pred_label stringclasses 2
values | pred_label_prob float64 0.5 1 | wiki_prob float64 0.25 1 | text stringlengths 182 1.01M | source stringlengths 39 44 |
|---|---|---|---|---|
__label__wiki | 0.995817 | 0.995817 | DAWN Shares New Songs "Die Without You" and "Buttah"
Just over a year removed from releasing her new breed album, DAWN has returned with a pair of new singles. You can hear "Die Without You"...
Austra Returns with New Song "Risk It"
Austra is finally making her return. Today the Toronto artist Katie Stelmanis is reviving her project with the new single "Risk It," marking...
Kesha Parties Hard on New Song "Tonight"
Kesha is just days away from releasing her latest album High Road, and she's shared another preview of the LP with "Tonight." The song f...
Caribou Shares "Never Come Back"
Ahead of the release of his forthcoming record Suddenly, Caribou has shared a new single titled "Never Come Back." According to a press r...
Lil Nas X and Nas Join Forces for New Version of "Rodeo"
Lil Nas X performed plenty of "Old Town Road" remixes at the Grammy Awards last night (January 26) with the likes of BTS, Diplo, Mason Ramsa...
Meek Mill and Roddy Ricch Honour Nipsey Hussle with New Song "Letter to Nipsey"
Meek Mill opened last night's (January 26) Grammys tribute to Nipsey Hussle with a new song called "Letter to Nipsey." It also features a pa...
Here's Your First Look at Spike Jonze's 'Beastie Boys Story' Documentary
After revealing the project earlier this month, Spike Jonze and Beastie Boys have now shared a teaser for the forthcoming Beastie Boys Story...
TRP.P Drop Video for "Chakra Con"
Continuing to roll out videos behind last year's 2TRP.P, Toronto duo TRP.P have shared a new clip for album cut "Chakra Con." Directed an...
Billy Talent Unleash New Single "Reckless Paradise"
Canadian rockers Billy Talent have returned with a new single dubbed "Reckless Paradise." It serves as a preview to the band's next reco...
Badly Drawn Boy Declares "We Live in a Society" in New Video
Delightful English singer-songwriter Badly Drawn Boy has shared a new song today titled "Is This a Dream?" alongside a flashy new animated v...
Matthew Good Shares New Song "Selling You My Heart"
Matthew Good has shared a new single from his forthcoming album Moving Walls. The song is called "Selling You My Heart" and arrives today al... | cc/2020-05/en_middle_0128.json.gz/line824 |
__label__wiki | 0.825276 | 0.825276 | No-cry zone
"Civil society and human rights organizations call on Canada to lead Syrian no-fly zone" Neocons! Wake up! That barn door is shut, and Putin is riding the horse, bare-chested! Having said that, I would enjoy watching MiGs shoot Canadian planes out of the Syrian skies.
"To Stem the Flow of Refugees, Stop the Syrian Regime’s Barrel Bombs" From the reliably hilarious ultra-Zionist, Kenneth Roth.
"Bashar al-Assad is still the problem" Written, ironically, by Research Fellows at the International Center for the Study of Radicalisation at Kings College London.
"UPDATED: "We know everything" - Putin's interview on American CBS PLUS what was cut from the interview" "What CBS edited out of Putin's interview: "US is preparing opposition forces to fight Assad, who then flee to ISIS with American weapons" (UPDATED)"
"In "Sweeping" Interview, Putin Calls US Syria Strategy "Illegal", Details Russia's Support For Assad"
"Russia seizes initiative in Syria" Note how carefully Putin picks his spots, exploiting the real contradictions between American national interest and what the Jewish billionaires force corrupt politicians to do for World Jewry. He is working on the same contradictions in Europe to eventually break the Nudelman sanctions. Note that the Nudelman ruination of Ukraine, and the anti-Russian sanctions, were put in place as World Jewry feared exactly what Putin is doing in Syria.
"What will Obama and Putin talk about?"
Bizarro CENTCOM Twitter feed! Petulant children on the playground, upset at the time-out!
"The Terrible Flight from the Killing" I'm enjoying how the crisis has backfired on Zionism, motivating Merkel to back Putin's sanity, backing which puts the fear in the Americans of a long overdue European pivot to Russia/China.
"What ‘Axis of Evil’? Iran’s President Makes Nice in New York – Newsweek" Iran is suddenly the lynch pin in solving Middle Eastern problems, and Israel is, at best, a nuisance.
"EU labeling of West Bank goods is a ‘red line,’ Israel’s top diplomat warns"
"Shell says it will abandon oil exploration in Alaska Arctic" Shell has concluded the world-wide depression, the real reason for the plunge in oil prices, isn't ending.
"Protests at Ann Coulter Book Signing – And It’s Not Immigrants!"
"“She’s going down”: Star GOP strategist Stuart Stevens on why Hillary Clinton won’t be the Democratic nominee":
"I’m very fond of the 1968 analogy for the Democratic primary. I’m writing this piece for HBO, and it’s set in the early ’60s, so I’m reading a lot about this, so I may be under the influence; but I think that Bernie Sanders is very likely to play the role of Eugene McCarthy, knocking off a de facto incumbent.
I doubt he will be the nominee, but I also doubt that Hillary Clinton will be. I think Hillary Clinton has a superb campaign so far. Technically, her campaign staff — it’s as good as it gets. But we’ve really never seen a campaign like this; it just continues to go down. Most campaigns always stop — like, they’ll go down, they’ll go up, they’ll plateau. She’s just going down.
Some folks within her campaign — and some of her supporters who aren’t involved, officially — chalk that up in part to media bias. As someone who’s been in the situation of running a campaign and having to grapple with the media and its biases, what’s your gut response when you hear those kinds of complaints?
Give me a break. They say the New York Times [is against her]; a paper that’s endorsed every Democrat since Truman, if not before. It’s an absurdity. What they’re really saying, I think, is that they’re not being treated the same way as Barack Obama was in 2008 — which I think is true. But I don’t think we’ll ever see that again, and I think [the complaint] is sort of like showing up at the Super Bowl and saying, “Someone’s trying to tackle me!” I think it’s a joke."
I smell toast
Assad is a winner
Vela Incident
Racism makes people happy
Logical political argument
The only czars are Russian
Dead pig
Fathomless loxism
Ministry of Parasites
Oyfn Veg, Shteyt a Boym
Instagram blackmail
Hilarious stupidity
Sordid tales
Super predator
Superior people
'Dual' loyalty
Bogeyman to ally
Jaws of defeat
Nobody did anything wrong
The hole to prove it
Louche, alcoholic, lazy | cc/2020-05/en_middle_0128.json.gz/line826 |
__label__wiki | 0.682079 | 0.682079 | Calls For Controversial New Bondi Beach Mural To Be Removed
Elfy Scott
A mural created by Sydney artist Luke Cornish on Sydney's iconic Bondi Beach has made a lot of people unhappy.
Cornish's mural depicts 24 heavily-armed Australian Border Force officers with the words "not welcome to Bondi" painted above.
The mural has stirred controversy and led to Waverley Liberal councillor Leon Goltsman publicly calling for its removal on Facebook.
"The World Famous Iconic Bondi Sea Wall is supposed to be a celebration of our beach and local culture...What we have now are politically motivated offensive propaganda likely to offend families and turn away visitors," Goltsman said.
Cornish told 10 daily that he was not trying to align himself with any political parties, he was simply commenting on the inhumane treatment of asylum seekers in Australia.
READ MORE: Aussie Artist Paints Controversial George Pell Mural Next To Vatican
READ MORE: There Is Currently A Paint-Off Over The 'Egg Boy' Mural
"It's artistic expression, it shouldn't be censored, I'm not attacking anybody," he said.
The 24 officers are intended to represent the 24 suicides in offshore detention centres since 2010.
The mural accompanies an exhibition of Cornish's art that is currently being held at Bondi Pavillion and he was invited to produce the work by Waverley Council.
He said he was inspired to produce the piece as he had visited Syria multiple times in the past two years and saw what asylum-seekers were escaping first-hand.
Cornish said that despite some "initial shock" the council have been very supportive of his work.
However, he did not anticipate the amount of backlash that the work would receive.
"I knew it was going to polarise people but probably not to this extent".
bondi art
Luke Cornish
I Painted This Bondi Mural Because Australians Have Their Heads In The Sand
Aussie Artist Paints Controversial George Pell Mural Next To Vatican
Man Stabbed To Death In Bondi | cc/2020-05/en_middle_0128.json.gz/line831 |
__label__cc | 0.745704 | 0.254296 | Access and Success
Dr. Gary Michelson
Spark Grants
Final Phase 2 Spark Grant Awarded to RAND Corporation
Dec 23, 2019 | Spark Grants
We have awarded our final Phase 2 Grant to the RAND Corporation. The grant funding will be used to develop and publish an educational guidebook for correctional professionals that outlines best practices and considerations for implementing high quality college in prison programs.
The guidebook will focus on postsecondary academic programs that are intended to lead to college degrees (e.g., AA or BA). It will provide an overview of the key elements of the operating agreements which a college and correctional facility would enter into when starting such a program. These agreements define the relationship and commitment of resources from both corrections system and the colleges colleges. These commitments could include administrative support by the college and correctional facility for the program, screening and orientation of college faculty, outlining the process for recruiting and screening of students, developing protocols for students communicating with college staff, and spelling out policies for use of computers and library resources. As the federal government moves to reinstate Second Chance Pell for students in prison, and as individual states make similar investments in expanding prison education, the guidebook will serve as an essential resource for streamlining implementation and improving connectivity between correctional administrators and educators.
Providing higher education in prisons is a promising and increasingly well-recognized opportunity to improve reentry success, to improve corrections’ institutional culture, and to meet workforce development challenges for incarcerated individuals. It is also a strong deterrent for reincarceration. RAND’s meta-analysis to evaluate the effectiveness of correctional education programs found that individuals who participate in college programs while incarcerated are half as likely to be reincarcerated than those who do not.
The Michelson 20MM Foundation and its initiatives are made possible by the generous support of Gary K. Michelson, M.D. and his wife, Alya Michelson. We will be conducting Phase 3 of the Michelson Spark Grant program on February 24, 2020. To learn more please visit our webpage or sign up for notifications via the form below.
Zero-Textbook Cost (ZTC) Degrees Included in Governor Newsom’s Budget
David Helene on the Future of Emergency Student Aid
Angela DeBarger of the Hewlett Foundation on OER
Wiki Education Awarded Spark Grant to Update Dashboard
811 W. 7th St. #1026
Copyright 2019 Michelson 20MM Foundation. All rights reserved. | Handcrafted by Map & Fire.
Keep Up With Spark Grants
Interested in learning more about our Spark Grant program? Sign up for email notifications to find out more about the next funding round! | cc/2020-05/en_middle_0128.json.gz/line835 |
__label__wiki | 0.788222 | 0.788222 | Home Destinations + Landmarks Attractions Step inside an interactive ode to H-town at Open House at Sam...
Destinations + Landmarks
Step inside an interactive ode to H-town at Open House at Sam Houston Park
Cody Swann
Get a look at Houston’s past and present at Open House, a small house turned peephole public sculpture, on view at Sam Houston Park through February 2019.
Created by Houston-based artist collaborative Havel Ruck Projects (Dan Havel and Dean Ruck), Open House gives visitors an architectural gaze of both the city’s modern skyscrapers of Downtown and surrounding landscape through holes that have been carved out of the house.
Open daily from dawn to dusk, the project serves as an addition to The Heritage Society’s ten historic 19th-century buildings and exhibits exploring the city’s history. The new addition fits right in with its vintage photo-lined interior filled with images sourced from family, friends, and local resale shops representing the city’s people, places, and past.
A part of Downtown District’s Art Blocks initiative, the immersive artwork is the sixth project in this stunning series that aims to feature world-renowned artists and designers repurposing and reenergizing under-utilized spaces through public art.
For an added bonus, check out the artwork in the evening. At night, the house will even be lit from within, creating a lantern effect from the home’s Swiss cheese-like appearance.
Click here for more information on Art Blocks and Open House.
Photo: Morris Malakoff
Constructing Open House
Sourced from Cherry House Moving Company, the 1940s-era house was originally located in Santa Fe, Texas.
After moving the home to Sam Houston Park in April, Havel and Ruck started by stripping the structure’s interior and exterior. Using drill saws and other tools, they cut circular holes into the walls and filled them with PVC pipe.
At the end of the project’s run, the artists will recycle as much material as possible by distributing it to artists and craftsmen in need; the remainder of the structure will be removed, and the site restored to its original state.
About Havel Ruck Projects
Since 1994, Havel and Ruck have worked together repurposing architectural structures into works of art in public and quasi-public environments.
By reorganizing the physical construction of unremarkable spaces and places, their sculptural interventions bring attention and recognition to utilizing under-appreciated, ordinary buildings and their histories to create extraordinary visual experiences.
Among their notable projects are Inversion (2005), which transformed two of Art League Houston’s condemned studio bungalows into a temporary public art event; Fifth Ward Jam (2010), a temporary sculpture that converted a wood frame house into a performative sculpture and community stage; Give and Take (2009), a dual-site project realized as part of the exhibition No Zoning: Artists Engage Houston at the Contemporary Arts Museum, Houston; and Ripple (2018), at the Cherryhurst House in Montrose.
Open House at Sam Houston Park
Dates: On view through February 2019
Times: Open dawn to dusk daily
Location: 1100 Bagby St, Houston, TX 77002
Parking: Limited free parking is available in The Heritage Society’s lot behind the Kellum-Noble House. You may enter the parking lot from Allen Parkway inbound or from the intersection of Clay and Bagby/West Dallas. Additional parking is available at the Heritage Clay Street Garage for a fee. The Heritage Society parking lot is open from 8:30am to 5pm, Monday through Saturday.
Creator: Havel and Ruck Projects
Admission: No cover
Previous articleTop 10 Concerts & Live Shows to See in Houston: August 2018
Next articleLook crisp & cool at White Linen Night in The Heights & other WLN-inspired events
https://www.wildmoccasins.net
Cody Swann is a writer and musician born and raised in Houston. When he isn't recording or touring the country with his band, Wild Moccasins, he can be found covering live music and arts events for 365 Things to Do in Houston.
Where to Brunch in Downtown
Indulge in house-brewed beans, fancy espresso & more at Boomtown Coffee
Walkable Houston: Buffalo Bayou Park
Featured Upcoming Events
"Improv! The Musical" Feb 7, 2020
The Houston Museum of Natural Science Dec 30, 2020
Cinemark Movie Tickets Jul 1, 2020 | cc/2020-05/en_middle_0128.json.gz/line840 |
__label__wiki | 0.74634 | 0.74634 | About 3CAFA
3 Counties Anti-Fascist Alliance (3CAFA)
Fighting fascism in Gloucestershire, Herefordshire and Worcestershire
Assault On Prisoners In Sofia Central Prison, October 17 (Bulgaria)
By 3cafa
via Brighton ABC:
Jock Palfreeman
Jock Palfreeman, a young Australian anti-fascist currently serving a 20-year prison sentence for defending 2 young Roma lads being brutally attacked by fascist thugs, was attacked along with a group of his fellow prisoners on October 17. here is a statement released by him:
“On the Bulgarian Prisoners’ Rehabilitation Association’s blog I have up until now not written much if anything about myself in an attempt to keep the Association’s blog neutral and equal for all issues and prisoners in Bulgaria and specifically Sofia Central Prison. However, I have done this at the expense of not reporting the prison’s attacks against myself for my unionism and solidarity with other prisoners, in an attempt to reform the corrupt prison administration, however on Thursday 17th of October an incident occurred involving myself that must be published.
At 8.30am a guard was counting prisoners for roll call, he quickly entered a cell and demanded that all 11 occupants exit the cell into the cold corridor, but before 10 of them could react he quickly left the cell and locked the door (the speed in which he left and locked the door made it evident that the guard was looking provocation). I Jock Palfreeman was not asleep but the guard did not see me as I had just exited the toilet and I was standing behind him in the guard’s blind spot, the guard swore at the 10 prisoners and said “now you’re going to see what will happen to you”.
However when the guard locked the cell door, I immediately banged on the door as it was getting close to when I had to go to my university studies at 9am. One of the guards shouted “you’re too late for roll call”, I replied “I’m not too late I have been up since 7am, you just didn’t see me as I just left the toilet, I was standing behind you”, the guard from the previous shift told me that he would open the door for me, but the guards started arguing with each other, one wanted to open the door, the other wouldn’t let him. The guards left the block at about 8.45am.
I sat down and waited to be let out to go to the study room, but at about 8.50am 50 guards rushed into the cell, took all of us out of the cell, 11 people, all of whom had not been in bed since the argument with the guard at 8.45am. The guards took all of us into the corridor and started viciously beating all of us. They used their boots, batons and also punches with their fists, they also took us by the hair and rammed our heads against the wall, myself included.
They lined us up against the wall and about 50 guards started beating everyone from behind. We were 3 Iranians, 6 Iraqis, 1 Sudanese and myself – Jock Palfreeman – citizen of Sofia Central Prison. The guards were comprised of two shifts, from the days of the 16th and the 17th. There were 2 commanding officers and 2 sub-commanding officers and the rest were normal prisoner guards.
During the attack I was shouting “this is a crime” and other prisoners were shouting “Why?”, because they did not speak Bulgarian, all they could say was “Why?”. After the attack had finished, I started to explain to the commanding officer that I didn’t have anything to do with any problem, the guard making the roll call had simply not seen me and that after I explained the situation to him he had refused to re-open the cell door again and that I had the right to go to the study room at 9am.
As I was explaining this, the same guard from the roll call, burst through the other guards, grabbed my shoulder from behind and started hitting me in the stomach and upper body. After this individual guard had finished beating me the commanding officer started threatening us, he said “I don’t care about the human rights organisations, I don’t care about your embassies, this is Bulgaria and we will beat you when we want”, I started to argue with him and he shouted “Shut up or I’ll cut off your beard and shave your head”, this threat perplexed me as it seemed out of context for the violent environment the guards had just put us through. I was shocked into silence as the threat was just so random and although very illegal, somewhat comical.
We were put back in the cell and the guards left. At 9.05am a group of us went to the bars that divide the block’s corridor from the stairs that leave to the block’s exit. Several prisoners wanted to go to the gym as it was their allocated time at 9am, others wanted to go to the Bulgarian language lessons also set at 9am, and I wanted to go to the study room for my own studies. But the same guard from the morning roll call refused to open the corridor gate and instead ran away. I believe that he thought that everyone was coming to him in a big group so as to seek revenge for his previous attack against 17th cell.
The guard was an old guard but new in Sofia Central Prison and so as is typical in Bulgarian institutions, none of his superiors properly instructed him to the fact that at 9am many prisoners have to leave the block to go to their respective activities (which aren’t many so should not have been hard to have known).
So the guard upon seeing people gathering around the gate ran and called the commanding officer thinking that a group was assembling for revenge for the guards’ earlier attack. We could hear him on the phone downstairs telling the commanding officer that a large group of prisoners are at the gates and that he needed help.
About 5 minutes later (which is amazing reaction time considering it can take over 30 minutes for medical help) 30 guards came running up the stairs and they assembled outside the gate of 10th group. They told all the prisoners to go into their cells, which all the prisoners did, including myself. The guards then tried to open the gate but they soon found out they couldn’t. I looked out of my cell and saw that there was a pad lock on the inside of the gate that the guards couldn’t reach.
They tried by force to open the gate by barging it, but the padlock wouldn’t break. I then realized that this was my only opportunity to call for external help. I took my prison phone card and went to the phone in the corridor about 2 metres from the gate where the guards were and I called a lawyer, the Bulgarian Helsinki Committee and the Australian consulate.
The guards started banging on the metal gate with metal rods, shouting and they also turned on the block’s siren to try and drown out my conversation with the consul and the lawyer. I told them one by one “please come ASAP, the guards beat us at 8.45 and they’re coming again to beat us”. After I made my phone calls I returned to my cell at 9.11, we know the exact time due to the recorded phone calls.
What is also interesting is at this time the prison told all the lawyers to leave from the lawyer consultation room at the other end of the prison then the prison administration shut down the lawyer consultation room. The prison administration tried all they could to try and stop their crime from leaving the premises of the prison and the confines of the prison administration. It is also completely illegal to expel lawyers from the prison premises, even more so during working hours. The right for a prisoner to meet with his/her lawyer is non-negotiable and this was another extreme violation of prisoners’ rights.
A prisoner from prisoner maintenance Budimir Kujovic came and cut the lock off the gate at about 9.15am and the guards ran into the empty corridor as if they were charging down for a rugby ball despite the total lack of aggression from the behalf of prisoners. They locked all the cell doors and entered 17th cell, my cell. They again started beating everyone with batons, punches, kicks and ramming heads against walls.
After they stopped beating us I asked the sub-commander “why have you come back to this cell? Why are you angry with us specifically?” the sub-commander replied “you (collective ‘you’) have made us come back twice today”, I said “we didn’t make you come one time, people wanted to go to their work and the gym and that guard called you here”.
Despite the beatings I was completely calm as were the other 10 prisoners. They handcuffed us all and they said “ok now we will start the search for telephones”. 5 minutes into the search I was taken out of the block and put into a temporary holding cell on the other side of the prison. I asked the arresting officer “why have you restrained me in handcuffs?” he replied “we (the guards) have been sick of your group for over two months now”, meaning that the problem wasn’t with me individually but rather the guards were trying to make a collective punishment on the entire group.
A normal search of a cell would take about 45 minutes, however they searched the cell for about 3 hours and confiscated only an undocumented hotplate for cooking and furniture. No mobile phone was found and the guards went crazy that not a single mobile could be found, this is as they are all acutely aware of the problem of corruption within the prison administration and therefore presume that every prisoner has a mobile.
The same guard who had provoked the two incidents then came to me in the temporary holding cell and tried to intimidate me to sign as a witness for the search in 17th cell that had been carried out without me, I flatly refused and explained that I would not be a witness for something that I didn’t in fact witness.
With nothing illegal found in the cell, the guards then tried threatening other prisoners to testify against me, but out of about 100 prisoners not a single one would lie, all of them stuck to the truth as they saw and heard it. I was kept in the temporary holding cell (which can be said to be less then comfortable) all day, but allowed visits from the Bulgarian Helsinki Committee, a lawyer and the Honorary Consul of Australia. At 4.30pm I was returned without explanation to 10th group, but needless to say all my personal belongings had been thrown around, destroyed or confiscated.
The prison administration wanted to put me in isolation, but could not find legal grounds to do this especially as my lawyer was present. So they took the administrative decision to move me from my old cell to a different cell, in a petty attempt to increase my discomfort, however for those of you who know me personally, you know I love camping!
An ‘investigation’ was carried out and concluded by the prison administration but has yet to be revealed, the Bulgarian Helsinki Committee have conducted their own investigation as well as the Ombudsman’s office of Bulgaria. The matter has been referred to the regional prosecutors office, but experience tells us not to expect anything when it comes to the Bulgarian state investigating itself.
The instigating guard was not moved from the block and on Monday the 21st of October he started threatening prisoners to not testify against him; however on the 25th of October he was moved to another place within the prison to separate him from his victims.
This is another case of unacceptable violence against the human rights of prisoners in Bulgaria, the commanding officers should be sanctioned, failing this the Association asks for the resignation of the Director Peter Krestev, so that law might prevail within Bulgarian prisons!”
Bulgarian Prisoners’ Rehabilitation Association
How you can help: see Freejock.com
Leave a comment | tags: 325nostate, abuse, Anti-fascism, Anti-fascist, australian, Brighton anarchist black cross, brutality, bulgaria, freejock, international news, Jock Palfreeman, Prison, prison guards, roma, sofia, sofia central prison, Violence | posted in Uncategorized
KKK man pleads guilty to stirring racial hatred over ‘mock golliwog hanging’
Christopher Philips – formerly known as Darren Clifft – admitted posting the three videos on YouTube from a March music concert, organised by an extreme right-wing group.
A 23-year old man, who posted pictures of himself in Ku Klux Klan regalia and hanging a life-sized golliwog doll, has admitted stirring racial hatred.
Christopher Philips – formerly known as Darren Clifft – admitted posting the three videos on YouTube from a March music concert, organised by an extreme right-wing group in West Wales.
Philips from Wolverhampton was arrested later that month following an investigation by the West Midlands Counter Terrorism Unit. Yesterday he admitted the race offence.
Philips was conditionally bailed to re-appear at court for sentencing on December 19. He was warned a prison sentence is likely.
Philips pleaded not guilty to a second charge of stirring racial hatred which the prosecution will ask to remain on file.
Det Insp Darren Powney said: “We reacted quickly to investigate this matter and bring the offender before the courts.
“We understand how offensive and distressing this type of material can be and urge anyone who has concerns about extremist behaviour of any type to contact the police on 101.”
Extremism on the internet can also be reported to a dedicated counter terrorism police unit by using an anonymous online reporting form, which can be found here: http://www.gov.uk/report-extremism
White supremacist sicko Clifft gives white power salute outside Wolverhampton crown court last week
Previous 3CAFA posting on Clifft here
Article from EDLNews here
Leave a comment | tags: Christopher Philips, Darren Clifft, EDLNews, hanging, KKK, Ku Klux Klan, Midlands, Neo nazi, racial hated, swansea, Walsall, white supremacist, Wolverhampton | posted in Uncategorized
A medal at the British embassy for Birmingham’s Neo-Nazi terrorist
Of all the circumstances surrounding last week’s conviction of Britain’s Neo-Nazi Ukrainian born terrorist, Pavlo Lapshyn, the London press’ failure to join the dots, even to call him a terrorist, is scandal all of its own.
When considering state actors’ role in aiding domestic terrorism, the London press has a blind spot. They seem to forget that during the 1970s & 1980s Irish troubles, state complicity and ‘collusion’ was pouring petrol on the flames. Evidence has been around for years that the British Army’s Force Research Unit (FRU), Brigadier Gordon Kerr specifically, was an integral part of the anti-IRA, Loyalist terror program.
State terrorism in Northern Ireland
State collusion with British terrorists arguably represents the greatest threat to UK national security, because it has gone almost entirely unrecognized and unpunished. This week Irish writer, Anne Cadwallader, pointed out in her new book about the Irish troubles, ‘Lethal Allies’, that serving policemen in the Royal Ulster Constabulary (RUC) instigated and took part in terrorist murders of Catholics. Along with the unofficial ‘shoot to kill’ policy, this collusion was a powerful recruiting tool, generating ever more terrorism.
Collusion also turned Northern Ireland into a civil war training ground for the police and army, pitting soldiers against urban guerrillas. Cadwallader says: “There was systematic collusion in the 1970s… there must have been somebody trying to push Northern Ireland over the edge of the abyss. If there had been a virtual civil war, I think it would have suited some people in London.”
The disbanding first of the British Army’s Ulster Defence Regiment (UDR) and then the RUC police force in Northern Ireland were, arguably, two of the most important acts that paved the way for the peace we see in the province today. Since so few were brought to justice for these state-sanctioned assassinations, it is absurd to suggest, as so many do, that UK state terrorism is ‘all in the past’.
Birmingham’s summer of terror
Britain’s most recent terrorist, 25 year old Ukrainian, Pavlo Lapshyn, who was convicted last week, was extraordinary in many ways. Despite a racially motivated murder and three bombs including Mosque bombings and a nail bomb, most of the London media used the word ‘murderer’ rather than ‘terrorist’ to describe him. The fact that no-one was killed by his bombs, which terrorized Birmingham’s Muslim community over the summer months, was described by the city’s spiritual leaders, quite rightly, as a miracle.
Lapshyn turned up in Britain in the spring, having won a work experience intern competition run by the robotics software company, Delcam. Astonishingly, this competition was run in conjunction with the British Embassy in Kiev, where he received his ticket to the UK from the British ambassador himself.
It is the Diplomatic Service and Foreign Office’s job to look into the credentials of anyone taking up residence in Britain. Yet not only, it seems, did they miss Lapshyn’s fanatical Neo-Nazism but failed to notice that he had been arrested in Dnepropetrovsk, Ukraine, in 2010 for using home-made explosives to virtually destroy the flat he was living in. Despite blowing out his mother’s doors and windows, Ukrainian police let him off with a caution because he said he was simply doing a ‘science experiment’.
Whether MI6 and the Diplomatic Service failed to do their job when vetting Lapshyn or not rather depends what their real job was. Incredible though it will seem to some, Lapshyn might have been identified by MI6 as a useful puppet to fuel sectarian strife in Britain and been conveyed to the UK for that very purpose. This is precisely the covert role the British Secret State has taken on in the past and does regularly abroad, all shrouded under the guise of ‘national security’.
Just like MI5 and GCHQ, the top echelons of MI6 operate like a cult, light years and several hermetically sealed cordons of security from democracy. The MP charged with their oversight, former Conservative Defense Secretary Sir Malcolm Rifkind, has even been criticized by former GCHQ boss Sir Francis Richards as being inappropriate.
One of Rifkind’s many jobs is working for LEK, who consult on satellite, missile, security systems and electronic warfare. He is blatantly a fox in charge of the democratic henhouse, a front in the corridors of power for the private profiteers of the NATO zone Military Industrial Complex.
The ‘lone wolf’ theory
Just five days after entering Britain and taking up residence at the Birmingham flat Delcam software provided for him, Pavlo Lapshyn crept up behind 82 year old Muslim grandfather, Mohammed Saleem, and killed him by plunging a knife into his back three times. The explanation he later gave to police was simply that Saleem ‘was not white’ and that he ‘wanted to start a race war’.
Mohammed Saleem’s daughters, Shazia Khan and Maz Saleem, say whilst dealing with the trauma of their father’s murder their grief was made worse by an excruciating struggle. It took them weeks to convince West Midlands police that their father’s murder was racially motivated.
The two sisters expressed their relief when Lapshyn confessed to the murder because they would not have to endure a lengthy and painful trial. The flip side though is we may never know whether, as the police say, the Ukrainian really was a ‘lone wolf’. The Norwegian police insisted Norwegian neo-Nazi killer of 77, Anders Breivik, was a ‘lone wolf’ too, despite some evidence of state collusion.
In the 1970s and 1980s, MI6 and the CIA were lead agencies in Operation Gladio, which recruited European Neo-Nazis like Lapshyn to commit terrorist acts in Italy, Germany, Belgium and elsewhere. The aim was to create a state of panic, a ‘Strategy of Tension’ which would enable governments to scapegoat society’s innocent minority groups and to take draconian measures, running rough-shod over civil liberties.
Otherwise professional, British police and journalists seem reluctant to take state collusion with far right terrorists seriously. One look at the 1992 three-part BBC Timewatch series on Operation Gladio should put them straight on that though. After watching it they’ll wonder, as with Norway’s Anders Breivik, are all these Nazis really just lone wolves?
In a country where the greatest threat to national security and natural justice is arguably the secret state itself, MI6 staff have once again let us all down in Birmingham. So rather than just shrugging their shoulders and turning a blind eye, perhaps named officers should be standing in the dock alongside Pavlo Lapshyn this week, ‘fessing up, and serving long jail sentences too.
Leave a comment | tags: BNP, british state, collusion, EDL, English Defence League, islamophobia, military, mosque bomb, murder, nail bomb, Nazi, Neo nazi, NF, northern ireland, Pavlo Lapshyn, racist hate campaign, secret services, terror, Terrorism, tipton, Walsall, white supremacy, Wolverhampton | posted in Uncategorized
Black Country mosque bomber Pavlo Lapshyn jailed for life
A racist terrorist who planted bombs at three mosques in the Black Country and murdered a man was today jailed for life.
Pavlo Lapshyn will spend a minimum of 40 years behind bars after mounting his campaign of terror across the West Midlands.
His sentencing was delayed after a suspect package was found in the court sparking an evacuation of the Old Bailey.
Staff and members of the public were told to leave the building shortly after 1pm while investigations were carried out.
After the unnamed item was checked thought officials said it was not a danger to the public.
No –one was detained in relation to the drama.
Jailing Lapshyn at the Old Bailey today, Judge Nigel Sweeney said: “You clearly hold extreme right wing, white supremacist views.
“Such views, hatred and motivation, are abhorrent to all right thinking people and have no place whatsoever in our multi faith, multi-cultural society.
“You were intent on finding a Muslim to murder, it seems to me you acted alone and were motivated by your extreme, appalling prejudices.”
West Midlands Police footage of the interview with jailed terrorist Pavlo Lapshyn.
The 25-year-old Ukranian had wanted to start a race war and told police he targeted his victims simply because they were not white.
But today Lapshyn, who was described by police as ‘extremely dangerous’, was handed the lengthy prison term.
The nail bomber’s 90-day campaign of terror began just five days after he entered the country.
He stabbed Mohammed Saleem three times in the back, killing the 82-year-old as he walked home from evening prayers in Birmingham on April 29.
On June 21, he targeted Walsall’s Aisha Mosque in Rutter Street, Caldmore, when he planted explosive devices in a child’s lunch box at the mosque gates.
Then seven days later he placed a bomb on a roundabout near Wolverhampton Central Mosque.
But his most serious attack was at Kanz-ul-Iman mosque in Tipton, where he packed hundreds of nails in a bomb on a railway embankment next to the mosque’s car park.
Pavlo Lapshyn is seen blowing up a tree believed to be in Ukraine in footage released by West Midlands Police.
Worshippers were only saved from serious harm as Friday afternoon prayers were being held an hour later than usual on the first Friday of Ramadan.
Lapshyn said he had planted the bombs because he wanted to ‘increase racial hatred’.
On Monday Lapshyn admitted murdering Mr Saleem, causing an explosion on July 12 and engaging in conduct in preparation of terrorist acts between April 24 and July 18.
Leave a comment | tags: bomb, explosive, IED, islamophobia, Jail, life, Mohammed Saleem, mosque, murder, muslims, nail bomb, Neo nazi, Pavlo Lapshyn, race hate, Racist, racist hate campaign, right wing, supremacy, tipton, Walsall, West Midlands, white, Wolverhampton | posted in Uncategorized
Man admits pensioner murder and mosque attack
A Ukrainian student with a hatred of “non-whites” pleads guilty to stabbing an 82-year-old grandfather to death and causing explosions near mosques in the West Midlands.
Pavlo Lapshyn
Pavlo Lapshyn, a postgraduate student from Dnipropetrovsk, in Ukraine, who moved to Birmingham after winning a work placement contest, was charged with the murder of Mohammed Saleem as he walked home from a mosque.
Mr Saleem, the pensioner and father-of-seven, was stabbed three times just yards from his house as he walked home alone after worship on 29 April. He was described as “a much-loved and respected community member” in a family statement at the time.
Twenty-five-year-old Lapshyn also admitted to causing an explosion on 12 July near the Kanzal Iman mosque in Tipton and planting bombs near mosques in Walsall and Wolverhampton, researching locations to plant bombs and buying chemicals on the internet to make explosives.
He will reappear at the Old Bailey for sentencing on Friday 25 October.
Mohammed Saleem
The court heard how the self-confessed racist, from Dnipropetrovesk but in the UK on a year-long visa had “acted alone.”
Detective Superintendent Shaun Edwards, from the West Midlands Counter Terrorism Unit, said: “In interview Lapshyn stressed he was acting alone – not part of a wider cell or influenced by any group – and was keen to take credit for masterminding and carrying out the attacks.”
Mr Lapshyn would undoubtedly have gone on to ramp-up his bombing campaign, had he not been caught, the court heard.
Mr Edwards added: “We found part-made devices in Lapshyn’s room – plus chemicals and bomb-making equipment – so it is clear he planned to place further devices with the intention of killing or maiming innocent members of the public.
Nails collected from the blast site in Tipton
“All three of the devices he detonated were powerful but his final attack in Tipton was the first to feature shrapnel and nails.
“He placed this near the mosque’s car-park with the intention of hitting worshippers as they arrived for prayers – thankfully the service had been put back an hour so the mosque was largely deserted when the bomb went off.”
Mr Lapshyn planted the first of his improvised explosive devices – hidden in a child’s lunchbox – by gates outside Walsall’s Aisha Mosque in Rutter Street on 21 June and followed that seven days later by detonating an IED on a roundabout near Wolverhampton Central Mosque.
And on 12 July he packed hundreds of nails into a bomb placed on a rail embankment near Kanzul Iman Masjid mosque in Binfield Street, Tipton, which sent debris flying across the car-park and into a residential street.
Detectives investigating the initial Walsall blast trawled many hours of CCTV and managed to identify Lapshyn arriving at the scene with his deadly package and leaving minutes later empty handed.
More security camera scrutiny enabled officers to plot the Ukraine Metallurgical Academy graduate’s route on a bus to Birmingham and an earlier service taking him into the city centre from Small Heath.
The Ukrainian had been in the UK on a sponsored work placement at a software firm in the Small Heath area of Birmingham when he was arrested on suspicion of Mr Saleem’s murder nearby on 20 July.
Speaking outside the court, Assistant Chief Constable Marcus Beale described Lapshyn as “dangerous and evil.”
He said: “I hope they (Mr Saleem’s family) get some solace from it. You must feel for them when they lose their dad in such circumstances.
“But hopefully it will be one small step in coming to terms with what has been an awful, awful time.”
He added: “He (Lapshyn) was extremely dangerous. It is of great relief that he is not free to walk the streets any further.
“He’s a dangerous, evil and completely ill-informed man. There is no justification for the crimes he committed or the intent that he has.
“He was operating alone, he was a lone actor.”
Leave a comment | tags: bomb, explosions, explosives, islamophobia, Mohammed Saleem, mosque, murder, nailbomb, Pavlo Lapshyn, racist hate campaign, stabbing, tipton, Ukrainian student, Walsall, West Midlands, Wolverhampton | posted in Uncategorized
Men admit Gloucester mosque arson
“Two men have admitted an arson attack on a Gloucester mosque.
Clive Michael Ceronne, 37, and Ashley Henry Juggins, 20, both pleaded guilty to arson being reckless as to whether life was endangered.
The pair attempted to set fire to the Masjid-E-Noor in the city’s Ryecroft Street on June 18 this year.
Ceronne, a former security guard of Redwood Close, in Gloucester and Juggins, of Brooklyn Road in Cheltenham will be sentenced at Gloucester Crown Court on November 18.
The court previously heard the pair had bought lager, vodka and a petrol can of fuel from a London Road garage before using the fuel to set fire to the place of worship by owned by the Muslim Welfare Association.
A passer-by saw the fire and helped put it out, before severe damage was caused.
The attack came in the wake of the death of Drummer Lee Rigby.
The pair both denied a more serious charge of arson with intent to endanger life.
Prosecutor Peter Combe said this was acceptable to the crown when Juggins appeared via video link and Ceronne in the dock.
Judge Jamie Tabor QC ordered a pre-sentence report on the pair prior to their return to the same court next month.
He said: “You have both pleaded guilty to a very serious offence.
“I will however order a pre-sentence report, but I make it quite plain I am certainly not tying the hands of myself or anyone else by doing so.”
They were remanded in custody.” Link.
3CAFA previously ran this story in its early development exposing Ceronne’s links with the English Defence League and The New British Union (of fascists) here.
Courtesy of Twitter
Leave a comment | tags: arson, Ashley Henry Juggins, Ashley Juggins, Brooklyn Road, cheltenham, Clive Ceronne, Clive Michael Ceronne, EDL, endangering life, English Defence League, Fascists, Gloucester Mosque, Gloucestershire, Gloucestershire echo, local news, Masjid-E-Noor, Muslim Welfare Association, new british union, petrol can, racist hate campaign, Redwood Close, remand, ryecroft street | posted in Uncategorized
Meet violent thug Lee Tustin and the Evesham EDL
One idiot to keep an eye on. Screenshots taken 10.10.13.
Leave a comment | tags: EDL, English Defence League, Evesham, Evesham EDL, gary glitter, Lee Tustin, local news, Offenham Rovers FC, racist hate campaign, Threats, Twitter, violent thug, Worcestershire | posted in Uncategorized | cc/2020-05/en_middle_0128.json.gz/line841 |
__label__wiki | 0.714176 | 0.714176 | Earnest McKinley Howell
World shares mixed … Capital One says doubts stolen data was used for fraud … No more mini-sized toiletries at Holiday Inn
BANGKOK (AP) – World shares were mixed today as investors await an expected interest rate cut by the U.S. Federal Reserve and watched for progress in trade talks between the U.S. and China. In early trading, Germany’s DAX lost 0.7% the CAC 40 in France gave up 0.4%. Britain’s FTSE 100 added 0.2%. In Asia, Japan’s Nikkei climbed 0.4%, the Shanghai Composite index added 0.4%, while Hong Kong’s Hang Seng gained 0.1%. In South Korea, the Kospi gained 0.5% Wall Street looks set for a tepid start Dow futures down nearly 0.1% and S&P 500 futures down 0.1%.
SEATTLE (AP) – Capital One says customer information stolen by a hacker was unlikely used for fraud, but the bank says it will continue to investigate. Paige A. Thompson has been charged with a single count of computer fraud and abuse after authorities say Thompson gained access to the personal information from more than 100 million Capital One credit applications. The bank says the hacker got information such as credit scores, balances and Social Security numbers.
LONDON (AP) – British Prime Minister Boris Johnson is visiting Wales as part of a national tour intended to reassure Britons that his push for a hard Brexit won’t hurt the economy and rip apart the U.K. He faces a tough reception today from Welsh farmers, who fear economic havoc if Britain leaves the European Union without a divorce deal. They say millions of sheep might have to be slaughtered if tariffs are slapped on lamb exports to the EU.
BEIJING (AP) – Huawei’s global sales rose by double digits in the first half of this year despite being placed on a U.S. security blacklist. The Chinese tech giant’s chairman says Washington’s campaign against the company has ‘galvanized our people.’ Liang Hua says sales have suffered “some impact” since the Trump administration imposed curbs in May on sales of U.S. technology to Huawei. But he says revenue rose 23.2% and smartphone shipments were up 24%.
LONDON (AP) – The fight to save the seas from plastic waste may mean the end for mini bottles of shampoo and other toiletries that hotel guests love to stuff into their luggage. The owner of Holiday Inn and InterContinental Hotels says that its nearly 843,000 guest rooms are switching to bulk-size bathroom amenities as part of an effort to cut waste. | cc/2020-05/en_middle_0128.json.gz/line847 |
__label__cc | 0.58077 | 0.41923 | ← On climate change, forest fires and the scientific method
On the global climate change math supporting BC LNG →
On #elbowgate and Crybullies in the environmental and political spheres
Posted on May 19, 2016 by Blair
Yesterday Canadians were introduced to a relatively new phenomenon. One that is well known to anyone in the resource extraction industries or with right-of-center views but is much less well known elsewhere: the concept of crybullying and the existence of crybullies. You might not have ever heard the term so let’s start with a definition. A “crybully” has been defined as:
Someone who uses the perceived righteousness of a social justice cause as a pretext to abuse others, and then plays the victim when confronted about that abuse.
We have all seen it but most have not known what to call it. For a classic example of crybullying (or crymobs in this case) watch this video where a reporter simply trying to take pictures of a demonstration in a public space is physically assaulted by protesters. The photographer, who is standing still, is repeatedly bumped by these protesters who then turn around and demand that he be arrested for assaulting them. These activists have a simple approach as Daniel Greenfield (who has written a lot on the topic) points out:
If you don’t fight back, the crybully bullies you. If you fight back, the crybully cries and demands a safe space because you made him feel unsafe.
As for yesterday’s event, the Canadian House of Commons was preparing for an important vote, but prior to the vote the members were milling about on the floor after a break. The House was being called to order and the Honourable Members were moving to their seats. At this point two members of the NDP caucus apparently decided that it would be funny to physically block the path of a senior member of the Conservative party: MP Gord Brown. The best video of the exchange is available here. As MP Brown tries to get to his seat, the NDP member in grey repeatedly moves to block MP Brown and the female MP in grey (MP Ruth Ellen Brosseau) joins him in doing so. MP Brown repeatedly tries to get by and is repeatedly blocked. At one point MP Ellen Brosseau is seen laughing about the activity to a fellow MP in red. Prime Minister Trudeau, clearly tiring of the antics, decides to intervene and in doing so brushes MP Ellen Brosseau.
Now remember here, MP Ellen Brosseau is a former bartender at a campus pub. I’m not sure about today, but in my days as a bartender getting a tray of drinks across a bar often involved a lot of pushing and physical contact. Unfortunately, while MP Ellen Brosseau can apparently handle a room full of drunken revelers she apparently cannot bear the trauma of brief physical contact with the Prime Minister. So instead of shrugging it off, she immediately recoils back like she has been hit by a charging bull. Her reaction is reminiscent of a classic by Christian Renaldo or one of his fellows trying to draw a yellow card in a soccer match. Like Renaldo she couldn’t leave it there and felt the need to take the act to the next level. She later spoke in the House and reported that she was so traumatized that “she had to leave”. Apparently she left the Chamber to sit outside where I’m guessing they probably sprayed her with the magic spray the trainers use on the sidelines of soccer games that allows the “injured” players to heal miraculously in time for the next whistle.
Now any teacher knows exactly what happened there. The two NDP MPs were bullying Mr. Brown. They repeatedly blocked his way and then laughed as they were doing it. MP Brown didn’t know what to do as almost any response would get him in trouble. Should he push them aside and get called out for being violent or should he simply wait it out? Being a good Canadian he simply stands there and takes the abuse from his fellow members. The hall monitor (Mr. Trudeau) finally intervenes and the bullies immediately claim victim-hood and demand that the hall monitor be punished. Happily in schools they know how to handle these sorts of things but apparently not in the House of Commons.
Now if this was a one-time affair it would be nothing to talk about, but in our modern era the crybullies are gradually winning the battles and gaining in strength and the reason is simple. Being a crybully gets results. In the House case MP Ellen Brosseau got an apology out of the Prime Minister. On the street the crybullies are winning as well and they are winning because the government and the media have encouraged their behaviours.
When the protesters broke a court order on Burnaby Mountain were they thrown in jail and sent before a judge? No most were simply escorted down to the bottom of the mountain and were not charged. Only the repeat offenders were actually arrested and even then they acted outraged. I think the funniest thing I read during the protest was this:
Wiping away tears, protester Emily Cook said a friend, whom she did not identify, was arrested outside of the injunction zone just as he was telling an officer he didn’t want to be arrested.
“They did not give him the option. They gave him no warning he would be arrested. They put him in zap straps,” she said.
Here was a person breaking the law and he felt he shouldn’t be arrested because “he didn’t want to be arrested”.
In his book “Uncivil Obedience: The Tactics and Tales of a Democratic Agitator” noted former civil rights activist A. Alan Borovoy made an important point. There are two ways to protest: you can protest within the confines of the law (uncivil obedience) or you can choose to break the law (civil disobedience). If you choose the latter then you must be willing to accept the consequences of your actions. What a lot of the current generation of protesters seem not to recognize is that there is no “right” to commit civil disobedience. I listen with decreasing interest to protesters who argue about their “rights” since most appear to have no clue what a “right” actually means under the law/constitution. Most activists these days appear to believe that they should be allowed to block roads and break the law with impunity.
The real problem with activists these days is that the government has trained them to believe that they can use the tactics of civil disobedience but that will not suffer the consequences of their actions. The government has enabled the protesters. In the case of Burnaby Mountain the police actually were asking the protesters which ones wanted to be arrested instead of simply arresting the lot.
The whole civil disobedience approach hearkens back to the days of the Clayoquot protests when the protesters blocked the logging roads. As I have written previously, the major difference between the civil disobedience of 1993 and that of 2016 is in the consequences of the protesters’ actions. One feature of the protests in 1993 that has apparently been forgotten by our current generation of activists, was that back then the protesters did not simply get to walk away after being picked up by the police. These protesters were arrested, charged, and had to face the consequences of their actions in a court of law. As described in the Wikipedia article on the subject “of the 932 people arrested, 860 were prosecuted in eight trials with all those prosecuted for criminal intent found guilty”. As recounted, many of protesters ended up spending a reasonable amount of time in jail. Can you imagine a modern environmentalist discovering that their actions would get them sent to jail? Moreover, this was not a Conservative or Liberal government that had them arrested and charged, the government of the day was NDP. Their allies put them in jail. You see the government of the day recognized that their role was to ensure that the law was obeyed.
The media, meanwhile, is also to blame for encouraging this type of behaviour. Credulous reporters breathlessly recount all the horrors rained down on these crybullies. Activists storm a building and demand the right to scream with loudspeakers at the people inside and the online report includes complaints that the security team was being “disproportionately violent”. These activists force their way into a building and then the media reports that “no one was expecting such a rough reception”. I’m guessing that if I forced my way into the Vancouver Observer’s offices and started yelling into a megaphone into the editor’s face her response would be less than cordial.
To conclude this piece I will quote Daniel Greenfield again. Now to be clear here, I normally disagree with almost everything the man has to say but on this topic he is bang on:
Crybullies are everything they claim to abhor. They are narcissists who complain about selfishness. Completely incapable of human empathy, they whine that no one cares about their feelings. They are prone to cowardly acts of violence, but demand safe spaces. They are bullies who say they’re bullied.
As Canadians we have to nip this new form of protest in the bud. Instead of painting MP Ellen Brosseau as the victim we should make it clear that she was the bully and MP Brown was the victim. We have to point out the truth of the matter and call out the crybullies for what they are. Reporters need to report what is actually happening and not simply repeat the crying of the crybullies. We need to hear who was the actual aggressor even if (especially if?) that ruins the easy narrative. Put simply the media and our government need to stop being the crybullies’ patsies and enablers. Canada works because we have one law for everyone, but that is changing because our current governments lack the courage of the NDP governments of the 1990’s to simply enforce the law evenly and fairly for all.
This entry was posted in Climate Change, Climate Change Politics, Uncategorized. Bookmark the permalink.
17 Responses to On #elbowgate and Crybullies in the environmental and political spheres
Samuel Wesley says:
Awesome… well written and sooooo true !!
J West Hardin says:
Sam, please…the evidence is self explanatory…..Junior T childishly and mindlessly rampaged across the floor twice in a fit of petulant rage and physically accosted other members in the HOC….As your ‘hero’s’ knowledge of bars is so accurate, he would also know that had Mr Trudeau’s actions taken place in a public setting he would have spent the weekend in jail and it would be a judge deciding on his bail conditions while the RCMP reviewed the evidence to recommend charges to Crown Counsel….regardless of whose political party he belonged to.
Michael McCallion says:
Except it is Just in as another Attempt to make the P. (petulent) M. (mini-me) of Canada look less like the adolescent He is:
Climate Otter says:
Considering treaudeaus’ (I can never spell his name right) policies will do a lot of damage to the middle-class, he still deserved what he got. He should also get recalled.
As to social justice warriors: I’ve been at war with one of them for the last 4 years. Crybullies don’t like when their victims fight back… long story short, I not only pounded him into the ground (this was over climate change), I got him to give me good press on his home page (an ‘apology’ more or less). ‘We need to hear who was the actual aggressor ‘ – Once I posted a detailed list of his agressions against myself for all to see, he fell apart pretty quick. But like I say it took 4 years to wear him down.
Don Morris says:
How well I remember the Clayyoquot sound protests. The NDP government,though,DID pander to their constituents at first, even going so far as to provide a school bus so the protesters, most of whom claimed to be self- employed artists, could go to the welfare office in Nanaimo to collect their monthly cheques.
The Opposition at the time said they should have been cut off welfare as there was (is?) a clause in the welfare agreement that any fit person has to be actively seeking work. This was met by an embarrassed silence from the Dipper government who didn’t want to PO too many of their constituents.
The upshot of these protests was the logging contractor from Nanaimo died from a heart attack due to the stress caused by these social justice warriors, but of course that story has long been buried by a compliant media.
The sons of bitches are complicit in a good man’s death, but to these bullying scum,that’s the best result they could hope for.
Brosseau disappoints me, she used to be a down-to-earth young woman who realized her good fortune and was working hard to do a good job for her constituents.Now she’s been “Ottawashed”, NDP style, and is just another Dipper drama queen.
Good column.Well said.
John Chittick says:
I agree with most of your comment, but if you are referring to Frank Beban as the contractor who died, arguably as a result of logging protests, it was actually the Lyell Island (Queen Charlotte Islands) protests of 1985 which resulted in the formation of South Moresby Island Park.
The NDP was quite conflicted over the Clayoquot protests because the “victims” who ultimately lost their jobs were for the most part loyal NDP supporters. The protesters ultimately won virtually every conflict thanks to moral cowardice of the corporate (partially) and political class (primarily) but mostly due to the unaccountable and faux stewardship of public ownership of resources. The results were public wealth destruction on an industrial scale.
I can recall only once where the protesters were meted with justice and that was in the Walbran where the RCMP were late arriving at the scene preventing them from guarding the protesters. The contractors (Company crews were neutered by their corporate spin doctors), arrived to find the blockade unprotected by the RCMP and they cleared the road by giving the protesters flying lessons over the embankment.
Ofay Cat says:
To help put an end to crybullies, considering it’s a no win, as mentioned in the article, take the best option and beat the living shit out of the CB and you will at least have struck a blow for freedom and you WILL feel much better for it. Once a bully has been properly dealt with they usually quit being bullies.
lou ann watson says:
but if you pull your pistol and cancel their tickets for physically threatening you, it’s self defense. sorry, canada, i live in florida where that is actually possible…no snark or derision intended
prudent Scot says:
Hi — touching a woman’s breath without permission in never acceptable — hence the apology.
Eyes wide open says:
The other aisle 6 ft to the left was wide open…poor MP Brown “didn’t know what to do”
bluetech says:
Has anyone considered that Gord Brown was choosing to ‘engage’ in the little game that the NDP were playing? Stalling is, after all, a known tactic in the HoC. But they all bore the wrath of the Little Prince. As for Ms. Brousseau, her the accidental encounter that she had is a result of the arrogance of Trudeau, and unfortunately all focus on her takes the focus of the PM’s temper tantrum
Russ Mack says:
Bluetech, you hit the nail on the head. Mr. Trudeau should not have crossed the floor. Unfortunately, the Brousseau incident has diverted attention away from the actual issue.
juniorannex says:
I have been reading your blog with much interest since I first discovered it in its prior iteration about a year or so ago. With respect, I think you and everyone else focusing on elbowgate have missed the much larger point. We’re there shenanigans going on in the Commons that day? Absolutely. Did our OM embarrass himself, his party and the country? Absolutely. Were the NDP and quite probably the Tories engaging in the ‘dark arts’s of parliamentary behaviour in attempting to delay the vote? Yes. Did the NDP, and member for Quebec northern wasteland seize an opportunity borne out of incidental contact? Why, surely not; justifiably outraged I’m sure.
All of this simply highlights the sheer ineptitude, the crass pandering for headlines, that characterises our media, and I am afraid you bought into it.
The muted, or nearly non existent coverage of the actual issue that preceded this event should concern Canadians. The opposition was quite upset at the changes to parliamentary procedure contained in Motion 6, being ramrodded down their throats, and employed every stalling tactic they could imagine. What a godsend that our impetuous, PETulant prime minister chose that moment to physically intervene, thus revealing himself to Canadians and confirming the conservative charge that he just wasn’t ready. Are the Tories and NDP making that from this? Absolutely. Was it oversold as an incident, definitely.
Cheers, Ted
How hell do you edit!
CityHoller (@ToCityHoller) says:
One minor correction I would like to make in your post: Brown wasn’t going to his seat. He was performing a ceremonial march to the speaker.
From your link:
“Now normally, once MPs are assembled and ready to vote, the whips for the government and the official opposition take up a position at the south end of the House of Commons — the end farthest away from the Speaker — and then, in unison, walk the aisle of the House and present themselves in front of the Speaker and, with a bow, signify they are ready to vote. A vote can happen without this ceremony but this is the usual way.”
That also answers the question some have posed about why he didn’t just go around the NDP, his ceremonial path wouldn’t let him.
This minor correction aside, I very much enjoyed your post.
Oh geez if MPs behave like 15 year old children what hope does a country have?
Last met a crybully a long time ago, but really the meanest crybully is the one who is physically stronger than you. To stop it, you need a lot of character. Sometimes a good sudden hit with a blunt object from backwards helps, at least then the crybully needs to cry for life instead of being jocular.
Bob Durtschi says:
“Put simply the media and our government need to stop being the crybullies’ patsies and enablers. Canada works because we have one law for everyone, but that is changing because our current governments lack the courage of the NDP governments of the 1990’s to simply enforce the law evenly and fairly for all.”
The way I see it, the difference is that the current governments and media are now run by the protesters of the 1990’s. Not only is the government not enforcing the law it is actively encouraging the protestors as is the media. Witness “Occupy Wall Street”. | cc/2020-05/en_middle_0128.json.gz/line849 |
__label__wiki | 0.581985 | 0.581985 | Columns/Opinions ›
Letter: Contribute to ‘Stamp out Hunger’ food drive
Submitted by Casscounty1 on Wed, 05/10/2017 - 9:00am
Saturday, May 13 marks the 25th anniversary of one of America’s great days of giving -- the National Association of Letter Carriers Stamp Out Hunger Food Drive. Letter carriers drive through the community every day, often coming face to face with a sad reality for too many, hunger.
So, each year on the second Saturday in May, letter carriers across the country collect nonperishable food donations from our customers. These donations go directly to local food pantries to provide food to people in Cass County who need our help.
Last year, we collected over 80 million pounds of food nationally, feeding an estimated 64 million people.
Over the course of its 24-year history, the drive has collected 1.5 billion pounds of food, thanks to a postal service universal delivery network that spans the entire nation, including Puerto Rico, Guam and U.S. Virgin Islands.
Fate of key transparency bills is uncertain
By Donnis Baggett
Jim Loomis ‘The Realistic Nutritionist’
Just Reminiscing with Roy Bale
“Life’s Dues”
The creation below started as a column for writer Dan O’Connor of Nevada. Dan is a native of Tipperary Ireland, been in America a wheelbarrow load of years. He wrote a column for the paper, submitted it, they rejected it. Dan was discouraged, just canned it, then sent it to me. I looked it over, it had much good, some bad -- I could see why the paper rejected it. I took out the beer drinking and Irish Pubs and racy women, rearranged many lines, added words, sent it back, he was amazed. He said “It’s now yours.” I said, “no, it’s ‘ours.’” For my column, I added three lines, September, my dear sister Ophelia in Nevada, and my niece the girl named Sue in Nevada, who is dying of cancer. The story below could be your story, or mine. Anyone’s, really. Enjoy. Oh, yeah, “Mama” was one of my additions also. Angie will like that.
“One Stormy Night”
Tiger Times with Trevor Rogers
From time to time, it’s probably a good idea to keep you up to date on the various programs and services that L-KCISD provides. Like all businesses, the education business must constantly watch its finances and operations. We are proud to say that L-KCISD is in fine shape financially. This past year, the district was able to put about $150,000 back into its fund balance. In order to put money back at the end of the year, a district must operate in such a way that serves students and staff but at the same time is mindful of its spending. We are also proud to let you know that we had a clean audit that included receiving a perfect score of “100” on the statewide financial accountability system the state uses for school districts.
Where the water is
By John Dilmore
Pathway to the past
Submitted by Casscounty1 on Wed, 12/07/2016 - 10:32am
By Randy Grider
randy@casscountynow.com
Upcoming events at L-K CISD
By Superintendent Trevor Rogers
Texas Farm Bureau
Chicken Express
Mays Lone Star Flooring
Cass County Equipment
Genesis PrimeCare
Kelton Home Health
Ward Timber
Red River Pharmacy
Gold Star Finance
linden's weather
to the Atlanta Citizens Journal
to the Cass County Sun
The Cass County Sun
122 W. Houston Street
Linden, TX 75563
Atlanta Citizens Journal
Atlanta, TX 75551
Copyright © 2020 | Cass County Sun and Atlanta Citizens Journal | All Rights Reserved | cc/2020-05/en_middle_0128.json.gz/line864 |
__label__cc | 0.526492 | 0.473508 | Arctic Council A high level intergovernmental forum
Kingdom of Denmark
Permanent Participants
Aleut International Association (AIA)
Arctic Athabaskan Council (AAC)
Gwich'in Council International (GCI)
Inuit Circumpolar Council (ICC)
Russian Association of Indigenous Peoples of the North (RAIPON)
Saami Council (SC)
EPPR
PAME
SDWG
Other Subsidiary Bodies
Finnish Chairmanship
Icelandic Chairmanship
Icelandic Chairmanship Team
Past Chairmanships
Arctic Council Secretariat
Arctic Peoples
Task Forces SLCFC Environmental protection Danish Chairmanship IPCAP Climate change Press 11th Ministerial meeting Expert Groups Swedish Chairmanship PAME TFTIA News Languages and Cultures Oil and Gas
Press Release: Welcome to the Arctic Council Ministerial Meeting
On 15 May 2013 the Arctic Council will hold its biennial Ministerial Meeting in Kiruna in the north of Sweden. Media are invited to a web cast press briefing with the Chair of the Senior Arctic Officials on 6 May.
A little break in-between: Experience ice sculpting and dog sledding in Kiruna!
Kiruna offers a perfect setting for a relaxing break between the hectic days around the Arctic Council Ministerial Meeting. If you are a fan of unique nature, speed and challenges, you might like to climb up to the Luossa fell or race through the woods in a dogsled. Kiruna Delegates should book their excursions now since the first booking deadline is Friday 3 May.
Conference on Sustainable Business in the Arctic
On Thursday April 19 the Swedish Chairmanship hosted a Conference on Sustainable Business in the Arctic in Stockholm. Over 50 participants representing government, industry, Indigenous Peoples, research institutions, and organizations were present.
Press Accreditation for Kiruna Ministerial Meeting Closed
14-15 May the Arctic Council will hold its biennial Ministerial Meeting in Kiruna in northern Sweden. Press accreditation for the meeting is now closed. It will also be possible to follow the meeting via webcast on the Arctic Council homepage. More details will be available soon.
Provisional programme released for AMAP international science conference on Arctic Ocean Acidification, Bergen, 6-8 May
The Arctic Monitoring and Assessment Programme (AMAP) working group will organize a science conference on Arctic Ocean Acidification 6-8 May in Bergen, Norway.
Canadian Chair of Senior Arctic Officials Announced
On March 11, 2013, Leona Aglukkaq, Canadian Minister for the Arctic Council, and Canadian Foreign Affairs Minister John Baird, announced that Patrick Borbey will become Chair of the Arctic Council’s Senior Arctic Officials (SAO) for the Canadian Chairmanship from 2013-2015.
The lively town of Kiruna will host Ministerial Meeting in May
The Arctic Council Ministerial Meeting will be held 15 May in the small town in Swedish Lapland. The venue is special not only for its beautiful nature, but also for its exceptional future: in a few years the whole town will be moved to a new location a few kilometers away.
Arctic Council working groups complete documents for Ministerial
Last week three of the Arctic Council working groups held their last meetings before the Ministerial Meeting in Kiruna in May. The ACAP, CAFF, and PAME working groups made the final changes to the assessments and reports which will be presented to the Arctic Ministers. The working groups also completed reports over their activities 2011-2013 and their work plans for 2013-2015.
Video from Host Country Agreement Signing
View the video from the Host Country Agreement signing ceremony in Tromsø last week. In the video you can hear some of the speeches held by Espen Barth Eide, Carl Bildt and Leona Aglukkaq and also observe the signing of the Host Country Agreement between Norway and the new Director of the secretariat Magnús Jóhannesson.
Electronic Memory of the Arctic: Digitized History and Culture
The cultural heritage of the Arctic, the history of the exploration of the Arctic and the life of the region’s inhabitants are highly important. However, these can often be hard to restore, because the information resources are rare and incomplete, have different formats and languages and is spread across many countries.
Santa, our Arctic colleague
As December 24 draws near children all over the world wait impatiently for Santa Claus to arrive with their gifts. In the Arctic countries Santa Claus goes by many different names and wears a variety of symbolic costumes. From North America to Russia to Scandinavia, the Santa Claus figure is celebrated in different ways in the regions of the Arctic.
Discussion on Arctic climate change at COP 18
On December 6 in Doha, as the COP 18 climate change negotiations switched gears for the finale, the Swedish Chairmanship of the Arctic Council arranged a side event on climate change in the Arctic. The event was held against the background of the rapid and ominous development lately in the Arctic, in particular the past summer's sea ice melt. The event was well attended and a strong panel including Martin Lidegaard, climate and energy
New ACAP project on climate mitigation
The ACAP Working Group has approved (November 2012) a new project on Reduction of Black Carbon Emissions from Residential Wood Combustion. The ACAP project is co-lead by Norway and Finland.
2012 Arctic Report Cards describe dramatic changes in the Arctic
The Arctic Report Cards produced by the National Oceanic and Atmospheric Administration (NOAA) are a source of reliable and brief information on the current state of the Arctic environment. The Arctic Council working groups CAFF and AMAP supported work on the 2012 Report Cards, which detail dramatic changes in the Arctic with record losses of sea ice and late spring snow. The Arctic Council, through the
Introduction to the Director of the Arctic Council Secretariat
During the opening of the Senior Arctic Officials' meeting in Haparanda 14 November Magnús Jóhannesson was presented as the first Director of the new standing Secretariat of the Arctic Council in Tromsø, Norway. Mr. Jóhannesson is eager to begin work in February next year and believes that the Secretariat will be important to ensure continuity and coordination of the Arctic Council work.
Arctic Resilience Report Workshop in Finnmark
The three-day Arctic Resilience Report (ARR) workshop 29-31 October, 2012, held in Kautokeino (Guovdageaidnu in Sámi), in Northern Norway, focused on bringing the assessment of resilience closer to northern realities and also on providing an opportunity for in-depth discussion about the meeting of traditional, local and scientific knowledge in the context of resilience.
Outcomes of the Haparanda SAO Meeting
The first director for the new standing Arctic Council Secretariat in Tromsø, Norway was selected and a statement on the situation with the Permanent Participant organization RAIPON was released. All major priorities of the Swedish chairmanship in the Arctic Council were negotiated.
Haparanda SAO Meeting Next Week
Next week 14-15 November more than 120 delegates from the Arctic Council Member States, Permanent Participants, and Working Groups will travel to Haparanda in Northern Sweden for the third Senior Arctic Officials’ meeting under the Swedish Chairmanship. Haparanda is located right on the border to Finland and demonstrates the special nature of cross-national exchange in northern Scandinavia.
Preparations for the Arctic environment ministers meeting in Jukkasjärvi 5-6 February
The Arctic is undergoing rapid change due to multiple pressures such as climate change and increased global resource use. When it comes to climate change, the effects appear more rapidly in the Arctic and provide us with insights into coming global effects.
Welcome to Haparanda
On November 14-15 the Senior Arctic Officials of the Arctic Council will gather in Haparanda, Sweden, for this year’s last meeting. Haparanda is located just on the border to Finland, and is the twin town of the Finnish city Tornio where one of the hotels used for the meeting is located. Futhermore, Haparanda is home to a Sauna museum and the world’s northernmost IKEA store. A bus tour of the city for the meeting participants is planned in
Contact the Arctic Council Secretariat
Fram Centre, Postboks 6606 Langnes, 9296 Tromsø, Norway
acs@arctic-council.org
ACS Privacy Policy
Calendar Arctic Frontiers 2020 26.Jan.2020 - 30.Jan.2020
Calendar Senior Arctic Officials executive retreat 29.Jan.2020 - 30.Jan.2020
Calendar CAFF Board Meeting 03.Feb.2020 - 06.Feb.2020
Calendar PAME Working Group Meeting (PAME I-2020) 03.Feb.2020 - 07.Feb.2020 | cc/2020-05/en_middle_0128.json.gz/line868 |
__label__cc | 0.518423 | 0.481577 | "The Other Sci-Fi"
The focus of the new issue of The American Book Review (Volume 32, Number 2: January/February 2011) is "The Other Sci-Fi," and its editor is Uppinder Mehan. Here's the ToC for the Focus section:
Uppinder Mehan’s “Introduction to Focus: The Other Sci-Fi”
Anil Menon reviews Dexter Palmer’s The Dream of Perpetual Motion (St. Martin’s Press)
Rimi B. Chatterjee reviews Manjula Padmanabhan’s Escape (Picador India)
Satwik Dasgupta reviews Anil Menon’s The Beast with Nine Billion Feet (Zubaan Books)
Steven Barnes reviews Nnedi Okorafor’s Who Fears Death (DAW)
The introduction name-checks a few other authors besides those reviewed in the issue:
Nalo Hopkinson, Archie Weller, Tobias Buckell, Andrea Hairston, Celu Amberstone, Anuradha Marwah, Sheree R. Thomas, Vandana Singh, Steven Barnes, Nnedi Okorafor, Karin Lowachee are just a few of the writers who have started to explore possible futures, experiment with generic conventions, expand the boundaries of "acceptable" literature produced by the subjects of colonial processes. In the Focus of this issue of ABR, a number of these writers have come together to comment on each other's work.
Not really "a number of," more "a few," of these writers make it into the ToC, as you can see above. Unfortunately, Mehan uses the rest of the space in his essay to talk about the very works and reviewers covered in the issue, rather than about, for instance, "the boundaries of 'acceptable' literature produced by the subjects of colonial processes." Which is our loss, since many of us are eager to read more on a sparsley addressed subject. In any case, do check out the issue, if you can.
Labels: science fiction and colonial processes
2011 Tiptree Jury
This just in:
Nisi Shawl says: "I am a 2011 Tiptree Award juror. Lynne Thomas is the jury panel chair. Karen Meisner, James Nicoll, and Tansy Rayner Roberts are my other co-jurors. Nominate winners at http://tiptree.org/?page_id=41."
Labels: James Tiptree Award, Nisi Shawl
The delicious "Duchess of Newcastle"
Back in 2006, Aqueduct Press published Absolute Uncertainty, a collection of short fiction by Lucy Sussex, as volume 12 in the Conversation Pieces series. The opening story, "The Duchess of Newcastle," which Locus characterized as "a delicious original," is now available as a podcast from Terra Incognita Speculative Fiction. You can listen to it here, or download it from iTunes.
Also? You can still purchase Absolute Uncertainty here, from Aqueduct Press.
Labels: Aqueduct Books, Lucy Sussex
Red and Wild on the road!
Pan Morigan and I have hit the road with my new novel, Redwood and Wildfire and her new CD, Wild Blue!
Or really, we took to the skies on a jumbo jet to do the old fashioned, bring-it-to-the-people, live-artist-thing!
We flew down to the International Conference on the Fantastic in the Arts (ICFA) last week…a glorious conference in Orlando, Florida home of the MOUSE with great people, great conversations, meaty panels, and moving readings.
ICFA’s focus this year was the fantastic ridiculous. I was guest scholar, receiving a lifetime achievement award for my scholarly writing on SF&F. My guest scholar talk for a lively crowd of four hundred academics, writers, graduate students, fans, and critics was on satire. I used playwright Tess Onwueme and the collective performative power of Igbo women in pre-colonial Nigeria as a frame to discuss District Nine. Pre-colonial Igbo women “sat on men” if they were greedy, foolish, or a danger to the community. With the grand style of griot praise singers, the women sang and danced, hounding men with parodies day and night if they refused to listen to reason. This was “women’s war” or ogu ndem in Igbo. The paper will be published next year in the Journal of the Fantastic in the Arts.
The other guests of honor at ICFA were Connie Willis and Terry Bisson. We three were a fierce, funny crew, clowns dancing with danger, crossing the line, sharing vulnerable humanity—definitely not absurdists despairing about the meaningless of pathetic human existence. We did a panel together on the ridiculous. Andie Duncan moderated. He brought a wind-up stuffed raccoon who played jazz harmonica—just to keep us on our toes. Connie declared that we (human beings) were all imperfect “fools” and comedy allows us to appreciate our flawed human nature. I agreed. Comic writers offer up sacred fools, who trip and stumble through life, but get up again, thrilled to be alive, thrilled to make the meaning we desire, thrilled to share the stumbling and the meaning with others.
Besides panels and papers, ICFA offered many inspiring readings—Nisi Shawl read from her Belgian Congo steampunk novel-in-progress and stunned us by riffing on history that might have been. Eileen Gunn had us laughing and groaning at Twitter sex. Terry Bisson had meat on the brain! Nalo Hopkinson’s characters were dressing their spirits and tight rope walking on the gender divide.
Pan and I did a performance/reading of Redwood and Wildfire with songs from her Al Wild Blue. The audience went wild with applause. People were moved and ran right out and bought the book! I'm not kidding.
Orlando was a revelation. The salt water pool was divine. The palm trees swayed in gentle breezes—a perfect seventy five degrees. Ibises soared above lazy alligators. March is paradise in Florida. Massachusetts welcomed us home with a wintry mix. So, I finally get the Florida thing! The heady exchanges and intense discussions were so much easier to absorb having shed my boots and fleece jackets.
Talking to several younger women graduate student/professor/scholars from Iowa was one of the high points of the weekend. Despite (too) much evidence to the contrary, many of their students hold fast to the view that we have indeed reached the promised land! WOMEN don’t need feminism any more since they/we are all equal now! Sexism was back then, OLD HISTORY, it’s definitely not here and now. We’re all “the guys” now—someone said in support of the “we’re all equal now.” All of us being “the guys” is not progress! Maybe if we were all “the chicks,” I could get with it! This is such an old, exasperating refrain, it’s enough to drive you to screaming and cussing. Each generation, so much energy goes into fighting the same battles (or almost the same battles)! The persistence of the old regime is magical.
To quote Paul Éluard, the French surrealist poet:
“There is another world, and it is in this one.”
We need potent magic to make the invisible visible.
So what was hopeful was the young women scholars’ fierce commitment to do just that. They insist on feminism. They refuse the ideological fantasy that we’ve arrived at that promised land. These young women are forging ahead—prophetic scholars, speaking the words we need to hear, asking the questions that clear away the bullshit, chanting the future I’d like to see, and inviting everyone to make it up as we go along!
Hitting the road and hearing their voices is quite a treat.
Glad to have Redwood and Wildfire and Wild Blue to offer them.
Posted by Andrea Hairston at 5:46 PM 5 comments: Links to this post
Labels: Andrea Hairston, Redwood and Wildfire
Gender Imbalance in sf reviewing: the cold, hard numbers
Following the examples of VIDA, Niall Harrison does the gender balance numbers for science fiction on the Strange Horizons blog, with The SF Count. "The good news." he writes, "is that we're not more imbalanced than the mainstream venues; that bad news is that we're not really any less imbalanced, either."
Sort of makes it clear why it's a major occasion for Aqueduct Press when any of its books gets reviewed. The red and blue pie charts are absolutely brilliant.
Labels: gender and reviewing
2010 James Tiptree Jr. Award
he 2010 James Tiptree Jr. Award has been announced:
The James Tiptree, Jr. Literary Award Council is pleased to announce that the 2010 Tiptree Award is being given to Baba Yaga Laid an Egg, by Dubravka Ugresic (Canongate, 2010).
Baba Yaga Laid an Egg impressed with its power and its grace. Tiptree juror Jessa Crispin explains that the beginning of the book “does not scream science fiction or fantasy. It starts quietly, with a meditation on the author’s aging mother, and the invisibility of the older woman…. But things shift wholly in the second act, with a surreal little tale of three old ladies, newly moneyed, who check into an Eastern European health spa. There’s another revolution in the third act, where what looks like a scholarly examination of the Russian fairy tale hag erupts into a rallying cry for mistreated and invisible women everywhere.”
Crispin notes that the fairy tale figure Baba Yaga is the witch, the hag, the inappropriate wild woman, the marginalized and the despised. She represents inappropriateness, wilderness, and confusion. “She’s appropriate material for Ugresic, who was forced into exile from Croatia for her political beliefs. The jurors feel Baba Yaga Laid an Egg is a splendid representation of this type of woman, so cut out of today’s culture.”
The Honor List is a strong part of the award’s identity and is used by many readers as a recommended reading list for the rest of the year. This year’s Honor List is:
The Bone Palace by Amanda Downum (Orbit 2010) — noted for a deliciously complicated plot that challenges 21st century Earth attitudes toward transfolk. One juror noted that this book came closest among the honor list to meeting her Tiptree ideal by including a character that not only embodies a challenge to prescribed roles, but also creates a crack in or addition to the structure that carries forward to future generations.
The Hundred Thousand Kingdoms by N.K. Jemisin (Orbit 2010) — set in a matriarchal society where the privilege and expectations between the sexes are reversed, while the gender roles are different but recognizable (and believable).
“Diana Comet and the Disappearing Lover” by Sandra McDonald (published as “Diana Comet,” Strange Horizons, March 2 & March 9, 2009) — a (true) love story, in which the author does something simple but radical with the identity issues at play.
“Drag Queen Astronaut” by Sandra McDonald (Crossed Genres issue 24, November 2010) — a wonderful exploration (and ultimately an affirmation) of a gender presentation that tends to be ignored or ridiculed.
The Secret Feminist Cabal by Helen Merrick (Aqueduct Press 2009) — an academic look at the history of early feminism in science fiction, science fiction criticism, and fandom that provides a valuable documentation of our beginnings
Who Fears Death by Nnedi Okorafor (DAW 2010) —A strong female lead character breaks out of restrictive gender roles to change her life, perhaps changing history as a result. A well-written perspective on prejudice and discrimination and the lessons needed to overcome their bonds on our identities and imaginations.
Living with Ghosts by Kari Sperring (DAW 2009) — an unusual perspective in a main character —a feminized man who makes much of his living as an escort/high-class sex worker who sees ghosts when he is not expecting — or expected — to be able to do so. An excellent read.
The Colony by Jillian Weise (Soft Skull Press 2010) — Takes on the idea that pervades our culture that women have to be perfect in order to have sex with men. One juror notes: “I’ve never read a book that made a woman with one leg so sexually normal.” Smart and well written with subtle gender politics.
In addition to the honor list, this year’s jury also compiled the following long list of other works they found worthy of attention:
* Beth Bernobich, Passion Play (Tor 2010)
* Stevie Carroll, “The Monitors” (Echoes of Possibilities, edited by Aleksandr Volnov, Noble Romance Publishing 2010)
* Roxane Gay, “Things I Know About Fairy Tales” (Necessary Fiction, May 13, 2009)
* Frances Hardinge, Gullstruck Island (MacMillan 2009)
* Julia Holmes, Meeks (Small Beer Press 2010)
* Malinda Lo, Ash (Little, Brown 2009)
* Alissa Nutting, Unclean Jobs for Women and Girls (Starcherone Books 2010)
* Helen Oyeyemi, White Is for Witching (Doubleday 2009)
* Rachel Swirsky, “Eros, Philia, Agape” (Tor.com, March 3, 2009)
This year’s jurors were Penny Hill (chair), Euan Bear, Jessa Crispin, Alice Sola Kim, and Lawrence Schimel.
Labels: Helen Merrick, James Tiptree Award
An Interview with Suzy McKee Charnas
I'm pleased to reprint here Paige Clifton-Steele's interview with Suzy McKee Charnas, which appears in the current issue of the Aqueduct Gazette.
by Paige Clifton-Steele
Suzy McKee Charnas’ Dorothea Dreams, first published in 1987, which is as intricate and ethical a work as her better-known Holdfast Trilogy, has been brought back to print under Aqueduct’s new Heirloom imprint. Set against the backdrop of invisibilized urban struggles over race and inequality and the isolated drama of Land Art, Dorothea Dreams is a drama that links people of many peripheries—people at the edges of populated space and the edges of public American consciousness—together in a graceful ghost story. Aqueduct goes into depth with Suzy about her writing, her characters, and her art.
Aqueduct: Dorothea Dreams takes for its narrators two women whose position in society is precarious, counterposing the different kinds of exclusion and the different degrees to which the women (Dorothea the white elder and Bianca the Latina child) have the power to choose that position, and binds them by the common thread of male violence. What else connects these two characters, if anything?
Suzy: Ambition, however repressed or disguised; a degree of self-chosen invisibility; quick wits and flexibility in the face of exigency; strong willfulness; daring and intelligence. And probably a lot of other things that aren’t that clear to me.
Aqueduct: Dorothea Dreams takes up ideas of possession and escape to transform them into concepts that increasingly resemble one another. Dorothea herself is a woman artist whose life is possessed by the towering figures of the literal ghost who haunts her and her obsessive desert artwork. Both have a hold on her that she escapes by the end of the book, and yet both “escapes” are partial. There can be no total severance of Dorothea and her art, Dorothea and her ghost.
Suzy: Well, she escapes from the art because Roberto’s damage of it releases her—perfection is no longer possible, acceptance of the imperfect occurs, and with acceptance comes forward motion, instead of the stasis of the perfect.
As for the ghost, Dorothea takes it into and makes it part of herself—again, acceptance, not of the course of action urged on her by the ghost but of the fact that she has been that person in that situation making that choice, but that she is now a more advanced version of that person, making instead a braver choice, to mix in with chaotic and dangerous events instead of avoiding them, and take her chances with the consequences.
Aqueduct: Likewise, the character of Bianca cannot escape from the neighborhood she comes from. It’s striking that Bianca’s escape from her neighborhood becomes an intrusion on Dorothea’s escape from the New York art world, and that these events happen against the background of a history of shifting borders in the American West. Is “escape” a total fantasy in a world in which every piece of land is someone’s neighborhood, or can it be recast as a new way of negotiating neighborhood? Is our very idea of “escape” a politically charged one?
Suzy: The physical frontier in this country did in fact represent possibilities of escape from class boundaries and, often, lifelong poverty for both Spanish and Caucasian settlers, but usually at the expense of others (the Indians, imported slaves from Africa or exploited labor from China and Ireland). Add the fact that for many settlers of the west the constantly moving frontier provided a literal escape from established systems on the eastern coast, and you have a wildly fractionated and heavily charged palimpsest of “escape” facts, metaphors, and, of course, frustrations (“wherever you go, there you are”).
Aqueduct: Carolyn Ives Gilman, in Narrative Power, draws out some of the dangers of the tropes of novelistic narrative—its emphasis on the personal over the communal, the simple over the complex, conflict over consensus-building. In its very structure, Dorothea Dreams seems to argue (or at least entertain the possibility) that it’s possible to have it all: that the human interest story and the current events story can coexist. Can you talk about your attitude to storytelling? Is there any friction between the integrity of the characters you create and their suitability to illustrate the conflicts and connections that they do? Or is the unity of the political and the personal a perfect one in the storytelling? If the focus on a few characters necessarily reduces a giant story, how do you as author ensure an illuminating rather than reductive simplification?
Suzy: Look, you don’t ensure anything in this enterprise. People tend to look at finished work and read into it a great deal more pre-planning and control than actually existed in the process of envisioning and then executing. For me as an author, at any rate, I may choose a character to “stand” for an element of the story (Roberto as angry teenaged male belonging to a particular group of people with a long history and a particular vulnerability to exploitation by a stronger, richer group). But once he opens his mouth and speaks, Roberto comes to life for me. He doesn’t “take over,” as some authors will say of characters whom they wish to exalt in the eyes of others, but every word that he speaks (and dialog goes onto the page as dictation) asserts a kind of autonomy for him as he develops his own inner life.
This is true for all the characters who move beyond spear-carrier status to that of principal or comprimario part in the opera that develops from their interplay. I provide a rough framework within which they write their story. Sometimes I see something irresistible, and I reach in and tweak things to go a certain way, on the road to what I am beginning to discern as an appropriate ending for this story (or at least a stopping place). If the characters go along with it, if they fall in with the new pattern without resistance, that’s the way we go. If they drop dead on the page, I regroup and find another way, maybe to the same conclusion, maybe not.
Once they’ve spoken and made choices for themselves, they acquire an internal consistency of their own that stands, for them, in the place that what we think of as “integrity” or “coherence” stands for a real human being. The author who tries to force that integrity into a pre-determined pattern or direction risks killing a story dead.
Characters develop their own personalities and politics. As an author, you mess with them at your peril.
Aqueduct: Where does this internal consistency come from?
Suzy: I think it comes from the wisdom that the author’s unconscious has gathered from living in the world. Without that, it’s plastic toy soldiers and of no real interest to me as either writer or reader.
I write to discover what I know/think/feel about some things: my characters teach me this. My job is to accept what they open to me, and explore and develop it by making room for the characters to be what they are.
Aqueduct: One of the novel’s particular strengths seems to be its insistence on the reality of unseen connections, such as between Revolutionary France and (then) contemporary US, or between communities made disparate by gulfs of space and wealth. The ghost story at the heart of the book makes, at some level, these connections concrete and present to the intuition. What else would be lost if this book were not a ghost story? What is gained by its being one?
Suzy: Part of what would be lost is simply my own understanding of the way the world works and how history exists and persists. I take a very long view, both backward and forward (one of my best courses in college was in geology: let that stuff in, and your mind is blown permanently into dimensions of time that the dominant American culture in particular is terrified of and rejects, which I take to be one reason that my work isn’t of “best-seller” quality).
A ghost story, in the sense that you see it in Dorothea, is actually a story of the persistent influences of the past, and of our attitudes toward and relationships to the fact that there has been a past and will be a future in which we ourselves will become part of the past. There is also, in my mind, a powerful connection between the influences of the past and the arts of the present, because I am of the opinion that we do in fact reincarnate many times, and in some lifetimes we draw on our past experiences to deepen and enrich the art that we bring to the present.
Without the ghost, that deep past full of anxious echoes wouldn’t exist to ground the story in the larger flow of time that I believe we all inhabit, sometimes knowingly, sometimes not.
I also believe that our connections to the past, both personal and cultural, are vital and full of power. Without the ghost in this story, Dorothea would be adrift, as so many modern people are (or feel) adrift and unattached, careening toward unimaginable futures without direction or any feeling of agency.
Without the ghost to react to and against, Dorothea would not fully understand the power and depth of her choices in the present.
Aqueduct: Ghosts traditionally appear as reminders of tragedy not properly resolved—while resolution is the function of the memorial. Dorothea Dreams grapples with tragedy: whether it is tragedies we as a society choose not to memorialize (the encroachment into communities of color) or those we choose to memorialize, whose enormity resists our understanding (the French Revolutionary slaughterbench), we have traffic with ghosts, perhaps, because there are some tragedies that we cannot make memorial for. Can you talk about the function of memory and tragedy in your book? How is the ghost related to Dorothea’s art? How is Dorothea’s art related to the/her past?
Suzy: The ghost brings with him a small, frightened perception of one of the great tragedies (and adventures) of history: the Revolution in France of 1789 and the decades of reaction that followed that series of events. He tried to withhold himself from the great flood of emotions and events that those decades embodied in Europe. He withdrew, and circumscribed himself, making himself small and frightened, and a ready tool of administrative control.
Dorothea has also withdrawn, trying to find her own artistic authenticity as opposed to her commercial identity.
Her contact with the chaotic energy of the Cantu family and its circumstances opens a window for her to make a different choice, and she does: she rejects the ghost’s self-protective contraction into self and system, and chooses instead to openly defend the exploited and to give her creativity up to the world to enjoy and learn from—to expand back into and re-engage with the world, both through concrete action to protect the Cantu kids from the wrath of the law and through opening her artwork to the gaze of the art world.
What she remembers is that once, in another life, she made the opposite choice. That is what the ghost brings: that awareness.
What she chooses is to honor memory, and then move on, into new, riskier, more challenging territory.
Aqueduct: There’s an interesting moment near the end where Dorothea’s daughter accuses her of an essentially maternal weakness. (“Today, she suggested point blank that I see in Roberto something of my younger son in his more wayward, draft-dodging days.”) How do you see the significance of Dorothea’s role as a mother, especially with regard to death and sentimentality as her old friend and lover advances toward death? Does it speak to any generational split between women that you were seeing at the time?
Suzy: There was and is a generational divide among women about what a woman is and should be, and Dorothea has recoiled from this so far, devoting herself to something she’s seen as gender-neutral—her art. Her daughter, an active feminist of the time, has challenged Dorothea to go beyond this minimal position, to claim her rightful place as someone who challenges masculine power simply by being the powerful creative person she is.
Dorothea, strengthened by taking action in the matter of the Cantus, steps up to the plate, and can now move forward into her daughter’s more activist world of feminist resistance. Time, of course, has altered this dynamic drastically. In our debased and deeply reactionary present, Dorothea’s daughter’s children, should she have them, would be showing their female autonomy by fellating their male schoolmates in the hallways in order to be “popular” among their peers and putting up YouTube clips of themselves in poses and activities perfectly appropriate to the Playboy “bunnies” of the past as a way of demonstrating how ”free” they are.
And, as a matter of course, objecting strenuously to the term “feminist” to describe themselves.
It should be understood, by now, that what we do, we do for ourselves and our own peers; our female posterity will do “their own thing,” and it’s very likely to be their grandmothers’ “thing” and a direct repudiation of all that we hoped and fought for, for them.
Aqueduct: Ricky Maulders, Dorothea’s dying friend, is something of a reverse Orpheus. He steps briefly away from his own death in order to retrieve Dorothea from a life lived in the artificial absence of death that her privileged seclusion has become. Is he successful?
Suzy: I think probably yes. The power of death and dying is great, and I think we underestimate it out of fear. Ricky brings the world to Dorothea in a different way than Robert and Blanca bring it, but because he doesn’t reject the inevitability of his own impending death what he brings is very effective. There is nothing in this world that can’t be turned to positive effect, if the will to do this is strong enough. He brings her his courage, and she finds the strength in herself to recognize her own and begin to use it. Love doesn’t just give: it also accepts gifts.
Aqueduct: What is the relationship of the land to the politics of the book? What draws you to the desert New Mexico setting?
Suzy: The land is the place where the politics plays itself out, but when the politics are done and gone, the land will still be here and will recreate itself as a functioning part of the ecology of the future. We make the land part of our politics, but this is only a dream of the feverish human consciousness, a fantasy of dramatic meaning.
For me, the power of the setting is its age, its endurance through past time and into future time, and its impassive presence upon which we perform our ridiculous little dances of pride and possessiveness. I love the evident age of this landscape, with no luxuriant green disguise: just the bones of the planet, right out in the open, scoured and devoured by wind and water.
It puts us in our place.
Labels: Paige Clifton-Steele, Suzy McKee Charnas
"So why should I waste my beautiful mind on something like that?"
Remember Barbara Bush's rationale, at the start of the Iraq War, for suppressing news and photos of dead service members? Opposition to thinking about harsh realities has always been with us, but there's more institutional enforcement of it than there used to be.
Via Nick, an article about the increasing strictures imposed by corporate publishing:
Peck’s argument is that editing has been corrupted by the new commercial mandates of publishing – or, at least, is more prone to a precautionary principle that dictates that if there are any reasons why a reader might not like something in a book, say an unsympathetic character, then there is a case for demanding the author get rid of [it].
One promising novelist's work is rejected by an editor insisting that "No one wants to read about a child dying."
Via Balloon Juice, a much scarier story about how a protectionist approach to people's thoughts can be used: "Iowa Woman Jailed for Thinking about an Abortion." "The nurse then summoned a doctor, who questioned her further about her thoughts on ending the pregnancy. Next thing Taylor knew, she was being arrested . . . ". The linked article discusses a couple of similar attacks on pregnant women's freedom, including a Florida woman who was forcibly hospitalized upon questioning her obstetrician's judgment.
Keep your beautiful mind pure.
Posted by Josh at 11:19 PM No comments: Links to this post
Lambda Literary Awards finalists
I thought y'all would be interested in the SF/Fantasy/Horror finalists for this year's Lambda Awards:
LGBT SF/FANTASY/HORROR
Diana Comet and Other Improbable Stories, by Sandra McDonald Lethe Press [Review]
Disturbed by Her Song, by Tanith Lee Lethe Press [Interview]
Flowers of Edo, by Nene Adams Black Car Publishing
Wilde Stories 2010: The Year’s Best Gay Speculative Fiction, edited by Steve Berman Lethe Press
Wolfsbane Winter, by Jane Fletcher Bold Strokes Books
Also of interest is one of the finalists in the Lesbian Debut Fiction category:
Alcestis, by Katharine Beutner Soho Press [Review]
Reading the linked review made me want to read the book.
Labels: Lambda Literary Awards
Links for a Friday
--Anent the New York Times's coverage of the gang rape in Cleveland, Texas, which a couple of us posted about a few days ago, an update is in order. Not only did the New York Times article blame the victim, but it also excluded race issues from its report. In her post at Colorlines, The Gang Rape of a Latina 6th Grader, and a Horrific Community Response, Akiba Solomon does a superb job of discussing the rape, community reaction to it, and reactions to the reactions to the reactions-- without ignoring race issues. (Link thanks to Suzie at Echidne of the Snakes, who also posts at length on the complications of the situation omitted from the Times' article.)
--A bill sponsored by the Republicans, expected to pass easily in the US House of Representatives, will instruct the IRS to police how abortions are paid for:
To ensure that taxpayers complied with the law, IRS agents would have to investigate whether certain terminated pregnancies were the result of rape or incest. And one tax expert says that the measure could even lead to questions on tax forms: Have you had an abortion? Did you keep your receipt?
In testimony to a House taxation subcommittee on Wednesday, Thomas Barthold, the chief of staff of the nonpartisan Joint Tax Committee, confirmed that one consequence of the Republicans' "No Taxpayer Funding for Abortion Act" would be to turn IRS agents into abortion cops—that is, during an audit, they'd have to detemine, from evidence provided by the taxpayer, whether any tax benefit had been inappropriately used to pay for an abortion.
[D]uring Wednesday's hearing, Rep. Mike Thompson (D-Calif.) highlighted the IRS enforcement issue, which has until now flown under the radar. He asked:
Would a woman have to certify that the Health Savings Account funds she spent on birth control pills or for a doctor's visit weren't used to pay for an abortion? If a woman were audited, would IRS agents be at her house demanding court documents or affidavits proving that her pregnancy was the result of rape or incest?
Barthold replied that the taxpayer would have to prove that she had complied with all applicable abortion laws. Under standard audit procedure, a woman would have to provide evidence to corroborate facts about abortions, rapes, and cases of incest, says Marcus Owens, an accountant and former longtime IRS official. If a taxpayer received a deduction or tax credit for abortion costs related to a case of rape or incest, or because her life was endangered, then "on audit [she] would have to demonstrate or prove, ideally by contemporaneous written documentation, that it was incest, or rape, or [her] life was in danger," Owens says. "It would be fairly intrusive for the woman."
Not everyone has "contemporaneous written documentation" that a pregnancy was the result of rape or incest. And, as Owens notes, adults sometimes pay for abortions for their children. If H.R. 3 becomes law, parents could face IRS questions about whether they spent pre-tax money from health savings accounts on abortions for their kids. "It would seem there would have to be a question about that [in an audit] and maybe even a question on the tax return," Owens says.
Read the whole Huffington Post article here (including several updates).
--Justin Snider's interview of Finland's Minister of Education, Henna Virkunnen, appears in the Huffington Post as Keys to Finnish Educational Success: Intensive Teacher-Training, Union Collaboration. In Finland, see, people want to be teachers, but only "the top students are offered the chance to become teachers." The interview explores why that is, and offers some sense of why Finland's educational system is so successful. It makes me want to cry, as I consider how privatization is destroying what is left of the US's existing educational system. I figure I may as well be reading about a fictional utopia. (And god, how I'd like to rub a few governors' noses in it.)
--Chris Rohman reviews Andrea Hairston's Redwood and Wildfire for the Valley Advocate. A snippet:
Hairston's work, on stage and page alike, insistently searches for signs that humans can overcome their divisions and oppressions, both external and self-inflicted. This book's geographical, emotional and spiritual journeys, spanning the early years of the 20th century, are odysseys of self-discovery and healing from wounds of the body and soul. The novel mirrors the eclectic, cross-cultural composition of the Chrysalis company and Hairston's own background—a multiracial poet-playwright-actor-musician-scholar who draws nourishment from diverse traditions.
--At Val Grimm's Portal, Jaymee Goh reviews Gwyneth Jones's The Universe of Things. The lengthy reviews begins thus:
The Universe of Things is a difficult anthology to review, since it is populated by some very difficult writing, and I don’t mean the language is hard to understand. By this, I mean that the stories are very challenging, and not straightforward at all. Gwyneth Jones’ writing is unsettling, which can be interpreted as a sign of her skill as a writer.
--And finally, don't forget to get a good look at tomorrow's "supermoon" (weather permitting). The moon will be both full and closer to the Earth than it has been for 18 years. This is from Space.com:
In a statement released Friday, noted NASA scientist Jim Garvin explains the mechanics behind the moon's phases and the causes of the supermoon. Garvin is the chief scientist at NASA's Goddard Space Flight Center in Greenbelt, Md.
"'Supermoon' is a situation when the moon is slightly closer to Earth in its orbit than on average, and this effect is most noticeable when it occurs at the same time as a full moon," Garvin wrote in the NASA statement. "So, the moon may seem bigger although the difference in its distance from Earth is only a few percent at such times." [Photos: Our Changing Moon]
The full moon of March will occur next Saturday on March 19, when the moon will be about 221,567 miles (356,577 kilometers) away from Earth. The average distance between the Earth and the moon is about 238.000 miles (382.900 km).
"It is called a supermoon because this is a very noticeable alignment that at first glance would seem to have an effect," Garvin explained. "The 'super' in supermoon is really just the appearance of being closer, but unless we were measuring the Earth-Moon distance by laser rangefinders (as we do to track the LRO [Lunar Reconnaissance Orbiter] spacecraft in low lunar orbit and to watch the Earth-Moon distance over years), there is really no difference."
Labels: Andrea Hairston, Gwyneth Jones, narrative politics, reproductive rights
Wanted: professional sock puppets
Speaking of social media: Nick Fielding and Ian Cobain's Revealed: US Spy Operation That Manipulates Social Media appears in today's Guardian. Here's the deal:
A Californian corporation has been awarded a contract with the US Central Command (Centcom) to develop what is described as an "online persona management service" that will allow one serviceman or woman to control up to 10 separate identities at once.
The contract stipulates each persona must have a convincing background, history and supporting details, and that up to 50 controllers must be able to operate false identities from their workstations "without fear of being discovered by sophisticated adversaries".
The project has been likened by web experts to China's attempts to control and restrict free speech on the internet.
Centcom's contract requires the provision of one "virtual private server" in the United States and eight appearing to be outside the US to give the impression the fake personas are real people located in different parts of the world. It calls for "traffic mixing", blending the persona controllers' internet usage with the usage of people outside Centcom in a manner that must offer "excellent cover and powerful deniability".
Once developed the software could allow US service personnel, working around the clock in one location, to respond to emerging online conversations with a host of co-ordinated blogposts, tweets, retweets, chatroom posts and other interventions. Details of the contract suggest this location would be MacDill air force base near Tampa, Florida, home of US Special Operations Command.
Will sock puppeteering replace phone sales as the new job for the desperate? A science fiction writer would like to know.
At any rate, please do read this piece and then Phoebe Connolly's How Social Media Is Science Fiction. I'd be very interested to hear what you'all think.
Posted by Timmi Duchamp at 2:38 PM 1 comment: Links to this post
Labels: perception management, social media, sock puppeteering
A lot of interesting mistakes
Phoebe Connolly's "How Social Media Is Science Fiction" reports on a recent panel discussion, conducted by Annalee Newitz, which included such sf luminaries as Maureen F. McHugh, Bruce Sterling, Charlie Anders. After noting that Matt Thompson posts "a spectrum that starts with collective intelligence, goes through social media and ends with AI," Connolly writes that Maureen McHugh interestingly
reminded the crowd of Robert Heinlein's definition of three levels of science fiction -- at the first level, we're inventors in the basement, at the second level we extrapolate an infrastructure and at the third level, we're positing changes in people's behaviors as a result of this changed world.
McHugh said we're well into the second level of abstraction in how we think about social media, but we're not yet into the third. Consider multitasking -- in general, we're still bad at it, as an MIT study recently demonstrated. "And we're freaked out. But Socrates was freaked out about literacy!" McHugh noted, and the result of literacy was a written record of history. The benefits we're going to gain from offloading part of our social interaction onto the net remain to be seen.
The discussion also talked about the apparently paradoxical shift away from allowing individuals to adopt multiple identities and keeping their Real Life identity private.
It's not just the conversation that we struggle to control online, it's our very avatars. "Part of being social animals is we construct identities," said [Matt] Thompson. Increasingly, our online avatars demand that our identities merge into one--we are asked to log-on to services using an existing Twitter or Facebook account, we're discouraged from interacting anonymously, be it on Craigslist or a discussion forum. This is a change from the fears about ourselves that we expressed in science fiction of say, the 1960s. Doris Lessing, to pick one example, took up this fear in The Golden Notebook. The novel's protagonist, Anna Wulf struggles with possessing multiple social identities.
Connolly's report ends with: "McHugh captured it best: "I think we're making a lot of interesting mistakes." You can read the entire geeky report here.
Labels: maureen mchugh, privacy, social media
Is the news getting you down? Then what you need is this podcast, in which Doug Lain engages Andrea Hairston in discussing performance art, literary and film criticism, shamans, histories of what might have been, the background for writing Redwood and Wildfire, and much, much more.
Labels: Andrea Hairston, Doug Lain
"Rape-Friendly Reporting"
(As Catherine Crockett has observed, the linked conversations contain "triggery as hell" descriptions).
Supplementing Timmi's account below: here's a Mother Jones column that was an early heads-up on the article; here's a Liz Henry post with some ideas about how to support the girl; here's a piece at The Rumpus that unpacks the topic of rape culture [ETA: Ambling reader Matt Cheney contributes to the discussion and offers more links].
Posted by Josh at 8:52 PM 1 comment: Links to this post
Mean, nasty narrative politics
On February 25, 2011, the New York Times published an editorial titled The War on Women, warning readers that Republicans in Congress are waging a harsh, legislative war against women and urging President Obama to oppose their agenda. Two days ago, on International Women's Day, the same newspaper, which many people consider the most responsible daily newspaper in the US, published an article, Vicious Assault Shakes Texas Town, depicting the gang-rape of an eleven year-old-girl by 18 young men and teenaged boys. The gang-rape was exposed by the circulation of a "lurid cellphone video" at the victim's middle school. (Just think about that.) The article's chief concern was not the crime, however, but the question of how the child's "alleged" rapists "could have been drawn into such an act" and how having participated in a gang-rape will be harmful to the perpetrators:
“It’s just destroyed our community,” said Sheila Harrison, 48, a hospital worker who says she knows several of the defendants. “These boys have to live with this the rest of their lives.”
The article goes on to characterize the eleven-year old as dressing "older than her age" and asking "Where was her mother? What was her mother thinking"-- implying that the girl and her mother are to blame for bringing harm to the suspects who were somehow "drawn in" to committing the assault. "The arrests have left many wondering who will be taken into custody next," the article asserts. It ends with a quote from Stacey Gatlin, a spokeswoman for the Cleveland Independent School District: "“I really wish that this could end in a better light.”
Could someone explain to me why a newspaper that prides itself on being the model of professional journalism was unable to do better than this? What the hell does "dressing older than her age" have to do with a terrible, prolonged assault against an eleven year-old? This is an old, indeed ancient narrative that should have been retired to the misogyny farm a long, long time ago. The New York Times clearly think this old, viciously misogynistic narrative has great explanatory power for its readers, or it wouldn't have provided such hearsay "information" (in an article that is fairly sparse with information).
The irony of publishing such an article on International Women's Day and not long after warning that the GOP is waging war against women is bitter indeed.
Labels: gender and journalism, gender and narrative, rape
Aqueductista News
--Vandana Singh has joined the ranks of Strange Horizons columnists. She is debuting this week with Diffractions: Soil, Water, and Pure Air.
--Alan DeNiro writes about Kristin Livdahl's A Brood of Foxes on his blog, and Gwenda Bond affirms his opinion on her blog:
One of the best things I've read lately is Kristin Livdahl's novella from Aqueduct Press's Conversation Pieces series, A Brood of Foxes. Her husband Alan may be biased, but I agree with everything he has to say in his post about it: "There are a lot of gestures in the fantasy field lately toward having an imaginary world mimic contemporary concerns–but in A Brood of Foxes, the shape of the narrative changes to reflect the very human cost of these concerns. There are no quick fixes or any lame “journey of the hero(ine)” knock-offs while paying lip service to some kind of transgressive ideal. No boss battles!" It is gorgeous and strange and lives up to the series' title.
-- Fred Cleaver reviews 80! Memories & Reflections on Ursula K. Le Guin for the Denver Post. He concludes:
Some of the tributes provide insights into the great writers paying tribute, such as Kim Stanley Robinson and Nancy Kress. It's a book of personal messages for someone I only know through her writing, but it's a joy to read these tributes from those who also know her as a friend and teacher.
Labels: Aqueduct Books, Kristin Livdahl, Vandana Singh
New E-books from Aqueduct Press
I'm in Sunnyvale this weekend, for Potlatch, but Tom's still in Seattle and today uploaded new e-book editions to Aqueduct's site. I'm very pleased to announce that among these is a masterpiece from the 1990s, Gwyneth Jones's Aleutian Trilogy:
Winner of the 1991 James Tiptree Jr. Award
Arthur C. Clarke Award nominee
As White Queen opens, mysterious humanoids arrive on Earth in 2038; apparently telepathic hermaphrodites, they are called Aleutians. The relationship between aliens and humans becomes a metaphor for the relationship between men and women. Johnny Guglioli, exiled as a "petrovirus" victim from the United States, befriends journalist Braemar Wilson and the "woman" Clavel. From Clavel's behaviors, they deduce the insidious invasion, but cannot unriddle what the aliens want. Are they superbeings, candidly offering assistance to a world shaken up by geological and political catastrophes?
North Wind
BSFA nominee
In North Wind, set a hundred years later, the story continues, featuring a quest by both aliens and humans to find the last flowering of human technology. Bella, a crippled Aleutian, and "her" human caretaker, Sydney Carton, share an unusual relationship in a world riven by gender war. Men want to violently eradicate the Aleutians and human collaborators, while the women desire a return to power through a more nurturing society. The aleutian' proposal to level the Himalayas generates violent anti-alien sentiment. While sheltering Bella, Sydney seeks the instantaneous travel device that the legendary Johnnay Guglioli used to reach the Aleutian's starship.
Phoenix Café
Phoenix Café concludes the tale of the Aleutian invasion in a hip, dark, violent novel. Another hundred years on, the Aleutians prepare to leave both Earth and a humanity transformed in strange and sometimes unpleasant ways by two hundred years of alien exploitation. The Aleutians have the space drive. But what has humanity gained or lost, and who will pick up the pieces? This is a novel of politics, economics, sexual identity, and the fate of humanity.
We've added several other new e-book editions to our list, as well: Nicola Griffith's With Her Body, Andrea Hairston's Carl Brandon Parallax Award-winning Mindscape, Gwyneth Jones's The Universe of Things, and L. Timmel Duchamp's The Red Rose Rages (Bleeding).
Labels: Andrea Hairston, Aqueduct Books, Gwyneth Jones, l. timmel duchamp, nicola griffith
Feed Your Brain!
Just had to pass this on: Powells.com is having a "Foucault sale." Yes, you heard me. When I saw that, I peered suspiciously at the screen, wondering if I'd had too much wine with dinner. I had to investigate, of course. So here's the deal: Powells is selling, for a limited time, eleven titles by Foucault at a 30% discount. (For a list of the titles, go here.) Interestingly, they've put at the top of their Foucault sale page a large apple chewed nearly to its core, along with the invitation to "Feed Your Brain."
It's a charming idea. Perhaps next they ought to have a Simone de Beauvoir sale. Or a Virginia Woolf sale.
Labels: Michel Foucault
The lifespan of "groovy" was, you know, exceedingly short
Just a few minutes ago hail was hurtling down out of the sky and bouncing all over the place. I heard it first, and then when I looked out the window, I heard my grandmother's voice in my head, saying "Look at that! It's hailing fit to beat the band!"-- at the moment I realized it was hail, not rain pummeling every surface in sight. And then it occurred to me that although I know what the expression "fit to beat the band" means, I don't have a clue where it came from. It's just one of those mysterious idioms people use. Other expressions from that generation my grandparents frequently used was "a hill of beans, "living daylights," and "all the tea in China." (I'm sure more will come to me, if I think longer about it.) A lot of these expressions are still with us, since certain idioms and piece of slang continue to appeal to succeeding generations. (Like "cool," for instance.)
Which then led me to think about the inverse, and how irritated I felt just a few days ago, reading a scene in a novel (published in 2010) depicting someone using the expression "Duh" (in its current, not its former, sense) in 1973. I can assure you, no one said "duh" in 1973. The author probably had not yet been born in 1973. And I could easily believe the book's editors hadn't been, either. Come to think of it, "Life on Mars" (both the British and the US series) were loaded with similar kinds of anachronisms. (But of course the makers of both of those shows could cover themselves by noting that they weren't depicting life in 1973 New York or London, only dreams or fantasies about it, and even claim, if they wanted to, that anachronisms were deliberate.)
Yikes! I'm supposed to be working, not daydreaming about the mysteries of slang.
Posted by Timmi Duchamp at 3:39 PM 11 comments: Links to this post
Labels: slang
Gender Imbalance in sf reviewing: the cold, hard n...
"So why should I waste my beautiful mind on someth...
The lifespan of "groovy" was, you know, exceedingl... | cc/2020-05/en_middle_0128.json.gz/line874 |
__label__wiki | 0.63587 | 0.63587 | A Remarkable Remark
My first memory of becoming aware of the work of Professor Lee was when I opened my copy of the July 1968 issue of Le Ma顃re Phon閠ique (the precursor of the Journal of the International Phonetic Association) to find that its leading article at pages 26 to 29 was his very modestly entitled — but on reading found to be rather startling — 'A Remark on the IPA Cardinal Back Vowels'. This made the, at that time to many, disturbing suggestion that there were actually backer vowels than those that Daniel Jones had said were the backest.
It began "The value of the IPA Cardinal Vowel system as an accurate and useful device for measuring vowel sounds in phonetics has been accepted so well and so long that it seems hardly necessary for me to say anything more about it. However, the usefulness of a certain scheme in its actual application is one thing, and the validity of the definition on which such a scheme is based and operates is quite another". He went on to quote the eighth edition of the Jones Outline of English Phonetics �6 "It is from among these vowels which are as remote as possible from the ‘neutral’ position that it has been found convenient to select the ‘Cardinal Vowels’...". He added that '...it amounts to saying that any vowel of any language can be indicated on or inside the quadrilateral but not outside [and] that the Cardinal back vowels are the most extreme back vowels humanly pronounceable ... etc". He had had meeting on the topic with Daniel Jones who in the course of their discussion had confirmed that he felt that this declaration of 1956 still fully stood.
Actually, Lee had formed the opinion that in the pronunciation of some Koreans there were four back vowels that were all more back in their qualities than the four nearest Cardinals. In order to ascertain how far his auditory judgments might be confirmed he undertook spectrographic analyses of the Korean vowels in question. He was able to produce comparative tables of their first and second formants. The first table gave the values for the four Cardinal back vowels [ɑ, ɔ, o, u] uttered by himself in practically identical imitation of Jones's recordings and the second table was of corresponding vowels produced by "modifying [the tongue posture] backward from each Cardinal position". Jones's auditory judgment of Lee's retracted versions was that they, especially [ɔ] and [o], were 'somewhat lower or opener' than the corresponding Cardinals. An accompanying comparative 'acoustic chart' that Lee provided seemed to suggest that, whatever might have been the somewhat uncertain particular tongue adjustments involved, the relative plottings of the vowel formants corresponded well to what might be associated with the possibility of further retraction of the tongue.
