cop screaming like fucking a banshee about why he shot Phil AND STILL HOLDING THE GUN ON PHIL, STILL ? Nobody calling for help for him, his girlfriend can’t move or she’ll be dead. Why do they even become police officers if they are too emotionally fragile to handle what the job entails? But as usual they spaz out and start shooting people all because someone is black and they twitched This is the fuckery that we, as melanated people have to deal with on a visceral level. Trauma is imbedded in our DNA. But back to that sister. Man. As I’ve said she and her little girl would have been dead dead dead if she wasn’t in full survival mode. I commend her bravery. I hope her little girl doesn’t develop PTSD. That’s a very impressionable age to experience this type of trauma. If you ain’t ready, you better get ready! Cause the revolution is HERE! on Sat Jul 9th 2016 at 23:06:13 sharinalr Just read somewhere that they claim they pulled him over because he fit the description of a man who robbed the store 4 days prior. Theven man in the store video had a goatee and castile had a goatee sideburn connect type cut. on Sun Jul 10th 2016 at 17:43:42 Origin @Sharina It seems the broken tail light was a reason Yanez made up for the stop. I’ve seen a report where they’re saying Castile was pulled over for his “wide set nose” according to dispatch audio. (https://www.youtube.com/watch?v=TeXW1ZqK0vs) on Sun Jul 10th 2016 at 17:45:59 nomad @sharinalr We all look alike to them. “Broken tail light” and “fit the description” are just nice ways of saying the N-word. https://www.washingtonpost.com/national/stopped-52-times-by-police-was-it-racial-profiling/2016/07/09/81fe882a-4595-11e6-a76d-3550dba926ac_story.html Apparently he was stopped over 50 times in the last few years. A large proportion of those stops were likely for BS too since many of his violations were dismissed. This is basically stalking then killing by a predatory system. @Origin That’s incredible! ” $6,588 in fines and fees, although more than half of the total 86 violations were dismissed” That’s incredible. I’ve been stopped several times for driving while black. But 52!!! I remember going to court and seeing hundreds of people lined up. 90 % of them black in a city that’s 50 % black. And then got a bullsh-t ticket on the same day that I had just been to traffic court! And I thought that was bad. But 52!!! That’s incredible! on Sun Jul 10th 2016 at 19:19:04 Mary Burrell @Origin: I read something about “wide set nose” in regards to Philando Castille and I just had to shut down my iPad I couldn’t read anymore that is the most disgusting and racist garbage, it’s beyond pathetic. I have read that cops have a quota to make so they go to low income communities where Black/Brown citizens live and harass those people. on Sun Jul 10th 2016 at 20:34:48 sharinalr @Mary This video says a lot. (https://youtu.be/oK35y9-dTuw) @Sharina: Thanks for the link it’s confirmation that the police culture is corrupt and it is similar to a gang. If the good cops snitch they will be retaliated against. on Mon Jul 11th 2016 at 15:07:23 Herneith ‘You fit the description’ is a stock and trade excuse. You must haave probable and reasonable cause to stop someone here(Toronto). Hence, you fit a suspects description. So what if you are 5’8, to the supects 6’5, or have a bald ead instead of a head full of hair? on Mon Jul 11th 2016 at 17:24:11 melissa Anyone notice a trend in these white hispanics killing helpless black people, e.g. George Zimmerman? Where does their anger stem from? on Tue Jul 12th 2016 at 16:46:13 nomad “State investigators named Jeronimo Yanez and Joseph Kauser as the officers involved. Both had been with the St. Anthony Police Department for four years and were put on administrative leave, as is standard. Yanez approached Castile’s car from the driver’s side, and Kauser from the passenger side, according to a statement from the Bureau of Criminal Apprehension. It said Yanez opened fire, striking Castile multiple times. No one else was injured.” Something I don’t understand. Is the video of the killing reversed? Why is Castile and the steering wheel on the right side of the car? What’s going on here? on Tue Jul 12th 2016 at 16:48:54 abagond @nomad I think the video is flipped. on Tue Jul 12th 2016 at 17:02:43 v8driver The video is mirror flipped because she used the front camera, I read. on Tue Jul 12th 2016 at 22:47:15 Zoe Jordan Haven’t commented on a post for many, many, months but feel compelled with this one. Watching the live feed on FB of this literally broke me. I was actually moved to send a message of love to Lavish Reynolds which is something I have never done before and probably never will again. Here in the UK we are all shocked to the core and heart broken for Mr Castile’s family. We all know this is not anything new or surprising but the world has witnessed it. That officer killed a man in front of his child! As a mother it makes me cry. My Boyfriend’s sister is planning to move to the states with her husband an 4 children at the end of the year and he is begging her not to go. They are a hard working and relatively wealthy family. Over there they will be considered quite middle class and of course British but what does it matter? They are black. We do not believe they will be safe. My heart bleeds for all the lives taken and all the families who have lost loved ones by a xenophobic police force simply because they are the ‘wrong’ colour. Shame on you America on Wed Jul 13th 2016 at 05:01:23 Afrofem @Zoe Jordan Please beg your boyfriend’s sister to reconsider. The US is in a scary place right now. Canada might be a safer destination. on Wed Jul 13th 2016 at 10:32:23 nomad Bears repeating. on Wed Jul 13th 2016 at 14:26:41 Herneith You may be right: https://www.thestar.com/business/economy/2016/07/12/how-canada-may-actually-benefit-from-brexit.html I would rephrase that to; ‘Shame on white America’! Black Americans are recipients of their dastardly acts. Kudos Black America, you have my unequivocal support. @abagond and v8driver Thanks. I suspected as much. But for a while I was thinking Castile was a passenger. I remember I had the same problem with this. http://cdn01.cdn.justjared.com/wp-content/uploads/2016/06/shooter-wife/omar-mateen-orlando-shooting-called-911-01.jpg http://a.disquscdn.com/get?url=https%3A%2F%2Fi1.wp.com%2Fbreakingbrown.com%2Fwp-content%2Fuploads%2F2016%2F06%2Fshooter1.png%3Fw%3D720%26quality%3D80%26strip%3Dinfo&key=INM8OQVWo5EEiah850W6MQ&w=800&h=647 Speaking of which, we’ve got to discuss the Dallas shooting as a possible false flag of the same order. on Wed Jul 13th 2016 at 21:14:57 Zoe Jordan @ Herneith. Not really. You have many black people in influential positions in the U.S. not least of all your very own president. I know Obama went to Dallas straight after the shootings there (as he should) but how many of the recently murdered black peoples families has he visited? ‘We are not as divided as we seem’! http://www.nytimes.com/2016/07/13/us/politics/obama-dallas-attacks-speech.html?_r=0 Really Obama? Really?? on Wed Jul 13th 2016 at 21:23:26 Solitaire @ Zoe Jordan Herneith is Canadian. Sorry Herneith, my mistake. However I still think my point is valid. I also ought to make it clear, I am white x @Jordan: I stand by what I wrote. Sure there are shuck and jive artists in the States, Judas goats. I stand with my fellow Blacks! Except the kerchief heads. I don’t have any ‘leaders’ regardless of their political stripes, they are not ‘mine’. on Thu Jul 14th 2016 at 17:16:05 Linda Wowww, Kiwi…. your first comment on this post and you hit the nail right on the head about the most important thing: black people who can’t tell the difference between different ethnic groups. because after seeing her boyfriend shot to death… for Diamond, the priority was to make sure she could tell the difference between a Chinese or Mexican person with Native American features yep, as you mentioned, she sure f’cked that one up (oh yeah, Kiwi – I’m sure you meant to say “RIP Philando” first but it slipped your mind in your haste to make a comment) back to the main topic at hand I wish Mexicans would stop calling themselves “Latino” and start calling themselves “Native Americans” then black Americans won’t be confused when they actually see a Mexican with Native American ancestry and won’t accidentally call them “Asian” (because as we know, Native Americans don’t look like any ethnic group from Asia at all) hopefully, the next witness to a police shooting gets the Ethnicity or Nationality of the cop right…if not for society, then just for you, Kiwi 🙂 can’t keep falsely identifying people — that just leads to stereotypes kind of like how officer Yanez thought Philando looked like the other black guy who robbed the store because of his wide nose – but we can rest in peace, Philando got shot for the other black man’s crimes — justice was served, right Kiwi I like how you are sticking to the topic here… good Job! (and by the way, in all seriousness Kiwi – I’m not mad at you – but even you know you are dead wrong for keeping up this BS) The picture that is in my previous comment is officer Jeronimo Yanez on Thu Jul 14th 2016 at 18:12:34 Origin Yup. Latinos can belong to any of Americas other racial classifications in addition to being Hispanophone. Mexicans are more likely to look European or Native while Caribbean Latinos like Cubans, Dominicans or Puerto Ricans tend to occupy the African/European continuum. (Now that Cuba is open Americans are probably going to be very surprised how “black” it is!). Castile’s girlfriend couldn’t divine Yanez’ ancestral homeland. She was just trying to get across what he looked liked after having watched her boyfriend’s murder. Origin, I was being totally sarcastic in my post to Kiwi I thought that would be evident, that’s why I didn’t add a disclaimer and I agree, people in the USA will be shocked at how “black” Cuba really is funny enough, I have friends from east/central Europe who moved to south Florida, and were shocked to discover that the Cubans in Miami were “white” they were used to seeing black Cubans visiting their countries when they were still part of the communist Eastern Europe I wasn’t contradicting you at all. I knew exactly what you meant. No worries. on Thu Jul 14th 2016 at 19:11:10 TerryC here is avideo about the 2nd amendment & racism (http://www.youtube.com/watch?v=qGtuH22pWtk) on Mon Jul 18th 2016 at 11:35:04 nomad Another cop murder: http://www.11alive.com/news/local/midtown/apd-cop-who-killed-man-didnt-know-his-skin-color/271655565 on Mon Jul 18th 2016 at 18:32:47 Afrofem “…didn’t know his skin color”. What a crock! on Mon Jul 18th 2016 at 18:35:18 taotesan I had been listening all the comments on the Alton Sterling thread, too. I am very sorry for Alton Sterling and his family and community. I am also very sorry that Philando Castile had lost his life in front of his little girl. And his girlfriend, for having the presence of mind under such harrowing circumstances.The post –traumatic stress disorder and complex traumatic stress disorder this child would inevitably suffer from…. I had been hesitant in commenting on the modern day lynching of the Philando Castile and Alton Sterling. At this moment, I would like to express my solidarity and thoughts, esp. to Mary Burrell. Also, to all commenters and readers who were affected by this terrible tragedy. Sadly, and very predictably their deaths will not be the last of the police murders. There was a very visceral feeling of sadness and controlled anger all the weekend reading Abagond’s Blog. Why should I, across the Atlantic ocean, far away, feel so affected by it? After all, am I not desensitized to violence as many South Africans are? I have witnessed and had violent crime committed against me by the state and by white and Black people. Alton Sterling’s and Philandro Castile’s deaths had started important conversations in South Africa. There were demonstrations outside the USA embassy in support of Black Lives Matter. Over the last few decades, the cultural export of negative images of Black Americans have become mainstream overseas in the same way negative images of Africa has been implanted in the American mind. I have been more informed by Abagond and the many insightful comments than by the mainstream press, which one just has to turn off. It was distressing to see the reaches of propaganda even on Al-Jazeera. Watching Barack Obama smiling with the ‘men In blue” just left me cold. Re: Barack Obama- what can one expect from a man who drones Pakistani children? Do you know they are called ‘bugsplat’? The one consolation is that a coward dies a thousand deaths. From the slave patrols to lynchings to Jim Crow to Alsatians and water hoses on protesters in Birmingham to COINTELPRO to mass incarceration of young African American men combined with modern lynchings and all other manner of Civil Rights undermining, white supremacy in the USA has been transmuted from one beast into another. The more things change, the more they stay the same. @taotesan ” There were demonstrations outside the USA embassy in support of Black Lives Matter. “ Thanks for sharing that bit of information. Few, if any American “news” outlets covered international response to the constant stream of murders by police. I also thought about the deep, deep post traumatic stress that the child in the car with Philando Castile will suffer for the rest of her life. No child should have to witness such ugliness. ◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎◎ “…a coward dies a thousand deaths.” Each one will be deserved for the coward in question. Glad you shared your thoughts and feelings, taotesan. @Afrofem Yeah. Wonder if he knew what color neighborhood he was in? One where SOP is to approach ‘suspects’ (victims) with guns blazing? Because you know the lives in this neighborhood don’t matter? on Tue Jul 19th 2016 at 00:10:57 Afrofem So true. None of the lives in the entire neighborhood matter. ‘Might as well shoot. There are no consequences for me as a police officer. Wrong person? Oh well. My motto is shoot first, ask questions later.’ Didn’t know about this one either. Guess it’s only the ones caught on camera that catches our attention. No pix? Didn’t happen. “The Revolutionary Black Panther Party will hold an armed march against genocide in St. Louis, Missouri, an open-carry weapons state, on August 5, to honor Angelo Brown, also known as General Houdari Juelani, the local party leader who was shot dead by police in nearby Belleville, Illinois, last month. The party also plans “to file human rights violations with the International Criminal Court and the World Court,” according to Chief General in Charge Dr. Ali Muhammad. Juelani died from a single bullet to the temple, but his face showed signs that he had been beaten before death. “Every time he was out he was harassed” by the cops, said Dr. Muhammad, a neurologist. “They assassinated him.”” Guess that’s why Miriam Carey, shot in essentially the same way as Walter Scott, fleeing and at that point no threat to no one. On the Washington mall no less. Yet her case did not stir the same kind of outrage. No pix? Didn’t happen. on Tue Jul 19th 2016 at 15:08:03 Linda Kiwi @ If someone were attacked and misidentified their assailant as “Black” or “Muslim”, they would rightly be called out as a racist. Kiwi, that’s a bunch of BS and you know it … why are you wasting everyone’s time with your ignorant blah blah blah and Kiwi … Thank you for showing what a child you are because you got your feelings hurt by GroJo and can’t seem to get over it. I hope your wounds heal soon but in the mean time, if you really wanted to – you could once again start adding value to the conversations and stop bringing up irrelevant sh’t that has nothing to do with the topic on Tue Jul 19th 2016 at 16:08:03 gro jo Linda, why are you blaming me for Kiwi’s bs? All I did was to bring out what was already there. on Tue Jul 19th 2016 at 16:17:01 Fan ... @ Taotesan “Over the last few decades, the cultural export of negative images of Black Americans [to African minds] have become mainstream overseas in the same way negative images of Africa has been implanted in the American mind. ” I wasn’t fully aware of the size of the African to African American disconnect until recently. It was something I read, or heard, from another Black man, Dr Sebi, a nutritionist and herbal doctor . I can’t begin to express the anger and sadness over the WEDGE we’ve permitted the enemy to use to continue to divide and separate us from each other. on Thu Jul 21st 2016 at 18:38:57 nomad This is how they do it in France when police murders black man. (https://youtu.be/4RJf85uike4) on Thu Jul 21st 2016 at 18:44:23 abagond @ nomad In the US, since at least the 1940s, most Black riots have been set off by an act of police brutality. “We know if things don’t burn nothing will come of it. That is how we feel.” Sounds like 1960s America. (https://youtu.be/M99nzyiS830) I guess you’re still choosing to be an a/shole with no real rational arguments… you just want to have the last word no Kiwi — I want you to stop saying stupid sh’t I miss the Kiwi that made rational comments and added value to the blog it would be nice to have him back. Exactly… being attacked is NOT an excuse to become a racist troll which is what you are indulging in because you feel like you were attacked by black commenters on this block and you got no support from anyone I see through all your smokes and mirrors Kiwi – you aren’t fooling