I was intrigued by these findings especially because they seemed to contribute to the confirmation of my increasing doubts about just how appropriate the Jones system was in respect of the identification of highly precise vowel values. It was one of various things which contributed to these uncertainties. I had and still have have firm faith in the great usefulness of the system in its provision of a simple but precisely specified diagram for certain practical applications. It's an excellent means of displaying with very satisfying adequacy the contrasts involved in the systems of the vowel phonemes of most languages. It also provides an extremely effective way of displaying side by side the contrasts between one language and practically any other. Again it's especially valuable in language teaching to show the learner's values beside those of a target language. I have demonstrated my faith in the diagram's usefulness at �2 of my Website (www.yek.me.uk) where 132 examples of attempts to show the vowel systems of a wide variety of languages from all over the world may be seen.
The version of the diagram used there is a slight adaptation involving three horizontal and five vertical relatively faint additional guidelines for the eye. The vowel indicators employed are all of a size specified as approximately one-thirtieth of the total area of the diagram. Each of them is circular in shape if any degree of lip-rounding is involved and square if that is not so. All are centred either upon one of the lines of the grid or of one or other of the square or quadrilateral divisions of the diagram. Each vowel indicator is one the four colours green, blue, red and yellow (with a minor exception) according to whether it is respectively front-unrounded, back-rounded, front-rounded or back-unrounded. The purpose of the grid is to convey that the placings are schematic and symbolic and to let it be understood that it was judged that more delicate positionings or indicators of smaller sizes would undesirably suggest what should be considered inappropriate not to say spurious precision.
My misgivings with regard to the Cardinal Vowels system do not apply to its practical uses of the types I have mentioned but to its appropriateness when it comes to specifying very precise vowel qualities. The more I observe the variabilities in the ways speakers employ their vocalic phonemes the more I feel unable to accept that specifications for phonemes should go beyond the degree of precision that can be for most items conveniently represented by a chart of the simplicity described above. The 'pinhead' dots (as small as one three hundredth of the area of the chart or even smaller) that some users of the IPA diagram still employ, for example in the latest editions of Jones's (now called by its publishers "The Cambridge") English Pronouncing Dictionary, to indicate phonemes seem to me to involve undesirably inappropriate implications.
Jones himself relaxed quite notably in the course of his long career in respect of the sizes of his vowel indicators. In his earliest diagrams the vowel indicators of the largest types he used were so small that that they occupied no more than about that one three-hundredth of the total area of the diagram. By the time he designed his last ones they were much more than twice his previous maximum sizes. Other evidence of his increasing cautiousness in respect of the doubtfully justified precision adopted in representing vowels on diagrams was his use of progressively simpler more regularised outlines for those diagrams. Beginning with trapezoids, he progressively straightened their backs and converted them to trapeziums i.e. with tops and bottoms horizontal and parallel.
Fig. 7. Jones Outline 1932-1956
A striking revelation came in 1932 at his Outline �5 when he published the most thoroughgoing of all the revisions of his Outline. There he introduced for the first time his most drastically simplified of all his versions of his Cardinal Vowels diagram. It is of course very significant that this very form has now actually became the only shape authorised by the International Phonetic Association with the publication of its important Handbook of 1999. Actually, Jones really only explicitly sanctioned this trapezium for use as a 'Simplified Chart of English Vowels for use in practical teaching of the language'. Various of the adustments it revealed him as willing to accept as teaching targets were quite surprisingly drastic. For example he moved /ᴧ/ from 'Half-open' (now called 'Open Mid') Near-Back to completely Central. He made several other similarly considerable moves.
During the period in which Hyun-Bok Lee was preparing his paper another researcher was finalising his assembly of what amounted to a very extensive and penetrating critique of the physiology-based approach to the analysis and description vowels — to what in fact can be said to have culminated in Daniel Jones's setting up of his Cardinal Vowels system. This other researcher was Peter Ladefoged (1925-2006) who finally published his findings in a major article summarising what had been in fact largely his work for his doctoral degree. This article was the 92-page centrepiece on 'The Nature of Vowel Quality' of his 1967 book entitled Three Areas of Experimental Phonetics. Its companion articles together occupied much less space than the main one did but the final one, which was of about thirty pages, was concerned with very much the same essential topic as the central one.
Since the publication of Hyun-Bok Lee's article his findings have remained unchallenged to the best of my knowledge and Daniel Jones never enlarged upon his initial comments. In the far-off days when our present universal easy access to high-quality recording and playback equipment was merely a dream of the future it was understandably felt to be enormously valuable to communicate on paper relatively precise information with respect to vowels and other sounds. This is now no longer felt to be such a vital necessity.
Although Ladefoged's extensive work had mounted the most cogent and complete undermining of reliance on the assumptions on which Jones had based his Cardinal Vowels scheme which, incidentally, he had developed from a basis invented by Alexander Melville Bell (1890-1905) and accepted by Jones's mentor Paul Passy (1859-1940), it was by no means the first. Ladefoged quotes the forceful comment of the very important American researcher George Oscar Russell (1890-1962) who, in one or other of his two 1928 publications both titled (initially but with diffferent extensions) The Vowel, remarked that "phoneticians are thinking in terms of acoustic fact and using physiological fantasy to express the idea". In the circumstances there is no argument but that Hyun-Bok Lee's "Remark" was to be taken very seriously. Indeed it is to be considered as a valuable early corroboration in a location not then pursued by other researchers, of the scientific dubiousness of the basis of Jones's system of vowel classification. | cc/2020-05/en_middle_0128.json.gz/line877 |
__label__cc | 0.564594 | 0.435406 | BOOM! Anti- Conservative Restaurant CLOSES After Disgusting Facebook Post Emerges… SPREAD THIS!
Dean James III% AMERICA’S FREEDOM FIGHTERS –
The owner of a Massachusetts coffee shop said she was closing the business due to the backlash following her daughter’s controversial comments about cops on Facebook.
Over the weekend, Sophie CK, the 23-year-old daughter of shop owner Kato Mele, started a firestorm when she vowed on her personal Facebook page never to allow a “Coffee with a Cop” event to take place at her family’s establishment.
The post started a debate that took a different turn when Sophie called police officers bullies and racists. In turn, social media users called for people to ban the coffeehouse, Fox News reported.
“She has taken down her Facebook page and is receiving death threats and is hiding right now,” Mele said. “I am not of the same opinion and yet I am being held accountable for someone else’s opinion and it’s not going to stop.”
That anti police post went viral and now the owner of the year-old White Rose Coffeehouse in Lynn, Mass., told Thomas Grillo at The Daily Item she was closing the store “so I can stop being harassed.”
“I’ve lost my business and I’ve lost my daughter. I don’t know how this story just keeps building, but I need people to leave me alone,” Mele told The Daily Item. “I’m closing my business so I can stop being harassed.”
Mele fired her daughter and wrote police an apology, calling the remarks “distasteful, biased and hateful.” She invited officers to the shop Monday for coffee.
In a letter to the Lynn Police Department, Mele apologized for what she called the reprehensible affront, distasteful, biased and hateful remarks made by her daughter on Facebook.
“The White Rose Coffee House publicly acknowledges and apologizes to all Law Enforcement agencies and specifically the Lynn Massachusetts Police Department for the reprehensible affront, distasteful, biased and hateful remarks made by the manager of the White Rose on a personal Facebook page.
We do not share any of the views expressed and are, in reality, proud and grateful to all law enforcement for their strength and brave disregard to their personal safety that they risk daily which allows us to live, work and worship in a sometimes hostile world.
Amazingly, they do so frequently under unwarranted scrutiny and with ever diminishing resources. The men and women of law enforcement are heroic. Make no mistake: I am incredibly proud of them and what they do.
Effective immediately, the manager of the White Rose Coffee House is terminated for cause.
The White Rose Coffee House realizes that we have a long road to hoe to ingratiate and demonstrate our true appreciation for law enforcement and all first responders. As a beginning, I invite interested Lynn law enforcement to visit the White Rose on Monday, Oct. 16, or anytime, to help us make amends, but more importantly provide us with some guidance and suggestions that through a cooperative effort will help make an ever improving Lynn.
I look forward to seeing you all. With gratitude and sincerest support….
Kato Mele
White Rose Coffee House
For the record, police did NOT show up and the usual customers didn’t show up either so Kato Mele has shut down her business- all because her daughter is a liberal cop hating moron.
(h/t Daily Mail)
TOGETHER WE WILL MAKE AMERICA GREAT AGAIN!
Dean James III% AMERICA’S FREEDOM FIGHTERS
FOLLOW us on Facebook at Nation In Distress!
Please like and share on Facebook and Twitter! | cc/2020-05/en_middle_0128.json.gz/line883 |
__label__cc | 0.670836 | 0.329164 | Hannibal and Me: life lessons from history
Book synopsis
Reviews & excerpts
A conversation about the book
The Economist & me
Tag Archives: Isaac Newton
Must great thinkers be “right”?
First an apple dropped, then ein Stein
We left off this search for the greatest thinker by laying down one criterion: Simplicity. Now we need to examine another. Is it necessary for a thinker to be right in order to be great?
This is a tough one. The answer, as the Germans would say, is Jein–ie, both Ja and Nein, Yes and No (I guess that would be Yo in English). Let me illustrate what I mean with four examples out of many. These are people whose thought a) simplified enormous complexity and b) turned out to be wrong: Isaac Newton, Plato, Sigmund Freud, and Karl Marx (whom at least one of you has nominated).
Nein (1): The case of Newton
I hardly need to make the case that Isaac Newton was one of the greatest thinkers ever. While the plague ravaged England, this twenty-something went home to the isolation of his farm, used his imagination and reason, and gave us breakthroughs in understanding (wait for it)…. calculus, light and gravity. That’s a lot for one or two years, you will agree. Only Einstein in his “miracle year” of 1905, would come close.
And yet: That same Einstein would, starting in that year, prove Newton wrong. The calculus was fine, but Einstein rocked our understanding of light and (more famously) gravity. It was far, far weirder than even Newton could have imagined.
And yet yet: Nobody, least of all Einstein, would ever entertain a notion as ridiculous as downgrading Newton’s contribution. Who cares if his ideas were incomplete, and thus wrong! Newton himself famously said: “If I have seen further it is by standing on the shoulders of giants.” Newton became the giant whose shoulder Einstein stood on. It is entirely possible that we will discover that Einstein was wrong too. Would that make him any less of a thinker? Hardly.
These thinkers are great because they shed progressively more light into the darkness of our ignorance. Being right in the sense of leaping ahead over all future generations is not part of the job description.
Nein (2): the case of Plato
Alfred North Whitehead, no slouch among philosophers himself, once said that all of western philosophy is but a series of footnotes to Plato. Why would he say such a thing?
Because Plato (or Socrates, if you believe that Plato mostly transcribed the stunning conversations of his teacher) raised pretty much every fundamental and intelligent question that mankind could ask. What is good? What is beautiful? What is just? What … is?
Once again, that is a lot. Coming up with the answers to all those questions was not part of the job description, especially since we have not figured them out yet 2,400 years later.
But Plato has been a lot luckier than, say, Marx, in that nobody ever thought to try his ideas out in practice. I think we can agree that none of us wants to live in a society such as the one in Plato’s Republic. Aldous Huxley’s Brave New World comes close to it. Thank god we never “tried Plato out”.
Tell me about your mother
Ja (1): The case of Freud
Freud gave us some beautifully profound, stirring and simple thinking. Everything has to do with sex! How refreshing, after Marx had put everything down to money, and Nietzsche to power.
Well, the trouble is that these were all oversimplifications. To quote our man Einstein again,”Everything should be made as simple as possible, but not one bit simpler.” If you make things too simple, you end up looking just plain silly.
Which is what happened to Freud, and the one to blow his cover was Carl Jung, his disciple at the time. Promise me to make the sexual theory a “bulwark”, Freud once implored Jung. “A bulwark against what?” asked Jung, disconcerted. “Against the black tide of occultism,” said Freud. Jung realized at that moment that his mentor was no longer looking for truth but power (his own). Sex is a biggie, Jung admitted, but not the only thing that matters. And so he broke with Freud. He was excommunicated from the clique, but in time found his footing and became an infinitely greater thinker (if less famous) than Freud.
Able and needy
Ja (2): The case of Marx
We have already pinpointed Marx’s biggest oversimplification, which was to put everything down to production, and who controls “the means of it.” Tangible wealth and its distribution matter, but they are not the only thing. And this was a tragic flaw in Marx’s thought.
There were others: His theory of value was wrong. (It’s not how much labor went into something that makes it worth what it is, but what somebody else will be prepared to pay for it.) And so on.
And, I would argue, his view of human nature was wrong: Once “From each according to his abilities; to each according to his need” becomes the law of the land, you will very quickly find the ablest people demonstrating impressive “abilities” at proving their own “need”. The entire philosophy spirals downward into a glorification of envy, which is a base, not a noble, instinct.
Still, Marx made a huge contribution to human thought, and if we had not tried him out–who knows?–we might rank him up there with Plato.
The conclusion is that being wrong must not disqualify a thinker from being nominated for the title of “greatest”. But since that title implies a certain timelessness, being right cannot be entirely irrelevant either. As it happens, the person I am leading up to, I believe, was right.
January 22, 2009 Andreas Kluth Carl Jung, greatest thinker, Isaac Newton, Karl Marx, Plato, Sigmund Freud 6 Comments
Brancusi, Einstein, simplicity and beauty
If non-conformity and “impudence” are the first ingredients in the astonishing creativity of a man such as Einstein, as I said here, are there yet other ingredients? Of course. And the most important, in my opinion, is an appreciation of simplicity.
More than most people I know, I yearn for simplicity in my life–on my desk, in my file folders, in my home decoration, in my writing, my sentences and of course my thoughts. Quite probably, that is because there is far too much complexity in all of these.
When I approach a new topic, as I did a years ago when I, who was a technophobe, took over the tech beat at The Economist, I first run it through my complexity/simplicity filter. At that time I came up with this.
If I had to choose a favorite sculptor, it might be Brancusi, who grasped simplicity as well as anybody. It is at heart an uncluttering. In Brancusi’s case, he strips a thing of all unnecessary detail in order to reveal its underlying form.
Simplicity is thus also a form of honesty. Once the underlying form of a thing is revealed, you know whether it has beauty or, in the case of writing, also substance. Some of you may recall my idiosyncratic way of reading, by copying and pasting a long document into my word processor, then deleting all extraneous detail as I go along. In effect, I force simplicity onto, say, a research paper. Often, this is how I realize that the boffin in question was a windbag and had nothing to say, hiding behind verbose complexity. Other times, I realize I have hit a treasure trove.
Back to Einstein. Isaac Newton in his Principia had already said that
Nature is pleased with simplicity.
Einstein extended his hunch, saying that
Nature is the realization of the simplest conceivable mathematical ideas.
I have been guided not be the pressure from behind of experimental facts, but by the attraction in front from mathematical simplicity.
What goes for sculptors, inventors, physicists and other forms of homo sapiens goes especially for writers.
January 2, 2009 Andreas Kluth art, beauty, Bird in Space, Brancusi, design, Einstein, Isaac Newton, science, simplicity 13 Comments | cc/2020-05/en_middle_0128.json.gz/line887 |
__label__wiki | 0.58007 | 0.58007 | Research ArticleMOLECULAR BIOLOGY
DNA-dependent protein kinase promotes DNA end processing by MRN and CtIP
Rajashree A. Deshpande1,
Logan R. Myler2,
Michael M. Soniat1,
Nodar Makharashvili1,
Linda Lee3,
Susan P. Lees-Miller3,
Ilya J. Finkelstein1,4 and
Tanya T. Paull1,*
1Department of Molecular Biosciences, University of Texas at Austin, Austin, TX 78712, USA.
2Laboratory for Cell Biology and Genetics, Rockefeller University, New York, NY 10065, USA.
3Department of Biochemistry and Molecular Biology, University of Calgary, Alberta T2N 1N4, Canada.
4Center for Systems and Synthetic Biology, University of Texas at Austin, Austin, TX 78712, USA.
↵*Corresponding author. Email: tpaull{at}utexas.edu
Rajashree A. Deshpande
Department of Molecular Biosciences, University of Texas at Austin, Austin, TX 78712, USA.
ORCID record for Rajashree A. Deshpande
Logan R. Myler
Laboratory for Cell Biology and Genetics, Rockefeller University, New York, NY 10065, USA.
ORCID record for Logan R. Myler
Michael M. Soniat
ORCID record for Michael M. Soniat
Nodar Makharashvili
Department of Biochemistry and Molecular Biology, University of Calgary, Alberta T2N 1N4, Canada.
Susan P. Lees-Miller
ORCID record for Susan P. Lees-Miller
Ilya J. Finkelstein
Department of Molecular Biosciences, University of Texas at Austin, Austin, TX 78712, USA.Center for Systems and Synthetic Biology, University of Texas at Austin, Austin, TX 78712, USA.
ORCID record for Ilya J. Finkelstein
Tanya T. Paull
ORCID record for Tanya T. Paull
For correspondence: tpaull@utexas.edu
The repair of DNA double-strand breaks occurs through nonhomologous end joining or homologous recombination in vertebrate cells—a choice that is thought to be decided by a competition between DNA-dependent protein kinase (DNA-PK) and the Mre11/Rad50/Nbs1 (MRN) complex but is not well understood. Using ensemble biochemistry and single-molecule approaches, here, we show that the MRN complex is dependent on DNA-PK and phosphorylated CtIP to perform efficient processing and resection of DNA ends in physiological conditions, thus eliminating the competition model. Endonucleolytic removal of DNA-PK–bound DNA ends is also observed at double-strand break sites in human cells. The involvement of DNA-PK in MRN-mediated end processing promotes an efficient and sequential transition from nonhomologous end joining to homologous recombination by facilitating DNA-PK removal.
DNA-dependent protein kinase (DNA-PK) consists of a catalytic kinase subunit (DNA-PKcs) and the DNA end-binding heterodimer of Ku70 and Ku80 (Ku). Together, these proteins form an end recognition complex (DNA-PK) that binds to DNA double-strand breaks (DSBs) within seconds of break formation (1). DNA-PK promotes the ligation of two DNA ends by ligase IV, aided by accessory factors, and in some cases, accompanied by limited end processing (1, 2). The recognition and repair of DNA breaks by the DNA-PK–associated nonhomologous end-joining (NHEJ) machinery is generally considered to be the first and rapid phase of DNA repair, occurring within ~30 min of DNA damage, while homologous recombination is specific to the S and G2 phases of the cell cycle and occurs over a longer time frame (3, 4). DNA-PK is present at micromolar concentrations in cells (5) and binds DNA ends in all cell cycle phases, even during S phase at single-ended breaks (6).
The Mre11/Rad50/Nbs1 (MRN) complex regulates the initiation of DNA end processing before homologous recombination by catalyzing the initial 5′ strand processing at blocked DNA ends and by recruiting long-range nucleases Exo1 and Dna2 (4, 7). At single-ended breaks during replication, the nuclease activity of Mre11 was shown to be important for removal of Ku (6), suggesting that MRN catalytic processing of ends during S phase is important for recombination-mediated repair of single-ended breaks. In addition, the presence of protein blocks on DNA ends has been shown to stimulate MRN(X) endonuclease activity in vitro (8–12), consistent with the idea that chromatin-bound proteins stimulate MRN activities. Here, we considered the possibility that the presence of DNA-PK on DNA ends might regulate MRN-dependent end processing and that this interaction may be a critical component of the choice between NHEJ and homologous recombination pathways in human cells.
To test for the effect of DNA-PKcs on end processing by the MRN complex, we performed a nuclease assay with purified human MRN, CtIP, Ku, and DNA-PKcs (fig. S1) on a 197–base pair (bp) linear double-stranded DNA (dsDNA) containing a single radiolabel at the end of one of the 5′ strands. Addition of all the protein complexes together to this substrate resulted in the appearance of a single major cleavage product approximately 45 nucleotides (nt) in length (Fig. 1A, lane 2). We previously reported MRN-mediated removal of the Ku heterodimer alone, showing that MRN makes an endonucleolytic cleavage at approximately 30 bp from the DNA end (13); here, we observe that the inclusion of DNA-PKcs in the reaction increases the efficiency of the cutting by approximately 50-fold as well as changing the position of the nuclease cleavage site to a location approximately 45 nt from the end (Fig. 1A, lanes 2 and 3). Efficient formation of the cleavage product requires CtIP, which is essential for DNA end resection in human cells (14). Mre11 nuclease activity in vitro is strictly manganese dependent (8, 15, 16); however, Mre11/Rad50 (MR) complexes from archaea and from T4 bacteriophage also exhibit nuclease activity in the absence of manganese when physiologically relevant protein cofactors are present (17, 18). Here, we observe that human MRN makes endonucleolytic cuts in magnesium-only conditions and that this requires the presence of both Ku and DNA-PKcs (Fig. 1A, lane 10). Because human cells do not contain high levels of manganese (19), we conclude that the physiologically relevant endonuclease activity of MRN is thus dependent on DNA-PK.
Fig. 1 Nucleolytic removal of DNA-PK by MRN and its stimulation by CtIP.
(A) Nuclease reactions were performed with a 197-bp DNA substrate, 5′ labeled with 32P (asterisk), with MRN (50 nM), CtIP (80 nM), Ku (10 nM), and DNA-PKcs (10 nM) as indicated, in the presence of both magnesium and manganese (lanes 1 to 8) or magnesium only (lanes 9 to 16). All reactions contained the DNA-PKcs inhibitor NU7441. Products were visualized by denaturing PAGE and visualized by phosphorimager. Red and black arrows indicate the predominant product in the presence of DNA-PKcs and Ku, or Ku alone, respectively. (B) Nuclease assays were performed as in (A) in the presence of both magnesium and manganese with wild-type MRN or MRN containing nuclease-deficient Mre11 (H129N). Reactions without ATP or with AMP-PNP instead of ATP are indicated, as is the reaction without NU7441. (C) Nuclease assays were performed as in (A) in the presence of magnesium, manganese, ATP, NU7441, CtIP (C), and DNA-PK (D) with MRN (M) containing wild-type Rad50 (WT) or adenosine triphosphatase (ATPase)–deficient Rad50 K42A (KA) or D1231A (DA). (D) Nuclease assays were performed as in (A) in the presence of both magnesium and manganese with wild-type MRN in the presence of 25, 50, and 100 μM Mre11 inhibitors and NU7441. (E) Quantitation of the MRN endonuclease observed in the presence of Mre11 inhibitors expressed as percentage of the activity in the absence of inhibitors. Error bars represent SD from two replicates.
Mre11 and CtIP both exhibit endonucleolytic activity (8, 20, 21), so we asked which protein is responsible for the catalysis. We found that substituting wild-type Mre11 with a nuclease-deficient form of Mre11, H129N (22, 23), completely abolished DNA-PK–dependent cutting by MRN, whereas we observed robust activity with nuclease-deficient N289A/H290A CtIP (Fig. 1B, lanes 4 and 5); thus, we conclude that the processing is done by the catalytic activity of Mre11.
We previously observed that adenosine 5′-triphosphate (ATP) binding by Rad50 promotes Nbs1-dependent endonucleolytic cutting by Mre11 (8, 15). Exclusion of ATP or substitution of the nonhydrolyzable adenylyl-imidodiphosphate (AMP-PNP) analog for ATP blocks MRN nuclease activity in the presence of DNA-PK (Fig. 1B, lanes 6 and 7), suggesting that ATP hydrolysis by Rad50 is critical for DNA-PK–promoted MRN nuclease activity. We also tested MRN complexes containing Rad50 K42A and D1231A proteins with mutations in the Walker A and Walker B ATP-binding motifs, respectively, that are deficient in ATP hydrolysis (24). Both complexes failed to support MRN endonuclease activity (Fig. 1C), confirming the requirement for Rad50 catalytic activity.
Phosphorylation of Ku has been shown to result in the removal of Ku from DNA (25) and autophosphorylation of DNA-PKcs also removes DNA-PKcs from the Ku-DNA complex (26–30); therefore, in reactions shown in Fig. 1 (A and B), we have also included an inhibitor of DNA-PKcs, NU7441, to block its kinase activity. Removal of the inhibitor reduced the efficiency of the reaction (Fig. 1B, lane 8), suggesting that reduced stability of DNA-PK on DNA reduces the nuclease activity of MRN on the DNA-PK–bound substrate. However, the endonucleolytic product is still observed in the absence of the inhibitor (also see fig. S2); thus, blocking DNA-PKcs phosphorylation is not absolutely essential.
Small-molecule inhibitors that specifically block either the exonuclease (PFM39) or the endonuclease (PFM01 and PFM03) activity of Mre11 have been developed (30). We found that PFM01 and PFM03 reduced MRN endonuclease activity by 60 and 98%, respectively, compared to 25% inhibition by PFM39 (Fig. 1, D and E). Efficient inhibition by PFM03 and PFM01 is consistent with Mre11 endonucleolytic activity acting on DNA ends bound by DNA-PK in this assay.
CtIP is phosphorylated by several different kinases in human cells (Fig. 2A) (31). Some of these phosphorylation events have been shown to promote DNA end resection (8, 9, 32–38), most notably the cyclin-dependent kinase (CDK)–dependent phosphorylation of T847. In addition, Ataxia telangiectasia Mutated (ATM) and Ataxia telangiectasia and Rad3 related (ATR) phosphorylation of T859 also plays an important role in CtIP binding to chromatin and CtIP-mediated resection (38, 39). To test the function of CtIP phosphorylation in the MRN endonuclease assay, we purified recombinant CtIP proteins containing phospho-blocking or phospho-mimic mutations at the T847 and T859 sites (fig. S1). Addition of these mutant proteins to the MRN endonuclease assay with DNA-PK shows that T847 and T859 phosphorylation are critical, as the phospho-deficient T847A and T859A mutants resulted in loss of CtIP stimulation (15- and 3-fold stimulation of MRN, respectively, compared to 43-fold by wild type) [Fig. 2, B (lanes 5 to 10) and C]. We know that there is substantial constitutive phosphorylation of CtIP expressed and purified from insect cells (20) and infer from this result that T847/T859 phosphorylated species in the recombinant protein preparation are essential for stimulation of the MRN endonuclease activity. In contrast to these sites, phosphorylation at S327 or the ATM sites S231, S664, and S745 appears not to be important for the endonucleolytic activity (Fig. 2B, lanes 11 to 13). We previously reported that the ATM phosphorylation sites are important for CtIP intrinsic nuclease activity (21). Here, we show that these sites do not regulate DNA-PK–dependent Mre11 endonuclease activity, consistent with our observation that the N289A/H290A mutations that reduce CtIP nuclease activity also do not affect Mre11 function in this assay.
Fig. 2 MRN, DNA-PK, and CtIP promote dsDNA end resection.
(A) A linear map of CtIP indicating a subset of known phosphorylated residues as well as residues important for DNA binding and catalytic activity as discussed in the text (orange, sites required for nuclease activity; green, ATM-dependent phosphorylation sites; blue, CDK-dependent phosphorylation sites; red, ATR/ATM-dependent phosphorylation site). (B) Nuclease assays were performed with MRN (12.5 nM), CtIP (40 nM), Ku (10 nM), DNA-PKcs (10 nM), and NU7441 as in Fig. 1A but with various mutants of CtIP, as indicated, in the presence of both magnesium and manganese. The red arrow indicates the predominant product formed in the presence of DNA-PKcs. (C) Nuclease assays were performed as in (B) with titrations of CtIP (10, 20, and 40 nM). (D) DNA end resection on a plasmid substrate (3.6 kb) was performed with MRN, CtIP, DNA-PK, and Exo1, as indicated, in the presence of a DNA-PKcs inhibitor. Reaction products were separated in a native agarose gel, which was stained with SYBR Green; molecular weight (MW) ladder migration is shown (kb). (E) dsDNA cleavage products from the MRN nuclease assay with DNA-PK and CtIP were detected on a 12% native polyacrylamide gel. The red arrow indicates the ~45-bp product. (F) Protein-protein interactions between CtIP, MRN, and DNA-PK were measured by IP with anti-CtIP antibody in the presence or absence of ATP followed by Western blotting of bound proteins, as indicated. (G) Interactions between CtIP, MRN, DNA-PKcs, and Ku were measured with CtIP IP as in (F) in the presence of ATP.
While mutation of the CtIP T847 residue to phospho-blocking alanine inhibited its stimulation of Mre11 nuclease activity, the phospho-mimic T847E mutant completely restored this ability in vitro (Fig. 2B, lane 6). This is important, as the T847E allele of CtIP was previously shown to restore localization of CtIP to sites of DNA damage as well as the resection of DSBs and promoted efficient CDK-dependent processing of these breaks (36). Thus Mre11 endonuclease activity is linked with the cell cycle–dependent processing of DNA damage via the phosphorylation of T847 in CtIP and will therefore only occur efficiently during the S and G2 phases of the cell cycle. The T859E phospho-mimic version of CtIP only partially restores Mre11 activity (Fig. 2B, lane 8), also consistent with the initial study of T859 phosphorylation by ATR in Xenopus extracts, which reported that T859E (T818E in Xenopus CtIP) is only weakly active in supporting DSB resection in CtIP-depleted extracts (39). Overall, however, the combined data suggest that CDK- and ATR/ATM-mediated phosphorylation of CtIP on T847 and T859 is critical for stimulation of MRN endonuclease activity on DNA-PK–bound ends.
Exo1 is one of the critical long-range exonucleases that perform DNA end resection in human cells (4), and we have previously shown a positive effect of MRN on Exo1-mediated degradation of DNA (13, 41, 42). Despite the well-known importance of CtIP in resection in human cells, however, we have not observed any effects of recombinant CtIP on Exo1 activity in previous experiments. Here, we examined the effect of CtIP on Exo1 on a plasmid DNA substrate in the presence of MRN and DNA-PK (Fig. 2D). As expected, Exo1 is substantially blocked by the presence of DNA-PK in the reaction, an inhibition that is relieved by the inclusion of MRN and requires CtIP (Fig. 2D, lanes 4 to 6). This finding that CtIP stimulates the activity of Exo1 sevenfold in the presence of DNA-PK is consistent with the effect of CtIP on Mre11 nuclease activity we observe on the labeled substrates (Fig. 1).
We recently showed that MRN can remove DNA end blocks by sequential endo-exo-endo activities, generating a DSB adjacent to the block (8, 13), a model first suggested by processing of meiotic DNA breaks (43). In the presence of DNA-PK bound to DNA ends, we found that the MRN complex executes similar end processing of the radiolabeled substrate to generate a new DSB. We detected a ~45-bp dsDNA product using native polyacrylamide gel electrophoresis (PAGE) (Fig. 2E, lane 2), corresponding to the major product seen on denaturing gels (Fig. 1). This activity was dependent on MRN and was enhanced when both Ku and DNA-PKcs were present in the reaction (Fig. 2E, lane 2). However, the formation of the dsDNA product was less efficient (approximately 1 to 2% of the substrate cleaved at site proximal to the radiolabel) compared to the single-strand endonucleolytic product seen on denaturing gels (approximately 27 to 34% of the substrate cleaved adjacent to the labeled 5′ end) (Fig. 1, A and B).
The unexpected dependence of Mre11 endonuclease activity on DNA-PK suggests that there may be specific protein-protein interactions underlying the cooperative behavior. We tested this by immobilizing purified, human CtIP on magnetic beads and monitoring binding of DNA-PK or MRN. Both MRN and DNA-PK bound to CtIP in an ATP-independent manner (Fig. 2F). Binding analysis of Ku and DNA-PKcs separately showed that each of the components of DNA-PK has affinity for CtIP (Fig. 2G). Binding of Nbs1 (added to this reaction separately from the MR complex) to CtIP is mostly independent of DNA-PK, while binding of MR to CtIP improves seven- to eightfold with DNA-PK present. Addition of EtBr or benzonase to the reaction did not affect the interaction, confirming that the binding is independent of DNA (fig. S3A). Although the stimulation of Mre11 nuclease activity requires CtIP phosphorylation on T847 and T859, we did not observe any obvious deficiency in binding between CtIP, MRN, and DNA-PK with the T847A/T859A CtIP mutant protein (fig. S3B); thus, the effect of the phosphorylation does not appear to be manifested through CtIP association with the other factors.
Single-molecule observations show MRN/CtIP-mediated removal of DNA-PK and MRN from DNA ends
To examine the interactions between DNA-PK and the MRN complex in greater detail, we turned to single-molecule microscopy. In this “DNA curtains” assay, arrays of lambda DNA molecules (~48 kb long) are attached via a biotin-streptavidin linkage to a microfluidic flow cell that is also passivated with a fluid lipid bilayer (Fig. 3A) (44). Microfabricated barriers align the DNA molecules and organize them for high-throughput analysis of bound proteins, which we have previously used to examine the interplay between the MRN complex and Ku at individual DNA ends (13). Here, we adapted this assay to observe the behavior of the DNA-PK complex, with DNA-PKcs labeled using a DNA-PKcs–specific antibody. Injection of fluorescently labeled DNA-PKcs led to only transient association with the DNA, as indicated by nonspecific sliding in the direction of buffer flow and subsequent release from the DNA ends [half-life (t1/2) = 5 ± 3 s, N = 17; Fig. 3, B and C]. Given that formation of the DNA-PK complex requires Ku and DNA (45), we considered that preloaded Ku may stabilize DNA-PKcs on the DNA ends. To test this, we injected hemagglutinin (HA)–tagged Ku heterodimer onto the DNA curtains, labeled with anti-HA antibody. As we observed previously, Ku bound only to DNA ends and did not slide on the DNA with buffer flow (13). Subsequent injection of DNA-PKcs did result in more stable association of the kinase with the Ku-bound ends; however, the inclusion of ATP in the buffer promoted rapid loss of ~80% of the bound Ku molecules (Fig. 3, D to F). These are single-turnover reactions that we observe with constant buffer flow, so even transient release of DNA-PKcs from the DNA results in loss of association. We considered that the ATP-dependent release might be associated with the phosphorylation of Ku70 by DNA-PKcs, which inhibits DNA binding by Ku (25). To prevent Ku phosphorylation and release by DNA-PKcs, we purified a phospho-blocking mutant of Ku(T305A/S306A/T307A/S314A/T316A, “5A”), which inhibits DNA-PKcs–induced release of Ku (25). Ku(5A) bound to DNA for >2000 s, consistent with our previous observations of extremely stable binding of wild-type Ku (Fig. 3, E and F) (13). Ku(5A) stabilized DNA-PKcs at the DNA ends even in the presence of ATP (Fig. 3, D to F), confirming that phosphorylation of the Ku70 S/TQ 305–316 cluster controls the association of DNA-PK with DNA ends.
Fig. 3 Single-molecule visualization of DNA-PK on DNA.
(A) Schematic of the DNA curtains assay for DNA-PK. (B) Illustration and kymograph (time series of one molecule over the course of the reaction) of DNA-PKcs injection onto DNA curtains. White arrow indicates a single DNA-PKcs binding event. This molecule then slides along the DNA in the direction of buffer flow to reach the DNA end (green arrow). The molecule then associates for a short time at the end (te) before dissociation (red arrow). (C) Lifetime of DNA-PKcs on DNA curtains in the presence of ATP. (D) Illustration and kymographs of DNA-PKcs colocalizing with an end-bound Ku and Ku(5A) in the presence or absence of ATP as indicated. (E and F) Lifetime of Ku (WT or 5A) on DNA curtains in the presence or absence of DNA-PKcs or ATP as indicated. Table shows half-life of Ku(WT) or Ku(5A) under various conditions and the number of molecules observed (N).
We next observed the interplay between MRN and DNA-PK [DNA-PKcs with Ku(5A)] using the DNA curtains platform. Consistent with our ensemble biochemical assays (fig. S2), injection of dark (unlabeled) MRN and CtIP onto DNA curtains with both fluorescent DNA-PKcs and fluorescent Ku in the presence of a physiologically relevant cleavage buffer (5 mM Mg2+) led to removal of both DNA-PKcs and Ku from the ends (Fig. 4A).
Fig. 4 Single-molecule visualization of DNA-PK removal by MRN and CtIP.
(A) Illustration and kymographs of DNA-PKcs (magenta) and Ku (green) upon injection of MRN and CtIP [both unlabeled (dark)]. (B) Kymographs of DNA-PKcs (magenta) with Ku (unlabeled), with injection of MRN (green) alone (top), or MRN with CtIP (middle), or a nuclease-dead mutant of MRN (H129N) with CtIP (bottom). (C and D) Lifetimes and associated half-lives of the DNA-PK complex (as observed by DNA-PKcs occupancy) upon no injection (green), injection with MRN and CtIP (black), MRN alone (red), nuclease-deficient H129N MRN and CtIP (magenta), CtIP only (blue), or MRN with phospho-blocking T847A/T859A CtIP (purple). Table shows half-life of DNA-PKcs under various conditions and the number of molecules observed (N). (E) Schematic model for DNA-PK removal from DSB ends, as discussed in the text. DNA-PKcs binds to the Ku heterodimer bound to DNA at the DSB. Transition from NHEJ to homologous recombination (HR) results from (i) DNA-PKcs phosphorylation of Ku, resulting in dissociation of Ku as well as DNA-PKcs from ends, (ii) DNA-bound DNA-PK stimulation of MRN single-strand endonucleolytic cleavage followed by 5′ to 3′ resection, or (iii) DNA-PK stimulation of MRN double-stranded endonucleolytic cleavage resulting in DNA-PK loss and 5′ to 3′ resection. Long-range 5′ to 3′ resection ensues from the nick or a new DSB, creating 3′ single-stranded DNA that is used for homology search. The DNA-bound DNA-PK complex (dashed box) is the species isolated in the modified ChIP protocol (Fig. 5 and fig. S4).
To probe the dynamics of this activity, we used fluorescently labeled MRN complex together with fluorescent DNA-PKcs (Ku is unlabeled in this case) and measured the occupancy of DNA-PK on ends that are also bound by MRN. Injection of MRN alone led to stable colocalization of the two complexes (DNA-PK t1/2, >2000 s), but injection of MRN and CtIP together led to removal of both Ku and DNA-PKcs from the DNA ends (t1/2 = 324 ± 15 s, N = 37; Fig. 4, B to D). In contrast, an MRN nuclease–deficient mutant (H129N) with CtIP did not remove DNA-PK; neither did CtIP added in the absence of MRN. Furthermore, injection of MRN with CtIP containing phospho-blocking mutations T847A and T859A also failed to remove DNA-PK (Fig. 4, B to D). These data suggest that colocalization of MRN with the DNA-PK complex is not sufficient to facilitate removal and that, consistent with our ensemble assays, phosphorylated CtIP is required for DNA-PK removal by MRN nuclease activity. It is notable that the rate of DNA-PK removal by MRN/CtIP under these conditions (t1/2 = 324 ± 15 s) is faster than the removal of Ku by DNA-PK–mediated phosphorylation (t1/2 = 780 ± 30 s); thus, the MRN-mediated pathway is likely to occur in a time frame comparable to other pathways of Ku removal in cells.
Our previous studies showed that MRN could remove Ku from DNA ends via a manganese-dependent reaction (8, 13). Here, we observe approximately the same kinetics of DNA-PK release catalyzed by MRN and CtIP as we did previously for Ku, but in magnesium-only conditions (all of the single-molecule experiments shown here were performed in the absence of manganese). These results demonstrate that DNA-PK stimulates Mre11 nuclease activity in the absence of manganese in physiologically relevant conditions and that CtIP is an essential component of this reaction.
These observations suggest a conserved mechanism for removal of blocks from DNA ends by the MRN complex (model in Fig. 4E). At two-ended DSBs, NHEJ would first engage the ends, and in cases where the ends are compatible, the ends would undergo productive end-joining. In situations where NHEJ fails and the DNA-PK complex remains at the DSB ends, Ku could be removed by DNA-PK–mediated phosphorylation (25). Alternatively, MRN can remove the complex through endonucleolytic processing, a reaction that is greatly enhanced by phosphorylated CtIP and is dependent on DNA-PK, as we show in this study. MRN activity nicks either one or both the strands close to the DNA-PK complex in a sequential or simultaneous manner. The nicked or freed end is then used for extensive 5′ to 3′ resection by exonucleases, allowing damage repair through homologous recombination or homology-dependent mechanisms.
MRN nuclease–mediated cutting of DNA-PK–bound ends occurs in human cells
To determine whether nucleolytic removal of DNA-PK occurs in human cells, we performed a chromatin immunoprecipitation (ChIP) assay using the inducible AsiSI restriction enzyme system in U2OS osteosarcoma cells (46). We modified the standard ChIP protocol (fig. S4) by reducing the duration of formaldehyde crosslinking and eliminating the extensive sonication used to fragment DNA. This gentle lysis procedure, which we are naming “Gentle Lysis And Size Selection-ChIP,” or GLASS-ChIP, allowed us to specifically separate small (50 to 300 bp) DNA-PK–associated DNA fragments from the bulk chromatin. The fragments were then further purified and used for quantitative polymerase chain reaction (qPCR) analysis. We monitored four genomic AsiSI sites (47) and found that this procedure generated DNA-PK–associated DNA fragments at all four sites that were strongly dependent on 4-hydroxytamoxifen (4-OHT) addition (Fig. 5A).
Fig. 5 DNA-PK–associated DNA end fragments are observed at AsiSI breaks in human cells using GLASS-ChIP.
(A) Small dsDNA products resulting from nucleolytic cleavage of DNA-PK–bound AsiSI–generated DNA ends (dashed line box, Fig. 4E) were isolated from U2OS cells treated with 4-OHT or vehicle for 4 hours as indicated. NU7441 (10 μM) was added as indicated for 5 hours starting at 1 hour before 4-OHT addition to induce AsiSI. DNA-PK–bound DNA was isolated using a modified ChIP protocol (GLASS-ChIP, fig. S4) and quantified by qPCR using primers located ~30 nt from the AsiSI cut site (results from primers ~300 nt from cut sites in fig. S5). Primer set U1 (solid) is upstream, whereas D1 (checkered) is downstream of the AsiSI cut sites. The DNA quantitated from U2OS cells in the presence or absence of 4-OHT and a DNA-PKcs inhibitor (NU7441) is shown for each AsiSI site (46). The inset magnifies the results for experiments performed in the absence of NU7441. Results are from three independent biological replicates, with Student’s two-tailed t test performed; *P < 0.05, ** P < 0.01, ***P < 0.001, in comparison to equivalent samples without 4-OHT. (B) The GLASS-ChIP protocol was performed as in (A) using cells treated with a DNA-PKcs inhibitor (NU7441, 10 μM), a Mre11 inhibitor (PFM03, 100 μM), and 4-OHT for 1 hour as indicated. Results are from three independent biological replicates, with Student’s two-tailed t test performed; **P < 0.005 and **** P < 0.0001, in comparison to equivalent samples without PFM03.
When cells were exposed to the DNA-PKcs inhibitor NU7441 during AsiSI induction, quantitation of DNA located very close (~30 nt) to the AsiSI genomic sites showed a 25- to 250-fold increase over background levels (i.e., levels of product formed with NU7441 but in the absence of 4-OHT induction) (Fig. 5A), consistent with the nucleolytic removal of DNA-PK–bound DNA ends we observed in vitro. These levels dropped substantially when measuring sites located farther away (~300 nt) from the AsiSI cut site (fig. S5), and no signals above background were observed at representative locations distant from AsiSI sites. With a DNA-PKcs inhibitor present as it is here, we expect that NHEJ is blocked and MRN cleavage of DNA-PK–bound ends is maximal, as we observed in purified protein reactions (Figs. 1 and 2).
Induction of AsiSI with 4-OHT in the absence of a DNA-PKcs inhibitor also generated DNA in the GLASS-ChIP assay, approximately 3- to 160-fold higher than background depending on the site, measured with primers 30 nt from the AsiSI location (Fig. 5A, inset). Under these conditions, NHEJ is not blocked; thus, the release of DNA-PKcs with associated DNA is expected to occur only as a consequence of DSB processing. The observation of these products in the absence of a DNA-PKcs inhibitor shows that processing of DNA-PKcs–bound ends occurs in human cells under normal physiological conditions.
To determine whether the DNA-PK–bound products arise through Mre11 nuclease activity, we treated the cells with the endonuclease inhibitor PFM03 based on our in vitro observations (Fig. 1, D and E). In preliminary experiments, we found that addition of 4-OHT to induce AsiSI activity in cells also exposed to PFM03 (100 μM) and the DNA-PKcs inhibitor NU7441 resulted in complete cell death within 1.5 hours. To circumvent this, we limited the treatment with 4-OHT and both DNA-PKcs and Mre11 inhibitors to 1 hour. In the absence of the Mre11 inhibitor, we observed short DNA fragments at three of four of the genomic loci tested that were dependent on 4-OHT (Fig. 5B), albeit at 10- to 20-fold reduced levels compared to the 4-hour 4-OHT induction (Fig. 5A). With the addition of PFM03, there was a significant reduction in the recovery of these fragments, indicating that Mre11 nuclease activity is responsible for the creation of DNA-PK–bound DSB products (Fig. 5B).
Here, we have shown that DNA-PK plays an important role in DNA end processing through its stimulation of Mre11 endonuclease activity. The extremely high concentration of DNA-PK in mammalian cells, particularly in human cells (5), and the high affinity of Ku for DNA ends (48) mean that DSB ends will be immediately bound by DNA-PK (see model in Fig. 4E). Removal of this block can be promoted by several distinct mechanisms: DNA-PKcs phosphorylation of Ku70, which reduces its DNA binding affinity (25); ubiquitination of Ku and degradation by proteasome-dependent or proteasome-independent mechanisms (49–51); or single-strand or double-strand endonucleolytic incision of DNA by MRN, as we show in this study. Single-strand DNA cutting by Mre11 followed by 3′ to 5′ Mre11 exonuclease activity was demonstrated as a mechanism for Spo11 removal by Mre11-Rad50-Xrs2 (MRX) in yeast (43).
We also demonstrate in this work that double-strand DNA cutting by MRN is promoted by stable occupancy of DNA-PK on the ends, as shown by the increased efficiency of MRN cleavage in the presence of the DNA-PK inhibitor in vitro and by our observation of the release of DNA-PK–bound DNA fragments in human cells. This requirement for stable occupancy of DNA-PK ensures that MRN does not cleave ends that are undergoing successful end-joining, as this outcome also leads to DNA-PKcs dissociation (1). DNA-PK and MRN have often been viewed as competitors for DNA ends, but the data presented here show that these complexes are linked in an ordered pathway (Fig. 4E), consistent with cytological observations (52). The dual roles of DNA-PKcs ensure rapid repair by NHEJ as well as an efficient transition to homologous recombination by promoting MRN-dependent initiation of end processing.
Loss of DNA-PKcs in mice results in radiosensitivity as well as immunodeficiency due to a failure to complete V(D)J recombination, and naturally occurring mutations in the gene have generated viable but immunocompromised animals (53). In contrast, no human patients have been identified with complete loss of DNA-PKcs, and human cell lines lacking the protein exhibit a severe growth deficit in addition to DNA damage sensitivity, extreme genomic instability, and telomere shortening (54). Similarly, Ku70- and Ku80-deficient mice are radiosensitive but viable, yet deletion of Ku subunits in human cells generates spontaneous DNA breaks, telomere defects, and cell lethality within several divisions (55). This combined set of observations shows that DNA-PK plays many roles in human cells and is more essential for the maintenance of genomic stability in human cells compared to rodents or other mammals. The function of DNA-PKcs in regulating MRN/CtIP-mediated end processing that we describe in this work is likely an important component of the responsibilities of DNA-PKcs in genome maintenance. Further structural analysis is necessary to fully understand how phosphorylated CtIP enables the MRN complex to breach the otherwise impenetrable block that DNA-PK creates on DNA ends and how the many posttranslational modifications on CtIP, MRN, and other factors present at ends can modulate these outcomes. The extreme sensitivity of U2OS cancer cells to simultaneous use of DNA-PKcs and Mre11 inhibitors points toward a potential use of these small molecule inhibitors in treatment of cancers with active homologous recombination pathways.
Plasmid, strains, and protein purification
Recombinant human proteins [MRN wild-type, M(H129N)RN, MR, MR(K42A), MR(D1231A), Nbs1, CtIP wild type, and CtIP mutants] were expressed and purified from Sf21 insect cells as described previously (8, 21, 24). 3XFLAG-MRN, 3XHA-Ku70/80 heterodimer, and Exo1-biotin were made as described previously (13). DNA-PKcs from human cells was purified as described previously (56). The Ku70(5A) mutant (T305A/S306A/T307A/S314A/T316A) was made from the baculovirus transfer vector containing wild-type Ku70 by QuikChange mutagenesis (Stratagene) to create the 5A mutant expression plasmid pTP4143 and the corresponding bacmid pTP4177, which was used with wild-type Ku80 baculovirus to infect Sf21 cells and purify Ku(5A).
DNA substrates
TP542 (GGTTTTCCCAGTCACGACGTTG) was 5′ [32P] radiolabeled using T4 polynucleotide kinase (New England Biolabs) and purified (New England Biolabs Nucleotide Removal Kit). The 197-bp DNA substrate labeled on the 5′ end was created by PCR using 5′ [32P] radiolabeled TP542 (GGTTTTCCCAGTCACGACGTTG) and TP4373 (TGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT) with pTP3718 followed by purification on a native 0.7% agarose gel as described previously (8). The DNA substrate used in Fig. 2A was made by digesting pCDF-1b plasmid with SspI to create a 3.6-kb linear DNA with blunt ends and was used without further purification. The lambda DNA substrate used in single-molecule studies was prepared as described previously (13).
Nuclease assays
Ten microliters of nuclease assays contained Ku70/80 (10 nM), DNA-PKcs (10 nM), hMR (50 nM), Nbs1 (50 nM), and CtIP (80 nM) unless indicated otherwise in figure legends. Reactions were performed with 0.1 nM DNA in 25 mM 3-(N-morpholino)propanesulfonic acid (MOPS) (pH 7.0), 20 mM Tris (pH 8.0), 80 mM NaCl, 8% glycerol, 1 mM dithiothreitol (DTT), 1 mM ATP, 0.2 mM NU7441, 5 mM MgCl2, 1 mM MnCl2, and bovine serum albumin (BSA) (0.2 mg/ml), with additions or exceptions as noted in the figures and legends. hMR and Nbs1 were preincubated (10 min at 4°C) before addition to reactions, and Ku and DNA-PKcs were allowed to bind DNA in the presence of NU7441 for 5 min at 25°C followed by the addition of other components. Assays were carried out in Protein LoBind Eppendorf tubes (Millipore) at 37°C for 30 min. Reactions were stopped with 0.2% SDS and 10 mM EDTA, lyophilized, dissolved in formamide, boiled at 100°C for 4 min, loaded on denaturing polyacrylamide gels containing 16% acrylamide, 20% formamide, and 6 M urea, and separated at 40 W for 1.5 hours, followed by phosphorimager analysis. Mre11 inhibitors were added at final concentrations of 25, 50, and 100 μM in assay reactions. Mre11 inhibitor dilutions were made in 20% dimethyl sulfoxide (DMSO) in buffer A, which results in 6% DMSO in these assay reactions, and an equivalent concentration of DMSO was used in control reactions. For the detection of dsDNA products, reactions were treated with 10 μg of proteinase K at 37°C for 1 hour after stopping the nuclease reaction. The samples were then separated using 12% native PAGE in 1× tris-borate-EDTA (TBE) buffer at 150 V followed by phosphorimager analysis.
DNA resection assays on plasmid substrates were carried out similarly using 0.1 nM 3.6-kb pCDF-1b plasmid linearized with Ssp I and 1 nM Exo1 in the presence of the DNA-PKcs inhibitor NU7026 (200 μM). Reactions were stopped with 0.2% SDS and 10 mM EDTA, and 1.5 μg of proteinase K was added and incubated at 37°C for 90 min followed by 10-min incubation at 50°C. These reactions were separated in a 0.7% native agarose gel in 1× TBE buffer, stained with SYBR Green, and visualized with a ChemiDoc gel imager (Bio-Rad).
Protein-protein interactions
IP assays were performed with anti-CtIP antibody (Active Motif 14E1) in Protein LoBind Eppendorf tubes (Millipore). In a 40-μl reaction volume, 20 nM Ku70/80, 20 nM DNA-PKcs, 25 nM hMR, 25 nM Nbs1, and 16 nM CtIP were incubated as indicated in the absence of DNA in 25 mM Mops (pH 7.0), 20 mM tris (pH 8.0), 80 mM NaCl, 8% glycerol, 1 mM DTT, 1 mM ATP, 0.2 mM NU7441, 5 mM MgCl2, and BSA (0.2 mg/ml) at 37°C for 10 min. The reaction was then incubated with 2 μg of anti-CtIP antibody, 0.4% CHAPS, and 2 μl of protein A/G magnetic beads (Pierce) at 37°C for 30 min with shaking. Beads were isolated using a magnet and washed three times with wash buffer {buffer A [25 mM tris (pH 8.0), 100 mM NaCl, 10% glycerol] containing 0.4% CHAPS and BSA (0.1 mg/ml)}. Tubes were changed at the third wash step, and proteins bound to the beads were eluted with 1× SDS-PAGE loading dye prepared in wash buffer. Samples were heated at 100°C for 5 min and separated by 8% SDS-PAGE followed by Western blotting. Because Mre11 and Ku80 migrate very close to each other, blots were developed sequentially—first for FLAG-tagged CtIP, Nbs1, and Mre11, then for DNA-PKcs and His-tagged Rad50 and Ku70, and lastly for biotin-tagged Ku80. Proteins were detected using rabbit anti-FLAG (Cell Signaling), rabbit anti–DNA-PKcs (Bethyl Laboratories), and mouse anti-His (GenScript) antibodies as well as streptavidin–Alexa Fluor 680 conjugate (Invitrogen) using an Odyssey imager (Li-Cor).
Single-molecule experiments
Single-molecule DNA curtains were performed as previously described (13). For labeling of DNA-PKcs, 400 nM anti-mouse secondary QDots (Thermo Fisher) were incubated with 360 nM anti–DNA-PKcs antibody (Abcam ab44815) on ice for 10 min in 5 μl of DNA-PKcs loading buffer [40 mM tris-HCl (pH 8.0), BSA (0.2 mg/ml), 2 mM MgCl2, and 2 mM DTT]. DNA-PKcs was added to this mixture to a final concentration of 267 nM QDots, 240 nM antibody, and 167 nM DNA-PKcs in 7.5 μl for another 10 min on ice. This mixture was diluted to a final volume of 200 μl (10 nM Qdots, 9 nM antibody, and 6.25 nM DNA-PKcs). Ku(5A) was loaded on DNA curtains essentially as described previously for wild-type Ku (13). Next, DNA-PKcs was injected onto DNA curtains from a 100-μl loop at 200 μl/min in DNA-PKcs loading buffer. For MRN cleavage experiments, after DNA-PKcs loading, the buffer was switched to MRN cleavage buffer [40 mM tris-HCl (pH 8.0), 60 mM NaCl, BSA (0.2 mg/ml), 5 mM MgCl2, 1 mM ATP, and 2 mM DTT]. After buffer switch, mixtures of 3 nM MRN, 14 nM CtIP, or both were loaded as previously described (13).
GLASS-ChIP assay
Human U2OS cells with inducible AsiSI (46) were grown to 50 to 60% confluency in 150-mm dishes and treated with 600 nM 4-OHT for 4 hours at 37°C. When used, 10 μM NU7441 was added 1 hour before 4-OHT addition. After 4-OHT treatment, cells were fixed with 1% formaldehyde for 7 min at room temperature (RT) with gentle rotation. Crosslinking was stopped by addition of 125 mM glycine for 5 min, washed twice with cold phosphate-buffered saline, harvested, flash-frozen in liquid nitrogen, and stored at −80°C.
For the ChIP assay, we modified a standard protocol (Abcam) with a gentle lysis procedure and minimal, low-level sonication to rupture cells without extensive DNA damage. The formaldehyde-fixed cells were thawed at RT for 5 min, resuspended in radioimmunoprecipitation assay buffer [50 mM tris-HCl (pH8.0), 150 mM NaCl, 2 mM EDTA (pH8.0), 1% NP-40, 0.5% sodium deoxycholate, and 0.1% SDS] with 1× protease inhibitors (Pierce, A32955), and sonicated using a QSonica sonicator at low power (amplitude 20) for 10 s, followed by 10 pulses after a 20-s interval. Cell lysates were then centrifuged at 3000 rpm for 3 min at RT to remove the bulk of chromatin. The supernatant was then incubated with 1.6 μg of anti–DNA-PKcs pS2056 antibodies (Abcam 124918) overnight at 4°C, followed by incubation with 25 μl of protein A/G magnetic beads (Pierce) at RT for 2 hours. Beads were then washed sequentially once in low-salt wash buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM tris-HCl (pH 8.0), and 150 mM NaCl], once in high-salt wash buffer [0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM tris-HCl (pH 8.0), and 500 mM NaCl], and once in LiCl wash buffer [0.25 M LiCl, 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA, and 10 mM tris-HCl (pH 8.0)]. Beads were then resuspended in TE buffer [10 mM tris (pH 8.0) and 1 mM EDTA] and transferred to a fresh tube and finally eluted with 100 μl of elution buffer (1% SDS and 100 mM NaHCO3). Crosslinks were reverted for the elutions (65°C for 24 hours). DNA fragments <300 bp from ChIP elutions were separated by pulling down larger fragments using paramagnetic AMPure XP beads: 65 μl of AMPure XP beads was added to the uncrosslinked ChIP elution and mixed thoroughly. After 10-min incubation at RT, beads were isolated using a magnet. The supernatant was collected, and 25 μl of fresh AMPure XP beads was added and mixed thoroughly. After 10 min at RT, beads were separated and the supernatant was cleaned using a Qiagen Nucleotide Cleanup kit. At the final step, DNA was eluted in 60 μl of elution buffer and used for qPCR. Four different AsiSI sites were monitored using upstream and downstream primers within 40 to 52 bp from the AsiSI cut site (table S1). %DNA was calculated using the following equation: 2[Ct(input) – Ct(test)] × 100%. DNA values obtained for IP in the absence of antibodies were subtracted from the values obtained in the presence of antibody and used for plotting the graphs in Fig. 5. To monitor the Mre11 nuclease dependence, we treated the human U2OS cells expressing inducible AsiSI with 10 μM NU7441, 100 μM PFM03, and 600 nM 4-OHT simultaneously for 1 hour at 37°C before harvesting cells.
Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/6/2/eaay0922/DC1
Fig. S1. Purified recombinant proteins used in this study.
Fig. S2. Ku(5A) promotes MRN-dependent endonuclease activity.
Fig. S3. Interactions between CtIP, DNA-PKcs, Ku, and MRN do not depend on DNA or CtIP phosphorylation.
Fig. S4. Schematic diagram of GLASS-ChIP protocol.
Fig. S5. Quantification of DNA immunoprecipitated with anti–DNA-PKcs pS2056 using primers 300 bp away from AsiSI DSB.
Table S1. Primers used for qPCR in Fig. 5 and fig. S5.
N. Jette,
S. P. Lees-Miller
, The DNA-dependent protein kinase: A multifunctional protein kinase with roles in DNA double strand break repair and mitosis. Prog. Biophys. Mol. Biol. 117, 194–205 (2015).
H. H. Y. Chang,
N. R. Pannunzio,
N. Adachi,
M. R. Lieber
, Non-homologous DNA end joining and alternative pathways to double-strand break repair. Nat. Rev. Mol. Cell Biol. 18, 495–506 (2017).
A. A. Goodarzi,
P. A. Jeggo
, The repair and signaling responses to DNA double-strand breaks. Adv. Genet. 82, 1–45 (2013).
L. S. Symington
, Mechanism and regulation of DNA end resection in eukaryotes. Crit. Rev. Biochem. Mol. Biol. 51, 195–212 (2016).
T. Blunt,
N. J. Finnie,
G. E. Taccioli,
G. C. Smith,
J. Demengeot,
T. M. Gottlieb,
R. Mizuta,
A. J. Varghese,
F. W. Alt,
P. A. Jeggo,
S. P. Jackson
, Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80, 813–823 (1995).
P. Chanut,
S. Britton,
J. Coates,
S. P. Jackson,
P. Calsou
, Coordinated nuclease activities counteract Ku at single-ended DNA double-strand breaks. Nat. Commun. 7, 12889 (2016).
T. Aparicio,
R. Baer,
J. Gautier
, DNA double-strand break repair pathway choice and cancer. DNA Repair 19, 169–175 (2014).
R. A. Deshpande,
S. Arora,
T. T. Paull
, Nbs1 converts the human Mre11/Rad50 nuclease complex into an endo/exonuclease machine specific for protein-DNA adducts. Mol. Cell 64, 593–606 (2016).
R. Anand,
L. Ranjha,
E. Cannavo,
P. Cejka
, Phosphorylated CtIP functions as a co-factor of the MRE11-RAD50-NBS1 endonuclease in DNA end resection. Mol. Cell 64, 940–950 (2016).
G. Reginato,
, Physiological protein blocks direct the Mre11-Rad50-Xrs2 and Sae2 nuclease complex to initiate DNA end resection. Genes Dev. 31, 2325–2330 (2017).
W. Wang,
J. M. Daley,
Y. Kwon,
D. S. Krasner,
P. Sung
, Plasticity of the Mre11-Rad50-Xrs2-Sae2 nuclease ensemble in the processing of DNA-bound obstacles. Genes Dev. 31, 2331–2336 (2017).
A. Jasrotia,
D. Bundschuh,
S. M. Howard,
M. Stucki,
, NBS1 promotes the endonuclease activity of the MRE11-RAD50 complex by sensing CtIP phosphorylation. EMBO J. 38, e101005 (2019).
L. R. Myler,
I. F. Gallardo,
M. M. Soniat,
X. B. Gonzalez,
Y. Kim,
T. T. Paull,
I. J. Finkelstein
, Single-molecule imaging reveals how Mre11-Rad50-Nbs1 initiates DNA break repair. Mol. Cell 67, 891–898.e4 (2017).
A. A. Sartori,
C. Lukas,
M. Mistrik,
S. Fu,
J. Bartek,
J. Lukas,
, Human CtIP promotes DNA end resection. Nature 450, 509–514 (2007).
M. Gellert
, Nbs1 potentiates ATP-driven DNA unwinding and endonuclease cleavage by the Mre11/Rad50 complex. Genes Dev. 13, 1276–1288 (1999).
, The 3’ to 5’ exonuclease activity of Mre 11 facilitates repair of DNA double-strand breaks. Mol. Cell 1, 969–979 (1998).
T. J. Herdendorf,
D. W. Albrecht,
S. J. Benkovic,
S. W. Nelson
, Biochemical characterization of bacteriophage T4 Mre11-Rad50 complex. J. Biol. Chem. 286, 2382–2392 (2011).
B. Hopkins,
, The P. furiosus Mre11/Rad50 complex promotes 5’ strand resection at a DNA double-strand break. Cell 135, 250–260 (2008).
A. B. Bowman,
M. Aschner
, Considerations on manganese (Mn) treatments for in vitro studies. Neurotoxicology 41, 141–142 (2014).
N. Makharashvili,
A. T. Tubbs,
S.-H. Yang,
H. Wang,
O. Barton,
Y. Zhou,
J.-H. Lee,
M. Lobrich,
B. P. Sleckman,
X. Wu,
, Catalytic and noncatalytic roles of the CtIP endonuclease in double-strand break end resection. Mol. Cell 54, 1022–1033 (2014).
Y. Li,
L. N. Truong,
L. Z. Shi,
P. Y.-H. Hwang,
J. He,
J. Do,
M. J. Cho,
H. Li,
A. Negrete,
J. Shiloach,
M. W. Berns,
B. Shen,
L. Chen,
X. Wu
, CtIP maintains stability at common fragile sites and inverted repeats by end resection-independent endonuclease activity. Mol. Cell 54, 1012–1021 (2014).
S. Moreau,
J. R. Ferguson,
, The nuclease activity of Mre11 is required for meiosis but not for mating type switching, end joining, or telomere maintenance. Mol. Cell. Biol. 19, 556–566 (1999).
J. Buis,
Y. Wu,
Y. Deng,
J. Leddon,
G. Westfield,
M. Eckersdorff,
J. M. Sekiguchi,
S. Chang,
D. O. Ferguson
, Mre11 nuclease activity has essential roles in DNA repair and genomic stability distinct from ATM activation. Cell 135, 85–96 (2008).
, Rad50 ATPase activity is regulated by DNA ends and requires coordination of both active sites. Nucleic Acids Res. 45, 5255–5268 (2017).
K. J. Lee,
J. Saha,
J. Sun,
K. R. Fattah,
S. C. Wang,
B. Jakob,
L. Chi,
S. Y. Wang,
G. Taucher-Scholz,
A. J. Davis,
D. J. Chen
, Phosphorylation of Ku dictates DNA double-strand break (DSB) repair pathway choice in S phase. Nucleic Acids Res. 44, 1732–1745 (2016).
W. D. Block,
Y. Yu,
D. Merkle,
J. L. Gifford,
Q. Ding,
K. Meek,
, Autophosphorylation-dependent remodeling of the DNA-dependent protein kinase catalytic subunit regulates ligation of DNA ends. Nucleic Acids Res. 32, 4351–4357 (2004).
Y. V. Reddy,
S. P. Lees-Miller,
D. A. Ramsden
, Non-homologous end joining requires that the DNA-PK complex undergo an autophosphorylation-dependent rearrangement at DNA ends. J. Biol. Chem. 279, 39408–39413 (2004).
P. Douglas,
D. A. Ramsden,
K. Meek
, Autophosphorylation of the catalytic subunit of the DNA-dependent protein kinase is required for efficient end processing during DNA double-strand break repair. Mol. Cell. Biol. 23, 5836–5848 (2003).
D. W. Chan,
B. P. Chen,
S. Prithivirajsingh,
A. Kurimasa,
M. D. Story,
J. Qin,
, Autophosphorylation of the DNA-dependent protein kinase catalytic subunit is required for rejoining of DNA double-strand breaks. Genes Dev. 16, 2333–2338 (2002).
N. Uematsu,
E. Weterings,
K. Yano,
K. Morotomi-Yano,
P. O. Mari,
D. C. van Gent,
, Autophosphorylation of DNA-PKCS regulates its dynamics at DNA double-strand breaks. J. Cell Biol. 177, 219–229 (2007).
A. Shibata,
D. Moiani,
A. S. Arvai,
J. Perry,
S. M. Harding,
M. M. Genois,
R. Maity,
S. van Rossum-Fikkert,
A. Kertokalio,
F. Romoli,
A. Ismail,
E. Ismalaj,
E. Petricci,
M. J. Neale,
R. G. Bristow,
J. Y. Masson,
C. Wyman,
J. A. Tainer
, DNA double-strand break repair pathway choice is directed by distinct MRE11 nuclease activities. Mol. Cell 53, 7–18 (2014).
, CtIP: A DNA damage response protein at the intersection of DNA metabolism. DNA Repair 32, 75–81 (2015).
M. Gottesman,
, MRN, CtIP, and BRCA1 mediate repair of topoisomerase II-DNA adducts. J. Cell Biol. 212, 399–408 (2016).
K. Nakamura,
T. Kogame,
H. Oshiumi,
A. Shinohara,
Y. Sumitomo,
K. Agama,
Y. Pommier,
K. M. Tsutsui,
K. Tsutsui,
E. Hartsuiker,
T. Ogi,
S. Takeda,
Y. Taniguchi
, Collaborative action of Brca1 and CtIP in elimination of covalent modifications from double-strand breaks to facilitate subsequent break repair. PLOS Genet. 6, e1000828 (2010).
F. Polato,
E. Callen,
N. Wong,
R. Faryabi,
S. Bunting,
H.-T. Chen,
M. Kozak,
M. J. Kruhlak,
C. R. Reczek,
W.-H. Lee,
T. Ludwig,
L. Feigenbaum,
S. Jackson,
A. Nussenzweig
, CtIP-mediated resection is essential for viability and can operate independently of BRCA1. J. Exp. Med. 211, 1027–1036 (2014).
P. Huertas,
, Human CtIP mediates cell cycle control of DNA end resection and double strand break repair. J. Biol. Chem. 284, 9558–9565 (2009).
M. H. Yun,
K. Hiom
, CtIP-BRCA1 modulates the choice of DNA double-strand-break repair pathway throughout the cell cycle. Nature 459, 460–463 (2009).
S. C. Naumann,
R. Diemer-Biehs,
J. Kunzel,
M. Steinlage,
S. Conrad,
L. Feng,
B. S. Lopez,
M. Löbrich
, Polo-like kinase 3 regulates CtIP during DNA double-strand break repair in G1. J. Cell Biol. 206, 877–894 (2014).
S. E. Peterson,
F. Wu-Baer,
B. T. Chait,
H. Yan,
M. E. Gottesman,
, Activation of DSB processing requires phosphorylation of CtIP by ATR. Mol. Cell 49, 657–667 (2012).
C. C. Wong,
X. Han,
P. Y. Hwang,
Z. Shao,
D. J. Chen,
J. R. Yates III.,
, The interaction of CtIP and Nbs1 connects CDK and ATM to regulate HR-mediated double-strand break repair. PLOS Genet. 9, e1003277 (2013).
F. Gong,
S. H. Yang,
M. S. Wold,
K. M. Miller,
, Single-molecule imaging reveals the mechanism of Exo1 regulation by single-stranded DNA binding proteins. Proc. Natl. Acad. Sci. U.S.A. 113, E1170–E1179 (2016).
M. L. Nicolette,
K. Lee,
Z. Guo,
M. Rani,
J. M. Chow,
S. E. Lee,
, Mre11-Rad50-Xrs2 and Sae2 promote 5’ strand resection of DNA double-strand breaks. Nat. Struct. Mol. Biol. 17, 1478–1485 (2010).
V. Garcia,
S. E. Phelps,
S. Gray,
M. J. Neale
, Bidirectional resection of DNA double-strand breaks by Mre11 and Exo1. Nature 479, 241–244 (2011).
P. Pasupathy,
M. Brown,
C. M. Manhart,
D. P. Neikirk,
E. Alani,
, High-throughput universal DNA curtain arrays for single-molecule fluorescence imaging. Langmuir 31, 10310–10317 (2015).
, The DNA-dependent protein kinase: Requirement for DNA ends and association with Ku antigen. Cell 72, 131–142 (1993).
J. S. Iacovoni,
P. Caron,
I. Lassadi,
E. Nicolas,
L. Massip,
D. Trouche,
G. Legube
, High-resolution profiling of gammaH2AX around DNA double strand breaks in the mammalian genome. EMBO J. 29, 1446–1457 (2010).
F. Aymard,
B. Bugler,
C. K. Schmidt,
E. Guillou,
S. Briois,
V. Daburon,
, Transcriptionally active chromatin recruits homologous recombination at DNA double-strand breaks. Nat. Struct. Mol. Biol. 21, 366–374 (2014).
P. R. Blier,
A. J. Griffith,
J. Craft,
J. A. Hardin
, Binding of Ku protein to DNA. Measurement of affinity for ends and demonstration of binding to nicks. J. Biol. Chem. 268, 7594–7601 (1993).
L. Postow
, Destroying the ring: Freeing DNA from Ku with ubiquitin. FEBS Lett. 585, 2876–2882 (2011).
N. Jiang,
X. Fei,
K. Sheng,
P. Sun,
Y. Qiu,
J. Larner,
L. Cao,
X. Kong,
J. Mi
, Valosin-containing protein regulates the proteasome-mediated degradation of DNA-PKcs in glioma cells. Cell Death Dis. 4, e647 (2013).
J. van den Boom,
M. Wolf,
L. Weimann,
N. Schulze,
F. Li,
F. Kaschani,
A. Riemer,
C. Zierhut,
M. Kaiser,
G. Iliakis,
H. Funabiki,
H. Meyer
, VCP/p97 extracts sterically trapped Ku70/80 rings from DNA in double-strand break repair. Mol. Cell 64, 189–198 (2016).
J.-S. Kim,
T. B. Krasieva,
H. Kurumizaka,
A. M. R. Taylor,
K. Yokomori
, Independent and sequential recruitment of NHEJ and HR factors to DNA damage sites in mammalian cells. J. Cell Biol. 170, 341–347 (2005).
A. G. Amatucci,
H. J. Beamish,
D. Gell,
X. H. Xiang,
M. I. Torres Arzayus,
A. Priestley,
A. Marshak Rothstein,
V. L. Herrera
, Targeted disruption of the catalytic subunit of the DNA-PK gene in mice confers severe combined immunodeficiency and radiosensitivity. Immunity 9, 355–366 (1998).
B. L. Ruis,
E. A. Hendrickson
, The catalytic subunit of DNA-dependent protein kinase regulates proliferation, telomere length, and genomic stability in human somatic cells. Mol. Cell. Biol. 28, 6182–6195 (2008).
C. Nelsen,
, Ku86 is essential in human somatic cells. Proc. Natl. Acad. Sci. U.S.A. 99, 832–837 (2002).
C. H. Mody,
N. S. Ting,
, Purification and characterization of the double-stranded DNA-activated protein kinase, DNA-PK, from human placenta. Biochem. Cell Biol. 74, 67–73 (1996).
Acknowledgments: We thank D. Moiani and J. Tainer for the Mre11 inhibitors and members of the Paull laboratory for useful discussions and for critical reading of the manuscript. Funding: This work was supported by the National Institute of General Medical Sciences of the NIH (GM120554 to I.J.F.), the National Cancer Institute of the NIH (CA092584 to I.J.F. and S.P.L.-M.), CPRIT (R1214 to I.J.F. and RP110465 to T.T.P.), and the Welch Foundation (F-l808 to I.J.F.). I.J.F. is a CPRIT Scholar in Cancer Research. L.R.M. is supported by the National Cancer Institute of the NIH (F99CA212452). M.M.S. is supported by a Postdoctoral Fellowship, PF-17-169-01-DMC, from the American Cancer Society. The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIH. Author contributions: R.A.D., L.R.M., and M.M.S. conceived and performed experiments and contributed to writing and editing of the manuscript. N.M., L.L., and S.P.L.-M. provided essential reagents for the experiments and contributed to the editing of the manuscript. I.J.F. and T.T.P. contributed to the ideas underlying the experiments and to the writing and editing of the manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.
You are going to email the following DNA-dependent protein kinase promotes DNA end processing by MRN and CtIP
By Rajashree A. Deshpande, Logan R. Myler, Michael M. Soniat, Nodar Makharashvili, Linda Lee, Susan P. Lees-Miller, Ilya J. Finkelstein, Tanya T. Paull
DNA-dependent protein kinase regulates end processing for homologous recombination. | cc/2020-05/en_middle_0128.json.gz/line890 |
__label__wiki | 0.63293 | 0.63293 | Retailer C&A investigates prison labor allegations following Financial Times article
Shomara Roosblad
today Feb 21, 2018
Dutch fashion retailer C&A is currently investigating whether it is true that part of its clothing is made and packaged by Chinese prison laborers. The investigation follows allegations made by British former journalist and business researcher, Peter Humphrey.
C&A branch in Arnhem, the Netherlands - Diederik van der Laan / Kiki Reijners for C&A
Humphrey revealed last weekend in the British newspaper, Financial Times, that Chinese detainees have to make clothes for well-known clothing brands, including C&A and Swedish retailer H&M. Humphrey himself spent two years in a prison in Shanghai after he was arrested for ‘illegally collecting private data from Chinese citizens’. At the time he was investigating a smear campaign against the pharmaceutical company GlaxoSmithKline.
In the Financial Times article, published on February 16, 2018, Humphrey describes how the prison put prisoners to work for large companies: “It was piece work; a hundred of this, a thousand of that. Full-time, they earned about Yn120 (£13.50) a month. But it was also about points. There was a sentence-reduction system based on points earned through labor — work such as floor cleaning, food serving, teaching and approved study,” Humphrey explained in the newspaper.
In a statement to FashionNetwork.com, C&A Europe commented: “We never tolerate any kind of forced or bonded labor in our supply chain. This is backed by our rigorous supplier code of conduct and audit programme, where if forced labor is found, the supplier is immediately terminated. This includes any kind of prison labor. We audit all 273 of our suppliers’ factories in China on at least annually basis, and have not observed or been made aware of the use of prison labor in our Chinese supply chain. To enhance our approach, our sustainable supply chain auditors and quality assurance teams have practices in place to detect unauthorized subcontracting that could ultimately lead to forced or bonded labor at the factory level.”
In addition, C&A said that it takes the allegations that were made by Humphrey ‘very seriously’ and that it is currently trying to obtain more information on the case.
C&A names former Asda boss as chairman
Tech accelerator Lafayette Plug & Play presents latest cohort of 17 start-ups
C&A Europe CFO Tjeerd van der Zee departs
Dutch fashion retailer C&A hires banks for Brazilian subsidiary IPO
Vero Moda joins Jeans Redesign project
Puma pledges 35% reduction in carbon emissions by 2030
Better Cotton Initiative hails H&M as leader in sustainable cotton use
Fashion For Good expands to South Asia
Big clothes brands found to fall short of own fair wage promises
Fashion for Good joins Circle Economy on new green initiative
C&A r de Rivoli | cc/2020-05/en_middle_0128.json.gz/line894 |
__label__wiki | 0.68635 | 0.68635 | Tag: john mellencamp
Suggest a New Song to Replace ‘Our Country’ During Every NFL Commercial Break
“The dream is still alive….” At least it has been for the past few NFL seasons for John Mellencamp’s variously-interpreted anti-War on Terror anthem and the Chevy Silverado ad for which it’s served as the audio backdrop.
I know Mellencamp has made millions off this campaign, in spite of the fact that it may have hurt sales of recent records (because it’s so annoying and omnipresent?)
But now I’m hoping to hear the voice of freedom to select new songs to synch with car ads this football season. Let’s face it, the “Our Country” ad and its brutal stickiness has in many ways ruined the past couple seasons for us football fans who don’t have TiVo. This year, perhaps we can deal simply with the Brett Favre soap opera as the primary spoiler to the season (and just the story, not his potential to bury my Bears).
What songs would you like to be spoonfed into your many hours of redundant NFL ads this season? M.I.A.? Madonna? Gnarls Barkley? The inevitable Brad Paisley? Metallica? Is an ad gonna break a single this season and then butcher the release of an album (as was the case with “Our Country?”)
Here’s to those pitching new songs for placement in ads likely to air during football games. I sure hope you landed something fresh and not-so-annoying.
Best Use of Metallica’s ‘One’ in a Public Radio Story
New Pew Surveys: Online Video & Web Use Among Teens
LA Times Creates Google Map for California Fire Storm ’07 | cc/2020-05/en_middle_0128.json.gz/line900 |
__label__cc | 0.722179 | 0.277821 | The Skeleton’s Wardrobe: Who Are You?
By ASF Last updated Jun 12, 2017
To be boy, to be girl or to be other; it seems to be the biggest concern, privilege, and question amongst all individuals in the United States of America.
The good ol’gender spectrum or the binary gender system, to be specific. This system implies two assumptions: that gender is binary and that the core aspect of self is biologically determined.
According to Gender Spectrum, by Joel, Baum, who opines that the binary system typically conflates gender and sex. One’s sex includes physical attributes such as external genitalia, sex chromosomes, gonads, sex hormones, and internal reproductive structures. At birth, this “biology of gender” is used to answer the boy or girl question.”
I say, “Yada, yada, yah. One may go seek the answers for themselves if they wish by clicking on Google if you will.” Go now, you’ll thank me later for the deeper appreciation and understanding of the entire subject.
Looking at it from the bottom up. Babies, to children and from children to adults.
At the age of four, a child, who would’ve been born to play with trucks and perhaps like collecting nasty bugs (prior to what I’ll call: The Be as You Will Movement) but instead gravitates towards liking ballerina tutu’s, the latest Disney movies, and even the dreaded color pink, has the legal right to be continually subjected to such back ass treatment by the adults raising him; vice versa for girls.
These young children have even been given the right to decide what bathroom they would like to use, even if the choice is different from their assigned gender identity. Then, of course, you have those who scream there shouldn’t be certain behavior traits ascertained to a specific gender and that labels are not needed. “There is no specific thing for girls and no specific thing for boys,” they would argue. They being those who are gender non-confirming.
I reached out to my long-time friend, Mike, Townsend, who I haven’t seen for about two years now; the longest of our time spent apart. We both grew up together. Mike, who was born a girl, lived down the street from my family for almost my entire childhood. Our parents, who were the best of friends and always together, would smoke a little weed, have a drink or two and forget they had children running madly around the house somehow; it was the early 80s after all.
Those days of endless movie nights where we would watch movies like: Milo & Otis, Fern Gully, or Willow, again and again; Let alone, the sleepover’s we had where going to sleep meant you slept when you wanted and where you wanted and with who you wanted. I hadn’t seen Mike since my brother’s baby shower which was in October 2015, and just thinking about the time that had gone by, made me miss him.
“Where has the time gone?” I ask as Mike answers the phone. “What?” he says. Immediately, I realize he hadn’t heard me. “Never mind, how are you?” I ask. We go through our usual exchange for a moment or two and then I jump right into the reason for my late evening call; due to the time difference, Mike lives about three hours into the future. Without hesitation, I tell Mike that I have a class assignment I’m working on and that I’d like to write about what it’s like being Transgender; I want to write about what it’s like being cisgender and what it’s like being of gender identity period.
Well, if I could’ve seen through the phone with x-ray vision of some sort, I’m sure Mike was probably having a conundrum. A long, eerie pause ensued. The kind that I’m not used to during our conversations. The kind that almost would’ve made me give up had I not been so pessimistic. At any rate, after reassuring that Mike was okay with various conditions and after agreeing to conduct the interview by email, for paper trail purposes, I felt overjoyed with relief at his agreeance to the project.
“I will answer the questions to the best of my abilities but there are some questions I won’t answer. I might explain why and mostly, I will not. These answers only speak the experience of me, a straight-cisgender-passing, transman of color, who has only lived in “blue” states for the most of his life. There is an entire spectrum of experiences out there and everyone is different.”
~ Mike Townsend
Q: Do you remember what you wanted to be as a child, career wise?
A: A doctor.
Q: Did you have any bedwetting as a child?
A: Nope
Q: What were some of your favorite toys? Remote control cars. In fact, I asked for one every year at my birthday and Christmas time. He Man action figure and Stretch Armstrong.
Q: Favorite foods?
A: Peanut butter! I just love it. Macaroni and cheese. Waffles.
When I finally reached my brother, Jarred, Palmer, and had the opportunity to ask him a few questions about what he remembered growing up on the same street as Mike and a few early memories pertaining to our childhood, my brother simply smiled and stated, “Well, I remember every time we played Barbie’s or house (you know the children’s pretend game that usually requires at least 2-3 kids, where a role is assumed; a mother, father and perhaps a child that almost always acts irate, clearly showing you that children are smarter than they appear.) that she (referring to Mike as a girl from our past) wanted to always be the Ken doll or the Dad. It weirded me out a little but that was our friend and we loved her. Plus, I think it helped that we were raised differently than most kids. You know to not ask adult-like questions, to always respect everyone, and to just go with the flow. Products of 80s parents, I guess. So, we never gave her any slack, know what I mean?” He stated, yet asked at the same time. And I understood perfectly.
~ ‘Reflected Agony’ by Nicholas, Sherman
Mirrors hold horrors That scare me and scar me. The picture before me— They say it’s my face He blinks, she blinks back at him… It’s me, but trapped within Looking glass nightmares Wrapped up in pink lace. Shreds of glass show me The terrors that throw me —the shattered self-portrait I cast as I pass Hot tears hit mirrored floor Fallen from a mirrored orb Silent explosions Mark splashes steadfast. His fist flew to smash it Hers flew out to match it They met in the middle Where crimson blood ran The blood of a stranger Whose face she endangered With dimples and lashes So far from a man.
~ Taken from allpoetry.com
So, in the world of transitioning out of what you’re physically born into, I’d say, “There is a high demand for education on the topic and into the entire spectrum as to what people are going through and how it affects people around them, as well.”
In a publication from Transgender People 2015 and The American Psychological Association, What Does It Mean to Be Transgender? It states that deciding to transition can be a difficult, but rewarding choice for the gender involved in making the decision. Most times the transition can be subtle and normally begins with the obvious.
– While there is no “right” way to transition genders, there are some common social changes transgender people experience that may involve one or more of the following: adopting the appearance of the desired sex through changes in clothing and grooming, adopting a new name, changing sex designation on identity documents (if possible), using hormone therapy treatment, and/or undergoing medical procedures that modify their body to conform with their gender identity.
Imagine if you will for a moment:
– Growing baby grows. Growing baby is now subjected to the bells and whistles of what his parents provide through stimuli and now Baby, Jackson, if you will, is now walking, talking, and acting like Baby, Jackie. Baby, Jackie, is now a teenager, who is very confused and upset. Upset, because his entire life, his body has failed him, his clothes have failed him, and his parents may —– have even failed him, —– and now he decides to fully transform into Jackie because Jackie is who he really wants to transition into. Why? Not because of choice at this point, but because he has known all along, influenced or not, that he was different, and to be a girl is his decision.
Origin of Stimulus-Stimuli:
something that incites to action or exertion or quickens action, feeling, thought.
incitement, enticement, motive, provocation.
The sweat under my breasts irritated me. There wasn’t and still isn’t enough powder in the world to absorb the moisture of the heavy boob syndrome. I had probably already taken about two or three showers that day, it just happened to be that hot and humid. I remember specifically because I was going out to the Brooklyn Market for the first time with my friend who had finally arrived in New York for the year. What made it most exciting, this was our first year as actual adults, well at least being twenty-one years of age. But this “Heffa,” had yet, to come and visit me.
Needlessly to say, we or I, for the most part, missed the market. About a week or maybe even two later she arrived at my house and made her peace with me. She had brought donuts. It worked and still does, almost every time. And then, before things could start to make sense, they started to get even more confusing. As not even four months into my friend’s serenity, did she really start to show us who she wanted to be? It was a warm summer afternoon on Long Island, New York, and my friend, with her beautiful, black, buoyantly-amazing hair; the kind that I had always been so jealous of for the way it just hung-long, as fucking Rapunzel’s, from that Disney movie; and how it shimmered in the sun like diamonds because obviously, her mom used something my mom didn’t; went out into town and hours later came back, with what would be considered as a boy’s hairstyle. It had all been cut off! And proudly, she made sure each of us who loved her, saw the abrupt change immediately.
Q: Was it a subtle change?
A: Lol, no not really. I just jumped in and did it. First open thing I did was to cut my hair off. Shocked the crap out of everyone!
Q: When did you decide to transition?
A: The day after I heard it was a thing. Had never heard of the term, Transman before. But a friend was talking about it one day and explained it to me and that was pretty much it. I googled everything I could on the subject and was looking up support groups the next day.
Q: Was it a hard decision?
A: Hard, no. Scary, yes!
Q: Were people against it?
A: Some people were. My mom was for the longest time. She has since come around. Friends were kind of shocked but not completely. My dad took it pretty well and that helped.
Q: At some point, were you gay? And if so, how many relationships did it take before realizing that was so?
A: Yes, in the beginning stage of my transition I was gay. And I went through one before I realized it. I do not consider myself to be gay any longer.
Q: How old were you when you entered your first gay relationship?
A: I was 18.
Q: Did you suspect you were different as a young adult? If so, how?
A: I didn’t like hanging out with the girls. But at the time, everyone suspected I was just going through a “tomboy” phase. So, not even I stressed what was happening with me. Although, I do remember daydreaming quite often about growing up and being this man. I never knew how, or why, or where to even begin or if in fact it was me. But I had em.
Q: At what age did you lose your virginity and was it to a man/boy, or woman/girl, or other?
A: I was 15 and it was to a boy.
Q: Any crushes?
A: Of course, I was still human! Her name was Lisa, Turtle, from Saved by The Bell; Oh, yeah and Clarissa, from Clarissa Explains It All, and one of those guys from the Criss Cross group we’d listen to all the time; although, I can’t recall which one it was after all this time.
It is said that women who cross-dress gain power. In western culture, “Women must constantly prove their worth and are not always given the same exact value for those worth’s, as their male counterparts.”
A woman must always prove their worth. A man must never fall too far into the feminine zone.
Q: Has being a Cisgender person changed your way of thinking towards anything? And if so, like what?
A: I am more open to different experiences than I was before.
Q: What are your favorite things to do for fun?
A: I hang out with my wife. I play video games. I even enjoy going hiking occasionally.
Q: Have you ever purposely lied about your sex to hurt someone?
Q: What is your bathroom of choice?
A: Men’s
Q: Where do you usually shop for clothes?
A: Old Navy
Q: Have you ever faced discrimination for being a person who identifies as a person of a different gender?
A: There are several laws in the state I live in that specifically target trans-people.
Q: Are you nervous about your future in America?
A: Sometimes. Especially, with the most current administration. Luckily, I pass as male without question. My wife and I are straight, Christian, and financially stable. We are afforded a lot of privilege that not all trans people, especially trans women, are granted.
Q: Do you still get a monthly cycle? If so, will you go through menopause?
A: No, I went through it already. And F. Y. FUCKING.I, menopause-sucks!
Q: Can you or would you still have any children?
A: I could but I would not.
Q: Is there ever any going back?
Q: What’s easier, being man or woman?
A: In my experience so far, being a man is a lot easier. There is a lot less expected emotionally and life so far has been awesome without that monthly cycle.
There were so many things on my mind. Thoughts entertained my mind wickedly with this project I entertained. Some, that I didn’t even think I should have. I had to really pull myself back down from cloud la-la-land a bit to be sure I wasn’t crossing over into some sort of an invasion of the privacy act. Feeling slight-fully sinful towards myself, at just how curious I indeed was with my unanswered questions. Questions I decided both not to ask and then the questions I said what the hell to and asked anyway, left me realizing I had probably crossed the line just a bit, no matter if we were childhood friends or not. In fact, the few questions I was brave enough to ask but unfortunately did not receive a response; questions pertaining to roles played in the bedroom during intimacy; questions pertaining to methods or procedures that are routinely followed to maintain a daily appearance; questions pertaining to inspirational individuals that had given hope and inspiration throughout the transition stage; and many others that I guess I’ll just have to forget like yesteryears one hit wonders.
“Do you remember when we went and got super drunk at Applebee’s in Bellmore? Oh yeah,” I said, as my hand’s fist pumped in the air but you couldn’t see me. “We were throwing everything back. It was what? A two-for-one night and your night off. A bartender, someone — who was crushing on you— just kept supplying the ½ filled cups, two at a time, of different brands of alcohol, like he just knew he was getting some. And he didn’t,” we both laughed as I said that!
“The drive home was a straight shot. But before we decided to go home, we stopped at Tee’s house with baseball bats ready for anything. That fucking bitch had it coming and that night, was the right night. ‘This nasty she-troll wanna run around town while I’m away on vacation and spread lies to my husband about me, regarding some bull shit and about some man I barely know. We’ll see about that!’ I shouted and you instigated in a normal fashion. We were beyond drunk if I really recall; probably high- after smoking a couple marijuana blunts in the Applebee’s parking lot before taking off in an attempt to lower our drunkenness. Which, I can’t recall if it worked or not, and dressed to kill in the latest NY style.
You pulled the car into the underground parking garage, did a marvelous job at parking, and we both stumbled out of my red, Pontiac-Grand-Prix-with the broken sunroof, ‘Remember, the one with the trash bag sealed down on top?’” I asked laughing a bit just thinking about how far we both have come from this situation. I’m not sure at this point if Mike is getting old, because I am older, or if being cisgender makes you less aware of your goddamn past because for whatever reason he doesn’t know what I’m talking about. I couldn’t believe it when he said he didn’t remember. After all, we had made it all the way up to her third-floor, apartment door and we knocked, no we banged, kicked even on that damn-dingy, ass, door-worse than the DEA would’ve done during a raid in a crack house!
No one was home. Damn, I miss my down for “whatever” girlfriend.
Transgender: The term transgender has largely replaced the older term transsexual, which is now considered outdated. Transgender is a less clinical term, referring more to gender identity and gender expression than to sexual orientation or physical sex characteristics. It is also a more general and inclusive term: a transgender person may be gay, transsexual, transvestite, or even genderqueer. Use of transgender as a noun is declining in use and is usually taken as offensive. And people object to the adjectival variant transgendered because the –ed suffix could imply that something happened to make the person transgender
Transman: an adult who was born female but whose gender identity is male.
Transwoman: an adult who was born male but whose gender identity is female.
Cisgender: There is A LOT you need to research on this topic. In fact, my initial reaction as I dived into looking up what CIS genderism is, “FUCK my life,” pretty much came to mind. There’s so much information out there regarding what it’s like being Cisgender and what it all involves. My advice is to always ask questions and research, research, research. And you can start here, by all means necessary: CIS genderism: Gavriel Y. Ansara and Israel Berger, The Sage Encyclopedia of LGBTQ Studies. Ed. Abbie E. Goldberg. Vol. 1. Los Angeles; Page 230
I am not sure where I stand on this entire debate. I just know that I am respectful. I was raised that way. I am not sure who I am. Because if everyone else can determine themselves to be other than what they were born, why can’t I? Or should I even want to think that way? Thanks, U.S.A! And what is stopping people from becoming or transitioning into unicorns or robots or fury’s or Princesses or dogs or leopards or invisibility cloaks, for all that matters? When we all live in a society that is now open or at least trying to be open to people seeing themselves as they wish and then expecting and gaining respect for their wishes in retrospect, what can you do to prepare yourself and those around you, other than learning about it?
And my sincere question is: What is the big fuss? It seems to me that even when a gender transgression is present, an identification with either one gender binary is made. So, are there truly any androgynous identities out there?
Just exactly who is Mike? Who are you? Who is she? Who is he? And who are we?
From the USA
Quality Steel by Sound Management | cc/2020-05/en_middle_0128.json.gz/line902 |
__label__cc | 0.690055 | 0.309945 | Anglicanorum Coetibus Society Blog
News and commentary on Anglican Patrimony inside and outside the Catholic Church
Posted on December 31, 2019 by Deborah Gyapong
On behalf of the Anglicanorum Coetibus Society, I wish all our readers a Joyous Christmastide and Happy New Year.
The society’s mission is: “To promote the Anglican tradition and common identity within the Catholic Church for the purposes of deeper conversion, evangelization, education, and the glory of God.”
Going into 2020, I am planning a series of podcasts and blog posts on how our various Personal Ordinariate parishes and communities are advancing “deeper conversion, evangelization, education, and the glory of God.”
Many parishes have founded or are now hosting schools and/or home education supplementation as a way of catechizing young children and exposing them to goodness, truth and beauty of the Catholic faith and of our patrimony.
Some parishes are using Catechesis of the Good Shepherdto evangelize and catechize young children. I cannot speak highly enough of this program.
At least one parish I know of is using the Alpha Course as a way to catechize adults in the basics of the Christian faith—the kerygma. Alpha is a great tool not only for reaching those with little or no exposure to the Christian faith, but also for giving Christians a refresher on the basics so they have more confidence in sharing the Gospel. It also provides a simple way of training up leaders who discover their capacity to lead in other areas.
We also hope to have soon video from the Anglican Tradition in the Catholic Church conference last November. So stay tuned! We have an exciting year and decade ahead.
The Christmas Martyrs
Posted on December 27, 2019 by Mark J. Kelly
A consideration of the collects for the four feasts of the historic English Church that immediately follow the Nativity of our Lord.
The four great feasts of the “Christmas Martyrs” celebrated amidst mirth and reflection due to their location in the calendar, have much to teach us. They provide a unique contrast to the expectation of Advent and the joy of the twelve-day Christmas feast. Each collect and feast contains a particular mystagogy concerning the Faith. Accompanied by an assist from Shakespeare and Dickens, I hope to present a brief reflection of their meaning.
In the post-reformation Prayer Book (BCP) tradition, three feasts follow The Nativity of our Lord. The collects used below are from the 1928 US BCP, while St. Thomas Becket’s collect derives from the Anglican Missal of published by the Anglican Parishes Association (1988)
St. Stephen’s Day, December 26
GRANT, O Lord, that, in all our sufferings here upon earth for the testimony of thy truth, we may steadfastly look up to heaven, and by faith behold the glory that shall be revealed; and, being filled with the Holy Ghost, may learn to love and bless our persecutors by the example of thy first Martyr Saint Stephen, who prayed for his murderers to thee, O blessed Jesus, who standest at the right hand of God to succour all those who suffer for thee, our only Mediator and Advocate. Amen.
The classic BCP collect states that we should give testimony amid suffering. The power to do so stems from our vision of Christ in Heaven. As we behold the glory of the King who once suffered for us at the right hand of the Father, we, now filled with the Holy Spirit, then, and only then can we bless our persecutors. St. Stephen represents all Christians who continue to suffer and die to this day, especially those new to the Faith who witness to the Advent of the King. Stephen’s greatest witness is his intercessory prayer. Stephen behold our Lord in intercessory prayer and mediates that ongoing ministry to his killers. As our Lord prayed, “Father, forgive them for they know not what they do.” Stephen acknowledges their meditated malice and asks that the sin, be not held to heir account.
And he kneeled down, and cried with a loud voice, Lord, lay not this sin to their charge. (Acts 7:60)
St. Stephen fulfills Christ’s prophecy that his disciples will do greater works than He will. Stephen forgives those who knew full well what they were doing. There is no ignorance in their crime. But it is the Martyr’s prayer of un-requested and unmitigated forgiveness that is his crowning achievement and effects deeply another conspicuous man, Saul of Tarsus. Stephen’s forgiveness is so powerful it echoes through the years of St. Paul’s life. Luke makes an intentional connection between the martyrdom of Stephen and the beginning of the ministry of Paul. Paul’s story and his conversion begin at the Forgiveness of Stephen. Paul was obviously affected, he mentions Stephen by name years later. It is he who obviously passed the details to Luke the careful researcher. (Acts 22:20)
The collect reminds us to find the vision of our first love and passion for Christ and live it. Stephen gives his young life and future into the hands of the Son of God and makes a sacrifice now joined to the sacrifice of Christ.
St. John the Apostle, December 27
MERCIFUL Lord, we beseech thee to cast thy bright beams of light upon thy Church, that it, being instructed by the doctrine of thy blessed Apostle and Evangelist Saint John, may so walk in the light of thy truth, that it may at length attain to everlasting life; through Jesus Christ our Lord. Amen.
John the Evangelist and Apostle exemplifies those who continue to the end through many sufferings. The collect prays that we may “at length” attain to everlasting life. It directs us to be mindful of this Apostle’s doctrine, which casts the bright beams of light upon us. While Stephen dies young, John persists to the end of his days and has been accorded the title of martyr. This collect and feast join us to the following liturgical season, Epiphany. John’s Gospel is the Gospel of the Epiphany, the season’s readings all stress light shining in the night. We know most creatures have a natural love, attraction, and movement toward light. The feast of the beloved John and his life and Gospel move us to Christ that we to may recline with Him at table.
This collect’s use of light vs. darkness in this season has effects seen in Charles Dickens. Scrooge, he informs us, likes the dark because it is cheap. The old money lender shuffles, wrapped in this drained, anemic dusk as he heads home on Christmas Eve.
“Half a dozen gas-lamps out of the street wouldn’t have lighted the entry too well, so you may suppose that it was pretty dark with Scrooge’s dip. Up Scrooge went, not caring a button for that. Darkness is cheap, and Scrooge liked it.”
Scrooge the Tight-fisted loves the dark because it does not cost him anything. If we are faithful, like John, and seek and proclaim the light it will cost us much in this world. A “martyrdom” for most remains a small daily struggle of sacrifice and self-denial. The collect again shows us how to persevere, by attending habitually to the Apostles’ doctrine and walking continually in the light. Where St. Stephen is a martyr that dies in the springtime of his life, St. John stands for those who maintain till the end through many hard and sacrificial years.
The Holy Innocents, December 28
O ALMIGHTY God, who out of the mouths of babes and sucklings hast ordained strength, and madest infants to glorify thee by their deaths: Mortify and kill all vices in us, and so strengthen us by thy grace, that by the innocency of our lives, and constancy of our faith even unto death, we may glorify thy holy Name; through Jesus Christ our Lord. Amen.
The Holy Innocents are those who are cut off in their gentle genesis. Their collect asks that Almighty God may mortify and kill all vices in us, in effect, to make us like innocent children to inherit the Kingdom of God. What greater vice is there than the ongoing slaughter of the innocents? Infanticide groans to us from long halls of ancient times. Those innocents died for the Christ Child, who will one day die for them, suffering the outrage of a fearful ruler and his mindless murder of the guiltless. Abortion and Infanticide, both plagues of the antique world, are still in strength and growing as the new creation of the Kingdom is under the assault of this old crime. Again, Dickens is fairly invoked concerning this issue in the mouth of the Spirit of Christmas Present.
“Spirit,” said Scrooge, with an interest he had never felt before, “tell me if Tiny Tim will live.’
“I see a vacant seat,” replied the Ghost, “in the poor chimney-corner, and a crutch without an owner, carefully preserved. If these shadows remain unaltered by the Future, the child will die.”
“No, no,” said Scrooge. “Oh, no, kind Spirit. Say he will be spared.”
“If these shadows remain unaltered by the Future, none other of my race,” returned the Ghost, “will find him here. What then. ‘If he be like to die, he had better do it, and decrease the surplus population.’ ”
Scrooge hung his head to hear his own words quoted by the Spirit, and was overcome with penitence and grief. “Man,” said the Ghost, “if man you be in heart, not adamant, forbear that wicked cant until you have discovered What the surplus is, and Where it is. Will you decide what men shall live, what men shall die? It may be, that in the sight of Heaven, you are more worthless and less fit to live than millions like this poor man’s child. Oh God. To hear the Insect on the leaf pronouncing on the too much life among his hungry brothers in the dust.”
Scrooge bent before the Ghost’s rebuke, and trembling cast his eyes upon the ground.
The length and breadth of sacred scripture adjure us to care for the Widow, Orphan, and helpless. After long centuries, are we worse than Herod? We have in our day fulfilled the charge of Shakespeare in Hamlet (3.2, 12-14) “I would have such a fellow whipped… It out-Herods Herod. Pray you, avoid it.” What Herod trespassed in greed, wrath, and momentary passion, we now organize, industrialize, and institutionalize our killing of the innocent, both young and old.
While the collect directs us properly to be as children in the Kingdom, the fallen world would again misuse the ideal of spiritual innocence in this festive season of the Christ Child. The voices in this Modern Age that attempt to de-emphasize and kill Christmas (as with other outward influences of Christianity in culture) tell us that Christmas is the holiday “for the children”. Varied voices use this very phrase. When Maureen O’Hara as Doris Miller, the serious businesswoman in Miracle on 34th Street, uttered the phrase in the eponymous movie, it was an old saw. The secular world would have us believe Christmas is only for Children and for their indulgence. These same progressive voices now want us to have fewer children running around to celebrate this feast that supposedly is just for them.
Dickens knew the Feast and Season of Christmas was for everyone, especially modern adults weighed down in an ever efficient and industrializing landscape. Dickens’ celebration of Christmas made the old, dewy young again, it created innocence amid suffering, an innocence like Tiny Tim’s. From the introduction:
I have endeavoured in this Ghostly little book, to raise the Ghost of an Idea, which shall not put my readers out of humour with themselves, with each other, with the season, or with me.
Later Dickens says, “I should have liked, I do confess, to have had the lightest license of a child, and yet to have been man enough to know its value.”
Scrooge vows to live the Spirit (innocence of Christmas all year through)
“I will honour Christmas in my heart, and try to keep it all the year. I will live in the Past, the Present, and the Future. The Spirits of all Three shall strive within me. I will not shut out the lessons that they teach!”
Christmas is a time to nurture the Innocent, young and old and the very innocence in our own Soul. We must like a reborn Scrooge to make proper amends in our future charity for past oversights.
St. Thomas of Canterbury, December 29
O God, who for thy Church’s sake didst suffer thy Bishop Saint Thomas gloriously to be slain by the sword of wicked men: grant we beseech thee; that all they who call upon him for succor may be profited by the obtaining of all that they desire. Through & c.
Thomas of Canterbury’s martyrdom stands for those who are willing to lose all; wealth, friends, family, the esteem of countrymen for the Gospel’s sake. St. Thomas was wealthy, influential, well titled, loved, and close to the king. Thomas found a greater honor then serving his earthly desires and those of Henry II. He defended the honor of God.
Sadly, Thomas of Canterbury suffered a second martyrdom as his memorial was destroyed by Henry VIII. The shrine stood until it was crushed in 1538, during the Dissolution of the Monasteries, on direct orders from King Henry VIII. The king also destroyed Becket’s bones and ordered that all mention of his name be obliterated from records.
The Martyrs of the Christmas Octave remind us that the feast is for all. The joy of the feast is for more than the pleasure of our senses. It is about the Kingdom of God and our ultimate destiny of Life Eternal with the Blessed Trinity. Bl. Bishop Sheen reminds us, “[E]very other person who ever came into this world came into it to live. He came into it to die.” And by Christ’s birth and death, he destroyed Death itself, imparting life to hose in the tombs.
Posted in Uncategorized | Tagged Christmas, Martyrs | 4 Replies
Hodie in Historia Ecclesia Anglicana
King James II, the last Roman Catholic British monarch flees to France from William of Orange. READ MORE.
David Torkington on prayer—marvelous!
While making supper this evening, I listened to this podcast: From Meditation to the beginning of Mystical Contemplation by David Torkington, who is an expert on contemplative prayer and author of Wisdom from the Western Isles, Wisdom from The Christian Mystics, and Wisdom from Franciscan Italy
It is marvelous and very much in line with the tradition of English Catholic mysticism. Thank you, Lisa Nicholas for introducing me to this man’s books, blog and podcasts.
His blog, full of extremely solid and practical teaching on prayer, is here.
I am as delighted as all other orthodox Catholics that the Spanish Bishops have spoken out against all forms of prayer involving Eastern meditation techniques and the mindfulness movement in their document, My Soul Thirsts for God, for the Living God: A Doctrinal Orientation on Christian Prayer (published 3rd September 2019). But is it too little, too late? This spiritual heresy has been deceiving people to my knowledge for over forty years with little official condemnation, leaving the laity in limbo-land, looking for guidance and looking in vain. Most of these techniques have been imported from Buddhism and have no place in Catholic spirituality. The particular form that I am familiar with is taught by ‘The World Community for Christian Meditation’ which was founded by a Benedictine monk, Fr John Main. Let me tell you a spiritual horror story to show just how dangerous the teaching of this movement is.
Authentic Christian Contemplative Prayer
Fr. Main told Amelia to keep repeating the word Maranatha. He explained that by repeating this mantra, she would almost instantly come to experience inner peace and inner recollection. Furthermore he told her, quite erroneously, that what she was experiencing was in fact the mystical contemplation as described by St Teresa of Avila in her masterwork Interior Castle. Exactly the opposite happened to her because she was using the word as a short prayer, not as a technique to generate inner peace. She was in fact using it to ask God to come into her, and to abide in her. Her prayer helped her to keep the deep primordial desire for love, that is in all of us, fixed on God the source of all love. The selfless loving embodied in her constant prayer acted as a spiritual lightning conductor directing God’s love into her heart. However, in authentic Catholic Mystical Theology, as explained best by St John of the Cross, the fire of God’s love first reveals and then draws out of a person all the sins and all the sinfulness that prevents being totally possessed by him. What the receiver must then do is to see the sins and the sinfulness that are preventing God’s love totally possessing them and confess them, receive absolution and continue praying as before to enable God’s love to continue the process of purification in what St John of the Cross calls The Dark Night of the Soul. Far from leading to inner peace it leads to inner turmoil and sometimes to spiritual depression to see oneself laid bare.
Sent to a Psychiatrist
To a competent mystical theologian this is how God acts in the Night of Purification. But Fr John Main was not a competent mystical theologian, nor for that matter do the later leaders of his movement know anything about mystical theology. Inevitably Amelia was tragically spiritually violated by a charlatan. When she explained how despite what he told her to do she experienced, not peace and tranquillity but inner turmoil, he was perplexed. His ignorance was responsible for giving her potentially disastrous advice. As he and his bogus way to mystical contemplation could not possibly be wrong, he concluded that there must be something wrong with her. He sent her to England to receive psychological help from a psychiatrist in London whom he recommended. Once cured she could then return to him and he would teach her how to attain mystical contemplation in no time at all, simply by endlessly repeating a mantra. Her problem he believed was that she was psychologically ill and therefore unable to benefit from his mystical teaching which is in fact the old heresy of Pelagianism. Believe me, it is utterly devastating for a poor soul struggling in the Night to be told they are mentally ill, because it confirms their worst fears and it can not just destroy their spiritual lives but devastate their whole lives, sometimes permanently. These false messiahs must be stopped and stopped for good.
Please read the whole thing and go on over and enrich your spiritual life by reading this man’s work.
Durham University’s Two Year Patristic Lectionary for the Divine Office
Durham University’s Centre for Catholic Studies has produced an excellent two-year lectionary for Vigils (Office of Readings). Initially edited by Stephen Mark Holmes (University of Edinburgh School of Divinity) and subsequently re-edited and formatted by Michele Freyhauf (Durham University); for Pluscarden Abbey, Scotland. Free access in various formats is provided below.
The History of the Patristic Lectionary
A ‘patristic lectionary’ is a series of readings from the fathers (in Latin patres) of the Church. Scripture has always been read in the Church in the context of tradition. Continue reading →
Gavin Ashenden explains why he is becoming Catholic this Sunday
Many of us have enjoyed listening to Gavin Ashenden on Anglican Unscripted on YouTube. Here in episode #558 he explains why he left the Church of England to be ordained a Bishop of the Christian Episcopal Church and now why he is now entering the Catholic Church this coming Fourth Sunday of Advent. A contact in the Personal Ordinariate of Our Lady of Walsingham tells me he does not believe Ashenden has contacted the ordinariate. In the discussion below, we hear the Roman Catholic Bishop Mark Davies of Shrewsbury reached out and invited him.
Matthew Parker was consecrated Archbishop of Canterbury.
Matthew Parker was consecrated Archbishop of Canterbury on this day, December 17, 1559, at Lambeth, England. But, was he properly and legitimately consecrated? One of the larger questions in the history of the English Church.
https://www.christianity.com/church/church-history/timeline/1501-1600/was-nosey-parker-properly-consecrated-11629998.html
Click on the Canterbury Cross to link to the ACS website
Full texts to pray the Daily Office (also via conference call) reset daily
For the “making our parishes schools of prayer” file
Toronto Conference Thanksgiving Mass Preview
Alpha testimony from a cradle Catholic
On “holy noticing” and Christian contemplation
Sarum Vespers for Candlemas
SVNDAY EDITION… on Some more thoughts on pra…
josparkeswolfetone65… on Alpha testimony from a cradle…
aiello01 on Alpha testimony from a cradle…
Micah:-6:8 on On “holy noticing”…
Fr John Hodgins on Anglican Tradition Conference…
Lisa A. Nicholas, Ph… on On “holy noticing”…
Andrew Petiprin join… on Great interview with Andrew Pe…
Andrew Petiprin join… on Andrew Petiprin—a man to…
The Anglicanorum Coetibus Society claims no rights to the photographs, videos and texts by third parties which are posted or quoted on this blog. If for any reason any object is called into question, or if the particular owner has an objection to its being displayed, please contact us and it will be removed.
All 150 Psalms sung by Church of England Cathedral Choirs | cc/2020-05/en_middle_0128.json.gz/line903 |
__label__wiki | 0.644048 | 0.644048 | Animal Corner
Discover the many amazing animals that live on our planet.
A-Z Animals
Elephant Seals (Mirounga leonina and Mirounga angustirostris)
There are two species of elephant seal. They are the sole members of the genus ‘Mirounga’ of the family ‘Phocidae’ or ‘true seals’. The Northern Elephant Seal (Mirounga angustirostris) and the Southern Elephant Seal (Mirounga leonina) were both hunted nearly to extinction by the end of the nineteenth century, however, numbers have since recovered.
The Northern elephant seal, somewhat smaller than its southern relative, ranges over the Pacific coast of the U.S. and Mexico, while the Southern Elephant Seal is found in the southern hemisphere on islands such as South Georgia, Macquarie Island and on the coasts of New Zealand, South Africa and Argentina in the Peninsula Valdés which is the fourth largest elephant seal colony in the world and the only growing population.
Elephant Seal Characteristics
The Elephant seal gets its name for being very large and having a nose with a small trunk-like proboscis. Males, also called bulls, use these trunks to fight for breeding rights. The elephant seals can barely move on land because of their heavy weight however, flippers make these creatures swift and powerful swimmers, but they are not strong enough to lift their body off the ground. Large fishes, squid and an occasional penguin fall prey to elephant seals, who have few, if any predators. Beach parties of hundreds of seals sunbathe on the shores together.
The Elephant seals nose is used in producing extraordinarily loud roaring noises, especially during the mating season. The largest known bull elephant seal was 6.7 metres in length and weighed 3400 kilograms (about four tons). Therefore the Elephant seal is one of the largest members of the order Carnivora.
Elephant seals are shielded from cold by their blubber, much more than by fur. The skin on top of this blubber and its hair molts. It has to be re-grown by blood vessels reaching through the blubber. When this process is occurring, the seal is susceptible to the cold, and must rest and molt on land, in a safe place called a ‘haul-out’. The type of molt which an elephant seal undergoes is a catastrophic molt. While this is taking place, the bulls actually cease fighting with one another.
Elephant Seal Habitat and Diet
The elephant seal is almost entirely aquatic, coming ashore primarily to breed. Its range is mostly in warm waters. Elephant seals presumably feed in deep water and eat squid, and fish, including small sharks and rays. They can fast as long as 3 months.
Elephant Seal Behaviour
The elephant seal is a powerful swimmer and well adapted to an aquatic life. The seals may be solitary at sea, but become very social on the beach. Even during nonbreeding times of the year, they will lie close together on the sand. The males arrive at rookery sites in early December and remain throughout the breeding season without going to sea to feed. Because they move slowly and awkwardly on land, the males cannot defend large territories or large numbers of females. Unlike other seals, which may have harems averaging 40 cows, a dominant bull elephant seal may have only a dozen cows within his territory.
Elephant seals spend an unusual amount of time in the ocean, up to 80% of their lives. Elephant seals can hold their breath for over 80 minutes, longer than any other non-cetacean mammal. Furthermore, elephant seals are incredible divers as well, with an ability to dive to 1500 metres beneath the oceans surface. The average depth of their dives is about 300 to 600 metres, as they search for their favourite food.
Elephant Seal Reproduction
The female Elephant seals arrive at the rookeries (breeding grounds) in late December. Elephant seals give birth within a week, usually to a single pup. Gestation lasts about 350 days. The greatest threat to the young pups is the heavy-bodied adult males, which totally ignore the presence of the pups and sometimes crush them. Female Elephant seals will bite and sometimes kill pups that are not their own.
Elephant Seal Life Span
Female Elephant seals have an average life expectancy of about 20 years, and can give birth starting at the age of 3 – 4. Males reach maturity at 5 years, but generally do not achieve alpha status until the age of 8, with the prime breeding years being between ages 9 and 12. The average life expectancy of a male elephant seal is 14 years.
Elephant Seal Conservation Status
During the nineteenth century, Elephant seals were hunted to near extinction and the entire population of Northern elephant seals was reduced to a small herd of less than 100 individuals on Isla de Guadalupe. The protection of this species during the twentieth century resulted in a gradual recovery, and the population spread north to other islands and some mainland beaches. The current population has been estimated at over 150,000.
More Fascinating Animals to Learn About
Galapagos Fur Seals
African Forest Elephant
Search the Animals
Most Popular Animals
Black Mamba Snakes
Trapdoor Spider
Bengal Tigers
King Cobra Snakes
Common Palm Civet
Animal Anatomy
The Best Puppy Shampoo Guide For 2020 – For Silky Smooth Skin And Hair
The Best Cat Shampoo Guide For 2020 – It’s Not Just Pampering
The Best Cat Water Fountain Buyers Guide For 2020
The Best Dog Treats Guide For 2020 – Rewards For Your Best Friend
The Best Cat Toys 2020 Guide – Great Fun For Your Feline Friends
Copyright © 2005-2019 · Animal Corner · All Rights Reserved · Affiliate Disclaimer
AnimalCorner.co.uk is a participant in the Amazon Services LLC Associates Program, an affiliate advertising program designed to provide a means for sites to earn advertising fees by advertising and linking to Amazon.com. Amazon and the Amazon logo are trademarks of Amazon.com, Inc. or its affiliates. | cc/2020-05/en_middle_0128.json.gz/line906 |
__label__cc | 0.714299 | 0.285701 | Austenprose – A Jane Austen Blog
Jane Austen’s Works in Detail
Jane Austen’s Lady Susan in Detail
Jane Austen’s Mansfield Park in Detail
Jane Austen’s Northanger Abbey in Detail
Jane Austen’s Pride and Prejudice in Detail
Jane Austen’s Sanditon in Detail
Austenesque
Pemberley or Pride and Prejudice Continued, by Emma Tennant – A Review
Posted in Blog Events, Book Reviews, Jane Austen Sequels Book Reviews, The Pride and Prejudice Bicentenary Challenge 2013 by Laurel Ann Nattress
This is my third selection for The Pride and Prejudice Bicentenary Challenge 2013, our year-long event honoring Jane Austen’s second published novel. Please follow the link above to read all the details of this reading and viewing challenge. Sign up’s are open until July 1, 2013.
If you can, take yourself back to 1993. Some of you reading this review were not even born yet, so bear with me. Imagine the Jane Austen universe pre Colin Firth as Mr. Darcy emerging soaking wet from Pemberley pond in the 1995 A&E/BBC miniseries Pride and Prejudice. No dripping Darcy. No thousands of Jane Austen-inspired prequels, sequels and inspired-by novels and self-help books brimming book shelves at your local bookstore. No buy-it-now button at your favorite online retailer. No INTERNET for that matter! You have read Pride and Prejudice (multiple times) and seen both the adaptations: the1940 movie starring Laurence Olivier and the 1980 BBC mini-series starring David Rintoul on Masterpiece Theatre. You are violently in love with Jane Austen’s novel and know of no one else who shares your obsession—and then one day you are in a bookstore and see Pemberley or Pride and Prejudice Continued, by Emma Tennant. You stare at it in total disbelief. Could someone else continue the story of your beloved Elizabeth and Darcy? Could you be back at Pemberley again?
Now that you have a closer understanding of the environment that Tennant’s brave foray into Jane Austen sequeldom entered in 1993, and what anticipation the reader might have felt, you will have a greater appreciation of its tepid reception. When the vast majority read this book they delusionally expected Jane Austen, again. How could they possibly not be disappointed? By the time I read it in 2002 it had gotten a bad rap all-around by media reviewers and pleasure readers. My first impressions were not positive either. Now, after eleven years of reading numerous Pride and Prejudice-inspired novels that have been published in its wake— I have re-read it with an entirely new perspective—with an open heart and a sense of humor.
It has been almost a year since the happy day in which Mrs. Bennet got rid of two of her most deserving daughters. Elizabeth Darcy nee Bennet is learning the ropes of being the chatelaine of Pemberley House while obsessing over her insecurities and lack of producing an heir. Her dear father has died and his entailed estate of Longbourn has passed on to his cousin Mr. Collins and his wife Charlotte. The displaced Mrs. Bennet and her two unmarried daughters Mary and Kitty have taken up residence at Meryton Lodge, their new home not far from Longbourn and neighbors Mrs. Long and Lady Lucas. Elizabeth’s elder sister Jane and her husband Charles Bingley have purchased an estate in Yorkshire thirty miles from Pemberley. After four years of marriage they have one daughter and another on the way. Thoughtless younger sister Lydia, her ner-do-well husband George Wickham and their four children are continually in debt and an embarrassment to Elizabeth and her family.
The holidays are approaching and the plans for the annual festivities will include gathering family at Pemberley for Christmas and a New Year’s Ball. Besides Georgiana, Mr. Darcy’s younger sister, the guest list is growing out-of-control. Even under the care of her capable housekeeper Mrs. Reynolds, Elizabeth is overwhelmed. Included are Elizabeth’s family: some welcome and others not. Mrs. Bennet, Mary and Kitty will make their first visit to Pemberley. Jane will also journey with her husband and his sisters Miss Caroline Bingley, Mrs. Hurst and her husband. Elizabeth’s favorite Uncle and Aunt Gardiner have let a house nearby so that the unwelcome George Wickham and his family can visit with Mrs. Bennet. Also on the guest list is Mr. Darcy’s officious Aunt Lady Catherine de Bourgh who disapproved of Darcy’s choice of bride but seems to have mended the fence enough for an extended stay. Arriving with her is her unmarried daughter Anne and the heir to the Pemberley estate, a distant cousin of Lady Catherine, Master Thomas Roper. Shortly before Mrs. Bennet is to depart for Pemberley she reveals to her friend Mrs. Long that even though Mr. Bennet departed this life but nine months ago, she intends to marry Colonel Kitchiner, a cousin and a crush from her youth whose father was a business partner of her father in Meryton. She has invited him to Pemberley as well—so it is a full house of unlikely companionship for its new mistress.
Any fans of Pride and Prejudice will recognize the irony of the guest list. The back story from the original novel and the combination of personalities is a set-up for the conflicts that inevitably arrive even before the guests do. Tennant has fudged on the facts from the original novel which were a bit off-putting. I remember being irked by this the first time around, and the second time did not sit as well either. Jane and Elizabeth were married on the same day in P&P, yet she chose to have Elizabeth marry Mr. Darcy four years after the original event—and how could any author writing a sequel or any historical novel set in the Regency-era not understand the ins and outs of British primogeniture? Lady Catherine de Bourgh’s cousin Thomas Roper, also the cousin of Mr. Darcy’s mother Ann, could not be the heir to Pemberley. If so, it would mean that the Darcy family and his mother a Fitzwilliam were related in earlier generations. This is possible but highly confusing to the reader who may understand the English inheritance laws, or not.
Quibbles in continuity and cultural history aside, my second impressions of Pemberley or Pride and Prejudice Continued were much more favorable—at least I didn’t despise it anymore. With the exception of Elizabeth Bennet being overly angst ridden and atypically un-spirited, I enjoyed Tennant’s characterizations of the delightfully dotty Mrs. Bennet and the slippery Bingley sisters. My biggest disappointment remained with the male characters. We see all of the action through Elizabeth’s eyes, and since she is uncertain and overly grateful of Darcy’s love, their relationship is strained and unpleasant. He is proud again and given nothing to say, and she is too unprejudiced to do anything about it. Tennant excelled most with her new creations: Mr. Gresham, Thomas Roper and the hysterical Col. Kitchiner who rivals the odious Mr. Collins (thankfully not invited to Pemberley) in the role of buffoon.
I appreciate Tennant much more as a writer than I did at first reading. It was interesting to put Pemberley into a wider perspective after many years. She was helping to create a new genre in which many would follow. This first attempt, though seriously flawed, merits some respect and congratulations. It is a must read for any ardent Austenesque fan, but most will be disappointed.
3 out of 5 Regency Stars
Pemberley or Pride and Prejudice Continued, by Emma Tennant
St. Martins Press (2006) reprint
Trade paperback (226) pages
Cover image courtesy St. Martins Press © 2006; text © 2013 Laurel Ann Nattress, Austenprose
Book Revews, Books, Emma Tennant, Jane Austen, Jane Austen Sequels, Pemberley or Pride and Prejudice Continued, Pride and Prejudice, Pride and Prejudice Sequels, Reading 55 Comments
« To Marry an English Lord, by Gail MacColl and Carol McD. Wallace – A Review
Giveaway Winners Announced for Return to Longbourn »
55 thoughts on “Pemberley or Pride and Prejudice Continued, by Emma Tennant – A Review”
Bess Gilmartin
I’ve never read it, but knowing that it was one of the first P&P sequels out there means it’s a must. I’m so glad you told us about it! Now here’s a link to my review for the month (Letters from Pemberley: the First Year by Jane Dawkins): http://www.groggspot.com/pride-prejudice-bicentenary-challenge-2013-march-review/
Thanks for the review, I just may have to add this one to my ever growing TBR list. :)
Here are my entries for the Pride and Prejudice Bicentenary Challenge since I do not have a blog:
#6- I read Friendship of a Special Kind by Moira Bianchi
#7- I read Celebrating Pride and Prejudice : 200 Years of Jane Austen’s Masterpiece by Susannah Fullerton
#8- I read Celebrating Pride and Prejudice 200 Years of Jane Austen’s Darling by Hazel Jones and Maggie Lane
A very productive Jane Austen month for me…not so much for my house work!
Ooops, that’s supposed to be numbered 5,6, and 7. I was getting ahead of myself.
MelissaW
I read this quite a while ago. The one thing that put me off, and still does, is the timeline. If one is going to “continue” the original story one doesn’t mess with the timeline. Was it necessary to give Lydia four children and Jane 1.5? Add to that Lizzie both getting lost on the Pemberley grounds and then flipping her sh*t and running off to Charlotte Lucas/Collins…bleah.
(and I hadn’t noticed the primogeniture/Roper issue then, but good point)
sueannbowlingauthor
My review of The Real Jane Austin by Paula Byrne came out yesterday: . Heard the interview on our local public radio station, and decided it would be perfect for my 3rd post of this challenge. By the way, do continuations of Jane Austin’s unfinished novels qualify? I love the continuation of Sanditon, by Jane Austen and “another lady.”
Doesn’t look like the link came through. I’ll try it naked: http://homecomingbook.wordpress.com/2013/03/12/the-real-jane-austen-book-review-ian1/
Kym Thorpe
I’m not sure I could get past the timeline issues, but maybe I’ll try this!
I have read three books for the Challenge so far, and haven’t previously entered them in the monthly posts, so I’m doing all three here. Hope that is okay.
1. Georgiana Darcy’s Diary by Anna Elliott http://justasecondblog.blogspot.com/2013/02/recent-reads-georgiana-darcys-diary.html
2.Pemberley Ranch by Jack Caldwell http://justasecondblog.blogspot.com/2013/02/recent-reads-pemberley-ranch.html
3. Lady Catherine’s Necklace by Joan Aiken http://justasecondblog.blogspot.com/2013/02/recent-reads-lady-catherines-necklace.html
I read this quite awhile ago, as one of my first P&P fics and as I recall I didn’t really care for it. All I remember is disliking Bingley and all the tension between Lizzy and Darcy. If I were to read it again now, after having read more P&Ps, I may also see it a bit differently.
Akaleistar
I read this several years ago, but I liked it. I think it’s time for a re-read!
I apologize for being very far behind updating and posting reviews for the bicentennary challenge but here are my reads thus far for the year
1. Last Man in the World by Abigail Reynolds (January)
2. Pride, Peejudice and the Perfect Match by Marilyn Brant (January)
3. Mr D Bites Back by Mary Simonsen (January)
4. According to Jane by Marilyn Brant (January)
5. Pemberley Medley by Abigail Reynolds (February)
crafts4others
my first review for this challenge, http://crafts4others.blogspot.com/2013/03/pride-and-prejudice-review.html
bettielee
I don’t know if I could get past the double whopper of changing the timeline and an angsty Elizabeth. But I thank you for the review! I reviewed the 2005 movie for this month’s challenge.
Loving doing these, and seeing all the other great reviews.
http://bettieleetwo.wordpress.com/2013/03/01/pride-and-prejudice-the-movie-2005/
My Dahling friend, I don’t care what you say, once was enough for me. I read your review and thought “well maybe.” Then I re-read my own amazon review and remembered exactly why I hated this book. I usually am open-minded to much of JAFF. Here are my thoughts upon reading it about 4 years ago.
“I am a huge fan of all things Pride and Prejudice and admit can be extremely forgiving with authors that take huge literary liberties when the writing is good and the story and characters interesting. But this was hardly worth the effort. I found myself struggling to continue this read by even the first chapter. Elizabeth is weak and filled with self-doubt; Darcy and Elizabeth do not speak together hardly at all, regardless of what Tennant tries to make you believe of their devotion and love for each other; Mrs. Bennett is beyond stupid; Georgiana is spoiled and petty. There is very little dialogue of any value; the story is weak because the author did not trouble herself to continue in any explanation when merited. For example, Lizzy inadvertaently has to spend the night in an abandoned gypsy tent when she is caught out in the rain — and after she is found, there is no real dialogue between the Darcy’s and this happens the night before they are to have a house full of relations arrive — and then no one gets a proper explanation as to why the Mistress of Pemberley is not available to properly receive them! It was all very odd and utterly unbelievable. And that is just about the extent of that description! I would not buy this book. Better to go with anything but this!” The rest of the book was just as frustrating. But kudos to you for giving it another go. But with all on your reading list, why bother?
Laurel Ann (Austenprose)
Ha! Yes, I agree with all of your comments – but you must have missed the part in my review that said I was reading it with an open heart and a sense of humor! As high comedy it is amusing.
I realize that many will not have the time or patience for this one, but it is a must read for ardent Austenesque fans. Everyone needs to understand the early attempts. It is a short read and will make the good ones so much better.
Oh I read It all!! How very ElizabethBennet of you to be diverted by these follies and nonsense, whims and inconsistencies! For myself however I must side with MrDarcy, “My good opinion once lost, is lost forever.”
I concede that you are the wittiest person I know Christina. Brava!
You flatter me.
Meredith (Austenesque Reviews)
They were married four years later? That seems so unlikely! Did she give a reason?
I think I might be experiencing the opposite, Laurel Ann. The more years go by, the more Austenesque literature that comes onto the scene, the more critical and discerning I become. I do understand the magnitude of what Emma Tennant accomplished for her time period, but there are other authors who have done better. Joan Austen-Leigh for example, whose gem of an epistolary novel is titled, A Visit to Highbury (1995). It was originally published as Mrs. Goddard, Mistress of a School in 1993. Too bad they are so hard to find!
No explanation Meredith of the time changes, and it did not really serve any purpose other than allowing Elizabeth’s sisters to have children before her and make her feel guilty for not having one of her own yet. Just weird. I have not read Joan Austen-Leigh’s work yet. I must track down a copy. I think we have both come full circle on the acceptance level Meredith – just at different curves at the moment.
I haven’t read this one yet, I’ll add it to my list (which is getting very long!).
Here’s my third review for the Bicentenary Challenge, on “The Missing Manuscript of Jane Austen”:
Dear Syrie James – please continue to ‘find’ lost Jane Austen manuscripts and publish them for the rest of us. Thank you, that is all.
Loved this book from beginning to end. Like Austen’s novels, you knew who Rebecca was going to end up with in the end, but you don’t care, because the journey is wonderful and worth it. I lives how Ms. James worked in so many plot devices from Austen’s stories, even in the non-Austen story. This is a wonderful book for Janeites and Austen novices alike.
I haven’t read this book but may add it to my TBR list. The fact that the author helped create the genre of books that are so popular and that I dearly love, makes it more desirable.
Below are the review links to my 2nd and 3rd books for the challenge.
Darcy on the Hudson by Mary Simonsen
http://moreagreeablyengaged.blogspot.com/2013/03/my-share-of-conversation.html
Mr. Darcy’s Secret by Jane Odiwe
http://moreagreeablyengaged.blogspot.com/2013/03/a-review.html
ks3nia
Interesting! I didn’t know someone wrote a sequel :-o
aem2
Thanks for the re-review. I’m not sure if I can enjoy supposed sequels when they mess with established timelines. It takes me too far out of the story. Speaking of which, here is my review of Death Comes to Pemberley, which I was less than impressed with. http://aem-physicsgirl.blogspot.ca/2013/03/death-falls-flat-p-4.html
Carol Settlage
Again, I enjoyed and appreciated your review and the subsequent comments! I agree that the errant timeline and bad characterization of Elizabeth and Darcy are enough to incline me against reading Tennet’s book, but I do give her credit and thanks for being one of the first in writing sequels.
My March reading is, “The Darcys of Pemberley: The Continuing Story of Jane Austen’s Pride and Prejudice” by Shannon Winslow. Now here is a sequel that satisfies and delights on every level, I felt! I find Shannon’s writing wonderfully Austenesque, her characters feel true to the original, or with a light softening, or modernizing trend, and the story enthralling! She even has Jane Austen’s humorous way of describing her characters, as when she introduces Mr. Bennet, as “a gentleman of satirical wit and indolent habit, chiefly amuses himself with the perusal of books and the study of human folly. These entertainments he keeps close to hand, possessing a fine library for one and an obliging family for the other.” I had read her short story of “Mr. Collins’s Last Supper” before starting this and enjoyed it as well, and was intrigued and happy with the life she then created for Charlotte, for whom I’ve always had an affection. I thought perhaps her account of the interactions with the Wickhams a little far-fetched and overly dramatic, but it made for an exciting read and a happy outcome, in my humble opinion! :-) I hope others will enjoy this bright and happy sequel as well!
Interesting review of a book I haven’t read before.
I read Austenland, by Shannon Hale and reviewed it both on my Goodreads account and my blog.
caitlinstern
When a P & P sequel/spin-off makes too many changes for it to feel ‘right’ any more, I usually can’t get into it. That sounds like one of those books.
Here’s my March review:
http://caitlinsternwrites.wordpress.com/2013/03/14/p-p-challenge-prom/
A weekend with Mr Darcy by Victoria Connelly
Paperback – Harper Collins 2010
ISBN 978 1 84756 225 8
I managed to read this book very quickly. It is about attending a Jane Austen conference and the Jane Austen addicts who participate in the conference. It was a light weight read but nevertheless entertaining. This will be my fourth review for the Jane Austen Challenge and I have to say I am really enjoying this challenge as I have read books I had not come across before and feel I am really getting to know Pride and Prejudice and the many spin offs that have been written.
I found it interesting to read about the interweaving tale of two Jane Austen addicts. One is Dr Katherine Roberts a young beautiful lecturer at Oxford University and an expert on Jane Austen and the other is Robyn Love a romantic who adores reading Jane Austen novels and watching any Jane Austen based film. They both attend a Jane Austen conference put on by Dame Pamela Harcourt at her home Purley Hall in Hampshire. Katherine and Robyn meet and become friends.
Dr Roberts also loves reading Regency novels and even devours the more racy ones.
Her guilty secret is that she reads the novels of Lorna Warwick whom Jane Austen purists would not normally admit to reading.
Robyn has a job in North Yorkshire, a love of animals and a strange boyfriend named Jason Collins who will not even attempt to read Jane Austen. Why I thought are Robyn and Jason together but all is revealed as the story unfolds.
The weekend retreat Dr Roberts hopes will be an opportunity for her to meet with Lorna Warwick with whom she has struck up a correspondence. Dr Roberts wrote several fan letters and Lorna Warwick has replied.
Meanwhile Robyn hopes the retreat will allow her to distance herself from Jason and enjoy the total immersion in all things Jane Austen that the weekend promises.
There are misunderstandings, revelations and romance to wallow in as the tale unfolds to a satisfying conclusion.
I liked the style of writing but some of the characters like Mrs Soames who grumbles at everything and who could do no right seemed to be one dimension stereotypes.
I liked the details of the conference that are given. It all adds to my enjoyment of the book. The quiz questions set at the conference are included as are details of the conference sessions. I felt I wanted to attend a Jane Austen Conference myself.
On the back cover I found a content guide wheel with pictures showing there was to be friendship, humour, drama and love. I appreciated that detail from the publisher.
Faith Hope & Cherrytea
Glad you had the chance to read one of Victoria Connelly’s Mr Darcy books. This is where I fell in love with VC’s writing and couldn’t wait to get each book as it was published! She has such a light touch and interesting character development…
HapPy reading ! :))
Lilyane S.
Pride and Prejudice Bicentarary Challenge – #3
“Pemberley, or Pride and Prejudice Continued”, Emma Tennant
The cover of this book has a quote from “Lady Antonia Fraser, “Authentic and convincing…”. I have read it, and it is neither.
My copy of the book is small with an old fashioned look. The font has a 19th century feel to it. It all adds to the Austen atmosphere. And I commend Ms. Tennant for breaking ground and beginning an Austen revival that we all enjoy so much today.
But the characters are poorly drawn, especially Elizabeth and Darcy. How they ever married is hard to imagine – she’s in over her head and he could care less. I miss the wit – the sparkling give and take, the humor. It’s just not here.
And, as been pointed out, the timeline is all wrong.
The book deserves a place in my Austen library, but I was sadly disappointed.
My 2nd P&P review in the Challenge is Alexa Adams’ First Impressions Reviewed at goodreads.
3rd P&P is movie review of Bridget Jones’s Diary
Louise Sparrow
My third review is for Falling for Mr. Darcy by KaraLynne Mackrory
http://www.goodreads.com/review/show/506125788
beethebookhoarder
My newest review on A Jane Austen Education.
http://bookhoarding.wordpress.com/2013/03/19/book-review-jane-educatio/
valerierlawson
Oh, I’d really like to leave it to my own imagination what happens afterwards to the bennets, i think.
here’s my entry for the challenge this month – a review of the lizzie bennet diaries. enjoy!
http://valerierlawson.wordpress.com/2013/03/20/pride-prejudice-in-the-modern-world-the-lizzie-bennet-diaries/
Laural Ann, I read this book quite a few years ago and if my memory serves me right I did not like it very much but maybe if read as a comedy I would like it better. Being in the right frame of mind I suppose helps.
I’ve listened to my March P&P entry, which was your first and I have to say that your pick was WEL DONE! Loved it. Anyway here’s my review.
This audio was amazing! I can’t say enough about Emilia Fox and her rendition of Pride and Prejudice! As Caroline Bingley would say ” she had the air and manner in her voice” that complimented every character in the book. I guess I was just a little surprised because I was prejudiced into thinking of little Georgiana Darcy and thought that was what you would get in her voice. But NO, she expertly read every Character as they ought to be read. I felt that I was watching the 1995 version of Pride and Prejudice in my mind. This audio book is not to be missed by ANY Jane Austen fan! And I highly recomend it to anyone who is even thinking of reading any of Jane’s works. This was truely wonderful and if I could rate it higher I would
Anna (Diary of an Eccentric)
I’m glad the book improved on your second read, but I think with all the Austenesque books out there, that’ll I’ll pass on this one. Isn’t Tennant the one who wrote a sequel to Emma that involved some lesbian affair?? I have no idea.
My latest challenge reviews:
A Walk in the Meadows at Rosings Park by Mary Lydon Simonsen
http://diaryofaneccentric.wordpress.com/2013/03/22/review-a-walk-in-the-meadows-at-rosings-park-by-mary-lydon-simonsen/
For All the Wrong Reasons by Mary Lydon Simonsen
http://diaryofaneccentric.wordpress.com/2013/03/20/review-for-all-the-wrong-reasons-by-mary-lydon-simonsen/
All Hallow’s Eve by Wendi Sotis
http://diaryofaneccentric.wordpress.com/2013/02/27/review-all-hallows-eve-by-wendi-sotis/
Yes, Anna, Tennant is the one who wrote a Emma sequel in which a lesbian affair is involved. The novel is quite interesting, as Emma’s character remains -almost- the same and reinforces some other characters like Frank Churchill, though some other minor ones are totally ridiculed.
I still recomend it, as it is quite enjoyable. At least more than some of her other sequels, such as “Elinor and Marianne”, which I would tell you not to read.
This month I reread for the thousandth time “Pride & Prejudice” by dear Jane Austen. I read it every year and I could not miss this particular year because it is too important to celebrate the bicentenary of the novel. I love it! I love everything about it: the characters, the places, the balls, the journeys people do.
My favourite character is Mr. Darcy, not only because I would love to meet a man like him, but because I like the way he changes for love. It is something we don’t see every day (even if I believe Darcy has always been a good man but he was not able to show his true feelings, he needed someone special to remind him what the important things were).
I like, of course, the heroine Elizabeth Bennet because of her wit and patience towards her family: her mother is a thorn in her daughters’ side! And I appreciate every time the goodness and sweetness of Jane, I think Mr. Bingley deserves her.
On the contrary, I cannot stand Wickham and Lydia. I mean, I like the way Jane describes their personality but I found myself talking alone on the silliness of the young Bennet and the behavior without shame of Wickham. I was ashamed for them!
Anyway, this is an incredible novel I will love forever and I always read it with great pleasure. I would love to read something more about Miss Anne de Bourgh. Perhaps I will write an Austen inspired novel dedicated to her… well, I would like to try, I am not a writer! I would like to know how her life evolved. Did she marry? Did she recover from her illness? This woman intrigues me, maybe without her mother she would have had a different life. Who knows?
I have yet to get to any of the P&P sequels on my list, but I’ve also yet to get to a number of books on my list! It is a truth universally acknowledged that a book lover will NEVER get through their TBR (To Be Read) pile! What I have made the time to do however is get through the incredible modern adaptation: The Lizzie Bennet Diaries that I was turned onto by none other than a post right here on AustenProse.
Here’s my review: http://bookblogbyb.blogspot.ca/2013/03/the-lizzie-bennet-diaries.html
I’m already a little wary of the Pride and Prejudice sequels, so this would probably be one I’d need to read after adjusting to the style. I appreciated your comparison between the sequels written before 1995 and those written after, though–that’s an interesting observation. Here’s my March review for the bicentenary challenge; I listened to the Recorded Books audio version of Pride and Prejudice, narrated by Flo Gibson: http://lingeringpianist.blogspot.com/2013/03/p-challenge-recorded-books-audio.html
candymorton
For my fifth selection, I have read and reviewed “A Most Civil Proposal” by C. P. Odom:
http://candy-m.blogspot.com/2013/03/review-most-civil-proposal-by-c-p-odom.html
Thanks for hosting this challenge! It’s fun!
This is my 3rd review for the challenge:
Correction: It’s #4!
eenayray
My third review for the challenge: the television adaptations of Pride and Prejudice (1980 and 1995).
http://obstinateheadstronggirl.wordpress.com/wp-admin/post.php?post=51&action=edit&message=6&postpost=v2
northmum
Just in time for the end of March, my March review – Darcy’s story by Janet Aylmer: http://wp.me/pUrhc-zY
Natallie
My review for March: Miss Austen regrets:
http://meucantinholiterario.blogspot.com.br/2013/03/miss-austen-regrets-2008-p-bicentenary.html
pasaiidesign
It’s interesting to read a review of Emma Tennant’s novel in context of when it was published. I’ll have to give it a second look!
My review for March of Mr. Darcy’s Daughters – http://www.pasaii.com/hello/mr-darcys-daughters-by-elizabeth-aston-review/
Theresa M
This challenge is way too much fun
#7 The Houseguest.. Adams definitely a favorite. I like how Georgiana is drawn here and how she invites Elizabeth to spend time with her in London giving Elizabeth and Darcy time to come to an understanding
#8 Mr Darcy’s Forbidden Love..Webb…this was a bit far fetched. I know Elizabeth had few resources but the Elizabeth/Darcy relationship was too contrived.
#9 Fault or Virtue Karber…fun
I was unfamiliar with this earlier Austenesque work so I enjoyed your thoughts. Now that we have so much out there in this niche of books, it doesn’t seem that bad to me.
Here are my contributions for the challenge from March. The link goes to my Good Reads challenge page.
http://www.goodreads.com/topic/show/1180009-2013-the-pride-and-prejudice-bicentenary-challenge
I am now up to eight books. Yay!
Jordan F.
My third (March) read for the JABC 2013 was “Death Comes to Pemberley,” the review of which can be found on my blog at http://dozmuffinxc.livejournal.com/375973.html
Great review! Here’s my March entry. A review of Bride & Prejudice. http://prettylittlepinkthings.wordpress.com/2013/04/04/bride-prejudice/
Pingback: The Pride and Prejudice Bicentenary Challenge 2013 | Austenprose - A Jane Austen Blog
Pingback: Presumption: An Entertainment: A Sequel to Pride and Prejudice, by Julia Barrett – A Review | Austenprose - A Jane Austen Blog
Jacinta & Nicole
It is a trust universally acknowledged that friendships forged over a love of Jane Austen last forever!
Pride & Prejudice (1940) with Greer Garson and Lawrence Olivier: A true classic black & white film bringing together phenomenal acting and creative writing to produce a masterpiece with a unique twist to the novel. Garson’s screen presence embodies the character of Elizabeth Bennett like no other. We find it interesting that the movie chooses to portray the families with less class differentiation, empowering Elizabeth not to hesitate in her criticism of Darcy. Humor and character-specific music written into the story gives this version a lively and emotional tone. One of our favorite scenes is where Lady Catherine and Darcy discuss her exchange with Lizzy. Surprisingly, she gives her consent for him to marry, causing Darcy to overstep his boundaries by hugging and kissing his Aunt. This personalizes Lady Catherine and obviously speaks to her good judgment!
The Laurence Olivier movie version, I don’t even consider to be P&P it was so hideously wrong, costumes were about 100 years after P&P, the acting was bad, it was just awful!! Gimme the Firth version!
8 July 2013 at 8:05 am
Seems I’m in agreement with Melissa’s comment preceding mine =) and my review is just that movie version – 1995 P&P movie [click to link] with Colin Firth …
Full length movie encompasses many more of the book’s scenes,
endearing it to a wide audience.
I personally appreciate the experience of participating in Jane Austen’s world
via this rendition of Pride and Prejudice.
Colin Firth’s appeal can’t be denied. Definitely adding to the romantic element.
Wickham is an excellent scoundrel. Rev Collins a hoot.
Mr Bennet appears more elderly than I imagined him to be, but he does have the rapport
with Lizzie as expected from reading the book
Locations are fantastic additions to my imagination, increasing my desire to return to England…
Costuming attractive.
On and on. It’s a delight.
Plan for a relaxed movie night to fully enjoy this journey into Jane Austen’s
imaginative commentary on her world and it’s reflection on ours.
Please join in and have your share of the conversation! Cancel reply
Follow Austenprose on Social Media
Enter a Sweepstakes for a copy of Miss Austen, open until Mar 01, 2020
WELCOME TO AUSTENPROSE
where "There is a monsterous deal of stupid quizzing, & common-place
nonsense talked, but scarcely any wit."
Jane Austen to her sister Cassandra,
Join us in celebration of author Jane Austen (1775-1817) through her novels, letters, life and modern interpretations.
© 2007 - 2020 All rights reserved by
Laurel Ann Nattress
Forthcoming Review on January 27th
Sanditon – a New Jane Austen-inspired TV series began on January 12th on Masterpiece PBS
Enter your email address to subscribe to Austenprose and receive notifications of new posts by email.
EMMA MOVIE UPDATE 12/16/19 Watch the 2nd trailer
@balletbookworm @2020Debuts Hey Melissa, are you moving your blog? 16 hours ago
@delightfulrepas @masterpiecepbs Yep. NO air date yet. 16 hours ago
@AnnaLeeHuber @BerkleyMystery @BerkleyPub Ooo, how exciting! 16 hours ago
Follow @Austenprose
Jane Austen Made Me Do It
“Austenesque ... box of bonbons.”
— The Seattle Times
MADE ME DO IT
My Austen-inspired short story anthology, from Ballantine Books
eBook only $4.99
Unabridged audio recording now available from Audible
LEARN MORE ABOUT JAMMDI
Follow Austenprose – A Jane Austen Blog on WordPress.com
Stream Downton Abbey the Motion Picture
Our Share of the Conversation
Janet Taylor on A Preview of Miss Austen: A No…
Mystica on A Preview of The Thief of Lanw…
Cozynookbks on A Preview of The Thief of Lanw…
Teresa Broderick on A Preview of The Thief of Lanw…
Pamela Mingle on Forever Amber, by Kathleen Win…
Laurel Ann Nattress on Forever Amber, by Kathleen Win…
Sophia Rose on Forever Amber, by Kathleen Win…
Forthcoming Preview on January 29th
A Preview of The Thief of Lanwyn Manor: The Cornwall Novels Book 2, by Sarah E. Ladd 24 January 2020
Forever Amber, by Kathleen Winsor — A Review 22 January 2020
The Mitford Scandal: A Mitford Murders Mystery (Book 3), by Jessica Fellowes—A Review 20 January 2020
All the Ways We Said Goodbye, by Beatriz Williams, Lauren Willig, & Karen White — A Review 15 January 2020
Sanditon: A Novelization of Andrew Davies’ TV Adaptation of Jane Austen’s Unfinished Novel, by Kate Riordan 13 January 2020
A Preview of Falling for Mr. Thornton: Tales of North and South, by Trudy Brasure, Et Al 10 January 2020
Poldark: Seasons 1-5 Complete Collection from Masterpiece PBS Now Available!
Sanditon: List of Characters
Pride and Prejudice: Quotes & Quips Chapters 1-7
Sanditon: Plot Summary Chapters 1-4
Pride and Prejudice: Quotes & Quips Chapters 15-21
Downton Abbey Season 1: Episode 1 on Masterpiece Classic PBS – A Recap & Review
Pride and Prejudice: Quotes & Quips Chapters 8-14
Lady Susan: Plot Summary Letters 1-11
Forthcoming Preview on February 5th
Category Menu Select Category A Soirée with Lady Susan Audiobooks Austenesque Author Interviews Being a Jane Austen Mystery Reading Challenge 2011 Between the Wars Era Biography Blog Events Blog Tours Book News Book Previews Book Recommendations Book Reviews By the Seaside with Sanditon Celebrating Georgette Heyer Children’s Books Christian Fiction Collaborative Fiction Contemporary Fantasy, Paranormal & Gothic Fiction Contemporary Fiction Contemporary Mystery, Thriller & Suspense Fiction Contemporary Romance Critiques & Analysis Cultural Studies Dining, Etiquette & Entertainment Downton Abbey Dual Time Frame Fiction Edwardian Era Emma Adaptations English Resortation Fashion & Clothing Favorite Books French Revolution Georgette Heyer Book Reviews Georgette Heyer Books Georgian Era Giveaways Go Gothic with Northanger Abbey Guest Blog Historical Fantasy, Paranormal & Gothic Fiction Historical Fiction Historical Mystery, Thriller & Suspense Fiction Historical Romance History Holiday Gifts Holiday Reading Home & Garden Jane Austen Jane Austen Adaptations Jane Austen Book Sleuth Jane Austen Books Jane Austen Contemporary Inspired Book Reviews Jane Austen Critiques & Analysis Book Reviews Jane Austen Humor Jane Austen Illustrators Jane Austen in the News Jane Austen Inspired Jane Austen Merchandise Jane Austen Quotes Jane Austen Sequels Book Reviews Jane Austen Stage Productions Jane Austen Tours Jane Austen’s Emma Jane Austen’s Emma Jane Austen’s Lady Susan Jane Austen’s Letters Jane Austen’s Life & Times Jane Austen’s Life & Times Book Reviews Jane Austen’s Mansfield Park Jane Austen’s Minor Works Jane Austen’s Northanger Abbey Jane Austen’s Novels & Letters Book Reviews Jane Austen’s Persuasion Jane Austen’s Pride & Prejudice Jane Austen’s Sanditon Jane Austen’s Sense and Sensibility Jane Austen’s The Watsons Jane Austen’s Works JASNA JASNA AGM Literary Analysis Literary Quotes Mansfield Park Madness Mansfield Park Movies Masterpiece Classic Masterpiece Mystery Miss Austen Regrets Movie & TV Previews Movie & TV Reviews Movie, TV & Stage Adaptations Nonfiction Northanger Abbey Movies Period Drama Persuasion Movies Pride and Prejudice Adaptations Pride and Prejudice Sequels Pride and Prejudice without Zombies Randomly Not Jane Austen Book Reviews Reading Austen Reading Challenges Regency Era Regency Era Book Reviews Regency History Regency Romance Regency Romance Reading Challenge 2013 Roaring Twenties Era Sense & Sensibility Movies Sex and the Austen Girl Short Story Anthology The Pride and Prejudice Bicentenary Challenge 2013 The Sense and Sensibility Bicentenary Challenge 2011 Travel Guides Victorian Authors Victorian Era Victorian Era Book Reviews WWI Era WWII Era Young Adult Fiction Young Adult Fiction Book Reviews
Forthcoming Review on February 10th
Austenprose Contributors
Debra E. Marvin
Debbie Brown
Katie Patchell
Natalie Jenner
Pamela Mingle
Tracy H
Forthcoming Preview on February 12th
All Things Jane Austen
Austen Authors
Austen Variations
My Jane Austen Book Club
Pride & Prejudice 2005 Blog
Favored Links
A Covent Garden Gilfurt's Guide to Life
Chawton House Library
Georgian Index
Jane Austen Books
Jane Austen Fiction Manuscripts
Jane Austen's Regency World Magazine
The Jane Austen Centre
The Regency Encyclopedia
The Regency Reader
The Republic of Pemberley
The Secret Victorianist
Write Like Jane Austen
Favored Book Blogs
Avid Reader's Musings
Babblings of a Bookworm
Bookfoolery
Books on the Brain
Calico Critic
Confessions of a Book Addict
Impressions in Ink
Laura's Reviews
Living Read Girl
Margie's Must Reads
My Vices and Weaknesses
Regency Reads
She Reads Novels
The Book Fetish
The Fiction Addiction
The Lit Bitch
The Silver Petticoat Reveiw
Forthcoming from Janice Hadlow on March 31st
Like Austenprose on Facebook
Forthcoming from Gill Hornby on April 7th
Archives Select Month January 2020 (9) December 2019 (9) November 2019 (15) October 2019 (13) September 2019 (5) August 2019 (3) July 2019 (2) May 2019 (3) January 2019 (5) December 2018 (1) November 2018 (2) October 2018 (2) July 2018 (1) July 2017 (1) May 2017 (1) July 2016 (1) June 2016 (4) May 2016 (4) April 2016 (6) March 2016 (1) February 2016 (1) January 2016 (5) December 2015 (7) November 2015 (2) October 2015 (4) September 2015 (4) August 2015 (10) July 2015 (17) June 2015 (12) May 2015 (3) April 2015 (1) March 2015 (7) February 2015 (13) January 2015 (6) December 2014 (13) November 2014 (10) October 2014 (12) September 2014 (6) August 2014 (10) July 2014 (9) June 2014 (6) May 2014 (10) April 2014 (7) March 2014 (11) February 2014 (11) January 2014 (8) December 2013 (9) November 2013 (13) October 2013 (15) September 2013 (9) August 2013 (13) July 2013 (8) June 2013 (5) May 2013 (6) April 2013 (11) March 2013 (17) February 2013 (19) January 2013 (18) December 2012 (21) November 2012 (10) October 2012 (17) September 2012 (20) August 2012 (20) July 2012 (8) June 2012 (3) May 2012 (20) April 2012 (18) March 2012 (16) February 2012 (21) January 2012 (21) December 2011 (24) November 2011 (14) October 2011 (24) September 2011 (23) August 2011 (28) July 2011 (21) June 2011 (25) May 2011 (26) April 2011 (29) March 2011 (28) February 2011 (22) January 2011 (16) December 2010 (21) November 2010 (16) October 2010 (11) September 2010 (18) August 2010 (52) July 2010 (24) June 2010 (22) May 2010 (19) April 2010 (19) March 2010 (31) February 2010 (19) January 2010 (17) December 2009 (16) November 2009 (11) October 2009 (11) September 2009 (29) August 2009 (16) July 2009 (18) June 2009 (13) May 2009 (6) April 2009 (7) March 2009 (21) February 2009 (18) January 2009 (15) December 2008 (23) November 2008 (13) October 2008 (36) September 2008 (24) August 2008 (25) July 2008 (12) June 2008 (8) May 2008 (15) April 2008 (11) March 2008 (13) February 2008 (17) January 2008 (22) December 2007 (30) November 2007 (30) October 2007 (5)
Forthcoming from Sonali Dev on May 19th
Forthcoming from Natalie Jenner on May 26th | cc/2020-05/en_middle_0128.json.gz/line914 |
__label__cc | 0.68027 | 0.31973 | Bluegrass Champs
Bluegrass Bands
2012 IBMA Winners
Regular Jams
Jam Camps
Download Shop
Sell Swap Buy
AustralianBluegrass.com
bringing bluegrass music news from all over downunder
Australian Bluegrass News
IBMA News
CD Releases
Ask Ozzie
Australian Bluegrass Conference
Australian Banjo Conference Meet the Faculty #2
19 Nov, 19 by Greg McGrath Leave a Comment
Here is post number two on the 2019 Bluegrass Conference faculty. The conference is the only chance bluegrass musicians in Australia would have to work, learn and play in an environment filled with quality teaching, musicianship and inspiration.
Bennett Sullivan
Bennett Sullivan banjo, composer, teacher, session musician and performer:
Bennett Sullivan is a young banjo player and professional educator from New York. He is described as a critically acclaimed composer, teacher, session musician and performer He has just won the IBMA’s 2019 Momentum Award, an award that recognises artists and business people in the early years of their bluegrass music careers.
Bennett main gig is performing in New York however, he is a successful banjo teacher, helping banjo pickers improve their skills. He offers lessons in person and via Skype. His uniqueness, versatility, and prowess on different stringed instruments makes him one of the most sought after musicians in the country music industry and beyond.
Mark Miracle
Mark Miracle mandolin, singer and teacher:
Mark has been playing music all his life in the southwest US region, having played festivals in Arizona, California and Colorado. Mark has won numerous mandolin contests and his band, Shady Creek, won the SW Regional Division of the Pizza Hut Showdown (now IBMA) Battle of the Bands in the late ’90’s. Mark is also the founding member of Clear Blue, which won the Telluride Bluegrass Festival Band Contest in 2000 and opened the festival in 2001. He also spent 5 years in Ohio, playing in 3 bands and extensively touring the area. His return to Arizona brought him to become a founding member of Sawmill Road, touring thoughout the US, Canada and Europe. Mark has been a regular visitor to Australian festivals and previous Bluegrass Conferences. He played and toured initially with the band X-Train and now performs and tours with the highly successful Arizona based band Sonoran Dogs.
Peter McLaughlan
Peter McLaughlin guitar, singer songwriter:
Peter McLaughlin is an acclaimed acoustic guitarist, songwriter, vocalist, performer, recording artist and music instructor from Tucson, Arizona. He plays many genres and styles, and specializes in acoustic flatpicking and fingerpicking techniques.
Peter started playing the guitar at the age of eight and was very soon jamming at bluegrass festivals and fiddle conventions. He lived in Denmark in the early 70s, and attended a Danish high school. In 1974, Peter moved to Northern Arizona to attend University, where he played with Tom Rozum (mandolin, fiddle, and vocals), Roger Smith (bass and vocals), John Zarske (rhythm guitar and vocals), and Frank Dedera (banjo) in the group, called Flying South, an acoustic string band specializing in bluegrass and early swing era jazz. A later incarnation of Flying South included Kirby Mittelmeier (mandolin and vocals) and John Willis (bass and vocals).
He has been a member of bands such as X-Train – his first tour to Australia – with banjo player Ross Nickerson, and in various other bands, including the 1988 Telluride Band Contest winners, The Titan Valley Warheads, which Peter still plays with on occasion.
In 1991, Peter had the opportunity to reunite with his long-time pal, Tom Rozum, and joined Laurie Lewis, touring nationally and internationally for six years as guitarist and harmony vocalist with her band.
This will be Peter’s fourth trip to Australia’s Bluegrass Conference.
Tyler James
Tyler James banjo:
Tyler who comes from a musical family, and like many accomplished and successful musicians today started playing music at a young age. After experimenting with several different instruments, he received a banjo on his fifteenth birthday and immersed himself in bluegrass music. In 2008, he “came up for air”, competing in and winning–the Rockygrass Banjo Championship in Lyons, Colorado. Tyler went on to take 1st place in the Arizona Banjo Championship that same year. Tyler did it again, winning the 2010 Huck Finn Festival banjo championship and attaining top 5 finalist status at the Winfield National Banjo Championship.
Bruce Packard – mandolin, bass, singer:
Bruce Packard was born in London in 1953, and lived in Christchurch, New Zealand before coming to Australia with his parents. He attended school and university in Canberra, and has lived in Melbourne since 1997
Bruce has recorded and travelled widely with “New Dogs Old Tricks”, folked-up jazzers “Straight Ahead” and traditional bluegrass band “Sleight of Hand”. He’s equally comfortable on double bass and mandolin, and plays mandocello in Melbourne’s mandolin orchestra Concordia.
He has composed and recorded music for film and stage, and also finds time for a bit of acting and sound engineering.
Bruce is a regular on the Australian Bluegrass Conference faculy and brings a wealth of talent as a musician, performer. His passionate bass playing and highly informative instruction are favourites highlighted by past delegate from the conference.
Filed Under: Australian Bluegrass News Tagged With: Australian Bluegrass Conference, Bennett Sullivan, Bruce Packard, Mark Miracle, Peter McLaughlin, Tyler James
The 2019 Bluegrass Conference is just weeks away. This year’s conference has a wealth of teaching talent and musical dexterity. We will spend the next few days introducing you to this years faculty, with some background on their careers.
Jens Kruger
Jens Kruger banjo, song writer, composer:
We gladly welcome back to Australia the amazing Jens Kruger from North Carolina USA. Originally from Switzerland, Jens Kruger began playing North American folk music at an early age and was particularly inspired by recordings of Doc Watson, Flatt and Scruggs, Bill Monroe, and other originators of country, bluegrass and folk music.
Jens is a member of the Blue Ridge Music Hall of Fame, having been inducted in 2011. In 2013, he was awarded the Steve Martin Prize for Excellence in Banjo and Bluegrass Music. Jens is the first winner of the award who resides in North Carolina and the first born outside of the United States.
(Jens Kruger is) one of the world’s most musically sophisticated and technically accomplished five‐string banjo players – Happy Traum.
Josh Goforth
Josh Goforth, fiddle, mandolin and guitar:
Josh resides in Asheville, North Carolina. He has been a member and road manager of Carolina Road for fifteen years. Josh attended East Tennessee State University where he majored in Instrumental Music Education. He is very active in the world renowned bluegrass and country music program at ETSU and also mentors upcoming fiddle players through residencies with universities including Colorado College, University of Georgia and University of Kentucky.
Josh teaches with the City of Asheville, North Carolina and has performed with Appalachian Trail, David Holt & Laura Boosinger, Open Road and The ETSU Bluegrass Pride Band. He has also performed in 13 foreign countries and throughout the United States. In 2000, 2003 and 2005 he was named the Fiddler of the Festival as the nationally acclaimed Fiddler’s Grove Competition, and awarded the title of Master Fiddler after winning the coveted position three times.
Josh has been a finalist for SPBGMA Fiddle Player of the Year. In 2009, he was nominated for a Grammy for the album Cutting Loose which he produced and recorded on with David Holt. Josh also showed off his acting chops in the 2000 film Song Catcher where he was given a small role, was the vocal coach on set, and performed on the film’s soundtrack. Josh is a successful producer and coproduced Carolina Road’s latest cd. Josh enjoys teaching folklore and sharing his talents with others. Josh is proud to endorse Henderson Guitars, Kogut Violins, D’addario Strings, and Baggs Pickups.
Jenny Lester
Jenny Lester, fiddle, guitar, singer songwriter:
Jenny Lester is no stranger to Australia. Her gorgeous voice and fiddle playing graced our shores when she toured with Hungry Hill in 2009. Jenny is a dynamic Canadian bluegrass performer and recording artist who has established herself as an important singer/songwriter and multi-instrumentalist. Her original songs are carefully crafted in the bluegrass convention while at the same time displaying a contemporary freshness and vitality that breathes new life into the fabled “high lonesome” sound.
Jenny is a veteran stage performer, beginning on the fiddle at age eight with her family’s Driftwood Canyon Family Band out of Smithers, B.C. After nearly a decade of touring West Coast festivals, Jenny won a musical scholarship to South Plains College in Texas, graduating with honors and three Golden Reel awards. The journey moved in the 1990s through Dark Horse based in Colorado, the Australian trio performing at Leo Foo Village in Taiwan, John Reischman and Bluegrass Signal in Vancouver, BC, and the Jenny Lester Trio. Music videos, telethons and documentaries were recorded in the 1980’s of the family band. As Jenny’s career continued she appears in Discovery, Disney and PBS movies. In 1998 Jenny released the internationally acclaimed debut album Friends Like You. The turn of the millennium brought together two new cds with the world touring, Yukon-based band, Hungry Hill. Her love of music has been paralleled by her love of horses and Jenny devotes her life to both.
Running over 4 days in December, from Thursday 12th to Sunday 15th and held at the Tranquil Park Resort in Maleny, this conference feature some 14 instructors in total.
Filed Under: Artists, Australian Bluegrass News Tagged With: Australian Bluegrass Conference, Jenny Lester, Jens Kruger, Josh Goforth
2019 Australian Bluegrass Conference Update No 2
22 Jun, 19 by Greg McGrath Leave a Comment
Photo credit – Chelle Lewin
The Australian Bluegrass Conference, (ABC) held annually near the picturesque town of Maleny in Queensland’s beautiful Sunshine Coast Hinterland is designed to be a high-powered, fun-filled, 4 days of bluegrass music immersion. It is the perfect place for learning essential techniques, jamming with friends and networking with other like-minded players who travel from all over Australia and New Zealand to attend.
Each year the ABC has been held in the stunning surroundings of the Sunshine Coast, and has catered to players of all temperaments and skill levels. When you attend the ABC, you meet and hear some of the finest bluegrass musicians from the USA and Australia as they play and teach exclusively for you in a relaxed, up close and personal setting. The conference is one of the premier events on the Australian music calendar.
The conference is one of the premier events on the Australian music calendar.
This fully catered event will take your playing and motivation to new heights.
There are only ever 65 spaces available so, unlike a festival, this unique format provides an exceptional instructor/player ratio with intimate access to some of the finest musicians available.
Book now for this unforgettable music experience. 2019 is set to be the largest, brightest and best conference yet to date.
Arrive with anticipation and leave inspired.
This is biggest team ever amassed for an Australian Bluegrass Conference. It is now set to provide you with an unparalleled line-up of national and international musicians who will share exclusively with you their wealth of musical knowledge and expertise. You will not only hear them perform in various settings over the 4 days, but you will be able to hang out with them, ask question and of course jam with some of the world’s leading bluegrass players.
Special guests this year include:
International Guests:
International Group -The Sonoran Dogs
Taylor Pfeiffer,
John O’Donnell
Mark Nahuysen
Peter Nahuysen
Gary Vann
Anita Nahuysen
Click here to download the full conference brochure (4.1Meg).
Filed Under: Australian Bluegrass News, Events, Headline News Tagged With: Australian Bluegrass Conference
2018 Australian Bluegrass Conference
19 Dec, 18 by Greg McGrath
As the rain clouds converged on Queensland’s south-east this weekend, a group of bluegrass musicians travelling by plane, train and car to converged on the mountain tourist town of Maleny for the 10th Australian Bluegrass Conference.
The venue for the 2018 conference is ironically named Tranquil Park Resort. It is nestled into the side of hills overlooking the famous glass house mountains some 20 kilometres inland from Caloundra on the Sunshine Coast. This year’s event was not marred by the endless rain of the weekend or the almost continuous cloud cover over the mountains, but buoyed by the enthusiasm and verve of an awaiting faculty and some 60 plus students.
The notion a bluegrass conference is not one that is easily explained to the uninitiated. In short it is the ultimate in personal bluegrass music development, allowing musicians to bathe in the overwhelming music, professional tuition, endless jamming and vital networking. It is the brainchild of Bellbird Banjo proprietor and luthier Peter Nahuysen of Brisbane. Some ten years ago now Peter saw the need to offer high level tuition to – initially – banjo players in Australia. Through evolution and demand, the mostly annual event has become a national celebration of all things bluegrass and features high quality tuition for not only banjos players but now includes mandolin, guitar, fiddle and double bass.
In terms of tuition this conference offers Australian bluegrass musicians the greatest opportunity to get along side and develop their craft through four days of intimate teaching contact with professional bluegrass musicians from not only Australia but from the USA, the origins of the music genre.
This years conference featured a faculty of high quality musicians and performers from Australia and the USA. The feature bands for this year included Mustered Courage from Melbourne, The Sonoran Dogs from Arizona, USA. Each of the band members also undertook to deliver workshops during the conference.
Mustered Courage:
Nick Keeling on 5-string banjo
Julian Abrahams on guitar
Josh Bennet on mandolin
Josh Bridges on bass.
The Sonoran Dogs:
Mark Miracle on mandolin
Tyler James on 5-string banjo
Peter McLaughlin on guitar
Bruce Packard* on bass
*Bruce is a Melbourne boy often recruited to play bass by local and international bands.
Russ Carson
Other individual tutors for the conference included Russ Carson, current banjo player with Ricks Skaggs and Kentucky Thunder, Russ’s father Glenn Carson and seasoned fiddle and old-timey banjo player. Peter Nahuysen and his twin brother Mark were also part of the teaching staff as well as Peter’s daughter Anita Nahuysen, a very competent old-time banjo player and excellent teacher and Brisbane banjo and fiddle master Gary Vann.
The weekend included 50 one-hour workshops/tutorials over the four days with class sizes limited to around six students in each of the one hour teaching sessions to ensure a level of intimacy and inclusiveness with instructors.
Thursday and Friday nights featured concerts from the teaching faculty. The Sonoran Dogs, Mustered Courage The Nahuysen Brothers band and Russ and Glenn Carson. The quality of musicianship in each of the concerts left little doubt as the the musicianship of the teaching staff for the weekend to come.
I have been to every bluegrass conference and I think this one has been the best yet. Peter (Nahuysen) never fails to bring the best of talent. To see and hear Russ Carson as well as the Sonoran Dogs has been fantastic – Greg Dunn.
As a frequent attendee to these events I can attest to the value of the four days to not just beginners but intermediate to advanced players of each bluegrass instrument. The artists’ personal anecdotes were also mesmerizing. Just listening to Russ Carson recount his experiences with Ricky Skaggs’s band Kentucky Thunder and his amazing ordeal leading up to his audition and eventual recruitment into the band left me in awe of this young man’s ability, determination and tenacity.
The two masterclasses gave us an insight into the inner workings, structure and discipline of a professional bluegrass band. While Mustered Courage recounted their eventual gravitation into bluegrass music having dabbled with jazz, hip hop and grunge ending the session with a demonstration of their highly disciplined approach to bluegrass harmony singing.
Regardless of your own level of competence with your instrument/s, you will be guaranteed to benefit from the next Australian Bluegrass Conference to be held at Tranquil Park in Maleny on Queensland’s Sunshine Coast from 12th to 15th December 2019.
Read for yourself what some of the attendees have said:
This has been a wonderful weekend and a great opportunity to catch up with friends and meet new people. The instruction has been really first-rate. While they are only one hours sessions there is so much packed in there and instructor have been happy have us record stuff to take home and apply later. A really wonderful weekend – Dave Hart.
I think it’s a weekend like no other. Great venue, great company and well worth coming to. It’s the highlight of the year for me. If you’re wondering if you are good enough to come or it sounds to frightening then you should come. You’ll feel included, you won’t regret it and you’ll have a great time – Therese Marty.
I love coming to the Bluegrass Conference in Maleny, the atmosphere is amazing, the venue is fabulous. We are ups in the mountains learning so much and jamming with people from around Australia and America, it has truly been a fantastic experience – Taylor Pfeiffer.
The highlight for me was the expert banjo pickers who were so gracious in sharing their wealth of knowledge and giving us tips that perhaps in any other industry would be considered trade secrets – Paul Mills.
I have really enjoyed learning the basics from the experts. How to strum, how to build chords and all of the theory has been a great help – Errold Bryant.
The highlight of the weekend has been seeing so many young musicians so passionate about bluegrass music learning and honing their skills on the spot as we teach. There aren’t enough of these events in Australia. It has meant a lot for us to be able to dig deeper into what we do and how we play our music – Julian Abrahams, Mustered Courage.
The Australian Bluegrass Conference has been one of the most positive musical experiences of my career. One of the best four days I have ever had. I have enjoyed, the (teaching) staff, the (conference) attendees, there has been such a tremendous outpouring of camaraderie. It has been wonderful to see people just so hungry to learn and to see their passion for the music – Russ Carson.
I am always delighted and surprised with the level of musicianship here in Australia when we come to teach at the Australian Bluegrass Conference. I find it just as enlightening for me as I get to learn from the students as well – Peter McLaughlin.
I have enjoyed the hospitality of the Nahyusen family and how welcoming all of the artists have been. I am all grateful that they have been so encouraging to my daughter Amy. For her to be able to get up and play with musicians of that calibre at such a young age (nine years old) has been something quite special – Andrew Ryan.
Mark it in your calendars for next year – Australian Bluegrass Conference 12th to 15th December 2019.
Filed Under: Australian Bluegrass News, Headline News Tagged With: Australian Bluegrass Conference
Mustered Courage Signed Up For Bluegrass Conference
3 Apr, 18 by Greg McGrath
The Australian Bluegrass Conference has welcomed Mustered Courage to the faculty for 2018.
ARIA nominated Mustered Courage breathe new life into the Australian roots music scene with a diverse sound that appeals to both traditionalists and newcomers alike. Since the release of their self-titled debut album in 2011, the Melbourne based outfit have become the torch bearers for string band music here in Australia.
the link between Bill Monroe and Mumford & Sons – Music Australia Guide.
The progressive folk-rock quintet blasted on to the national music scene when their second album, Powerlines, garnered two Golden Guitar nominations and a live performance at the 2014 CMAA Country Music Awards in Tamworth. This led to a collaboration with Kasey Chambers on the song Rosa which was included on the album’s American release.
This year’s 4-day Bluegrass Conference will feature two fantastic bands, as well of course as special guest Russ and Glenn Carson from the USA.
The updated faculty now comprises:
Russ Carson – USA (banjo)
Glenn Carson – USA (clawhammer banjo)
The Sonoran Dogs Bluegrass Band:
Mark Miracle – USA (mandolin)
Peter McLaughlin – USA (guitar)
Tyler James – USA (banjo)
Bruce Packard – AUS (bass)
Martin Louis – AUS (banjo)
Anita Nahuysen – AUS (clawhammer banjo)
Nick Keeling (banjo)
Josh Bennett (fiddle)
Julian Abrahams (guitar)
Josh Bridges (bass)
Conference organiser Peter Nahyusen has advised us that bookings are going strong. If you plan to attend this year, make sure you get in touch as soon as you can.
Filed Under: Artists, Australian Bluegrass News, Headline News Tagged With: Australian Bluegrass Conference, Mustered Courage
Russ Carson Secured for Australian Bluegrass Conference
22 Feb, 18 by Greg McGrath
Australian Bluegrass Conference – Thursday December 13th till Sunday December 16th.
Banjo player Russ Carson has been confirmed for this year’s Bluegrass Conference to be held in Maleny on Queensland’s Sunshine Coast.
Russ Carson currently shares the stage with Ricky Skaggs playing banjo in Skaggs’ band Kentucky Thunder. Carson’s previous stints include two years with Virginia based bluegrass band, Gold Heart and three years with Audie Blaylock’s Redline.
From as far back as he can recall Carson he was surrounded by banjo and fiddle music. He developed a passion for the banjo and acoustic music and at age 10 he heard Earl Scruggs play on a recording leading to his desire to learn the banjo. His supportive parents contacted local banjo teacher Nev Jackson and got Russ signed up as a student. After 6 years with Nev he was able to take occasional lessons from musicians such as Alan Munde, Bill Keith, Jens Kruger, Tony Trischka, Mike Munford, Chris Warner, Tom Adams and Jeremy Stephens.
A great choice for the Australian Bluegrass Conference.
Filed Under: Australian Bluegrass News, Headline News Tagged With: Australian Bluegrass Conference, Russ Carson
Australian Bluegrass Conference – Thursday December 13th till Sunday December 16th
The organisers of the Australian Bluegrass Conference are currently securing the faculty for the 2018 conference.
To date they have secured American/Aussie bluegrass band The Sonoran Dogs featuring Mark Miracle, Peter McLaughlin, Tyler James and Bruce Packard.
There are another 6-8 names of players in the mix who have yet to have been able to commit, but rest assured I will have a crackerjack line up of Australian and International players in attendance – Peter Nahuysen conference convener.
The venue will be Tranquil Park Resort in Maleny on the Sunshine Coast hinterland.
Please feel free to register your expression of interest in this event by emailing Peter.
2016 Australian Bluegrass Conference Update
7 Sep, 16 by Greg McGrath
As folks across the country gear up for the next Bluegrass Conference to be held at Tranquil Park Maleny in South East Queensland we have a few updates on this year’s event.
Reminder on Details:
Date: Thursday 8th Dec – Sunday 11th Dec 2016
Place: Tranquil Park Resort, Maleny, Qld., Australia.
Contact Email: peternahuysen@optusnet.com.au Mob.: 0416 113 496
For those who might not have heard the news, banjo virtuoso Jens Kruger is our special return guest this year. Jens has said he is really looking forward to meeting old friends and new. Jens will augment the already stunning camp faculty, including Arizona bluegrass band, The Sonoran Dogs, and Australia’s own music legends, The Company.
Sonoran Dogs
The Sonoran Dogs bring camp favourites Mark Miracle (mandolin) and Peter McLaughlin (guitar) back to our shores, along with their amazing banjo player, Tyler James. And as a special guest – the talented Bruce Packard (Coolgrass) will join the boys on bass, both in concerts and at the conference.
Other special guests will be featured over the course of the weekend conference and concerts.
As always, beginners are most welcome, and the camp atmosphere is friendly and inspirational. This is an amazing opportunity to get up close and personal with some of the world’s best bluegrass musicians.
Please note that bookings for this event are essential.
Numbers are limited, so to avoid disappointment, please book and pay conference fees as soon as possible, to reserve your spot.
If you have already booked, the balance of you fees are now due. Please note that as with any event, paid up attendees will take priority over unpaid expressions of interest.
The cost includes:
3 nights accommodation at the fully licensed Tranquil Park Resort.
9 superb main meals (Thursday dinner to Sunday lunch)
Morning and Afternoon Teas.
Instruction and Workshop Sessions and all In-house concerts
Entry to the traditional downtown Maleny Friday night concert
Concert Dates featuring Jens Kruger, The Sonoran Dogs, and the Nahuysen’s:
Fri. Dec 2nd, 7:30PM – Bray Park – Genesis Christian College Auditorium. 12-16 Youngs Crossing Rd, Bray Park, Qld.
Sun, Dec 4th, 7:30PM – Samford – Samford Community Centre, School Rd, Samford, Qld.
More Details: peternahuysen@optusnet.com.au.
Filed Under: Australian Bluegrass News Tagged With: Australian Bluegrass Conference
16 Aug, 16 by Greg McGrath
The Australian Bluegrass Conference is designed as a high-powered, fun-filled long weekend of bluegrass instrument and music instruction. It is the perfect place for jamming and networking and caters for players of all skill levels. Fast track your playing to new heights and get more fun out of playing than you even thought was possible.
The Conference runs over 4 days with 12 instructors in total. The event features some of the finest players from both Australia and the USA. There are 55 spaces available. The conference is scheduled for 8th Dec. through to 11th Dec.
Book now for this unforgettable music experience.
Hear some of the finest bluegrass musicians from both Australia and the USA as they play and teach exclusively for you in relaxed and intimate surroundings. This is one of the premier events on the Australian bluegrass music calendar.
The 2016 Bluegrass Conference:
Intensive instruction in 5 String Banjo Guitar, Mandolin, Fiddle and Bass.
From midday, Thursday 8th December to 2:00pm, Sunday 11th December.
Venue is Tranquil Park Resort, located near Maleny in the Sunshine Coast Hinterland just north of Brisbane.
Tyler James Martin Louis
Michael Patrick Jamie Clarke
Markus Karlsen
Cost: $850 per person includes:
Check-in will be after 12:00pm on the Thursday, and wrap up Sunday afternoon at 2:00pm. All rooms have ensuites and are either 2, 3 or 4 share.
Q1. How do I register and pay?
A. The best way is to contact Peter Nahuysen via email at: peternahuysen@optusnet.com.au
You can speak to him about the conference details and arrange a direct deposit payment, or send a cheque payable to Peter Nahuysen to: PO Box 505 Aspley Qld 4034. ALternativelty you can call Peter on 0416 113 496 to discuss options.
Q2(a). Can I bring a partner?
A. Yes but space will be limited to 5 due to the small number of double rooms available.
First in bookings will have priority for these partner spots.
Q2(b). If I bring my partner, how much will it cost for them?
A. Because they are not receiving instruction it will be $650.00.
Q3 If I come by myself will I be sharing a room with others?
A. Yes. Just like any Bluegrass Festival or Conference, to keep costs down for everyone we must dorm share the available rooms. However the maximum is only 4 per room with a number of 3 and 2 share, and they are very comfortable.
Q4. If I land at Brisbane Airport will there be transport to get to the camp?
A. To assist any Interstate attendees, we will be offering lifts from the airport to Tranquil Park on the Thursday departing between 9:00 and 11.00 am and returning to the Airport departing the camp site at around 2.00 pm on the Sunday. Let us know if you require transport when you book.
Peter Nahuysen – Conference Convenor
Email: peternahuysen@optusnet.com.au
2016 Australian Banjo and Bluegrass Conference
22 Mar, 16 by Greg McGrath
The Australian Bluegrass Conference December 8th – 11th 2016
After a year off in 2015 organisers have announced details of the Banjo and Bluegrass Conference for 2016. As previously done, the conference is 3 full days in length, with 12 instructors in total, and special guest players from the USA. There are 55 spaces available although many are already selling.
The Australian Bluegrass Conference is designed as a high-powered, fun filled long weekend of bluegrass instrument and music instruction. It is the perfect place for jamming and networking and caters for players of all skill levels. Fast track your playing to new heights and get more fun out of playing than you even thought was possible.
Hear some of the finest bluegrass musicians from both Australia and the USA as they both play and teach exclusively for you in relaxed and up close surroundings. This is one of the premier events on the music calendar.
The Australian Bluegrass Conference December 8th – 11th 2016 – Thursday midday – Sunday 2.00pm
Intensive instruction in 5 String Banjo Guitar, Mandolin, Fiddle and Bass. Venue: Tranquil Park Resort Located near Maleny in the Sunshine Coast Hinterland just north of Brisbane.
From the USA, The Sonoran Dogs featuring Mark Miracle, Peter Mclaughlin and Tyler James. Also Martin Louis, Bruce Packard, Michael Patrick, Jamie Clarke, Markus Karlsen, and more.
Download the registration form now and send it to Peter Nahuysen via email or post to: Australian Banjo Conference Convenor, 30 Alexis St, Aspley. Q 4034.
Golden Guitar For Kristy Cox
Michael Cleveland Receives Grammy Honours
Flashback – John Henry Holliday
2020 IBMA Showcase Applications
Bluegrass Music Introduced to US Schools
KiwiGrass 2020
Some Cajun From Les Saules Pleureurs
Kristy Cox – No Headlights
The Sad Reality of Bluegrass
35th Illawarra Folk Festival Program
Awarded Best Blogs
Enter your email address to subscribe. Receive notifications of new posts by email.
Spammers Caught and Reported
· © Copyright 2013 AustralianBluegrass.com Inc. · All Rights Reserved · Powered by WordPress · | cc/2020-05/en_middle_0128.json.gz/line915 |
__label__cc | 0.596734 | 0.403266 | Submit search form search
League Networks
Local Networks
Online Outlets
Announcing Schedules
Close menuclose
Link to Instagram Link to Instagram
Comeback Media knows that you care about how your personal information is used and shared, and we take your privacy very seriously. Please read the following to learn more about our privacy policy. By visiting our website, you are accepting the practices outlined in this Privacy Policy.
This Privacy Policy covers Comeback Media’s treatment of personal information that Comeback Media gathers when you are on any of the Comeback Media websites and when you use Comeback Media services. This policy does not apply to the practices of third parties that Comeback Media does not own or control, or to individuals that Comeback Media does not employ or manage.
Information Collected by Comeback Media: We only collect personal information that is relevant to the purpose of our website. This information allows us to provide you with a customized and efficient experience. We do not process this information in a way that is incompatible with this objective. We collect the following types of information from our Comeback Media users:
1. Information You Provide to Us: We receive and store any information you enter on our website or provide to us in any other way. You can choose not to provide us with certain information, but then you may not be able to take advantage of many of our special features.
2. Automatic Information: We receive and store certain types of information whenever you interact with us. Comeback Media and its authorized agents automatically receive and record certain “traffic data” on their server logs from your browser including your IP address, Comeback Media cookie information, and the page you requested. Comeback Media uses this traffic data to help diagnose problems with its servers, analyze trends and administer the website.
Comeback Media may collect and, on any page, display the total counts that page has been viewed.
Many companies offer programs that help you to visit websites anonymously. While Comeback Media will not be able to provide you with a personalized experience if we cannot recognize you, we want you to be aware that these programs are available.
E-mail Communications: Comeback Media is very concerned about your privacy and we will never provide your email address to a third party without your explicit permission, as detailed in the “Sharing Your Information” section below. Comeback Media may send out e-mails with Comeback Media-related news, products, offers, surveys or promotions.
Cookies: Cookies are alphanumeric identifiers that we transfer to your computer’s hard drive through your Web browser to enable our systems to recognize your browser and tell us how and when pages in our website are visited and by how many people. Comeback Media cookies do not collect personal information, and we do not combine information collected through cookies with other personal information to tell us who you are or what your screen name or e-mail address is.
The “help” portion of the toolbar on the majority of browsers will direct you on how to prevent your browser from accepting new cookies, how to command the browser to tell you when you receive a new cookie, or how to fully disable cookies. We recommend that you leave the cookies activated because cookies allow you to use some of Comeback Media’s coolest features.
Comeback Media’s advertising partners may place a cookie on your browser that makes it possible to collect anonymous non-personally identifiable information that ad delivery systems use to present more relevant ads. If you would prefer to opt-out of this standard practice, please visit our advertising partner Platform-A’s privacy policy and opt-out page.
Sharing Your Information: Rest assured that we neither rent nor sell your personal information to anyone and that we will share your personal information only as described below.
Comeback Media Personnel: Comeback Media personnel and authorized consultants and/or contractors may have access to user information if necessary in the normal course of Comeback Media’s business.
Business Transfers: In some cases, we may choose to buy or sell assets. In these types of transactions, user information is typically one of the business assets that is transferred. Moreover, if Comeback Media, or substantially all of its assets, were acquired, user information would be one of the assets that is transferred.
Protection of Comeback Media and Others: We may release personal information when we believe in good faith that release is necessary to comply with a law; to enforce or apply our Terms of Use and other policies; or to protect the rights, property, or safety of Comeback Media, our employees, our users, or others. This includes exchanging information with other companies and organizations for fraud protection and credit risk reduction.
Syndication: Comeback Media allows for the RSS syndication of all of its public content within the Comeback Media Network websites.
With Your Consent: Except as noted above, we will contact you when your personal information is shared with third parties or used for a purpose incompatible with the purpose(s) for which it was originally collected, and you will be able to opt out to prevent the sharing of this information.
Children Under 18 Years of Age: You must be 13 years and older to register to use any of Comeback Media’s websites. As a result, Comeback Media does not specifically collect information about children. If we learn that Comeback Media has collected information from a child under the age of 13, we will delete that information as quickly as possible. We recommend that minors between the ages of 13 and 18 ask and receive their parents’ permission before using Comeback Media or sending information about themselves or anyone else over the Internet.
Changes to this Privacy Policy: Comeback Media may amend this Privacy Policy from time to time, at its sole discretion. Use of information we collect now is subject to the Privacy Policy in effect at the time such information is used. If we make changes to the Privacy Policy, we will notify you by posting an announcement on the Comeback Media Network websites so you are always aware of what information we collect, how we use it, and under what circumstances if any, it is disclosed.
Conditions of Use: If you decide to visit any of Comeback Media’s websites, your visit and any possible dispute over privacy is subject to this Privacy Policy and our Terms of Use, including limitations on damages, arbitration of disputes, and application of California state law.
Effective Date of this Privacy Policy: This Privacy Policy is effective as of 10/30/2011 and last updated 2/22/2016.
74 thoughts on “Privacy Policy”
The best, worst, and WTF moments of 144 movies in 2019
The 10 best NFL quarterbacks of the decade
The top 20 games of the 2010s
The 10 best club soccer teams of the decade
The 2019 NFL announcer rankings
Your 2019 local MLB announcer rankings
ESPN severs ties with New Mexico Bowl title sponsor, which apparently isn’t a real company
Trey Wingo’s rumored departure from Golic & Wingo would keep the morning show merry-go-round spinning
Dan Le Batard reveals that Trent Dilfer tried to negotiate private plane travel with ESPN, failed spectacularly
Entire Deadspin staff resigns in wake of Barry Petchesky’s firing, G/O Media reiterating “stick to sports” mandate [updated]
The 10 best movies of the decade
What is the most ridiculous scene in a sports movie?
5 times Mad Men reduced me to tears
The 10 best sports movies currently available on Disney+
Here is a list of things that millennials are killing
AwfulAnnouncing.com is a Sports fan web site and is in no way affiliated with any media organization, any professional sports league, team, organization, or its Properties. This site is for informational and entertainment purposes only. AwfulAnnouncing.com is not an official web site for any media organization, professional sports league, team, or organization.
Copyright © 2017 www.AwfulAnnouncing.com - All Rights Reserved - Trademarks used herein are property of their respective owners.
AwfulAnnouncing.com is part of the NESN digital network. | cc/2020-05/en_middle_0128.json.gz/line920 |
__label__cc | 0.61555 | 0.38445 | "Gov. Scott Walker holds single-digit leads over several potential Democratic opponents in hypothetical recall matchups..."
"In the survey of 701 registered voters, Walker leads his 2010 opponent, Milwaukee Mayor Tom Barrett, 50% to 44%. He leads former Dane County executive Kathleen Falk 49% to 42%. He also leads two other Democrats, former congressman Dave Obey and state lawmaker Tim Cullen."
In the same statewide poll, President Obama leads Republican Mitt Romney in a hypothetical matchup 48% to 40%.
Maybe Wisconsinites just like incumbents. Seriously, what's going on there? We've got Obama 8 points ahead of the supposedly kind of moderate Romney, yet the supposedly staunchly conservative Walker is beating all the potential Democratic opponents?
Looking through to the full results — PDF — it's interesting that on the right direction/wrong track question, 70% of the respondents think the country is on the wrong track (24% say "right direction"), but when the same question is asked about Wisconsin, 50% say "right direction," and 46% say "wrong track."
Check out question 30: "In general, which of the following statements do you agree with more? I'd rather pay higher taxes and have a state government that provides more services, or I'd rather pay lower taxes and have a state government that provides fewer services?" 50% prefer the lower taxes approach, compared to 41% who want more services.
And question 38: "Thinking about all the changes in state government over the past year, do you think Wisconsin is better off in the long run because of these changes or worse off in the long run?" 54% say "better off," over 40% that say "worse off."
Interesting results. I think it's predictable that Scott Walker will survive the recall election.
Tags: polls, Scott Walker, Wisconsin recall
"Seriously, what's going on there?"
Perhaps a lot of people are still afraid that if they vote against Obama it means they are racist.
Sorun said...
People are only afraid to say they'd vote against Obama.
shiloh said...
Perhaps it's early and the "actual" campaigning has yet to begin.
And yes incumbency is huge, even for Walker, who has been campaigning ie talkin' to his buddies the koch boys non-stop, much like Obama recently.
ok, call me crazy! :-P
Obama was (30) pts. behind Hillary nationally and one month later beat Hillary in Iowa bt 8 pts.
Coakley was (30) pts. ahead of Brown and one month later lost mainly 'cause she a no-show ie didn't campaign.
As always, stay tuned as voters can be quite fickle! :D
Thinking about all the changes in state government over the past year, do you think Wisconsin is better off in the long run because of these changes or worse off in the long run?" 54% say "better off," over 40% that say "worse off."
Probably because Walker's reforms are working.
Maybe people with name recognition do better than those without. Shiloh's anecdotes speak to that.
It would be interesting to compare this poll with one taken at the same time with the same methodology that compared Scott Brown to "Generic Democrat" and Barack Obama to "Generic Republican."
Regardless $$$ will be pouring into WI. :)
Ann Althouse said...
"Perhaps it's early and the "actual" campaigning has yet to begin."
Do you really think the named Democrats are going to build support as they campaign and Walker campaigns?
I don't. They aren't appealing and charismatic people, and what are they going to say?
I think the most interesting question is how the recall distraction will affect the fall elections.
"Regardless $$$ will be pouring into WI. :)"
Yes, unlimited fundraising that will be spent in a season when there are other races going on where the candidates do have limits.
The people who pushed for the recall set up a screwed up season of TV commercials.
Keep in mind, GodZero's been pretty much out of the news the last week or so and his numbers always go up then.
Once people have to look at him and hear him on a daily basis, the numbers nosedive.
(even so, he's at -16 in Rasmussen's approval index and that's what he was polling a year ago when he was on the tube every day)
And what Jay said. People are starting to see the money saved.
RonF said...
"In general, which of the following statements do you agree with more? I'd rather pay higher taxes and have a state government that provides more services, or I'd rather pay lower taxes and have a state government that provides fewer services?" 50% prefer the lower taxes approach, compared to 41% who want more services.
In Illinois you'd get the reverse answer, as we have a large number of people dependent on government funding either through welfare payments or other assistance or because they're on a government payroll.
John Stodder said...
I think the electorate thinks the recall is unfair, unwarranted and a partisan stunt.
When Gov. Gray Davis was recalled in 2003, it was because the state's finances were a wreck. It seemed as if the only way to salvage the situation was to change leaders. Desperation was in the air.
Not so in Wisconsin. The only desperate people in Wisconsin's political universe are the public employee unions and the Democratic party. Which did SO much to boost its reputation by leaving the state to block a vote.
It looks like a refight of the previous election, and the voters hate that. They want campaigns every four years, not every time the losers are unhappy.
So the polling suggests that there are a whole bunch more Walker supporters than there are voting-age, living Wisconsin residents who signed their real name to a petition once.
The petitions for the state senators are up. I took a look through Van Wangaard's of Racine and in 5 minutes found a man and a woman with the exact same handwriting, as well as a two signatures from a couple in Wisconsin Rapids (about 200 miles away). Anecdotal? Most certainly! Means that there are not enough valid signatures -- certainly not. But those four "signatures" will equate to only one vote against Wangaard. Such is the hard math faced by the recallers.
PackerBronco said...
Walker's lead will only grow.
The Dems said that disaster would occur when Walker's reforms were installed.
Well it hasn't happened.
Not everything in the Wisconsin economy is perfect. I would like to see a lower unemployment rate, but compared to the rest of the country it is't bad.
The larger question is whether Walker should be kicked out after a year in office. Should the state that this extraordinary action?
Unless you're a died-in-wool Walker hater the answer is obviously "no".
"The people who pushed for the recall set up a screwed up season of TV commercials."
Thank God for DVRs.
"The petitions for the state senators are up."
What's the website?
damikesc said...
shiloh, if there is already a comfortable lead for Walker at this point, good luck in making a lot of inroads. The haters are already as fervent as they can be and are still losing.
These numbers are why Russ Feingold isn't gooing to run in opposition to Scott Walker.
Please, please, please, let Kathleen Falk's dream of running against Walker come true.
I ♥ Willard said...
I object to Willard being categorized as moderate.
One of Willard's great strengths is that he cannot be pigeonholed. He isn't strictly conservative, moderate or liberal; Willard is in fact all of the above.
Policy issues are very complex and require complex solutions. Willard understands this because he's an outstanding, experienced problem solver and manager. That's why, for example, he can be pro-life and pro-choice at the same time.
Willard has very strong convictions. One of his most firmly held convictions is that his convictions are flexible and should change as necessary to fit the circumstances. That's why in reality Willard is both the most conservative and the most moderate GOP presidential candidate.
Of course, there's no math involved in collecting these statistics. What should probably be known, though, is that it is "weighted" towards democraps.
And, still Walker leads.
"Please, please, please, let Kathleen Falk's dream of running against Walker come true."
At the moment, she's got my vote in the primary.
Recall petitions on the internet
http://gab.wi.gov/
Perhaps Wisconsites (Wisconsonians?) prefer conservative state government and liberal federal government. If I had to choose, I'd take conservative federal government and liberal state government.
When Gov. Gray Davis was recalled in 2003, it was because the state's finances were a wreck.
Thank goodness California elected Governor Arnold! The voters obviously knew what they were doing because Governor Arnold left California on a sound financial footing.
Wince said...
Notably, Question 30 left out the option of more services for the same or lower taxes.
Isn't that the essence of Walker's success?
"shiloh, if there is already a comfortable lead for Walker at this point"
Yes, as mentioned, he's the incumbent and will have a $$$ advantage and how often has a U.S. governor been recalled out of office?
IIRC, as I don't pay much attention to WI, didn't Walker give more tax breaks to large corporations at the expense of union/state workers. Soooo, if WI unemployment continues to tank ~ stay tuned!
I think those behind this whole recall stunt know the hard fact that they probably have 800,000 real votes out of all the signatures collected. I think it will be difficult to grow appreciably that number. Walker simply needs to get those to the polls who voted for him in 2010.
He will have a fight, but I think Walker wants this fight because the payoff will be huge.
Thank goodness California elected Governor Arnold!
Irrelevant to my point but thanks for playing.
"Perhaps Wisconsites (Wisconsonians?)"
Cheese Heads.
"He will have a fight, but I think Walker wants this fight because the payoff will be huge."
I don't know. The economy may tank when the 800,000 commit suicide.
Or, maybe not.
I'm just glad we have John Stodder, on loan to us from Southern California, to explain this all to us. Our "go to guy" in all things Wisconsin.
Christopher in MA said...
Women, minorities and Garage Mahal hardest hit.
Joe Schmoe said...
John Stodder, I Heart Willard is just trying his or her hand at satire/parody writing, and failing badly.
Doesn't matter where I am Garage. The point is, you don't have the conditions in place for a successful recall. I've been through one, you haven't. Gray Davis was despised on a bipartisan basis. Walker apparently still has the Reeps, and a good share of the independents, and probably will end up getting lots of Dem votes, though those voters won't tell you that.
In fact, all he had was your base -- the state employees. And even some of them were mad at him because he "broke a promise" to bribe them shamelessly because the state ran out of money.
That "right track" poll result referenced above is another deadly stat for your side.
What lovers of government don't understand, well one thing they don't, is that most people hate politics. The last thing they want is an unscheduled election, a refight of a battle that was settled. They don't want to see a bunch of political ads depicting Walker as a shitbag. They want to be left alone. You are disturbing their peace because you don't like it that you lost, and can't wait four years for your next shot. I'm sorry, I'd like to make kissy-face with you, I have no desire to disagree with you, but my analysis is going to be your post-mortem.
Nice delfection.
After the recall fails, maybe American commandos will race into Wisconsin and rescue all the government workers.
I'm sorry, I'd like to make kissy-face with you, I have no desire to disagree with you, but my analysis is going to be your post-mortem.
Please. You don't know jack shit about Wisconsin politics, just as I don't know anything about SoCal politics. You're a Pat Caddell/Doug Schoen type fake Democrat, always wanting to pass on bad conventional wisdom advice to them. Whatever happens in the recalls won't have anything to do with your trolling/mobying.
Hmmm give tax breaks to people who employee people or to people who live off other people's taxes?
Brilliant analysis Shiloh. Simply brilliant.
Where is the third option? The one that asks I rather pay taxes for services that directly benefit me the taxpayer and not pay taxes to subsidize those living off government?
The Limbaugh Doctrine at work: A strong conservative message by a good candidate that is not a "Crazy Meanie"" on social issues beats a moderate compromiser who has no reason to live except to promote himself.
Registered voters skew Democrat, not the same as likely voters.
This sample prefers Obama by an outsized percentage, also indicating that the sample skews Democrat.
Maybe it is time to head over to intrade. Walker will win, uless R's don't work, because the D's will voting the cemetaries, nursing homes, homeless alcoholics and having the college kids vote twice and more, the way they did when they stole Wisconsin from Bush in 2000.
But still, the R's should prevail.
IIRC, as I don't pay much attention to WI, didn't Walker give more tax breaks to large corporations at the expense of union/state workers. Soooo, if WI unemployment continues to tank ~ stay tuned
Um, no. But it is rather entertaining that you think the only unemployment figures that matter are those regarding state workers.
Cubanbob,
You didn't see the true option either. I would rather other people pay high taxes, and I pay none, and have all the services I could imagine.
You don't know jack shit about Wisconsin politics,
You tell 'em garagie!
Ask him to see his W-2 you politics knower you!!
Stodder speaks the truth, garage. Now answer your email.
What email?
Bender said...
If it is a choice between a lib-Dem and a mod/lib-Republican, voters will go for the full deal each time.
Given a choice between Obama and Obama-lite Romney, they will choose the complete version.
Wow, Garage -- all tantrum and name-calling. No substance. The news is bugging the shit out of you, isn't it?
I'm too old to be accused of "mobying" or "trolling." Besides, how could I possibly be accused of trolling on a site where I agree with the blogger most of the time?
"Given a choice between Obama and Obama-lite Romney, they will choose the complete version."
Not you of course, but other 'stupid' people, I am assuming.
I would vote for anybody but Hugo Chavez rather than Obama.
Boy, talk about groupthink. Romney is "Obama-lite?" Romney is a strong conservative. He might not be Tea Party-esque in style, but he is completely in tune with conservatives on all the issues.
I'm wondering if the Tea Party is starting to evolve into the kind of noxious purists that wrecked the Democratic Party in the 70s. As I watch the regrettable rise of Newt Gingrich, I fear that these purists are going to give us what the left purists gave us in 1972 - four more years of a corrupt regime.
"Brilliant analysis Shiloh. Simply brilliant."
Thanx, many try, few succeed! :D
But very relevant to my point.
Nobody in the state knows how it will end up. I talk to people in the state a lot, and I have no real feel for how it will end up. Anyone that does claim to know is yanking someone's chain. You, in this case.
Well I agree Arnold was a terrible governor. But the focus is on how to recall a governor. Conditions were riper to recall Gray Davis -- including the presence of Arnold on the ballot, at the time seen as having more capacity to lead than he in the end demonstrated.
If the Dems can't offer a similarly appealing candidate as an alternative to Walker, that's another hurdle for them in what looks like an impossible task, on top of the perceived nuisance and unfairness of recalling a governor after just a year, the lack of a compelling issue that affects the broad interests of all voters, and the perception that it's all a special-interest turf war. Those special interests are about to waste a ton of money.
Wow. Garage is sandbagging already. That's telling.
Nobody in the state knows how it will end up. I talk to people in the state a lot, and I have no real feel for how it will end up.
But, but, but, what about the one million signatures!!
One.Million.Signatures!!!!
Romney ... is completely in tune with conservatives on all the issues.
I agree. RomneyCare is just one example of how in tune Willard is with conservatives. Willard is definitely singing their tune!
I think your analysis is correct.
Meade said...
"As I watch the regrettable rise of Newt Gingrich, I fear that these purists are going to give us what the left purists gave us in 1972 - four more years of a corrupt regime."
By "corrupt regime" you meant the 92nd, 93rd, 94th, and 95th Congress, right?
The TEA Party is going to give you a Gingrich Presidency with a TEA Party Congress to keep Newt on time and on target. On the hand with a TEA Party congress Mitt won't go wobbly either. Either way its a win-win over the current congress and president.
Nobody in the state knows how it will end up. I talk to people in the state a lot, and I have no real feel for how it will end up
Even tho the "professionals" didn't think it would be possible to launch the re-call drive during the winter months, I always felt confident that there would be enough signatures.
However, it is pretty obvious that this is gonna be a tough hard race...those who wish to see him out of office are motivated and dedicated, but Walker has already raised an unprecedented amount of money and he starting airing reelection commercials right after one of his supporters launched the recall-drive early. That doesn't sound like someone who is confident of victory, does it?
Rational people, on all sides of this issue, know that the race will be too close to call...anyone who says otherwise is either very naive or simply a partisan hack.
That said, no matter what way the election unfolds, I'm afraid that the violence will still continue (latest update: Police reports state that a Recall HQ in Columbus has been repeatedly vandalized) This whole We refuse to negotiate or even listen to you, so you WILL do what you're told! attitude that the WI-GOP has brought forth in the last year has deeply poisoned our state, and it will take a long time to recover...
Bushman of the Kohlrabi said...
So, after all the tantrums, the organizing, the chanting, the vuvuzella blowing and the favorable media coverage, Walker maintains about the same lead over Barrett that he had in the general election.
And to think, this circus will only cost us about another $20 million before it's over.
On the bright side, winning the recall will make Walker virtually unbeatable should he decide to run for reelection.
I'm afraid that the violence will still continue (latest update: Police reports state that a Recall HQ in Columbus has been repeatedly vandalized) This whole We refuse to negotiate or even listen to you, so you WILL do what you're told! attitude that the WI-GOP has
So let me get this straight.
The "WI-GOP" is responsible for a recall HQ being vandalized?
When are you going to make a post about the death threats against Republicans in WI?
A lot of concern out there on Planet Recall.
On the hand with a TEA Party congress Mitt won't go wobbly either
A nominee Romney will tell the Tea Party to shut up and fall in line. A President Romney will tell the Tea Party to shut up and fall in line, just as Romney-esque Boehner has told them to do.
@garage: Check your DM's then. Don't make me call you!
I am trying to guess what Romney did to Bender cause Bender sure hates Romney. :)
His opponents haven't had their negatives put into the limelight. ALL of Walker's negatives are there --- and he is still winning.
Again, lots of luck.
If he wins this election, he should do EVERYTHING specifically at the expense of union/state workers.
That you --- a true believer --- doesn't know how it will end is not positive.
Well, not for you, anyway.
So, running away to IL because you didn't win the argument didn't poison the state?
The death threats against Republicans?
The recalls out of spite?
Althouse initially was totally skeptical, in her pandering sarcastic manner to her conservative flock, that there would ever be a recall.
'nuf said!
The TEA Party will push enough votes for Congress that and that Congress will make Mitt do their bidding. Also Romney isn't stupid. He knows without a fired up base he will have gained nothing other than being another McCain.
Walker is not so unpopular as his enemies wish.
And separately...
Romney is an ass-clown, whereas Obama is the incumbent. It's Obama's job to lose, and he's done a damn good job trying. But to beat the incumbent, a challenger at least has to seem like he'd be an improvement.
See John Kerry.
All head to heads were within the margin of error of the poll +/- 7%, except for Cullen. The poll oversampled Milwaukee suburbs (30%) landlines (71%) and 60% of the poll sampled were over the age of 45.
>>IIRC, as I don't pay much attention to WI, didn't Walker give more tax breaks to large corporations at the expense of union/state workers. Soooo, if WI unemployment continues to tank ~ stay tuned!
Just a minute...you aren't a Wisconsin resident? Let's see if Garage Mahal calls you out.
James, as an Ohioan, I thoroughly enjoyed Kasich's union busting Issue 2 going down in total flames! :)
So WI conservatives, especially your fearless leader Althouse, don't count your chickens before they hatch.
Again, stay tuned ...
>>...because the D's will voting the cemetaries, nursing homes, homeless alcoholics and having the college kids vote twice and more, the way they did when they stole Wisconsin from Bush in 2000.<<
Not likely; Voter ID is the law now.
Side note: I always find it amusing what Althouse doesn't blog about. Like this for instance.
The corruption investigation into Gov. Scott Walker's time as Milwaukee County executive is focusing on the bid competition to house the county's Department on Aging in private office space, the Journal Sentinel has learned.
As shiloh would say, stay tuned!
"James, as an Ohioan, I thoroughly enjoyed Kasich's union busting Issue 2 going down in total flames! :)"
Of course there are significant differences between the Ohio and Wisconsin issues.
1) WI reforms have been implemented and lived under for a year, whereas Ohio they were unknown.
2) Ohio included emergency services and WI did not -- no scaring people into thinking their house will burn down.
3) It's an election with a person vs. a person, not an up or down on a particular law.
4) Walker will have money to defend himself, Kasich didn't have money or an effectively campaign vehicle to defend the idea.
With regard to the Milwaukee Journal-Sentinel article ..... three people in SE WI have read it since everyone else used their 15 free articles (now a paid content site) to read about the Packers.
The referenced poll says that 74% favor "Requiring public employees to contribute to their own pensions and pay more for health insurance" but only 48% favor "Limiting public employees' ability to collectively bargain over benefits and non-wage issues."
From which one must conclude that a significant percentage of the electorate believes that it would have been possible to get the first without the second??
The poll oversampled Milwaukee suburbs (30%) landlines (71%) and 60% of the poll sampled were over the age of 45.
Which, I take to mean, you think older, conservative voters were over sampled? Like will happen at the recall election polling places this summer when all the snow birds are back in state and the college kids are off?
TosaGuy's rationalizations are duly noted, my not sayin' both elections were/are the same in any way notwithstanding.
ie Ohio was an issue and WI may bounce a governor which doesn't happen to often, so Walker must be soooo proud for the opportunity lol.
coolkevs said...
"Soooo, if WI unemployment continues to tank ~ stay tuned!"
Wisconsin is 20th lowest or 30th highest in unemployment. I don't know where you're getting the tanking opinion from, but it doesn't jibe with the facts, no matter how the media spins it. We are right in the middle. And as goes the rest of the US unemployment, Wisconsin will go right along with it. At least we're not #8 highest Illinois...
Interesting Tommy Thompson is hedging on that question:
"I was not there when he was making his decision based on the facts and evidence that he had. I'm not going to come now and Monday (morning) quarterback and say I would have done it different," Thompson said, according to the Journal Sentinel. "Probably would have, but I don't know."
Thompson also said he does not support right-to-work legislation, another proposal popular with fiscal conservatives. Link
Nearly all elections are decided by single digit leads...why a politician would have to run against Cardboard Man Romney to win by double digits.
Maybe when Mitch Daniels replaces Romney, we can see a close vote again.
Tyrone Slothrop said...
Arnold was on track to reverse decades of mindless Democrat spending with a series of ballot initiatives. A story about him feeling up some babe on a movie set went around, making him personally unpopular, and the initiatives failed. After that, Arnold essentially became a Democrat, and that accounts for the horrible state of the California economy. I sorely regret voting for him, but how was I to know he would go liberal on me?
"Shut up and do as I say" sounds a lot more like Gingrich than Romney.
Anyway, outside of a war situation (a real war that threatens us, not the current war) neither Congress nor the American people have tolerance for the "shut up and fall in line" schtick. He's President, not King. Also... "fall in line" with WHAT? What does Romney believe in strongly enough to pick a fight with his own party?
As Newt's career illustrates, the elements of Romneycare were only ruled out of bounds for conservatives recently.
It was a state plan. Most authentic conservatives have no problem with states trying out experiments like Romneycare.
The bottom line is Romney has said he will repeal Obamacare, defund it, and destroy it through executive orders. What more do you need?
I defend Romney because he clearly is the only existant GOP candidate that can win. He's plenty conservative, but he's also a successful person who can govern. Gingrich is a buffoon who happens to say interesting things from time to time, then self-destructs. If he gets the nomination, you won't live long enough to stop regretting it.
"It was a state plan. Most authentic conservatives have no problem with states trying out experiments like Romneycare."
I'm really tired of Romney using this argument. It's a straw man, and he knows it. "No one" disputes MA's right to implement this plan, and "everybody" agrees that state experimenes are helpful, but the fact remains IT'S AN AWFUL PLAN, for the exact same reasons that ObamaCare is awful. I may well support Romney if the Wisconsin primary still matters by the time they get here, but Romney needs to say "I fucked up". He also needs to fire the advisers who cooked up this "states rights" dodge.
Of course there is because up until now the Walker haters have mainly been talking to each other. "You hate Walker?" "Yeah, I hate Walker". "Hate, hate, hate Walker". "Anyone here not hate Walker?" "No we ALL hate Walker!!" "Hate!! Hate!! Hate"
But the Walker haters are simply not a big enough group to defeat Walker. So the Dems are going to have to convince people who DON'T hate Walker that things are SO BAD that he has to get kicked out of office after 1 year.
And quite frankly, they don't have a good argument for that. And as the election date gets closer and that armageddon that the Dems were predicting was going to visit our state never materializes, Walker's position will only get stronger.
Romney has no authority to repeal ObamaCare by an executive order.
But says he will. On DAY ONE!
"Romney has no authority to ..."
Hasn't seemed to slow down President Recess.
My take....there are a lot of people in Wisconsin who only vote Democrat. They'll vote for Obama in 2012, and they will vote for the Democrat Governor candidate in 2014.
But they don't want a do over election. They don't want their spring and summer ruined by non-stop angry political ads on TV and radio.
So they will vote no on recalling the governor even if they don't really care for him.
Also, people don't like bullies.
"Of course there is because up until now the Walker haters have mainly been talking to each other."
That is what happened in 2004. How the heck did Bush win when everyone hated him?
-Anti-Bush movies
-Anti Bush books
-Anti Bush concert tours
-Anti Bush web sites (big ones)
-Anti Bush rallies
-Anti Bush radio
Turns out, it was all the same people attending/reading/using these things. So it wasn't 50.1% of the population.
@Original Mike,
It's not like Romney implemented Romneycare in Texas.
He did it in Massachussetts.
He was representing his constituents.
If you think a majority of constituents would be better served by repealing Obamacare, and a Tea Party/Conservative/GOP controlled Congress does so, do you think Romney would veto it just because he felt obliged to come up with the best possible universal health care system* in the bluest of blue states for blue voters?!??
*Please note: Romney also helped prove that "best possible universal health care system" is clearly worse than "no universal health care system"
Obama believes the admin DOES have the power to issue waivers. Romney will just issue waivers indefinitely. He could also refuse to appoint anybody to oversee the bureaucracy.
"If you think a majority of constituents would be better served by repealing Obamacare, and a Tea Party/Conservative/GOP controlled Congress does so, do you think Romney would veto it..."
No, I don't. I take him at his word. But the fact remains it is a plan that can do nothing but fail because the incentives are counterproductive. He could say that (in fact he is better positioned to do this than anybody else, having been it's architect). But he won't. I'm worried he doesn't understand what's wrong with it. And that troubles me mightly.
"garage mahal said...
As shiloh would say, stay tuned!"
Having had the "John Doe" investigation blow up in his face...after months of OT comments bringing it up, garage mahal finds a new straw to grasp.
Lawsuit on the Walker bill: Fail
Supreme Court race: Fail
Recount of same: Fail
Fall Recall attempt to take over Senate: Fail
John Doe: Fail
And the above too will fail.
Any poll that shows Walker with only a %7 lead over Kathy Falk is skewed (Falk like Gingrich will never get to represent the ticket) and suggests this race is wide open. I would like to see Tom Barrett re-enter the race now that the actual studies on the mess Walker left Milwaukee in can be discussed. Add the high job loss numbers to the investigation into high level Walker aids, and things get interesting.
That said, no matter what way the election unfolds, I'm afraid that the violence will still continue (latest update: Police reports state that a Recall HQ in Columbus has been repeatedly vandalized) This whole We refuse to negotiate or even listen to you, so you WILL do what you're told! attitude that the WI-GOP has brought forth in the last year has deeply poisoned our state, and it will take a long time to recover..."
Hey penguin, why weren't you here wetting your pants last week when recallers were arrested assaulting a cop?
You are the fucking poster child of liberal hypocrisy. From lunch breaks being "life and death" to this shit. Pathetic.
Garage - you have been predicting Walker's arrest for a while now. Here is what you said on 9/15/11 for God's sake:
"Wonder when were going to see the "Scott Walker is in trouble" tag. Soon I bet! He is lawyered up, as they say. Absolute worse timing for him it would seem."
Will you ever admit you were wrong about him?
I would like to see Tom Barrett re-enter the race now that the actual studies on the mess Walker left Milwaukee in can be discussed.
LOL. Like how Barrett used Walker's tools to balance the city of Milwaukee budget?
Walker has spent over 100k on lawyers relating to the John Doe. Why, do you suppose? His own spokesman was granted immunity from prosecution for gods sake. How many governors can say that?
Why Curious George sticks up for child molesters and people who raid Veterans Charities is anyone's guess though.
Whoa! This is a change.
What's the matter? They start finding all those phony signatures already?
Yeah, and nobody ever forged an ID card. Ever.
"Why Curious George sticks up for child molesters and people who raid Veterans Charities is anyone's guess though."
What a fuckstick.
Interesting Tommy Thompson is hedging on that question:"
Only if "interesting" means "predictable."
Sorry you missed me, but if you had bothered to check on my website you'd have seen I was on vacation last week.
(And tell me again how you don't obsess over me...'cause getting uptight about someone not being around a week ago sure seems like an obsession.)
Are you really disputing that fatigue is an issue for some trades/professions? Or have you convinced yourself that I really said "Lunch breaks are life and death!" without any other context?
So far it appears that you're trolling for the sake of trolling.
'cause your actions...ranging from childish name-calling to gleefully posting videos showing workers dying on the job to the way you attack me for stances that are the complete opposite of what I just stated they were...strongly indicate that you aren't interested in having a good-faith discussion about any of the issues.
My gut tells me Gov Walker is not going to make it.
Careful, Lem, garage is attempting to censor the comments of non-Wisconsinites.
I took issue with someone claiming to know how and why Wisconsinites were going to vote.
Romney has no authority to repeal ObamaCare by an executive order
How would you know?
Hysterical.
And the number of posts you made chastising the recallers for assaulting the police remains at zero.
bad day for garage. But then again, 100% of his life is predicated on politics.
@garage,
If you don't approve of what Ms. Althouse chooses to blog and not blog, there's this nifty little social tool, you may have heard of it: it's called a "blog".
You start it, you choose the topics. If people think they are worthwhile, they come read.
Of course, you have to put up with idiots who try to hijack the threads with their own topics that are so pathetic and ridiculous they don't get coverage anywhere but FireDogLake and Daily Kos, but if you have good commenters, like Ms. Althouse does, the trolls get humiliated over and over and over.
Of course, the thread swerve liberal trolls seem to think "winning" like Charlie Sheen represents some actual victory, but that just adds to the entertainment.
So go ahead: spend your time on blogging instead of writing the nonsense you usually do here.
Thanks, but I'll pass. I like it here.
See if he can answer how much Walker's policies saved Milwaukee and where they'd be if not for those policies.
Here is what you said on 9/15/11 for God's sake:
And this idiot is whining that people don't know "Jack Shit about Wisconsin politics"
Of course he's projecting.
Just in case the link Jay provided doesn't work above here it is again:
Walker's Reforms saving Wisconsin Millions
How STUPID are these Wisconsin Recallers? Seriously?
THIS stupid:
1) They are not just shooting themselves in the foot, they are effectively lining up their children and grandchildren and shooting them in the ass! How selfish!
I read a pro-recaller say that "they (government workers) are not responsible for the bad economy, they deserve their "fair share". She didn't give a damn about the additional monies reform has brought to Wisconsin schools or the budget savings to Wisconsin or the less debt and better services for her children's future. Typical self-interest.
2) They want to live in the 1950's and 60's again and dream of luscious never-ending government care and union coddling. Holding on the past that's gone forever.
The world has changed. That economy is gone forever. Like Steve Jobs telling Obama to basically get over Obama's outdated economic notions - "those jobs are not coming back".
Wake up Wisconsin Recallers - the damage you do will screw your children and on and they will curse your self serving shirt-sightedness.
Walker is lawyered up, moron. He's paid 100k. Any ideas why, Jaytard?
Because anyone accused of something - whether rightly or wrongly - needs a lawyer in this over-litigious and over-regulated day and age?
Did I win?
Carnifex said...
I've got to admit. I sit here in Kentucky AWED by the energy you people put into hating each other(Wisconsinites). I got a congressman I detest, but I am not going to go wherever, and stand around chanting, or blowing vulvas (or whatever they're called), or signing a recall petition. I just wait , and use my vote, and try to convince other people not to vote for him.
Maybe it's the piss poor weather you all have, locked up all winter long gots to make anyone crazy.
Arnold was on track to reverse decades of mindless Democrat spending with a series of ballot initiatives. A story about him feeling up some babe on a movie set went around, making him personally unpopular, and the initiatives failed. After that, Arnold essentially became a Democrat, and that accounts for the horrible state of the California economy.
I agree. Governor Arnold failed because he was a secret Democrat. Very good analysis!
Carnifex said
"...but I am not going to go wherever, and stand around chanting, or blowing vulvas (or whatever they're called),..."
Thanks, I just spatter painted my monitor with veggie chili...LOL!!!
'DELORES' ('Mulva')
That would be an interesting study ie per capita % of bloggers in each state and breakdown of that % re: anger/passive aggressive behavior.
Many Althouse conservatives would qualify in the anger/passive aggressive column.
As mentioned previously, chill as this is one of many inconsequential political blogs.
The bottom line is Romney has said he will repeal Obamacare, defund it, and destroy it through executive orders.
Don't get me wrong... I'm happy that Willard plans to destroy ObamaCare.
My point is that unlike politicians like John Kerry, Willard doesn't fall back on silly excuses like "I was for it before I was against it" to explain apparently contradictory positions. In this case, Willard was ALWAYS against RomneyCare; he only supported RomneyCare as an experiment to show Americans why ObamaCare would be bad. And that's why he's always been right.
Willard will make a great President for the very reason you identify: he can beat Obama.
I ♥ Willard
Are you familiar w/Poe's Law? Rhetorical. :D
Because of course he's guilty!!!!!
Innocent people never need lawyers.
Ever!
Seriously, if I were this dumb, I would stop commenting.
You'll continue.
We'll know soon Jaytard, from what it sounds like. But you seem to be an expert in the John Doe - why don't you give us your thoughts as to what is going on. Feel free to use the linked article I provided.
In my days at corp accounting for a fortune 100 firm, I saw how much they spent on lawyers to defend the company in lawsuits. Why? Because the company was guilty? No. Well, not most of the time. It was due to slick lawyers and unethical people seeing a deep pockets entity as a cash machine. You should see the employment discrimination claims.
The unionists/Democrats are throwing everything they can at Governor Walker, hoping something will stick. That is why the governor needs a good legal team.
blowing vulvas (or whatever they're called),..."
There is probably a joke there about liberals driving Volvos.
Listening to Walker's State of the State address. Sounds like garage's friends are in the gallery. What a bunch of jerks.
You have a stronger stomach than I do, Original. What's he lying about right now?
He's listing the one-time gimmicks Doyle used to fill the budget gap.
It's a big night on PBS tonight, garage. At 9:00, it's the David Kock hour (a.k.a. Nova).
Walker is a one time, one year gimmick.
If Walker isn't guilty of anything, he has no reason to worry.
There's a basic principle involved here that some conservatives seem to have forgotten: if you're innocent, you have nothing to fear.
Liberals don't get this. That's why they oppose sensible laws like Arizona's SB 1070. And that's why most lawyers are Democrats. Thank goodness the professor isn't one of them.
It's interesting watching the Dems not clap for holding down property taxes.
I think even the Dems were embarrassed at the woman who was just dragged out screaming.
School districts saving money by competitive bidding for health insurance.
Another gallery jerk.
More jerks. What do these people think they are achieving?
OK. Dinner, and then the David Kock hour. I love Wednesdays.
Just remember, anytime any elected Democrat retains a lawyer, they are guilty.