anyone but yourself at this point, you are throwing any and everything against the wall to see what sticks… throwing out random premises and answering them yourself… does not foster discussion, nor does it make you a righteous soldier if you no longer have intentions of having an honest discussion with people, why are you still here and what the h’ll are you trying to achieve? Kiwi… who the h’ll cares about 9/11… but I’ll play you’re stupid game: please describe how Diamond describing the Yanez as “Chinese” is racist? and lets keep in mind what the going definition of racism is, based on the western academics that we were all educated in: rac·ism ˈrāˌsizəm/ prejudice, discrimination, or antagonism directed against someone of a different race based on the belief that one’s own race is superior. http://www.oxforddictionaries.com/us/definition/american_english/racism so, please enlighten all of us just how Diamond displayed “racism” (and also keep this in mind when you respond back to me… even though you have been saying the dumbest sh’t for the last few weeks, trying to play the “tit for tat” game by equating black people with white people because you are mad at black commenters I still don’t believe you are racist… wounded animals lash out all the time) did I bring up 9/11 or is this post about 9/11? why are talking about 9/11 attackers… what the h’ll does that have to do with the question I asked you? you made a statement that Diamond was racist for describing Yanez as Chinese– so now back up your hypothesis (take a sh’t or get off the pot, Kiwi) So, Kiwi I guess with that BS statement… you decided to wipe your a’s with some toilet paper, so you can get off the toilet I’ll lay a rose on the grave of the former Kiwi I’m not interested in this new personal… ciao I certainly don’t give a sh’t about anything your saying right because it’s all pure, utter, irrevocable bullsh’t you haven’t answered my question.. which was in response to your original statement… on the topic of Diamond Reynolds– Philando Castiles girlfriend why are you now talking about everything under the sun, except for Diamond and Philando are you having fun… because I know you realize you are having a discussion with yourself? you are making statements and discussing “said” statement with and by yourself you obviously aren’t interested in being serious but keep going… you obviously need the human interaction online on Fri Jul 29th 2016 at 00:11:32 Solitaire So you don’t see a difference between (1) a direct victim of a crime making a mistake when trying to describe the appearance of the assailant (2) people who were not at a crime scene and who did not see the assailants junping to conclusions about what the assailants’ race must be due to the nature of the crime? on Fri Aug 5th 2016 at 22:21:10 gro jo “This case only proves to me that Chinese are in fact being scapegoated for police brutality, as I’ve been saying all along.” You know Kiwi, I agree with you. If that bastard, Peter Liang hadn’t gunned down Akai Gurley for no reason, Reynolds wouldn’t have made the mistake of ethnic attribution she did. Why do you flatter me so shamelessly. Show a little originality. on Sat Aug 6th 2016 at 01:15:56 Herneith http://www.independent.co.uk/voices/philanto-castile-gun-police-officers-black-lives-matter-right-to-bear-arms-wrong-skin-colour-alton-a7130471.html on Mon Aug 8th 2016 at 20:52:16 Linda what Kiwi really said to Linda with his last response: blah blah blah, I have nothing of real value to say anymore because I am now the new troll on Abagonds blog Linda responds to Kiwi: Yawnnnn, did you speak… the nothingness of your words was very deafening and blinding? Kiwi responds: Oh my God, now black people believe Asians should all get tickets for texting and driving…black people are sooooo racist!! (see Kiwi, I can be childish too… it’s fun sometimes isn’t it) and by the way, mimicry is not a response or an answer the way the game of “tit-to-tat” is played is: since I asked my question FIRST — then you respond second to my question; Then you get to ask me your question (no matter how Left field it is) “Although Castile had been stopped 46 times, only six of those were for offenses that an officer could have seen before stopping the car.” So 40 times he was stopped for no reason at all – except, presumably, for driving while Black. https://www.theguardian.com/us-news/2016/aug/09/baltimore-police-department-justice-department-investigation-findings on Thu Aug 11th 2016 at 16:43:29 Origin It’s ridiculous and depressing. It’s really as if he was stalked and finally killed. on Thu Aug 25th 2016 at 20:28:51 Linda no darling Kiwi that whole paragraph is all YOU…. only you believe those things and that’s why you come here and say them – so you can share your new “racial” views your issues and resentments against black people are clouding your view and judgment good luck with your new comedy schtick called “black people are just white people with dark tans” on Fri Jun 16th 2017 at 21:42:37 resw The racist white supremacist officer Jeronimo Yanez was cleared on all counts. Where are all the black Democrats and the good white liberals working to eliminate the fake “feared for my life” defence codes that keep racist murderers out of prison? on Fri Jun 16th 2017 at 23:21:47 Mary Burrell So the murdering cop was acquitted black lives will never matter. Black people are not considered human. I am not surprised at the outcome it’s always the same murdering thugs with badges kill with impunity. I am sick to my stomach right now. Rest In Peace Brother Castille. on Sat Jun 17th 2017 at 00:18:41 michaeljonbarker The news made me nauseous as well. R.I.P. Philando and deepest sympathies towards his girl Diamond Reynolds and close family. on Sat Jun 17th 2017 at 09:20:45 Mack Lyons (@DDSSBlog) A predictable outcome, all things considered. Funny how a black man’s life is worth nothing in this country, but his labor is worth more than gold. A great summation of slavery, if you ask me. on Sat Jun 17th 2017 at 18:06:30 Origin What can one say really? We’d all have been very surprised by a guilty verdict. Our perceptions and understandings are validated over and over again. Black lives do not matter to others and we should accept this. Acceptance that is, cognizance as prerequisite to responding appropriately, not defeatism. Instead of being infected by that atmosphere and viewing each other with contempt our reaction should be one of rebellion against it. That is, we must matter to each other as we all face the viciousness of racism whether overt or covert. That is the only equation we have to solve as only our own arms will save us. Some pray to Jesus but even he says “The Kingdom of God is within YOU” [Luke 17:21]. Even in the old testament there are curious verses like Psalms 82:7: “You are gods and all of you are sons of the Most High. Nevertheless you will die like men and fall like one of the princes”. The human, as the most complete material manifestation of the divine forces, is something accepted as a given by many ancestral cultures. [It seems likely that this would be adopted, and likely warped in meaning, by younger people] He/she is seen as the means by which the divine involutes into its own creation much as you do when you involve yourself in your own dream by creating an avatar to experience it. That one is both you and not you. Just as Jesus is both the father and not. In that view he is a model, a picture, of you. His very name means “Jah is salvation” while Jah is the “I am”, the spiritual force of existence and consciousness. The one thing you are absolutely sure of is that you exist. You are your savior. While historically, the orthodoxy has fought against “heretical” esoteric interpretations of Jesus’ words I suggest that such an empowering view is the only one valuable to Christianized Africans facing the trials of the present season. That way we won’t sit around waiting for salvation to appear in the shape of a blond-haired, blue-eyed white man but will act to realize a victorious vision confident that once the spirit has been aroused with the will we’ll see success. That’s my personal approach to going after what I want in life anyway, even in the face of obstacles. Mourn at the injustice but don’t let your spirits be broken. Take care of yourselves everyone. on Sat Jun 17th 2017 at 19:24:24 Afrofem @ Origin “Black lives do not matter to others and we should accept this.[…] …our reaction should be one of rebellion against it. That is, we must matter to each other as we all face the viciousness of racism whether overt or covert. That is the only equation we have to solve as only our own arms will save us.[…] Sometimes Black people forget that when they are (mostly) united, focused and willing to persevere, White people and their allies are forced to make transformational changes. They will play mind games on an industrial scale to keep Black people from acting. They will brandish fearsome weaponry to keep Black people from acting. They will stuff Black people into cages (mass imprisonment) and shatter our families (foster care system) to keep Black people from acting. Yet, only when Black people are finally ready to create and act on that “victorious vision” will the path to through the artificial obstacles of anti-Black racism become clear. I agree that the first step is acceptance of the fact that Black people’s lives do not matter to anyone but themselves. The second step is the realization that the White Power Structure (WPS) and its allied forces are not invulnerable. There are several points of weakness where Black people can exert enough pressure to not only stop current actions against them, but to make long lasting changes. The response will be an increase in formal and informal violence against Black people because that is the primary tool of the WPS (and to paraphrase Maslow, “when all you have is a hammer, everything looks like a nail.”) Yet, Black people already live in an era of ever increasing violence against our community members. There is already a chorus of White and allied voices telling Black people that non-violent resistance against WPS violence is violence(is that Orwellian or what?). According to those voices, Black people should just accept the murder of our people with passivity and silence. To do otherwise, would lead Black people to upsetting the carefully stacked racial hierarchy that benefits White people and their non-Black allies. I think Black folk should move forward with a Sankofa awareness that anything they do will not only be fiercely fought in the present moment but the WPS will seek to undermine any concessions to Black people in the future. Black people must also accept that the struggle will be multi-generational and that the forces arrayed against Black people will continue their depredations well into the future. https://www.berea.edu/cgwc/the-power-of-sankofa/ Origin, that “victorious vision” you write of must be clear, broad and deep. It must be imbued with spirit. Some Black people love the supine position of most of all. They will always choose White over all other. on Sun Jun 18th 2017 at 00:44:17 michaeljonbarker Valerie Castile makes a powerful statement about the murder of her son. (https://youtu.be/tsTGh8JoIEA) on Sun Jun 18th 2017 at 04:22:20 Afrofem @ michaeljonbarker Thanks for sharing that video. I agree with Mr. Castile’s mother that Black people are just the first to suffer. The system (WPS) will go after others in the near future. on Sun Jun 18th 2017 at 15:03:03 Mary Burrell “The state of Minnesota killed my son” Mr. Castile’ is correct the state of Minnesota allowed a murderer to go free. This murdering animal killed a man who obeyed his commands and Mr. Castile told him he had a gun. Yet this cowardly piece of human feces fired his weapon into their car with an unarmed woman and a young child in the back seat. Jeronamo Yanez is a monster. Even though he was fired that will not placate the people and family of Mr. Castile. I guess the family of Mr. Castile will sue the police department or the city and they will get some type of financial restitution, but no amount of money will bring Mr. Castile back. I was on a couple of mainstream media sites and in the comments the hateful and vitriol was outrageous. It’s true that black Americans need to accept our lives mean nothing and we are not even considered human. Mr Castile’s mother^^^^^^^typo on Sun Jun 18th 2017 at 17:52:38 Solitaire http://www.cnn.com/2017/06/17/opinions/philando-castile-verdict-is-too-familiar-jackson/index.html …What’s even more compelling is that Officer Yanez appeared unhinged in the viral Facebook Live video. Even after firing the barrage of fatal shots, Yanez stands outside the car, with his gun still trained on a bleeding and dying Castile while yelling hysterically: “I told him not to reach for it. I told him to get his hands open.” Contrast this with Reynolds’ calm and composed demeanor, while she addresses Yanez as “sir,” and reminds him that what he asked Castile to do was produce his driver’s license…. Yanez is the only one who appears to be hyper and out of control. Reynolds is respectful and polite — despite witnessing her boyfriend dying before her. Even her 4-year-old daughter is more composed than Yanez, as she reassures her mom by saying “it’s okay, I’m right here with you.” Isn’t it the officer who is supposed to be trained and experienced in these encounters? Isn’t it the officer who takes the oath to protect and serve? Isn’t it the officer who must adhere to that oath by exercising good judgment and self-control? Isn’t it the officer who should be calm, steady, even tempered, composed and courteous? What does it say when a civilian is more level-headed and restrained than law enforcement? Worse, what does it say when a 4-year-old has to calmly sooth and reassure her mom after witnessing an officer lose his composure. Should we expect children to be more reasonable than a man with a badge and gun? @Solitaire: 10000+ Why didn’t those stupid jurors see that. What were they thinking to produce this outrageous verdict to let this monster Yanez go free? on Mon Jun 19th 2017 at 07:21:05 Origin Thanks for that Afrofem. On another note, youtube comments on videos related to this might induce all manner of severe diseases. You have people still trying to justify Catille’s murder just because he was black. I appreciated Valerie Castille’s honesty though. Unfortunately, the verdict did not surprise me one bit. The police dashcam video has just been released. Already burned into my brain as part of What America Is. on Fri Sep 1st 2017 at 20:55:21 Psalms - By Their Strange Fruit […] 4 – #DelrawnSmall July 5 – #AltonSterling July 6 – #PhilandoCastile July 7 – #DallasPoliceShooting Every day laid a thick new layer of grief, fear, frustration, […] on Tue Oct 24th 2017 at 03:00:14 Afrofem Philando Castile’s family and friends set up a fund to help the children Castile cared for everyday in his job as a nutrition services supervisor. The fund continues his work of helping all children to have access to lunch everyday. According to Think Progress, the fund started with a goal of $5000.00 and ended up raising more than $72,000.00. The article states: “Pamela Fergus, a psychology professor at a community college in Minnesota launched a fundraiser called “Philando Feeds the Children”, which was created to honor Castile’s memory. The funds are being used to pay off several thousands of dollars worth of school lunch debt accrued by students at J.J. Hill. “[Castile] supervised their food program and interacted with the kids every day. He knew their names and their diets. He LOVED his job!” Ferguson wrote on the fundraiser’s YouCaring site. “Philando’s death affected every one of those kids. This fund hopes to provide the kids with a lasting connection to Mr. Phil.” The fund also seeks to stop the practice of “lunch shaming” where children whose lunch accounts are past due are singled out for humiliation by cafeteria staff. The article describes lunch-shaming: In one particularly eregerious instance of lunch-shaming, a Santa Fe woman working the cash register at a local school’s cafeteria told a 4-year-old girl whose parents had missed her lunch payments that she had no money and threw the girl’s lunch in the trash. Some states have taken preventative measures to halt lunch-shaming practices. California and Texas have both passed legislation that bans schools from shaming children — either by tossing their meals in the trash, making them wear identifying labels noting their debt, making them do extra chores, or giving them alternative meals — who don’t have the ability to pay for food. https://thinkprogress.org/fundraiser-philando-castile-school-lunch-debt-aa4d64a06f94/ The US is an extremely wealthy nation where the children of working people are humiliated in lunch rooms and forced to rack up debt while money is wasted on weapons systems that don’t, can’t and will never work. I found an article that shows that compares US school lunches to school lunches in other countries. I posted it on the Open Thread: https://abagond.wordpress.com/open-thread/comment-page-1/#comment-382760 on Tue Oct 24th 2017 at 10:52:41 Mary Burrell @Afrofem: That’s so horrible that a young child if they are poor and their parents can’t afford to pay for their lunch get shamed. I feel this system that oppresses the poor and disenfranchised is deliberate. How are young children supposed to perform efficiently in school? So the babies are hungry and they can’t learn because they are hungry. This is so shameful and heartbreaking. on Tue Oct 24th 2017 at 11:08:08 Solitaire That was the whole point of the free and reduced lunch program, to keep the kids from being too hungry to learn and to concentrate!!! @ Mary Burrell Especially when there is enough money in this country to ensure a nutritious lunch for every single child in school. @ Solitaire Many of the children whose parents fall behind in payments are either just above the income threshold for reduced lunches, don’t know they qualify or find the paperwork overwhelming. Philando Castile was beloved by the children and staff because he cared about the children. He knew their names and diets. He was also known for paying for children’s lunches out of his own pocket, when the need arose. He was a true asset to society. @ Afrofem Right, I see what you’re saying. If a child was already getting lunches entirely free, presumably their account would not come up showing any payment due. And in addition to the points you made above about reduced lunches, some families who qualify may still struggle to pay that reduced amount every week or may have times when unexpected expenses like car repairs squeeze their finances too tight. I guess the point I was trying to make is the principle ought to remain the same. A hungry child isn’t prepared to learn. And a child who has been publicly shamed on top of that is going to be very upset, which makes it even more likely they won’t be able to concentrate. I cannot imagine doing such a thing to a four-year-old. That’s a baby! They aren’t going to understand! And to throw away the food sends such a mixed message about the value of it, like the money is somehow more precious!! I’m sorry, this is the first I’d heard of lunch-shaming, and I’m outraged almost to the point of incoherency. Yes, he was. His death was a great loss to society. People like him make such a huge impact on the lives of children. Jobs like his don’t get much respect in society, but the truth is that someone with a caring heart like his does more good in one day in a school cafeteria than most of the rich fat cats do in their entire lives. on Wed Oct 25th 2017 at 00:18:49 Afrofem “I guess the point I was trying to make is the principle ought to remain the same. A hungry child isn’t prepared to learn.” My mom was a teacher and always kept snacks in the classroom for her students. This was before free and reduced price lunch programs. During the holidays, she would also cook a full meal for her students, haul it to the classroom and send them home with leftovers. In the current climate of fear, disrespect (for teachers and students) and frivolous litigation, she would be prohibited from that level of caring for her students. I feel fortunate to have seen that level of devotion on the part of a teacher. I still remember how her former students would thank her years later when they met her in public places, for believing in them and showing how much she cared about them. “…to throw away the food sends such a mixed message about the value of it, like the money is somehow more precious!!” Yes, a child’s first lesson that profit is more important than people. Reminds me of the line in the Guanahani post: “They were looking for yellow gold, which they worship.” https://abagond.wordpress.com/2017/10/09/guanahani/ Our society still kneels at the altar of yellow gold. on Wed Oct 25th 2017 at 01:26:00 Mary Burrell Throwing away food is so wasteful treating children in this horrific manner. I have never heard of this before either so the system starts in on the babies by starving them so they perform poorly. on Wed Oct 25th 2017 at 02:11:16 Solitaire Your mother sounds like a wonderful person and role model. I don’t remember any teachers feeding students, but I do remember them discreetly collecting hand-me-downs and buying underclothes for very needy families. A lot of us wore hand-me-downs so that wasn’t a big deal, but those exchanges usually took place within family or neighbor networks. There were a few families who didn’t have those networks and/or whose need for clothing went beyond those resources, so the teachers stepped in. And it was done discreetly; I only knew about it because my family was one of those the teachers typically asked, and I remember as a kid being admonished to keep it a secret and not shame the children of the recipient families. I could go on and on about teachers. So many of them spend their own money one way or the other on their students, and they don’t get paid enough to begin with. ” teachers…many of them spend their own money one way or the other on their students, and they don’t get paid enough to begin with.” Yes. One great teacher at the top of their game is worth more than ten bankers. In Texas, at least, a law was passed to ban lunch-shaming. That is a good first step. @That’s good to know but this lunch shaming shouldn’t be happening anywhere. Throwing away food is reprehensible. @Afrofem: Your mother sounds like a lovely lady. on Thu Oct 26th 2017 at 04:30:07 Afrofem She was a complex figure with good, bad, ugly and beautiful aspects—–like all other humans.	cc/2020-05/en_middle_0126.json.gz/line795
__label__cc	0.584073	0.415927	- Grant Williams Podcast: May 9, 2019 https://ayne.podbean.com/mf/play/ye8uzm/AYNE_0029.mp3 Today, much of what sport has always meant to true fans, has been lost in a blizzard of corporate communications, fireworks and froth. The attachments, that were once so strong, seem more trivial in the global age of televised sport as entertainment. What was once authentic, is increasingly staged. In this podcast, we’ll get back to the things that sport has always meant to true fans. Episode 22: Grant and Roger welcome world class, and very erudite, cricketer Chris Cairns for a very honest conversation about played sport and the directions he sees in the business of sport. This chat strongly reveals the linkage among sport, life and business. And in a very honest, direct and pragmatic way. Chris firstly discusses how he has dealt with being the son of a great sportsman. He then talks the future of New Zealand sport, Allblacks and CVC; what takes a sportsperson to elite level: the culture of failure; inside stories of great all rounders; Miller and the Don; Christchurch and the role of sports. He then tells us about a very personal story on matchfixing; how he managed to deal with it and move on; finally, his beautiful present as an entrepreneur: Chris talks about the future of sport content and how he would like to add value to minor sports through rendered virtual worlds.	cc/2020-05/en_middle_0126.json.gz/line802
__label__wiki	0.713199	0.713199	Climb Information Why We Climb only 32 days to the climb! March 1, 20208:00 a.m. One Kansas City Place Kansas City, MO (view on map)42 Floors and 902 Stairs Leslie Hernandez Brownkcclimb@lung.org913-353-9166 Together We've Raised… We've Raised: Our Goal: $210,000.00 Every Step Counts Step up and make a positive impact for lung health by participating in a Fight For Air Climb event. Raise funds and challenge yourself to support the American Lung Association's mission while climbing the 42 Floors and 902 Stairs of the One Kansas City Place. You can do it and we'll help you every step of the way! Whether you're climbing alone or with friends and family, for a healthier lifestyle or in honor of all those who are affected by lung disease, you'll feel victorious when you reach the top. Defeating the physical challenge and reaching the height of your fundraising potential will be a gratifying experience, and one that provides hope for millions of people. Every Step Counts as we unite in the fight for healthy lungs and clean air! Register today and we'll help you reach your goals – from the first step in your Climb experience all the way to the finish line. Along the way, think about all the people you're helping, and remember: we're climbing for hope because they're fighting for breath. Contact us with questions or for more information. Register Today Donate Now What is a Fight For Air Climb? One of the American Lung Association's signature fundraising events, Fight For Air Climbs are stair climbs held in prominent skyscrapers around the country. Climbers join friends, family, co-workers or even fly solo, climbing the stairs of the building to the top! Over the last several years, our Fight For Air Climbs have raised more than $53 million to support the mission of the American Lung Association. More than 27,000 participants from 42 Climb events across the country came together last year to raise more than $8 million. This year, you can join the challenge and raise money to help provide life-saving lung health research, patient education and public policy efforts. The Fight For Air Climbs vary in the number of stairs to climb, but each event offers an opportunity for teams and individuals to challenge themselves. And every step you take moves us forward in our fight for healthy lungs and clean air. Are you ready to help make Every Step Count? Register Today Donate Erik Lund - $3,754.00 Michael Filing - $1,218.00 Alex Wilson - $1,098.00 Bert Maidment - $1,008.00 Kelsy Burton - $875.00 Sara Prem - $785.00 Margaret Cox - $707.00 Russ Everhart - $675.00 Andrew Silins - $614.00 Rachel Cox - $595.00 Jones LUNG LaSalle - $4,307.00 Empower Retirement - $2,023.00 UMB Climb Squad - $1,973.00 TEAM BERT - $1,699.00 Southsiders - $1,496.00 Certified Radon Action Awareness Month - $1,341.00 Wolfpack - $1,233.00 Gladstone Fire/EMS - $1,158.00 Affinis Corp - $873.00 BHC RHODES - $859.25 Fight For Air Climb - Kansas City Building Sponsor National Climb Partner for Healthy Air © 2020 American Lung Association \| Fight For Air Climb American Lung Association, 55 W. Wacker Drive, Suite 1150, Chicago, IL 60601 T: 1-800-LUNGUSA \| Contact Us	cc/2020-05/en_middle_0126.json.gz/line803
__label__wiki	0.94512	0.94512	Displaying items by tag: Holyhead Adrenaline Junkies Will Love The All Wales Boat & Leisure Show 2020 Wales’ largest indoor watersport event takes place at the Anglesey Showground in Holyhead on 29-30 May next year. The All Wales Boat & Leisure Show will feature the finest of personal watercraft and active watersport in a region that hosts some of the world’s best coastal waters and coastline, lakes, white water rivers and gorges. The show connects together industry leaders in boat and leisure products and services across Wales, with not only watersport and boating enthusiasts but all those that have a passion for the great outdoors. Discover a huge range of exhibitors, show events and activities where you can have a go, too — it’s a must-visit for boat owners, watersport lovers or families looking for a great day out. Tickets are £10 for adults, £5 for children (under 4s free) and £20 for families, and also give access to the Anglesey Food Festival, Bangor Science Festival and Festival of Discovery. Published in Watersport All Wales Boat & Leisure Show Port of Holyhead ‘Relaxed’ about Brexit, British-Irish Assembly Hears #ferries - The Port of Holyhead has shown “no sense of emergency” about Brexit, while Dublin Port bemoaned the huge expense preparing for a no-deal exit that might not happen, the British-Irish Parliamentary Assembly heard. As The Irish Times writes at the biannual gathering of Irish and UK parliamentarians heard details of a report from one of its committees on a visit to the two Irish Sea ports by a delegation from the assembly to assess preparations for Brexit. The committee painted a contrasting picture on preparations being taken in Dublin and Holyhead. Darren Millar, a Conservative member of the Welsh national assembly, said that Dublin Port officials expressed concern about the number of customs officials that still needed to be hired to deal with a potential no-deal Brexit. “Our biggest concern was that there was huge effort and huge expense going into these things and they may not be required,” he said on Tuesday, the second day of the assembly at Druids Glen in Co Wicklow. Further reading on this story can be read through this link. Published in Ferry Port of Holyhead Under threat from Breakwater Erosion #ferries - BBC News writes that action is needed to repair damaged Victorian sea defences protecting a Welsh port, experts have warned. Anglesey council has been told the 1.7 mile (2.4km) breakwater at Holyhead - the longest in Britain - is suffering from erosion to its rubble mound base. Ferry company Stena Line which owns the structure estimated in 2013 that it was costing £150,000 a year in maintenance. Consultations and a public meeting are being held to support the case for Welsh Government funding for repairs. The Grade II-listed structure was opened in 1873 after 28 years of construction involving more than 1,300 workers. Anglesey council said the rubble mound on which the wall stands has gradually been eroded by the constant wave action and could be breached within 15 years. For more on this story click here. Breakwater Works Welsh Gov Trearddur Bay’s Myths & Seabird Half Raters To Cross Irish Sea For Dun Laoghaire Regatta #VDLR - Trearddur Bay Sailing Club brings its centenary year celebrations to Dublin Bay this summer as a number of its Myth class and Seabird Half Raters will be making the trip across the Irish Sea for the Volvo Dun Laoghaire Regatta. Myths are one of the original classes raced since the Holyhead club’s inception in 1919, with three of the 14-footers joining a fleet of five 12-foot Insects — three of the latter, the first boats built for the club, having been restored for the centenary. While no original Myths remain from those days, the open boat class has seen a resurgence in recent years, and a modern Myth fleet at Trearddur Bay has grown to over 40 vessels. Designed along the lines of the International 14 but inspired by what the club calls “a hotch-potch of ideas”, Myths are distinguished as much by their tight specification as their turkey red sails and either white-painted or varnished hulls that comprise five different types of wood. With the Myth class now in its 99th year, its lasting legacy is no doubt also connected to the boat’s particular suitability to the environment of Trearddur Bay — not to mention the absence of an age barrier when it comes to racing, as young and old can compete on equal terms. They are matched by the Seabird Half Rater — which was adopted in 1922 and is one of the oldest one-designs still sailing in British waters — at a club which currently has a strong dinghy scene with Mirrors, Fevas and Optimists among a full member list of more than 1,100 that sails every August. Due to the uniquely short season, Trearddur Bay’s members regularly sail and race at other clubs, so some of the contingent will likely be no strangers to the waters of Dublin Bay as they join the likes of Olympic medalist Mike McIntyre at the biennial regatta — and Ireland’s largest sailing event — from 11-14 July. The entry form for the Volvo Dun Laoghaire Regatta 2019 is available HERE. Early bird entry fees are available up to Sunday 31 March. Published in Volvo Regatta VDLR Trearddur Bay Trearddur Bay Sailing Club Seabird Half Rater Plan By Protesters to Go-Slow And Holyhead Port Blockade - 'Will Continue' Until Brexit is Resolved #ports - Plans for vehicle go-slows orchestrated by a north Wales man in protest at the UK Government's handling of Brexit are now expected to take place across the country. As NorthWalesLive reports, The Brexit Protest and Direct Action Group, which is led by Deeside man Ian Charlesworth, has organised a go-slow protest on the A494 on Friday , March 22. A second protest at Holyhead Port is also back on the agenda for this Saturday, March 23. The intention is to cause disruption to Irish wagons heading toward Holyhead Port along the A55 - a main trading route with the EU, which the UK is set to leave on March 29. For more including the political landscape click here. Published in Ports & Shipping Vehicle GoSlows Brexit Campaign No-Deal Disruption Says Brexit Minister at Holyhead Port 'Can Be Avoided' #ferries - There have been calls for the UK Prime Minister to remove the threat of a no-deal Brexit have been repeated by the Counsel General and Brexit Minister Jeremy Miles, following a visit to Holyhead Port. As ITV News reports, he met with the Port's manager, Captain Wyn Parry, who set out some of his concerns about operations in Holyhead if the UK crashes out of the EU without a deal. Welsh ports are the gateway between Ireland and the rest of Europe, with 80% of goods carried in Irish-registered HGVs between the Republic of Ireland and Europe passing through Welsh ports. Holyhead is the second busiest roll-on roll-off ferry port in the UK - providing the link in the supply chain for businesses across Wales, the UK and Ireland. To read a comment by the Brexit Minister, click here. Brexit Minister Holyhead Lorry Backlog Plan in Case of No-Deal Brexit #ferries - Parking sites in Anglesey, north Wales, could be turned into places for lorries to use in the event of a no-deal Brexit. The contingency plan, led by the Welsh Government, reports BBC News, has been drawn up in case Holyhead port is unable to handle traffic after the UK leaves the EU (see story: Dover truck test on trade exercise held earlier this week). It comes as MPs are expected to reject Theresa May's Brexit deal. The two sites on Anglesey are at the Roadking truck stop, near Holyhead, and land adjacent to the Mona airfield in the centre of the island. The plan has been drawn up amid concerns that