But you seem to be an expert in the John Doe - why don't you give us your thoughts
It has little to do with Walker other than his former Chief of Staff asked the Milwaukee County District Attorney to investigate.
It is beyond parody you think this is some "scandal" implicating the Governor.
You do realize he's been in office more than a year, right?
You are a one note goof ball.
I love Willard: "If Walker isn't guilty of anything, he has no reason to worry.
There's a basic principle involved here that some conservatives seem to have forgotten: if you're innocent, you have nothing to fear. "
I used to believe this too but it seems that too often that is no longer the case. I recall the two year jail sentence for poor paperwork on imported orchids. http://boingboing.net/2009/10/05/swat-team-raids-orch.html
Walker may have bought a coffee from campaign cash but drank it in the governors office and been in violation of so campaign finance law. If I were the gov I'd be sure we had plenty of lawyers to prevent that sort of b.s.
May in Wiscosin:
Look the ice has melted finally - let's got outside for the next three months.
Wonder how the Brewers are doing?
An election? What? Isn't that supposed to be in November? What a waste - what a bunch of sore losers.
I gonna get a beer and setup the fire pit.
These numbers, just after submitting "1 million" signatures has to be hard to swallow for Walkers enemies. Still an uphill climb, but it will get closer.
Why Curious George sticks up for child molesters and people who raid Veterans Charities is anyone's guess though."
Really dude we've been down this path before.
First, I have never "stuck up" for those involved in the crime, but if you can show otherwise, please do.
Second, Walker's administration doesn't "stick up" for these people either, as it turns out they were the ones that initiated the John Doe investigation. Too bad, so sad.
Finally there were no charges of child molestation. It was child enticement, and those were not against anyone that has ever worked for Walker, or was ever hired by Walker. As it was pointed out, that person actually was hired by a Democrat.
Why are we always left wondering if you are a liar, or an idiot, or both?
So the Wisconsin election commission, or whatever system ya'll got in place to monitor voter fraud, have granted the republicans 61 day to challenge signatures instead of the usual 31.
Question; At what percentage point are all of the petitions thrown out?
I only ask because it has been my experience that democrats are zealots at cooking the books.
Mike (MJB Wolf) said...
What the hell is the point of ANY Garage post here? Really. One day he's making wild projections about the Senate recall the next month he says no one knows. But the tide of history keeps flowing away from Mahal's glorious liberal oasis in the Land of Cheese & Harleys. I spend A LOT of time in WI (and live in CA) but it doesn't take long to see, like most people, Badger Folk just aren't that interested in politics.
Ann called it correctly long ago: "normal" people don't appreciate a stupid needless election forced upon them, a 2-wave season of attack ads and sophistry. These annoyed folk DON'T blame Walker for this fiasco. They blame people who populate Dane County! | cc/2020-05/en_middle_0128.json.gz/line924 |
__label__cc | 0.666165 | 0.333835 | "My gut tells me much of the contempt for Trump reflects contempt for his working-class white support."
"It is one prejudice gentry liberals and gentry conservatives share. It is perhaps the last acceptable bigotry, and you can see it expressed on any primetime TV program. The insults don’t all seem good-natured to me. I grew up in central Pennsylvania, surrounded by the kind of people supporting Trump, and I sympathize with their worsening plight. For generations, they went all in for the American dream. Their families fought the wars, worked in the factories, taught school, coached Little League and built a middle-class culture. Now they are abandoned and know it. Nobody speaks for them. The left speaks for the unions, the poor and the nonwhite, even shedding tears for illegal immigrants and rioters and looters. The GOP speaks for the Chamber of Commerce, big business and Wall Street. Trump alone is bringing many of these forgotten Americans into the political system.... I would be delighted to support a more conventional candidate who has Trump’s courage and appeal, but we don’t always get to pick our revolutionaries. And make no mistake, Donald Trump is leading a political revolution that is long overdue."
Writes Michael Goodwin in The New York Post.
Posted by Ann Althouse at 12:14 PM
Tags: class politics, Donald Trump, GOP 2016, Michael Goodwin
mikee said...
No, the contempt for Trump is contempt for the man himself, not primarily or just his supporters.
Sometimes hatred is simply hatred. It need not have a reason to exist, it just is.
Hatred is what progressives do; anger is their modus operandi for daily life.
It isn't just white. A lot of working class Hispanics are on board too. All of the people we used to employ on our family orchard and extended families who have been here working for 2 generations. Some have businesses now. They are the ones who suffer the most from the illegal immigration crime wave. There are stories in the local paper every day about it and the perps and the victims overwhelmingly share ethnicity.
The legal ones like the ones I described have more in common with white working class than they do with the la raza crowd the media props up.
"we don’t always get to pick our revolutionaries. And make no mistake, Donald Trump is leading a political revolution that is long overdue."
I've been saying this for a while.
I also think he might get significant black and Latino support.
This is the truth. Bigotry has consequences. Suffer the consequences ye bigots.
"I've been saying this for a while.
I also think he might get significant black and Latino support."
It is not a might. He is the first Republican ever who is pointing out Black people got screwed by Obama.
I know many in the Hispanic working class. He is going to bring them in in large numbers because he is listening to them and not projecting the CoC amnesty wishes on a community that is being torn apart by the illegal crime wave.
The left speaks for the unions, the poor and the nonwhite, even shedding tears for illegal immigrants and rioters and looters. The GOP speaks for the Chamber of Commerce, big business and Wall Street.
Well, sort of. Go down to Appalachia and ask a UMW member what he thinks of the left's support for unions. Or go to a city where the Democrat leadership has done the kowtow to BLM and ask a member of the FOP. Also a lot of the big businesses -- especially in Silicon Valley and on Wall Street -- support Democrats, something that the RNC still doesn't quite seem ready to accept.
No one speaks for the small businesses. They gravitate without enthusiasm to the Republicans because the GOP treats them with indifference and the Democrats actively hate them.
But on the whole Goodwin is more right than wrong. Trump's a jackass and lacks many of the qualities I'd like to see in president, but he's speaking for these people and as far as Paul Ryan, Mitch McConnell, and Reince Priebus are concerned, they don't exist.
If there was one thing Karl Marx was right about, it was that a bottom-up revolution of the proletariat wasn't going to be a pretty thing.
The Dems don't have the union members. They have the union leaders. Trump has the union members. There used to be a lot more of them before jobs got shipped to other countries. Union leaders couldn't stop this so they were pretty useless. The union leaders were no match for bipartisan trade policy.
Trump's a jackass and lacks many of the qualities I'd like to see in president, but he's speaking for these people and as far as Paul Ryan, Mitch McConnell, and Reince Priebus are concerned, they don't exist.
Yes and they are not telling pollsters, who are mostly minimum wage college kids, what they think.
Individual dignity. Intrinsic value. Natural imperatives. Go forth and reconcile.
Class diversity schemes are immoral and repulsive.
Elites are perfectly comfortable with discriminating against Asian Americans in higher education, in ignoring the blue collar when they aren't mocking them, and in maintaining a majority of blacks in the permanent underclass. The elites love Latinos because they work hard for low wages and keep their mouths shut while they service the elites by serving their food in fine restaurants, raising their children, and cutting their lawns. Plus, although Latinos are poor and undereducated like blacks, they arent anyhere near as violent. So they are perfect for the elites. Given them a higher minimum wage and substandard schools and healthcare that are much better than Mexico and they are happy.
It sounds like the people impacted by class diversity schemes should file a class action lawsuit against the federal government and the civil rights crony industry.
As well the universities and colleges that have materially misrepresented the universal value of higher education and the progressive burden of unresolved fiscal deficits.
I am white but I am certainly not poor, have been a huge beneficiary of the last "recovery", do not live in the sticks, lean liberal on social issues, labored years in the civil rights movement and taught in an historically black college, own bespoke clothing, travel first class and have been all over the world. The anti-Trump crowd has convinced me that Trump is the way to go. When Cruz decided to side with the rioters in Chicago, the people proud of "shutting down" Trump, I wrote Cruz off. He is full of shit.
Every time I listen to or read one of these pundits going off on Trump and using words like fascist or Hitler or vulgar or crazy I am more in favor of him. They aren't talking about him, they are talking about the great unwashed in our country, the people who fix these assholes" cars and plumbing and build their pool houses and pave their streets and replace their roofs and mine the products that make their lives as fucking smooth as silk.
A lot of working class Hispanics are on board too.
It's his message on illegal immigration that resonates with those who toiled to get here through legal channels.
If the 'working class' believes their quality of life will improve through borders closed to immigration and trade then we're lucky that politicians sympathetic to their beliefs haven't been in power.
You go to war with the army you have, not the one you wish you had.
NorthOfTheOneOhOne said...
It isn't just white. A lot of working class Hispanics are on board too.
And middle class Whites, Hispanices, and Blacks as well. The Left (especially the political class)has forgotten that many of these groups are just a generation or two away from being working class. I suspect Trump has more support in these areas than anyone on the other side realizes.
Brando said...
Good thing he has his "gut" because he presents no evidence that anti-Trump sentiment is due to contempt for working class whites. He sounds a lot like leftists who just "knew" that all the anti-Obama vitriol was due to anti-black sentiment.
Just maybe some of us who despise Trump don't have anything against working class whites, and our feelings about this vain, ignorant, unstable blowhard have to do with what he says and does. Naaah....must be contempt for the working class! Much easier to just go with that.
Howard said...
Trump is no revolutionary, he is a pied piper who has mastered the blue collar siren song. He is leading the rethuglicans straight off a cliff and onto the rocks. It's no wonder the political genius William Jefferson Clinton encouraged his friend and foundation supporter to run for president.
robinintn said...
"Their families fought the wars, worked in the factories, taught school, coached Little League..." And there are more people like this, but living fairly prosperous lives for now. We too feel the contempt; we see where things are going; we fear for what our kids will face; we see it's being thrown away. It's not only the people suffering economically.
Theranter said...
They’ve had it with vanilla men who play nice and quietly lose elections. ...It is one prejudice gentry liberals and gentry conservatives share. ... It is perhaps the last acceptable bigotry, ...
Yes, it is. To which another blog's commenter said
"This past week has caused me to look hard in the mirror and wonder: are "our" elites just as outrageous as "their" elites?"
I asked myself the same question as I read the shocking and disappointing NRO article by authors (and signatories) I have (had?) great respect for, titled "An appeal to our fellow Catholics... and all men and women of goodwill" Excerpts:
Donald Trump is manifestly unfit to be president of the United States. ... There are indeed many reasons to be concerned about the future of our country, and to be angry at political leaders and other elites. We urge our fellow Catholics and all our fellow citizens to consider, however, that there are candidates... who do not exhibit his vulgarity, oafishness, shocking ignorance, and — we do not hesitate to use the word — demagoguery.
I dunno, maybe it's passive-aggressiveness (in addition to the giant "fuck you" to the establishment) on a mass scale that is part of Trump's rising. People are fed up with the elite chumps telling them what to do. Every anti-Trump antic--from the elite screeds to the undocumented paid protesters, seems to net him gains.
Brando: You still underestimate Trump like the checked-pants Rockefeller country club republicans who are losing control of their party. Trump is vain, but he is crazy like a fox, unstable like a wrecking-ball and is blowing the exact tune "folks" want to hear.
The GOP and the Dems positions don't offer anything for blue collar. The GOP appeals to what's left of the country club republicans, evangelicals, and the small government tea party types who love Social Security and Medicare and think small government is rolling the government back to the size it was in 2008.
Birkel said...
You believed the press reports about what Cruz said?
After all the press has lied about, somehow people believe the reports about Cruz are accurate? smh
I do not understand this tendency toward confirmation bias from people who otherwise know better.
dreams said...
Howard is confused about whose party the GOP is. The voters believe, correctly, that it is their party. Howard thinks the voters -- Rethuglicans, apparently -- have no say.
"Just maybe some of us who despise Trump don't have anything against working class whites, and our feelings about this vain, ignorant, unstable blowhard have to do with what he says and does."
And maybe you do. Why "despise?"
I assume you know him well as you seem to be an expert.
Gusty Winds said...
The chasm Trump has exposed between working class white voters and George Will/Bill Krystol elites is the same that exists between Campus elite socialist liberals and inner city African-Americans. One just revolted earlier than the other.
Lewis Wetzel said...
"If the 'working class' believes their quality of life will improve through borders closed to immigration and trade then we're lucky that politicians sympathetic to their beliefs haven't been in power."
1) The middle classes and working classes have seen their wages decline through the last few decades of open immigration and free trade.
2) The middle and working classes have seen family wealth (mostly wealth) destroyed by a banking system designed by the elites and managed by the elites.
3) In this time of open immigration, free trade, and financial folly, the elites have grown more wealthy, not less wealthy.
Michael K:
I believe a President Trump is unlikely to identify the Leviathan State as the enemy of freedoms and economic expansion. I think he believes he can negotiate with that croctopus (apologies to Churchill) to be eaten last.
It is about policies with me.
"Hatred is what progressives do; anger is their modus operandi for daily life"
This what I think Trump does so well: he destroys the stories liberals tell about themselves, to themselves. He breaks their narratives apart and shows everyone that there is no there, there. Just an empty shell with no substrate behind it. Hillary is the acme of this reality--the progressives in the party desperately need her to be something she is not because without her, without the possibility of her victory, they have next to nothing--just a grumpy 77 year old codger with no political future.
If Trump wins and actually does something for the poor the current Democratic coalition is dead. And given that the Republicans already control both Houses of Congress and most of the state Governorships the reality is that Trump is a much greater threat to the Democrats than he ever will be to the Republican establishment. Its not simply that they have no bench (except maybe Warren and Cumo), it's that they will have no base other than the social liberals and they can't win elections based upon pleas to sympathy alone.
The argument I hear from the free-marketeers is that we live in a global economy with increased competition, where education is much more important than it used to be. Americans will have to work harder and invest more to get the same return from their labor that they did before globalization.
This sounds to me a lot like the message Jimmy Carter was trying to sell the American voter back in the late 1970s. "The good times are over, pal, your best days are behind you."
Fabi said...
Michael@1:03 -- You've captured a lot ground in that comment. I've heard very similar assessments on the ground.
Trump has exposed one absolute truth: the so-called elite has tremendous disdain for the working class. Most Amerucans don't share that vulgar opinion -- thank goodness. Where I sit on the economic scale is unimportant, but I have friends and acquaintances on both extremes (day laborers to movers-and-shakers) who have great passion for Trump.
Birkel: You are naive to think the voters and not big money have ruled the GOP and the Democrat Party. Why do we always have an investment bankers, frequently from Goldman Sachs as treasury secretary no matter the "party" in power?
If the GOP does not broker away Trump, then you will be right. Either way, Hitlary wins.
Writ Small said...
I don't understand why the argument breaks down on either / or lines. Clearly Trump has low income white support and the de-manufacturing of the US economy has screwed them hard. But just as clearly, Trump has said a lot of things that are far beyond simply being "politically incorrect". He as spoken admiringly of Kim Jung Un for "wiping out" his political opponents, been untroubled by Putin's killing of opposition journalists, etc. He is a grand "wizard" of emotional manipulation according to his admirers. Being worried about what Trump could do to our democratic experiment is not the same as being bigoted against his supporters. That is really doing what the Left always does. You don't like such-and-such a position. It's because you don't like black people. Trump is a fraud, and I think people who are heedless to the threat he may represent are foolishly playing with fire. But here's the tricky part. I think Trump supporters are making a tragic mistake. Many Trump supporters are poor whites. That does not mean I hate poor whites. That a Democrat makes this kind of mistake, I get. That fellow Republicans are going to call racist on their opponents after being on the receiving end of it all these years based on what their "gut" tells them is beyond sad.
James Longfellow wrote . . .
He breaks their narratives apart and shows everyone that there is no there, there. Just an empty shell with no substrate behind it.
When Hillary or her supporters talk about her successes as secretary of state, they inevitably repeat women's rights boilerplate:
Globally, no candidate has done more for women’s rights than Secretary Clinton. In her time as Secretary of State, she appointed the first-ever Ambassador-at-Large for Global Women’s Issues at the State Department; oversaw the creation of the U.S. National Action Plan on Women, Peace, and Security; and introduced the Global Health Initiative (GHI), investing $63 billion to help partner countries provide robust maternal and infant health services. Secretary Clinton has worked tirelessly to elevate women’s rights as the key towards economic prosperity and global stability. Her public and private initiatives have appropriated millions of dollars towards providing secondary education to young girls around the world, and tackling the obstacles that face at-risk youths.
http://www.huffingtonpost.com/andrea-dew-steele/why-hillary-clinton-has-t_b_8073982.html
This stuff probably plays well with the Democrat activist base, but real Americans find it inane. It is as though she thought the state department was the kind of non-profit community organization that old, empty-nest women get involved in.
What did Obama say to them? They cling to their guns and religion. Well, Hillary had them in her pocket in 2008. They walked away from Obama and they are not coming back to Hillary because she has walked away from them in 2016. As simple as that. For these people Trump is not as Republican that they will hate him. All disenfranchised middle is coalescing around Trump.
How about the video from the Arizona rally of a black Trump supporter punching the shit out of the modern day, back pack wearing Abbie Hoffman wanna be. The protestor with the KKK hood on was coming up the stairs right behind.
I think those visuals work to Trumps advantage.
Michael K--I don't claim any special insight into the man but base my opinion on him on what I've observed. Much as some see in him the answer to out problems, I see him as making things worse. But this idea that people like me don't care about the working class is baseless. It reminds me of the "you don't care about black people!" stuff from the left.
Trump's advisor Stephen Miller, he is one of the new faces from the campaign and he is great. One of the points he made on Bartiromo's show this morning was that America cannot prosper as a service-based economy alone. I have not heard any other politico say that so far. And you want to know where I heard it first? Some 20+ years, when we were discussing 'America and its future' with one of our brilliant Indian friends.
And who does not benefit from a service-based economy? It is the working class people who perhaps had vocational skills that saw them through their mining or manufacturing jobs.
I just got called naive! This is a welcome day!
I am terribly cynical most days so this comes as a surprise.
How can we get rid of George Will from our TVs?
"Just maybe some of us who despise Trump don't have anything against working class whites, and our feelings about this vain, ignorant, unstable blowhard have to do with what he says and does. Naaah....must be contempt for the working class! Much easier to just go with that."
It's class snobbery through and through. For months I've been saying the Trump haters despise him because HE is blue collar, culturally, if not financially. He would fit right in shooting the shit with the regular guys in a working class bar in Brooklyn or Queens. The elites, intellectuals, academics, policy wonks, and eggheads in general despise such people. Like someone up thread said, it's the last acceptable bigotry.
Trump actually plans to make America great again by bringing back the industrial plants shipped to China. He is bringing them back to a Cheap Energy source that is presently replacing Saudi Arabia and their British allies so fast that the Saudis have launched the world's biggest Predatory Price cutting ever seen to kill it before it's too late
That's all folks.
Too bad, so sad if international trade has to restructure itself.
Manufacturing will not return to America without significant regulatory rollback. If Trump is serious about bringing manufacturing back to America he will be forced to address this issue.
Perhaps I could be convinced about Trump...
Beaumont said...
I'm not convinced that Trump is without contempt for the working class.
No matter what your intention or message, if you put on a KKK hood, and start giving Nazi Solutes, you might get punched.
This only seems to surprise liberals and the media. And of course the dude that got punched. He was hoping for a white assailant.
Imagine his ignorant surprise when he realized he was getting punched by a black Trump supporter. I'm not the only one who thinks this is funny.
David Begley said...
Big Mike "Well, sort of. Go down to Appalachia and ask a UMW member what he thinks of the left's support for unions."
After all the coal company BKs, I can't imagine a single UMW member voting Dem. Lots of Union people won't vote Dem this year.
Nyamujal said...
No, it's not contempt. It's disbelief. It's clear that tariffs on imports will hurt the working class by increasing the prices of basically everything. You want a trade war, then get ready for the price of everything at Walmart to increase a lot.
This happened with the tire import tariffs Obama imposed in 2009. The cost of tires went up for all consumers and that act didn't really end up saving any jobs. Mitt Romney actually used that as an argument against Obama in a debate by accusing him of buying votes from unions in return for basically nothing. Here's what actually happened:
"The tariffs did ultimately lead to a 30% reduction in Made in China tire imports from 2009 to 2011, but that didn’t mean 30% more tires were produced in the U.S. It just meant that 30% more tires were imported from Canada; 110% more from South Korea; 44% more from Japan; 152% more from Indonesia; 154% more from Thailand; 117% more from Mexico and 285% more from low volume provider Taiwan, according to the U.S. International Trade Commission.
When it comes to global trade, the horse has already bolted. Trump makes grand promises that he can turn back the clock, but he can't. Besides, India, China and South East Asia have close to 3 billion potential customers. Do you really want to hurt American companies selling their products there with these BS Trumpian policies?
Yes, jobs were lost, but on balance a lot of money was invested into the US economy by sovereign wealth funds and investors using their trade surplus to buy American debt and invest in US based ventures. That obviously isn't something that Trump cites.
Let's also talk about how the US government can't force a private company like Apple to produce its products in the US because of supply chain issues which makes China such a great partner.
I could go on about how all the policies being thrown around by Trump and Sanders will actually hurt the working class, but I'd rather talk about what can be done to help them.
It would be a good idea to invest the largesse gained from trade towards worker retraining programs, and towards igniting innovation in technologies that could potentially have a multi-decade impact like microelectronics or the internet. Clean energy seems like a good bet. Reducing corporate tax rates and closing tax loopholes will also help keep jobs. Good education policy and starting more technical high schools will also help...
"The GOP speaks for the Chamber of Commerce, big business and Wall Street."
So says an acknowledged registered Democrat and Obama-voter.
We know a few things, with only a little information about The New York Post's Michael Goodwin. One is that he can't possibly be concerned about the direction or future of the Republican Party; he is by his own account a registered Democrat.
Another is that we have little reason to trust his judgment of policies or issues or candidates; by his own account he voted for Obama.
Last but most important, Michael Goodwin seems to judge candidates on some personal likability measure derived from his gut. His gut apparently told him to vote for Obama in 2008. I don't know what his gut told him in 2012, but early in this campaign, his gut told him that Trump wasn't a serious candidate. But now his gut is telling him that Trump is a serious candidate. Without a single thought as to any guiding philosophy (conservative, or not).
Americans can do things well. Building and operating Industrial plants are no big deal for us. If President Trump is pushing something, it will get done ahead of schedule and under budget.
If all President Trump does in his first two years is stop the tsunami of outflowing jobs, he will be our literal savior. Bringing jobs back may take longer.
But the sooner we start, the sooner it happens.
The middle classes and working classes have seen their wages decline through the last few decades of open immigration and free trade.
Not if you measure correctly
"Blogger Birkel said...
I believe a President Trump is unlikely to identify the Leviathan State as the enemy of freedoms and economic expansion. "
I'm curious at all these people who "know" what he will do.
I don't and have no idea. I do know what Hillary will do.
I do know what the GOP Congress has done the past six years.
I'm with the guy who wrote this Post piece.
As noted, I do admire Cruz, but he strikes me as more Barry Goldwater than Ronald Reagan. He’s whip smart, but too rigid ideologically and personally joyless. If I were president, I would nominate him for the Supreme Court in hopes he could fill Antonin Scalia’s shoes as the leading constitutionalist.
Which leaves only Donald J. Trump. He’s weird, erratic and I have no idea what he will say or do next. His nasty put-downs of rivals and journalists, especially Megyn Kelly, diminish him. His policies are as detailed as bumper stickers and his lack of knowledge about complex issues scares me.
If he weren’t the GOP front-runner, the gaps in his game would make it easy to dismiss him. But dismissing him requires dismissing the concerns of the 7.5 million people who have voted for him. That I can’t do.
My gut tells me much of the contempt for Trump reflects contempt for his working-class white support. It is one prejudice gentry liberals and gentry conservatives share.
It is perhaps the last acceptable bigotry, and you can see it expressed on any primetime TV program. The insults don’t all seem good-natured to me. I grew up in central Pennsylvania, surrounded by the kind of people supporting Trump, and I sympathize with their worsening plight.
For generations, they went all in for the American dream. Their families fought the wars, worked in the factories, taught school, coached Little League and built a middle-class culture. Now they are abandoned and know it.
Nobody speaks for them. The left speaks for the unions, the poor and the nonwhite,
I get that. The rest is speculation.
I just hope some serious people join up as I think he will be elected unless the GOPe figures out a way to exclude him. Then we will have hell to pay.
Ron Winkleheimer said...
Manufacturing will not return to America without significant regulatory rollback.
I agree with that. Carrier isn't moving its manufacturing to Mexico simply to save a few bucks on salary.
A NYT story I saw on that put the hourly wage for a Carrier employer at $30 - $35 an hour, the Mexicans will be getting $5 - $10 a day. So best case scenario for Carrier is they save $175 per day per employee. That sounds like a lot, but there are other costs associated with manufacturing in Mexico.
Political stability, corruption. crime level, infrastructure, etc are all additional factors that add to the cost of doing business in Mexico. However, by moving to Mexico you no longer have to deal with OSHA and pollution laws, and a whole host of other regulations, and that is the real benefit to Carrier.
The savings they realize from no longer having to follow US regulations far outstrip any "savings" they may realize from stiffing their American workers.
More must-read Kevin Williamson, at the National Review Online:
The populist Right’s descent into Trumpism has been accompanied by another chorus of that great daft stupid hymn of American political economy: “We Don’t Make Things Here Anymore.” That is completely untrue, of course: As measured by the Industrial Production Index, we’re producing four times as much today as we did in 1960. Our exports have been flirting with record levels for a while, and we export many times more than what we did in the 1950s or 1960s. The largest markets for our exports are also the countries from which we take most of our imports: Canada, Mexico, and China. This is no surprise. Would you rather be a midlevel employee at a textile mill, or at Apple? “But when you go into Walmart, nothing says ‘Made in the USA.’ Everything says ‘Made in China’!” Some variation on that claim can be heard on every talk-radio show, in every mentally dead Donald Trump speech, and on nine-tenths of the barstools across the fruited plains. It got to be so common that a couple of years back Walmart pledged to buy an extra $250 billion in U.S.-made goods over the course of a decade. The firm immediately ran into trouble meeting that pledge. As James B. Kelleher put it in The Huffington Post, would-be Walmart suppliers faced “an experienced workforce, and other shortcomings.” That’s a very polite way of saying that the stuff they sell at Walmart isn’t the kind of stuff that Americans make. Yes, China is an absolute powerhouse in the world flip-flop market — good for them.
The Chinese buy vast quantities of American soybeans not because we have a clever trade policy vis-à-vis tofu-making material, but because American farmers are the world’s best and most efficient producers of soybeans, so much so that it makes more sense to ship them halfway around the world than to grow them in China or in nearby countries that are, in purely agricultural terms, perfectly capable of producing soybeans. (You may not think of soybeans or cotton as a high-tech wonder of American ingenuity, but only because you don’t know much about where soybeans or cotton come from.) It isn’t Italian protectionism that inclines Americans to buy Armani suits and Gucci briefcases. The Italians really are good at that sort of thing. And, as it turns out, lots of Americans want inexpensive flip-flops. De gustibus and all that.
Read more at: http://www.nationalreview.com/article/432989/free-trade-consumer-goods-economic-wealth
http://www.nationalreview.com/article/432989/free-trade-consumer-goods-economic-wealth
The problem with 'retraining programs' is that labor is not capital. Capital is fungible. You can move a million dollars to where it will get the best return with a phone call or by clicking a button on a browser. It takes at least months and more often years to retrain a worker. In many cases the idea of retraining is a panacea. Are you going to turn a pipe fitter into a stock broker or a software engineer? Back in the 70s and 80s, many state-sponsored 'job retraining' programs tried to turn assembly line workers into data-entry clerks. Then all the data entry jobs were mechanized or sent overseas.
The money spent to retrain a worker, and to support him or her while being retrained is an economic inefficiency that can be addressed by importing cheap overseas labor or by exporting the labor overseas, or by using tech to decrease the numbers of skilled workers needed to perform the job. You can't lament that people prefer economic inefficiency over being unemployed, and then propose a fix that involves accepting economic inefficiency so that people can stay employed.
I have been addressing this over the last few days.... I know you Smart People.
I don't know: maybe you Smart People are making Zero-Gravity Shit.
I am a Prophet, right under Althouse's nose.
People who can't get a job because of illegal immigration and manufacturing being shipped overseas just aren't interested in being lectured on comparative advantage.
Also, for most people the choice isn't between being a mid-level employee at a textile mill or a mid-level employee at Apple. The fact that he put that in the article just goes to prove what a tool Kevin Williamson is.
It's funny that the writer uses the word contempt, because it seems that Trump expresses contempt toward anyone who does not praise him (I also think that Cruz oozes with high levels of contempt for his opposition, in turn, provoking it in others). Maybe it is a mass form of projective identification. (https://en.wikipedia.org/wiki/Projective_identification)
Sebastian said...
@rehajm": The middle classes and working classes have seen their wages decline through the last few decades of open immigration and free trade./Not if you measure correctly" There you go again, citing evidence and all, when Scott Adams has already explained to you that emotions drive everything.
Conservatives used to think the lying, manipulative, substance-free, counterproductive politics of the Left was bad. Now we are being told that the lying, manipulative, substance-free, counterproductive politics of Trump is the way to show respect for the "working class." No. To view Trump as antidote to anti-prole contempt is itself a form of gross condescension.
Contempt for the white working class among DC and NYC wealth and power controllers is as. Old as the hills.
Trump is only infuriating the wealth and power guys by exposing them as pro foreign weath flow schemes and showing how he can protect
The Working Americans of every race and ethnicity from the scams hidden under pretense of Pure Free Trade Conservatism by god's Pastor Ted through a deal with his wife's employers.
What Kevin Williamson doesn't understand.
1) Free trade was sold to the American electorate via promises that sure, those crappy jobs would go to third worlders (where they don't worry so much about pollution or worker safety or unions, wink wink, nod nod) but everybody would get shiny new science fiction type jobs working in "computers" or some shit like that.
2) The 1986 amnesty was sold as the absolute, last, honest to God, ever amnesty because after that we would start enforcing the immigration laws and there wouldn't be any illegal immigration. Pinky swear!
Well maybe he does understand that, but he definitely doesn't understand that a pretty large percentage of Americans have decided that they are mad as hell and aren't going to take it anymore.
Trumpism: ‘It’s the Culture, Stupid’:
...the view that economic anxiety explains the rise of Trump has become prevalent on both the left and the right. There is, however, little evidence that points to that conclusion.
From exit poll data in the states that have had primaries:
Trump performed no better in states where the economy was the biggest issue than in other states. In the ten states where the economy was the top issue, Trump won eight, or 80 percent. In the five states where the economy was second, Trump won four . . . or 80 percent. His average margin of victory was 7.8 points in states where the economy ranked second but just 6.9 points in states where the economy was the top issue.
Trump also did worse among voters for whom the economy was a top issue than among other voters. He won voters who chose the economy as their top issue in 10 of 15 states, worse than his showing among voters over all, which he carried in 12 of 15. While he won jobs-and-economy voters in ten states, he won immigration voters in twelve, and terrorism voters in twelve. In all 15 states, Trump’s margin of victory was higher among at least one other category of voters than it was among jobs-and-economy voters. In eight states, Trump’s margins were greater on at least two other issues, and in two states his margins were lowest among jobs-and-economy voters.
Re the culture:
The idea that Trump’s success primarily reflects the failure of conservative policies to address the economic concerns of its base gets things completely backward. Those whom public-opinion analyst Sean Trende calls “cultural traditionalists” are in the Republican party today because they left the Democratic party beginning in the 1960s. Those who rejected liberal cultural positions related to civil rights, feminism, the counterculture, secularism, and anti-authoritarianism fatefully were embraced by the Republican party.
As someone who comes from a working class family, sometimes contempt can be contempt for its own sake and as a reflection bias against some group.
But, I'm not surprised to see Marxist class reasoning come into play to discuss Trump. Trump is on the side of the proletariat! If you don't like Trump you're bourgeois!
@Lydia
Concern about immigration is concern about jobs. Illegal immigrants are competition for jobs for blue collar workers. The fact that the author separates concern over illegal immigration from people concerned about jobs tells me a lot about his perspective, but I don't see how it helps deconstruct the perception that Trump support is caused by economic anxiety.
That said, yeah a lot of Trump's support is cultural, in that, according to at least one poll, most Trump supporters feel that they have no say in government. Now the author may be OK with that since they apparently don't agree with him, but Trump supporters may not agree.
Trump is not on the side of the proletariat. He wants their land, their homes, their women, their livelihood. But he's very good at posturing.
“It is a Gentry-class tradition to sweep aside all prejudices except class prejudice, which must be held with the intensity of all the old prejudices combined.” -- Scott Alexander
3/20/16, 1:15 PM"
The 'political genius' will be visiting his wife on visitors day and that's assuming he avoids being sent up the river for corruption. Perhaps the Federal Bureau of Prisons can give them a special accommodation by providing them a double wide conjugal prison cell.
You owe me an apology, sir. I typed believe and you pretended I meant know. You even quoted me and still got it wrong.
PB said...
why is the left so full of contempt and hate?
I should have followed the link before replying. We have reached a nadir. National Review is now cheer leading the Obama economy.
That's new.
This article is from about a week ago.
http://www2.nationalreview.com/article/432688/president-obama-economy-slow-recovery
This one is somewhat older, August 2013
http://m.learning.hccs.edu/faculty/julie.janzer/govt2305/assignments-and-articles/assignment-5/article-obama-skips-the-kennedy-tax-cuts
If that were true, we'd see Trump perform better in the primary elections than he does in the pre-primary polls. In fact the opposite is true.
This all sounds a lot like the wishful thinking we heard so much about just before the 2012 election. Many conservatives convinced themselves that the polls were understating Romney's support, but in fact the pollsters mostly got it right.
Trump's supporters are clearly anti-immigrant. Not only do they call for stopping illegal immigration, they also want many fewer H1-B visas, fewer green cards, and less legal immigration. Some of them express outrage at having to hear Spanish spoken in public. And you expect large numbers of Hispanics to vote with them? Dream on.
President Toilet Paper Shoe's Perfect Phone Call said...
Duh. That's the problem with hierarchies and the way conservatives obsess over trying to find ways of implementing them. In America they thought that doing this by wealth/class would make it more feasible, but it doesn't.
Jeff:
Anti-immigration is not the same as anti-immigrant. There might be overlap but you would need to show your work.
Fixing things for the working class is going to be hard in a lot of places, but easy in some others. Obama has killed the pipeline from Canada, and prevented fracking off shore. Those can presumably be reversed as easily as they were instituted. And, probably ditto for the fossil fuels nonsense (except that that air "quality" nonsense would have to go through more notice and comment by the EPA - but that just needs different people in charge there). And, the feds could start authorizing nuclear plants, which are immensely safer than the ones we have had in the past. All of these things would bring down energy costs, and, thus, the costs of living, for a very large percentage of Americans. Energy costs were intentionally driven up by Obama and the Democrats, and can be brought down intentionally just as easily.
"Rhythm and Balls" does not want hierarchies. He wants the lumpenproletariat to give up their bourgeois values and follow the government diktats.
When Cruz decided to side with the rioters in Chicago, the people proud of "shutting down" Trump, I wrote Cruz off. He is full of shit.
I'm trying to remember my first "Ted Cruz is full of shit" moment.
I think it was when he was elected senator and I first heard him open his mouth.
Maybe these memories are something people can bond over.
Let the record show that Burpel's fine with finding rigid and authoritarian ways to go about organizing and structuring society.
Bruce Hayden:
The 4.2 million government workers will not willingly follow a new direction. The eight years of Obama added 900,000 new federal employees. Add in the hundreds of thousands of turnover and you have more than a million Obama-selected workers.
They will resist.
He wants the lumpenproletariat to give up their bourgeois values and follow the government diktats.
Exactly. That's how they did it in Sweden, right?
Burpel: How rich are you? Remember, the right wing is just finding out that it wants its poor to die off.
Even Michael realizes the folly in this, you lemming.
Not that I mind you dying off, or anything. Darwinism sounds harsh but it's hard to stop the intensely and stupidly suicidal.
Too funny, "Rhythm and Balls"! I want less power invested in the federal government. I want fewer rules and regulations.
The record on this point is crystal clear, comrade.
Let's be like Sweden: as much income, on average, as in Mississippi, America's poorest state.
You first, "Rhythm and Balls".
Free market = rigid and authoritarian
Up = down
All animals are equal but some are more equal than others.
We are increasing your chocolate rations from 12 to 10 grams.
No truth in Pravda, baby.
No news in Isvestia.
All right. That's not going to happen. 30 years of conservative rule has only bloated it. They refuse to define a budget to GDP ratio as Obama had requested for a parameter about this whole weird "size" issue and don't mean it. If they did what they say they wanted then they could no longer run a permanent campaign on it and that's that.
You're the one who wants and actually thinks he's going to get a revolution of ideology after 30 years of the most conservatively radical anti-government talking-point talkers that have ever existed.
You're way too stupid to realize that the people who run for jobs in the organization they claim to hate are not doing so in order to tear it down - no matter how conclusively they've convinced you that they would.
It really does take a dummy of the highest order to believe that hiring someone who says he wants to take the company down is a rational idea.
Another mathematical fucktard who doesn't know the difference between the median and the mean.
Oh, it will happen. Wishing away reality will not release you from the inevitable.
You would have us eat the seed corn and then complain at next year's harvest. I am not so foolish.
I wish you all the pain and misery you will cause others.
What's your income, Mississippi Burpel, and how did a GOP policy make it as high as it is?
Seeing as how you're all into being the first one to prove things.
Tell me how America's billionaires have made it as high as you'd like me to think that it is. Other than by skewing the "mean income" numbers, that is.
Damn you are one leather-headed dumb-dumb.
This is like watching the limbless knight in Monty Python. The GOP tears itself down while in the process of tearing itself away from the elitists whose talking points Burpel gravitates to like the swirl in a flushing toilet bowl, but the "reality" of their inevitably prevailing is going to happen. ;-)
Can you use a metaphor that applies to the real life that all us non-farmers live in?
I'm glad to know how much pain and misery I've caused you.
When the ball of string grows boring, the cat finds another toy.
"To view Trump as antidote to anti-prole contempt is itself a form of gross condescension."
Gross condescension is breaking out all over.
You owe me an apology, sir. I typed believe and you pretended I meant know. You even quoted me and still got it wrong."
Did you happen to notice the quotes around "know?" Lots of people, not just you, "know" what Trump will do. An what he thinks.
I notice our PhD from Hamburger U has arrived. His shift must be over.
When the loser loses, he can't help coming up with more fortune cookie sayings.
Birches said...
A new way of saying, this is racism,straight up. Gosh, you guys are good at playing the victim.
Birkel:
No, I don't need to show my work. I'm making a statement about how Trump is perceived by Hispanics. All of the polls agree with common sense: Hispanics mostly don't like Trump. They think he's anti-immigrant, and if he's the Republican nominee, they will also think the party is anti-immigrant. You pretending there's a difference in a blog comment will make no difference to how Hispanics vote. They are going to hurt the Republicans even worse than they did in 2012.
You know, it's conceivable that there could be a difference between being anti-immigration and being anti-immigrant. If, for example, immigration were costing the jobs of people who are already here. But every empirical study done by actual economists who know how to do these things says that's not the case. Similarly, if new immigrants were comitting crimes at a higher rate than people already here, but again that's not the case. If you go down the list of reasons why you might be anti-immigration without being anti-immigrant, it turns out that none of them are valid. We're left with ignorance or racism. Are you ignorant, Birkel?
Oh looky! It's the Nazi with a ne'er-do-well daughter Michael K!
MichaelK.: Why are you so obsessed with a certain fast-food restaurant? Is it your GOP elitist way of reiterating your identification of all the working Americans upon whom you look down on?
The Kevin Williamson argument is the conventional one of comparative advantage. It is correct within its assumptions, if one sticks to theory. Unfortunately in economics theories suffer from an inability to find all the factors that may be in play. In engineering a machine builder could, for instance, specify parts based on some limited strength of materials formula, but if he doesnt take into account something like harmonics he could be making a disastrous error. Such factors can be found through careful empirical tests that are impossible in economics.
Free trade/comparative advantage, beyond a fairly general point (hermit kingdoms are right out) are not especially well supported by empirical evidence. Part of this is so much of the evidence, modeling, etc. normally used for analysis is collinear with a multitude of other modern trends in macroeconomic models. It is a theory for which the data is unavailable.
The other arguments Williamson cites - re growth in "output" - are also collinear with other modern trends. Improvements in technology have the bulk of the credit here, and I believe also "soft" social factors that are ignored in most development models because they can't be quantified, such as a propensity for risk-taking or degree of personal initiative, just a few things that vary among cultures. And these things have extremely complex feedback loops. In machine design terms, this means most of the rules of thumb, empirical formulas, for drawing-board design just aren't there.
The soundest approach, given that macro models are useless, is micro ones. A single industry/market at a time. This ignores the entirely theoretical outcome of comparative advantage, where it's assumed that an alternative advantaged industry will substitute for the loss of a disadvantaged one.
I honestly don't get this human infighting. When the Borg comes do you think you'll get brownie points for being a progressive? Nope, you will be assimilated.
Maybe I read too much science fiction, but I can't help but laugh at humanity. They think they have the luxury of fighting each other when apocalypse is on its way.
Last time MichaelK (with the loser daughter, who may or may not work at McDonalds along with all those other "losers" that the GOP elite hate) jumped aboard, it was to bemoan the tragedy he felt for being a simple self-hating non-Jew.
"a ne'er-do-well daughter Michael K!"
Well, she is an FBI agent and I guess that's a negative to you.
The other two also have degrees, one of them three.
How many languages do you speak, Ritmo ?
Do they teach Spanish at Hamburger U ?
R&B,
Median is the appropriate measure for these comparisons. Even so, median income or median disposable income measures favor the US considerably vis a vis nearly all of Europe. There is an enormous literature on this, a great deal of it trying (for obvious political/policy reasons) to find an alternate measure with more politically acceptable results, like the HDI.
Come November who will R & B hold his nose and vote for? Donny the Fascist or Hillary the Criminal and Traitor? Or if by chance its a contest between Ted the Evangelist and Hillary the Grifter? Or will he go third party? Inquiring minds want to know. As bad as it is for the Republicans it must really be hard for Democrats when their front runner is a criminal and traitor who might be indicted after the convention or worse still if Obama pardons her and she gets elected only to be the first president to be impeached and removed. At least the Republican Old Guard recognizes it has a problem with Trump. The Democrat Elders are in what appears to be in deep, deep denial.
"Free trade/comparative advantage, beyond a fairly general point (hermit kingdoms are right out) are not especially well supported by empirical evidence."
The problem with the theory is that, if a country commits suicide by regulation and idiotic policies like "global warming," all free trade bets are off. One weakness of libertarians is that they assume the rules apply to everyone and the Second Law of Thermodynamics won't bite them in the ass.
She must love the way you come on here so often to berate her. (At least, when it's not overshadowed by your need to berate me. Or just working Americans who don't conform to the elitism that you hold in such high regard).
Interesting that you knew the one I was talking about, despite pretending to now find pride in her being a government agent.
That's Republicans for you. Talking about liberty and government tyranny while their kids go to work for government agencies that will collude with Hillary Clinton.
It's ok, Michael K. She and Hillary can bond. They can talk about going through emails and setting up email servers and being too good to either flip burgers or be a conventional Arkansas first lady.
Come November who will R & B hold his nose and vote for? Donny the Fascist or Hillary the Criminal and Traitor?
Neither. No vote. Count me out.
Let guys like Michael the Daughter Basher decide how he's going to rationalize his vote for Hillary. Maybe it will be to set a good example for young women, or something.
This is the worst election we've ever had. The choice is between a rank narcissist and a rank opportunist. Someone who never failed at getting other people's failures to work for him and someone who never failed to take credit for other people's successes.
This is the election you wanted, GOP. And now you've got it.
All economic theories suffer from the lack of data and the inability to experiment, other than "natural experiments".
The result is an inability to find and deal with factors that may be critical, but are unavailable as data or imperceptible. Social factors are at the top of the list. I have a long relationship with Development Economics. No economic policy model/theory will explain, say, Bangladesh vs South Korea over the last 70 years.
Saint Croix said...
My gut tells me much of the contempt for Trump reflects contempt for his working-class white support. It is one prejudice gentry liberals and gentry conservatives share. It is perhaps the last acceptable bigotry, and you can see it expressed on any primetime TV program.
I think Donald Trump suggests a brutality that many people find abhorrent. Specifically, it's his willingness/eagerness to inflict pain. To use torture on captured terrorists, and to intentionally kill their family members. It's also stuff like, "I don't mind a trade war." Trump is a fighter, and many of the men in the Republican party are itching for a fight.
But I was struck today by how some Republicans are more scared of Donald Trump than they are of Barack Obama or Hillary Clinton. For instance, George Will wrote a column that says, in essence, that the Senate ought to hear and confirm Merrick Garland because Trump's nominee will be embarrassing and bad.
It's rather astounding to me that a so-called Republican would be impressed with the Ivy League credentials of Garland. It's a bunch of Ivy League Supreme Court Justices who, after all, said it was a constitutional right to stab a baby in the neck. My opposition to Trump's glee in killing innocent people is rather like my opposition to the baby-killing the Supreme Court does on a routine basis.
I think George Will, like much of our media, finds pro-life people obnoxious, low-class, and tacky. They are much more upset about pro-lifers than they are about abortion. George Will's network, whatever it is, has been censoring abortion photographs for 40 years. And he wants to put another status quo, "it has been decided," baby-killer on the bench, rather than take a chance that Donald Trump might nominate...who, exactly? The Ivy League has already gone Jack the Ripper.
Maybe the embarrassment about Trump is that he talks that barbaric and vicious talk in public. And they would prefer the status quo, of nice-nice in public and vicious and barbaric behavior in private.
What's your ethnic background, Mr. "I'm too good for low-wage labor"?
The real problem being us proles out here in flyover country just haven't measured
up. And I for one am ashamed of myself. When I began to make real money I didn't spent it going to the symphony. I built a dragster. Then I bought a house in a nice suburban neighborhood. Then I selfishly started travelling instead of giving all my discretionary income to the poor so they could buy beer and dope. To cap it all off I began to save and invest so in my old age I wouldn't be a burden to my family (or the taxpayers). I'm so ashamed I think I'll go watch PBS for a while.
What is your ethnic background R&B?
Also, what are your languages?
And, for what it's worth, your credentials?
"What's your ethnic background, Mr. "I'm too good for low-wage labor"?"
What were you doing yesterday, Ritmo ?
Were you in Arizona by any chance ?
Ritmo, like many lefties, must have gone to my blog but I can't figure out what he is talking about with my family.
Don't you like horses, Ritmo ?
I don't care about Arizona.
I'm just wondering where you get the chip on your shoulder against working folks. What was your own family background? Are there lots of Catholics in California who associate the use of Spanish language with something lowly and uncouth?
I mean, I know you have to pull something out of your butt as if it were a way of insulting me. But these imaginary "issues" say much more about you than they could about me. They're not even remotely accurate.
You're too good for so many things, Michael K. We get that. You even have to pretend I have anything to do with these things (i.e. McDonalds, Spanish language, low income) in order to put me down.
But what do these prejudices say about you? I know little about them. Why are they your primary focus for the hierarchical pecking order at the top of which you feel a reason to place yourself?
Or just feel free to not answer and keep that self awareness back in the closet where it belongs.
"Quick, Robin, to the Venn Diagram. Cross reference anti-Trump people with anti-NASCAR people. Report the overlap. Robin, looks like the overlap is 96.4%."
Well, she is an FBI agent and I guess that's a negative to you."
It would be a joyous irony if your daughter was one of the agents involved in the Hillary Clinton task force.
"t would be a joyous irony if your daughter was one of the agents involved in the Hillary Clinton task force." She is a lefty and we don't talk politics but I have thought of asking her. She was peripherally involved in the San Bernardino shooting.
Maybe that is what Ritmo considers "berate her."
I can't guess. I have never concealed who I am let alone switched identities like he has.
"What was your own family background? "
I actually have a sort of biography on my blog, Ritmo. Who are you ?
Blogger Rhythm and Balls said...
I give you credit for chutzpah! Yes the GOP is responsible for the rise of the criminal and traitor Hillary Clinton. The DNC had nothing to do with it. So you're going to sit it out and then come back and bitch about how this country could have given the keys to this one or that one. Hey maybe the Democrats can pull a magic act and get someone else besides Clinton on the ballot that isn't a communist or a criminal.
"the chip on your shoulder against working folks."
Where in the world did he ever get that ? I have worked since I was in 4th grade. I went through college and medical school on scholarship.
The reason why I am interested in Trump is that he is attracting working people while the "donor class" seems to be mostly hedge fund types. I have commented that you sounded rational at times but then you revert to a lunatic left state. It almost makes me wonder if you are two commenters. Maybe that's reason for the identity switch.
"t would be a joyous irony if your daughter was one of the agents involved in the Hillary Clinton task force." She is a lefty and we don't talk politics but I have thought of asking her. She was peripherally involved in the San Bernardino shooting."
Is there such a thing as scuttlebutt in the FBI? Ask her.
Ken Mitchell said...
He sounds like you, Ann; voted for Obama in 2008, having been ... "taken in"? ... by his Hopenchange schtick, and filled with regrets....
I've pasted this in before, starting last September....
I'm a Cruz supporter, but I'm going to paste in this tweet every chance I get:
Jeff @EmpireOfJeff tweets:
"You "conservative" "pundits" still don't get it: Trump isn't our candidate. He's our murder weapon. And the GOP is our victim. We good, now?
12:25 PM - 14 Aug 2015 "
Here it is, Spring 2016, and I'm still a Cruz guy, but I'm starting to agree with Goodwin; perhaps Trump is who we need to begin repairing the country. Obama has been SO VERY divisive, ripping the nation apart race from race, class from class, young from old. Certainly neither the incompetent leftist Sanders nor the entirely corrupt harridan Clinton can do anything except accelerate the decline.
"perhaps Trump is who we need to begin repairing the country."
Yup. This is how I feel, too. I think Ritmo even accused me of wanting a revolution. I don't but I think we are getting it and may need it to clean out the Augean Stables.
"Is there such a thing as scuttlebutt in the FBI? Ask her."
We have a birthday coming up (Her younger brother) and I think I will. I only see her about once a month as she lives 100 miles away. In LA traffic.
"This is the election you wanted, GOP. And now you've got it"
Logically, everything bad that happens is the fault of the GOP, so Ritmo is on solid ground here.
HT said...
“Whether or not you enunciate, whether or not you have a graduate school education doesn’t matter all that much to me. What matters is the principle. And [the caller] said again and again that Donald Trump projects strength, that he appears to be strong…..He said that actually H1B visas are terrific….the thing is that DT is a salesman. It turns out that many people have been duped by someone who is essentially a performer. He has been described as a carnival barker, with good reason. He is pulling a con on the American public. This is not someone who has any coherent views. He reverses his positions constantly. What he does is have an affect. And for many people that is very appealing. For people who do not follow these all that closely they don’t actually see the contradictions, they do not see a track record in which he is constantly reversing himself. He will say different things to different audiences. They don’t appreciate that the appearance of strength and strength are not the same thing. I’d say that that really gets to the heart of it. Do you care about a track record?”
Reihan Salam is executive editor and a National Review Institute Policy Fellow
National Review has lost me after 35 years. The Derbyshite firing began it and the distancing from Mark Steyn continued it.
They seem to have decided to go with whoever contributes to their fund raisers. That's not me.
I've had dinner with Salam on the cruise. He seemed a nice fellow. I actually like Jay Nordlinger and haven't seen him get into this mess.
The Weeklty Standard is equally bereft of common sense. George Will is also going rogue.
We were all waiting with bated breath for NRO to weigh in. NPR listening, red wine drinking, Volvo driving Republicans. Those aren't bad things, unless you are a bigot about it.
Well, they are the ones who think it's great to get paid and accumulate influence in the government in exchange for pretending to do nothing, or at least a lot less with their job. Yes, I do look for the people bragging about their willingness to do nothing first when it comes to suspicions on how things got fucked up.
Listen, the big issue of the day is the GOP's implosion, by class. So of course the party that said it will END class tensions by praising the rich and telling the poor that all their problems are their own fault - and implemented or initiated 30 years worth of policies to that effect - of course the fission of their party into two halves is their own making. We knew something at least as bad would have come of it 30 years ago. This is what they get for 30 years of telling one very tiny and powerful and influential class that they matter and telling everyone else that they don't.
How can anyone hope to be intelligent enough to understand politics and not understand something as simple as that?
I don't see contempt for Sanders, whom Goodwin says he's voting for in NY primary. It's obvious the contempt is based on Trump's noxious personal qualities, which he has shown himself utterly incapable of tamping down over 9 months of campaigning. No reason to believe he can do so over the next 9 months.
American Liberal Elite said...
I have had an abiding contempt for the narcissistic dishonest con man Donald Trump since the 1980's. Any contempt I harbor for his supporters is entirely attributable to their being his supporters.
I think George Will, like much of our media, finds pro-life people obnoxious, low-class, and tacky. They are much more upset about pro-lifers than they are about abortion.
I thought George Will was himself pro-life. At least that's the impression I got after reading this piece: George Will Celebrates 40-Year-Old Down Syndrome Son’s Life
George Will wrote this last July: Planned Parenthood and the barbarity of America
The number of poor attempts at argumentation you made are too numerous to count. The naked appeals to authority were my favorite.
"Rhythm and Balls" is just getting his kicks. He will not attempt an argument except to be obtuse. Wrestling a petulant pig in the mud is fun enough, for the pig anyway.
Blogger American Liberal Elite said...
So I gather you are going to vote for that exemplary candidate, that epitome of honesty and humility and incidentally the subject of a massive FBI criminal and national security breach the grifter and traitor Hillary Clinton.
It started spewing again and it's my fault. You would think that someone who claims to work with surgeons would know that doing something just to do something often leads to disaster. But you would be wrong.
Who gets richer in politics? Republicans or Democrats?
This is what Neil Degrasse Tyson was talking about when he said most Trump protesters were protesting against Trump supporters rather than against Trump himself. Why else would they try to block access to his rallies and try to disrupt them?
American People and Posterity are harmed by excessive immigration, environmental sequestration, devalued capital and labor through deficit and debt, class diversity schemes, affirmative discrimination, selective exclusion or "=", abortion rites or debasement of human life, progressive morality, shifted and obfuscated "green" toxic products, outsourced and imported legal and illegal labor, expensive and unreliable energy production, expensive and underperforming education systems, progressive health care costs, integration of pro-choice cult and state, the crony civil rights industry, class warfare, gender dysfunction, the crony welfare industry, uncompensated or undercompensated eminent domain through regulation, redistribution, subsidy, and taxation...
I get where ALE is coming from. I feel exactly the same about Clinton voters. Who are these amoral scumbags?
Char Char Binks said... "This is what Neil Degrasse Tyson was talking about when he said most Trump protesters were protesting against Trump supporters rather than against Trump himself. Why else would they try to block access to his rallies and try to disrupt them?"
Because the American left has only one playbook; protests, brainless chants from 40 years ago, and disruption. Since that's what the professors are teaching these days, the crybullies LITERALLY know nothing else. The sound you hear is the sound of a horde of 22-24 year old infants having a collective temper tantrum.
R&B wrote:
"Well, they are the ones who think it's great to get paid and accumulate influence in the government in exchange for pretending to do nothing"
Every single person I know who works for the government at the federal, state and county level, or makes their living from the government (contract service provider, politician) is a Democrat who harbors a deep and abiding hatred for the GOP and any person who does not make their living from the tax dollars extorted from working people.
"Rhythm and Balls" is just getting his kicks. He will not attempt an argument except to be obtuse.
Translation: Agree with my emotional and very fact-free ideas or else you are stupid!
"...doing something just to do something often leads to disaster."
Doing nothing just to do nothing, which is what you advocate, is what leads to disaster. Your gripe is against doing the obvious and necessary thing.
Well, there you have it, folks! Everyone "Terry" knows is such-and-such so the fact Republicans dominate the federal legislature and most state governments means NOTHING. THE WORLD REVOLVES AROUND HIS OWN PERSONAL EXPERIENCE! No facts! Anecdotes only! Terry's personal experience is the ultimate reality, and will replace what every objective analysis and observation reveals.
Why does he think something so stupid... that his personal experience is the new objective reality? Because he is a Republican. They are almost all to a man afflicted with this mental illness. Other anecdotes - let alone objective reality - need to bow down to the superiority of what he has been through.
Did you know that when he was a kid politicians used to walk uphill to Congress both ways?
Hmmmm... If every Republican's own personal experience is the only reality and other experiences or objective reality don't matter at all, then I'm really stumped at how they got their party into the bind it's in. What a laborious state of affairs. So difficult to understand. How could an organization as complex as a political party go wrong when everyone makes up their own reality?
I live in Hawaii, R&B, a solid blue state, dominated by the Democrats since statehood in 1959.
The state is famous for its machine politics and its endemic political corruption.
Both senators are democrat. Both congressional reps are Democrat. The governor is a democrat. in the state legislature, the senate has 24 Dems and one republican, and the house has 44 dems and 7 republicans.
Our state government and our congressional delegation to DC are dominated by non-whites.
So go fuck yourself, you ignorant "master of objective reality."
Well, there you have it, folks! Everyone "Terry" knows is such-and-such so the fact Republicans dominate the federal legislature and most state governments means NOTHING
Birkel, you're not intimidating anyone here. I actually do have some expertise on this stuff, enough to be able to read and evaluate econometric studies myself. I have in PhD in Economics, and my area of concentration was econometrics. I have forgotten more statistics than you will ever know. I know enough to recognize real expertise when I see it. You don't.
The really hilarious thing about watching people like you flocking to the Trump anti-immigrant banner is that you are being had by a con man. Trump himself is neither anti-immigrant nor anti-immigration. Nor is he a racist. He doesn't actually believe any of the stuff he spouts, he's just conning you. The man hires immigrant labor, he donates to Democratic politicians, and he even married an immigrant! But you think he's on your side. You are foolish beyond measure.
Lol. The brilliance of "Terry" strikes again!
He clarifies by saying that it's not just his own personal experience that he believes is the objective reality across the board in the United States. It's Hawaii's experience that defines American politics!
So the thousands of other municipalities and 49 other states and the federal government can "fuck themselves" because TERRY KNOWS EVERYTHING ABOUT HAWAIIAN POLITICS AND PRETENDS IT'S THE SAME AS ALL U.S. POLITICS! LOLOLOLOLOLOLOL
I think I know now why it was that Adam Carolla believes Hawaiians are especially stupid.
I Callahan said...
R&B - do you always have to be an asshole? You're not arguing points, you're not bringing up issues, you just come into the thread and fling dung against the wall.
Maybe you ought to find someplace that's more to your liking.
Professor - is the "adds to the discussion" rule still in effect? Because R&B doesn't.
Actually, I told you to go fuck yourself, R&B. You are thick as the metaphorical whale omelette. You claim to know about this thing called 'objective reality.' I made no such claim, however, I was able to clearly demonstrate that your claim about 'objective reality' was false. Idiocy and corruption in government is not reserved to a single party. If you want to see corruption, go to any big city. You know, the big cities run by democrats and socialists. Even the hard-core socialist governments you admire -- like Cuba, for example -- are the corrupt dominions of mad kings.
If you hate corruption and hate elitism, you have no choice but to endorse small government conservatism. If you like to order people around, vote democrat and pray that your vote is rewarded with a position in the bureaucracy.
Are you able to read, I Cal? I've brought up more substance here than anyone, and will gladly debate substance with anyone who can bring it to the table.
But when it comes to someone like Michael K., a man who's obsessed with me and with insulting me, there's no longer any substance he's bringing to debate. That doesn't mean I have to take his insults laying down.
Likewise, when Terry refuses to get the point of a comment over and over again, and says "go fuck yourself," perhaps you consider that a meaningful, substantive comment for me to engage. I don't.
And yet, I still pointed out that pointing to Hawaii as emblematic of the American political system (as Terry apparently believes it to be), is folly. But I guess you considered that an unfair point to make.
So why don't you make a substantive point then, if you think I'm incapable of meeting one? It seems that's the question that should be asked. Unless, of course, your agenda is just to make no substantive points and call "foul" and say it's unfair when no one can successfully rebut any of the many that I've made. You're particularly deaf to your own side's insults and reliance on ad hominems, But for some reason, when I push back on them, it hurts your acute ears.
How painful that must be for you.
Thanks for the straw man, Terry. As well as the red herring. And thanks for also completely misunderstanding my point. Again.
But I'm not sure you're really even making sense of your own points. You are more difficult to follow than a scrimmage on a field with adjustable goalposts. Suffice it to say, I won't be endorsing things obsessively endorsed by the same people who make the goals they endorse harder to achieve with every election cycle that they win. But that's because for me, talk is cheap. Perhaps you feel differently.
You're cute when you're assuming things about people. You made so many unfounded assumptions it calls into question your objectivity.
First, I am not a Trump supporter. Ask around.
Second, on the internet everybody is above average.
If you hate corruption and hate elitism, you have no choice but to endorse small government conservatism.
What if you just hate incompetence and the constant selling of an idea that's somehow, magically, never implemented? Especially by the party/people who sell it most energetically?
Which party can those people go for, Terry?
Or is that a bipartisan problem that should somehow nevertheless convince me to vote Republican?
"The really hilarious thing about watching people like you flocking to the Trump anti-immigrant banner is that you are being had by a con man. "
So you say. I'm not sure who is the "con man" here.
There are a lot of people who have been conned but not all by Trump.
"Rhythm and Balls"
Try applying principles. I would bet you do so in other areas of life. Fairly certain of it, actually.
But frustration about politicians responding to their incentives seems to overwhelm you. As an advocate of smaller, less intrusive and decentralized government I am prepared to lose every election. It's liberating.
I wrote "If you hate corruption and hate elitism, you have no choice but to endorse small government conservatism." I said nothing about voting republican. I implied that if you believe that you can get honest government by not voting Republican, you are mistaken.
I run into this with liberals all of the time. I write A. They respond "You wrote B! That's stupid!"
That is what is called the straw-man logical fallacy.
I am not a Trump supporter. I refuse to engage in the bigotry that motivates many people, not all of them on the left, who belittle the concerns of what appears to be a large segment of the American working class.
Kevin Williamson's recent piece on Trump supporters was both bigoted and a cheap shot. Williamson has a libertarian side and a Catholic side. He seems to write from whichever POV most justifies his contempt for others. Pro abortion? The Catholic side comes out. Anti free trade? The libertarian side comes out. It can make for an entertaining writing style.
Harumph. I take R&B's criticism about not being able to understand what I wrote in my original comment seriously. I ran the comment through the readability tester at http://www.webpagefx.com/tools/read-able/.
"Readability Test Results:
This page has an average grade level of about 23.
Ooh, that's probably a bit too complicated.
Have you thought about using smaller words and shorter sentences?"
It says nothing good about America that R&B could not understand my writing. Nevertheless, in the future, I shall try to do as suggested, and use 'smaller words and shorter sentences' for his sake.
Yep, I think I see the problem. I ran R&B's last comment through the same readability checker:
"This page has an average grade level of about 12.
It should be easily understood by 17 to 18 year olds."
"Doing nothing just to do nothing, which is what you advocate, is what leads to disaster. Your gripe is against doing the obvious and necessary thing."
I would rate this argument somewhere above "so's your mother " but below "I'm rubber and you're glue. "
Obvious and necessary without a reference as to what and a blanket characterization of what I advocate, some would call that a straw man type argument, but R&B calls it "substance"
tim in vermont said...
Well. I'm from Chicago........... | cc/2020-05/en_middle_0128.json.gz/line925 |
__label__cc | 0.56412 | 0.43588 | "#MeToo depends on the credibility of the journalists who report on it."
This is an excellent WaPo column by Megan McArdle.
McArdle says she was ready to write "It's now clear that Brett Kavanaugh's nomination cannot go forward" if another sexual assault allegation came out, but she changed her mind when she saw that New Yorker article about Deborah Ramirez. McArdle had thought that "a second allegation would be stronger, not weaker, than the first." She's "frankly surprised the New Yorker ran the article."
And so I'm writing a different column than I expected, about something I hadn't fully understood until I watched that seismic shift [toward expediting the process lest after nominee would go down to a string of unverifiable allegations]: the extent to which the success of #MeToo depends on the credibility of the journalists who report on it.
We hear the slogan "believe women" a lot, but even its strongest media proponents can't really mean it literally, because journalists know how often people tell them things that aren't true....
As #MeToo has grown, mainstream media outlets have generally been scrupulous about getting that confirmation before they publish. It's hard to overstate the dangers when that filter fails. When Rolling Stone failed to check allegations about gang rape at the University of Virginia, the magazine both smeared innocent young men and caused other victims to be treated more skeptically. And when a weak story breaks into an already raging political conflagration, it not only creates skepticism under which future abusers can shelter but also threatens to turn #MeToo into yet another divide in the culture wars.
In the #MeToo movement, it has seemed that multiple accusations have been crucial in taking down prominent men. And now here is a prominent man who began as the target of a desired takedown. The first accusation inspired credulity because of the built-up strength of the believe-all-survivors ethic, but the second one felt so weak that it not only failed to strengthen the attack, it roused suspicion about the first accusation.
If only the authorities would do their work, then we could rely on them, McArdle seems to say. They've been "generally... scrupulous" in the past. Oh? Somehow I rankle at that idealized image. And I resist the complacency about professionalized journalism and its alliance with a political movement. It's up to us, the citizenry, to maintain our vigilance. No shortcuts. You can't "believe all women" or trust the "mainstream" press. Pay attention and sharpen up, or we are lost.
NOTE: This is the fifth in a series of posts about Kavanaugh this morning. Comments on this post should only be about this article. Here's my post warning you that a series of posts is forthcoming. If you want to draw attention to other articles, do so in the comments section for that post, not this one.
Tags: #MeToo, defamation, evidence, Kavanaugh, Megan McArdle, Rolling Stone, University of Virginia
Somebody's gonna get the cold shoulder at the next meeting...
MadisonMan said...
The press suffers from credibility when they ignore things like Ellison's woes. And boy do they ignore them. No one asks Hillary about Sexual Harrassment except in the most bland of terms. And now we have Kavanausea and everyone is sick of the Media.
Surprisingly.
"If only the authorities would do their work, then we could rely on them, McArdle seems to say."
I insist on this to laughter, daily, in other contexts. Why's it important in this one?
Everything should be homeopathic: We don't care if it's true, or accurate, or factual - as long as you feel better about yourself.
Anything more is oppressive.
McArdle is a woman and goes for the domestic disagreement analysis. Guys for for the system analysis.
Staying sharp isn't enough. You have to be able to think like a man even if it's not interesting to you.
Systems come first at the national level.
There are efforts to keep the #MeToo movement from decending into brainless misandry, but there seems to be this gravitational pull towards rage filled gender grievence vengence seeking to redress historical sins of males regardless of actual guilt. Righteous anger and revenge feel so good.
Remember that the Bush TANG allegations were uncovered as a fraud by a blog reader, not the news media.
The fraudulent documents were shown to be typed on a word processor within minutes of the story being broadcast.
The authenticity of the documents was challenged within hours on Internet forums and blogs, with questions initially focused on alleged anachronisms in the documents' typography. Content soon spread to the mass media.[11] Although CBS and Rather defended the authenticity and usage of the documents for a two-week period, continued scrutiny from other news organizations and independent analysis of the documents obtained by USA Today and CBS raised questions about their validity and led to a public repudiation on September 20, 2004.
The political left STILL composed a a movie they titled "Truth" about the hoax.
That was the beginning of the loss of trust in media, written and TV.
Humperdink said...
McArdle is coming around to where most conservatives were a few weeks ago.
Bill, Republic of Texas said...
Now there are three allegations:
"I witnessed Mark Judge and Brett Kavanaugh drink excessively and engage in highly inappropriate conduct, including being overly aggressive with girls and not taking 'No' for an answer. This conduct included the fondling and grabbing of girls without their consent," Swetnick writes.
"I also witnessed efforts by Mark Judge, Brett Kavanaugh and others to cause girls to become inebriated and disoriented so they could then be 'gang raped' in a side room or bedroom by a 'train' of numerous boys ... These boys included Mark Judge and Brett Kavanaugh ... In approximately 1982, I became the victim of one of these 'gang' or 'train' rapes where Mark Judge and Brett Kavanaugh were present," she added.
She said she was drugged during the gang rape of which she was a victim, but has "a firm recollection of seeing boys lined up outside rooms at many of these parties waiting for their 'turn' with a girl inside the room."
McArdle tried to be honest, and once in a while she comes close. This may be one of those times.
TRISTRAM said...
The credulous part is that the believe the women only applies to Republicans. Were they going after Ellison, Booker, Biden, Menendez, and not telling men to just shut up, I'd be willing to consider the accusations more than as a shallow political ploy.
After the railroading of (R) law makers to clear the way for progressives (Delay, Stephens), and abuse of sealed records (Bush, Ryan from Chicago), I frankly don't think convictions, much less accusations are actionable.
Sad, but at this point, it is better that guilty get away with it than this kind of thing be permitted to repeat.
Woody Allen didn’t molest his daughter. And Mia Farrow has staunchly defended Roman Polanski, who raped a 13 year old.
Rosenary’s Baby has been made out to be some sort of journalistic beacon of MeToo.
He’s not. He’s a fucked up guy because his parents are fucked up people. He can take down all the Weinsteins and Moonves.
He whiffed on this bullshit Ramirez story because he’s a Crusader. But crusading doesn’t change who your parents are. It’s not going to change how fucked uo his childhood was.
This MeToo movement is going to disintegrate because Rosemary’s Baby isn’t a reporter. He’s a Crusader
Amadeus 48 said...
Well, if only the authorities would do their work, we could rely on them. WAIT! STOP RIGHT THERE!
Apparently, the FBI is the most incompetent background checker of all time, because they apparently missed Brett Kavanaugh's weekend gig as a "partier" extraordinaire. And as we speak, that genius seeker of truth Bob Avenati has trolled up some fifth-tier federal employee who says Kavanaugh and Judge ran a gang rape racket when they were 16. How did they miss that in the six background checks? I am sure many senators will want to know more.
I don't believe any of this, and you shouldn't either. Soon Kavanagh will be identified as Uncle Brett in the McMartin Preschool case (I think I read that in another comment thread). In Salem he would be flying invisibly around the meeting house to torment the poor bewitched girls.
This is all really bad.
mezzrow said...
@Michael K - and we know the purpose of the movie was to make the movie into the accepted historical narrative when another 20 - 30 years have passed.
After all, would Robert Redford work in service to a lie? He's a great actor, you know.
And that facial structure. So convincing. They'll wish they had news readers like Redford, er... Rather.
This rankles some folks. Me, for example.
Browndog said...
They're coming fast and furious now. Look for the "witness list" to grow.
The latest is Julie Swetnick. From her official declaration today:
I currently hold the following active clearances associated with working within the federal government: Public Trust-U.S. Department of Treasury (DOT), U.S. Mint (USM), Internal Revenue Service (IRS)
I have previously held the following inactive clearances: Secret-U.S. Department of State (DOS), U/S/ Department of Justice (DOJ)and Public Trust-U.S. Department of Homeland Security (DHS), Customs and Border Protection (CBP)
You can call her Deep State Julie for short-
If Gang rape was going on - week after week - why didn't anyone say something?
If she knew people were going to be drugged, why did she keep going to the parties?
This is nonsense on stilts.
By the way, where has this "witness" been for the last two months?
Static Ping said...
Well, that should be obvious. Once the rabble figure out that the cause cannot be trusted, they stop trusting. After that, the only hope is to intimidate the rabble, at which point the cause may have power but no longer have any credibility. Unless MeToo is planning on a coup, they are not going to get anywhere making random and weak accusations. Even if they do make a coup such things tend to end badly. Coups work when the new leaders are good at their jobs and "desperation to hold onto power" coups do not tend to provide as such.
Did she file a police report?
Since she is a federal employee, we know she can't be fired.
AustinRoth said...
And the credibility, or lack thereof, of the lawyers involved (looking at you Avenatti).
Random Onlooker said...
So this newest woman....watched a number of her friends/peers get raped and did nothing to stop it...was raped herself and did/said nothing...kept going to these parties even though she knew there would be more rapes/sexual assaults...then 35 years later...waited until all the confirmation hearings were over....and THEN said something?
Me too was already a divide in the culture wars.
Lots of young men are becoming Republicans.
We should immediately start several multi-pronged investigations into how many dicks Sotomayor, Kagan and Ginsberg sucked in college and how many abortions they had, if any. Maybe, they got into an argument with a boyfriend, and slapped him, and we can root out this "domestic violence"
1. Get all their high school year books.
2. Get all their college year books
3. Get all the alumni lists for each of their schools
4. Get the WSJ and Foxnews to hire teams of reporters to talk to all their classmates.
5. Find the handful of college/high school Republicans who don't like these women
6. Find ex-boyfriends
7. Investigate illegal abortion clinics used in NYC in the 50s, 60s, 70s by elite families.
8. Write lots of stories about stuff you find. Nail some of the sluttier friends of these 3 women.
This sounds totally vicious and crazy, doesn't it?
But this is what they are doing to Kavanaugh, under the guise of #metoo.
Sink Kavanaugh at any cost is the name of the Democrat game.
At least with Bork, these sonsabitches stuck to his published opinions and judicial philosophy.
I am serious.
If drunken (and drug use) gang rape parties were happening - week after week..."every weekend" why would these girls let themselves and their friends get drugged and gang rapped... and it starts all over next weekend?
Also, the "new" statements via Avenatti do not claim he raped anyone. It is careful, lawyerly weasel wording, to whit “I saw a line of boys...that included...” and “I became a victim...and he was present” at the party.
They purposely avoided directly accusing him, and simply smeared him by association.
It's now clear that left wingers are willing to make unsubstantiated allegations because they expect other people to come forward eliminating the need to review their allegations for truthfulness.
Mayer & Farrow are going to win awards for their reporting. They're going down in journalistic history. Aside from other stories, they took down Eric Schneiderman. Was that partisan?
The Federalist society has a LOT to answer for about their vetting. Past nominees have removed themselves for smoking pot once. Background should have been more thoroughly vetted.
Should a hard undergraduate partier be disqualified from SCOTUS when the drinking age was 21? I dunno. But sure think they should have been aware of it before putting his name forward. How did the vetters not know about Mark Judge's book w/ a Burt Kavanaugh character in it?
The original goal was not to get K. on the court. The original goal was a conservative jurist on SCOTUS.
Steve M. Galbraith said...
Kavanaugh and Judge drugged and disabled young girls for sex but they themselves didn't have sex with them? They handed the girls off to other boys?
Is this remotely plausible?
Tommy Duncan said...
Multiple gang rapes by 16 year old boys on 15 year old girls in a nice neighborhood using drugs on the girls? That sort of thing is difficult to keep under wraps for 36 minutes, much less 36 years.
The Democrats have gone all in. They intend to to ride this line of attack until Cavanaugh withdraws. I say "bring it on". The Democrat attack is beginning to look like a political Battle of the Bulge.
"The political left STILL composed a a movie they titled "Truth" about the hoax."
-- Did the most politically important gif of a generation (the two memos flipping side-by-side showing the differences) get any screen time in that?
In 1692 Salem the little girls bagged all the witches. Now, it's time for the big girls
to bag the warlocks.
tcrosse said...
A few days ago McArdle wrote that Kavanaugh should be treated as an individual, not as a proxy for whatever group of people whose collective ass we want to fix. It's the flip side of OJ's criminal trial, where he became a proxy for all the Blacks who had been treated unjustly.
Wait! More breaking news on Kavanaugh!
Another woman now claims that she, too, was gang raped multiple times while Kavanaugh was in the same city as her, and yet another woman is reporting that Kavanaugh shot her dead on at least four separate occasions!
This is Salem all over again. "I saw goody Proctor with Kavanaugh!!!" "Kavanaugh sent out his spirit in the night to attack me!!!" Good, old fashioned, American bandwagon hysteria...
If gender relations in this country could get any worse, I don't know what that looks like.
"Kavanaugh and Judge drugged and disabled young girls for sex but they themselves didn't have sex with them?"
-- Except for Ford. Who was alone. And not drugged to being incapacitated, but able to overcome the two of them in a physical scrum.
I *really* don't see how Ramirez or Swetnick reinforce Ford's story.
rhhardin is right.
The only good analysis is a systems analysis.
From a strategic point of view the MSM is obviously an instrument of political influence and is being deliberately used as such in a coordinated manner.
Virgil Hilts said...
I hate all of this but the Julie Swetnick stuff is going to be fascinating. I am not sure if women appreciate this, but the vast majority of American men from this socio-economic stratum are simply incapable of behaving in the manner described. That is why so many of us believed so quickly that the Duke LaCrosse/U of V story were horseshit. Men that are capable of this type of behavior typically end up in prison or homeless or dead; they don't make it into good schools and become prominent citizens. Are there exceptions - sure, look at the crazy surgeon in California or some of the educated serial killers -- but in those cases the guys act out their perversions in secret, not in front of a bunch of others. This is Duke LaCrosse and Rolling Stone. Avenatti is a f-ing idiot for believing this woman. But I remember all of the educated women who believed the Duke LaCrosse and Jackie crap without an ounce of skepticism and I do not have any hope that this time will be different. It will probably be much worse since so much harder to disprove.
The first accusation inspired [in]credulity. Fixed that for you. I found the first accusation ludicrous on its face, that you take it seriously is personal to you and some others, but certainly not everyone saw it so.
gahrie said...
Not confirming Kavanagh at this point would be rewarding the bad behavior of the Democrats and the MSM, and simply encourage more of the same.
Now is the time for people to read or reread The Crucible
It was required reading in junior HS. Unfortunately that was more than 50 years ago and my memory is vague. One thing I recall is that multiple witnesses saw the protagonist communicating with the Devil.
Swetnick is just as free to file a criminal complaint in Maryland as Ford is.
Oso Negro said...
I think I did it all as a young man, but I never attended a party at which there was a gang rape, and I never HEARD of a single such party. Did any of you here? The idea of routine gang rape parties seems preposterous on the face of it, even for Catholics.
"Now is the time for people to read or reread The Crucible."
-- I remember having it taught alongside McCartyhism. I wonder if any professor is brave enough to teach it and compare it to Rolling Stone and Duke Lacrosse.
At multiple parties. The girls came back to the party the next week or so.
To be drugged. Again. And gang raped. Again. By dozens of boys.
But Kavanaugh and Judge just watched? Kavanaugh was there doing something.
Just when you though we had hit rock bottom, a new level has been made.
What horrible times we live in.
MRC study found only 8% of the news coverage of the Kavanaugh travesty has been about his denials and the evidence contradicting the so-called victims. 8%! There is no issue about the credibility of the journolistas. They have none. They are just “Democrats with bylines.” (via Instapundit)
Welcome to hearsay America courtesy of the women of the #metoo movement and their fawning mediaswine busy trivializing the trauma and suffering of genuine victims of sexual assault .
I apologize to Althouse for taking her OP/topic off into another direction.
The Patriarchy.
Juliet of the Spirits is claiming that there were many house parties all across Montgomery County where Kavanaugh and Judge were preying on girls. I am from the area and there was no way for these two groups of kids to find out about each others' "private house parties" on any large scale.
This is a large county poorly served by bus and subway lines even now. At the time the subway didn't run to Gaithersburg which is quite a distance from Bethesda where Georgetown Prep is located and on a different bus line. The private schools were in their own sports league, different from the up county high schools. Most of these high school students didn't have their own cars, especially up county where they had to earn the money for them. None of them had cell phones, obviously, and no Facebook, again obviously. Gaithersburg and Bethesda had different country clubs. In short, there was no way for these two groups of kids to find out about each others' "private house parties."
It is impossible to believe that an unchecked culture of gang rape and drinking was going on between the Preppies and the up-county teens or even between Bethesda and Gaithersburg teens.
As hard to believe as the third accusation might be i feel this column has been overtaken by events. Certainly folks underestimated Avenatti.
If my male friends and I had ever heard of such a thing, we would have kicked asses of the guys responsible. Severely. The girls we went to school with were our friends.
Not really. MeToo was largely an internal left wing realignment. Standards of professionalism were already incorporated into right leaning institutions. Openly left institutions rejected those standards because the embrace of sexuality bolstered their characterization of the right as prudish and the need to support the Clintons prevented much pushback. The right-most effected men of MeToo were still in a left wing dominated culture (media - the Fox News crew).
MeToo is about the left catching up to the right.
If there's a gang rape party going on every weekend, count me in.
the extent to which the success of #MeToo depends on the credibility of the journalists who report on it.
But apparently doesn't depend upon the credibility of the women making the accusations. That's the fundamental problem.
Certainly folks underestimated Avenatti.
If you mean his ability to troll the swamp, no.
so the journalist who uncovered avenatti's ties to two Saudi princes, prince talal, and prince turki the lesser, Richard armand mills, finds Christine and other accounts dubious.
I expected him to have something; I don't expect it to stand up to scrutiny. But he'll get his pay check.
I don’t think most Americans see this as an issue of credibility among politicians, let alone journalists.
I think most Americans don’t trust either group, with good reason, and drawing attention to some journalistic meta-narrative now just sounds like more narcissism, more beltway myopia, and more tone-deaf elitism.
Most Americans, fairly or unfairly, see this as a battle of super-elite against super-elite.
The only way to change the narrative is to change the nominee. Then go full Sicilian on your enemies. Politics sucks.
She better name the rapists.
Ficta said...
I have thought for the last couple of weeks that this will be the rock upon which #MeToo founders. People of good will were on board with the goals of #MeToo, but the movement is burning its credibility and political capital with these blatantly ridiculous accusations.
miss swetnick, currently works for treasury or the irs, now anything curious about those two institutions, say about six years,
This is Duke LaCrosse and Rolling Stone. Avenatti is a f-ing idiot for believing this woman. But I remember all of the educated women who believed the Duke LaCrosse and Jackie crap without an ounce of skepticism and I do not have any hope that this time will be different. It will probably be much worse since so much harder to disprove.
Yes. She is probably one of those people that Veritas tapes saying they do all their work for DSA while the taxpayers pay their salaries.
My name goes here. said...
Well, the good news is that the media ought to be able to find *SOMEBODY* that went to one of these parties.
Meh, it doesn't matter how absurd it is and they all know it. It's only another story to give the media to associate rape with Kavanaugh, blah blah blah.
"The only way to change the narrative is to change the nominee. "
-- That is stupid. There will simply be another secret, unknown gang rape party train for that nominee.
People of good will were on board with the goals of #MeToo, but the movement is burning its credibility and political capital with these blatantly ridiculous accusations.
Some of the more cynical amongst us believe the only reason the movement exists at all is for this single purpose.
"She better name the rapists."
-- Kavanaugh and a nominee to be named later.
mjg235 said...
I think Avenatti just lost the Democrats the midterms. He just proved Anton completely right about the Flight 93 election. If they're going to UVA rape case an entirely pedestrian conservative jurist, no conservative should feel confident he or she will be granted any semblance of dignity in the brave new progressive world.
Even half-witted never trumpers will have to see this now.
I still think there is a 50-50 chance to get Kavanaugh confirmed and the GOP to retain the Senate. Perhaps, I am wildly optimistic.
One mistake that Grassley has to fix is something akin to what lawyers say is the discovery deadline. You say something like the door closes for statements, claims, evidence, 1 week BEFORE his testimony, so that you don't have all these late hits in the media AFTER his testimony.
If given enough time, the Dems and the media could stitch together a negative dossier against Mother Theresa. She also happens to be Pro-Life -- that bitch!
"If my male friends and I had ever heard of such a thing, we would have kicked asses of the guys responsible. Severely. The girls we went to school with were our friends."
Agree 100%. Even in my high school, which was probably 5-10 times larger BK's, we all knew who was sleeping with whom. No way news of something like this would not spread and no way that the perps would have survived the first such event.
"Some of the more cynical amongst us believe the only reason the movement exists at all is for this single purpose."
-- As with a lot of things, once politically motivated people got hold of it, it was ruined.
It's only another story to give the media to associate rape with Kavanaugh, blah blah blah.
Since the quality is so poor, it's a quantity over quality gambit.
All you need to know about the hivemind left can be found in the utterances of the ugly white Democrat named Joy Behar.
I’d vote for a rapist as long as they’re pro-abortion
-- Joy Behar
"Quantity has a quality of its own." Uncle Joe Stalin.
and I never HEARD of a single such party. Did any of you here?
Yes. It's not common. It's not talked about in the same way but I've heard of it at undergrad parties.
You know, in the last couple of weeks I've heard a lot of people writing about how they know that their kids got up to in college. Maybe you know, and maybe you don't.
One of my friends was a RA at a Catholic college as upper-classman. She has ALL sorts of stories.
Seriously, if there repeated gang rapes occurring how is it possible that no one but the victims and the perps knew about it? This is fantasy.
A gentle reminder:
1. Rape is a terrible crime.
2. To falsely accuse someone of rape is also a terrible crime.
Avenatti did not cost Dems midterms but if one gives Republicans only 50-50 to hold the Senate that forgets how Dems have to run the table to take Senate.
"so that you don't have all these late hits in the media AFTER his testimony."
Hopelessly naive.
we all knew who was sleeping with whom.
You did not know. You THOUGHT you KNEW.
There should be tons of witnesses.
Regarding Swetnick, CNN reports:
Swetnick says she attended "well over ten" parties where Kavanaugh was present and saw him "drink excessively at many of these parties and engage in abusive and physically aggressive behavior towards girls, including pressing girls against him without their consent, 'grinding' against girls and attempting to remove or shift girls' clothing to expose private body parts. "
Swetnick made her allegations in a sworn statement that was given to the Senate Judiciary Committee. Her statement includes a series of other serious allegations that CNN has not yet been able to corroborate.
In what way did they corroborate the allegations that they did report? For some reason they left that out. They also left out the preposterous claims, so that the plausible ones might have a chance to stick.
It's interesting that McArdle reports "a seismic shift" among Republicans when the second story came and proved weak. Evidently Republicans, at any rate, have finally realized that the Dems will lie and will go after any Republican with any story if said Republican seems to be achieving power. The shift was so strong that McArdle had to write on the media keeping its credibility instead of Kavanaugh keeping his. This shift isn't being reported in the Pravda media but it exists and it has many implications - for #MeToo and also perhaps for the elections. If 2016 was the Flight 93 election, perhaps the 2018 elections will be the Miracle on the Hudson.
They are coming for you. Turn out and vote.
Ms Swetnick, who claims to have multiple clearances, now gets to explain to the FBI/DISCO authorities how multiple episodes of mass criminality by others & her being a rape victim was not mentioned in her interviews for her clearances. Or, was it?
Authorities who handle clearances are not fond of revelations like this out of the blue. It makes them look bad. I expect the downstream effect of this revelation will be that Ms Swetnick will lose her clearances & then her job.
A brief synopsis of The Crucible, Act I:
the Reverend Hale is a famed witch expert from a nearby town. Suddenly, in front of Reverend Hale, Abigail changes her story and begins to suggest that Tituba did indeed call on the Devil. Tituba, surprised at this accusation, vehemently denies it. But when Rev. Hale and Rev. Parris interrogate Tituba, she confesses (under pressure) to witchcraft and names several other women as “witches” in the village. While Tituba and Abigail are accusing women in the town, several other young girls, including Mary Warren follow Abigail’s lead and begin accusing other women as well.
I guess if there are several accusers, witchcraft must have been happening.
"Extraordinary claims require extraordinary evidence."
Gang rape is certainly an extraordinary claim. The evidence is basically nil at this point.
At least Ford and Ramirez had the sense to make vague claims with minimal evidence of something that was not completely ridiculous.
As with others above I never heard of any group rape stories while in school either. There were occasionally orgy or group sex stories but they were all described as consensual. Even with these stories we all gave them the same level of concern we did to the rumor that the Wilson sisters from Heart were an incestuous lesbian couple. Which is to say 16 year old boys have better sense than left wing (supposed) adults about the likelihood of an organized gang rape ring run by Catholic schoolboys in which Catholic schoolgirls return week after week apparently just praying it won't be their turn - and never filing any complaints.
This ranks right up with Jackie's (of UVA) assertion that frat boys engaged in gang rape as a fraternity initiation ritual.
These people are numbnuts.
The latest accuser at bat recites that beach parties had a punch with grain alcohol to get party goers drunk. OK. Than she links that to gang rapes Kavanaugh did not participate in but must have known about.
How can K disprove that semi accusation? He has to say it never happened.
I expect the downstream effect of this revelation will be that Ms Swetnick will lose her clearances & then her job.
She has been promised a big payday. Her DSA colleagues will cheer her.
Bill Peschel said...
Perhaps the point of these allegations is not to get Kavanaugh to withdraw, but to get the squishy GOP senators to vote Present.
It won't take that many, right? Just one or two?
Which is why we can't let this stand. Not only that, but Feinstein needs to stand in the well of Congress for a public reprimand for actions contributing to the disgrace of the Senate.
There has to be personal consequences for lying and introducing false evidence.
I read that New Yorker story. I was a newspaper copy editor for two decades. I cut my teeth in the newsroom at age 15 in 1975. Any reasonably competent editor would not have published that story without further corroboration. Period, full stop.
Of course, that was when newspapers believed in ethics and could face a libel suit if they got it wrong.
Trumpit said...
[Kavanaugh and Judge drugged and disabled young girls for sex but they themselves didn't have sex with them? They handed the girls off to other boys?
Just when you though we had hit rock bottom, a new level has been made.]
Does double spacing make your argument, such as it is, stronger?
Schlump and the GOP hit "rock bottom" every day of the week. I've followed the story closely, and listened to his self-serving interview on FOX. His taciturn wife at his side during his denials did nothing for me. As the late Tammy Wynette sang, "Stand by Your Man" through thick and thin. Stay home and bake cookies. The totality of facts and circumstances leads me to believe that Kavanaugh is a goddamn liar. If he admitted to getting drunk, and rowdy at parties while in college, he'd be more credible. I'd still vote against his confirmation because I don't vote for Rethuglicans no matter how squeaky clean he or she appears. The rot goes too deep with that rotten bunch of hypocrites.
At least, that was the attitude at the mid-sized newspapers I worked at.
Only home-schooled justices from now on.
Yancey Ward said...
Avenatti is going to have to issue the witness supporting material- if he doesn't have that, then this new story won't stop Kavanaugh. The affidavit should have named the witnesses itself- that it didn't is kind of a tell, in my opinion. By the time you give such a document, you have the witnesses in hand if you have any kind of competent attorney.
This still smells like a hoax to me- the sheer lunacy of the story is breath-taking- Avenatti and Swetnick had better have pretty convincing back up from actual witnesses to the activity described- it won't be nearly enough to have people telling us Swetnick told them about this at so and so time- that boat has already sailed.
Speaking of alleged journalists, yesterday Nate Silver published a story that the “least worst” option for Republicans was for Kavanaugh to withdraw.
HELL NO!!!
Force Heitkamp and McCaskill and Manchin and Donnelly and Tester to vote against Kavanaugh and defend their votes a few weeks from now. Give Trump’s “crawl over broken glass” voters a reason to vote for Cruz, McSally, Scott, and Blackburn. Do it.
I don't think this woman went to college. What I saw was high school allegations.
My two younger daughters were in high school then. Nothing like this.
"I *really* don't see how Ramirez or Swetnick reinforce Ford's story."
We have arrived at a strange place where the Democrats now seem intent on destroying their own narrative with absurdity. Perhaps some adult in the Democrat Party finally recognized the danger and decided to derail the whole thing. Perhaps the Clintons realized there's no way this can be good for them in the long run. Expect the next accuser to be even more ridiculous. Probably something in the nature of Satanic pedophilia...
Swetnick next in line in the Accuser duJour reputation rape-train
Under the guise of protecting women (from the embarrassment of revealing 36-year old claims), the Left is coming after your husbands and sons and fathers. They are exaggerating past high school hijinx antics and trying to morph them into present claims of rape.
I have no doubt that in high school and college, the mix of alcohol, horny young men, and young women has led to many regrettable, awkward and unpleasant conflicts. Maybe, the worst of the lot would be considered rape.
But don't let these assholes weaponize old charges to slander a good, innocent man.
Avenatti and Swetnick had better have pretty convincing back up from actual witnesses to the activity described-
They will get paid anyway. He is a slimeball and she doesn't sound much better.
@Big Mike,
The Republican faithful don't won't Kavanuagh to withdraw for another reason: they know that the Dems will do the exact same thing to the next nominee. The base doesn't want to reward Democratic bad behavior because they know if the Senate does so, that's what we're going to get from here on out.
@Matthew Sablan: I seriously doubt there will be similar stories about Amy Coney Barrett.
FWIW I think they are crazy stories. That affidavit is about as affidavit-y as a cocktail napkin. But the Republicans have been outflanked. Their mistakes started when they let Democrat Senator guests hijack the hearings by shrieking and yelling. The Republicans did nothing. By doing nothing, they looked weak and uncommitted to the right of the American public to have orderly hearings. Everything the Democrats do, they get blamed for.
That sucks, but the only solution is to get better at politics. Which is their job description.
I assume you saw "Absence of Malice."
wwww said: "The Federalist society has a LOT to answer for about their vetting."
Laughable. Look at Kavanaugh's body of work. Look at Avenatti's body of work.
Tomcc said...
WWWW said: "Yes. It's not common." Really? You've heard of/about gang-rape parties?
My experience is somewhat unique since I didn't live on campus; but I certainly attended numerous parties on campus at other local universities. I never heard of such at the time. That's not to say I haven't heard reference to those kind of things in subsequent years- mostly referring to events involving athletic teams. (Not corroborated, by the way)
There may not be "she lead a rape gang" stories, but they'll Palinize her.
Lloyd W. Robertson said...
Journalism. In the recent commotion about Woodward's book, there was a reminder of his book about John Belushi. Many of Belushi's friends cooperated, gave lengthy interviews etc. They were shocked at how the product was a standard Woodward sausage: he had his story from the beginning, before any facts; "drugs ruined every aspect of Belushi's life." Belushi's friends knew this wasn't true; the drugs were terrible, but a talented wonderful Belushi shone through quite regularly. Woodward twisted all anecdotes, all facts, and managed to get everything wrong. Belushi's friends had a joke: "I'm beginning to think Nixon was innocent."
lgv said...
Now that we have a new Avenatti client allegation, I think I will wait for that post to comment. We have officially jumped the shark. Tomorrow we will learn more about Kavanaugh as his buddies sacrificing babies.
If the timeline that just popped up at Ace's -- then this woman graduated three years before Kavanaugh.
If Republicans think Barrett won't be smearable, then they are stupider than I thought. The smears will be different in kind- but they will be just as vicious and "disqualifying".
Word is that this new accuser graduated 3 years before Kavanaugh. Make of that what you will, but it does seem a bit odd that a (presumeably) 20 or 21 year old woman would attend a highschool party.
IF, and this is a very big if, there were repeated, weekly parties that involved underage drinking, drug use, and sex, and the same women/girls kept showing up over and over again, then to me that certainly seems to imply they were willing participants.
No woman/girl I have ever known would repeatedly keep going back to get raped again and again.
@YoungHegelian, that too. A wipeout if vulnerable Democrat senators in November may — might! — help stop this crap. Nothing short of the risk of losing reelection will have any effect.
Inga...Allie Oop said...
“I was a virgin for many years” Kavinaugh’s past seems to be catching up with him. I guess what happened at Georgetown Prep didn’t stay at Georgetown Prep after all.
"Make of that what you will, but it does seem a bit odd that a (presumeably) 20 or 21 year old woman would attend a highschool party."
-- Best case scenario: She, as the of age person, brought the alcohol and loses her clearances for that and being an accessory to gang rapes.
Any nominee for the 5th SCOTUS vote will be slandered. Alito was hit pretty hard, but nothing like this. Thomas got hit really hard, but stood his ground against 8 year old, vague, bogus allegations by Hill.
To their credit, the Dems (who held the Senate majority) did not filibuster Thomas. In fact, 1 Dem Senator DeConcini from Arizona, voted for Thomas in Committee and later for him on the floor to help him squeak by. 11 Dems (mostly from the South) voted for Thomas.
The Dem party was much more sane back then. But the lesson they learned was to fight harder. Use Alinsky tactics, make personal attacks, use filibuster.
Whereas the GOP easily confirmed Ginsberg, Sotomayor and Breyer without too much psychodrama.
@wwww - so you are saying it’s a Catholic thing? Who knew.
@Nonapod - maybe she was just there for the rape
It's weird - when it comes to NewAge cultism, the credibility of the journalists doesn't matter at all. Nobody will care. You can scream at the top of your lungs - even through a NYT journalist for years - and the reaction is "Ho-Hum, check out Tom Cruise's new movie!" Why would anyone who's been through that take the rest of you seriously?
A conversation with Nathan Rich about the unique Scientology hellscape he survived
That happened in AMERICA. And is still happening to others. While you want to know about Brett.
You're all lying to yourselves - about yourselves and this country. There's no justice here. Brett won't change that.
No matter if he gets the job or not.
How does Claire McCatkill stand a chance in red state MO?
"I was a virgin for many years” Kavinaugh’s past seems to be catching up with him. I guess what happened at Georgetown Prep didn’t stay at Georgetown Prep after all."
There is a well established rumor that Inga pulled trains in college in order to make extra money.
Before we ask the FBI to investigate, tell us when and under what circumstances you lost your virginity, Inga.
That's fair, isn't it?
McCatKill and Feinstein almost hold a candle to HIllary's insider money-grubbing corruption.
For the record, from what I am hearing the sworn deposition is not actually committing to any actual claims against Kavanaugh. It's all weasel words to make an impression without technically leaving anyone open to lawsuits.
Etienne said...
Make no mistake, this is all about Senator Feinstein and the Progressive socialist movement.
@ Crack - so are you lying to yourself too? As for me, I have one foot out the door for Eastern Europe.
You're all lying to yourselves - about yourselves and this country.
Just because no one else shares your hobbyhorse doesn't mean people support cultism. Get over yourself you fucking idiot.
The new gang rape accuser (who never said a thing until now!) is a government employee.
Zerohedge has article showing Avenatti's client has IRS State tax liens in excess of $100,000.
Basil Duke said...
In the summer of 1984, I played strip poker with three classmates - two of them females and one male. We were drinking alcohol, but were nowhere close to black-out drunk. In time, all of us were completely naked. The female classmate seated to my right had beautiful, full breasts and a coal black pubic bush. At one point, she stood up and walked across the room to access the bathroom. What a delightful vision she was. Tragically, that was the first and last time I ever saw her nude. Although she later that night, playfully, sat on my lap, nothing of a carnal nature transpired. However, after the card game broke up, the other two card players wound up fornicating on the houseboat owned by the girl's father. Under the Get Kavanaugh Playbook unveiled in the last two weeks by our friends on the other side of the aisle, both my male friend and I could be "credibly" accused of getting our lady companions in an advanced state of intoxication for the express purpose of raping them (in my friend's case) and molesting them (in my case, vis a vis her sitting nude on my equally bare lap). Curiously, the girl with the awesome rack gave me her bra as a keepsake. That, too, would be "proof" of my guilt. "The white devil seized her clothes and forced her to drive home nude!!!"
“I think I did it all as a young man, but I never attended a party at which there was a gang rape, and I never HEARD of a single such party. Did any of you here? The idea of routine gang rape parties seems preposterous on the face of it, even for Catholics. “
In the world old #me too whingers and their Democrat enablers, not even the preposterous is preposterous. And the real is not real if itponts to K. Ellison, Booker, Biden, Clinton or Menendez or evidence exonerating Kavanaugh. It is also evident that many Yalies learn that the progressive agenda is everything and honor, justice and evidence mean nothing.
If this ruse works, anything will work. Sarah Hoyt is right: lefties are equal parts idiots and evil people.
"Zerohedge has article showing Avenatti's client has IRS State tax liens in excess of $100,000."
-- That's... awkward for someone who apparently works/worked at the IRS.
Every sane, virile man in his 50s is now thinking about every high school and college "interaction" with the opposite sex from 35 years ago......
You too could be a sexual assaulter!
Nan King just Tweeted that she is about to come forward. Everybody knows about the rape of Nan KIng.
Quaestor said...
No. this is merely evil done in the cause of totalitarianism. Today the martyrs are smeared and defamed. Tomorrow they will be shot. Trumpit is an example of the kind of amoral robot who gleefully wears the boot that stamps the human face forever.
They are saying Avenatti is running for President in 2020. First thought- President of what? Second- all the candidates for President in 2020 deserve to be heard. That's gonna be one crowded dais.
Everybody knows about the rape of Nan KIng.
Yeah, Kavanaugh looks a bit Jappo if you squint hard enough.
The Vault Dweller said...
The credibility of journalists seems secondary to the credibility of the underlying allegation. Regardless of how the it was reported, the allegation of Dr. Ford has some very glaring credibility issues. The specifics of allegation are very unclear. She can't identify a specific place or a time it occurred, there are no corroborating witnesses. Some of the people she named as corroborating witnesses say they have no memory of anything like she described occurring. This isn't even broaching the subject that Dr. Ford could have political motivations to lie about the issue. All these problems with her allegation would still exist regardless of how it is reported on. If Megan McCardle is hoping for a society where journalists are entirely scrupulous and much more objective it would still be a bad idea to rely on their reporting. One point that should be a part of the #MeToo movement is to treat allegations seriously which should mean examining each case on an individual basis. This must include looking at all the credibility problems of each accusation.
I Have Misplaced My Pants said...
"a firm recollection of seeing boys lined up outside rooms at many of these parties waiting for their 'turn' with a girl inside the room."
She was so distressed by this that she did fuck-all about it, and evidently continued attending those parties. So she can fuck off and get bent.
@MatthewSablan: That’s a good point. If she was witnessing gang rapes, wouldn’t she be culpable for continuing to participate in these parties? And if she brought another woman to one of these parties, was she culpable for more?
This was the era of National Lampoon. A lot of guys wanted to be Hunter Thompson, but it doesn’t seem likely that many of them succeeded.
I still wonder how being the running buddy of a journalist who wrote detailed confessions of high school perfidy wasn’t anticipated better by the people who presented Kavanaugh as a snow-driven choirboy.
Some of the most revered figures in the news business have been accused of far worse misconduct than anything attributed to Clarence Thomas. The associates of these newscasters turned a willfully blind eye to the misconduct of these newscasters. The news business has damaged credibility in reporting on sex cases. Hollywood, the Catholic Church, broadcast journalists--they have no standing when it comes to passing judgment on sexual misconduct.
I think the Commie-pinko lefties have their 2020 candidate - the one, the only, Michael Avenatti. He holds all the qualifications.
> While in college and later in law school, Avenatti worked at The Research Group, a political opposition research and media firm run by Rahm Emanuel.
> In 2013 Avenatti formed a company, Global Baristas, to buy Seattle-based Tully's Coffee out of bankruptcy. Since 2015, Global Baristas has been named in more than 50 lawsuits in state and federal courts for breach of contract, unpaid bills, and unpaid taxes.
> In 2017, a Florida man named Gerald Tobin alleged Avenatti failed to pay him $28,700 for
private investigatory work. As a result, Avenatti's firm was abruptly forced into bankruptcy
> In 2018, Avenatti's law firm was subjected to a $10 million judgment in U.S. bankruptcy court.[47] Avenatti has also defaulted on a $440,000 judgment in back taxes, penalties, and interest that he was personally obligated to pay under another bankruptcy settlement.
> Avenatti has on several occasions, including in a post to Twitter, expressed interest in running for president in 2020.[50] In a CBC TV interview published in September 2018, Avenatti said he would run in 2020 only against Trump or Pence. (Source for all of the above: Wiki)
Yep lefties, he's your guy. Note: You will need to overlook he's a bald, white guy.
gspencer said...
Leftist ideas then turned into policy depends on journalists' duplicity.
Six FBI investigations into Kavanaugh's background and little Michael Avenatti punked them all by himself.
Stud.
Giovan Pietro Bellori said...
“Grandma Inga, I looked wrong at a disgusting hag who reminded me of you and now I’m an accused rapist!”—Disgusting Hag Inga’s Grandson
One obvious question about this account: Why would she constantly attend parties where she believed girls were being gang-raped?
-Rich Lowry
I dunno, how do notoriously date-rapey frats continue to exist and throw well-attended parties? Human behavior, man.
-Josh Barro
Their podcast this Friday is gonna be Lit. Wonder what Popehat will say?
You have to imagine literally hundreds of people who knew Kavanaugh and Judge during the period of 1980-1983 have been interviewed by both the FBI in the 6 background checks and by journalists in just the last 2 weeks. Did none of them know about Kavanaugh and Judge's rape gangs that Swetnick claims had boys lined up in the hallways of multiple parties to participate in? This seems so improbable as to be bordering on impossible. I am still waiting to hear from the witnesses that Swetnick claims exists- if her affidavit has been forwarded to the judiciary committee, then the witnesses should have been identified within the packet somewhere. I am beginning to think it is just a bluff by Swetnick and Avenatti- surely if they had the corroboration, nothing is gained by withholding it, right? Withholding it undermines the claim almost from the start.
She can't identify a specific place or a time it occurred, there are no corroborating witnesses. Some of the people she named as corroborating witnesses say they have no memory of anything like she described occurring.
Her inability to remember the location has a bigger hole now than it did when first presented. She now claims to remember everyone at the "party". In addition to Kavanaugh and Judge the particpants include "PJ" (male) and the ex wife of Democrat media member Bob Beckel (forget her name offhand).
She knows everyone there but can't remember whose home it is? Why not figure it out?
The party had to be at one of the participant's homes. We know it wasn't at Ford's house so there's a grand total of 4 homes to check out. Why aren't the people who profess to be interested in truth showing her a lineup of the homes (mixed in with unrelated homes as all lineups should be)?
Known Unknown said...
"credibility of the journalists"
HAHAHAHAHAHAHAHA. Oh man, that is some funny shit right there.
I think Avenatti just lost the Democrats the midterms.
If you believe his Iowa flirtations are to run for President in 2020 and not just as fodder for a full time CNN gig, then he NEEDS the democrats to lose the midterms. Less crowded battlespace.
People understand the Frat = rapey assertion is propaganda. Similarly people keep sending their daughters to college even though 1 in 5 women are notoriously sexually assaulted during their time on campus. People understand reality no matter how much the left is willing to live their own lives in FantasyLand.
Not tough to understand Josh.
I believe there are only 2 names in the Swetnick affidavit -- Kavanaugh and Judge. Seems convenient. None of the actual rapists are named.
"the ex-wife of Democrat media member Bob Beckel (forget her name offhand). "
Leland Keyser has basically denied every facet of Ford's story.
walter said...
Blogger Inga...Allie Oop said...
Inga swallows!
I am disappointed that the current SCOTUS has not put out a group statement deploring the damage done to the US criminal justice and the SCOTUS itself.
Real American said...
this entire thing is one of history's biggest bluffs. IT's built on a foundation of quicksand. You can't use one uncorroborated and politically motivated accusation to corroborate another just like it.
there's no fucking evidence that kavanaugh did any of the things he's accused of doing. the me too movement also depends on the credibility of the accusers and the strength of the supporting evidence, and it will go down in flames if it is repeatedly that the only evidence is the accusation itself.
eddie willers said...
I think the Commie-pinko lefties have their 2020 candidate - the one, the only, Michael Avenatti.
We have seen the last white male (Kerry) to top the Democratic Presidential ticket.
They have consciously decided to exclude the most successful people in history from consideration.
TA said...
As I read this, I'm thinking of Janet Malcolm and The Journalist and the Murderer. There's some irony here for the women who are talking to the press, as Malcolm emerges as a chronicler of this particular story.
As Malcolm so well knows, the story the journalist writes may not be the story the women want to tell, or even if it is mostly, may, when read in cold black print on a cold screen, will leave them looking perhaps like fools, or harboring a not so honorable agenda.
Ellis for 2020! The dude's bulletproof.
Vance said...
I object to the demand to ask Inga to reveal when she lost her virginity. Assumes facts not in evidence.
Also, I wonder if Inga's spouse (assuming she has one) is looking sideways at her, wondering if or when she'll accuse him of raping her by looking at her once on their wedding night or something.
By the way, what about Democrat Client No. 9; that New York AG--didn't he sexually assault women by paying them money to have sex with him?
@Dickinbimbos,
"The new gang rape accuser (who never said a thing until now!) is a government employee.
Of course."
Deep State meets Deep Throat!
(Sorry, I can't help it. I am going to trademark this:)
gg6 said...
"...The first accusation inspired credulity because of the built-up strength of the believe-all-survivors ETHIC"
(caps are mine). That's a total BS premise all by itself - "believe all survivors" is NOT an "ethic", it's a dysfunction. Something akin to the idea of a Journalist opining on the credulity of other Journalists. McCardle now becomes just another hack writing morality lessons for her less insightfully moral readers.
Infinite Monkeys said...
If he admitted to getting drunk, and rowdy at parties while in college, he'd be more credible.
Why? I didn't drink and/or get rowdy at parties in high school or college. You disbelieving him tells me more about you than it does about him.
She attended ten such parties, and was gang raped only at the first one.
Well, Ginsburg - to her credit - criticized the confirmation process about a week ago. That was before all of this craziness came out.
At this point the best thing is for them to remain quiet.
There, horrors! I used paragraph breaks in between my sentences.
Heartless Aztec said...
It's the brown acid. They're all on brown acid. Trippin' balls. It's the only explanation that makes sense.
The third set of allegations sounds like a woman's idea of how a gang rape takes place, but not like they actually do. I don't thinks girls would continue to attend parties where gang rapes take place or that such a thing could remain even remotely secret. They would have dozens of witnesses who would remember and corroborate. Or you can believe Michael Creepavanti, and the integrity-challenged people he seems to gravitate to.
RMc said...
Swetnick's charges will ring true with the far-lefty base because that's the way they think people like Kavanaugh are...all of them. "Well, of course K and company brutalized women in the more horrific ways -- they're Republicans, aren't they...?!"
I am beginning to think it is just a bluff by Swetnick and Avenatti- surely if they had the corroboration, nothing is gained by withholding it, right? Withholding it undermines the claim almost from the start.
How did he get her to sign an affidavit? She is now at risk for perjury. Of course the DSA members in DC know they will never be prosecuted.
It would be nice to surprise them.
Anything that depends on the credibility of journalist can no longer be credible, and it was always pretty rare.
I think Bill Clinton was the last person ever punished for perjury, and that still left him a hero of the Dems.
Bay Area Guy points out:
But point #2 is not quite right, is it? Even when the false accuser confesses or is proved way past the reasonable doubt stage to the “only a moron or a Democrat could possibly believe that crap” stage, it is rare that anything bad happens to her. Maybe some community service or a little probation. It’s all wink-wink, nudge-nudge and “girls sometimes exaggerate a little.”
buster said...
No matter how this turns out, the Supreme Court as an institution will suffer harm that will take decades to repair, and that could have been avoided if Ford's letter had been turned over to the Judiciary Committee last Jult, when Feinstein received it. As it is, it is impossible to arrive at even a rough consensus whether the process was fair, let alone whether the accusations are true. Feinstein or who ever is responsible for this outrage has a lot to answer for.
gerry said...
Dave Begley said...
State v. Owen, 1 Neb. App. 1060, 510 N.W.2d 503 (1993). In that case the defendant alleged she went to sex and drug parties with prominent Omaha people. She testified under oath that the Omaha police chief had afternoon sex with her in area motels. And that he used his gun in a sexual manner. She further testified that he had no surgical marks on his body.
At trial it was proved that he had significant scars on his arm from a gunshot injury and that he never carried a gun on the job.
Convicted for perjury.
The affidavit is general rather than specific so therefore it is harder to pin a perjury rap on Swetnick. Creep Porn Lawyer knows that.
Sammy Finkelman said...
>> McArdle had thought that "a second allegation would be stronger, not weaker, than the first."
If they are phony charges, they are released in inverse order of credibility.
>> The affidavit is general rather than specific so therefore it is harder to pin a perjury rap on Swetnick. Creep Porn Lawyer knows that.
Unless the conspiracy is broken, and we get testimony as to who put her up to it. (I mean besides Michael Avenetti, whose hands are probably clean)
This allegation has about the level of credibility of Pizzagate.
No matter how this turns out, the Supreme Court as an institution will suffer harm that will take decades to repair
Not if we get rid of the US Constitution.
That fucker is over a hundred years old! Hawaiian judge can issue the final rulings on critical issues.
The third set of allegations sounds like a [Title IX cultist's] idea of how a gang rape takes place,
Jackie from UVA was also undone by her immersion in the sexual assault apparatus on American campuses. Since they exclude reasonable people there was no one to explain how crazy their stories sounded as they escalated trying to one-up each others' horror stories. But then those stories transition from their controlled environment where no one is allowed to suggest asking hundreds of men to commit brutal rapes without a single one declining and reporting just isn't remotely plausible except to the insane.
It's amazing how closely the obvious failures in the two stories track each other.
In general, I oppose the ownership of guns, but from what I'm reading lately women need to pack a piece to blow away these rapists at parties. Kavanaugh is lucky to be alive, so is Clarence Thomas, and Cosby. Join the gun club girls.
Since POTUS has proclaimed a cancer at the FBI he should get his birth certificate investigators on this. Oh, but if Cohen is tied up....
Most men would refuse to participate in a gang rape, and they would certainly talk about it the next day. It could not be kept a secret.
Maybe left wing guys and sluts WERE having gang rape train parties in the 80s. But not us conservatives. THat's the kind of people they were and still are.
At this point I think we have to consider whether Avenatti is a Republican plant.
Weekend gang rapes... week after week - and nobody said anything.
I find Swetnick claims rather baffling in their implications:
* She was 19 and 20 when the events occurred.
* There were underage teens at these parties. (If she had sex with underage teens, she's guilty of statutory rape.)
* She claims to know gang rapes were happening, but a) did not report them and b) kept going to the parties. (She admitted to obstruction of justice.)
* She claims to have been gang raped in 1982, yet also states that she continued to go to the same parties into 1983.
* She claims that Kavanaughs claim of being a virgin to be "absolutely false and a lie" but no where actually refutes Kavanaugh's claim.
You'd think an experienced auteur like Stormy could write something more convincing.
Maybe she's pissed at Avenatti but still on the hook for his fees.
btw- we are not respecting Althouse's wish to stay on topic.
So, to go back to the post comment about credibility & the credibility of reporters:
Note: This stuff w/ Avanatti was not fact-checked by a reporter. He did not make his client available to investigative reporters like Farrow & Meyers.
I don't have any idea if it's credible or not. I'd find it more likely to be credible if Farrow & Meyers had investigated her story.
I think McArdle is being optimistic here. The Media is no longer a factor.
I'm aware of the stuff going on in Washington, so is Ms Althouse. Likely many people here. I would like you to ask your circle of acquaintances and people you see if they are. I did that the other day and no one knew anything about it.
How many people do you know who watch CNN or the news channels, who read newspapers? 1 in 30? Who read the Washington Post? 1 in 20,000?
It doesn't matter what the Media says. The delay by Republicans is to see if what Trump is telling them is true; the Media isn't worth listening to, they represent no one rational, and will have no effect on voters.
Anyone with a bit of interest will turn things on for a couple minutes and find rampant speculation and a prurient focus on the private lives of people. Then turn it off.
The credibility of the journalists goes up and down with the stakes. Didn't we establish that relationship yesterday?
If the #MeToo movement must be sacrificed to keep Kavanaugh off the court, the media has decided it must be done.
Women searched their souls and decided they'd rather let women continue to be raped and harassed as long as abortion remains legal.
"She attended ten such parties, and was gang raped only at the first one."
Your lowbrow, low I.Q. is showing. What is your ethnic makeup? Chimps are smarter than you are according to Stanford–Binet-Chimp testing.
Misplaced pants.
"She was so distressed by this that she did fuck-all about it, and evidently continued attending those parties. So she can fuck off and get bent.
Yes. I mean who doesn't report gang rape? That is some serious evil not reporting gang rape when it happens. She claims all sorts of guys gang raped all sorts of girls weekend after weekend. Like a conveyor belt. Nobody ever said a thing. Then they returned for more next weekend. Amazing.
>> Swetnick's charges will ring true with the far-lefty base because that's the way they think people like Kavanaugh are...all of them
Iisn't she alleging:
1) She went to parties she had no reason to go to, having graduated from high school two years before. (or what year is tis supposed to be taking place>?)0
2) She wnet there ten times, knowing what was going on.
3) No victims or witnesses ever reported it. In spite of the feminist movement already existing. No political machine dominated the area for that whole time.
4) You don't need a Supreme Court nomination for this to be major story, yet no publication ran anything about this for over 35 years. Rolling Stone wasn't interested?
We should note: It;s nto Brett Kavanaugh being smeared; it's Mark Judge. Who possibly may have done soemthing not quite like that, so he's afraid to testify.
https://www.thecut.com/2018/09/mark-judge-kavanaugh-prep-school-new-yorker.html
Rasor says that Judge “told her ashamedly” about an incident in which he and other boys took turns having sex with a drunk woman, per The New Yorker. He seemed to think it was consensual, she added, and he didn’t name anyone else who had been involved. There is no indication that Kavanaugh was one of the boys, The New Yorker notes.
But that story may also be not true and there's nothing that coinnects it to Geoergetown Prep or Kavanaugh.
Its publication seems to be have been tied in to this allegation.
An hour after the report was published, attorney Michael Avenatti tweeted an email in which he claimed to have “significant evidence” that Kavanaugh, Judge, and others would “participate in the targeting of women with alcohol/drugs in order to allow a ‘train’ of men to subsequently gang rape them.”
Pizzagate II.
Still, Judge was an alcoholic and wrote a book about it,
https://www.amazon.com/Wasted-Tales-Mark-Gauvreau-Judge/dp/1568381425
And Brett Kavanaugh did engage in some drinking (although he never had an alcoholic blackout he says)
And he pledged to a fraternity, (DKE) and maybe also a secret society (Truth and Courage aka as TNC and aka as something else) at Yale which were very contemptuous of women - or maybe not.
The fraternity as well as the secret society were eventually disbanded several decades later although the franernity was revived.
That's about the extent of any trurth to this.
If true, there will be many more people coming forth. I once talked to an archaeologist who said that lefties would plant artifacts to stop projects, but real artifacts come from an environment of stuff that is impossible to fake.
Blogger Kristian Holvoet said...
The credulous part is that the believe the women only applies to Republicans
Another thing they do, is, when the Democrat isn't too important, they shuffle him off the stage, like Eric Schneiderman, before the allegation can get too much publicity.
What, maybe you never heard of Eric Schneiderman?
My point exactly.
"Just because no one else shares your hobbyhorse doesn't mean people support cultism. Get over yourself you fucking idiot."
If you're not stopping it, you're for it.
To save abortion many women (and men) are cheering on other women making unsubstantiated accusations about rape.
Meanwhile, such unsubstantiated accusations will likely result in actual rape victims proceeding forward in a society where many will now be looking at such charges with increasing suspicion and cynicism.
So: access to no-limitations abortion is more important than women having a harder time getting justice in future sexual crimes.
Charles Bronson just talked to me from the Great Hereafter: he says y'all fucked up.
sinz52 said...
Michael K said: "Remember that the Bush TANG allegations were uncovered as a fraud by a blog reader, not the news media."
So was the infamous "fauxtography" scandal. That scandal concerned Reuters publishing photos of the Lebanon War that had been deliberately Photoshopped to make Israel's bombing campaign look more indiscriminate than it was.
https://en.wikipedia.org/wiki/Adnan_Hajj_photographs_controversy
That was ten times worse than the New Yorker story about Ramirez and Kavanaugh. The New Yorker is guilty of negligence (didn't bother to check sources well enough), but Reuters was guilty of deliberate fakery. | cc/2020-05/en_middle_0128.json.gz/line926 |
__label__cc | 0.706371 | 0.293629 | Restructuring Bourbon offloads laid-up anchor-handler
Restructuring French offshore support vessel (OSV) owner Bourbon has continued to trim its
Solstad Offshore offloads anchor handler
Solstad Offshore subsidiary Farstad Marine has sold 2002-built anchor handling tug supply vessel Far Saltire. The...
Splash24/7 2019-09-19
Bourbon sells anchor handler to Horizon Maritime
French offshore vessel provider Bourbon has sold one of its anchor handling tug supply (AHTS) vessels to Canada's Horizon Maritime. ... ......
Offshore Energy Today 2019-03-20
Solstad Farstad offloads anchor handler
Norway’s Solstad Farstad has sold 2011-built anchor handling tug supply vessel Sea Badger. The company has already delivered the...
Horizon Maritime sets up shop in Norway with Bourbon AHTS vessel deal
Canadian owner Horizon Maritime has completed the takeover of the 2016-built anchor handling tug supply vessel Bourbon Arctic from Bourbon and renamed the vessel Horizon...
12 Bourbons You Need To Have on Your Bar Cart
How Bourbon is Made: 12 Distilleries in 5 Days
Top 10 Budget-ish Bourbons (according to whiskey lovers)
The Top Six Bourbons of 2018
Irish People Try Bourbon For The First Time
How to Drink Your Bourbon Properly
Gallant - Bourbon
5 Things You Didn't Know About Blanton's Bourbon
Best Bourbons and Whiskeys for 2019 and Review
Bourbon races to rescue tug hit by Hurricane Lorenzo
French offshore vessel owner Bourbon has launched a rescue operation for tug supply vessel Bourbon Rhode, which developed a water ingress in the rear of the vessel after it was hit by bad weather associated with category 4 hurricane Lorenzo. The vessel, while headed for Guyana, was around 1,200 nautical miles off Martinique Island and 60 nautical miles...
Splash24/7
Solstad Farstad offloads PSV
Norway’s Solstad Farstad continues to trim its fleet back, selling 1996-built platform supply vessel Far Supporter. The sale of the...
Solstad Farstad sells two more anchor handlers
Solstad Farstad has announced the sale of two anchor handling tug supply vessels Far Senior (built 1998) and Far Sailor (built 1997). The pair appear to have been laid up at Floro in...
Bourbon to bring in conciliator to help with financial restructuring
French offshore vessel owner Bourbon Offshore has gone to the courts to commence conciliation procedures to help with its financial restructuring, a move which will see a conciliator appointed to help reach an agreement with the company’s stakeholders. Conciliation is a pre-insolvency procedure available to French companies which face legal or financial difficulties. Bourbon...
Solstad Offshore anchor handler extended by Eni
Norway’s Solstad Offshore has been awarded a contract extension for 2013-built anchor handling tug supply vessel...
Bourbon to offload 41 older vessels as part of digital transformation
French offshore giant Bourbon is accelerating its transformation plans, announcing a new strategic action plan called #BOURBONINMOTION, which it says will help it meet customer demands and improve competitiveness. The plan’s priorities will see the company reorganise activities into three divisions: Bourbon Marine & Logistics, Bourbon Subsea Services and Bourbon Mobility. Each...
Bourbon Whiskey: The Definitive Beginner Buying Guide (Part 1)
Find out what bourbon whiskey is the best for you to start your whiskey experience with. All under $50! Want to skip to the list? 1:40 - Buffalo Trace 2:09 - Bulleit Bourbon 2:35 - Four Roses Yellow Label 3:09 - Eagle Rare 3:28 - Knob Creek 4:00 - Wild Turkey 101 4:23 - Woodford Reserve Distiller\'s Select __________________________________________________________________ Come join the conversation on my discord, so many good people who love to talk whiskey: http://bit.ly/2Ly34iZ Like what I do? Consider looking at the perks of the Patreon. https://www.patreon.com/thewhiskeydic Want some more day to day dictionary? @thewhiskeydic on twitter and instagram Monthly Email Newsletter? http://bit.ly/WhiskeyNewsletter Reddit? Sure why not https://www.reddit.com/r/TheWhiskeyDictionary Interested in some merch? I sell Challenge Coins and Glencairns (send me an email to find out more!) T-shirts? http://bit.ly/WDMerch Just want to email me? I love hearing from all of you! thewhiskeydic@gmail.com #WhiskyTube #Whiskey #Whisky...
In an effort to not turn your living room into a Bourbon Bunker filled to the nines with bottles, we bring you 12(ish) Bourbons to have on your bar cart. This list is made with availability, price, and well-rounded function in mind, so if you don\'t see one of your favorites on here, we probably have a reason for it. That being said, selection is subjective, and we would love to hear what you keep on your bar cart! ----------------------------------------------------------------------------------------------------------- Patreon? Yeah! Become one of our drinking buddies. http://www.patreon.com/itsbourbonnight Social media? Oh, my, yes. @itsbourbonnight Facebook? Yep. http://www.facebook.com/itsbourbonnight Like the glasses and other items we use for Flight Fights, Uncorkings and more? You can find them right here: http://www.amazon.com/shop/itsbourbonnight Wanna say hi? Please do. itsbourbonnight@gmail.com PayPal, in case you want it: PayPal.Me/itsbourbonnight AFFILIATE DISCLOSURE: Any Amazon links used in this description will direct you to Amazon, and as an Amazon Associate, we earn a commission from qualifying purchases at no additional cost to you. #WhiskyTube #Bourbon #Whiskey...
We toured 12 distilleries in a five-day blitz, asking everyone we met to walk us through the bourbon-making process. Here, you’ll find all of the steps that go into making America’s unique take on whiskey. Read now -The Best Bourbons You Can Buy: https://gearpatrol.com/2019/03/22/best-bourbon-whiskey/ Special thanks to (in order of appearance): Dave Pudlo, Distillery Education Director at Maker’s Mark Distillery Freddy Johnson, Tour Guide at Buffalo Trace Distillery Drew Kulsveen, Master Distiller at Willett Distillery Hunter Davis, Tour Guide at the Jim Beam American Stillhouse Doug Wade, Miller at Maker’s Mark Distillery 6. Chris Morris, Master Distiller at Woodford Reserve *** Gear Patrol is a team of creators, users and enthusiasts, hell-bent on building the definitive resource for discovering products and exploring the stories that surround them. Want more from Gear Patrol? Website: https://gearpatrol.com Twitter: https://twitter.com/gearpatrol Instagram: https://instagram.com/gearpatrol Facebook: https://www.facebook.com/gearpatrol Note: Purchasing products through our links may earn us a portion of the sale, which supports our editorial team’s mission. Learn more here: https://gearpatrol.com/about/#affiliate -~-~~-~~~-~~-~- Please watch: \"Samsung Galaxy Note10+ | First Look at the New Smartphone\" https://www.youtube.com/watch?v=hsaaoZXEcDQ -~-~~-~~~-~~-~-...
Today we taste through our list of the Top Ten Budget-ish Bourbons crowdsourced from whiskey lovers around the world. The list includes Four Roses Small Batch, Wild Turkey 101, Woodford Reserve, Ejila Craig Small Batch, Michter\'s American, McKenna 10, Make\'s Mark, Eagle Rare, Buffalo Trace and Bulleit Bourbon. #10 Woodford Reserve #9 Four Roses Small Batch #8 Elijah Craig #7 Michters American (Not Bourbon) #6 Henry McKenna Bottled in Bond #5 Makers Mark #4 Bulleit Bourbon #3 Wild Turky 101 #2 Eagle Rare #1 Buffalo Trace If you want to toast the channel: 1) Upload your video toast to YouTube. 2) Mark it as \"unlisted\" if you don\'t want the video to appear in public search results. 3) Put a link to the video in our comments with the hashtag \"#toast\". Check out the Instagram account @whiskey_marketing_school ** Can I donate a whisk(e)y for you to review in The Whisk(e)y Vault? Of course! If you’re interested in making a tax-deductible donation towards our whiskey selection, head on over to: 11:27 - boof http://austinwhiskyvault.com/whisky-donations/ ** What\'s with the necklaces? Rex is a whiskey mooch. His necklace is a manifestation of pure glory - forged from the irradiated bones of eagles and wolves. Also a tube sock. See the origin story here: http://goo.gl/JMc2Hr Daniel is a whiskey sommelier. His necklace is a token of his sommelier level, and he trains whiskey sommeliers at The Whisk(e)y Marketing School in Austin Texas. **A Whisk(e)y school? Yup. Here are a few things we believe. ** You don’t have to be a snob to appreciate and love great whiskey. Whi...
We\'ve been waiting all year for this one! We took 21 contenders from 2018 and whittled it down the best six bourbons of the year. But we didn\'t stop there, we then took our favorite four to the Flight Fight stage to determine the Best Bourbon of 2018! ----------------------------------------------------------------------------------------------------------- Patreon? Yeah! Become one of our drinking buddies. http://www.patreon.com/itsbourbonnight You can buy official It\'s Bourbon Night merch! http://www.whiskeyambitions.com Social media? Oh, my, yes. @itsbourbonnight Facebook? Yep. http://www.facebook.com/itsbourbonnight Like the glasses and other items we use for Flight Fights, Uncorkings and more? You can find them right here: http://www.amazon.com/shop/itsbourbonnight Want to drop us a line? itsbourbonnight@gmail.com (Disclaimer: We receive a small commission on items bought through our Amazon store. It helps out the channel and doesn\'t cost the buyer any extra in the process.) #WhiskeyTube #BestBourbon #Bourbon...
\"This is something a cowboy would drink when he wants to kill himself.\" Subscribe to Facts. http://goo.gl/yEIawC - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - More Information: Ireland produces a fair amount of whiskey but bourbon is a specifically American delicacy. We gave our contributors a sample of the finest bourbons. #tastetest #food #bourbon - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - People featured in this video: facts.yt Have a suggestion for a Facts. video? https://facts.yt/suggestions - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Credits : Produced by Creative Nation Music licensed from Epidemic Sound Facts. is an online brand that creates short and relate-able videos including taste tests, watching TV/ YouTubers, gender taboos & more. Similar to channels such as BuzzFeed, WatchCut, TheFineBros & GMM we focus on creating content that depicts people (usually Irish people) experiencing new things for the first time, whether that be food, drink or maybe a TV show!...
Glasses I LOVE: http://amzn.to/2kGYrYn Norlan Glasses I use: http://amzn.to/2yQytqj Kid you not, I use this SOAP: http://amzn.to/2DCd5I1 DELICIOUS: http://amzn.to/2BVmGJz Is there a right way to drink your bourbon or whiskey? The short answer is yes. Subscribe for new videos every Saturday: https://goo.gl/JCpjAJ There are four different ways to drink your bourbon, as well as four ways to properly enjoy it. You can drink whiskey mixed, on the rocks, with a splash of water, or neat. But no matter how you take your drink, there are four steps to enjoying it. First take a good whiff and enjoy the aroma. Then check out the color and appreciate the age (as well as the money you\'ve just spent on that dram). Then sip and enjoy. Finally, repeat. Facebook: https://www.facebook.com/thebourbonite/ Instagram: https://www.instagram.com/thechris_fox...
Gallant - Bourbon • It’s been less than a year since Gallant premiered his slinky breakout, “Weight In Gold,” and now he’s back with an album and a soaring new track \"Bourbon\". The L.A. based singer is going to release his debut LP, Ology, April 6. \"I\'ve waited a long time to say everything that I\'m saying in this album and it\'s terrifying to think that people will hear it. But I couldn\'t be more proud of this body of work and I hope people take it in a way that\'s as honest as I was when I was making it.\" – Gallant ● STREAM Ology spotify - https://open.spotify.com/album/4VZh7EI0gjL2FkLWNBVIWf ● FOLLOW Gallant facebook - https://facebook.com/sogallant instagram - https://instagram.com/sogallant ● PHOTO Dea Ardyanda http://deaardyanda.tumblr.com/ ● LYRICS \"BOURBON\": i’m a headless horseman on quilted sand dunes. with my neck wide open, i pray for refuge cuz since I\'ve been found i’ve been living a life in cages withering down to the champagne quicksand wrestling doubt i’ve been dragging around for ages i tried to let it drain but my veins are hopeless cuz I loved in cold blood and got used to it angels say trust the detox, but I’m shaking I need it like bourbon in my coffee cup i’m a tritone bible with misprint logic; i count lunar cycles with faithless prophets i’m a mountainless valley never comforted crashing i\'m just another stone on broken walls racing the wind in a hurricane i’m not as brave as i once was i’ve been kicking these rocks in a river and they’ve been sinking low ● EXPLORE Majestic Casual all uploads - https://www.youtube.com/playlist?list...
Even the casual Bourbon drinker has heard of Blanton\'s, but there\'s a lot more about the Kentucky Straight Bourbon Whiskey that you might not know about. Here\'s 5 facts about Blanton\'s that you might have not known! ----------------------------------------------------------------------------------------------------------- Patreon? Yeah! Become one of our drinking buddies. http://www.patreon.com/itsbourbonnight Social media? Oh, my, yes. @itsbourbonnight Facebook? Yep. http://www.facebook.com/itsbourbonnight Like the glasses and other items we use for Flight Fights, Uncorkings and more? You can find them right here: http://www.amazon.com/shop/itsbourbonnight Wanna say hi? Please do. itsbourbonnight@gmail.com PayPal, in case you want it: PayPal.Me/itsbourbonnight Visit http://www.nobourbonfest.com for tickets to the New Orleans Bourbon Festival. See you there! (Disclaimer: We receive a small commission on items bought through our Amazon store. It\'s a way you can support our channel and doesn\'t cost you any extra in the process.) #WhiskyTube #Bourbon #Whiskey...
Whiskey tips for the best Bourbons for 2019 from Whiskey Expert Tom Fischer along with Bourbon and whiskey suggestions for an epic taste test for your New Year\'s Eve or cocktail party. A bonus whiskey review of Second Glance Bourbon by Savage and Cooke, Highland Park Full Volume Scotch Whisky, and Jefferson\'s Manhattan Barrel Finished Cocktail. For more on the best new whiskies, liquor and cocktail trends, subscribe to our BourbonBlog YouTube channel....
Find out what bourbon whiskey is the best for you to start your whiskey experience with. All under $50! Want to skip to the list? 1:40 - Buffalo Trace 2:09 - Bulleit Bourbon 2:35 - Four Roses Yellow Label 3:09 - Eagle Rare 3:28 - Knob Creek 4:00 - Wild Turkey 101 4:23 - Woodford Reserve Distiller\'
In an effort to not turn your living room into a Bourbon Bunker filled to the nines with bottles, we bring you 12(ish) Bourbons to have on your bar cart. This list is made with availability, price, and well-rounded function in mind, so if you don\'t see one of your favorites on here, we probably hav
We toured 12 distilleries in a five-day blitz, asking everyone we met to walk us through the bourbon-making process. Here, you’ll find all of the steps that go into making America’s unique take on whiskey. Read now -The Best Bourbons You Can Buy: https://gearpatrol.com/2019/03/22/best-bourbon-whis
Today we taste through our list of the Top Ten Budget-ish Bourbons crowdsourced from whiskey lovers around the world. The list includes Four Roses Small Batch, Wild Turkey 101, Woodford Reserve, Ejila Craig Small Batch, Michter\'s American, McKenna 10, Make\'s Mark, Eagle Rare, Buffalo Trace and Bul
We\'ve been waiting all year for this one! We took 21 contenders from 2018 and whittled it down the best six bourbons of the year. But we didn\'t stop there, we then took our favorite four to the Flight Fight stage to determine the Best Bourbon of 2018! ----------------------------------------------
\"This is something a cowboy would drink when he wants to kill himself.\" Subscribe to Facts. http://goo.gl/yEIawC - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - More Information: Ireland produces a fair amount of whiskey but bourbon is a specifically American delicacy. We gave our
Glasses I LOVE: http://amzn.to/2kGYrYn Norlan Glasses I use: http://amzn.to/2yQytqj Kid you not, I use this SOAP: http://amzn.to/2DCd5I1 DELICIOUS: http://amzn.to/2BVmGJz Is there a right way to drink your bourbon or whiskey? The short answer is yes. Subscribe for new videos every Saturday: https:
updated: 10 Jun 2017
Gallant - Bourbon • It’s been less than a year since Gallant premiered his slinky breakout, “Weight In Gold,” and now he’s back with an album and a soaring new track \"Bourbon\". The L.A. based singer is going to release his debut LP, Ology, April 6. \"I\'ve waited a long time to say everything that I\'
updated: 02 Mar 2016
Even the casual Bourbon drinker has heard of Blanton\'s, but there\'s a lot more about the Kentucky Straight Bourbon Whiskey that you might not know about. Here\'s 5 facts about Blanton\'s that you might have not known! -----------------------------------------------------------------------------------
Whiskey tips for the best Bourbons for 2019 from Whiskey Expert Tom Fischer along with Bourbon and whiskey suggestions for an epic taste test for your New Year\'s Eve or cocktail party. A bonus whiskey review of Second Glance Bourbon by Savage and Cooke, Highland Park Full Volume Scotch Whisky, and | cc/2020-05/en_middle_0128.json.gz/line927 |
__label__cc | 0.508109 | 0.491891 | Chat Now Chat
State-Required Information
ARVA Mission Statement
How It Works (K-8)
How It Works (High School)
Myths about Online Schools
Expectations for Online Schools
K-8 Curriculum
Destinations Career Academy
Agriculture Science and Technology
Business and Marketing Technology
Science Technology Engineering and Math (STEM)
Trade and Industry: Visual Arts
Events for Enrolled Families
Events for Prospective Families
Learning Coach Corner
Enrollment and Attendance FAQs
Testing and Assessment FAQs
OLS Login
We are not available at this time. Please fill out the form below and an enrollment consultant will contact you within 48 hours or less. Thank you.
Type* Select Work Home Cell
State* Select State Alabama Alaska Arizona Arkansas California Colorado Connecticut Delaware District of Columbia Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Virginia Washington West Virginia Wisconsin Wyoming Outside of USA
High school enrollment closed. Grades K–8 still open! Enroll now!
Choose a Pathway with Destinations Career Academy. Go>>
Attend an Information Session to Discover Public School at Home! Go!
#EverySchoolDayCounts – From day 1 until the last day of school, attendance matters! Go>>
Find college and career options all in one place with Tallo! Learn more.
Minutes of Regular and Special Board Meetings
Arkansas Virtual Academy is governed by a Board comprised of community leaders. Public notice of our board meetings can be found here.
Meeting Notice Posted
Please direct any questions to ARVA Head of School, Amy Johnson at ajohnson@arva.org.
Upcoming Board Meeting Agenda
***Special Committee Meeting***
Zoom online meeting
Contact ARVA office for meeting details/access
ARVA Office
1400 W. Markham Suite 206
March 16th, 2020 4:00 PM
June 8th, 2020 4:00 PM
July 13th, 2020 4:00 PM
Past Board Meeting Minutes
Board Meeting Minutes – August 2019
Board Meeting Minutes – June 2019 [PDF]
Board Meeting Minutes – March 2019 [PDF]
Board Meeting Minutes – January 2019 [PDF]
Board Meeting Minutes – November 2018 [PDF]
Board Meeting Minutes – January 22, 2018 [PDF]
Board Meeting Minutes – March 12, 2018 [PDF]
Board Meeting Minutes – May 7, 2018 [PDF]
Revenue and Budget Information
2018 Financial Statement [PDF]
District Budgets (current year)
2019–2020 Budget [PDF]
Licensed Salary Schedules and Personnel Policies
Arkansas Virtual Academy holds a waiver from Salary Schedule.
2019–2020 Certified Personnel Policies
2019–2020 Classified Personnel Policies
2018–2019 Certified Personnel Policies [PDF]
2018–2019 Classified Personnel Policies [PDF]
2019–2020 District Employee Information [PDF]
State and Local Revenue Sources
2020 Preliminary State Aid Notice [PDF]
2019 Final State Aid Notice [PDF]
Annual District/School Report Card
2017–2018 School Report Card
Dyslexia Announcement
Dyslexia Announcement [PDF]
School Improvement Status of Each School
2019-2020 Elementary School Improvement Plan [PDF]
2019-2020 Middle School Improvement Plan [PDF]
2019-2020 High School Improvement Plan [PDF]
2018–2019 Elementary School Improvement Plan [PDF]
2018–2019 Middle School Improvement Plan [PDF]
2018–2019 High School Improvement Plan [PDF]
District Parent and Family Engagement Plan 2019–2020
Elementary Parent and Family Engagement Plan 2019–2020
Middle School Parent and Family Engagement Plan 2019–2020
High School Parent and Family Engagement Plan 2019–2020
Elementary Parent and Family Enagement Plan 2018-2019
Middle School Parent and Family Engagement Plan 2018-2019
High School Parent and Family Engagement Plan 2018-2019
2019–2020 Annual Report to the Public
2017–2018 Annual Statistical Report
Arkansas Annual Statistical Report State Page
ARVA Operations Documents
Immunization Report [XLSX download]
Comprehensive School Counseling Plan
2019-2020 Comprehensive School Counseling Plan [PDF]
Current ARVA Board Members
Dr. Gary M. McHenry, Board Chair
Gary McHenry is the Director of Education for the Schmieding Center for Senior Health and Education, a Center on Aging affiliated with the University of Arkansas for Medical Science's Reynolds Institute on Aging. Dr. McHenry is responsible for the choice and delivery of the Center's education programs for health professionals, paraprofessionals, and the general public. Dr. McHenry also manages the Center's Community Aging Resources, Education and Services project (C.A.R.E.S.).
From 1996 to 2010 Dr. McHenry was the Director of Credit Studies for the University of Arkansas' School of Continuing Education and Academic Outreach. In that capacity he managed the delivery of University of Arkansas academic courses and programs through the Departments of Independent Study, Off-Campus Classes, and National/International Credit Studies.
Dr. McHenry has served in a number of university, public service, and non-profit organizations which include past-commissioner, past-regional chair, and past-board member of the University Continuing Education Association, past-chair of the Chamber of Commerce Leadership Fayetteville Education Committee, past-chair and current member of the Arkansas Fair Housing Commission, current chair of the Arkansas Advisory Committee to the U.S. Commission on Civil Rights, and current national program director for the Leadership Training Institute of America.
Dr. McHenry has a B.S. in Mathematics from Southern Arkansas University, a M.S. in Computer Science and an Ed.D. in Workforce Development from the University of Arkansas.
Jess Askew III, Vice Chair
Jess Askew practices in the areas of business litigation, constitutional, media and appellate law. His recent notable cases include Arkansas Blue Cross v. Little Rock Cardiology Clinic, 551 F. 3d 812 (2009), dealing with federal ancillary jurisdiction in a health-care case; Arkansas Democrat-Gazette v. District Court, Ark. S. Ct. No. 08-1435 (Dec. 18, 2008), establishing the availability of a writ of certiorari from a circuit court to an inferior court under Amendment 80 to the Arkansas Constitution; Cox v. Daniels, 374 Ark. 437 (2008), rejecting a ballot-title challenge to the Arkansas College Scholarship Lottery Amendment under Amendment 7 to the Arkansas Constitution; Pulaski County v. Arkansas Democrat-Gazette, Inc., 370 Ark. 459 (2007), affirming the right of access to emails of a public employee against privacy challenges; Beverly Enters. - Ark., Inc. v. Circuit Court, 367 Ark. 13 (2006), reversing a $25 million supersedeas requirement imposed by a trial judge in a class action and clarifying the law of supersedeas bonds, and Hartford Fire Ins. Co. v. Sauer, 358 Ark. 89 (2004), and Advocat, Inc. v. Sauer, 353 Ark. 29 (2003), which together reduced by $51.5 million the largest personal injury judgment in the history of Arkansas.
A Little Rock native, Mr. Askew graduated with honors from Harvard University in 1982 and magna cum laude from the University of California, Hastings College of the Law in 1986. In law school he was Order of the Coif, a member of the Thurston Society, and an editorial board member of the Hastings Constitutional Law Quarterly. After law school, he was a law clerk for two years for Richard Sheppard Arnold of the United States Court of Appeals for the Eighth Circuit.
Mr. Askew is a member of the American Bar Association and its Litigation Section, and the Media Law Resource Center. In the Arkansas Bar Association, he has served as a member of the House of Delegates, Chair of the Appellate Practice Committee and was the first Chair of the Arkansas Bar Association's Litigation Section. Mr. Askew is listed in Best Lawyers in America under Appellate Law, Communications Law, Media Law, First Amendment Law and Commercial Litigation; in Chambers USA as a "Leader" in the field of General Commercial Litigation; and in Mid-South Super Lawyers in the areas of Business Litigation and Intellectual Property Litigation. Mr. Askew is active in civic and non-profit groups and serves as Chairman of the Board of eSTEM Public Charter Schools, Inc., which supports the eSTEM Public Charter Schools in downtown Little Rock. He is a cyclist, woodworker, gardener and, with his wife, Kate Anderson Askew, the proud parent of two daughters.
Paige Gorman, Secretary/Treasurer
Paige Gorman earned her Bachelor’s in Human Development and Family Studies with Child Development Emphasis from the University of Arkansas, Fayetteville in 1991. She earned her Master’s in Early Childhood/Special Ed. Interdisciplinary Studies of Preschool Education and Development in 1994. She feels strongly that students receive quality education from early childhood throughout the student’s academic career as reflected in her experience.
Ms. Gorman has served in a multitude of roles related to education. She has worked in early childhood classrooms, served at the state level, and most recently, as an educational consultant for a private education company. Additionally, she has taught her three children while in the role of ARVA learning coach and understands the importance of that role.
Ms. Gorman is an experienced trainer for her academic colleagues. She has presented at workshops and conferences at the local, state, and national levels related to providing quality early childhood education. She provided consultation services for the Oklahoma State Department with the “STARS” licensing system and as a Research Data Collector with the University of North Carolina at Chapel Hill, she produced a training video on a program used to assess the quality of early childhood programs. Ms. Gorman has worked at the state level as the Resource Center Director and then the State Approval Coordinator for Arkansas. During this same time frame, she also served as Treasurer on the State Board for the Arkansas Early Childhood Association.
Ms. Gorman is active in her local community. She has enjoyed volunteering at her children’s schools and extra-curricular activities including Little Rock Lacrosse, the Innovation HUB, and scouting activities.
Ann Clemmer
Ann Clemmer is the Senior Associate Director for Academic Affairs at the Arkansas Department of Higher Education. Ms. Clemmer oversees the Academic Affairs staff, coordinating with the Academic Officers of public colleges and universities in Arkansas, examining academic programs and practices to provide informed recommendations to the Arkansas Higher Education Coordinating Board. Prior to this position, Ms. Clemmer was an Instructor of Political Science at the University of Arkansas - Little Rock for 23 years.
Ms. Clemmer is active in civic and community affairs. She served our state as a member of the House of Representatives from 2009–2015 where she worked on many committees in support of education. She is involved in several organizations, such as, the Benton and Bryant chambers of commerce, Economics Arkansas, and the Arkansas Humanities Council.
Ms. Clemmer received a Bachelors and Master's degree in political science from Arkansas State University.
David Straessle
Dana Kelley
Oops! Looks like you forgot something.
Which grades are you interested in?
Type... home work cell
Interested in a career preparation program?
CTE - Interested
Considering ARVA?
Learn How to Enroll
to explore on your own
for face-to-face or live online discussion
866.339.4951 Call to talk to an enrollment consultant
Tweets by OPS_Virtual
Enter K12's 2019 Art Contest!
Create and submit your ARTISTIC ADVENTURE piece for a chance to win! All students in kindergarten through 12th grade are invited to enter.
{{/showImage}}
{{#news_and_or_announcement_item}} {{title}} {{/news_and_or_announcement_item}} {{#event_item}} {{event_name}} {{/event_item}}
{{#showFormattedDate}}
{{date_formatted}}
{{/showFormattedDate}} {{#showDescription}}
{{/showDescription}}
{{/listData}} {{#viewAllText}}
{{viewAllText}}
{{/viewAllText}}
The Arkansas Virtual Academy
1400 West Markham Street
K12 Customer Support
Follow ARVA
Families do not pay tuition for a student to attend an online public school. Common household items and office supplies like printer ink and paper are not provided. Our enrollment consultants can help address your technological and computer questions and needs.
Copyright © 2020 Arkansas Virtual Academy. All rights reserved.
No Video Presentation Available for this Page | cc/2020-05/en_middle_0128.json.gz/line929 |
__label__wiki | 0.885681 | 0.885681 | A 3-Year-Old Died After Eating A Grilled Cheese At Pre-K And His Parents Want Answers
Officials in New York City have shut down a preschool and launched an investigation after a 3-year-old died from what his parents say was an allergic reaction to a grilled cheese sandwich.
Last week, Elijah Silvera was playing at the Seventh Avenue Center for Family Services in Manhattan when a worker at the preschool gave him a grilled cheese to eat. The school had previously been given documentation stating Elijah “has a severe allergy to dairy” products, according to a GoFundMe page created by a family member.
On Wednesday, health officials shuttered the facility for failing to follow its written safety plan and inadequately supervising a child, said Christopher Miller, a spokesman for the New York City Department of Health and Mental Hygiene.
“There is nothing more important than the safety of our children and we are deeply saddened by this tragedy,” Miller said. “We will get to the bottom of what happened here. In the meantime, we closed the Center for Family Services and continuing to aggressively investigate what happened and whether the facility could have done something differently to prevent this tragedy.”
After eating the sandwich, family members say that Elijah “went into anaphylactic shock,” but the school did not seek emergency help. The New York City Fire Department told the New York Times that no emergency calls came from the center that day. Ruben Porras, a family member, said that the school called Elijah's mother, Dina Hawthorne, who rushed him to the hospital.
Elijah, his mother, and 5-year-old brother, Sebastian.
Emergency room doctors were “tragically unable to save him,” the family said.
“I lost one of the loves of my life yesterday,” Hawthorne posted on Facebook. “My son Elijah passed away.”
The pre-kindergarten school is a nonprofit, federally-funded Head Start program geared to providing care and education to economically disadvantaged three and four-year-olds and their families, health officials said.
“There were no red flags at the center,” Lorelei A. Vargas, a deputy commissioner at the Administration for Children’s Services, said from a press conference at the now-shuttered school on Thursday.
The boy's mother and father, “overwhelmed by grief,” want a second, independent autopsy to clarify “where responsibility for Elijah’s death will fall between the pre-K and the hospital itself,” the family's GoFundMe page said. “Where, if any, breakdowns may have occurred at either the school or the hospital. We just want justice for Elijah.”
BuzzFeed News has reached out to his parents and school for comment
Source: https://www.buzzfeed.com/usnews.xml
People Are Messaging Their Moms After Reading This Teen's Realization About Her Mom Being An "Angel"
Apple plans software update to fix iPhone X screen responsiveness in cold weather – The Verge
Belkin High-Speed Internet Modem Cable with Signal Exact Twist Technology, RJ11M/M (15 Feet)
TP-Link Wireless Wi-Fi Router $29.99 – $69.99
Best Choice Products Digital safe Drop Deposit Front Load Cash Vault Depository Lock Box Home Jewelry
BiteBuster Nitrile/Kevlar Bite Gauntlet Extreme Cat Glove, 18-Inch, Medium/Large, Blue
Type-c to HDMI adapter cable transfer rate can reach USB 3.1 10Gbps $10.90
12V 7.2AH Battery Replaces Razor Ground Force Drifter Fury By Neptune Power $18.99
VIPERTEK VTS-195 METAL Rechargeable Police Stun Gun LED Flashlight + Taser Case
Vinker T-01A DIY Kit 99 Zones Wireless Home and Office Security Alarm System with Auto-Dial, Door / Window Magnetic Contacts Sensor, PIR Motion Detectors and Siren, Create a Safe & Intelligent Life for You.
Dahua HAC-HDBW1220E 2MP 1080P HDCVI IR Dome Camera HD and SD output switchable $60.00
First Alert AUTO5 Auto Fire Extinguisher, Red $28.30
2 PACK POLICE MAGNUM PEPPER SPRAY .50oz PINK MOLDED KEYCHAIN $9.49 | cc/2020-05/en_middle_0128.json.gz/line931 |
__label__cc | 0.718013 | 0.281987 | How to extract building footprints from satellite images using deep learning
Siyu Yang Data Scientist, AI for Earth
As part of the AI for Earth team, I work with our partners and other researchers inside Microsoft to develop new ways to use machine learning and other AI approaches to solve global environmental challenges. In this post, we highlight a sample project of using Azure infrastructure for training a deep learning model to gain insight from geospatial data. Such tools will finally enable us to accurately monitor and measure the impact of our solutions to problems such as deforestation and human-wildlife conflict, helping us to invest in the most effective conservation efforts.
Applying machine learning to geospatial data
When we looked at the most widely-used tools and datasets in the environmental space, remote sensing data in the form of satellite images jumped out.
Today, subject matter experts working on geospatial data go through such collections manually with the assistance of traditional software, performing tasks such as locating, counting and outlining objects of interest to obtain measurements and trends. As high-resolution satellite images become readily available on a weekly or daily basis, it becomes essential to engage AI in this effort so that we can take advantage of the data to make more informed decisions.
Geospatial data and computer vision, an active field in AI, are natural partners: tasks involving visual data that cannot be automated by traditional algorithms, abundance of labeled data, and even more unlabeled data waiting to be understood in a timely manner. The geospatial data and machine learning communities have joined effort on this front, publishing several datasets such as Functional Map of the World (fMoW) and the xView Dataset for people to create computer vision solutions on overhead imagery.
An example of infusing geospatial data and AI into applications that we use every day is using satellite images to add street map annotations of buildings. In June 2018, our colleagues at Bing announced the release of 124 million building footprints in the United States in support of the Open Street Map project, an open data initiative that powers many location based services and applications. The Bing team was able to create so many building footprints from satellite images by training and applying a deep neural network model that classifies each pixel as building or non-building. Now you can do exactly that on your own!
With the sample project that accompanies this blog post, we walk you through how to train such a model on an Azure Deep Learning Virtual Machine (DLVM). We use labeled data made available by the SpaceNet initiative to demonstrate how you can extract information from visual environmental data using deep learning. For those eager to get started, you can head over to our repo on GitHub to read about the dataset, storage options and instructions on running the code or modifying it for your own dataset.
In computer vision, the task of masking out pixels belonging to different classes of objects such as background or people is referred to as semantic segmentation. The semantic segmentation model (a U-Net implemented in PyTorch, different from what the Bing team used) we are training can be used for other tasks in analyzing satellite, aerial or drone imagery – you can use the same method to extract roads from satellite imagery, infer land use and monitor sustainable farming practices, as well as for applications in a wide range of domains such as locating lungs in CT scans for lung disease prediction and evaluating a street scene.
Illustration from slides by Tingwu Wang, University of Toronto (source).
Satellite imagery data
The data from SpaceNet is 3-channel high resolution (31 cm) satellite images over four cities where buildings are abundant: Paris, Shanghai, Khartoum and Vegas. In the sample code we make use of the Vegas subset, consisting of 3854 images of size 650 x 650 squared pixels. About 17.37 percent of the training images contain no buildings. Since this is a reasonably small percentage of the data, we did not exclude or resample images. In addition, 76.9 percent of all pixels in the training data are background, 15.8 percent are interior of buildings and 7.3 percent are border pixels.
Original images are cropped into nine smaller chips with some overlap using utility functions provided by SpaceNet (details in our repo). The labels are released as polygon shapes defined using well-known text (WKT), a markup language for representing vector geometry objects on maps. These are transformed to 2D labels of the same dimension as the input images, where each pixel is labeled as one of background, boundary of building or interior of building.
Some chips are partially or completely empty like the examples below, which is an artifact of the original satellite images and the model should be robust enough to not propose building footprints on empty regions.
Training and applying the model
The sample code contains a walkthrough of carrying out the training and evaluation pipeline on a DLVM. The following segmentation results are produced by the model at various epochs during training for the input image and label pair shown above. This image features buildings with roofs of different colors, roads, pavements, trees and yards. We observe that initially the network learns to identify edges of building blocks and buildings with red roofs (different from the color of roads), followed by buildings of all roof colors after epoch 5. After epoch 7, the network has learnt that building pixels are enclosed by border pixels, separating them from road pixels. After epoch 10, smaller, noisy clusters of building pixels begin to disappear as the shape of buildings becomes more defined.
A final step is to produce the polygons by assigning all pixels predicted to be building boundary as background to isolate blobs of building pixels. Blobs of connected building pixels are then described in polygon format, subject to a minimum polygon area threshold, a parameter you can tune to reduce false positive proposals.
Training and model parameters
There are a number of parameters for the training process, the model architecture and the polygonization step that you can tune. We chose a learning rate of 0.0005 for the Adam optimizer (default settings for other parameters) and a batch size of 10 chips, which worked reasonably well.
Another parameter unrelated to the CNN part of the procedure is the minimum polygon area threshold below which blobs of building pixels are discarded. Increasing this threshold from 0 to 300 squared pixels causes the false positive count to decrease rapidly as noisy false segments are excluded. The optimum threshold is about 200 squared pixels.
The weight for the three classes (background, boundary of building, interior of building) in computing the total loss during training is another parameter to experiment with. It was found that giving more weights to interior of building helps the model detect significantly more small buildings (result see figure below).
Each plot in the figure is a histogram of building polygons in the validation set by area, from 300 square pixels to 6000. The count of true positive detections in orange is based on the area of the ground truth polygon to which the proposed polygon was matched. The top histogram is for weights in ratio 1:1:1 in the loss function for background : building interior : building boundary; the bottom histogram is for weights in ratio 1:8:1. We can see that towards the left of the histogram where small buildings are represented, the bars for true positive proposals in orange are much taller in the bottom plot.
Last thoughts
Building footprint information generated this way could be used to document the spatial distribution of settlements, allowing researchers to quantify trends in urbanization and perhaps the developmental impact of climate change such as climate migration. The techniques here can be applied in many different situations and we hope this concrete example serves as a guide to tackling your specific problem.
Another piece of good news for those dealing with geospatial data is that Azure already offers a Geo Artificial Intelligence Data Science Virtual Machine (Geo-DSVM), equipped with ESRI’s ArcGIS Pro Geographic Information System. We also created a tutorial on how to use the Geo-DSVM for training deep learning models and integrating them with ArcGIS Pro to help you get started.
Finally, if your organization is working on solutions to address environmental challenges using data and machine learning, we encourage you to apply for an AI for Earth grant so that you can be better supported in leveraging Azure resources and become a part of this purposeful community.
I would like thank Victor Liang, Software Engineer at Microsoft, who worked on the original version of this project with me as part of the coursework for Stanford’s CS231n in Spring 2018, and Wee Hyong Tok, Principal Data Scientist Manager at Microsoft for his help in drafting this blog post. | cc/2020-05/en_middle_0128.json.gz/line932 |
__label__cc | 0.726299 | 0.273701 | Bone Faction Coin
The Court of the Dead, the original series by Sideshow Collectibles, tells the story of the war between Heaven and Hell. The monetary system of The Underworld features coins that represent each of the factions of the court.
Details: The front of the Bone Faction coin features a four eyed skull on a decorative disk surrounded by a pentagon engraved in the language of the Underworld. Five evenly spaced spikes connect the skull to the pentagon. The Court of the Dead coin is officially licensed with Sideshow Collectibles. The Bone Faction coin measures 31.4 mm long, 31.4 mm wide, and 4.8 mm at the thickest point. The coins weighs 9.1 grams.
Packaging: This item comes packaged in a satin pouch. Includes Card of Authenticity.
“Court of The Dead”, “Rise Conquer Rule”, and the characters and places herein, are trademarks of ©2016 Sideshow, Inc. Court of the Dead under license to Badali Jewelry. All Rights Reserved.
Back to VAMPIRE | cc/2020-05/en_middle_0128.json.gz/line934 |
__label__cc | 0.650673 | 0.349327 | Photograph by Charlie Engman
Photograph by Prince Gyasi
Dead White Man's Clothes
In Accra, Ghana, imported second-hand clothing—or “dead white man’s clothes”—represents a massive industry with complex environmental, social, and economic implications.
Words by Liz Ricketts and J. Branson Skinner
Photographs by Charlie Engman and Prince Gyasi
5°33′00.5″ N, 0°12′31.2″ W
It’s 5 AM on Saturday and Abena dresses for work. Using the light of her phone to guide her to the kitchen, she moves quietly, trying not to wake her two children, who returned just yesterday from spending Christmas holiday with their grandmother. They will start school on Monday—Junior in primary school and Prince in junior high school—and they must be well rested.
Abena is tired, but today is day six, the last day of her workweek. Tomorrow she will rest, attend church, catch up with her boys, and pound fufu for a shared family meal. Saturday is a market day, the busiest day of the week. Abena is in a rush to get to Kantamanto early, so she doesn’t get stuck in gridlock traffic and miss her top customers. The sun is rising as she grabs a water sachet and her trusty money pouch. Winding through the neighborhood to the Nungua trotro stop, Abena does some mental calculations, setting her sales goals for the day. She knows the market will be slower than it was before Christmas (everyone has spent their money), but she hopes she can get a good bale with at least 50 pieces of first selection that she can sell before 11 AM. She prays on it during the ride to work. “As a Christian, in everything, God should be first.”
Abena’s commute takes an hour when traffic is light, and it’s a beautiful ride. It’s Harmattan, the dry season in Ghana, when the sun’s rays are often softened by a dusty haze, but the sun is shining bright today, glistening on the Gulf of Guinea. Most days, Abena attempts to sleep on the way in to Accra, but today, she is seated in the first row of the haphazard bus known as a trotro. Pressed against the window, the distractions are plenty. Her ride takes her past the Achiase Military Training School and small stretches of yet-to-be-developed beach. They pass the street where her boutique, Cynthia’s Palace, used to be—Cynthia being her Christian name. It was a small container shop that sold mostly first selection obroni w’awu (used clothing, literally “dead white man’s clothes”). She had done alright, but her sister Yaa had advised Abena that she could make more money if she operated out of Kantamanto. “If you are a woman and you don’t work and your schooling is not too high, you have to sell,” Abena says.
The driver plays music videos on the dashboard TV. She can barely hear the lyrics over the news blaring from another passenger’s mobile phone behind her, but she catches glimpses of the costumes. Abena tries to keep up with the latest music videos because customers are often inspired by what the artists are wearing. Most of her fellow riders (there are 18 of them) are busy scrolling, tapping, and talking on their phones, but Abena left hers behind today for Junior to play his favorite game. Glancing to her right, she sees that the young man next to her is checking his Facebook for likes on a picture he posted the night before. He is seeking approval for his outfit—a delightful combination of obroni w’awu on top and local cloth on the bottom, his pants probably sewn by his family’s neighborhood tailor. Today, he sports a full Off-White look, and Abena wonders if he works in Kantamanto. A lot of young men seem to like that brand, but she doesn’t find any of it in her UK bales of women’s tops.
As the trotro draws closer to Accra, traffic begins to slow. The sounds and smells of the sprawling metropolis intensify. The bells of the street-food vendors compliment the hiplife music coming from the trotro’s stereo, which is soon overpowered by gospel music blaring from a portable PA system. The scent of burning trash mixes with that of fried yam and the ocean breeze. Abena buys another water sachet from the hawkers who take advantage of traffic stops to visit each trotro with their goods. You can get anything from these informal vendors: water, kleenex, mango, phone credit, fire extinguishers, a shoe rack complete with six pairs of shoes, detergent, toothbrushes, passport holders, drumsticks, limes, and secondhand clothing. She glances at the Facebook boy’s phone, it’s nearly 6:30 AM. By the time the trotro stops and Abena makes her way through the maze of Makola—the market adjacent to Kantamanto—commercial activity will be in full swing. She is late. If she had her phone, Abena could text Maabena, a fellow retailer, to let her know.
We leave our Airbnb around 6 AM, our journey to Kantamanto taking less than 20 minutes on foot. Despite repeating this same walk over a hundred times, there is always something new to see. Since our last trip, in 2017, the market has sprawled, with piles of secondhand clothing being sold nearly half a mile before Kantamanto officially begins. Even before the sun is up, trading is well underway, with a few dealers using flashlights to cast light on their goods while eager consumers shine their cell phone on the items for a closer look. We walk quickly past a whirlwind of color and an ever-surprising mixture of aromas. Piles of panties and bras sit next to bowls of fried fish and baskets of delicious green pepper. The sellers shield themselves from the impending sunshine with wide brimmed hats, colorful umbrellas, and excess clothing.
We are early enough to catch the dump truck at the edge of the market. Three men haul bags of refuse onto the truck. We stop to take pictures of the waste generated by Kantamanto the day before. Some people pass by, laughing at us for taking pictures of the bola. How strange it is to document such a thing. Others express their anger, concerned that our pictures might be used to perpetuate the poverty narrative of “Africa” that often dominates people’s perceptions in Europe and the United States.
A hair salon has taken over the four stalls next to Abena’s, one of the few changes since we were last on her side of the market, in 2017. The repurposed billboard vinyl roof has been replaced by tin, and a latrine appears to have been hastily constructed along the back wall of the market area. But the traders’ stalls are still made of unfinished wood and nails. Nothing about the structure of the place feels permanent, and yet Abena is exactly where we last saw her, over a year before.
Abena arrives and another retailer runs over to deliver a message. The market’s social network offers glimpses of a thriving collectivist mentality. Abena’s section of the market is the newest and perhaps least permanent part of Kantamanto, which has a footprint of roughly seven acres. The retailers in this section are almost all women, and they sell mostly women’s clothing. Everyone working in Abena’s part of the market knows one another, and everyone watches out for one another—delivering messages, assisting with the weight of the clothing, and even stepping in to help sell one another’s goods. Aunty Abena is clearly respected and loved by her colleagues. She is an experienced retailer who offers advice to the younger ones. She is protective of her friends, and at times, she is also the life of the party, a comedian on a pedestal of clothing.
Moments after Abena arrives, a young woman comes into view carrying the bale Abena had purchased on Thursday, letting the bale drop from atop her head to the floor of Abena’s stall with a thud. Carrying the bale doesn’t look so hard.
We have known Abena since the first day we began our research, in 2016. We have watched her cut many bales—UK bales when she is making a profit and Canada bales when last week’s sales weren’t as good. Abena only sells ladies’ tops. (Each retailer in the market chooses one item, usually from the same country, in order to differentiate themselves.) Abena’s customers, mostly office workers and women who manage boutiques outside of the market, have come to expect a certain quality of item from Abena, even though Abena has no control over the contents of her bales.
“I have been here for three years now. It has changed. When I came here, if I cut one bale, I would sell it all and get my money back, but nowadays, if you cut a bale it is very hard to get back your money.”
Abena readies herself, pulling her stool closer to the bale, taking a deep breath and cutting the metal bands that compress over 400 pieces of clothing into a 34 x 16 x 14 inch bale weighing at least 120 pounds. A label indicates “UK Mixed Ladies Tops,” but the woven plastic wrapping conceals any details of the garments inside.
Bales of clothing like the one Abena is cutting arrive on the importer side of Kantamanto in 40-foot shipping containers throughout the week. These containers make their way from Ghana’s main port in Tema Harbour, a city some 25 minutes past Abena’s home. Our research has concluded that there are roughly 100 containers offloaded in Kantamanto on a weekly basis. Each container holds an average of 400 120-pound bales, with each bale containing secondhand and deadstock clothing that has been collected and packed abroad. That adds up to nearly five million pounds of clothing flowing through the market every week. At an average of three garments per pound, that’s roughly 15 million items. We calculate that some of those items immediately make their way to other markets and other countries, leaving Kantamanto with around 11 million items of clothing to sell each week. By all accounts, Kantamanto is the largest secondhand clothing market in Ghana, but it is not the only secondhand market in the country where containers are offloaded. To put that in perspective, the population of Ghana is 30 million people.
Once Abena has cut the bale and peeled away the plastic, sorting begins. The selection process involves dividing the clothes into four categories. First selection is the top-quality garments. Quality is subjective, but generally, a first selection garment includes anything that has never been worn (deadstock and donated goods with tags still attached) and trendy items (both in brand and silhouette) that are clean and free of holes. Abena will sell a first selection top for 10 Ghana cedis (about $2). Second selection includes worn but trendy, well-maintained items that are the right size for the retailer’s customer base. Third selection includes anything that has obvious signs of wear, is noticeably faded, is the wrong size (too large), or is culturally taboo (e.g. booty shorts). The final category is referred to as asie or “under.” This is what the retailer immediately considers to be trash, including non-clothing items (plastic waste, food, a random boot), slashed deadstock (a common fashion industry practice), torn or deteriorating garments, and clothing that is covered in stains or offensive smells.
Bales are expensive. Contrary to popular belief, donated clothing is often not handed out for free to people in need. Individual bales cost between $75 and $400. Considering other expenses (rent, sanitation fees, storage fees), retailers need to recoup at least 75 percent of the bale’s price with the sale of first selection alone. If they cut a bale and find that it contains only a few first selection pieces, the retailer will not make their money back. At times, the situation can be remedied by taking a chance on another bale, but more often than not, such doubling down sends the retailer further into debt.
For this reason, most secondhand clothing retailers describe their job as gambling.
Through survey data, interviews, and reviewing retailers’ financial logs, we have found that the average bale contains 18 percent first selection, 30 percent second selection, 46 percent third selection, and 6 percent “under.” Of the retailers we surveyed, 46 percent did not make their money back on their last bale and only 16 percent made a profit. While most traders have the cash flow to buy food and take public transit, living expenses—like electricity, children’s school fees, and phone data—become a luxury.
The market days when the vast majority of bales are cut open—Wednesdays and Saturdays—are filled with a tense energy among the retailers. At the same time, many Ghanaian consumers come to the market excited. Shoppers huddle around the retailers as they sort, hoping to snag first selection items—just as consumers in the Global North stand in lines for product drops. But in Kantamanto, exclusivity truly reigns supreme, as it is nearly impossible to find two of the same item. For consumers, market days represent opportunity. Not only are the price points accessible, so too is the expression of identity through style.
It takes Abena around 40 minutes to sort roughly 400 ladies’ tops. Today, Abena’s bale is good, with 70 pieces of first selection—more than she had hoped for this morning—and no more than 30 pieces of “under,” which now lay in the dirt aisle. The selection process gives insight into the expertise of the retailers: Each seller knows her customers, and many of the sellers keep up with international trends and celebrity influencers. Abena’s first customers are two boutique owners who buy up half of the first selection. Their boutiques cater to young women working in an office or a bank. They buy and sell only first selection obroni w’awu, mixed with counterfeit products from China. One of the boutique owners asks Abena to reduce the price of a shirt to five Ghana cedis, saying that a young office woman won’t spend more than “seven Ghana” on a style like that. Abena says she will only reduce the price if this customer also takes three pieces of second selection. Money is exchanged. Abena has managed to shrink the quantity of goods piling, quite literally, around her.
Abena is happy. She hopes to sell all of her first selection today along with some second selection. Monday and Tuesday will be dedicated to selling off more of her second selection, before she cuts a new bale on Wednesday. With the pace of goods coming in from overseas, consumers expect fresh goods at least twice a week. This puts a limit on the time she has to sell everything. After one week, whatever is left from the bale she cut today will become undesirable excess, last week’s haul, in need of removal.
We leave Abena to her business and make our way across the market to visit with another retailer, David Adams.
There are over a dozen ways to get to David’s stall from Abena’s. We choose to wind through the heart of the market, instead of returning to the street. The aisleways are small, most no more than three feet wide. There are at least 5,000 sheds like Abena’s. The Accra Metropolitan Assembly estimates that 30,000 people work in Kantamanto, the overwhelming majority of them engaged in the trade of secondhand clothing.
If we were given one word to describe Kantamanto, it would be “vibrant.” No day spent in Kantamanto is the same, just as no item is the same. Similar to any center of commerce, auxiliary services cater to the needs of both consumers and traders like Abena and David. Readymade food and daily groceries can be procured while walking around. Both the local news and scripture are broadcast by committed individuals with megaphones in hand. During election season, promoters of each political party can also be found vying for attention. Beauty products are in good supply, and retailers can even receive a pedicure while they market their goods.
And yet, this vibrancy can also read as chaos. It is easy to become overwhelmed by the sheer quantity of stuff.
Because that is the constant: stuff. Clothing, shoes, accessories. Piles and piles. Piles sitting, piles moving. People sitting on piles. Standing on piles. Walking on piles. Sleeping on piles. Everywhere. Stuff.
“Ago! Ago!” That means move. A young woman, no older than 16, is struggling to make it through the crowded aisles carrying a 120 pound bale on her head. We clumsily step aside.
Continuing toward David’s takes us through another woman-dominated part of the market, past several storage rooms, past a dyeing station where lighter-colored denim is dyed black, past a hidden bar with slot machines, and through one of several sewing centers where tailors mend and alter clothing for both retailers and consumers. It is not uncommon to find consumers ordering alterations in order to mimic trending looks by Rihanna or M.anifest. Just beyond the hum of sewing machines is a screenprinting service, where customers can design their own graphics or have brand logos, like Nike and Adidas, added to whatever they bought. Behind the sewing and screenprinting, lies the laundering services—cleaning, ironing, starching—and the cobbler where you can repair and customize.
Kantamanto is full-service.
This blend of consumption, customization, and cocreation seems to be precisely what everyone is striving for with new “experiential retail” models in the Global North. Ghana has it. Additionally, the secondhand clothing trade is an accessible source of material. In fact, two of Abena’s most consistent customers are a pair of high school-aged boys who purchase her third selection ladies tops (the larger sizes) and transform them into more masculine cuts, since men’s fashion sells for a higher price point than women’s. These boys sell the tops on the street, saving up to return to school. Following the lifecycle of garments from each selection category begins to reveal a more complex economy of secondhand goods.
Enter the stylists and the designers. Not every Ghanaian finds the hunt for first selection delightful, and many elect to avoid Kantamanto as much as possible. Fueled by social media, dozens of entrepreneurial stylists travel to the market, locate the gems within the piles and piles of stuff, wash and iron their finds and present them as “thrift” or “vintage” via Instagram and Facebook. Internet consumers may pay four times the price that they would in Kantamanto, but they can do so from the comfort of their home. There are also stylists of a different type who pull looks from Kantamanto for photoshoots and music videos. Daniel “Mawuli” Quist is one such stylist who also operates a showroom called De FortyFive, full of glasses, hats, and clothing that he has upcycled with precision and compassion. Mawuli and other designers like him see potential in items that less astute shoppers pass over, creating one-of-a-kind works intended for one-of-a-kind humans.
Past the screenprinters lies several pens of goats and chickens. This is where we take a sharp right.
David’s stall is at the front of the “elders” market. This side, containing around 1,700 of the 5,000 stalls, boasts wider aisles and larger, more permanent stalls. David has made several upgrades to his retail environment, investing in a fan, shelves, a rolling gate, a full-length mirror, a soundsystem, a steamer, and a refrigerator stocked with chilled bottled water, the ultimate luxury.
David greets us with the customary Ghana handshake, hands us water, and invites us to take a seat. He is always worried about us obroni (foreigners, white people) getting dehydrated and overheated in his country. David is 29 years old, with a bachelor's degree in biological sciences.
“My family has been trading in secondhand goods since before I was born. My dad started trading in secondhand clothes when he was about 25 years. And my aunt introduced him to the secondhand business, and my aunt is dead. They were the pioneers.”
When a fire burned the market down in 2013, David stepped in to take over his dad’s business of selling men’s and ladies’ suits. After quickly plunging into debt, David began to study the market with the scientific precision he had learned in his university courses. He soon realized that, if he could raise the value of second selection goods by washing, mending, and altering them, he could optimize the purchase of each bale. He then strategically examined consumer behavior and learned how to create a luxury shopping experience for his customers. We call David by his market nickname, the Professor, because he is an expert in all facets of the secondhand clothing trade. He has even mastered the timing of his bale purchases to align with discount season in the Global North. What does not sell in a summer blow-out sale in the UK will be donated to clothing collectors and packed into bales, leading to a higher percentage of deadstock—first selection—per bale.
Of his craft, David says, “It’s a food chain. So, if you understand the food chain, you understand everything. The sun shines, the leaves start producing chlorophyll, photosynthesis, everything goes on. Then, they start bearing fruits and the leaves give off oxygen, and that is how everything starts. That’s the food chain. The same applies to clothing.”
While David has succeeded in gaming the market, and although he has gotten himself out of debt, he is exhausted with the fast pace of consumer demand, which he feels is fueled by the currency of the selfie and the need for validation via social media platforms. It doesn’t help that the business is grueling. David gets to work no later than 6 AM and doesn’t leave until after 5 PM, Monday through Saturday. He eats dinner early, reads the newspaper and as many books as he can get his hands on, listens to the BBC—something he does religiously both at night and in the morning—and is in bed by 9 PM. On Sunday, David washes second and third selection and picks up his order of mended suits from the family tailor.
David’s goal was to pay for his two sisters to finish university. With their studies nearly complete, David is preparing to wrap up the business and apply to grad school to research cancer treatments, hopefully in the USA.
Despite his admiration for American academia, David selIs suits exclusively from the UK. Generally, UK bales are considered the best quality across all product categories, whereas American and Canadian bales are considered the lowest quality and are thus the cheapest. But bales are exported by clothing collectors with headquarters all over the world—the Netherlands, Australia, Korea, Germany, and China, to name a few of the other key exporting countries we hear about in the market.
Walking through the importer side of Kantamanto Market, the global connections of the secondhand clothing trade are immediately clear. Shipping containers line the crowded streets waiting to be offloaded. Each container traces back to an exporter somewhere abroad. With a seemingly endless supply of donated clothes, exporters in the Global North sell container loads of clothing to Ghanaian importers as fast as the containers can be packed. Ghanaian importers, in turn, work with middlemen and retailers to offload individual bales fast enough to pay the exporters back for the containers that they often purchased on credit and in foreign currency. Importers express concerns that if they are unable to accept a container, they will lose their relationship with exporters abroad. This supply-driven cycle is based on quantity not quality, with each player passing on clothing to the next rung down the ladder and taking a cut of the pie in the process.
Each item of clothing carries a different value once it gets to Ghana. Abena’s garment of choice, ladies’ tops, is one of the toughest on which to turn a profit, because there is such an abundance of them and because silhouette, fabric, and finishing trends are so diverse that a bale from the same supplier might be entirely different from one week to the next, containing a lot or a little of what her customers want. David, on the other hand, is well positioned to succeed by selling men’s suits, a more limited, more uniform, and universally high-ticket item.
David and Abena sit at opposite sides of the spectrum. David is most likely to profit, while Abena is most likely to lose money and fall into debt.
This lost financial value also represents physical waste.
On average, 40 percent of each bale is not sold. In most cases, what is not sold is sent to the landfill. The dump-truck we saw in the morning was one of two trucks that the Accra Metropolitan Assembly uses to collect waste from Kantamanto each day that the market is open. These trucks take 70 metric tons, or 154,000 pounds, of clothing and textile waste to the landfill on a daily basis, an increase from 50 metric tons in 2017. What the AMA cannot pick up due to limited truck and landfill capacity is collected by informal garbage collectors and is illegally burned or dumped on unofficial landfills. At times, the clothing is dumped directly into the Gulf of Guinea.
Kantamanto’s vibrancy is dimmed by this never-ending accumulation of excess. As the market day draws to an end, piles and piles of unwanted clothing have filled the aisleways under our feet.
The name given to secondhand clothing in Ghana perfectly illustrates this reality. Obroni w’awu is an Akan term that translates to “dead white man’s clothes.” When secondhand clothing first arrived in Ghana decades ago, it was presumed that the previous owner had died. Why else would someone pass on their clothing? The very concept of excess was not understood. Today, the understanding of the term “dead white man's clothes” incorporates the knowledge that not all of the clothing comes from dead people. The concept of excess has taken on a new meaning.
Kantamanto and other secondhand clothing markets are not retail utopias where each item of clothing, each object rejected by the Global North, finds a user. While secondhand markets do present an opportunity for reuse, the lifecycle of an item of clothing does not necessarily continue. With the continued hyper-acceleration of production and consumption in the Global North, Kantamanto serves as a necessary extension of this fast-fashion economy.
Kantamanto is the outlet for our excess.
The story of dead white man’s clothes does not stop here.
Woven throughout Kantamanto are the kayayei, the backbone of the secondhand clothing trade. The kayayei (singular kayayo) are head porters, predominantly women, who transport the bales of clothing from importer to retailer, from retailer to storage, from retailer to retailer, from retailer to consumer, and so on. Kantamanto could not exist without the labor of the women and men working as kayayei, because there would be no other way of transporting the bales through the narrow and congested passageways of the market.
Asana is a kayayei. She is 18 years old. Her family is from a farming community near Tamale in the north of Ghana, where drought has lead to shrinking harvests. She came to Accra one year ago with the hope of earning enough money to feed herself and to save the few thousand dollars necessary to attend nursing school. She wants to be a nurse to help her community back home, some 300 miles away.
Asana carries a bale in the images captured at Osu Castle, where people were once locked up in dungeons for months at a time before passing through the “door of no return,” where the British Colonialists once administered the Gold Coast, where Kwame Nkrumah once signed Ghana’s independence documents. Weighing nearly her entire body weight, the bale of men’s T-shirts from the UK makes it impossible for Asana to stand still. The weight is crushing. On busy market days she might carry 10 of these bales for no less than half a mile, through the narrow, crowded aisleways. She will make at most $10 from these 10 journeys. Her money for the week. With the risk of injury, illness, robbery, and rape, she may never save enough to pay for nursing school.
As David says, “The kayayos are basically the slaves of the entire system...in Ghana a kayayo simply means someone who carries a load. Someone who carries a burden.”
At the end of the day, Asana walks through the aisles of Kantamanto as people sweep unwanted clothes into rice sacks to carry away to the dumps. Wiping sweat from her brow and slowly drinking a water sachet, she winds her way through the aisles and overflowing streets back to the crowded room that she shares with four other girls. Under a ceiling barely taller than their heads, the girls have one small fan and no windows. The putrid air is barely noticeable after a year of breathing it while she sleeps on the bare concrete floor. Thousands of kayayei like Asana live here, atop the dumping grounds of our waste. Clothing from Kantamanto is illegally—but openly—piled high, a mountain of the Anthropocene. Mixed with our smoldering clothes, laptops and televisions are mined for their metals by young men who melt off the plastic and rubber of computer chips and electrical wiring in open flames that seem to carry on for miles. This e-waste dump, which may be largest on our planet, is the environment in which Asana lives.
Accra is a city of transformation. Not far from the burning and illegal dumping, new air-conditioned malls seem to open on a monthly basis. Luxurious cars shuttle a growing elite between bank headquarters, hotels, government office buildings, and walled mansions filling in the landscape of the sprawling city.
Yet for Asana, the city of Accra is small. She knows the path from the room she shares to the market. And she knows the weight she bears.
Freedom: Pondicherry, India
Freedom: Ladakh, India
Artificial glaciers in the Himalayas are being used to make arid terrain more habitable by supplying local villages with fresh water year-round. | cc/2020-05/en_middle_0128.json.gz/line937 |
__label__cc | 0.662153 | 0.337847 | Registros únicos, 15 resultados 15
Inglés, 15 resultados 15
Ronnie Tessler, 1 resultados 1
Gordon Miller, 1 resultados 1
Lyle Wilson, 1 resultados 1
Bob Kingsmill, 1 resultados 1
Douglas & McIntyre, 1 resultados 1
Genni Hennessy, 1 resultados 1
Gillian Darling Kovanic, 1 resultados 1
Ken Kuramoto, 1 resultados 1
Robert Keziere, 1 resultados 1
Doug Cranmer, 1 resultados 1
Audrey Hawthorn, 1 resultados 1
R.A. Brooks, 1 resultados 1
University of British Columbia. Department of Anthopology, 1 resultados 1
Vancouver, 15 resultados 15
British Columbia, 15 resultados 15
Canada, 15 resultados 15
North Vancouver, 2 resultados 2
Kitimat, 1 resultados 1
Nelson, 1 resultados 1
Vernon, 1 resultados 1
Richmond, 1 resultados 1
First Nations, 12 resultados 12
Cultural groups, 12 resultados 12
Totem poles, 1 resultados 1
University of British Columbia, 1 resultados 1
Fundo, 13 resultados 13
Sólo las descripciones de nivel superior Vancouver
Ken Kuramoto fonds
This fonds consists of 39 16mm film reels of Celebration of the Raven. There are also five audio reels which are soundtracks for the film. Film reels include stills and test stills and camera originals. Most reels are labeled according to the scene.
Ken Kuramoto
Douglas & McIntyre fonds
The fonds consists of 83 images associated with two books published by Douglas & McIntyre: Bill Reid by Doris Shadbolt and The Raven Steals the Light by Bill Reid. The photographers responsible for these images are R. Dereth, R. Keziere, R. Lum and B. McLemore.
Genni Hennessy fonds
The fonds consists of records relating to Hennessy’s 2003 MA thesis titled The Spirit of Collaboration: Exploring Critical Pedagogical Principles in Transforming the Museum Through Space and Time. Hennessy was interested in the relationships that developed between community members and museum staff during the process of putting together the Museum of Anthropology’s exhibit The Spirit of Islam, which ran from October 2001 to May 2002. Her purpose was to document the kinds of collaborative processes that occurred as the exhibit planning progressed in order to identify a model from which other museums working with communities might benefit.
Genni Hennessy
Gillian Darling Kovanic fonds
This fonds consists of textual records, photographs, negatives, slides, audio recordings, compact discs and video on DVD that relate to Kovanic’s academic and film career. The fonds relates especially to her work in Pakistan, India and Afghanistan, but also captures her work with First Nations on the Northwest coast of British Columbia.
Gillian Darling Kovanic
Ronnie Tessler fonds
The fonds consists of photographs created by Ronnie Tessler between 1986 and 1987 documenting a canoe project by Nisga’a carver Norman Tait. The project was abandoned in the summer of 1987, and the canoe was left uncompleted. The photographs depict models for the canoe, transportation of the log for the canoe to the Museum of Anthropology, ceremonies performed throughout the project, and various stages of work on the canoe and model. Additional photographs from this period depict a totem pole-raising ceremony at Capilano Mall in North Vancouver, as well as portraits of Les Baker, a model Tait wanted to use for a “white man” mask. The fonds is arranged into a single series: Norman Tait canoe project and related materials.
Ronnie Tessler
William Carr fonds
The fonds consists of black and white photographs and negatives. Subjects depicted include villages, boats and ferries, landscapes, bridges, logging clearcuts, and totem poles. Some of the photos appear to be of the Lions Gate Bridge, Stanley Park, and the Capilano Suspension Bridge.
Lyle Wilson fonds
Fonds consists of a copy of Wilson’s “Kitlope Report: Various Haisla Artifacts.”
Lyle Wilson
Harry B. Hawthorn fonds
[189-] - [200-], predominant [193-] - [197-]
The fonds consists of records created and collected by Harry B. Hawthorn in a number of different capacities: as researcher, professor, Dean of Anthropology and Director of the Museum of Anthropology. Textual records in the fonds include correspondence, transcripts, research notes and clippings from publications. Much of the graphic materials relate to Harry Hawthorn’s interactions with aboriginal communities as an anthropologist, a professor, and as the Director of MOA. Other images relate to his personal life, documenting his youth in New Zealand, his life as a father and anthropologist, and his later established professional roles.
Harry Bertram Hawthorn
George Szanto fonds
Fonds consists of eight slides of totem poles being raised in the Haida Village at the University of British Columbia (UBC). The slides are dated May, 1962. The photographs were taken by George Szanto, the son-in-law of Geoffrey Andrew who was the Dean and Deputy President of UBC from 1947 to 1962.
The totem poles represented in the images were carved by Haida artist Bill Reid and 'Namgis artist Doug Cranmer. They were originally situated at UBC's Totem Park. They are now located on the grounds behind the Museum of Anthropology, and modelled on a 19th century Haida village.
George Szanto
[1979?]-1993
The collection consists of nine large watercolour illustrative panels commissioned by the UBC Museum of Anthropology, eight of which were commissioned for the exhibit "The Four Seasons: Food Getting in British Columbia Prehistory," which ran from April to November 1979. The other watercolour is from an unidentified exhibit or sourcebook.
The collection also contains one painting that was commissioned by the museum for a publication (Museum Note, no.12, "Ninstints: World Heritage Site"), as well as a blueprint reproduction of a related drawing. These are renderings of how the houses and poles on a beach at the Ninstints village site might have looked when they were in use. The rendering is based on George MacDonald's map.
Collection consists of the following items:
001: The Four Seasons – Spring – Interior [1979?]
002: The Four Seasons – Spring – Coast [1979?]
003: The Four Seasons – Summer – Interior [1979?]
004: The Four Seasons – Summer – Coast [1979?]
005: The Four Seasons – Autumn – Interior [1979?]
006: The Four Seasons – Autumn – Coast [1979?]
007: The Four Seasons – Winter – Interior [1979?]
008: The Four Seasons – Winter – Coast [1979?]
009: Haida six beam house 1993
010: [Ninstints village painting] 1983
011: [Ninstints village, drawing for Museum Note] 1983
Gordon Miller
Robert Keziere fonds
The fonds consists of 7 photographs taken by Robert Keziere on October 20, 1982 of artist Bill Reid working in his Kerrisdale (Vancouver) studio. The film remained unprocessed until 2009, when it was developed and the prints, contact sheet, and DVD were created. The DVD contains image files in multiple resolutions.
Robert Keziere
Sharon Fortney fonds
The fonds consists of one file titled Interview Transcripts, which contains recorded interviews, transcripts, and printed copies of transcribed interviews of research done by Sharon Fortney towards her PhD thesis titled Forging New Partnerships: Coast Salish Communities and Museums. Forney's thesis explores what motivates Coast Salish communities to participate in museum representations; considers the legal implications of such representations with respect to aboriginal rights; and analyzes of the diverse experiences of Coast Salish individuals in specific museum projects and partnerships with the goal of progressing museum and community interactions along a path to equal partnership.
The audiotapes in the fonds contain interviews with Coast Salish community members and artists regarding museums. The CD-R contains transcripts of interviews and is located in the temporary CD storage box. Sharon Fortney's curriculam vitae, thesis abstract, and 10 interviewee consent forms are located in the case file.
Sharon Fortney
Bob Kingsmill fonds
The fonds consists of correspondence, questionnaires, and photographs relating to Bob Kingsmill’s research for his book A Catalogue of British Columbia Potters (1978). In order to gather material for his book, Kingsmill created a questionnaire requesting information and photographs, which he sent to about 70 potters throughout British Columbia. The fonds consists mainly of the responses Kingsmill received, which include the completed questionnaires containing short biographical and artistic statements by each potter, together with black and white or colour photographs of the artists and their pottery.
Bob Kingsmill
Victoria Yip fonds
Fonds consists of theatre programs from Victoria, opera clippings, photographs of the Chinese Carnival in 1936, a copy of the Chinese Times, and Yip’s reminiscences of the establishment of The Chinese Canadian Times in Vancouver and the Chinese Opera in Victoria.
MAN 1997-007-001 : Chinese Times, 1936, article on Chinese Times, Willie Le[-]o n.d.
MAN 1997-007-002 : Cantonese Opera clippings, n.d.
MAN 1997-007-003 : Six photographs of Chinese Carnival, Vancouver, 1936
MAN 1997-007-004 : Theatre program from Victoria, B.C., 1923
MAN 1997-007-005 : Theatre program from Victoria, B.C., with poetry on back written by Yip’s father, 1930
Victoria Yip
R.A. Brooks collection
Collection consists of 81 b&w photographic prints of the Brooks heads and one of the Vancouver airport. | cc/2020-05/en_middle_0128.json.gz/line939 |
__label__wiki | 0.579474 | 0.579474 | Topson Downs Selects Port Logistics Group for Omnichannel Logistics Services
LOS ANGELES, Nov. 1, 2016 /PRNewswire/ -- Port Logistics Group, the nation's leading provider of gateway logistics services, today announced it has secured a multi-year service contract with Topson Downs, a global apparel manufacturer in the branded and private-label fast-fashion segment.
Under the agreement, Port Logistics Group, as a third-party logistics provider (3PL) offering B2B and B2C supply chain solutions, will manage the U.S. distribution and fulfillment for Topson Downs from its retail distribution campus in Chino, CA. The 3PL is providing full-scale services, overseeing the complex flow of Topson Downs' direct-to-consumer and retail orders.
The partnership allows Topson Downs to focus on its core competency of designing on-trend apparel. "We were looking to strengthen our company by partnering with a 3PL who offers best-in-class logistics and distribution as well as with a company that shares our same core values," said Kelly Gordon, Chief Operating Officer at Topson Downs. "After a lengthy RFP process, Port Logistics Group stood out from their competitors not only as experts in their field, but in their company culture and the importance of relationships to them both internally and externally."
Many former warehouse employees of Topson Downs will be retained at Port Logistics Group's Chino campus, allowing for a seamless transition and greater sharing of knowledge across the two companies.
"Topson Downs is a significant account for us. It's really a great marriage between two rapidly growing companies," said Brian Weinstein, Vice President of Business Development at Port Logistics Group, noting the customer will benefit tremendously by utilizing a sophisticated warehouse management system that can take advantage of a single physical inventory location for all of their multiple selling channels through Port Logistics Group's proprietary warehouse management system, EventTracker.
Weinstein added: "Ecommerce is growing fast and IT capabilities are a key component of omnichannel. In addition to the strength of our WMS, we have an in-house engineering department and retail implementation experts on staff to give us the flexibility to meet Topson Downs' needs as they evolve in a rapidly changing marketplace."
ABOUT PORT LOGISTICS GROUP
Port Logistics Group is the nation's leading provider of gateway logistics services, including value added warehousing and omnichannel distribution, transloading and crossdocking, ecommerce fulfillment, and national transportation. With 6.5 million square feet of warehouse space strategically located in and around major North American ports, Port Logistics Group provides the critical link between international transportation and the last-mile supply chain.
ABOUT TOPSON DOWNS
Based in Los Angeles, CA, Topson Downs is a global leader in the apparel and manufacturing industry. Topson Downs prides itself on its design talent and vast market intelligence allowing them to consistently provide their customers with the latest trends. With its strong network of retail partners and a vast global infrastructure, it maintains an unparalleled standard in production and quality control. Its core values remain the same since 1971, centering on quality, sustainability and community.
Other Barcode news of interest:
New Location for Seagull Scientific Madrid Office
William Frick & Company Releases SmartCAT Asset Tracking Android App
Webinar, “How to Automate Logistics and Streamline Operations with RAIN RFID”
Identiv to Demonstrate FICAM Solution at New Government Office Open House
DENSO Announces New Marketing Manager
Teklynx International Among Milwaukee Business Journal's 2016 Best Places To Work
Tagged under warehouse management Logistics
Smartrac Technology Group | cc/2020-05/en_middle_0128.json.gz/line943 |
__label__wiki | 0.732298 | 0.732298 | 24-HOUR DRONE
Basilica SoundScape
Basilica Farm & Flea
Pioneering People
(FREAK) FLAG DAY
BASILICA GREEN
Food + Community
Team + Board
Basilica Non-Fiction Screening Series: Ghost Fleet
Thursday, August 1 | 7.30PM
// FREE //
Followed by a Q&A between Ghost Fleet producer Jon Bowermaster and Hudson-based filmmaker Daniel McCabe
Food truck from 6.30PM
Screening begins 7.30PM
Ghost Fleet follows a small group of activists who risk their lives on remote Indonesian islands to find justice and freedom for the enslaved fishermen who feed the world’s insatiable appetite for seafood. Bangkok-based Patima Tungpuchayakul, a Thai abolitionist, has committed her life to helping these “lost” men return home. Facing illness, death threats, corruption and complacency, Patima’s fearless determination for justice inspires her nation and the world.
Thailand supplies a large portion of America’s seafood, but Thailand’s giant fishing fleet is chronically short tens of thousands of fishermen per year. Human traffickers have stepped in, selling captives from the region to the captains for a few hundred dollars each.
Once at sea, the men may never return to land – unless they escape. These boats work the islands of Indonesia and Thailand, but also off the coasts of West Africa and Europe. Attempts to “certify” where fish come from, and who is catching it, are in the works but are currently hit-and-miss. In the meantime, as fishing stocks are depleted and commercial fishing operations toiling under tighter and tighter budgets, the need for slave labor grows. Threats and punishments do too.
Next time you order a fish in a restaurant or buy it from a freezer at your local shop, ask yourself, who caught this fish?
“Ghost Fleet is a power-packed gut-punch that is both intense and infuriating, and is wholly deserving of Academy Award consideration.” – Mark Johnson, AWARDS CIRCUIT
“The underlying power of Ghost Fleet and what it reveals: that slavery still exists in certain parts of the world, with only a few people trying to fight it…Patima is a genuine hero.” – Jordan Mintzer, THE HOLLYWOOD REPORTER
ABOUT PRODUCER JON BOWERMASTER
A writer, filmmaker and adventurer, Jon is a six-time grantee of the National Geographic Expeditions Council. One of the Society’s ‘Ocean Heroes,’ his first assignment for National Geographic magazine in 1989 was to document a dog-sled expedition that crossed Antarctica taking 221 days. He is the founder of Oceans 8 Films and One Ocean Media Foundation. Listen to his podcast “The Green Radio Hour with Jon Bowermaster” on Radio Kingston.
ABOUT BASILICA NON-FICTION SCREENING SERIES
This screening is part of Basilica Hudson’s Basilica Non-Fiction Screening Series, which explores the documentary genre through screenings and dialogue with visiting directors. Now in its third year, the series was developed in partnership with Chris Boekmann of Colombia MO’s acclaimed True/False Film Fest.
The series has previously included documentary films including Oscar nominee Abacus: Small Enough To Jail and is part of Basilica’s long-standing film program. Now in its eighth year, Basilica’s film program has displayed a longstanding commitment to bringing independent and innovative voices in film to the Hudson waterfront, through new and repertory film and video art, often with filmmakers and special guests in conversation.
Basilica Hudson’s Film and Media program is generously supported, in part, by the New York State Council on the Arts with the support of Governor Andrew M. Cuomo and the New York State Legislature, and the Alexander & Marjorie Hover Foundation.
Annual Events:
Basilica Farm and Flea
All Events:
110 S. Front St Hudson, NY 12534 • Maps + Directions
© 2020 Basilica Arts Inc. All Rights Reserved. | cc/2020-05/en_middle_0128.json.gz/line944 |
__label__wiki | 0.943321 | 0.943321 | B.C. man carries guns aboard Air Canada flight
CTVNews.ca Staff Published Wednesday, September 21, 2011 7:21PM PDT
A serious case of miscommunication led a British Columbia man to carry two guns onto an Air Canada flight with what he was told was the proper authorization, only to be arrested for impersonating a police officer upon landing in Toronto.
Aaron Haight and his wife were travelling to Ontario on June 14 so his mother could meet her 11-month-old granddaughter for the first time. While on the trip, Haight intended to participate in a shooting competition, and so brought a Glock 22 and another gun with him.
Haight says he was sure to get the proper authorization to fly with his guns from the RCMP.
"You're supposed to declare them and they're supposed to go through special baggage," Haight told CTV News. "That's not what happened this day."
Air Canada's customer service agents were on strike when Haight and his family arrived at the airport around 4:30 a.m. When he told the manager at the Air Canada desk about his guns, and that he was authorized to carry them, he was handed a form.
He filled it out, and then was told "to bring the firearms on the plane with me." His ammunition was stored in a checked suitcase.
Haight made his way through security, where officials told him not to walk through the metal detector but asked to see his badge. He said he didn't have one, since he was not a police officer. Instead, he showed his possession and acquisition licence that, as Haight points out, looks more like a driver's licence than a badge.
"They proceeded me onto the plane," Haight said. "I then was looking around and wondering why are they letting me on here with two pistols in a briefcase?"
When he asked that very question, Haight was told to give the briefcase to a flight attendant. Two hours into the flight, Haight was again asked for a badge. When the pilot learned that Haight didn't have one -- about halfway through the flight -- the police were contacted.
When the plane landed, Haight was arrested on a charge of impersonating a police officer.
"At some point, someone believed he was a police officer (and) gave him the proper documentation to fill out to board the plane with his firearms," Peel Regional Police Const. Thomas Ruttan told CTV News.
Haight was held for three hours, while his wife was left stranded with their baby and luggage.
According to Ruttan, at some point police realized that Haight never claimed to be a police officer.
"It must have been miscommunication as he was boarding the plane that led to him being able to bring the firearms on to the plane," Ruttan said.
When the family returned home nine days later, they were met at the Vancouver airport by an RCMP officer who wanted to know how Haight got the guns on the flight to Toronto. After an hour of questioning, Haight and his family were allowed to go home.
Both the Canadian Air Transport Security Authority and Air Canada declined to comment on camera for the story. However, they issued statements saying they have conducted their own investigations into the incident and have taken steps to ensure a similar mix-up doesn't happen again.
Air Canada has also offered Haight $1,000 in travel vouchers -- for another Air Canada flight.
Haight says the fact Air Canada employees mistook him for a police officer has him worried about security measures, particularly given the fact he was offered the same incorrect form before his flight home.
"It's affecting me not just because of me and my family, but for the rest of Canadians," he said. "We're not safe."
With a report from CTV's Vancouver Bureau Chief Sarah Galashan
Officials to probe if live ammo was allowed on plane
Vancouver Top Stories
Day 2 on stand for man who testified about killing Vancouver couple
B.C. announces new 'Fairness Office,' other measures to increase accountability at ICBC
'Better safe than sorry': Many travellers at YVR don masks as coronavirus concerns grow
'Historic agreement' to help SkyTrain reach UBC announced
'A little anxious': Expat family expecting baby hopes to get out of China
One-on-one with Surrey's mayor: McCallum on Uber and crime in his city
Should junkyards have tougher regulations?
Stolen ice cream shop bear statue returned with an apology
'Can't let ignorance triumph': Mayor on coronavirus racism
Murder victim a former star athlete
More From CTV News Vancouver
Coronavirus rumours are everywhere. Officials warn they can lead to discrimination.
9 Metro Vancouver cab companies file legal challenges to halt Uber, Lyft
'They work at night': Someone is distributing white supremacist flyers in East Van
B.C. teen's petition to add Kobe Bryant to NBA logo collects 1 million signatures
'No more warning tickets': Surrey's mayor threatens Uber with fines, crackdown
Cab driver recorded shouting racial slur at pedestrian in Burnaby
This research project could help end Arctic food insecurity
B.C. woman calls for Canada to help extract daughter from quarantined Chinese city
'This is not why I joined customs': Whistleblower speaks out amid spike in 5-year bans at U.S. border
B.C. health officials prepare for possible virus spread using lessons from SARS
'I can't get out and I cannot scream': Young woman shares terrifying story of Burnaby attack
SPCA treating St. Bernard mix for gunshot wound
Uber, Lyft are now operating in Metro Vancouver. Here's what you should know.
B.C. confirms province's first presumptive positive case of new coronavirus
B.C. drivers are paying as much as 42% more than Albertans for insurance, a report suggests
Two Manitobans test negative for coronavirus
Surrey Mayor McCallum on Uber, crime in his city
It's time to address the racism being caused by coronavirus
Plane secured for Canadians in China | cc/2020-05/en_middle_0128.json.gz/line947 |
__label__wiki | 0.532592 | 0.532592 | Bergen County Students Recognized for Academic Achievement at Berkeley College
FRIDAY, JANUARY 25, 2019 Contact: Ilene Greenfield
Students from Bergen County, NJ, have been named to the President’s and Dean’s Lists at Berkeley College for the fall 2018 semester.
The following students from Bergen County have been recognized:
President’s List
--Alvin Cancio of Bergenfield
--Samantha Favia of New Milford
--Jose Gil Ortiz of Bergenfield
--Glen Langmaack of Bergenfield
--Jonathan Soler of New Milford
--Yanni Vrakas of Bergenfield
--Kimberly Bartolomucci of New Milford
--Elizabeth Boby of Bergenfield
--Morgan Goldberg of Dumont
--Cindy Lewis of Bergenfield
--Janyll Lora of Bergenfield
--Patricia Rendon of New Milford
Berkeley College students who achieve a grade point average of 4.00 with a minimum of 12 academic credits qualify for the President’s List. Students who achieve a grade point average of 3.50 or better with a minimum of 12 academic credits quality for the Dean’s List.
Berkeley College has four New Jersey campuses – Newark, Paramus, Woodbridge and Woodland Park. In New York there are three campuses – Midtown Manhattan, Brooklyn and White Plains. Berkeley College Online® serves a global population. For six consecutive years, U.S. News & World Report has named Berkeley College among the Best Colleges for Online Bachelor’s Programs and among the Best Online Bachelor’s Programs for Veterans. The website address is www.BerkeleyCollege.edu. | cc/2020-05/en_middle_0128.json.gz/line949 |
__label__wiki | 0.815234 | 0.815234 | Authorities believe Fotis Dulos, estranged husband of missing mom, attempted suicide
Amazons Ring app shares loads of your personal info, report finds
London to deploy live facial recognition to find wanted faces in crowd
Samsung Galaxy Z flip gets official renders, full spec sheet
Apple releases iOS 13.3.1 and macOS Catalina 10.15.3
Apple reports a blowout Q1 2020, but names coronavirus as a worry for the next quarter
US handed Berlin smoking gun on Huawei: report
Peru court orders opposition leader Keiko Fujimori to return to prison
‘It sounded like rape’: Weinstein accuser’s ex-roommate backs up sexual assault allegation
Lawmaker says he regrets comparing gender reassignment and Nazi experiments
Home/Technology/New study adds evidence to debate over the only known Clovis burial
New study adds evidence to debate over the only known Clovis burial
Enlarge / Lorena Becerra-Valdivia used this equipment to extract hydroxyproline from the Anzick site bone samples.Becerra-Valdivia
At sites scattered across western North America, long, fluted stone projectile points mark the presence of ancient people from a culture archaeologists now call Clovis. For much of the 20th century, the Clovis people were considered the very first Americans. But more recent data has shown that people arrived in North America several thousand years before the oldest known Clovis projectile points were made. But Clovis appears to be the first widespread culture, and it still represents a key chapter in the story of how people spread across two continents.
Beyond the things they left behind, theres little trace of the Clovis people themselves. In fact, a lone infant skeleton may be the only known representative of the Clovis culture. Due to some discrepancies in radiocarbon dating, however, archaeologists still aren't sure whether the child's remains are Clovis. Now, a new study adds some evidence to that debate.
Meet Anzick-1
In 1968, construction workers near Anzick, Montana, unearthed the partial skeleton of an infant boy: fragments of his skull, his left collarbone, and a few ribs. At first glance, the boy now known as Anzick-1 seems to be the only member of the Clovis culture found so far. His skeleton was found with Clovis-style artifacts—more than 100 stone and bone objects, all dusted with red ochre. But radiocarbon dating of his remains didn't line up with dates from a pair of antler artifacts from the Clovis materials, raising questions as to how they ended up at Anzick together.
According to paleogenomic studies carried out previously, Anzick-1 is most closely related to modern Native American groups, but he also shares some ancestry with the Malta, a group of people who lived in Sibera during the Upper Paleolithic. And hes more closely related to Central and South American indigenous groups than to those who settled farther north. If archaeologists could be sure of when Anzick-1 lived, he could help us better understand how and when the first Americans split into different populations and spread across two continents.
When archaeologists dated Anzick-1 in the late 1980s and early 1990s, they used several different methods to prepare the samples for study. Two of them involved pretreating collagen samples from the bones, but two others involved separating single amino acids from the samples and then radiocarbon dating those isolated compounds. The methods that involved testing whole collagen generally showed the skeleton being younger than the Clovis antlers: about 10,575 to 9,005 years old. But when archaeologists dated samples of amino acids glycine and glutamic acid extracted from the collagen, their results lined up with the 13,000- to 12,795-year-old range for the antler artifacts.
Because radiocarbon dating collagen samples produced dates that didnt match the Clovis artifacts, some archaeologists say they cant consider Anzick-1 a Clovis burial. Others argue that the collagen samples may have been contaminated by modern carbon sources during sample preparation. If so, then isolating single amino acids should help filter out that contamination and produce a more accurate date.
New methods, really old bones
Most of the arguments about Anzick-1 have centered on which radiocarbon dates were more accurate, so Oxford University archaeologist Lorena A. Becerra-Valdivia and her colleagues decided to try the dating again with more recent sample preparation methods, which she says have improved significantly in the last 20 years. Three of the newer methods involved different ways of decontaminating the collagen samples. But one method, called HYP, extracted and purified a sample of a single amino acid, hydroxyproline, from the collagen sample. Becerra-Valdivia says that this will provide a purer sample with less chance of contamination.
The dates still werent consistent; the three collagen methods still produced dates different from the antler samples, but the HYP method yielded an overlapping set of dates: 12,905 to 12,695 years old.
According to Becerra-Valdivia and her colleagues, that means Anzick-1 was buried at the same time as the ochre-dyed Clovis artifacts, which proves that he was a member of the Clovis culture.
“Our data, coupled with Rasmussen et al.s palaeogenomic evidence on the Anzick-1 individual, tell us that the peopling of the American continent was a more complex process than previously thought,” Becerra-Valdivia told Ars Technica. “It also serves to emphasize the importance of a robust chronology in the study of human dispersal. First Americans research must be anchored in a reliable timeline.”
But its probably far from a settled debate, since the dates on the whole collagen samples still dont line up with the antler artifacts from the Clovis collection. These results lend support to the dates from single amino acids in the earlier studies, but they may not fully resolve the debate over whether to trust dates on single compounds or whole collagen samples.
“Disagreement is good and healthy in academia; it pushes us toward the critical assessment of evidence,” Becerra-Valdivia said. “The Anzick site has always sparked a good amount of debate. I hope for our data to add to the current discussion on a peopling process that is complex and nuanced.”
Anzick-1 was reburied in 2014, with several Native American tribes participating in the ceremony.
PNAS, 2018. DOI: 10.1073/journal.pnas.1803624115 (About DOIs).
Dealmaster: TCLs new Roku TVs are here, so the old one is down to $500 today
Start your (machine learning) engines: Amazons DeepRacer is almost here
This Prime Day Audible deal is actually awesome for book lovers
Apple, Google, Facebook line up to pay homage to EU privacy rules
House Democrats introduce bill to keep the US in the Paris Agreement
How Canada’s postal service makes Christmas extra magical by having Santa reply to every letter
Everyone thinks Cara Delevingne’s new Jimmy Choo ad is sexist – do you?
7 things you’ll only know if you work in retail on Christmas Eve
Missguided releases a collection of Disney themed tees
Glittery bag that’s actually a secret flask is perfect for Boxing Day pre-drinks
MOST WATCH
Space and science news
How to get the Ugandan Knuckles Snapchat filter: Do you know da wae?
‘Multilingualism is an enrichment, not a deficit’: raising bilingual kids in Germany
Berlin Tomorrow News © Copyright 2020, All Rights Reserved
Berlin Tomorrow News | cc/2020-05/en_middle_0128.json.gz/line950 |
__label__wiki | 0.595278 | 0.595278 | One Size Fits Small
The impact one size clothing has on body image
When scrolling through Brandy Melvilles website the thing that stands out most is that lack of diversity. All the models look the same, they range from a 22’ to 24’ waist and 5’7- 5’9.
Photo courtesy of Annabelle Harshbarger
By Annabelle Harshbarger, Millard West High School
In the past years, brands like American Eagle, Target and Old Navy have launched body-positive campaigns in order to include more diverse body types. Companies do this by adding sizes and having a diverse group of models. Although many brands are expanding to spread a body-positive message, there are still companies that are stuck in the past.
Many popular brands such as Brandy Mellvile and Hollister carry “one size fits most” clothing. But in reality, their clothing is targeted for size x-small or small. The idea behind one-size is to create a store where young girls can come and shop without worrying about size, but this lack of diversity in sizing can make the average-sized female feel like the odd one out.
Due to social media, brands like Hollister and Brandy Melville are given so much hype. Influencers with millions of followers promote and model for these brands, making it seem if people cannot fit into the clothes they cannot fit into the exclusive “club”. The company uses exclusivity to make the customer feel as if they belong if they are able to fit into the clothes.
Photo courtesy of Brandy Melville
Many social media influencers are featured on Brandy Melvilles instagram. Ellie Thumann is a fashion Youtuber with 2 million followers.
According to the National Eating Disorder Association, teenage girls who use social media are more likely to have an internalized drive for thinness and to participate in body surveillance. These habits are unhealthy and can greatly impact young girls’ body image.
When looking at the models from Brandy Melville’s Instagram and website it is clear that the models are a certain type: tall and slender with unrealistic beauty standards. The lack of diversity in not only the models body types,but in race shows how stuck in the past Brandy Melville really is. The company uses society’s ideal body image to create an aesthetic that will appeal to their teenage audience, but the image this gives teenage girls can be unhealthy.
According to the National Eating Disorder Association, 9 out of 10 women will resort to unhealthy eating habits, such as starving themselves and purging when they feel bad about their body image. These unhealthy habits can lead to eating disorders.
The negative impact that Brandy Melville has on young girls’ perceptions of their own bodies is dangerous and can lead to unhealthy eating habits.
The truth is everyone has a different body shape and not everyone is going to fit into one size. As cliche as it sounds, people come in all shapes and sizes and more realistic sizing would attract more customers to these brands.
This story was originally published on The Catalyst on November 8, 2019.
Cancel culture promotes mob mentality
Words: Declining in power, increasing in importance
Women’s March & Feminism: “Separate But Equal”
Opinion: Your World War III memes aren’t funny
The Stigma Behind Psychiatric Care and How it’s Detrimental
It’s time to talk about child marriage in the U.S.
Being gay is not a trend
Kentucky Needs to Expand Language Requirement
Column: Starving for hope
Integration of memes and politics | cc/2020-05/en_middle_0128.json.gz/line951 |
__label__wiki | 0.547038 | 0.547038 | Lietuviškai Help
23 results: 1 - 10 11 - 20 21 - 23 Next
VU scientific journals
Lithuanian scientific journals
Foreign scientific journals
Subscribed by VUL
Open access e-books
Dictionaries, reference books
ecology and environment protection
engineering and technologies
zoology, veterinary
Free access (all)
Open access (all)
full text (all)
abstracts (19)
bibliographic records (1)
English (all)
Browsing botanics (subject), resource type open access repository
Finding journals in databases or articles inside journals using this system is not possible. Please perform such searches inside databases and journals in their websites.
Data of subscribed databases may be copied (transferred to computer, printed, etc.) only in small quantities (One article from one journal or up to 20% of electronic book during one session). It shall be strictly prohibited to copy information completely. Transfer of such data to third parties, placement into web sites or use for commercial purposes is strictly prohibited. These legal relations are regulated by Law on Copyright and related rights of the Republic of Lithuania.
ARAN (National University of Ireland Galway)
The collection contains ARAN, the open access repository of the National University of Ireland, Galway. The repository includes peer-reviewed articles, working papers, and conference papers produced at the National University of Ireland.
CERES (Cranfield Collection of E-Research)
This collection contains The Cranfield Collection of E-Research – CERES, a digital repository of the research conducted at Cranfield University. Materials include journal articles, theses and dissertations, book chapters, working papers, and technical reports. Subjects covered include Engineering, Library Science, Management, Health, the Applied Sciences, and more.
DataCite support researchers by helping them to find, identify, and cite research datasets. It assigns persistent identifiers to citable datasets. All DataCite DOIs resolve to a public landing page that contains information about the associated dataset and a direct link to the dataset itself. A wide range of organizations contribute records to the DataCite Metadata Store.
Digital Commons @ SPU (Seattle Pacific University)
This collection contains DigitalCommons@SPU, the institutional repository of the research and scholarly output at Seattle Pacific University, as well as other institutional publications. The repository is open access.
Digital Dissertations
The collection includes dissertations submitted to LMU Muenchen. Subject areas cover a range of academic interests with an emphasis on Biology and Medicine.
Digital Repository @ Iowa State University (Iowa State University)
This collection contains the content of the Digital Repository @ Iowa State University. It includes scholarly and creative works, research, publications, and reports contributed by faculty, students, and staff at Iowa State University (ISU).
Digitale Sammlungen (Universitätsbibliothek Paderborn)
The Digital Collections of the University Library Paderborn allow free open access to electronic publications. The material includes pre-20th century books and documents of historical value from the holdings of the Library and its partners, and also documents pertaining to the the history of the University which was founded in 1972.
Dokumentenserver der FU Berlin
This collection contains the theses and dissertations produced at the Free University of Berlin.
DSpace@Cambridge (University of Cambridge)
DSpace@Cambridge, the institutional repository of the University of Cambridge, was founded to allowing academics and departments at the University to share and preserve material of a scholarly or heritage nature.
Edinburgh Research Archive (University of Edinburgh)
This collection provides the research found in the digital repository produced at the University of Edinburgh, including theses and dissertations, working papers, technical reports, and peer-reviewed journal reprints, among other publications. Topics covered include a full range of academic disciplines.
Vilnius University Library, Universiteto 3, LT-01122, Vilnius, Lithuania | mb@mb.vu.lt0.026259899139404 s | cc/2020-05/en_middle_0128.json.gz/line956 |
__label__cc | 0.708652 | 0.291348 | Ever wondered the best time to visit Koh Samui, Thailand? Checkout our latest blog to find out what to expect in each season!.
Koh Samui is one of Thailand's most popular tropical paradises, for good reason. It boasts stretches of white sand and lush jungles. For most of the year, it's balmy and sun-soaked, but Koh Samui does have a fierce monsoon season! The weather in Koh Samui can be tricky to navigate. We take you through month by month so you can discover the best time to visit Koh Samui. Our Koh Samui Guide outlines to what to expect in each season.
DRY SEASON: JANUARY- FEBRUARY
Koh Samui's Dry Season starts in January and runs through February for three months of temperate, dry beach-ready weather.
WHAT TO EXPECT IN: JANUARY
Tourists flock to Koh Samui in January to soak up some island rays at your beach club while avoiding the sweltering heat. Temperatures hover in the 70s and low 80s, making January pleasant weather for those not accustomed to tropical heat.
WHAT TO EXPECT IN: FEBRUARY
February is the driest month of the year, with incredible weather! Take your sweetheart to a luxurious beach club during February and you won't be disappointed.
WHAT TO EXPECT IN: MARCH
You'll enjoy the dry weather and warm seaside winds during March, but those who visit towards the end of the month will find that the mercury is rising fast.
HOT SEASON: APRIL- SEPTEMBER
Koh Samui's Hot Season is the longest and most varied of the seasons. Some months are scorchers, while others are absolutely sublime. Read on for details! Hot Season starts in April and runs through September.
WHAT TO EXPECT IN: APRIL
April is the hottest month of the year, with temperatures reaching up to 100 degrees Celsius. Fortunately, it's also when Songkran (Thai New Year) occurs. Songkran is famous for it's huge water fights so you can beat the heat by joining the fun!
WHAT TO EXPECT IN: MAY
May's temperatures are sizzling but you'll find some relief in an uptick of rainfall, as Hot Season begins its slow descent into monsoon/rainy season. May storms are a brief and welcome respite from the heat.
WHAT TO EXPECT IN: JUNE
June is the height of Hot Season. It's cooler than April and May, but ferocious thunderstorms are not yet a daily occurrence. Enjoy splendid days relaxing on Koh Samui's gorgeous beaches.
WHAT TO EXPECT IN: JULY
Along with January; July and August are when vacationers flock to Koh Samui. The weather is beautiful, the rain is sparing and it's the perfect time to enjoy this fabulous island.
WHAT TO EXPECT IN: AUGUST
Visitors can expect magnificent weather in August, arguably the best time to visit Koh Samui. Divers and snorkelers will especially love visiting during August.
WHAT TO EXPECT IN: SEPTEMBER
Early September mimics August, but as the month rolls on you'll notice a change in the temperature and precipitation. September rests on the edge of the rainy season.
RAINY SEASON: OCTOBER- DECEMBER
Koh Samui’s rainy season can be intense but it’s still possible to have a string of nice days. You can find something fun to do like chilling in the ocean club, enjoying an indoor brunch or watching a good movie.
WHAT TO EXPECT IN: OCTOBER
October can be a hit-and-miss month. Some days are clear and sunny, while others are cloudy and rainy. The last week of October issues in the official rainy season.
WHAT TO EXPECT IN: NOVEMBER
November is the heart of the rainy season, with Koh Samui getting well over a foot of rain. Even if paradise is drenched, there are still several indoor activities to do if you visit during November.
WHAT TO EXPECT IN: DECEMBER
December is windy and rainy at the beginning of the month, then slowly becomes warmer with calmer seas as the New Year approaches.
The "Gem of the Gulf" is amazing any time of the year, but having a good understanding of the weather in Koh Samui will make your trip memorable and help you make the most of your vacation! | cc/2020-05/en_middle_0128.json.gz/line967 |
__label__cc | 0.537868 | 0.462132 | Home How To How to Receive Location Updates from Friends Using Find My on iPhone...
How to Receive Location Updates from Friends Using Find My on iPhone and iPad
Rajesh Mishra -
Last Updated: November 25, 2019 11:56 am
Apple has combined both the Find My Friends and Find My iPhone and named it as “Find My” in iOS 13 and iPadOS. From a user-experience point of view, I think it’s a well-thought-out move. While there is hardly anything new in terms of functionality, the app has simplified quite a few things including the option to get location updates from a person. If you wish to keep a track of the location of your friend or loved one to stay in the loop about their whereabouts but aren’t sure how it works, follow along as I show you how you can receive location updates from friends using Find My app on iPhone or iPad.
Receive Location Updates from Friends Using Find My
By default, Find My app sends you everyone’s location updates – even from those with whom you don’t share your location. Just in case, you want to receive alerts only from the ones you share your whereabouts with, there is a way to get it done. With that said, let’s get going!
1. Open Find My app on your device.
2. Now, tap on People tab and then select the friend you want to receive location updates from.
3. Next, swipe up your friend’s card to get more information. Tap on Add under Notifications section.
4. Next up, choose the “Notify Me” option in the pop-up menu.
That’s it! Going forward, you will receive location updates from the selected friends. If you ever happen to change your mind, all you have to do is come back to the same notification section of the person’s card and then turn it off.
Choose to Receive Location Updates from Everyone or Only with People You Share Your Location
1. Open Find My app on your iPhone or iPad.
2. Now, tap on Me tab at the bottom right corner.
3. Next, swipe up from the bottom to reveal more info and then hit Receive Location Updates.
4. Next up, you have two options:
Everyone: Receive updates from everyone.
People You Share With: Receive updates only from the people you share your location with.
Select the preferred option and you are ready to go.
Get Location Updates from Friends Using Find My App…
So, that’s how you can keep an eye on the location of your friends. I like the revamped look of the Find My iPhone and Find My Friends. The new app has a more intuitive design that enhances user experience. By the way, which is your favorite iOS 13 feature? Is it improved security and privacy, the redesigned dark mode, or anything else. Let us know in the comments section below.
Find My
Poco X2 Will Be a Rebranded Redmi K30 4G; But Is That a Bad Thing?