additional border checks in the event of a no-deal Brexit on 29 March could lead to traffic problems at Welsh ports connected to the Republic of Ireland. In order to avoid disruption in that scenario, the UK government has said that it would minimise checks or simply waive through trucks from EU countries, such as Ireland. However, the EU has said it would impose full controls on people and goods entering the EU from Wales and the UK. For much more on the ferryport story (click here) including reaction from truck-drivers and politicians. Brexit Backlog Truck Park Plan Irish Fishing Vessel Rescued By Holyhead Lifeboat #Lifeboats - Holyhead’s all-weather lifeboat launched yesterday morning (Saturday 29 September) to the rescue of an Irish fishing boat adrift in the Irish Sea with mechanical failure. Pagers sounded for the Holyhead RNLI crew just after 8am following a distress call to HM Coastguard from the 10m potting vessel, which was some 21 miles northwest of Holyhead. On reaching the stricken boat, the crew on the lifeboat Christopher Pearce set up a tow for the slow return to Holyhead. In all the lifeboat was five hours at sea. Aafter ensuring all were well, the fishermen set off to return to Ireland on the next ferry, leaving their vessel to be repaired locally. Holyhead coxswain Tony Price said: “The casualty craft and her crew were well-equipped. It’s always a shame for any craft or persons in difficulty, but it’s particularly sad when a vessel is earning her living from the sea, and we wish our Irish fishermen friends a speedy return to normality after their misfortune. “I’d also like to send thanks to the local coastguard teams for helping with mooring the craft safely back in Holyhead.” Reality Check: Brexit Dilemma In Port of Holyhead #FerryNews- The locals in the north Wales Port of Holyhead call it hum: it's the sound of refrigeration units attached to lorry trailers waiting, 24 hours a day, seven days a week, for the next ferry bound for Dublin. This small town on Anglesey reports BBC News, lies at the heart of one of the poorest areas in the UK. But it is also the second busiest roll-on roll-off ferry port in the country, a vital link in a seamless supply chain for businesses across the UK and Ireland. Brexit, for which Anglesey narrowly voted in the 2016 referendum, could change everything. Why? Because at the moment this is the quickest route across the Irish Sea - the sailing time from Dublin to Holyhead is just over three hours. "At night-time," says Ian Davies, trade director for Stena Line, which runs Holyhead Port, "we have 400 to 500 articulated lorries coming off two ferries within 25 minutes of each other." For much more including photos click here. Enniskillen Lifeboat Rescues Two After Boat Breaks Free From Jetty During Storm Hector #RNLI - Enniskillen RNLI rescued two people on Lower Lough Erne after their 42ft cruiser broke free from its jetty during Storm Hector yesterday morning (Thursday 14 June). Belfast Coastguard requested the launch of the inshore lifeboat at 6.42am, with the volunteer crew proceeding north to the stricken vessel close to the shoreline south of Rossigh. With increasing winds through the night, the vessel had broken free from its mooring and some of the jetty was still secured to the boat. The winds were starting to settle but they were estimated to be Force 6 or 7 when launching from the Lough Erne Yacht Club. The lifeboat managed to refloat the vessel and brought it into safer water. The hire company then took charge of the cruiser with the lifeboat accompanying them to a sheltered location. “With challenging conditions this morning the crews training was put into action and brought the two people and vessel to safety,” said Gary Jones, Enniskillen RNLI’s lifeboat operations manager. Elsewhere, pagers sounded across the Irish Sea at Holyhead RNLI just after midnight on Thursday in the midst of the storm, with reports of an 18-metre yacht with mechanical failure west of the Skerries lighthouse off Anglesey. At the scene, the lifeboat crew found the 60-tonne vessel, with two on board, had lost all power and was struggling to cope with the weather conditions, including southerly gale-force winds and spring tides. The lifeboat undertook a tow of the stricken yacht, which was returning from the Isle of Man TT races back to her mooring at Holyhead. Both vessels arrived safely in port at 4.30am. Speaking on behalf of Holyhead RNLI, press officer Vicki Owens said: “The weather was unseasonably rough, but our dedicated crew left their beds to help someone in trouble.” The surprise Storm Hector was also responsible for blowing a yacht ashore on the Kerry coast, as previously noted on Afloat.ie. Storm Hector	cc/2020-05/en_middle_0126.json.gz/line807
__label__cc	0.593005	0.406995	Custom Animation Smugglers used power tools to breach Trump's new border wall animation, 3D, graphics, Next Animation, feature, sidebar, video, explainer, image, illustration, graphic, Donald Trump, Trump, new border wall, new wall, border wall, wall, power tool, reciprocating saw, smugglers, US-Mexico border, impenetrable, US, politics, For story suggestions or custom animation requests, contact [email protected] Visit http://archive.nextanimationstudio.com to view News Direct's complete archive of 3D news animations. RESTRICTIONS: Broadcast: NO USE JAPAN, NO USE TAIWAN Digital: NO USE JAPAN, NO USE TAIWAN According to the Washington Post, the new border wall President Trump is building features steel and concrete bollards up to 30 feet tall, and concrete foundation that deters tunneling. U.S. Customs and Border Protection tweeted on October 24 that it has built 75 miles of Trump's new border wall and aims to finish 450 miles by 2020. The Post reports that although Trump called the wall "virtually impenetrable," smugglers have been able to cut through with cordless power saws costing as little as US$100. They go through the resulting gap one at a time and often move the damaged bollards back in place for future crossings. U.S. officials confirmed that there have been multiple breaches, but added that smugglers targeted sections of the wall not yet equipped with electronic vibration sensors. The BBC reports that when it is completed, Trump's border wall will feature steel barriers, all weather roads, cameras, and other technology. According to the Washington Post, the wall has cost US$10 billion so far. RUNDOWN SHOWS: 1. Construction of border wall 2. Smugglers cut through new border wall with power saw 3. Vibration sensors being installed to deter cutting 4. The wall system and construction locations VOICEOVER (in English): "According to the Washington Post, the new border wall system U.S. President Trump is building features steel and concrete bollards up to 30 feet tall, and concrete foundation that defeats tunneling." "U.S. Customs and Border Protection tweeted on October 24 that it has built 75 miles of Trump's new border wall and aims to finish 450 miles by 2020." "The Post reports that although Trump called the wall 'virtually impenetrable,' smugglers have been able to cut through with cordless power saws costing as little as US$100." "They go through the resulting gap one at a time and often move the damaged bollards back in place for future crossings." "U.S. officials confirmed that there have been multiple breaches, but added that smugglers targeted sections of the wall not yet equipped with electronic vibration sensors." "The BBC reports that when it is completed, Trump's border wall will feature steel barriers, all weather roads, cameras, and other technology." "According to the Washington Post, the wall has cost US$10 billion so far." SOURCES: The Washington Post, BBC News https://www.washingtonpost.com/national/smugglers-are-sawing-through-new-sections-of-trumps-border-wall/2019/11/01/25bf8ce0-fa72-11e9-ac8c-8eced29ca6ef_story.html?fbclid=IwAR2Iu4kwbsuNdWtp0V8Q-u9MYiT5kHn00x22y2NF0XbrxRWtDZUTJ42CZSk https://www.bbc.com/news/world-us-canada-46824649 © 2018 Next Animation Studio Limited. All rights reserved	cc/2020-05/en_middle_0126.json.gz/line810
__label__cc	0.564294	0.435706	Best of San Francisco Sports & Recreation Best WTF Free Agent Sports Signing Aldon Smith Once famous throughout the league as a haven for misfits and rejects looking to resurrect their careers, the Raiders have for the last decade or more made an art from out of epically wrong personnel decisions. February 02, 2011 Calendar » Night&Day On Whirling Stages By Hiya Swanhuyser Wednesday, Feb 2 2011 It's impossible to exaggerate the scale of Busby Berkeley's work: This is the man who gave us hundreds and hundreds of “girls,” arranged kaleidoscopically, simpering in unison. No one and nothing has approached the choreographer's successes of the 1930s Warner Brothers studio musicals since; why try? Numbers such as “The Tapestry of Girls,” “The Fountain of Beauty,” and “The Human Waterfall” have many, many slobbering admirers including, in recent memory, the dream sequence in The Big Lebowski and the Magnetic Fields' song “Busby Berkeley Dreams.” On Thursday, the Busby Berkeley Bonanza offers a double feature to beat all double features: 42nd Street and Gold Diggers of 1933, two of those huge, sparkling, opulent, wisecracking features in their intended habitat: the big screen. Before the show, all tap dancers are invited to show off out front of the theater; prizes are in the offing and we pray everyone wears gold-colored shorts and marcelled blonde wigs. Today's double feature is Footlight Parade and Dames, a pair of the more rarely screened Berkeley treats. Author Jeffrey Spivak introduces both shows; his recent biography Buzz: The Life and Art of Busby Berkeley is the first of its kind. Tags: Night&Day, Highlights, Busby Berkeley, Jeffrey Spivak, The Magnetic Fields, Warner Bros. Entertainment Inc.	cc/2020-05/en_middle_0126.json.gz/line812
__label__cc	0.696947	0.303053	Artist Talk: Invisible Spaces of Parenthood This Artist Talk will highlight Andrea Francke and Kim Dhillon’s research into parenthood, childcare and Early Years Education through their collaborative open-research platform, Invisible Spaces of Parenthood. Art Talk previously on at Serpentine Galleries in Greater London, United Kingdom. From Saturday 24 October 2015 to Saturday 24 October 2015 Published by anonymous on Monday 12 October 2015. Andrea Francke and Kim Dhillon of Invisible Spaces of Parenthood will discuss their collaborative practice following on from their Changing Play residency at the Portman Early Childhood Centre. Influenced by the DIY culture of the Sixties and Seventies, Invisible Spaces of Parenthood takes Second Wave Feminist thought as a frame of reference to question the political, pedagogical, social and economic structures around parenting today. Beginning in Autumn 2014, Andrea and Kim undertook a residency at the Portman Early Childhood Centre, Westminster, as part of The Serpentine Galleries Changing Play programme. Inspired by the pedagogy of early years pioneer Friedrich Froebel and his influence on the Bauhaus movement, they worked with children, parents, carers and staff to use Froebel’s ‘Gifts and Occupations’ as an open-ended, non-gendered and inexpensive resource which supported intergenerational play. Andrea and Kim are in the process of producing Shapes; a kit for play based on a reworking of Froebel’s 7th Gift. Changing Play is the Serpentine Galleries three year project exploring aspects of play through long-term engagement with children aged 0-5, their families and the people who work with them. Free. No booking required. http://www.serpentinegalleries.org/exhibitions-events/artist-talk-invisible-spaces-parenthood Andrea Francke Kim Dhillon Serpentine Galleries	cc/2020-05/en_middle_0126.json.gz/line817
__label__cc	0.636167	0.363833	BEING A WOMAN AMONG MEN THIS WAY OR NO WAY WHY THAT TELEPHONE NUMBER WON’T DIAL ITSELF ALL STORIES / BLOG Copyright: The illustration is inspired by a story of the foundation of Alma Quattro, which has colored the grayness of everyday life with blue and gold. Illustrated by Iva Kujundžić. precision innovation entrepreneurship empathy THE BLUE&GOLD ROOTS OF DOMESTIC OOH Created: Feb 10, 2019 This is a story about Alma Quattro, the first out-of-home advertising company in Serbia founded in 1994, with an ambitious idea to be the light of the capital. THE FIRST LOCATION The first backlit billboard in Serbia “sprouted” in front of the Main Post Office building in 1994 “directed by” Alma Quattro. At that time, the idea of an out-of-home advertising provider in the country experiencing electricity supply restrictions, embargo and hyperinflation seemed, to say the least, unrealistic. However, today, almost a quarter century later, we celebrate those who were brave enough to envision, initiate, and persist in the realisation of the vision of illuminated advertisements. THE FIRST VISUAL The PVC poster for the first backlight in Serbia, installed for the first time in 1994. With blue, gold and with champagne, the “new dimension of advertising” was opened and the cornerstone for OOH in Serbia was laid. Fun fact: At that time it was impossible to print formats of this size and, therefore, this PVC poster “flew” from Italy and, by mistake, it was 20 cm shorter than the frame for which it was printed. But there was nothing to worry about: owing to the Serbian resourcefulness, it was fixed with wires. OOH ADVERTISEMENT EVOLUTION One journalist once wrote that billboards were the mirrors of our reality. Some of them are distorted; some are a bit blurred, and some are cracked. The framed image they project represents not only the author, but also the society to which the message is communicated. During almost 25 years our framed “mirrors” have reflected various messages: appeals for help, declarations of love, advertisements promising an ideal body, happier home, more beautiful cars, etc. The contents of advertisements were the reflections of tectonic movements in this society and this country. With the opening of the country’s borders in 1998, foreign clients splashed cold water and activated the market that had been dormant until then. Streets became the playground for tournaments played by coffee and beer producers, mobile service providers, and banks. Players changed successively as indicators of changes in the country undergoing transition. Every economic and social change had its own reflection and became an expression or a sentence in the history of advertising. BACK TO THE BEGINNING AND DIGITAL FUTURE Heading towards the 27th day of October 2019 and the 25th anniversary of the company, we have replaced the first backlight in front of the Main Post Office building with a new state-of-the-art LED screen and announced a new digitalised chapter in the history of OOH advertising. We celebrate the people who get work done and the brave vision that has come true despite all “crosswinds”. Would you like to find out more? Continue reading... VISIT ALMA QUATTRO WEBSITE All rights reserved by Alma Quattro 2019	cc/2020-05/en_middle_0126.json.gz/line824
__label__cc	0.660168	0.339832	‘Polar Bear’s Cafe’ Added To Spring 2012 Anime Crunchyroll Simulcast Schedule kyosuke\|2857d ago \|News\|0\| Crunchyroll has added yet another new simulcast to its spring 2012 anime lineup with the news that Polar Bear’s Cafe (aka Shirokuma Cafe) will start up this week. The series is set for streaming on Thursday’s at 5:00 am ET. The series will be available to premium members worldwide except for Japan. Free members will be able to chill out with the show in the United States, Canada, United Kingdom, Ireland, Australia, New Zealand, South Africa, Denmark, Finland, Iceland, the Netherlands, Norway, and Sweden. Anime Crunchyroll Polar Bear's Cafe (Shirokuma Cafe) fandompost.com fandompost.com Amazon Opens Pre-Orders For Dragon Ball Super World Colosseum 2 Special Broly Figure Articlegameidealist.com Project Sakura Wars Gets New Trailer and Gameplay of the DLC; Moscow Revue Revealed for the Anime	cc/2020-05/en_middle_0126.json.gz/line827
__label__cc	0.732248	0.267752	Barrick Gold to sell stake in Massawa project to Teranga for up to $430m TORONTO: Canadian gold miner Barrick Gold Corp moved closer to its asset sales target on Tuesday by agreeing to sell its entire 90 per cent stake in its Massawa project in Senegal to Teranga Gold Corporation for up to $430 million. The sale is the latest by Barrick Chief Executive Officer Mark Bristow as he seeks to "You've seen a lot of these seniors consolidate and there are non-core assets for them that are quite meaningful for other companies like ourselves,"	cc/2020-05/en_middle_0126.json.gz/line840
__label__wiki	0.959951	0.959951	Oscars to go hostless again The Oscars are going without a host again this year. ABC Entertainment President Karey Burke said Wednesday the February 9 telecast will focus on what worked last year: "huge entertainment value, big musical numbers, big comedy and star power." Last year’s ceremony attracted 29.6 million viewers, the Entertainment \| Akshay Kumar, Tamannaah Bhatia \| Hindi Movie Part 5 Mo Kola To Jhulana \|\| Popular Odia Film \|\| Siddhanta Mahapatra \|\| Rachna \|\| BasantNaik Entertainment Dogs Fighting With Prakash Raj & Sonu Sood- Comedy Scenes \| Entertainment \| Hindi Film Adam Lambert - For Your Entertainment (Official Video) Akshay Kumar Comedy Scenes \| Back To Back Comedy \| Entertainment \| Tamannaah Bhatia, Johnny Lever\|HD Canada Dot Com LIVE: Parasite Island Presscon \| September 9, 2019 Watch Rafael Rosell, Desiree del Valle, Ria