Alleged Motorola Edge+ Geekbench Listing Shows 12GB RAM
MWC 2020: Motorola Confirms ‘Flagship Smartphone’ Launch
Tata Nexon EV with 312Km Range Launched in India Starting at Rs. 14 Lakhs
Global Smartphone Sales to Grow 3% in 2020: Gartner
Positionstack: Forward and Reverse Geocoding REST API
How to Disable Ultra Wideband Chip on iPhone 11/11 Pro to Prevent Location Data...
Following security expert Brian Krebs' sensational revelation in December last year that the iPhone 11 Series devices access location data even when a user...
Rajesh Mishra - Jan 28, 2020
How to Filter YouTube Subscriptions Feed on iPhone and iPad
If you love watching YouTube videos, you may have subscribed to a ton of channels like our own YouTube channel. But did you ever...
How to Connect iPhone to Chromebook and Transfer Photos
iPhone and Chromebook are products from two tech giants who are distinct in their approach and often at crossroads on software compatibility. And since...
Arjun Sha - Jan 22, 2020
How to Enable Dark Mode in Apple Books on iPhone, iPad, and Mac
A full-fledged system-wide dark mode seems to be an automatic choice when you want to turn the entire user-interface pitch black for an easier-on-the-eyes...
7 Best Tips to Speed up Typing in iOS 13 and iPadOS 13
Typing on a tiny software keyboard isn't something that most enjoy. While many may still argue that onscreen keyboard remains inconvenient to type -...
Lenovo Legion Y540 Review: A Sleek Laptop with Great Performance
8.6 Akshay Gangwar
With ray tracing becoming more and more mainstream, gaming laptop makers are now embracing RTX graphics all over the place, across a variety of price points. I’ve reviewed a fair amount of RTX-p[...]
Asus Vivobook 14 X403 Review: Insane Battery Life, Impressive Performance
Whenever we get a new laptop in to review at the Beebom office, I’m usually fairly excited. Sometimes, I’m too excited, and sometimes I’m not, but I am excited to a certain degree [...]
Asus ROG G703GXR Review: What Can’t This Thing Do!?
I’ve reviewed a lot of Asus gaming laptops, and while I’ve liked a lot of them a fair bit, I don’t think anyone of them comes close to the feeling that the ROG G703GXR evoked inside [...] | cc/2020-05/en_middle_0128.json.gz/line972 |
__label__wiki | 0.726565 | 0.726565 | NCAA court database
By kodrinsky, March 22, 2013 in Concepts
ncaa courts
kodrinsky 195
Location:The Kingdom of Valencia
Wells Fargo Center (2017/2018)
Cintas Center (2017/2018)
Cameron Indoor Stadium (2017/2018)
McCarthey Athletic Center (2017/2019)
United Supermarkets Arena (2017/2018)
Allen Fieldhouse (2017/2018)
Mackey Arena (2017/2018)
Dean Smith Center (2017/2018)
BB&T Arena (2017/2018)
Auburn Arena (2017/2018)
Charles Koch Arena (2017/2018)
McKale Memorial Center (2017/2018)
LittleJohn Coliseum (2017/2018)
Value City Arena at Jerome Schottenstein Center (2017/2018)
Crisler Center (2017/2018)
Thompson-Boling Arena (2017/2018)
Ryan Center (2017/2018)
WVU Coliseum (2017/2018)
Lawlor Events Center (2017/2018)
McKeon Pavilion (2017/2018) | cc/2020-05/en_middle_0128.json.gz/line977 |
__label__wiki | 0.806217 | 0.806217 | Home » Yearly Breakdowns » 2000 » THE CREW
Genre(s): Comedy | Crime
Directed By: Michael Dinner
Written By: Barry Fanaro
Domestic Distributor: Disney (Touchstone)
Cast: Richard Dreyfuss, Burt Reynolds, Dan Hedaya
Financed by: George Litto Pictures; Disney
Domestic Box Office: $13,023,075 Overseas Box Office: $82,778
The Crew was in development in the late ’90s at Disney, but the mouse house put it into turnaround. DreamWorks picked up the project in 1998, which was looking to dip its toes for the first time into lower budget movies with The Crew and what would become the 2000 best picture winner and huge box office success American Beauty — but DreamWorks eventually put The Crew into turnaround.
The project began to move forward again with financing from George Litto Pictures. The budget for The Crew was $25 million and George Litto Pictures covered 65% and a deal was brokered with Disney to contribute the remaining 35% and handle domestic distribution. George Litto formed a partnership with Capella International, called Capella/Litto International to handle overseas sales for what would be their upcoming slate of movies, but The Crew was the first and only picture to materialize — which ended in litigation for George Litto. $14 million in overseas sales were accounted for.
After The Crew flopped at the box office, a messy legal battle began. George Litto planned on producing a minimum of five movies within two years from a $250 million financing arrangement through Chase Manhattan Bank. The French insurance company AXA Reassurance, would cover any loss for Chase. AXA partnered with Underwriters Reinsurance Company (URC) and a few other insurers for the deal. Once The Crew bombed and lost $13,107,880, AXA refused to pay the shortfall and severed their contract with Litto, which prompted Chase to also end their five picture financing arrangement. URC and the other insurers also did not pay. Chase sued AXA for nonpayment and Litto Sued AXA for $50 million in damages. AXA also brought a suit against Chase, but the courts found AXA responsible to Chase. In 2002, when that judgement was handed down, AXA then sued URC seeking rescission of the contract and payment from URC’s portion of underwriting The Crew. URC countersued, but was found responsible for $1,163,508 to AXA. Chase also sued URC and the other insurers who were responsible for covering the loss and the case was settled between the companies. Did you follow all that bullsh-t? AXA pulled out of the film underwriting business and fired the executive who setup the deal. All this costly and lengthy litigation for a worthless movie.
As for the actual release of the movie, Disney dated The Crew for the slow end of summer August 25 frame, where it bowed against Bring It On and The Art Of War. It would also have direct competition with the hit geezer pic Space Cowboys in its 4th weekend. The Crew received terrible reviews and tanked with $4,051,921 — placing #8 for the weekend led by Bring It On. Audiences gave it an awful C+ cinemascore, but it declined just 8.3% over the slow Labor Day frame to $3,714,745. The Crew then sank 69% to $1,156,268 in its third session and the domestic run closed with only $13,023,075. Disney would see returned about $7.1 million after theaters take their percentage of the gross, leaving much of the P&A costs in the red.
The Crew was dumped straight to video in almost every overseas market and the only recorded offshore gross is $82,778.
Jp780 says
I love this movie | cc/2020-05/en_middle_0128.json.gz/line978 |
__label__cc | 0.733582 | 0.266418 | CD Workshops
in The Actors Voice on August 15, 2005 January 13, 2019 Share Facebook Twitter Pinterest Email
Here it is: my column on casting director workshops! As you’ll recall, I was asked about CD workshops a few weeks ago, and due to my inexperience with the CD workshops currently available, I asked for your help in putting together my column. First off, thank you for the emails! Next, I found the email responses to fall into several distinct categories: pro-workshop (and naming favorites), workshops-are-a-necessary-evil (and reluctantly listing a few that are “less-evil”), anti-workshop (and calling ’em names), and here’s-how-we-can-improve-the-workshop-world (with some great advice and suggestions).
Please note that I am protecting the identities of those who shared so graciously with me on this controversial issue. I am well aware of the political heat the CD workshop issue took a couple of years ago and I know that actors are in a precarious position, when they complain about something in which they feel they have no choice but to participate. So, those of you who feel the need to find out who said what about whom, know right now that I will not be sharing such information. Period. Those who own this website don’t know who said what to me on this issue either. Don’t bug them. Please.
Also note that nearly every email I received about experiences with CD workshops began with, “I’m new in town,” “I just got to town,” and, “Since I only recently arrived in Hollywood,” before launching into why CD workshops may have worked for the actor writing the email. It seems the standard practice in Los Angeles is to take CD workshops while the various casting offices are getting to know you, weaning yourself from them once you’ve been called in to audition legitimately. Many veteran actors referred to CD workshops as “something I did when I first got here” or an option “for a very specific purpose” in connecting with a particular casting director. “Until I could learn LA and find out how to begin to network here, CD workshops were my best opportunity; but they should not be the be-all and end-all of one’s networking attempts,” one actor said.
Okay, so now that the disclaimer portion of this week’s column is out of the way, let’s get to the good stuff, one category at a time.
Favorite Workshops
Act Now: “Act Now offers three-week classes with the same casting director and the classes are fairly evenly priced with other workshops (working out to about $50/night) but my manager was on my case because she doesn’t feel that I’m meeting enough CDs since each class is almost a month long.” “Every one of the CDs I’ve met at Act Now has called me in and Dana Olson recently called me directly and booked me for an U5 on Passions.” “They have consultants that call to let me know which workshops are going on.”
Actors Alliance (NY): “I chose Actors Alliance because they are very discerning about both the level of talent allowed in through auditions and the level of honest interest from CDs in actually meeting talent with the intent of possible future contact.” “I’ve gotten so much info and insight from most of the sessions I’ve attended that it has been worth it.” “Also in New York, I’ve heard great things about the workshops run by Bob Lambert. I know a few people who have booked U5s on All My Children from his workshop alone.”
Actors Co-Op Group: “I love Actors Co-Op Group because I get cold reading practice with very good scenes brought in by CDs and the level of our group is very high. I get to begin long-term relationships on which this whole wacky biz is based for $95/four-pack (nonunion actors pay more) and it’s fully tax-deductible. I know they’re not for everyone, but I’ve enjoyed our workshop so much!”
ActorSite: “I was informed, going in, that without a satisfactory audition with ActorSite, I couldn’t become a member. I was not given a sales pitch or induced in any way to join. I feel that attending workshops along with the other things that are available as a member have been well worth the cost.”
ITA (In the Act): “ITA offers discounts to members for referrals who are accepted (since an audition is required).” “In one year, I have gotten ten auditions that are a direct result of having met CDs through the ITA workshops.”
One on One: “Of the auditions I’ve gotten as a result of meeting CDs at One on One, so far I have booked three jobs.” “They audition actors and not everyone is accepted.”
Reel Pros: “I think the best way to judge is by the talent in the room. Reel Pros has good actors doing good work.”
SAG CAP — Casting Access Program (NY and LA): “I’ve only been doing SAG workshops for a few months, but I’ve learned quite a lot. CDs are just people. My cold reading skills are getting better. I’m gaining confidence.” “The NY SAG CAP session I recently attended was well worth it.” “I am fortunate enough to be a member of both SAG and AFTRA. These unions have opportunities for their members to attend free workshops. Although there are restrictions on how often you can attend the performance workshops, I think any actor would benefit by taking advantage of these wonderful workshops from their first day in the union!”
Favorite general comment from a pro-workshop email: “The odds of booking a job directly because of attending a specific workshop are miserably low, as you say, but the chance is real (however small). CD workshops provide the benefit of daily cold reading in front of CDs. This keeps you loose, fresh, and bookable for when that audition comes. The odds of winning Mega Millions are 1 in 175 million. There are like 1700 submissions per role on Actors Access, right? We’re used to long odds.”
Since-We-Have-To Workshops
Most comments from the “since-we-have-to” group of emails are of this nature:
“Let’s call them what they are: paid auditions.”
“I will continue to go to workshops to meet CDs I’ve never met until I feel enough energy has been generated.”
“I don’t think I’m going to be discovered or anything, but I just wonder if doing workshops will be a good springboard for me to make some good first impressions and perhaps a foundation to begin new relationships as I travel to LA from Vancouver to attend workshops from time to time.”
“It’s no mystery how this works. You take a workshop and within the next week or so, you find yourself called in on The West Wing. Money well spent.”
“It does bother me to pay-to-play as it were, but as an unknown actor, I’m not sure how else to get in front of CDs now that most of you don’t do generals.”
“Nothing else was working, so I figured I might as well give it a shot. I received great feedback, but that’s never gotten me an audition and that’s why we go to these things, right?”
“I was new to town, didn’t know any CDs, and had no luck requesting general appointments. I figured paying was the only way for me to meet casting directors. I did about 30 workshops at a variety of places over a year and a half, spent $1000, and never got one audition.”
“In an industry with almost no control for the actor (especially bottom-of-the-heap, lower-level actors trying to get co-star roles), workshops are one way to control our ability to be seen by assistant and associate casting directors.”
“We’re all paying to come in and audition for CDs. I held out for a long time, but I’ve finally surrendered because they told me to. They said this is the best and only way of getting CDs to know me so that when I’m submitted on something, they’ll know who I am.”
“Not all CD workshops are overly expensive. In fact, some of the better ones are the most reasonably-priced.”
With that said, here are the workshops mentioned by name with something between a rave review and an outright “avoid” comment.
Act Now: “I’ve heard dubious things about Act Now, but I haven’t been there myself.” “They did audition me to enter the program, however I don’t feel that there are any levels in terms of which class you can take, so that felt a little bogus.”
Casting Network: “I have heard good things about Casting Network. They come recommended by agents, managers, and actors, so I feel like I owe it to myself to check it out.”
PrimeTime: “I had excellent experiences with PrimeTime back before they melted down. I’m under the impression that they are completely out of business now, but if they’ve reformed, actors should be aware that it’s a different group than the one that established such a stellar reputation ten years ago.”
Reel Pros: “Of all the CDs I met at Reel Pros, not one of them called me in.” “I have several actor and CD friends who recommend Reel Pros. When I get the money, that’s where I’ll be starting back up.”
Workshops We Avoid
Reel Pros: “Many of the actors were what I considered below par and because most of the CDs had us read in pairs, it was difficult to overcome that.” “I did not like the workshops I went to at Reel Pros II. They felt very much like the CDs were only there for the money. Each class I took felt rushed; like the CDs were just trying to get through all of us and that’s it. I understand that attitude at an audition, but at a class that I paid for, I expect at least an iota of feedback.”
TVI: “Places like TVI take anyone. If you’re going to do a workshop, surround yourself with great talent.” “I advise against TVI. They fancy themselves as managers and charge gobs of money for this service (things that actors can do themselves) as a prerequisite for signing up for their most popular classes (which also cost money).” “TVI’s consultants advise that you pad your resumé, calling extra work featured work, to make it look like you have more on-camera experience than you do.” “They routinely advertise that a certain CD will be running a workshop, knowing full well that the CD in question is unavailable. Then, at the last minute, they bring in some low-level assistant to fill in for the unavailable CD.”
While I received many more negative comments on specific CD workshops, the ones I’ve chosen not to post here were overly-general or second-hand in nature.
Some really good guidelines, from readers emailing about CD workshops to avoid include:
“Avoid any workshop where you are not exactly meeting with the actual casting director, but rather with an assistant. Those workshops feel like a scam.”
“Pick workshops where you’ll see the primary CD in the office. Some associates do have some ability to bring in actors for auditions, but it’s different in every office.”
“The most frustrating part of CD workshops is meeting with a casting associate or assistant and then trying to follow up with that person after the workshop, when this person no longer works for the casting office. I shelled out this money to be seen in front of this CD’s assistant and within a few weeks, this person isn’t even in that office anymore! What a rip-off!”
“Don’t these people care that they’re only seeing the actors who can afford to pay for the privilege?”
“I don’t like CD workshops that come to our city and charge $200 per actor for about three or four hours. Scam!”
How To Improve Workshops
“Where it starts to go haywire is when people make a career out of going to workshops. No one should be going to a CD workshop until ready to be seen by a CD. Once you’ve seen a CD and been called in for an audition in the office (or have been cast), it is totally unnecessary to see them again. Just like with everything in this business, there are scams and shoddy venues. Shop around.”
“I’d love to see SAG and AFTRA step up to the plate and create many, many opportunities for CDs to have workshops and generals for actors. If supply met demand under union auspices, it would seem a lot less sleazy and be viewed as more regulated. The CDs could still get an honorarium from SAG and I’m sure the actors would gladly pay the administrative costs of the program.”
“Most lie to the actors. Workshops say so-and-so is casting this-and-that (or they’ll be casting two new projects in the next few weeks). They prey on the fact that most actors do not know what’s going on. How about knowing what we are paying for? How about a central website where people post what they booked from workshops and who called them in? Let’s find out who’s doing what so the good ones are recognized for bringing us in.”
So, get on it! Mobilize yourselves and share information with one another. Plays are reviewed every day! Why not review the CD workshops? If what we witness in the workshop culture is simply supply and demand, then why not subject the industry to the process of “consumer review” so many products and services in a capitalist society rely on?
I’m sure I’ll be hearing from you on this topic again. Thanks, everyone, for the source material for this piece. Wherever you stand on the workshop issue, make sure you make well-researched choices before spending any of your hard-earned actor money!
Bonnie Gillespie is living her dreams by helping others figure out how to live theirs. Wanna work with Bon? Start here. Thanks!
Originally published by Actors Access at http://more.showfax.com/columns/avoice/archives/000275.html. Please support the many wonderful resources provided by the Breakdown Services family. This posting is the author’s personal archive.
casting what you control
← Me in 100 Things
Me in 100 Things
Trust Your Agent →
Trust Your Agent
Bonnie Gillespie
is living her dreams by helping others figure out how to live theirs. Wanna work with Bon? Start here. Thanks!
The Actors Voice
But Famous Actors Don’t Need to Worry about Branding!
Dichotomy Required
Stop Multitasking
Living my dreams by helping others figure out how to live theirs.
SUBSCRIBE NOW AND RECEIVE INSPIRATIONAL INBOX LOVE, PLUS A FREE MP3 OF THE SMFA TOP 20!
Timeframe for Casting?
Bad Headshots, Good Headshots
Life as a Series Regular
Using Notes in Actors Access Submissions
Your Bio
Advice for Canadian Actors Hoping to Work in the States
Magic 8 Bon
Chris Clowers
https://bonniegillespie.com/testimonials/chris-clowers/
Lindsay Hollister
https://bonniegillespie.com/testimonials/lindsay-hollister/
Cat LaCohie on 6W2LA
https://bonniegillespie.com/testimonials/cat-lacohie-on-6w2la/
Stef Dawson (3-picture deal on HUNGER GAMES)
https://bonniegillespie.com/testimonials/stef-dawson/ | cc/2020-05/en_middle_0128.json.gz/line979 |
__label__wiki | 0.827961 | 0.827961 | Image via NSW Government
CIMIC subsidiaries, CPB Contractors and UGL, have been selected by the NSW Government to deliver the ‘Line-wide works package’ in support of the Stage Two Sydney Metro City & Southwest project, pinned as Australia’s grandest public transport project.
“This new work at Sydney Metro aligns well with CIMIC Group’s unique offering as an integrated rail solutions provider,” said Michael Wright, CIMIC Group CEO.
“The project combines the proven rail-sector expertise within our construction company CPB Contractors and our asset solutions provider UGL to deliver an end-to-end result, covering design, construction and commissioning of the project.”
CPB Contractors is already engaged in various Sydney Metro activities, where they have been delivering contracts on Sydney Metro City & Southwest and Sydney Metro Northwest, WestConnex M4E and the new M5.
UGL’s work covers tunnel fit-outs for the Metro Northwest and Epping to Chatswood projects.
The metro works will begin this year with completion anticipated by 2024.
“As Australia’s leading systems contractor in the transportation sector, the Sydney Metro City and Southwest Line-Wide Works package will continue our relationship and strong performance with Sydney Metro,” said Jason Spears, UGL Managing Director.
“The involvement of our in-house operation and maintenance teams throughout the design and construct phases will optimise operational performance at the project.”
Sydney Metro has been a family affair for CIMIC Group, where CPB Contractors, UGL, EIC Activities and Pacific Partnerships are all involved in the project across development, delivery and operations.
“This project further builds on CPB Contractors’ rapidly growing portfolio of rail projects across Australia, including the Sydney Metro Northwest and the Metro Tunnel in Melbourne,” said Juan Santamaria, CPB Contractors Managing Director.
We’re committed to leveraging our unrivalled experience on major projects to safely deliver this important infrastructure for the people of NSW.”
According to CPB, the JV will play a pivotal role in the design, construction and commissioning of:
Major rail systems in the new twin 15km Sydney Metro tunnels from Chatswood to Sydenham;
The expansion of the existing Sydney Metro Trains Facility at Rouse Hill and delivery of the new Sydney Metro Trains Facility South at Marrickville; and
Tunnel ventilation, mechanical and electrical systems for seven underground stations, and power systems for the Sydenham to Bankstown section.
Source: CBP Contractors | cc/2020-05/en_middle_0128.json.gz/line983 |
__label__cc | 0.718391 | 0.281609 | New music: Sue Samuel - Songs from the Secret Place
Shabbat shalom, holy friends. Fresh new Messianic music on Chavah for your listening pleasure and edification in the Lord!
Sue Samuel – Songs from the Secret Place
We spoke with Sue a few weeks back about getting her music on Chavah, and we’re pleased she was receptive to the idea, and now we get the first of her music on the station.
Sue Samuel is a Messianic Believer in Messiah Yeshua (Jesus) who loves to sing, worship, and write songs all to His glory.
Having lived victoriously through health challenges and heartbreak, her greatest desire is to convey a sense of wonder, amazement and awe for all the L-rd has done, in a language that spans generations and cultures. She longs to comfort others with the comfort she, herself has received of G-d. Her music can be described as folky/adult contemporary with a Hebraic flare, and her voice has been compared to Natalie Merchant, Patsy Cline, Christine Dente, and Joni Mitchell. If you are looking for some calm, comforting, "secret place" (Psalm 91) music, give Sue a listen.
After meeting her husband Brian in 1995, they began attending a Messianic Jewish Synagogue, where Sue grew a deeper appreciation for the Jewish roots of her Christian faith and a love for G-d's people, Israel. Sue and Brian often minister together, his skillful keyboard playing, sweet "Paul Balochian" voice and clever schtick are always a welcome addition.
Sue's two albums, "Home Away From Home" and "Songs ...from the Secret Place" are both produced by CCM great Margaret Becker.
You can purchase Sue’s music over at http://www.suesamuel.com. Enjoy the fresh new music for Messiah.
New music: Sue Samuel - Songs from the Secret Plac...
New music: James Block - Open the Gates
New music: Moshav - Shabbat Vol. 2 | cc/2020-05/en_middle_0128.json.gz/line987 |
__label__cc | 0.624035 | 0.375965 | Struggling Moose Now Face a Toxic New Threat
Jane Kirchner | January 15, 2014
Moose depend on clean water in rivers, streams and ponds, where they feed on aquatic plants.
Several moose populations are struggling in places where this majestic animal was once a common sight. In New Hampshire, the number of moose has dipped to fewer than 5,000 across the state and a population in northeastern Minnesota is declining at an alarming rate of 25% each year. Research is currently underway to determine why the moose are disappearing, but we do know that habitat loss in this country is one of the threats they face!
Habitat at Risk
Now, moose in the Northeast and Upper Midwest are facing a deadly new threat: toxic tar sands oil spills in the waters where they feed.
Big Oil is proposing to pump up to 300,000 barrels of tar sands oil per day through pristine moose habitat in New England. The proposed route would run across or near vital waterways such as the restored Androscoggin River, Sebago Lake and the Connecticut River. Moose are also in jeopardy in Minnesota where an oil pipeline is slated to increase transport to up to 850,000 barrels per day of this dirty oil through the forests they inhabit.
Protecting Moose from a Tar Sands Pipeline Spill
When a pipeline carrying tar sands oil ruptures, the poisonous sludge spewing into the water spreads quickly and is almost impossible to clean up—a heartbreaking lesson learned in Michigan’s Kalamazoo River, where toxic oil lingers and wildlife is still suffering from a pipeline spill three years ago.
But, we can help prevent a similar tragedy from destroying thousands of acres of sensitive wildlife habitat and taking a toll on moose and other wildlife by stopping tar sands pipelines.
Wildlife advocates like you have stood strong over the past year with communities like South Portland, Maine who are saying “no to tar sands” and “yes to wildlife”. With your help, we can press federal officials to deny Big Oil’s plans and keep tar sands from polluting the rivers, streams and ponds that moose and other wildlife depend on.
Please donate today to help keep moose habitat safe from tar sands and protect other at-risk wildlife.
Wildlife Facts | clean water, Great Lakes, moose, Northeast, oil spill, tar sands pipeline, wildlife habitat
Written by Jane Kirchner | cc/2020-05/en_middle_0128.json.gz/line988 |
__label__wiki | 0.524572 | 0.524572 | Snowy Owls, Farm Bill in the Weekly News Roundup–February 7, 2014
Anne Goddard | February 7, 2014
The Polar Vortex Brings Rare Snowy Owl Sightings
Photo by National Wildlife Photo Contest entrant Brian Hansen.
No, it’s not Hedwig carrying your long awaited acceptance letter from Hogwarts, but recent rare sightings of snowy owls have inspired many Americans to take up birding.
“The sudden arrival of snowy owls up and down the East Coast and as far south as Florida is a surprise winter gift from North America’s northern realms, and people are flocking to airports, beaches and parking lots to see them. This ‘irruption’ as the ornithologists call it is one of the largest known migrations of snowy owls in U.S. history.”
The snowy owls surprise arrival serves as a significant reminder of the precious wildlife in the North that could be harmed by the proposed Keystone pipeline. Read Larry’s post about Snowy Owls to find out how the Keystone XL pipeline can compromise North American wildlife for generations to come.
What’s happening at National Wildlife Federation this week?
Sportsmen: Public land use must be balanced
Nov 5- As members of Congress tackle ways to manage our public lands, a national sportsmen’s coalition continues to urge lawmakers to strike a balance that permits responsible energy development while maintaining healthy fish, wildlife and habitat and allowing public input.
Speakers in a hearing of the House Subcommittee on Energy and Mineral Resources Wednesday objected to what they see as unnecessary regulation of drilling on public lands. Sportsmen for Responsible Energy Development supports a process that involves the public and provides certainty for everyone – the industry, public agencies, landowners and the millions of Americans who hunt, fish, recreate and make a living off public lands.
Take Action! Tell the Bureau of Land Management to protect the Roan Plateau’s crucial mule deer habitat from drilling.
Senate Passes Farm Bill that Locks in Key Benefits for Wildlife
Nov 4- The U.S. Senate today passed by a vote of 68-32 a new five-year farm bill that prioritizes the conservation of our nation’s wildlife, water and soil. The bill is expected to be signed into law by President Obama imminently, clearing the last hurdle in a drawn out battle that has taken more than two years.
Larry Schweiger, president and CEO of the National Wildlife Federation, said today:
“With so many competing interests, it is a huge victory for wildlife that the conservation of our nation’s natural resources was prioritized and included in the final bill. By re-linking conservation compliance to crop insurance, funding key conservation programs, and including a sodsaver provision in key states to protect grasslands, this bill will help wildlife from across our prairies to our oceans.
Read our full analysis of the bill (pdf) and our blog post for more information on how the bill helps wildlife.
NWF applauds sportsmen’s legislation
Nov 4- The National Wildlife Federation welcomes the announcement of a bipartisan legislative package in the Senate that would expand and enhance hunting, angling and other outdoor recreation on our public lands and help secure conservation funding for years to come.
The Bipartisan Sportsmen’s Act of 2014 prepared by Sens. Lisa Murkowski, R-Alaska, and Kay Hagan, D-N.C., and introduced Tuesday includes a provision to open currently inaccessible public lands to hunting and fishing. Another would give the Interior secretary permanent authority to permit states to issue electronic duck stamps, which generate vital funding for wetlands conservation.
“Hunters, anglers and outdoor enthusiasts of all sorts make up about half our 4 million members and supporters. The National Wildlife Federation was formed nearly 80 years ago after our founder, J.N. “Ding” Darling joined other sportsmen and wildlife conservationists to protect wildlife and invest in conservation,” said Larry Schweiger, president and CEO of the National Wildlife Federation.
Learn about how climate change is affecting hunters and anglers.
And now here are highlights from NWF in the news:
CNN: Keystone Pipeline Push
CNN’s Jonathan Mann speaks to Joshua Saks of National Wildlife Federation about the newly released Keystone Pipeline Report.
New York Times: Report Opens Way to Approval for Keystone Pipeline
Larry Schweiger, the president of the National Wildlife Federation, said: “This is a large source of carbon that’s going to be unleashed. We’re headed in a terribly wrong direction with this project, and I don’t see how that large increase in carbon is going to be offset.”
Washington Post: State Department IG won’t release Keystone XL report on a contractor Friday
“What about Canada’s own government or the oil industry, which has repeatedly said Keystone XL is needed to realize tar sands growth plans that Canada projects will cause its own carbon emissions to soar 38% by 2030? Or will State stand by the oil industry consultants it hired to write that first draft currently being investigated for conflicts of interest?”
MSNBC: Reactions to Keystone Pipeline Impact Report
“In this report, for the very first time, the State Department acknowledges a scenario in which the Keystone XL tar sands export pipeline dramatically increases carbon pollution. That’s a welcome and long overdue change, and it gives President Obama all the evidence he needs to reject Keystone XL.”
Science World Report: Is Climate Change Affecting Mental Health?
According to a report released by the National Wildlife Federation’s Climate Education Program and the Robert Wood Johnson Foundation in 2012, climate change-related events are expected to cause an increase in mental and social disorders. Such disorders include depression, anxiety, post-traumatic stress disorder, substance abuse, suicide and violence.
Washington Post: The farm bill is up for a final vote soon. Here’s why so many people hate it.
And hundreds of conservation groups, including the National Wildlife Federation and Nature Conservancy, favor the bill’s protections for water and soil.
Coloradoan.com: Colorado weighs need for new oil rules in flood’s wake
Colorado oil and gas regulators set a precedent on Thursday by hosting a public forum on lessons learned from oil spills caused by the September 2013 floods, said Colorado Oil and Gas Conservation Commission Director Matt Lepore.
The Herald: How to get kids (and their gadgets) outdoors
I have written tons about how to get kids to put down their gadgets and get outdoors. So I thought it was fascinating that the National Wildlife Federation has actually decided to embrace a new approach when it comes to kids and tech – get kids to go outside with their gadgets.
Kansas City Star: FEMA: Caught between climate change and Congress
Two leading environmental groups, the Natural Resources Defense Council and the National Wildlife Federation, have petitioned FEMA for more than a year to overhaul its disaster mitigation program, asking to require – not just suggest – that communities include climate impacts in their grant requests and strategic plans.
Conservation | climate change, Congress, energy, Global Warming, keystone xl, Keystone XL pipeline, nature, public lands, Senate, snowy owls, tar sands, Weekly News Roundup, wildlife, wildlife and global warming
Written by Anne Goddard | cc/2020-05/en_middle_0128.json.gz/line989 |
__label__cc | 0.711071 | 0.288929 | Positive Technologies - learn and secure
Low-level Hacking NCR ATM
Image credit: Sascha Kohlmann, CC BY-SA 2.0
Many of the systems that power the modern world are supposed to be beyond the reach of mere mortals. Developers naively assume that these systems will never give up their secrets to attackers and eagle-eyed researchers.
ATMs are a perfect case in point. Thefts with malware of the likes of Cutlet Maker, as well as unpublicized incidents when unknown attackers plugged in their laptop to an ATM and stole cash without leaving any system logs behind, confirm what the security community has long known. There is no such thing as a hack-proof system, merely one that has not been sufficiently tested.
Even now, many people think that the only way to rob an ATM involves the brutest of brute force: pulling up in a pickup, attaching a hook, and pushing hard on the gas pedal, before savaging the ATM with a circular saw, crowbar, and welding kit.
But there is another way.
After a brief search on eBay, I obtained the board for a NCR USB S1 Dispenser with firmware. I had two objectives:
Bypass the encryption used for commands (such as "dispense banknotes") that are sent by the ATM computer via USB to the dispenser.
Bypass the requirement for physical access to the safe in order to complete authentication (which must be performed by toggling the bottom cassette in the safe), which is needed for generating the encryption keys for the commands mentioned above.
The firmware is an ELF file for the NXP ColdFire processor (the Motorola 68040, my favorite CPU!) running on VxWorks v5.5.1.
There are two main sections of interest in the ELF file, .text and .data:
The first contains code that loops continuously most of the time (we'll call it the "main firmware") when the dispenser is connected to the system in the upper part of the ATM.
The second contains a zlib-compressed bootloader (locally named "USB Secure Bootloader"), which is responsible for uploading firmware and running the main code.
And best of all (for researchers, anyway), is that the debug symbols in the ELF file were all there and easily searchable.
Inner workings of the main firmware
We can divide the code into four main levels, from top to bottom in the hierarchy:
USB Receive Thread, which accepts USB packets and distributes them to the different services.
Services are the main units of execution. Each service has a particular role and corresponding tasks (classes).
Classes, here, are tasks that can be performed by a particular service using controllers.
Controllers are the workers that validate tasks, perform tasks, and generate result packets.
There was a lot of firmware code, so I decided to start by finding all possible services and only then trying to figure out where tasks are transferred.
Here are the services I found that were responsible for the actions of interest:
1) DispTranService (Dispenser Transaction Service): Handles encrypted commands, generates bundle of banknotes, authenticates, and much more. Sure, the interesting stuff.
2) securityService: After authentication, a session key is generated on the dispenser. When requested by the ATM computer, the session key is sent to it in encrypted form. This key is then used to encrypt all commands designated important by the vendor, such as dispensing cash and banknotes bundle forming.
But then another service, UsbDownloadService, caught my eye. The job of this service is, when the dispenser is connected to the computer and the firmware version on the dispenser doesn't match the version on the computer, switch to the bootloader in order to upload the firmware needed to work (which is stored in the folder with the vendor's software on the computer) with the OS. This service can also give us information about the current firmware version.
Physical authentication
Physical authentication is in fact implemented extremely well, with the mission of protecting the ATM from unauthorized USB commands. The ATM safe with cash must be open in order to perform either of the following actions:
Remove and insert the lower cassette.
Toggle the switch on the dispenser main board.
But this all is required only if the access level is set to the maximum. There are a total of three access levels: USB (0), logical (1), and physical (2). The first two are used by firmware developers for debugging and testing. The vendor, of course, strongly urges selecting the third one by default.
Here I will describe a critical vulnerability (now fixed by the vendor) that with physical access to the service zone of the ATM but not to the safe zone (such as through a hole drilled in the ATM front panel), allowed the dispenser execute any command – even if the command is "give me cash now!"
I found that UsbDownloadService accepts commands that don't require encryption. That sounds tempting, but shouldn't Secure Bootloader prevent any further mischief, as its name implies?
Spoiler: …it doesn't!
We need to go deeper
As mentioned already, the .data section contains compressed bootloader code that didn't initially catch my attention or that of my colleagues.
As long as the bootloader remained a secret, there was no way to answer the question: "How does the software on the computer upload the dispenser’s firmware?" The main firmware did not reveal any clues.
So the bootloader is unpacked and loaded into the IDA at offset 0x100000, from where investigation can start… except there are no debug symbols there!
But after comparing the main firmware with the bootloader code and reading the controller datasheet, I started to get a better idea of what was happening.
Although the process of firmware uploading seemed to be secure, in reality it was not. The trick was just to upload the firmware in the right way :)
Fully understanding this process took a lot of time and dedication (details can be learned from "Blackbox is dead – Long live Blackbox!" at Black Hat USA 2018 in Las Vegas). These efforts included re-soldering NVRAM and copying the backup to it in order to unbrick the controller… and other easy-peasy stuff like that.
Thank you to my colleague Alexey for his patience!
Here is the method for uploading firmware to the dispenser:
1) Generate an RSA key pair and upload the public key to the controller.
2) Write .data and .text from the ELF in sequence to their physical addresses, taken from the section headers:
3) Calculate the SHA-1 checksum for the newly written data, encrypt that value with the private key, and send the result to the controller.
4) Calculate and send the sum of all firmware words that have been written.
At which point, if everything has been calculated and written correctly, the main firmware will boot without a hitch.
Only one restriction was found for the firmware writing process: the version of the "new" firmware cannot be less than the version of the current firmware. But there's nothing to stop you from tinkering with the firmware number in the data that you write yourself.
So my special firmware with anti-security "secret sauce" was uploaded and run successfully!
By now I had a good knowledge of the main firmware, commands used to dispense cash, and more. All that remained was to send (unencrypted) commands, which the dispenser would eagerly obey.
Cash dispensing
This successful result was a worthy intellectual (although not monetary) reward for all the travails of research, such as bricking a real ATM (oops!). My curiosity almost inspired me to try repeating this trick with another major ATM vendor.
Ultimately, a very real ATM began to whirr and spit out very not-real dummy bills (vendors' shiny equivalent of Hollywood prop money). No magic was necessary: just a laptop, brainpower, and a USB cord.
"Security through obscurity" is no security at all. Merely keeping code or firmware proprietary will not stop an attacker from finding a way in and taking advantage of vulnerabilities. Curiosity and an initial financial outlay are all that is required.
Just as development is best handled by developers, security should be the job of security professionals. The most productive approach for vendors is to work closely with dedicated security companies, which have teams possessing the necessary experience and qualifications to assess flaws and ensure a proper level of protection on a case-by-case basis.
The vendor has confirmed the vulnerability (which was also found in the S2 model) and declared it fixed as of the February 2018 patch.
CVE listings:
CVE-2017-17668 (NCR S1 Dispenser)
CVE-2018-5717 (NCR S2 Dispenser)
Before I had even set to work on the firmware, Dmitry Sklyarov and Mikhail Tsvetkov had already discovered a lot about it (even without having a dispenser board). Their findings were of enormous assistance! And as concerns everything hardware-related, Alexey Stennikov's help was absolutely invaluable.
Author: Vladimir Kononovich, Positive Technologies
Author Positive Research at 6:00 AM
Tags ATM, firmware hacking, NCR, security
Follow @ptsecurity_uk
Machine learning: good for security or a new threa...
Positive Technologies Official Site
PT Application Firewall
PT Telecom Attack Discovery
PT BlackBox Scanner
telecom phdays Best of Positive Research Linux positive technologies PCI DSS audit SQL-Injection Microsoft blackbox positive research | cc/2020-05/en_middle_0128.json.gz/line992 |
__label__wiki | 0.679481 | 0.679481 | Tony Ridnell
Insights into USA Rugby
About Tony 4
tonyridnell
Seattle, WA USA
Bio: Anthony (Tony) Ridnell was born in New York City on January 1, 1961 and grew up in Bronxville, New York and Sydney, Australia. He graduated a 2nd Lieutenant in 1982 from the United States Military Academy, West Point, New York. His undying avocation is to support Rugby football in America become a mainstream sport, and for the National Teams (Eagles) of both sexes to be Championship contenders at all levels of the international Rugby stage. His rugby career culminated representing the USA Eagles (USA National Team) in three separate Rugby World Cup events (1987, 1991, and 1993) and is one of only a few to have represented the USA on three such occasions. Ridnell founded TRInternational, Inc. (TRI) in 1994 and 25 years later serves as TRI’s CEO. He has sat on the Board of Directors - National Association of Chemical Distributors (2000 – 2008) & Board of Advisors, Seattle University Albers School of Business. (2006 - Present). TRI conducts over $70 Million in sales, w 30 employees. The company has 4 regional offices in the USA, a Global Trade headquarters in Dubai UAE, & sourcing office in Shanghai, China He lives on a small family farm in Issaquah, WA (www.foxhollowfamilyfarm.com) with his wife, Autumn, and three beautiful daughters (Kyra, Maddy, and Gabby) and his son, Harrison, where they tend to a variety of farm animals including many horses, peacocks, chickens, pigs, cats and numerous animals.
Joe Klay says:
Hi Tony, Your story is an inspiration to me, as a small chemical distributor I would like to aspire to a fraction of what you have achieved! Congratulations and I would love to work with you in someway!!
Hi admin do you need unlimited content for your page ? What if you could copy post from other sites, make it
pass copyscape test and publish on your site –
i know the right tool for you, just search in google:
Loimqua’s article tool
oceanstreetgroup says:
TR: Would love to hear your view on the part the event owners, not USA Rugby, did or should play in securing national coverage and buliding strategic partnerships that benefit the development of Rugby at the grass roots levels. This tournament is a for profit business. As long as the fan base and ticket sales continue to grow there is no need for them to actively partner with RIM, step out of their comfort zones, innovate and take risks.
tonyridnell says:
Pls clarify: Which tournament, and what is your definition of ‘continues to grow’?
What’s the Beef with USA Rugby??
Massive Financial Implications for the Eagles win streak. USA Rugby Must Do Whatever it Takes to gain Inclusion in Top Tier of World Rugby’s “League of Nations”
Michael Sagehorn on What’s the Beef with USA Rugby??
Standish on What’s the Beef with USA Rugby??
Bill Gardner on What’s the Beef with USA Rugby??
tholmessr on Massive Financial Implications for the Eagles win streak. USA Rugby Must Do Whatever it Takes to gain Inclusion in Top Tier of World Rugby’s “League of Nations”
toporod
ProRugbyScrum.com
Meiriceá - Rugbaí - Pro
Follow Tony Ridnell on WordPress.com
Follow @tonyridnell
ChemBlend of America, LLC
TRInternational, Inc
Business Chad Keck chemical Chemical industry Chemical Trader Dan Lyle Dan Payne distribution Doug Schoninger Major League Rugby National Association of Chemical Distributors Nigel Melville ProRugby RIM Ross Young RWC2015 RWC2027 Social Media Stephen Lewis STRAT2020 The Rugby Channel trading usarugby USA Rugby Will Chang
Grow the game? Let's also Retain the Game. Rugby for Life!
A Message to all US Major League Rugby (MLR) fans - What's up in Seattle?
I want to hear "The State of USA Rugby" from Chairmen Chang/Keck. Why not the CEO you ask?...
RUGBY LEADERS' Opinions on Rugby, Lifestyle & Mental Health Management
Longform is an art, Rugby an expression.
Professional Club Rugby North America's NO:1 News Source. Endorsed by Players such as Eagle Zach Fenoglio. | cc/2020-05/en_middle_0128.json.gz/line993 |
__label__cc | 0.549795 | 0.450205 | Schoolscape
Supplier Events
Anti-Bullying Week – South Africa ranks high in global survey on cyberbullying
South Africa showed the highest prevalence of cyberbullying in a recent report by Ipsos Global, based on research in 28 countries. The report showed that more than 80% of South Africans said they were aware of cyberbullying and almost three-quarters of South Africans believe that the anti-bullying measures that are in place are insufficient. A Vodafone survey from 2018 ranked South Africa fourth for teen cyberbullying out of 13 countries, and Dean McCoubrey, founder of MySociaLife, a South African in-school Digital Life Skills Program teaching digital life skills program for schools, says that it’s likely even more prevalent, based on student feedback.
Cyberbullying is real, it’s here, and it’s harming South African children and teenagers daily, with its effects often being mistaken for ‘kids just being kids’ by parents who are yet to understand how rife and damaging cyberbullying can be. Anti-Bullying Week 2019, from 11-15 November, is a good time for schools to pay attention to the extent of cyberbullying, and for parents to get a handle on what they can do to avoid and deal with it.
“The challenge with cyberbullying is that parents can’t permanently monitor their child’s devices,” explains McCoubrey, whose programme teaches thousands of students, parents, teachers, and psychologists to help children feel safer and behave smarter online.
“Parents and teachers need specifics – not just the broad term of ‘cyberbullying’ – as this is a broad and elusive form of ‘warfare’ on these devices – and parents will definitely find it difficult to track or understand what’s actually going on.
He shares the five faces of cyberbullying:
Children can use negative, harmful, false images or text, chat, apps or social media posts to embarrass or threaten someone.
The sharing of personal or private information that may cause the victim to feel embarrassed or humiliated. This can surprisingly hail from a friend (a practical joke) or a former friend, turned enemy. In that event, the controlling of a person’s account, posting photographs, starting rumors, or changing profile photos can also occur.
Faking profiles, known as ‘catfishing’, when bullies create new accounts and borrow profile photos and names and pretend to be a person to create a false relationship – sometimes sharing the personal and confidential declarations made in confidence.
Sexting or sextortion is the sharing of nude photographs either within group chats, or on social media sites, or websites (although less likely due to the possibility of tracking the source of the publisher). Sextortion is focused more on the threat and bribery associated with publishing photographs, rather than the act itself.
Video shaming is the sharing of videos of someone being embarrassed, threatened or hurt, and then publishing these to allow the content to go wider, or even viral, compounding the psychological harm.
Students and parents have a few options:
Record: Most importantly, kids need to be reminded to record the cyberbullying event by using the device to take a screenshot and even send the screenshot to a safe place (email, storage) so you can take it off your device. This can be used to prove the problem exists as bullies are cunning and cover their tracks.
Don’t take the bait: As difficult as it may seem, reacting is what the bully wants, and kids need to avoid the situation and remove themselves from groups or feeds which aren’t supporting their mental health. It may be hard but it’s necessary.
Seek support: Parents and schools need to create safe spaces to discuss the issues and not ‘freak out’ – students often say that reactive parents and teachers who tackle the issue too abruptly can snowball or magnify the problem. Adults need to handle situations calmly with patience and maturity.
Engage: From a mental health perspective, students need support, but it’s essential to select a trusted expert. This may be a counselor or senior figure in the school to assist with the situation. Alternatively, you can seek out a social media lawyer or the police, dependent on the extent of the harm. Suggestions include SafetyNet for bullying, or the South African Depression and Anxiety Group for mental health concerns.
In conducting MySociaLife’s interactive social media and safety program, which includes a module about cyberbullying, McCoubrey has been surprised by students coming forward and admitting they had no idea of the extent of cyberbullying, the different sensitivities of human beings, and how different images, social media posts, chat forums and messages can hurt people, and impact them long-term. McCoubrey explained that of the ten modules they teach; cyberbullying is the #1 problem followed by mental health and self-esteem, then privacy and security and sexuality online.
But cyberbullying is an issue which starts early and continues throughout. It’s the nature of social media – we feel we have a voice to say good and bad things! “These are kids, and because they look savvy online, it doesn’t mean they have the maturity to handle the device.
“Four out of 10 kids don’t want to share their concerns. We need to find a way to engage, a safe platform to discuss these concerns, without withdrawing them from their community, unless of course, that’s a necessity to keep them safe.
According to Commonsense Media, there are four parties involved in a cyberbullying situation: the cyberbully that’s using digital tools to deliberately upset or harass their target – the victim of cyberbullying. The bystanders are aware that something cruel is happening, but who stay on the side-lines out of indifference or fear of becoming targets themselves. The upstanders are the kids who actively try to stop the cyberbullying cycle, whether it’s by sticking up for the victim, standing up to the bully, or notifying the appropriate authorities about what’s happening.
“Parents and teachers can use Anti-Bullying Week to make children aware that it’s everyone’s responsibility to make the online and real-life worlds a safe place,” says McCoubrey. “Anyone can be an upstander by reporting a bully, flagging a cruel comment, or even just choosing not to forward or share cyberbullying content. Doing so will stop a cyberbullying episode from escalating, and will reduce or even remove the bully’s power.
“It’s also important to have open paths of communication with everyone and to continue talking about how to prevent cyberbullying from happening. That is why every school should have a digital life skills program in place,” he says.
This content was provided by MySociaLife, a top-rated company on SchoolAdvisor. Click here to get in touch with the team from MySociaLife and to read their reviews from schools that have experienced the effect of their awesome program.
By Desi den Hollander|2019-11-13T08:25:17+02:00Nov 13th, 2019|
What does art have to do with learning to code?
When Can A Child Be Excluded For Unpaid School Fees At A Private School
Schools, parents “need to take it seriously”: World Mental Health Day
SchoolAdvisor
SchoolAdvisor helps schools make better purchasing through an online platform that brings schools and suppliers together.
On this site you will be able to: find a new supplier, research a product, get quotes, keep suppliers accountable and choose a supplier according to which schools they service and what these schools say about them.
Contact us: Send Mail | +2721-565-0401
Review Company
Copyright © SchoolAdvisor 2015-2019 | All Rights Reserved | | cc/2020-05/en_middle_0128.json.gz/line994 |
__label__cc | 0.732048 | 0.267952 | Everybody’s talking about Apple Watch
We can’t wait to get our hands on the latest and greatest in wearable technology, the upcoming Apple Watch. Announced alongside the iPhone 6 and iPhone 6 Plus in September, we’ve been anxiously awaiting any news we can find about when Apple’s smartwatch will hit the market.
Of course, the internet’s already buzzing with ideas about how we’ll use the latest innovation in Apple tech. See what people are saying:
Just this morning, mobile analysts at CCS Insight released a research report that USA Today picked up in their article “Apple Watch projected to sell 20 million in first year.” In it, the piece compares the numbers behind Pebble smartwatch, Samsung and LG Android Wear watches, the new LAG luxury smartwatch, Watch Urbane, and what’s expected from Apple.
In an article also published this morning, CNET references the same study, quoting that the Apple Watch is expected to be “the most successful smartwatch ever.”
ABC News pointed to Tim Cook’s words himself, from a conference last week where he said people will be most surprised by “the breadth of what it will do,” which isn’t just limited to Apple Pay, easy reminders, and a plethora of apps that sync with your iPhone and iPad.
Missed the original September announcement? Read up on all Apple had to say about its largest and slimmest iPhones yet on Speck Buzz.
Are you as jazzed as we are? Comment below to let us know what Apple Watch feature you’re most excited to try out! Or, share with us on Facebook or Twitter.
It’s only a matter of time. Speck for Apple Watch coming soon.
Your Apple Watch could use an extra layer of protection | cc/2020-05/en_middle_0128.json.gz/line996 |
__label__wiki | 0.608688 | 0.608688 | JDRF Founder Carol Lurie Passes But Leaves A Legacy
By The Diabetes Site
One of our beloved diabetes advocates and founder of JDRF, Carol Lurie, has passed away on February 15ht, 2013. The work her and her husband Erwin, has played a huge role in diabetes research, inspiration, and the knowledge that this disease will not stop us from living a fulfilling life.
Watch as Carol speaks about what inspired her to start JDRF and what she hopes this foundation will offer to future generations along with someday finding a cure to type 1 diabetes. Thank you Carol, you will be missed!
One-Handed Injection Device Could Be a Game-Changer for People with Insulin-Dependent Diabetes: Click “Next” below!
The Diabetes Site is a place where people can come together to help those whose lives have been affected by diabetes. In addition to sharing inspiring stories, shopping for the cause, and signing petitions, visitors can take just a moment each day to c lick on the red button to provide much-needed support for diabetes research. Visit The Diabetes Site and click today - it's free!
10 Ways to Keep Your Family Safe from the Coronavirus Outbreak | cc/2020-05/en_middle_0128.json.gz/line999 |
__label__cc | 0.676987 | 0.323013 | Manga Mondays is a meme hosted by Alison at Alison Can Read where bloggers can share their passion for reading mangas. It's a great place to get new manga titles to try and to meet new bloggers. Today I'll be reviewing the latest volume of Vampire Knight.
Description (from back of the book): The Vampire Hunter Society has imprisoned Aido in order to interrogate him about Kaname’s connection to Sara Shirabuki. Meanwhile, Yuki wants a fresh start with Kaname, but circumstances arise that may force them apart.
Review: Volume 14 continues with the dark, moody, and thought provoking overtones of the last volume. Throughout the story we are asked how we see our main cast of characters, especially the evasive and mysterious Kaname. Through Yuki's eyes, Kaname has always been a sympathetic and admirable character. As the higher echelon of pureblood vampires, he is most revered and feared. He has shown Yuki kindness and protection when she was younger while displaying snippets of his vulnerability.
Unlike Yuki's rose tinted version, I see Kaname as a walking contradiction. He seeks forgiveness, but punishes without a second thought. He provides Yuki options but only after he has manipulated the situation and even her memories. He would like Yuki to see him as her equal, but he always carries an air of self righteous that purposely places him above all others. I feel deceived by Kaname every time I think I should give him a chance. I don't understand his actions, especially when it comes to punishment because it seems so arbitrary especially in this volume. He takes action against those that are hardly a threat, but yet turns a blind eye to Sara Shirabuki and finding out who killed the pureblood that attended his soiree.
Kaname isn't the only one evolving as a character. Aido, who is continually used as a comic relief, becomes much more serious in this volume. His loyalty to Kaname, even undergoing torture by the Vampire Hunter society, is unparallelled. His devotion, however, is strongly tested as this volume ends. I'm curious to see where Hino takes his character and I hope that he gets a storyline of his own.
In addition to Aido's new character growth, Sara Shirabuki is becoming a serious threat. Like the previous villain before her, she is also a pureblood vampire who is trying to form a race that will submit to her wishes. She uses her demure appearance to get close before she strikes. In a lot of ways, she and Kaname share a lot of similarities.
Our heroine Yuki is still confused about everything that is happening. Her ties to Kaname, who is suspected to help enable the new pureblood threat, gets her arrested by the Vampire Society. Yuki's arrest can only mean more beautiful artwork demonstrating the agonizing tension with Zero. Speaking of Zero, I wish he had more presence in this volume. Though a man of a few words, we can easily identify his feelings written all over his face for Yuki though he adamantly says he doesn't have any. We also know that he is physically weakening due to his self imposed diet. I hope he has a bigger role in the next volume.
Words of Caution: There is some strong violence, but most of it happens off the page. Rated T for teens.
If you like this book try: Vampire Knight Volume 15 by Matsuri Hino, Black Bird series by Kanoko Sakurakouji, Millennium Snow series by Bisco Hatori
Labels: 2012 100+ Reading Challenge, 4 stars, Death, Manga, Manga Monday, Paranormal, Romance, Vampire Knight, YA |
Drooling with jealousy. I'm curious how you describe Aido in this volume. Kaname is a contradictory figure. It seems that he wants to be good to Yuki, but his instincts have him treating her poorly.
BURIED IN BOOKS Says:
This is one series that isn't hard to find on the manga shelf at Barnes and Noble. It's lined up like nice little soldiers perfectly numbered at least two of each, so I know it must be a popular series. I did see a review of a novel I was checking out on Amazon and it stated it was a rip off of Vampire Knight. Would she be referring to this manga series? I don't want to name the book for obvious reasons. | cc/2020-05/en_middle_0128.json.gz/line1001 |
__label__wiki | 0.762799 | 0.762799 | Oil price hits six-month low in London trading
Oil fell to a six-month low in London as Iran vowed to boost production immediately after sanctions are lifted and manufacturing in China slowed.
By Sharon Cho and Grant Smith
Brent futures declined as much as 3.1 per cent, extending an 18 per cent drop in July that was the biggest in seven months. Iran can raise output by 500,000 barrels a day within a week of sanctions ending, the state-run Islamic Republic News Agency reported. Meanwhile, a Chinese private factory gauge released on Monday fell to a two-year low in July, while an official index on Saturday slipped to the lowest in five months.
Crude slid into a bear market last month, joining a broader slide in raw materials amid expanding supplies and signs of slower growth in China. Iran’s nuclear deal with world powers fueled speculation about when and by how much it will lift output. Sanctions against the Persian Gulf nation should be lifted by late November, the Iranian Oil Ministry’s Shana news agency reported.
“The Iran deal is not 100 per cent done but it’s definitely much, much closer,” Bjarne Schieldrop, Oslo-based chief commodities analyst at SEB AB, said by phone. “We’re running a two-million-barrels-a-day surplus this year — it’s basically crushing the oil price, and something has to give.”
Double Exports
Brent crude prices are trading at more than 20 per cent below this year’s high on May 6, meeting a common definition of a bear market. West Texas Intermediate hit its lowest intraday price since March 23, trading as low as $46 a barrel in electronic trading on the New York Mercantile exchange. Prices are down 13 per cent this year.
Hedge funds reduced bullish bets on the U.S. benchmark to the lowest level in five years as the world’s biggest oil companies including BP PLC said prices will be lower for longer. The net-long position in WTI contracted seven per cent in the week ended July 28, U.S. Commodity Futures Trading Commission data show.
Money managers reduced their bullish stance on Brent crude in the week to July 28 by 37,527 contracts, the most in a year, according to data on Monday from ICE.
Iran plans to double exports, IRNA reported, citing Oil Minister Bijan Namdar Zanganeh in an interview with state TV. The Islamic Republic produced an average of 2.85 million barrels a day last month, compared with 3.6 million at the end of 2011, according to estimates compiled by Bloomberg.
A Chinese factory index for July released Monday by Caixin Media and Markit Economics came in at 47.8, a decline from 49.4 in June, indicating the effects of easier monetary policy have yet to kick in. The country’s official Purchasing Managers’ Index was 50 in July, down from 50.2 in the previous month. Numbers above 50 indicate expansion.
Critics say program to deal with dormant wells must be strengthened Yedlin: Harsh economic realities becoming more clear | cc/2020-05/en_middle_0128.json.gz/line1004 |
__label__cc | 0.655666 | 0.344334 | Your letters for Saturday, Sept. 30
Bear 148, a female grizzly, was shot and killed by a B.C. hunter. Calgary Herald
Bear 148 should never have been shot
Re: “Sadness, frustration as hunter in B.C. shoots well-known Bear 148,” Sept. 28.
I was working when I heard that Bear 148 was shot in B.C. I stopped working. I am angry. Bear 148 should be alive and well.
Moving the bear to the Upper Kakwa in Alberta, with the expectation that she would abide by the provincial boundary, was ridiculous. Bear 148 was collared and monitored, so crossing over into B.C. was known, as was the obvious consequence.
Why was a collared bear in Alberta not protected in B.C.? This is simply another example of bad decisions with a predictable outcome.
So was anything learned? Conflicts will not go away.
Regulations, monitoring and enforcement are inadequate in Alberta, on both provincial and federal lands.
B.C.’s approach to managing wildlife, other than on the coast, is shoot first, second and beyond. There is a better way, but it will take a greater commitment than is present today.
Don James, Calgary
B.C. needs a full ban on grizzly hunting
Earlier this week, a trophy hunter shot and killed a female grizzly bear after she wandered from Alberta to B.C., where grizzly trophy hunting is still legal.
Bear 148 was moved in July from its range near Banff to Kakwa Wildland Park, closer to the B.C.-Alberta border. Sadly, the proposals by the B.C. NDP and Greens to end grizzly trophy hunting would not prevent such a tragic situation.
Both parties support a loophole that would allow hunting grizzly bears, like Bear 148, to continue as long as the animal’s head, pelt, claws, teeth and other “trophy” items are surrendered to a government official (as the NDP proposes) and/or the meat is removed from the carcass and packed out (as the Greens propose).
Polls show that over 90 per cent of B.C. residents want an end to grizzly bear hunting. Only a full and complete ban on grizzly hunting, as Alberta has done, will ensure that the senseless slaughter of B.C’s majestic grizzly bears ends once and for all.
Faisal Moola, Toronto
Faisal Moola is director general, Ontario and Northern Canada, with the David Suzuki Foundation.
An odd idea of sport
It must be some kind of perverse pleasure to shoot a habituated, breeding-age female grizzly – probably at close range with a high-powered rifle or, if at longer range, with a scope on the gun.
Because it sure isn’t sport.
Mike Priaro, Calgary
There’s no excuse for not being active
Re: “Sport can unite as equally as it proves divisive,” Chris Nelson, Opinion, Sept. 28.
Perhaps the greatest contribution being made by Prince Harry and the Invictus Games is the encouragement it provides to all of us to participate in sport.
In a world where childhood obesity is on a dangerous upslope, such encouragement is urgently needed. If soldiers who have lost one or more limbs can find the will to significantly improve their physical and mental health by doing sports, there are few excuses left for couch potatoes who choose to ignore these health benefits and instead become bigger burdens on our health system.
So much attention is given to a small minority, the rich professional athletes, but this is not in line with the original intent of sport. Even the Olympics promote nationalism over participation. We need a new set of heroes. I vote for the participants in Invictus.
Peter Mannistu, Calgary
Boom or bust, police always want more
Re: “City urged to resist cuts, give police $14.3M more,” Sept. 27.
Its simply amazing how some people can throw their support behind an additional $14.3 million in funding for the Calgary Police Service.
During the boom times, the CPS leveraged population increases as a reason for increasing staff and payroll. Now, the CPS leverages the bust for increasing staff and payroll.
These are pathetic and expensive political points, and it simply adds to the already-overburdened taxpayer. Businesses in the city have already felt the wrath of incompetent spending, with ludicrous tax increases leaving homeowners as the next target.
Patrick Bruton, Calgary
Your letters for Monday, Oct. 2 Your letters for Friday, Sept. 29
Make sure to include your full name, phone number and address. Only your name will appear in the newspaper or on our website.
Also, please keep your letter under 150 words.
Click here to send your letter to the Editor.
Who we are: The Calgary Herald Editorial Board
Who we are: Meet the Calgary Herald Editorial Board | cc/2020-05/en_middle_0128.json.gz/line1005 |
__label__cc | 0.645681 | 0.354319 | Top Lankan players boycott upcoming Pakistan series for security reasons
September 10, 2019 September 10, 2019 campaign240 Sports
A total of 10 Sri Lankan cricket players have chosen to stay away from the upcoming Pakistan series, mainly for security reasons.
This was revealed to Sri Lankan Cricket board today during a meeting with players, who were chosen as part of a preliminary squad to play 3 ODIs and 3 T20 matches in Pakistan beginning later this month.
The meeting was aimed at informing the players about the security arrangements, during the forthcoming tour and also to find out players decision to participate.
The players were briefed about the security situation in Pakistan and the security arrangements PCB plans on implementing during the tour.
Accordingly, 10 players including Lasith Malinga and Angelo Mathews chose to stay away from the tour.
The cricket board has suggested alternative names for the proposed tour.
It may be mentioned that Sri Lankan cricket team faced a terrorist attack during their tour to Pakistan in 2009.
Sensex ends 163 pts higher, Nifty reclaims 11,000-mark
India to host first SCO conference on military medicine | cc/2020-05/en_middle_0128.json.gz/line1007 |
__label__wiki | 0.877919 | 0.877919 | Best Of TV Awards 2015 - WINNER - Best Youth Actress - CHANDLER KINNEY "Gortimer Gibbons Life On Normal Street"
The 2015 Best Of TV Awards Winner for Best Youth Actress is Chandler Kinney "Gortimer Gibbons Life On Normal Street".
Chandler Kinney "Gortimer Gibbons Life On Normal Street" came in as a write in candidate to win this years Best Youth Actress Award. Kinney finished 3rd in the opening round as a write in candidate, and followed that up in the semi-finals with a 2nd place showing to show she was no fluke.
Kinney narrowly won by 6 votes over 2013 winner and last years runner up Maisie Williams "Game Of Thrones" who I will fully admit, I was so sure would win I had already written up a write up a post for her as she was leading by 11 votes with a day & a half left & seemed to be pulling away. In 3rd was another "Gortimer Gibbons" actress Ashley Boettcher giving this childrens show two of the top 3 finalists here. Sasha Pieterse "Pretty Little Liars" was down 1 spot from last years 3rd place finish to nab 4th. Camren Bicondova "Gotham" looked like a challenger after the opening round, finished 5th in the finals.
In 6th was Olivia Steele-Falconer "Once Upon A Time". Sophie Tuner "Game Of Thrones" in her 3rd year slips to 7th after a 6th last year. Danielle Campbell "The Originals" hold son to last years ranking as she again finishes 8th. Teilor Grubbs "Hawaii Five-0" sneaks up 1 spot from last years 10th place finish to get 9th this year. Skyler Wexler "Orphan Black" switches spots with Grubbs to go from 9th to 10th.
Zoe De Grand'Maison "Orphan Black" aslo was in her 2nd finals, finishing 13th. While newcomers Madison McLaughlin "Chicago PD" finished 11th and Natalie Alyn Lind "The Goldbergs" was 12th and "Gotham" 14th
1st CHANDLER KINNEY "Gortimer Gibbons Life On Normal Street" 281
2nd MAISIE WILLIAMS "Game Of Thrones" 275
3rd ASHLEY BOETTCHER "Gortimer Gibbons Life On Normal Street" 167
4th SASHA PIETERSE "Pretty Little Liars" 140
5th CAMREN BICONDOVA " Gotham" 136
6th OLIVIA STEELE-FALCONER "Once Upon A Time" 132
7th SOPHIE TURNER "Game Of Thrones" 100
8th DANIELLE CAMPBELL "The Originals" 98
9th TEILOR GRUBBS "Hawaii Five-0" 91
10th SKYLER WEXLER "Orphan Black" 82
11th MADISON MCLAUGHLIN "Chicago PD" 77
12th NATALIE ALYN LIND "The Goldbergs" 62
13th ZOE DE GRAND MAISON "Orphan Black" 53
14th NATALIE ALYN LIND "Gotham" 41
This is the first win for Gortimer Gibbons Life On Normal Street, and the first win for Amazon Prime.
You can find all the finalists on their Social Media accounts here
Chandler Kinney Twitter
Maisie Williams Twitter facebook
Ashley Boettcher Twitter
Sasha Pieterse Twitter facebook
Camren Bicondova Twitter facebook
Sophie Turner Twitter facebook
Danielle Campbell Twitter facebook
Teilor Grubbs Twitter
Skyler Wexler Twitter
Madison McLaughlin Twitter
Natalie Alyn Lind Twitter
Zoe De Grand'Maison Twitter
Best Of TV Awards 2014 - Best Youth Actress Winner - BEX TAYLOR-KLAUS "Arrow"
2014 Best Of TV Awards - Best Youth Actress WINNER - BEX TAYLOR-KLAUS "Arrow". Photo Credit - Canadagraphs
The Winner of the 2014 Best Of TV Award for Best Youth Actress is.... Bex Taylor-Klaus "Arrow"
With 3 finals nominations in 2 years for this award, Bex Taylor-Klaus wins in her final year of eligibility for the award for her role as the smart mouthed street kid "Sin" on "Arrow" with 524 votes. Bex finished 8th last year for her role on "The Killing" and also finished 5th for this role on "Arrow". Bex managed to beat out last years winner Maisie Williams "Game Of Thrones" who came well back in 2nd with 280 votes. The 244 vote margin is a new category record. Coming in 3rd was Sasha Pieterse "Pretty Little Liars" in her 1st finals appearance.
In 4th is newcomer Camren Bicondova from the rookie hit "Gotham", ahead of 5th place Brighton Sharbino in her last year on "The Walking Dead’ was up from her 7th place finish last year. Last years 3rd place finalist Sophie Turner "Game Of Thrones" finished back in 6th this year. Taissa Farmiga "American Horror Story" also drops from 4th to 7th this year. In 8th is Zoe de Grand’Maison "Orphan Black", 9th was Danielel Campbell "The Originals", 10th was Skyler Wexler "Orphan Black" & Telior Grubbs "Hawaii Five-0" rounds out the finalists in 11th.
1st BEX TAYLOR-KLAUS "Arrow" 524
3rd SASHA PIETERSE "Pretty Little Liars" 246
4th Camren Bicondova "Gotham" 155
5th Brighton Sharbino "The Walking Dead" 129
7th Taissa Farmiga "American Horror Story" 103
8th Zoe de Grand’Maison "Orphan Black" 85
9th Skyler Wexler "Orphan Black" 78
10th Teilor Grubbs "Hawaii Five-0" 61
Best Of TV Awards 2014 - FINALISTS - Best Youth Actor & Actress
The 2014 Best Of TV Awards Semi-Finals are now Closed. The Finals for the 5th annual BOTVA's will begin in early 2015.
But 1st we need candidates to compete in the finals.
The results below are for the categories of Best Youth Actor & Actress.
Vote totals are in RED
Finalists are in BOLD TEXT
ISAAC HEMPSTEAD WRIGHT "Game Of Thrones" 118
CHANDLER RIGGS "The Walking Dead" 98
JAKE T. AUSTIN "The Fosters" 51
NOLAN GOULD "Modern Family" 46
LUKE BILYK "Degrassi : The Next Generation" 43
CHARLIE ROWE "Red Band Society" 43
NICK ROBINSON "Melissa & Joey" 41
CONNOR JESSUP "Falling Skies" 35, MAX BURKHOLDER "Parenthood" 30, MAXIM KNIGHT "Falling Skies" 27, SEAN GIAMBRONE "The Goldbergs" 26, STERLING BEAUMON "The Killing" 25, LIAM JAMES "The Killing" 21, BRANDON SOO HOO "From Dusk Till Dawn" 15
BEX TAYLOR-KLAUS "Arrow" 327
SOPHIE TURNER "Game Of Thrones" 126
SASHA PIETERSE "Pretty Little Liars" 70
BRIGHTON SHARBINO "The Walking Dead" 61
TAISSA FARMIGA "American Horror Story" 61
TEILOR GRUBBS 'Hawaii Five-O" 60
BAILEE MADISON "The Fosters" 48, ANA GOLJA "Degrassi: Next Generation" 42, ARIEL WINTER "Modern Family" 42, SKYLER SAMUELS "American Horror Story" 33, HAYLEY ORRANTIA "The Goldbergs" 33, PEYTON LIST "Jessie" 27, MAKENZIE VEGA "The Good Wife" 26, MADISON DAVENPORT "From Dusk Till Dawn" 21
In the Youth Actor category.... last years winner Robbie Kay did not have a chance to defend his title due to the show writing him off, so the field is open. Newcomer David Mazouz "Gotham" jumped in and took the lead in the semi-final round, narrowly beating last years runner up Jared Gilmore "Once Upon A Time". Another newcomer to the category Isaac Hempstead Wright "Game Of Thrones" came in 3rd ahead of last years 3rd place finisher Chandler Riggs "The Walking Dead". This year 4 of last years finalists are in this eyars finals. As stated earlier, the defending champ is out due to not being on the show this year, Same goes for Rowan Longworth, while Shane Harper was ineligible due to his age.
In the Youth Actress category... last eyars winner Maisie Williams "Game Of Thrones" again looks like she will be a major contender. However, the semi-final vote saw last years double finalist Bex Taylor-Klaus "Arrow" take a strong stranglehold on things and will go into the finals as the probable favorite based on her nearly 2 to 1 vote ratio of last years winner in the runner up spot. Camren Bicondova "Gotham" like her male counterpart finished strong with a 3rd place spot ahead of last years 3rd place finalist Sophie Turner "Game Of Thrones" who finished 4th in the semi-finals this year. Like on the guys side, theres a couple missing from this year who were in last year. Molly Quinn "Castle" was ineligible for her age, Gage Golightly was both ineligible for her age and the fact her show ended, and finally Bex Taylor-Klaus "The Killing" will only be a finalist for 1 show this year as her role in the final season of the drama was not reprised.
The finals for these categeories will take place in January 2015 HERE. | cc/2020-05/en_middle_0128.json.gz/line1008 |
__label__cc | 0.649454 | 0.350546 | Seminar talk: Early glaciations and fjord formation in N and NE Greenland and Scandinavia
On the 23 of October, Vivi Kathrine Pedersen from Aarhus University will give a seminar talk at the Bjerknes Centre.
The timing and extent of early glaciations in Greenland, and their co-evolution with the underlying landscape remain elusive. Here I will present a study, where we infer the timing of fjord formation in N and NE Greenland, by investigating the flexural isostatic response of the solid Earth associated with fjord erosion. We constrain this erosion-induced isostatic uplift in time using marine sediments of late Pliocene-early Pleistocene age, that are now exposed on land between ~24 and 230 m above sea level. By constraining the timing of fjord formation, we constrain the timing of widespread and prolonged glaciation in these regions, and infer something about the early history of the Greenland Ice Sheet.
We find that the Independence Fjord system (82°N) must have formed since ~2.5 Ma, in order to explain the current elevation of the marine late Pliocene-early Pleistocene sediments by erosion-induced isostatic uplift. In contrast, fjord formation in the outer parts of Scoresby Sund (70°N) commenced before the Pleistocene, most likely in late Miocene, and continued throughout the Pleistocene by progressive inland fjord formation. Our results suggest that the inception of the Greenland Ice Sheet began in the central parts of NE Greenland before the Pleistocene and spread to N Greenland only at the onset of the Pleistocene.
In Scandinavia we do not find such marine sediments preserved on land, that can help us constrain the timing of fjord formation. Instead, we have a much better control on the sediment volumes deposited offshore – the products of onshore erosion. In addition, we can sample the bedrock that was previously covered by thick ice. Combining clues from the offshore sediment volumes, cosmogenic nuclides and numerical modeling, we can speculate about the recent Quaternary landscape evolution in Scandinavia and the effects glaciations have on the underlying topography.
Vivi Pedersen
Vivi is a Marie Skłodowska Curie Fellow/assistant professor at the Department of Geoscience at Aarhus University.
Her research focuses on interactions between ice, surface processes, solid Earth, and sea level, with the common factor being landscape evolution.
Vivi completed her PhD at Aarhus University in 2011, whereafter she stayed several years as a postdoc at the Department of Earth Science at UiB.
Arranged date for the seminar talk: Oct 23, 2019 at 14:15, BCCR lecture room 4020. Jahnebakken 5.
Seminar: Paul Kushner | cc/2020-05/en_middle_0128.json.gz/line1011 |
__label__cc | 0.577304 | 0.422696 | ← Police Sergeant and Dispatcher Arrested On Federal Charges
Cyberabusers →
George Zimmerman – Again
Posted by towerflower
At about 1 pm in Lake Mary, FL, on Lake Mary Blvd near 1-4, George Zimmerman was once again making the news. I don’t know about you but I’m not surprised, I made a comment the other day on Twitter how it was about time for him to once again make the news.
It involved a road rage incident (his second). The driver of a Lexus claims that Zimmerman waved a gun at him so he fired back. The bullet entered the passenger side window of Zimmerman’s Honda and Zimmerman was slightly injured in the face by flying glass/debris. The bullet missed him.
The driver of the other car drove to a strip center and begged a man returning from lunch to call 911 for him, and that he just shot George Zimmerman. It should be interesting to note that this center is very near his former ex-girlfriend’s dentist office from his last domestic violence incident.
The 911 caller was interviewed by CNN, and this is where it gets interesting. Personally, I can’t believe others didn’t pick it up. The caller says the shooter didn’t have a phone and to please call police. The man complied and he said that the shooter’s name is Matt Apperson, and that he has had at least 3 prior incidents with George Zimmerman.
Matt Apperson is none other that the same man who was involved with the last road rage incident with George Zimmerman back in Sept. 2014. He didn’t want to file charges back then but now, has taken it a step further.
Early reports are saying that George Zimmerman waved a gun at him so he shot back at him. You would have thought that Zimmerman would give this guy a very wide berth knowing after the last incident that the man is a licensed concealed carry in the State of FL. But then again we are talking about Zimmerman.
Reports are also saying that Apperson is cooperating fully with police, while Zimmerman is refusing to cooperate.
News is still breaking and I’ll add if anything big changes, but keep in mind I don’t have the expertise to add things like Xena does.
(Xena believes that Towerflower does. She’s a quick learner.)
From Wesh TV. They had problems with the sound.
Posted on 05/11/2015, in Conceal Carry & SYG, George and Shellie Zimmerman and tagged George Zimmerman, injured, Lake Mary, Matt Apperson, road rage, shot. Bookmark the permalink. 190 Comments.
so ironic, the last few days I’ve had Zippy on my mind, thinking of how long it’s been since he was involved in an ‘incident’ and how any day now there would be one.
found this on twitter;
akacharleswade
Zimmerman ain’t hurt? Oh.
https://pbs.twimg.com/media/CEv94RaW8AAHH_X.jpg:large
Me too. Like clockwork and my intuition must’ve been telling me it’s time for another incident.
isn’t that eerie?
Maybe the time that elapses between gz events represents the time it takes gz to read all the articles and all the comments on his earlier “incident”. 🙂 Then, perhaps, when there is nothing more for him to read, he gets edgy and gets into trouble.
I have been checking the news regularly (except for today – going over estate matters with my sister) for the last few days saying the same thing, that GZ is due to surface any time now. SMH
Hmmm – this one says “West said before the news conference that Zimmerman thought he knew who was responsible for the shooting and is cooperating with authorities.”
http://abcnews.go.com/US/wireStory/police-george-zimmerman-involved-shooting-florida-30961785
Don West has given a statement on Z’s version……Z was minding his own business when a vehicle approached from behind, honking horn and flashing lights. The vehicle pulled up on passenger side and when Z recognized Apperson he rolled up his passenger window and then Apperson shot.
I’m not surprise after all in his mind he is always the victim and others are always to blame.
I wonder if he had a gun in the vehicle with him. I hope there were witnesses.
of course he is going to lie thats in his DNA problem is Georgie has had 2 previous incidents involving this man and its on record
Of course he was “minding his own business.” Gun slinging is his business. Sounds like a confession to me!! Just saying.
#Breaking #Video of #GeorgeZimmerman being treated after gunshot @WESH pic.twitter.com/7kWD6k8c2B
— Stewart Moore (@Stewartmoore) May 11, 2015
WESH interviewed a couple of workers who saw him getting released from hospital. They said they saw no injuries, walked normal, seemed calm, no bandages, and then got into a LE vehicle.
Wanna bet he shows up later wearing huge bandages?
I don’t know. LOL! Unless Shellie is around to apply knuckle bandages or he has another girlfriend with maxi-pads, he might not have bandages this time around.
Saw no injuries, walked normal, seemed calm – why does that sound so familiar?
um hmm, exactly Rachael
Lake Mary PD won’t confirm if a gun was with Zimmerman.
I think ABC confirmed it tonight that he had a gun.
Of course he had one, he has publicly stated before he always carries, Lake Mary PD won’ confirm it.
pilcherje | 05/11/2015 at 4:14 pm
Not that Zippy’s character wasn’t evident before…but this half cocked trigger happy one step over the line danger to himself and the public has an insatiable revenge streak. I get it. Now I’m waiting for the fleas to soothe the beast.
How peculiar, even auto correct gets it… 😊
LOLOL.
Lisa Bloom @LisaBloom
· 3h 3 hours ago
George Zimmerman shot in face in road rage case. By my count it’s his 5th angry gun related incident in which he claims to be the victim.
Talib Kweli Greene @TalibKweli
George Zimmerman constantly involved in violent altercations where police are called. But Trayvon Martin was the “thug.” #BlackLivesMatter
My take…………..Fogen wouldn’t let the 1st road rage incident pass, and has been stalking Apperson and decided that, well, he’s coated with Teflon, he’d rub it in and start waving his gun around.
Apperson……….”Fearing for his life” “defended himself”
Don, “I’m really an idiot West” props up the same old “everyone’s picking on him, and ya know, he was just minding his own business.”
Now, Fogen is unemployable…………….so what are the chances of his crossing paths with Mr. Apperson again ?? Hmmmmmmmmmm ?????
Fuck you Don and the same for PhuckingFogenPhoole.
Pardon my Phrench
This whole thing is odd.
Does “odd” really describe it ??
Does Fogen think he’s, like, some Wild, Wild West character ?? Gun play as a normal everyday thing ??
How many of us, in the real world, know of anyone who now has at least half a dozen incidents where a gun was drawn, or threatened to be drawn, and shots fired, and someone was hit or killed ?? I’m thinking 99.99999% of us will have to say 0
What the hell is in the water down there ????
Things we’ll never hear from or about Fogen
“I was on my way to work when……”
“I was just sitting at my desk, doing my job when……”
“So this kindly old black man needed a hand getting his groceries into his car so naturally I gave him a hand”
“I love what the Pastor at our Church has to say every Sunday”
“Oh, my bad………I’m so sorry”
“Yeah, guns just create reasons for crime”
“No, that’s okay, dinner’s on me….what, with all you’ve done for me so far”
“I just hated taking all that money from them on the internet”
“He’s just such a, well…a good guy”
“Here, use my truck……”
“No thanks, I’ve had too much to eat already”
“I filled out an application last week…..has anybody been hired yet?”
“It was nothing, I don’t need to be on TV…..talk to those guys”
“You can never have enough education”
“Maybe I should take that job”
“I think I’ll send some money for child support to Sam…..”
“……….guilty, Your Honor”
“The troubles in my marriage to Shellie were mostly my fault”
“I really shouldn’t carry this gun around, hell, somebody might get hurt, or I might lose my temper and then……………..”
Yep……….he’s a real prince.
eurekajim | 05/11/2015 at 6:48 pm
This one cracked me up…
But then again I’ve got a pretty weird sense of humor.
That cracked me up too. Because you can make lots of excuses for the more complicated stuff, but the intense overeating is about simple impulse control.
I do have an ex-boyfriend (almost 40 years ago) who also shot a man after instigating the incident (fortunately long after we broke up) and he’s has since been involved in all sorts of incidents – sending stepkid to break out car windows, etc. and some stuff that may be bigger – I heard some lurid rumors years ago – and I’m sure he’s done plenty that I don’t know about because he had those meltdowns at predictable time intervals. This is what I see in GZ too. My ex is definitely a narcissist, and narcissists are on a spectrum, so my ex is malignant, definitely sociopathic because he’s a chronic thief and liar, I found out as he slowly revealed himself to me and the world. I think GZ is not quite as far out angry as my ex but he’s quite a bit slyer, using his slurry soft voice to make the public think he’s mellow. My ex-boyfriend just showed his anger all the time, no charm included.
Well………..there ya go. You fit the 0.000001 % !!!
ugh, we’re dealing with a young female in our lives at the moment, who pretty much fits that description. Sociopath and narcissist.
No fun. I had to move to another part of the state long, long after I’d already broken up with my ex. Malignant narcissists and sociopaths can’t stand it when you draw boundaries or disappear.
ABC is suppose to have an interview with Zimmerman tonight. He just can’t resist coming on camera to give his story, but at least this time, his victim isn’t dead and can speak for himself.
Uhhhhmmmmmmmmm, let me guess. It wasn’t his fault, but the BIG question is……….
………………………….would he change anything about what happened today ??
Racer, GZ said what he did on 2/26/12 was all God’s plan. He must believe the same for everything — unless Obama, the media, and social media are also God, because that is who he blames.
I’m kind of wondering why he hasn’t blamed me for anything?? ……….yet.
“He just can’t resist coming on camera to give his story”
Yeah, and do you remember how he called 911 to go on and on about his side of the story in his domestic violence incident against Samantha?
I wonder if he’ll blame President Obama for this too
eurobrat | 05/11/2015 at 8:23 pm
Weird how Obama being in office just makes everyone do such crazy things! Thanks a lot, Obama! 😉
I wonder if this means we’ll see another video made by his divorce lawyer.
2nd time this is not by chance obviously Zimmerman has beef he wants to settle with this man but did not think this man would stand his ground. Lake Mary has some serious decisions to make as the cat is now out of the bag this man has went to the local police regarding zimmerman before and they have allowed it to be swept under the rug now we see just how far this has come its at the point now in which Guns are being used.
Lake Mary Police department has an obligation to protect its citizens and also to protect George from himself. I fully believe Charges are going to be filed once the investigation completes.
What cracked me up some have claimed this man was braggin to the man who called 911 saying “I shot George Zimmerman” let me clarify this the shooter was telling this person to call 911 naming George because George is well known and is also known to carry a gun that wasnt bragging that was informing the citizen call the cops cus I just shot this crazy ass stalker of mine and I dont think he is dead
Yes the other “side” is full of the conspiracies, Z doesn’t live in Florida and was only visiting his mom on Mother’s day…..which was the day before. Apperson is the real stalker, Apperson was bragging about shooting Z, Apperson has a history of a bad temper—-remind me again who has the multiple mug shots. Apperson’s neighbor has called 911 on him–saying he left a dead squirrel on her law–sounds like the neighbor is a bit squirrely.
The conspiracies are building and some quite amusing.
The guy who shot at gz was aiming for gz’s head….look at this photo of the passenger’s window of gz’s vehicle.
I wonder if any traffic cameras captured the incident.
OH MAN TRAFFIC CAMS! THAT WOULD BE A THE NAIL IN THE COFFIN!
Right???
NeJame said he has investigators going over scene…you know they will be looking for every camera in the area leading up to the shooting area.
Where I live, they aren’t allowed to use traffic cams that way 😦 I hope they are there!
We do in Florida, and when you get a tickets they send you a link to go look at yourself on video. But I don’t think it was so clear that you can see whats going on inside the car really..
Yes, they do that here too – but they are ONLY allowed to use them for the traffic violations – however, they (at least here) ARE clear enough to see what is going on in side of cars. There was talk about how using the cams could serve in that fashion, but that was decided to be too Big Brother-ish – they are only allowed to use them here for the traffic infarction you are ticketed with (and yes, there are sites you can go to to look at the video – believe me, I’ve had a couple, I know LOL) and not for anything else that is going on – even though (at least here) it is clear enough to see – and if they wanted, they could see drugs and all kinds of things – they knocked that one down. Now business that have cams that look out onto parking lots or the sidewalk, that is another story and police secure the video from businesses all the time – so if there were businesses that capture video that far, that would be the way to do it.
Doesnt matter where he was aiming if George was using his vehicle as a weapon that is no different than using a gun, then George Flashed his gun giving this man no choice to leave anything to chance.
I just realized that gz said he put the window up.
So if the window was going up as Apperson fired his gun, we really don’t know at what level Apperson’s bullet was traveling.
plus an Infinity car is shorter than gz’s vehicle.
I want to know where the bullet ended up in the car–trajectory. Z admits he was rolling up the window, so was the shot actually lower?
Towerflower, EXCELLENT QUESTION! Did it go through the driver’s side window, come to rest in something in the truck?
They say it missed his head by inches and came to rest above driver’s side window frame near the safety handle….the hand grip above a window.
I wonder if he saw it wizzzz by his eyes.
Isn’t GZ a lot shorter. Missed his head by miles.
This is a funny/strange comment coming from a lawyer;
“I don’t believe he had a direct hit with a bullet,” said Don West, Zimmerman’s attorney.
http://www.orlandosentinel.com/news/trayvon-martin-george-zimmerman/os-george-zimmerman-shooting-lake-mary-20150511-story.html
Yeah, it was just pieces of glass that scratched gz.
(Maybe there were also some flying shards of Cheez-its, also.)
Maybe…..or worse, flying glass got into the Cheez – its.
Well…..we all miss the obvious. Remember those tiny little scratches from 2/2012. He, and his entire posse made them seem to be so horrendous it was a major miracle he survived. Hell, Robbie the Racist claimed Fogen was near having to wear diapers the rest of his life and would have to be spoon fed.
Damn !!!!!! what will Fogen say once he gets in front of a camera about an actual bullet whizzing past his thick skull.
On the other hand, any shot that connects with that brain would have to, by actual damage, be called “a minor wound” since he has nothing working up there.
You can see Matthew Apperson in the video at this link:
http://www.wesh.com/news/raw-video-matthew-apperson-blows-cigarette-smoke-in-camera/32948930
um he looks…nice. /s
Excerpt from this linked article:
http://www.cnn.com/2015/05/11/us/florida-george-zimmerman-shooting/index.html
An employee at a nearby business, Kenneth Cornell, said he was exiting his car after lunch when a man drove up and started yelling about the shooting.
The man, who identified himself as Apperson, shouted to Cornell: “I shot George Zimmerman, call 911. I don’t have a phone.”
Cornell said Apperson didn’t know whether Zimmerman was hurt. He called 911.
According to Cornell, Apperson told him that he and Zimmerman have had three disputes. This time, Zimmerman waved a gun, and Apperson shot at him, according to Cornell.
I find this waiting game to be exasperating! There’s a lose cannon near my place of residence. I’m nit that far from Lake Mary!
Well………..the way I see it is that Apperson needs to exercise better gun control. That way he’ll hit his target.
………….hey, just sayin’
Thank you. I was trying to think of a way to say that without it sounding like, well…hey, just sayin’
As sad as that is, it’s tragically true. Seems Fogen may have met someone who isn’t going to just say ……”….what are you followin’ me for?”
I have no trepidations here since Fogen likes to pick on kids women, older people and cops. Now he picked on someone that may be his own size.
He picked on someone who also carries with a concealed carry.
Yep…….bet he wasn’t counting on that one.
Well, it’s a lot easier when you pin the arm of your target, grab and hold his shirts, and the target weighs less than you with a 12 year age difference and hasn’t reached maturity.
It looks like Mark NeJame will represent Apperson…..if the name rings a bell it should…..he refused to represent Zimmerman twice and his law firm’s “involvement” was one of the reasons one of the judges were removed from his trial.
Hey towerflower,
Oooh, I remember that now. Thanks for the reminder.
yes, Me too, I remember that!
amnaim | 05/11/2015 at 6:20 pm
This is his third road rage incident.
Hey Amnaim. Welcome to Blackbutterfly7. Yep — Matthew said that this was the third time GZ stalked him, and I believe he said he called the cops both times previously.
Before Trayvon, gz had a road rage case where he followed the person home.
Also NeJame was a big gz booster despite not “representing” him. He want to CNN with the pictures of the black great grand daddy.
It is odd to me that he is representing Apperson. He helped gz craft his initial media message and handed him off to gz’s first media lawyers of shaken baby syndrome.
With NeJame on the opposing side, I think the fix is in. I think he has major conflict of interest.
Third that we know of.
IIRC, he was involved in a road rage incident couple of years prior to 2012. (???? ) I’d have to look to see if I still have his 911 calls including when he called on a former landlord.
Media makes it seem like he’s never been in any trouble until post Trayvon. Not true.
http://www.thedailybeast.com/articles/2012/03/22/george-zimmerman-s-history-of-911-calls-a-complete-log.html
I confused his reporting a road rage incident with him actually being part of it. 😦
i must note that many still do not call fogen a “thug” but still cling to saying the Trayvon was a “thug” with zero history of violence or crime.
I have no doubt Zimmernut, “such a stupid a** jerk”, is being seen for exactly what he is now, even by those most skeptical in the past.
Flashing his guns, gun shows, repeated traffic stops, stalking’s, road rage, playing “Cop” in the parking lot of a store that didn’t even want him there (and banned him), stupid copied pictures he tried to sell for quick cash, much less violence against Shellie, her Father, and so called girlfriend.
And Trayvon??????? A teen, in the wrong place, at the wrong time, and the “Wrong” color to suit Zimmernut. With only a bag of skittles, and a can of tea, Trayvon was stalked, confronted, and killed. (Because wannabe “COP” Zimmernut felt empowered)
And it’s quite obvious this idiot still feels empowered! But his day will come.
RIP Trayvon
Enjoy your wings Honey.
Karma!
As always……well stated.
That would be true. Funny how those racist right wing hate mongers seem to pass off facts like that. To me, all those Fogen mug shots don’t mean anything.
Posted by Croaker Queen:
“Press Conference #2 – Matthew Apperson’s attorney addresses Zimmerman shooting” also includes comments by family)
Thanks Yahtzee for posting. Mark Nejame has gz’s number. He doesn’t want to divulge any info not only because it could obstruct the investigation but he doesn’t want z to twist it to benefit himself. (like he did w/Trayvon)
watch it turn out to be that they do know each other, through some nefarious activity. Does anyone know of/if Apperson’s criminal background?
towerflower | 05/12/2015 at 10:48 am
Apperson has some misdemeanors in his background….possession of pot a couple of times, a DUI 13 yrs ago, and a trespassing (if I remember right); but no felonies.
ah I see! thanks TF!
You’re downright psychic to know Zimmerman is going to get into trouble again 😉 Or…it’s just logical and we all know he will, sooner or later…
On the plus side, I’m a huge Prince fan and was very excited about his Baltimore song/show!
Mr. Militant Negro | 05/11/2015 at 9:12 pm
Mr. Militant Negro | 05/12/2015 at 4:10 am
My pleasure, we must keep people informed.
roderick2012 | 05/12/2015 at 12:11 am
This situation has a false flag quality to it.
1) This incident gets Zimmerman’s name back in the news
2) Zimmerman is only slightly injured
3) Zimmerman is seen as the victim in this situation ( of course we don’t know the entire story)
Kinda good to be Zimmerman today,huh?
Did anyone catch that O’Mara is representing the family of the black man Matthew Ajibade who was bipolar and chained to the chair by nine jail personnel in Georgia?
Is O’Mara working on some type of penitence?
Oh really? Maybe that’s because some of the officers fired are a dark complexion like Matthew.
Could be. I guess O’Mara needs to bring home some bacon. The Mrs. may need a new vehicle or some jewelry.
I read this too yesterday, about O’Mara representing the family of Matthew.
The man who called the police:
http://abcnews.go.com/US/witness-recounts-man-allegedly-shooting-george-zimmerman/story?id=30979872
WESH at noon gave an interesting story about the news conference from Lake Mary PD. They said they are looking into “Aggravated Assault with a deadly weapon without intent to kill” charges.
Now lets go to FL Statues:
784.011 Assault.—
(1) An “assault” is an intentional, unlawful threat by word or act to do violence to the person of another, coupled with an apparent ability to do so, and doing some act which creates a well-founded fear in such other person that such violence is imminent.
(2) Whoever commits an assault shall be guilty of a misdemeanor of the second degree, punishable as provided in s. 775.082 or s. 775.083
784.021 Aggravated assault.—
(1) An “aggravated assault” is an assault:
(a) With a deadly weapon without intent to kill; or
(b) With an intent to commit a felony.
(2) Whoever commits an aggravated assault shall be guilty of a felony of the third degree, punishable as provided in s. 775.082, s. 775.083, or s. 775.084.
I put up the first one because of the definition of assault…….”doing some act which creates a well-founded fear in such other person that such violence is imminent. ”
Can this mean that they are looking at charging Zimmerman? I say this because of Apperson’s claim that GZ waved his gun at him…..thus creating the act which caused a well founded fear in Apperson that he would be shot. Also with them investigating a charge of a deadly weapon (Z’s gun) without intent to kill (he waved it to scare Apperson but didn’t intend to shoot Apperson).
I hope this is the case.
Also Apperson has admitted to shooting at Z and even thought he shot him so the not intent to kill does not apply to his actions, this is another reason I think they are looking at charging Z.
I agree with you, Towerflower!
O/T –
DA just announced no charges against Ofc. Matt Kenny for the killing of Tony Robinson.
“Tony Robinson Was Unarmed When Fatally Shot By Wisconsin Police Officer”
http://www.huffingtonpost.com/2015/03/07/police-chief-19-year-old_n_6823624.html
http://abcnews.go.com/US/george-zimmerman-911-calls-released-florida-shooting-incident/story?id=30982942
as i now understand fogen had moved and was just visiting….since these 2 had had problems before it is unlikely apperson knew fogen was around, far more likely if it was not a mere chance encounter that is was fogen seeking him out since apperson wouldnt know he was around if he knew he had moved away.
Last seen on Twitter, little Eddie Haskel was in town for Mother’s Day…and had a Dr appointment. We shall see…thinking West may nix interviews for him. Maybe they’ll go for ice cream instead.
Pilcherje,
LOL @ West and gz going for ice cream.
https://encrypted-tbn1.gstatic.com/images?q=tbn:ANd9GcTz3ki31vu91pp74lDj70yvg6HwQU1CkfAAxBwxwWypBHrEzSWR
That makes sense, Bill.
Perhaps gz saw Apperson in the traffic coming toward him. gz then turn on his flashers to make a u-turn and catch up to Apperson. That would explain why gz’s vehicle was on the left side of Apperson’s Infinity car. (Total speculation on my part.)
Well…..FogenPhoole knew where Apperson worked and it’s a matter of public record on at least 2 police reports. I can’t imagine any other scenario than Fogen was back in town to shut off his mom’s electric again for a Mothers day surprise and decided to stalk Apperson.
Fogen’s line of logic would go something like “……I don’t live here anymore so I can do what I want and nobody will suspect the Teflon man” I doubt PhatFogenPhoole ever imagined he have someone return fire.
There is at least 1 witness who said he clearly heard 2 shots. Did FogenPhoole fire and miss ?
Did Apperson return fire ??
This supports what Bill T. said above. There is no way I’d believe Apperson say Fogen and went after him. BUT…..Fogen now has a history of following and provoking people, then turning it around and making himself the victim.
I think Fogen needs to be charged with assault or something relating to brandishing a weapon. Maybe we’ll find he did fire a shot.
If Z did fire at Apperson then the cops should find the spent cartridge in his truck. But the man who was mowing his lawn has said he definitely heard one shot but maybe 2. We know that Apperson used his .357 revolver and only one bullet was fired….since only one spent shell casing was still in revolver.
One of the things several people noticed about Z in his TM interviews….he seems to project what he did as what others did. He even started to slip in one of his Serino interviews about that saying “I” instead of TM.
Police have not decided on whether to press charges. The video includes a portion of the 911 call.
Rachael | 05/12/2015 at 10:37 pm
GZ “is still in a state of shock…this has been a very traumatic event for him.” Too bad, so sad.
He thinks his karma doesn’t stink? Sheesh.
Maybe………….just maybe Fogen had the need to field test his new Extra – Extra – Large bullet proof vest……..maybe ??
“Zimmerman lawyer Don West insisted Apperson was the aggressor and had been chasing him in his car just before the 1 p.m. Monday shooting.
“George decided to do a U-turn to where he had seen a police car parked near a park,” West told The News. ****** “He rolled up his window.”*********
West said Zimmerman had a legally registered gun in his truck but denied he brandished it. He said ******Apperson could not have seen the gun because Zimmerman has tinted windows.”*******
Hummmm – What’s that you say, Don?
http://www.nydailynews.com/news/national/george-zimmerman-armed-gun-latest-incident-cops-article-1.2219253
Bill Taylor | 05/12/2015 at 11:02 pm
really “he rolled up his window”….meaning when they saw each other the window was DOWN…..get some more ice cream cones dude.
Yeah, West must have forgot about earlier interviews when he said the windows were down. Instead he is following the latest Internet defense….dark windows so he couldn’t have seen Z’s gun…..yeah right.
Now look at that bullet hole in the window, now compare the height of Z…about 5’7″, that bullet hole is at least 5′ from the ground……hmmmmm. Just how high sitting is that Infinity (sorry I thought it was a lexus)? The bullet ended up in the frame above the driver’s window near the safety handle. This shows that the bullet was traveling upwards ever so slightly even if the window was fully up. But Z never says Apperson got out of his car so how did Apperson get a shot like that? Answer: window was still going up and was actually lower when the shot went thru the window. That would make the angle of Apperson sitting in his car and the shot more believable.
You can compare/guesstimate the heights by the photo of Z above.
pilcherje | 05/13/2015 at 12:27 am
Love it, West pitching out of right field. So if Mr. Haskell has dark tinted side windows, how did Apperson know it was him? And you know, Apperson has a job, assuming the same position, I’d venture to guess Apperson wouldn’t jeopardize that position for such a wasted piece of…oh sorry,phone…Happy Mother’s Day Mrs. Zimmerman 😁
While there are lots of grey Honda Ridgelines in the Orlando area, not many have Kel-tec stickers on the back windows.
Don “Vanilla Ice Cream” West says that George won’t give a statement to police until later this week — but he’s cooperating.
So just a statement? Later this week? Need a week to get it crafted just right?
Emphasis on statement = will not submit to questioning? ….but cooperating, of course…in a gz kind of way
“So tell us Z did you see the light?”
For gz, “seeing the light”, probably means he has only scurried under the refrigerator. My guess is that gz will never have a spiritual awakening.
towerflower | 05/13/2015 at 1:25 am
A near-death experience (NDE) is a personal experience associated with impending death, encompassing multiple possible sensations including detachment from the body, feelings of levitation, total serenity, security, warmth, the experience of absolute dissolution, and the presence of a light. (Wikipedia)
When was Z faced with impending death? Gee, according to them he should have experienced a near death experience with TM since he claimed he was one head banging away from death then, smh.
See my reply above at
https://blackbutterfly7.wordpress.com/2015/05/11/george-zimmerman-again/#comment-47734
Let me get this right. Zimmerman’s story when he killed Trayvon is that he was having near death experience; head felt like it was going to explode, blood in eyes, being smothered; so he pinned Trayvon’s arm and then aimed and shot the kid in the heart. Zimmerman was talking that night, the next day at work, and then appeared on a “walk-through” video.
But when a bullet whizzes by his head that he didn’t see coming, he can’t talk.
Xena…he is a mess, “almost dies”, according to him, with his encounter with TM and never goes to a hospital but is walking and talking to anyone who will listen and he never claimed to having a near death experience with TM. Now a bullet whizzes in front of his face, he gets a scratch on his arm, and he goes to a hospital in an ambulance, is having a near death experience and can’t talk.
West and his client are fools.
Proof that gz’s life was never in danger from Trayvon, that gz was the aggressor and in complete control of Trayvon, and that it was Trayvon who was desperately crying out for help.
He was calm that night. He is such a fake and liar.
“when sort of the full weight of what he experienced yesterday kind of hit him…” AFAIC, it didn’t hit him hard enough, IYKWIM.
“with his near-death experience, takes a lot of processing to deal with…” Gag me. How much processing is Trayvon doing. Near-death experience OMG. What a drama llama.
“…on track to do the things we need to do.” Like make up some lies.
“Mr. Zimmerman is adamant that he didn’t display, wave, point, brandish the gun that he had.” Of course he didn’t. Ughhhhhh
“I’m confident that under the scenario, as George explained it to me…” Oh yeah. SMH
“…on track to do the things we need to do.”
Like make up some lies.
Yep…we know their routine, don’t we?
Apperson’s lawyer was brilliant to keep Apperson from divulging any details. (by invoking the 5th). Now West has nothing to work with/play around with as he creates gz’s statement.
This is a seriously flawed sack of garbage. (condescending tone and head tilt) and the “near death exp.” line is a laugh. No…….he waved his gun and when Apperson pulled his out he said “Oh…..shit…..Our Lady of Blessed Acceleration, please don’t fail me now”
Then he rolled up his window. Get it right Skeletor.
Oh, and by the way, the “how could Apperson see into Fogen’s car if the tinted windows were up is well……your story…….which is diametrically opposed to what Fogen said to the police, which is what actually counts. Fogen said, he saw Apperson point a gun THEN he rolled up the passenger side window….see how easy that was.
Exactly, Racer!
gz is in deep doo doo.
George Zimmerman had moved out of Florida recently, hoping for a fresh start.
Zimmerman had returned to the area for Mother’s Day and a doctor’s appointment, and was driving to his doctor’s office when the confrontation took place, said his attorney, Don West. Apperson works nearby, at a disability-benefits office.
http://abcnews.go.com/US/wireStory/lawyer-man-zimmerman-shooting-acted-defense-31003511
Remembering what Dr. Turi wrote about Zimmerman in 2012, I wonder if Zim is getting his prescription drugs from two different locations because ……
On March 26, 2013, Dr. Turi wrote the following about Zimmerman;
Zimmerman’s Moon (emotional response to life) is in his subconscious’ 12th house and motivated him to cleanse the entire neighborhood of “umpurities” or anything he perceived as dirty. This Moon position enunciate living in confinement (jail/hospital) dealing, using drugs or forced into hiding in an island.
We now know that Zim has lived in confinement.
Dr. Turi also wrote:
Neptune (drugs/dementia) is also in the 3rd house afflicting his mental process dictating the high possibility of using drugs which will probably surface in the future.
https://drturi.wordpress.com/2012/03/24/why-george-zimmerman-killed-trayvon-martin/
I don’t think Z will ever have much of a life, considering his track record over the past three years. So his confinement to a small life will continue.
But I wouldn’t be surprised if Apperson and not Z is charged. I mean, I’m hopeful the law will find something to slap Z with, but I look at it like this – it’s awfully hard to prove that Z was brandishing his gun, but there’s proof that Apperson not only brandished but fired his. It appears to me that St. Mary PD would love to charge Z with something but have no real proof of Apperson’s story, unless someone else witnessed the incident. So Z may very well get away with his shizzazz once again.
And where, pray tell, is he living now? Inquiring minds would like to know.
What gz has going against him is that he had his vehicle to the left of Apperson’s.
Aggressors (at least in the movies 🙂 ) bring their vehicles alongside their victims on the left side.
Also, gz had his passenger window down at the beginning of the encounter. (Remember West said that gz put his window up.)
Two sides, I suspect that no charges will be filed against either of them.
Where is he living now? Probably with an older woman in Texas, which is why they are having very strange weather. 🙂
Ha aha!!
I’m still curious as to how he’s surviving financially.
I guess those monthly checks from the NRA for not having a SYG hearing is still paying handsomely.
Hey Roderick! I think by now that Zimmerman has learned to live without money. He didn’t have money on him the night he killed Trayvon. It’s his way of life.
There was an article in the Daily mail where a “friend” says that others give him jobs to help him out. Sounds like he is a professional moocher and is living off of his friends giving him odd jobs and getting paid under the table.
Odd jobs, uh? What if — just what if — instead of Zimmerman plagiarizing paintings and coming on camera with the blame game, he had asked for a job instead? Well, maybe that would not have worked either since he really didn’t wait long after the verdict before he was caught on camera being aggressive to his then father-in-law and destroying Shellie’s Ipad.
Well he isn’t mooching off any women that we know of so who’s feeding the fat phuck because it doesn’t look as if he’s missed any meals.
roderrick……just for the record the NRA wouldn’t touch him. The President of the NRA gave a statement after the shooting and they wouldn’t have anything to do with him. He doesn’t fall into the NRA’s program of a responsible gun owner.
And you believe in Santa and the Easter Bunny.
Ha,ha, ha!
Looks like Little Robbie Z is demanding Chief Bracknell to recuse himself from the investigation now why is that Robbie? I understand your claiming Bracknell is Biased due to some e mails that went public in late 2013.
But those E mails were not Biased in any way what you have there is a Police Chief being Brutally Honest in regards to the behavior of your Brother Georgie. and I know Honesty isnt exactly something the zimmerman family is familiar with.
However for such a Biased Chief your brother sure did seem to skip out on charges that could have and should have sent him away for 20 years X’s 2 keep in mind Samantha isn’t the only person George threatened to shoot since he chased and murdered an unarmed kid.
He threatened Shellie & her father as well and lets not forget he threatened Apperson a year ago in another road rage incident only to show up at Matts place of work the next day.
By now its clear that Zimmerman has a pattern of following people with intent to shoot them
Chief Bracknell also made a comment recently to a LA times reporter:
“Man, it would be fantastic if you have an apartment out there [in Los Angeles] for George Zimmerman,” Bracknell, the police chief, told The Times. “This guy is killing me. We’re just a small-town police department — this really taxes us.”
If George has moved out of Central Florida why is he still seeing a local doctor?
If he did move he moved within driving distance and he’s playing games with his location which at this late date doesn’t make sense unless of course he’s still playing the sympathy card.
Roderick, some doctors will not renew prescriptions for certain medications. Patients need a new prescription every 30 days. But, if they are abusing the drug or selling it, they have more than one doctor.
That makes sense.
Can’t someone make him stop?!!!
George Zimmerman has once again gone into hiding and tells friends he is “badly shaken” after being shot at by Matthew Apperson Monday in Lake Mary, Florida.
According to the Daily Mail, the acquitted killer has told friends close to him that “he feels lucky to be alive” and that “God was watching over him” the day he reportedly waived a gun at Apperson in the third of such encounters between the two men — which according to Apperson had previously included Zimmerman stalking him while armed and threatening to “fucking kill” him.
While Zimmerman acknowledges that he could’ve been killed when Apperson fired a shot into the driver’s side window of Zimmerman’s truck, he told friends “It just wasn’t my time to go.”
http://www.deathandtaxesmag.com/248567/george-zimmerman-fears-for-his-life-plans-to-leave-florida/
What a load. Ughhh – he feels lucky to be alive and it wasn’t his time to go. Puhhleeezeeeee!!!
Good morning Rachael! It’s not his “time to go” because he’s digging his own ditch, and the lazy killer is taking his time.
I don’t believe a lot of what his friends have to say but then again they got that version from Z. They claim he gets nervous and sweats a lot when in public…..yet the fool has no problem promoting himself at gun shows and bragged at times on twitter about going to the movies, shopping, and parties.
I wish he would move to Virginia or anywhere else out of this state. I find myself always looking over my shoulder when I’m in the Lake Mary area, afraid that I’ll run into that crazy person. I survived a trip through there today…..thankfully no one followed me.
I do hope for one thing. I wonder if he experienced even the slightest fear that TM felt just prior to Z taking his life. I hope he did…..maybe then he’ll think twice before following another person.
Apperson arrested. I’m done.
I just found out too, once again Z pulls his same crap and talks his way out of trouble. Remember how the CarMax co worker said he was so smooth he started to doubt his own claims against Z.
I feel this will only empower the fool even more in his own mind.
Yeah so he tells police apperson called him a “fat fuck & said he didn’t press charges BC he wanted to kill him himself” and instead of what any normal, completely innocent person would say, like why, WTF is wrong w you? He laughs & calls him a clown.
Shannon, I found your comment in the spam folder. It contained the “f” word. LOL! Funny — since I changed options requiring a Word Press account to submit comments, it has eliminated spam by 99 percent, so when I saw that, it got my attention.
Wow. I guess WordPress is a little Oppressed! That word has been so mainstreamed it’s hardly a cuss word anymore.
Brought up in a hyper religious family, I thought that was the worst word in the world, I remember being horrified & literally turning red when i was in the lunch line & 1st over heard some kid say it, even though I’d never really defined it in my own mind. It took me until I was 23 to even say it. right after i saw the movie boys in da hood at some friends house to prepare me for my 1st trip to California! LMAO
And then I could.not.stop.saying.it! LMAO I mean it was ridiculous! i have video of me where i’ve lost my mind because i repeated it over & over thinking it was the funniest shit on earth.. i swore i was sooo cool!! OMG I’m so stupid!
Shannon, blame me for that. 🙂 Back in mid 2013 until I got the problem resolved (at least on a temporary basis), this blog received an average of 3 vile comments a day from the cyberextortionists through proxy IP addresses. All of their favorite vocabulary was placed in the blacklist queue so if they hit a proxy IP that wasn’t blocked, the comment would go into spam. I’ve not taken time to go through and delete those words because recently, Miss Filth from Texas has opened a Word Press account for the expressed purpose of trying to get her vile filth before my eyes again.
OH, by the way, it just goes to show what type of inconvenience they cause. Here we are minding our own business, and her creepy obsession with me just won’t let go.
shannoninmiami | 05/16/2015 at 12:06 am
yep. they’ve gone to great lengths to harass you but every time keep falling into the black hole of doom! lmao
Shannon, and you’ve been with me through it all. Words cannot express how much I appreciate you. (((((Hugs)))))
He has opportunity to have a SYG hearing. Actually, I’m looking forward to Zimmerman being a witness, taking the stand, giving his side of the story and being cross-examined.
Yeah, I’m trying to think of something positive too. But it’s hard.
I think that Apperson knew all along there was a good chance that he would be arrested. This is case where the rubber meets the road because both parties are alive, and neither party has authority to withdraw their complaint. Zimmerman is now on the other side as a witness, being deposed and required to testify. He won’t have a choice about it.
Apperson’s motion for a SYG hearing is probably already in the works.
The Apperson arrest report has now been added under “Documents” on the right-side border of the blog.
https://blackbutterfly7.files.wordpress.com/2015/05/apperson-arrest-report.pdf
From the news tonight…..Apperson was arrested solely on Z’s statement. On advice from NeJame, Apperson has not spoken to or given a statement beyond what was already said….before he lawyer end up. NeJame said this was expected and no surprise.
Rumor has it that police report has a redacted line in which it says that Apperson was recently in a mental institution recently. I tried to get it to show up but couldn’t. If he did I wonder if it was voluntary or involuntary and results. Depending on the circumstances, Apperson’s gun ownership and Concealed carry might have been illegal.
I swear i heard that isn’t the concealed carry permit (at least in FL) granted on a case by case basis at the discretion of the county sheriff or local police dept?
and what about someone who’s apparently an out patient like Zimmerman who has to see a psychiatrist to get Adderall ect.. suffering from paranoia & anxiety?
Shannon you heard wrong or the person telling you is misinformed. FL is not a case by case basis determined by the local law enforcement. It is decided by the State itself and as long as you meet the requirements and do not have a disqualifier then you get one. There are a few states though that it is true.
This is what the requirement says about mental health:
You are NOT ELIGIBLE for a Florida concealed weapon license if any of the following conditions applies to you: (1) you have
been adjudicated incapacitated under section 744.331, F.S., or similar laws of any other state; (2) you have been committed
to a mental institution in accordance with the provisions of Chapter 394, FS, or similar laws of any other state; (3) you have
been adjudicated mentally defective or incompetent in any court. Your eligibility for licensure would be restored only
if you had received relief from federal firearms disabilities through the Bureau of Alcohol, Tobacco, Firearms and
Explosives (ATF).
744.331, F.S. deals with the courts evaluating a patient and their rights.
Chapter 394 deals with everything else:
Operation and administration.
Screening of mental health personnel.
Continuity of care management system; measures of performance; reports.
Department responsibilities for a mental health resident who resides in an assisted living facility that holds a limited mental health license.
Introduction or removal of certain articles unlawful; penalty.
Rights of patients.
Sexual misconduct prohibited; reporting required; penalties.
Florida statewide and local advocacy councils; access to patients and records.
Persons to be notified; patient’s representative.
Guardian advocate.
Rights of professionals.
Designation of receiving and treatment facilities.
Integrated adult mental health crisis stabilization and addictions receiving facilities.
Clinical records; confidentiality.
Voluntary admissions.
Involuntary examination.
Involuntary outpatient placement.
Involuntary inpatient placement.
Rulemaking authority.
Procedure for placement of veteran with federal agency.
Plan and report.
Admission and discharge procedures.
Transfer of patients among facilities.
Discharge of involuntary patients.
Attorney’s fee; expert witness fee.
Acceptance, examination, and involuntary placement of Florida residents from out-of-state mental health authorities.
Residential care for psychotic and emotionally disturbed children.
Minors; access to outpatient crisis intervention services and treatment.
Children and adolescents; admission and placement in mental facilities.
South Florida State Hospital; privatization.
Definitions; ss. 394.4786, 394.4787, 394.4788, and 394.4789.
Use of certain PMATF funds for the purchase of acute care mental health services.
Establishment of referral process and eligibility determination.
Military veterans and servicemembers court programs.
Z has never been deemed incompetent by a court or admitted into a mental institution. Yes, he sees a “therapist”/doctor to deal with his “issues” and gets medicine to help with it but that alone doesn’t disqualify one.
Knew I could count on you to set me straight! I think I got that idea from something about a report on making it hard for black ppl to get guns. That local sheriffs wld deny black ppl their permits for their arbitrary reasons.
I saw only one redaction and it was for where the cop met Apperson — unless I missed it. Because of HIPPA law, no one has to disclose their private health info and if LE obtained it through means other than the legal procedure, (AND IF IT’S TRUE), they can be sued.
look towards the end on the bottom of the report where the cop opines that apperson has it out for Zimmerman & has been acting strange, there’s some blank spaces. that looks like redactions.
From what I understand the decision also came after the PD interviewed his mother and wife…….maybe one of them let them know about it.
looks like its true so looks like the PD’s error is grounds for a lawsuit & someone should be disciplined. after all remember this is the same PD that discouraged Apperson from filing charges against Zimmerman for threatening him & stalking.
another thing, they had ample evidence of Zimmerman’s aggression against his wife & father in law on video. he’s seem patting his chest where the gun is and motioning them to come here. just because they couldn’t get the video from the ipad, doesn’t mean they couldn’t see the damn idiot on home cams and it corroborated Shellie’s
‘excited utterance’ to 911.
one doesn’t call 911, especially shellie after all the drama she musta known would happen if she did, if she wasn’t in fear.
BTW; another thing that bothers me is the idea that they couldn’t get the video off the ipad when most of the time, at least with every android & iphone I’ve had, any photos & video I’ve taken is uploaded to a cloud almost instantly. & even faster if I’m using wifi. and they deff had wifi since they had the security cams.
lake mary totally failed to take action against Zimmerman when they had a number of opportunities. i don’t believe it would’ve been difficult to have convinced his victims they could make a strong case stick against him, considering his previous behavior, if they’d just press charges. instead everyone just wanted to wash their hands of him & hoped he wouldn’t be stupid enough to do anything again. they were so wrong.
Shannon, Zimmerman has a mob leader method in that it appears he only brutalizes people who are blackmailable. When he threatened Shellie, attacked her dad, and destroyed evidence, Shellie was on probation. She was vulnerable.
When Sam called the cops on Zimmerman, and in spite of there being evidence of destroyed property and his barricading himself in the house, Sam recanted because Zimmerman’s minions went after her mom as a gold-digger. Oh — and let’s not forget the revenge porn that Zimmerman showed Sam’s daughter.
The other girlfriend had something going on between her and a former boyfriend who she said Zimmerman threatened to contact.
Now there’s Matthew, and after calling the cops twice about Zimmerman threatening and stalking him, he didn’t file charges. He might have wanted to avoid what Zimmerman’s minions are doing now, which is placed him under the microscope to dig into not just his life, but his mind.
NeJame is smart. The cops redacted that portion of their report, and whichever Zimmerman minion figured it out and publicly reported it is in a position of being sued. It’s a federal violation.
From the Apperson arrest report:
Sgt. Towler arrived, overheard Apperson say,
“I hope I got him this time”.
This causes me to think that things do not bode well for Apperson.
you could look at it like that or you could look at it in another way. “i hope i got him this time’ sounds to me that he’s scared & finally had the courage to stand up to the bully who’d stalked & threatened him already.
if that idiot threatened you twice & you felt you needed to put him down before he made good on those threats, you’d hope this would’ve put an end to his reign of terror too?
BTW. remember the other person in the car with him when he threatened apperson the 1st time? wouldn’t it be great if Zimmerman had burned his bridge with that person by now & he’s ready to come clean & admit what happened? if apperson could get that guy to testify for him this case is done!
Shannon, thanks for sharing your point of view. It sure is going to be interesting how this all plays out.
Shannon, I’m back again. 🙂
Thinking of gz’s and Apperson’s story versions:
Apperson must have been driving with his gun readily available to have been able to shoot the moment he saw gz waving his gun at him.
gz must have had his window down to have heard all of Apperson’s words shouted at him. (Plus he did say he put his window up.)
Wonder what speed they were going. (or did Apperson fire his gun when they were not moving?)
Wonder how much traffic was on the road.
It would be helpful to have a map of where all of this started and ended.
gz is said to have flagged down a police cruiser. Do you think he called 911 ?
Lake Mary Blvd. is a main drag and it occurred around lunch time and it is a heavily traveled road. There had to be considerable traffic out there and so far it doesn’t appear anyone knew what had transpired. A bystander did recognize Z’s vehicle and started to film what was happening, that is the person who caught the footage of him getting the ambulance.
Speed limit on that road is mainly 45 mph. It would not be unheard of for traffic to slow for a light or come to a stop.
Thanks, Towerflower. Your answers are helpful.
Idk where he carries it, maybe in a holster or like most ppl I know in their pocket &then stick it in the glove box/or compartment in the middle when they get in the car. I don’t think most ppl wld keep it on them while driving.
Yes, I want to see the map too with the routes they claim they each took. I need a visual before I can understand.
I’m like you in that a visual map would help me understand more.
This is what the redacted part says:
(Removed per request) | cc/2020-05/en_middle_0128.json.gz/line1012 |
__label__wiki | 0.572179 | 0.572179 | ← A Gigantic Step Backwards: Trump Bans Transsexuals from the Military on the Anniversary of Truman’s Desegregation of the Armed Forces
A Huge Thank You, Changes, Embedding Videos From Youtube, and Open Discussion →
Trial Starts For Former St. Louis Officer Jason Stockley
Anthony Lamar Smith with his daughter
On December 20, 2011, 24-year old Anthony Lamar Smith was pulled over by St. Louis police officer Jason Stockley on suspicion of making a drug deal. Anthony took off in a rented Buick. Against policy, Stockley shot at the fleeing car. Dash cam video shows that Anthony slowed down. Stockley called for another officer to “hit” the car driven by Anthony, and that officer, Brian Bianchi, did just that.
Footage from three recordings obtained by the St. Louis Post-Dispatch shows Stockley walking to Anthony’s rented Buick. One recording was from a cell phone, and at least one other was from a store’s surveillance camera.
The impact of being hit by the police SUV resulted in the Buick’s side curtain air bags engaging, blocking part of the view from the dashboard’s camera. Bianchi is seen reaching into the Buick with his gun still in its holster. Stockley is seen with an AK=47, and his head is bobbing up and down as if he was lifting the curtain as well.
Stockley shot 5 times. Officer Bianchi suddenly backed away as if he was not expecting the gunshots.
Backseat of police SUV where Jason Stockley’s personally owned AK-47 is seen on the right.
Stockley is seen taking his personal AK-47 back to his SUV and putting it into the backseat. Stockley then returned to the Buick that was driven by Anthony. St. Louis Today reports that according to officials, Stockley was not authorized to carry the rifle, which he personally owned.
Inside dashcam recorded Stockley going into a duffle bag in the back seat, and subsequently leave the SUV with nothing in his hands.
After other officers removed Anthony’s body from the Buick, Stuckley is seen crawling inside the Buick.
Stockley said that he shot Anthony because Anthony disobeyed his commands to show his hands and he believed Anthony was reaching for a gun that was found in Anthony’s car.
According to Stockley’s father, Jason Stockley attended the U.S. Military Academy at West Point and served a 15-month tour in Iraq with the Army. He attributed the sudden charges against his son to “a change in the country, which is frightening”.
WHAT HAS HAPPENED IN 6 YEARS
You can no doubt guess that much happened in the 6 years between December 2011 and July 2017.
There was an Internal Affairs investigation into the shooting.
In 2011, Stockley told Internal Affairs Investigators that he returned to the SUV to get a first-aid kit. The investigators deciding that .38-caliber Taurus revolver was found in the Buick, found the shooting justified.
A lab analysis of the revolver found that the only DNA on the gun was from Stockley.
In 2013, Stockley resigned his position with the St. Louis Police Department. He moved to Houston, Texas.
Anthony’s Estate filed a civil suit on behalf of Anthony’s young daughter. The St. Louis Board of Police Commissioners settled the case for $900k.
According to court records, during the chase, Stockley is recorded saying, “Going to kill that mother(expletive), don’t you know it.”
In August 2016, Stockley was indicted by a St. Louis grand jury. He is charged with first-degree murder and armed criminal action. Stockley was arrested and held in Texas with no bail until he was extradited from Houston, Texas to St. Louis, MO. by the U.S. Marshall. He was arraigned and placed on a million dollar bail. The bail was secured by the St. Louis Police Officer’s Association. Stockley is staying with relatives in Illinois until the completion of trial.
Originally, jurors were to be selected from a pool of 150 people and be sequestered at an undisclosed location. Stockley’s attorney’s request for a change of venue was denied by the court. Stockley has waived his right to a trial by jury and is having a bench trial.
At a press conference, Circuit Attorney Jennifer Joyce stated:
“I’m disappointed because I know what fine public servants the vast majority of police officers are, and this kind of conduct on the part of this former officer doesn’t reflect the excellent work I see from them every day. So it’s disappointing in that regard, but it’s important that people understand that if you commit a crime, and we have the evidence to prove it, it doesn’t matter to us what you do for a living. Our job is to hold people accountable if we have the evidence. And in this case, we do.”
The judge has ordered no cameras in the courtroom. I will look today to see if a reporter is reporting on the trial and if so, the information will be posted in the comment section below.
Sources: Riverfronttimes.com
St. Louis Today
St. Louis Today; No cameras
Posted on 07/31/2017, in Anthony Lamar Smith, Cases, Trial Videos and tagged Anthony Lamar Smith, bench trial, Jason Stockley, murder charge, St. Louis. Bookmark the permalink. 59 Comments.
No electronic devices will be allowed in the courtroom.
INBOX: Anyone caught w/ electronics at next week's murder trial for ex-STL officer #JasonStockley faces arrest. pic.twitter.com/bn3Htv0XND
— Joel Currier (@joelcurrier) July 28, 2017
Courtrooms are public places. I can’t understand the judge not allowing the media to have cameras. There is no jury, so no danger in capturing jury members on camera. It’s a bench trial so only the judge decides the verdict. There are no dangers of having the jury hearing about the case in the media to persuade them one way or the other.
ladylove1120 | 07/31/2017 at 8:25 am
I’m praying for a great outcome, but we all know how it ends!
Ladylove,
I am more concerned over bench trials than trial by jury. Remember when those members of the Baltimore 6 decided to have bench trials, and the judge acquitted all of them? It sounded like trials and decisions by script.
ladylove1120 | 07/31/2017 at 3:17 pm
That’s the reason I believe that defendants choose them. I’m just praying that his gamble will be his down fall.
Gronda Morin | 07/31/2017 at 10:01 am
I am not sure that the judge won’t find Mr. Stockley guilty, UNLESS THE FIX IS IN. The peoples just can’t have a police officers carrying and using unauthorized killing machines like the AK47.
Gronda,
Like you, I hold on to hope.
Stockley didn’t fire his AK-47, and the thing for prosecutors to prove is that he pre-planned to kill Anthony, and after doing so, planted a gun in Anthony’s car.
In bench trials when officers are defendants, judges generally perceive them as officers of the court given discretion in their decisions the same as judges are given discretion. The standard of proof is suppose to be beyond a reasonable doubt, but in reality, it’s abuse of discretion.
He didn’t fire the AK? That’s not the gun used to kill Anthony? Am re-reading now!
I stand corrected about the firing of the AK-47. Today it’s been reported that Stockley fired it at the Church’s where he first pulled Anthony over.
Prosecutors: Jason Stockley first fired upon Anthony Smith at Church's Chicken using his personal AK47, against @SLMPD policy. @ksdknews
— Jacob Long (@JacobLong_KSDK) August 3, 2017
Excerpt from article at this link:
http://www.stltoday.com/news/local/crime-and-courts/murder-trial-of-ex-cop-in-st-louis-could-draw/article_ae3a1139-cd68-52be-bda0-af553bf8a1ba.html
“Opening statements in Stockley’s two-week trial begin Tuesday in front of St. Louis Circuit Judge Timothy Wilson, who will decide the case because Stockley waived his right to a jury trial.”
St. Louis Circuit Judge Timothy Wilson
Dr. Kris Mohandie will be a defense witness. Dr. Mohandie testified at the trial of Ofc. Betty Jo Shelby, who was acquitted
Per depo, #JasonStockley defense witness Dr. Kris Mohandie testified at manslaughter trial of Tulsa cop Betty Jo Shelby, who was acquitted.
In depo, Ex-LAPD police psychologist said #JasonStockley's response "not excessive" and "understandable within the situation" before him. https://t.co/doTOr4iAbs
this is a serious problem with the system, “experts” being taken seriously when they ALWAYS 100% no matter the facts side with the police….my experience is most “experts” are no more informed than any well read person…….you cant explain away a person saying you know i am going to kill that person and then minutes later doing exactly that…..clear premeditated murder.
Bill, I hear you. Here is what a witness for the defense (Dr. Kris Mohandie) said in his deposition:
…Mohandie believes #JasonStockley said that to motivate his partner, Brian Bianchi, to prep himself for possible deadly force. (2/2) https://t.co/vDf2W7xQoP
TY for this that is laughably ridiculous we may have to use deadly force conveys that, NOT “you know i am going to kill him” they conveys what he intended to do and DID…….any expert trying to defend those words is NOT an expert they are a paid liar.
Dr. Mohandie (an ex-LAPD police psychologist) also said this in his deposition:
The state does not want Dr. Mohandie to testify:
State has filed motion to exclude testimony from former LAPD forensic psychologist, hired by #JasonStockley defense at $450 per hour. https://t.co/doTOr4iAbs
Do you know if the court accepted or rejected him as an expert witness for the defense? I’m so disappointed that we’re not kept informed by the media.
I tried to learn more after reading the tweet that I posted. I could not find a pdf of the state’s motion nor could I find out whether the court has responded to the motion.
One has to ask WHY the public has to be kept in the dark and why so little information will be coming out minute by minute during the trial due to the prohibition of electronic devices in the courtroom.
i fear he chose trial by judge because he already knows the verdict……seems is should be much easier to get ONE juror out of 12 than to find crooked judges, but recent history throws that logic out the window…….
Hi Bill!
I can’t remember one case involving a police officer who chose a bench trial that ended in a finding of guilt. On this blog, I have reported on cases involving bench trials that ended in acquittal; the trial of Daniel Willis who killed Yvette Smith, and the ttrial of Craig Taylor who killed 95-year old John Wrana by tasing and shooting his frail body 5 times with bean bags.
On the other hand, a man who was not a law enforcement officer, Rolando Cruz was convicted for murder. He spent 9 years on death row. At his forth trial, he opted for a bench trial and was acquitted.
our system is very messed up…..the structure is sound but the people administering it are corrupt far too often
Opening statements at 9:00. Joel Courrier with the St. Louis Post-Dispatch will give an update at noon.
Opening statements for #JasonStockley murder trial start at 9am in #STL. No devices in court; will update at lunch. https://t.co/BnkTiV2MhT
— Joel Currier (@joelcurrier) August 1, 2017
Link to KMOV article on opening statements today:
http://www.kmov.com/story/36022604/prosecution-smith-did-not-deserve-to-be-executed-stockley-planted-gun
‘During opening statements in the first-degree murder trial against former St. Louis Police Officer Jason Stockley, the prosecution claimed Anthony Lamar Smith was trying to get away from police and did not deserve to be executed.
“After arriving at the courthouse Tuesday morning, the prosecution gave their opening statement. In the statement, they argued that Stockley made bad, deadly decisions and there was a “kill shot.” They also claimed Stockley planted a gun following the fatal shooting.
“The defense argued that Smith created a violent encounter and fled from Stockley, putting himself and others at risk. They also claimed a gun was not planted and Stockley acted in self-defense and reasonably.
“The defense also claimed that both officers saw the gun Smith reportedly had.
the gun had only the officers dna on it……it could not have been the victims gun IF it had none of his dna on it.
I think the results of that test is what convinced the prosecutor to charge Stockley.
“… the prosecution claimed Anthony Lamar Smith was trying to get away from police and did not deserve to be executed.”
That’s logical. If Anthony had a gun, it’s only logical that he would have used it when he was stopped the first time before driving off.
Yes, it is logical.
Xena, here is a link to an article on today’s proceedings:
http://www.stltoday.com/news/local/crime-and-courts/officer-s-kill-shot-was-six-inches-from-anthony-smith/article_22fce07d-70a6-5ce3-8bcd-b1567f53ed46.html
Thanks for the source references and for your time in finding them and keeping us informed. (((((Hugs)))))
You are very welcome, Xena.
Hugs back at you 🙂
“…Jason Stockley fired his “kill shot” at Anthony Lamar Smith from just six inches away…”
That doesn’t sound like fear of Anthony having a gun. It sounds deliberate.
I hope that prosecutors have a video expert to testify and go through the video for when Stockley went back to the SUV and ruffled around in the duffle bag. While I think that I saw him place something into his shirt, I would like to see if an expert can break it down what he/she saw Stockley doing. He certainly did not leave the SUV with a first aid kit like he claimed he was getting.
Exactly…you don’t put “a first aid kit” in your shirt like that.
Indeed! Not only did he not have a first aid kit, but the cell phone video shows him casually walking back to Anthony’s car. The moment Anthony’s lifeless body was removed from his car, Stockley jumped into the driver’s side.
I would also think that an officer involved in a shooting is not required to clear evidence such as a firearm purportedly belonging to the person they just killed.
Great points, Xena!
As reported by stlamerican.
“The defense argued that Stockley would not have planted the gun, because his fingerprints are the only ones found on it. He wasn’t wearing gloves when he handled the gun, which the defense asserted was not the action of someone trying to cover his tracks – instead, his handling of the gun found in Smith’s car was simply a necessary (and legal) action to secure the scene.”
In my opinion, no matter if Stockley cleared the gun, if it was Anthony’s gun, then Anthony’s DNA should have ALSO been on it.
“In court, the defense asked witness John Baumgartner of the police force to demonstrate the grip required to unload a pistol, which he demonstrated using the same pistol that had been found in Smith’s car that day. The witness who handled the gun, however, was asked to wear gloves.”
“Another topic up for debate Wednesday was whether or not a crowd gathered at the scene. Simpson, along with Stockley’s defense, described the aftermath of the shooting as “crazy.” Cell phone video by French, which shows “about 10” officers gathering in the parking lot after the shooting, contradicts that. It doesn’t show a civilian crowd at all, much less an “aggressive” one.”
This argument, in my opinion, was not relevant. If a jury trial, it might appeal to personal biases to persuade the jury to believe that the area is occupied by residents that would hinder the police from doing their jobs at the crime scene.
In the upcoming days, a DNA expert is expected to testify, along with other witnesses, possibly including Stockley himself.”
This is another problem with our system clearly officers feel they can LIE about known details, the crowd as an example, and you simply can’t explain away no dna from the victim on the gun…that is proof of a drop gun being used.
Bill, I agree. I would like to know why the defense thinks that was even necessary to bring up since it was AFTER Stokley killed Anthony.
Defense alleging Smith was leaning to right of car for gun. M.E. says based on trajectory of shots, that may/may not be true @ksdknews
Testimony today included M.E. who said 2 of 5 shots were fatal for Anthony Lamar Smith, including one through the heart. @ksdknews
Also forgot to mention that when Officer Elijah Simpson got on shooting scene, he saw NO gun inside Anthony Lamar Smith's car. @ksdknews
A Lt. from @SLMPD internal affairs testified it was against policy in 2011 for Stockley to fire upon fleeing vehicle like Smith's @ksdknews
I was somewhat confused by the reports that only Stockley’s DNA was found on the gun in Anthony’s car, but there was also blood found on the gun. I presumed it had to have been Anthony’s blood since he was the person shot. It turns out that the blood on the screw of the gun was Stockley’s. The defense argued that it proves the gun belongs to Stockley.
Stockley’s defense however, argued that the material on the gun was rust. They also argued that no test confirmed what the material is.
Last state witness of the day was a @SLMPD DNA analyst who testified where she found Jason Stockley's DNA on evidence. @ksdknews
Some more detail in the article at this link:
https://www.riverfronttimes.com/newsblog/2017/08/03/prosecutors-question-why-stockley-was-allowed-to-search-suspects-vehicle-after-shooting
#JasonStockley update: Defense seeks to exclude presumptive blood tests of screw of revolver in #AnthonySmith's car: https://t.co/jqOEffnoNE pic.twitter.com/iMWiol9EJf
The only thing I was able to find out about the trial today is that there was no trial.
CBS reported;
” It’s another off day in the murder trial of former St. Louis Police Officer Jason Stockley.
After calling 18 witnesses last week, the prosecution is expected to rest its case in the morning. Then the defense will call its first witness.
Last week the prosecution tried to demonstrate that Stockley violated department policy several times during the chase and after the shooting that claimed the life of Anthony Smith.
Among the most dramatic testimony was that from an FBI firearms analyst, who determined one of the five shots fired by Stockley came from within six inches of Smith.
Judge Timothy Wilson, who will decide the case, will rule on some motions and then testimony will resumes. Proceedings begin at nine tomorrow morning.”
The State and defense both rested today. Stockley testified on his own behalf. Hopefully, more news will come and can be reported here.
News posted 25 minutes ago:
Defense rests case in murder trial of former St. Louis police officer”
http://www.stltoday.com/news/local/crime-and-courts/defense-rests-case-in-murder-trial-of-former-st-louis/article_990ba469-4922-596f-85bf-3e27217b3da9.html?utm_medium=social&utm_source=twitter&utm_campaign=user-share
#StL
Former SLMPD Ofc #JasonStockley's murder trial continues today.
Caught #Roorda coming out of the courthouse. Not looking too happy. 💁 pic.twitter.com/6R7xxmfwDK
— Heather ♿📷📱🔭 (@MissJupiter1957) August 8, 2017
Closing arguments are scheduled for tomorrow, Wednesday.
At 352pm, defense rests in #JasonStockley murder trial; closing arguments Wednesday morning https://t.co/6hTSU16E9p
During cross-examination, it sounds as if Stockley claimed forgetfulness when asked what he stated when giving chase. In answer to why he violated policy by carrying his own AK-47, he replied, “Because I valued the lives of my and the other officers more than the policy.”
http://www.stltoday.com/news/local/crime-and-courts/stockley-testifies-he-heard-partner-yell-gun-saw-weapon-in/article_990ba469-4922-596f-85bf-3e27217b3da9.html
was the origins of the gun in the car even mentioned? it had a serial number on it…..who owned that gun? what was its history? seems to me to be very important information that should be easily known.
That’s an excellent question about the serial number and history of that gun found in Anthony’s car. I have not read if that was presented at trial. Inconsistencies have been reported involving the reports of officers, including Stockley. For example, he said that he went to the SUV to get a “clot kit” but decided that Anthony’s wounds were fatal. Yet, he did not go back to Anthony’s car to see if he were alive or dead before deciding on his own that Anthony’s wounds were fatal. Another officer however, said that Stockley was providing first-aid when he arrived on the scene. The reports by officers, including the supervising officer, are found on the St. Louis Today website.
The defense has rested.
The judge will not enter a decision before August 18th.
(Let’s see if this works to show the video)
“It appears city leaders anticipate a verdict soon; they’ve placed barriers around the courthouse and have reminded people to remain calm.”
http://fox2now.com/2017/09/11/waiting-for-a-verdict-in-jason-stockley-murder-trial/
Verdict is shocking.
Pingback: Trial Starts For Former St. Louis Officer Jason Stockley | We Hold These Truths To Be Self-Evident – Never the less… | cc/2020-05/en_middle_0128.json.gz/line1013 |
__label__cc | 0.536392 | 0.463608 | Sept 07: Welcoming Scranton - A Celebration of Neighbors & Community, 3:00-6:00pm. Connor's Park, 515 Orchard St, Scranton, Pa. Sept 06: Small Space Pop-Up @ First Friday. 5:30pm-8:00pm - The Marketplace at Steamtown, 300 Lackawanna Ave, Scranton. Aug 02: First Friday: Black Scranton Art by Travis Prince and Glynis Johns at The Garden Mediterranean Restaurant July [...]
Newspaper clippings have afforded a glimpse into the Black Life as both a community and culture dating back to late 1880s. These excerpts collected for Local and Regional newspaper outlets courtesy of local and national archives such as Lackawanna Historical Society, Scranton, PA; Albright Memorial Library of Scranton, PA; Pennsylvania State Library, Harrisburg PA; and Newspapers.com
Get In Touch We want to hear from you! Need help connecting with community organizations? Want to donate to our archives? or Nominate a P.O.C resident for a Citizen Shout Out? OR Just want to say hello. Please, drop us a line. info@blackscranton.com
Game Changers: Pennsylvania Women Who Made History
Featured By blackscranton
The exhibit, entitled Game Changers: Pennsylvania Women who made history, showcases 32 Pennsylvania women who made a significant impact over the last century. One of those 32 women was a Black Scrantonian.
Making History with a Pop- Up Exhibit
Opening Night of BSP's Black History Month Exhibition "Remembering and Understanding the Heritage of Black Scrantonians" Black Scranton Project's Pop-Up Exhibition If you were not at our opening reception inside the Marketplace at Steamtown on First Friday to kick of Black History Month, then you missed out on a monumental evening! Friday night was disrespectfully [...]
Muhammad Ali in Scranton, 1981
on April 28, 2019 April 28, 2019 By blackscranton
Muhammad Ali invited to city by former Mayoral Candidate Angelo Craig 1981 Muhammad Ali invited to city by former Mayoral Candidate Angelo Craig in 1981. | cc/2020-05/en_middle_0128.json.gz/line1014 |
__label__wiki | 0.660927 | 0.660927 | Home » Pop Culture » Ranking the Weapons of The Walking Dead
Ranking the Weapons of The Walking Dead
By Jon Steffens Published on October 31, 2019 in Firearms
Over a lengthy run of nine-plus seasons of walker-splattering action, horror and drama, The Walking Dead has featured many iconic weapons wielded by its cast.
From a gargantuan array of firearms to swords, crossbows, bows, knives and baseball bats (yeah, Negan, we’re looking at you), if it can be found in the popular show’s post-apocalyptic wasteland, there’s a good chance it’s been used to take down walkers and marauding menaces of all stripes.
Since it’s Halloween, let’s rank some of the more recognizable weapons used by Rick, Daryl, Michonne and the gang throughout the zombie-filled show’s run.
NOTE: These rankings are purely subjective. This piece is meant to be fun, not to determine the superiority of any particular weapon.
1. Rick’s Colt Python .357 Magnum
The gun of The Walking Dead, the .357 Magnum Colt Python revolver was carried by the main protagonist, Rick Grimes, for most of his tenure on the show.
The gun is big, nickel-plated and intimidating, which is great to frighten would-be evildoers, but the walkers don’t seem to notice.
Used by Andrew Lincoln’s Rick in most of his iconic action (and a few great dramatic) moments, the Colt Python is the undisputed “hoss” of the series. Many firearm collectors have referred to the Colt Python as the greatest production revolver ever made.
2. Darrell’s Crossbow – PSE Fang 350
Certainly one of the most iconic weapons associated with the series, a crossbow is used extensively by loveable-but-rough outdoorsman Daryl Dixon (portrayed by Norman Reedus) in combat and hunting situations.
Daryl is so comfortable with the crossbow, it is essentially an extension of his physical body—and two different crossbows have been used throughout the series.
In seasons 1-3, he used a Horton Scout 125. During season three, Michonne gave him a Stryker Strykzone 380 she acquired from Morgan’s weapons stash. That Stryker has been his weapon of choice ever since, and it will return in season 10.
3. Negan’s Lucille
Brutal, effective, beyond intimidating and just a bit unsanitary, Lucille is Negan’s favorite tool for instilling fear in others. A stand-in for his late wife, Lucille is simply a baseball bat wrapped in barbed wire.
That simplicity is only matched by its threatening effect on Negan’s enemies (and fellow Saviors) when they see (or experience) him using it.
4. Michonne’s Katana
Danai Gurira’s Michonne uses a razor-sharp katana to slice through walkers like a hot knife through butter in several seasons of the series, beginning in season two.
Her deadly proficiency with the blade even surpasses the menace of her two companions during her character’s introduction: two shackled, armless and jawless walkers.
Though she’s used a wide selection of firearms throughout the show, it seems as though she prefers the swift, silent and deadly close combat her katana allows.
5. Carol’s Smith & Wesson M&P
Resourceful and ultra-tough, Melissa McBride’s Carol has carried an enormous amount of guns throughout the series. One standout a Smith & Wesson M&P used by Carol through seasons eight and nine.
A popular and well-made pistol, it’s also used by several other characters in key scenes throughout season eight, including King Ezekiel, Rosita, Morgan, and other Saviors and soldiers of the Kingdom.
Colt Detective Special
Used by fan-favorite Carol throughout seasons four through eight, the Colt Detective Special .38 is a great sidearm for the character due to its relatively inconspicuous size. She loses the revolver in the season eight episode, “Some Guy.”
The gun was originally found by Daryl in season two and used by Lori (Sarah Wayne Callies) in seasons two and three.
In the season seven finale, “The First Day of the Rest of Your Life,” Negan uses a wild-looking MAC-10 in his fight against the Alexandrians.
The gun features a rifle scope mounted onto a suppressor, and its look was inspired by the gun used by the Snake Plissken character in Escape from New York. This gun looks like something straight out of an ’80s action movie.
Another extremely popular pistol in the zombie-riddled landscape of the Walking Dead universe, the Beretta 92FS has been used or carried by a vast array of characters throughout the first seven seasons of the series.
(It’s also been used in at least one season of Fear the Walking Dead). In one memorable scene during the season seven episode “Service”, Carl (Chandler Riggs) gives a Beretta 92FS to his father, Rick.
It’s then taken from Rick by the formidable baddie Negan (Jeffrey Dean Morgan).
Airtronic RPG-7
In the season six episode “Always Accountable,” Abraham (Michael Cudlitz) takes a loaded Airtronic RPG-7 from the reanimated corpse of a soldier. Nearby, he also finds a carrying case filled with several RPG warheads.
Later in the season, during episode nine (“No Way Out”), Daryl uses the RPG launcher to ignite a pond filled with fuel to draw the attention of a horde of walkers.
What walker-wasting weaponry would you include on this list? Let us know in the comments below. Happy Halloween!
Cool that they have a never ending supply of ammo, none of their ARs seem to need maintenance, and the batteries in their red dots last forever. I also like how you can shoot a 357 indoors without hearing damage in the apocalypse.
Not one shotgun mentioned! I would go with a Benelli M1 Super 90 with extended mag….
From about four years ago, three consecutive issues of a magazine (I think it was SI) ran an advertisement for the Hyundai Veloster. Each one showed a hypothetical tricked-out Veloster, “made” especally for the Dead good guys (and gals). Options included snow plows, roof mounted machine guns, RPGs, ete, etc. Some day I’ll visit my nearby Hyundai dealer with those pages and see if they’re available! Unfortunately, I don’t see a path to downloading the images.
Y’all missed one. Carl in the prison used a Marlin brush type lever gun to clear zombies.
Sasha Royale says:
Obviously, their society has broken down. There is no indication that they have a large cache of ammunition, without which a Colt Python is a sad club. I’ll take the katana. Reliable and effective against zombies, requiring no ammunition or replacement parts. Fire would also seem a good choice.
The only appeal of the show might be the large volume of violence. Otherwise, it’s kinda dumb.
Since gunfire attracts more walkers, I always thought they should shoot a lot less. I enjoyed Andrea in season three just stabbing and chopping them in the head like they were just a minor nuisance. Where shooting is necessary, I like the idea of keeping them safely far away and conserving scarce ammo. Didn’t Sasha carry a bolt rifle for a while, and appeared to be pretty good with it.
P Lowe says:
And the best weapons seemed to evade them:
Suppressed .22 (silent- tons of ammo)
Spear (because getting close enough to use a knife is ridiculous)
Mongo says:
An AK, because 5 shots are not enough, and why let the Walkers get within pistol range if you don’t have to?
Scott Summers says:
The Walking Dead has never gotten firearms right. First season almost everyone was unarmed, except for a few hunting type guns and a few handguns. Then at the CDC they literally stepped over all the military hardware, ammo, fuel, etc. that surrounded the building. When large numbers of firearms started showing up later most were again “hunting” guns. Then they went to the other extreme and EVERYONE had a full auto rifle! Which of course in proud A Team tradition never really hit any living people, but were deadly accurate on Walkers. Now apparently after a few years all the billions of rounds of existing ammo are used up, even though Eugene knows how to reload, and they are reduced to bows, swords, knives, and impact weapons for the most part?
Best weapon for the Zombie Apocalypse would be a magazine fed .22 rilfe and handgun combo. There are literally trillions of rounds of rimfire out there to be found, .22s work great for headshots, and are easily silenced. Plus everyone could carry enough ammo to take out a Horde at their leisure.
Steven Jonas says:
As a fan of the show, you didn’t mention any knives…Carol carries a badass knife with a brass-knuckle grip. Also, Morgan’s Staff, the Kings Walking Cane Sword…or Jerry’s double-sided Ax. This season you have Aaron’s Spiked Mace-Hand, that even Negan admires. Also the Sling Shots that the 2 sisters use. Cheers!
Edward M Pate says:
I always liked Glenn’s Mosin M44 Carbine. Fires that great 7.62x54R and nice big fireballs out the carbine. Also the attached folding bayonet and nice steel buttplate!
The only weapon that makes any sense in this group, is the katana.
Unless you permanently lived next to a Remington or Winchester ammo factory, and had keys to the same, eventually you would run dry.
If the overwhelming majority of the world population are zombies, there is’t enough stored ammo on the planet to kill them all.
I am constantly amazed that after so many seasons, so many people still have ammo, even in .357 which has not been a police/military or popular civilian round for a lot of years. Not saying it’s not a great round, but if everybody isn’t using a lot of it, factories cut production and load more popular calibers.
I do love the Python (wish I had one)
Smith and Wesson 29 – highly recommended by none other than Dirty Harry Callahan because it will blow their heads clean off.
Time limit exceeded. Please click the reload button and complete the captcha once again. four × = sixteen | cc/2020-05/en_middle_0128.json.gz/line1022 |
__label__cc | 0.612267 | 0.387733 | Dr Brock Chisholm
Home/Dr Brock Chisholm
About Dr Brock Chisholm
Dr Chisholm is highly experienced in assisting people who have faced events such as sexual and physical assaults, accidents, bereavements, domestic violence and traumatic childhoods, as well as with adjustment to life events.
VIDEO: What is Anxiety and how can it be Reduced?
Featuring Dr Brock Chisholm for Doctify
Anxiety is something that many people live with and have to conquer every day. Whether you suffer every so often in times of great stress or whether you feel crippled by it all the time, it can be debilitating. Luckily, there is help to be had. Psychologist Dr Brock Chisholm […]
By Dr Brock Chisholm|2018-07-16T10:34:17+00:00May 14th, 2018|Conditions|Comments Off on VIDEO: What is Anxiety and how can it be Reduced?
VIDEO: An Expert’s Guide to Dealing with the Fallout from Trauma
Hot Topics, Top Articles
The world we live in can feel overwhelming sometimes. Terror attacks, natural disasters and accidents are all sources of trauma and can have a profound effect on mental health.
Doctify Psychologist Dr Brock Chisholm has some advice for those present at traumatic events, their friends and families and those in any way saddened or […]
By Dr Brock Chisholm|2018-07-20T09:46:05+00:00August 18th, 2017|Hot Topics, Top Articles|Comments Off on VIDEO: An Expert’s Guide to Dealing with the Fallout from Trauma
VIDEO: Could you be Working for a Psychopath?
The word psychopath is thrown around a lot these days. For some, it’s how they describe their last Tinder date. Others use the term to apply only to serial killers or movie villains. But what actually is it that constitutes a psychopath?
Here to fill us in on how to spot […]
By Dr Brock Chisholm|2017-08-18T12:32:53+00:00August 4th, 2017|Hot Topics|Comments Off on VIDEO: Could you be Working for a Psychopath?
A Psychologist’s Advice on Dealing with Trauma
Written by Dr Brock Chisholm for Doctify.
The tragedy that occurred at Manchester Arena on Monday evening is one that has rocked, not only the UK, but the world. Our thoughts and prayers are with the families of the 22 people reported dead and the further 59 injured after the attack at pop star Ariana Grande’s […]
By Dr Brock Chisholm|2018-07-20T09:41:00+00:00May 25th, 2017|Hot Topics|Comments Off on A Psychologist’s Advice on Dealing with Trauma | cc/2020-05/en_middle_0128.json.gz/line1024 |
__label__cc | 0.613255 | 0.386745 | Tag Archives: Preeya Kalidas
Relative Values
KHANDAN – family
The REP Studio, Birmingham, Tuesday 27th May, 2014
Gurpreet Kaur Bhatti’s new play is set in the home of an Indian family in Birmingham. At the heart and head of the family, formidable matriarch Jeeto (Sudha Bhuchar) clings to a dream of going ‘home’ to a vista of green fields, viewed from the ancestral verandah. To this end she pushes son Pal (Rez Kempton) to keep the family shop established by her late husband open on Christmas Day, but Pal has other ideas. He wants to sell the shop and set up his own business, a care home for elderly Asians in a refurbished pub. Pal’s wife Liz (Lauren Crace) has been assimilated into the family and is more than happy to adopt the traditional role of the daughter-in-law as live-in domestic help, while Pal’s spirited sister Cookie (Zita Sattar) regrets having married and raised children, as she was expected to. When cousin Reema arrives from India with her own views of independence and fending for herself, the family tensions that have been simmering like the ever-present pan of ‘chai’ boil over.
It’s an involving play, keeping on the right side of soap opera and melodrama, acted and presented naturalistically. Director Roxana Silbert handles the events that put strain on family ties by keeping things simple and straightforward, allowing the characters to spark off each other. The script is very much a conventional one and does not need gimmicks or flashy transitions to dress it up.
Jamie Varton’s set has the audience as three of the walls of the house, giving an intimate setting complete with running tap water and a working gas hob, grounding the play in the realness of its subject matter.
The cast is excellent with Bhuchar and Sattar standing out as mother and daughter with contrasting temperaments. Kempton and Crace also do well in their scenes of marital strife with the latter especially touching as the white girl who left her own family behind for love. Neil D’Souza is good fun as Cookie’s hapless husband, Major, ostensibly a bit of a prat until Pal’s plans go awry, and Preeya Kaludas impresses with her portrayal of Reema’s decline from idealism to destitution.
The spectre (or should that be ‘spirit’?) of alcohol looms large in the family’s past and present, and the notion of Pal trying to establish an Asian care home in an old English pub symbolises the difficulties of trying to graft two cultures together to make something new…
There are some very funny lines, many of which come from salon owner Cookie who is not opening on New Year’s Day because ‘ you can’t do a Brazilian with a hangover.’ There is also a lot of heart and no shortage of tension in this story of family dynamics and the clash between ambition and tradition. You may not understand the odd word or line of Punjabi with which the dialogue is peppered, but you don’t need to. The universal truths of human relationships speak loud and clear.
Dramatically, Khandan is old-fashioned and sturdy but above all it’s an engaging and satisfying evening’s entertainment.
Mother knows best! Sudha Bhuchar and Rez Kempton (photo: Robert Day)
Leave a comment | tags: Gurpreet Kaur Bhatti, Jamie Vartan, Khandan, Lauren Crace, Neil D'Souza, Preeya Kalidas, review, Rez Kempton, Roxana Silbert, Sudha Bhuchar, The REP Birmingham, theatre review, Zita Sattar | posted in Theatre Review | cc/2020-05/en_middle_0128.json.gz/line1026 |
__label__wiki | 0.701688 | 0.701688 | Sherman E. Burroughs
BHS 1961 Alumni
1961 Triva
The cold war continued to worsen with the USSR exploding some very large bombs during testing and then masterminding the building of the Berlin Wall separating East from West Berlin, America sent a battle group to Germany and Americans and Russians Glared at each other across the border, due to this uncertainty many Americans built backyard fallout shelters in case of nuclear war. To make matters worse the Americans financed anti-Castro Cubans for an invasion at the bay of pigs which was an unmitigated disaster. The Soviets put the first man in space in April Yuri Gagarin followed by the US in May with Alan Shepard. Popular music included Chubby Checker’s “Pony Time” and “Will You Love Me Tomorrow” by the Shirelles, and top movies included “West Side Story” and “The Parent Trap.”
UN General Assembly condemns Apartheid
The Antarctic Treaty System comes into force to regulate international relations with respect to Antarctica to ensure that Antarctica shall continue forever to be used exclusively for peaceful purposes
The World Wide Fund for Nature (WWF) started
Estimate of the Worlds Population reaches 4 billion
John F. Kennedy inaugurated as President of the United States
President John F. Kennedy advises American families to build bomb shelters
The Peace Corps is established by John F. Kennedy
Segregation on railways in the south ends
Texas Sales Tax Introduced
The first six flags theme parks opens “Six Flags Over Texas” at Arlington, Texas
“Freedom Riders” test the United States Supreme Court decision Boynton v. Virginia by riding racially integrated interstate buses into the South. Some are attacked and beaten by white supremacist supporters of racial segregation.U.S.
Pampers the first disposable diaper introduced
Britain applies for membership of the EEC
Amnesty International Started in United Kingdom
Members of The UK Portland Spy Ring are found guilty of selling plans of the HMS Dreadnought, Britain’s first nuclear submarine to the Russians
First Direct US Military Involvement in Vietnam
The Xingu National Park is created in Brazil
During the Monza Italian Grand Prix Race Baron Wolfgang von Trips Ferrari crashes off the track onto embankment filled with spectators killing 14 plus the driver.
Members of the Portuguese leftist movement hijack the luxury cruise liner Santa Maria.
Last Journey of The Orient Express Paris - Bucharest
Somalia suffers wide spread flooding after the two main rivers overflowed their banks and merged in a vast flood plain leaving hundreds of thousands homeless.
South Africa becomes an independent republic. | cc/2020-05/en_middle_0128.json.gz/line1027 |
__label__cc | 0.574611 | 0.425389 | This Orphan Will Do Everything It Takes To Make Mum’s Day
by Sharanya Pillai in Good on August 11, 2015
His mother has passed on, but this little boy believes that she is still right next to him, in spirit. It’s her birthday, and he wants to make their meal a memorable one.
The boy goes in search of fire to light up his candle. But everytime he tries to walk back with a lit candle, the fire extinguishes. His morale takes another blow when he accidentally drops the candle.
Eventually, he finds a lit candle and brings it back cautiously, shielding the flame with his body. However, when he returns, a chilling truth awaits.
Watch ‘At the Tip of the Candlewick’ by Brianne Carlo Amparado (The Philippines) on Viddsee:
Brianne’s film was a finalist at the 2014 CineKabalen Kapampangan Film Festival’s Short Film Competition in The Philippines.
Here’s another realistic take on child poverty. Watch ‘Curian’ by Eysham Ali (Singapore), a story of young father and his seven-year-old son struggling to provide for themselves.
Article by Sharanya Pillai in Good on August 11, 2015
Tags: accident, At the Tip of the Candlewick, birthday, Brianne Carlo Amparado, candle, child, death, drama, faith, family, hope, love, mother, poverty, society, the philippines, women
Rape Victim Suffers In Silence, Finds Comfort In An Orphan Girl
Why Do Mums Fuss Over Us In The Little Ways That Mean “I Love You?”
A New Postman’s Delivery Takes A Cold, Twisted Turn
Mums Do Everything For Their Kid’s Happiness. What About Their Needs?
These Kids Tell Their Working Mums What Really Makes Them Happy | cc/2020-05/en_middle_0128.json.gz/line1030 |
__label__cc | 0.576401 | 0.423599 | Dragon Splashes Down in Pacific Ocean
The SpaceX Dragon is pictured seconds before splashing down in the Pacific Ocean. Credit: SpaceX
SpaceX’s Dragon cargo craft splashed down in the Pacific Ocean at 10:46 a.m. EDT, about 200 miles southwest of Long Beach, California, marking the end of the company’s tenth contracted cargo resupply mission to the International Space Station for NASA.
Expedition 50 astronauts Thomas Pesquet of ESA (European Space Agency) and Shane Kimbrough of NASA released the SpaceX Dragon cargo spacecraft from the International Space Station’s robotic arm right on schedule, at 5:11 a.m.
A variety of technological and biological studies are returning in Dragon. The Microgravity Expanded Stem Cells investigation had crew members observe cell growth and other characteristics in microgravity. This information will provide insight into how human cancers start and spread, which aids in the development of prevention and treatment plans. Results from this investigation could lead to the treatment of disease and injury in space, as well as provide a way to improve stem cell production for human therapy on Earth.
Samples from the Tissue Regeneration-Bone Defect study, a U.S. National Laboratory investigation sponsored by the Center for the Advancement of Science in Space (CASIS) and the U.S. Army Medical Research and Materiel Command, studied what prevents vertebrates such as rodents and humans from re-growing lost bone and tissue, and how microgravity conditions affect the process. Results will provide a new understanding of the biological reasons behind a human’s inability to grow a lost limb at the wound site, and could lead to new treatment options for the more than 30 percent of the patient population who do not respond to current options for chronic non-healing wounds.
The Dragon spacecraft launched Feb. 19 on a SpaceX Falcon 9 rocket from historic Launch Complex 39A at NASA’s Kennedy Space Center in Florida, and arrived at the station Feb. 23.
Keep up with the International Space Station, and its research and crew members, at:
www.nasa.gov/station
Get breaking news, images, videos and features from the station on social media at:
https://www.facebook.com/ISS
http://instagram.com/iss
http://www.twitter.com/Space_Station
Author Mark GarciaPosted on March 19, 2017 Categories Expedition 50Tags dragon, European Space Agency, Expedition 50, International Space Station, NASA, Roscosmos, spacex
Previous Previous post: SpaceX Dragon Spacecraft Departs Space Station
Next Next post: Crew Gears Up for Three Spacewalks as Dragon Heads to Port
Crew Works Human Research, CubeSats and Gears Up for Spaceship Departures
Ultra-Cold Science, CubeSats and Spaceship Departures Coming Up
Science Soon Resumes on Cosmic Ray Detector, Crew Packs Cargo Ship for Departure
Astronauts Wrap Up Spacewalk Repair Job on Cosmic Ray Detector
Spacewalkers Finalizing Repairs on Dark Matter, Antimatter Detector
Elaine Hulse on Ultra-Cold Science, CubeSats and Spaceship Departures Coming Up
Mark Garcia on Meir, Koch Complete Battery Swaps to Upgrade Station Power Systems
Mark Garcia on Astronauts Wrap Up Spacewalk Repair Job on Cosmic Ray Detector
Setocasas on Astronauts Wrap Up Spacewalk Repair Job on Cosmic Ray Detector
Commercial Crew
One-Year Crew
Scott Tingle
Space Station National Aeronautics and Space Administration NASA Official: Brian Dunbar | cc/2020-05/en_middle_0128.json.gz/line1041 |
__label__cc | 0.522204 | 0.477796 | The minimally effective dose of sucrose for procedural pain relief in neonates: a randomized controlled trial
Bonnie Stevens1,
Janet Yamada2,
Marsha Campbell-Yeo3,
Sharyn Gibbins4,
Denise Harrison5,
Kimberley Dionne6,
Anna Taddio7,
Carol McNair8,
Andrew Willan9,
Marilyn Ballantyne10,
Kimberley Widger11,
Souraya Sidani12,
Carole Estabrooks13,
Anne Synnes14,
Janet Squires15,
Charles Victor16 &
Shirine Riahi17
Orally administered sucrose is effective and safe in reducing pain intensity during single, tissue-damaging procedures in neonates, and is commonly recommended in neonatal pain guidelines. However, there is wide variability in sucrose doses examined in research, and more than a 20-fold variation across neonatal care settings. The aim of this study was to determine the minimally effective dose of 24% sucrose for reducing pain in hospitalized neonates undergoing a single skin-breaking heel lance procedure.
A total of 245 neonates from 4 Canadian tertiary neonatal intensive care units (NICUs), born between 24 and 42 weeks gestational age (GA), were prospectively randomized to receive one of three doses of 24% sucrose, plus non-nutritive sucking/pacifier, 2 min before a routine heel lance: 0.1 ml (Group 1; n = 81), 0.5 ml (Group 2; n = 81), or 1.0 ml (Group 3; n = 83). The primary outcome was pain intensity measured at 30 and 60 s following the heel lance, using the Premature Infant Pain Profile-Revised (PIPP-R). The secondary outcome was the incidence of adverse events. Analysis of covariance models, adjusting for GA and study site examined between group differences in pain intensity across intervention groups.
There was no difference in mean pain intensity PIPP-R scores between treatment groups at 30 s (P = .97) and 60 s (P = .93); however, pain was not fully eliminated during the heel lance procedure. There were 5 reported adverse events among 5/245 (2.0%) neonates, with no significant differences in the proportion of events by sucrose dose (P = .62). All events resolved spontaneously without medical intervention.
The minimally effective dose of 24% sucrose required to treat pain associated with a single heel lance in neonates was 0.1 ml. Further evaluation regarding the sustained effectiveness of this dose in reducing pain intensity in neonates for repeated painful procedures is warranted.
ClinicalTrials.gov: NCT02134873. Date: May 5, 2014 (retrospectively registered).
Multiple trials and recent systematic reviews with meta-analyses have shown that sweet solutions, including orally administered sucrose, are effective and safe in reducing pain intensity (using clinical observational or composite measures) during single, tissue-damaging procedures in neonates [1, 2]. These solutions are commonly recommended in neonatal pain guidelines [3]. However, there is wide variability in sucrose doses examined in research, and more than a 20-fold variation across neonatal care settings [4]. Despite the large number of randomized controlled trials in the 2016 Cochrane review [2], an optimal dose of sucrose could not be determined due to the wide range of volumes and concentrations (0.05 ml of 24% to 2.0 ml of 50% solution) studied, and due to variation in study methods (e.g., administration techniques, types of painful procedures, outcome measures, and co-interventions). There are no definitive conclusions about the minimally effective dose of sucrose associated with a clinically significant reduction in pain intensity scores in neonates.
To our knowledge, there have been no direct comparisons of different volumes of sucrose at the same concentration. In this study, we evaluated the three smallest doses of sucrose most commonly reported to be effective in previous research (i.e., 0.1 ml, 0.5 ml, and 1.0 ml of 24% sucrose) [2] to determine the minimally effective dose for neonates undergoing a skin-breaking heel lance procedure while in the neonatal intensive care unit (NICU). Doses smaller than 0.1 ml were not included in the study due to challenges posed by accurate measurement and delivery. All neonates received sucrose for procedural pain (i.e., there was no placebo or no-treatment group), which was consistent with neonatal pain guidelines and in keeping with the ethical conduct of clinical trials in newborns [5,6,7]. We hypothesized that (a) there was no difference in pain intensity between the sucrose doses, measured at 30 and 60 s following the heel lance using the Premature Infant Pain Profile-Revised (PIPP-R), and (b) adverse events would be minimal.
A prospective multi-centered single-blind randomized controlled trial was conducted from July 2013–April 2015 at 4 Canadian tertiary NICUs following research ethics approval. The inclusion criteria were neonates 24 to 42 weeks gestational age (GA) at birth and less than 30 days of life/or less than 44 weeks GA at the time of the intervention, scheduled to receive a heel lance, and who had not received opioids within 24 h prior to the heel lance. The exclusion criteria were neonates with a contraindication for sucrose administration (e.g., were too ill or unstable as per neonatologist’s assessment, unable to swallow, pharmacologically muscle relaxed) and/or inability to assess behavioral responses to pain accurately (e.g., the neonate’s face was blocked with taping). We did not use the diagnosis of neurological impairment as an exclusion criterion because the timing of diagnosis and determining the severity of impairment can be very difficult in this population. However, inability to swallow had the effect of excluding neonates with severe neurologic impairment from hypoxic-ischemic encephalopathy. Observation of the procedure was timed to ensure that no additional sucrose doses were provided within the previous 4 h. All parents or legal guardians provided informed consent.
Randomization was performed using a web-based privacy protected randomization service [8]. Randomization was block stratified by GA at birth (< 29 weeks or 29–42 weeks) to enhance balanced intervention groups. A research nurse, aware of group allocation, drew up the assigned sucrose dose into an amber colored syringe. The dose was double-checked by a second nurse, not involved with the study, and documented on the medication administration record as per unit protocol. The research nurse followed a standard dose administration time to blind the bedside nurse performing the heel lance to the sucrose volume. The syringes used to administer sucrose were also shielded from view by the research nurse from the bedside nurse and video recording. No other study personnel had access to the treatment allocation.
The treatment intervention was videotaped and included 4 phases. (a) Baseline observation of the neonate for 2 min prior to the heel lance. (b) Administering the total volume of 24% sucrose [0.1 ml(Group 1), 0.5 ml (Group 2), or 1.0 ml (Group 3)] drop-by-drop via syringe over the anterior surface of the tongue, allowing for individual neonate swallowing rates over a period of 1–2 min (for the largest dose). A pacifier was offered to all neonates immediately following sucrose administration to facilitate non-nutritive sucking, which has been shown to enhance sucrose efficacy in a synergistic way [9]. (c) Conducting the heel lance procedure with an automated lancet approximately 2 min after the sucrose administration, to allow for peak effects [10]. (d) Observation of return-to-baseline pain indicator values over 30 s to several minutes. The bedside nurse conducted the heel lance according to the specific unit policy, while the research nurse experienced in NICU care ensured complete data collection.
We did not limit participating neonates from receiving other pain-relieving parent-initiated interventions (e.g., skin-to-skin/kangaroo care and breastfeeding) [11] as per unit protocols. These were documented by the research nurse, so any group differences could be controlled for in the analysis. Pharmacological interventions shown to be ineffective in reducing heel lance pain (e.g., acetaminophen) [12] were not administered.
The primary outcome was pain intensity measured with the PIPP-R [13, 14], which has demonstrated construct validity in neonates of varying GA [13,14,15]. The PIPP-R includes 2 physiological (heart rate, oxygen saturation), 3 behavioral (brow bulge, eye squeeze, nasolabial furrow) and 2 contextual (GA, behavioral state) variables known to modify pain responses. Throughout the treatment intervention, physiological and behavioral/facial indicators of pain intensity were collected using an infant monitoring system developed and used extensively by the research team over the past decade. The research nurse placed pulse oximetry probes on the neonate to record heart rate and oxygen saturation continuously, and positioned a digital video recorder to capture facial movements. Electronic event markers synchronized all physiological and behavioral data, and demarcated the 4 phases of the treatment intervention.
Two trained coders, blinded to group allocation and study purpose, viewed the physiological and behavioral data captured by the infant monitoring system, and coded neonates’ pain intensity using the PIPP-R. An inter-rater reliability > 0.9 was achieved on a random sample of 5 neonates, early in the study and with each 25% of data collected.
The secondary outcome was frequency of a priori specified adverse event/tolerance criteria (heart rate > 240 beats/min or heart rate < 80 beats/min for > 20 s; oxygen saturation < 80% for > 20 s; no spontaneous respirations for > 20 s; and choking/gagging). Adverse event data were collected by the research nurse during the intervention. The research nurse kept a record of ‘rescue doses’ administered (i.e., additional doses of sucrose given on direction of the nurse caring for the neonate, if the neonate became overly distressed during the procedure).
We estimated a sample size of 71 neonates per group (total sample size of 213). The sample size calculation accounts for multiple testing due to 3 intervention groups, and is based on a type I error probability of 5%, a power of 80%, and a smallest minimally clinically significant difference of 1 on the PIPP-R with a standard deviation (SD) of 2. Consistent with previous research, this minimally clinically significant difference was justifiable given the lack of a treatment control in this study versus preceding studies [16]. To account for potential missing data (e.g., equipment failure), we increased the sample size by 15% to 245. Analysis of covariance models adjusting for GA and study site examined between group differences in PIPP-R scores.
Randomization and demographic characteristics
The trial profile is presented in Fig. 1. Of the 4172 neonates screened for eligibility, 248 were enrolled and randomly allocated to Group 1, 2 or 3. Three neonates were excluded following randomization, as they did not undergo a heel lance, leaving 245 for the outcomes analyses. Demographic characteristics in all 3 groups were adequately matched (Table 1). These included GA at birth, days since birth, birth weight, sex, severity of illness assessed using the Score for Neonatal Acute Physiology Perinatal Extension-II (SNAPPE-II) [17, 18], number of prior painful procedures, number of previous doses of sucrose, and concurrent use of non-pharmacologic pain strategies. As standard care in each unit included parent-initiated non-pharmacologic strategies (e.g., swaddling, skin-to-skin/kangaroo care, and breastfeeding) we could not ethically disallow these interventions during the painful procedure. However, there was no difference in the use of parent-initiated pain strategies across groups (Table 1). All neonates were offered a pacifier for non-nutritive sucking following sucrose administration. Overall 204/ 245 (83.2%) sucked on the pacifier, while the remainder refused or did not receive the pacifier due to medical considerations (e.g., intubated, or not tolerated well). We noted a discrepancy between the number of painful procedures documented and the number of sucrose doses documented since birth. Information on non-pharmacologic interventions was often not available in the neonates’ medical records; therefore, it was difficult to discern if the discrepancy was an administration or documentation issue.
Consort flow diagram of all neonates in participating NICUs screened for eligibility and randomized to sucrose intervention groups. Reasons for exclusion included not meeting inclusion criteria, refusals to participate, and other reasons [e.g., exclusion criteria, medical refusal (palliative care, social issues, and multiple research studies), isolation precautions, and researcher or parents unavailable for consent discussion]
Table 1 Demographic characteristics of the sucrose intervention groups
Pain intensity
The mean pain intensity [SD] PIPP-R scores at 30 s post heel lance (Group 1 6.8[3.5]; Group 2 6.8[3.2]; Group 3 6.7[3.4]) were not statistically different after adjusting for GA and research site (F[6233] = 0.01, P = .97; Table 2). Similarly, there were no significant differences in mean PIPP-R scores between groups at 60 s (F [2229] = 0.10, P = .93; Table 2). Mean pain intensity PIPP-R scores at 30 and 60 s were inversely associated with GA (P < .001) and significantly different when stratified by site (P < .001; Table 3); therefore both factors were controlled for in the analysis. Mean PIPP-R scores ranged from 6.03 (3.37) for neonates > 36 weeks GA to 9.07 (4.00) for neonates < 28 weeks GA at 30 s and 5.70 (3.31) for neonates > 36 weeks GA to 9.43 (4.04) for neonates < 28 weeks GA. No associations were found between pain intensity scores and other demographic characteristics [i.e., SNAPPE-II/ severity of illness on admission, gender, concurrent use of non-pharmacologic pain strategies (e.g. breastfeeding and skin-to-skin care), and number of painful procedures and sucrose doses since birth; Table 3]. Pain intensity scores across the 3 groups equated to mild pain for the majority of neonates (scores of < 7 on the PIPP-R; Table 4).
Table 2 Mean pain intensity scores at 30s and 60s post heel lance
Table 3 Association of mean pain intensity scores with site and demographic characteristics
Table 4 Frequency of pain intensity scores by severity at 30s and 60s post heel lance
Adverse events and rescue doses
There were 5 reported adverse events among 5/245 (2.0%) neonates as defined by the a priori criteria. These events included 3 neonates who gagged/choked, 1 with heart rate < 80 bpm and 1 with oxygen saturation < 80% following sucrose administration. All events resolved spontaneously without medical intervention. The neonate who experienced oxygen saturation < 80%, was repositioned and recovered quickly. There were no significant differences in the proportion of adverse events by sucrose group (P = .62); however, a higher proportion of younger neonates experienced an adverse event (6.7% < 29 weeks versus 1.0% 29–42 weeks; P = .044).
In 13/245 (5.3%) neonates, the bedside nurse perceived that the intervention was not effective in minimizing pain during the procedure, and the research nurse (at the discretion of the bedside nurse) administered a “rescue” dose of sucrose (amount determined by the unit standard/policy). There was no significant difference in the number of rescue doses by sucrose group (P = .33), site (P = .070), or GA (P = .47).
Oral administration of a very small dose of sucrose (0.1 ml) appears to be equally effective at reducing pain in neonates during a single painful procedure as larger doses. Sucrose administration in the clinical setting was associated with very few adverse events. This trial was more closely aligned with a pragmatic design on the continuum between pragmatic and exploratory trials [19]. Unlike explanatory trials that test interventions under optimal conditions, pragmatic trials are more generalizable; however, they are also more prone to co-intervention.
Although site was controlled for in the primary outcome analyses, there was a difference in PIPP-R scores across sites (Table 3) that may be partially explained by organizational contextual factors that were not controlled for or assessed in the analyses. For example, although we enrolled neonates in the first 30 of days of life and collected information on exposure to painful procedures and sucrose received since birth, it is possible that sucrose administration and documentation practices differed due to clinical practice guidelines or organizational contextual factors (e.g., workload/staff ratios, unit culture, and the research or clinical experience of the bedside nurses) [20]. We also found higher pain scores were associated with more preterm neonates (P < .001; Table 3) and they experienced a slightly greater proportion of adverse events (3 versus 2 in neonates > 29 weeks GA), although total numbers were very small. Despite higher pain scores with lower GA, there was no difference in the number of rescue doses across GA, which might be explained by site differences in sucrose administration practices.
We could think of two possible explanations for why PIPP-R scores were significantly higher in the least mature group of neonates: (a) the PIPP-R measure inherently scores younger GA higher, or b) sucrose is less effective in these babies (e.g., they are less able to mount an endogenous opioid response that is the underlying mechanism of action of sweet taste [21]). Differences seen in mean pain intensity were not thought to be due to additional weighting in the PIPP-R measure by GA [< 28 weeks (+ 3), 28–31 weeks and 6 days (+ 2), 32 weeks to 35 weeks and 6 days (+ 1), and ≥ 36 weeks (0)], as there were no corresponding incremental differences seen by GA group. In terms of the latter explanation (b), this needs to be further researched with an adequate sample size of extremely premature neonates (< 28 weeks GA).
Our findings are consistent with past research (primarily in animals) that demonstrated that the analgesic effects of sucrose were primarily mediated by exposure and not dose [10, 22]. Although there was no difference in pain intensity at 30 and 60 s, pain was not fully eliminated during the heel lance procedure. Mean pain intensity scores equated to mild pain (Table 2), or approximately 3/10 if converted to the more common 10-point scale metric. As pain intensity was measured on a continuum, and treatment failure was not defined, the incidence of treatment failure was not determined. However, severe pain could definitely be considered a treatment failure and this occurred in 7.5 to 11.3% of neonates (Table 4) across sucrose doses. These results are similar to systematic reviews of other behavioral interventions, including breastfeeding [23] and skin-to-skin care [24]. Given that the majority of previous studies have used a single procedure, it is uncertain if the wide variably in neonatal pain response is attributed to the intervention or other factors which remain unknown [25]. Future work in the repeated use of interventions is warranted. In the meantime, we would recommend that if the initial dose of sucrose does not appear to be ameliorating the pain that additional rescue doses be provided during the procedure up to a specified amount. We would also recommend that multiple non-pharmacologic strategies be implemented simultaneously including swaddling, facilitated tucking, skin-to-skin/kangaroo care, breastfeeding, and/ or pacifiers.
Knowledge is lacking on the long-term effects of sucrose with repeated administration. Of the studies that have evaluated repeated doses of sucrose [26,27,28,29,30], none have evaluated long-term outcomes of using sucrose for all painful procedures performed throughout the neonate’s stay in the NICU. Johnston [26, 31] reported that 107 preterm infants < 31 weeks GA who were exposed to > 10 doses of sucrose per day in the first 7 days of life, after which time no pain relief was used, were more likely to exhibit poorer attention and motor development on the Neurobehavioral Assessment of Preterm Infants (NAPI) scale in the early months of life. Conversely, Banga [32] reported that of 93 neonates randomized to either repeated doses of sucrose or water for painful procedures for 7 consecutive days, there were no significant differences in NAPI scores or adverse events. Stevens [27] found no statistically significant differences between sucrose plus pacifier, water plus pacifier, or the standard care group on neurobiological risk status outcomes. Future research needs to address the repeated use of minimally effective doses of sucrose on the neurodevelopment of neonates and effectiveness over time.
Approximately 2% of neonates suffered adverse events. These all resolved spontaneously without medical intervention or with minimal caregiver intervention (e.g. positioning). Most adverse events occurred at one site, where the highest proportion of the sickest neonates is cared for, although this is not represented in the study sample. This adverse event rate is consistent with the 2016 Cochrane sucrose review [2]. Although researchers are becoming more vigilant in observing and reporting adverse events, it remains unclear how adverse events are reported (i.e., chart review is considerably different from careful direct observation of every newborn infant who is receiving the intervention).
A few study limitations need mention. Pain intensity did not differ significantly between the 30 and 60-s time points. Although these time intervals have been used in multiple research studies of acute procedural pain, they are arbitrary and designed based on mean behavioral response time; observing neonates for longer periods of time may demonstrate additional responses of less typical responders or other types of responses (e.g. physiologic, cortical). Although there has been significant validation and updating of the PIPP-R measure, there remains no gold standard for measuring pain in infants that may influence the determination of the effectiveness (or lack thereof) of pain relieving interventions. The future, which includes novel strategies for better understanding of the developing cortical pain circuitry, will pave the way for better prevention and treatment of pain in this vulnerable population.
Finally, we were limited by the documentation in the medical records, which may not have included all pain relieving strategies such as sucrose and non-pharmacologic interventions. Although we believe infants should receive some form of intervention for all painful procedures, it is difficult to speculate on whether the discrepancy between number of documented painful procedures and pain-relieving interventions is an administration or documentation issue. As the number of painful procedures included since birth was extensive (e.g., tape removals, bloodwork, injections, vascular access attempts/insertions, NG/OG tube insertions and suctioning, chest tube attempts/insertions, lumbar punctures, eye exams, and urinary catheterizations), it is possible oral sucrose is not routinely administered for each of these types of procedures, depending on unit standards/practices.
No difference in pain intensity was shown among 3 doses of sucrose during an acute tissue-damaging procedure in hospitalized neonates. The 0.1 ml of 24% sucrose dose was the minimally effective dose that can be recommended for use out of the 3 doses most commonly reported to be effective in previous research. Subsequent study is required to determine the sustained effectiveness of this dose in reducing pain intensity during painful procedures neonates experience in the NICU over time and across GA, and the long-term effects of cumulative sucrose use.
GA:
NAPI:
Neurobehavioral assessment of preterm infants
NICU:
PIPP-R:
Premature infant pain profile-revised
SNAPPE-II:
Score for neonatal acute physiology perinatal extension- II
Bueno M, Yamada J, Harrison D, Khan S, Ohlsson A, Adams-Webber T, et al. A systematic review and meta-analyses of nonsucrose sweet solutions for pain relief in neonates. Pain Res Manage. 2013;18(3):153–61.
Stevens B, Yamada J, Ohlsson A, Haliburton S, Shorkey A. Sucrose for analgesia in newborn infants undergoing painful procedures. Cochrane Database Syst Rev. 2016;7(7):CD001069.
Lee GY, Yamada J, Kyololo O, Shorkey A, Stevens B. Pediatric clinical practice guidelines for acute procedural pain: a systematic review. Pediatrics. 2014;133(3):500–15.
Taddio A, Yiu A, Smith RW, Katz J, McNair C, Shah V. Variability in clinical practice guidelines for sweetening agents in newborn infants undergoing painful procedures. Clin J Pain. 2009;25(2):153–5.
Bellieni CV, Johnston CC. Analgesia, nil or placebo to babies, in trials that test new analgesic treatments for procedural pain. Acta Paediatr. 2016;105(2):129–36.
Campbell-Yeo M. ‘First, do no harm’--the use of analgesia or placebo as control for babies in painful clinical trials. Acta Paediatr. 2016;105(2):119–20.
Harrison D, Bueno M, Yamada J, Adams-Webber T, Stevens B. Analgesic effects of sweet-tasting solutions for infants: current state of equipoise. Pediatrics. 2010;126(5):894–902.
Randomize.net. A comprehensive internet-based randomization service for clinical trials. http://www.randomize.net (2015). Accessed 11 Apr 2017.
Stevens B, Johnston C, Franck L, Petryshen P, Jack A, Foster G. The efficacy of developmentally sensitive interventions and sucrose for relieving procedural pain in very low birth weight neonates. Nurs Res. 1999;48(1):35–43.
Blass EM, Shide DJ. Some comparisons among the calming and pain-relieving effects of sucrose, glucose, fructose and lactose in infant rats. Chem Senses. 1994;19(3):239–49.
Pillai Riddell RR, Racine NM, Gennis HG, Turcotte K, Uman LS, Horton RE, et al. Non-pharmacological management of infant and young child procedural pain. Cochrane Database Syst Rev. 2015;(12):Cd006275.
Ohlsson A, Shah PS. Paracetamol (acetaminophen) for prevention or treatment of pain in newborns. Cochrane Database Syst Rev. 2015;(6):Cd011219.
Gibbins S, Stevens BJ, Yamada J, Dionne K, Campbell-Yeo M, Lee G, et al. Validation of the premature infant pain profile-revised (PIPP-R). Early Hum Dev. 2014;90(4):189–93.
Stevens BJRNP, Gibbins SRNP, Yamada JRNP, Dionne KRNMN, Lee GRNM, Johnston CRNDF, et al. The premature infant pain profile-revised (PIPP-R): initial validation and feasibility. Clin J Pain. 2014;30(3):238–43.
Lee GY, Stevens BJ. Neonatal and infant pain assessment. In: McGrath PJ, Stevens BJ, Walker SM, Zempsky WT, editors. Oxford textbook of paediatric pain. 1st ed. Oxford: Oxford University Press; 2014. p. 353–69.
Campbell-Yeo ML, Johnston CC, Joseph KS, Feeley N, Chambers CT, Barrington KJ. Cobedding and recovery time after heel lance in preterm twins: results of a randomized trial. Pediatrics. 2012;130(3):500–6.
Harsha SS, Archana BR. SNAPPE-II (score for neonatal acute physiology with Perinatal extension-II) in predicting mortality and morbidity in NICU. J Clin Diagn Res. 2015;9(10):Sc10–2.
Richardson DK, Corcoran JD, Escobar GJ, Lee SK. SNAP-II and SNAPPE-II: simplified newborn illness severity and mortality risk scores. J Pediat. 2001;138(1):92–100.
Patsopoulos NA. A pragmatic view on pragmatic trials. Dialogues Clin Neurosci. 2011;13(2):217–24.
Estabrooks CA, Squires JE, Hutchinson AM, Scott S, Cummings GG, Kang SH, et al. Assessment of variation in the Alberta context tool: the contribution of unit level contextual factors and specialty in Canadian pediatric acute care settings. BMC Health Ser Res. 2011;11(1):1.
Johnston CC, Fillion F, Campbell-Yeo M, Goulet C, Bell L, McNaughton K, Byron J, Aita M, Finley GA, Walker CD. Kangaroo mothercare diminishes pain from heel lance in very preterm neonates: a crossover trial. BMC Pediatr. 2008;8(1):13.
Anseloni VC, Weng HR, Terayama R, Letizia D, Davis BJ, Ren K, et al. Age-dependency of analgesia elicited by intraoral sucrose in acute and persistent pain models. Pain. 2002;97(1–2):93–103.
Shah PS, Herbozo C, Aliwalas LL, Shah VS. Breastfeeding or breast milk for procedural pain in neonates. Cochrane Database Syst Rev. 2012;12:Cd004950.
Johnston C, Campbell-Yeo M, Fernandes A, Inglis D, Streiner D, Zee R. Skin-to-skin care for procedural pain in neonates. Cochrane Database Syst Rev. 2014;(1):Cd008435.
Cignacco E, Denhaerynck K, Nelle M, Buhrer C, Engberg S. Variability in pain response to a non-pharmacological intervention across repeated routine pain exposure in preterm infants: a feasibility study. Acta Paediatr. 2009;98(5):842–6.
Johnsston CC, Filion F, Snider L, Majnemer A, Limperopoulos C, Walker CD, et al. Routine sucrose analgesia during the first week of life in neonates younger than 31 weeks’ postconceptional age. Pediatrics. 2002;110(3):523-8.
Stevens B, Yamada J, Beyene J, Gibbins S, Petryshen P, Stinson J, et al. Consistent management of repeated procedural pain with sucrose in preterm neonates: is it effective and safe for repeated use over time? Clin J Pain. 2005;21(6):543–8.
Gaspardo CM, Miyase CI, Chimello JT, Martinez FE, Martins Linhares MB. Is pain relief equally efficacious and free of side effects with repeated doses of oral sucrose in preterm neonates? Pain. 2008;137(1):16–25.
Taddio A, Shah V, Atenafu E, Katz J. Influence of repeated painful procedures and sucrose analgesia on the development of hyperalgesia in newborn infants. Pain. 2009;144(1–2):43–8.
Harrison D, Loughnan P, Manias E, Gordon I, Johnston L. Repeated doses of sucrose in infants continue to reduce procedural pain during prolonged hospitalizations. Nurs Res. 2009;58(6):427–34.
Johnston CC, Filion F, Snider L, Limperopoulos C, Majnemer A, Pelausa E, et al. How much sucrose is too much sucrose? Pediatrics. 2007;119(1):226.
Banga S, Datta V, Rehan HS, Bhakhri BK. Effect of sucrose analgesia, for repeated painful procedures, on short-term neurobehavioral outcome of preterm neonates: a randomized controlled trial. J Trop Pediat. 2016;62(2):101–6.
Thank you to the research nurses who collected data at each site: KC, BG, MP, JR and JW; the research database manager: VK; and the neonatal intensive care units that agreed to participate.
Supported by the Canadian Institutes of Health Research (MOP-126167). All study sucrose and supplies were purchased through grant funds. The funder had no role in the design and conduct of the study; collection, management, analysis, and interpretation of the data; preparation, review, or approval of the manuscript; and decision to submit the manuscript for publication.
The Hospital for Sick Children, Lawrence S. Bloomberg Faculty of Nursing, University of Toronto, 686 Bay Street, Toronto, Ontario, M5G 0A4, Canada
Bonnie Stevens
Daphne Cockwell School of Nursing, Ryerson University, 350 Victoria Street, Toronto, Ontario, M5B 2K3, Canada
Janet Yamada
School of Nursing and Departments of Pediatrics, Psychology, and Neuroscience, Dalhousie University, IWK Health Centre, Forrest Building, P.O. Box 15000, Halifax, Nova Scotia, B3H 4R2, Canada
Marsha Campbell-Yeo
Trillium Health Partners, 100 Queensway West, Mississauga, Ontario, L5B 1B8, Canada
Sharyn Gibbins
Faculty of Health Sciences, School of Nursing, University of Ottawa, Children’s Hospital of Eastern Ontario, Research Institute, 451 Smyth Road, Ottawa, Ontario, K1H 8M5, Canada
Denise Harrison
The Hospital for Sick Children, 686 Bay Street, Toronto, Ontario, M5G 0A4, Canada
Kimberley Dionne
The Hospital for Sick Children, Leslie Dan Faculty of Pharmacy, University of Toronto, 686 Bay Street, Toronto, Ontario, M5G 0A4, Canada
Anna Taddio
Carol McNair
The Hospital for Sick Children, Dalla Lana School of Public Health, University of Toronto, 686 Bay Street, Toronto, Ontario, M5G 0A4, Canada
Andrew Willan
Holland Bloorview Kids Rehabilitation Hospital, Lawrence S. Bloomberg Faculty of Nursing, University of Toronto, 150 Kilgour Road, Toronto, Ontario, M4G 1R8, Canada
Marilyn Ballantyne
The Hospital for Sick Children, Lawrence S. Bloomberg Faculty of Nursing, University of Toronto, 155 College Street, Suite 130, Toronto, Ontario, M5T 1P8, Canada
Kimberley Widger
Souraya Sidani
Faculty of Nursing, University of Alberta, 3-141 Edmonton Clinic Health Academy, 11405 87 Avenue, Edmonton, Alberta, T6G 1C9, Canada
Carole Estabrooks
Division of Neonatology, Department of Pediatrics, University of British Columbia, 2D19-4480 Oak Street, Vancouver, British Columbia, V6H 4V4, Canada
Anne Synnes
Faculty of Health Sciences, School of Nursing, University of Ottawa, Ottawa Hospital Research Institute, 451 Smyth Road, Ottawa, Ontario, K1H 8M5, Canada
Janet Squires
Institute for Clinical Evaluative Sciences (ICES), The Institute of Health Policy, Management and Evaluation, University of Toronto, Veterans Hill Trail, 2075 Bayview Avenue G1 06, Toronto, Ontario, M4N 3M5, Canada
Charles Victor
Shirine Riahi
Search for Bonnie Stevens in:
Search for Janet Yamada in:
Search for Marsha Campbell-Yeo in:
Search for Sharyn Gibbins in:
Search for Denise Harrison in:
Search for Kimberley Dionne in:
Search for Anna Taddio in:
Search for Carol McNair in:
Search for Andrew Willan in:
Search for Marilyn Ballantyne in:
Search for Kimberley Widger in:
Search for Souraya Sidani in:
Search for Carole Estabrooks in:
Search for Anne Synnes in:
Search for Janet Squires in:
Search for Charles Victor in:
Search for Shirine Riahi in:
The authors have read and given final approval for this version to be published, and take full responsibility for the work. Each meets the criteria set out by ICMJE for authorship. BS and CV had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. Study design and concept: BS, MB, MCY, KD, CE, SG, DH, CM, SS, JS, AS, AT, CV, KW, AW, and JY. Management, analysis, and interpretation of data: BS, MCY, SG, DH, CM, SR, AT, CV, KW, and JY. Preparation, review, or approval of the final manuscript: BS, MB, MCY, KD, CE, SG, DH, CM, SR, SS, JS, AS, AT, CV, KW, AW, and JY. Statistical analysis: CV. Obtained funding: BS, MB, MCY, KD, CE, SG, DH, CM, SS, JS, AS, AT, CV, KW, AW, and JY. Administrative, technical, or material support: BS and CV. Study supervision: BS, MCY, KD, SG, DH, and JY. All authors read and approved the final manuscript.
Correspondence to Bonnie Stevens.
This study was approved by the Research Ethics Boards at The Hospital for Sick Children (1000038052), Sunnybrook Health Sciences Centre (354–2013), IWK Health Centre (1013855), The Ottawa Hospital (20130327-01H), and Children’s Hospital of Eastern Ontario (13/12E). Informed written consent was obtained from a parent prior to study enrollment.
Stevens, B., Yamada, J., Campbell-Yeo, M. et al. The minimally effective dose of sucrose for procedural pain relief in neonates: a randomized controlled trial. BMC Pediatr 18, 85 (2018). https://doi.org/10.1186/s12887-018-1026-x
Adverse event
Heel lance
PIPP-R
Preterm infants | cc/2020-05/en_middle_0128.json.gz/line1047 |
__label__cc | 0.744972 | 0.255028 | Pepe Karmel
PEPE KARMEL is a Associate Professor of Art History at New York University, New York.
Three Crises
By Pepe Karmel
It seems to me that there are at least three crises in contemporary art criticism: first, a perceived marginalization; second, a loss of intellectual moorings following on the disappearance of the avant-garde; third, a dawning recognition of the inadequacy of conventional taste.
Ad Reinhardt: Unvirtual Images
Like a procession of Japanese monks with black robes and shaven heads, the 13 late paintings by Ad Reinhardt circle a large white room at David Zwirner Gallery. | cc/2020-05/en_middle_0128.json.gz/line1054 |
__label__cc | 0.739607 | 0.260393 | How do I Buy U.S. Saving Bonds?
by Kathryn Hatter
The Treasury Department stopped selling paper bonds on January 1, 2012.
If you’re looking for a safe investment, U.S. savings bonds might fit the bill. U.S. savings bonds are backed by the full faith and credit of the U.S. government, which means you don't have to worry much about the bond issuer defaulting. In addition, you can earn interest on your investment and don't have to pay state or local taxes on the interest. There are a couple different ways to buy U.S. savings bonds.
Electronic Savings Bonds
You can purchase Series EE U.S. savings bonds or Series I bonds electronically by opening an account with TreasuryDirect on its website. You will need to provide your Social Security number, U.S. address, the routing and account numbers for a checking or savings account, and an email address. Select “individual” for the type of account and enter your information in the blanks on the application. When the information is complete, you will submit the application. Next, choose a password and answer three security questions, and you will receive your TreasuryDirect account number. Log in to your account and buy a savings bond by navigating through the purchase process. TreasuryDirect will place the electronic bond directly into your account, where you can monitor its value.
Standard Paper Savings Bonds
As of Jan. 1, 2012, you can no longer buy paper savings bonds over-the-counter at financial institutions. The move was made as a way of saving money, and the Treasury Department estimates that it will save an estimated $70 million over five years. However, there are ways to still buy paper bonds through different channels.
Tax Refund Bonds
If you’ve got your heart set on paper bonds, the Internal Revenue Service has a solution for you. If you’re getting a tax refund, you can choose to receive all or part of your refund as a paper Series I savings bond when you file your income tax return. To do this, file Form 8888 with your income tax return. You can buy up to $5,000 worth of bonds in $50 increments. If you choose not to spend your entire refund on bonds, you can still get part of it back via a check or have it deposited electronically in a bank account. The IRS forwards your request for savings bonds to the Treasury Retail Securities Site. After that, it takes up to three weeks to send your bonds to the address on your tax return.
You can also buy savings bonds as gifts. To do this, you will need to know your recipient’s full name and Social Security number. Log in to your TreasuryDirect account and enter the recipient’s information as the bond owner. You can either enter the recipient’s TreasuryDirect account number to receive the bond or you can hold it in your own account as a gift. You can even print a gift certificate for your recipient.
U.S. Securities and Exchange Commission: Savings Bonds
U.S. Department of the Treasury: Buy Savings Bonds
IRS.gov: Now you Can Buy U.S. Series I Savings Bonds for Anyone With your Tax Refund
TreasuryDirect: Open an Account
TreasuryDirect: Give the Gift of Savings
Kathryn Hatter is a veteran home-school educator, as well as an accomplished gardener, quilter, crocheter, cook, decorator and digital graphics creator. As a regular contributor to Natural News, many of Hatter's Internet publications focus on natural health and parenting. Hatter has also had publication on home improvement websites such as Redbeacon.
How Do I Buy Paper Savings Bonds From the Federal Reserve Bank?
How to Find Savings Bond Serial Numbers if Bonds Have Been Destroyed
How to Start a College Bond for an Unborn Child
What Is an F-Series Bond?
How to Calculate Interest on U.S. Savings Bonds
How Do I Calculate the Value of a $200 Savings Bond?
Can I Cash My Savings Bond at a Post Office?
How Do I Find Out What My Bonds Are Worth?
How to Choose U.S. Saving Bonds
What Kind of Savings Bond Do You Buy a Newborn?
How to Buy Savings EE Bonds
Can US Savings Bonds Be Purchased Without Refund Money?
How to Find the Status of a WWII Bond
How to Purchase Premium Bonds
How to Find Out the Value of a U.S. Savings Bond
How to Calculate the Unamortized Bond Premium | cc/2020-05/en_middle_0128.json.gz/line1055 |
__label__cc | 0.546954 | 0.453046 | US Census Bureau, Department ...
TIGER/Line Shapefile, 2014, county, Catoosa County, GA, Linear Hydrography County-based Shapefile
Metadata Updated: October 31, 2014
The TIGER/Line shapefiles and related database files (.dbf) are an extract of selected geographic and cartographic information from the U.S. Census Bureau's Master Address File / Topologically Integrated Geographic Encoding and Referencing (MAF/TIGER) Database (MTDB). The MTDB represents a seamless national file with no overlaps or gaps between parts, however, each TIGER/Line shapefile is designed to stand alone as an independent data set, or they can be combined to cover the entire nation.
Linear Water Features includes single-line drainage water features and artificial path features that run through double-line drainage features such as rivers and streams, and serve as a linear representation of these features. The artificial path features may correspond to those in the USGS National Hydrographic Dataset (NHD). However, in many cases the features do not match NHD equivalent feature and will not carry the NHD metadata codes. These features have a MAF/TIGER Feature Classification Code (MTFCC) beginning with an "H" to indicate the super class of Hydrographic Features.
Collection TIGER/Line Shapefile, 2014, Series Information File for the Linear Hydrography County-based Shapefiles
Linear Water Features includes single-line drainage water features and...
TGRSHP (compressed)
tl_2014_13047_linearwater.zip
2014 (publication)
Harvested from 2014 Linear Hydrography
county or equivalen...
linearfeature
Access Constraints: None, Use Constraints:The TIGER/Line Shapefile products are not copyrighted however TIGER/Line and Census TIGER are registered trademarks of the U.S. Census Bureau. These products are free to use in a product or publication, however acknowledgement must be given to the U.S. Census Bureau as the source. The horizontal spatial accuracy information present in these files is provided for the purposes of statistical analysis and census operations only. No warranty, expressed or implied is made with regard to the accuracy of the spatial accuracy, and no liability is assumed by the U.S. Government in general or the U.S. Census Bureau, specifically as to the spatial or attribute accuracy of the data. The TIGER/Line Shapefiles may not be suitable for high-precision measurement applications such as engineering problems, property transfers, or other uses that might require highly accurate measurements of the earth's surface.Coordinates in the TIGER/Line shapefiles have six implied decimal places, but the positional accuracy of these coordinates is not as great as the six decimal places suggest.
ea3b6876-0941-4448-8b89-3b208f050115
tl_2014_13047_linearwater.shp.xml
62bd30f2-6438-4a7f-8fe0-98f1186b7fe2
dd9a68b9-a8e3-4af8-b20c-4d6608965ab7
2014 Linear Hydrography
US Census Bureau, Department of Commerce
The Census Bureau's mission is to serve as the leading source of quality data about the nation's people and economy. We honor privacy, protect confidentiality, share our... read more | cc/2020-05/en_middle_0128.json.gz/line1057 |
__label__wiki | 0.656968 | 0.656968 | Home Catholic School News Prayers and support for those who protect and serve
Prayers and support for those who protect and serve
Mary Beth Peabody
Police and emergency vehicles, cars and school buses poured into the parking lot at Saint Agnes Church, Our Lady of Hope Parish, for the annual Blue Mass Sept. 27. Horses and service dogs (and their keepers) greeted the guests, and a large flag of the United States strung between two fire truck ladders waved high above a grand statue of Jesus, across a cloudless blue sky. The setting may have been mistaken for an outdoor festival, but the reverence inside the church told a different story.
Local law enforcement officers, firefighters and first responders salute during the Pledge of Allegiance at the 18th annual Diocesan Blue Mass. Bishop Dennis Sullivan was the celebrant of the Mass Sept. 27 at Saint Agnes Church, Our Lady of Hope Parish, Blackwood. Photo by Alan M. Dumoff
Father Joseph T. Szolack, pastor of Our Lady of Hope Parish, distributes Communion. Photo by Mary McCusker
The service started with a cadenced procession and posting of flags, followed by the singing of “The Star Spangled Banner.” Pipes and drums reverberated throughout the full church. Attendees were asked to “uncover,” and a sea of hats were removed so Mass could begin.
Ava McCarthy of Saint John Paul II School, Stratford, stands with her father, Lindenwold Police Capt. Michael McCarthy.
Bishop Dennis Sullivan greeted the congregation, offering a special welcome to visitors of other faiths. “No matter your religion, thank you for being here,” he said to the men and women in uniform. He also thanked the nearly 500 uniformed students for their presence.
“It was a great experience,” said eighth grader Delaney Dougherty from Good Shepherd Regional School in Collingswood. We got to honor police and other officers. There was special music, like ‘Amazing Grace’ on bagpipes, and the deacon gave a great homily.”
She specifically referenced a point in Deacon Aaron Smith’s homily when he said, “No cop wakes up wanting to fire their weapon at another human being, but we also know that there may come a time our weapon is necessary to protect ourselves and others.”
An active law enforcement officer, husband and the father of two children, Deacon Smith is assigned to Saint Bridget University Parish in Glassboro. He was invited by Bishop Sullivan to deliver the homily.
Deacon Smith began by remembering Father Mychal Judge, the New York City Fire Department chaplain who was killed by falling debris as he tried to save others in the World Trade Center attack on Sept. 11, 2001. Just a day before, Father Judge had preached about never knowing from one day to the next what you will be asked to do as a responder.
“It’s a tough job for sure, and a job that the community needs us to do well, and a job God calls us to do well, one contact at a time,” said Deacon Smith. To his fellow officers and responders he said, “God hears his people. Sometimes, God answers those prayers through your voice over the radio when you respond, ‘10-4, in route, ETA two minutes.’ Always honor that badge, whether it says Police, Fire or EMS. It represents the trust that both God and the community puts in your hands.”
At the end of the service, a single bell tolled for each local police officer, fire fighter and emergency medical responder who died during the past year. Special tribute was paid to retired Sgt. Richard Desmond from the Camden County Police Department, who died in January 2019. A Blue Mass committee member, Desmond was founder and drum major for the Camden County Emerald Society, one of the pipe and drum bands represented at the Mass.
The joyful recessional included distribution of Rosary beads made for the occasion by members of Saint Simon Stock Parish, Berlin.
Blue Mass Committee chair Deputy Chief David Harkins from the Gloucester Township Police Department was thrilled with the day. “This year we had even more participation from schools, [community members], and our contingent of law enforcement and first responders,” he said.
Harkins attended his first Blue Mass as a young patrol officer and was taken aback by how beautiful it was. “As a Catholic it caught me and I said, ‘Wow this is a great intersection of my vocation as a police officer and my faith. … What a great way of celebrating both aspects.’” So Harkins asked to become involved about 13 years ago and has been integral to the growth of the event ever since.
“We really encourage our non-Catholic brothers and sisters to attend,” said Harkins, emphasizing that the event is an opportunity to praise God and honor men and women who serve. “It’s for everyone.”
Previous articleGod answers prayers, sometimes through you
Next articleHuman life must be cherished, protected and defended | cc/2020-05/en_middle_0128.json.gz/line1060 |
__label__cc | 0.737536 | 0.262464 | Automated mapping of laboratory tests to LOINC codes using noisy labels in a national electronic health record system database.
Standards such as the Logical Observation Identifiers Names and Codes (LOINC®) are critical for interoperability and integrating data into common data models, but are inconsistently used. Without consistent mapping to standards, clinical data cannot be harmonized, shared, or interpreted in a meaningful context. We sought to develop an automated machine learning pipeline that leverages noisy labels to map laboratory data to LOINC codes. Across 130 sites in the Department of Veterans Affairs Corporate Data Warehouse, we selected the 150 most commonly used laboratory tests with numeric results per site from 2000 through 2016. Using source data text and numeric fields, we developed a machine learning model and manually validated random samples from both labeled and unlabeled datasets. The raw laboratory data consisted of >6.5 billion test results, with 2215 distinct LOINC codes. The model predicted the correct LOINC code in 85% of the unlabeled data and 96% of the labeled data by test frequency. In the subset of labeled data where the original and model-predicted LOINC codes disagreed, the model-predicted LOINC code was correct in 83% of the data by test frequency. Using a completely automated process, we are able to assign LOINC codes to unlabeled data with high accuracy. When the model-predicted LOINC code differed from the original LOINC code, the model prediction was correct in the vast majority of cases. This scalable, automated algorithm may improve data quality and interoperability, while substantially reducing the manual effort currently needed to accurately map laboratory data.
Journal of the American Medical Informatics Association : JAMIA. 2018 Aug;():.
Authors: Sharidan K Parr, Matthew S Shotwell, Alvin D Jeffery, Thomas A Lasko, Michael E Matheny | cc/2020-05/en_middle_0128.json.gz/line1065 |
__label__wiki | 0.661399 | 0.661399 | Furniture, Furnishings & Household Items
Import: value metal furniture in the UK 2011-2018
Published by Tugba Sabanoglu, Sep 9, 2019
This statistic portrays the import trade value of metal furniture in the United Kingdom (UK) between 2011 and 2018. Over the total time frame observed, the import trade value increased from 658.46 million U.S. dollars in 2011 to 761.25 million U.S. dollars in 2018. The lowest value was seen in 2012, accounting for 589.45 million U.S. dollars. Since then, the import trade value has increased steadily.
Import trade value of metal furniture in the United Kingdom (UK) from 2011 to 2018 (in million U.S. dollars)
Import trade value in million U.S. dollars
The data in this statistics has been rounded to two decimals.
Furniture purchase trend in the United Kingdom (UK) 2005-2018
Furniture Retail
Homewares market value in the United Kingdom (UK) 2010-2019
Upholstery retail market value in the United Kingdom (UK) 2016-2019
Furniture import value in the United Kingdom (UK) 2016-2018, by region
Statistics on "Furniture in the United Kingdom (UK)"
Furniture retail sales turnover in the United Kingdom (UK) 2008-2017
Wholesale turnover of furniture, carpets and lighting in the United Kingdom 2008-2017
Home furnishings market CAGR forecast in the UK 2014-2019, by category
Furniture: Manufacturing turnover in the United Kingdom (UK) 2008-2017
Furniture manufacturing sales in the United Kingdom (UK) 2008-2018
Furniture manufacturers' sales in the United Kingdom (UK) 2018, by product category
Production value of furniture manufacturing in the United Kingdom (UK) 2008 to 2015
Furniture producer price index (PPI) in the United Kingdom (UK) 2003-2018
Furniture: monthly producer price index (PPI) in the UK 2015-2019
Number of furniture manufacturers in the United Kingdom (UK) 2008-2017
Furniture, bedding and mattresses: UK import value 2001-2018
Furniture import value in the United Kingdom (UK) 2003-2018, by EU and non-EU trade
Furniture, bedding, mattresses and cushions: UK export value 2001-2018
United Kingdom (UK): furniture export value 2003-2018, by EU and non-EU trade
United Kingdom (UK): furniture export value 2016-2018, by destination region
Furniture and lighting retail sales value index in Great Britain 2010-2018
Furniture retail sales value percentage change in Great Britain 2010-2018
Furniture and lighting retail sales volume index in Great Britain 2010-2018
Furniture retail sales volume percentage change in Great Britain 2010-2018
Furniture retail sales in household goods stores in Great Britain 2016-2019
Furniture and lighting average weekly retail spend in Great Britain 2016-2019
Number of furniture and household retail stores in the United Kingdom (UK) 2008-2017
CPI of furniture, furnishings and carpets in the UK 2000-2018
Expenditure on furniture and furnishings in the United Kingdom (UK) 2005-2018
Furniture and floor coverings: weekly household expenditure in the UK 2018, by type
Furniture and furnishings: weekly household expenditure in the UK 2018, by age
Furniture and floor coverings: weekly UK household expenditure 2018, by gross income
Import: quantity metal furniture in the UK 2011-2018
Export: quantity metal furniture in the UK 2011-2018
Export: value metal furniture in the UK 2011-2018
Import: quantity wooden bedroom furniture UK 2011-2015
Import: value wooden kitchen furniture UK 2011-2018
Import trade value of plastic furniture in the UK 2011-2018
Import: value wooden office furniture in the UK 2011-2018
Export quantity wooden office furniture UK 2011-2015
Export: quantity wooden bedroom furniture UK 2011-2018
Import quantity wooden office furniture UK 2011-2015
Import: value wooden bedroom furniture UK 2011-2018
Export: value wooden bedroom furniture UK 2011-2018
Export: value wooden office furniture in the UK 2011-2018
Value of furniture imported to Luxembourg 2008-2018
Distribution of furniture and furnishings imports to Norway 2017, by type
Leading suppliers of furniture to the Netherlands 2018, by import value
Leading suppliers of furniture to Belgium 2018, by import value
Leading suppliers of furniture to Luxembourg 2018, by import value
U.S. Furniture Retail Home Improvement IKEA Williams-Sonoma Mattress Retail in the U.S.
UN Comtrade. (September 9, 2019). Import trade value of metal furniture in the United Kingdom (UK) from 2011 to 2018 (in million U.S. dollars) [Graph]. In Statista. Retrieved January 29, 2020, from https://cdn1.statista.com/statistics/630292/import-value-furniture-metal-uk/
UN Comtrade. "Import trade value of metal furniture in the United Kingdom (UK) from 2011 to 2018 (in million U.S. dollars)." Chart. September 9, 2019. Statista. Accessed January 29, 2020. https://cdn1.statista.com/statistics/630292/import-value-furniture-metal-uk/
UN Comtrade. (2019). Import trade value of metal furniture in the United Kingdom (UK) from 2011 to 2018 (in million U.S. dollars). Statista. Statista Inc.. Accessed: January 29, 2020. https://cdn1.statista.com/statistics/630292/import-value-furniture-metal-uk/
UN Comtrade. "Import Trade Value of Metal Furniture in The United Kingdom (Uk) from 2011 to 2018 (in Million U.S. Dollars)." Statista, Statista Inc., 9 Sep 2019, https://cdn1.statista.com/statistics/630292/import-value-furniture-metal-uk/
UN Comtrade, Import trade value of metal furniture in the United Kingdom (UK) from 2011 to 2018 (in million U.S. dollars) Statista, https://cdn1.statista.com/statistics/630292/import-value-furniture-metal-uk/ (last visited January 29, 2020) | cc/2020-05/en_middle_0128.json.gz/line1066 |
__label__wiki | 0.566577 | 0.566577 | 2013 Group 3 Project
Revision as of 16:34, 16 May 2013 by Z3374507 (talk | contribs) (→Metaphase & Anaphase)
2013 Projects: Group 1 | Group 2 | Group 3 | Group 4 | Group 5 | Group 6 | Group 7
1 THE GOLGI APPARATUS
1.3.1 Models of Division
1.4 Behavior of the Golgi during Mitosis
1.5 Morphology and Molecular Mechannisms
1.5.1 Prior to Cell Division
1.5.1.1 Interphase
1.5.2 During Cell Division
1.5.2.1 Prophase
1.5.2.2 Metaphase & Anaphase
1.5.2.3 Telophase & Cytokinises
1.6 Limitations of Current Models
1.7 Areas of Future Research
THE GOLGI APPARATUS
A) Electron micrograph of typical metazoan cell.
B) A Golgi from unicellular green alga imaged by electron cryotomography.
The Golgi Apparatus discovered in 1897 by physician Camillo Golgi is a vital cellular organelle which is found in almost all eukaryotic cells. It is found in the cytoplasm and facilitates the formation and direction of membrane bound vesicles, mainly formed from proteins directed from the rough endoplasmic reticulum before they reach the plasma membrane. The Golgi is capable of regulating cellular transport and secretion depending on the volume and density of the vesicles and their contents. Structurally, it consists of a series of stacked components of cisternae and has two identified faces- a cis face and a trans face. [1]
Diagram of the Golgi Apparatus
The Golgi apparatus is a relatively large, membrane-bound organelle and thus one of the easiest cell structures to study in detail [2]. The organelle is located nearby the cell nucleus and is closely associated with the endoplasmic reticulum. By observing via metallic impregnation, it can be seen through phase contrast microscopy that the Golgi has a convoluted, dense and “ill-formed” morphology [3]. Initial studies have shown that the organelle has great variance in its form dependent on the type of cell it is in as well as the state of activity that the cell is in. There are roughly around 40-100 Golgi apparatus ‘stacks’ within a mammalian cell [4].
Overall, the Golgi apparatus is made of 4-8 flattened, membrane-bound sacs that are stacked upon one another [5]. These are known as cisternae. The Golgi also includes associated nearby vesicles. Each cisterna primarily contains products from the endoplasmic reticulum, which enter the Golgi at the cis face – the end that is closest to the ER and accepts incoming vesicles [6]. The cis face is where new cisternae are formed. The products eventually pass through two more functional regions (medial Golgi and endo Golgi networks) and then are exported via outgoing vesicles at the trans face of the organelle. The trans face is where formed proteins are sent off and is the face furthest away from the ER. There is a constant and relatively consistent distance kept between cisternae of the Golgi apparatus [5].
Golgi apparatus is considered to be essential membrane-bound organelle in eukaryotic cells that sums all plant, animal and fungi life [7]. It's physical structure is a composition of dozens of flattened cristernae that has been brought together and flattened with fenestrated rims. Golgi has a primary function of modifying and packaging proteins and lipids into several transport carriers to be able to send them to their proper locations. Proteins such as secretory or trans-membrane proteins are delivered from the endoplasmic reticulum (ER) to the cis-Golgi network. Consequently, the Golgi act as a series of transportation canal where cargo molecules travel via different Golgi cristernae where residential enzymes modify and post-transitionally process them. Different modification involve different processes such as proteolysis, phosphorylation, glycosylation and sulfation [8]. Different cargo molecules move in different manner in the Golgi stack [9]. One such manner is through cisternal maturation where the cargo remains steady inside the cisternae, eventually forming a new functional cisternae at the cis-side. Coat Protein (COPI) is a complex protein that function by coating the vesicles transporting proteins from the cis end of the endoplasmic reticulum (ER)and golgi compartmets. COPI in the Golgi apparatus will be responsible for the process of delivering the Golgi enzymes necessary for maturation of the newly synthesized cisternae that contains the cargo [10] [11] [12].
As an alternative, COPI is a usueful protein that facilitates transportation of different proteins between cisternae however it does not affect the resident enzymes since they reside in a relatively stable cisternal compartments [13] [14]. Cargo molecules may flow through the transient tubular connections between adjacent cisternae [15] or by fast partitioning between different lipid domains [16]. Golgi body also have a region where cargo molecules are being segregated and sorted out and transported to their appropriate destination, such region is called trans-Golgi network. It transports cargo proteins into the wider area destinations of the cell (in and out of cells)such as the plasma membrane and endosomal-lysosomal systems.It also contribute to the process of protein trafficking which is essentialin cell polarity [17] and the process of controlling the cell cycle [18]. Studies suggested that there is a strong link between cell trafficking and its effect to cell growth and the homeostasis of cell cycle.
Time Discovery
1898 The organelle was first described by Camillo Golgi. It was observed via treatment of tissue with potassium dichromate and osmic acid followed by silver nitrate[19]. He termed the organelle 'appareil reticulaire interne' (internal reticular apparatus) and documented his findings in 'Arhives Italliennes de Biol 1898'.
Up to 1950s The term 'Golgi apparatus' was coined in 1910, and its first appearance in scientific literature was in 1913[2]. The organelle was beginning to be observed in many animal cells and from this, SR Cajal concluded that it was a common component in all living cells. However, some French cytologists denied the presence of a Golgi apparatus, claiming it to be an artefact.
1950s With electron microscopy becoming more and more accessible, Dalton and Felix were able to demonstrate that certain structures observed under the electron microscope matched Golgi and Cajal’s description of the 'appareil reticulaire interne'[20]. Vacuoles and cisternae could now also be observed.
1961-1981 G Farquhar and G Palade recognised 3 key features to the Golgi apparatus through 20 years of research (published 1981 Journal of Cell Biology 91) [21]
• It is divided into compartments
• It is required for the transport of secretory proteins and formation of secretory granules
• It houses proteins responsible for the modification of cell products.
G Palade also theorised a vesicular transport hypothesis – Communication between Golgi components is irregular and probably caused by the budding-fission-fusion of vesicles.
1984-1996 Studies conducted by J Rothmann et. al. (published as J Rothmann, 1996, Protein Sci, 5) supported the vesicular transport hypothesis. This was done via viral proteins marking vesicle membranes.
Up to 1990s It was believed that all organelles, including the Golgi Apparatus never disappeared during mitosis but remained intact or in a fragmented state which would then be distributed between the two daughter cells. Thus, the two models of organelle partitioning were proposed. [22]
After the 1990s The theory that organelle identity remained (via either models of division) were challenged due to new imaging techniques allowing in vivo studies of intracellular compartments during cell division[23]. These studies suggest that the Golgi apparatus, along with the nuclear envelope are reabsorbed into the ER, and hence disappears during mitosis[24].
Models of Division
Within the category of animal cells, there are several methods of division used by organelles to ensure the proper partitioning of cellular content into daughter cells.
1.) The Stochastic Strategy, determined by the law of probabilities is adopted by organelles which are dispersed and numerous. This accuracy of this method of separation relies of the equal dispersion of organelles throughout the cytoplasm.[25]
2.) An alternate strategy for cell division is the Ordered Partitioning Strategy. Unlike the former this method is highly regulated and organised. It is structured around the theory of mitotic spindles. This method ensures a high degree of accuracy particularly for low number organelles. In general, most membrane bound organelles use both methods through the process of cell division, however some organelles depend on one method more heavily.[26]
There is still much to be uncovered regarding the mitotic division of the Golgi. There are several steps in the process which remain obscure and controversial. Researchers have proposing various models for cell division. However, a general consensus can be seen in three major stages in its partitioning:
Disassembly/Fragmentation
Re-assembly
Behavior of the Golgi during Mitosis
During mitosis, the Golgi can undergoes one of two courses, depending on wether it is from an animal cell or a plant or yeast cell. In animal cells, it completely disintegrates and separates. The cisternae stacks come apart and move away from one another [27]. However in plant or yeast cells, the Golgi remains together. It is just before cytokinesis (during telophase) that the parts of the Golgi reassemble and from an intact organelle (in plant cell mitosis).
The relationship between the Golgi and microtubules
Despite being one of the earliest organelles to be identified and studied, there are still grey areas concerning the division of the Golgi Apparatus. Some existing models of division for the Golgi suggest that it interacts with the endoplasmic reticulum during several points throughout cell division. This is due to their structural similarities during the interphase stage of mitosis in mammalian cells. Both consist of interconnect membrane networks and studies have found that both Golgi and ER proteins can be found together in bound vesicles. An experiment conducted by Jesch SA et. al. compares the distribution of the two organelles during interphase using innumnoflourecence microscopy, velocity gradient fractionation and density gradient fractionation. They concluded that the Golgi and the ER do not combine and furthermore that mitotic cells are unable to facilitate the fusion of the two.[28]
It was once theorised that the Golgi apparatus could be formed de novo within daughter and mitotic cells. It has since been discovered that in animal cells, the organelle cannot be synthesised de novo and thus, must divide when a cell divides [29]. Through cytochemical and immunofluorescence light microscopy, it has been shown that the Golgi would undergo breakdown early on in mitosis, giving rise to many Golgi fragments [30]. These fragments (in the form of small tubules and vesicles) would be dispersed throughout the cytoplasm at random. The partitioned Golgi would segregate into even groups and end up in the daughter cells to serve as a template to new Golgi apparatuses[31].
In both animal and plant cells, cytokinesis is the final stage of mitosis, which describes the division of the cell membrane into two separate and independent new cells. It is known that part of the driving mechanism of this process are vesicles formed by the Golgi apparatus[32]. These formed vesicles travel along microtubules of the cytoplasm to the centre of the cell and assist in the cleaving of the cell membrane. Within plant cells, the vesicles travel along the phragmoplast, which forms at the beginning of mitosis and begins the creation of a cell plate.
Morphology and Molecular Mechannisms
Morphology of the GA Throughout Cell Division
Prior to Cell Division
The Golgi apparatus in mammalian interphase cells is composed of flattened, membrane-bound structures approximately 1µm long, named Golgi cisternae. Between two and five cisternae align in a parallel fashion forming a Golgi stack[33]. At the onset of mitosis, the Golgi stacks take a polarized position around the cell nucleus and centrosome in a cis-trans fashion. The cisternae of same polarity belonging to two adjacent stacks are connected by thin tububules, forming the Golgi Ribbons [34]
Towards the end on interphase at G2/M of the cell cycle the Golgi ribbons begin to disassemble and assume a peri-nuclear arrangement around the nucleus. Micro-tubules are known to assist in this structural organization[35].
Unlinking the Golgi ribbon
This process emerge from Interphase to early G2 (prophase). It unlinks the golgi ribbon by detaching the cell's tubular connections between the cell's stacks [35]. In this process the ribbon may be converted into stacks depending on the protein enzymes such as MAP(Mitogen-activated protein) kinase and MEK1 (MAP ERK [Extracellular signal-regulated kinases] kinase 1) [36]. Study shows that the presence of MEK1 in cell division causes ribbon unlinking by reacting with ERK2 that also reacts with GRASP55 (Golgi reassembly stacking protein of 55kD) via the process of mitotic phosphorylation [37]. However, this can be a delicate process because if it reacted with the nonphosphorylatable GRASP55 which is a mutant form of GRASP55, it could interfere the ribbon unlinking especially in the late G2 [38]. Similarly, GRASP65 serve the role in severing the ribbon and connects the bridge in progression from G2 into M-phase [39]. There are also other proteins besides these kinases that serve an essential role in ribbon unlinking like the membrane fission protein CtBP1/BARS (C-Terminal Binding Protein 1/beta-adrenergic receptors) [40]. If BARS is non functional because of any defection or inhibition, it would prevent the golgi's ability to detach severe the ribbon and consequently affecting the G2/M transition during interphase [41].
Cell division that shows two disassembling processes, partitioning, reassembling and merging
During Cell Division
Prophase
Here, fragmentation of the Golgi stacks continue until hundreds of Golgi stacks and vesicles are formed.At this stage the Golgi is a heterogeneous collection of tubular networks, short tubules, and vesicles, termed mitotic clusters.[42] These rudimentary building blocks are organised around the templates of spindle poles and a microtubule network. Research indicates that peaking levels of cdc2 kinase activity triggers much of the structural changes seen in the disassembly process.[43] This indicates that there is a possible correlation between kinase activity and structural fragmentation/assembly.[44]
Vesiculation and Unstacking
This process involves the cisternae. After the successful conversion of the Golgi ribbon into stacks via protein kinases and membrane fission protein, the cisternae will undergo into the process of vesiculation which is made possible by the COPI-dependent vesicle formation [45] [46]. The process occurs instantly and synchronously in early mitosis. Consequently, this gives an effect of fast transformation of Golgi into vesicular and tubular membranes. Such process occurs due to the imbalance of membrane budding and fusion in mitosis [47] [48]. During interphase, the cis-cisternae contains the COPI vesicles that has been captured and secured by giantin,p115 (protein115) interactive proteins and GM130 (Golgi matrix protein) via giantin-p115-GM130 tethering complex before the membrane fusion [49].