Atayde, Fino Herrera, Parasite Island press conference Subscribe to the ABS-CBN Entertainment channel! http://bit.ly/ABS-CBNEntertainment Visit our official website! http://entertainment.abs-cbn.com http://www.push.com.ph Facebook: http://www.facebook.com/ABSCBNnetwork Twitter: https://twitter.com/ABSCBN https://twitter.com/abscbndotcom Instagram: http://instagram.com/abscbnonline #ParasiteIsland #ParasiteIslandPresscon #FantaSerye... Movie Name - Entertainment Movie Cast - Akshay Kumar, Tamannaah Bhatia, Johnny Lever, Krishna Abhishek, Mithun Chakraborty, Ritesh Deshmukh, Prakash Raj , Sonu Sood, Shreyas Talpade and others Synopsis - Akhil (Akshay Kumar) finds out that he is the heir of 3000 crore rupees as he and his mother were abandoned by his diamond baron father (Panna Laal Johari) who is now dead. However, his life goes Topsy-turvy when he learns that the empire goes to entertainment (a dog).... #MoKolaToJhulana #SiddhantaMahapatra #RachnaBanerjee... A funny scene where Prakash Raj & Sonu Sood are surrounded by millions of dogs. Entertainment is a 2014 Bollywood comedy film directed by duo Sajid-Farhad in their directorial debut. Starring Akshay Kumar and Tamannaah Bhatia in the lead role, Subscribe now for the latest Bollywood movies http://bit.ly/subscribe-PenMovies... Adam Lambert\'s official music video for \'For Your Entertainment\'. Click to listen to Adam Lambert on Spotify: http://smarturl.it/AdamLSpotify?IQid=AdamLFYE As featured on For Your Entertainment. Click to buy the track or album via iTunes: http://smarturl.it/FYEAdamLambert?IQid=AdamLFYE Google Play: http://smarturl.it/FYEGPlay?IQid=AdamLFYE Amazon: http://smarturl.it/FYEAmazon?IQid=AdamLFYE More From Adam Lambert Whataya Want From Me: https://youtu.be/X1Fqn9du7xo If I Had You: https://youtu.be/wmXQFwlD7vk Never Close Our Eyes: https://youtu.be/u3dkVk3F57c More great 00\'s videos here: http://smarturl.it/Ultimate00?IQid=AdamLFYE Follow Adam Lambert Website: http://www.adamofficial.com/ Facebook: https://www.facebook.com/AdamLambert Twitter: https://twitter.com/adamlambert Instagram: https://instagram.com/adamlambert/ Subscribe to Adam Lambert on YouTube: http://smarturl.it/AdamLambertSub?IQid=AdamLFYE --------- Lyrics: So hot Out the box Can you pick up the pace? Turn it up, Heat it up I need to be entertained Push the limit Are you with it? Baby, don\'t be afraid I\'m a hurt \'ya real good, baby Let\'s go It\'s my show Baby, do what I say Don\'t trip off the glitz That I\'m gonna display I told ya I\'m a hold ya down until you\'re amazed Give it to ya \'til you\'re screaming my name No escaping when I start Once I\'m in I own your heart There\'s no way you\'ll ring the alarm So hold on until it\'s over #AdamLambert #ForYourEntertainment #Vevo... The film starts with Akhil Lokande getting paid for doing an ad, where he gets into a fight, as he wasn\'t paid the full amount of money that they had promised. This continues with a few other ads, where Akhil constantly ends the fight when he gets a phone call, and says he has to go somewhere. He then arrives on a shoot where Saakshi is shooting for her television series. After her shoot lets out, they go for a walk around the park, observing other couples. At the end of their walk, Akhil proposes to Saakshi. Akhil and Saakshi go to her father\'s house, where they are told that until Akhil becomes rich, he can\'t marry Saakshi. Akhil goes to his film-obsessed friend\'s shop. He tells him that he is going to visit his father at the hospital because he has chest pain. However, his father, is actually acting and is dancing around with the nurse, only staying in the hospital because it has service like a 5-Star hotel. Akhil arrives just in time to hear and see this, and goes to beat up his father, when he reveals that Akhil is adopted and his real father wasn\'t ready for a child so his mother left, but was killed in a train crash. Luckily Akhil survived, and was sent to his adoptive father. Then Akhil beats him up. He goes back to his house, and opens the chest that he never had before, which contains love letters from his real father, to his mother, and a locket with his father and mother\'s pictures. He discovers that his father is Pannalal Johri who is a billionaire in Bangkok. Right as he finds this, on the television comes news that Pannalal Johri is dead and his 3000 crore\'s ... Watch Rafael Rosell, Desiree del Valle, Ria Atayde, Fino Herrera, Parasite Island press conference Subscribe to the ABS-CBN Entertainment channel! http://bit.ly/ABS-CBNEntertainment Visit our official website! http://entertainment.abs-cbn.com http://www.push.com.ph Facebook: http://www.facebook Movie Name - Entertainment Movie Cast - Akshay Kumar, Tamannaah Bhatia, Johnny Lever, Krishna Abhishek, Mithun Chakraborty, Ritesh Deshmukh, Prakash Raj , Sonu Sood, Shreyas Talpade and others Synopsis - Akhil (Akshay Kumar) finds out that he is the heir of 3000 crore rupees as he and his mother we #MoKolaToJhulana #SiddhantaMahapatra #RachnaBanerjee A funny scene where Prakash Raj & Sonu Sood are surrounded by millions of dogs. Entertainment is a 2014 Bollywood comedy film directed by duo Sajid-Farhad in their directorial debut. Starring Akshay Kumar and Tamannaah Bhatia in the lead role, Subscribe now for the latest Bollywood movies http:// Adam Lambert\'s official music video for \'For Your Entertainment\'. Click to listen to Adam Lambert on Spotify: http://smarturl.it/AdamLSpotify?IQid=AdamLFYE As featured on For Your Entertainment. Click to buy the track or album via iTunes: http://smarturl.it/FYEAdamLambert?IQid=AdamLFYE Google Play: The film starts with Akhil Lokande getting paid for doing an ad, where he gets into a fight, as he wasn\'t paid the full amount of money that they had promised. This continues with a few other ads, where Akhil constantly ends the fight when he gets a phone call, and says he has to go somewhere. He th	cc/2020-05/en_middle_0126.json.gz/line841
__label__cc	0.682517	0.317483	True Crime sources? April 25, 2010 11:12 AM Subscribe I’m looking for workaday capers. Not brilliant thieves or brilliant cops – down a notch or three. The crimes I seek to understand were committed by people somewhere a junkie with a pistol, and a smug accountant at a big company. What was the play? What tripped them up? Even unsolved cases yield tidbits and value. So where would you read about these? I don’t expect deep analysis — that’s for the blockbusters — but I do need some report of what happened. Police reports? Newspaper columns? Books? Capers that involve violence are ok, but I’m not particularly looking for them. Innovation is fine, too, but I’m want craft as much as art. (Or lack thereof.) I have a predilection toward the past, when lower technology ruled. But I’ll look at the latest instant-trade scandal, too. posted by LonnieK to Law & Government (9 answers total) 6 users marked this as a favorite Are you looking for these for your enjoyment or as research? If you're just looking for something to read, I highly recommend the crime stories of St. Clair McKelway, in particular "Mr. Eight Eighty" about an unusually modest counterfeiter. posted by ocherdraco at 11:25 AM on April 25, 2010 [1 favorite] Should have said: Research, not just pleasure. McKelway tip excellent. Mr 880 looks like the bird I'm looking for. Thx posted by LonnieK at 11:43 AM on April 25, 2010 Gilbert Bland (gotta love the name) was responsible for some serious map theft. posted by IndigoJones at 12:58 PM on April 25, 2010 Frede Møller-Kristensen, an employee of the Royal Danish Library, stole about 1,600 books from the library over a decade. The total value of the theft was over US $50MM. posted by tellumo at 1:05 PM on April 25, 2010 "The Fix is In" (from This American Life): "The whole program is devoted to one story, in which we go inside the back rooms of one multinational corporation and hear the intricate workings—recorded on tape—of how they put the fix in. "We hear from Kurt Eichenwald, whose book The Informant is about the price fixing conspiracy at the food company ADM, Archer Daniels Midland, and the executive who cooperated with the FBI in recording over 250 hours of secret video and audio tapes, probably the most remarkable videotapes ever made of an American company in the middle of a criminal act." posted by MonkeyToes at 1:33 PM on April 25, 2010 [2 favorites] Oh, also, look into Tino De Angelis and the $37MM Salad Oil Swindle. How about dumb cops? "The Cops are Robbers" tells the tale of several bad cops and their robbery of a local savings bank and the aftermath. posted by Gungho at 2:34 PM on April 25, 2010 You could always request court transcripts. I testified in a $1 million embezzlement case a couple of years ago. The perpetrator's actions came to light as the result of an anonymous faxed note (which, we later found out, was sent by an accomplice she double-crossed). Feel free to MeMail me if you're looking for anecdotal information. posted by paulg at 5:42 PM on April 25, 2010 Just recalled Edward J. Reiners and the Philip Morris scam. « Older Waiting begets waiting \| Used car tips? Newer » Case studies of FBI foreign investigations?... February 16, 2015 Real Life Royston Vasey? January 4, 2013 How to find a Federal Indictment November 14, 2012 Dirty cops in small-town America May 6, 2012 Crime News and Information? November 6, 2008	cc/2020-05/en_middle_0126.json.gz/line843
__label__wiki	0.746864	0.746864	Looking Beyond Mortality, Heart Association Targets Years Lived Healthy Blocking IL-18 Shows Promise in Still's Disease 50% response rate at week 12 in adults with refractory disease by Nancy Walsh Nancy Walsh, Senior Staff Writer, MedPage Today February 26, 2018 Tadekinig alfa, a recombinant human IL-18 binding protein, showed promise as a novel strategy for the treatment of refractory adult-onset Still's disease (AOSD), in a phase II, European, multicenter study of 23 patients. Note that AOSD is similar clinically to systemic juvenile idiopathic arthritis, but less common and of unknown etiology, and while IL-18 is thought to be involved in its pathogenesis treatment has relied on nonsteroidal anti-inflammatory drugs, conventional disease-modifying anti-rheumatic drugs (DMARDs), and biologics. Targeting interleukin (IL)-18 with tadekinig alfa showed promise as a novel strategy for the treatment of refractory adult-onset Still's disease in a phase II study. Among 10 patients who received subcutaneous tadekinig alfa, 80 mg three times weekly, five achieved the predefined response criteria by week 12, as did six of 13 receiving 160 mg three times per week, for response rates of approximately 50%, according to Cem Gabay, MD, of University Hospitals of Geneva in Switzerland, and colleagues. Only three serious adverse events were reported, the investigators wrote online in Annals of the Rheumatic Diseases. One of these events, toxic optic neuropathy, was considered possibly related to the therapy by the treating physician, but review by the Data Safety Monitoring Board suggested that there was insufficient information to determine this because the patient had previously had serious thrombotic episodes, and ophthalmic vein thrombosis was not conclusively ruled out, the team explained. Adult-onset Still's disease is similar clinically to systemic juvenile idiopathic arthritis, but is less common and its etiology is unknown. Disease features include arthritis and systemic inflammatory features such as fever and rash, and treatment typically has relied on nonsteroidal anti-inflammatory drugs (NSAIDs), conventional disease-modifying anti-rheumatic drugs (DMARDs), and biologics. Interleukin (IL)-18 is thought to be involved in the pathogenesis of adult-onset Still's disease, and Gabay's group recently demonstrated that levels of free IL-18 were high in these patients and correlated with disease activity. Therefore, to explore a possible therapeutic role for IL-18 blockade with the recombinant human IL-18 binding protein tadekinig alfa in this disorder, the investigators enrolled patients from 20 centers in Switzerland, Germany, and France. All had active disease and either fever or elevated levels of C-reactive protein (CRP) despite having at least 1 month of treatment with prednisone in dosages of 5 mg/day or higher. Participants also could have previously received conventional DMARDs and biologics, and concomitant use of NSAIDS, prednisone, and DMARDs was permitted in the trial. Response at 12 weeks was defined as an improvement of 20% or more in swollen and tender joint counts plus a 70% decrease in CRP level or normalization of the ferritin level. At week 3, patients receiving the 80 mg three times weekly dosage who had not responded were switched to the 160 mg group. Patients' mean age was 41, and the majority were women; mean disease duration was 15 months. Baseline disease manifestations in the 23 patients included in the analysis were rash in 13, arthritis in 19, and neutrophilia in 14. Mean swollen and tender joint counts were four and six, respectively. Almost all patients had previously been given prednisone, at a mean daily dose of 30 mg, 13 patients had received DMARDs, and nine had been treated with a biologic. The most commonly used biologics were anakinra (Kineret) in six patients, canakinumab (Ilaris) in three, and tocilizumab (Actemra) in three. Treatments given concomitantly during the study included glucocorticoids in 21 patients, NSAIDS in 12, and methotrexate in seven. Five patients who initially were in the 80 mg group and did not show a response by week 3 were switched to 160 mg. The 12-week response criteria were met in eight of 18 patients who either started on the 160 mg dose or switched to it. By week 12, only six patients still had skin rashes, and median prednisone dosages had decreased from 12.5 to 10 mg/day (P=0.01). Changes also were seen in disease biomarkers, with significant decreases observed for CRP, ferritin, serum amyloid A, and IL-6. Adverse events leading to discontinuation of treatment were reported in four patients, including the case of optic neuropathy and three cases of injection site reactions. The investigators noted that some efficacy has been seen in adult-onset Still's disease with other anticytokine therapies, including agents that target IL-1 and IL-6. "Our results show that IL-18 inhibition offers another possibility of therapy within the scope of anticytokine treatment for the management of adult-onset Still's disease. "Our study is the first prospective study examining a drug with a completely new mode of action in adult-onset Still's disease," the team wrote, adding that further clinical investigation is warranted. Limitations of the study, the researchers said, were its open label design and lack of a control group. The study was funded by AB2 Bio Ltd. The authors reported financial relationships with AB2 Bio, Roche, Pfizer, Merck Sharp & Dohme, Novartis, Sanofi, AbbVie, Biogen, Bristol-Myers Squibb, Celgene, Janssen, Lilly, MEDAC, Nordic Swedish Orphan Biovitrum, Novartis, Union Chimique Belge, Actelion, GlaxoSmithKline, Sanofi, and UCB. Reviewed by Henry A. Solomon, MD, FACP, FACC Clinical Associate Professor, Weill Cornell Medical College Source Reference: Gabay C, et al "Open-label, multicenter, dose-escalating phase II clinical trial on the safety and efficacy of tadekinig alfa (IL-18BP) in adult-onset Still's disease" Ann Rheum Dis 2018; DOI:10.1136/annrheumdis-2017-212608.	cc/2020-05/en_middle_0126.json.gz/line855
__label__wiki	0.68619	0.68619	Volleyball Goes 1-3 at UMass-Boston Tournament Olivia Kolodka finished with a combined 27 kills during Friday's matches. The Middlebury volleyball team posted a 1-3 record during a quartet of matches at the UMass-Boston Tournament. During Friday’s action, Whitman edged past the Panthers 3-1, but Middlebury responded with a 3-0 victory over Western Connecticut State. On Saturday, the host Beacons beat the Panthers 3-0, and Salisbury defeated Middlebury 3-0. In Friday’s opening match, Whitman grabbed the first two sets against the Panthers by scores of 25-15 and 25-21. Middlebury won the third set by a 25-21 tally, but Whitman secured the win via a score of 25-21. Senior Olivia Kolodka (Verona, N.J.) paced the attack with 12 kills and a pair of service aces, while rookie Alice Roberts (Media, Pa.) added nine kills. Sophomore Hannah Blackburn (Chapel Hill, N.C.) dished out 37 assists. Defensively, four Panthers recorded double-digit dig totals led by senior Lizzy Reed (Cazenovia, N.Y.) with 21. Sophomore Charlotte Devine (Charlottesville, Va.) added 14 digs, while Blackburn chipped in with 11 for a double-double. Against Western Connecticut State, the Panthers handed the Colonials their first loss of the season (10-1) by set scores of 25-21, 29-27 and 25-20. O. Kolodka led three in double figures with 15 kills, while younger sister and rookie Emily Kolodka (Verona, N.J.) finished with 12 and sophomore Melanie English (Montgomery Village, Md.) added 10. Blackburn set the offense handing out 42 assists. Reed once again led multiple players with double-digit dig totals, finishing with 22. E. Kolodka posted a double-double with 19 digs. English recorded two block solos and three block assists in the win. During Saturday’s opening match, Middlebury hung tough with the Beacons for a pair of sets, falling 25-22 and 25-18, before bowing out 25-14 in the third set. E. Kolodka paced the offensive attack with five kills, while O. Kolodka and Roberts added seven apiece. Blackburn dished out 27 assists in the match, while Lizzy Reed (15 digs) and E. Kolodka (eight digs) paced the defense. Against Salisbury, Middlebury played the Gulls tight, but came up on the short end of 25-18, 25-16 and 25-19 sets. O. Kolodka earned six kills in the match, while three others picked up four. Reed led the defense with 14 digs, Blackburn added 11 with seven kils and four service aces, while E. Kolodka had 10 digs. • Volleyball record: 1-3 • Up next: 9/16 vs. Union – 7:00, 9/20 vs. Bates – 3:00	cc/2020-05/en_middle_0126.json.gz/line858
__label__wiki	0.787272	0.787272	#5 Field Hockey Posts Pair of Decisive Wins Anna Kenyon had a goal and dished out a pair of assists in Sunday's win. During a pair of weekend road matches, the Middlebury field hockey team defeated NESCAC foe Colby by a 3-1 count on Saturday in Maine. The team turned around a day later, cruising past ninth-ranked Montclair State on Sunday by a 9-1 tally in a match played in Albany, New York. During Saturday’s match, junior Bridget Instrum (Granby, Mass.) scored a goal in each half propelling the Panthers to the 3-1 NESCAC victory on Bill Alfond Field. Middlebury took control in the first nine minutes of the game with a pair of goals. Instrum tallied an unassisted score just 2:10 into the game. The second goal started off a penalty corner and ended up with a scrum in front of the net. Junior Jillian Green (Chappaqua, N.Y.) was credited with the goal off an assist from junior Shannon Hutteman (Webster, N.Y.) at 8:50. In the second half, the Panthers used a quick counter to develop a three-on-one advantage. Junior Anna Kenyon (Dedham, Mass.) worked down the right side, and pushed a ball across to Instrum for the one-touch score with 28:54 remaining. The Mules got on the scoreboard when Caroline Ferguson scored on a play that started off a penalty corner with 3:48 remaining. Kellie Walsh had a shot blocked in front. In the scramble, the ball was pushed out to Ferguson on the right side of the goal for the score. Both teams finished with 20 shots, while the Panthers held a slight 9-8 edge in penalty corners. Middlebury senior Emily Knapp (Scarsdale, N.Y.) recorded five of her seven saves in the first half. Colby goaltender Sarah Evans was credited with nine stops. In Sunday’s match, seven different players scored a goal, as Middlebury cruised to a 9-1 victory over the Red Hawks. The Panthers jumped on the board early with a pair of goals in the opening 2:22. Just 1:17 into the match, Hutteman scored following a penalty corner when senior Alyssa DiMaio (Morristown, N.J.) inserted the ball to the stick of Kenyon, who set it for Hutteman on the left side. A little more than a minute later, senior Catherine Fowler (Grosse Pointe, Mich.) recorded her first goal of the game on a penalty stroke. In the ninth minute, Kenyon passed the ball across the top of the arc from left to right onto the stick of sophomore Lauren Berestecky (Madison, Conn.), who put the Panthers up 3-0. Sophomore Pam Schulman (Greenwich, Conn.) tapped in her own rebound at 20:56, giving Middlebury a four-goal advantage. Trailing 4-0, Montclair State got on the board following three-consecutive penalty corners at 23:08 when Maura Johnston scored her sixth of the year via an assist from Gianna Moglino. The score remained 4-1 in favor of Middlebury until the 33rd minute. Kenyon capped off the quintet of first-half goals for the Panthers with an unassisted tally at 32:57. Following the halftime break, rookie Annie Leonard (Darien, Conn.) and Instrum each recorded scores at 38:05 and 40:56, respectively, via assists from Fowler. At 46:09, Fowler completed her four-point performance with her second goal of the match on a low, hard shot from the right side. Just over 10 minutes later, Hutteman completed the scoring with a goal on a penalty corner on assists from rookie Lauren Schweppe (Chester Springs, Pa.) and DiMaio. Middlebury, who tied a season-high with its nine goals, finished with a 26-7 shots advantage in the contest, while holding a 13-6 edge in penalty corners. Knapp (65:57) and rookie Evangeline Dunphy (Williston, Vt.) (4:03) both saw playing time in front of the net for the Panthers, as Knapp tallied three saves. Montclair State starter Rebecca Brattole allowed nine goals and was credited with eight saves. • Field Hockey record: 6-1 • Up next: 10/1 @ Skidmore – 4:00, 10/4 vs. Tufts – 1:30	cc/2020-05/en_middle_0126.json.gz/line859
__label__cc	0.683741	0.316259	Regression to the mean and evolution I don't have a strong biological background but, in studying statistics, I met the idea of regression to the mean. e.g. children of tall parents tend to be shorter than their parents, and so on. Does this interact with evolution ? Ahmed ElmahyAhmed Elmahy $\begingroup$ Interestingly, statistics have evolved quite significantly in parallel of evolutionary biology. Galton, Pearson and R. Fisher are important names that contributed to both biology and statistics. $\endgroup$ – Remi.b Jan 3 '16 at 17:01 $\begingroup$ Have a look at Wikipedia > Heritability > Parent-offspring_regression. $\endgroup$ – Remi.b Jan 3 '16 at 18:33 $\begingroup$ When you talk about "regression toward the mean", do you refer to the modelling of data (linear regressions) or do you refer to the natural tendency for extreme values to be less extreme in a future measurement (origin of the term regression but rarely used with this meaning today)? $\endgroup$ – Remi.b Jan 3 '16 at 18:35 $\begingroup$ answers to this question are related: Is it possible for a child to grow taller than their tallest parent? $\endgroup$ – fileunderwater Jan 4 '16 at 13:17 $\begingroup$ Actually i was referring to the tendency of values to be around the mean on the normal distribution curve. $\endgroup$ – Ahmed Elmahy Jan 4 '16 at 13:34 TL;DR answer: Regression to the mean doesn't always occur (children can be taller than either parent, as can be easily observed at any high-school basketball game), so it doesn't affect the theory of evolution through natural selection. The observation of regression to the mean was of great concern to Darwin and early thoughts on natural selection (don't confuse "evolution", which is the observed phenomenon, and "natural selection", which is one of the theories proposed to explain evolution). The problem has been effectively resolved since the rediscovery of Mendel's genetic work at the end of the 19th century. "Regression to the mean" is inevitable if inheritance works through blending of features. That was how everyone believed inheritance to work in the mid-1800s, and Darwin understood that it presented an insuperable obstacle to his theory. That is, if blending inheritance was true, then natural selection could not be true. Darwin puzzled over this quite a bit, and came up with some unsatisfying suggestions to overcome it, but at the end of the day, one of the predictions that his theory of evolution through natural selection made, was that blending inheritance could not be true. Of course, blending inheritance is not true. Mendel showed that in fact inheritance is quantal, not blending. We now know that many traits of interest look, superficially, as if they're blending (which leads to regression to the mean), but are actually the result of multiple traits interacting. With blending inheritance, the variation that is required for natural selection to work is lost, generation after generation; regression to the mean in an inevitable consequence. With gene-based inheritance, variation (can be) preserved generation after generation; regression to the mean is a common but not inevitable consequence, because the variation in the original population is still present and can be re-created given appropriate selection pressure. iayorkiayork $\begingroup$ Interesting read on how Mendel was mostly wrong. $\endgroup$ – MattDMo Jan 3 '16 at 19:08 $\begingroup$ Mendel wasn't wrong on the key point that inheritance is not blended, which is what's relevant here. $\endgroup$ – iayork Jan 3 '16 at 19:57 $\begingroup$ That's true, I should have been more specific. I was just mentioning the article as possible interesting reading for those whose understanding of Mendel's work didn't go beyond high school biology. Your answer is actually pretty decent. $\endgroup$ – MattDMo Jan 3 '16 at 20:02 There is a concept known as "heritability" which essentially is a measure of how much of the variability in a certain trait that is due to genetic factors. This is closely related to regression to the mean. Now for length the heritability sometimes is estimated, by measuring the lengths of many parents and their offspring, to be around 0.7. This means that if your father is ten centimeters taller than the average man in your population and your mother is ten centimeter taller than the average woman in your population you are expected to be around three centimeters shorter than your same sex parent but still seven centimeters taller than the average for your sex in your population. A heritability of 0.7 is very high so if it were a clear evolutionary advantage for an individual to be taller or shorter than the current average height the length of the population will be expected to change rather fast. There are other traits, for instance the tendency to have one-egg twins, where the heritability is believed to be basically zero. This means that even if you are a one-egg twin and being a one-egg twin constitutes a clear evolutionary advantage the relative amounts of one-egg twins will not increase in the population because there is no heritability. You could say that the higher the heritability, and thus the lower the regression to the mean, the faster a trait will change in a population in a certain direction if there is evolutionary pressure for it to do so. AgerhellAgerhell Not the answer you're looking for? Browse other questions tagged evolution or ask your own question. Is it possible for a child to grow taller than their tallest parent? Height and natural selection in humans? How does “be altruist to those who are similar to you” evolve? Why does the slope of parent-offspring regression equals the heritability in the narrow sense? Cell-level selection and inheritance of acquired mutations Visual and clear example of the idea that “animal doesn't need to understand the evolutionary function of its actions”	cc/2020-05/en_middle_0126.json.gz/line878
__label__cc	0.740404	0.259596	News The Difference Between Wasps and Bees The Difference Between Wasps and Bees When we hear a buzzing sound outside, we instantly think of them; bees and wasps! Although summer is the peak season for these little critters to flock, it’s important to know how to spot their differences all year round. But what are the differences between wasps and bees? As they buzz by you, they seem to look the same and have almost the same aggressive nature. Protect yourself from a horrible interaction with these flyers by finding out the distinctions between bees and wasps. Features of Bees Bees are closely related to the ant and the wasp, but have some very different features and uses in nature. Known for their role with pollination, bees are an essential component in gardening. Because of a decline in wild bees, commercially maintained hives have had to go into place to make sure pollination in an area is maintained for a healthy plant environment. Features of Wasps Most commonly known as a yellow jacket or hornet, wasps can be known to pollinate, but are mostly known as predators. Their most important form of pollination is that of fig trees, which would not be around if it weren’t for the wasp. They also been known to help in grape production as they pass needed yeast back and forth. However, as predators, their main job is garden pest control. They’ll eat bugs that hurt your garden or feed them to their broods. What’s the Difference between Wasps and Bees? Some individuals flinch at just hearing the mention of wasps and bees, as these buzzing insects tend to inflict harm when you provoke them. But you don’t have to live in fear when you begin to distinguish the difference between the features of bees and the features of wasps. Physical aspects The size and physical differences between a wasp and a bee may not seem too different. However, on closer inspection, from the safety of a computer screen, bees and wasps can be differentiated pretty easily. The much more slender wasp tends to not have hair like bees do, and much more slender legs. Their bodies are built for hunting other insects and speed when flying. A wasps coloration is also much move vivid, while the honey bees or bumble bees have much more hair and their coloration is much more subdued. Their big legs and hairy bodies help them collect pollen. Nesting and community The ways bees and wasps live are very different as well. Although some types of bees do live by themselves, most bees live in colonies, with honey bee colonies being among the largest. Their hives are built out of wax which they process in the act of gathering and eating honey. Most bees’ hives are located in hollowed trees, the ground, and sometimes in buildings. Wasps, on the other hand, can live on their own and when they do live in colonies they are much smaller than bee colonies. Wasps nests are constructed out of fiber and saliva for a more papery home. The big difference between wasps and bees is their eating habits, as wasps go for more human food—unlike the pollen and flowers bees eat. Wasps like to feast on the same food we love, which is why you often see them enjoying your picnic alongside you. Along with human food, some wasps enjoy other insects and sometimes will steal bee honey as well. Bees’ diets are much more narrow, and they indulge their cravings on nectar and pollen. Their ability to sting Another huge difference between bees and wasps is their sting. Wasps can sting multiple times because their stinger remains intact after they have stung their victim. Because of a wasp’s predatory nature, they will cause harm even if you don’t provoke them, so look out for these more narrow brightly colored flying insects Once a bee has stung its human victim with its barbed stinger, the bee sting stays in the victim. If it’s torn out of the bee’s body, that leads to the bee dying within minutes.. What happens when it’s cold? Bees also don’t hibernate with the seasons, and wasps tend to sleep through the cold winter. Bees may seem like they are sleeping, but they are very much awake, eating honey they have reserved for the winter and clustering together to create heat to keep their colony warm. Do You Have More Aggressive Bees Near You? Africanized honey bees are similar to the aggression of wasps, which makes them dangerous to have around your home. Bee Master of Las Vegas offers bee relocation in Las Vegas to prevent an unfortunate incident from occurring to your family. Contact us today for our help! Tags: bees and wasps, Difference between wasps and bees, features of bees, features of wasps	cc/2020-05/en_middle_0126.json.gz/line883
__label__wiki	0.615524	0.615524	By California, February 10, 2018 in Pennsylvania Ballet A postcard just went out to previous ticket buyers, donors, and subscribers reporting that the 2018-19 season will be announced in "a few weeks." But it also says that the season will open in October with MacMillan's Romeo and Juliet. canbelto Angel is really making PABallet into a mini-ABT. Amy Reusch No more Cranko? That's a shame, their performance of Cranko's R&J used to send chills down my spine. How many companies in the US do the MacMillan? The complete season is now on their web site: http://paballet.org/2018-2019-season/ Sir Kenneth Macmillan’s emotional choreography pairs with Prokofiev’s famous score to portray this moving tale of star-crossed lovers that is sure to stay with you long after you leave the Academy of Music. Petite Mort World Premiere by Andrea Miller World Premiere by Russell Ducker November 8 – 11 Set to music by Mozart, Jiří Kylián’s Petite Mort features six men, six women, and six fencing foils, which combine to explore ideas of aggression, sexuality, energy and vulnerability. The program will also include world premieres from award-winning choreographer and Pennsylvania Ballet company dancer Russell Ducker and Gallim Dance founder and artistic director Andrea Miller, who currently Artist in Residence at the Metropolitan Museum of Art. George Balanchine’s The Nutcracker® December 7 – 30 What would the holidays be without George Balanchine’s The Nutcracker®? Whether it’s your first or thirty-first time seeing Pennsylvania Ballet’s production of the classic, watching the timeless story brought to life is always a delight. March 7 – 17 One of ballet’s oldest and most continually-performed works, Giselle tells the story of a young woman whose love triumphs over vengeance and lasts even beyond death. World Premiere by Matthew Neenan April 4 – 7 We celebrate the work of famed Russian-born composer Igor Stravinsky with four works set to his music: George Balanchine’s Apollo and Stravinsky Violin Concerto, Jerome Robbins’ The Cage (company premiere), and a world premiere by our Choreographer in Residence, Matthew Neenan. DGV (Danse à grande vitesse) World Premiere by Jorma Elo Glass Pieces May 9 – 12 Christopher Wheeldon’s DGV: Danse à Grand Vitesse is set to Michael Nyman’s MGV (Musique à Grande Vitesse), which was composed to commemorate the French train à grand vitesse, and conveys the sense of movement and momentum of the high-speed train. Internationally recognized choreographer Jorma Elo will present an all new-ballet for us, and the program will