Molecular mechanisms of Golgi body during cell division
Metaphase & Anaphase
The clusters formed in prophase adopt a ring-like formation around each centrosome, which are partitioned according to associated spindle poles and a sister chromatids. The division of the Golgi clusters are balanced due to the arrangement of spindle poles and structural support of the microtubules. This method of division should ultimately allow for the accurate partitioning of the Golgi into the resulting daughter cells.[50]
Telophase & Cytokinises
In the final steps of cell division the Golgi stacks begin to combine and re-position themselves at either side of the mid body and at each daughter cell centrosome. Ultimately they slowly begin to merge and reform into Golgi Apparatus.[51]
Limitations of Current Models
A key problem with this line of reasoning is that micro- injection of the identical Sar1p mutant protein (GDP- or GTP- bound form) in interphase cells leads to the fragmentation of the Golgi apparatus into vesicles and tubules very similar to those comprising the MGCs.
This suggests that in itself cessation of transport from the ER is a detrimental factor for the maintenance of the Golgi apparatus and is independent of the localization of Golgi enzymes. One possibility is the requirement for a factor that needs to be transported to a downstream location to regulate maintenance/reassembly of the Golgi apparatus is accumulated in the ER. It is perhaps therefore not possible for normal Golgi reassembly to occur at the end of the mitosis in cells micro-injected with Sar1p DN .
The recycling of Golgi enzymes to the ER observed during interphase could take place to a certain extent during mitosis. More sensitive electron microscopy methods need to be developed to detect endogenous and transfected and epitope-tagged proteins that are expressed at low levels. These enzymes, when present in the ER, could indeed be partitioned in an ER-dependent manner, while others Golgi components, the structural Golgi proteins (see the Introduction), could be partitioned with the MGCs.
Areas of Future Research
Mechanisms for the redistribution of Golgi clusters in structural dis-assembly during mitosis
Microtubules are known to play a large role in the partitioning in the Golgi, however there many obscure areas regarding the specific relationship between the two. Studies have shown that there is a hindrance of structural organisation of the Golgi occurs once microtubule disrupting drugs such as nocodazole are introduced into the cells. Further research could clearly identify the role of microtubules and determine whether the relationship is direct or secondary element of regulation.[52]
Research is currently delving into the involvement of the Golgi apparatus in cell death and thus, the use of its pathways in the treatment of cancer [53]. Inducing cell death within neoplastic tissue is imperative in cancer therapy as both a treatment as well as an indication of the progression of tumor growth and efficacy of treatments.
In current times, a number of pathways and cell processes have been identified and targeted as a way of treating cancer. However, recent studies have revealed the involvement of the ER-Golgi compartment in the apoptosis of cells[54]. Proteins that are involved in the homeostasis of the Golgi and ER have been noted and may be used in the development of therapeutic drugs. Further studies are required to implement drugs that may activate signalling pathways of the Golgi apparatus to create suicide programming of neoplastic tissue.
Golgi Apparatus Maintains Its Organization Independent of the Endoplasmic Reticulum
Partitioning of the Golgi Apparatus during Mitosis in Living HeLa Cells
Golgi biogenesis
Apparatus - an animatic
Protein trafficking
GA - Golgi Apparatus
ER - Endoplasmic Reticulum, an organelle closely situated with the nucleus and Golgi apparatus, responsible for protein synthesis.
Endocytosis - The process of cell absorption of molecules via engulfment
Exocytosis - The secretion of internally synthesised molecules from of a cell to the external environment via vesicles
Microtubules -
Spindles -
↑ <pubmed>PMC2106267</pubmed>
↑ 2.0 2.1 <pubmed>9865849</pubmed>
↑ HW BEAMS, RG KESSEL - The Golgi Apparatus: Structure And Function. International Review of Cytology Vol. 23 1968
↑ 5.0 5.1 <pubmed>19866649</pubmed>
↑ Krieger M, Scott MP, Matsudaira PT, Lodish HF, Darnell JE. Lawrence Z, Kaiser C, Arnold B. Molecular cell biology (5th edn ed.). 2004 New York: W.H. Freeman and CO
↑ Tixier-Vidal A - The History of the Golgi apparatus. From structure to concepts. Biology of the Cell, Volume 90, Number 1, January 1998 , pp. 106-107(2)8
↑ Nunnari, J. and Walter, P., 1996, Regulation of organelle biogenesis. Cell., 94, 389-394.
↑ Otegui, M.S., Mastronarde, D.N., Kang, B.H., Bednarek, S.Y., and Staehelin, L.A. "Three-dimensional analysis of syncytial-type cell plates during endosperm cellularization visualized by high resolution electron tomography." Plant Cell 13, 2033-2051 (2001)
↑ <pubmed>PMC25291</pubmed>
↑ <pubmed>519753</pubmed>
↑ John M.Lucocq and Graham Warren. Fragmentation and partitioning of the Golgi apparatus during mitosis in HeLa cells. The EMBO Journal vol.6 no. 11 pp. 3239 -3246, 1987
↑ Rambourg, A. and Clermont, Y., 1997, Three-dimensional structure of the Golgi apparatus in mammalian cells. In The Golgi Apparatus , E. G. Berger and J. Roth, eds. (Birkhauser). pp.37-61.
↑ 35.0 35.1 <pubmed>17689238</pubmed>
Dr Mark Hill 2013, UNSW Embryology ISBN: 978 0 7334 2609 4 - UNSW CRICOS Provider Code No. 00098G | cc/2020-05/en_middle_0128.json.gz/line1068 |
__label__cc | 0.531132 | 0.468868 | Imax Ventures Into Virtual Reality in Cinemas
By Patrick von Sychowski | May 22, 2016 8:15 pm PDT
The Wall Street Journal has revealed that large format operator Imax is venturing into the virtual reality (VR) market in partnership with Google and Swedish technology developer Starbreeze AB. The venture will see special VR venues launched in cinemas and malls, as a precursor for any move into the home and consumer market.
Imax first announced a collaboration with Google to launch a 360-degree camera that will capture surround images to be experienced with VR headsets, set to be launched before the end of 2017. Imax will also use Starbreeze’s VR headsets and games, ahead of any film launched specifically for its devices.
Initially the Imax VR deployment will be in six venues, of which Los Angeles is expected to have the first one, with China expected to be amongst the next destinations. Having recently launched into cruise liners and even cycle spinning classes, WSJ quotes Imax’s CEO Richard Gelfond as stating that VR being part of a larger strategy to take the Imax band beyond just movies.
“Virtual reality in the home is going to be a crowded space, but we thought the idea of doing VR in the multiplex of the future was a place where we can provide a superior experience and a social experience, which are the same reasons people go to movies.”
VR content is expected to be linked to major film franchises, with a ten minute VR experience sid to be priced at between USD $7 and USD $10. Carmine’s CEO David Passman is quoted as saying that Imax VR rooms could be retrofitted into arcade spaces or auditoriums with flattened floors.
With advanced VR systems such as Facebook’s Occulus Rift requiring tethering to powerful PCs – as opposed to Samsung’s Gear and Google Cardboard, which are built around smartphones – there will be a high initial cost and limited market, which is why Imax sees VR as first taking off in public places before the home.
“We’ll be able to leap five years ahead of what most people can do in their homes,” Starbreeze CEO Bo Andersson Klint is quoted as saying.
Regular readers of Celluloid Junkie will know that we predicted Imax’s move into VR almost two months ago – as an April Fool’s Day joke!
Imax’s partner Starbreezer AB
Tags: IMAX, Google, Virtual reality, Richard Gelfond, VR, Starbreezer, Bo Andersson Klint | cc/2020-05/en_middle_0128.json.gz/line1069 |
__label__wiki | 0.6602 | 0.6602 | Why Fandango is Getting Friendly With Facebook to Sell Movie Tickets
By J. Sperling Reich | September 25, 2016 10:12 pm PDT
As Sony’s “The Magnificent Seven” remake shot to the top of the North American box office this weekend some of those moviegoers contributing to the film’s USD $35 million domestic bounty (USD $54.2 million worldwide) may have purchased their tickets through Facebook, the popular social media platform. The same goes for “Storks” which delivered USD $21.8 million in North America and USD $40.1 million globally.
In what is being billed as a first, Fandango has teamed up with Facebook to roll out an integrated ticketing service in North America that allows moviegoers to purchase tickets directly through the social media site. Historically, those wishing to purchase movie tickets were redirected to Fandango’s own website, forcing them to leave Facebook. Users will be directed to Fandango ticketing through both ads and from a movie’s Facebook page.
Not every user will be able to experience the new ticketing service initially, as Fandango and Facebook are implementing it through limited tests; just three releases and in limited markets. Besides “The Magnificent Seven” and Warner Bros. “Storks” the Universal Pictures stand-up comedy concert film “Kevin Hart: What Now?” will be on offer. Neither Fandango nor Facebook is saying which geographic markets have been tapped for the trial run, however the service is likely to expand in the near future to all major markets that Fandango serves. Presently the Comcast owned company, which grew a whopping 81% last year, sells tickets for over 27,000 screens throughout the United States, making it the regions largest web ticketing outfit.
Of course, calling Fandango a “web ticketing” or “online ticketing” company is really a bit of a misnomer since these days Fandango sells nearly 70% of its tickets through mobile devices. Selling tickets through Facebook is simply adding to the number of channels through which Fandango can acquire customers and simply bringing the product to those customers by negating the need to visit Fandango directly.
This is a concept that has not escaped Paul Yanover, the President of Fandango. “Not only is this a huge convenience for the millions of movie fans who are discovering and sharing their love of movies on Facebook, it is also a big win for studios and exhibitors, who are looking to activate moviegoers’ interests into ticket purchases.”
On paper, Facebook would seem to be a natural sales channel for Fandango, since 680 million users are “following” or have “liked” the official Facebook page of theatrical movie releases on the social network. As Yanover implied, studios rely heavily on social media to help market their releases and that often includes heavy promotion on Facebook.
Though there have previously been small initiatives by studios and exhibitors to sell tickets through Facebook, little ever came of these experiments and they eventually faded away. This is the first major push by a third-party ticket service to sell tickets directly through Facebook in North America. For Facebook itself, it’s a no-lose situation since, even if they don’t get a cut of each ticket sale, they are keeping users on their platform longer, without sending them away to conduct a commercial transaction.
What will be interesting to keep an eye on is whether selling tickets via Facebook leads to an incremental increase in moviegoing attendance. Will the social aspect and peer influence inherent in a social media site spur users to invite larger groups of friends to the movies for which they are buying tickets? In other words, will there be a true social network effect on the sale of movie tickets through such channels? We will likely never know the metrics and figures generated by this initial test, however its success can be gauged by the speed with whichFandango and Facebook make the service broadly available.
J. Sperling Reich
Latest posts by J. Sperling Reich (see all)
Christopher Nolan Requests You View His Latest Movie Trailer In Cinemas - December 19, 2019
Cinema of the Month: Star Cinema Grill – Houston, Texas - December 16, 2019
The Problem With Playing Netflix Movies in Cinemas - November 23, 2019
Tags: Fandango, Facebook, ticketing, Paul Yanover | cc/2020-05/en_middle_0128.json.gz/line1070 |
__label__cc | 0.719674 | 0.280326 | 2 large studies show an association between pollution exposure and acute cardiovascular problems
by Hepeng Jia, special to C&EN
January 10, 2020 | APPEARED IN VOLUME 98, ISSUE 2
Most Popular in Environment
Periodic Graphics: The chemistry of snow and ice
Carbon capture drives metal purification
‘Forever chemicals’ no more? These technologies aim to destroy PFAS in water
EPA adds 160 PFAS to Toxics Release Inventory
Plastic has a problem; is chemical recycling the solution?
Plastics recycling with microbes and worms is further away than people think
Poor air-quality days like this one in Tiananmen Square in 2013 are associated with increased hospitalization for cardiovascular disease.
The link between air pollution exposure and risk of premature death is well known to epidemiologists—according to one study, in 2015 alone, air pollution killed about 4.2 million people worldwide. Two large studies from China have now provided further evidence of how such exposure increases the risk of specific and acute health problems. Most such studies have been done in high-income countries and used relatively small samples. The new studies, both led by researchers at Huazhong University of Science and Technology, focused on fine particulate matter pollution, or PM2.5. The first study, led by Yonghua Hu, investigated the relationship between daily PM2.5 concentrations and 8.83 million hospital admissions of people with cardiovascular disease in 184 Chinese cities between 2014 and 2017 (BMJ 2019, DOI: 10.1136/bmj.l6572). At the national level, an average increase of 10 μg/m3 in daily concentration of PM2.5 was associated with a 0.26% increase in hospital admissions on the same day for cardiovascular diseases, including heart failure, stroke, and restricted blood flow to the heart. The second study, led by Dongfeng Gu, examined 3,540 hospitalizations due to stroke from 2000 to 2015. Gu’s team found that each increase of 10 μg/m3 in PM2.5 concentration led to a 13% higher risk of stroke (BMJ 2019, DOI: 10.1136/bmj.l6720).
Regulations improved air quality in China
Restricting NO2 emissions linked with reduction in childhood asthma incidence
Prenatal exposure to air pollution has wide-ranging health effects in rats
Title: Air pollution in China linked to risk of hospitalization
Author: Hepeng Jia, special to C&EN | cc/2020-05/en_middle_0128.json.gz/line1071 |
__label__cc | 0.513643 | 0.486357 | Anonymous reviews Best Served Hot by Jimmy Arnis
Best Served Hot by Jimmy Arnis
Jimmy Arni's did a very good job at the way he narrated this story, from a first person's POV. Emotions, thoughts, heart beats, and every painstaking detail about the narrator are all detailed. This could pass for a movie. At the point where Chief was about to be murderd, I could feel my heart beating because I thought he almost failed and that would have been disastrous, knowing what a villain chief was.
The officer who opened the door in the end is just a great way to leave us wondering a million things that could have just happened. Let's wait for a follow up if any is in progress. Great story.
I wouldn't recommended this book to anyone below the age of 18 because of the rate of f-word usage... In the past, we read stories and could use a little help from a dictionary to digest new words. For this book, you need internet connection and need to have watched a lot of contemporary movies to understand some comparisons.
Reply · Share · 3k Views · Report
Americanah by Chimamanda Adichie
Ekene Onuorah
Posted 4 Years ago · 0 Likes · 0 Comments
O ma ga, amma like, assomeh. That was supposed to mean oh my God, I'm like, I'm so mad. That was from someone who wants to blend into America in the book Americanah. Chimamanda was so meticuolus in exposing the life so many thought would be perfect outside an African Nation. It was never easy for Ifemelu. The book is a great lesson for all, and most importantly a must read
Who Fears Death by Nnedi Okorafor - Mbachu
In a far future, post-nuclear-holocaust Africa, genocide plagues one region. The aggressors, the Nuru, have decided to follow the Great Book and exterminate the Okeke. But when the only surviving member of a slain Okeke village is brutally raped, she manages to escape, wandering farther into the desert. She gives birth to a baby girl with hair and skin the color of sand and instinctively knows that her daughter is different. She names her daughter Onyesonwu, which means Who Fears Death? in an ancient African tongue.
Reared under the tutelage of a mysterious and traditional shaman, Onyesonwu discovers her magical destiny-to end the genocide of her people. The journey to fulfill her destiny will force her to grapple with nature, tradition, history, true love, the spiritual mysteries of her culture-and eventually death itself
The Potter's Wheel by Chukwuemeka Ike Vincent
Satirist and chronicler of the many-faceted world of education in Nigeria, the author is one of Nigeria's foremost writers. In this novel, he tells of Obuechina, the only brother of six older sisters, prize pupil in the village school, apple of his doting mother's eye, eight years old and hopelessly spoilt. In a vain attempt to salvage his character, his father decides he must be sent away as a servant to a schoolmaster with a dragon of a wife. Obu goes - and comes back very different
The Hobbit, or There and Back Again by J. R. R. Tolkien
Whether children's or adult's, I think everyone enjoyed reading the story. The Hobbit both as a creature and as a classic novel is genuine. While reading, you can't think of having read something like this, unless you have read something copied from it. I particularly loved the theme of Bilbo not caring what others may think of him going for an adventure. It happens in the world today. And I was glad that he came back very rich, even though I was sad that Thorin died. That's why it's fiction. An Enchanting prelude to the Lord of The Rings series. Very interesting.
Powerful Prayers That Makes Things Happen by Rev. Fr. Ejike C. Mbaka
I think I'm a testimony too
to this book. So many have
been said about it and
I've read some prayers in
it, especially the Prayer for
our nation Nigeria. It
worths reading for every
Half Of A Yellow Sun by Chimamanda Adichie
Posted 50 Years ago · 0 Likes · 0 Comments
A masterly, haunting new novel from a writer heralded by The Washington Post Book World as �the 21st-century daughter of Chinua Achebe,� Half of a Yellow Sun re-creates a seminal moment in modern African history: Biafra�s impassioned struggle to establish an independent republic in Nigeria in the 1960s, and the chilling violence that followed.
With astonishing empathy and the effortless grace of a natural storyteller, Chimamanda Ngozi Adichie weaves together the lives of three characters swept up in the turbulence of the decade. Thirteen-year-old Ugwu is employed as a houseboy for a university professor full of revolutionary zeal. Olanna is the professor�s beautiful mistress, who has abandoned her life of privilege in Lagos for a dusty university town and the charisma of her new lover. And Richard is a shy young Englishman in thrall to Olanna�s twin sister, an enigmatic figure who refuses to belong to anyone. As Nigerian troops advance and the three must run for their lives, their ideals are severely tested, as are their loyalties to one another.
After The Juju Man by Chinwuba Iyizoba
After the Juju-man is a classic -- a story of life in West-Africa before the arrival of the Whites. It tells of the struggles of a man named Okafor whom at last died of injustice. Not only was it a tragedy that he died, his sincere In-law died too to bring out the truth and to cleanse the village of Izagu. Okafor disobeyed his father to become a palm-wine tapper, instead of the farmer his father prepared him for. It was later that Okafor revealed to his son Ikenna that his refusal was to stop trouble since his father�s second wife, along with children meant evil for him if he walked into the land.
As an unsuccessful palm wine tapper, he fell from the tree and broke his leg. His brother-In-law Okoye meant well for him by taking him to a distant village, Umuoru, because the healer they had in Izagu was powerless and fake. This almost caused trouble but the elders believed Okoye since his son and wife were victims of fake healers.
At Umuoru, Nweke did wonders with the cock he handed back to them. Okafor was healed when this cock began to walk and many were happy. But Okafor wanted to do more. He believed he needed to appease his late father by becoming a farmer, but his half-brothers were an obstacle to giving him the land which was rightfully his. Ekene convinced Ukaegbu to give him the land, citing that he would still fail.
But the brothers were disappointed. With help from Okoye, Okafor became one of the wealthiest at the next harvest that he decided to take an �Ozo� title. Ukaegbu did all to stop him, even by claiming his land and by beating his wife. This made Okafor fight Ukaegbu which attracted the public; it wasn�t good for a man about to be given an Ozo title. The case was to be settled at the shrine but no one knew that Ojiugo has been bribed to poison Okafor, except the planners. Okafor and Ukaegbu took the oath by drinking poisons, but Ukaegbu had the anti-dote.
Okafor died and was given a burial fit for a dog. Okoye knew that there was a problem so travelled to invite a stronger deity Aligome to come and cleanse their land. This deity would go with the person who invited it after it had done its work. Okoye knew this and was ready to make the sacrifice. He knew that it would still cost innocent lives if evil prevailed.
Aligome was invited and the village purged. Those who did evil were punished and the village became a place worth living. But it was time for Okoye to go. From his death bed, he heard the news of Whites coming to trade slaves. He told his nephew Ikenna, the son of Okafor, that evil sometimes brings something good, and urged him to ask them to give him the message if he ever meets them. The boy was really confused but agreed while Okoye died in his hands. He was given a befitting burial.
I am guessing this message would be Christianity or Technology or Civilisation. | cc/2020-05/en_middle_0128.json.gz/line1080 |
__label__wiki | 0.617855 | 0.617855 | Mountain Echo
Teacher recommendation day is Wed. Jan. 29
Sign up for the blood drive on Jan. 30 in your homeroom or the B building nurses
Auditions for the Talent show are Feb. 11 @ 5
Ski club storage is in the English Department Office this year
Join Mr. Spayd's SAT Google Classroom with the code b x t 1 z n
Congrats to our choral students who participated in the PMEA District Chorus
Everything is to like about ‘Everything, Everything
Frankie Price, Reporter
Yoon, author of Everything, Everything, makes a heartwarming debut with this novel. It is a story about a 17-year-old girl named Madeline Whittier. Maddy has a rare disease called Severe Combined Immunodeficiency, forcing ...
The Student News Site of Altoona Area High School | cc/2020-05/en_middle_0128.json.gz/line1082 |
__label__wiki | 0.703684 | 0.703684 | LC City Council to vote to allow drilling near residences
The plans call for natural gas drilling near the Magnolia Creek subdivision.
The City Council meeting is underway. They haven't yet discussed the potential change to oil and gas regulations. If passed it would create much more protection for homeowners there.
Homeowners in the Magnolia Creek subdivision in League City are focused Tuesday night on City Hall.
"We hope to have a good turnout," said resident Jennifer Woeste.
She is among those who's been pushing for the city not to allow drilling just adjacent to their neighborhood.
"This possibility wasn't brought to our attention when we were purchasing our homes," Woeste said.
But the developer owns the mineral rights and has asked the city for approval to drill for oil and gas there.
"We've been told by one of the city council members that if we didn't want this to happen then we shouldn't have moved here," said resident Ashley Mueller.
Homeowners say its too close to them, to a day care and to an elementary school. Legally, in League City the law only requires a 300-foot buffer between those locations or a home and drilling. A Yes vote Tuesday night doubles that buffer to 600 feet.
"Taking a stronger stance on the requirements that are necessary," said Tony Allender with the City of League City.
Allender is with the city's planning and research department and says city leaders have to be careful to strike a balance between concerns of homeowners and the wishes of those who own mineral rights.
Residents say drilling here would increase traffic and noise and decrease property values in an economy where it's already difficult to sell.
This mother of two young children insists the risk is just too great to allow drilling too close.
"It's not safe. And they wouldn't want to live with that in their backyard," said Mueller.
The developer has said drilling near Magnolia Creek would have minimal impact on those living there. We'll keep you posted on how the council votes. | cc/2020-05/en_middle_0128.json.gz/line1084 |
__label__cc | 0.670002 | 0.329998 | AI Could Supercharge Corporate Sustainability with New Applications
Danya Liu
Associate, Digital Industry
Two of the biggest challenges in improving a carbon footprint are determining its size in the first place – and analyzing the actions that might significantly impact it. The more data available, the more an individual or a corporation can make a plan and quantify the likely impact.
Over the past few years, the use of artificial intelligence has exploded, driven by cheaper computing and more available big-data sets. When applied to predictive maintenance, it can prolong the lives of industrial equipment and reduce O&M costs by 10%. Programmed into robots, drones, or cars, it can make possible object recognition and autonomous navigation. It already plays a part in sustainability because of its ability to reduce energy and resource consumption. Now there is a chance for AI to improve the way companies determine and report their sustainability impact.
The opportunity in corporate sustainability
Businesses of all sizes, sectors, and regions are stepping up their sustainability efforts in response to shareholder pressure. BNEF’s sustainability team tracks the pledges of companies committed to sustainability frameworks like the ones shown below. These commitments are a powerful lever in overall decarbonization. But behind the scenes, planning for corporate sustainability is a mammoth undertaking often mired in uncertainty. Uncertainty stems from not knowing total emissions volume, what extreme climate events will happen, when they will take place, and how they will impact existing assets. For investors, this uncertainty translates into risk.
Wide-scale collection and analysis of data using artificial intelligence might help meet the growing demand for corporate sustainability reporting. Startups have emerged leveraging AI technology to help track emissions accurately, to simplify reporting, and to enhance climate change strategy. Here we look at two such startups – Normative and Cervest. The former aims to bring sustainability data into external communications, while the latter targets internal decision-making.
Automating emissions reporting
One of the challenges in emissions reduction is taking stock of everything in the first place. This is especially true for calculating scope 3 emissions, essentially the footprint of all your suppliers and products in your value chain. Normative, a Swedish startup, has a software application that makes reporting easier. It goes as far as automating emissions reporting for scope 1 (direct emissions from operations), 2 (indirect emissions from electricity purchased) and 3 (indirect emissions from the value chain.
It does this by parsing through enterprise resource planning (ERP) data. Users upload procurement records from ERP systems, and Normative’s AI recognizes and pairs those products with the latest scientific research on linked environmental and social impact. Users can also upload energy bills, incident records, expense reports and various other enterprise datasets. The engine uses this to generate a bottom-up estimate of a company’s environmental and social footprint, along with recommendations on ways to reduce impact.
Normative’s service has attracted early customers with complicated supply chains, such as the building and construction industries. Other interested parties include private equity investors keen to standardize reporting across their portfolio companies.
Large companies can often spend hundreds of thousands of dollars hiring outside consultants to help them compile emissions and sustainability data. Normative says it can deliver the same service for a tenth of the price.
Modeling climate risk and impact
To help with internal decision-making, U.K.-based Cervest uses AI to model corporate climate risk. It offers a Geographic Information System (GIS) -based platform where different decision-makers can query the potential risk and impact that they care about. For instance, agricultural companies can model the impact of extreme droughts in Western Europe, or manufacturing companies can analyze which facilities are most at risk of weather-related disruption. The platform lets users model climate impacts over their chosen time-frame and also zoom in to specific sites.
To do this, Cervest uses AI algorithms to understand climate signals from satellite imagery and projections. Computer vision applications extract climate trends from remote sensing data, machine learning algorithms stitch all data sources into one integrated set, and finally statistical modeling predicts the impact of risks on assets.
By providing this model, Cervest hopes to illuminate the climate risks and implications for strategic decisions involving sites for expansion, or investments for climate resiliency, and even which insurance policies are worthwhile. So far its clients include research agencies, insurance companies, asset managers, as well as food and beverage companies.
BNEF Take
The power of AI lies in its ability to see patterns in large unstructured datasets, and predict machine, weather, and human behavior. Startups are particularly nimble at fine-tuning AI to suit specific industry applications. As climate and sustainability become an increasing concern for a range of industries, we would expect AI to be increasingly applied to these challenges. In addition to the two services profiled here, other companies are developing additional AI-based services in areas like building energy optimization and clean energy procurement.
These services aim to make the task of corporate sustainability more manageable and the reporting process easier. This in turn could encourage other corporates currently on the fence to commit to sustainability measures and take action.
Robots Are Sorting Plastic Waste Better Than Humans
Where Next For China’s Technology Policy? Creating the Industrial Internet
Bullard: We Really Can’t Live Without the Internet
China invests $29 billion to beat U.S. semiconductors
Amazon Spurs Competition in Logistics Robots
Artificial Intelligence Goes Underground With Urbint: Q&A
Hardware Startups See Revival From VC
Making Sense of the Energy Transition: New Report Provides Framework for Navigating Conflicting Narratives | cc/2020-05/en_middle_0128.json.gz/line1085 |
__label__cc | 0.62049 | 0.37951 | Robotech’s #1 Product Management Lesson
Carl Macek — who launched the syndicated animated series Robotech, igniting the 1980s anime boom in North America — passed away last weekend. Today we’re celebrating his legacy, and the vital lesson his most renowned series can teach us.
Source: Robotech.com
What’s Robotech?
By the mid 1980s, several animated series from Japan had come to North America. However, Robotech was the first to retain the emotional drama and seriousness of its original source material.
Which is a little odd because Robotech is actually an American creation.
Produced by Harmony Gold USA, Inc. in association with Tatsunoko Prod. Co., Ltd., Robotech is a multi-generational sci-fi adventure developed by Carl Macek by stitching together three unrelated anime series.
This was done for commercial reasons: At the time, American weekday syndicated TV required 65 minimum episodes; by combining the three series, they surpassed the goal with 85 total episodes. And the story Macek wove — with new dialog and completely new themes and storylines — changed the way I, and many other kids-at-the-time, saw TV.
At The Time, G.I. Joe Was As Dangerous As It Got
As a child of the 1980s, I would pretty much watch any cartoon. For the most part, they were not good. I mean, even The Transformers — which I love — is pretty lame when viewed through adult eyes.
The G.I. Joe cartoon stands up a little better — mainly for the crazy plots and kickass theme song — but even that didn’t exactly elevate the art of kids television, or anything else.
Robotech, though — that was different.
And it taught me something very important.
People Are Complex
From the emotional love triangle of Rick Hunter/Lisa Hayes/Lynn Minmei…
To Zor Prime’s determination to avoid destroying humanity despite his own alien legacy and heritage…
To Marlene’s attempts to reconcile her Invid identity with her sympathy for the people of planet earth…
People (and aliens) are complicated, and don’t always react “logically” to new information.
“Your opinion, although interesting, is irrelevant.”
Maybe you’ve heard that phrase before?
As product managers it can be easy to assume we’re the ones saying that witticism to engineering/sales/whomever because we have the data and all they have is the belief, the viewpoint, the conviction.
Who cares about those trivialities when it’s market facts, uber alles, right?
Emotion Trumps Logic
Facts are important, but they rarely can speak for themselves. Equally important is making those facts meaningful to the audience.
To be effective product managers, we must be market-motivated and be able to effectively sell those facts to our teams.
People are driven by different things. Some want to do the impossible. Others want to make money while their teammate wants to change the world. Personally, I want to entertain people, to give them a break from their real lives.
Understand what makes your individual teammates and supervisors tick, and you’ll find the right way to communicate and sell those facts. And that’s how you get things done.
Bye-Bye, Mars
Robotech pushed the boundaries of what could be shown on American TV for children: Characters died, had their hearts broken, and faced down their fears in a fairly realistic way. I was 10 years old when I first came into contact with Robotech and it influenced me profoundly.
Thanks, Mr. Macek.
Harmony Gold, in association with Fireworks International and Manga Entertianment, have made Robotech available for free on Hulu and YouTube.
Subscribe to the feed to receive future updates; follow me on Twitter to keep the discussion going! And don’t forget to listen to our podcast on iTunes or wherever amateur fine podcasts are available.
Product Management Lesson From The Life Of Roxette's…
animeCarl MacekRick HunterRobotechsci-fiScience Fiction
Josie’s Observation & The Secret To Better Product Strategy Meetings
Comics Legend Steve Ditko Illustrates The Importance Of Properly Framing Your Product Decisions
Product Management Lesson From Ralph Baer, Father Of Console Video Games
Presentation: Welcome To Product Management… Hope You Survive The Experience!
2 thoughts on “Robotech’s #1 Product Management Lesson”
Scott W. says:
Good article. Another lesson could be taken from Macek’s decision to repurpose original content and create something new with it. He saw an unserved market segment that could be developed (the North American anime fan) and a presumably profitable solution to meet their needs.
Christopher Cummings says:
@Scott W. –
Good point! I don’t know about the ROI… but, given that he tried the same strategy again (albeit unsuccessfully) with Captain Harlock, that’s a reasonable assumption 🙂 | cc/2020-05/en_middle_0128.json.gz/line1091 |
__label__wiki | 0.705847 | 0.705847 | CITI I/O
Cities + Technology + People
dotZero
Outsights
Techton
29 Jan 2020 The Deadliest Pandemics In Human History
29 Jan 2020 When Will There Be A Coronavirus Vaccine? 5 Questions Answered
29 Jan 2020 Millennial Millionaires Are Redefining What A Good Location Means In Real Estate
29 Jan 2020 How To Cool A CPU
28 Jan 2020 The World’s Population Is Ageing: The Number Of Elderly People Now Exceeds The Number Of Children
28 Jan 2020 What We Know Suggests The Economic Impact Of Wuhan Coronavirus Will Be Limited
28 Jan 2020 Are Stablecoins Ushering In A New Cryptocurrency Era?
28 Jan 2020 5 Products You Need To Be More Green
CITIESPEOPLEScapes
Learning About And From A City That Truly Stood The Test Of Time
28 Apr 2016 Curator - Citi I/O
Learning About And From A City That Truly Stood The Test Of Time Curator - Citi I/O 2016-04-28
In the Basilicata region, in Southern Italy, is an ancient city named Matera known for its cave houses called “sassi”. The sassi are carved into the cliffs of a rocky ravine created by what was once a big river but is now a small stream. These cave dwellings are believed to be among the first human settlements in Italy dating back to the Paleolithic era, some 9,000 years ago. Since then, until as recently as the 1950s, the caves were continuously inhabited.
The first human settlements in the territory of Matera took advantage of the region’s many natural caves that define the rocky landscape. Over time new caves were dug out to accommodate the growing population. Some of the earliest houses looks like stone huts, but behind the house-like facades are simple caves. As the city developed, it became a jumble of narrow alleys and stairways as residents dug wherever a cliff-face provided opportunity.
Photo Credit : Alessio Milan/Flickr
Until the late 20th century, the Matera region was one of the poorest in Italy. There was no electricity or running water or sewage disposal facility. The people lacked basic goods because there were no shops in the village. A typical diet consisted of bread, oil, crushed tomatoes, and peppers. Large families lived alongside their livestock, and in such unhygienic conditions, disease was rampant, especially malaria. The extreme poverty of these people during Benito Mussolini’s fascist rule was exposed in the book “Christ stopped at Eboli” by an Italian doctor Carlo Levi.
After the Second World War, the new government tried to move the city’s cave residents into modern dwellings but many people were reluctant to move. Eventually, the government had to forcibly relocate the inhabitants to the new town on top of the cliff.
LEARN MORE Ancient City Ruins Warn Us About Our Urban Future
Matera’s fortune changed after 1993 when UNESCO declared Matera’s sassi and cave churches a world heritage site, bringing a wave of curious tourists. Since then, many of Matera’s crumbling caves has been restored and transformed into cozy homes, stylish hotels and restaurants.
Photo Credit : Pietro & Silvia/Flickr
Photo Credit : Basilicata Turistica/Flickr
Photo Credit : Riccardo Francesconi/Flickr
Photo Credit : Elga Cappellari/Flickr
The interior of a cave. Photo Credit : Revol Web/Flickr
Photo Credit : Roberto Dona/Panoramio
Photo Credit : Burkhard Foltz/Panoramio
Photo Credit : vic15/Wikimedia
The set of “Passion of the Christ” which was shot at Matera. Photo Credit : Donato Mola/Flickr
This feature originally appeared in Amusing Planet.
Tags:CaveCave CityHistoryMateraSecond World War
US Top Cities for Single Moms In 2016
A Peek Into Imagining China Without The Crowds
The 10 Biggest Empires In Human History
A Brief History Of The US-Iran Conflict
Why We Gobble Up Specific Foods On Thanksgiving
The Gunpowder Plot: Torture And Persecution In Fact And Fiction
Like & Follow Us Here!
Get the latest stories delivered to your inbox.
Don’t Miss Out On This
The Immense Impact of Street Design In Our Behavior
124.6k 195
Technological Advantages Of Studying At Top Universities: Is Stanford Mobile An Example Of The Best App For Stanford University Students?
What The Latest Coronavirus Tells Us About Emerging New Infections
The Top 10 Craziest Party Hotspots In The World
98.8k 218
The Deadliest Pandemics In Human History
How New Technology Is Changing Online Gaming
Finally! Clever Building Technologies Can Clean Pollution In Cities
Top 10 Best Subway Systems Of The World
Are Stablecoins Ushering In A New Cryptocurrency Era?
5 Products You Need To Be More Green
The World’s Population Is Ageing: The Number Of Elderly People Now Exceeds The Number Of Children
Top Breakthrough Technologies For 2018 : Babel-Fish Earbuds
What We Know Suggests The Economic Impact Of Wuhan Coronavirus Will Be Limited
Top Cleanest Cities In The World 2017
Should We Be Worried About The New Wuhan Coronavirus?
The Largest Military Forces In The World
VPN Usage And Trends Around The World In 2019
If Countries Were As Large As Their Populations, Here’s How The World Would Look Like
In 2100, These 10 Countries Will Emerge As The Largest
What Everybody Ought To Know About Rope Access Services
The 10 Best Party Cities In The World
10 Truly Oppressive Working Conditions Of The Clothing Industry
The 10 Best College Towns In The U.S.
The Top 10 Cleanest Cities Of The World 2016
10 Best Oktoberfest Celebrations In The USA
The 25 Must-See Libraries In The World
The Top 10 Best Cities for Conservatives In The U.S. During Trump
How Is The United States Such A Powerful Superpower & Yet Americans Seem To Be So Stupid?
The Top 11 Most Educated Countries Of The World
Why Life Imitating Art & Vis-A-Vis, Now Extends To Gaming
Millennial Millionaires Are Redefining What A Good Location Means In Real Estate
How To Cool A CPU
75 Years After The Holocaust: A Memorial To The Concentration Camp Victims
Just For You. Check It Out.
CITI IO
Tackling the core of humanity's survival and well-being in cities.
Cities and technologies, through the lens of history, of present events, and of our hopes for the future, as it drives and is driven by the spirit of its people.
Copyright © 2020 Citi I/O. All Rights Reserved.
A photographer’s solo journey led to an uniquely beautiful take…
Photo Credit : www.rafaeel.it | cc/2020-05/en_middle_0128.json.gz/line1092 |
__label__cc | 0.686616 | 0.313384 | All categories Assessor Building Inspection City Clerk EMS Engineering Fire Human Resources Knox Boxes Maps & GIS Municipal Court Museum Parks & Forestry Planning Police Department Property Taxes Public Works Recreation & Aquatics Sun Prairie Media Center Tax Increment Financing Traffic Control
Parks & Forestry
Recreation & Aquatics
Sun Prairie Media Center
According to city ordinance, in order to protect the public health and public sanitation, the number of dogs and cats you can have is limited to no more than 2 dogs and 2 cats, or 3 animals (3 dogs, or 3 cats) of any 1 of the 2 species, shall be kept in or upon 1 residential unit or by 1 or more persons constituting 1 residential unit, unless the premises be licensed as a kennel. Get more information regarding this ordinance.
1. Where do I vote?
There are eight sites for polling purposes in the City of Sun Prairie. Your polling location is determined by the ward that you live in. To find out where you vote, visit My Vote Wisconsin.
2. How many animals can I have licensed in the city?
3. How can I apply for an Operator's License? (Bartender's License)
Anyone applying for a new operator's license must complete the Responsible Beverage Server Training course or show proof that they have been a licensed operator in the last two years in another Wisconsin municipality.
Information for obtaining an Operator's License can be found here.
4. What items do I need to apply for a Dog License?
State Statutes and the City of Sun Prairie Ordinances requires all dogs five (5) months of age or older, to be vaccinated for rabies and licensed. Licenses are valid as of January 1st and expire on December 31st of each year and are to be purchased on an annual basis.
Additional information on how to obtain a Dog License can be found here.
5. Can you tell me if a certain business in the city is licensed?
Not every business that operates in the city is licensed by the City of Sun Prairie. The City licenses some types of businesses while the county and state license other types of businesses. You can contact our office at 837-2511 to inquire about licenses issued by the City of Sun Prairie. If you have a problem with a particular business, you can contact the Better Business Bureau of Wisconsin at 800-273-1002.
6. Can I serve wine/beer at my business to the public for a grand opening, ladies night out, anniversary, etc?
Answer: No.
Businesses that are open to the public and have no appropriate alcohol license cannot sell or give away or provide tastings of alcohol, including beer, wine, or spirits, to the public.
An alcohol license is required to serve alcohol beverages. Wis. Stat. s. 125.04(1) states that no person (person includes individuals, corporations, LLC’s, etc.) may sell or engage in any other activity for which this chapter provides a license without holding the appropriate license. The City of Sun Prairie forfeiture for violation of this statutory provision ranges from $250 - $500. The penalty under state law is a forfeiture of up to $10,000, nine months in jail, or both (Wis. Stat. s. 125.04 (13)).
If a business does not have an alcohol license, alcohol beverages cannot be sold or given away. Wis. Stat. s. 125.09(1) prohibits “consumption” of alcohol in unlicensed public places. For example, a business at an unlicensed premise cannot have an open house, grand opening, or event that caters to the general public and serves alcohol.
Any charge made directly or indirectly for the alcohol beverage requires the person in charge to hold the appropriate license. The term “sale” is broadly defined. “Sale” is a transfer with consideration or transfer without consideration, if made to evade law, or any shift, device, scheme, or transaction for obtaining an alcoholic beverage (Wis. Stat. s. 125.02(20)).
- Examples of indirect charges include, but are not limited to, a ticket price including an alcohol beverage, cost of a meal including an alcohol beverage, a purchase of a service with a “free” alcohol beverage, or a donation required in order to consume an alcohol beverage.
Wis. Stat. s. 125.315 prohibits the “giving” of fermented malt beverages to evade law (i.e., businesses such as credit unions, barbershops, salons, etc., giving away beer to customers without a fermented malt beverage license). Wine and spirits also cannot be given away in the same manner under Wis. Stat. s. 125.67. Again, the penalty under state law is a forfeiture of up to $10,000, 9 months in jail, or both (Wis. Stat. s. 125.66).
7. How can I rent a community room?
Community rooms are available for renting through the City Clerk's Office or our Recreation Department. Contact us at 608-837-2511 or via email for availability.
8. What's the population of Sun Prairie?
In the last 10 years, the City of Sun Prairie has been one of the fastest growing communities in Dane County. As of January 2019, the city's population was 33,966. Please call 608-837-2511 or email us for more information.
9. Can I get something notarized at City Hall?
Yes. There are Notary Publics in the City Clerk's Office. This service is provided at no charge.
10. What are the Recycle Center hours?
The Sun Prairie Recycle Center is located at 1798 South Bird Street. To view the hours the Recycle Center is open, please visit the Department of Public Works page.
11. My organization would like to sponsor a raffle. How do I go about this?
Raffles are governed by the Wisconsin Division of Administration. If you have questions regarding Raffles, please call 608-270-2552 or 800-791-6973 or visit their website.
12. How can I contact one of the Sun Prairie Schools?
The best way to obtain information regarding the public schools is by visiting the Sun Prairie School District website.
13. Where can I apply for a marriage license?
Marriage licenses are available at the Dane County Clerk's Office.
14. Where can I obtain a birth certificate?
If you were born in Dane County a copy of your birth certificate is available in the Register of Deeds Office at the County Building, located at:
210 Martin Luther King Jr. Blvd.
15. Where can I obtain a passport?
Passports are available at the Post Office. At some locations, they may even take your passport photo. Please visit the USPS website for more information.
16. How do I contact the Sun Prairie Post Office?
Click here to go to the official United States Postal Service's Office's website. Or you can call (608) 834-1662 to reach someone at the local Sun Prairie office. | cc/2020-05/en_middle_0128.json.gz/line1094 |
__label__cc | 0.504408 | 0.495592 | CivilWarTalk
New posts Calendar
New posts New threadmarks Latest activity
Welcome to CivilWarTalk, a forum about the American Civil War! - Join today! It's fast, simple, and FREE!
The Knapsack - Holds a Lot, Keeps Stuff Dry
Period Photos & Examinations
Civil War Battle Sketches
Thread starter AUG
artist artists artwork sketch sketches
Fewer ads. Lots of American Civil War content!
JOIN NOW: REGISTER HERE!
At the time of the Civil War, camera shutters were too slow to record movement sharply. Celebrated photographers such as Mathew Brady and Timothy O’Sullivan, encumbered by large glass negatives and bulky horse-drawn processing wagons, could neither maneuver the rough terrain nor record images in the midst of battle. So newspaper publishers hired amateur and professional illustrators to sketch the action for readers at home and abroad. Embedded with troops on both sides of the conflict, these “special artists,” or “specials,” were America’s first pictorial war correspondents. They were young men (none were women) from diverse backgrounds—soldiers, engineers, lithographers and engravers, fine artists, and a few veteran illustrators—seeking income, experience, and adventure.
It was a cruel adventure. One special, James R. O’Neill, was killed while being held prisoner by Quantrill’s Raiders, a band of Rebel guerrillas. Two other specials, C. E. F. Hillen and Theodore Davis, were wounded. Frank Vizetelly was nearly killed at Fredericksburg, Virginia, in December 1862, when a “South Carolinian had a portion of his head carried away, within four yards of myself, by a shell.” Alfred Waud, while documenting the exploits of the Union Army in the summer of 1862, wrote to a friend: “No amount of money can pay a man for going through what we have had to suffer lately.”
The English-born Waud and Theodore Davis were the only specials who remained on assignment without respite, covering the war from the opening salvos in April 1861 through the fall of the Confederacy four years later. Davis later described what it took to be a war artist: “Total disregard for personal safety and comfort; an owl-like propensity to sit up all night and a hawky style of vigilance during the day; capacity for going on short food; willingness to ride any number of miles horseback for just one sketch, which might have to be finished at night by no better light than that of a fire.”
"In spite of the remarkable courage these men displayed and the events they witnessed, their stories have gone unnoticed: Virginia native son and Union supporter D. H. Strother’s terrifying assignment sketching the Confederate Army encampments outside Washington, D.C., which got him arrested as a spy; Theodore Davis’s dangerously ill-conceived sojourn into Dixie in the summer of 1861 (he was detained and accused of spying); W. T. Crane’s heroic coverage of Charleston, South Carolina, from within the Rebel city; Alfred Waud’s detention by a company of Virginia cavalry (after he sketched a group portrait, they let him go); Frank Vizetelly’s eyewitness chronicle of Jefferson Davis’s final flight into exile.
- From an interview with author, Harry Katz, who published the book The Civil War Sketch Book, which is filled with Civil War period sketches from professional illustrators documenting the events for newpapers and sketches by soldiers or civilians.
http://emergingcivilwar.com/2012/05/24/battlefield-art-with-national-geographic-magazine-and-author-harry-katz/
Reactions: reading48, 4th-MSM and Nathanb1
Brev. Brig. Gen'l
Near Kankakee
Another thing we tend to forget, AUG, is that photographs had to be turned into etchings before they could be reproduced in print. Same with sketches. It was many years after the war that a photo or a sketch could be published in a newspaper.
Brady's photos were distributed by mail and first hand purchase.
Reactions: AUG
Borderruffian
1st Lieutenant
Livingston Tn
Pvt Andrew Tinkham Company F, 1st Kansas Volunteers, sketch of the battle of Wilson's Creek.
Expired Image Removed
Reactions: bradleywhall, reading48, 4th-MSM and 1 other person
A few from Library of Congress: https://www.loc.gov/
Fighting in the woods, Kearneys division repulsing the enemy, June 30, 1862 (battle of Glendale) by Alfred Waud.
Battle of Second Bull Run, August 30, 1862, by Edwin Forbes.
Defeat of the Army of Genl. Pope at Manassas on the Old Bull run battleground, August 30, 1862, by Alfred Waud.
1st Virginia Cavalry, September 1862, by Alfred Waud.
The Wilderness, on the Brock road, 2nd Corps, May 11, 1864, by Edwin Forbes.
7th N.Y. Heavy Arty. at Cold Harbor, June 3, 1864, by Alfred Waud.
Ricketts' Advance, Third Winchester, September 19, 1864, by Alfred Waud.
5th Corps, 7th of February, 1865 (battle of Hatcher's Run), by Alfred Waud.
Last stand of Picketts men. Battle of Five Forks, April 1, 1865, by Alfred Waud.
Cavalry charge by Edwin Forbes.
Cavalry charge near Brandy Station, Va., by Edwin Forbes.
Reactions: Borderruffian, reading48 and 4th-MSM
ole said:
Yes, there are many sketches you'll find that are exact copies of photographs so they could be published in the newspaper, like this one of the sunken road at Antietam.
Reactions: reading48
4th-MSM
Battle of Dug Springs, Missouri:
Reactions: AUG, Borderruffian and reading48
kel1985
Very cool thread! Thanks for posting!
Another good one, the 44th Indiana at Shiloh by Henry Lovie.
"The woods on fire. The 44th Regt. Ind. Voltr. Col. H.B. Reed commdg. Left Wing near the Peach Orchard."
Very cool love seeing those.
oleslavecatcher
AUG351 said:
"Shell burst in the spot sketched [center left] killed 6 horses & wounded all the postition [sic] and tore Sergeant Tosey previously wounded in pieces," wrote Henri Lovie. He called this scene the Union's "Desperate Retreat."
On July 2, 1863, the Louisiana Tigers, depicted by Alfred Waud, attack the Union's XI Corps during the Battle of Gettysburg.
Gen. Andrew Humphreys leads a futile Union charge in this sketch by Alfred Waud of the 1862 Battle of Fredericksburg, Virginia.
Frank Vizetelly's depiction of the Southern victory at Fredericksburg, Virginia, shows Confederate troops firing down on Union soldiers.
English war artist Frank Vizetelly huddled inside Fort Fisher while it was being shelled by more than 50 Union warships. His drawing of the attack ran two months later as an engraving in the Illustrated London News.
Battle of Fort Fisher.
Assualt on Fort Blakely
http://ngm.nationalgeographic.com/2012/05/civil-war-sketches/art-gallery#/1
http://www.sonofthesouth.net/
I own this book. It is a really great collection.
Battle of Townsend's Plantation Jan. 31 - Feb. 2, 2020 The Event Wire: Reenactments, Walks, Shows, & More 0 Today at 8:52 AM
First Post Battle Image of the Cemetery Gatehouse Gettysburg 5 Today at 6:19 AM
M Visiting the Battle of Perryville. The Traveler's Companion - Visit Historic Sites 4 Yesterday at 6:49 PM
Edwin Forbes sketches of The Battle of Gettysburg Gettysburg 23 Feb 11, 2013
Battle of Townsend's Plantation Jan. 31 - Feb. 2, 2020
First Post Battle Image of the Cemetery Gatehouse
Visiting the Battle of Perryville.
Edwin Forbes sketches of The Battle of Gettysburg
CWT 1200px Style
►About CivilWarTalk
►Link to CivilWarTalk
►View Today's Discussions
►Forum Rules & Etiquette
Bringing the American Civil War and More to Life.
© 1999 - , CIVILWARTALK, LLC - Site Version 10.0
SlaveryTalk.com - SecessionTalk.com - CivilWarTalk.com - ReconstructionTalk.com
CivilWarTalkBookshop.com - CivilWarWiki.net - WarBetweenTheStatesRadio.com - CivilWarHome.com
Join CivilWarTalk Today!
Subscribe to remove ads & get exclusive perks! | cc/2020-05/en_middle_0128.json.gz/line1095 |
__label__cc | 0.538527 | 0.461473 | REQUEST FOR REINSTATEMENT OF BISHOP KYLES
Filed under: African-American,Bishop Blake,Bishop Rufus Kyles,Black Christian News,black church,Church Justice,COGIC,COGIC GENERAL ASSEMBLY,COGIC Judicial System,Cogic Supreme Court,Denominations,Judiciary Board,Pastors and Clergy — R.E. Stidham @ 10:02 AM
One of the attorneys for Bishop Rufus Kyles has sent a request to Bishop Sheard for the reinstatement of their client. It seems the primary reason is the difference in treatment of Bishop Kyles and Bishop Jones. Bishop Kyles has been suspended for almost two years for his conduct, Bishop Jones has been given a pass.
[REQUEST FOR REINSTATEMENT]
PACIFIC MOUNT OLIVE COGIC, LOS ANGELES, CALIFORNIA
Filed under: African-American,Bishop Blake,Black Christian News,black church,C.O.G.I.C.,Church Justice,COGIC,COGIC GENERAL ASSEMBLY,COGIC Judicial System,Cogic Supreme Court,Denominations,Episcopal Church,Judiciary Board,Pastors and Clergy — R.E. Stidham @ 2:25 PM
Tags: African-American, black church, Church Government, Church Justice, Church Property, COGIC, COGIC sues its members, Denominations, Mt. Olive COGIC, Pacific Mount Olive, Pastors and Clergy
WHO OWNS THE LOCAL CHURCH, LOCAL MEMBERS OR THE NATIONAL CHURCH?
This is a question that is being asked across the country in the Church of God in Christ. Bishops seem to believe the National Church owns the property and because they are the National Church’s representative, they manage these so called ownership rights.
“Local churches and, pastors are leaving the Church of God in Christ. They are leaving because they see no benefit in laboring to develop a strong congregation whose assets are vulnerable to the intrusion of those who have contributed nothing to its well being, or establishment. Can we validly insist on authority without any investment, withdrawals without any deposits?” (Why I Stood For The Defense In Orlando; Bishop Charles E Blake)
In the Church of God in Christ, many of the local members believe ownership of the local church rest with them. They believe, they purchased, repair, and pay all the bills means ownership. That is not what the leaders of COGIC believe. We are still asking the question; “Can we validly insist on authority without any investment, withdrawals without any deposits?”
Here is a list of churches where the people are in civil court because the National Officials believe (in the words of Bishop Blake) the trust creates ownership rights for COGIC, Inc. which they can exert and manage [Read Letter].
Greater First Knoxville, Tennessee– By using deception and half-truths Bishop James Scott with assistance from Bishop Blake is trying to take over this church. It is all about the Benjamin’s ($100 dollar bills).
Pacific Mount Olive Los Angeles, CA – Bishop Hackworth and Bishop Blake , with the use of deception, half-truths are trying to oust these members from their Church and all PMO property. [Read Chronology]
Bishop Brandon Porter– At Williams Temple Houston, Texas, Bishop Brandon Porter, in violation of Texas statutes has held a bogus vote and removed the duly elected Board of Trustees, refused to perform a count and is trying to steam roll over the people. A letter was sent to Bishop Blake and other COGIC official which fell on deaf ears.[Read Letter]
Bishop David Hall – Bishop Hall sued a church there in Memphis seeking control over the church’s real and personal property. His suit was dismissed, Bishop Hall appealed and the dismissal was affirmed. [Read Order]
Bishop Matthew Williams – Is suing the Remnant Church in Tampa, Florida which wants to leave COGIC. This story was reported by the Tampa ABC affiliate TV News.
In the April 2014 General Assembly meeting the Constitution Committee presented and read an amendment which would end all of this madness. The amendment which is included in Attachment H, calls for the local church to have exclusive control and ownership of the local church. It does not change or modify in any way the appointment of the Pastor. For whatever reason, this amendment has not been allowed to come forward anymore. It is not known if that is because Bishop David A. Hall is now the chairman of that committee or not. This amendment would eliminate most of the lawsuits such as the ones listed above. If the local people build it, pay for it, maintain it, it is only logical that they should own it. Again this amendment has been read once, do not allow it to be weakened.
From the April 2014 General Assembly Minutes Attachment H
Greater First COGIC Knoxville, Tenn- The Judiciary Board Stand For Justice
Filed under: African-American,Bishop Blake,Black Christian News,black church,C.O.G.I.C.,Church Justice,COGIC,COGIC GENERAL ASSEMBLY,COGIC Judicial System,Cogic Supreme Court,Denominations,Pastors and Clergy — R.E. Stidham @ 5:53 PM
Tags: African-American, Bishop Holsey, black church, Church Justice, COGIC, Pastors and Clergy
Greater First Church of God in Christ, Knoxville, Tennessee is a church at the center of a firestorm. Bishop Thomas Holsey requested an interpretation of the Article III, Section D of the COGIC Constitution which controls the transfer of churches from one jurisdiction to another. Now the Judiciary Board has ruled and the Church leadership is not pleased. Here is an excerpt from his request;
“It is requested the Judiciary Branch of the Church of God in Christ, render an interpretation of the constitution:
SECTION D TRANSFER OF CHURCH
CONSTITUTIONAL PROCEDURE FOR LOCAL CHURCHES”
Does Article state geographical guidelines?
Click here to read Bishop Holsey’s request
The Judiciary Board’s interpretation;
Article III, Part 2, Section D, ¶ 17, 18, 19, of the Constitution of the Church of God in Christ, Inc. governs the transfer of churches between jurisdictions. A careful review of said provision reveals that the Constitution is silent on the issue of geographic location as it relates to transfers.
Therefore, it is the finding of this Court that the Constitution does not prohibit nor restrict local churches from transferring their jurisdictional affiliation regardless of geographical location(s).
Article III, Part 2, Section D, paragraph 17,18, 19
Just this past November in the General Assembly, Bishop Blake spoke of a meeting between the three branches of Church government, (excerpt from page 2 of the November 2015 General Assembly minutes);
“Bishop Blake continued informing the delegates of a meeting he convened between the leaders of the three branches of the church’s government. The goal of the meeting was to work out any division or differences among these bodies for the unity and future of the Church. A special resolution (see Attachment C) was prepared as a result of their collaboration and read to the Assembly for acceptance. A motion was made to adopt the resolution. After a proper second, the MOTION CARRIED and Joint Resolution #112015 was ADOPTED.”
Paragraph 5 of the Joint resolution stated;
“BE IT FURTHER RESOLVED, that the rulings of the Judiciary Board are final and not subject to scrutiny or review; and”
Complete Joint Resolution
As I stated before there is now a huge uproar over this ruling.
More on this subject at a later date.
Bishop Rufus Kyles, Jr.-The JUDICIARY BOARD TAKES A STAND FOR JUSTICE:
Filed under: African-American,Bishop Blake,Bishop Rufus Kyles,Black Christian News,black church,C.O.G.I.C.,Church Justice,COGIC,COGIC GENERAL ASSEMBLY,COGIC Judicial System,Denominations,Pastors and Clergy — R.E. Stidham @ 8:12 AM
Tags: African-American, Bishop Blake, Bishop Rufus Kyles, black church, Church Justice, COGIC, COGIC General Assembly, Jr., Pastors and Clergy
The Case of Bishop Kyles
The Judiciary Board of the Church of God in Christ, has taken a stand for justice that is unprecedented. This week they have released two rulings in which they looked at what the document says (what is written) and made these rulings.
In the case against Bishop Kyles of Texas, because of errors by the Board of Bishops, Bishop Kyles won his appeal. The Judiciary Board did not address his guilt or innocence, they only looked to see if errors claimed by Bishop Kyles occurred in his trial.. These are their findings of errors made by the trial court (Board of Bishops). Judiciary Board Order
Here are excerpts of the Judiciary Boards Order which only consist of the reason their decision was rendered as it was. The purpose of these excerpts is so the average person can understand their decision. Links will be provided for the complete documents. Links will be provided for the Board of Bishops rules which are mentioned.
Certification, Function and Deliberation of Jurors
The first issue the court will consider pertains to the certification, function and deliberation of the jurors in this case. The Constitution of the Church of God in Christ, Inc. as recorded in Section D, paragraph (i) of the Official Manual and the Board of Bishops Rule 10(r) govern the trial of a Bishop. For a Bishop to be convicted of misconduct, the majority of bishops present and voting must so vote. (See Board of Bishops Rule 10(5) (r)).* Likewise, the sentence for said wrongdoing must be agreed upon by the majority of bishops present and voting. (See Board of Bishops Rule 10(q))….
…The record is silent as to the number of bishops that voted for conviction. That deafening silence renders a review impossible. In the absence of numbers, there is no way that this court can accurately calculate the existence or absence of a majority. If this court is unable to confirm the existence of a majority, it cannot affirm a conviction predicated thereupon. As for the penalty phase, the record reflects that 46 (+5) voted for removal from office.
Simple arithmetic clearly indicates that the sentence cannot stand as is does not reflect a majority of the certified number of bishops present. It is largely irrelevant, however, because without a valid conviction, the sentence cannot stand. As a result, both the conviction and the sentence must be vacated.
This court is at a loss as to why the specific voting results were not recorded and incorporated into the official record of these proceedings. The failure to do so denies the respondent fundamental fairness and impugns the integrity of our church’s adjudicative process.
[(from Official Manual Article VIII, Section D, paragraph 2(i))]
(i) It will take a vote of the majority of the members of the Board of Bishops, present and voting, to sustain the charges or charge. If less than a majority, present and voting, fail to vote to sustain the charges, the accused Bishop shall stand acquitted.
Grievance Committee Members as Jurors
It appears from the record that bishops who served as grievance committee members also served as jurors. (See transcript of Day 2, Page 7, Line 6). For bishops to serve in this dual capacity denies the respondent due process and fundamental fairness.
First, the Grievance Committee members serve in an investigative capacity. As such, they are privy to information pertaining to the allegations that may or may not ultimately be admitted at trial. Additionally, their function is not merely to collect data, but they must evaluate that data. They not only determine whether charges should be brought, but they actually issue the charges. (See transcript of Day 1, Page 3, Lines 22-24; Page 4, Lines 1-5).
…Additionally, as investigators, they may be called upon to testify as to some portion of their investigation, in much the same way that a police officer is subject to be called upon to testify during the course of a criminal trial where he conducted some portion of the investigation.
In summary, not only does such a circumstance deny the respondent due process by tainting the jury pool, but it also compromises the legal process as it allows for the potentiality of grievance committee members to serve both as jurors and as witnesses in the same proceeding.
Arguing in Opening Statement/Standard of Proof
The next allegation to be addressed is whether allowing the plaintiff/prosecutor to argue during his opening statement was reversible error. It is fundamental that arguing during opening statements is improper. It is also fundamental that arguing during opening statements is generally not a basis for reversible error. However, in this case, the prosecutor did not merely argue in his opening but he effectively charged the jury which, of course, is improper. (See transcript of Day 1, Pages 17-19)….
Given that multiple standards of proof were provided to the jury, there is no way to ascertain if the jurors utilized the applicable standard of Clear and Convincing Evidence or the lesser standard of Preponderance of the Evidence. As a result, the conviction cannot stand.
Removal as Pastor
The respondent also argued that he was illegally removed from his post as pastor. Pursuant to the Board of Bishops Rule No. 3, paragraph (b) “[I]f the Complaint is being brought against the Bishop for his conduct in his capacity as a pastor of a local congregation, the Complainant must certify in writing that the Complaint is being brought by a majority of the members of the local congregation. (Emphasis added).” A review of the record from the proceedings below reflects that no such certification was ever referenced, presented or made part of the record. Furthermore, the order entered by the Board of Bishops does not include any language that pertains to restrictions or reprimands pertaining to the Respondent’s role as Pastor. Accordingly, no action taken against him as Pastor can stand, as no charge was levied against him in that capacity and no order has been entered against him infringing upon his functioning in that role. Furthermore, any action taken against the respondent in his capacity as Pastor is void ab initio.
Admission of Evidence of 20 year old trial
The final issue considered for review by this court is the admission of evidence of a charge from twenty years ago where the respondent was accused of similar offenses, but was ultimately exonerated. This court is unable to see the probative value of such evidence. Moreover, any probative value that it may have had was substantially outweighed by its prejudicial impact.
We find that such is the case here; it was plain error to allow the jurors to hear and consider that the respondent had been similarly charged over two decades ago.
For the foregoing reasons, the “Final Order and Judgment” of the lower
court is vacated and the matter is remanded for a new trial.
MASON TEMPLE, BUILT FOR A JOYOUS NOISE
Filed under: Bishop Blake,black church,C.O.G.I.C.,Church Justice,COGIC,COGIC GENERAL ASSEMBLY,COGIC Judicial System,Denominations,Pastors and Clergy — R.E. Stidham @ 7:57 PM
Here is a letter written by Bishop Nathaniel Wells, in reaction to a column written by David Waters in the Memphis Commercial Appeal .
Here is a link to a PDF of that article.
2015 General Assembly- Job Description and Remuneration Booklet
Filed under: African-American,Bishop Blake,Black Christian News,Catholic Church,Church Justice,COGIC,COGIC GENERAL ASSEMBLY,COGIC Judicial System,Denominations,Pastors and Clergy — R.E. Stidham @ 1:34 PM
Click this link to read the Job Description and Remuneration Booklet which was passed out at the November 2015 General Assembly. Here is a link for the Job Description and Remuneration Report.
This booklet details the qualifications and the duties of all the elected officials. It also details the areas of authority each official and Branch or Department has.
THE CHURCH OF GOD IN CHRIST CONSTITUTIONAL CRISIS!!
Filed under: African-American,Bishop Blake,black church,Church Justice,COGIC,COGIC GENERAL ASSEMBLY,COGIC Judicial System,Denominations,Pastors and Clergy — R.E. Stidham @ 12:19 PM
Federal Lawsuit update:
The Federal lawsuit filed by Pastor Andre Johnson and others was recently dismissed without prejudice, (it can be filed again). I have been informed, the technical items the Federal Judge stated were the cause of the dismissal are in the process of being corrected. It is possible it will be refiled in October 2015.
The three branches of government of the Church of God in Christ, are in a power struggle. In my opinion and for reasons unknown, it appears the Legislative Branch (General Assembly) desires to undermine the authority of the Judicial Branch (Judiciary Board), this only benefits the remaining branch, the Executive Branch.
Prior to April 1991, the General Assembly was the highest Judicial authority in the Church of God in Christ, there was no appeal from the decisions of the General Assembly.
On April 11, 1991 at 8:15 P.M., the General Assembly transferred all of its Judicial Authority to the newly created Third Branch of Government The Judiciary Board, with the exception of the three following instances each with right to appeal to the Judiciary Board (the Supreme Court):
Trial of a General Board member
Trial of a Judiciary Board member
Trial of the Chairman of the General Assembly
(Found in Article VIII-The Judiciary Board)
The Judiciary Board was created on April 11, 1991 at 8:15 p.m. and the Judicial Code was passed November 15, 1994.
Click these links to view excerpts of the minutes when this transfer of authority was discussed and PASSED.
April 1991, November 1994
I have taken excerpts from theses minutes and highlighted the previously mentioned portions for ease of reading.
The Cause of a Constitutional Crisis:
When one branch of government attempts to infringe upon the Constitutionally granted rights of another, a crisis is created. We then descend into rule by the powerful elite rather than the rule of law, where the rights of the ordinary members are subject to the desires of those who hold power. In an attempt to end this crisis, the heads of the three Branches of COGIC Government met in Memphis on April 16, 2015. According to a “Memorandum” of the meeting by Chief Justice Jackson the following individuals were present,
Executive Branch Legislative Branch Judicial Branch
Presiding Bishop
Charles E. Blake, Sr. General Assembly Chairman Bishop James W. Hunt, Sr. Chief Justice
Thomas Jackson, Jr.
1st Asst. Presiding Bishop
P. A. Brooks Vice-Chairman
Bishop Lemuel F. Thuston Vice-Chairman, Justice
Talbert Swann
2nd Asst. Presiding Bishop
J.W. Macklin General Assembly Delegate Pastor Melvin Smith General Assembly Delegate
Javier Baily
General Board Member
Bishop George McKinney General Assembly Delegate
Click here to read the Memorandum by Chief Justice Jackson
For copies of the complete minutes send a request through the contact form.
COGIC CHIEF JUSTICE THOMAS JACKSON CLEARED OF ALL CHARGES!!!
Filed under: African-American,black church,Church Justice,COGIC,COGIC GENERAL ASSEMBLY,COGIC Judicial System,Denominations,Pastors and Clergy — R.E. Stidham @ 7:23 PM
In a stunning display of integrity and honesty, the Church of God in Christ, Judicial Investigating Committee (a standing committee of the General Assembly formed in April 2014) performed a thorough investigation of the charges brought by Elder Charles Blacksear against Chief Justice Thomas Jackson. They interviewed both parties, they requested and reviewed documents to ascertain the validity of allegations. The consensus was “that Chief Justice Thomas Jackson was exonerated of all these charges.”
Page 2, paragraphs 2 and 3, from a copy of the minutes of the meeting states;
Chairman Lewis asked does the Board agree that Chief Justice Thomas Jackson is cleared of all the charges brought against him?
All of the committee members agreed that Chief Justice Thomas Jackson is exonerated of all these charges.
Click here to read the minutes from the final meeting.
Also, here are excerpts from a declaration by the chairman of the Investigating Committee. The Investigating Committee is to be applauded for its thorough investigation. By looking at the evidence and talking to both parties they have set an example for others to use.
For the complete documents, contact me by using the supplied form.
FEDERAL SUBPOENAS HAVE BEEN ISSUED IN JOHNSON vs HUNT COGIC LAWSUIT
Filed under: African-American,Bishop Blake,Black Christian News,black church,C.O.G.I.C.,Church Justice,COGIC,COGIC GENERAL ASSEMBLY,COGIC Judicial System,Denominations,Pastors and Clergy — R.E. Stidham @ 5:10 PM
Four subpoenas have been issued for members of the Church of God in Christ. In times past COGIC has encouraged those whom have been subpoenaed to claim they are too busy to attend. Those cases have been filed at the State Courts.
This action however was filed in the United States District Court for the Northern District of Illinois, Eastern Division (Federal Court). The way these subpoenas were issued, a failure to attend could have the U. S. Marshal show up to escort you to the site. Here is part of the subpoena, below it you can click the links to view the complete documents.
Those to whom the subpoenas were issued are;
Bishop Thuston Supt. Williams Bishop Wells . Supt. Saffold
HAS GOD SENT JUDGMENT TO COGIC?
Filed under: African-American,Bishop Blake,Black Christian News,black church,Church Justice,COGIC,COGIC GENERAL ASSEMBLY,Denominations,Pastors and Clergy — R.E. Stidham @ 12:52 PM
I received this essay via email and after reading it I wanted to share it with as many people as possible. It is a 9 page letter which requires the reader to think. Here is an excerpt from the essay written by Dr. Edward Lee Johnson Sr., Pastor of New Vision Cathedral Church of God in Christ. Click this link to read the complete article. Has God sent JUDGMENT to COGIC?
Here is a link to a blog he has started: COGIC ON FIRE
Dr. Edward Johnson Sr.
I would like to begin by saying how much I admired Bishop Charles Blake as a teenager, and to this very day, for the work that he has established in California. The West Angeles Cathedral is a marvel to that region and this nation as well. As an accomplished American of African ancestry—he deserves credit for building and overseeing one of the most elaborate worship facilities in the history of America. And, we are all enamored by our “so called” favorite Hollywood movie stars that Bishop Blake heralds as prominent members of West Angeles Cathedral. However, as a church that is founded upon New Testament biblical principles—promoting individuals because of their social, political, or financial status is a “direct violation” of our spiritual principles . We are to esteem those who labor in the kingdom for preaching the gospel, and their work sake. But when it comes to salvation, everyone must come through the same narrow gate and forsake the “lust” of this world in order to win Christ. There are no “celebrities” in God’s kingdom. “Yea doubtless, and I count all things but loss for the excellency of the knowledge of Christ Jesus my Lord: for whom I have suffered the loss of all things, and do count them but dung, that I may win Christ,” (Philippians 3 :8 ) How is it that some individuals can claim to be Christians, members of a Pentecostal Church—and at the same time promote values in politics, movies, music, and civic activities that are morally detestable?
When it comes to the kingdom of God—the message of the cross is for everyone in the human family to come to Jesus just as they are. But, you cannot come to Jesus and remain as you are. Jesus said, “take on my yoke and learn of Me.” And, we all know that the prevailing message that comes out of Hollywood and the entertainment industry does not reflect the teaching of Christ and His apostles. So, if an individual has committed to being a Christian, and an active member of a Pentecostal institution (The Church Of God In Christ), he or she must shun the very appearance of evil in order to follow Christ. If the said person is overly concerned about their livelihood once taking a stand for the kingdom of God, lead him to this passage of scripture. “Take no thought saying, what shall we eat? Or, what shall we drink? Or wherewithal shall we be clothe? (For all these things do the Gentiles seek:) for your heavenly Father know that you have need of these things. But seek ye first the kingdom of God, and His righteousness (what God requires out of a professing believer); and all of these things shall be given freely to you by your heavenly Father.”
(Matthew 6:31-33)
I would be the first to say that a spiritually healthy, grounded, and full-grown adult can probably decipher through most of the filth that some of these individuals portray on the big screen, and in many of their songs. But impressionable young children, most teenagers, and some adults don’t stand a chance against the overt and subliminal messages that come from these morally depraved institutions. The reason why America is currently in a moral free-fall is because too many churches have taken their focus off the “transformed” life and placed it on the almighty ($) dollar….(continued)
For the full essay click here Has God sent JUDGMENT to COGIC? | cc/2020-05/en_middle_0128.json.gz/line1105 |
__label__wiki | 0.73686 | 0.73686 | 5 Upstart ColdHardFootballFacts for Week 14
A strange thing sometimes happens late in NFL seasons: The hard-worn truths that develop across 12 and 13 weeks of crunching hard data can sometimes be turned on their head at the snap of your fingers. What's more, even when things seem to go as expected on the field, they sometimes don't reflect in the Quality Stats.
That was illuminated by the ColdHardFootballFacts after Week 13, where the Ravens won, the 49ers and Patriots lost, and the big winners in the Power Rankings were ... the 49ers and Patriots?
Here are the big takeaways we gleaned from all the ColdHardFootballFacts Quality Stats:
5) About that weird twist in the Quality Stats Power Rankings: Yes, the Ravens beat the 49ers. Yes, the Patriots were de-pantsed by the Texans in Houston. And yes, when all was said and done, the 49ers maintained the top spot in the Power Rankings while the Patriots slipped past the Ravens into second place. The empirical numbers show that San Francisco did dip a bit from Week 13, as did the Ravens and Patriots. So what's up? The answer seems to be about relative performance against quality opponents. The Ravens surged into second place a week earlier on the back of a near-historic rout of the once Super Bowl competing Rams. This week they eked past the 49ers on a last second field goal. And while the Patriots may have lost, a pair of garbage time touchdowns ensured that the loss was closer than it really was on the field, and that the offense's numbers were puffed up from what New England has achieved in some other recent performances. The net result was a surprising flip in the rankings, even if New England and Baltimore remain close enough that the Ravens could easily leapfrog New England again this week, even if both teams win against the Chiefs (Pats) and Bills (Ravens) respectively.
4) As expected, the Texans' win against New England, in which the Houston ex-Pats brain trust truly appeared to outmaneuver the great Bill Belichick and co., led to the biggest leap up the Intelligence Index standings. Houston is still stuck in the relative doldrums of 11th place, but that's far better than their previous hold on 15th (the Broncos also made a four-position leap after rookie quarterback Drew Locke's first victory, for what it's worth). The other big movers of even more significance reflect the improvement of one new quarterback and the continued dominance of another. The rejuvenated Titans under Ryan Tannehill, always darlings of the Quality Stats, have now reached the No. 3 spot in the Intelligence Index. That's a far cry from the 11th place spot they occupied before benching former first round pick Marcus Mariota. The Chiefs have also hit their statistical stride, emerging as a top-five coached team despite the everpresent Andy Reid time management issues. That speaks volumes about the play of Patrick Mahomes, who has lifted the Chiefs back up to the top-three in Scoreability and propped up Kansas City's lackluster defense in the process.
3) The Patriots are losing their grip on the top of the three key statistical indeces! OK, that's an overreaction, but the Pats have now officially been leapfrogged in Real Quarterback Rating Differential by the surging Ravens. That's all about the Ravens' unstoppable offense, as New England still retains a huge lead on top of Defensive Real QBR, by more than 10 points. The Ravens? They lead Real QBR by five points ... but are more than 22 points better than the Patriots in the same statistic. The total edge to Baltimore's favor is less than a single point, because New England's advantage in Defensive Real QBR is ... also 22 points. Something tells us that more will give on one side or the other in the next four weeks.
2) It's almost impossible to overstate the rushing dominance of the Ravens. Take a quick gander at the Offensive Rusher Rating rankings and it's readily apparent: Only four teams on the list are within 900 yards of the Ravens' rushing total ... and just one is within 800 yards (the Seahawks). That's explains why Baltimore's edge in Offensive Rusher Rating — magnified by a league-best 18-to-5 touchdown to fumbles lost ratio — is nearly five points higher than the Panthers, who continue to enjoy a historic season from running back Christian McCaffrey despite coach Ron Rivera's dismissal. The flip side of Baltimore's dominance in Offensive Rusher Rating? The Ravens are among the league's worst in Defensive Rusher Rating, ranked 24th and less than four points removed from 30th-place Green Bay. The fact that two of the NFL's most successful W-L teams would be in the bottom quartile of Defensive Rusher Rating showcases that a team can win while struggling to stuff the run in 2019, but it also illuminates a potential glaring Achilles heel for both apparent Super Bowl contenders. Hear that Saints, Seahawks, 49ers, Patriots, Texans and Chiefs? Pound the rock against the Packers and Ravens. Like Obi Wan, it may be your only hope.
1) After Seattle's clutch victory against the Vikings on Monday Night Football, it sure appears that we may be seeing separation of a top-four in the Passer Rating Differential standings, which could be extremely telling heading into the playoffs. "The mother of all statistics," Passer Rating Differential has always been considered the most, or one of the most, accurate prognosticators of a team's long term potential. Essentially, if a team wants to win the Super Bowl, it better rank near the top of Passer Rating Differential or it's not going to be playing to hoist a Lombardi Trophy. Now the 2019 standings have had a five point gap open between fourth-place Seattle and their recently vanquished foe, fifth-place Minnesota. By comparison, there is a five point gap between New England at the top and Seattle in fourth. If that's a clear indicator of the true top four teams in the league with just four weeks of the regular season remaining, the real contenders to win it all are the aforementioned Patriots and Seahawks, plus the Ravens and 49ers sandwiched between them. That certainly passes the smell test, though it's instructive to note the absence of the Saints and Packers (in seventh and ninth, respectively), in particular. It was be fascinating to see if a team or two creates even more separation at the top after the season's final four regular season matchups. | cc/2020-05/en_middle_0128.json.gz/line1107 |
__label__cc | 0.510018 | 0.489982 | Photography on Photography: Reflections on the Medium since 1960 @the Met
By Loring Knoblauch / In Museums / September 10, 2008
JTF (just the facts): 22 artists represented by one work each (although some contain multiple images or a series), displayed in the Joyce and Robert Menschel Hall, a large white box of a room with a high ceiling. Here’s a list of the artists in the show (alphabetically):
Janice Guy
Allen McCollum
Comments/Context: The new contemporary photography gallery is probably the only place (save the special exhibits areas) in the hallowed halls of the Met where some real risk taking in exhibit making can take place. The art in this room hasn’t necessarily weathered the trials of decades or centuries, and any one work may or may not have yet risen to the top as best of breed for a certain style or time period. It’s a place where fresh ideas can be shown, providing interesting contrasts to what’s on view elsewhere in museum.
This exhibit takes on the challenge of making sense of the entire sweep of photography since the 1960s. Some of the themes it touches on include:
Appropriation/rephotography
The idea of truth in photography
Photography as a ubiquitous mass medium
Photographic advertising
New and old photographic processes
This is a small gallery remember, and therefore a relatively limited place in which to tell the stories of all these individual movements/concepts coherently. As a result, I’m sorry to say that this exhibit had a random “dressed in the dark” feel for me. I felt I had to engage each work and play the guessing game of which theme this particular image was trying to represent – “why is this here” for each and every picture or series of images. With some effort, these puzzles can be deciphered and the audience can see the thought process behind the exhibit; it just takes some work, and I’m guessing that 80% of the fly-by viewers who stroll through these galleries on their way to someplace else will leave mystified. While the mix of established artists and unknowns is a good thing, there was just so much going on that the juxtapositions of different works didn’t seem to make much sense (I bet this will be the first and only time that a Sugimoto portrait and a Welling flower will hang next to each other; see the Welling image at right, 012 Flowers, 2006). Given the size of this space, any one of the themes mentioned above could fill this room with an interesting and representative array of work to tell its particular story more thoroughly. So while risks are good, perhaps some tighter focus is required.
As an aside, there are two entrances to this room, that are nearly equally likely for someone to come through. This exhibit was arranged generally chronologically, so if you came in through the far doors are worked back (as I did), it seems even more of a grab bag, until you get to the other end, where the historical context is more obvious. I think the lesson here is that this room does not lend itself well to a linear narrative, and shows need to be monolithic in this space.
Collector’s POV: For our particular collection, there were really only a couple of works that would fit well. The first is the flower image I referenced above by James Welling. This is a large image, hearkening back to various hand crafted processes of the past, but fully rooted in the present and with a strong point of view. If we had a wall big enough, I could imagine one of these in our collection.
A second is Mark Wyse’s Mark of Indifference #1 (Shelf) from 2006 (see image at right). This artist was previously unknown to me, but I liked the simplicity of the vision.
While not a fit for us, I think the Sugimoto wax figure portraits in general (there is one of Fidel Castro in this show) are both thought provoking and spectacular. My guess is that they will end up being truly signature pieces from this era.
Rating: * (1 star) GOOD (rating system defined here)
Photography on Photography: Reflections on the Medium since 1960
Through October 19th
Read more about: Metropolitan Museum of Art
Metropolitan Museum of Art 1000 5th Avenue
Museum Index
Select a museum80WSE Gallery (NYU)Aldrich Contemporary Art MuseumAmericas SocietyArt Institute of ChicagoArtists SpaceAsia SocietyBerkeley Art MuseumBibliothèque Nationale de FranceBronx Museum of the ArtsBrooklyn MuseumBruce MuseumCenter for Curatorial Studies (CCS Bard)/Hessel Museum of ArtCantor Center for Visual Arts (Stanford)Casa Italiana Zerilli-Marimò (NYU)China InstituteMuseum of the City of New York (MCNY)Czech Center New YorkGeorge Eastman HouseEl Museo del BarrioFLAG Art FoundationFeature Hudson FoundationFotografiskaFox Talbot MuseumThe Frick CollectionGrand Central TerminalGrey Art Gallery (NYU)Florence Griswold MuseumSolomon R. Guggenheim MuseumHigh LineHolbrook Arts Center (Millbrook)Hunter College Art Galleries (CUNY)International Center of Photography (ICP Museum)International Center of Photography (ICP School)Istituto Italiano di CulturaJapan SocietyJeu de PaumeJewish MuseumJGS/Forward Thinking MuseumKatonah Museum of ArtKresge Art Museum (Michigan State)Lenfest Center for the Arts (Columbia)Leslie-Lohman Museum of Gay and Lesbian ArtLever House Art CollectionFrances Lehman Loeb Art Center (Vassar)Los Angeles County Museum of Art (LACMA)Metropolitan Museum of ArtMinneapolis Institute of ArtsMuseum of Modern Art (MoMA)The Morgan Library & MuseumMuseum of Contemporary Art ChicagoMuseum of Fine Arts BostonNational Gallery of ArtThe National Arts ClubNatural History Museum (London)Neuberger Museum of Art (SUNY Purchase)Neue GalerieNew York Historical SocietyNew York Public Library (NYPL)New MuseumOpen Society FoundationsMusée de l'OrangerieGordon Parks FoundationParrish Art MseumPortland Museum of ArtPratt Photography GalleryPrinceton University Art MuseumQueens College CUNYRauschenberg Foundation Project SpaceRed Bull Arts New YorkRubin Museum of ArtScandinavia HouseScience Museum (London)Museum of SexSlought (UPenn)Smithsonian National Air and Space MuseumStudio Museum in HarlemTate ModernVictoria and Albert MuseumVilcek FoundationWadsworth Atheneum Museum of ArtWalker Art CenterMiriam and Ira D. Wallach Art Gallery (Columbia)Walther Collection (NY Project Space)Whitney Museum of American ArtYale University Art GalleryThe KitchenUBS/Bayview Correctional Facility | cc/2020-05/en_middle_0128.json.gz/line1109 |
__label__wiki | 0.864376 | 0.864376 | Street Fighter X Mega Man Review
Dev: Seow Zong Hui
Pub: Capcom
Release: December 17, 2012
Screen Resolution: 480p-1080p
Happy Twenty-Fifth, Mega Man
by Robert VerBruggen
We Mega Man fans have been through a lot lately, and by “lately” I mean “in the last fifteen years.” The Blue Bomber never quite managed to transition out of the 2D era, and in the years since the death of the Super Nintendo, we've been treated to numerous half-hearted throwbacks, some painful attempts to bring Mega Man into other genres, and the occasional 2D gem like Mega Man X6 or Mega Man 9.
Now, to celebrate the 25th anniversary of the original Mega Man game—and also to commemorate 25 years of Street Fighter—Capcom has released Street Fighter X Mega Man, a fan-developed crossover for the PC that can be downloaded free of charge. This is not the Mega Man game we've all been waiting for—the one that finally drags the franchise, kicking and screaming, into the 21st century. That would be too much to ask of a free game, of course. Instead, SFXMM is another throwback to the 8-bit era, a Mega Man 9-style appreciation of what the series used to be.
That's not a bad thing, because Mega Man used to be awesome, and a Street Fighter crossover is a great way to relive the old magic. This franchise is maddening, and this game has its share of flaws, but it's worth putting all of that aside to enjoy the simple brilliance on display here.
Get exclusive PC Game Trainers at Cheat Happens
Hottest Stuff On CheatCC!
10 WTF Game Mods (Worth Checking Out)
Top 7 Stadia Games Google Did Right
Top 10 Essential Life Hacks for Gamers
Top 7 Game Series (That'd Be Great in VR)
Top New Year's Resolutions (Gamers Should Make)
CheatCC's 2019 Cody Awards
Top 5 Underrated Games of the Last Decade
Top 7 Newest Heroines (That Kick Major Ass)
Top 7 Quarter-Munchin' Arcade Games Ever
CheatCC's Gaming Preview Guide 2020
The Best of the Worst in 2019
Top 5 Movies or Shows That GET Gamers
Gamer’s Love/Hate Relationship w/Square Enix
7 Silliest Celebrity Cameos in Gaming
Is “Netflix for Games” Too Unrealistic?
Top 5 Games (You’ll Wanna Rage-Quit)
How to Fix VR in 2020
Top 7 Killer Comics (That Need Their Own Game)
Can Gaming Nostalgia Play Tricks on Us?
MK vs. Street Fighter: Will It EVER Happen?
Top 10 Movie-Licensed Games (That Don't Suck)
Why Size Matters (In Video Games Too)
How Games Used to Learn Us Somethin'
Top 7 Best Disney+ Shows Streaming Now
How the Sonic Movie Drama Worked Out for the Best
What Video Game Junk Food Are You?
7 Reasons We Bow Before the PC Master Race
Take Cover! Review Bombs Incoming!
If you're wondering why I'm treating this as a Mega Man game even though Street Fighter comes first in the title, the reason is that, well, it's a Mega Man game. The graphics, sound, and controls are straight from the 8-bit console era, you play as the Blue Bomber, and the basic format—choose any of eight bosses, do some platforming, kill the boss, take their weapon, move to another one—is intact. Many of the enemies, such as Mets, can be found in any other Mega Man game. SFXMM even keeps to the traditional format of Mega Man stages: two brief platforming sections followed by a boss, with checkpoints in between so long as you don't run out of lives.
The Street Fighter universe is well-represented here, though. The bosses, including favorites Ryu, Dhalsim, Blanka, and Chun Li, are taken straight from the Street Fighter rosters, and the stage backgrounds are faithful to what you've seen in countless SF games over the past couple of decades. In a nice touch, the damage you inflict on the bosses charges a special move they can unleash, à la Street Fighter IV.
The World Warriors' fighting moves and weaknesses are what you'd expect if you've been following the franchise, with a few exceptions. The developer says that whenever he couldn't use a character's standard fighting moves to create a Mega Man-style boss, he combed through various Street Fighter media until he saw them do a move he could work with.
The music pays homage to Street Fighter as well, with original tunes that blend classic melodies from both franchises.
All of this isn't to say SFXMM is a perfect game, however. The level design leaves something to be desired; the best Mega Man stages are a series of tricky, carefully placed obstacles, and too often it feels like SFXMM is just throwing some enemies, platforms, and death pits at you.
And if there's a game-breaking problem here, it's that SFXMM has no saving option at all—no passwords, nothing. This can't be passed off as fidelity to the franchise, either, because Mega Man 2 included passwords all the way back in 1988. This was just a year after the first entry, and Mega Man 2 is widely seen as the moment the series came into its own.
Also Worth Reading!
Why This Year's CoD Is Worth Every Penny
It's Time for the Return of X-Men
The Toll of Being Famous on YouTube
Are Developers Laughing All the Way to the Bank?
Feel the Force of Star Wars Crossovers
What Is the Future of Digital Gaming? | cc/2020-05/en_middle_0128.json.gz/line1116 |
__label__cc | 0.617193 | 0.382807 | Our Textbook
Teaching Slides
Professional Responsibility: A Contemporary Approach
a legal ethics textbook companion blog and teaching resource
Fred C. Zacharias Memorial Prize for Scholarship in Professional Responsibility
March 18, 2014 March 18, 2014 Contemporary Professional ResponsibilityLeave a comment
Submissions and nominations of articles are now being accepted for the fifth annual Fred C. Zacharias Memorial Prize for Scholarship in Professional Responsibility. To honor Fred’s memory, the committee will select from among articles in the field of Professional Responsibility with a publication date of 2014. The prize will be awarded at the 2015 AALS Annual Meeting in Washington, DC. Please send submissions and nominations to Professor Samuel Levine at Touro Law Center: slevine@tourolaw.edu. The deadline for submissions and nominations is September 1, 2014.
The Florida Supreme Court Rules on the Eligibility of Unauthorized Immigrants For Bar Admission
March 18, 2014 September 17, 2014 Contemporary Professional ResponsibilityLeave a comment
The Florida Supreme Court has finally issued a per curiam decision in the much watched case of an undocumented immigrant who sought admission to the Florida Bar.The applicant, Jose Godinez-Samperio, graduated from Florida State University School of Law, and passed the Florida Bar Examination. http://www.floridabar.org/DIVCOM/JN/JNNews01.nsf/SMTGT/Are%20undocumented%20immigrants%20eligible%20for%20Bar%20admission%3F
The Supreme Court ruled that unauthorized immigrants are ineligible for bar admission and must show that they are legally present in the United States. Even though the applicant was covered by the Dream Act (DACA) under Federal Law, the Supreme Court found that the State of Florida still needed to take legislative action to permit aliens to receive public benefits, including the granting of a license to practice law. In a passionate concurrence, Justice Labarga notes the injustice of this result as mandated under federal and state law.
The decision is full is found here. http://www.floridasupremecourt.org/decisions/2014/sc11-2568.pdf
Janet Stearns
Dean of Students and Lecturer
University of Miami School of Law
New York Changing Its Contingency Fee Formula – New York Personal Injury Law Blog
March 9, 2014 September 17, 2014 George ConkLeave a comment
OTHERWISE: New York Changing Its Contingency Fee Formula – New York Personal Injury Law Blog.
The Second Department of the Appellate Division of New York Supreme Court is tinkering with the time-honored rule in personal injury cases – the plaintiff;s law firm fronts the costs, pays itself back off the top, and calculates the contingent fee on the net recovery. Eric Turkewitz reports and discusses the issues. – gwc
Senate Rejects Obama Nominee Linked to Abu-Jamal Case – NYTimes.com
March 5, 2014 George ConkLeave a comment
OTHERWISE: Senate Rejects Obama Nominee Linked to Abu-Jamal Case – NYTimes.com.
Capital defense attorneys – like others who represent the despised – have long been held in high regard by the legal profession. “A lawyer’s representation of a client”, RPC 1.2 (c) tells us “does not constitute an endorsement of the clients political, economic, social or moral views or activities”. One would hope, we know now in vain, that the United States Senate would appreciate that point. Instead conservative Democrats from “red states” abandoned “Debo P. Adegbile, who headed the NAACP Legal Defense and Education Fund when it represented Mr. [Mumia] Abu-Jamal decades after his conviction, could not overcome a concerted campaign by Republicans, conservative activists and law enforcement organizations, still infuriated by the murder of Police Officer Daniel Faulkner.” – gwc
Follow via RSS or Email
Posts by Chapter and Topic
Chapter 1: Introducing Professionalism and Legal Ethics
Chapter 2: The Basic Elements of Law Practice
Chapter 3: The Business, Technology, and Marketing of Legal Services
Chapter 4: The Lawyer's Duty of Confidentiality
Chapter 5: Conflicts of Interest
Chapter 6: The Lawyer's Duties to the Legal System, the Profession, and Nonclients
Chapter 7: Special Ethical Rules: Prosecutors and Judges
Chapter 8: What is the Proper Role of a Lawyer
Chapter 9: Why Do Lawyers Have Special Privileges and Responsibilities
Teaching PR
Text Updates | cc/2020-05/en_middle_0128.json.gz/line1132 |
__label__wiki | 0.529906 | 0.529906 | Monica Gattinger
Institute for Science, Society and Policy
Monica Gattinger is Director of the Institute for Science, Society and Policy, Full Professor at the School of Political Studies and Chair of Positive Energy at the University of Ottawa. Professor Gattinger’s research and engagement focus on strengthening governance, public policy and regulation in the context of fast-paced innovation, technological change and markets, fundamental social and value change, and lower public trust in government, industry, science and expertise. She explores these issues principally in the energy and cultural policy sectors. Gattinger is a Fellow at the Canadian Global Affairs Institute, a member of the International Advisory Board of the DC-based think tank the Center for Policy on Emerging Technologies, a member of the Advisory Councils for Pollution Probe's Energy Exchange and Energy Ambassadors initiatives, and a member of the Editorial Boards of the University of Ottawa Press and the journal Canadian Public Administration. She holds a Ph.D. in public policy from Carleton University.
(90 min) Risk Communication and Engagement with the Public in the Nuclear, Climate and Artificial Intelligence Sectors / Communication des risques et engagement auprès du public dans les secteurs du nucléaire... Delta Hotel - Joliet-FrontenacDuane Bratt • Elaine Chatigny • Monica Gattinger • Dr. Kimberly Girling • Margot Hurlbert • Bob Watts
Supporting Canada’s Energy Transition – Bridging the Gap between Fundamental Research, Industry, and Policy Delta Ottawa - ChaudièreCarolyn DeLoyde • Joy Romero, P.Eng, MBA PM, ICD.D, FCAE • Michael Fraser • Monica Gattinger • Dr. Praveen Jain • Warren Mabee • Trevor Nightingale • Dr. Ron Oberth • Laura Oleson • Dr. Kimberly A. Woodhouse | cc/2020-05/en_middle_0128.json.gz/line1140 |
__label__cc | 0.653416 | 0.346584 | HOWTO: 100W Nucleus & Quantar Power Supplies - Yes they are interchangeable.
Thread: HOWTO: 100W Nucleus & Quantar Power Supplies - Yes they are interchangeable.
This has come up a couple of times in the past. The title says it all. I'm just posting this here for anyone who happens to search for this topic in the future.
The Nucleus paging station and the Quantar station power supplies are in fact interchangeable. I had an emergency situation at a customer's location a year or so ago where the Quantar voice repeater lost it's power supply, and the customer didn't have a spare. The customer also owns a Nucleus paging transmitter, and decided that the voice repeater was more critical than the paging system.
Cautioning the customer that I'd never attempted this before, but that theoretically it should work but may in fact result in an explosion, I inserted the Nucleus power supply into the Quantar, and it powered up without issue. The station ran fine until it's power supply returned from repair, and the systems were returned to their original configuration.
We all know about the crappy Onan exploding power supplies. The one out of the Nucleus was in fact an Onan, but luckily it didn't explode. I was more concerned about an incompatibility, but like so many other things, these two parts are common between the Nucleus paging transmitter and the Quantar station.
Both stations in question were 100W UHF units. High power Nucleus station power supplies (150W+) may not be cross compatible to Quantar, so watch what you're doing.
Cool stuff, good to know. How far away did you stand when first powering it up? Lol. I'd have laid money on an explosion.
I was 50% sure I was going to make a bad situation worse, but the customer said to try it as they needed the voice repeater back online.
I think what I ended up doing was unplugging the thing from the wall, turning it on, and then plugging it in so I wasn't too close to it if it cut loose.
Luckily, the only thing that happened was the thing clicked, the fans came on, and it woke up. Exactly what I'd hoped for.
I wouldn't have tried it if I didn't have some degree of faith that it would actually work. Now, if the Nucleus power supply goes bad, I can bring a spare from the shop for it. | cc/2020-05/en_middle_0128.json.gz/line1145 |
__label__cc | 0.717509 | 0.282491 | Is Exxon Taking Advantage of Tiny Guyana's Huge Oil Wealth?
cryptocurator April 9, 2018 in Oil (General)
crdue
oil discoveries
resource curse
cryptocurator + 17
I guess this is another resource curse story ... The IMF is calling on Guyana to rewrite its tax laws because of an Exxon Mobil deal there that is unusually favorable to the oil giant: meaning, below the international standard for big oil exploration deals. Exxon of course says there's nothing unfair about the deal, but it's easy for someone to take advantage of a country like Guyana that has no experience dealing with these huge companies.
https://www.bloomberg.com/amp/news/articles/2018-04-09/exxon-sparks-imf-concern-with-weighty-returns-in-tiny-guyana
TraderTate + 182
I think this is a good topic to bring up and definitely worth talking about; however, I'm not so sure that Bloomberg handled this well. They went for the headline, but bury half of what the IMF actually said. And Exxon has a point here: It got a good deal because it went into Guyana to explore when no one else would. At the time, it was a major risk for Exxon so they got a good deal that will still earn Guyana more than it's ever imagined. I think one can argue that this deal wasn't "below the international standard" for unproven "frontier" venues in oil and gas exploration (and deepwater, at that).
TomTom + 168
I don't see why Guyana would not benefit... rewriting the tax law will most likely result in more money landing in the pockets of corrupt officials.
J Owens + 45
7 minutes ago, TraderTate said:
Yeah it's definitely not as black and white as it seems. Exxon would argue that it took all the risk and that the alternative for Guyana would be to have a 'favourable' portion of nothing.
I do agree though that this is somewhere where international regulation is needed, arguably going beyond simply getting these countries good deals but also assistance in setting up a wealth fund so as to help avoid the oil curse. Always going to be tough to introduce regulation without scaring the oil majors away though....
" IMF in report suggests Guyana should rewrite its tax laws after "favorable" oil deal with Exxon". Big oil will go where the tax codes are the lowest....
pinto + 283
Legal plunder. Guyana will receive 2% royalties on oil produced when production beings in 2020. That’s about $1 million a day. The international norm for profit sharing’s are closer to between 10 and 20 percent. David vs. Goliath.
In the original agreement Guyana had zero, now they have 2% which is not great, but much better than before. Guyana would have no way to utilize its natural wealth if there is no Exxon because they don't have expertise in this industry. Exxon has give them that opportunity. Maybe not the one they wanted but at least now they have an opportunity to get to their wealth.
Exactly, but this is how it goes. The next supermajors to come in should definitively not get a good deal. The first one on the scene willing to take the risk gets the deal. The IMF isn't even saying the Exxon deal is bad. What they're trying to do is make sure there isn't a run on Guyana wherein a bunch of big companies are fleecing it and running. This is about future deals, not the Exxon deal.
dowmike + 37
Read the Bloomberg story. Everyone notice how they split the IMF quotes up and pushed the bit about this being a usual kind of frontier deal to the bottom so they could have their headline?
And re JOwens, I agree, but that's exactly the IMF is doing here. They are paving the way for a more constructive deal going forward. But I agree with everyone that Exxon took the big risk here. Guyana wasn't on anyone's deepwater map before this. Not that supermajors aren't known for taking advantage, but ...
This was a HUGE risk for Exxon. It makes sense to me that they should bargain for a killer deal. This opens up a world of opportunity for Guyana.
Missy + 42
4 hours ago, J Owens said:
Ugh. No more regs. You hit the nail on the head when you say it will scare oil majors away. There is lots of risk here to develop new plays in unknown regions. It has to be well worth their while.
Marina Schwarz + 1,576
Yes, but since producing regions won't produce forever, in the end the majors will have to consider frontier regions, regulation or no regulation. I wonder what the reserve replacement rate is now. It was very, very bad a couple years ago. | cc/2020-05/en_middle_0128.json.gz/line1149 |
__label__cc | 0.534178 | 0.465822 | Home Arts and Entertainment Chinese artist’s works to be featured at Plainsboro Library
Chinese artist’s works to be featured at Plainsboro Library
Paintings by Chinese artist Zuimeng Cao will be on display at the Plainsboro Public Library in January and February.
To help usher in the Chinese New Year, the Plainsboro Library Gallery will feature a collection of reproductions of traditional Chinese paintings by Zuimeng Cao.
Having grown up in the highlands of northeast China, Cao’s art focuses on the natural environment he observed for years, depicting landscapes, ice and snow, flora and fauna, and portraits as well. The exhibit runs from Wednesday, Jan. 25 to Thursday, Feb. 23.
A reception will be held on Saturday, Feb. 4, from noon to 2 p.m., and will be immediately followed by the library’s annual Chinese New Year celebration.
Cao was born in Liao Ning Province, China, in 1966. He graduated from Harbin Normal University with a degree in Chinese Painting and later from Communication University of China with a Master’s Degree in Art Direction.
Currently he is an associate professor of painting and TV production in Liao Ning Province Normal University Fine Arts Institute.
“Lotus” by Zuimeng Cao.
Cao has won many awards from the American World Art Centre, including the Silver “World Peace Reward” in 2002. He has also received awards from Houston University, China National Painting and Calligraphy Exhibition of Teachers, China Artist Association, Shanghai Artist Association, Liaoning Artist Association and other International Art Exhibitions.
Cao has developed three areas of scientific research in the international field of art. One concerns his ideological theories about “Ugly Art.”
According to a biography in his latest book, Selected Paintings of Zuimeng Cao, Cao “is the first person to criticize the ‘ugly creative’ arts which are the opposite of the ‘beauty’ (fine) arts. He also advocates a close correlation between the artist’s appreciation of beauty and the subjective initiative of audiences. In his work, Zuimeng Cao manifests the establishment of noble moral art.”
In addition, Cao has conducted research revealing principles of creative thinking in modeling art of Eastern and Western artwork; and research into the black and white system of Chinese painting. Cao is currently working to establish the Art Ideology Research Institute.
Cao compiled and published several books including Modeling Anatomy for art, Television Pre-production Art, Television Post-production Art, Artistic Creation of Documentary and Collected works of Cao Zuimeng.
The Plainsboro Library is located at 9 Van Doren Street, Plainsboro, NJ. Hours are 10-8:30 Monday – Thursday, and 10-5 Friday – Sunday. For more information, call (609) 275-2897.
Previous articleMayor Hsueh speaks on the state of West Windsor 2017
Next articlePlainsboro Township Committee and school board reorganize
Community News is committed to bringing readers the latest news from across Mercer County and Central Jersey. An accumulation of more than eight print publications, Community News strives to deliver hyperlocal news directly to residents, community members and businesses.
Construction starts on Robbinsville Wawa | cc/2020-05/en_middle_0128.json.gz/line1151 |
__label__cc | 0.713985 | 0.286015 | * * * * * English Level Beginner intermediate advanced TOFEL IELTS If you are school student If you are university student
About Divan
Medical Student programs
Coop Program Master & Paid Internship in USA
Camp Exchange USA
English Language Course
Help Visa Applications
High school in USA
Internship and career training
Foundation Year / NCUK
NCUK
INQUIRY-FORM
Divan International came into existence 18 years ago. It is an accredited and licensed platform founded by Mr. Kamal Wajih Hijazi, an educationist and cultural-inspired person who is formally managing many international businesses and joint ventures.
As a Rice terminal general director recruiting staffs, he discovered after interviewing so many university graduates, who were unemployed. Being unable to speak English and having no practical experience were the main obstacles against placing them in job positions. For these reasons, Mr. Kamal was so worried and concerned about that it made him decide to help them out and that is where the idea of Divan was emanated from. He put everything he had learned as an exchange student who finished high school and university studies in the United State of America, having so much experienced studying English as a second language and studying while working and gaining practical work experience into the company that bears DIVAN INTERNATIONAL today. An organization founded with a focus on making the world a secure and better place for its people, to meet their needs, to inspire and to make a difference in their lives, a focus that keeps on resonating with the organization today.
Now, Divan International is arguably the best leading cultural exchange, educational, training, and travel organization, widely known for its impeccable service for young people from the Arab countries and the whole world as well.
As Divan International is moving forward, we will certainly keep our core values upon which the organization was established. Reducing unemployment, organizing a platform that will enable them to speak English fluently, experience foreign cultures and making them feel a sense of belonging in anywhere they found themselves in the world have always been, and always will be, the keystone of our business.
To provide young people with the highest quality of education and training and traveling
services to be qualified for job acceptance.
To provide a competitive price for the services rendered to our patrons.
To continue emphasizing excellence at all levels.
To pursue quality in every program we offer for youth
To be one of the world’s high-flying companies recognized for outstanding education and traveling services, through a life-changing programme, making education and traveling process convenient, straightforward and more efficient while ensuring our core values in every area. | cc/2020-05/en_middle_0128.json.gz/line1158 |
__label__wiki | 0.993052 | 0.993052 | Veteran ITV News Presenter Alastair Stewart Steps Down After “Misjudgment” On Social Media
‘The Trade’: Morgan Spurlock Dropped As Executive Producer Of Showtime’s Sundance-Bound Docu Series
By Nellie Andreeva
Nellie Andreeva
Co-Editor-in-Chief, TV
@DeadlineNellie
More Stories By Nellie
‘One Piece’ Live-Action Series Based On Manga Classic Ordered By Netflix From Tomorrow Studios
‘Memory’ Thriller Drama Based On Korean Format In Works At Showtime From Michael Saltzman & Kapital
‘In From The Cold’ Spy Drama Series Starring Margarita Levieva Greenlighted By Netflix
The fallout from Morgan Spurlock’s public confession of sexual misconduct earlier this week continues. The documentary maker has been dropped as an executive producer of Showtime’s upcoming five-episode docu-series The Trade, which will have a world premiere at the 2018 Sundance Film Festival, followed by a Feb. 2 debut on Showtime. The move follows Spurlock’s exit from his production company, Warrior Poets, in the wake of the controversy.
The Trade spotlights the opioid crisis through the eyes of the growers, addicts, cartel bosses and law enforcement hopelessly caught in its web. It’s directed and executive produced by Matthew Heineman (Cartel Land). The Trade is a joint production of Warrior Poets and Heineman’s Our Time Projects. In addition to Heineman, Warrior Poets’ Jeremy Chilnick, who has been running point at the company, Pagan Harleman, Matthew Galkin and Ethan Goldman also serve as executive producers.
Since Spurlock’s stunning admission, his Super Size Me 2 has been dropped by YouTube Red and pulled from Sundance, while TNT has suspended production on the unscripted series Who Rules the World (working title), with co-producers, Sarah Jessica Parker’s Pretty Matches and Refinery29, severing ties with Spurlock. The Devil We Know filmmakers also have distanced themselves from Spurlock.
Amazon Eyeing 'The Hospital' Animated Series From Natasha Lyonne And Maya Rudolph's Animal Pictures
'One Piece' Live-Action Series Based On Manga Classic Ordered By Netflix From Tomorrow Studios
Adult Animated Comedy 'Fairfax' Gets 2-Season Order By Amazon | cc/2020-05/en_middle_0128.json.gz/line1161 |
__label__cc | 0.723201 | 0.276799 | Tag Archives: The Hub: Wellcome Collection
Novel Approaches to Understanding Creativity and Artistic Appreciation in Dementia (BBC News / Wellcome Open Research)
Summary The Created Out of Mind initiative comprises scientists, artists, musicians and writers, based at the Wellcome Collection’s “The Hub”, who are engaged in exploring the varied influences of dementia on the whole range of human creativity (and vice versa). … Continue reading →
Posted in BBC News, Charitable Bodies, Community Care, For Carers (mostly), For Doctors (mostly), For Nurses and Therapists (mostly), For Researchers (mostly), For Social Workers (mostly), In the News, Integrated Care, Management of Condition, Mental Health, Models of Dementia Care, Non-Pharmacological Treatments, Person-Centred Care, Personalisation, Quick Insights, UK, Universal Interest, Wales | Tagged All Party Parliamentary Group on Arts Health and Wellbeing, Arts and Music in Dementia, Arts Therapies, Awareness Raising, Bangor University, BBC Health News, Benefits of Music for People With Dementia, Bob Fulcher (Playwrite), British Broadcasting Corporation (BBC), Canterbury Christ Church University, Co-Creativity, Collaborate: Clarence Centre for Enterprise and Innovation (London), Community-Based Arts and Health interventions, Complementary Qualitative and Quantitative Evaluation, Coping Strategies, Created Out of Mind, Created Out of Mind: Preparatory Planning Framework. Perceptions of Dementia Through Art and Science, Creative Activities, Creative Ageing, Creative Arts, Creative Arts for Dementia, Creative Health: the Arts for Health and Wellbeing, Creative Self-Expression, Creativity, Creativity and Artistic Appreciation in Dementia, Critical Gerontology, Cultural Arts Interventions, Cultural Commissioning, Dementia and Music, Dementia Arts Photo Challenge, Dementia as a Cultural Metaphor, Dementia Research, Dementia Research Centre: University College London, Dementia Services Development Centre (DSDC), Dementia-Focussed Arts Activities, Dementia-Friendly Communities, Dementias, Department of Computer Science: University College London, Department of Molecular Neuroscience: University College London, DSDC Wales: Bangor University, Emotional and Psychological Wellbeing, Engagement, Exploring Dementia Through Art and Science, Faculty of Engineering Science: University College London, Festival of Theatre and Dementia: West Yorkshire Playhouse, Gerontologist, In the Moment, Institute of Neurology: University College London, Interdisciplinarity, Jewish Care, Jewish Care Homes, Lisa Genova (Author), Living Well with Dementia, Living Well with Dementia Research, Living Words: The Workshop (Folkestone), London, London College of Fashion: University of the Arts London, Meaningful Activity, Meaningful Relationships, Mental Wellbeing, Mental Wellbeing and Older People, Mood and Engagement, Museology, Museum Objects, Museums, Music for Life, Music for Life (Wigmore Hall), Music Therapy, Music Therapy for BPSD, Music-Based Therapeutic Interventions, Musical Activities, Musical Interventions, Musical Therapies, National Youth Choirs Great Britain (Rivergreen Centre; Durham), NHS Research Ethics Committee, Participation in the Creative Arts by Older People, Participative Arts for People Living With Dementia, Patient Engagement, Patient Involvement, Patient Participation, People and Perceptions, Personal Resilience, Pete Grogan (Curator: Every Third Minute), Poetry, Posterior Cortical Atrophy (PCA), Professor Sebastian Crutch: Director of Created Out of Mind, Psychological and Emotional Wellbeing, Psychological Wellbeing, Psychosocial Interventions, Public Perception of Dementia, Quality of Life, Quality of Life for People With Dementia, Rare Dementia Support (London), Reducing Agitation and Distress, Reducing Stigma, Reminiscence Arts in Dementia, Royal Academy of Music, Salomons Centre for Applied Psychology: Canterbury Christ Church University, Significant Arts (Reminiscence), Sociocultural Construction of Dementia (Critical Gerontology Perspective), Stigma of Dementia, Subtypes of Dementia, Support for Creativity and Self-Actualisation in People Living With Dementia, The Hub: Wellcome Collection, Tryce Ltd., Types of Dementia, University College London, University of the Arts London, Visual Arts, Wellcome, Wellcome Open Research, West Yorkshire Playhouse, West Yorkshire Playhouse: Every Third Minute (2018 Festival) | Leave a comment | cc/2020-05/en_middle_0128.json.gz/line1167 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.