conclude with the company premiere Jerome Robbins’ Glass Pieces, set to the music of composer Philip Glass. Besides Nutcracker, one program with Balanchine. Which I suppose is a good thing, since there really aren't many Balanchine-trained dancers left in the company. It's really becoming mini-ABT. 8 minutes ago, canbelto said: But with a better website! ;) This might be a good strategy in terms of box office, assuming there isn't a great deal of overlap between NYC and Philly audiences. (I know some balletomanes may trek back and forth between the cities, but I've always been under the impression that NYC and Philly are somewhat distinct markets, despite their relative geographic proximity.) Hmm I don't know ... their full-length productions have not sold well this season. I have gotten email offers about discounts. Their upcoming Swan Lake (usually a cash cow in whatever form) has plenty of seats left. 1 hour ago, canbelto said: I'm curious why that would be. And the mixed programs have been selling better? In most markets, one so often hears that full lengths sell better than mixed programs. Why might Philly be different? Could it be an adjustment period? Dissatisfaction among the general public with the direction of the company? Other reasons? Just curious, since it doesn't seem to fit (what one thinks of as) the norm. Edited February 21, 2018 by nanushka 57 minutes ago, nanushka said: It's a rather small company and I think many people think that they can go to NY if they want to see "the classics." PA Ballet is still a rather small regional company and I don't think the average ballet goer really knows, say, Sterling Baca or Mayara Piniero or the other dancers Angel Corella has been pushing heavily. I'm sure the company's heavy turnover the past couple of years hasn't helped. I don't recall Swan Lake selling poorly back in the Christopher d'Amboise days... is this low turn-out something new? Maybe that poster image isn't helping much... 21 hours ago, canbelto said: It will be interesting to see how Jewels sells. If the Philly crowd is still more pro-Balanchine than full length, I would expect to see Jewels sell better. Is casting out for Giselle? If I can only make one performance, any suggestions for who I should try to catch in the role of Giselle? (And why doesn't the company release casting at the beginning of the season?) ABT Fan 30 minutes ago, pbl said: I was looking for casting today myself, but it’s still not released on their website. I have no idea why they wait so long. Really appreciate any recommendations for who I should try to catch in the role of Giselle Casting for the entire run of Giselle has been posted: http://paballet.org/wp-content/uploads/2019/02/Giselle-Casting-1.pdf jelsey I'll be seeing Mayara Piniero and Zecheng Liang. This is partially what fit best with my schedule, but I'm really excited for this pair. Mayara is probably my favorite dancer at the ballet, and she's wonderfully light on her feet. Her rehearsal videos have been very tempting. Plus I saw the two of them in Rubies last year, and I thought they had great chemistry.	cc/2020-05/en_middle_0126.json.gz/line895
__label__wiki	0.741597	0.741597	CBHL 2017: Expanding Access visits the Twin Cities The Council on Botanical and Horticultural Libraries met for its annual conference in Chaska, Minnesota this year. The conference, which took place June 5th through June 9th, was attended by three Expanding Access to Biodiversity Literature team members: Susan Fraser, Susan Lynch, and Mariah Lewis. July 20, 2017byMariah Lewis 2016 BHL Annual Report The 2016 BHL Annual Report is now available! Find out how our collections grew and audiences engaged with our library in 2016, learn more about some exciting new projects, and explore impact stories from users across the globe. Read the report now!You can also get the latest updates from BHL in our newsletters. Explore past newsletters here and subscribe to our mailing list here. July 19, 2017byMichelle Strizever The Southern Cultivator The Expanding Access to Biodiversity Literature (EABL) collection has grown rapidly over the last year, with the addition of born digital material and in-copyright titles scanned by various BHL member libraries. It wasn’t until recently, however, that the collection included titles contributed directly by non-BHL members. This process—a significant departure from usual BHL workflows—is part of EABL’s effort to digitize valuable content from organizations outside the consortium. June 15, 2017byPatrick Randall DPLA Reharvest of BHL Data On April 11, 2017 the Digital Public Library of America (DPLA) reharvested all BHL data for ingest into its portal at https://dp.la/. While BHL has served as a content hub for DPLA since its launch in 2013, our data has not been updated in their portal since that launch, primarily due to the absence of a workflow on DPLA’s end for automatically harvesting new data. Since 2013, the number of BHL records in our portal has increased significantly and changes and corrections to pre-2013 records were not reflected in the DPLA portal. May 18, 2017byTrish Rose-Sandler and Bianca Crowley The Worcester Country Horticultural Society In the fall of 1840, in Worcester, Massachusetts, two dozen attendees of the Worcester Agricultural Society’s Annual Cattle Show put on a display of local fruits and flowers. The attention it received led to the creation, in 1842, of the Worcester County Horticultural Society (WCHS), the third oldest active society of its kind in the United States. Today, the WCHS is based at Tower Hill Botanic Garden, which it established in 1986. April 20, 2017byPatrick Randall New in-copyright titles for a new year The first quarter of 2017 saw 39 in-copyright titles added to BHL, setting the pace for another record-breaking year. New international BHL Members and Affiliates, as well as grant projects like Expanding Access to Biodiversity Literature, have contributed to the growing number of recent titles in the collection, as member libraries continue to chip away at digitizing the legacy literature. Expanding Access goes to Hollywood! This is Mariah Lewis, Metadata Specialist for the Expanding Access to Biodiversity Literature Grant Project, reporting in! Well, we didn’t get that biodiversity literature television show we had been hoping for, but the Expanding Access grant team was on the move again in February conducting training sessions. This time it was a cross-country adventure to California. Happy to escape the New York winter, I began my adventure in San Diego. March 16, 2017byMariah Lewis Page 3 of 6« First...«2345»...Last »	cc/2020-05/en_middle_0126.json.gz/line902
__label__cc	0.710653	0.289347	Workplace by Facebook: Could This Be An Alternative to Your Enterprise In-House Designed Intranet and Mailing System? Workplace by Facebook launched officially last year, yet it is already set to become an industry leader when it comes to business software. So what does Workplace by Facebook have that your in-house intranet might be lacking? Having worked with many different intranet platforms in the past, I know that one of the main issues of having a new system introduced to a company can be change management and the time and effort it takes to re-train staff who may resist against the unknown – a common problem that can be difficult to tackle straight away. Great internal communication requires effective communication at all levels of your company However, even though Workplace by Facebook only launched in October 2016, it is reported to already have 14,000 organisations on board the platform. They are figures that new contenders on the market can only dream of achieving even after years of hard work, let alone a few months. But with the brand of Facebook behind it and nearly 2 billion users that can provide user feedback, they have clearly made the most of their resources to create a software that meets the requirements of its intended customer base. Most of our daily activities including many of our work habits are controlled by a part of the brain called the basal ganglia On top of that, some of their clients include global big brand names who have adopted Workplace by Facebook into their own organisations and their faith in the Workplace software has inspired others to jump on the bandwagon, rather than sticking with an in-house built intranet system. We want to know what all the fuss is about so we decided to take a look at some of the features and the benefits it is providing to businesses across the globe: The main features found on Workplace by Facebook are the following: Work chat Team and project groups Newsfeed updates Personalised profiles File, photo and video storage 1:1 support for administrators Secure collaboration between companies Single-sign on (SSO) Mobile applications (for iOS & Android) Multi-company groups Workplace Group Types. Simple and intuitive, and apply to common use cases Although Workplace may not have as many features available as some of its competition, there is a reason behind it. Due to feedback received, Workplace decided to focus the platform to support and improve employee engagement, culture, on-boarding/off-boarding and other team building functions. This means there is still a lot of room for Workplace to grow if it wants but it is dealing with some of the main problems companies face every day across their workforce. The best of facebook, plus new features With feedback playing a crucial role in the success of Workplace by Facebook, it is no wonder that they openly invite users to ‘send feedback’ via the Homepage to give views on what is working well for you or your organisation and what improvements you would recommend. This is quite refreshing to see as other intranet solutions would either avoid this feature altogether or put the link in an obscure location making it difficult to deal with and work on feedback potentially being received. You can chat with a colleague across the world in real time, host a virtual brainstorm in a Group, or follow along with your CEO’s presentation on Facebook Live Starbucks now has over 80% of their Store Managers actively using Workplace by Facebook on a weekly basis and according to their staff, it has dramatically improved communication across the organisation due to its user friendly interface that allows live, real time support bringing the teams closer together which can only improve areas like consistency, transparency, culture, continuity and engagement – everything that is important to the smooth running of a business. Got bots if you want ’em With Workplace by Facebook using the same type of strong encryption tech that banks use to keep financial data secure and ensure their staff are fully trained on the importance of security, ethics and confidentiality as part of their onboarding process, having a Company treating security as a top priority can help make business owners feel a little less anxious about the likelihood of their data being leaked or shared. Workplace Service Partners assist with purchasing, deploying and running Workplace. This includes helping you understand the specific value and use cases for your organization; providing training and helping with setting up IT, change management and internal communications; and integrating Workplace with other systems you use in your organization With well-known global companies partnering up with Workplace they offer assistance with buying, deploying and set-up for easier integration with other systems you may be using within your Company. Having experts in the field with knowledge of other software and how they can work in-line with Workplace is bound to make implementation easier which is one of the main issues companies have with change management of new technology over a large workforce is bound to make implementation easier which is one of the main issues companies have with change management of new technology over a large workforce. The more your company uses Workplace, the less you pay per person. Our pricing is per active user, per month. Pay $3 for each of the first 1,000 active users. Additional users (up to 10,000) are charged at $2. Need more? Beyond 10,000 each person costs just $1 per month. You might think with this type of support and technology that the price will be extremely high but you may be pleasantly surprised. First of all, you can just join for free which gives you limited access to the communication features and most of the productivity features which include: Voice and video calls Workplace and Work Chat applications Unlimited file, photo and video storage Unlimited team and project groups Desktop notifications for Windows But if you want to make use of the full software, then upgrading to a premium package will unlock the enterprise and admin support functions which will come at a cost of: $3 per user for the first 1000 active users $2 per user for the nest 9000 active users $1 per additional active user after that Free for non-profit organisations and educational institutes Prices outside of the US are yet to be confirmed but at present they are still some of the lowest seen on the market. There is also no long-term contract to lock you in which gives you the freedom to cancel if it turns out not to be a good fit for your business which means more businesses may be likely to at least give it a shot as there is nothing really to lose financially. Brand & Familiarity Starbucks now has over 80% of their store managers using Workplace on a weekly basis Having a brand name such as Facebook with its many successful years of experience behind it means that Companies are more than likely to trust in the Workplace tool to actually work well within their business and as the majority of people (an assumption I am willing to put out there!) know how to use Facebook already, the familiar interface of Workplace is going to prove easier for employees to master which is usually a problem that companies worry about when it comes to new software. Although the layout is similar to that of normal Facebook, the different colour scheme and profile design gives Workplace a more professional feel. Even the small references to ‘work chat’ and having a list of ‘coworkers’ rather than friends is enough to differentiate between the two platforms. Integrates with 5% of the most popular apps We already mentioned that Workplace has teamed up with some global partners for easier integration but the biggest set of integrations are now for file storage and it can easily be paired with the likes of OneDrive, Box, Dropbox, Microsoft Office, G-Suite and Salesforce – however Workforce is reported to only integrate with 5% of the most popular apps which is something that could change going forward. With the addition of API, consumers can also build their own software to integrate if need be. So is Workplace by Facebook a decent alternative to some of the enterprise in-house designed intranet and mailing systems? If you’ve used Facebook, you’ll know how to use Workplace I would say if you are a Company who wants to promote positive values, with an engaging and transparent communicative company culture – then the answer is yes. The top 13 features of Workplace by Facebook are the following: Robyn. facebook intranet workplace by facebook Robyn is a HR professional with over 7 years experience in generalist and complex employee relations matters. A newly established Virtual HR Assistant offering a range of HR services online, who loves to travel and part of the content management team at CakeHR. 11 Reasons You Should Work at Women-led Companies We're living in a third-wave feminism movement; everywhere we turn, successful and empowering women surround us Employee Scheduling Module is Coming to CakeHR Still relying on Excel spreadsheets and dry erase boards with scribbled-in names of employees to know who’s working when? Your life is about to change. Say hello to CakeHR’s employee scheduling module. Ilona Kalniņa Improve Employee Engagement Through Succession Plans [Report] 94% Of Employers Agree	cc/2020-05/en_middle_0126.json.gz/line903
__label__wiki	0.678486	0.678486	More Is Not Better Quite a few of my recent posts have been about how the mainstream media is catching on to the corruption of science caused by the bad incentives all parties operate under, from science journalists to publishers to institutions to researchers. Below the fold I look at some recent evidence that this meme has legs. Donald S. Kornfeld and Sandra L. Titus have a comment in Nature entitled Stop ignoring misconduct arguing that the bad incentives for researchers inevitably produce misconduct, but that this is routinely swept under the carpet: In other words, irreproducibility is the product of two factors: faulty research practices and fraud. Yet, in our view, current initiatives to improve science dismiss the second factor. For example, leaders at the US National Institutes of Health (NIH) stated in 2014: “With rare exceptions, we have no evidence to suggest that irreproducibility is caused by scientific misconduct”. In 2015, a symposium of several UK science-funding agencies convened to address reproducibility, and decided to exclude discussion of deliberate fraud. The scientific powers-that-be are ignoring the science: Only 10–12 individuals are found guilty by the US Office of Research Integrity (ORI) each year. That number, which the NIH used to dismiss the role of research misconduct, is misleadingly low, as numerous studies show. For instance, a review of 2,047 life-science papers retracted from 1973 to 2012 found that around 43% were attributed to fraud or suspected fraud. A compilation of anonymous surveys suggests that 2% of scientists and trainees admit that they have fabricated, falsified or modified data. And a 1996 study of more than 1,000 postdocs found that more than one-quarter would select or omit data to improve their chances of receiving grant funding. Linked from this piece are several other Nature articles about misconduct: Misconduct: Lessons from researcher rehab by James M. DuBois, John T. Chibnall, Raymond Tait and Jillon Vander Wal is an interesting report on a program to which researchers are referred after misconduct has been detected. It identifies the pressure for "more not better" as a factor: By the metrics that institutions use to reward success, our programme participants were highly successful researchers; they had received many grants and published many papers. Yet, becoming overextended was a common reason why they failed to adequately oversee research. It may also have led them to make compliance a low priority. ... Scientists become overextended in part because their institutions value large numbers of projects. Robust research: Institutions must do their part for reproducibility by C. Glenn Begley, Alastair M. Buchan and Ulrich Dirnagl argues for compliance processes for general research analogous to those governing animal research. They too flag "more not better": Institutions must support and reward researchers who do solid — not just flashy — science and hold to account those whose methods are questionable. ... Although researchers want to produce work of long-term value, multiple pressures and prejudices discourage good scientific practices. In many laboratories, the incentives to be first can be stronger than the incentives to be right. Workplace climate: Metrics for ethics by Monya Baker reports on institutions using a survey of researcher's workplace climate issues in areas such as "integrity norms (such as giving due credit to others' ideas), integrity inhibitors (such as inadequate access to material resources) and adviser–advisee relations". Also in Nature is Corie Lok's Science’s 1%: How income inequality is getting worse in research, which starts: For a portrait of income inequality in science, look no further than the labs of the University of California. Twenty-nine medical researchers there earned more than US$1 million in 2015 and at least ten non-clinical researchers took home more than $400,000 each. Meanwhile, thousands of postdocs at those universities received less than $50,000. Young professors did better, but many still collected less than one-quarter of the earnings of top researchers. The work of Richard Wilkinson, Kate Pickett and others shows that increasing inequality is correlated with misconduct, among other social ills. The finance industry is the poster-child of inequality, their machinations in the 2008 financial crisis, such as robosigning and synthetic CDOs, should be evidence enough. Which way round the chain of causation runs is not clear. Even if there is no actual misconduct, the bad incentives will still cause bad science to proliferate via natural selection, or the scientific equivalent of Gresham's Law that "bad money drives out good". The Economist's Incentive Malus, subtitled Poor scientific methods may be hereditary, is based on The natural selection of bad science by Paul E. Smaldino and Richard McElreath, which starts: Poor research design and data analysis encourage false-positive findings. Such poor methods persist despite perennial calls for improvement, suggesting that they result from something more than just misunderstanding. The persistence of poor methods results partly from incentives that favour them, leading to the natural selection of bad science. This dynamic requires no conscious strategizing—no deliberate cheating nor loafing—by scientists, only that publication is a principal factor for career advancement. The Economist writes that Smaldino and McElreath: decided to apply the methods of science to the question of why this was the case, by modelling the way scientific institutions and practices reproduce and spread, to see if they could nail down what is going on. They focused in particular on incentives within science that might lead even honest researchers to produce poor work unintentionally. To this end, they built an evolutionary computer model in which 100 laboratories competed for “pay-offs” representing prestige or funding that result from publications. ... Labs that garnered more pay-offs were more likely to pass on their methods to other, newer labs (their “progeny”). Some labs were better able to spot new results (and thus garner pay-offs) than others. Yet these labs also tended to produce more false positives—their methods were good at detecting signals in noisy data but also, as Cohen suggested, often mistook noise for a signal. More thorough labs took time to rule these false positives out, but that slowed down the rate at which they could test new hypotheses. This, in turn, meant they published fewer papers. In each cycle of “reproduction”, all the laboratories in the model performed and published their experiments. Then one—the oldest of a randomly selected subset—“died” and was removed from the model. Next, the lab with the highest pay-off score from another randomly selected group was allowed to reproduce, creating a new lab with a similar aptitude for creating real or bogus science. ... they found that labs which expended the least effort to eliminate junk science prospered and spread their methods throughout the virtual scientific community. Worse, they found that replication was did not suppress this selection process: Replication has recently become all the rage in psychology. In 2015, for example, over 200 researchers in the field repeated 100 published studies to see if the results of these could be reproduced (only 36% could). Dr Smaldino and Dr McElreath therefore modified their model to simulate the effects of replication, by randomly selecting experiments from the “published” literature to be repeated. A successful replication would boost the reputation of the lab that published the original result. Failure to replicate would result in a penalty. Worryingly, poor methods still won—albeit more slowly. This was true in even the most punitive version of the model, in which labs received a penalty 100 times the value of the original “pay-off” for a result that failed to replicate, and replication rates were high (half of all results were subject to replication efforts). The Economist reports Smaldino and McElreath's conclusion is bleak: that when the ability to publish copiously in journals determines a lab’s success, then “top-performing laboratories will always be those who are able to cut corners”—and that is regardless of the supposedly corrective process of replication. Ultimately, therefore, the way to end the proliferation of bad science is not to nag people to behave better, or even to encourage replication, but for universities and funding agencies to stop rewarding researchers who publish copiously over those who publish fewer, but perhaps higher-quality papers. Alas, the people in a position to make this change are reached this exalted state by publishing copiously, so The Economist's is a utopian suggestion. In Bad incentives in peer-reviewed science I wrote: Fixing these problems of science is a collective action problem; it requires all actors to take actions that are against their immediate interests roughly simultaneously. So nothing happens, and the long-term result is, as Arthur Caplan (of the Division of Medical Ethics at NYU's Langone Medical Center) pointed out, a total loss of science's credibility: The time for a serious, sustained international effort to halt publication pollution is now. Otherwise scientists and physicians will not have to argue about any issue—no one will believe them anyway. (see also John Michael Greer). This loss of credibility is the subject of Andrea Saltelli's Science in crisis: from the sugar scam to Brexit, our faith in experts is fading which starts: Worldwide, we are facing a joint crisis in science and expertise. This has led some observers to speak of a post-factual democracy – with Brexit and the rise of Donald Trump the results. Today, the scientific enterprise produces somewhere in the order of 2m papers a year, published in roughly 30,000 different journals. A blunt assessment has been made that perhaps half or more of all this production “will not stand the test of time”. Meanwhile, science has been challenged as an authoritative source of knowledge for both policy and everyday life, with noted major misdiagnoses in fields as disparate as forensics, preclinical and clinical medicine, chemistry, psychology and economics. Like I did above, Saltelli uses the finance analogy point out the deleterious effect of simplistic metrics - you get what you reward: One can see in the present critique of finance – as something having outgrown its original function into a self-serving entity – the same ingredients of the social critique of science. Thus the ethos of “little science” reminds us of the local banker of old times. Scientists in a given field knew one another, just as local bankers had lunch and played golf with their most important customers. The ethos of techno-science or mega-science is similar to that of the modern Lehman bankers, where the key actors know one another only through performance metrics. But I think in this case the analogy is misleading. The balkanization of science into many sub-fields leads to cliques and the kind of group-think illustrated in William A. Wilson's Scientific Regress: once an entire field has been created—with careers, funding, appointments, and prestige all premised upon an experimental result which was utterly false due either to fraud or to plain bad luck—pointing this fact out is not likely to be very popular. Peer review switches from merely useless to actively harmful. It may be ineffective at keeping papers with analytic or methodological flaws from being published, but it can be deadly effective at suppressing criticism of a dominant research paradigm. Charles Seife's How the FDA Manipulates the Media shows how defensive scientific institutions are becoming in the face of these problems. They are so desperate to control how the press reports science and science-based policy that they are using "close-hold embargos": The deal was this: NPR, along with a select group of media outlets, would get a briefing about an upcoming announcement by the U.S. Food and Drug Administration a day before anyone else. But in exchange for the scoop, NPR would have to abandon its reportorial independence. The FDA would dictate whom NPR's reporter could and couldn't interview. The FDA isn't the only institution doing this: This January the California Institute of Technology was sitting on a great story: researchers there had evidence of a new giant planet—Planet Nine—in the outer reaches of our solar system. The Caltech press office decided to give only a dozen reporters, including Scientific American's Michael Lemonick, early access to the scientists and their study. When the news broke, the rest of the scientific journalism community was left scrambling. “Apart from the chosen 12, those working to news deadlines were denied the opportunity to speak to the researchers, obtain independent viewpoints or have time to properly digest the published research paper,” complained BBC reporter Pallab Ghosh about Caltech's “inappropriate” favoritism in an open letter to the World Federation of Science Journalists. But it may be the only one doing it in violation of their stated policy: in June 2011, the FDA's new media policy officially killed the close-hold embargo: “A journalist may share embargoed material provided by the FDA with nonjournalists or third parties to obtain quotes or opinions prior to an embargo lift provided that the reporter secures agreement from the third party to uphold the embargo.” The downside of the close-hold embargo is obvious from this example: in 2014 the Harvard-Smithsonian Center for Astrophysics (CfA) used a close-hold embargo when it announced to a dozen reporters that researchers had discovered subtle signals of gravitational waves from the early universe. “You could only talk to other scientists who had seen the papers already; we didn't want them shared unduly,” says Christine Pulliam, the media relations manager for CfA. Unfortunately, the list of approved scientists provided by CfA listed only theoreticians, not experimentalists—and only an experimentalist was likely to see the flaw that doomed the study. (The team was seeing the signature of cosmic dust, not gravitational waves.) Defensiveness is rampant. Cory Doctorow's Psychology's reproducibility crisis: why statisticians are publicly calling out social scientists reports on a response by Andrew Gelman, a professor of statistics and political science, and director of Columbia's Applied Statistics Center, to a screed by Princeton University psychology professor Susan Fiske, a past president of the Association for Psychological Science. Fiske is unhappy that "self-appointed data police" are using blogs and other social media to criticize published research via "methodological terrorism", instead of using the properly peer-reviewed and "monitored channels". Gelman's long and detailed blog post starts: Fiske doesn’t like when people use social media to publish negative comments on published research. She’s implicitly following what I’ve sometimes called the research incumbency rule: that, once an article is published in some approved venue, it should be taken as truth. I’ve written elsewhere on my problems with this attitude—in short, (a) many published papers are clearly in error, which can often be seen just by internal examination of the claims and which becomes even clearer following unsuccessful replication, and (b) publication itself is such a crapshoot that it’s a statistical error to draw a bright line between published and unpublished work. Gelman's post connects to the work of Smaldino and McElreath: Fiske expresses concerns for the careers of her friends, careers that may have been damaged by public airing of their research mistakes. Just remember that, for each of these people, there may well be three other young researchers who were doing careful, serious work but then didn’t get picked for a plum job or promotion because it was too hard to compete with other candidates who did sloppy but flashy work that got published in Psych Science or PPNAS. It goes both ways. Labels: publishing business, scholarly communication David. said... Tolu Oni et al have a comment at Nature entitled Let researchers try new paths: "When reviewers assess grants or academic performance, they focus largely on track records in a particular field. Young scientists, who must focus on developing their careers, are thus discouraged from exploration. Our own experiences provide a glimpse of the well-intentioned forces that can keep researchers from trying other paths." They have to publish lots of results that are (a) incremental but (b) attention-grabbing. Catch-22. Thus they can't take risks, which are essential to real progress. Their Four tales are instructive. More corruption: "Financial conflicts of interest were found in 40 percent of published research articles on the genetically modified crops, also known as GMO crops, French researchers said this week. The findings in the December 15 edition of the US journal PLOS ONE focused on hundreds of research articles published in international scientific journals. "We found that ties between researchers and the GM crop industry were common, with 40 percent of the articles considered displaying conflicts of interest," said the study. Researchers also found that studies that had a conflict of interest were far more likely to be favorable to GM crop companies than studies that were free of financial interference." The PLoS One paper is here. On Scientific American's blog, Steven B. Krivit and Michael J. Ravnitzky's It's Not Cold Fusion... But It's Somethinglooks at what may have been behind the notorious Pons and Fleischman "cold fusion" claim. "From this dubious beginning, to the surprise of many people, a new field of nuclear research has emerged: It offers unexplored opportunities for the scientific community. Data show that changes to atomic nuclei, including observed shifts in the abundance of isotopes, can occur without high-energy accelerators or nuclear reactors. For a century, this has been considered impossible. In hindsight, glimpses of the new phenomena were visible 27 years ago." Stephen Buryani's The hi-tech war on science fraud is another good read in this area: "One morning last summer, a German psychologist named Mathias Kauff woke up to find that he had been reprimanded by a robot. In an email, a computer program named Statcheck informed him that a 2013 paper he had published on multiculturalism and prejudice appeared to contain a number of incorrect calculations – which the program had catalogued and then posted on the internet for anyone to see." Updates on the Dyn DDoS You Were Warned A Cost-Effective Large LOCKSS Box Why Did Institutional Repositories Fail? Software Art and Emulation Software Heritage Foundation Another Vint Cerf Column RU18? Panel on Software Preservation at iPRES	cc/2020-05/en_middle_0126.json.gz/line904

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.